WorldWideScience

Sample records for acid sequence based

  1. Chip-based sequencing nucleic acids

    Beer, Neil Reginald

    2014-08-26

    A system for fast DNA sequencing by amplification of genetic material within microreactors, denaturing, demulsifying, and then sequencing the material, while retaining it in a PCR/sequencing zone by a magnetic field. One embodiment includes sequencing nucleic acids on a microchip that includes a microchannel flow channel in the microchip. The nucleic acids are isolated and hybridized to magnetic nanoparticles or to magnetic polystyrene-coated beads. Microreactor droplets are formed in the microchannel flow channel. The microreactor droplets containing the nucleic acids and the magnetic nanoparticles are retained in a magnetic trap in the microchannel flow channel and sequenced.

  2. Nanopore Analysis of Nucleic Acids: Single-Molecule Studies of Molecular Dynamics, Structure, and Base Sequence

    Olasagasti, Felix; Deamer, David W.

    Nucleic acids are linear polynucleotides in which each base is covalently linked to a pentose sugar and a phosphate group carrying a negative charge. If a pore having roughly the crosssectional diameter of a single-stranded nucleic acid is embedded in a thin membrane and a voltage of 100 mV or more is applied, individual nucleic acids in solution can be captured by the electrical field in the pore and translocated through by single-molecule electrophoresis. The dimensions of the pore cannot accommodate anything larger than a single strand, so each base in the molecule passes through the pore in strict linear sequence. The nucleic acid strand occupies a large fraction of the pore's volume during translocation and therefore produces a transient blockade of the ionic current created by the applied voltage. If it could be demonstrated that each nucleotide in the polymer produced a characteristic modulation of the ionic current during its passage through the nanopore, the sequence of current modulations would reflect the sequence of bases in the polymer. According to this basic concept, nanopores are analogous to a Coulter counter that detects nanoscopic molecules rather than microscopic [1,2]. However, the advantage of nanopores is that individual macromolecules can be characterized because different chemical and physical properties affect their passage through the pore. Because macromolecules can be captured in the pore as well as translocated, the nanopore can be used to detect individual functional complexes that form between a nucleic acid and an enzyme. No other technique has this capability.

  3. 3-d structure-based amino acid sequence alignment of esterases, lipases and related proteins

    Gentry, M.K.; Doctor, B.P.; Cygler, M.; Schrag, J.D.; Sussman, J.L.

    1993-05-13

    Acetylcholinesterase and butyrylcholinesterase, enzymes with potential as pretreatment drugs for organophosphate toxicity, are members of a larger family of homologous proteins that includes carboxylesterases, cholesterol esterases, lipases, and several nonhydrolytic proteins. A computer-generated alignment of 18 of the proteins, the acetylcholinesases, butyrylcholinesterases, carboxylesterases, some esterases, and the nonenzymatic proteins has been previously presented. More recently, the three-dimensional structures of two enzymes enzymes in this group, acetylcholinesterase from Torpedo californica and lipase from Geotrichum candidum, have been determined. Based on the x-ray structures and the superposition of these two enzymes, it was possible to obtain an improved amino acid sequence alignment of 32 members of this family of proteins. Examination of this alignment reveals that 24 amino acids are invariant in all of the hydrolytic proteins, and an additional 49 are well conserved. Conserved amino acids include those of the active site, the disulfide bridges, the salt bridges, in the core of the proteins, and at the edges of secondary structural elements. Comparison of the three-dimensional structures makes it possible to find a well-defined structural basis for the conservation of many of these amino acids.

  4. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan

    2008-01-01

    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  5. New families in the classification of glycosyl hydrolases based on amino acid sequence similarities.

    Henrissat, B; Bairoch, A

    1993-01-01

    301 glycosyl hydrolases and related enzymes corresponding to 39 EC entries of the I.U.B. classification system have been classified into 35 families on the basis of amino-acid-sequence similarities [Henrissat (1991) Biochem. J. 280, 309-316]. Approximately half of the families were found to be monospecific (containing only one EC number), whereas the other half were found to be polyspecific (containing at least two EC numbers). A > 60% increase in sequence data for glycosyl hydrolases (181 additional enzymes or enzyme domains sequences have since become available) allowed us to update the classification not only by the addition of more members to already identified families, but also by the finding of ten new families. On the basis of a comparison of 482 sequences corresponding to 52 EC entries, 45 families, out of which 22 are polyspecific, can now be defined. This classification has been implemented in the SWISS-PROT protein sequence data bank. PMID:8352747

  6. Templated Synthesis of Peptide Nucleic Acids via Sequence-Selective Base-Filling Reactions

    Heemstra, Jennifer M.; Liu, David Ruchien

    2009-01-01

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either re...

  7. Templated synthesis of peptide nucleic acids via sequence-selective base-filling reactions.

    Heemstra, Jennifer M; Liu, David R

    2009-08-19

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either reductive amination or amine acylation chemistries, we observed efficient and selective addition of each of the four nucleobases to an abasic site in the middle of the PNA strand. We also describe the addition of single nucleobases to the end of a PNA strand through base filling, as well as the tandem addition of two bases to the middle of the PNA strand. These findings represent an experimental foundation for nonenzymatic information transfer through base filling. PMID:19722647

  8. Real-Time Nucleic Acid Sequence-Based Amplification Using Molecular Beacons for Detection of Enterovirus RNA in Clinical Specimens

    Landry, Marie L.; Garner, Robin; Ferguson, David

    2005-01-01

    Real-time nucleic acid sequence-based amplification (NASBA) using molecular beacon technology (NASBA-beacon) was compared to standard NASBA with postamplification hybridization using electrochemiluminescently labeled probes (NASBA-ECL) for detection of enteroviruses (EV) in 133 cerebrospinal fluid and 27 stool samples. NASBA-ECL and NASBA-beacon were similar in sensitivity, detecting 55 (100%) and 52 (94.5%) EV-positive samples, respectively. There were no false positives. Both NASBA assays w...

  9. iTriplet, a rule-based nucleic acid sequence motif finder

    Gunderson Samuel I

    2009-10-01

    Full Text Available Abstract Background With the advent of high throughput sequencing techniques, large amounts of sequencing data are readily available for analysis. Natural biological signals are intrinsically highly variable making their complete identification a computationally challenging problem. Many attempts in using statistical or combinatorial approaches have been made with great success in the past. However, identifying highly degenerate and long (>20 nucleotides motifs still remains an unmet challenge as high degeneracy will diminish statistical significance of biological signals and increasing motif size will cause combinatorial explosion. In this report, we present a novel rule-based method that is focused on finding degenerate and long motifs. Our proposed method, named iTriplet, avoids costly enumeration present in existing combinatorial methods and is amenable to parallel processing. Results We have conducted a comprehensive assessment on the performance and sensitivity-specificity of iTriplet in analyzing artificial and real biological sequences in various genomic regions. The results show that iTriplet is able to solve challenging cases. Furthermore we have confirmed the utility of iTriplet by showing it accurately predicts polyA-site-related motifs using a dual Luciferase reporter assay. Conclusion iTriplet is a novel rule-based combinatorial or enumerative motif finding method that is able to process highly degenerate and long motifs that have resisted analysis by other methods. In addition, iTriplet is distinguished from other methods of the same family by its parallelizability, which allows it to leverage the power of today's readily available high-performance computing systems.

  10. Construction Strategy for an Internal Amplification Control for Real-Time Diagnostic Assays Using Nucleic Acid Sequence-Based Amplification: Development and Clinical Application

    Rodríguez-Lázaro, David; D'Agostino, Martin; Pla, Maria; Cook, Nigel

    2005-01-01

    An important analytical control in molecular amplification-based methods is an internal amplification control (IAC), which should be included in each reaction mixture. An IAC is a nontarget nucleic acid sequence which is coamplified simultaneously with the target sequence. With negative results for the target nucleic acid, the absence of an IAC signal indicates that amplification has failed. A general strategy for the construction of an IAC for inclusion in molecular beacon-based real-time nu...

  11. The structural analysis of protein sequences based on the quasi-amino acids code

    Zhu Ping; Tang Xu-Qing; Xu Zhen-Yuan

    2009-01-01

    Proteomics is the study of proteins and their interactions in a cell. With the successful completion of the Human Genome Project, it comes the postgenome era when the proteomics technology is emerging. This paper studies protein molecule from the algebraic point of view. The algebraic system (∑, +, *) is introduced, where ∑ is the set of 64 codons. According to the characteristics of (∑,+, *), a novel quasi-amino acids code classification method is introduced and the corresponding algebraic operation table over the set ZU of the 16 kinds of quasi-amino acids is established. The internal relation is revealed about quasi-amino acids. The results show that there exist some very close correlations between the properties of the quasi-amino acids and the codon. All these correlation relationships may play an important part in establishing the logic relationship between codons and the quasi-amino acids during the course of life origination. According to Ma F et al (2003 J. Anhui Agricultural University 30 439), the corresponding relation and the excellent properties about amino acids code are very difficult to observe. The present paper shows that (ZU, +, ×) is a field. Furthermore, the operational results display that the codon tga has different property from other stop codons. In fact, in the mitochondrion from human and ox genomic codon, tga is just tryptophane, is not the stop codon like in other genetic code, it is the case of the Chen W C et al (2002 Acta Biophysica Sinica 18(1) 87). The present theory avoids some inexplicable events of the 20 kinds of amino acids code, in other words it solves the problem of 'the 64 codon assignments of mRNA to amino acids is probably completely wrong' proposed by Yang (2006 Progress in Modern Biomedicine 6 3).

  12. The structural analysis of protein sequences based on the quasi-amino acids code

    Proteomics is the study of proteins and their interactions in a cell. With the successful completion of the Human Genome Project, it comes the postgenome era when the proteomics technology is emerging. This paper studies protein molecule from the algebraic point of view. The algebraic system (Σ, +, *) is introduced, where Σ is the set of 64 codons. According to the characteristics of (Σ, +, *), a novel quasi-amino acids code classification method is introduced and the corresponding algebraic operation table over the set ZU of the 16 kinds of quasi-amino acids is established. The internal relation is revealed about quasi-amino acids. The results show that there exist some very close correlations between the properties of the quasi-amino acids and the codon. All these correlation relationships may play an important part in establishing the logic relationship between codons and the quasi-amino acids during the course of life origination. According to Ma F et al (2003 J. Anhui Agricultural University 30 439), the corresponding relation and the excellent properties about amino acids code are very difficult to observe. The present paper shows that (ZU, ⊕, ) is a field. Furthermore, the operational results display that the codon tga has different property from other stop codons. In fact, in the mitochondrion from human and ox genomic codon, tga is just tryptophane, is not the stop codon like in other genetic code, it is the case of the Chen W C et al (2002 Acta Biophysica Sinica 18(1) 87). The present theory avoids some inexplicable events of the 20 kinds of amino acids code, in other words it solves the problem of 'the 64 codon assignments of mRNA to amino acids is probably completely wrong' proposed by Yang (2006 Progress in Modern Biomedicine 6 3). (cross-disciplinary physics and related areas of science and technology)

  13. Detection of nucleic acid sequences by invader-directed cleavage

    Brow, Mary Ann D. (Madison, WI); Hall, Jeff Steven Grotelueschen (Madison, WI); Lyamichev, Victor (Madison, WI); Olive, David Michael (Madison, WI); Prudent, James Robert (Madison, WI)

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  14. Detection of nucleic acid sequences by invader-directed cleavage

    Brow, Mary Ann D.; Hall, Jeff Steven Grotelueschen; Lyamichev, Victor; Olive, David Michael; Prudent, James Robert

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  15. Detection of Aspergillus fumigatus in a Rat Model of Invasive Pulmonary Aspergillosis by Real-Time Nucleic Acid Sequence-Based Amplification▿

    Zhao, Yanan; Park, Steven; Warn, Peter; Shrief, Raghdaa; Harrison, Elizabeth; Perlin, David S.

    2010-01-01

    Rapid and sensitive detection of Aspergillus from clinical samples may facilitate the early diagnosis of invasive pulmonary aspergillosis (IPA). A real-time nucleic acid sequence-based amplification (NASBA) method was investigated by use of an inhalational rat model of IPA. Immunosuppressed male Sprague-Dawley rats were exposed to Aspergillus fumigatus spores for an hour in an aerosol chamber. Bronchoalveolar lavage (BAL) fluid, lung tissues, and whole blood were collected from five infected ...

  16. Comparative Amino Acid Sequences of Dengue Viruses

    Haishi, Shozo; TANAKA Mariko; Igarashi, Akira

    1990-01-01

    Amino acid (AA) sequences of 4 serotype of dengue viruses deduced from their nucleotide (nt) sequences of genomic RNA were analyzed for each genome segment and each stretch of 10 AA residues. Precursor of membrane protein (pM), and 4 nonstructural proteins (NS1, NS3, NS4B, NS5) were highly conserved, while another nonstructural protein (NS2A) was least conserved among 5 strains of dengue viruses. When homology was compared among heterotypic viruses, type 1 and type 3 dengue viruses showed clo...

  17. On Quantum Algorithm for Multiple Alignment of Amino Acid Sequences

    Iriyama, Satoshi; Ohya, Masanori

    2009-02-01

    The alignment of genome sequences or amino acid sequences is one of fundamental operations for the study of life. Usual computational complexity for the multiple alignment of N sequences with common length L by dynamic programming is O(LN). This alignment is considered as one of the NP problems, so that it is desirable to find a nice algorithm of the multiple alignment. Thus in this paper we propose the quantum algorithm for the multiple alignment based on the works12,1,2 in which the NP complete problem was shown to be the P problem by means of quantum algorithm and chaos information dynamics.

  18. 77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

    2012-10-29

    ... Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request. SUMMARY: The United States....'' SUPPLEMENTARY INFORMATION: I. Abstract Patent applications that contain nucleotide and/or amino acid...

  19. Detection and identification of human Plasmodium species with real-time quantitative nucleic acid sequence-based amplification

    P.F. Mens; G.J. Schoone; P.A. Kager; H.D.F.H. Schallig

    2006-01-01

    Background: Decisions concerning malaria treatment depend on species identification causing disease. Microscopy is most frequently used, but at low parasitaemia (< 20 parasites/mu l) the technique becomes less sensitive and time consuming. Rapid diagnostic tests based on Plasmodium antigen detection

  20. Detection of Aspergillus fumigatus in a rat model of invasive pulmonary aspergillosis by real-time nucleic acid sequence-based amplification.

    Zhao, Yanan; Park, Steven; Warn, Peter; Shrief, Raghdaa; Harrison, Elizabeth; Perlin, David S

    2010-04-01

    Rapid and sensitive detection of Aspergillus from clinical samples may facilitate the early diagnosis of invasive pulmonary aspergillosis (IPA). A real-time nucleic acid sequence-based amplification (NASBA) method was investigated by use of an inhalational rat model of IPA. Immunosuppressed male Sprague-Dawley rats were exposed to Aspergillus fumigatus spores for an hour in an aerosol chamber. Bronchoalveolar lavage (BAL) fluid, lung tissues, and whole blood were collected from five infected rats at 1, 24, 48, 72, and 96 h postinfection and five uninfected rats at the end of the experiment. Total nucleic acid (TNA) was extracted on an easyMAG instrument. A primer-molecular beacon set targeting 28S rRNA was designed to detect Aspergillus spp. The results were compared to those of quantitative PCR (qPCR) (18S rDNA) and quantitative culture. The analytical sensitivity of the real-time NASBA assay was tissue burdens, while the CFU counts were stable over time. The fungal burdens in BAL fluid were more variable and not indicative of a progressive infection. The results of both real-time assays correlated well for both sample types (r = 0.869 and P tissue, r = 0.887 and P < 0.0001 for BAL fluid). For all whole-blood specimens, NASBA identified Aspergillus-positive samples in the group from which samples were collected at 72 h postinfection (three of five samples) and the group from which samples were collected at 96 h postinfection (five of five samples), but no positive results were obtained by culture or PCR. Real-time NASBA is highly sensitive and useful for the detection of Aspergillus in an experimental model of IPA. PMID:20129972

  1. SSE: a nucleotide and amino acid sequence analysis platform

    Simmonds Peter

    2012-01-01

    Abstract Background There is an increasing need to develop bioinformatic tools to organise and analyse the rapidly growing amount of nucleotide and amino acid sequence data in organisms ranging from viruses to eukaryotes. Finding A simple sequence editor (SSE) was developed to create an integrated environment where sequences can be aligned, annotated, classified and directly analysed by a number of built-in bioinformatic programs. SSE incorporates a sequence editor for the creation of sequenc...

  2. Unifying bacteria from decaying wood with various ubiquitous Gibbsiella species as G. acetica sp. nov. based on nucleotide sequence similarities and their acetic acid secretion.

    Geider, Klaus; Gernold, Marina; Jock, Susanne; Wensing, Annette; Völksch, Beate; Gross, Jürgen; Spiteller, Dieter

    2015-12-01

    Bacteria were isolated from necrotic apple and pear tree tissue and from dead wood in Germany and Austria as well as from pear tree exudate in China. They were selected for growth at 37 °C, screened for levan production and then characterized as Gram-negative, facultatively anaerobic rods. Nucleotide sequences from 16S rRNA genes, the housekeeping genes dnaJ, gyrB, recA and rpoB alignments, BLAST searches and phenotypic data confirmed by MALDI-TOF analysis showed that these bacteria belong to the genus Gibbsiella and resembled strains isolated from diseased oaks in Britain and Spain. Gibbsiella-specific PCR primers were designed from the proline isomerase and the levansucrase genes. Acid secretion was investigated by screening for halo formation on calcium carbonate agar and the compound identified by NMR as acetic acid. Its production by Gibbsiella spp. strains was also determined in culture supernatants by GC/MS analysis after derivatization with pentafluorobenzyl bromide. Some strains were differentiated by the PFGE patterns of SpeI digests and by sequence analyses of the lsc and the ppiD genes, and the Chinese Gibbsiella strain was most divergent. The newly investigated bacteria as well as Gibbsiella querinecans, Gibbsiella dentisursi and Gibbsiella papilionis, isolated in Britain, Spain, Korea and Japan, are taxonomically related Enterobacteriaceae, tolerate and secrete acetic acid. We therefore propose to unify them in the species Gibbsiella acetica sp. nov. PMID:26071988

  3. Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.

  4. Los Alamos sequence analysis package for nucleic acids and proteins.

    Kanehisa, M I

    1982-01-01

    An interactive system for computer analysis of nucleic acid and protein sequences has been developed for the Los Alamos DNA Sequence Database. It provides a convenient way to search or verify various sequence features, e.g., restriction enzyme sites, protein coding frames, and properties of coded proteins. Further, the comprehensive analysis package on a large-scale database can be used for comparative studies on sequence and structural homologies in order to find unnoted information stored i...

  5. A conversational system for the computer analysis of nucleic acid sequences.

    Sege, R; Söll, D.; Ruddle, F H; Queen, C

    1981-01-01

    We present a conversational system for the computer analysis of nucleic acid and protein sequences based on the well-known Queen and Korn program (1). The system can be used by persons with only minimal knowledge of computers.

  6. Nucleotide Sequence of a Chicken Vitellogenin Gene and Derived Amino Acid Sequence of the Encoded Yolk Precursor Protein

    Schip, Fred D. van het; Samallo, John; Broos, Jaap; Ophuis, Jan; Mojet, Mart; Gruber, Max; AB, Geert

    1987-01-01

    The gene encoding the major vitellogenin from chicken has been completely sequenced and its exon-intron organization has been established. The gene is 20,342 base-pairs long and contains 35 exons with a combined length of 5787 base-pairs. They encode the 1850-amino acid pre-peptide of vitellogenin,

  7. Identifying discriminative classification-based motifs in biological sequences

    Vens, Celine; Rosso, Marie-Noëlle; Danchin, Etienne

    2011-01-01

    Motivation: Identification of conserved motifs in biological sequences is crucial to unveil common shared functions. Many tools exist for motif identification, including some that allow degenerate positions with multiple possible nucleotides or amino acids. Most efficient methods available today search conserved motifs in a set of sequences, but do not check for their specificity regarding to a set of negative sequences. Results: We present a tool to identify degenerate motifs, based on a giv...

  8. MEANS AND METHODS FOR CLONING NUCLEIC ACID SEQUENCES

    Geertsma, Eric Robin; Poolman, Berend

    2008-01-01

    The invention provides means and methods for efficiently cloning nucleic acid sequences of interest in micro-organisms that are less amenable to conventional nucleic acid manipulations, as compared to, for instance, E.coli. The present invention enables high-throughput cloning (and, preferably, expr

  9. Comparative genomics beyond sequence-based alignments

    Þórarinsson, Elfar; Yao, Zizhen; Wiklund, Eric D.;

    2008-01-01

    Recent computational scans for non-coding RNAs (ncRNAs) in multiple organisms have relied on existing multiple sequence alignments. However, as sequence similarity drops, a key signal of RNA structure--frequent compensating base changes--is increasingly likely to cause sequence-based alignment me...

  10. EST sequences and their annotation (amino acid sequence and results of homology search) - Dicty_cDB | LSDB Archive [Life Science Database Archive metadata

    Full Text Available lone covering full-length ORF provided by the National BioResource Project ( http://www.nbrp.jp/ ). The...ein Coding Gene in dictyBase ( http://dictybase.org/ ). The link to dictyBase is provided in the...Dicty_cDB EST sequences and their annotation (amino acid sequence and results of homology search) Data detai...l Data name EST sequences and their annotation (amino acid sequence and results of homology search) Descript...ion of data contents Sequences of cDNA clones of Dictyostelium discoideum and the

  11. An Integrated Sequence-Structure Database incorporating matching mRNA sequence, amino acid sequence and protein three-dimensional structure data.

    Adzhubei, I A; Adzhubei, A. A.; Neidle, S.

    1998-01-01

    We have constructed a non-homologous database, termed the Integrated Sequence-Structure Database (ISSD) which comprises the coding sequences of genes, amino acid sequences of the corresponding proteins, their secondary structure and straight phi,psi angles assignments, and polypeptide backbone coordinates. Each protein entry in the database holds the alignment of nucleotide sequence, amino acid sequence and the PDB three-dimensional structure data. The nucleotide and amino acid sequences for ...

  12. Accuracy of sequence alignment and fold assessment using reduced amino acid alphabets.

    Melo, Francisco; Marti-Renom, Marc A

    2006-06-01

    Reduced or simplified amino acid alphabets group the 20 naturally occurring amino acids into a smaller number of representative protein residues. To date, several reduced amino acid alphabets have been proposed, which have been derived and optimized by a variety of methods. The resulting reduced amino acid alphabets have been applied to pattern recognition, generation of consensus sequences from multiple alignments, protein folding, and protein structure prediction. In this work, amino acid substitution matrices and statistical potentials were derived based on several reduced amino acid alphabets and their performance assessed in a large benchmark for the tasks of sequence alignment and fold assessment of protein structure models, using as a reference frame the standard alphabet of 20 amino acids. The results showed that a large reduction in the total number of residue types does not necessarily translate into a significant loss of discriminative power for sequence alignment and fold assessment. Therefore, some definitions of a few residue types are able to encode most of the relevant sequence/structure information that is present in the 20 standard amino acids. Based on these results, we suggest that the use of reduced amino acid alphabets may allow to increasing the accuracy of current substitution matrices and statistical potentials for the prediction of protein structure of remote homologs. PMID:16506243

  13. Amino acid sequences of proteins from Leptospira serovar pomona

    Alves Selmo F

    2000-01-01

    Full Text Available This report describes a partial amino acid sequences from three putative outer envelope proteins from Leptospira serovar pomona. In order to obtain internal fragments for protein sequencing, enzymatic and chemical digestion was performed. The enzyme clostripain was used to digest the proteins 32 and 45 kDa. In situ digestion of 40 kDa molecular weight protein was accomplished using cyanogen bromide. The 32 kDa protein generated two fragments, one of 21 kDa and another of 10 kDa that yielded five residues. A fragment of 24 kDa that yielded nineteen residues of amino acids was obtained from 45 kDa protein. A fragment with a molecular weight of 20 kDa, yielding a twenty amino acids sequence from the 40 kDa protein.

  14. Acids and bases solvent effects on acid-base strenght

    Cox, Brian G

    2013-01-01

    Acids and bases are ubiquitous in chemistry. Our understanding of them, however, is dominated by their behaviour in water. Transfer to non-aqueous solvents leads to profound changes in acid-base strengths and to the rates and equilibria of many processes: for example, synthetic reactions involving acids, bases and nucleophiles; isolation of pharmaceutical actives through salt formation; formation of zwitter- ions in amino acids; and chromatographic separation of substrates. This book seeks to enhance our understanding of acids and bases by reviewing and analysing their behaviour in non-aqueous solvents. The behaviour is related where possible to that in water, but correlations and contrasts between solvents are also presented.

  15. Representation of protein-sequence information by amino acid subalphabets

    Andersen, C.A.F.; Brunak, Søren

    2004-01-01

    -sequence information, using machine learning strategies, where the primary goal is the discovery of novel powerful representations for use in AI techniques. In the case of proteins and the 20 different amino acids they typically contain, it is also a secondary goal to discover how the current selection of amino acids......-which now are common in proteins-might have emerged from simpler selections, or alphabets, in use earlier during the evolution of living organisms....

  16. The amino-acid sequence of kangaroo pancreatic ribonuclease.

    Gaastra, W; Welling, G W; Beintema, J J

    1978-05-01

    Red kangaroo (Macropus rufus) ribonuclease was isolated from pancreatic tissue by affinity chromatography. The amino acid sequence was determined by automatic sequencing of overlapping large fragments and by analysis of shorter peptides obtained by digestion with a number of proteolytic enzymes. The polypeptide chain consists of 122 amino acid residues. Compared to other ribonucleases, the N-terminal residue and residue 114 are deleted. In other pancreatic ribonucleases position 114 is occupied by a cis proline residue in an external loop at the surface of the molecule. Other remarkable substitutions are the presence of a tyrosine residue at position 123 instead of a serine which forms a hydrogen bond with the pyrimidine ring of a nucleotide substrate, and a number of hydrophobichydrophilic interchanges in the sequence 51-55, which forms part of an alpha-helix in bovine ribonuclease and exhibits few substitutions in the placental mammals. Kangaroo ribonuclease contains no carbohydrate, although the enzyme possesses a recognition site for carbohydrate attachment in the sequence Asn-Val-Thr (62-64). The enzyme differs at about 35-40% of the positions from all other mammalian pancreatic ribonucleases sequenced to date, which is in agreement with the early divergence between the marsupials and the placental mammals. From fragmentary data a tentative sequence of red-necked wallaby (Macropus rufogriseus) pancreatic ribonuclease has been derived. Eight differences with the kangaroo sequence were found. PMID:658039

  17. Electrophoresis-Enhanced Detection of Deoxyribonucleic Acids on a Membrane-Based Lateral Flow Strip Using Avian Influenza H5 Genetic Sequence as the Model

    Jui-Chuang Wu

    2014-03-01

    Full Text Available This study reports a simple strategy to detect a deoxyribonucleic acid (DNA on a membrane-based lateral flow (MBLF strip without tedious gel preparation, gel electrophoresis, and EtBr-staining processes. The method also enhances the detection signal of the genetic sample. A direct electric field was applied over two ends of the MBLF strips to induce an electrophoresis of DNAs through the strips. The signal enhancement was demonstrated by the detection of the H5 subtype of avian influenza virus (H5 AIV. This approach showed an excellent selectivity of H5 AIV from other two control species, Arabidopsis thaliana and human PSMA5. It also showed an effective signal repeatability and sensitivity over a series of analyte concentrations. Its detection limit could be enhanced, from 40 ng to 0.1 ng by applying 12 V. The nano-gold particles for the color development were labeled on the capture antibody, and UV-VIS and TEM were used to check if the labeling was successful. This detection strategy could be further developed to apply on the detection of drug-allergic genes at clinics or detection of infectious substances at incident sites by a simple manipulation with an aid of a mini-PCR machine and auxiliary kits.

  18. Seq2Logo: a method for construction and visualization of amino acid binding motifs and sequence profiles including sequence weighting, pseudo counts and two-sided representation of amino acid enrichment and depletion

    Thomsen, Martin Christen Frølund; Nielsen, Morten

    2012-01-01

    Seq2Logo is a web-based sequence logo generator. Sequence logos are a graphical representation of the information content stored in a multiple sequence alignment (MSA) and provide a compact and highly intuitive representation of the position-specific amino acid composition of binding motifs, active...... sites, etc. in biological sequences. Accurate generation of sequence logos is often compromised by sequence redundancy and low number of observations. Moreover, most methods available for sequence logo generation focus on displaying the position-specific enrichment of amino acids, discarding the equally...... valuable information related to amino acid depletion. Seq2logo aims at resolving these issues allowing the user to include sequence weighting to correct for data redundancy, pseudo counts to correct for low number of observations and different logotype representations each capturing different aspects...

  19. Deoxyribonucleic acid sequence mapping on metaphase chromosomes by immunoelectron microscopy

    Nucleic acid sequences can be localized on chromosomes in the electron microscope after hybridization with a biotinylated DNA probe followed by detection with a primary antibiotin antibody and a secondary antibody coupled to colloidal gold. Hybridization probes can also be labelled with alternative ligands such as N-acetoxy-2-acetylaminofluorene (AAF), Dinitrophenyl-dUTP and Digoxigenin-dUTP. Multiple labelling is possible if these differently modified DNA probes are used in conjunction with colloidal gold preparations of varying particle sizes. A substantial signal amplification can be achieved by incubating preparations with successive cycles of primary antibiotin antibody followed by a biotinylated secondary antibody. Detection is with Streptavidin-gold, and in the case of highly and moderately repeated sequences, the signal is visible in the light microscope. Detailed protocols are given for EM in-situ hybridization to whole mount metaphase chromosomes and include instructions necessary to perform multiple sequence localization and signal amplification

  20. Real-Time Detection of Noroviruses in Surface Water by Use of a Broadly Reactive Nucleic Acid Sequence-Based Amplification Assay

    Rutjes, Saskia A.; van den Berg, Harold H. J. L.; Lodder, Willemijn J.; Roda Husman, Ana Maria de

    2006-01-01

    Noroviruses are the most common agents causing outbreaks of viral gastroenteritis. Outbreaks originating from contaminated drinking water and from recreational waters have been described. Due to a lack of cell culture systems, noroviruses are detected mostly by molecular methods. Molecular detection assays for viruses in water are often repressed by inhibitory factors present in the environment, like humic acids and heavy metals. To study the effect of environmental inhibitors on the performa...

  1. Real-time detection of noroviruses in surface water by use of a broadly reactive nucleic acid sequence-based amplification assay.

    Rutjes, Saskia A.; Berg, Harold H J L van den; Lodder, Willemijn J.; Roda Husman, Ana Maria de

    2006-01-01

    Noroviruses are the most common agents causing outbreaks of viral gastroenteritis. Outbreaks originating from contaminated drinking water and from recreational waters have been described. Due to a lack of cell culture systems, noroviruses are detected mostly by molecular methods. Molecular detection assays for viruses in water are often repressed by inhibitory factors present in the environment, like humic acids and heavy metals. To study the effect of environmental inhibitors on the performa...

  2. Nucleotide sequence and corresponding amino acid sequence of the gene for the major antigen of foot and mouth disease virus.

    Kurz, C; Forss, S; Küpper, H; K Strohmaier; Schaller, H

    1981-01-01

    A segment of 1160 nucleotides of the FMDV genome has been sequenced using three overlapping fragments of cloned cDNA from FMDV strain O1K. This sequence contains the coding sequence for the viral capsid protein VP1 as shown by its homology to known and newly determined amino acid sequences from this man antigenic polypeptide of the FMDV virion. The structural gene for VP1 comprises 639 nucleotides which specify a sequence of 213 amino acids for the VP1 protein. The coding sequence is not flan...

  3. Correlation between fibroin amino acid sequence and physical silk properties.

    Fedic, Robert; Zurovec, Michal; Sehnal, Frantisek

    2003-09-12

    The fiber properties of lepidopteran silk depend on the amino acid repeats that interact during H-fibroin polymerization. The aim of our research was to relate repeat composition to insect biology and fiber strength. Representative regions of the H-fibroin genes were sequenced and analyzed in three pyralid species: wax moth (Galleria mellonella), European flour moth (Ephestia kuehniella), and Indian meal moth (Plodia interpunctella). The amino acid repeats are species-specific, evidently a diversification of an ancestral region of 43 residues, and include three types of regularly dispersed motifs: modifications of GSSAASAA sequence, stretches of tripeptides GXZ where X and Z represent bulky residues, and sequences similar to PVIVIEE. No concatenations of GX dipeptide or alanine, which are typical for Bombyx silkworms and Antheraea silk moths, respectively, were found. Despite different repeat structure, the silks of G. mellonella and E. kuehniella exhibit similar tensile strength as the Bombyx and Antheraea silks. We suggest that in these latter two species, variations in the repeat length obstruct repeat alignment, but sufficiently long stretches of iterated residues get superposed to interact. In the pyralid H-fibroins, interactions of the widely separated and diverse motifs depend on the precision of repeat matching; silk is strong in G. mellonella and E. kuehniella, with 2-3 types of long homogeneous repeats, and nearly 10 times weaker in P. interpunctella, with seven types of shorter erratic repeats. The high proportion of large amino acids in the H-fibroin of pyralids has probably evolved in connection with the spinning habit of caterpillars that live in protective silk tubes and spin continuously, enlarging the tubes on one end and partly devouring the other one. The silk serves as a depot of energetically rich and essential amino acids that may be scarce in the diet. PMID:12816957

  4. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    Nolan, John P.; White, P. Scott

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  5. Multiple Sequence Alignment Based on Chaotic PSO

    Lei, Xiu-Juan; Sun, Jing-Jing; Ma, Qian-Zhi

    This paper introduces a new improved algorithm called chaotic PSO (CPSO) based on the thought of chaos optimization to solve multiple sequence alignment. For one thing, the chaotic variables are generated between 0 and 1 when initializing the population so that the particles are distributed uniformly in the solution space. For another thing, the chaotic sequences are generated using the Logistic mapping function in order to make chaotic search and strengthen the diversity of the population. The simulation results of several benchmark data sets of BAliBase show that the improved algorithm is effective and has good performances for the data sets with different similarity.

  6. Human apolipoprotein C-II: complete nucleic acid sequence of preapolipoprotein C-II.

    Fojo, S S; Law, S W; Brewer, H B

    1984-01-01

    Apolipoprotein (apo) C-II is a cofactor for lipoprotein lipase, the enzyme that catalyzes the hydrolysis of triglycerides on plasma triglyceride-rich lipoproteins. The complete coding sequence of apoC-II mRNA has been determined from an apoC-II clone isolated from a human liver cDNA library. A 17-base-long synthetic oligonucleotide based on amino acid residues 5-10 of apoC-II was utilized as a hybridization probe to select recombinant plasmids containing the apoC-II sequence. Two thousand fou...

  7. SNAD: sequence name annotation-based designer

    Gorbalenya Alexander E

    2009-08-01

    Full Text Available Abstract Background A growing diversity of biological data is tagged with unique identifiers (UIDs associated with polynucleotides and proteins to ensure efficient computer-mediated data storage, maintenance, and processing. These identifiers, which are not informative for most people, are often substituted by biologically meaningful names in various presentations to facilitate utilization and dissemination of sequence-based knowledge. This substitution is commonly done manually that may be a tedious exercise prone to mistakes and omissions. Results Here we introduce SNAD (Sequence Name Annotation-based Designer that mediates automatic conversion of sequence UIDs (associated with multiple alignment or phylogenetic tree, or supplied as plain text list into biologically meaningful names and acronyms. This conversion is directed by precompiled or user-defined templates that exploit wealth of annotation available in cognate entries of external databases. Using examples, we demonstrate how this tool can be used to generate names for practical purposes, particularly in virology. Conclusion A tool for controllable annotation-based conversion of sequence UIDs into biologically meaningful names and acronyms has been developed and placed into service, fostering links between quality of sequence annotation, and efficiency of communication and knowledge dissemination among researchers.

  8. Amino acid sequences used for clusterintg (Multi FASTA format) - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Full Text Available Gclust Server Amino acid sequences used for clusterintg (Multi FASTA format) Data detail Data name Amino acid sequences use... Site Policy | Contact Us Amino acid sequences used for clusterintg (Multi FASTA format) - Gclust Server | LSDB Archive ...

  9. Human liver type pyruvate kinase: Complete amino acid sequence and the expression in mammalian cells

    Pyruvate kinase (PK) has four isozymes (L, R, M1, M2) that are encoded by two different genes. Among these isozymes, abnormalities of liver (L)-type PK is considered to be associated with hereditary nonspherocytic hemolytic anemia in humans. The authors isolated and determined the full-length sequence of human L-type PK cDNA. The cDNA contains 1,629 base pairs encoding 543 amino acids, 68 base pairs of 5'-noncoding sequence, and 734 base pairs of 3'-noncoding sequence. The similarity between human and rat L-type PK was 86.9% at the nucleotide sequence level and 92.4% at the amino acid sequence level. The full-length L-type PK cDNA was placed under the promoter of simian virus 40 and introduced into monkey COS cells. Human L-type PK activity was detected in the extract of COS cells by the classical PK electrophoresis method

  10. Molten fatty acid based microemulsions.

    Noirjean, Cecile; Testard, Fabienne; Dejugnat, Christophe; Jestin, Jacques; Carriere, David

    2016-06-21

    We show that ternary mixtures of water (polar phase), myristic acid (MA, apolar phase) and cetyltrimethylammonium bromide (CTAB, cationic surfactant) studied above the melting point of myristic acid allow the preparation of microemulsions without adding a salt or a co-surfactant. The combination of SANS, SAXS/WAXS, DSC, and phase diagram determination allows a complete characterization of the structures and interactions between components in the molten fatty acid based microemulsions. For the different structures characterized (microemulsion, lamellar or hexagonal phases), a similar thermal behaviour is observed for all ternary MA/CTAB/water monophasic samples and for binary MA/CTAB mixtures without water: crystalline myristic acid melts at 52 °C, and a thermal transition at 70 °C is assigned to the breaking of hydrogen bounds inside the mixed myristic acid/CTAB complex (being the surfactant film in the ternary system). Water determines the film curvature, hence the structures observed at high temperature, but does not influence the thermal behaviour of the ternary system. Myristic acid is partitioned in two "species" that behave independently: pure myristic acid and myristic acid associated with CTAB to form an equimolar complex that plays the role of the surfactant film. We therefore show that myristic acid plays the role of a solvent (oil) and a co-surfactant allowing the fine tuning of the structure of oil and water mixtures. This solvosurfactant behaviour of long chain fatty acid opens the way for new formulations with a complex structure without the addition of any extra compound. PMID:27241163

  11. Nucleotide and amino acid sequences of human intestinal alkaline phosphatase: close homology to placental alkaline phosphatase

    A cDNA clone for human adult intestinal alkaline phosphatase (ALP) [orthophosphoric-monoester phosphohydrolase (alkaline optimum); EC 3.1.3.1] was isolated from a λgt11 expression library. The cDNA insert of this clone is 2513 base pairs in length and contains an open reading frame that encodes a 528-amino acid polypeptide. This deduced polypeptide contains the first 40 amino acids of human intestinal ALP, as determined by direct protein sequencing. Intestinal ALP shows 86.5% amino acid identity to placental (type 1) ALP and 56.6% amino acid identity to liver/bone/kidney ALP. In the 3'-untranslated regions, intestinal and placental ALP cDNAs are 73.5% identical (excluding gaps). The evolution of this multigene enzyme family is discussed

  12. ANTICALIgN: visualizing, editing and analyzing combined nucleotide and amino acid sequence alignments for combinatorial protein engineering.

    Jarasch, Alexander; Kopp, Melanie; Eggenstein, Evelyn; Richter, Antonia; Gebauer, Michaela; Skerra, Arne

    2016-07-01

    ANTIC ALIGN: is an interactive software developed to simultaneously visualize, analyze and modify alignments of DNA and/or protein sequences that arise during combinatorial protein engineering, design and selection. ANTIC ALIGN: combines powerful functions known from currently available sequence analysis tools with unique features for protein engineering, in particular the possibility to display and manipulate nucleotide sequences and their translated amino acid sequences at the same time. ANTIC ALIGN: offers both template-based multiple sequence alignment (MSA), using the unmutated protein as reference, and conventional global alignment, to compare sequences that share an evolutionary relationship. The application of similarity-based clustering algorithms facilitates the identification of duplicates or of conserved sequence features among a set of selected clones. Imported nucleotide sequences from DNA sequence analysis are automatically translated into the corresponding amino acid sequences and displayed, offering numerous options for selecting reading frames, highlighting of sequence features and graphical layout of the MSA. The MSA complexity can be reduced by hiding the conserved nucleotide and/or amino acid residues, thus putting emphasis on the relevant mutated positions. ANTIC ALIGN: is also able to handle suppressed stop codons or even to incorporate non-natural amino acids into a coding sequence. We demonstrate crucial functions of ANTIC ALIGN: in an example of Anticalins selected from a lipocalin random library against the fibronectin extradomain B (ED-B), an established marker of tumor vasculature. Apart from engineered protein scaffolds, ANTIC ALIGN: provides a powerful tool in the area of antibody engineering and for directed enzyme evolution. PMID:27261456

  13. Characterization of the microbial acid mine drainage microbial community using culturing and direct sequencing techniques.

    Auld, Ryan R; Myre, Maxine; Mykytczuk, Nadia C S; Leduc, Leo G; Merritt, Thomas J S

    2013-05-01

    We characterized the bacterial community from an AMD tailings pond using both classical culturing and modern direct sequencing techniques and compared the two methods. Acid mine drainage (AMD) is produced by the environmental and microbial oxidation of minerals dissolved from mining waste. Surprisingly, we know little about the microbial communities associated with AMD, despite the fundamental ecological roles of these organisms and large-scale economic impact of these waste sites. AMD microbial communities have classically been characterized by laboratory culturing-based techniques and more recently by direct sequencing of marker gene sequences, primarily the 16S rRNA gene. In our comparison of the techniques, we find that their results are complementary, overall indicating very similar community structure with similar dominant species, but with each method identifying some species that were missed by the other. We were able to culture the majority of species that our direct sequencing results indicated were present, primarily species within the Acidithiobacillus and Acidiphilium genera, although estimates of relative species abundance were only obtained from direct sequencing. Interestingly, our culture-based methods recovered four species that had been overlooked from our sequencing results because of the rarity of the marker gene sequences, likely members of the rare biosphere. Further, direct sequencing indicated that a single genus, completely missed in our culture-based study, Legionella, was a dominant member of the microbial community. Our results suggest that while either method does a reasonable job of identifying the dominant members of the AMD microbial community, together the methods combine to give a more complete picture of the true diversity of this environment. PMID:23485423

  14. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

    2010-07-01

    ... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data...

  15. Next-Generation Sequencing Techniques for Eukaryotic Microorganisms: Sequencing-Based Solutions to Biological Problems▿

    Nowrousian, Minou

    2010-01-01

    Over the past 5 years, large-scale sequencing has been revolutionized by the development of several so-called next-generation sequencing (NGS) technologies. These have drastically increased the number of bases obtained per sequencing run while at the same time decreasing the costs per base. Compared to Sanger sequencing, NGS technologies yield shorter read lengths; however, despite this drawback, they have greatly facilitated genome sequencing, first for prokaryotic genomes and within the las...

  16. Contig sequences and their annotation (amino acid sequence and results of homology search), and expression profile - Dicty_cDB | LSDB Archive [Life Science Database Archive metadata

    Full Text Available Dicty_cDB Contig sequences and their annotation (amino acid sequence and results of homology search), and ex...pression profile Data detail Data name Contig sequences and their annotation (amino acid sequence and result... sequences of cDNA sequences of Dictyostelium discoideum and their annotation (amino acid sequence and resul...ence and full-length cDNA sequence by the assembly program Phrap ( http://www.phrap.org/index.html ). Link to the... list of clones constituting the contig, the information on its mapping to the genome mapped to genome sequence and the

  17. A repetitive sequence assembler based on next-generation sequencing.

    Lian, S; Tu, Y; Wang, Y; Chen, X; Wang, L

    2016-01-01

    Repetitive sequences of variable length are common in almost all eukaryotic genomes, and most of them are presumed to have important biomedical functions and can cause genomic instability. Next-generation sequencing (NGS) technologies provide the possibility of identifying capturing these repetitive sequences directly from the NGS data. In this study, we assessed the performances in identifying capturing repeats of leading assemblers, such as Velvet, SOAPdenovo, SGA, MSR-CA, Bambus2, ALLPATHS-LG, and AByss using three real NGS datasets. Our results indicated that most of them performed poorly in capturing the repeats. Consequently, we proposed a repetitive sequence assembler, named NGSReper, for capturing repeats from NGS data. Simulated datasets were used to validate the feasibility of NGSReper. The results indicate that the completeness of capturing repeat is up to 99%. Cross validation was performed in three real NGS datasets, and extensive comparisons indicate that NGSReper performed best in terms of completeness and accuracy in capturing repeats. In conclusion, NGSReper is an appropriate and suitable tool for capturing repeats directly from NGS data. PMID:27525861

  18. Human retroviruses and AIDS 1996. A compilation and analysis of nucleic acid and amino acid sequences

    Myers, G.; Foley, B.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States). Theoretical Div.; Mellors, J.W. [ed.] [Univ. of Pittsburgh, PA (United States); Jeang, K.T. [ed.] [National Institutes of Health, Bethesda, MD (United States). Molecular Virology Section; Wain-Hobson, S. [Pasteur Inst., Paris (France)] [ed.

    1997-04-01

    This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (1) Nuclear Acid Alignments and Sequences; (2) Amino Acid Alignments; (3) Analysis; (4) Related Sequences; and (5) Database Communications. Information within all the parts is updated throughout the year on the Web site, http://hiv-web.lanl.gov. While this publication could take the form of a review or sequence monograph, it is not so conceived. Instead, the literature from which the database is derived has simply been summarized and some elementary computational analyses have been performed upon the data. Interpretation and commentary have been avoided insofar as possible so that the reader can form his or her own judgments concerning the complex information. In addition to the general descriptions of the parts of the compendium, the user should read the individual introductions for each part.

  19. Natural vs. random protein sequences: Discovering combinatorics properties on amino acid words.

    Santoni, Daniele; Felici, Giovanni; Vergni, Davide

    2016-02-21

    Casual mutations and natural selection have driven the evolution of protein amino acid sequences that we observe at present in nature. The question about which is the dominant force of proteins evolution is still lacking of an unambiguous answer. Casual mutations tend to randomize protein sequences while, in order to have the correct functionality, one expects that selection mechanisms impose rigid constraints on amino acid sequences. Moreover, one also has to consider that the space of all possible amino acid sequences is so astonishingly large that it could be reasonable to have a well tuned amino acid sequence indistinguishable from a random one. In order to study the possibility to discriminate between random and natural amino acid sequences, we introduce different measures of association between pairs of amino acids in a sequence, and apply them to a dataset of 1047 natural protein sequences and 10,470 random sequences, carefully generated in order to preserve the relative length and amino acid distribution of the natural proteins. We analyze the multidimensional measures with machine learning techniques and show that, to a reasonable extent, natural protein sequences can be differentiated from random ones. PMID:26656109

  20. Entamoeba histolytica: observations on metabolism based on thegenome sequence

    Anderson, Iain J.; Loftus, Brendan J.

    2005-07-01

    The sequencing of the genome of Entamoeba histolytica has allowed a reconstruction of its metabolic pathways, many of which are unusual for a eukaryote. Based on the genome sequence, it appears that amino acids may play a larger role than previously thought in energy metabolism, with roles in both ATP synthesis and NAD regeneration. Arginine decarboxylase may be involved in survival of E. histolytica during its passage through the stomach. The usual pyrimidine synthesis pathway is absent, but a partial pyrimidine degradation pathway could be part of a novel pyrimidine synthesis pathway. Ribonucleotide reductase was not found in the E. histolytica genome, but it was found in the close relatives Entamoeba invadens and Entamoeba moshkovskii, suggesting a recent loss from E. histolytica. The usual eukaryotic glucose transporters are not present, but members of a prokaryotic monosaccharide transporter family are present.

  1. Transcriptome Sequencing in Response to Salicylic Acid in Salvia miltiorrhiza.

    Zhang, Xiaoru; Dong, Juane; Liu, Hailong; Wang, Jiao; Qi, Yuexin; Liang, Zongsuo

    2016-01-01

    Salvia miltiorrhiza is a traditional Chinese herbal medicine, whose quality and yield are often affected by diseases and environmental stresses during its growing season. Salicylic acid (SA) plays a significant role in plants responding to biotic and abiotic stresses, but the involved regulatory factors and their signaling mechanisms are largely unknown. In order to identify the genes involved in SA signaling, the RNA sequencing (RNA-seq) strategy was employed to evaluate the transcriptional profiles in S. miltiorrhiza cell cultures. A total of 50,778 unigenes were assembled, in which 5,316 unigenes were differentially expressed among 0-, 2-, and 8-h SA induction. The up-regulated genes were mainly involved in stimulus response and multi-organism process. A core set of candidate novel genes coding SA signaling component proteins was identified. Many transcription factors (e.g., WRKY, bHLH and GRAS) and genes involved in hormone signal transduction were differentially expressed in response to SA induction. Detailed analysis revealed that genes associated with defense signaling, such as antioxidant system genes, cytochrome P450s and ATP-binding cassette transporters, were significantly overexpressed, which can be used as genetic tools to investigate disease resistance. Our transcriptome analysis will help understand SA signaling and its mechanism of defense systems in S. miltiorrhiza. PMID:26808150

  2. Predicting DNA-binding sites of proteins from amino acid sequence

    Wu Feihong

    2006-05-01

    Full Text Available Abstract Background Understanding the molecular details of protein-DNA interactions is critical for deciphering the mechanisms of gene regulation. We present a machine learning approach for the identification of amino acid residues involved in protein-DNA interactions. Results We start with a Naïve Bayes classifier trained to predict whether a given amino acid residue is a DNA-binding residue based on its identity and the identities of its sequence neighbors. The input to the classifier consists of the identities of the target residue and 4 sequence neighbors on each side of the target residue. The classifier is trained and evaluated (using leave-one-out cross-validation on a non-redundant set of 171 proteins. Our results indicate the feasibility of identifying interface residues based on local sequence information. The classifier achieves 71% overall accuracy with a correlation coefficient of 0.24, 35% specificity and 53% sensitivity in identifying interface residues as evaluated by leave-one-out cross-validation. We show that the performance of the classifier is improved by using sequence entropy of the target residue (the entropy of the corresponding column in multiple alignment obtained by aligning the target sequence with its sequence homologs as additional input. The classifier achieves 78% overall accuracy with a correlation coefficient of 0.28, 44% specificity and 41% sensitivity in identifying interface residues. Examination of the predictions in the context of 3-dimensional structures of proteins demonstrates the effectiveness of this method in identifying DNA-binding sites from sequence information. In 33% (56 out of 171 of the proteins, the classifier identifies the interaction sites by correctly recognizing at least half of the interface residues. In 87% (149 out of 171 of the proteins, the classifier correctly identifies at least 20% of the interface residues. This suggests the possibility of using such classifiers to identify

  3. Prediction of protein motions from amino acid sequence and its application to protein-protein interaction

    Wako Hiroshi

    2010-07-01

    Full Text Available Abstract Background Structural flexibility is an important characteristic of proteins because it is often associated with their function. The movement of a polypeptide segment in a protein can be broken down into two types of motions: internal and external ones. The former is deformation of the segment itself, but the latter involves only rotational and translational motions as a rigid body. Normal Model Analysis (NMA can derive these two motions, but its application remains limited because it necessitates the gathering of complete structural information. Results In this work, we present a novel method for predicting two kinds of protein motions in ordered structures. The prediction uses only information from the amino acid sequence. We prepared a dataset of the internal and external motions of segments in many proteins by application of NMA. Subsequently, we analyzed the relation between thermal motion assessed from X-ray crystallographic B-factor and internal/external motions calculated by NMA. Results show that attributes of amino acids related to the internal motion have different features from those related to the B-factors, although those related to the external motion are correlated strongly with the B-factors. Next, we developed a method to predict internal and external motions from amino acid sequences based on the Random Forest algorithm. The proposed method uses information associated with adjacent amino acid residues and secondary structures predicted from the amino acid sequence. The proposed method exhibited moderate correlation between predicted internal and external motions with those calculated by NMA. It has the highest prediction accuracy compared to a naïve model and three published predictors. Conclusions Finally, we applied the proposed method predicting the internal motion to a set of 20 proteins that undergo large conformational change upon protein-protein interaction. Results show significant overlaps between the

  4. Prediction of flexible/rigid regions from protein sequences using k-spaced amino acid pairs

    Ruan Jishou

    2007-04-01

    Full Text Available Abstract Background Traditionally, it is believed that the native structure of a protein corresponds to a global minimum of its free energy. However, with the growing number of known tertiary (3D protein structures, researchers have discovered that some proteins can alter their structures in response to a change in their surroundings or with the help of other proteins or ligands. Such structural shifts play a crucial role with respect to the protein function. To this end, we propose a machine learning method for the prediction of the flexible/rigid regions of proteins (referred to as FlexRP; the method is based on a novel sequence representation and feature selection. Knowledge of the flexible/rigid regions may provide insights into the protein folding process and the 3D structure prediction. Results The flexible/rigid regions were defined based on a dataset, which includes protein sequences that have multiple experimental structures, and which was previously used to study the structural conservation of proteins. Sequences drawn from this dataset were represented based on feature sets that were proposed in prior research, such as PSI-BLAST profiles, composition vector and binary sequence encoding, and a newly proposed representation based on frequencies of k-spaced amino acid pairs. These representations were processed by feature selection to reduce the dimensionality. Several machine learning methods for the prediction of flexible/rigid regions and two recently proposed methods for the prediction of conformational changes and unstructured regions were compared with the proposed method. The FlexRP method, which applies Logistic Regression and collocation-based representation with 95 features, obtained 79.5% accuracy. The two runner-up methods, which apply the same sequence representation and Support Vector Machines (SVM and Naïve Bayes classifiers, obtained 79.2% and 78.4% accuracy, respectively. The remaining considered methods are

  5. Nanopore-Based Target Sequence Detection

    Morin, Trevor J.; Shropshire, Tyler; Liu, Xu; Briggs, Kyle; Huynh, Cindy; Tabard-Cossa, Vincent; Wang, Hongyun; Dunbar, William B.

    2016-01-01

    The promise of portable diagnostic devices relies on three basic requirements: comparable sensitivity to established platforms, inexpensive manufacturing and cost of operations, and the ability to survive rugged field conditions. Solid state nanopores can meet all these requirements, but to achieve high manufacturing yields at low costs, assays must be tolerant to fabrication imperfections and to nanopore enlargement during operation. This paper presents a model for molecular engineering techniques that meets these goals with the aim of detecting target sequences within DNA. In contrast to methods that require precise geometries, we demonstrate detection using a range of pore geometries. As a result, our assay model tolerates any pore-forming method and in-situ pore enlargement. Using peptide nucleic acid (PNA) probes modified for conjugation with synthetic bulk-adding molecules, pores ranging 15-50 nm in diameter are shown to detect individual PNA-bound DNA. Detection of the CFTRΔF508 gene mutation, a codon deletion responsible for ∼66% of all cystic fibrosis chromosomes, is demonstrated with a 26-36 nm pore size range by using a size-enhanced PNA probe. A mathematical framework for assessing the statistical significance of detection is also presented. PMID:27149679

  6. Nanopore-Based Target Sequence Detection.

    Morin, Trevor J; Shropshire, Tyler; Liu, Xu; Briggs, Kyle; Huynh, Cindy; Tabard-Cossa, Vincent; Wang, Hongyun; Dunbar, William B

    2016-01-01

    The promise of portable diagnostic devices relies on three basic requirements: comparable sensitivity to established platforms, inexpensive manufacturing and cost of operations, and the ability to survive rugged field conditions. Solid state nanopores can meet all these requirements, but to achieve high manufacturing yields at low costs, assays must be tolerant to fabrication imperfections and to nanopore enlargement during operation. This paper presents a model for molecular engineering techniques that meets these goals with the aim of detecting target sequences within DNA. In contrast to methods that require precise geometries, we demonstrate detection using a range of pore geometries. As a result, our assay model tolerates any pore-forming method and in-situ pore enlargement. Using peptide nucleic acid (PNA) probes modified for conjugation with synthetic bulk-adding molecules, pores ranging 15-50 nm in diameter are shown to detect individual PNA-bound DNA. Detection of the CFTRΔF508 gene mutation, a codon deletion responsible for ∼66% of all cystic fibrosis chromosomes, is demonstrated with a 26-36 nm pore size range by using a size-enhanced PNA probe. A mathematical framework for assessing the statistical significance of detection is also presented. PMID:27149679

  7. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-01-01

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S ...

  8. Amino acid selective unlabeling for sequence specific resonance assignments in proteins

    Krishnarjuna, B.; Jaipuria, Garima; Thakur, Anushikha [Indian Institute of Science, NMR Research Centre (India); D' Silva, Patrick, E-mail: patrick@biochem.iisc.ernet.in [Indian Institute of Science, Department of Biochemistry (India); Atreya, Hanudatta S., E-mail: hsatreya@sif.iisc.ernet.in [Indian Institute of Science, NMR Research Centre (India)

    2011-01-15

    Sequence specific resonance assignment constitutes an important step towards high-resolution structure determination of proteins by NMR and is aided by selective identification and assignment of amino acid types. The traditional approach to selective labeling yields only the chemical shifts of the particular amino acid being selected and does not help in establishing a link between adjacent residues along the polypeptide chain, which is important for sequential assignments. An alternative approach is the method of amino acid selective 'unlabeling' or reverse labeling, which involves selective unlabeling of specific amino acid types against a uniformly {sup 13}C/{sup 15}N labeled background. Based on this method, we present a novel approach for sequential assignments in proteins. The method involves a new NMR experiment named, {l_brace}{sup 12}CO{sub i}-{sup 15}N{sub i+1}{r_brace}-filtered HSQC, which aids in linking the {sup 1}H{sup N}/{sup 15}N resonances of the selectively unlabeled residue, i, and its C-terminal neighbor, i + 1, in HN-detected double and triple resonance spectra. This leads to the assignment of a tri-peptide segment from the knowledge of the amino acid types of residues: i - 1, i and i + 1, thereby speeding up the sequential assignment process. The method has the advantage of being relatively inexpensive, applicable to {sup 2}H labeled protein and can be coupled with cell-free synthesis and/or automated assignment approaches. A detailed survey involving unlabeling of different amino acid types individually or in pairs reveals that the proposed approach is also robust to misincorporation of {sup 14}N at undesired sites. Taken together, this study represents the first application of selective unlabeling for sequence specific resonance assignments and opens up new avenues to using this methodology in protein structural studies.

  9. GENAS: a database system for nucleic acid sequence analysis.

    Kuhara, S; Matsuo, F; Futamura, S; A. Fujita; Shinohara, T.; Takagi, T.; Sakaki, Y

    1984-01-01

    A database system, named GENAS (GENe Analyzing System), for computer analysis of sequence was constructed using Adbis which is a relational database management system (1). GENAS enables us to retrieve any sequence data from EMBL nucleotide sequence data library (2) and readily to analyze them (if necessary, together with private data) by various application programs in a interactive manner. Analysis of structure of replication origin of replicons was demonstrated using this system.

  10. Students' Understanding of Acids/Bases in Organic Chemistry Contexts

    Cartrette, David P.; Mayo, Provi M.

    2011-01-01

    Understanding key foundational principles is vital to learning chemistry across different contexts. One such foundational principle is the acid/base behavior of molecules. In the general chemistry sequence, the Bronsted-Lowry theory is stressed, because it lends itself well to studying equilibrium and kinetics. However, the Lewis theory of…

  11. Will my protein crystallize? A sequence-based predictor.

    Smialowski, Pawel; Schmidt, Thorsten; Cox, Jürgen; Kirschner, Andreas; Frishman, Dmitrij

    2006-02-01

    We propose a machine-learning approach to sequence-based prediction of protein crystallizability in which we exploit subtle differences between proteins whose structures were solved by X-ray analysis [or by both X-ray and nuclear magnetic resonance (NMR) spectroscopy] and those proteins whose structures were solved by NMR spectroscopy alone. Because the NMR technique is usually applied on relatively small proteins, sequence length distributions of the X-ray and NMR datasets were adjusted to avoid predictions biased by protein size. As feature space for classification, we used frequencies of mono-, di-, and tripeptides represented by the original 20-letter amino acid alphabet as well as by several reduced alphabets in which amino acids were grouped by their physicochemical and structural properties. The classification algorithm was constructed as a two-layered structure in which the output of primary support vector machine classifiers operating on peptide frequencies was combined by a second-level Naive Bayes classifier. Due to the application of metamethods for cost sensitivity, our method is able to handle real datasets with unbalanced class representation. An overall prediction accuracy of 67% [65% on the positive (crystallizable) and 69% on the negative (noncrystallizable) class] was achieved in a 10-fold cross-validation experiment, indicating that the proposed algorithm may be a valuable tool for more efficient target selection in structural genomics. A Web server for protein crystallizability prediction called SECRET is available at http://webclu.bio.wzw.tum.de:8080/secret. PMID:16315316

  12. Genome Sequence of a Candidate World Health Organization Reference Strain of Zika Virus for Nucleic Acid Testing.

    Trösemeier, Jan-Hendrik; Musso, Didier; Blümel, Johannes; Thézé, Julien; Pybus, Oliver G; Baylis, Sally A

    2016-01-01

    We report here the sequence of a candidate reference strain of Zika virus (ZIKV) developed on behalf of the World Health Organization (WHO). The ZIKV reference strain is intended for use in nucleic acid amplification (NAT)-based assays for the detection and quantification of ZIKV RNA. PMID:27587826

  13. Numerical Characterization of DNA Sequence Based on Dinucleotides

    Xingqin Qi; Edgar Fuller; Qin Wu; Cun-Quan Zhang

    2012-01-01

    Sequence comparison is a primary technique for the analysis of DNA sequences. In order to make quantitative comparisons, one devises mathematical descriptors that capture the essence of the base composition and distribution of the sequence. Alignment methods and graphical techniques (where each sequence is represented by a curve in high-dimension Euclidean space) have been used popularly for a long time. In this contribution we will introduce a new nongraphical and nonalignment approach based...

  14. Homology between the invertible deoxyribonucleic acid sequence that controls flagellar-phase variation in Salmonella sp. and deoxyribonucleic acid sequences in other organisms.

    Szekely, E; Simon, M.

    1981-01-01

    The invertible deoxyribonucleic acid (DNA) segment cloned from Salmonella sp. was radioactively labeled and used as a probe to search for homologous sequences by Southern hybridization. Only one copy of the invertible segment could be found on the Salmonella sp. genome. Partial sequence homology with the invertible region was detected in bacteriophage Mu and P1 DNA by low-stringency hybridization. Under these conditions, no homology was detected with Escherichia coli DNA. A strain of Salmonel...

  15. Characterization of mouse cellular deoxyribonucleic acid homologous to Abelson murine leukemia virus-specific sequences.

    Dale, B.; Ozanne, B.

    1981-01-01

    The genome of Abelson murine leukemia virus (A-MuLV) consists of sequences derived from both BALB/c mouse deoxyribonucleic acid and the genome of Moloney murine leukemia virus. Using deoxyribonucleic acid linear intermediates as a source of retroviral deoxyribonucleic acid, we isolated a recombinant plasmid which contained 1.9 kilobases of the 3.5-kilobase mouse-derived sequences found in A-MuLV (A-MuLV-specific sequences). We used this clone, designated pSA-17, as a probe restriction enzyme ...

  16. Nucleic and amino acid sequences relating to a novel transketolase, and methods for the expression thereof

    Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Lange, Bernd Markus (Pullman, WA); McCaskill, David G. (Pullman, WA)

    2001-01-01

    cDNAs encoding 1-deoxyxylulose-5-phosphate synthase from peppermint (Mentha piperita) have been isolated and sequenced, and the corresponding amino acid sequences have been determined. Accordingly, isolated DNA sequences (SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7) are provided which code for the expression of 1-deoxyxylulose-5-phosphate synthase from plants. In another aspect the present invention provides for isolated, recombinant DXPS proteins, such as the proteins having the sequences set forth in SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8. In other aspects, replicable recombinant cloning vehicles are provided which code for plant 1-deoxyxylulose-5-phosphate synthases, or for a base sequence sufficiently complementary to at least a portion of 1-deoxyxylulose-5-phosphate synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding a plant 1-deoxyxylulose-5-phosphate synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant 1-deoxyxylulose-5-phosphate synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant 1-deoxyxylulose-5-phosphate synthase may be used to obtain expression or enhanced expression of 1-deoxyxylulose-5-phosphate synthase in plants in order to enhance the production of 1-deoxyxylulose-5-phosphate, or its derivatives such as isopentenyl diphosphate (BP), or may be otherwise employed for the regulation or expression of 1-deoxyxylulose-5-phosphate synthase, or the production of its products.

  17. Representation of Protein-Sequence Information by Amino Acid Subalphabets

    Andersen, Claus A. F.; Brunak, Soren

    2004-01-01

    Within computational biology, algorithms are constructed with the aim of extracting knowledge from biological data, in particular, data generated by the large genome projects, where gene and protein sequences are produced in high volume. In this article, we explore new ways of representing protein-sequence information, using machine learning strategies, where the primary goal is the discovery of novel powerful representations for use in AI techniques. In the case of proteins and the 20 differ...

  18. Simulation-Based Evaluation of Learning Sequences for Instructional Technologies

    McEneaney, John E.

    2016-01-01

    Instructional technologies critically depend on systematic design, and learning hierarchies are a commonly advocated tool for designing instructional sequences. But hierarchies routinely allow numerous sequences and choosing an optimal sequence remains an unsolved problem. This study explores a simulation-based approach to modeling learning…

  19. Amino Acid Sequence - KOME | LSDB Archive [Life Science Database Archive metadata

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ...CE Amino acid sequence Joomla SEF URLs by Artio About This Database Database Description Download License Update History

  20. Boronic acid-based autoligation of nucleic acids

    Barbeyron, R.; Vasseur, J.-J.; Smietana, M.;

    2013-01-01

    Abstract: The development of synthetic systems displaying dynamic and adaptive characteristics is a formidable challenge with wide applications from biotechnology to therapeutics. Recently, we described a dynamic and programmable nucleic acid-based system relying on the formation of reversible...

  1. cDNA-derived amino acid sequences of myoglobins from nine species of whales and dolphins.

    Iwanami, Kentaro; Mita, Hajime; Yamamoto, Yasuhiko; Fujise, Yoshihiro; Yamada, Tadasu; Suzuki, Tomohiko

    2006-10-01

    We determined the myoglobin (Mb) cDNA sequences of nine cetaceans, of which six are the first reports of Mb sequences: sei whale (Balaenoptera borealis), Bryde's whale (Balaenoptera edeni), pygmy sperm whale (Kogia breviceps), Stejneger's beaked whale (Mesoplodon stejnegeri), Longman's beaked whale (Indopacetus pacificus), and melon-headed whale (Peponocephala electra), and three confirm the previously determined chemical amino acid sequences: sperm whale (Physeter macrocephalus), common minke whale (Balaenoptera acutorostrata) and pantropical spotted dolphin (Stenella attenuata). We found two types of Mb in the skeletal muscle of pantropical spotted dolphin: Mb I with the same amino acid sequence as that deposited in the protein database, and Mb II, which differs at two amino acid residues compared with Mb I. Using an alignment of the amino acid or cDNA sequences of cetacean Mb, we constructed a phylogenetic tree by the NJ method. Clustering of cetacean Mb amino acid and cDNA sequences essentially follows the classical taxonomy of cetaceans, suggesting that Mb sequence data is valid for classification of cetaceans at least to the family level. PMID:16962803

  2. Homology of amino acid sequences of rat liver cathepsins B and H with that of papain.

    Takio, K; Towatari, T; Katunuma, N.; Teller, D C; Titani, K

    1983-01-01

    The amino acid sequences of rat liver lysosomal thiol endopeptidases, cathepsins B and H, are presented and compared with that of the plant thiol protease papain. The 252-residue sequence of cathepsin B and the 220-residue sequence of cathepsin H were determined largely by automated Edman degradation of their intact polypeptide chains and of the two chains of each enzyme generated by limited proteolysis. Subfragments of the chains were produced by enzymatic digestion and by chemical cleavage ...

  3. Semantics-based Refinement of Mandatory Behavior of Sequence Diagrams

    Lu, Lunjin

    2010-01-01

    Sequence diagrams are a widely used design notation for describing software behaviors. Many reusable software artifacts such as design patterns and design aspects make use of sequence diagrams to describe interaction behaviors. When a pattern or an aspect is reused in an application, it is important to ensure that the sequence diagrams for the application correctly refines the corresponding sequence diagrams for the pattern or aspect. Reasoning about refinement of sequence diagrams has not been addressed adequately in literature. In this paper, we focus on refinement of mandatory behavior specified by a UML sequence diagram. A novel trace semantics is given that captures precisely mandatory behavior specified by a sequence diagram and a refinement relation between sequence diagrams is formalized based on the semantics. Properties of the trace semantics and the refinement relation are studied.

  4. Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA

    Cowell, G M; Kønigshøfer, E; Danielsen, E M;

    1988-01-01

    The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC 3.4.11.2) was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...

  5. Representation of protein-sequence information by amino acid subalphabets

    Andersen, C.A.F.; Brunak, Søren

    2004-01-01

    Within computational biology, algorithms are constructed with the aim of extracting knowledge from biological data, in particular, data generated by the large genome projects, where gene and protein sequences are produced in high volume. In this article, we explore new ways of representing protei......-which now are common in proteins-might have emerged from simpler selections, or alphabets, in use earlier during the evolution of living organisms....

  6. Identification of protein superfamily from structure- based sequence motif

    2002-01-01

    The structure-based sequence motif of the distant proteins in evolution, protein tyrosine phosphatases (PTP) Ⅰ and Ⅱ superfamilies, as an example, has been defined by the structural comparison, structure-based sequence alignment and analyses on substitution patterns of residues in common sequence conserved regions. And the phosphatases Ⅰ and Ⅱ can be correctly identified together by the structure-based PTP sequence motif from SWISS-PROT and TrEBML databases. The results show that the correct rates of identification are over 98%. This is the first time to identify PTP Ⅰ and Ⅱ together by this motif.

  7. Two distinct ferredoxins from Rhodobacter capsulatus: complete amino acid sequences and molecular evolution.

    Saeki, K; Suetsugu, Y; Yao, Y; Horio, T; Marrs, B L; Matsubara, H

    1990-09-01

    Two distinct ferredoxins were purified from Rhodobacter capsulatus SB1003. Their complete amino acid sequences were determined by a combination of protease digestion, BrCN cleavage and Edman degradation. Ferredoxins I and II were composed of 64 and 111 amino acids, respectively, with molecular weights of 6,728 and 12,549 excluding iron and sulfur atoms. Both contained two Cys clusters in their amino acid sequences. The first cluster of ferredoxin I and the second cluster of ferredoxin II had a sequence, CxxCxxCxxxCP, in common with the ferredoxins found in Clostridia. The second cluster of ferredoxin I had a sequence, CxxCxxxxxxxxCxxxCM, with extra amino acids between the second and third Cys, which has been reported for other photosynthetic bacterial ferredoxins and putative ferredoxins (nif-gene products) from nitrogen-fixing bacteria, and with a unique occurrence of Met. The first cluster of ferredoxin II had a CxxCxxxxCxxxCP sequence, with two additional amino acids between the second and third Cys, a characteristics feature of Azotobacter-[3Fe-4S] [4Fe-4S]-ferredoxin. Ferredoxin II was also similar to Azotobacter-type ferredoxins with an extended carboxyl (C-) terminal sequence compared to the common Clostridium-type. The evolutionary relationship of the two together with a putative one recently found to be encoded in nifENXQ region in this bacterium [Moreno-Vivian et al. (1989) J. Bacteriol. 171, 2591-2598] is discussed. PMID:2277040

  8. Comparison of sequence-based and structure-based phylogenetic trees of homologous proteins: Inferences on protein evolution

    S Balaji; N Srinivasan

    2007-01-01

    Several studies based on the known three-dimensional (3-D) structures of proteins show that two homologous proteins with insignificant sequence similarity could adopt a common fold and may perform same or similar biochemical functions. Hence, it is appropriate to use similarities in 3-D structure of proteins rather than the amino acid sequence similarities in modelling evolution of distantly related proteins. Here we present an assessment of using 3-D structures in modelling evolution of homologous proteins. Using a dataset of 108 protein domain families of known structures with at least 10 members per family we present a comparison of extent of structural and sequence dissimilarities among pairs of proteins which are inputs into the construction of phylogenetic trees. We find that correlation between the structure-based dissimilarity measures and the sequence-based dissimilarity measures is usually good if the sequence similarity among the homologues is about 30% or more. For protein families with low sequence similarity among the members, the correlation coefficient between the sequence-based and the structure-based dissimilarities are poor. In these cases the structure-based dendrogram clusters proteins with most similar biochemical functional properties better than the sequence-similarity based dendrogram. In multi-domain protein families and disulphide-rich protein families the correlation coefficient for the match of sequence-based and structure-based dissimilarity (SDM) measures can be poor though the sequence identity could be higher than 30%. Hence it is suggested that protein evolution is best modelled using 3-D structures if the sequence similarities (SSM) of the homologues are very low.

  9. Complete nucleotide sequence of cDNA and deduced amino acid sequence of rat liver catalase.

    Furuta, S.; Hayashi, H; Hijikata, M; Miyazawa, S.; Osumi, T; Hashimoto, T.

    1986-01-01

    We have isolated five cDNA clones for rat liver catalase (hydrogen peroxide:hydrogen peroxide oxidoreductase, EC 1.11.1.6). These clones overlapped with each other and covered the entire length of the mRNA, which had been estimated to be 2.4 kilobases long by blot hybridization analysis of electrophoretically fractionated RNA. Nucleotide sequencing was carried out on these five clones and the composite nucleotide sequence of catalase cDNA was determined. The 5' noncoding region contained 83 b...

  10. Protein chemotaxonomy. XIII. Amino acid sequence of ferredoxin from Panax ginseng.

    Mino, Yoshiki

    2006-08-01

    The complete amino acid sequence of [2Fe-2S] ferredoxin from Panax ginseng (Araliaceae) has been determined by automated Edman degradation of the entire S-carboxymethylcysteinyl protein and of the peptides obtained by enzymatic digestion. This ferredoxin has a unique amino acid sequence, which includes an insertion of Tyr at the 3rd position from the amino-terminus and a deletion of two amino acid residues at the carboxyl terminus. This ferredoxin had 18 differences in its amino acid sequence compared to that of Petroselinum sativum (Umbelliferae). In contrast, 23-33 differences were observed compared to other dicotyledonous plants. This suggests that Panax ginseng is related taxonomically to umbelliferous plants. PMID:16880642

  11. DNA Sequence Representation and Comparison Based on Quaternion Number System

    Hsuan-T. Chang

    2012-12-01

    Full Text Available Conventional schemes for DNA sequence representation, storage, and processing areusually developed based on the character-based formats.We propose the quaternion number system for numerical representation and further processing on DNA sequences.In the proposed method, the quaternion cross-correlation operation can be used to obtain both the global and local matching/mismatching information between two DNA sequences from the depicted one-dimensional curve and two-dimensional pattern, respectively.Simulation results on various DNA sequences and the comparison result with the wellknown BLAST method are obtained to verify the effectiveness of the proposed method.

  12. Echo Cancellation Research of Channel Estimation based on PN Sequence

    Yongqin Zhou

    2010-11-01

    Full Text Available For the problem of estimation sequence effect on channel estimation accuracy and echo cancellation effect, this paper, based on the basic principle of echo cancellation, analyses the effect of PN sequence mechanism and the correlation on the channel estimation parameters. Comparing with using the input signal itself as the estimation sequence. With the input signal OFDM, the results of simulation and actual operation show that the method can increase both the accuracy of channel estimation and echo cancellation effect effectively.

  13. RNA-RNA interaction prediction based on multiple sequence alignments

    Li, Andrew X; Qin, Jing; Reidys, Christian M

    2010-01-01

    Recently, $O(N^6)$ time and $O(N^4)$ space dynamic programming algorithms have become available that compute the partition function of RNA-RNA interaction complexes for pairs of RNA sequences. These algorithms and the biological requirement of more reliable interactions motivate to utilize the additional information contained in multiple sequence alignments and to generalize the above framework to the partition function and base pairing probabilities for multiple sequence alignments.

  14. Property-based sequence representations do not adequately encode local protein folding information.

    Solis, A D; Rackovsky, S

    2007-06-01

    We examine the informatic characteristics of amino acid representations based on physical properties. We demonstrate that sequences rewritten using contracted alphabets based on physical properties do not encode local folding information well. The best four-character alphabet can only encode approximately 57% of the maximum possible amount of structural information. This result suggests that property-based representations that operate on a local length scale are not likely to be useful in homology searches and fold-recognition exercises. PMID:17387739

  15. Nucleotide sequence of the beta-cyclodextrin glucanotransferase gene of alkalophilic Bacillus sp. strain 1011 and similarity of its amino acid sequence to those of alpha-amylases.

    Kimura, K.; Kataoka, S; Ishii, Y; Takano, T.; Yamane, K

    1987-01-01

    The nucleotide sequence of the gene for cyclodextrin glucanotransferase of alkalophilic Bacillus sp. strain 1011 was determined. The deduced amino acid sequence at the NH2-terminal side of the enzyme showed a high homology with the sequences of alpha-amylase in the three regions which constitutes the active centers of alpha-amylases.

  16. Feature-based Image Sequence Compression Coding

    2001-01-01

    A novel compressing method for video teleconference applications is presented. Semantic-based coding based on human image feature is realized, where human features are adopted as parameters. Model-based coding and the concept of vector coding are combined with the work on image feature extraction to obtain the result.

  17. Complete amino acid sequence of human plasma Zn-α2-glycoprotein and its homology to histocompatibility antigens

    In the present study the complete amino acid sequence of human plasma Zn-α2-glycoprotein was determined. This protein whose biological function is unknown consists of a single polypeptide chain of 276 amino acid residues including 8 tryptophan residues and has a pyroglutamyl residue at the amino terminus. The location of the two disulfide bonds in the polypeptide chain was also established. The three glycans, whose structure was elucidated with the aid of 500 MHz 1H NMR spectroscopy, were sialylated N-biantennas. The molecular weight calculated from the polypeptide and carbohydrate structure is 38,478, which is close to the reported value of ≅ 41,000 based on physicochemical measurements. The predicted secondary structure appeared to comprised of 23% α-helix, 27% β-sheet, and 22% β-turns. The three N-glycans were found to be located in β-turn regions. An unexpected finding was made by computer analysis of the sequence data; this revealed that Zn-α2-glycoprotein is closely related to antigens of the major histocompatibility complex in amino acid sequence and in domain structure. There was an unusually high degree of sequence homology with the α chains of class I histocompatibility antigens. Moreover, this plasma protein was shown to be a member of the immunoglobulin gene superfamily. Zn-α2-glycoprotein appears to be truncated secretory major histocompatibility complex-related molecule, and it may have a role in the expression of the immune response

  18. Introduction of restriction enzyme sites in protein-coding DNA sequences by site-specific mutagenesis not affecting the amino acid sequence: a computer program.

    Arentzen, R; Ripka, W. C.

    1984-01-01

    Structure/function relationship studies of proteins are greatly facilitated by recombinant DNA technology which allows specific amino acid mutations to be made at the DNA sequence level by site-specific mutagenesis employing synthetic oligonucleotides. This technique has been successfully used to alter one or two amino acids in a protein. Replacement of existing DNA sequence coding for several amino acids with new synthetic DNA fragments would be facilitated by the presence of unique restrict...

  19. An Ant-Based Model for Multiple Sequence Alignment

    Guinand, Frédéric

    2008-01-01

    Multiple sequence alignment is a key process in today's biology, and finding a relevant alignment of several sequences is much more challenging than just optimizing some improbable evaluation functions. Our approach for addressing multiple sequence alignment focuses on the building of structures in a new graph model: the factor graph model. This model relies on block-based formulation of the original problem, formulation that seems to be one of the most suitable ways for capturing evolutionary aspects of alignment. The structures are implicitly built by a colony of ants laying down pheromones in the factor graphs, according to relations between blocks belonging to the different sequences.

  20. Base-acid hybrid water electrolysis.

    Chen, Long; Dong, Xiaoli; Wang, Fei; Wang, Yonggang; Xia, Yongyao

    2016-02-21

    A base-acid hybrid electrolytic system with a low onset voltage of 0.78 V for water electrolysis was developed by using a ceramic Li-ion exchange membrane to separate the oxygen-evolving reaction (OER) in a basic electrolyte solution containing the Li-ion and hydrogen-evolving reaction (HER) in an acidic electrolyte solution. PMID:26804323

  1. Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

    Budzanivska I. G.

    2014-03-01

    Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

  2. Movement Pattern Analysis Based on Sequence Signatures

    Seyed Hossein Chavoshi

    2015-09-01

    Full Text Available Increased affordability and deployment of advanced tracking technologies have led researchers from various domains to analyze the resulting spatio-temporal movement data sets for the purpose of knowledge discovery. Two different approaches can be considered in the analysis of moving objects: quantitative analysis and qualitative analysis. This research focuses on the latter and uses the qualitative trajectory calculus (QTC, a type of calculus that represents qualitative data on moving point objects (MPOs, and establishes a framework to analyze the relative movement of multiple MPOs. A visualization technique called sequence signature (SESI is used, which enables to map QTC patterns in a 2D indexed rasterized space in order to evaluate the similarity of relative movement patterns of multiple MPOs. The applicability of the proposed methodology is illustrated by means of two practical examples of interacting MPOs: cars on a highway and body parts of a samba dancer. The results show that the proposed method can be effectively used to analyze interactions of multiple MPOs in different domains.

  3. Accurate prediction of hot spot residues through physicochemical characteristics of amino acid sequences

    Chen, Peng

    2013-07-23

    Hot spot residues of proteins are fundamental interface residues that help proteins perform their functions. Detecting hot spots by experimental methods is costly and time-consuming. Sequential and structural information has been widely used in the computational prediction of hot spots. However, structural information is not always available. In this article, we investigated the problem of identifying hot spots using only physicochemical characteristics extracted from amino acid sequences. We first extracted 132 relatively independent physicochemical features from a set of the 544 properties in AAindex1, an amino acid index database. Each feature was utilized to train a classification model with a novel encoding schema for hot spot prediction by the IBk algorithm, an extension of the K-nearest neighbor algorithm. The combinations of the individual classifiers were explored and the classifiers that appeared frequently in the top performing combinations were selected. The hot spot predictor was built based on an ensemble of these classifiers and to work in a voting manner. Experimental results demonstrated that our method effectively exploited the feature space and allowed flexible weights of features for different queries. On the commonly used hot spot benchmark sets, our method significantly outperformed other machine learning algorithms and state-of-the-art hot spot predictors. The program is available at http://sfb.kaust.edu.sa/pages/software.aspx. © 2013 Wiley Periodicals, Inc.

  4. Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.

    Meng-Jun Li; Ai-Qin Li; Han Xia; Chuan-Zhi Zhao; Chang-Sheng Li; Shu-Bo Wan; Yu-Ping Bi; Xing-Jun Wang

    2009-06-01

    The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, -ketoacyl-ACP synthase (I, II, III), -ketoacyl-ACP reductase, -hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

  5. 37 CFR 1.824 - Form and format for nucleotide and/or amino acid sequence submissions in computer readable form.

    2010-07-01

    ... nucleotide and/or amino acid sequence submissions in computer readable form. 1.824 Section 1.824 Patents... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... readable form may be created by any means, such as word processors, nucleotide/amino acid sequence...

  6. Draft genome sequence of the docosahexaenoic acid producing thraustochytrid Aurantiochytrium sp. T66.

    Liu, Bin; Ertesvåg, Helga; Aasen, Inga Marie; Vadstein, Olav; Brautaset, Trygve; Heggeset, Tonje Marita Bjerkan

    2016-06-01

    Thraustochytrids are unicellular, marine protists, and there is a growing industrial interest in these organisms, particularly because some species, including strains belonging to the genus Aurantiochytrium, accumulate high levels of docosahexaenoic acid (DHA). Here, we report the draft genome sequence of Aurantiochytrium sp. T66 (ATCC PRA-276), with a size of 43 Mbp, and 11,683 predicted protein-coding sequences. The data has been deposited at DDBJ/EMBL/Genbank under the accession LNGJ00000000. The genome sequence will contribute new insight into DHA biosynthesis and regulation, providing a basis for metabolic engineering of thraustochytrids. PMID:27222814

  7. Sequence Context Specific Mutagenesis and Base Excision Repair

    Donigan, Katherine; Sweasy, Joann B.

    2009-01-01

    Base excision repair is critical for the maintenance of genome stability because it repairs at least 20,000 endogenously generated DNA lesions per cell per day. Several enzymes within the base excision repair pathway exhibit sequence context dependency during the excision and DNA synthesis steps of repair. New evidence is emerging that germ line and tumor-associated variants of enzymes in this repair pathway exhibit sequence context dependence that is different from their ancestral counterpar...

  8. A Diagnostic HIV-1 Tropism System Based on Sequence Relatedness

    Edwards, Suzanne; Stucki, Heinz; Bader, Joëlle; Vidal, Vincent; Kaiser, Rolf; Battegay, Manuel; Klimkait, Thomas

    2014-01-01

    Key clinical studies for HIV coreceptor antagonists have used the phenotyping-based Trofile test. Meanwhile various simpler-to-do genotypic tests have become available that are compatible with standard laboratory equipment and Web-based interpretation tools. However, these systems typically analyze only the most prominent virus sequence in a specimen. We present a new diagnostic HIV tropism test not needing DNA sequencing. The system, XTrack, uses physical properties of DNA duplexes after hyb...

  9. Immune and Genetic Algorithm Based Assembly Sequence Planning

    YANG Jian-guo; LI Bei-zhi; YU Lei; JIN Yu-song

    2004-01-01

    In this paper an assembly sequence planning model inspired by natural immune and genetic algorithm (ASPIG) based on the part degrees of freedom matrix (PDFM) is proposed, and a proto system - DSFAS based on the ASPIG is introduced to solve assembly sequence problem. The concept and generation of PDFM and DSFAS are also discussed. DSFAS can prevent premature convergence, and promote population diversity, and can accelerate the learning and convergence speed in behavior evolution problem.

  10. Base-sequence-dependent sliding of proteins on DNA

    Barbi, M; Place, C.; Popkov, V.; Salerno, M.

    2004-01-01

    The possibility that the sliding motion of proteins on DNA is influenced by the base sequence through a base pair reading interaction, is considered. Referring to the case of the T7 RNA-polymerase, we show that the protein should follow a noise-influenced sequence-dependent motion which deviate from the standard random walk usually assumed. The general validity and the implications of the results are discussed.

  11. DNA sequence analysis with droplet-based microfluidics

    Abate, Adam R.; Hung, Tony; Sperling, Ralph A.; Mary, Pascaline; Rotem, Assaf; Agresti, Jeremy J.; Weiner, Michael A.; Weitz, David A.

    2014-01-01

    Droplet-based microfluidic techniques can form and process micrometer scale droplets at thousands per second. Each droplet can house an individual biochemical reaction, allowing millions of reactions to be performed in minutes with small amounts of total reagent. This versatile approach has been used for engineering enzymes, quantifying concentrations of DNA in solution, and screening protein crystallization conditions. Here, we use it to read the sequences of DNA molecules with a FRET-based assay. Using probes of different sequences, we interrogate a target DNA molecule for polymorphisms. With a larger probe set, additional polymorphisms can be interrogated as well as targets of arbitrary sequence. PMID:24185402

  12. Better prediction of protein contact number using a support vector regression analysis of amino acid sequence

    Yuan Zheng

    2005-10-01

    Full Text Available Abstract Background Protein tertiary structure can be partly characterized via each amino acid's contact number measuring how residues are spatially arranged. The contact number of a residue in a folded protein is a measure of its exposure to the local environment, and is defined as the number of Cβ atoms in other residues within a sphere around the Cβ atom of the residue of interest. Contact number is partly conserved between protein folds and thus is useful for protein fold and structure prediction. In turn, each residue's contact number can be partially predicted from primary amino acid sequence, assisting tertiary fold analysis from sequence data. In this study, we provide a more accurate contact number prediction method from protein primary sequence. Results We predict contact number from protein sequence using a novel support vector regression algorithm. Using protein local sequences with multiple sequence alignments (PSI-BLAST profiles, we demonstrate a correlation coefficient between predicted and observed contact numbers of 0.70, which outperforms previously achieved accuracies. Including additional information about sequence weight and amino acid composition further improves prediction accuracies significantly with the correlation coefficient reaching 0.73. If residues are classified as being either "contacted" or "non-contacted", the prediction accuracies are all greater than 77%, regardless of the choice of classification thresholds. Conclusion The successful application of support vector regression to the prediction of protein contact number reported here, together with previous applications of this approach to the prediction of protein accessible surface area and B-factor profile, suggests that a support vector regression approach may be very useful for determining the structure-function relation between primary protein sequence and higher order consecutive protein structural and functional properties.

  13. Complete amino acid sequence of branched-chain amino acid aminotransferase (transaminase B) of Salmonella typhimurium, identification of the coenzyme-binding site and sequence comparison analysis

    The complete amino acid sequence of the subunit of branched-chain amino acid aminotransferase of Salmonella typhimurium was determined by automated Edman degradation of peptide fragments generated by chemical and enzymatic digestion of S-carboxymethylated and S-pyridylethylated transaminase B. Peptide fragments of transaminase B were generated by treatment of the enzyme with trypsin, Staphylococcus aureus V8 protease, endoproteinase Lys-C, and cyanogen bromide. Protocols were developed for separation of the peptide fragments by reverse-phase high performance liquid chromatography (HPLC), ion-exchange HPLC, and SDS-urea gel electrophoresis. The enzyme subunit contains 308 amino acid residues and has a molecular weight of 33,920 daltons. The coenzyme-binding site was determined by treatment of the enzyme, containing bound pyridoxal 5-phosphate, with tritiated sodium borohydride prior to trypsin digestion. Monitoring radioactivity incorporation and peptide map comparisons with an apoenzyme tryptic digest, allowed identification of the pyridoxylated-peptide which was isolated by reverse-phase HPLC and sequenced. The coenzyme-binding site is a lysyl residue at position 159. Some peptides were further characterized by fast atom bombardment mass spectrometry

  14. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert

    2010-05-03

    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  15. The human receptor for urokinase plasminogen activator. NH2-terminal amino acid sequence and glycosylation variants

    Behrendt, N; Rønne, E; Ploug, M; Petri, T; Løber, D; Nielsen, L S; Schleuning, W D; Blasi, F; Appella, E; Danø, K

    1990-01-01

    -PA. The purified protein shows a single 55-60 kDa band after sodium dodecyl sulfate-polyacrylamide gel electrophoresis and silver staining. It is a heavily glycosylated protein, the deglycosylated polypeptide chain comprising only 35 kDa. The glycosylated protein contains N-acetyl-D-glucosamine and sialic...... acid, but no N-acetyl-D-galactosamine. Glycosylation is responsible for substantial heterogeneity in the receptor on phorbol ester-stimulated U937 cells, and also for molecular weight variations among various cell lines. The amino acid composition and the NH2-terminal amino acid sequence are reported...

  16. Molecular cloning and sequence analysis of cDNA encoding human prostatic acid phosphatase.

    Vihko, P; Virkkunen, P; Henttu, P; Roiko, K; Solin, T; Huhtala, M L

    1988-08-29

    lambda gt11 clones encoding human prostatic acid phosphatase (PAP) (EC 3.1.3.2) were isolated from human prostatic cDNA libraries by immunoscreening with polyclonal antisera. Sequence data obtained from several overlapping clones indicated that the composite cDNAs contained the complete coding region for PAP, which encodes a 354-residue protein with a calculated molecular mass of 41,126 Da. In the 5'-end, the cDNA codes for a signal peptide of 32 amino acids. Direct protein sequencing of the amino-terminus of the mature protein and its proteolytic fragments confirmed the identity of the predicted protein sequence. PAP has no apparent sequence homology to other known proteins. However, both the cDNA clones coding for human placental alkaline phosphatase and PAP have an alu-type repetitive sequence about 900 nucleotides downstream from the coding region in the 3'-untranslated region. Two of our cDNA clones differed from others at the 5'-ends. RNA blot analysis indicated mRNA of 3.3 kb. We are continuing to study whether acid phosphatases form a gene family as do alkaline phosphatases. PMID:2842184

  17. Draft Genome Sequence of Perfluorooctane Acid-Degrading Bacterium Pseudomonas parafulva YAB-1

    Yi, Langbo; Tang, Chongjian; Peng, Qingjing; Peng, Qingzhong; Chai, Liyuan

    2015-01-01

    Pseudomonas parafulva YAB-1, isolated from perfluorinated compound-contaminated soil, has the ability to degrade perfluorooctane acid (PFOA) compound. Here, we report the draft genome sequence and annotation of the PFOA-degrading bacterium P. parafulva YAB-1. The data provide the basis to investigate the molecular mechanism of PFOA metabolism.

  18. Draft Genome Sequence of Perfluorooctane Acid-Degrading Bacterium Pseudomonas parafulva YAB-1

    Tang, Chongjian; Peng, Qingjing; Peng, Qingzhong

    2015-01-01

    Pseudomonas parafulva YAB-1, isolated from perfluorinated compound-contaminated soil, has the ability to degrade perfluorooctane acid (PFOA) compound. Here, we report the draft genome sequence and annotation of the PFOA-degrading bacterium P. parafulva YAB-1. The data provide the basis to investigate the molecular mechanism of PFOA metabolism. PMID:26337877

  19. Evolution of vertebrate IgM: complete amino acid sequence of the constant region of Ambystoma mexicanum mu chain deduced from cDNA sequence.

    Fellah, J S; Wiles, M V; Charlemagne, J; Schwager, J

    1992-10-01

    cDNA clones coding for the constant region of the Mexican axolotl (Ambystoma mexicanum) mu heavy immunoglobulin chain were selected from total spleen RNA, using a cDNA polymerase chain reaction technique. The specific 5'-end primer was an oligonucleotide homologous to the JH segment of Xenopus laevis mu chain. One of the clones, JHA/3, corresponded to the complete constant region of the axolotl mu chain, consisting of a 1362-nucleotide sequence coding for a polypeptide of 454 amino acids followed in 3' direction by a 179-nucleotide untranslated region and a polyA+ tail. The axolotl C mu is divided into four typical domains (C mu 1-C mu 4) and can be aligned with the Xenopus C mu with an overall identity of 56% at the nucleotide level. Percent identities were particularly high between C mu 1 (59%) and C mu 4 (71%). The C-terminal 20-amino acid segment which constitutes the secretory part of the mu chain is strongly homologous to the equivalent sequences of chondrichthyans and of other tetrapods, including a conserved N-linked oligosaccharide, the penultimate cysteine and the C-terminal lysine. The four C mu domains of 13 vertebrate species ranging from chondrichthyans to mammals were aligned and compared at the amino acid level. The significant number of mu-specific residues which are conserved into each of the four C mu domains argues for a continuous line of evolution of the vertebrate mu chain. This notion was confirmed by the ability to reconstitute a consistent vertebrate evolution tree based on the phylogenic parsimony analysis of the C mu 4 sequences. PMID:1382992

  20. Complete amino acid sequence of the human alpha 5 (IV) collagen chain and identification of a single-base mutation in exon 23 converting glycine 521 in the collagenous domain to cysteine in an Alport syndrome patient

    Zhou, J; Hertz, Jens Michael; Leinonen, A; Tryggvason, K

    1992-01-01

    alleles. The mutation which was located to exon 23 was sequenced from a polymerase chain reaction-amplified product, and shown to be a G----T change in the coding strand. The mutation changed the GGT codon of glycine 521 to cysteine. The same mutation was found in one allele of the female cousin. The...

  1. Molecular cloning and sequence analysis of complementary DNA encoding rat mammary gland medium-chain S-acyl fatty acid synthetase thio ester hydrolase

    Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from ∼ 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH

  2. Amino acid sequence of the serine-repeat antigen (SERA) of Plasmodium falciparum determined from cloned cDNA.

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1988-09-01

    We report the isolation of cDNA clones for a Plasmodium falciparum gene that encodes the complete amino acid sequence of a previously identified exported blood stage antigen. The Mr of this antigen protein had been determined by sodium dodecylsulphate-polyacrylamide gel electrophoresis analysis, by different workers, to be 113,000, 126,000, and 140,000. We show, by cDNA nucleotide sequence analysis, that this antigen gene encodes a 989 amino acid protein (111 kDa) that contains a potential signal peptide, but not a membrane anchor domain. In the FCR3 strain the serine content of the protein was 11%, of which 57% of the serine residues were localized within a 201 amino acid sequence that included 35 consecutive serine residues. The protein also contained three possible N-linked glycosylation sites and numerous possible O-linked glycosylation sites. The mRNA was abundant during late trophozoite-schizont parasite stages. We propose to identity this antigen, which had been called p126, by the acronym SERA, serine-repeat antigen, based on its complete structure. The usefulness of the cloned cDNA as a source of a possible malaria vaccine is considered in view of the previously demonstrated ability of the antigen to induce parasite-inhibitory antibodies and a protective immune response in Saimiri monkeys. PMID:2847041

  3. cDNA-derived amino-acid sequence of a land turtle (Geochelone carbonaria) beta-chain hemoglobin.

    Bordin, S; Meza, A N; Saad, S T; Ogo, S H; Costa, F F

    1997-06-01

    The cDNA sequence encoding the turtle Geochelone carbonaria beta-chain was determinated. The isolation of hemoglobin mRNA was based on degenerate primers' PCR in combination with 5'- and 3'-RACE protocol. The full length cDNA is 615 bp with the ATG start codon at position 53 and TGA stop codon at position 495; The AATAAA polyadenylation signal is found at position 599. The deduced polypeptyde contains 146 amino-acid residues. The predicted amino acid sequence shares 83% identity with the beta-globin of a related specie, the aquatic turtle C. p. belli. Otherwise, identity is higher when compared with chicken beta-Hb (80%) than with other reptilian orders (Squamata, 69%, and Crocodilia, 61%). Compared with human HbA, there is 67% identity, and at least three amino acid substitutions could be of some functional significance (Glu43 beta-->Ser, His116 beta-->Thr and His143 beta-->Leu). To our knowledge this represents the first cDNA sequence of a reptile globin gene described. PMID:9238523

  4. Use of a structural alphabet to find compatible folds for amino acid sequences.

    Mahajan, Swapnil; de Brevern, Alexandre G; Sanejouand, Yves-Henri; Srinivasan, Narayanaswamy; Offmann, Bernard

    2015-01-01

    The structural annotation of proteins with no detectable homologs of known 3D structure identified using sequence-search methods is a major challenge today. We propose an original method that computes the conditional probabilities for the amino-acid sequence of a protein to fit to known protein 3D structures using a structural alphabet, known as "Protein Blocks" (PBs). PBs constitute a library of 16 local structural prototypes that approximate every part of protein backbone structures. It is used to encode 3D protein structures into 1D PB sequences and to capture sequence to structure relationships. Our method relies on amino acid occurrence matrices, one for each PB, to score global and local threading of query amino acid sequences to protein folds encoded into PB sequences. It does not use any information from residue contacts or sequence-search methods or explicit incorporation of hydrophobic effect. The performance of the method was assessed with independent test datasets derived from SCOP 1.75A. With a Z-score cutoff that achieved 95% specificity (i.e., less than 5% false positives), global and local threading showed sensitivity of 64.1% and 34.2%, respectively. We further tested its performance on 57 difficult CASP10 targets that had no known homologs in PDB: 38 compatible templates were identified by our approach and 66% of these hits yielded correctly predicted structures. This method scales-up well and offers promising perspectives for structural annotations at genomic level. It has been implemented in the form of a web-server that is freely available at http://www.bo-protscience.fr/forsa. PMID:25297700

  5. Nanopore-based Fourth-generation DNA Sequencing Technology

    Yanxiao Feng; Yuechuan Zhang; Cuifeng Ying; Deqiang Wang; Chunlei Du

    2015-01-01

    Nanopore-based sequencers, as the fourth-generation DNA sequencing technology, have the potential to quickly and reliably sequence the entire human genome for less than $1000, and possibly for even less than$100. The single-molecule techniques used by this technology allow us to further study the interaction between DNA and protein, as well as between protein and protein. Nanopore analysis opens a new door to molecular biology investigation at the single-molecule scale. In this article, we have reviewed academic achievements in nanopore technology from the past as well as the latest advances, including both biological and solid-state nanopores, and discussed their recent and potential applications.

  6. An optical CDMA system based on chaotic sequences

    Liu, Xiao-lei; En, De; Wang, Li-guo

    2014-03-01

    In this paper, a coherent asynchronous optical code division multiple access (OCDMA) system is proposed, whose encoder/decoder is an all-optical generator. This all-optical generator can generate analog and bipolar chaotic sequences satisfying the logistic maps. The formula of bit error rate (BER) is derived, and the relationship of BER and the number of simultaneous transmissions is analyzed. Due to the good property of correlation, this coherent OCDMA system based on these bipolar chaotic sequences can support a large number of simultaneous users, which shows that these chaotic sequences are suitable for asynchronous OCDMA system.

  7. Reassociation kinetics-based approach for partial genome sequencing of the cattle tick, Rhipicephalus (Boophilus microplus

    Bellgard Matthew

    2010-06-01

    Full Text Available Abstract Background The size and repetitive nature of the Rhipicephalus microplus genome makes obtaining a full genome sequence fiscally and technically problematic. To selectively obtain gene-enriched regions of this tick's genome, Cot filtration was performed, and Cot-filtered DNA was sequenced via 454 FLX pyrosequencing. Results The sequenced Cot-filtered genomic DNA was assembled with an EST-based gene index of 14,586 unique entries where each EST served as a potential "seed" for scaffold formation. The new sequence assembly extended the lengths of 3,913 of the 14,586 gene index entries. Over half of the extensions corresponded to extensions of over 30 amino acids. To survey the repetitive elements in the tick genome, the complete sequences of five BAC clones were determined. Both Class I and II transposable elements were found. Comparison of the BAC and Cot filtration data indicates that Cot filtration was highly successful in filtering repetitive DNA out of the genomic DNA used in 454 sequencing. Conclusion Cot filtration is a very useful strategy to incorporate into genome sequencing projects on organisms with large genome sizes and which contain high percentages of repetitive, difficult to assemble, genomic DNA. Combining the Cot selection approach with 454 sequencing and assembly with a pre-existing EST database as seeds resulted in extensions of 27% of the members of the EST database.

  8. Markov chaotic sequences for correlation based watermarking schemes

    In this paper, statistical analysis of watermarking schemes based on correlation detection is presented. Statistical properties of watermark sequences generated by piecewise-linear Markov maps are exploited, resulting in superior watermark detection reliability. Correlation/spectral properties of such sequences are easily controllable, a fact that affects the watermarking system performance. A family of chaotic maps, namely the skew tent map family, is proposed for use in watermarking schemes

  9. Analysis of Chimpanzee History Based on Genome Sequence Alignments

    Caswell, Jennifer L.; Richter, Daniel J.; Neubauer, Julie; Schirmer, Christine; Gnerre, Sante; Mallick, Swapan; Reich, David Emil

    2008-01-01

    Population geneticists often study small numbers of carefully chosen loci, but it has become possible to obtain orders of magnitude for more data from overlaps of genome sequences. Here, we generate tens of millions of base pairs of multiple sequence alignments from combinations of three western chimpanzees, three central chimpanzees, an eastern chimpanzee, a bonobo, a human, an orangutan, and a macaque. Analysis provides a more precise understanding of demographic history than was previously...

  10. Amino acid sequences and structures of chicken and turkey beta 2-microglobulin

    Welinder, K G; Jespersen, H M; Walther-Rasmussen, J; Skjødt, K

    The complete amino acid sequences of chicken and turkey beta 2-microglobulins have been determined by analyses of tryptic, V8-proteolytic and cyanogen bromide fragments, and by N-terminal sequencing. Mass spectrometric analysis of chicken beta 2-microglobulin supports the sequence-derived Mr of 11......,048. The higher apparent Mr obtained for the avian beta 2-microglobulins as compared to human beta 2-microglobulin by SDS-PAGE is not understood. Chicken and turkey beta 2-microglobulin consist of 98 residues and deviate at seven positions: 60, 66, 74-76, 78 and 82. The chicken and turkey sequences are...... complex suggest that the seven chicken to turkey differences are exposed to solvent in the avian MHC class I complex. The key residues of beta 2-microglobulin involved in alpha chain contacts within the MHC class I molecule are highly conserved between chicken and man. This explains that heterologous...

  11. Software scripts for quality checking of high-throughput nucleic acid sequencers.

    Lazo, G R; Tong, J; Miller, R; Hsia, C; Rausch, C; Kang, Y; Anderson, O D

    2001-06-01

    We have developed a graphical interface to allow the researcher to view and assess the quality of sequencing results using a series of program scripts developed to process data generated by automated sequencers. The scripts are written in Perl programming language and are executable under the cgibin directory of a Web server environment. The scripts direct nucleic acid sequencing trace file data output from automated sequencers to be analyzed by the phred molecular biology program and are displayed as graphical hypertext mark-up language (HTML) pages. The scripts are mainly designed to handle 96-well microtiter dish samples, but the scripts are also able to read data from 384-well microtiter dishes 96 samples at a time. The scripts may be customized for different laboratory environments and computer configurations. Web links to the sources and discussion page are provided. PMID:11414222

  12. Nucleotide sequence analysis of the gene encoding the Deinococcus radiodurans surface protein, derived amino acid sequence, and complementary protein chemical studies

    Peters, J.; Peters, M.; Lottspeich, F.; Schaefer, W.; Baumeister, W.

    1987-11-01

    The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate (HPI))-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%) of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids.

  13. Nucleotide sequence analysis of the gene encoding the Deinococcus radiodurans surface protein, derived amino acid sequence, and complementary protein chemical studies

    The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate [HPI])-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%) of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids

  14. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  15. The developmental transcriptome landscape of bovine skeletal muscle defined by Ribo-Zero ribonucleic acid sequencing.

    Sun, X; Li, M; Sun, Y; Cai, H; Li, R; Wei, X; Lan, X; Huang, Y; Lei, C; Chen, H

    2015-12-01

    Ribonucleic acid sequencing (RNA-Seq) libraries are normally prepared with oligo(dT) selection of poly(A)+ mRNA, but it depends on intact total RNA samples. Recent studies have described Ribo-Zero technology, a novel method that can capture both poly(A)+ and poly(A)- transcripts from intact or fragmented RNA samples. We report here the first application of Ribo-Zero RNA-Seq for the analysis of the bovine embryonic, neonatal, and adult skeletal muscle whole transcriptome at an unprecedented depth. Overall, 19,893 genes were found to be expressed, with a high correlation of expression levels between the calf and the adult. Hundreds of genes were found to be highly expressed in the embryo and decreased at least 10-fold after birth, indicating their potential roles in embryonic muscle development. In addition, we present for the first time the analysis of global transcript isoform discovery in bovine skeletal muscle and identified 36,694 transcript isoforms. Transcriptomic data were also analyzed to unravel sequence variations; 185,036 putative SNP and 12,428 putative short insertions-deletions (InDel) were detected. Specifically, many stop-gain, stop-loss, and frameshift mutations were identified that probably change the relative protein production and sequentially affect the gene function. Notably, the numbers of stage-specific transcripts, alternative splicing events, SNP, and InDel were greater in the embryo than in the calf and the adult, suggesting that gene expression is most active in the embryo. The resulting view of the transcriptome at a single-base resolution greatly enhances the comprehensive transcript catalog and uncovers the global trends in gene expression during bovine skeletal muscle development. PMID:26641174

  16. Preparation of Nucleic Acid Libraries for Personalized Sequencing Systems Using an Integrated Microfluidic Hub Technology (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

    Patel, Kamlesh D [Ken; SNL,

    2012-06-01

    Kamlesh (Ken) Patel from Sandia National Laboratories (Livermore, California) presents "Preparation of Nucleic Acid Libraries for Personalized Sequencing Systems Using an Integrated Microfluidic Hub Technology " at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

  17. Complete nucleic acid sequence of Penaeus stylirostris densovirus (PstDNV) from India.

    Rai, Praveen; Safeena, Muhammed P; Karunasagar, Iddya; Karunasagar, Indrani

    2011-06-01

    Infectious hypodermal and hematopoietic necrosis virus (IHHNV) of shrimp, recently been classified as Penaeus stylirostris densovirus (PstDNV). The complete nucleic acid sequence of PstDNV from India was obtained by cloning and sequencing of different DNA fragment of the virus. The genome organisation of PstDNV revealed that there were three major coding domains: a left ORF (NS1) of 2001 bp, a mid ORF (NS2) of 1092 bp and a right ORF (VP) of 990 bp. The complete genome and amino acid sequences of three proteins viz., NS1, NS2 and VP were compared with the genomes of the virus reported from Hawaii, China and Mexico and with partial sequence available from isolates from different regions. The phylogenetic analysis of shrimp, insect and vertebrate parvovirus sequences showed that the Indian PstDNV isolate is phylogenetically more closely related to one of the three isolates from Taiwan (AY355307), and two isolates (AY362547 and AY102034) from Thailand. PMID:21402111

  18. Hypokalemic paralysis and acid-base balance

    Ivo Casagranda

    2006-10-01

    Full Text Available Three cases of hypokalemic paralysis are reported, presenting to the Emergency Department. The first is a patient with a hypokalemic periodic paralysis with a normal acid-base status, the second is a case of hypokalemic flaccid paralysis of all extremities with a normal anion gap metabolic acidosis, the last is a patient with a hypokalemic distal paralysis of right upper arm with metabolic alkalosis. Afterwards some pathophysiologic principles and the clinical aspects of hypokalemia are discussed and an appropriate approach to do in Emergency Department, to identify the hypokalemic paralysis etiologies in the Emergency Department, is presented, beginning from the evaluation of acid-base status.

  19. DNA sequence analysis using hierarchical ART-based classification networks

    LeBlanc, C.; Hruska, S.I. [Florida State Univ., Tallahassee, FL (United States); Katholi, C.R.; Unnasch, T.R. [Univ. of Alabama, Birmingham, AL (United States)

    1994-12-31

    Adaptive resonance theory (ART) describes a class of artificial neural network architectures that act as classification tools which self-organize, work in real-time, and require no retraining to classify novel sequences. We have adapted ART networks to provide support to scientists attempting to categorize tandem repeat DNA fragments from Onchocerca volvulus. In this approach, sequences of DNA fragments are presented to multiple ART-based networks which are linked together into two (or more) tiers; the first provides coarse sequence classification while the sub- sequent tiers refine the classifications as needed. The overall rating of the resulting classification of fragments is measured using statistical techniques based on those introduced to validate results from traditional phylogenetic analysis. Tests of the Hierarchical ART-based Classification Network, or HABclass network, indicate its value as a fast, easy-to-use classification tool which adapts to new data without retraining on previously classified data.

  20. Site-directed gene mutation at mixed sequence targets by psoralen-conjugated pseudo-complementary peptide nucleic acids.

    Kim, Ki-Hyun; Nielsen, Peter E; Glazer, Peter M

    2007-01-01

    Sequence-specific DNA-binding molecules such as triple helix-forming oligonucleotides (TFOs) provide a means for inducing site-specific mutagenesis and recombination at chromosomal sites in mammalian cells. However, the utility of TFOs is limited by the requirement for homopurine stretches in the target duplex DNA. Here, we report the use of pseudo-complementary peptide nucleic acids (pcPNAs) for intracellular gene targeting at mixed sequence sites. Due to steric hindrance, pcPNAs are unable to form pcPNA-pcPNA duplexes but can bind to complementary DNA sequences by Watson-Crick pairing via double duplex-invasion complex formation. We show that psoralen-conjugated pcPNAs can deliver site-specific photoadducts and mediate targeted gene modification within both episomal and chromosomal DNA in mammalian cells without detectable off-target effects. Most of the induced psoralen-pcPNA mutations were single-base substitutions and deletions at the predicted pcPNA-binding sites. The pcPNA-directed mutagenesis was found to be dependent on PNA concentration and UVA dose and required matched pairs of pcPNAs. Neither of the individual pcPNAs alone had any effect nor did complementary PNA pairs of the same sequence. These results identify pcPNAs as new tools for site-specific gene modification in mammalian cells without purine sequence restriction, thereby providing a general strategy for designing gene targeting molecules. PMID:17977869

  1. Amino acid sequence of the beta subunit of bovine lung casein kinase II.

    Takio, K.; Kuenzel, E A; Walsh, K. A.; Krebs, E G

    1987-01-01

    The amino acid sequence of the 209-residue beta subunit of bovine lung casein kinase II has been determined. Excluding the amino-terminal blocking group, which was not identified, the molecular weight of the polypeptide chain is 24,239. A marked polarity of the beta subunit is indicated by clusters of negative charges in the amino-terminal region and of positive charges in the carboxyl-terminal region. Whereas the beta subunit shows no homology with any known protein, a segment of the sequenc...

  2. Critical assessment of sequence-based protein-protein interaction prediction methods that do not require homologous protein sequences

    Park Yungki

    2009-01-01

    Abstract Background Protein-protein interactions underlie many important biological processes. Computational prediction methods can nicely complement experimental approaches for identifying protein-protein interactions. Recently, a unique category of sequence-based prediction methods has been put forward - unique in the sense that it does not require homologous protein sequences. This enables it to be universally applicable to all protein sequences unlike many of previous sequence-based predi...

  3. Sequence-specific nucleic acid detection from binary pore conductance measurement

    Esfandiari, Leyla; Monbouquette, Harold G.; Jacob J. Schmidt

    2012-01-01

    We describe a platform for sequence-specific nucleic acid (NA) detection utilizing a micropipette tapered to a 2 μm diameter pore and 3 μm diameter polystyrene beads to which uncharged peptide nucleic acid (PNA) probe molecules have been conjugated. As the target NAs hybridize to the complementary PNA-beads, the beads acquire negative charge and become electrophoretically mobile. An applied electric field guides these NA-PNA-beads toward the pipette tip, which they obstruct, leading to an ind...

  4. Nucleotide sequence homology between the heat-labile enterotoxin gene of Escherichia coli and Vibrio cholerae deoxyribonucleic acid.

    Moseley, S L; Falkow, S

    1980-01-01

    Isolated deoxyribonucleic acid fragments encoding the heat-labile enterotoxin of Escherichia coli were used to probe for homologous sequences in restricted whole-cell deoxyribonucleic acid from Vibrio cholerae. Significant sequence homology between the heat-labile enterotoxin gene and V. cholerae deoxyribonucleic acid was demonstrated, and apparent differences were observed in the organization of the cholera toxin gene among different strains of V. cholerae.

  5. Fermented probiotic beverages based on acid whey

    Katarzyna Skryplonek

    2015-12-01

    Full Text Available Background. Production of fermented probiotic beverages can be a good method for acid whey usage. The obtained products combine a high nutritional value of whey with health benefits claimed for probiotic bac- teria. The aim of the study was to define quality properties of beverages based on fresh acid whey and milk with addition of buttermilk powder or sweet whey powder. Material and methods. Samples were inoculated with two strains of commercial probiotic cultures: Lac- tobacillus acidophilus La-5 or Bifidobacterium animalis Bb-12. After fermentation, samples were stored at refrigerated conditions. After 1, 4, 7, 14 and 21 days sensory characteristics, hardness, acetaldehyde content, titratable acidity, pH acidity and count of bacteria cells were evaluated. Results. Throughout all storage period, the number of bacteria was higher than 8 log cfu/ml in the all sam- ples. Beverages with La-5 strain had higher hardness and acidity, whilst samples with Bb-12 contained more acetaldehyde. Samples with buttermilk powder had better sensory properties than with sweet whey powder. Conclusions. Obtained products made of acid whey combined with milk and fortified with buttermilk pow- der or sweet whey powder, are good medium for growth and survival of examined probiotic bacteria strains. The level of bacteria was sufficient to provide health benefits to consumers.

  6. Purification and amino acid sequence of a bacteriocins produced by Lactobacillus salivarius K7 isolated from chicken intestine

    Kenji Sonomoto

    2006-03-01

    Full Text Available A bacteriocin-producing strain, Lactobacillus K7, was isolated from a chicken intestine. The inhibitory activity was determined by spot-on-lawn technique. Identification of the strain was performed by morphological, biochemical (API 50 CH kit and molecular genetic (16S rDNA basis. Bacteriocin purification processes were carried out by amberlite adsorption, cation exchange and reverse-phase high perform- ance liquid chromatography. N-terminal amino acid sequences were performed by Edman degradation. Molecular mass was determined by electrospray-ionization (ESI mass spectrometry (MS. Lactobacillus K7 showed inhibitory activity against Lactobacillus sakei subsp. sakei JCM 1157T, Leuconostoc mesenteroides subsp. mesenteroides JCM 6124T and Bacillus coagulans JCM 2257T. This strain was identified as Lb. salivarius. The antimicrobial substance was destroyed by proteolytic enzymes, indicating its proteinaceous structure designated as a bacteriocin type. The purification of bacteriocin by amberlite adsorption, cation exchange, and reverse-phase chromatography resulted in only one single active peak, which was designated FK22. Molecular weight of this fraction was 4331.70 Da. By amino acid sequence, this peptide was homology to Abp 118 beta produced by Lb. salivarius UCC118. In addition, Lb. salivarius UCC118 produced 2-peptide bacteriocin, which was Abp 118 alpha and beta. Based on the partial amino acid sequences of Abp 118 beta, specific primers were designed from nucleotide sequences according to data from GenBank. The result showed that the deduced peptide was high homology to 2-peptide bacteriocin, Abp 118 alpha and beta.

  7. Self-Sequencing of Amino Acids and Origins of Polyfunctional Protocells

    Fox, Sidney W.

    1984-12-01

    The primal role of the origins of proteins in molecular evolution is discussed. On the basis of this premise, the significance of the experimentally established self-sequencing of amino acids under simulated geological conditions is explained as due to the fact that the products are highly nonrandom and accordingly contain many kinds of information. When such thermal proteins are aggregated into laboratory protocells, an action that occurs readily, the resultant protocells also contain many kinds of information. Residue-by-residue order, enzymic activities, and lipid quality accordingly occur within each preparation of proteinoid (thermal protein). In this paper are reviewed briefly the phenomenon of self-sequencing of amino acids, its relationship to evolutionary processes, other significance of such self-ordering, and the experimental evidence for original polyfunctional protocells.

  8. Jigsaw Cooperative Learning: Acid-Base Theories

    Tarhan, Leman; Sesen, Burcin Acar

    2012-01-01

    This study focused on investigating the effectiveness of jigsaw cooperative learning instruction on first-year undergraduates' understanding of acid-base theories. Undergraduates' opinions about jigsaw cooperative learning instruction were also investigated. The participants of this study were 38 first-year undergraduates in chemistry education…

  9. Repeat Sequences and Base Correlations in Human Y Chromosome Palindromes

    Neng-zhi Jin; Zi-xian Liu; Yan-jiao Qi; Wen-yuan Qiu

    2009-01-01

    On the basis of information theory and statistical methods, we use mutual information, n-tuple entropy and conditional entropy, combined with biological characteristics, to analyze the long range correlation and short range correlation in human Y chromosome palindromes. The magnitude distribution of the long range correlation which can be reflected by the mutual information is P5>P5a>P5b (P5a and P5b are the sequences that replace solely Alu repeats and all interspersed repeats with random uncorrelated sequences in human Y chromosome palindrome 5, respectively); and the magnitude distribution of the short range correlation which can be reflected by the n-tuple entropy and the conditional entropy is P5>P5a>P5b>random uncorrelated sequence. In other words, when the Alu repeats and all interspersed repeats replace with random uncorrelated sequence, the long range and short range correlation decrease gradually. However, the random uncorrelated sequence has no correlation. This research indicates that more repeat sequences result in stronger correlation between bases in human Y chromosome. The analyses may be helpful to understand the special structures of human Y chromosome palindromes profoundly.

  10. SDT: a virus classification tool based on pairwise sequence alignment and identity calculation.

    Brejnev Muhizi Muhire

    Full Text Available The perpetually increasing rate at which viral full-genome sequences are being determined is creating a pressing demand for computational tools that will aid the objective classification of these genome sequences. Taxonomic classification approaches that are based on pairwise genetic identity measures are potentially highly automatable and are progressively gaining favour with the International Committee on Taxonomy of Viruses (ICTV. There are, however, various issues with the calculation of such measures that could potentially undermine the accuracy and consistency with which they can be applied to virus classification. Firstly, pairwise sequence identities computed based on multiple sequence alignments rather than on multiple independent pairwise alignments can lead to the deflation of identity scores with increasing dataset sizes. Also, when gap-characters need to be introduced during sequence alignments to account for insertions and deletions, methodological variations in the way that these characters are introduced and handled during pairwise genetic identity calculations can cause high degrees of inconsistency in the way that different methods classify the same sets of sequences. Here we present Sequence Demarcation Tool (SDT, a free user-friendly computer program that aims to provide a robust and highly reproducible means of objectively using pairwise genetic identity calculations to classify any set of nucleotide or amino acid sequences. SDT can produce publication quality pairwise identity plots and colour-coded distance matrices to further aid the classification of sequences according to ICTV approved taxonomic demarcation criteria. Besides a graphical interface version of the program for Windows computers, command-line versions of the program are available for a variety of different operating systems (including a parallel version for cluster computing platforms.

  11. Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope.

    Xu, W; Ellington, A. D.

    1996-01-01

    In vitro selection of nucleic acid binding species (aptamers) is superficially similar to the immune response. Both processes produce biopolymers that can recognize targets with high affinity and specificity. While antibodies are known to recognize the sequence and conformation of protein surface features (epitopes), very little is known about the precise interactions between aptamers and their epitopes. Therefore, aptamers that could recognize a particular epitope, a peptide fragment of huma...

  12. Sequence-selective targeting of duplex DNA by peptide nucleic acids

    Nielsen, Peter E

    2010-01-01

    nucleic acid (PNA) can recognize duplex DNA with high sequence specificity and affinity in triplex, duplex and double-duplex invasive modes or non-invasive triplex modes. Novel PNA modification has improved the affinity for DNA recognition via duplex invasion, double-duplex invasion and triplex......Sequence-selective gene targeting constitutes an attractive drug-discovery approach for genetic therapy, with the aim of reducing or enhancing the activity of specific genes at the transcriptional level, or as part of a methodology for targeted gene repair. The pseudopeptide DNA mimic peptide...... recognition considerably. Such modifications have also resulted in new approaches to targeted gene repair and sequence-selective double-strand cleavage of genomic DNA....

  13. Amino acid sequences mediating vascular cell adhesion molecule 1 binding to integrin alpha 4: homologous DSP sequence found for JC polyoma VP1 coat protein

    Michael Andrew Meyer

    2013-07-01

    Full Text Available The JC polyoma viral coat protein VP1 was analyzed for amino acid sequences homologies to the IDSP sequence which mediates binding of VLA-4 (integrin alpha 4 to vascular cell adhesion molecule 1. Although the full sequence was not found, a DSP sequence was located near the critical arginine residue linked to infectivity of the virus and binding to sialic acid containing molecules such as integrins (3. For the JC polyoma virus, a DSP sequence was found at residues 70, 71 and 72 with homology also noted for the mouse polyoma virus and SV40 virus. Three dimensional modeling of the VP1 molecule suggests that the DSP loop has an accessible site for interaction from the external side of the assembled viral capsid pentamer.

  14. Random amino acid mutations and protein misfolding lead to Shannon limit in sequence-structure communication.

    Andreas Martin Lisewski

    Full Text Available The transmission of genomic information from coding sequence to protein structure during protein synthesis is subject to stochastic errors. To analyze transmission limits in the presence of spurious errors, Shannon's noisy channel theorem is applied to a communication channel between amino acid sequences and their structures established from a large-scale statistical analysis of protein atomic coordinates. While Shannon's theorem confirms that in close to native conformations information is transmitted with limited error probability, additional random errors in sequence (amino acid substitutions and in structure (structural defects trigger a decrease in communication capacity toward a Shannon limit at 0.010 bits per amino acid symbol at which communication breaks down. In several controls, simulated error rates above a critical threshold and models of unfolded structures always produce capacities below this limiting value. Thus an essential biological system can be realistically modeled as a digital communication channel that is (a sensitive to random errors and (b restricted by a Shannon error limit. This forms a novel basis for predictions consistent with observed rates of defective ribosomal products during protein synthesis, and with the estimated excess of mutual information in protein contact potentials.

  15. Protein Function Prediction Based on Sequence and Structure Information

    Smaili, Fatima Z.

    2016-05-25

    The number of available protein sequences in public databases is increasing exponentially. However, a significant fraction of these sequences lack functional annotation which is essential to our understanding of how biological systems and processes operate. In this master thesis project, we worked on inferring protein functions based on the primary protein sequence. In the approach we follow, 3D models are first constructed using I-TASSER. Functions are then deduced by structurally matching these predicted models, using global and local similarities, through three independent enzyme commission (EC) and gene ontology (GO) function libraries. The method was tested on 250 “hard” proteins, which lack homologous templates in both structure and function libraries. The results show that this method outperforms the conventional prediction methods based on sequence similarity or threading. Additionally, our method could be improved even further by incorporating protein-protein interaction information. Overall, the method we use provides an efficient approach for automated functional annotation of non-homologous proteins, starting from their sequence.

  16. Draft Genome Sequence of Acid-Tolerant Clostridium drakei SL1T, a Potential Chemical Producer through Syngas Fermentation

    Jeong, Yujin; Song, Yoseb; Shin, Hyeon Seok; Cho, Byung-Kwan

    2014-01-01

    Clostridium drakei SL1T is a strictly anaerobic, H2-utilizing, and acid-tolerant acetogen isolated from an acidic sediment that is a potential platform for commodity chemical production from syngas fermentation. The draft genome sequence of this strain will enable determination of the acid resistance and autotrophic pathway of the acetogen.

  17. Complete Genome Sequence of the Probiotic Lactic Acid Bacterium Lactobacillus Rhamnosus

    Samat Kozhakhmetov

    2014-01-01

    Full Text Available Introduction: Lactobacilli are a bacteria commonly found in the gastrointestinal tract. Some species of this genus have probiotic properties. The most common of these is Lactobacillus rhamnosus, a microoganism, generally regarded as safe (GRAS. It is also a homofermentative L-(+-lactic acid producer. The genus Lactobacillus is characterized by an extraordinary degree of the phenotypic and genotypic diversity. However, the studies of the genus were conducted mostly with the unequally distributed, non-random choice of species for sequencing; thus, there is only one representative genome from the Lactobacillus rhamnosus clade available to date. The aim of this study was to characterize the genome sequencing of selected strains of Lactobacilli. Methods: 109 samples were isolated from national domestic dairy products in the laboratory of Center for life sciences. After screaning isolates for probiotic properties, a highly active Lactobacillus spp strain was chosen. Genomic DNA was extracted according to the manufacturing protocol (Wizard® Genomic DNA Purification Kit. The Lactobacillus rhamnosus strain was identified as the highly active Lactobacillus strain accoridng to its morphological, cultural, physiological, and biochemical properties, and a genotypic analysis. Results: The genome of Lactobacillus rhamnosus was sequenced using the Roche 454 GS FLX (454 GS FLX platforms. The initial draft assembly was prepared from 14 large contigs (20 all contigs by the Newbler gsAssembler 2.3 (454 Life Sciences, Branford, CT. Conclusion: A full genome-sequencing of selected strains of lactic acid bacteria was made during the study.

  18. Metazoan Remaining Genes for Essential Amino Acid Biosynthesis: Sequence Conservation and Evolutionary Analyses

    Igor R. Costa

    2014-12-01

    Full Text Available Essential amino acids (EAA consist of a group of nine amino acids that animals are unable to synthesize via de novo pathways. Recently, it has been found that most metazoans lack the same set of enzymes responsible for the de novo EAA biosynthesis. Here we investigate the sequence conservation and evolution of all the metazoan remaining genes for EAA pathways. Initially, the set of all 49 enzymes responsible for the EAA de novo biosynthesis in yeast was retrieved. These enzymes were used as BLAST queries to search for similar sequences in a database containing 10 complete metazoan genomes. Eight enzymes typically attributed to EAA pathways were found to be ubiquitous in metazoan genomes, suggesting a conserved functional role. In this study, we address the question of how these genes evolved after losing their pathway partners. To do this, we compared metazoan genes with their fungal and plant orthologs. Using phylogenetic analysis with maximum likelihood, we found that acetolactate synthase (ALS and betaine-homocysteine S-methyltransferase (BHMT diverged from the expected Tree of Life (ToL relationships. High sequence conservation in the paraphyletic group Plant-Fungi was identified for these two genes using a newly developed Python algorithm. Selective pressure analysis of ALS and BHMT protein sequences showed higher non-synonymous mutation ratios in comparisons between metazoans/fungi and metazoans/plants, supporting the hypothesis that these two genes have undergone non-ToL evolution in animals.

  19. Which Microbial Communities Are Present? Sequence-Based Metagenomics

    Caffrey, Sean M.

    The use of metagenomic methods that directly sequence environmental samples has revealed the extraordinary microbial diversity missed by traditional culture-based methodologies. Therefore, to develop a complete and representative model of an environment's microbial community and activities, metagenomic analysis is an essential tool.

  20. Low molecular weight human pulmonary surfactant protein (SP5): isolation, characterization, and cDNA and amino acid sequences

    Warr, R.G.; Hawgood, S.; Buckley, D.I.; Crisp, T.M.; Schilling, J.; Benson, B.J.; Ballard, P.L.; Clements, J.A.; White, R.T.

    1987-11-01

    Pulmonary surfactant is a lipid-protein complex that promotes alveolar stability by lowering the surface tension at the air-fluid interface in the peripheral air spaces. A group of hydrophobic surfactant-associated proteins has been shown to be essential for rapid surface film formation by surfactant phospholipids. The authors have purified a hydrophobic surfactant protein of approx. = 5kDa that they term SP5 from bronchopulmonary lavage fluid from a patient with alveolar proteinosis and shown that it promotes rapid surface film formation by simple mixtures of phospholipids. They have derived the full amino acid sequence of human SP5 from the nucleotide sequence of cDNAs identified with oligonucleotide probes based on the NH/sub 2/-terminal sequence of SP5. SP5 isolated from surfactant is a fragment of a much larger precursor protein (21 kDa). The precursor contains an extremely hydrophobic region of 34 amino acids that comprises most the mature SP5. This hydrophobicity explains the unusual solubility characteristics of SP5 and the fact that it is lipid-associated when isolated from lung.

  1. Low molecular weight human pulmonary surfactant protein (SP5): isolation, characterization, and cDNA and amino acid sequences

    Pulmonary surfactant is a lipid-protein complex that promotes alveolar stability by lowering the surface tension at the air-fluid interface in the peripheral air spaces. A group of hydrophobic surfactant-associated proteins has been shown to be essential for rapid surface film formation by surfactant phospholipids. The authors have purified a hydrophobic surfactant protein of ≅ 5kDa that they term SP5 from bronchopulmonary lavage fluid from a patient with alveolar proteinosis and shown that it promotes rapid surface film formation by simple mixtures of phospholipids. They have derived the full amino acid sequence of human SP5 from the nucleotide sequence of cDNAs identified with oligonucleotide probes based on the NH2-terminal sequence of SP5. SP5 isolated from surfactant is a fragment of a much larger precursor protein (21 kDa). The precursor contains an extremely hydrophobic region of 34 amino acids that comprises most the mature SP5. This hydrophobicity explains the unusual solubility characteristics of SP5 and the fact that it is lipid-associated when isolated from lung

  2. A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome.

    Kumar, Ashutosh; Singh, Himanshu N; Pareek, Vikas; Raza, Khursheed; Dantham, Subrahamanyam; Kumar, Pavan; Mochan, Sankat; Faiq, Muneeb A

    2016-01-01

    Owing to the reports of microcephaly as a consistent outcome in the fetuses of pregnant women infected with ZIKV in Brazil, Zika virus (ZIKV)-microcephaly etiomechanistic relationship has recently been implicated. Researchers, however, are still struggling to establish an embryological basis for this interesting causal handcuff. The present study reveals robust evidence in favor of a plausible ZIKV-microcephaly cause-effect liaison. The rationale is based on: (1) sequence homology between ZIKV genome and the response element of an early neural tube developmental marker "retinoic acid" in human DNA and (2) comprehensive similarities between the details of brain defects in ZIKV-microcephaly and retinoic acid embryopathy. Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5'-AGGTCA-3') in promoter regions of retinoic acid-dependent genes. We screened genomic sequences of already reported virulent ZIKV strains (including those linked to microcephaly) and other viruses available in National Institute of Health genetic sequence database (GenBank) for the RARE consensus repeats and obtained results strongly bolstering our hypothesis that ZIKV strains associated with microcephaly may act through precipitation of dysregulation in retinoic acid-dependent genes by introducing extra stretches of RARE consensus sequence repeats in the genome of developing brain cells. Additional support to our hypothesis comes from our findings that screening of other viruses for RARE consensus sequence repeats is positive only for those known to display neurotropism and cause fetal brain defects (for which maternal-fetal transmission during developing stage may be required). The numbers of RARE sequence repeats appeared to match with the virulence of screened positive viruses. Although, bioinformatic evidence and embryological

  3. Multiple Base Substitution Corrections in DNA Sequence Evolution

    Kowalczuk, M.; Mackiewicz, P.; Szczepanik, D.; Nowicka, A.; Dudkiewicz, M.; Dudek, M. R.; Cebrat, S.

    We discuss the Jukes and Cantor's one-parameter model and Kimura's two-parameter model unability to describe evolution of asymmetric DNA molecules. The standard distance measure between two DNA sequences, which is the number of substitutions per site, should include the effect of multiple base substitutions separately for each type of the base. Otherwise, the respective tables of substitutions cannot reconstruct the asymmetric DNA molecule with respect to the composition. Basing on Kimura's neutral theory, we have derived a linear law for the correlation of the mean survival time of nucleotides under constant mutation pressure and their fraction in the genome. According to the law, the corrections to Kimura's theory have been discussed to describe evolution of genomes with asymmetric nucleotide composition. We consider the particular case of the strongly asymmetric Borrelia burgdorferi genome and we discuss in detail the corrections, which should be introduced into the distance measure between two DNA sequences to include multiple base substitutions.

  4. Genome Sequence of Lactobacillus saerimneri 30a (Formerly Lactobacillus sp. Strain 30a), a Reference Lactic Acid Bacterium Strain Producing Biogenic Amines

    Romano, Andrea; Trip, Hein; Campbell-Sills, Hugo; Bouchez, Olivier; Sherman, David; Lolkema, Juke S.; Lucas, Patrick M

    2013-01-01

    Lactobacillus sp. strain 30a (Lactobacillus saerimneri) produces the biogenic amines histamine, putrescine, and cadaverine by decarboxylating their amino acid precursors. We report its draft genome sequence (1,634,278 bases, 42.6% G+C content) and the principal findings from its annotation, which might shed light onto the enzymatic machineries that are involved in its production of biogenic amines.

  5. 3D Motion Parameters Determination Based on Binocular Sequence Images

    2006-01-01

    Exactly capturing three dimensional (3D) motion information of an object is an essential and important task in computer vision, and is also one of the most difficult problems. In this paper, a binocular vision system and a method for determining 3D motion parameters of an object from binocular sequence images are introduced. The main steps include camera calibration, the matching of motion and stereo images, 3D feature point correspondences and resolving the motion parameters. Finally, the experimental results of acquiring the motion parameters of the objects with uniform velocity and acceleration in the straight line based on the real binocular sequence images by the mentioned method are presented.

  6. Local Sequence Information-based Support Vector Machine to Classify Voltage-gated Potassium Channels

    Li-Xia LIU; Meng-Long LI; Fu-Yuan TAN; Min-Chun LU; Ke-Long WANG; Yan-Zhi GUO; Zhi-Ning WEN; Lin JIANG

    2006-01-01

    In our previous work, we developed a computational tool, PreK-ClassK-ClassKv, to predict and classify potassium (K+) channels. For K+ channel prediction (PreK) and classification at family level (ClassK), this method performs well. However, it does not perform so well in classifying voltage-gated potassium (Kv) channels (ClassKv). In this paper, a new method based on the local sequence information of Kv channels is introduced to classify Kv channels. Six transmembrane domains of a Kv channel protein are used to define a protein, and the dipeptide composition technique is used to transform an amino acid sequence to a numerical sequence. A Kv channel protein is represented by a vector with 2000 elements, and a support vector machine algorithm is applied to classify Kv channels. This method shows good performance with averages of total accuracy (Acc), sensitivity (SE), specificity (SP); reliability (R) and Matthews correlation coefficient (MCC) of 98.0%, 89.9%, 100%, 0.95 and 0.94 respectively. The results indicate that the local sequence information-based method is better than the global sequence information-based method to classify Kv channels.

  7. DNA sequence analysis with droplet-based microfluidics

    Abate, Adam R.; Hung, Tony; Sperling, Ralph A.; Mary, Pascaline; Rotem, Assaf; Agresti, Jeremy J.; Weiner, Michael A.; Weitz, David A.

    2013-01-01

    Droplet-based microfluidic techniques can form and process micrometer scale droplets at thousands per second. Each droplet can house an individual biochemical reaction, allowing millions of reactions to be performed in minutes with small amounts of total reagent. This versatile approach has been used for engineering enzymes, quantifying concentrations of DNA in solution, and screening protein crystallization conditions. Here, we use it to read the sequences of DNA molecules with a FRET-based ...

  8. Complete amino acid sequence of globin chains and biological activity of fragmented crocodile hemoglobin (Crocodylus siamensis).

    Srihongthong, Saowaluck; Pakdeesuwan, Anawat; Daduang, Sakda; Araki, Tomohiro; Dhiravisit, Apisak; Thammasirirak, Sompong

    2012-08-01

    Hemoglobin, α-chain, β-chain and fragmented hemoglobin of Crocodylus siamensis demonstrated both antibacterial and antioxidant activities. Antibacterial and antioxidant properties of the hemoglobin did not depend on the heme structure but could result from the compositions of amino acid residues and structures present in their primary structure. Furthermore, thirteen purified active peptides were obtained by RP-HPLC analyses, corresponding to fragments in the α-globin chain and the β-globin chain which are mostly located at the N-terminal and C-terminal parts. These active peptides operate on the bacterial cell membrane. The globin chains of Crocodylus siamensis showed similar amino acids to the sequences of Crocodylus niloticus. The novel amino acid substitutions of α-chain and β-chain are not associated with the heme binding site or the bicarbonate ion binding site, but could be important through their interactions with membranes of bacteria. PMID:22648692

  9. Parameters of proteome evolution from histograms of amino-acid sequence identities of paralogous proteins

    Yan Koon-Kiu; Axelsen Jacob; Maslov Sergei

    2005-01-01

    Abstract Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model...

  10. Skeleton-based human action recognition using multiple sequence alignment

    Ding, Wenwen; Liu, Kai; Cheng, Fei; Zhang, Jin; Li, YunSong

    2015-05-01

    Human action recognition and analysis is an active research topic in computer vision for many years. This paper presents a method to represent human actions based on trajectories consisting of 3D joint positions. This method first decompose action into a sequence of meaningful atomic actions (actionlets), and then label actionlets with English alphabets according to the Davies-Bouldin index value. Therefore, an action can be represented using a sequence of actionlet symbols, which will preserve the temporal order of occurrence of each of the actionlets. Finally, we employ sequence comparison to classify multiple actions through using string matching algorithms (Needleman-Wunsch). The effectiveness of the proposed method is evaluated on datasets captured by commodity depth cameras. Experiments of the proposed method on three challenging 3D action datasets show promising results.

  11. Spectroscopic investigation on the telomeric DNA base sequence repeat

    2002-01-01

    Telomeres are protein-DNA complexes at the terminals of linear chromosomes, which protect chromosomal integrity and maintain cellular replicative capacity.From single-cell organisms to advanced animals and plants,structures and functions of telomeres are both very conservative. In cells of human and vertebral animals, telomeric DNA base sequences all are (TTAGGG)n. In the present work, we have obtained absorption and fluorescence spectra measured from seven synthesized oligonucleotides to simulate the telomeric DNA system and calculated their relative fluorescence quantum yields on which not only telomeric DNA characteristics are predicted but also possibly the shortened telomeric sequences during cell division are imrelative fluorescence quantum yield and remarkable excitation energy innerconversion, which tallies with the telomeric sequence of (TTAGGG)n. This result shows that telomeric DNA has a strong non-radiative or innerconvertible capability.``

  12. Steganalytic method based on short and repeated sequence distance statistics

    WANG GuoXin; PING XiJian; XU ManKun; ZHANG Tao; BAO XiRui

    2008-01-01

    According to the distribution characteristics of short and repeated sequence (SRS),a steganalytic method based on the correlation of image bit planes is proposed.Firstly,we provide the conception of SRS distance statistics and deduce its statistical distribution.Because the SRS distance statistics can effectively reflect the correlation of the sequence,SRS has statistical features when the image bit plane sequence equals the image width.Using this characteristic,the steganalytic method is fulfilled by the distinct test of Poisson distribution.Experimental results show a good performance for detecting LSB matching steganographic method in still images.By the way,the proposed method is not designed for specific steganographic algorithms and has good generality.

  13. Comparative characterization of random-sequence proteins consisting of 5, 12, and 20 kinds of amino acids.

    Tanaka, Junko; Doi, Nobuhide; Takashima, Hideaki; Yanagawa, Hiroshi

    2010-04-01

    Screening of functional proteins from a random-sequence library has been used to evolve novel proteins in the field of evolutionary protein engineering. However, random-sequence proteins consisting of the 20 natural amino acids tend to aggregate, and the occurrence rate of functional proteins in a random-sequence library is low. From the viewpoint of the origin of life, it has been proposed that primordial proteins consisted of a limited set of amino acids that could have been abundantly formed early during chemical evolution. We have previously found that members of a random-sequence protein library constructed with five primitive amino acids show high solubility (Doi et al., Protein Eng Des Sel 2005;18:279-284). Although such a library is expected to be appropriate for finding functional proteins, the functionality may be limited, because they have no positively charged amino acid. Here, we constructed three libraries of 120-amino acid, random-sequence proteins using alphabets of 5, 12, and 20 amino acids by preselection using mRNA display (to eliminate sequences containing stop codons and frameshifts) and characterized and compared the structural properties of random-sequence proteins arbitrarily chosen from these libraries. We found that random-sequence proteins constructed with the 12-member alphabet (including five primitive amino acids and positively charged amino acids) have higher solubility than those constructed with the 20-member alphabet, though other biophysical properties are very similar in the two libraries. Thus, a library of moderate complexity constructed from 12 amino acids may be a more appropriate resource for functional screening than one constructed from 20 amino acids. PMID:20162614

  14. Test Case Generation Based on Use case and Sequence Diagram

    Santosh Kumar Swain

    2010-07-01

    Full Text Available We present a comprehensive test case generation technique from UML models. We use the features in UML 2.0 sequence diagram including conditions, iterations, asynchronous messages and concurrent components. In our approach, test cases are derived from analysis artifacts such as use cases, their corresponding sequence diagrams and constraints specified across all these artifacts. We construct Use case Dependency Graph (UDG from use case diagram and Concurrent Control Flow Graph (CCFG from corresponding sequence diagrams for test sequence generation. We focus testing on sequences of messages among objects of use case scenarios. Our testing strategy derives test cases using full predicate coverage criteria. Our proposed test case generation technique can be used for integration and system testing accommodating the object message and condition information associated with the use case scenarios. The test cases thus generated are suitable for detecting synchronization and dependency of use cases and messages, object interaction and operational faults. Finally, we have made an analysis and comparison of our approach with existing approaches, which are based on other coverage criterion through an example.

  15. DUK - A Fast and Efficient Kmer Based Sequence Matching Tool

    Li, Mingkun; Copeland, Alex; Han, James

    2011-03-21

    A new tool, DUK, is developed to perform matching task. Matching is to find whether a query sequence partially or totally matches given reference sequences or not. Matching is similar to alignment. Indeed many traditional analysis tasks like contaminant removal use alignment tools. But for matching, there is no need to know which bases of a query sequence matches which position of a reference sequence, it only need know whether there exists a match or not. This subtle difference can make matching task much faster than alignment. DUK is accurate, versatile, fast, and has efficient memory usage. It uses Kmer hashing method to index reference sequences and Poisson model to calculate p-value. DUK is carefully implemented in C++ in object oriented design. The resulted classes can also be used to develop other tools quickly. DUK have been widely used in JGI for a wide range of applications such as contaminant removal, organelle genome separation, and assembly refinement. Many real applications and simulated dataset demonstrate its power.

  16. An Uncompressed Image Encryption Algorithm Based on DNA Sequences

    Shima Ramesh Maniyath

    2011-07-01

    Full Text Available The rapid growth of the Internet and digitized content made image and video distribution simpler. Hence the need for image and video data protection is on the rise. In this paper, we propose a secure and computationally feasible image and video encryption/decryption algorithm based on DNA sequences. The main purpose of this algorithm is to reduce the big image encryption time. This algorithm is implemented by using the natural DNA sequences as main keys. The first part is the process of pixel scrambling. The original image is confused in the light of the scrambling sequence which is generated by the DNA sequence. The second part is the process of pixel replacement. The pixel gray values of the new image and the one of the three encryption templates generated by the other DNA sequence are XORed bit-by-bit in turn. The main scope of this paper is to propose an extension of this algorithm to videos and making it secure using modern Biological technology. A security analysis for the proposed system is performed and presented.

  17. Application of combined mass spectrometry and partial amino acid sequence to the identification of gel-separated proteins.

    Patterson, S D; Thomas, D; Bradshaw, R A

    1996-05-01

    The combined use of peptide mass information with amino acid sequence information derived by chemical sequencing or mass spectrometry (MS)-based approaches provides a powerful means of protein identification. We have used a two-part strategy to identify proteins from nerve growth factor (NGF)-stimulated rat adrenal pheochromocytoma cell line PC-12 cell lysates that associate with the adaptor protein Shc (Shc homologous and collagen protein). Initial experiments with metabolically radiolabeled cell extracts separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) revealed a number of proteins that coimmunoprecipitated with anti-Shc antibody compared with control (unstimulated) cell extracts. The experiment was scaled up and cell lysate from NGF-stimulated PC-12 cells was applied to a glutathione-S-transferase (GST)-Shc affinity column, eluted, separated by SDS-PAGE and blotted to Immobilon-CD. The blotted proteins were proteolytically digested in situ, and the masses obtained from the extracted peptides were used in a peptide-mass search program in an attempt to identify the protein. Even if a strong candidate was found using this search, an additional step was performed to confirm the identification. The mixtures were fractionated by reversed-phase high-performance liquid chromatography (RP-HPLC) and subjected to chemical sequencing to obtain (partial) sequence information, or post-source decay (PSD-) matrix-assisted laser-desorption ionization (MALDI)-MS to obtain sequence-specific fragment ions. This data was used in a peptide-sequence tag search to confirm the identity of the proteins. This combined approach allowed identification of four proteins of M(r) 43,000 to 200,000. In one case the identified protein clearly did not correspond to the radiolabeled band, but to a protein contaminant from the column. The advantages and pitfalls of the approach are discussed. PMID:8783013

  18. Partial amino acid sequence of fructose-1,6-bisphosphatase from the blue-green algae Synechococcus leopoliensis.

    Marcus, F; Latshaw, S P; Steup, M; Gerbling, K P

    1989-08-01

    Purified fructose-1,6-bisphosphatase from the cyanobacterium Synechococcus leopoliensis was S-carboxymethylated and cleaved with trypsin. The resulting peptides were purified by reversed-phase high performance liquid chromatography and the amino acid sequence of six of the purified peptides was determined by gas-phase microsequencing. The results revealed sequence homology with other fructose-1,6-bisphosphatases. The obtained sequence data provides information required for the design of oligonucleotide hybridization probes to screen existing libraries of cyanobacterial DNA. The determination of the amino acid sequence of cyanobacterial proteins may yield important information with respect to the endosymbiotic theory of evolution. PMID:2550924

  19. Solid-State Nanopore-Based DNA Sequencing Technology

    Zewen Liu

    2016-01-01

    Full Text Available The solid-state nanopore-based DNA sequencing technology is becoming more and more attractive for its brand new future in gene detection field. The challenges that need to be addressed are diverse: the effective methods to detect base-specific signatures, the control of the nanopore’s size and surface properties, and the modulation of translocation velocity and behavior of the DNA molecules. Among these challenges, the realization of the high-quality nanopores with the help of modern micro/nanofabrication technologies is a crucial one. In this paper, typical technologies applied in the field of solid-state nanopore-based DNA sequencing have been reviewed.

  20. Generation of deviation parameters for amino acid singlets, doublets and triplets from three-dimensional structures of proteins and its implications for secondary structure prediction from amino acid sequences

    S A Mugilan; K Veluraja

    2000-03-01

    We present a new method, secondary structure prediction by deviation parameter (SSPDP) for predicting the secondary structure of proteins from amino acid sequence. Deviation parameters (DP) for amino acid singlets, doublets and triplets were computed with respect to secondary structural elements of proteins based on the dictionary of secondary structure prediction (DSSP)-generated secondary structure for 408 selected non-homologous proteins. To the amino acid triplets which are not found in the selected dataset, a DP value of zero is assigned with respect to the secondary structural elements of proteins. The total number of parameters generated is 15,432, in the possible parameters of 25,260. Deviation parameter is complete with respect to amino acid singlets, doublets, and partially complete with respect to amino acid triplets. These generated parameters were used to predict secondary structural elements from amino acid sequence. The secondary structure predicted by our method (SSPDP) was compared with that of single sequence (NNPREDICT) and multiple sequence (PHD) methods. The average value of the percentage of prediction accuracy for α-helix by SSPDP, NNPREDICT and PHD methods was found to be 57%, 44% and 69% respectively for the proteins in the selected dataset. For -strand the prediction accuracy is found to be 69%, 21% and 53% respectively by SSPDP, NNPREDICT and PHD methods. This clearly indicates that the secondary structure prediction by our method is as good as PHD method but much better than NNPREDICT method.

  1. Hypokalemic paralysis and acid-base balance

    Ivo Casagranda; Riccardo Boverio; Andrea Defrancisci; Sara Ferrillo; Francesca Gargiulo

    2006-01-01

    Three cases of hypokalemic paralysis are reported, presenting to the Emergency Department. The first is a patient with a hypokalemic periodic paralysis with a normal acid-base status, the second is a case of hypokalemic flaccid paralysis of all extremities with a normal anion gap metabolic acidosis, the last is a patient with a hypokalemic distal paralysis of right upper arm with metabolic alkalosis. Afterwards some pathophysiologic principles and the clinical aspects of hypokalemia are discu...

  2. Evolutionary insights from suffix array-based genome sequence analysis

    Anindya Poddar; Nagasuma Chandra; Madhavi Ganapathiraju; K Sekar; Judith Klein-Seetharaman; Raj Reddy; N Balakrishnan

    2007-08-01

    Gene and protein sequence analyses, central components of studies in modern biology are easily amenable to string matching and pattern recognition algorithms. The growing need of analysing whole genome sequences more efficiently and thoroughly, has led to the emergence of new computational methods. Suffix trees and suffix arrays are data structures, well known in many other areas and are highly suited for sequence analysis too. Here we report an improvement to the design of construction of suffix arrays. Enhancement in versatility and scalability, enabled by this approach, is demonstrated through the use of real-life examples. The scalability of the algorithm to whole genomes renders it suitable to address many biologically interesting problems. One example is the evolutionary insight gained by analysing unigrams, bi-grams and higher n-grams, indicating that the genetic code has a direct influence on the overall composition of the genome. Further, different proteomes have been analysed for the coverage of the possible peptide space, which indicate that as much as a quarter of the total space at the tetra-peptide level is left un-sampled in prokaryotic organisms, although almost all tri-peptides can be seen in one protein or another in a proteome. Besides, distinct patterns begin to emerge for the counts of particular tetra and higher peptides, indicative of a ‘meaning’ for tetra and higher n-grams. The toolkit has also been used to demonstrate the usefulness of identifying repeats in whole proteomes efficiently. As an example, 16 members of one COG, coded by the genome of Mycobacterium tuberculosis H37Rv have been found to contain a repeating sequence of 300 amino acids.

  3. Current and future developments in nucleic acid-based diagnostics

    The detection and characterization of specific nucleic acids of protozoa, rickettsia, bacteria and viruses have proven to be particularly useful for detecting pathogens of human and veterinary importance. It is also proving an invaluable tool for surveillance purposes and as a means of ensuring food security. Previous approaches towards pathogen isolation have often been tedious or even impossible. PCR, first conceived by Mullis in 1983, has proven to be a revolutionary technique for the rapid and accurate detection of numerous pathogens. The discovery and cloning of thermostable DNA polymerases has further contributed to this technology. Many additional developments, based on the basic principles of PCR, have been described e.g. RT-PCR, NASBA, RAPD, AFLP, LCR, PCR ELISA, strand displacement amplification (SDA), transcription-mediated amplification (TMA), branched DNA (bDNA), hybrid capture, immunocapture PCR. This list continues to expand with new variations on basic PCR principles. Improvements in thermocyclers involve the development of integrated amplification and signal detection systems, including on-line real-time devices. In addition, rugged portable instruments have been designed for field use. These are particularly useful as systems for early warning in detecting biowarfare agents and outbreaks of cross-boundary and other pathogens. Fluorophores, utilising principles of fluorescence resonance energy transfer, are used as labels for probes in such real-time assays. Molecular beacon technology also utilises such mechanisms. Real-time thermocyclers allow the monitoring of amplified DNA as well as establishing sequence characteristics based on melting or hybridisation curves. Taqman chemistry makes use of such a system. Stem-loop DNA probes have been designed to have increased specificity for target recognition and include molecular beacon methodologies, suppression PCR approaches and hairpin probes in DNA microarrays. Automated sample processing or robotic

  4. Automating the Photogrammetric Bridging Based on MMS Image Sequence Processing

    Silva, J. F. C.; Lemes Neto, M. C.; Blasechi, V.

    2014-11-01

    The photogrammetric bridging or traverse is a special bundle block adjustment (BBA) for connecting a sequence of stereo-pairs and of determining the exterior orientation parameters (EOP). An object point must be imaged in more than one stereo-pair. In each stereo-pair the distance ratio between an object and its corresponding image point varies significantly. We propose to automate the photogrammetric bridging based on a fully automatic extraction of homologous points in stereo-pairs and on an arbitrary Cartesian datum to refer the EOP and tie points. The technique uses SIFT algorithm and the keypoint matching is given by similarity descriptors of each keypoint based on the smallest distance. All the matched points are used as tie points. The technique was applied initially to two pairs. The block formed by four images was treated by BBA. The process follows up to the end of the sequence and it is semiautomatic because each block is processed independently and the transition from one block to the next depends on the operator. Besides four image blocks (two pairs), we experimented other arrangements with block sizes of six, eight, and up to twenty images (respectively, three, four, five and up to ten bases). After the whole image pairs sequence had sequentially been adjusted in each experiment, a simultaneous BBA was run so to estimate the EOP set of each image. The results for classical ("normal case") pairs were analyzed based on standard statistics regularly applied to phototriangulation, and they show figures to validate the process.

  5. Revision of Begomovirus taxonomy based on pairwise sequence comparisons

    Brown, Judith K.

    2015-04-18

    Viruses of the genus Begomovirus (family Geminiviridae) are emergent pathogens of crops throughout the tropical and subtropical regions of the world. By virtue of having a small DNA genome that is easily cloned, and due to the recent innovations in cloning and low-cost sequencing, there has been a dramatic increase in the number of available begomovirus genome sequences. Even so, most of the available sequences have been obtained from cultivated plants and are likely a small and phylogenetically unrepresentative sample of begomovirus diversity, a factor constraining taxonomic decisions such as the establishment of operationally useful species demarcation criteria. In addition, problems in assigning new viruses to established species have highlighted shortcomings in the previously recommended mechanism of species demarcation. Based on the analysis of 3,123 full-length begomovirus genome (or DNA-A component) sequences available in public databases as of December 2012, a set of revised guidelines for the classification and nomenclature of begomoviruses are proposed. The guidelines primarily consider a) genus-level biological characteristics and b) results obtained using a standardized classification tool, Sequence Demarcation Tool, which performs pairwise sequence alignments and identity calculations. These guidelines are consistent with the recently published recommendations for the genera Mastrevirus and Curtovirus of the family Geminiviridae. Genome-wide pairwise identities of 91 % and 94 % are proposed as the demarcation threshold for begomoviruses belonging to different species and strains, respectively. Procedures and guidelines are outlined for resolving conflicts that may arise when assigning species and strains to categories wherever the pairwise identity falls on or very near the demarcation threshold value.

  6. alpha-Amylase gene of Streptomyces limosus: nucleotide sequence, expression motifs, and amino acid sequence homology to mammalian and invertebrate alpha-amylases.

    Long, C M; Virolle, M J; Chang, S Y; Chang, S.; Bibb, M.J.

    1987-01-01

    The nucleotide sequence of the coding and regulatory regions of the alpha-amylase gene (aml) of Streptomyces limosus was determined. High-resolution S1 mapping was used to locate the 5' end of the transcript and demonstrated that the gene is transcribed from a unique promoter. The predicted amino acid sequence has considerable identity to mammalian and invertebrate alpha-amylases, but not to those of plant, fungal, or eubacterial origin. Consistent with this is the susceptibility of the enzym...

  7. Genome Sequence Analysis of the Naphthenic Acid Degrading and Metal Resistant Bacterium Cupriavidus gilardii CR3.

    Xiaoyu Wang

    Full Text Available Cupriavidus sp. are generally heavy metal tolerant bacteria with the ability to degrade a variety of aromatic hydrocarbon compounds, although the degradation pathways and substrate versatilities remain largely unknown. Here we studied the bacterium Cupriavidus gilardii strain CR3, which was isolated from a natural asphalt deposit, and which was shown to utilize naphthenic acids as a sole carbon source. Genome sequencing of C. gilardii CR3 was carried out to elucidate possible mechanisms for the naphthenic acid biodegradation. The genome of C. gilardii CR3 was composed of two circular chromosomes chr1 and chr2 of respectively 3,539,530 bp and 2,039,213 bp in size. The genome for strain CR3 encoded 4,502 putative protein-coding genes, 59 tRNA genes, and many other non-coding genes. Many genes were associated with xenobiotic biodegradation and metal resistance functions. Pathway prediction for degradation of cyclohexanecarboxylic acid, a representative naphthenic acid, suggested that naphthenic acid undergoes initial ring-cleavage, after which the ring fission products can be degraded via several plausible degradation pathways including a mechanism similar to that used for fatty acid oxidation. The final metabolic products of these pathways are unstable or volatile compounds that were not toxic to CR3. Strain CR3 was also shown to have tolerance to at least 10 heavy metals, which was mainly achieved by self-detoxification through ion efflux, metal-complexation and metal-reduction, and a powerful DNA self-repair mechanism. Our genomic analysis suggests that CR3 is well adapted to survive the harsh environment in natural asphalts containing naphthenic acids and high concentrations of heavy metals.

  8. Heterodimeric l-amino acid oxidase enzymes from Egyptian Cerastes cerastes venom: Purification, biochemical characterization and partial amino acid sequencing

    A.E. El Hakim

    2015-12-01

    Full Text Available Two l-amino acid oxidase enzyme isoforms, Cc-LAAOI and Cc-LAAOII were purified to apparent homogeneity from Cerastes cerastes venom in a sequential two-step chromatographic protocol including; gel filtration and anion exchange chromatography. The native molecular weights of the isoforms were 115 kDa as determined by gel filtration on calibrated Sephacryl S-200 column, while the monomeric molecular weights of the enzymes were, 60, 56 kDa and 60, 53 kDa for LAAOI and LAAOII, respectively. The tryptic peptides of the two isoforms share high sequence homology with other snake venom l-amino acid oxidases. The optimal pH and temperature values of Cc-LAAOI and Cc-LAAOII were 7.8, 50 °C and 7, 60 °C, respectively. The two isoenzymes were thermally stable up to 70 °C. The Km and Vmax values were 0.67 mM, 0.135 μmol/min for LAAOI and 0.82 mM, 0.087 μmol/min for LAAOII. Both isoenzymes displayed high catalytic preference to long-chain, hydrophobic and aromatic amino acids. The Mn2+ ion markedly increased the LAAO activity for both purified isoforms, while Na+, K+, Ca2+, Mg2+ and Ba2+ ions showed a non-significant increase in the enzymatic activity of both isoforms. Furthermore, Zn2+, Ni2+, Co2+, Cu2+ and AL3+ ions markedly inhibited the LAAOI and LAAOII activities. l-Cysteine and reduced glutathione completely inhibited the LAAO activity of both isoenzymes, whereas, β-mercaptoethanol, O-phenanthroline and PMSF completely inhibited the enzymatic activity of LAAOII. Furthermore, iodoacitic acid inhibited the enzymatic activity of LAAOII by 46% and had no effect on the LAAOI activity.

  9. Development in Rice Genome Research Based on Accurate Genome Sequence

    2008-01-01

    Rice is one of the most important crops in the world. Although genetic improvement is a key technology for the acceleration of rice breeding, a lack of genome information had restricted efforts in molecular-based breeding until the completion of the high-quality rice genome sequence, which opened new opportunities for research in various areas of genomics. The syntenic relationship of the rice genome to other cereal genomes makes the rice genome invaluable for understanding how cereal genomes...

  10. A Correlational Encoder Decoder Architecture for Pivot Based Sequence Generation

    SAHA, AMRITA; Khapra, Mitesh M.; Chandar, Sarath; Rajendran, Janarthanan; Cho, Kyunghyun

    2016-01-01

    Interlingua based Machine Translation (MT) aims to encode multiple languages into a common linguistic representation and then decode sentences in multiple target languages from this representation. In this work we explore this idea in the context of neural encoder decoder architectures, albeit on a smaller scale and without MT as the end goal. Specifically, we consider the case of three languages or modalities X, Z and Y wherein we are interested in generating sequences in Y starting from inf...

  11. A Refinement of Perfect Equilibria Based On Substitute Sequences

    Aliprantis, C. D.; I. Topolyan

    2009-01-01

    We propose an equilibrium refinement of strict perfect equilibrium for the finite normal form games, which is not known in the literature. Okada came up with the idea of strict perfect equilibrium by strengthening the main definition of a perfect equilibrium, due to Selten [14]. We consider the alternative (and equivalent) definition of perfect equilibrium, based on the substitute sequences, as appeared in Selten [14]. We show that by strengthening and modifiyng this definition slightly, one ...

  12. Sequencing of oligonucleotide phosphorothioates based on solid-supported desulfurization.

    Wyrzykiewicz, T K; Cole, D L

    1994-01-01

    We described a solid-supported desulfurization procedure allowing easy access to the sequence analysis of oligonucleotide phosphorothioates. The described method is based upon selective removal of the 2-cyanoethyl phosphate protecting groups, followed by iodine-promoted desulfurization of the resulting phosphorothioate diesters. Automatic oxidation of oligonucleotide phosphorothioates, anchored via an ester linkage to a standard solid support (LCAA/CPG), is combined with Maxam-Gilbert solid-s...

  13. Sequence-defined bioactive macrocycles via an acid-catalysed cascade reaction

    Porel, Mintu; Thornlow, Dana N.; Phan, Ngoc N.; Alabi, Christopher A.

    2016-06-01

    Synthetic macrocycles derived from sequence-defined oligomers are a unique structural class whose ring size, sequence and structure can be tuned via precise organization of the primary sequence. Similar to peptides and other peptidomimetics, these well-defined synthetic macromolecules become pharmacologically relevant when bioactive side chains are incorporated into their primary sequence. In this article, we report the synthesis of oligothioetheramide (oligoTEA) macrocycles via a one-pot acid-catalysed cascade reaction. The versatility of the cyclization chemistry and modularity of the assembly process was demonstrated via the synthesis of >20 diverse oligoTEA macrocycles. Structural characterization via NMR spectroscopy revealed the presence of conformational isomers, which enabled the determination of local chain dynamics within the macromolecular structure. Finally, we demonstrate the biological activity of oligoTEA macrocycles designed to mimic facially amphiphilic antimicrobial peptides. The preliminary results indicate that macrocyclic oligoTEAs with just two-to-three cationic charge centres can elicit potent antibacterial activity against Gram-positive and Gram-negative bacteria.

  14. Complete Genome Sequence of Lactococcus lactis IO-1, a Lactic Acid Bacterium That Utilizes Xylose and Produces High Levels of l-Lactic Acid

    Kato, Hiroaki; Shiwa, Yuh; Oshima, Kenshiro; Machii, Miki; Araya-Kojima, Tomoko; Zendo, Takeshi; Shimizu-Kadota, Mariko; Hattori, Masahira; Sonomoto, Kenji; Yoshikawa, Hirofumi

    2012-01-01

    We report the complete genome sequence of Lactococcus lactis IO-1 (= JCM7638). It is a nondairy lactic acid bacterium, produces nisin Z, ferments xylose, and produces predominantly l-lactic acid at high xylose concentrations. From ortholog analysis with other five L. lactis strains, IO-1 was identified as L. lactis subsp. lactis.

  15. Morphological tranformation of calcite crystal growth by prismatic "acidic" polypeptide sequences.

    Kim, I; Giocondi, J L; Orme, C A; Collino, J; Evans, J S

    2007-02-13

    Many of the interesting mechanical and materials properties of the mollusk shell are thought to stem from the prismatic calcite crystal assemblies within this composite structure. It is now evident that proteins play a major role in the formation of these assemblies. Recently, a superfamily of 7 conserved prismatic layer-specific mollusk shell proteins, Asprich, were sequenced, and the 42 AA C-terminal sequence region of this protein superfamily was found to introduce surface voids or porosities on calcite crystals in vitro. Using AFM imaging techniques, we further investigate the effect that this 42 AA domain (Fragment-2) and its constituent subdomains, DEAD-17 and Acidic-2, have on the morphology and growth kinetics of calcite dislocation hillocks. We find that Fragment-2 adsorbs on terrace surfaces and pins acute steps, accelerates then decelerates the growth of obtuse steps, forms clusters and voids on terrace surfaces, and transforms calcite hillock morphology from a rhombohedral form to a rounded one. These results mirror yet are distinct from some of the earlier findings obtained for nacreous polypeptides. The subdomains Acidic-2 and DEAD-17 were found to accelerate then decelerate obtuse steps and induce oval rather than rounded hillock morphologies. Unlike DEAD-17, Acidic-2 does form clusters on terrace surfaces and exhibits stronger obtuse velocity inhibition effects than either DEAD-17 or Fragment-2. Interestingly, a 1:1 mixture of both subdomains induces an irregular polygonal morphology to hillocks, and exhibits the highest degree of acute step pinning and obtuse step velocity inhibition. This suggests that there is some interplay between subdomains within an intra (Fragment-2) or intermolecular (1:1 mixture) context, and sequence interplay phenomena may be employed by biomineralization proteins to exert net effects on crystal growth and morphology.

  16. Amino acid sequence of the cold-active alkaline phosphatase from Atlantic cod (Gadus morhua)

    Asgeirsson, Bjarni; Nielsen, Berit Noesgaard; Højrup, Peter

    2003-01-01

    Atlantic cod is a marine fish that lives at low temperatures of 0-10 degrees C and contains a cold-adapted alkaline phosphatase (AP). Preparations of AP from either the lower part of the intestines or the pyloric caeca area were subjected to proteolytic digestion, mass spectrometry and amino acid...... sequencing by Edman degradation. The primary structure exhibits greatest similarity to human tissue non-specific AP (80%), and approximately 30% similarity to AP from Escherichia coli. The key residues required for catalysis are conserved in the cod AP, except for the third metal binding site, where cod AP...

  17. Translating sanger-based routine DNA diagnostics into generic massive parallel ion semiconductor sequencing

    Diekstra, A.; Bosgoed, E.A.J.; Rikken, A.; Lier, B. van; Kamsteeg, E.J.; Tychon, M.W.J.; Derks, R.C.; Soest, R.A.; Mensenkamp, A.R.; Scheffer, H.; Neveling, K.; Nelen, M.R.

    2015-01-01

    BACKGROUND: Dideoxy-based chain termination sequencing developed by Sanger is the gold standard sequencing approach and allows clinical diagnostics of disorders with relatively low genetic heterogeneity. Recently, new next generation sequencing (NGS) technologies have found their way into diagnostic

  18. Frequencies of amino acid strings in globular protein sequences indicate suppression of blocks of consecutive hydrophobic residues

    Schwartz, Russell; Istrail, Sorin; King, Jonathan

    2001-01-01

    Patterns of hydrophobic and hydrophilic residues play a major role in protein folding and function. Long, predominantly hydrophobic strings of 20–22 amino acids each are associated with transmembrane helices and have been used to identify such sequences. Much less attention has been paid to hydrophobic sequences within globular proteins. In prior work on computer simulations of the competition between on-pathway folding and off-pathway aggregate formation, we found that long sequences of cons...

  19. Watermarking scheme of colour image based on chaotic sequences

    LIU Nian-sheng; GUO Dong-hui

    2009-01-01

    The proposed perceptual mask is based on the singularity of cover image and matches very well with the properties of the human visual system. The cover colour image is decomposed into several subbands by the wavelet transform. The water-mark composed of chaotic sequence and the covert image is embedded into the subband with the largest energy. The chaos system plays an important role in the security invisibility and robustness of the proposed scheme. The parameter and initial state of chaos system can directly influence the generation of watermark information as a key. Moreover, the watermark information has the property of spread spectrum signal by chaotic sequence to improve the invisibility and security of watermarked image. Experimental results and comparisons with other watermarking techniques prove that the proposed algorithm is effective and feasible, and improves the security, invisibility and robustness of watermarking information.

  20. [Determination of body fluid based on analysis of nucleic acids].

    Korabečná, Marie

    2015-01-01

    Recent methodological approaches of molecular genetics allow isolation of nucleic acids (DNA and RNA) from negligible forensic samples. Analysis of these molecules may be used not only for individual identification based on DNA profiling but also for the detection of origin of the body fluid which (alone or in mixture with other body fluids) forms the examined biological trace. Such an examination can contribute to the evaluation of procedural, technical and tactical value of the trace. Molecular genetic approaches discussed in the review offer new possibilities in comparison with traditional spectrum of chemical, immunological and spectroscopic tests especially with regard to the interpretation of mixtures of biological fluids and to the confirmatory character of the tests. Approaches based on reverse transcription of tissue specific mRNA and their subsequent polymerase chain reaction (PCR) and fragmentation analysis are applicable on samples containing minimal amounts of biological material. Methods for body fluid discrimination based on examination of microRNA in samples provided so far confusing results therefore further development in this field is needed. The examination of tissue specific methylation of nucleotides in selected gene sequences seems to represent a promising enrichment of the methodological spectrum. The detection of DNA sequences of tissue related bacteria has been established and it provides satisfactory results mainly in combination with above mentioned methodological approaches. PMID:26419517

  1. Draft Genome Sequences of Gluconobacter cerinus CECT 9110 and Gluconobacter japonicus CECT 8443, Acetic Acid Bacteria Isolated from Grape Must

    Sainz, Florencia

    2016-01-01

    We report here the draft genome sequences of Gluconobacter cerinus strain CECT9110 and Gluconobacter japonicus CECT8443, acetic acid bacteria isolated from grape must. Gluconobacter species are well known for their ability to oxidize sugar alcohols into the corresponding acids. Our objective was to select strains to oxidize effectively d-glucose. PMID:27365351

  2. Draft Genome Sequence of Bacillus subtilis GXA-28, a Thermophilic Strain with High Productivity of Poly-γ-Glutamic Acid

    Zeng, Wei; Chen, Guiguang; Tang, Zhen; Wu, Hao; Shu, Lin; Liang, Zhiqun

    2014-01-01

    Bacillus subtilis GXA-28 is a thermophilic strain that can produce high yield and high molecular weight of poly-γ-glutamic acid under high temperature. Here, we report the draft genome sequence of this strain, which may provide the genomic basis for the high productivity of poly-γ-glutamic acid.

  3. FiveS rRNA sequences and fatty acid profiles of colourless sulfur-oxidising bacteria

    LokaBharathi, P.A.; Ortiz-conde, B.A; Nair, S.; Chandramohan, D.; Colwell, R.R.

    these at the molecular level, 5S ribosomal ribonucleic acid (5S rRNA) sequences have been determined. Fatty acid profiles showed strain 29 to be related to Pseudomonas vesicularis with an E.D. of 5.965 and similarity index of 0.182. The nearest organism of strain 82...

  4. Biodegradable polyesters based on succinic acid

    Nikolić Marija S.

    2003-01-01

    Full Text Available Two series of aliphatic polyesters based on succinic acid were synthesized by copolymerization with adipic acid for the first series of saturated polyesters, and with fumaric acid for the second series. Polyesters were prepared starting from the corresponding dimethyl esters and 1,4-butanediol by melt transesterification in the presence of a highly effective catalyst tetra-n-butyl-titanate, Ti(0Bu4. The molecular structure and composition of the copolyesters was determined by 1H NMR spectroscopy. The effect of copolymer composition on the physical and thermal properties of these random polyesters were investigated using differential scanning calorimetry. The degree of crystallinity was determined by DSC and wide angle X-ray. The degrees of crystallinity of the saturated and unsaturated copolyesters were generally reduced with respect to poly(butylene succinate, PBS. The melting temperatures of the saturated polyesters were lower, while the melting temperatures of the unsaturated copolyesters were higher than the melting temperature of PBS. The biodegradability of the polyesters was investigated by enzymatic degradation tests. The enzymatic degradation tests were performed in a buffer solution with Candida cylindracea lipase and for the unsaturated polyesters with Rhizopus arrhizus lipase. The extent of biodegradation was quantified as the weight loss of polyester films. Also the surface of the polyester films after degradation was observed using optical microscopy. It could be concluded that the biodegradability depended strongly on the degree of crystallinity, but also on the flexibility of the chain backbone. The highest biodegradation was observed for copolyesters containing 50 mol.% of adipic acid units, and in the series of unsaturated polyesters for copolyesters containing 5 and 10 mol.% of fumarate units. Although the degree of crystallinity of the unsaturated polyesters decreased slightly with increasing unsaturation, the biodegradation

  5. Prediction of potential drug targets based on simple sequence properties

    Lai Luhua

    2007-09-01

    Full Text Available Abstract Background During the past decades, research and development in drug discovery have attracted much attention and efforts. However, only 324 drug targets are known for clinical drugs up to now. Identifying potential drug targets is the first step in the process of modern drug discovery for developing novel therapeutic agents. Therefore, the identification and validation of new and effective drug targets are of great value for drug discovery in both academia and pharmaceutical industry. If a protein can be predicted in advance for its potential application as a drug target, the drug discovery process targeting this protein will be greatly speeded up. In the current study, based on the properties of known drug targets, we have developed a sequence-based drug target prediction method for fast identification of novel drug targets. Results Based on simple physicochemical properties extracted from protein sequences of known drug targets, several support vector machine models have been constructed in this study. The best model can distinguish currently known drug targets from non drug targets at an accuracy of 84%. Using this model, potential protein drug targets of human origin from Swiss-Prot were predicted, some of which have already attracted much attention as potential drug targets in pharmaceutical research. Conclusion We have developed a drug target prediction method based solely on protein sequence information without the knowledge of family/domain annotation, or the protein 3D structure. This method can be applied in novel drug target identification and validation, as well as genome scale drug target predictions.

  6. JRC GMO-Amplicons: a collection of nucleic acid sequences related to genetically modified organisms.

    Petrillo, Mauro; Angers-Loustau, Alexandre; Henriksson, Peter; Bonfini, Laura; Patak, Alex; Kreysa, Joachim

    2015-01-01

    The DNA target sequence is the key element in designing detection methods for genetically modified organisms (GMOs). Unfortunately this information is frequently lacking, especially for unauthorized GMOs. In addition, patent sequences are generally poorly annotated, buried in complex and extensive documentation and hard to link to the corresponding GM event. Here, we present the JRC GMO-Amplicons, a database of amplicons collected by screening public nucleotide sequence databanks by in silico determination of PCR amplification with reference methods for GMO analysis. The European Union Reference Laboratory for Genetically Modified Food and Feed (EU-RL GMFF) provides these methods in the GMOMETHODS database to support enforcement of EU legislation and GM food/feed control. The JRC GMO-Amplicons database is composed of more than 240 000 amplicons, which can be easily accessed and screened through a web interface. To our knowledge, this is the first attempt at pooling and collecting publicly available sequences related to GMOs in food and feed. The JRC GMO-Amplicons supports control laboratories in the design and assessment of GMO methods, providing inter-alia in silico prediction of primers specificity and GM targets coverage. The new tool can assist the laboratories in the analysis of complex issues, such as the detection and identification of unauthorized GMOs. Notably, the JRC GMO-Amplicons database allows the retrieval and characterization of GMO-related sequences included in patents documentation. Finally, it can help annotating poorly described GM sequences and identifying new relevant GMO-related sequences in public databases. The JRC GMO-Amplicons is freely accessible through a web-based portal that is hosted on the EU-RL GMFF website. Database URL: http://gmo-crl.jrc.ec.europa.eu/jrcgmoamplicons/. PMID:26424080

  7. Parameters of proteome evolution from histograms of amino-acid sequence identities of paralogous proteins

    Yan Koon-Kiu

    2007-11-01

    Full Text Available Abstract Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model that allows one to extract some of this information and apply it to the set of all pairs of paralogous proteins in H. pylori, E. coli, S. cerevisiae, C. elegans, D. melanogaster, and H. sapiens. It was found that the histogram of sequence identities p generated by an all-to-all alignment of all protein sequences encoded in a genome is well fitted with a power-law form ~ p-γ with the value of the exponent γ around 4 for the majority of organisms used in this study. This implies that the intra-protein variability of substitution rates is best described by the Gamma-distribution with the exponent α ≈ 0.33. Different features of the shape of such histograms allow us to quantify the ratio between the genome-wide average deletion/duplication rates and the amino-acid substitution rate. Conclusion We separately measure the short-term ("raw" duplication and deletion rates rdup∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsgaKjabbwha1jabbchaWbqaaiabgEHiQaaaaaa@3283@, rdel∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsga

  8. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Meiler Arno

    2012-09-01

    Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  9. Clostridium sticklandii, a specialist in amino acid degradation:revisiting its metabolism through its genome sequence

    Pelletier Eric

    2010-10-01

    Full Text Available Abstract Background Clostridium sticklandii belongs to a cluster of non-pathogenic proteolytic clostridia which utilize amino acids as carbon and energy sources. Isolated by T.C. Stadtman in 1954, it has been generally regarded as a "gold mine" for novel biochemical reactions and is used as a model organism for studying metabolic aspects such as the Stickland reaction, coenzyme-B12- and selenium-dependent reactions of amino acids. With the goal of revisiting its carbon, nitrogen, and energy metabolism, and comparing studies with other clostridia, its genome has been sequenced and analyzed. Results C. sticklandii is one of the best biochemically studied proteolytic clostridial species. Useful additional information has been obtained from the sequencing and annotation of its genome, which is presented in this paper. Besides, experimental procedures reveal that C. sticklandii degrades amino acids in a preferential and sequential way. The organism prefers threonine, arginine, serine, cysteine, proline, and glycine, whereas glutamate, aspartate and alanine are excreted. Energy conservation is primarily obtained by substrate-level phosphorylation in fermentative pathways. The reactions catalyzed by different ferredoxin oxidoreductases and the exergonic NADH-dependent reduction of crotonyl-CoA point to a possible chemiosmotic energy conservation via the Rnf complex. C. sticklandii possesses both the F-type and V-type ATPases. The discovery of an as yet unrecognized selenoprotein in the D-proline reductase operon suggests a more detailed mechanism for NADH-dependent D-proline reduction. A rather unusual metabolic feature is the presence of genes for all the enzymes involved in two different CO2-fixation pathways: C. sticklandii harbours both the glycine synthase/glycine reductase and the Wood-Ljungdahl pathways. This unusual pathway combination has retrospectively been observed in only four other sequenced microorganisms. Conclusions Analysis of the C

  10. Isolation and amino acid sequences of squirrel monkey (Saimiri sciurea) insulin and glucagon

    It was reported two decades ago that insulin was not detectable in the glucose-stimulated state in Saimiri sciurea, the New World squirrel monkey, by a radioimmunoassay system developed with guinea pig anti-pork insulin antibody and labeled park insulin. With the same system, reasonable levels were observed in rhesus monkeys and chimpanzees. This suggested that New World monkeys, like the New World hystricomorph rodents such as the guinea pig and the coypu, might have insulins whose sequences differ markedly from those of Old World mammals. In this report the authors describe the purification and amino acid sequences of squirrel monkey insulin and glucagon. They demonstrate that the substitutions at B29, B27, A2, A4, and A17 of squirrel monkey insulin are identical with those previously found in another New World primate, the owl monkey (Aotus trivirgatus). The immunologic cross-reactivity of this insulin in their immunoassay system is only a few percent of that of human insulin. It appears that the peptides of the New World monkeys have diverged less from those of the Old World mammals than have those of the New World hystricomorph rodents. The striking improvements in peptide purification and sequencing have the potential for adding new information concerning the evolutionary divergence of species

  11. Complete amino acid sequence of the myoglobin from the Pacific spotted dolphin, Stenella attenuata graffmani.

    Jones, B N; Wang, C C; Dwulet, F E; Lehman, L D; Meuth, J L; Bogardt, R A; Gurd, F R

    1979-04-25

    The complete amino acid sequence of the major component myoglobin from the Pacific spotted dolphin, Stenella attenuata graffmani, was determined by the automated Edman degradation of several large peptides obtained by specific cleavage of the protein. The acetimidated apomyoglobin was selectively cleaved at its two methionyl residues with cyanogen bromide and at its three arginyl residues by trypsin. By subjecting four of these peptides and the apomyoglobin to automated Edman degradation, over 80% of the primary structure of the protein was obtained. The remainder of the covalent structure was determined by the sequence analysis of peptides that resulted from further digestion of the central cyanogen bromide fragment. This fragment was cleaved at its glutamyl residues with staphylococcal protease and its lysyl residues with trypsin. The action of trypsin was restricted to the lysyl residues by chemical modification of the single arginyl residue of the fragment with 1,2-cyclohexanedione. The primary structure of this myoglobin proved to be identical with that from the Atlantic bottlenosed dolphin and Pacific common dolphin but differs from the myoglobins of the killer whale and pilot whale at two positions. The above sequence identities and differences reflect the close taxonomic relationship of these five species of Cetacea. PMID:454657

  12. Isolation and amino acid sequences of squirrel monkey (Saimiri sciurea) insulin and glucagon

    Yu, Jinghua (Veterans Administration Medical Center, Bronx, NY (United States)); Eng, J.; Yalow, R.S. (Veterans Administration Medical Center, Bronx, NY (United States) City Univ. of New York, NY (United States))

    1990-12-01

    It was reported two decades ago that insulin was not detectable in the glucose-stimulated state in Saimiri sciurea, the New World squirrel monkey, by a radioimmunoassay system developed with guinea pig anti-pork insulin antibody and labeled park insulin. With the same system, reasonable levels were observed in rhesus monkeys and chimpanzees. This suggested that New World monkeys, like the New World hystricomorph rodents such as the guinea pig and the coypu, might have insulins whose sequences differ markedly from those of Old World mammals. In this report the authors describe the purification and amino acid sequences of squirrel monkey insulin and glucagon. They demonstrate that the substitutions at B29, B27, A2, A4, and A17 of squirrel monkey insulin are identical with those previously found in another New World primate, the owl monkey (Aotus trivirgatus). The immunologic cross-reactivity of this insulin in their immunoassay system is only a few percent of that of human insulin. It appears that the peptides of the New World monkeys have diverged less from those of the Old World mammals than have those of the New World hystricomorph rodents. The striking improvements in peptide purification and sequencing have the potential for adding new information concerning the evolutionary divergence of species.

  13. Quantitative sequence-function relationships in proteins based on gene ontology

    Lesk Arthur M

    2007-08-01

    Full Text Available Abstract Background The relationship between divergence of amino-acid sequence and divergence of function among homologous proteins is complex. The assumption that homologs share function – the basis of transfer of annotations in databases – must therefore be regarded with caution. Here, we present a quantitative study of sequence and function divergence, based on the Gene Ontology classification of function. We determined the relationship between sequence divergence and function divergence in 6828 protein families from the PFAM database. Within families there is a broad range of sequence similarity from very closely related proteins – for instance, orthologs in different mammals – to very distantly-related proteins at the limit of reliable recognition of homology. Results We correlated the divergence in sequences determined from pairwise alignments, and the divergence in function determined by path lengths in the Gene Ontology graph, taking into account the fact that many proteins have multiple functions. Our results show that, among homologous proteins, the proportion of divergent functions decreases dramatically above a threshold of sequence similarity at about 50% residue identity. For proteins with more than 50% residue identity, transfer of annotation between homologs will lead to an erroneous attribution with a totally dissimilar function in fewer than 6% of cases. This means that for very similar proteins (about 50 % identical residues the chance of completely incorrect annotation is low; however, because of the phenomenon of recruitment, it is still non-zero. Conclusion Our results describe general features of the evolution of protein function, and serve as a guide to the reliability of annotation transfer, based on the closeness of the relationship between a new protein and its nearest annotated relative.

  14. Generalization of entropy based divergence measures for symbolic sequence analysis.

    Miguel A Ré

    Full Text Available Entropy based measures have been frequently used in symbolic sequence analysis. A symmetrized and smoothed form of Kullback-Leibler divergence or relative entropy, the Jensen-Shannon divergence (JSD, is of particular interest because of its sharing properties with families of other divergence measures and its interpretability in different domains including statistical physics, information theory and mathematical statistics. The uniqueness and versatility of this measure arise because of a number of attributes including generalization to any number of probability distributions and association of weights to the distributions. Furthermore, its entropic formulation allows its generalization in different statistical frameworks, such as, non-extensive Tsallis statistics and higher order Markovian statistics. We revisit these generalizations and propose a new generalization of JSD in the integrated Tsallis and Markovian statistical framework. We show that this generalization can be interpreted in terms of mutual information. We also investigate the performance of different JSD generalizations in deconstructing chimeric DNA sequences assembled from bacterial genomes including that of E. coli, S. enterica typhi, Y. pestis and H. influenzae. Our results show that the JSD generalizations bring in more pronounced improvements when the sequences being compared are from phylogenetically proximal organisms, which are often difficult to distinguish because of their compositional similarity. While small but noticeable improvements were observed with the Tsallis statistical JSD generalization, relatively large improvements were observed with the Markovian generalization. In contrast, the proposed Tsallis-Markovian generalization yielded more pronounced improvements relative to the Tsallis and Markovian generalizations, specifically when the sequences being compared arose from phylogenetically proximal organisms.

  15. Species specific amino acid sequence-protein local structure relationships: An analysis in the light of a structural alphabet.

    de Brevern, Alexandre G; Joseph, Agnel Praveen

    2011-05-01

    Protein structure analysis and prediction methods are based on non-redundant data extracted from the available protein structures, regardless of the species from which the protein originates. Hence, these datasets represent the global knowledge on protein folds, which constitutes a generic distribution of amino acid sequence-protein structure (AAS-PS) relationships. In this study, we try to elucidate whether the AAS-PS relationship could possess specificities depending on the specie. For this purpose, we have chosen three different species: Saccharomyces cerevisiae, Plasmodium falciparum and Arabidopsis thaliana. We analyzed the AAS-PS behaviors of the proteins from these three species and compared it to the "expected" distribution of a classical non-redundant databank. With the classical secondary structure description, only slight differences in amino acid preferences could be observed. With a more precise description of local protein structures (Protein Blocks), significant changes could be highlighted. S. cerevisiae's AAS-PS relationship is close to the general distribution, while striking differences are observed in the case of A. thaliana. P. falciparum is the most distant one. This study presents some interesting view-points on AAS-PS relationship. Certain species exhibit unique preferences for amino acids to be associated with protein local structural elements. Thus, AAS-PS relationships are species dependent. These results can give useful insights for improving prediction methodologies which take the species specific information into account. PMID:21333657

  16. Analysis of Sequence Based Classifier Prediction for HIV Subtypes

    S. Santhosh Kumar

    2012-10-01

    Full Text Available Human immunodeficiency virus (HIV is a lent virus that causes acquired immunodeficiency syndrome (AIDS. The main drawback in HIV treatment process is its sub type prediction. The sub type and group classification of HIV is based on its genetic variability and location. HIV can be divided into two major types, HIV type 1 (HIV-1 and HIV type 2 (HIV-2. Many classifier approaches have been used to classify HIV subtypes based on their group, but some of cases are having two groups in one; in such cases the classification becomes more complex. The methodology used is this paper based on the HIV sequences. For this work several classifier approaches are used to classify the HIV1 and HIV2. For implementation of the work a real time patient database is taken and the patient records are experimented and the final best classifier is identified with quick response time and least error rate.

  17. Next-Generation Sequencing-Based Molecular Diagnosis of Choroideremia

    Kayo Shimizu

    2015-07-01

    Full Text Available We screened patients with choroideremia using next-generation sequencing (NGS and identified a novel mutation and a known mutation in the CHM gene. One patient presented an atypical fundus appearance for choroideremia. Another patient presented macular hole retinal detachment in the left eye. The present case series shows the utility of NGS-based screening in patients with choroideremia. In addition, the presence of macular hole in 1 of the 2 patients, together with a previous report, indicated the susceptibility of patients with choroideremia to macular hole.

  18. Comparison of sequencing-based methods to profile DNA methylation and identification of monoallelic epigenetic modifications

    Analysis of DNA methylation patterns relies increasingly on sequencing-based profiling methods. The four most frequently used sequencing-based technologies are the bisulfite-based methods MethylC-seq and reduced representation bisulfite sequencing (RRBS), and the enrichment-based techniques methylat...

  19. Implications of HLA sequence-based typing in transplantation

    Shankarkumar U

    2008-01-01

    Full Text Available Serology-based conventional microlymphocytotoxicity HLA typing method, which has been regarded as the gold standard in organ and hematopoietic stem cell transplantation, has been replaced now by DNA-based typing. Many laboratories all over the world have already switched over to molecular methods. Microlymphocytotoxicity-based tissue typing was done using commercial sera, while the molecular typing by genomic DNA based. DNA quality and its quantity obtained using various DNA extraction protocols was found to be an important factor in the molecular method of tissue typing in transplant outcome. Many polymerase chain reaction-based molecular techniques have been adopted with far reaching clinical outcome. The sequence-based typing (SBT has been the ultimate technique, which has been of the highest reliability in defining the HLA alleles. The nonavailability of specific HLA antisera from native populations, large number of blank alleles yet to be defined and comparable low resolution of HLA alleles in SSP or SSOP technique, suggests that highly refined DNA-based methods like SBT should be used as an adjunct to HLA serology and/or low/intermediate/high resolution HLA typing in order to achieve a better transplant outcome.

  20. Sequence-structure based phylogeny of GPCR Class A Rhodopsin receptors.

    Kakarala, Kavita Kumari; Jamil, Kaiser

    2014-05-01

    Current methods of G protein coupled receptors (GPCRs) phylogenetic classification are sequence based and therefore inappropriate for highly divergent sequences, sharing low sequence identity. In this study, sequence structure profile based alignment generated by PROMALS3D was used to understand the GPCR Class A Rhodopsin superfamily evolution using the MEGA 5 software. Phylogenetic analysis included a combination of Neighbor-Joining method and Maximum Likelihood method, with 1000 bootstrap replicates. Our study was able to identify potential ligand association for Class A Orphans and putative/unclassified Class A receptors with no cognate ligand information: GPR21 and GPR52 with fatty acids; GPR75 with Neuropeptide Y; GPR82, GPR18, GPR141 with N-arachidonylglycine; GPR176 with Free fatty acids, GPR10 with Tachykinin & Neuropeptide Y; GPR85 with ATP, ADP & UDP glucose; GPR151 with Galanin; GPR153 and GPR162 with Adrenalin, Noradrenalin; GPR146, GPR139, GPR142 with Neuromedin, Ghrelin, Neuromedin U-25 & Thyrotropin-releasing hormone; GPR171 with ATP, ADP & UDP Glucose; GPR88, GPR135, GPR161, GPR101with 11-cis-retinal; GPR83 with Tackykinin; GPR148 with Prostanoids, GPR109b, GPR81, GPR31with ATP & UTP and GPR150 with GnRH I & GnRHII. Furthermore, we suggest that this study would prove useful in re-classification of receptors, selecting templates for homology modeling and identifying ligands which may show cross reactivity with other GPCRs as signaling via multiple ligands play a significant role in disease modulation. PMID:24503482

  1. Scanning mutagenesis of the amino acid sequences flanking phosphorylation site 1 of the mitochondrial pyruvate dehydrogenase complex

    Nagib eAhsan

    2012-07-01

    Full Text Available The mitochondrial pyruvate dehydrogenase complex is regulated by reversible seryl-phosphorylation of the E1α subunit by a dedicated, intrinsic kinase. The phospho-complex is reactivated when dephosphorylated by an intrinsic PP2C-type protein phosphatase. Both the position of the phosphorylated Ser-residue and the sequences of the flanking amino acids are highly conserved. We have used the synthetic peptide-based kinase client assay plus recombinant pyruvate dehydrogenase E1α and E1α-kinase to perform scanning mutagenesis of the residues flanking the site of phosphorylation. Consistent with the results from phylogenetic analysis of the flanking sequences, the direct peptide-based kinase assays tolerated very few changes. Even conservative changes such as Leu, Ile, or Val for Met, or Glu for Asp, gave very marked reductions in phosphorylation. Overall the results indicate that regulation of the mitochondrial pyruvate dehydrogenase complex by reversible phosphorylation is an extreme example of multiple, interdependent instances of co-evolution.

  2. Sequence and structural features of binding site residues in protein-protein complexes: comparison with protein-nucleic acid complexes

    Selvaraj S

    2011-10-01

    Full Text Available Abstract Background Protein-protein interactions are important for several cellular processes. Understanding the mechanism of protein-protein recognition and predicting the binding sites in protein-protein complexes are long standing goals in molecular and computational biology. Methods We have developed an energy based approach for identifying the binding site residues in protein–protein complexes. The binding site residues have been analyzed with sequence and structure based parameters such as binding propensity, neighboring residues in the vicinity of binding sites, conservation score and conformational switching. Results We observed that the binding propensities of amino acid residues are specific for protein-protein complexes. Further, typical dipeptides and tripeptides showed high preference for binding, which is unique to protein-protein complexes. Most of the binding site residues are highly conserved among homologous sequences. Our analysis showed that 7% of residues changed their conformations upon protein-protein complex formation and it is 9.2% and 6.6% in the binding and non-binding sites, respectively. Specifically, the residues Glu, Lys, Leu and Ser changed their conformation from coil to helix/strand and from helix to coil/strand. Leu, Ser, Thr and Val prefer to change their conformation from strand to coil/helix. Conclusions The results obtained in this study will be helpful for understanding and predicting the binding sites in protein-protein complexes.

  3. Rapid and Sensitive Isothermal Detection of Nucleic-acid Sequence by Multiple Cross Displacement Amplification

    Yi Wang; Yan Wang; Ai-Jing Ma; Dong-Xun Li; Li-Juan Luo; Dong-Xin Liu; Dong Jin; Kai Liu; Chang-Yun Ye

    2015-01-01

    We have devised a novel amplification strategy based on isothermal strand-displacement polymerization reaction, which was termed multiple cross displacement amplification (MCDA). The approach employed a set of ten specially designed primers spanning ten distinct regions of target sequence and was preceded at a constant temperature (61–65 °C). At the assay temperature, the double-stranded DNAs were at dynamic reaction environment of primer-template hybrid, thus the high concentration of primer...

  4. Large scale clustering of protein sequences with FORCE -A layout based heuristic for weighted cluster editing

    Baumbach Jan

    2007-10-01

    Full Text Available Abstract Background Detecting groups of functionally related proteins from their amino acid sequence alone has been a long-standing challenge in computational genome research. Several clustering approaches, following different strategies, have been published to attack this problem. Today, new sequencing technologies provide huge amounts of sequence data that has to be efficiently clustered with constant or increased accuracy, at increased speed. Results We advocate that the model of weighted cluster editing, also known as transitive graph projection is well-suited to protein clustering. We present the FORCE heuristic that is based on transitive graph projection and clusters arbitrary sets of objects, given pairwise similarity measures. In particular, we apply FORCE to the problem of protein clustering and show that it outperforms the most popular existing clustering tools (Spectral clustering, TribeMCL, GeneRAGE, Hierarchical clustering, and Affinity Propagation. Furthermore, we show that FORCE is able to handle huge datasets by calculating clusters for all 192 187 prokaryotic protein sequences (66 organisms obtained from the COG database. Finally, FORCE is integrated into the corynebacterial reference database CoryneRegNet. Conclusion FORCE is an applicable alternative to existing clustering algorithms. Its theoretical foundation, weighted cluster editing, can outperform other clustering paradigms on protein homology clustering. FORCE is open source and implemented in Java. The software, including the source code, the clustering results for COG and CoryneRegNet, and all evaluation datasets are available at http://gi.cebitec.uni-bielefeld.de/comet/force/.

  5. Physiological roles of acid-base sensors.

    Levin, Lonny R; Buck, Jochen

    2015-01-01

    Acid-base homeostasis is essential for life. The macromolecules upon which living organisms depend are sensitive to pH changes, and physiological systems use the equilibrium between carbon dioxide, bicarbonate, and protons to buffer their pH. Biological processes and environmental insults are constantly challenging an organism's pH; therefore, to maintain a consistent and proper pH, organisms need sensors that measure pH and that elicit appropriate responses. Mammals use multiple sensors for measuring both intracellular and extracellular pH, and although some mammalian pH sensors directly measure protons, it has recently become apparent that many pH-sensing systems measure pH via bicarbonate-sensing soluble adenylyl cyclase. PMID:25340964

  6. Comparison of the chromosomal localization of murine and human glucocerebrosidase genes and of the deduced amino acid sequences

    To study structure-function relationships and molecular evolution, the authors determined the nucleotide sequence and chromosomal location of the gene encoding murine glucocerebrosidase. In the protein coding region of the murine cDNA, the nucleotide sequence and the corresponding deduced amino acid sequences were 82% and 86% identical to the respective humans sequences. All five amino acids presently known to be essential for normal enzymatic activity were conserved between mouse and man. The murine enzyme had a single deletion relative to the human enzyme at amino acid number 273. One ATG translation initiation signal was present in the mouse sequence in contrast to the human sequence, where two start codons have been reported. Nucleotide sequencing of a clone derived from murine genomic DNA revealed that the murine signal for translation initiation was located in exon 2. The locations of all 10 introns were conserved among mouse and man. They mapped the genetic locus for glucocerebrosidase to mouse chromosome 3, at a position 7.6 ± 3.2 centimorgans from the locus for the β subunit of nerve growth factor. Comparison of linkage relationships in the human and murine genome indicates that these closely linked mouse genes are also syntenic on human chromosome 1 but in positions that span the centromere

  7. Mutation-selection models of coding sequence evolution with site-heterogeneous amino acid fitness profiles.

    Rodrigue, Nicolas; Philippe, Hervé; Lartillot, Nicolas

    2010-03-01

    Modeling the interplay between mutation and selection at the molecular level is key to evolutionary studies. To this end, codon-based evolutionary models have been proposed as pertinent means of studying long-range evolutionary patterns and are widely used. However, these approaches have not yet consolidated results from amino acid level phylogenetic studies showing that selection acting on proteins displays strong site-specific effects, which translate into heterogeneous amino acid propensities across the columns of alignments; related codon-level studies have instead focused on either modeling a single selective context for all codon columns, or a separate selective context for each codon column, with the former strategy deemed too simplistic and the latter deemed overparameterized. Here, we integrate recent developments in nonparametric statistical approaches to propose a probabilistic model that accounts for the heterogeneity of amino acid fitness profiles across the coding positions of a gene. We apply the model to a dozen real protein-coding gene alignments and find it to produce biologically plausible inferences, for instance, as pertaining to site-specific amino acid constraints, as well as distributions of scaled selection coefficients. In their account of mutational features as well as the heterogeneous regimes of selection at the amino acid level, the modeling approaches studied here can form a backdrop for several extensions, accounting for other selective features, for variable population size, or for subtleties of mutational features, all with parameterizations couched within population-genetic theory. PMID:20176949

  8. Genome Sequence of Lactobacillus saerimneri 30a (Formerly Lactobacillus sp. Strain 30a), a Reference Lactic Acid Bacterium Strain Producing Biogenic Amines

    Romano, Andrea; Trip, Hein; Campbell-Sills, Hugo; Bouchez, Olivier; Sherman, David; Lolkema, Juke S.; Lucas, Patrick M

    2013-01-01

    Lactobacillus sp. strain 30a (Lactobacillus saerimneri) produces the biogenic amines histamine, putrescine, and cadaverine by decarboxylating their amino acid precursors. We report its draft genome sequence (1,634,278 bases, 42.6% G+C content) and the principal findings from its annotation, which might shed light onto the enzymatic machineries that are involved in its production of biogenic amines.

  9. The amino acid alphabet and the architecture of the protein sequence-structure map. I. Binary alphabets.

    Ferrada, Evandro

    2014-12-01

    The correspondence between protein sequences and structures, or sequence-structure map, relates to fundamental aspects of structural, evolutionary and synthetic biology. The specifics of the mapping, such as the fraction of accessible sequences and structures, or the sequences' ability to fold fast, are dictated by the type of interactions between the monomers that compose the sequences. The set of possible interactions between monomers is encapsulated by the potential energy function. In this study, I explore the impact of the relative forces of the potential on the architecture of the sequence-structure map. My observations rely on simple exact models of proteins and random samples of the space of potential energy functions of binary alphabets. I adopt a graph perspective and study the distribution of viable sequences and the structures they produce, as networks of sequences connected by point mutations. I observe that the relative proportion of attractive, neutral and repulsive forces defines types of potentials, that induce sequence-structure maps of vastly different architectures. I characterize the properties underlying these differences and relate them to the structure of the potential. Among these properties are the expected number and relative distribution of sequences associated to specific structures and the diversity of structures as a function of sequence divergence. I study the types of binary potentials observed in natural amino acids and show that there is a strong bias towards only some types of potentials, a bias that seems to characterize the folding code of natural proteins. I discuss implications of these observations for the architecture of the sequence-structure map of natural proteins, the construction of random libraries of peptides, and the early evolution of the natural amino acid alphabet. PMID:25473967

  10. Trypsin inhibitors from ridged gourd (Luffa acutangula Linn.) seeds: purification, properties, and amino acid sequences.

    Haldar, U C; Saha, S K; Beavis, R C; Sinha, N K

    1996-02-01

    Two trypsin inhibitors, LA-1 and LA-2, have been isolated from ridged gourd (Luffa acutangula Linn.) seeds and purified to homogeneity by gel filtration followed by ion-exchange chromatography. The isoelectric point is at pH 4.55 for LA-1 and at pH 5.85 for LA-2. The Stokes radius of each inhibitor is 11.4 A. The fluorescence emission spectrum of each inhibitor is similar to that of the free tyrosine. The biomolecular rate constant of acrylamide quenching is 1.0 x 10(9) M-1 sec-1 for LA-1 and 0.8 x 10(9) M-1 sec-1 for LA-2 and that of K2HPO4 quenching is 1.6 x 10(11) M-1 sec-1 for LA-1 and 1.2 x 10(11) M-1 sec-1 for LA-2. Analysis of the circular dichroic spectra yields 40% alpha-helix and 60% beta-turn for La-1 and 45% alpha-helix and 55% beta-turn for LA-2. Inhibitors LA-1 and LA-2 consist of 28 and 29 amino acid residues, respectively. They lack threonine, alanine, valine, and tryptophan. Both inhibitors strongly inhibit trypsin by forming enzyme-inhibitor complexes at a molar ratio of unity. A chemical modification study suggests the involvement of arginine of LA-1 and lysine of LA-2 in their reactive sites. The inhibitors are very similar in their amino acid sequences, and show sequence homology with other squash family inhibitors. PMID:8924202

  11. CLUSS: Clustering of protein sequences based on a new similarity measure

    Brzezinski Ryszard

    2007-08-01

    Full Text Available Abstract Background The rapid burgeoning of available protein data makes the use of clustering within families of proteins increasingly important. The challenge is to identify subfamilies of evolutionarily related sequences. This identification reveals phylogenetic relationships, which provide prior knowledge to help researchers understand biological phenomena. A good evolutionary model is essential to achieve a clustering that reflects the biological reality, and an accurate estimate of protein sequence similarity is crucial to the building of such a model. Most existing algorithms estimate this similarity using techniques that are not necessarily biologically plausible, especially for hard-to-align sequences such as proteins with different domain structures, which cause many difficulties for the alignment-dependent algorithms. In this paper, we propose a novel similarity measure based on matching amino acid subsequences. This measure, named SMS for Substitution Matching Similarity, is especially designed for application to non-aligned protein sequences. It allows us to develop a new alignment-free algorithm, named CLUSS, for clustering protein families. To the best of our knowledge, this is the first alignment-free algorithm for clustering protein sequences. Unlike other clustering algorithms, CLUSS is effective on both alignable and non-alignable protein families. In the rest of the paper, we use the term "phylogenetic" in the sense of "relatedness of biological functions". Results To show the effectiveness of CLUSS, we performed an extensive clustering on COG database. To demonstrate its ability to deal with hard-to-align sequences, we tested it on the GH2 family. In addition, we carried out experimental comparisons of CLUSS with a variety of mainstream algorithms. These comparisons were made on hard-to-align and easy-to-align protein sequences. The results of these experiments show the superiority of CLUSS in yielding clusters of proteins

  12. Human Retroviruses and AIDS. A compilation and analysis of nucleic acid and amino acid sequences: I--II; III--V

    Myers, G.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States); Wain-Hobson, S. [ed.] [Laboratory of Molecular Retrovirology, Pasteur Inst.; Smith, R.F. [ed.] [Baylor Coll. of Medicine, Houston, TX (United States). Dept. of Pharmacology; Pavlakis, G.N. [ed.] [National Cancer Inst., Frederick, MD (United States). Cancer Research Facility

    1993-12-31

    This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (I) HIV and SIV Nucleotide Sequences; (II) Amino Acid Sequences; (III) Analyses; (IV) Related Sequences; and (V) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.

  13. Characterization of N-glycosylation and amino acid sequence features of immunoglobulins from swine.

    Lopez, Paul G; Girard, Lauren; Buist, Marjorie; de Oliveira, Andrey Giovanni Gomes; Bodnar, Edward; Salama, Apolline; Soulillou, Jean-Paul; Perreault, Hélène

    2016-02-01

    The primary goal of this study was to develop a method to study the N-glycosylation of IgG from swine in order to detect epitopes containing N-glycolylneuraminic acid (Neu5Gc) and/or terminal galactose residues linked in α1-3 susceptible to cause xenograft-related problems. Samples of immunoglobulin were isolated from porcine serum using protein-A affinity chromatography. The eluate was then separated on electrophoretic gel, and bands corresponding to the N-glycosylated heavy chains were cut off the gel and subjected to tryptic digestion. Peptides and glycopeptides were separated by reversed phase liquid chromatography and fractions were collected for matrix-assisted laser desorption/ionization time-of-flight mass spectrometric (MALDI-TOF-MS) analysis. Overall no α1-3 galactose was detected, as demonstrated by complete susceptibility of terminal galactose residues to β-galactosidase digestion. Neu5Gc was detected on singly sialylated structures. Two major N-glycopeptides were found, EEQFNSTYR and EAQFNSTYR as determined by tandem MS (MS/MS), as previously reported by Butler et al. (Immunogenetics, 61, 2009, 209-230), who found 11 subclasses for porcine IgG. Out of the 11, ten include the sequence corresponding to EEQFNSTYR, and only one codes for EAQFNSTYR. In this study, glycosylation patterns associated with both chains were slightly different, in that EEQFNSTYR had a higher content of galactose. The last step of this study consisted of peptide-mapping the 11 reported porcine IgG sequences. Although there was considerable overlap, at least one unique tryptic peptide was found per IgG sequence. The workflow presented in this manuscript constitutes the first study to use MALDI-TOF-MS in the investigation of porcine IgG structural features. PMID:26586247

  14. Targeting of an Interrupted Polypurine:Polypyrimidine Sequence in Mammalian Cells by a Triplex-Forming Oligonucleotide Containing a Novel Base Analogue†

    Semenyuk, A.; Darian, E.; Liu, J; Majumdar, A; Cuenoud, B; Miller, P S; MacKerell, A.D.; Seidman, M M

    2010-01-01

    The DNA triple helix consists of a third strand of nucleic acid lying in the major groove of an intact DNA duplex. The most stable triplexes form on polypurine:polypyrimidine sequences, and pyrimidine interruptions in the purine strand are destabilizing. Sequence stringency is imparted by specific Hoogsteen hydrogen bonds between third strand bases and the purine bases in the duplex. Appropriate base and sugar modifications of triple helix-forming oligonucleotides (TFOs) confer chromosome tar...

  15. Development of Sequence-Based Microsatellite Marker for Phalaenopsis Orchid

    FATIMAH

    2011-06-01

    Full Text Available Phalaenopsis is one of the most interesting genera of orchids due to the members are often used as parents to produce hybrids. The establishment and development of highly reliable and discriminatory methods for identifying species and cultivars has become increasingly more important to plant breeders and members of the nursery industry. The aim of this research was to develop sequence-based microsatellite (eSSR markers for the Phalaenopsis orchid designed from the sequence of GenBank NCBI. Seventeen primers were designed and thirteen primers pairs could amplify the DNA giving the expected PCR product with polymorphism. A total of 51 alleles, with an average of 3 alleles per locus and polymorphism information content (PIC values at 0.674, were detected at the 16 SSR loci. Therefore, these markers could be used for identification of the Phalaenopsis orchid used in this study. Genetic similarity and principle coordinate analysis identified five major groups of Phalaenopsis sp. the first group consisted of P. amabilis, P. fuscata, P. javanica, and P. zebrine. The second group consisted of P. amabilis, P. amboinensis, P. bellina, P. floresens, and P. mannii. The third group consisted of P. bellina, P. cornucervi, P. cornucervi, P. violaceae sumatra, P. modesta. The forth group consisted of P. cornucervi and P. lueddemanniana, and the fifth group was P. amboinensis.

  16. Lactic acid production from potato peel waste by anaerobic sequencing batch fermentation using undefined mixed culture.

    Liang, Shaobo; McDonald, Armando G; Coats, Erik R

    2015-11-01

    Lactic acid (LA) is a necessary industrial feedstock for producing the bioplastic, polylactic acid (PLA), which is currently produced by pure culture fermentation of food carbohydrates. This work presents an alternative to produce LA from potato peel waste (PPW) by anaerobic fermentation in a sequencing batch reactor (SBR) inoculated with undefined mixed culture from a municipal wastewater treatment plant. A statistical design of experiments approach was employed using set of 0.8L SBRs using gelatinized PPW at a solids content range from 30 to 50 g L(-1), solids retention time of 2-4 days for yield and productivity optimization. The maximum LA production yield of 0.25 g g(-1) PPW and highest productivity of 125 mg g(-1) d(-1) were achieved. A scale-up SBR trial using neat gelatinized PPW (at 80 g L(-1) solids content) at the 3 L scale was employed and the highest LA yield of 0.14 g g(-1) PPW and a productivity of 138 mg g(-1) d(-1) were achieved with a 1 d SRT. PMID:25708409

  17. Site-directed gene mutation at mixed sequence targets by psoralen-conjugated pseudo-complementary peptide nucleic acids

    Kim, Ki-Hyun; Nielsen, Peter E.; Glazer, Peter M.

    2007-01-01

    Sequence-specific DNA-binding molecules such as triple helix-forming oligonucleotides (TFOs) provide a means for inducing site-specific mutagenesis and recombination at chromosomal sites in mammalian cells. However, the utility of TFOs is limited by the requirement for homopurine stretches in the target duplex DNA. Here, we report the use of pseudo-complementary peptide nucleic acids (pcPNAs) for intracellular gene targeting at mixed sequence sites. Due to steric hindrance, pcPNAs are unable ...

  18. Nucleotide and amino acid sequence coding for polypeptides of foot-and-mouth disease virus type A12.

    Robertson, B H; Grubman, M J; Weddell, G N; Moore, D.M.; Welsh, J D; Fischer, T.; Dowbenko, D J; Yansura, D G; Small, B.; Kleid, D G

    1985-01-01

    The coding region for the structural and nonstructural polypeptides of the type A12 foot-and-mouth disease virus genome has been identified by nucleotide sequencing of cloned DNA derived from the viral RNA. In addition, 704 nucleotides in the 5' untranslated region between the polycytidylic acid tract and the probable initiation codon of the first translated gene, P16-L, have been sequenced. This region has several potential initiation codons, one of which appears to be a low-frequency altern...

  19. Similarity Measurement of Web Sessions Based on Sequence Alignment

    LI Chaofeng; LU Yansheng

    2007-01-01

    The task of clustering Web sessions is to group Web sessions based on similarity and consists of maximizing the intra-group similarity while minimizing the inter-group similarity.The first and foremost question needed to be considered in clustering Web sessions is how to measure the similarity between Web sessions. However, there are many shortcomings in traditional measurements. This paper introduces a new method for measuring similarities between Web pages that takes into account not only the URL but also the viewing time of the visited Web page. Then we give a new method to measure the similarity of Web sessions using sequence alignment and the similarity of Web page access in detail.Experiments have proved that our method is valid and efficient.

  20. Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides

    McMillen, Chelsea L.; Wright, Patience M.; Cassady, Carolyn J.

    2016-05-01

    Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides.

  1. Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides.

    McMillen, Chelsea L; Wright, Patience M; Cassady, Carolyn J

    2016-05-01

    Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides. Graphical Abstract ᅟ. PMID:26864792

  2. Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides

    McMillen, Chelsea L.; Wright, Patience M.; Cassady, Carolyn J.

    2016-02-01

    Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides.

  3. Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

    Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution

  4. Thermochemical comparisons of homogeneous and heterogeneous acids and bases. 1. Sulfonic acid solutions and resins as prototype Broensted acids

    Arnett, E.M.; Haaksma, R.A.; Chawla, B.; Healy, M.H.

    1986-08-06

    Heats of ionization by thermometric titration for a series of bases (or acids) can be used to compare solid acids (or bases) with liquid analogues bearing the same functionalities in homogeneous solutions. The method is demonstrated for Broensted acids by reacting a series of substituted nitrogen bases with solutions of p-toluenesulfonic acid (PTSA) in acetonitrile and with suspensions of the microporous polymeric arylsulfonic acid resin-Dowex 50W-X8 in the same solvent. Under well-controlled anhydrous conditions there is a good correlation (r = 0.992) between the heats of reaction of the bases with the homogeneous and heterogeneous acid systems, but the homogeneous system gives a more exothermic interaction by 3-4 kcal mol/sup -1/ for a series of 29 substituted pyrimidines, anilines, and some other amines. This difference may be attributed to homohydrogen bonding interactions between excess acid and sulfonate anion sites which are more restricted geometrically in the resin than in solution. Other factors which affect the enthalpy change for the acid-base interaction are the acid/base ratio, the water content of the sulfonic acid, the solvent, and the resin structure (e.g., microporous vs. macroporous). Steric hindrance in the base does not differentiate solid from homogeneous acid. In addition to the use of titration calorimetry, heats of immersion are reported for the Dowex-arylsulfonic acid resins and the Nafion-perfluorinated sulfonic acid resin in a series of basic liquids. The results are compared with each other and with those from a previous study of several varieties of coal.

  5. GPCODON ALIGNMENT: A GLOBAL PAIRWISE CODON BASED SEQUENCE ALIGNMENT APPROACH

    Zeinab A. Fareed

    2016-02-01

    Full Text Available The alignment of two DNA sequences is a basic step in the analysis of biological data. Sequencing a long DNA sequence is one of the most interesting problems in bioinformatics. Several techniques have been developed to solve this sequence alignment problem like dynamic programming and heuristic algorithms. In this paper, we introduce (GPCodon alignment a pairwise DNA-DNA method for global sequence alignment that improves the accuracy of pairwise sequence alignment. We use a new scoring matrix to produce the final alignment called the empirical codon substitution matrix. Using this matrix in our technique enabled the discovery of new relationships between sequences that could not be discovered using traditional matrices. In addition, we present experimental results that show the performance of the proposed technique over eleven datasets of average length of 2967 bps. We compared the efficiency and accuracy of our techniques against a comparable tool called “Pairwise Align Codons” [1].

  6. AbCD: arbitrary coverage design for sequencing-based genetic studies

    Kang, Jian; Huang, Kuan-Chieh; Xu, Zheng; Wang, Yunfei; Abecasis, Gonçalo R.; Li, Yun

    2013-01-01

    Summary: Recent advances in sequencing technologies have revolutionized genetic studies. Although high-coverage sequencing can uncover most variants present in the sequenced sample, low-coverage sequencing is appealing for its cost effectiveness. Here, we present AbCD (arbitrary coverage design) to aid the design of sequencing-based studies. AbCD is a user-friendly interface providing pre-estimated effective sample sizes, specific to each minor allele frequency category, for designs with arbi...

  7. A DNA Structure-Based Bionic Wavelet Transform and Its Application to DNA Sequence Analysis

    Fei Chen; Yuan-Ting Zhang

    2003-01-01

    DNA sequence analysis is of great significance for increasing our understanding of genomic functions. An important task facing us is the exploration of hidden structural information stored in the DNA sequence. This paper introduces a DNA structure-based adaptive wavelet transform (WT) – the bionic wavelet transform (BWT) – for DNA sequence analysis. The symbolic DNA sequence can be separated into four channels of indicator sequences. An adaptive symbol-to-number mapping, determined from the s...

  8. ACID-BASE INTERACTIONS BETWEEN POLYMERS AND FILLERS

    WANG Qingguo; CHEN Fute; HUANG Yuanfu; ZHOU Qingli

    1987-01-01

    Inverse gas chromatography(IGC) and Fourier-transform infrared (FT-IR) techniques were applied to determining the relative acid-base strength of polymers and coupling agents. The acid-base characteristics of fillers such as CaCO3 could be altered by treatment with different coupling agents. It was shown that some mechanical properties of filled polymers were obviously associated with acid-base interactions between polymers and fillers.

  9. SIMILARITY ANALYSIS OF DNA SEQUENCES BASED ON THE CHEMICAL PROPERTIES OF NUCLEOTIDE BASES, FREQUENCY AND POSITION OF GROUP MUTATIONS

    Fatima KABLI

    2016-01-01

    Full Text Available The DNA sequences similarity analysis approaches have been based on the representation and the frequency of sequences components; however, the position inside sequence is important information for the sequence data. Whereas, insufficient information in sequences representations is important reason that causes poor similarity results. Based on three classifications of the DNA bases according to their chemical properties, the frequencies and average positions of group mutations have been grouped into two twelve-components vectors, the Euclidean distances among introduced vectors applied to compare the coding sequences of the first exon of beta globin gene of 11 species.

  10. Enhanced Acid/Base Catalysis in High Temperature Liquid Water

    Xiu Yang LU; Qi JING; Zhun LI; Lei YUAN; Fei GAO; Xin LIU

    2006-01-01

    Two novel and environmentally benign solvent systems, organic acids-enriched high temperature liquid water (HTLW) and NH3-enriched HTLW, were developed, which can enhance the reaction rate of acid/base-catalyzed organic reactions in HTLW. We investigated the decomposition of fructose in organic acids-enriched HTLW, hydrolysis of cinnamaldehyde and aldol condensation of phenylaldehyde with acetaldehyde in NH3-enriched HTLW. The experimental results demonstrated that organic acids-enriched or NH3-enriched HTLW can greatly accelerate acid/base-catalyzed organic reactions in HTLW.