WorldWideScience

Sample records for acid sequence based

  1. Chip-based sequencing nucleic acids

    Beer, Neil Reginald

    2014-08-26

    A system for fast DNA sequencing by amplification of genetic material within microreactors, denaturing, demulsifying, and then sequencing the material, while retaining it in a PCR/sequencing zone by a magnetic field. One embodiment includes sequencing nucleic acids on a microchip that includes a microchannel flow channel in the microchip. The nucleic acids are isolated and hybridized to magnetic nanoparticles or to magnetic polystyrene-coated beads. Microreactor droplets are formed in the microchannel flow channel. The microreactor droplets containing the nucleic acids and the magnetic nanoparticles are retained in a magnetic trap in the microchannel flow channel and sequenced.

  2. Nanopore Analysis of Nucleic Acids: Single-Molecule Studies of Molecular Dynamics, Structure, and Base Sequence

    Olasagasti, Felix; Deamer, David W.

    Nucleic acids are linear polynucleotides in which each base is covalently linked to a pentose sugar and a phosphate group carrying a negative charge. If a pore having roughly the crosssectional diameter of a single-stranded nucleic acid is embedded in a thin membrane and a voltage of 100 mV or more is applied, individual nucleic acids in solution can be captured by the electrical field in the pore and translocated through by single-molecule electrophoresis. The dimensions of the pore cannot accommodate anything larger than a single strand, so each base in the molecule passes through the pore in strict linear sequence. The nucleic acid strand occupies a large fraction of the pore's volume during translocation and therefore produces a transient blockade of the ionic current created by the applied voltage. If it could be demonstrated that each nucleotide in the polymer produced a characteristic modulation of the ionic current during its passage through the nanopore, the sequence of current modulations would reflect the sequence of bases in the polymer. According to this basic concept, nanopores are analogous to a Coulter counter that detects nanoscopic molecules rather than microscopic [1,2]. However, the advantage of nanopores is that individual macromolecules can be characterized because different chemical and physical properties affect their passage through the pore. Because macromolecules can be captured in the pore as well as translocated, the nanopore can be used to detect individual functional complexes that form between a nucleic acid and an enzyme. No other technique has this capability.

  3. 3-d structure-based amino acid sequence alignment of esterases, lipases and related proteins

    Gentry, M.K.; Doctor, B.P.; Cygler, M.; Schrag, J.D.; Sussman, J.L.

    1993-05-13

    Acetylcholinesterase and butyrylcholinesterase, enzymes with potential as pretreatment drugs for organophosphate toxicity, are members of a larger family of homologous proteins that includes carboxylesterases, cholesterol esterases, lipases, and several nonhydrolytic proteins. A computer-generated alignment of 18 of the proteins, the acetylcholinesases, butyrylcholinesterases, carboxylesterases, some esterases, and the nonenzymatic proteins has been previously presented. More recently, the three-dimensional structures of two enzymes enzymes in this group, acetylcholinesterase from Torpedo californica and lipase from Geotrichum candidum, have been determined. Based on the x-ray structures and the superposition of these two enzymes, it was possible to obtain an improved amino acid sequence alignment of 32 members of this family of proteins. Examination of this alignment reveals that 24 amino acids are invariant in all of the hydrolytic proteins, and an additional 49 are well conserved. Conserved amino acids include those of the active site, the disulfide bridges, the salt bridges, in the core of the proteins, and at the edges of secondary structural elements. Comparison of the three-dimensional structures makes it possible to find a well-defined structural basis for the conservation of many of these amino acids.

  4. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan

    2008-01-01

    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  5. New families in the classification of glycosyl hydrolases based on amino acid sequence similarities.

    Henrissat, B; Bairoch, A

    1993-01-01

    301 glycosyl hydrolases and related enzymes corresponding to 39 EC entries of the I.U.B. classification system have been classified into 35 families on the basis of amino-acid-sequence similarities [Henrissat (1991) Biochem. J. 280, 309-316]. Approximately half of the families were found to be monospecific (containing only one EC number), whereas the other half were found to be polyspecific (containing at least two EC numbers). A > 60% increase in sequence data for glycosyl hydrolases (181 additional enzymes or enzyme domains sequences have since become available) allowed us to update the classification not only by the addition of more members to already identified families, but also by the finding of ten new families. On the basis of a comparison of 482 sequences corresponding to 52 EC entries, 45 families, out of which 22 are polyspecific, can now be defined. This classification has been implemented in the SWISS-PROT protein sequence data bank. PMID:8352747

  6. Templated Synthesis of Peptide Nucleic Acids via Sequence-Selective Base-Filling Reactions

    Heemstra, Jennifer M.; Liu, David Ruchien

    2009-01-01

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either re...

  7. Templated synthesis of peptide nucleic acids via sequence-selective base-filling reactions.

    Heemstra, Jennifer M; Liu, David R

    2009-08-19

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either reductive amination or amine acylation chemistries, we observed efficient and selective addition of each of the four nucleobases to an abasic site in the middle of the PNA strand. We also describe the addition of single nucleobases to the end of a PNA strand through base filling, as well as the tandem addition of two bases to the middle of the PNA strand. These findings represent an experimental foundation for nonenzymatic information transfer through base filling. PMID:19722647

  8. Real-Time Nucleic Acid Sequence-Based Amplification Using Molecular Beacons for Detection of Enterovirus RNA in Clinical Specimens

    Landry, Marie L.; Garner, Robin; Ferguson, David

    2005-01-01

    Real-time nucleic acid sequence-based amplification (NASBA) using molecular beacon technology (NASBA-beacon) was compared to standard NASBA with postamplification hybridization using electrochemiluminescently labeled probes (NASBA-ECL) for detection of enteroviruses (EV) in 133 cerebrospinal fluid and 27 stool samples. NASBA-ECL and NASBA-beacon were similar in sensitivity, detecting 55 (100%) and 52 (94.5%) EV-positive samples, respectively. There were no false positives. Both NASBA assays w...

  9. iTriplet, a rule-based nucleic acid sequence motif finder

    Gunderson Samuel I

    2009-10-01

    Full Text Available Abstract Background With the advent of high throughput sequencing techniques, large amounts of sequencing data are readily available for analysis. Natural biological signals are intrinsically highly variable making their complete identification a computationally challenging problem. Many attempts in using statistical or combinatorial approaches have been made with great success in the past. However, identifying highly degenerate and long (>20 nucleotides motifs still remains an unmet challenge as high degeneracy will diminish statistical significance of biological signals and increasing motif size will cause combinatorial explosion. In this report, we present a novel rule-based method that is focused on finding degenerate and long motifs. Our proposed method, named iTriplet, avoids costly enumeration present in existing combinatorial methods and is amenable to parallel processing. Results We have conducted a comprehensive assessment on the performance and sensitivity-specificity of iTriplet in analyzing artificial and real biological sequences in various genomic regions. The results show that iTriplet is able to solve challenging cases. Furthermore we have confirmed the utility of iTriplet by showing it accurately predicts polyA-site-related motifs using a dual Luciferase reporter assay. Conclusion iTriplet is a novel rule-based combinatorial or enumerative motif finding method that is able to process highly degenerate and long motifs that have resisted analysis by other methods. In addition, iTriplet is distinguished from other methods of the same family by its parallelizability, which allows it to leverage the power of today's readily available high-performance computing systems.

  10. Construction Strategy for an Internal Amplification Control for Real-Time Diagnostic Assays Using Nucleic Acid Sequence-Based Amplification: Development and Clinical Application

    Rodríguez-Lázaro, David; D'Agostino, Martin; Pla, Maria; Cook, Nigel

    2005-01-01

    An important analytical control in molecular amplification-based methods is an internal amplification control (IAC), which should be included in each reaction mixture. An IAC is a nontarget nucleic acid sequence which is coamplified simultaneously with the target sequence. With negative results for the target nucleic acid, the absence of an IAC signal indicates that amplification has failed. A general strategy for the construction of an IAC for inclusion in molecular beacon-based real-time nu...

  11. The structural analysis of protein sequences based on the quasi-amino acids code

    Proteomics is the study of proteins and their interactions in a cell. With the successful completion of the Human Genome Project, it comes the postgenome era when the proteomics technology is emerging. This paper studies protein molecule from the algebraic point of view. The algebraic system (Σ, +, *) is introduced, where Σ is the set of 64 codons. According to the characteristics of (Σ, +, *), a novel quasi-amino acids code classification method is introduced and the corresponding algebraic operation table over the set ZU of the 16 kinds of quasi-amino acids is established. The internal relation is revealed about quasi-amino acids. The results show that there exist some very close correlations between the properties of the quasi-amino acids and the codon. All these correlation relationships may play an important part in establishing the logic relationship between codons and the quasi-amino acids during the course of life origination. According to Ma F et al (2003 J. Anhui Agricultural University 30 439), the corresponding relation and the excellent properties about amino acids code are very difficult to observe. The present paper shows that (ZU, ⊕, ) is a field. Furthermore, the operational results display that the codon tga has different property from other stop codons. In fact, in the mitochondrion from human and ox genomic codon, tga is just tryptophane, is not the stop codon like in other genetic code, it is the case of the Chen W C et al (2002 Acta Biophysica Sinica 18(1) 87). The present theory avoids some inexplicable events of the 20 kinds of amino acids code, in other words it solves the problem of 'the 64 codon assignments of mRNA to amino acids is probably completely wrong' proposed by Yang (2006 Progress in Modern Biomedicine 6 3). (cross-disciplinary physics and related areas of science and technology)

  12. The structural analysis of protein sequences based on the quasi-amino acids code

    Zhu Ping; Tang Xu-Qing; Xu Zhen-Yuan

    2009-01-01

    Proteomics is the study of proteins and their interactions in a cell. With the successful completion of the Human Genome Project, it comes the postgenome era when the proteomics technology is emerging. This paper studies protein molecule from the algebraic point of view. The algebraic system (∑, +, *) is introduced, where ∑ is the set of 64 codons. According to the characteristics of (∑,+, *), a novel quasi-amino acids code classification method is introduced and the corresponding algebraic operation table over the set ZU of the 16 kinds of quasi-amino acids is established. The internal relation is revealed about quasi-amino acids. The results show that there exist some very close correlations between the properties of the quasi-amino acids and the codon. All these correlation relationships may play an important part in establishing the logic relationship between codons and the quasi-amino acids during the course of life origination. According to Ma F et al (2003 J. Anhui Agricultural University 30 439), the corresponding relation and the excellent properties about amino acids code are very difficult to observe. The present paper shows that (ZU, +, ×) is a field. Furthermore, the operational results display that the codon tga has different property from other stop codons. In fact, in the mitochondrion from human and ox genomic codon, tga is just tryptophane, is not the stop codon like in other genetic code, it is the case of the Chen W C et al (2002 Acta Biophysica Sinica 18(1) 87). The present theory avoids some inexplicable events of the 20 kinds of amino acids code, in other words it solves the problem of 'the 64 codon assignments of mRNA to amino acids is probably completely wrong' proposed by Yang (2006 Progress in Modern Biomedicine 6 3).

  13. Detection of nucleic acid sequences by invader-directed cleavage

    Brow, Mary Ann D. (Madison, WI); Hall, Jeff Steven Grotelueschen (Madison, WI); Lyamichev, Victor (Madison, WI); Olive, David Michael (Madison, WI); Prudent, James Robert (Madison, WI)

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  14. Detection of nucleic acid sequences by invader-directed cleavage

    Brow, Mary Ann D.; Hall, Jeff Steven Grotelueschen; Lyamichev, Victor; Olive, David Michael; Prudent, James Robert

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  15. Detection of Aspergillus fumigatus in a Rat Model of Invasive Pulmonary Aspergillosis by Real-Time Nucleic Acid Sequence-Based Amplification▿

    Zhao, Yanan; Park, Steven; Warn, Peter; Shrief, Raghdaa; Harrison, Elizabeth; Perlin, David S.

    2010-01-01

    Rapid and sensitive detection of Aspergillus from clinical samples may facilitate the early diagnosis of invasive pulmonary aspergillosis (IPA). A real-time nucleic acid sequence-based amplification (NASBA) method was investigated by use of an inhalational rat model of IPA. Immunosuppressed male Sprague-Dawley rats were exposed to Aspergillus fumigatus spores for an hour in an aerosol chamber. Bronchoalveolar lavage (BAL) fluid, lung tissues, and whole blood were collected from five infected ...

  16. Comparative Amino Acid Sequences of Dengue Viruses

    Haishi, Shozo; TANAKA Mariko; Igarashi, Akira

    1990-01-01

    Amino acid (AA) sequences of 4 serotype of dengue viruses deduced from their nucleotide (nt) sequences of genomic RNA were analyzed for each genome segment and each stretch of 10 AA residues. Precursor of membrane protein (pM), and 4 nonstructural proteins (NS1, NS3, NS4B, NS5) were highly conserved, while another nonstructural protein (NS2A) was least conserved among 5 strains of dengue viruses. When homology was compared among heterotypic viruses, type 1 and type 3 dengue viruses showed clo...

  17. On Quantum Algorithm for Multiple Alignment of Amino Acid Sequences

    Iriyama, Satoshi; Ohya, Masanori

    2009-02-01

    The alignment of genome sequences or amino acid sequences is one of fundamental operations for the study of life. Usual computational complexity for the multiple alignment of N sequences with common length L by dynamic programming is O(LN). This alignment is considered as one of the NP problems, so that it is desirable to find a nice algorithm of the multiple alignment. Thus in this paper we propose the quantum algorithm for the multiple alignment based on the works12,1,2 in which the NP complete problem was shown to be the P problem by means of quantum algorithm and chaos information dynamics.

  18. 77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

    2012-10-29

    ... Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request. SUMMARY: The United States....'' SUPPLEMENTARY INFORMATION: I. Abstract Patent applications that contain nucleotide and/or amino acid...

  19. Detection and identification of human Plasmodium species with real-time quantitative nucleic acid sequence-based amplification

    P.F. Mens; G.J. Schoone; P.A. Kager; H.D.F.H. Schallig

    2006-01-01

    Background: Decisions concerning malaria treatment depend on species identification causing disease. Microscopy is most frequently used, but at low parasitaemia (< 20 parasites/mu l) the technique becomes less sensitive and time consuming. Rapid diagnostic tests based on Plasmodium antigen detection

  20. Detection of Aspergillus fumigatus in a rat model of invasive pulmonary aspergillosis by real-time nucleic acid sequence-based amplification.

    Zhao, Yanan; Park, Steven; Warn, Peter; Shrief, Raghdaa; Harrison, Elizabeth; Perlin, David S

    2010-04-01

    Rapid and sensitive detection of Aspergillus from clinical samples may facilitate the early diagnosis of invasive pulmonary aspergillosis (IPA). A real-time nucleic acid sequence-based amplification (NASBA) method was investigated by use of an inhalational rat model of IPA. Immunosuppressed male Sprague-Dawley rats were exposed to Aspergillus fumigatus spores for an hour in an aerosol chamber. Bronchoalveolar lavage (BAL) fluid, lung tissues, and whole blood were collected from five infected rats at 1, 24, 48, 72, and 96 h postinfection and five uninfected rats at the end of the experiment. Total nucleic acid (TNA) was extracted on an easyMAG instrument. A primer-molecular beacon set targeting 28S rRNA was designed to detect Aspergillus spp. The results were compared to those of quantitative PCR (qPCR) (18S rDNA) and quantitative culture. The analytical sensitivity of the real-time NASBA assay was tissue burdens, while the CFU counts were stable over time. The fungal burdens in BAL fluid were more variable and not indicative of a progressive infection. The results of both real-time assays correlated well for both sample types (r = 0.869 and P tissue, r = 0.887 and P < 0.0001 for BAL fluid). For all whole-blood specimens, NASBA identified Aspergillus-positive samples in the group from which samples were collected at 72 h postinfection (three of five samples) and the group from which samples were collected at 96 h postinfection (five of five samples), but no positive results were obtained by culture or PCR. Real-time NASBA is highly sensitive and useful for the detection of Aspergillus in an experimental model of IPA. PMID:20129972

  1. SSE: a nucleotide and amino acid sequence analysis platform

    Simmonds Peter

    2012-01-01

    Abstract Background There is an increasing need to develop bioinformatic tools to organise and analyse the rapidly growing amount of nucleotide and amino acid sequence data in organisms ranging from viruses to eukaryotes. Finding A simple sequence editor (SSE) was developed to create an integrated environment where sequences can be aligned, annotated, classified and directly analysed by a number of built-in bioinformatic programs. SSE incorporates a sequence editor for the creation of sequenc...

  2. Unifying bacteria from decaying wood with various ubiquitous Gibbsiella species as G. acetica sp. nov. based on nucleotide sequence similarities and their acetic acid secretion.

    Geider, Klaus; Gernold, Marina; Jock, Susanne; Wensing, Annette; Völksch, Beate; Gross, Jürgen; Spiteller, Dieter

    2015-12-01

    Bacteria were isolated from necrotic apple and pear tree tissue and from dead wood in Germany and Austria as well as from pear tree exudate in China. They were selected for growth at 37 °C, screened for levan production and then characterized as Gram-negative, facultatively anaerobic rods. Nucleotide sequences from 16S rRNA genes, the housekeeping genes dnaJ, gyrB, recA and rpoB alignments, BLAST searches and phenotypic data confirmed by MALDI-TOF analysis showed that these bacteria belong to the genus Gibbsiella and resembled strains isolated from diseased oaks in Britain and Spain. Gibbsiella-specific PCR primers were designed from the proline isomerase and the levansucrase genes. Acid secretion was investigated by screening for halo formation on calcium carbonate agar and the compound identified by NMR as acetic acid. Its production by Gibbsiella spp. strains was also determined in culture supernatants by GC/MS analysis after derivatization with pentafluorobenzyl bromide. Some strains were differentiated by the PFGE patterns of SpeI digests and by sequence analyses of the lsc and the ppiD genes, and the Chinese Gibbsiella strain was most divergent. The newly investigated bacteria as well as Gibbsiella querinecans, Gibbsiella dentisursi and Gibbsiella papilionis, isolated in Britain, Spain, Korea and Japan, are taxonomically related Enterobacteriaceae, tolerate and secrete acetic acid. We therefore propose to unify them in the species Gibbsiella acetica sp. nov. PMID:26071988

  3. Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.

  4. Los Alamos sequence analysis package for nucleic acids and proteins.

    Kanehisa, M I

    1982-01-01

    An interactive system for computer analysis of nucleic acid and protein sequences has been developed for the Los Alamos DNA Sequence Database. It provides a convenient way to search or verify various sequence features, e.g., restriction enzyme sites, protein coding frames, and properties of coded proteins. Further, the comprehensive analysis package on a large-scale database can be used for comparative studies on sequence and structural homologies in order to find unnoted information stored i...

  5. A conversational system for the computer analysis of nucleic acid sequences.

    Sege, R; Söll, D.; Ruddle, F H; Queen, C

    1981-01-01

    We present a conversational system for the computer analysis of nucleic acid and protein sequences based on the well-known Queen and Korn program (1). The system can be used by persons with only minimal knowledge of computers.

  6. Nucleotide Sequence of a Chicken Vitellogenin Gene and Derived Amino Acid Sequence of the Encoded Yolk Precursor Protein

    Schip, Fred D. van het; Samallo, John; Broos, Jaap; Ophuis, Jan; Mojet, Mart; Gruber, Max; AB, Geert

    1987-01-01

    The gene encoding the major vitellogenin from chicken has been completely sequenced and its exon-intron organization has been established. The gene is 20,342 base-pairs long and contains 35 exons with a combined length of 5787 base-pairs. They encode the 1850-amino acid pre-peptide of vitellogenin,

  7. Identifying discriminative classification-based motifs in biological sequences

    Vens, Celine; Rosso, Marie-Noëlle; Danchin, Etienne

    2011-01-01

    Motivation: Identification of conserved motifs in biological sequences is crucial to unveil common shared functions. Many tools exist for motif identification, including some that allow degenerate positions with multiple possible nucleotides or amino acids. Most efficient methods available today search conserved motifs in a set of sequences, but do not check for their specificity regarding to a set of negative sequences. Results: We present a tool to identify degenerate motifs, based on a giv...

  8. MEANS AND METHODS FOR CLONING NUCLEIC ACID SEQUENCES

    Geertsma, Eric Robin; Poolman, Berend

    2008-01-01

    The invention provides means and methods for efficiently cloning nucleic acid sequences of interest in micro-organisms that are less amenable to conventional nucleic acid manipulations, as compared to, for instance, E.coli. The present invention enables high-throughput cloning (and, preferably, expr

  9. Comparative genomics beyond sequence-based alignments

    Þórarinsson, Elfar; Yao, Zizhen; Wiklund, Eric D.;

    2008-01-01

    Recent computational scans for non-coding RNAs (ncRNAs) in multiple organisms have relied on existing multiple sequence alignments. However, as sequence similarity drops, a key signal of RNA structure--frequent compensating base changes--is increasingly likely to cause sequence-based alignment me...

  10. EST sequences and their annotation (amino acid sequence and results of homology search) - Dicty_cDB | LSDB Archive [Life Science Database Archive metadata

    Full Text Available lone covering full-length ORF provided by the National BioResource Project ( http://www.nbrp.jp/ ). The...ein Coding Gene in dictyBase ( http://dictybase.org/ ). The link to dictyBase is provided in the...Dicty_cDB EST sequences and their annotation (amino acid sequence and results of homology search) Data detai...l Data name EST sequences and their annotation (amino acid sequence and results of homology search) Descript...ion of data contents Sequences of cDNA clones of Dictyostelium discoideum and the

  11. An Integrated Sequence-Structure Database incorporating matching mRNA sequence, amino acid sequence and protein three-dimensional structure data.

    Adzhubei, I A; Adzhubei, A. A.; Neidle, S.

    1998-01-01

    We have constructed a non-homologous database, termed the Integrated Sequence-Structure Database (ISSD) which comprises the coding sequences of genes, amino acid sequences of the corresponding proteins, their secondary structure and straight phi,psi angles assignments, and polypeptide backbone coordinates. Each protein entry in the database holds the alignment of nucleotide sequence, amino acid sequence and the PDB three-dimensional structure data. The nucleotide and amino acid sequences for ...

  12. Accuracy of sequence alignment and fold assessment using reduced amino acid alphabets.

    Melo, Francisco; Marti-Renom, Marc A

    2006-06-01

    Reduced or simplified amino acid alphabets group the 20 naturally occurring amino acids into a smaller number of representative protein residues. To date, several reduced amino acid alphabets have been proposed, which have been derived and optimized by a variety of methods. The resulting reduced amino acid alphabets have been applied to pattern recognition, generation of consensus sequences from multiple alignments, protein folding, and protein structure prediction. In this work, amino acid substitution matrices and statistical potentials were derived based on several reduced amino acid alphabets and their performance assessed in a large benchmark for the tasks of sequence alignment and fold assessment of protein structure models, using as a reference frame the standard alphabet of 20 amino acids. The results showed that a large reduction in the total number of residue types does not necessarily translate into a significant loss of discriminative power for sequence alignment and fold assessment. Therefore, some definitions of a few residue types are able to encode most of the relevant sequence/structure information that is present in the 20 standard amino acids. Based on these results, we suggest that the use of reduced amino acid alphabets may allow to increasing the accuracy of current substitution matrices and statistical potentials for the prediction of protein structure of remote homologs. PMID:16506243

  13. Amino acid sequences of proteins from Leptospira serovar pomona

    Alves Selmo F

    2000-01-01

    Full Text Available This report describes a partial amino acid sequences from three putative outer envelope proteins from Leptospira serovar pomona. In order to obtain internal fragments for protein sequencing, enzymatic and chemical digestion was performed. The enzyme clostripain was used to digest the proteins 32 and 45 kDa. In situ digestion of 40 kDa molecular weight protein was accomplished using cyanogen bromide. The 32 kDa protein generated two fragments, one of 21 kDa and another of 10 kDa that yielded five residues. A fragment of 24 kDa that yielded nineteen residues of amino acids was obtained from 45 kDa protein. A fragment with a molecular weight of 20 kDa, yielding a twenty amino acids sequence from the 40 kDa protein.

  14. Acids and bases solvent effects on acid-base strenght

    Cox, Brian G

    2013-01-01

    Acids and bases are ubiquitous in chemistry. Our understanding of them, however, is dominated by their behaviour in water. Transfer to non-aqueous solvents leads to profound changes in acid-base strengths and to the rates and equilibria of many processes: for example, synthetic reactions involving acids, bases and nucleophiles; isolation of pharmaceutical actives through salt formation; formation of zwitter- ions in amino acids; and chromatographic separation of substrates. This book seeks to enhance our understanding of acids and bases by reviewing and analysing their behaviour in non-aqueous solvents. The behaviour is related where possible to that in water, but correlations and contrasts between solvents are also presented.

  15. Representation of protein-sequence information by amino acid subalphabets

    Andersen, C.A.F.; Brunak, Søren

    2004-01-01

    -sequence information, using machine learning strategies, where the primary goal is the discovery of novel powerful representations for use in AI techniques. In the case of proteins and the 20 different amino acids they typically contain, it is also a secondary goal to discover how the current selection of amino acids......-which now are common in proteins-might have emerged from simpler selections, or alphabets, in use earlier during the evolution of living organisms....

  16. The amino-acid sequence of kangaroo pancreatic ribonuclease.

    Gaastra, W; Welling, G W; Beintema, J J

    1978-05-01

    Red kangaroo (Macropus rufus) ribonuclease was isolated from pancreatic tissue by affinity chromatography. The amino acid sequence was determined by automatic sequencing of overlapping large fragments and by analysis of shorter peptides obtained by digestion with a number of proteolytic enzymes. The polypeptide chain consists of 122 amino acid residues. Compared to other ribonucleases, the N-terminal residue and residue 114 are deleted. In other pancreatic ribonucleases position 114 is occupied by a cis proline residue in an external loop at the surface of the molecule. Other remarkable substitutions are the presence of a tyrosine residue at position 123 instead of a serine which forms a hydrogen bond with the pyrimidine ring of a nucleotide substrate, and a number of hydrophobichydrophilic interchanges in the sequence 51-55, which forms part of an alpha-helix in bovine ribonuclease and exhibits few substitutions in the placental mammals. Kangaroo ribonuclease contains no carbohydrate, although the enzyme possesses a recognition site for carbohydrate attachment in the sequence Asn-Val-Thr (62-64). The enzyme differs at about 35-40% of the positions from all other mammalian pancreatic ribonucleases sequenced to date, which is in agreement with the early divergence between the marsupials and the placental mammals. From fragmentary data a tentative sequence of red-necked wallaby (Macropus rufogriseus) pancreatic ribonuclease has been derived. Eight differences with the kangaroo sequence were found. PMID:658039

  17. Electrophoresis-Enhanced Detection of Deoxyribonucleic Acids on a Membrane-Based Lateral Flow Strip Using Avian Influenza H5 Genetic Sequence as the Model

    Jui-Chuang Wu

    2014-03-01

    Full Text Available This study reports a simple strategy to detect a deoxyribonucleic acid (DNA on a membrane-based lateral flow (MBLF strip without tedious gel preparation, gel electrophoresis, and EtBr-staining processes. The method also enhances the detection signal of the genetic sample. A direct electric field was applied over two ends of the MBLF strips to induce an electrophoresis of DNAs through the strips. The signal enhancement was demonstrated by the detection of the H5 subtype of avian influenza virus (H5 AIV. This approach showed an excellent selectivity of H5 AIV from other two control species, Arabidopsis thaliana and human PSMA5. It also showed an effective signal repeatability and sensitivity over a series of analyte concentrations. Its detection limit could be enhanced, from 40 ng to 0.1 ng by applying 12 V. The nano-gold particles for the color development were labeled on the capture antibody, and UV-VIS and TEM were used to check if the labeling was successful. This detection strategy could be further developed to apply on the detection of drug-allergic genes at clinics or detection of infectious substances at incident sites by a simple manipulation with an aid of a mini-PCR machine and auxiliary kits.

  18. Seq2Logo: a method for construction and visualization of amino acid binding motifs and sequence profiles including sequence weighting, pseudo counts and two-sided representation of amino acid enrichment and depletion

    Thomsen, Martin Christen Frølund; Nielsen, Morten

    2012-01-01

    Seq2Logo is a web-based sequence logo generator. Sequence logos are a graphical representation of the information content stored in a multiple sequence alignment (MSA) and provide a compact and highly intuitive representation of the position-specific amino acid composition of binding motifs, active...... sites, etc. in biological sequences. Accurate generation of sequence logos is often compromised by sequence redundancy and low number of observations. Moreover, most methods available for sequence logo generation focus on displaying the position-specific enrichment of amino acids, discarding the equally...... valuable information related to amino acid depletion. Seq2logo aims at resolving these issues allowing the user to include sequence weighting to correct for data redundancy, pseudo counts to correct for low number of observations and different logotype representations each capturing different aspects...

  19. Deoxyribonucleic acid sequence mapping on metaphase chromosomes by immunoelectron microscopy

    Nucleic acid sequences can be localized on chromosomes in the electron microscope after hybridization with a biotinylated DNA probe followed by detection with a primary antibiotin antibody and a secondary antibody coupled to colloidal gold. Hybridization probes can also be labelled with alternative ligands such as N-acetoxy-2-acetylaminofluorene (AAF), Dinitrophenyl-dUTP and Digoxigenin-dUTP. Multiple labelling is possible if these differently modified DNA probes are used in conjunction with colloidal gold preparations of varying particle sizes. A substantial signal amplification can be achieved by incubating preparations with successive cycles of primary antibiotin antibody followed by a biotinylated secondary antibody. Detection is with Streptavidin-gold, and in the case of highly and moderately repeated sequences, the signal is visible in the light microscope. Detailed protocols are given for EM in-situ hybridization to whole mount metaphase chromosomes and include instructions necessary to perform multiple sequence localization and signal amplification

  20. Real-Time Detection of Noroviruses in Surface Water by Use of a Broadly Reactive Nucleic Acid Sequence-Based Amplification Assay

    Rutjes, Saskia A.; van den Berg, Harold H. J. L.; Lodder, Willemijn J.; Roda Husman, Ana Maria de

    2006-01-01

    Noroviruses are the most common agents causing outbreaks of viral gastroenteritis. Outbreaks originating from contaminated drinking water and from recreational waters have been described. Due to a lack of cell culture systems, noroviruses are detected mostly by molecular methods. Molecular detection assays for viruses in water are often repressed by inhibitory factors present in the environment, like humic acids and heavy metals. To study the effect of environmental inhibitors on the performa...

  1. Real-time detection of noroviruses in surface water by use of a broadly reactive nucleic acid sequence-based amplification assay.

    Rutjes, Saskia A.; Berg, Harold H J L van den; Lodder, Willemijn J.; Roda Husman, Ana Maria de

    2006-01-01

    Noroviruses are the most common agents causing outbreaks of viral gastroenteritis. Outbreaks originating from contaminated drinking water and from recreational waters have been described. Due to a lack of cell culture systems, noroviruses are detected mostly by molecular methods. Molecular detection assays for viruses in water are often repressed by inhibitory factors present in the environment, like humic acids and heavy metals. To study the effect of environmental inhibitors on the performa...

  2. Nucleotide sequence and corresponding amino acid sequence of the gene for the major antigen of foot and mouth disease virus.

    Kurz, C; Forss, S; Küpper, H; K Strohmaier; Schaller, H

    1981-01-01

    A segment of 1160 nucleotides of the FMDV genome has been sequenced using three overlapping fragments of cloned cDNA from FMDV strain O1K. This sequence contains the coding sequence for the viral capsid protein VP1 as shown by its homology to known and newly determined amino acid sequences from this man antigenic polypeptide of the FMDV virion. The structural gene for VP1 comprises 639 nucleotides which specify a sequence of 213 amino acids for the VP1 protein. The coding sequence is not flan...

  3. Correlation between fibroin amino acid sequence and physical silk properties.

    Fedic, Robert; Zurovec, Michal; Sehnal, Frantisek

    2003-09-12

    The fiber properties of lepidopteran silk depend on the amino acid repeats that interact during H-fibroin polymerization. The aim of our research was to relate repeat composition to insect biology and fiber strength. Representative regions of the H-fibroin genes were sequenced and analyzed in three pyralid species: wax moth (Galleria mellonella), European flour moth (Ephestia kuehniella), and Indian meal moth (Plodia interpunctella). The amino acid repeats are species-specific, evidently a diversification of an ancestral region of 43 residues, and include three types of regularly dispersed motifs: modifications of GSSAASAA sequence, stretches of tripeptides GXZ where X and Z represent bulky residues, and sequences similar to PVIVIEE. No concatenations of GX dipeptide or alanine, which are typical for Bombyx silkworms and Antheraea silk moths, respectively, were found. Despite different repeat structure, the silks of G. mellonella and E. kuehniella exhibit similar tensile strength as the Bombyx and Antheraea silks. We suggest that in these latter two species, variations in the repeat length obstruct repeat alignment, but sufficiently long stretches of iterated residues get superposed to interact. In the pyralid H-fibroins, interactions of the widely separated and diverse motifs depend on the precision of repeat matching; silk is strong in G. mellonella and E. kuehniella, with 2-3 types of long homogeneous repeats, and nearly 10 times weaker in P. interpunctella, with seven types of shorter erratic repeats. The high proportion of large amino acids in the H-fibroin of pyralids has probably evolved in connection with the spinning habit of caterpillars that live in protective silk tubes and spin continuously, enlarging the tubes on one end and partly devouring the other one. The silk serves as a depot of energetically rich and essential amino acids that may be scarce in the diet. PMID:12816957

  4. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    Nolan, John P.; White, P. Scott

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  5. Multiple Sequence Alignment Based on Chaotic PSO

    Lei, Xiu-Juan; Sun, Jing-Jing; Ma, Qian-Zhi

    This paper introduces a new improved algorithm called chaotic PSO (CPSO) based on the thought of chaos optimization to solve multiple sequence alignment. For one thing, the chaotic variables are generated between 0 and 1 when initializing the population so that the particles are distributed uniformly in the solution space. For another thing, the chaotic sequences are generated using the Logistic mapping function in order to make chaotic search and strengthen the diversity of the population. The simulation results of several benchmark data sets of BAliBase show that the improved algorithm is effective and has good performances for the data sets with different similarity.

  6. Human apolipoprotein C-II: complete nucleic acid sequence of preapolipoprotein C-II.

    Fojo, S S; Law, S W; Brewer, H B

    1984-01-01

    Apolipoprotein (apo) C-II is a cofactor for lipoprotein lipase, the enzyme that catalyzes the hydrolysis of triglycerides on plasma triglyceride-rich lipoproteins. The complete coding sequence of apoC-II mRNA has been determined from an apoC-II clone isolated from a human liver cDNA library. A 17-base-long synthetic oligonucleotide based on amino acid residues 5-10 of apoC-II was utilized as a hybridization probe to select recombinant plasmids containing the apoC-II sequence. Two thousand fou...

  7. SNAD: sequence name annotation-based designer

    Gorbalenya Alexander E

    2009-08-01

    Full Text Available Abstract Background A growing diversity of biological data is tagged with unique identifiers (UIDs associated with polynucleotides and proteins to ensure efficient computer-mediated data storage, maintenance, and processing. These identifiers, which are not informative for most people, are often substituted by biologically meaningful names in various presentations to facilitate utilization and dissemination of sequence-based knowledge. This substitution is commonly done manually that may be a tedious exercise prone to mistakes and omissions. Results Here we introduce SNAD (Sequence Name Annotation-based Designer that mediates automatic conversion of sequence UIDs (associated with multiple alignment or phylogenetic tree, or supplied as plain text list into biologically meaningful names and acronyms. This conversion is directed by precompiled or user-defined templates that exploit wealth of annotation available in cognate entries of external databases. Using examples, we demonstrate how this tool can be used to generate names for practical purposes, particularly in virology. Conclusion A tool for controllable annotation-based conversion of sequence UIDs into biologically meaningful names and acronyms has been developed and placed into service, fostering links between quality of sequence annotation, and efficiency of communication and knowledge dissemination among researchers.

  8. Amino acid sequences used for clusterintg (Multi FASTA format) - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Full Text Available Gclust Server Amino acid sequences used for clusterintg (Multi FASTA format) Data detail Data name Amino acid sequences use... Site Policy | Contact Us Amino acid sequences used for clusterintg (Multi FASTA format) - Gclust Server | LSDB Archive ...

  9. Human liver type pyruvate kinase: Complete amino acid sequence and the expression in mammalian cells

    Pyruvate kinase (PK) has four isozymes (L, R, M1, M2) that are encoded by two different genes. Among these isozymes, abnormalities of liver (L)-type PK is considered to be associated with hereditary nonspherocytic hemolytic anemia in humans. The authors isolated and determined the full-length sequence of human L-type PK cDNA. The cDNA contains 1,629 base pairs encoding 543 amino acids, 68 base pairs of 5'-noncoding sequence, and 734 base pairs of 3'-noncoding sequence. The similarity between human and rat L-type PK was 86.9% at the nucleotide sequence level and 92.4% at the amino acid sequence level. The full-length L-type PK cDNA was placed under the promoter of simian virus 40 and introduced into monkey COS cells. Human L-type PK activity was detected in the extract of COS cells by the classical PK electrophoresis method

  10. Molten fatty acid based microemulsions.

    Noirjean, Cecile; Testard, Fabienne; Dejugnat, Christophe; Jestin, Jacques; Carriere, David

    2016-06-21

    We show that ternary mixtures of water (polar phase), myristic acid (MA, apolar phase) and cetyltrimethylammonium bromide (CTAB, cationic surfactant) studied above the melting point of myristic acid allow the preparation of microemulsions without adding a salt or a co-surfactant. The combination of SANS, SAXS/WAXS, DSC, and phase diagram determination allows a complete characterization of the structures and interactions between components in the molten fatty acid based microemulsions. For the different structures characterized (microemulsion, lamellar or hexagonal phases), a similar thermal behaviour is observed for all ternary MA/CTAB/water monophasic samples and for binary MA/CTAB mixtures without water: crystalline myristic acid melts at 52 °C, and a thermal transition at 70 °C is assigned to the breaking of hydrogen bounds inside the mixed myristic acid/CTAB complex (being the surfactant film in the ternary system). Water determines the film curvature, hence the structures observed at high temperature, but does not influence the thermal behaviour of the ternary system. Myristic acid is partitioned in two "species" that behave independently: pure myristic acid and myristic acid associated with CTAB to form an equimolar complex that plays the role of the surfactant film. We therefore show that myristic acid plays the role of a solvent (oil) and a co-surfactant allowing the fine tuning of the structure of oil and water mixtures. This solvosurfactant behaviour of long chain fatty acid opens the way for new formulations with a complex structure without the addition of any extra compound. PMID:27241163

  11. Nucleotide and amino acid sequences of human intestinal alkaline phosphatase: close homology to placental alkaline phosphatase

    A cDNA clone for human adult intestinal alkaline phosphatase (ALP) [orthophosphoric-monoester phosphohydrolase (alkaline optimum); EC 3.1.3.1] was isolated from a λgt11 expression library. The cDNA insert of this clone is 2513 base pairs in length and contains an open reading frame that encodes a 528-amino acid polypeptide. This deduced polypeptide contains the first 40 amino acids of human intestinal ALP, as determined by direct protein sequencing. Intestinal ALP shows 86.5% amino acid identity to placental (type 1) ALP and 56.6% amino acid identity to liver/bone/kidney ALP. In the 3'-untranslated regions, intestinal and placental ALP cDNAs are 73.5% identical (excluding gaps). The evolution of this multigene enzyme family is discussed

  12. ANTICALIgN: visualizing, editing and analyzing combined nucleotide and amino acid sequence alignments for combinatorial protein engineering.

    Jarasch, Alexander; Kopp, Melanie; Eggenstein, Evelyn; Richter, Antonia; Gebauer, Michaela; Skerra, Arne

    2016-07-01

    ANTIC ALIGN: is an interactive software developed to simultaneously visualize, analyze and modify alignments of DNA and/or protein sequences that arise during combinatorial protein engineering, design and selection. ANTIC ALIGN: combines powerful functions known from currently available sequence analysis tools with unique features for protein engineering, in particular the possibility to display and manipulate nucleotide sequences and their translated amino acid sequences at the same time. ANTIC ALIGN: offers both template-based multiple sequence alignment (MSA), using the unmutated protein as reference, and conventional global alignment, to compare sequences that share an evolutionary relationship. The application of similarity-based clustering algorithms facilitates the identification of duplicates or of conserved sequence features among a set of selected clones. Imported nucleotide sequences from DNA sequence analysis are automatically translated into the corresponding amino acid sequences and displayed, offering numerous options for selecting reading frames, highlighting of sequence features and graphical layout of the MSA. The MSA complexity can be reduced by hiding the conserved nucleotide and/or amino acid residues, thus putting emphasis on the relevant mutated positions. ANTIC ALIGN: is also able to handle suppressed stop codons or even to incorporate non-natural amino acids into a coding sequence. We demonstrate crucial functions of ANTIC ALIGN: in an example of Anticalins selected from a lipocalin random library against the fibronectin extradomain B (ED-B), an established marker of tumor vasculature. Apart from engineered protein scaffolds, ANTIC ALIGN: provides a powerful tool in the area of antibody engineering and for directed enzyme evolution. PMID:27261456

  13. Characterization of the microbial acid mine drainage microbial community using culturing and direct sequencing techniques.

    Auld, Ryan R; Myre, Maxine; Mykytczuk, Nadia C S; Leduc, Leo G; Merritt, Thomas J S

    2013-05-01

    We characterized the bacterial community from an AMD tailings pond using both classical culturing and modern direct sequencing techniques and compared the two methods. Acid mine drainage (AMD) is produced by the environmental and microbial oxidation of minerals dissolved from mining waste. Surprisingly, we know little about the microbial communities associated with AMD, despite the fundamental ecological roles of these organisms and large-scale economic impact of these waste sites. AMD microbial communities have classically been characterized by laboratory culturing-based techniques and more recently by direct sequencing of marker gene sequences, primarily the 16S rRNA gene. In our comparison of the techniques, we find that their results are complementary, overall indicating very similar community structure with similar dominant species, but with each method identifying some species that were missed by the other. We were able to culture the majority of species that our direct sequencing results indicated were present, primarily species within the Acidithiobacillus and Acidiphilium genera, although estimates of relative species abundance were only obtained from direct sequencing. Interestingly, our culture-based methods recovered four species that had been overlooked from our sequencing results because of the rarity of the marker gene sequences, likely members of the rare biosphere. Further, direct sequencing indicated that a single genus, completely missed in our culture-based study, Legionella, was a dominant member of the microbial community. Our results suggest that while either method does a reasonable job of identifying the dominant members of the AMD microbial community, together the methods combine to give a more complete picture of the true diversity of this environment. PMID:23485423

  14. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

    2010-07-01

    ... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data...

  15. Next-Generation Sequencing Techniques for Eukaryotic Microorganisms: Sequencing-Based Solutions to Biological Problems▿

    Nowrousian, Minou

    2010-01-01

    Over the past 5 years, large-scale sequencing has been revolutionized by the development of several so-called next-generation sequencing (NGS) technologies. These have drastically increased the number of bases obtained per sequencing run while at the same time decreasing the costs per base. Compared to Sanger sequencing, NGS technologies yield shorter read lengths; however, despite this drawback, they have greatly facilitated genome sequencing, first for prokaryotic genomes and within the las...

  16. Contig sequences and their annotation (amino acid sequence and results of homology search), and expression profile - Dicty_cDB | LSDB Archive [Life Science Database Archive metadata

    Full Text Available Dicty_cDB Contig sequences and their annotation (amino acid sequence and results of homology search), and ex...pression profile Data detail Data name Contig sequences and their annotation (amino acid sequence and result... sequences of cDNA sequences of Dictyostelium discoideum and their annotation (amino acid sequence and resul...ence and full-length cDNA sequence by the assembly program Phrap ( http://www.phrap.org/index.html ). Link to the... list of clones constituting the contig, the information on its mapping to the genome mapped to genome sequence and the

  17. A repetitive sequence assembler based on next-generation sequencing.

    Lian, S; Tu, Y; Wang, Y; Chen, X; Wang, L

    2016-01-01

    Repetitive sequences of variable length are common in almost all eukaryotic genomes, and most of them are presumed to have important biomedical functions and can cause genomic instability. Next-generation sequencing (NGS) technologies provide the possibility of identifying capturing these repetitive sequences directly from the NGS data. In this study, we assessed the performances in identifying capturing repeats of leading assemblers, such as Velvet, SOAPdenovo, SGA, MSR-CA, Bambus2, ALLPATHS-LG, and AByss using three real NGS datasets. Our results indicated that most of them performed poorly in capturing the repeats. Consequently, we proposed a repetitive sequence assembler, named NGSReper, for capturing repeats from NGS data. Simulated datasets were used to validate the feasibility of NGSReper. The results indicate that the completeness of capturing repeat is up to 99%. Cross validation was performed in three real NGS datasets, and extensive comparisons indicate that NGSReper performed best in terms of completeness and accuracy in capturing repeats. In conclusion, NGSReper is an appropriate and suitable tool for capturing repeats directly from NGS data. PMID:27525861

  18. Human retroviruses and AIDS 1996. A compilation and analysis of nucleic acid and amino acid sequences

    Myers, G.; Foley, B.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States). Theoretical Div.; Mellors, J.W. [ed.] [Univ. of Pittsburgh, PA (United States); Jeang, K.T. [ed.] [National Institutes of Health, Bethesda, MD (United States). Molecular Virology Section; Wain-Hobson, S. [Pasteur Inst., Paris (France)] [ed.

    1997-04-01

    This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (1) Nuclear Acid Alignments and Sequences; (2) Amino Acid Alignments; (3) Analysis; (4) Related Sequences; and (5) Database Communications. Information within all the parts is updated throughout the year on the Web site, http://hiv-web.lanl.gov. While this publication could take the form of a review or sequence monograph, it is not so conceived. Instead, the literature from which the database is derived has simply been summarized and some elementary computational analyses have been performed upon the data. Interpretation and commentary have been avoided insofar as possible so that the reader can form his or her own judgments concerning the complex information. In addition to the general descriptions of the parts of the compendium, the user should read the individual introductions for each part.

  19. Natural vs. random protein sequences: Discovering combinatorics properties on amino acid words.

    Santoni, Daniele; Felici, Giovanni; Vergni, Davide

    2016-02-21

    Casual mutations and natural selection have driven the evolution of protein amino acid sequences that we observe at present in nature. The question about which is the dominant force of proteins evolution is still lacking of an unambiguous answer. Casual mutations tend to randomize protein sequences while, in order to have the correct functionality, one expects that selection mechanisms impose rigid constraints on amino acid sequences. Moreover, one also has to consider that the space of all possible amino acid sequences is so astonishingly large that it could be reasonable to have a well tuned amino acid sequence indistinguishable from a random one. In order to study the possibility to discriminate between random and natural amino acid sequences, we introduce different measures of association between pairs of amino acids in a sequence, and apply them to a dataset of 1047 natural protein sequences and 10,470 random sequences, carefully generated in order to preserve the relative length and amino acid distribution of the natural proteins. We analyze the multidimensional measures with machine learning techniques and show that, to a reasonable extent, natural protein sequences can be differentiated from random ones. PMID:26656109

  20. Entamoeba histolytica: observations on metabolism based on thegenome sequence

    Anderson, Iain J.; Loftus, Brendan J.

    2005-07-01

    The sequencing of the genome of Entamoeba histolytica has allowed a reconstruction of its metabolic pathways, many of which are unusual for a eukaryote. Based on the genome sequence, it appears that amino acids may play a larger role than previously thought in energy metabolism, with roles in both ATP synthesis and NAD regeneration. Arginine decarboxylase may be involved in survival of E. histolytica during its passage through the stomach. The usual pyrimidine synthesis pathway is absent, but a partial pyrimidine degradation pathway could be part of a novel pyrimidine synthesis pathway. Ribonucleotide reductase was not found in the E. histolytica genome, but it was found in the close relatives Entamoeba invadens and Entamoeba moshkovskii, suggesting a recent loss from E. histolytica. The usual eukaryotic glucose transporters are not present, but members of a prokaryotic monosaccharide transporter family are present.

  1. Transcriptome Sequencing in Response to Salicylic Acid in Salvia miltiorrhiza.

    Zhang, Xiaoru; Dong, Juane; Liu, Hailong; Wang, Jiao; Qi, Yuexin; Liang, Zongsuo

    2016-01-01

    Salvia miltiorrhiza is a traditional Chinese herbal medicine, whose quality and yield are often affected by diseases and environmental stresses during its growing season. Salicylic acid (SA) plays a significant role in plants responding to biotic and abiotic stresses, but the involved regulatory factors and their signaling mechanisms are largely unknown. In order to identify the genes involved in SA signaling, the RNA sequencing (RNA-seq) strategy was employed to evaluate the transcriptional profiles in S. miltiorrhiza cell cultures. A total of 50,778 unigenes were assembled, in which 5,316 unigenes were differentially expressed among 0-, 2-, and 8-h SA induction. The up-regulated genes were mainly involved in stimulus response and multi-organism process. A core set of candidate novel genes coding SA signaling component proteins was identified. Many transcription factors (e.g., WRKY, bHLH and GRAS) and genes involved in hormone signal transduction were differentially expressed in response to SA induction. Detailed analysis revealed that genes associated with defense signaling, such as antioxidant system genes, cytochrome P450s and ATP-binding cassette transporters, were significantly overexpressed, which can be used as genetic tools to investigate disease resistance. Our transcriptome analysis will help understand SA signaling and its mechanism of defense systems in S. miltiorrhiza. PMID:26808150

  2. Predicting DNA-binding sites of proteins from amino acid sequence

    Wu Feihong

    2006-05-01

    Full Text Available Abstract Background Understanding the molecular details of protein-DNA interactions is critical for deciphering the mechanisms of gene regulation. We present a machine learning approach for the identification of amino acid residues involved in protein-DNA interactions. Results We start with a Naïve Bayes classifier trained to predict whether a given amino acid residue is a DNA-binding residue based on its identity and the identities of its sequence neighbors. The input to the classifier consists of the identities of the target residue and 4 sequence neighbors on each side of the target residue. The classifier is trained and evaluated (using leave-one-out cross-validation on a non-redundant set of 171 proteins. Our results indicate the feasibility of identifying interface residues based on local sequence information. The classifier achieves 71% overall accuracy with a correlation coefficient of 0.24, 35% specificity and 53% sensitivity in identifying interface residues as evaluated by leave-one-out cross-validation. We show that the performance of the classifier is improved by using sequence entropy of the target residue (the entropy of the corresponding column in multiple alignment obtained by aligning the target sequence with its sequence homologs as additional input. The classifier achieves 78% overall accuracy with a correlation coefficient of 0.28, 44% specificity and 41% sensitivity in identifying interface residues. Examination of the predictions in the context of 3-dimensional structures of proteins demonstrates the effectiveness of this method in identifying DNA-binding sites from sequence information. In 33% (56 out of 171 of the proteins, the classifier identifies the interaction sites by correctly recognizing at least half of the interface residues. In 87% (149 out of 171 of the proteins, the classifier correctly identifies at least 20% of the interface residues. This suggests the possibility of using such classifiers to identify

  3. Prediction of protein motions from amino acid sequence and its application to protein-protein interaction

    Wako Hiroshi

    2010-07-01

    Full Text Available Abstract Background Structural flexibility is an important characteristic of proteins because it is often associated with their function. The movement of a polypeptide segment in a protein can be broken down into two types of motions: internal and external ones. The former is deformation of the segment itself, but the latter involves only rotational and translational motions as a rigid body. Normal Model Analysis (NMA can derive these two motions, but its application remains limited because it necessitates the gathering of complete structural information. Results In this work, we present a novel method for predicting two kinds of protein motions in ordered structures. The prediction uses only information from the amino acid sequence. We prepared a dataset of the internal and external motions of segments in many proteins by application of NMA. Subsequently, we analyzed the relation between thermal motion assessed from X-ray crystallographic B-factor and internal/external motions calculated by NMA. Results show that attributes of amino acids related to the internal motion have different features from those related to the B-factors, although those related to the external motion are correlated strongly with the B-factors. Next, we developed a method to predict internal and external motions from amino acid sequences based on the Random Forest algorithm. The proposed method uses information associated with adjacent amino acid residues and secondary structures predicted from the amino acid sequence. The proposed method exhibited moderate correlation between predicted internal and external motions with those calculated by NMA. It has the highest prediction accuracy compared to a naïve model and three published predictors. Conclusions Finally, we applied the proposed method predicting the internal motion to a set of 20 proteins that undergo large conformational change upon protein-protein interaction. Results show significant overlaps between the

  4. Prediction of flexible/rigid regions from protein sequences using k-spaced amino acid pairs

    Ruan Jishou

    2007-04-01

    Full Text Available Abstract Background Traditionally, it is believed that the native structure of a protein corresponds to a global minimum of its free energy. However, with the growing number of known tertiary (3D protein structures, researchers have discovered that some proteins can alter their structures in response to a change in their surroundings or with the help of other proteins or ligands. Such structural shifts play a crucial role with respect to the protein function. To this end, we propose a machine learning method for the prediction of the flexible/rigid regions of proteins (referred to as FlexRP; the method is based on a novel sequence representation and feature selection. Knowledge of the flexible/rigid regions may provide insights into the protein folding process and the 3D structure prediction. Results The flexible/rigid regions were defined based on a dataset, which includes protein sequences that have multiple experimental structures, and which was previously used to study the structural conservation of proteins. Sequences drawn from this dataset were represented based on feature sets that were proposed in prior research, such as PSI-BLAST profiles, composition vector and binary sequence encoding, and a newly proposed representation based on frequencies of k-spaced amino acid pairs. These representations were processed by feature selection to reduce the dimensionality. Several machine learning methods for the prediction of flexible/rigid regions and two recently proposed methods for the prediction of conformational changes and unstructured regions were compared with the proposed method. The FlexRP method, which applies Logistic Regression and collocation-based representation with 95 features, obtained 79.5% accuracy. The two runner-up methods, which apply the same sequence representation and Support Vector Machines (SVM and Naïve Bayes classifiers, obtained 79.2% and 78.4% accuracy, respectively. The remaining considered methods are

  5. Nanopore-Based Target Sequence Detection.

    Morin, Trevor J; Shropshire, Tyler; Liu, Xu; Briggs, Kyle; Huynh, Cindy; Tabard-Cossa, Vincent; Wang, Hongyun; Dunbar, William B

    2016-01-01

    The promise of portable diagnostic devices relies on three basic requirements: comparable sensitivity to established platforms, inexpensive manufacturing and cost of operations, and the ability to survive rugged field conditions. Solid state nanopores can meet all these requirements, but to achieve high manufacturing yields at low costs, assays must be tolerant to fabrication imperfections and to nanopore enlargement during operation. This paper presents a model for molecular engineering techniques that meets these goals with the aim of detecting target sequences within DNA. In contrast to methods that require precise geometries, we demonstrate detection using a range of pore geometries. As a result, our assay model tolerates any pore-forming method and in-situ pore enlargement. Using peptide nucleic acid (PNA) probes modified for conjugation with synthetic bulk-adding molecules, pores ranging 15-50 nm in diameter are shown to detect individual PNA-bound DNA. Detection of the CFTRΔF508 gene mutation, a codon deletion responsible for ∼66% of all cystic fibrosis chromosomes, is demonstrated with a 26-36 nm pore size range by using a size-enhanced PNA probe. A mathematical framework for assessing the statistical significance of detection is also presented. PMID:27149679

  6. Nanopore-Based Target Sequence Detection

    Morin, Trevor J.; Shropshire, Tyler; Liu, Xu; Briggs, Kyle; Huynh, Cindy; Tabard-Cossa, Vincent; Wang, Hongyun; Dunbar, William B.

    2016-01-01

    The promise of portable diagnostic devices relies on three basic requirements: comparable sensitivity to established platforms, inexpensive manufacturing and cost of operations, and the ability to survive rugged field conditions. Solid state nanopores can meet all these requirements, but to achieve high manufacturing yields at low costs, assays must be tolerant to fabrication imperfections and to nanopore enlargement during operation. This paper presents a model for molecular engineering techniques that meets these goals with the aim of detecting target sequences within DNA. In contrast to methods that require precise geometries, we demonstrate detection using a range of pore geometries. As a result, our assay model tolerates any pore-forming method and in-situ pore enlargement. Using peptide nucleic acid (PNA) probes modified for conjugation with synthetic bulk-adding molecules, pores ranging 15-50 nm in diameter are shown to detect individual PNA-bound DNA. Detection of the CFTRΔF508 gene mutation, a codon deletion responsible for ∼66% of all cystic fibrosis chromosomes, is demonstrated with a 26-36 nm pore size range by using a size-enhanced PNA probe. A mathematical framework for assessing the statistical significance of detection is also presented. PMID:27149679

  7. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-01-01

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S ...

  8. Amino acid selective unlabeling for sequence specific resonance assignments in proteins

    Krishnarjuna, B.; Jaipuria, Garima; Thakur, Anushikha [Indian Institute of Science, NMR Research Centre (India); D' Silva, Patrick, E-mail: patrick@biochem.iisc.ernet.in [Indian Institute of Science, Department of Biochemistry (India); Atreya, Hanudatta S., E-mail: hsatreya@sif.iisc.ernet.in [Indian Institute of Science, NMR Research Centre (India)

    2011-01-15

    Sequence specific resonance assignment constitutes an important step towards high-resolution structure determination of proteins by NMR and is aided by selective identification and assignment of amino acid types. The traditional approach to selective labeling yields only the chemical shifts of the particular amino acid being selected and does not help in establishing a link between adjacent residues along the polypeptide chain, which is important for sequential assignments. An alternative approach is the method of amino acid selective 'unlabeling' or reverse labeling, which involves selective unlabeling of specific amino acid types against a uniformly {sup 13}C/{sup 15}N labeled background. Based on this method, we present a novel approach for sequential assignments in proteins. The method involves a new NMR experiment named, {l_brace}{sup 12}CO{sub i}-{sup 15}N{sub i+1}{r_brace}-filtered HSQC, which aids in linking the {sup 1}H{sup N}/{sup 15}N resonances of the selectively unlabeled residue, i, and its C-terminal neighbor, i + 1, in HN-detected double and triple resonance spectra. This leads to the assignment of a tri-peptide segment from the knowledge of the amino acid types of residues: i - 1, i and i + 1, thereby speeding up the sequential assignment process. The method has the advantage of being relatively inexpensive, applicable to {sup 2}H labeled protein and can be coupled with cell-free synthesis and/or automated assignment approaches. A detailed survey involving unlabeling of different amino acid types individually or in pairs reveals that the proposed approach is also robust to misincorporation of {sup 14}N at undesired sites. Taken together, this study represents the first application of selective unlabeling for sequence specific resonance assignments and opens up new avenues to using this methodology in protein structural studies.

  9. GENAS: a database system for nucleic acid sequence analysis.

    Kuhara, S; Matsuo, F; Futamura, S; A. Fujita; Shinohara, T.; Takagi, T.; Sakaki, Y

    1984-01-01

    A database system, named GENAS (GENe Analyzing System), for computer analysis of sequence was constructed using Adbis which is a relational database management system (1). GENAS enables us to retrieve any sequence data from EMBL nucleotide sequence data library (2) and readily to analyze them (if necessary, together with private data) by various application programs in a interactive manner. Analysis of structure of replication origin of replicons was demonstrated using this system.

  10. Students' Understanding of Acids/Bases in Organic Chemistry Contexts

    Cartrette, David P.; Mayo, Provi M.

    2011-01-01

    Understanding key foundational principles is vital to learning chemistry across different contexts. One such foundational principle is the acid/base behavior of molecules. In the general chemistry sequence, the Bronsted-Lowry theory is stressed, because it lends itself well to studying equilibrium and kinetics. However, the Lewis theory of…

  11. Will my protein crystallize? A sequence-based predictor.

    Smialowski, Pawel; Schmidt, Thorsten; Cox, Jürgen; Kirschner, Andreas; Frishman, Dmitrij

    2006-02-01

    We propose a machine-learning approach to sequence-based prediction of protein crystallizability in which we exploit subtle differences between proteins whose structures were solved by X-ray analysis [or by both X-ray and nuclear magnetic resonance (NMR) spectroscopy] and those proteins whose structures were solved by NMR spectroscopy alone. Because the NMR technique is usually applied on relatively small proteins, sequence length distributions of the X-ray and NMR datasets were adjusted to avoid predictions biased by protein size. As feature space for classification, we used frequencies of mono-, di-, and tripeptides represented by the original 20-letter amino acid alphabet as well as by several reduced alphabets in which amino acids were grouped by their physicochemical and structural properties. The classification algorithm was constructed as a two-layered structure in which the output of primary support vector machine classifiers operating on peptide frequencies was combined by a second-level Naive Bayes classifier. Due to the application of metamethods for cost sensitivity, our method is able to handle real datasets with unbalanced class representation. An overall prediction accuracy of 67% [65% on the positive (crystallizable) and 69% on the negative (noncrystallizable) class] was achieved in a 10-fold cross-validation experiment, indicating that the proposed algorithm may be a valuable tool for more efficient target selection in structural genomics. A Web server for protein crystallizability prediction called SECRET is available at http://webclu.bio.wzw.tum.de:8080/secret. PMID:16315316

  12. Genome Sequence of a Candidate World Health Organization Reference Strain of Zika Virus for Nucleic Acid Testing.

    Trösemeier, Jan-Hendrik; Musso, Didier; Blümel, Johannes; Thézé, Julien; Pybus, Oliver G; Baylis, Sally A

    2016-01-01

    We report here the sequence of a candidate reference strain of Zika virus (ZIKV) developed on behalf of the World Health Organization (WHO). The ZIKV reference strain is intended for use in nucleic acid amplification (NAT)-based assays for the detection and quantification of ZIKV RNA. PMID:27587826

  13. Numerical Characterization of DNA Sequence Based on Dinucleotides

    Xingqin Qi; Edgar Fuller; Qin Wu; Cun-Quan Zhang

    2012-01-01

    Sequence comparison is a primary technique for the analysis of DNA sequences. In order to make quantitative comparisons, one devises mathematical descriptors that capture the essence of the base composition and distribution of the sequence. Alignment methods and graphical techniques (where each sequence is represented by a curve in high-dimension Euclidean space) have been used popularly for a long time. In this contribution we will introduce a new nongraphical and nonalignment approach based...

  14. Homology between the invertible deoxyribonucleic acid sequence that controls flagellar-phase variation in Salmonella sp. and deoxyribonucleic acid sequences in other organisms.

    Szekely, E; Simon, M.

    1981-01-01

    The invertible deoxyribonucleic acid (DNA) segment cloned from Salmonella sp. was radioactively labeled and used as a probe to search for homologous sequences by Southern hybridization. Only one copy of the invertible segment could be found on the Salmonella sp. genome. Partial sequence homology with the invertible region was detected in bacteriophage Mu and P1 DNA by low-stringency hybridization. Under these conditions, no homology was detected with Escherichia coli DNA. A strain of Salmonel...

  15. Characterization of mouse cellular deoxyribonucleic acid homologous to Abelson murine leukemia virus-specific sequences.

    Dale, B.; Ozanne, B.

    1981-01-01

    The genome of Abelson murine leukemia virus (A-MuLV) consists of sequences derived from both BALB/c mouse deoxyribonucleic acid and the genome of Moloney murine leukemia virus. Using deoxyribonucleic acid linear intermediates as a source of retroviral deoxyribonucleic acid, we isolated a recombinant plasmid which contained 1.9 kilobases of the 3.5-kilobase mouse-derived sequences found in A-MuLV (A-MuLV-specific sequences). We used this clone, designated pSA-17, as a probe restriction enzyme ...

  16. Nucleic and amino acid sequences relating to a novel transketolase, and methods for the expression thereof

    Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Lange, Bernd Markus (Pullman, WA); McCaskill, David G. (Pullman, WA)

    2001-01-01

    cDNAs encoding 1-deoxyxylulose-5-phosphate synthase from peppermint (Mentha piperita) have been isolated and sequenced, and the corresponding amino acid sequences have been determined. Accordingly, isolated DNA sequences (SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7) are provided which code for the expression of 1-deoxyxylulose-5-phosphate synthase from plants. In another aspect the present invention provides for isolated, recombinant DXPS proteins, such as the proteins having the sequences set forth in SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8. In other aspects, replicable recombinant cloning vehicles are provided which code for plant 1-deoxyxylulose-5-phosphate synthases, or for a base sequence sufficiently complementary to at least a portion of 1-deoxyxylulose-5-phosphate synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding a plant 1-deoxyxylulose-5-phosphate synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant 1-deoxyxylulose-5-phosphate synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant 1-deoxyxylulose-5-phosphate synthase may be used to obtain expression or enhanced expression of 1-deoxyxylulose-5-phosphate synthase in plants in order to enhance the production of 1-deoxyxylulose-5-phosphate, or its derivatives such as isopentenyl diphosphate (BP), or may be otherwise employed for the regulation or expression of 1-deoxyxylulose-5-phosphate synthase, or the production of its products.

  17. Representation of Protein-Sequence Information by Amino Acid Subalphabets

    Andersen, Claus A. F.; Brunak, Soren

    2004-01-01

    Within computational biology, algorithms are constructed with the aim of extracting knowledge from biological data, in particular, data generated by the large genome projects, where gene and protein sequences are produced in high volume. In this article, we explore new ways of representing protein-sequence information, using machine learning strategies, where the primary goal is the discovery of novel powerful representations for use in AI techniques. In the case of proteins and the 20 differ...

  18. Simulation-Based Evaluation of Learning Sequences for Instructional Technologies

    McEneaney, John E.

    2016-01-01

    Instructional technologies critically depend on systematic design, and learning hierarchies are a commonly advocated tool for designing instructional sequences. But hierarchies routinely allow numerous sequences and choosing an optimal sequence remains an unsolved problem. This study explores a simulation-based approach to modeling learning…

  19. Amino Acid Sequence - KOME | LSDB Archive [Life Science Database Archive metadata

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ...CE Amino acid sequence Joomla SEF URLs by Artio About This Database Database Description Download License Update History

  20. Boronic acid-based autoligation of nucleic acids

    Barbeyron, R.; Vasseur, J.-J.; Smietana, M.;

    2013-01-01

    Abstract: The development of synthetic systems displaying dynamic and adaptive characteristics is a formidable challenge with wide applications from biotechnology to therapeutics. Recently, we described a dynamic and programmable nucleic acid-based system relying on the formation of reversible...

  1. cDNA-derived amino acid sequences of myoglobins from nine species of whales and dolphins.

    Iwanami, Kentaro; Mita, Hajime; Yamamoto, Yasuhiko; Fujise, Yoshihiro; Yamada, Tadasu; Suzuki, Tomohiko

    2006-10-01

    We determined the myoglobin (Mb) cDNA sequences of nine cetaceans, of which six are the first reports of Mb sequences: sei whale (Balaenoptera borealis), Bryde's whale (Balaenoptera edeni), pygmy sperm whale (Kogia breviceps), Stejneger's beaked whale (Mesoplodon stejnegeri), Longman's beaked whale (Indopacetus pacificus), and melon-headed whale (Peponocephala electra), and three confirm the previously determined chemical amino acid sequences: sperm whale (Physeter macrocephalus), common minke whale (Balaenoptera acutorostrata) and pantropical spotted dolphin (Stenella attenuata). We found two types of Mb in the skeletal muscle of pantropical spotted dolphin: Mb I with the same amino acid sequence as that deposited in the protein database, and Mb II, which differs at two amino acid residues compared with Mb I. Using an alignment of the amino acid or cDNA sequences of cetacean Mb, we constructed a phylogenetic tree by the NJ method. Clustering of cetacean Mb amino acid and cDNA sequences essentially follows the classical taxonomy of cetaceans, suggesting that Mb sequence data is valid for classification of cetaceans at least to the family level. PMID:16962803

  2. Homology of amino acid sequences of rat liver cathepsins B and H with that of papain.

    Takio, K; Towatari, T; Katunuma, N.; Teller, D C; Titani, K

    1983-01-01

    The amino acid sequences of rat liver lysosomal thiol endopeptidases, cathepsins B and H, are presented and compared with that of the plant thiol protease papain. The 252-residue sequence of cathepsin B and the 220-residue sequence of cathepsin H were determined largely by automated Edman degradation of their intact polypeptide chains and of the two chains of each enzyme generated by limited proteolysis. Subfragments of the chains were produced by enzymatic digestion and by chemical cleavage ...

  3. Semantics-based Refinement of Mandatory Behavior of Sequence Diagrams

    Lu, Lunjin

    2010-01-01

    Sequence diagrams are a widely used design notation for describing software behaviors. Many reusable software artifacts such as design patterns and design aspects make use of sequence diagrams to describe interaction behaviors. When a pattern or an aspect is reused in an application, it is important to ensure that the sequence diagrams for the application correctly refines the corresponding sequence diagrams for the pattern or aspect. Reasoning about refinement of sequence diagrams has not been addressed adequately in literature. In this paper, we focus on refinement of mandatory behavior specified by a UML sequence diagram. A novel trace semantics is given that captures precisely mandatory behavior specified by a sequence diagram and a refinement relation between sequence diagrams is formalized based on the semantics. Properties of the trace semantics and the refinement relation are studied.

  4. Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA

    Cowell, G M; Kønigshøfer, E; Danielsen, E M;

    1988-01-01

    The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC 3.4.11.2) was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...

  5. Representation of protein-sequence information by amino acid subalphabets

    Andersen, C.A.F.; Brunak, Søren

    2004-01-01

    Within computational biology, algorithms are constructed with the aim of extracting knowledge from biological data, in particular, data generated by the large genome projects, where gene and protein sequences are produced in high volume. In this article, we explore new ways of representing protei......-which now are common in proteins-might have emerged from simpler selections, or alphabets, in use earlier during the evolution of living organisms....

  6. Identification of protein superfamily from structure- based sequence motif

    2002-01-01

    The structure-based sequence motif of the distant proteins in evolution, protein tyrosine phosphatases (PTP) Ⅰ and Ⅱ superfamilies, as an example, has been defined by the structural comparison, structure-based sequence alignment and analyses on substitution patterns of residues in common sequence conserved regions. And the phosphatases Ⅰ and Ⅱ can be correctly identified together by the structure-based PTP sequence motif from SWISS-PROT and TrEBML databases. The results show that the correct rates of identification are over 98%. This is the first time to identify PTP Ⅰ and Ⅱ together by this motif.

  7. Two distinct ferredoxins from Rhodobacter capsulatus: complete amino acid sequences and molecular evolution.

    Saeki, K; Suetsugu, Y; Yao, Y; Horio, T; Marrs, B L; Matsubara, H

    1990-09-01

    Two distinct ferredoxins were purified from Rhodobacter capsulatus SB1003. Their complete amino acid sequences were determined by a combination of protease digestion, BrCN cleavage and Edman degradation. Ferredoxins I and II were composed of 64 and 111 amino acids, respectively, with molecular weights of 6,728 and 12,549 excluding iron and sulfur atoms. Both contained two Cys clusters in their amino acid sequences. The first cluster of ferredoxin I and the second cluster of ferredoxin II had a sequence, CxxCxxCxxxCP, in common with the ferredoxins found in Clostridia. The second cluster of ferredoxin I had a sequence, CxxCxxxxxxxxCxxxCM, with extra amino acids between the second and third Cys, which has been reported for other photosynthetic bacterial ferredoxins and putative ferredoxins (nif-gene products) from nitrogen-fixing bacteria, and with a unique occurrence of Met. The first cluster of ferredoxin II had a CxxCxxxxCxxxCP sequence, with two additional amino acids between the second and third Cys, a characteristics feature of Azotobacter-[3Fe-4S] [4Fe-4S]-ferredoxin. Ferredoxin II was also similar to Azotobacter-type ferredoxins with an extended carboxyl (C-) terminal sequence compared to the common Clostridium-type. The evolutionary relationship of the two together with a putative one recently found to be encoded in nifENXQ region in this bacterium [Moreno-Vivian et al. (1989) J. Bacteriol. 171, 2591-2598] is discussed. PMID:2277040

  8. Complete nucleotide sequence of cDNA and deduced amino acid sequence of rat liver catalase.

    Furuta, S.; Hayashi, H; Hijikata, M; Miyazawa, S.; Osumi, T; Hashimoto, T.

    1986-01-01

    We have isolated five cDNA clones for rat liver catalase (hydrogen peroxide:hydrogen peroxide oxidoreductase, EC 1.11.1.6). These clones overlapped with each other and covered the entire length of the mRNA, which had been estimated to be 2.4 kilobases long by blot hybridization analysis of electrophoretically fractionated RNA. Nucleotide sequencing was carried out on these five clones and the composite nucleotide sequence of catalase cDNA was determined. The 5' noncoding region contained 83 b...

  9. Comparison of sequence-based and structure-based phylogenetic trees of homologous proteins: Inferences on protein evolution

    S Balaji; N Srinivasan

    2007-01-01

    Several studies based on the known three-dimensional (3-D) structures of proteins show that two homologous proteins with insignificant sequence similarity could adopt a common fold and may perform same or similar biochemical functions. Hence, it is appropriate to use similarities in 3-D structure of proteins rather than the amino acid sequence similarities in modelling evolution of distantly related proteins. Here we present an assessment of using 3-D structures in modelling evolution of homologous proteins. Using a dataset of 108 protein domain families of known structures with at least 10 members per family we present a comparison of extent of structural and sequence dissimilarities among pairs of proteins which are inputs into the construction of phylogenetic trees. We find that correlation between the structure-based dissimilarity measures and the sequence-based dissimilarity measures is usually good if the sequence similarity among the homologues is about 30% or more. For protein families with low sequence similarity among the members, the correlation coefficient between the sequence-based and the structure-based dissimilarities are poor. In these cases the structure-based dendrogram clusters proteins with most similar biochemical functional properties better than the sequence-similarity based dendrogram. In multi-domain protein families and disulphide-rich protein families the correlation coefficient for the match of sequence-based and structure-based dissimilarity (SDM) measures can be poor though the sequence identity could be higher than 30%. Hence it is suggested that protein evolution is best modelled using 3-D structures if the sequence similarities (SSM) of the homologues are very low.

  10. Protein chemotaxonomy. XIII. Amino acid sequence of ferredoxin from Panax ginseng.

    Mino, Yoshiki

    2006-08-01

    The complete amino acid sequence of [2Fe-2S] ferredoxin from Panax ginseng (Araliaceae) has been determined by automated Edman degradation of the entire S-carboxymethylcysteinyl protein and of the peptides obtained by enzymatic digestion. This ferredoxin has a unique amino acid sequence, which includes an insertion of Tyr at the 3rd position from the amino-terminus and a deletion of two amino acid residues at the carboxyl terminus. This ferredoxin had 18 differences in its amino acid sequence compared to that of Petroselinum sativum (Umbelliferae). In contrast, 23-33 differences were observed compared to other dicotyledonous plants. This suggests that Panax ginseng is related taxonomically to umbelliferous plants. PMID:16880642

  11. DNA Sequence Representation and Comparison Based on Quaternion Number System

    Hsuan-T. Chang

    2012-12-01

    Full Text Available Conventional schemes for DNA sequence representation, storage, and processing areusually developed based on the character-based formats.We propose the quaternion number system for numerical representation and further processing on DNA sequences.In the proposed method, the quaternion cross-correlation operation can be used to obtain both the global and local matching/mismatching information between two DNA sequences from the depicted one-dimensional curve and two-dimensional pattern, respectively.Simulation results on various DNA sequences and the comparison result with the wellknown BLAST method are obtained to verify the effectiveness of the proposed method.

  12. RNA-RNA interaction prediction based on multiple sequence alignments

    Li, Andrew X; Qin, Jing; Reidys, Christian M

    2010-01-01

    Recently, $O(N^6)$ time and $O(N^4)$ space dynamic programming algorithms have become available that compute the partition function of RNA-RNA interaction complexes for pairs of RNA sequences. These algorithms and the biological requirement of more reliable interactions motivate to utilize the additional information contained in multiple sequence alignments and to generalize the above framework to the partition function and base pairing probabilities for multiple sequence alignments.

  13. Echo Cancellation Research of Channel Estimation based on PN Sequence

    Yongqin Zhou

    2010-11-01

    Full Text Available For the problem of estimation sequence effect on channel estimation accuracy and echo cancellation effect, this paper, based on the basic principle of echo cancellation, analyses the effect of PN sequence mechanism and the correlation on the channel estimation parameters. Comparing with using the input signal itself as the estimation sequence. With the input signal OFDM, the results of simulation and actual operation show that the method can increase both the accuracy of channel estimation and echo cancellation effect effectively.

  14. Property-based sequence representations do not adequately encode local protein folding information.

    Solis, A D; Rackovsky, S

    2007-06-01

    We examine the informatic characteristics of amino acid representations based on physical properties. We demonstrate that sequences rewritten using contracted alphabets based on physical properties do not encode local folding information well. The best four-character alphabet can only encode approximately 57% of the maximum possible amount of structural information. This result suggests that property-based representations that operate on a local length scale are not likely to be useful in homology searches and fold-recognition exercises. PMID:17387739

  15. Nucleotide sequence of the beta-cyclodextrin glucanotransferase gene of alkalophilic Bacillus sp. strain 1011 and similarity of its amino acid sequence to those of alpha-amylases.

    Kimura, K.; Kataoka, S; Ishii, Y; Takano, T.; Yamane, K

    1987-01-01

    The nucleotide sequence of the gene for cyclodextrin glucanotransferase of alkalophilic Bacillus sp. strain 1011 was determined. The deduced amino acid sequence at the NH2-terminal side of the enzyme showed a high homology with the sequences of alpha-amylase in the three regions which constitutes the active centers of alpha-amylases.

  16. Feature-based Image Sequence Compression Coding

    2001-01-01

    A novel compressing method for video teleconference applications is presented. Semantic-based coding based on human image feature is realized, where human features are adopted as parameters. Model-based coding and the concept of vector coding are combined with the work on image feature extraction to obtain the result.

  17. Complete amino acid sequence of human plasma Zn-α2-glycoprotein and its homology to histocompatibility antigens

    In the present study the complete amino acid sequence of human plasma Zn-α2-glycoprotein was determined. This protein whose biological function is unknown consists of a single polypeptide chain of 276 amino acid residues including 8 tryptophan residues and has a pyroglutamyl residue at the amino terminus. The location of the two disulfide bonds in the polypeptide chain was also established. The three glycans, whose structure was elucidated with the aid of 500 MHz 1H NMR spectroscopy, were sialylated N-biantennas. The molecular weight calculated from the polypeptide and carbohydrate structure is 38,478, which is close to the reported value of ≅ 41,000 based on physicochemical measurements. The predicted secondary structure appeared to comprised of 23% α-helix, 27% β-sheet, and 22% β-turns. The three N-glycans were found to be located in β-turn regions. An unexpected finding was made by computer analysis of the sequence data; this revealed that Zn-α2-glycoprotein is closely related to antigens of the major histocompatibility complex in amino acid sequence and in domain structure. There was an unusually high degree of sequence homology with the α chains of class I histocompatibility antigens. Moreover, this plasma protein was shown to be a member of the immunoglobulin gene superfamily. Zn-α2-glycoprotein appears to be truncated secretory major histocompatibility complex-related molecule, and it may have a role in the expression of the immune response

  18. Introduction of restriction enzyme sites in protein-coding DNA sequences by site-specific mutagenesis not affecting the amino acid sequence: a computer program.

    Arentzen, R; Ripka, W. C.

    1984-01-01

    Structure/function relationship studies of proteins are greatly facilitated by recombinant DNA technology which allows specific amino acid mutations to be made at the DNA sequence level by site-specific mutagenesis employing synthetic oligonucleotides. This technique has been successfully used to alter one or two amino acids in a protein. Replacement of existing DNA sequence coding for several amino acids with new synthetic DNA fragments would be facilitated by the presence of unique restrict...

  19. An Ant-Based Model for Multiple Sequence Alignment

    Guinand, Frédéric

    2008-01-01

    Multiple sequence alignment is a key process in today's biology, and finding a relevant alignment of several sequences is much more challenging than just optimizing some improbable evaluation functions. Our approach for addressing multiple sequence alignment focuses on the building of structures in a new graph model: the factor graph model. This model relies on block-based formulation of the original problem, formulation that seems to be one of the most suitable ways for capturing evolutionary aspects of alignment. The structures are implicitly built by a colony of ants laying down pheromones in the factor graphs, according to relations between blocks belonging to the different sequences.

  20. Base-acid hybrid water electrolysis.

    Chen, Long; Dong, Xiaoli; Wang, Fei; Wang, Yonggang; Xia, Yongyao

    2016-02-21

    A base-acid hybrid electrolytic system with a low onset voltage of 0.78 V for water electrolysis was developed by using a ceramic Li-ion exchange membrane to separate the oxygen-evolving reaction (OER) in a basic electrolyte solution containing the Li-ion and hydrogen-evolving reaction (HER) in an acidic electrolyte solution. PMID:26804323

  1. Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

    Budzanivska I. G.

    2014-03-01

    Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

  2. Movement Pattern Analysis Based on Sequence Signatures

    Seyed Hossein Chavoshi

    2015-09-01

    Full Text Available Increased affordability and deployment of advanced tracking technologies have led researchers from various domains to analyze the resulting spatio-temporal movement data sets for the purpose of knowledge discovery. Two different approaches can be considered in the analysis of moving objects: quantitative analysis and qualitative analysis. This research focuses on the latter and uses the qualitative trajectory calculus (QTC, a type of calculus that represents qualitative data on moving point objects (MPOs, and establishes a framework to analyze the relative movement of multiple MPOs. A visualization technique called sequence signature (SESI is used, which enables to map QTC patterns in a 2D indexed rasterized space in order to evaluate the similarity of relative movement patterns of multiple MPOs. The applicability of the proposed methodology is illustrated by means of two practical examples of interacting MPOs: cars on a highway and body parts of a samba dancer. The results show that the proposed method can be effectively used to analyze interactions of multiple MPOs in different domains.

  3. Accurate prediction of hot spot residues through physicochemical characteristics of amino acid sequences

    Chen, Peng

    2013-07-23

    Hot spot residues of proteins are fundamental interface residues that help proteins perform their functions. Detecting hot spots by experimental methods is costly and time-consuming. Sequential and structural information has been widely used in the computational prediction of hot spots. However, structural information is not always available. In this article, we investigated the problem of identifying hot spots using only physicochemical characteristics extracted from amino acid sequences. We first extracted 132 relatively independent physicochemical features from a set of the 544 properties in AAindex1, an amino acid index database. Each feature was utilized to train a classification model with a novel encoding schema for hot spot prediction by the IBk algorithm, an extension of the K-nearest neighbor algorithm. The combinations of the individual classifiers were explored and the classifiers that appeared frequently in the top performing combinations were selected. The hot spot predictor was built based on an ensemble of these classifiers and to work in a voting manner. Experimental results demonstrated that our method effectively exploited the feature space and allowed flexible weights of features for different queries. On the commonly used hot spot benchmark sets, our method significantly outperformed other machine learning algorithms and state-of-the-art hot spot predictors. The program is available at http://sfb.kaust.edu.sa/pages/software.aspx. © 2013 Wiley Periodicals, Inc.

  4. Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.

    Meng-Jun Li; Ai-Qin Li; Han Xia; Chuan-Zhi Zhao; Chang-Sheng Li; Shu-Bo Wan; Yu-Ping Bi; Xing-Jun Wang

    2009-06-01

    The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, -ketoacyl-ACP synthase (I, II, III), -ketoacyl-ACP reductase, -hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

  5. 37 CFR 1.824 - Form and format for nucleotide and/or amino acid sequence submissions in computer readable form.

    2010-07-01

    ... nucleotide and/or amino acid sequence submissions in computer readable form. 1.824 Section 1.824 Patents... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... readable form may be created by any means, such as word processors, nucleotide/amino acid sequence...

  6. Draft genome sequence of the docosahexaenoic acid producing thraustochytrid Aurantiochytrium sp. T66.

    Liu, Bin; Ertesvåg, Helga; Aasen, Inga Marie; Vadstein, Olav; Brautaset, Trygve; Heggeset, Tonje Marita Bjerkan

    2016-06-01

    Thraustochytrids are unicellular, marine protists, and there is a growing industrial interest in these organisms, particularly because some species, including strains belonging to the genus Aurantiochytrium, accumulate high levels of docosahexaenoic acid (DHA). Here, we report the draft genome sequence of Aurantiochytrium sp. T66 (ATCC PRA-276), with a size of 43 Mbp, and 11,683 predicted protein-coding sequences. The data has been deposited at DDBJ/EMBL/Genbank under the accession LNGJ00000000. The genome sequence will contribute new insight into DHA biosynthesis and regulation, providing a basis for metabolic engineering of thraustochytrids. PMID:27222814

  7. Sequence Context Specific Mutagenesis and Base Excision Repair

    Donigan, Katherine; Sweasy, Joann B.

    2009-01-01

    Base excision repair is critical for the maintenance of genome stability because it repairs at least 20,000 endogenously generated DNA lesions per cell per day. Several enzymes within the base excision repair pathway exhibit sequence context dependency during the excision and DNA synthesis steps of repair. New evidence is emerging that germ line and tumor-associated variants of enzymes in this repair pathway exhibit sequence context dependence that is different from their ancestral counterpar...

  8. A Diagnostic HIV-1 Tropism System Based on Sequence Relatedness

    Edwards, Suzanne; Stucki, Heinz; Bader, Joëlle; Vidal, Vincent; Kaiser, Rolf; Battegay, Manuel; Klimkait, Thomas

    2014-01-01

    Key clinical studies for HIV coreceptor antagonists have used the phenotyping-based Trofile test. Meanwhile various simpler-to-do genotypic tests have become available that are compatible with standard laboratory equipment and Web-based interpretation tools. However, these systems typically analyze only the most prominent virus sequence in a specimen. We present a new diagnostic HIV tropism test not needing DNA sequencing. The system, XTrack, uses physical properties of DNA duplexes after hyb...

  9. Immune and Genetic Algorithm Based Assembly Sequence Planning

    YANG Jian-guo; LI Bei-zhi; YU Lei; JIN Yu-song

    2004-01-01

    In this paper an assembly sequence planning model inspired by natural immune and genetic algorithm (ASPIG) based on the part degrees of freedom matrix (PDFM) is proposed, and a proto system - DSFAS based on the ASPIG is introduced to solve assembly sequence problem. The concept and generation of PDFM and DSFAS are also discussed. DSFAS can prevent premature convergence, and promote population diversity, and can accelerate the learning and convergence speed in behavior evolution problem.

  10. Base-sequence-dependent sliding of proteins on DNA

    Barbi, M; Place, C.; Popkov, V.; Salerno, M.

    2004-01-01

    The possibility that the sliding motion of proteins on DNA is influenced by the base sequence through a base pair reading interaction, is considered. Referring to the case of the T7 RNA-polymerase, we show that the protein should follow a noise-influenced sequence-dependent motion which deviate from the standard random walk usually assumed. The general validity and the implications of the results are discussed.

  11. DNA sequence analysis with droplet-based microfluidics

    Abate, Adam R.; Hung, Tony; Sperling, Ralph A.; Mary, Pascaline; Rotem, Assaf; Agresti, Jeremy J.; Weiner, Michael A.; Weitz, David A.

    2014-01-01

    Droplet-based microfluidic techniques can form and process micrometer scale droplets at thousands per second. Each droplet can house an individual biochemical reaction, allowing millions of reactions to be performed in minutes with small amounts of total reagent. This versatile approach has been used for engineering enzymes, quantifying concentrations of DNA in solution, and screening protein crystallization conditions. Here, we use it to read the sequences of DNA molecules with a FRET-based assay. Using probes of different sequences, we interrogate a target DNA molecule for polymorphisms. With a larger probe set, additional polymorphisms can be interrogated as well as targets of arbitrary sequence. PMID:24185402

  12. Better prediction of protein contact number using a support vector regression analysis of amino acid sequence

    Yuan Zheng

    2005-10-01

    Full Text Available Abstract Background Protein tertiary structure can be partly characterized via each amino acid's contact number measuring how residues are spatially arranged. The contact number of a residue in a folded protein is a measure of its exposure to the local environment, and is defined as the number of Cβ atoms in other residues within a sphere around the Cβ atom of the residue of interest. Contact number is partly conserved between protein folds and thus is useful for protein fold and structure prediction. In turn, each residue's contact number can be partially predicted from primary amino acid sequence, assisting tertiary fold analysis from sequence data. In this study, we provide a more accurate contact number prediction method from protein primary sequence. Results We predict contact number from protein sequence using a novel support vector regression algorithm. Using protein local sequences with multiple sequence alignments (PSI-BLAST profiles, we demonstrate a correlation coefficient between predicted and observed contact numbers of 0.70, which outperforms previously achieved accuracies. Including additional information about sequence weight and amino acid composition further improves prediction accuracies significantly with the correlation coefficient reaching 0.73. If residues are classified as being either "contacted" or "non-contacted", the prediction accuracies are all greater than 77%, regardless of the choice of classification thresholds. Conclusion The successful application of support vector regression to the prediction of protein contact number reported here, together with previous applications of this approach to the prediction of protein accessible surface area and B-factor profile, suggests that a support vector regression approach may be very useful for determining the structure-function relation between primary protein sequence and higher order consecutive protein structural and functional properties.

  13. Complete amino acid sequence of branched-chain amino acid aminotransferase (transaminase B) of Salmonella typhimurium, identification of the coenzyme-binding site and sequence comparison analysis

    The complete amino acid sequence of the subunit of branched-chain amino acid aminotransferase of Salmonella typhimurium was determined by automated Edman degradation of peptide fragments generated by chemical and enzymatic digestion of S-carboxymethylated and S-pyridylethylated transaminase B. Peptide fragments of transaminase B were generated by treatment of the enzyme with trypsin, Staphylococcus aureus V8 protease, endoproteinase Lys-C, and cyanogen bromide. Protocols were developed for separation of the peptide fragments by reverse-phase high performance liquid chromatography (HPLC), ion-exchange HPLC, and SDS-urea gel electrophoresis. The enzyme subunit contains 308 amino acid residues and has a molecular weight of 33,920 daltons. The coenzyme-binding site was determined by treatment of the enzyme, containing bound pyridoxal 5-phosphate, with tritiated sodium borohydride prior to trypsin digestion. Monitoring radioactivity incorporation and peptide map comparisons with an apoenzyme tryptic digest, allowed identification of the pyridoxylated-peptide which was isolated by reverse-phase HPLC and sequenced. The coenzyme-binding site is a lysyl residue at position 159. Some peptides were further characterized by fast atom bombardment mass spectrometry

  14. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert

    2010-05-03

    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  15. The human receptor for urokinase plasminogen activator. NH2-terminal amino acid sequence and glycosylation variants

    Behrendt, N; Rønne, E; Ploug, M; Petri, T; Løber, D; Nielsen, L S; Schleuning, W D; Blasi, F; Appella, E; Danø, K

    1990-01-01

    -PA. The purified protein shows a single 55-60 kDa band after sodium dodecyl sulfate-polyacrylamide gel electrophoresis and silver staining. It is a heavily glycosylated protein, the deglycosylated polypeptide chain comprising only 35 kDa. The glycosylated protein contains N-acetyl-D-glucosamine and sialic...... acid, but no N-acetyl-D-galactosamine. Glycosylation is responsible for substantial heterogeneity in the receptor on phorbol ester-stimulated U937 cells, and also for molecular weight variations among various cell lines. The amino acid composition and the NH2-terminal amino acid sequence are reported...

  16. Molecular cloning and sequence analysis of cDNA encoding human prostatic acid phosphatase.

    Vihko, P; Virkkunen, P; Henttu, P; Roiko, K; Solin, T; Huhtala, M L

    1988-08-29

    lambda gt11 clones encoding human prostatic acid phosphatase (PAP) (EC 3.1.3.2) were isolated from human prostatic cDNA libraries by immunoscreening with polyclonal antisera. Sequence data obtained from several overlapping clones indicated that the composite cDNAs contained the complete coding region for PAP, which encodes a 354-residue protein with a calculated molecular mass of 41,126 Da. In the 5'-end, the cDNA codes for a signal peptide of 32 amino acids. Direct protein sequencing of the amino-terminus of the mature protein and its proteolytic fragments confirmed the identity of the predicted protein sequence. PAP has no apparent sequence homology to other known proteins. However, both the cDNA clones coding for human placental alkaline phosphatase and PAP have an alu-type repetitive sequence about 900 nucleotides downstream from the coding region in the 3'-untranslated region. Two of our cDNA clones differed from others at the 5'-ends. RNA blot analysis indicated mRNA of 3.3 kb. We are continuing to study whether acid phosphatases form a gene family as do alkaline phosphatases. PMID:2842184

  17. Draft Genome Sequence of Perfluorooctane Acid-Degrading Bacterium Pseudomonas parafulva YAB-1

    Yi, Langbo; Tang, Chongjian; Peng, Qingjing; Peng, Qingzhong; Chai, Liyuan

    2015-01-01

    Pseudomonas parafulva YAB-1, isolated from perfluorinated compound-contaminated soil, has the ability to degrade perfluorooctane acid (PFOA) compound. Here, we report the draft genome sequence and annotation of the PFOA-degrading bacterium P. parafulva YAB-1. The data provide the basis to investigate the molecular mechanism of PFOA metabolism.

  18. Draft Genome Sequence of Perfluorooctane Acid-Degrading Bacterium Pseudomonas parafulva YAB-1

    Tang, Chongjian; Peng, Qingjing; Peng, Qingzhong

    2015-01-01

    Pseudomonas parafulva YAB-1, isolated from perfluorinated compound-contaminated soil, has the ability to degrade perfluorooctane acid (PFOA) compound. Here, we report the draft genome sequence and annotation of the PFOA-degrading bacterium P. parafulva YAB-1. The data provide the basis to investigate the molecular mechanism of PFOA metabolism. PMID:26337877

  19. Evolution of vertebrate IgM: complete amino acid sequence of the constant region of Ambystoma mexicanum mu chain deduced from cDNA sequence.

    Fellah, J S; Wiles, M V; Charlemagne, J; Schwager, J

    1992-10-01

    cDNA clones coding for the constant region of the Mexican axolotl (Ambystoma mexicanum) mu heavy immunoglobulin chain were selected from total spleen RNA, using a cDNA polymerase chain reaction technique. The specific 5'-end primer was an oligonucleotide homologous to the JH segment of Xenopus laevis mu chain. One of the clones, JHA/3, corresponded to the complete constant region of the axolotl mu chain, consisting of a 1362-nucleotide sequence coding for a polypeptide of 454 amino acids followed in 3' direction by a 179-nucleotide untranslated region and a polyA+ tail. The axolotl C mu is divided into four typical domains (C mu 1-C mu 4) and can be aligned with the Xenopus C mu with an overall identity of 56% at the nucleotide level. Percent identities were particularly high between C mu 1 (59%) and C mu 4 (71%). The C-terminal 20-amino acid segment which constitutes the secretory part of the mu chain is strongly homologous to the equivalent sequences of chondrichthyans and of other tetrapods, including a conserved N-linked oligosaccharide, the penultimate cysteine and the C-terminal lysine. The four C mu domains of 13 vertebrate species ranging from chondrichthyans to mammals were aligned and compared at the amino acid level. The significant number of mu-specific residues which are conserved into each of the four C mu domains argues for a continuous line of evolution of the vertebrate mu chain. This notion was confirmed by the ability to reconstitute a consistent vertebrate evolution tree based on the phylogenic parsimony analysis of the C mu 4 sequences. PMID:1382992

  20. Complete amino acid sequence of the human alpha 5 (IV) collagen chain and identification of a single-base mutation in exon 23 converting glycine 521 in the collagenous domain to cysteine in an Alport syndrome patient

    Zhou, J; Hertz, Jens Michael; Leinonen, A; Tryggvason, K

    1992-01-01

    alleles. The mutation which was located to exon 23 was sequenced from a polymerase chain reaction-amplified product, and shown to be a G----T change in the coding strand. The mutation changed the GGT codon of glycine 521 to cysteine. The same mutation was found in one allele of the female cousin. The...

  1. Molecular cloning and sequence analysis of complementary DNA encoding rat mammary gland medium-chain S-acyl fatty acid synthetase thio ester hydrolase

    Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from ∼ 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH

  2. Amino acid sequence of the serine-repeat antigen (SERA) of Plasmodium falciparum determined from cloned cDNA.

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1988-09-01

    We report the isolation of cDNA clones for a Plasmodium falciparum gene that encodes the complete amino acid sequence of a previously identified exported blood stage antigen. The Mr of this antigen protein had been determined by sodium dodecylsulphate-polyacrylamide gel electrophoresis analysis, by different workers, to be 113,000, 126,000, and 140,000. We show, by cDNA nucleotide sequence analysis, that this antigen gene encodes a 989 amino acid protein (111 kDa) that contains a potential signal peptide, but not a membrane anchor domain. In the FCR3 strain the serine content of the protein was 11%, of which 57% of the serine residues were localized within a 201 amino acid sequence that included 35 consecutive serine residues. The protein also contained three possible N-linked glycosylation sites and numerous possible O-linked glycosylation sites. The mRNA was abundant during late trophozoite-schizont parasite stages. We propose to identity this antigen, which had been called p126, by the acronym SERA, serine-repeat antigen, based on its complete structure. The usefulness of the cloned cDNA as a source of a possible malaria vaccine is considered in view of the previously demonstrated ability of the antigen to induce parasite-inhibitory antibodies and a protective immune response in Saimiri monkeys. PMID:2847041

  3. cDNA-derived amino-acid sequence of a land turtle (Geochelone carbonaria) beta-chain hemoglobin.

    Bordin, S; Meza, A N; Saad, S T; Ogo, S H; Costa, F F

    1997-06-01

    The cDNA sequence encoding the turtle Geochelone carbonaria beta-chain was determinated. The isolation of hemoglobin mRNA was based on degenerate primers' PCR in combination with 5'- and 3'-RACE protocol. The full length cDNA is 615 bp with the ATG start codon at position 53 and TGA stop codon at position 495; The AATAAA polyadenylation signal is found at position 599. The deduced polypeptyde contains 146 amino-acid residues. The predicted amino acid sequence shares 83% identity with the beta-globin of a related specie, the aquatic turtle C. p. belli. Otherwise, identity is higher when compared with chicken beta-Hb (80%) than with other reptilian orders (Squamata, 69%, and Crocodilia, 61%). Compared with human HbA, there is 67% identity, and at least three amino acid substitutions could be of some functional significance (Glu43 beta-->Ser, His116 beta-->Thr and His143 beta-->Leu). To our knowledge this represents the first cDNA sequence of a reptile globin gene described. PMID:9238523

  4. Use of a structural alphabet to find compatible folds for amino acid sequences.

    Mahajan, Swapnil; de Brevern, Alexandre G; Sanejouand, Yves-Henri; Srinivasan, Narayanaswamy; Offmann, Bernard

    2015-01-01

    The structural annotation of proteins with no detectable homologs of known 3D structure identified using sequence-search methods is a major challenge today. We propose an original method that computes the conditional probabilities for the amino-acid sequence of a protein to fit to known protein 3D structures using a structural alphabet, known as "Protein Blocks" (PBs). PBs constitute a library of 16 local structural prototypes that approximate every part of protein backbone structures. It is used to encode 3D protein structures into 1D PB sequences and to capture sequence to structure relationships. Our method relies on amino acid occurrence matrices, one for each PB, to score global and local threading of query amino acid sequences to protein folds encoded into PB sequences. It does not use any information from residue contacts or sequence-search methods or explicit incorporation of hydrophobic effect. The performance of the method was assessed with independent test datasets derived from SCOP 1.75A. With a Z-score cutoff that achieved 95% specificity (i.e., less than 5% false positives), global and local threading showed sensitivity of 64.1% and 34.2%, respectively. We further tested its performance on 57 difficult CASP10 targets that had no known homologs in PDB: 38 compatible templates were identified by our approach and 66% of these hits yielded correctly predicted structures. This method scales-up well and offers promising perspectives for structural annotations at genomic level. It has been implemented in the form of a web-server that is freely available at http://www.bo-protscience.fr/forsa. PMID:25297700

  5. Nanopore-based Fourth-generation DNA Sequencing Technology

    Yanxiao Feng; Yuechuan Zhang; Cuifeng Ying; Deqiang Wang; Chunlei Du

    2015-01-01

    Nanopore-based sequencers, as the fourth-generation DNA sequencing technology, have the potential to quickly and reliably sequence the entire human genome for less than $1000, and possibly for even less than$100. The single-molecule techniques used by this technology allow us to further study the interaction between DNA and protein, as well as between protein and protein. Nanopore analysis opens a new door to molecular biology investigation at the single-molecule scale. In this article, we have reviewed academic achievements in nanopore technology from the past as well as the latest advances, including both biological and solid-state nanopores, and discussed their recent and potential applications.

  6. An optical CDMA system based on chaotic sequences

    Liu, Xiao-lei; En, De; Wang, Li-guo

    2014-03-01

    In this paper, a coherent asynchronous optical code division multiple access (OCDMA) system is proposed, whose encoder/decoder is an all-optical generator. This all-optical generator can generate analog and bipolar chaotic sequences satisfying the logistic maps. The formula of bit error rate (BER) is derived, and the relationship of BER and the number of simultaneous transmissions is analyzed. Due to the good property of correlation, this coherent OCDMA system based on these bipolar chaotic sequences can support a large number of simultaneous users, which shows that these chaotic sequences are suitable for asynchronous OCDMA system.

  7. Reassociation kinetics-based approach for partial genome sequencing of the cattle tick, Rhipicephalus (Boophilus microplus

    Bellgard Matthew

    2010-06-01

    Full Text Available Abstract Background The size and repetitive nature of the Rhipicephalus microplus genome makes obtaining a full genome sequence fiscally and technically problematic. To selectively obtain gene-enriched regions of this tick's genome, Cot filtration was performed, and Cot-filtered DNA was sequenced via 454 FLX pyrosequencing. Results The sequenced Cot-filtered genomic DNA was assembled with an EST-based gene index of 14,586 unique entries where each EST served as a potential "seed" for scaffold formation. The new sequence assembly extended the lengths of 3,913 of the 14,586 gene index entries. Over half of the extensions corresponded to extensions of over 30 amino acids. To survey the repetitive elements in the tick genome, the complete sequences of five BAC clones were determined. Both Class I and II transposable elements were found. Comparison of the BAC and Cot filtration data indicates that Cot filtration was highly successful in filtering repetitive DNA out of the genomic DNA used in 454 sequencing. Conclusion Cot filtration is a very useful strategy to incorporate into genome sequencing projects on organisms with large genome sizes and which contain high percentages of repetitive, difficult to assemble, genomic DNA. Combining the Cot selection approach with 454 sequencing and assembly with a pre-existing EST database as seeds resulted in extensions of 27% of the members of the EST database.

  8. Analysis of Chimpanzee History Based on Genome Sequence Alignments

    Caswell, Jennifer L.; Richter, Daniel J.; Neubauer, Julie; Schirmer, Christine; Gnerre, Sante; Mallick, Swapan; Reich, David Emil

    2008-01-01

    Population geneticists often study small numbers of carefully chosen loci, but it has become possible to obtain orders of magnitude for more data from overlaps of genome sequences. Here, we generate tens of millions of base pairs of multiple sequence alignments from combinations of three western chimpanzees, three central chimpanzees, an eastern chimpanzee, a bonobo, a human, an orangutan, and a macaque. Analysis provides a more precise understanding of demographic history than was previously...

  9. Markov chaotic sequences for correlation based watermarking schemes

    In this paper, statistical analysis of watermarking schemes based on correlation detection is presented. Statistical properties of watermark sequences generated by piecewise-linear Markov maps are exploited, resulting in superior watermark detection reliability. Correlation/spectral properties of such sequences are easily controllable, a fact that affects the watermarking system performance. A family of chaotic maps, namely the skew tent map family, is proposed for use in watermarking schemes

  10. Software scripts for quality checking of high-throughput nucleic acid sequencers.

    Lazo, G R; Tong, J; Miller, R; Hsia, C; Rausch, C; Kang, Y; Anderson, O D

    2001-06-01

    We have developed a graphical interface to allow the researcher to view and assess the quality of sequencing results using a series of program scripts developed to process data generated by automated sequencers. The scripts are written in Perl programming language and are executable under the cgibin directory of a Web server environment. The scripts direct nucleic acid sequencing trace file data output from automated sequencers to be analyzed by the phred molecular biology program and are displayed as graphical hypertext mark-up language (HTML) pages. The scripts are mainly designed to handle 96-well microtiter dish samples, but the scripts are also able to read data from 384-well microtiter dishes 96 samples at a time. The scripts may be customized for different laboratory environments and computer configurations. Web links to the sources and discussion page are provided. PMID:11414222

  11. Amino acid sequences and structures of chicken and turkey beta 2-microglobulin

    Welinder, K G; Jespersen, H M; Walther-Rasmussen, J; Skjødt, K

    The complete amino acid sequences of chicken and turkey beta 2-microglobulins have been determined by analyses of tryptic, V8-proteolytic and cyanogen bromide fragments, and by N-terminal sequencing. Mass spectrometric analysis of chicken beta 2-microglobulin supports the sequence-derived Mr of 11......,048. The higher apparent Mr obtained for the avian beta 2-microglobulins as compared to human beta 2-microglobulin by SDS-PAGE is not understood. Chicken and turkey beta 2-microglobulin consist of 98 residues and deviate at seven positions: 60, 66, 74-76, 78 and 82. The chicken and turkey sequences are...... complex suggest that the seven chicken to turkey differences are exposed to solvent in the avian MHC class I complex. The key residues of beta 2-microglobulin involved in alpha chain contacts within the MHC class I molecule are highly conserved between chicken and man. This explains that heterologous...

  12. Nucleotide sequence analysis of the gene encoding the Deinococcus radiodurans surface protein, derived amino acid sequence, and complementary protein chemical studies

    Peters, J.; Peters, M.; Lottspeich, F.; Schaefer, W.; Baumeister, W.

    1987-11-01

    The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate (HPI))-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%) of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids.

  13. Nucleotide sequence analysis of the gene encoding the Deinococcus radiodurans surface protein, derived amino acid sequence, and complementary protein chemical studies

    The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate [HPI])-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%) of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids

  14. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  15. The developmental transcriptome landscape of bovine skeletal muscle defined by Ribo-Zero ribonucleic acid sequencing.

    Sun, X; Li, M; Sun, Y; Cai, H; Li, R; Wei, X; Lan, X; Huang, Y; Lei, C; Chen, H

    2015-12-01

    Ribonucleic acid sequencing (RNA-Seq) libraries are normally prepared with oligo(dT) selection of poly(A)+ mRNA, but it depends on intact total RNA samples. Recent studies have described Ribo-Zero technology, a novel method that can capture both poly(A)+ and poly(A)- transcripts from intact or fragmented RNA samples. We report here the first application of Ribo-Zero RNA-Seq for the analysis of the bovine embryonic, neonatal, and adult skeletal muscle whole transcriptome at an unprecedented depth. Overall, 19,893 genes were found to be expressed, with a high correlation of expression levels between the calf and the adult. Hundreds of genes were found to be highly expressed in the embryo and decreased at least 10-fold after birth, indicating their potential roles in embryonic muscle development. In addition, we present for the first time the analysis of global transcript isoform discovery in bovine skeletal muscle and identified 36,694 transcript isoforms. Transcriptomic data were also analyzed to unravel sequence variations; 185,036 putative SNP and 12,428 putative short insertions-deletions (InDel) were detected. Specifically, many stop-gain, stop-loss, and frameshift mutations were identified that probably change the relative protein production and sequentially affect the gene function. Notably, the numbers of stage-specific transcripts, alternative splicing events, SNP, and InDel were greater in the embryo than in the calf and the adult, suggesting that gene expression is most active in the embryo. The resulting view of the transcriptome at a single-base resolution greatly enhances the comprehensive transcript catalog and uncovers the global trends in gene expression during bovine skeletal muscle development. PMID:26641174

  16. Preparation of Nucleic Acid Libraries for Personalized Sequencing Systems Using an Integrated Microfluidic Hub Technology (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

    Patel, Kamlesh D [Ken; SNL,

    2012-06-01

    Kamlesh (Ken) Patel from Sandia National Laboratories (Livermore, California) presents "Preparation of Nucleic Acid Libraries for Personalized Sequencing Systems Using an Integrated Microfluidic Hub Technology " at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

  17. Complete nucleic acid sequence of Penaeus stylirostris densovirus (PstDNV) from India.

    Rai, Praveen; Safeena, Muhammed P; Karunasagar, Iddya; Karunasagar, Indrani

    2011-06-01

    Infectious hypodermal and hematopoietic necrosis virus (IHHNV) of shrimp, recently been classified as Penaeus stylirostris densovirus (PstDNV). The complete nucleic acid sequence of PstDNV from India was obtained by cloning and sequencing of different DNA fragment of the virus. The genome organisation of PstDNV revealed that there were three major coding domains: a left ORF (NS1) of 2001 bp, a mid ORF (NS2) of 1092 bp and a right ORF (VP) of 990 bp. The complete genome and amino acid sequences of three proteins viz., NS1, NS2 and VP were compared with the genomes of the virus reported from Hawaii, China and Mexico and with partial sequence available from isolates from different regions. The phylogenetic analysis of shrimp, insect and vertebrate parvovirus sequences showed that the Indian PstDNV isolate is phylogenetically more closely related to one of the three isolates from Taiwan (AY355307), and two isolates (AY362547 and AY102034) from Thailand. PMID:21402111

  18. Hypokalemic paralysis and acid-base balance

    Ivo Casagranda

    2006-10-01

    Full Text Available Three cases of hypokalemic paralysis are reported, presenting to the Emergency Department. The first is a patient with a hypokalemic periodic paralysis with a normal acid-base status, the second is a case of hypokalemic flaccid paralysis of all extremities with a normal anion gap metabolic acidosis, the last is a patient with a hypokalemic distal paralysis of right upper arm with metabolic alkalosis. Afterwards some pathophysiologic principles and the clinical aspects of hypokalemia are discussed and an appropriate approach to do in Emergency Department, to identify the hypokalemic paralysis etiologies in the Emergency Department, is presented, beginning from the evaluation of acid-base status.

  19. DNA sequence analysis using hierarchical ART-based classification networks

    LeBlanc, C.; Hruska, S.I. [Florida State Univ., Tallahassee, FL (United States); Katholi, C.R.; Unnasch, T.R. [Univ. of Alabama, Birmingham, AL (United States)

    1994-12-31

    Adaptive resonance theory (ART) describes a class of artificial neural network architectures that act as classification tools which self-organize, work in real-time, and require no retraining to classify novel sequences. We have adapted ART networks to provide support to scientists attempting to categorize tandem repeat DNA fragments from Onchocerca volvulus. In this approach, sequences of DNA fragments are presented to multiple ART-based networks which are linked together into two (or more) tiers; the first provides coarse sequence classification while the sub- sequent tiers refine the classifications as needed. The overall rating of the resulting classification of fragments is measured using statistical techniques based on those introduced to validate results from traditional phylogenetic analysis. Tests of the Hierarchical ART-based Classification Network, or HABclass network, indicate its value as a fast, easy-to-use classification tool which adapts to new data without retraining on previously classified data.

  20. Site-directed gene mutation at mixed sequence targets by psoralen-conjugated pseudo-complementary peptide nucleic acids.

    Kim, Ki-Hyun; Nielsen, Peter E; Glazer, Peter M

    2007-01-01

    Sequence-specific DNA-binding molecules such as triple helix-forming oligonucleotides (TFOs) provide a means for inducing site-specific mutagenesis and recombination at chromosomal sites in mammalian cells. However, the utility of TFOs is limited by the requirement for homopurine stretches in the target duplex DNA. Here, we report the use of pseudo-complementary peptide nucleic acids (pcPNAs) for intracellular gene targeting at mixed sequence sites. Due to steric hindrance, pcPNAs are unable to form pcPNA-pcPNA duplexes but can bind to complementary DNA sequences by Watson-Crick pairing via double duplex-invasion complex formation. We show that psoralen-conjugated pcPNAs can deliver site-specific photoadducts and mediate targeted gene modification within both episomal and chromosomal DNA in mammalian cells without detectable off-target effects. Most of the induced psoralen-pcPNA mutations were single-base substitutions and deletions at the predicted pcPNA-binding sites. The pcPNA-directed mutagenesis was found to be dependent on PNA concentration and UVA dose and required matched pairs of pcPNAs. Neither of the individual pcPNAs alone had any effect nor did complementary PNA pairs of the same sequence. These results identify pcPNAs as new tools for site-specific gene modification in mammalian cells without purine sequence restriction, thereby providing a general strategy for designing gene targeting molecules. PMID:17977869

  1. Amino acid sequence of the beta subunit of bovine lung casein kinase II.

    Takio, K.; Kuenzel, E A; Walsh, K. A.; Krebs, E G

    1987-01-01

    The amino acid sequence of the 209-residue beta subunit of bovine lung casein kinase II has been determined. Excluding the amino-terminal blocking group, which was not identified, the molecular weight of the polypeptide chain is 24,239. A marked polarity of the beta subunit is indicated by clusters of negative charges in the amino-terminal region and of positive charges in the carboxyl-terminal region. Whereas the beta subunit shows no homology with any known protein, a segment of the sequenc...

  2. Critical assessment of sequence-based protein-protein interaction prediction methods that do not require homologous protein sequences

    Park Yungki

    2009-01-01

    Abstract Background Protein-protein interactions underlie many important biological processes. Computational prediction methods can nicely complement experimental approaches for identifying protein-protein interactions. Recently, a unique category of sequence-based prediction methods has been put forward - unique in the sense that it does not require homologous protein sequences. This enables it to be universally applicable to all protein sequences unlike many of previous sequence-based predi...

  3. Sequence-specific nucleic acid detection from binary pore conductance measurement

    Esfandiari, Leyla; Monbouquette, Harold G.; Jacob J. Schmidt

    2012-01-01

    We describe a platform for sequence-specific nucleic acid (NA) detection utilizing a micropipette tapered to a 2 μm diameter pore and 3 μm diameter polystyrene beads to which uncharged peptide nucleic acid (PNA) probe molecules have been conjugated. As the target NAs hybridize to the complementary PNA-beads, the beads acquire negative charge and become electrophoretically mobile. An applied electric field guides these NA-PNA-beads toward the pipette tip, which they obstruct, leading to an ind...

  4. Nucleotide sequence homology between the heat-labile enterotoxin gene of Escherichia coli and Vibrio cholerae deoxyribonucleic acid.

    Moseley, S L; Falkow, S

    1980-01-01

    Isolated deoxyribonucleic acid fragments encoding the heat-labile enterotoxin of Escherichia coli were used to probe for homologous sequences in restricted whole-cell deoxyribonucleic acid from Vibrio cholerae. Significant sequence homology between the heat-labile enterotoxin gene and V. cholerae deoxyribonucleic acid was demonstrated, and apparent differences were observed in the organization of the cholera toxin gene among different strains of V. cholerae.

  5. Fermented probiotic beverages based on acid whey

    Katarzyna Skryplonek

    2015-12-01

    Full Text Available Background. Production of fermented probiotic beverages can be a good method for acid whey usage. The obtained products combine a high nutritional value of whey with health benefits claimed for probiotic bac- teria. The aim of the study was to define quality properties of beverages based on fresh acid whey and milk with addition of buttermilk powder or sweet whey powder. Material and methods. Samples were inoculated with two strains of commercial probiotic cultures: Lac- tobacillus acidophilus La-5 or Bifidobacterium animalis Bb-12. After fermentation, samples were stored at refrigerated conditions. After 1, 4, 7, 14 and 21 days sensory characteristics, hardness, acetaldehyde content, titratable acidity, pH acidity and count of bacteria cells were evaluated. Results. Throughout all storage period, the number of bacteria was higher than 8 log cfu/ml in the all sam- ples. Beverages with La-5 strain had higher hardness and acidity, whilst samples with Bb-12 contained more acetaldehyde. Samples with buttermilk powder had better sensory properties than with sweet whey powder. Conclusions. Obtained products made of acid whey combined with milk and fortified with buttermilk pow- der or sweet whey powder, are good medium for growth and survival of examined probiotic bacteria strains. The level of bacteria was sufficient to provide health benefits to consumers.

  6. Purification and amino acid sequence of a bacteriocins produced by Lactobacillus salivarius K7 isolated from chicken intestine

    Kenji Sonomoto

    2006-03-01

    Full Text Available A bacteriocin-producing strain, Lactobacillus K7, was isolated from a chicken intestine. The inhibitory activity was determined by spot-on-lawn technique. Identification of the strain was performed by morphological, biochemical (API 50 CH kit and molecular genetic (16S rDNA basis. Bacteriocin purification processes were carried out by amberlite adsorption, cation exchange and reverse-phase high perform- ance liquid chromatography. N-terminal amino acid sequences were performed by Edman degradation. Molecular mass was determined by electrospray-ionization (ESI mass spectrometry (MS. Lactobacillus K7 showed inhibitory activity against Lactobacillus sakei subsp. sakei JCM 1157T, Leuconostoc mesenteroides subsp. mesenteroides JCM 6124T and Bacillus coagulans JCM 2257T. This strain was identified as Lb. salivarius. The antimicrobial substance was destroyed by proteolytic enzymes, indicating its proteinaceous structure designated as a bacteriocin type. The purification of bacteriocin by amberlite adsorption, cation exchange, and reverse-phase chromatography resulted in only one single active peak, which was designated FK22. Molecular weight of this fraction was 4331.70 Da. By amino acid sequence, this peptide was homology to Abp 118 beta produced by Lb. salivarius UCC118. In addition, Lb. salivarius UCC118 produced 2-peptide bacteriocin, which was Abp 118 alpha and beta. Based on the partial amino acid sequences of Abp 118 beta, specific primers were designed from nucleotide sequences according to data from GenBank. The result showed that the deduced peptide was high homology to 2-peptide bacteriocin, Abp 118 alpha and beta.

  7. Self-Sequencing of Amino Acids and Origins of Polyfunctional Protocells

    Fox, Sidney W.

    1984-12-01

    The primal role of the origins of proteins in molecular evolution is discussed. On the basis of this premise, the significance of the experimentally established self-sequencing of amino acids under simulated geological conditions is explained as due to the fact that the products are highly nonrandom and accordingly contain many kinds of information. When such thermal proteins are aggregated into laboratory protocells, an action that occurs readily, the resultant protocells also contain many kinds of information. Residue-by-residue order, enzymic activities, and lipid quality accordingly occur within each preparation of proteinoid (thermal protein). In this paper are reviewed briefly the phenomenon of self-sequencing of amino acids, its relationship to evolutionary processes, other significance of such self-ordering, and the experimental evidence for original polyfunctional protocells.

  8. Jigsaw Cooperative Learning: Acid-Base Theories

    Tarhan, Leman; Sesen, Burcin Acar

    2012-01-01

    This study focused on investigating the effectiveness of jigsaw cooperative learning instruction on first-year undergraduates' understanding of acid-base theories. Undergraduates' opinions about jigsaw cooperative learning instruction were also investigated. The participants of this study were 38 first-year undergraduates in chemistry education…

  9. Repeat Sequences and Base Correlations in Human Y Chromosome Palindromes

    Neng-zhi Jin; Zi-xian Liu; Yan-jiao Qi; Wen-yuan Qiu

    2009-01-01

    On the basis of information theory and statistical methods, we use mutual information, n-tuple entropy and conditional entropy, combined with biological characteristics, to analyze the long range correlation and short range correlation in human Y chromosome palindromes. The magnitude distribution of the long range correlation which can be reflected by the mutual information is P5>P5a>P5b (P5a and P5b are the sequences that replace solely Alu repeats and all interspersed repeats with random uncorrelated sequences in human Y chromosome palindrome 5, respectively); and the magnitude distribution of the short range correlation which can be reflected by the n-tuple entropy and the conditional entropy is P5>P5a>P5b>random uncorrelated sequence. In other words, when the Alu repeats and all interspersed repeats replace with random uncorrelated sequence, the long range and short range correlation decrease gradually. However, the random uncorrelated sequence has no correlation. This research indicates that more repeat sequences result in stronger correlation between bases in human Y chromosome. The analyses may be helpful to understand the special structures of human Y chromosome palindromes profoundly.

  10. SDT: a virus classification tool based on pairwise sequence alignment and identity calculation.

    Brejnev Muhizi Muhire

    Full Text Available The perpetually increasing rate at which viral full-genome sequences are being determined is creating a pressing demand for computational tools that will aid the objective classification of these genome sequences. Taxonomic classification approaches that are based on pairwise genetic identity measures are potentially highly automatable and are progressively gaining favour with the International Committee on Taxonomy of Viruses (ICTV. There are, however, various issues with the calculation of such measures that could potentially undermine the accuracy and consistency with which they can be applied to virus classification. Firstly, pairwise sequence identities computed based on multiple sequence alignments rather than on multiple independent pairwise alignments can lead to the deflation of identity scores with increasing dataset sizes. Also, when gap-characters need to be introduced during sequence alignments to account for insertions and deletions, methodological variations in the way that these characters are introduced and handled during pairwise genetic identity calculations can cause high degrees of inconsistency in the way that different methods classify the same sets of sequences. Here we present Sequence Demarcation Tool (SDT, a free user-friendly computer program that aims to provide a robust and highly reproducible means of objectively using pairwise genetic identity calculations to classify any set of nucleotide or amino acid sequences. SDT can produce publication quality pairwise identity plots and colour-coded distance matrices to further aid the classification of sequences according to ICTV approved taxonomic demarcation criteria. Besides a graphical interface version of the program for Windows computers, command-line versions of the program are available for a variety of different operating systems (including a parallel version for cluster computing platforms.

  11. Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope.

    Xu, W; Ellington, A. D.

    1996-01-01

    In vitro selection of nucleic acid binding species (aptamers) is superficially similar to the immune response. Both processes produce biopolymers that can recognize targets with high affinity and specificity. While antibodies are known to recognize the sequence and conformation of protein surface features (epitopes), very little is known about the precise interactions between aptamers and their epitopes. Therefore, aptamers that could recognize a particular epitope, a peptide fragment of huma...

  12. Sequence-selective targeting of duplex DNA by peptide nucleic acids

    Nielsen, Peter E

    2010-01-01

    nucleic acid (PNA) can recognize duplex DNA with high sequence specificity and affinity in triplex, duplex and double-duplex invasive modes or non-invasive triplex modes. Novel PNA modification has improved the affinity for DNA recognition via duplex invasion, double-duplex invasion and triplex......Sequence-selective gene targeting constitutes an attractive drug-discovery approach for genetic therapy, with the aim of reducing or enhancing the activity of specific genes at the transcriptional level, or as part of a methodology for targeted gene repair. The pseudopeptide DNA mimic peptide...... recognition considerably. Such modifications have also resulted in new approaches to targeted gene repair and sequence-selective double-strand cleavage of genomic DNA....

  13. Amino acid sequences mediating vascular cell adhesion molecule 1 binding to integrin alpha 4: homologous DSP sequence found for JC polyoma VP1 coat protein

    Michael Andrew Meyer

    2013-07-01

    Full Text Available The JC polyoma viral coat protein VP1 was analyzed for amino acid sequences homologies to the IDSP sequence which mediates binding of VLA-4 (integrin alpha 4 to vascular cell adhesion molecule 1. Although the full sequence was not found, a DSP sequence was located near the critical arginine residue linked to infectivity of the virus and binding to sialic acid containing molecules such as integrins (3. For the JC polyoma virus, a DSP sequence was found at residues 70, 71 and 72 with homology also noted for the mouse polyoma virus and SV40 virus. Three dimensional modeling of the VP1 molecule suggests that the DSP loop has an accessible site for interaction from the external side of the assembled viral capsid pentamer.

  14. Random amino acid mutations and protein misfolding lead to Shannon limit in sequence-structure communication.

    Andreas Martin Lisewski

    Full Text Available The transmission of genomic information from coding sequence to protein structure during protein synthesis is subject to stochastic errors. To analyze transmission limits in the presence of spurious errors, Shannon's noisy channel theorem is applied to a communication channel between amino acid sequences and their structures established from a large-scale statistical analysis of protein atomic coordinates. While Shannon's theorem confirms that in close to native conformations information is transmitted with limited error probability, additional random errors in sequence (amino acid substitutions and in structure (structural defects trigger a decrease in communication capacity toward a Shannon limit at 0.010 bits per amino acid symbol at which communication breaks down. In several controls, simulated error rates above a critical threshold and models of unfolded structures always produce capacities below this limiting value. Thus an essential biological system can be realistically modeled as a digital communication channel that is (a sensitive to random errors and (b restricted by a Shannon error limit. This forms a novel basis for predictions consistent with observed rates of defective ribosomal products during protein synthesis, and with the estimated excess of mutual information in protein contact potentials.

  15. Protein Function Prediction Based on Sequence and Structure Information

    Smaili, Fatima Z.

    2016-05-25

    The number of available protein sequences in public databases is increasing exponentially. However, a significant fraction of these sequences lack functional annotation which is essential to our understanding of how biological systems and processes operate. In this master thesis project, we worked on inferring protein functions based on the primary protein sequence. In the approach we follow, 3D models are first constructed using I-TASSER. Functions are then deduced by structurally matching these predicted models, using global and local similarities, through three independent enzyme commission (EC) and gene ontology (GO) function libraries. The method was tested on 250 “hard” proteins, which lack homologous templates in both structure and function libraries. The results show that this method outperforms the conventional prediction methods based on sequence similarity or threading. Additionally, our method could be improved even further by incorporating protein-protein interaction information. Overall, the method we use provides an efficient approach for automated functional annotation of non-homologous proteins, starting from their sequence.

  16. Metazoan Remaining Genes for Essential Amino Acid Biosynthesis: Sequence Conservation and Evolutionary Analyses

    Igor R. Costa

    2014-12-01

    Full Text Available Essential amino acids (EAA consist of a group of nine amino acids that animals are unable to synthesize via de novo pathways. Recently, it has been found that most metazoans lack the same set of enzymes responsible for the de novo EAA biosynthesis. Here we investigate the sequence conservation and evolution of all the metazoan remaining genes for EAA pathways. Initially, the set of all 49 enzymes responsible for the EAA de novo biosynthesis in yeast was retrieved. These enzymes were used as BLAST queries to search for similar sequences in a database containing 10 complete metazoan genomes. Eight enzymes typically attributed to EAA pathways were found to be ubiquitous in metazoan genomes, suggesting a conserved functional role. In this study, we address the question of how these genes evolved after losing their pathway partners. To do this, we compared metazoan genes with their fungal and plant orthologs. Using phylogenetic analysis with maximum likelihood, we found that acetolactate synthase (ALS and betaine-homocysteine S-methyltransferase (BHMT diverged from the expected Tree of Life (ToL relationships. High sequence conservation in the paraphyletic group Plant-Fungi was identified for these two genes using a newly developed Python algorithm. Selective pressure analysis of ALS and BHMT protein sequences showed higher non-synonymous mutation ratios in comparisons between metazoans/fungi and metazoans/plants, supporting the hypothesis that these two genes have undergone non-ToL evolution in animals.

  17. Complete Genome Sequence of the Probiotic Lactic Acid Bacterium Lactobacillus Rhamnosus

    Samat Kozhakhmetov

    2014-01-01

    Full Text Available Introduction: Lactobacilli are a bacteria commonly found in the gastrointestinal tract. Some species of this genus have probiotic properties. The most common of these is Lactobacillus rhamnosus, a microoganism, generally regarded as safe (GRAS. It is also a homofermentative L-(+-lactic acid producer. The genus Lactobacillus is characterized by an extraordinary degree of the phenotypic and genotypic diversity. However, the studies of the genus were conducted mostly with the unequally distributed, non-random choice of species for sequencing; thus, there is only one representative genome from the Lactobacillus rhamnosus clade available to date. The aim of this study was to characterize the genome sequencing of selected strains of Lactobacilli. Methods: 109 samples were isolated from national domestic dairy products in the laboratory of Center for life sciences. After screaning isolates for probiotic properties, a highly active Lactobacillus spp strain was chosen. Genomic DNA was extracted according to the manufacturing protocol (Wizard® Genomic DNA Purification Kit. The Lactobacillus rhamnosus strain was identified as the highly active Lactobacillus strain accoridng to its morphological, cultural, physiological, and biochemical properties, and a genotypic analysis. Results: The genome of Lactobacillus rhamnosus was sequenced using the Roche 454 GS FLX (454 GS FLX platforms. The initial draft assembly was prepared from 14 large contigs (20 all contigs by the Newbler gsAssembler 2.3 (454 Life Sciences, Branford, CT. Conclusion: A full genome-sequencing of selected strains of lactic acid bacteria was made during the study.

  18. Draft Genome Sequence of Acid-Tolerant Clostridium drakei SL1T, a Potential Chemical Producer through Syngas Fermentation

    Jeong, Yujin; Song, Yoseb; Shin, Hyeon Seok; Cho, Byung-Kwan

    2014-01-01

    Clostridium drakei SL1T is a strictly anaerobic, H2-utilizing, and acid-tolerant acetogen isolated from an acidic sediment that is a potential platform for commodity chemical production from syngas fermentation. The draft genome sequence of this strain will enable determination of the acid resistance and autotrophic pathway of the acetogen.

  19. Which Microbial Communities Are Present? Sequence-Based Metagenomics

    Caffrey, Sean M.

    The use of metagenomic methods that directly sequence environmental samples has revealed the extraordinary microbial diversity missed by traditional culture-based methodologies. Therefore, to develop a complete and representative model of an environment's microbial community and activities, metagenomic analysis is an essential tool.

  20. Low molecular weight human pulmonary surfactant protein (SP5): isolation, characterization, and cDNA and amino acid sequences

    Pulmonary surfactant is a lipid-protein complex that promotes alveolar stability by lowering the surface tension at the air-fluid interface in the peripheral air spaces. A group of hydrophobic surfactant-associated proteins has been shown to be essential for rapid surface film formation by surfactant phospholipids. The authors have purified a hydrophobic surfactant protein of ≅ 5kDa that they term SP5 from bronchopulmonary lavage fluid from a patient with alveolar proteinosis and shown that it promotes rapid surface film formation by simple mixtures of phospholipids. They have derived the full amino acid sequence of human SP5 from the nucleotide sequence of cDNAs identified with oligonucleotide probes based on the NH2-terminal sequence of SP5. SP5 isolated from surfactant is a fragment of a much larger precursor protein (21 kDa). The precursor contains an extremely hydrophobic region of 34 amino acids that comprises most the mature SP5. This hydrophobicity explains the unusual solubility characteristics of SP5 and the fact that it is lipid-associated when isolated from lung

  1. Low molecular weight human pulmonary surfactant protein (SP5): isolation, characterization, and cDNA and amino acid sequences

    Warr, R.G.; Hawgood, S.; Buckley, D.I.; Crisp, T.M.; Schilling, J.; Benson, B.J.; Ballard, P.L.; Clements, J.A.; White, R.T.

    1987-11-01

    Pulmonary surfactant is a lipid-protein complex that promotes alveolar stability by lowering the surface tension at the air-fluid interface in the peripheral air spaces. A group of hydrophobic surfactant-associated proteins has been shown to be essential for rapid surface film formation by surfactant phospholipids. The authors have purified a hydrophobic surfactant protein of approx. = 5kDa that they term SP5 from bronchopulmonary lavage fluid from a patient with alveolar proteinosis and shown that it promotes rapid surface film formation by simple mixtures of phospholipids. They have derived the full amino acid sequence of human SP5 from the nucleotide sequence of cDNAs identified with oligonucleotide probes based on the NH/sub 2/-terminal sequence of SP5. SP5 isolated from surfactant is a fragment of a much larger precursor protein (21 kDa). The precursor contains an extremely hydrophobic region of 34 amino acids that comprises most the mature SP5. This hydrophobicity explains the unusual solubility characteristics of SP5 and the fact that it is lipid-associated when isolated from lung.

  2. A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome.

    Kumar, Ashutosh; Singh, Himanshu N; Pareek, Vikas; Raza, Khursheed; Dantham, Subrahamanyam; Kumar, Pavan; Mochan, Sankat; Faiq, Muneeb A

    2016-01-01

    Owing to the reports of microcephaly as a consistent outcome in the fetuses of pregnant women infected with ZIKV in Brazil, Zika virus (ZIKV)-microcephaly etiomechanistic relationship has recently been implicated. Researchers, however, are still struggling to establish an embryological basis for this interesting causal handcuff. The present study reveals robust evidence in favor of a plausible ZIKV-microcephaly cause-effect liaison. The rationale is based on: (1) sequence homology between ZIKV genome and the response element of an early neural tube developmental marker "retinoic acid" in human DNA and (2) comprehensive similarities between the details of brain defects in ZIKV-microcephaly and retinoic acid embryopathy. Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5'-AGGTCA-3') in promoter regions of retinoic acid-dependent genes. We screened genomic sequences of already reported virulent ZIKV strains (including those linked to microcephaly) and other viruses available in National Institute of Health genetic sequence database (GenBank) for the RARE consensus repeats and obtained results strongly bolstering our hypothesis that ZIKV strains associated with microcephaly may act through precipitation of dysregulation in retinoic acid-dependent genes by introducing extra stretches of RARE consensus sequence repeats in the genome of developing brain cells. Additional support to our hypothesis comes from our findings that screening of other viruses for RARE consensus sequence repeats is positive only for those known to display neurotropism and cause fetal brain defects (for which maternal-fetal transmission during developing stage may be required). The numbers of RARE sequence repeats appeared to match with the virulence of screened positive viruses. Although, bioinformatic evidence and embryological

  3. Multiple Base Substitution Corrections in DNA Sequence Evolution

    Kowalczuk, M.; Mackiewicz, P.; Szczepanik, D.; Nowicka, A.; Dudkiewicz, M.; Dudek, M. R.; Cebrat, S.

    We discuss the Jukes and Cantor's one-parameter model and Kimura's two-parameter model unability to describe evolution of asymmetric DNA molecules. The standard distance measure between two DNA sequences, which is the number of substitutions per site, should include the effect of multiple base substitutions separately for each type of the base. Otherwise, the respective tables of substitutions cannot reconstruct the asymmetric DNA molecule with respect to the composition. Basing on Kimura's neutral theory, we have derived a linear law for the correlation of the mean survival time of nucleotides under constant mutation pressure and their fraction in the genome. According to the law, the corrections to Kimura's theory have been discussed to describe evolution of genomes with asymmetric nucleotide composition. We consider the particular case of the strongly asymmetric Borrelia burgdorferi genome and we discuss in detail the corrections, which should be introduced into the distance measure between two DNA sequences to include multiple base substitutions.

  4. Genome Sequence of Lactobacillus saerimneri 30a (Formerly Lactobacillus sp. Strain 30a), a Reference Lactic Acid Bacterium Strain Producing Biogenic Amines

    Romano, Andrea; Trip, Hein; Campbell-Sills, Hugo; Bouchez, Olivier; Sherman, David; Lolkema, Juke S.; Lucas, Patrick M

    2013-01-01

    Lactobacillus sp. strain 30a (Lactobacillus saerimneri) produces the biogenic amines histamine, putrescine, and cadaverine by decarboxylating their amino acid precursors. We report its draft genome sequence (1,634,278 bases, 42.6% G+C content) and the principal findings from its annotation, which might shed light onto the enzymatic machineries that are involved in its production of biogenic amines.

  5. 3D Motion Parameters Determination Based on Binocular Sequence Images

    2006-01-01

    Exactly capturing three dimensional (3D) motion information of an object is an essential and important task in computer vision, and is also one of the most difficult problems. In this paper, a binocular vision system and a method for determining 3D motion parameters of an object from binocular sequence images are introduced. The main steps include camera calibration, the matching of motion and stereo images, 3D feature point correspondences and resolving the motion parameters. Finally, the experimental results of acquiring the motion parameters of the objects with uniform velocity and acceleration in the straight line based on the real binocular sequence images by the mentioned method are presented.

  6. DNA sequence analysis with droplet-based microfluidics

    Abate, Adam R.; Hung, Tony; Sperling, Ralph A.; Mary, Pascaline; Rotem, Assaf; Agresti, Jeremy J.; Weiner, Michael A.; Weitz, David A.

    2013-01-01

    Droplet-based microfluidic techniques can form and process micrometer scale droplets at thousands per second. Each droplet can house an individual biochemical reaction, allowing millions of reactions to be performed in minutes with small amounts of total reagent. This versatile approach has been used for engineering enzymes, quantifying concentrations of DNA in solution, and screening protein crystallization conditions. Here, we use it to read the sequences of DNA molecules with a FRET-based ...

  7. Local Sequence Information-based Support Vector Machine to Classify Voltage-gated Potassium Channels

    Li-Xia LIU; Meng-Long LI; Fu-Yuan TAN; Min-Chun LU; Ke-Long WANG; Yan-Zhi GUO; Zhi-Ning WEN; Lin JIANG

    2006-01-01

    In our previous work, we developed a computational tool, PreK-ClassK-ClassKv, to predict and classify potassium (K+) channels. For K+ channel prediction (PreK) and classification at family level (ClassK), this method performs well. However, it does not perform so well in classifying voltage-gated potassium (Kv) channels (ClassKv). In this paper, a new method based on the local sequence information of Kv channels is introduced to classify Kv channels. Six transmembrane domains of a Kv channel protein are used to define a protein, and the dipeptide composition technique is used to transform an amino acid sequence to a numerical sequence. A Kv channel protein is represented by a vector with 2000 elements, and a support vector machine algorithm is applied to classify Kv channels. This method shows good performance with averages of total accuracy (Acc), sensitivity (SE), specificity (SP); reliability (R) and Matthews correlation coefficient (MCC) of 98.0%, 89.9%, 100%, 0.95 and 0.94 respectively. The results indicate that the local sequence information-based method is better than the global sequence information-based method to classify Kv channels.

  8. Complete amino acid sequence of globin chains and biological activity of fragmented crocodile hemoglobin (Crocodylus siamensis).

    Srihongthong, Saowaluck; Pakdeesuwan, Anawat; Daduang, Sakda; Araki, Tomohiro; Dhiravisit, Apisak; Thammasirirak, Sompong

    2012-08-01

    Hemoglobin, α-chain, β-chain and fragmented hemoglobin of Crocodylus siamensis demonstrated both antibacterial and antioxidant activities. Antibacterial and antioxidant properties of the hemoglobin did not depend on the heme structure but could result from the compositions of amino acid residues and structures present in their primary structure. Furthermore, thirteen purified active peptides were obtained by RP-HPLC analyses, corresponding to fragments in the α-globin chain and the β-globin chain which are mostly located at the N-terminal and C-terminal parts. These active peptides operate on the bacterial cell membrane. The globin chains of Crocodylus siamensis showed similar amino acids to the sequences of Crocodylus niloticus. The novel amino acid substitutions of α-chain and β-chain are not associated with the heme binding site or the bicarbonate ion binding site, but could be important through their interactions with membranes of bacteria. PMID:22648692

  9. Parameters of proteome evolution from histograms of amino-acid sequence identities of paralogous proteins

    Yan Koon-Kiu; Axelsen Jacob; Maslov Sergei

    2005-01-01

    Abstract Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model...

  10. Skeleton-based human action recognition using multiple sequence alignment

    Ding, Wenwen; Liu, Kai; Cheng, Fei; Zhang, Jin; Li, YunSong

    2015-05-01

    Human action recognition and analysis is an active research topic in computer vision for many years. This paper presents a method to represent human actions based on trajectories consisting of 3D joint positions. This method first decompose action into a sequence of meaningful atomic actions (actionlets), and then label actionlets with English alphabets according to the Davies-Bouldin index value. Therefore, an action can be represented using a sequence of actionlet symbols, which will preserve the temporal order of occurrence of each of the actionlets. Finally, we employ sequence comparison to classify multiple actions through using string matching algorithms (Needleman-Wunsch). The effectiveness of the proposed method is evaluated on datasets captured by commodity depth cameras. Experiments of the proposed method on three challenging 3D action datasets show promising results.

  11. Spectroscopic investigation on the telomeric DNA base sequence repeat

    2002-01-01

    Telomeres are protein-DNA complexes at the terminals of linear chromosomes, which protect chromosomal integrity and maintain cellular replicative capacity.From single-cell organisms to advanced animals and plants,structures and functions of telomeres are both very conservative. In cells of human and vertebral animals, telomeric DNA base sequences all are (TTAGGG)n. In the present work, we have obtained absorption and fluorescence spectra measured from seven synthesized oligonucleotides to simulate the telomeric DNA system and calculated their relative fluorescence quantum yields on which not only telomeric DNA characteristics are predicted but also possibly the shortened telomeric sequences during cell division are imrelative fluorescence quantum yield and remarkable excitation energy innerconversion, which tallies with the telomeric sequence of (TTAGGG)n. This result shows that telomeric DNA has a strong non-radiative or innerconvertible capability.``

  12. Steganalytic method based on short and repeated sequence distance statistics

    WANG GuoXin; PING XiJian; XU ManKun; ZHANG Tao; BAO XiRui

    2008-01-01

    According to the distribution characteristics of short and repeated sequence (SRS),a steganalytic method based on the correlation of image bit planes is proposed.Firstly,we provide the conception of SRS distance statistics and deduce its statistical distribution.Because the SRS distance statistics can effectively reflect the correlation of the sequence,SRS has statistical features when the image bit plane sequence equals the image width.Using this characteristic,the steganalytic method is fulfilled by the distinct test of Poisson distribution.Experimental results show a good performance for detecting LSB matching steganographic method in still images.By the way,the proposed method is not designed for specific steganographic algorithms and has good generality.

  13. Comparative characterization of random-sequence proteins consisting of 5, 12, and 20 kinds of amino acids.

    Tanaka, Junko; Doi, Nobuhide; Takashima, Hideaki; Yanagawa, Hiroshi

    2010-04-01

    Screening of functional proteins from a random-sequence library has been used to evolve novel proteins in the field of evolutionary protein engineering. However, random-sequence proteins consisting of the 20 natural amino acids tend to aggregate, and the occurrence rate of functional proteins in a random-sequence library is low. From the viewpoint of the origin of life, it has been proposed that primordial proteins consisted of a limited set of amino acids that could have been abundantly formed early during chemical evolution. We have previously found that members of a random-sequence protein library constructed with five primitive amino acids show high solubility (Doi et al., Protein Eng Des Sel 2005;18:279-284). Although such a library is expected to be appropriate for finding functional proteins, the functionality may be limited, because they have no positively charged amino acid. Here, we constructed three libraries of 120-amino acid, random-sequence proteins using alphabets of 5, 12, and 20 amino acids by preselection using mRNA display (to eliminate sequences containing stop codons and frameshifts) and characterized and compared the structural properties of random-sequence proteins arbitrarily chosen from these libraries. We found that random-sequence proteins constructed with the 12-member alphabet (including five primitive amino acids and positively charged amino acids) have higher solubility than those constructed with the 20-member alphabet, though other biophysical properties are very similar in the two libraries. Thus, a library of moderate complexity constructed from 12 amino acids may be a more appropriate resource for functional screening than one constructed from 20 amino acids. PMID:20162614

  14. DUK - A Fast and Efficient Kmer Based Sequence Matching Tool

    Li, Mingkun; Copeland, Alex; Han, James

    2011-03-21

    A new tool, DUK, is developed to perform matching task. Matching is to find whether a query sequence partially or totally matches given reference sequences or not. Matching is similar to alignment. Indeed many traditional analysis tasks like contaminant removal use alignment tools. But for matching, there is no need to know which bases of a query sequence matches which position of a reference sequence, it only need know whether there exists a match or not. This subtle difference can make matching task much faster than alignment. DUK is accurate, versatile, fast, and has efficient memory usage. It uses Kmer hashing method to index reference sequences and Poisson model to calculate p-value. DUK is carefully implemented in C++ in object oriented design. The resulted classes can also be used to develop other tools quickly. DUK have been widely used in JGI for a wide range of applications such as contaminant removal, organelle genome separation, and assembly refinement. Many real applications and simulated dataset demonstrate its power.

  15. An Uncompressed Image Encryption Algorithm Based on DNA Sequences

    Shima Ramesh Maniyath

    2011-07-01

    Full Text Available The rapid growth of the Internet and digitized content made image and video distribution simpler. Hence the need for image and video data protection is on the rise. In this paper, we propose a secure and computationally feasible image and video encryption/decryption algorithm based on DNA sequences. The main purpose of this algorithm is to reduce the big image encryption time. This algorithm is implemented by using the natural DNA sequences as main keys. The first part is the process of pixel scrambling. The original image is confused in the light of the scrambling sequence which is generated by the DNA sequence. The second part is the process of pixel replacement. The pixel gray values of the new image and the one of the three encryption templates generated by the other DNA sequence are XORed bit-by-bit in turn. The main scope of this paper is to propose an extension of this algorithm to videos and making it secure using modern Biological technology. A security analysis for the proposed system is performed and presented.

  16. Test Case Generation Based on Use case and Sequence Diagram

    Santosh Kumar Swain

    2010-07-01

    Full Text Available We present a comprehensive test case generation technique from UML models. We use the features in UML 2.0 sequence diagram including conditions, iterations, asynchronous messages and concurrent components. In our approach, test cases are derived from analysis artifacts such as use cases, their corresponding sequence diagrams and constraints specified across all these artifacts. We construct Use case Dependency Graph (UDG from use case diagram and Concurrent Control Flow Graph (CCFG from corresponding sequence diagrams for test sequence generation. We focus testing on sequences of messages among objects of use case scenarios. Our testing strategy derives test cases using full predicate coverage criteria. Our proposed test case generation technique can be used for integration and system testing accommodating the object message and condition information associated with the use case scenarios. The test cases thus generated are suitable for detecting synchronization and dependency of use cases and messages, object interaction and operational faults. Finally, we have made an analysis and comparison of our approach with existing approaches, which are based on other coverage criterion through an example.

  17. Application of combined mass spectrometry and partial amino acid sequence to the identification of gel-separated proteins.

    Patterson, S D; Thomas, D; Bradshaw, R A

    1996-05-01

    The combined use of peptide mass information with amino acid sequence information derived by chemical sequencing or mass spectrometry (MS)-based approaches provides a powerful means of protein identification. We have used a two-part strategy to identify proteins from nerve growth factor (NGF)-stimulated rat adrenal pheochromocytoma cell line PC-12 cell lysates that associate with the adaptor protein Shc (Shc homologous and collagen protein). Initial experiments with metabolically radiolabeled cell extracts separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) revealed a number of proteins that coimmunoprecipitated with anti-Shc antibody compared with control (unstimulated) cell extracts. The experiment was scaled up and cell lysate from NGF-stimulated PC-12 cells was applied to a glutathione-S-transferase (GST)-Shc affinity column, eluted, separated by SDS-PAGE and blotted to Immobilon-CD. The blotted proteins were proteolytically digested in situ, and the masses obtained from the extracted peptides were used in a peptide-mass search program in an attempt to identify the protein. Even if a strong candidate was found using this search, an additional step was performed to confirm the identification. The mixtures were fractionated by reversed-phase high-performance liquid chromatography (RP-HPLC) and subjected to chemical sequencing to obtain (partial) sequence information, or post-source decay (PSD-) matrix-assisted laser-desorption ionization (MALDI)-MS to obtain sequence-specific fragment ions. This data was used in a peptide-sequence tag search to confirm the identity of the proteins. This combined approach allowed identification of four proteins of M(r) 43,000 to 200,000. In one case the identified protein clearly did not correspond to the radiolabeled band, but to a protein contaminant from the column. The advantages and pitfalls of the approach are discussed. PMID:8783013

  18. Partial amino acid sequence of fructose-1,6-bisphosphatase from the blue-green algae Synechococcus leopoliensis.

    Marcus, F; Latshaw, S P; Steup, M; Gerbling, K P

    1989-08-01

    Purified fructose-1,6-bisphosphatase from the cyanobacterium Synechococcus leopoliensis was S-carboxymethylated and cleaved with trypsin. The resulting peptides were purified by reversed-phase high performance liquid chromatography and the amino acid sequence of six of the purified peptides was determined by gas-phase microsequencing. The results revealed sequence homology with other fructose-1,6-bisphosphatases. The obtained sequence data provides information required for the design of oligonucleotide hybridization probes to screen existing libraries of cyanobacterial DNA. The determination of the amino acid sequence of cyanobacterial proteins may yield important information with respect to the endosymbiotic theory of evolution. PMID:2550924

  19. Solid-State Nanopore-Based DNA Sequencing Technology

    Zewen Liu

    2016-01-01

    Full Text Available The solid-state nanopore-based DNA sequencing technology is becoming more and more attractive for its brand new future in gene detection field. The challenges that need to be addressed are diverse: the effective methods to detect base-specific signatures, the control of the nanopore’s size and surface properties, and the modulation of translocation velocity and behavior of the DNA molecules. Among these challenges, the realization of the high-quality nanopores with the help of modern micro/nanofabrication technologies is a crucial one. In this paper, typical technologies applied in the field of solid-state nanopore-based DNA sequencing have been reviewed.

  20. Generation of deviation parameters for amino acid singlets, doublets and triplets from three-dimensional structures of proteins and its implications for secondary structure prediction from amino acid sequences

    S A Mugilan; K Veluraja

    2000-03-01

    We present a new method, secondary structure prediction by deviation parameter (SSPDP) for predicting the secondary structure of proteins from amino acid sequence. Deviation parameters (DP) for amino acid singlets, doublets and triplets were computed with respect to secondary structural elements of proteins based on the dictionary of secondary structure prediction (DSSP)-generated secondary structure for 408 selected non-homologous proteins. To the amino acid triplets which are not found in the selected dataset, a DP value of zero is assigned with respect to the secondary structural elements of proteins. The total number of parameters generated is 15,432, in the possible parameters of 25,260. Deviation parameter is complete with respect to amino acid singlets, doublets, and partially complete with respect to amino acid triplets. These generated parameters were used to predict secondary structural elements from amino acid sequence. The secondary structure predicted by our method (SSPDP) was compared with that of single sequence (NNPREDICT) and multiple sequence (PHD) methods. The average value of the percentage of prediction accuracy for α-helix by SSPDP, NNPREDICT and PHD methods was found to be 57%, 44% and 69% respectively for the proteins in the selected dataset. For -strand the prediction accuracy is found to be 69%, 21% and 53% respectively by SSPDP, NNPREDICT and PHD methods. This clearly indicates that the secondary structure prediction by our method is as good as PHD method but much better than NNPREDICT method.

  1. Hypokalemic paralysis and acid-base balance

    Ivo Casagranda; Riccardo Boverio; Andrea Defrancisci; Sara Ferrillo; Francesca Gargiulo

    2006-01-01

    Three cases of hypokalemic paralysis are reported, presenting to the Emergency Department. The first is a patient with a hypokalemic periodic paralysis with a normal acid-base status, the second is a case of hypokalemic flaccid paralysis of all extremities with a normal anion gap metabolic acidosis, the last is a patient with a hypokalemic distal paralysis of right upper arm with metabolic alkalosis. Afterwards some pathophysiologic principles and the clinical aspects of hypokalemia are discu...

  2. Evolutionary insights from suffix array-based genome sequence analysis

    Anindya Poddar; Nagasuma Chandra; Madhavi Ganapathiraju; K Sekar; Judith Klein-Seetharaman; Raj Reddy; N Balakrishnan

    2007-08-01

    Gene and protein sequence analyses, central components of studies in modern biology are easily amenable to string matching and pattern recognition algorithms. The growing need of analysing whole genome sequences more efficiently and thoroughly, has led to the emergence of new computational methods. Suffix trees and suffix arrays are data structures, well known in many other areas and are highly suited for sequence analysis too. Here we report an improvement to the design of construction of suffix arrays. Enhancement in versatility and scalability, enabled by this approach, is demonstrated through the use of real-life examples. The scalability of the algorithm to whole genomes renders it suitable to address many biologically interesting problems. One example is the evolutionary insight gained by analysing unigrams, bi-grams and higher n-grams, indicating that the genetic code has a direct influence on the overall composition of the genome. Further, different proteomes have been analysed for the coverage of the possible peptide space, which indicate that as much as a quarter of the total space at the tetra-peptide level is left un-sampled in prokaryotic organisms, although almost all tri-peptides can be seen in one protein or another in a proteome. Besides, distinct patterns begin to emerge for the counts of particular tetra and higher peptides, indicative of a ‘meaning’ for tetra and higher n-grams. The toolkit has also been used to demonstrate the usefulness of identifying repeats in whole proteomes efficiently. As an example, 16 members of one COG, coded by the genome of Mycobacterium tuberculosis H37Rv have been found to contain a repeating sequence of 300 amino acids.

  3. Current and future developments in nucleic acid-based diagnostics

    The detection and characterization of specific nucleic acids of protozoa, rickettsia, bacteria and viruses have proven to be particularly useful for detecting pathogens of human and veterinary importance. It is also proving an invaluable tool for surveillance purposes and as a means of ensuring food security. Previous approaches towards pathogen isolation have often been tedious or even impossible. PCR, first conceived by Mullis in 1983, has proven to be a revolutionary technique for the rapid and accurate detection of numerous pathogens. The discovery and cloning of thermostable DNA polymerases has further contributed to this technology. Many additional developments, based on the basic principles of PCR, have been described e.g. RT-PCR, NASBA, RAPD, AFLP, LCR, PCR ELISA, strand displacement amplification (SDA), transcription-mediated amplification (TMA), branched DNA (bDNA), hybrid capture, immunocapture PCR. This list continues to expand with new variations on basic PCR principles. Improvements in thermocyclers involve the development of integrated amplification and signal detection systems, including on-line real-time devices. In addition, rugged portable instruments have been designed for field use. These are particularly useful as systems for early warning in detecting biowarfare agents and outbreaks of cross-boundary and other pathogens. Fluorophores, utilising principles of fluorescence resonance energy transfer, are used as labels for probes in such real-time assays. Molecular beacon technology also utilises such mechanisms. Real-time thermocyclers allow the monitoring of amplified DNA as well as establishing sequence characteristics based on melting or hybridisation curves. Taqman chemistry makes use of such a system. Stem-loop DNA probes have been designed to have increased specificity for target recognition and include molecular beacon methodologies, suppression PCR approaches and hairpin probes in DNA microarrays. Automated sample processing or robotic

  4. Automating the Photogrammetric Bridging Based on MMS Image Sequence Processing

    Silva, J. F. C.; Lemes Neto, M. C.; Blasechi, V.

    2014-11-01

    The photogrammetric bridging or traverse is a special bundle block adjustment (BBA) for connecting a sequence of stereo-pairs and of determining the exterior orientation parameters (EOP). An object point must be imaged in more than one stereo-pair. In each stereo-pair the distance ratio between an object and its corresponding image point varies significantly. We propose to automate the photogrammetric bridging based on a fully automatic extraction of homologous points in stereo-pairs and on an arbitrary Cartesian datum to refer the EOP and tie points. The technique uses SIFT algorithm and the keypoint matching is given by similarity descriptors of each keypoint based on the smallest distance. All the matched points are used as tie points. The technique was applied initially to two pairs. The block formed by four images was treated by BBA. The process follows up to the end of the sequence and it is semiautomatic because each block is processed independently and the transition from one block to the next depends on the operator. Besides four image blocks (two pairs), we experimented other arrangements with block sizes of six, eight, and up to twenty images (respectively, three, four, five and up to ten bases). After the whole image pairs sequence had sequentially been adjusted in each experiment, a simultaneous BBA was run so to estimate the EOP set of each image. The results for classical ("normal case") pairs were analyzed based on standard statistics regularly applied to phototriangulation, and they show figures to validate the process.

  5. Revision of Begomovirus taxonomy based on pairwise sequence comparisons

    Brown, Judith K.

    2015-04-18

    Viruses of the genus Begomovirus (family Geminiviridae) are emergent pathogens of crops throughout the tropical and subtropical regions of the world. By virtue of having a small DNA genome that is easily cloned, and due to the recent innovations in cloning and low-cost sequencing, there has been a dramatic increase in the number of available begomovirus genome sequences. Even so, most of the available sequences have been obtained from cultivated plants and are likely a small and phylogenetically unrepresentative sample of begomovirus diversity, a factor constraining taxonomic decisions such as the establishment of operationally useful species demarcation criteria. In addition, problems in assigning new viruses to established species have highlighted shortcomings in the previously recommended mechanism of species demarcation. Based on the analysis of 3,123 full-length begomovirus genome (or DNA-A component) sequences available in public databases as of December 2012, a set of revised guidelines for the classification and nomenclature of begomoviruses are proposed. The guidelines primarily consider a) genus-level biological characteristics and b) results obtained using a standardized classification tool, Sequence Demarcation Tool, which performs pairwise sequence alignments and identity calculations. These guidelines are consistent with the recently published recommendations for the genera Mastrevirus and Curtovirus of the family Geminiviridae. Genome-wide pairwise identities of 91 % and 94 % are proposed as the demarcation threshold for begomoviruses belonging to different species and strains, respectively. Procedures and guidelines are outlined for resolving conflicts that may arise when assigning species and strains to categories wherever the pairwise identity falls on or very near the demarcation threshold value.

  6. alpha-Amylase gene of Streptomyces limosus: nucleotide sequence, expression motifs, and amino acid sequence homology to mammalian and invertebrate alpha-amylases.

    Long, C M; Virolle, M J; Chang, S Y; Chang, S.; Bibb, M.J.

    1987-01-01

    The nucleotide sequence of the coding and regulatory regions of the alpha-amylase gene (aml) of Streptomyces limosus was determined. High-resolution S1 mapping was used to locate the 5' end of the transcript and demonstrated that the gene is transcribed from a unique promoter. The predicted amino acid sequence has considerable identity to mammalian and invertebrate alpha-amylases, but not to those of plant, fungal, or eubacterial origin. Consistent with this is the susceptibility of the enzym...

  7. Genome Sequence Analysis of the Naphthenic Acid Degrading and Metal Resistant Bacterium Cupriavidus gilardii CR3.

    Xiaoyu Wang

    Full Text Available Cupriavidus sp. are generally heavy metal tolerant bacteria with the ability to degrade a variety of aromatic hydrocarbon compounds, although the degradation pathways and substrate versatilities remain largely unknown. Here we studied the bacterium Cupriavidus gilardii strain CR3, which was isolated from a natural asphalt deposit, and which was shown to utilize naphthenic acids as a sole carbon source. Genome sequencing of C. gilardii CR3 was carried out to elucidate possible mechanisms for the naphthenic acid biodegradation. The genome of C. gilardii CR3 was composed of two circular chromosomes chr1 and chr2 of respectively 3,539,530 bp and 2,039,213 bp in size. The genome for strain CR3 encoded 4,502 putative protein-coding genes, 59 tRNA genes, and many other non-coding genes. Many genes were associated with xenobiotic biodegradation and metal resistance functions. Pathway prediction for degradation of cyclohexanecarboxylic acid, a representative naphthenic acid, suggested that naphthenic acid undergoes initial ring-cleavage, after which the ring fission products can be degraded via several plausible degradation pathways including a mechanism similar to that used for fatty acid oxidation. The final metabolic products of these pathways are unstable or volatile compounds that were not toxic to CR3. Strain CR3 was also shown to have tolerance to at least 10 heavy metals, which was mainly achieved by self-detoxification through ion efflux, metal-complexation and metal-reduction, and a powerful DNA self-repair mechanism. Our genomic analysis suggests that CR3 is well adapted to survive the harsh environment in natural asphalts containing naphthenic acids and high concentrations of heavy metals.

  8. Heterodimeric l-amino acid oxidase enzymes from Egyptian Cerastes cerastes venom: Purification, biochemical characterization and partial amino acid sequencing

    A.E. El Hakim

    2015-12-01

    Full Text Available Two l-amino acid oxidase enzyme isoforms, Cc-LAAOI and Cc-LAAOII were purified to apparent homogeneity from Cerastes cerastes venom in a sequential two-step chromatographic protocol including; gel filtration and anion exchange chromatography. The native molecular weights of the isoforms were 115 kDa as determined by gel filtration on calibrated Sephacryl S-200 column, while the monomeric molecular weights of the enzymes were, 60, 56 kDa and 60, 53 kDa for LAAOI and LAAOII, respectively. The tryptic peptides of the two isoforms share high sequence homology with other snake venom l-amino acid oxidases. The optimal pH and temperature values of Cc-LAAOI and Cc-LAAOII were 7.8, 50 °C and 7, 60 °C, respectively. The two isoenzymes were thermally stable up to 70 °C. The Km and Vmax values were 0.67 mM, 0.135 μmol/min for LAAOI and 0.82 mM, 0.087 μmol/min for LAAOII. Both isoenzymes displayed high catalytic preference to long-chain, hydrophobic and aromatic amino acids. The Mn2+ ion markedly increased the LAAO activity for both purified isoforms, while Na+, K+, Ca2+, Mg2+ and Ba2+ ions showed a non-significant increase in the enzymatic activity of both isoforms. Furthermore, Zn2+, Ni2+, Co2+, Cu2+ and AL3+ ions markedly inhibited the LAAOI and LAAOII activities. l-Cysteine and reduced glutathione completely inhibited the LAAO activity of both isoenzymes, whereas, β-mercaptoethanol, O-phenanthroline and PMSF completely inhibited the enzymatic activity of LAAOII. Furthermore, iodoacitic acid inhibited the enzymatic activity of LAAOII by 46% and had no effect on the LAAOI activity.

  9. A Correlational Encoder Decoder Architecture for Pivot Based Sequence Generation

    SAHA, AMRITA; Khapra, Mitesh M.; Chandar, Sarath; Rajendran, Janarthanan; Cho, Kyunghyun

    2016-01-01

    Interlingua based Machine Translation (MT) aims to encode multiple languages into a common linguistic representation and then decode sentences in multiple target languages from this representation. In this work we explore this idea in the context of neural encoder decoder architectures, albeit on a smaller scale and without MT as the end goal. Specifically, we consider the case of three languages or modalities X, Z and Y wherein we are interested in generating sequences in Y starting from inf...

  10. Development in Rice Genome Research Based on Accurate Genome Sequence

    2008-01-01

    Rice is one of the most important crops in the world. Although genetic improvement is a key technology for the acceleration of rice breeding, a lack of genome information had restricted efforts in molecular-based breeding until the completion of the high-quality rice genome sequence, which opened new opportunities for research in various areas of genomics. The syntenic relationship of the rice genome to other cereal genomes makes the rice genome invaluable for understanding how cereal genomes...

  11. A Refinement of Perfect Equilibria Based On Substitute Sequences

    Aliprantis, C. D.; I. Topolyan

    2009-01-01

    We propose an equilibrium refinement of strict perfect equilibrium for the finite normal form games, which is not known in the literature. Okada came up with the idea of strict perfect equilibrium by strengthening the main definition of a perfect equilibrium, due to Selten [14]. We consider the alternative (and equivalent) definition of perfect equilibrium, based on the substitute sequences, as appeared in Selten [14]. We show that by strengthening and modifiyng this definition slightly, one ...

  12. Sequencing of oligonucleotide phosphorothioates based on solid-supported desulfurization.

    Wyrzykiewicz, T K; Cole, D L

    1994-01-01

    We described a solid-supported desulfurization procedure allowing easy access to the sequence analysis of oligonucleotide phosphorothioates. The described method is based upon selective removal of the 2-cyanoethyl phosphate protecting groups, followed by iodine-promoted desulfurization of the resulting phosphorothioate diesters. Automatic oxidation of oligonucleotide phosphorothioates, anchored via an ester linkage to a standard solid support (LCAA/CPG), is combined with Maxam-Gilbert solid-s...

  13. Sequence-defined bioactive macrocycles via an acid-catalysed cascade reaction

    Porel, Mintu; Thornlow, Dana N.; Phan, Ngoc N.; Alabi, Christopher A.

    2016-06-01

    Synthetic macrocycles derived from sequence-defined oligomers are a unique structural class whose ring size, sequence and structure can be tuned via precise organization of the primary sequence. Similar to peptides and other peptidomimetics, these well-defined synthetic macromolecules become pharmacologically relevant when bioactive side chains are incorporated into their primary sequence. In this article, we report the synthesis of oligothioetheramide (oligoTEA) macrocycles via a one-pot acid-catalysed cascade reaction. The versatility of the cyclization chemistry and modularity of the assembly process was demonstrated via the synthesis of >20 diverse oligoTEA macrocycles. Structural characterization via NMR spectroscopy revealed the presence of conformational isomers, which enabled the determination of local chain dynamics within the macromolecular structure. Finally, we demonstrate the biological activity of oligoTEA macrocycles designed to mimic facially amphiphilic antimicrobial peptides. The preliminary results indicate that macrocyclic oligoTEAs with just two-to-three cationic charge centres can elicit potent antibacterial activity against Gram-positive and Gram-negative bacteria.

  14. Complete Genome Sequence of Lactococcus lactis IO-1, a Lactic Acid Bacterium That Utilizes Xylose and Produces High Levels of l-Lactic Acid

    Kato, Hiroaki; Shiwa, Yuh; Oshima, Kenshiro; Machii, Miki; Araya-Kojima, Tomoko; Zendo, Takeshi; Shimizu-Kadota, Mariko; Hattori, Masahira; Sonomoto, Kenji; Yoshikawa, Hirofumi

    2012-01-01

    We report the complete genome sequence of Lactococcus lactis IO-1 (= JCM7638). It is a nondairy lactic acid bacterium, produces nisin Z, ferments xylose, and produces predominantly l-lactic acid at high xylose concentrations. From ortholog analysis with other five L. lactis strains, IO-1 was identified as L. lactis subsp. lactis.

  15. Morphological tranformation of calcite crystal growth by prismatic "acidic" polypeptide sequences.

    Kim, I; Giocondi, J L; Orme, C A; Collino, J; Evans, J S

    2007-02-13

    Many of the interesting mechanical and materials properties of the mollusk shell are thought to stem from the prismatic calcite crystal assemblies within this composite structure. It is now evident that proteins play a major role in the formation of these assemblies. Recently, a superfamily of 7 conserved prismatic layer-specific mollusk shell proteins, Asprich, were sequenced, and the 42 AA C-terminal sequence region of this protein superfamily was found to introduce surface voids or porosities on calcite crystals in vitro. Using AFM imaging techniques, we further investigate the effect that this 42 AA domain (Fragment-2) and its constituent subdomains, DEAD-17 and Acidic-2, have on the morphology and growth kinetics of calcite dislocation hillocks. We find that Fragment-2 adsorbs on terrace surfaces and pins acute steps, accelerates then decelerates the growth of obtuse steps, forms clusters and voids on terrace surfaces, and transforms calcite hillock morphology from a rhombohedral form to a rounded one. These results mirror yet are distinct from some of the earlier findings obtained for nacreous polypeptides. The subdomains Acidic-2 and DEAD-17 were found to accelerate then decelerate obtuse steps and induce oval rather than rounded hillock morphologies. Unlike DEAD-17, Acidic-2 does form clusters on terrace surfaces and exhibits stronger obtuse velocity inhibition effects than either DEAD-17 or Fragment-2. Interestingly, a 1:1 mixture of both subdomains induces an irregular polygonal morphology to hillocks, and exhibits the highest degree of acute step pinning and obtuse step velocity inhibition. This suggests that there is some interplay between subdomains within an intra (Fragment-2) or intermolecular (1:1 mixture) context, and sequence interplay phenomena may be employed by biomineralization proteins to exert net effects on crystal growth and morphology.

  16. Amino acid sequence of the cold-active alkaline phosphatase from Atlantic cod (Gadus morhua)

    Asgeirsson, Bjarni; Nielsen, Berit Noesgaard; Højrup, Peter

    2003-01-01

    Atlantic cod is a marine fish that lives at low temperatures of 0-10 degrees C and contains a cold-adapted alkaline phosphatase (AP). Preparations of AP from either the lower part of the intestines or the pyloric caeca area were subjected to proteolytic digestion, mass spectrometry and amino acid...... sequencing by Edman degradation. The primary structure exhibits greatest similarity to human tissue non-specific AP (80%), and approximately 30% similarity to AP from Escherichia coli. The key residues required for catalysis are conserved in the cod AP, except for the third metal binding site, where cod AP...

  17. Translating sanger-based routine DNA diagnostics into generic massive parallel ion semiconductor sequencing

    Diekstra, A.; Bosgoed, E.A.J.; Rikken, A.; Lier, B. van; Kamsteeg, E.J.; Tychon, M.W.J.; Derks, R.C.; Soest, R.A.; Mensenkamp, A.R.; Scheffer, H.; Neveling, K.; Nelen, M.R.

    2015-01-01

    BACKGROUND: Dideoxy-based chain termination sequencing developed by Sanger is the gold standard sequencing approach and allows clinical diagnostics of disorders with relatively low genetic heterogeneity. Recently, new next generation sequencing (NGS) technologies have found their way into diagnostic

  18. Frequencies of amino acid strings in globular protein sequences indicate suppression of blocks of consecutive hydrophobic residues

    Schwartz, Russell; Istrail, Sorin; King, Jonathan

    2001-01-01

    Patterns of hydrophobic and hydrophilic residues play a major role in protein folding and function. Long, predominantly hydrophobic strings of 20–22 amino acids each are associated with transmembrane helices and have been used to identify such sequences. Much less attention has been paid to hydrophobic sequences within globular proteins. In prior work on computer simulations of the competition between on-pathway folding and off-pathway aggregate formation, we found that long sequences of cons...

  19. Watermarking scheme of colour image based on chaotic sequences

    LIU Nian-sheng; GUO Dong-hui

    2009-01-01

    The proposed perceptual mask is based on the singularity of cover image and matches very well with the properties of the human visual system. The cover colour image is decomposed into several subbands by the wavelet transform. The water-mark composed of chaotic sequence and the covert image is embedded into the subband with the largest energy. The chaos system plays an important role in the security invisibility and robustness of the proposed scheme. The parameter and initial state of chaos system can directly influence the generation of watermark information as a key. Moreover, the watermark information has the property of spread spectrum signal by chaotic sequence to improve the invisibility and security of watermarked image. Experimental results and comparisons with other watermarking techniques prove that the proposed algorithm is effective and feasible, and improves the security, invisibility and robustness of watermarking information.

  20. [Determination of body fluid based on analysis of nucleic acids].

    Korabečná, Marie

    2015-01-01

    Recent methodological approaches of molecular genetics allow isolation of nucleic acids (DNA and RNA) from negligible forensic samples. Analysis of these molecules may be used not only for individual identification based on DNA profiling but also for the detection of origin of the body fluid which (alone or in mixture with other body fluids) forms the examined biological trace. Such an examination can contribute to the evaluation of procedural, technical and tactical value of the trace. Molecular genetic approaches discussed in the review offer new possibilities in comparison with traditional spectrum of chemical, immunological and spectroscopic tests especially with regard to the interpretation of mixtures of biological fluids and to the confirmatory character of the tests. Approaches based on reverse transcription of tissue specific mRNA and their subsequent polymerase chain reaction (PCR) and fragmentation analysis are applicable on samples containing minimal amounts of biological material. Methods for body fluid discrimination based on examination of microRNA in samples provided so far confusing results therefore further development in this field is needed. The examination of tissue specific methylation of nucleotides in selected gene sequences seems to represent a promising enrichment of the methodological spectrum. The detection of DNA sequences of tissue related bacteria has been established and it provides satisfactory results mainly in combination with above mentioned methodological approaches. PMID:26419517

  1. Draft Genome Sequence of Bacillus subtilis GXA-28, a Thermophilic Strain with High Productivity of Poly-γ-Glutamic Acid

    Zeng, Wei; Chen, Guiguang; Tang, Zhen; Wu, Hao; Shu, Lin; Liang, Zhiqun

    2014-01-01

    Bacillus subtilis GXA-28 is a thermophilic strain that can produce high yield and high molecular weight of poly-γ-glutamic acid under high temperature. Here, we report the draft genome sequence of this strain, which may provide the genomic basis for the high productivity of poly-γ-glutamic acid.

  2. Draft Genome Sequences of Gluconobacter cerinus CECT 9110 and Gluconobacter japonicus CECT 8443, Acetic Acid Bacteria Isolated from Grape Must

    Sainz, Florencia

    2016-01-01

    We report here the draft genome sequences of Gluconobacter cerinus strain CECT9110 and Gluconobacter japonicus CECT8443, acetic acid bacteria isolated from grape must. Gluconobacter species are well known for their ability to oxidize sugar alcohols into the corresponding acids. Our objective was to select strains to oxidize effectively d-glucose. PMID:27365351

  3. FiveS rRNA sequences and fatty acid profiles of colourless sulfur-oxidising bacteria

    LokaBharathi, P.A.; Ortiz-conde, B.A; Nair, S.; Chandramohan, D.; Colwell, R.R.

    these at the molecular level, 5S ribosomal ribonucleic acid (5S rRNA) sequences have been determined. Fatty acid profiles showed strain 29 to be related to Pseudomonas vesicularis with an E.D. of 5.965 and similarity index of 0.182. The nearest organism of strain 82...

  4. Biodegradable polyesters based on succinic acid

    Nikolić Marija S.

    2003-01-01

    Full Text Available Two series of aliphatic polyesters based on succinic acid were synthesized by copolymerization with adipic acid for the first series of saturated polyesters, and with fumaric acid for the second series. Polyesters were prepared starting from the corresponding dimethyl esters and 1,4-butanediol by melt transesterification in the presence of a highly effective catalyst tetra-n-butyl-titanate, Ti(0Bu4. The molecular structure and composition of the copolyesters was determined by 1H NMR spectroscopy. The effect of copolymer composition on the physical and thermal properties of these random polyesters were investigated using differential scanning calorimetry. The degree of crystallinity was determined by DSC and wide angle X-ray. The degrees of crystallinity of the saturated and unsaturated copolyesters were generally reduced with respect to poly(butylene succinate, PBS. The melting temperatures of the saturated polyesters were lower, while the melting temperatures of the unsaturated copolyesters were higher than the melting temperature of PBS. The biodegradability of the polyesters was investigated by enzymatic degradation tests. The enzymatic degradation tests were performed in a buffer solution with Candida cylindracea lipase and for the unsaturated polyesters with Rhizopus arrhizus lipase. The extent of biodegradation was quantified as the weight loss of polyester films. Also the surface of the polyester films after degradation was observed using optical microscopy. It could be concluded that the biodegradability depended strongly on the degree of crystallinity, but also on the flexibility of the chain backbone. The highest biodegradation was observed for copolyesters containing 50 mol.% of adipic acid units, and in the series of unsaturated polyesters for copolyesters containing 5 and 10 mol.% of fumarate units. Although the degree of crystallinity of the unsaturated polyesters decreased slightly with increasing unsaturation, the biodegradation

  5. Prediction of potential drug targets based on simple sequence properties

    Lai Luhua

    2007-09-01

    Full Text Available Abstract Background During the past decades, research and development in drug discovery have attracted much attention and efforts. However, only 324 drug targets are known for clinical drugs up to now. Identifying potential drug targets is the first step in the process of modern drug discovery for developing novel therapeutic agents. Therefore, the identification and validation of new and effective drug targets are of great value for drug discovery in both academia and pharmaceutical industry. If a protein can be predicted in advance for its potential application as a drug target, the drug discovery process targeting this protein will be greatly speeded up. In the current study, based on the properties of known drug targets, we have developed a sequence-based drug target prediction method for fast identification of novel drug targets. Results Based on simple physicochemical properties extracted from protein sequences of known drug targets, several support vector machine models have been constructed in this study. The best model can distinguish currently known drug targets from non drug targets at an accuracy of 84%. Using this model, potential protein drug targets of human origin from Swiss-Prot were predicted, some of which have already attracted much attention as potential drug targets in pharmaceutical research. Conclusion We have developed a drug target prediction method based solely on protein sequence information without the knowledge of family/domain annotation, or the protein 3D structure. This method can be applied in novel drug target identification and validation, as well as genome scale drug target predictions.

  6. JRC GMO-Amplicons: a collection of nucleic acid sequences related to genetically modified organisms.

    Petrillo, Mauro; Angers-Loustau, Alexandre; Henriksson, Peter; Bonfini, Laura; Patak, Alex; Kreysa, Joachim

    2015-01-01

    The DNA target sequence is the key element in designing detection methods for genetically modified organisms (GMOs). Unfortunately this information is frequently lacking, especially for unauthorized GMOs. In addition, patent sequences are generally poorly annotated, buried in complex and extensive documentation and hard to link to the corresponding GM event. Here, we present the JRC GMO-Amplicons, a database of amplicons collected by screening public nucleotide sequence databanks by in silico determination of PCR amplification with reference methods for GMO analysis. The European Union Reference Laboratory for Genetically Modified Food and Feed (EU-RL GMFF) provides these methods in the GMOMETHODS database to support enforcement of EU legislation and GM food/feed control. The JRC GMO-Amplicons database is composed of more than 240 000 amplicons, which can be easily accessed and screened through a web interface. To our knowledge, this is the first attempt at pooling and collecting publicly available sequences related to GMOs in food and feed. The JRC GMO-Amplicons supports control laboratories in the design and assessment of GMO methods, providing inter-alia in silico prediction of primers specificity and GM targets coverage. The new tool can assist the laboratories in the analysis of complex issues, such as the detection and identification of unauthorized GMOs. Notably, the JRC GMO-Amplicons database allows the retrieval and characterization of GMO-related sequences included in patents documentation. Finally, it can help annotating poorly described GM sequences and identifying new relevant GMO-related sequences in public databases. The JRC GMO-Amplicons is freely accessible through a web-based portal that is hosted on the EU-RL GMFF website. Database URL: http://gmo-crl.jrc.ec.europa.eu/jrcgmoamplicons/. PMID:26424080

  7. Parameters of proteome evolution from histograms of amino-acid sequence identities of paralogous proteins

    Yan Koon-Kiu

    2007-11-01

    Full Text Available Abstract Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model that allows one to extract some of this information and apply it to the set of all pairs of paralogous proteins in H. pylori, E. coli, S. cerevisiae, C. elegans, D. melanogaster, and H. sapiens. It was found that the histogram of sequence identities p generated by an all-to-all alignment of all protein sequences encoded in a genome is well fitted with a power-law form ~ p-γ with the value of the exponent γ around 4 for the majority of organisms used in this study. This implies that the intra-protein variability of substitution rates is best described by the Gamma-distribution with the exponent α ≈ 0.33. Different features of the shape of such histograms allow us to quantify the ratio between the genome-wide average deletion/duplication rates and the amino-acid substitution rate. Conclusion We separately measure the short-term ("raw" duplication and deletion rates rdup∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsgaKjabbwha1jabbchaWbqaaiabgEHiQaaaaaa@3283@, rdel∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsga

  8. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Meiler Arno

    2012-09-01

    Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  9. Clostridium sticklandii, a specialist in amino acid degradation:revisiting its metabolism through its genome sequence

    Pelletier Eric

    2010-10-01

    Full Text Available Abstract Background Clostridium sticklandii belongs to a cluster of non-pathogenic proteolytic clostridia which utilize amino acids as carbon and energy sources. Isolated by T.C. Stadtman in 1954, it has been generally regarded as a "gold mine" for novel biochemical reactions and is used as a model organism for studying metabolic aspects such as the Stickland reaction, coenzyme-B12- and selenium-dependent reactions of amino acids. With the goal of revisiting its carbon, nitrogen, and energy metabolism, and comparing studies with other clostridia, its genome has been sequenced and analyzed. Results C. sticklandii is one of the best biochemically studied proteolytic clostridial species. Useful additional information has been obtained from the sequencing and annotation of its genome, which is presented in this paper. Besides, experimental procedures reveal that C. sticklandii degrades amino acids in a preferential and sequential way. The organism prefers threonine, arginine, serine, cysteine, proline, and glycine, whereas glutamate, aspartate and alanine are excreted. Energy conservation is primarily obtained by substrate-level phosphorylation in fermentative pathways. The reactions catalyzed by different ferredoxin oxidoreductases and the exergonic NADH-dependent reduction of crotonyl-CoA point to a possible chemiosmotic energy conservation via the Rnf complex. C. sticklandii possesses both the F-type and V-type ATPases. The discovery of an as yet unrecognized selenoprotein in the D-proline reductase operon suggests a more detailed mechanism for NADH-dependent D-proline reduction. A rather unusual metabolic feature is the presence of genes for all the enzymes involved in two different CO2-fixation pathways: C. sticklandii harbours both the glycine synthase/glycine reductase and the Wood-Ljungdahl pathways. This unusual pathway combination has retrospectively been observed in only four other sequenced microorganisms. Conclusions Analysis of the C

  10. Isolation and amino acid sequences of squirrel monkey (Saimiri sciurea) insulin and glucagon

    It was reported two decades ago that insulin was not detectable in the glucose-stimulated state in Saimiri sciurea, the New World squirrel monkey, by a radioimmunoassay system developed with guinea pig anti-pork insulin antibody and labeled park insulin. With the same system, reasonable levels were observed in rhesus monkeys and chimpanzees. This suggested that New World monkeys, like the New World hystricomorph rodents such as the guinea pig and the coypu, might have insulins whose sequences differ markedly from those of Old World mammals. In this report the authors describe the purification and amino acid sequences of squirrel monkey insulin and glucagon. They demonstrate that the substitutions at B29, B27, A2, A4, and A17 of squirrel monkey insulin are identical with those previously found in another New World primate, the owl monkey (Aotus trivirgatus). The immunologic cross-reactivity of this insulin in their immunoassay system is only a few percent of that of human insulin. It appears that the peptides of the New World monkeys have diverged less from those of the Old World mammals than have those of the New World hystricomorph rodents. The striking improvements in peptide purification and sequencing have the potential for adding new information concerning the evolutionary divergence of species

  11. Complete amino acid sequence of the myoglobin from the Pacific spotted dolphin, Stenella attenuata graffmani.

    Jones, B N; Wang, C C; Dwulet, F E; Lehman, L D; Meuth, J L; Bogardt, R A; Gurd, F R

    1979-04-25

    The complete amino acid sequence of the major component myoglobin from the Pacific spotted dolphin, Stenella attenuata graffmani, was determined by the automated Edman degradation of several large peptides obtained by specific cleavage of the protein. The acetimidated apomyoglobin was selectively cleaved at its two methionyl residues with cyanogen bromide and at its three arginyl residues by trypsin. By subjecting four of these peptides and the apomyoglobin to automated Edman degradation, over 80% of the primary structure of the protein was obtained. The remainder of the covalent structure was determined by the sequence analysis of peptides that resulted from further digestion of the central cyanogen bromide fragment. This fragment was cleaved at its glutamyl residues with staphylococcal protease and its lysyl residues with trypsin. The action of trypsin was restricted to the lysyl residues by chemical modification of the single arginyl residue of the fragment with 1,2-cyclohexanedione. The primary structure of this myoglobin proved to be identical with that from the Atlantic bottlenosed dolphin and Pacific common dolphin but differs from the myoglobins of the killer whale and pilot whale at two positions. The above sequence identities and differences reflect the close taxonomic relationship of these five species of Cetacea. PMID:454657

  12. Isolation and amino acid sequences of squirrel monkey (Saimiri sciurea) insulin and glucagon

    Yu, Jinghua (Veterans Administration Medical Center, Bronx, NY (United States)); Eng, J.; Yalow, R.S. (Veterans Administration Medical Center, Bronx, NY (United States) City Univ. of New York, NY (United States))

    1990-12-01

    It was reported two decades ago that insulin was not detectable in the glucose-stimulated state in Saimiri sciurea, the New World squirrel monkey, by a radioimmunoassay system developed with guinea pig anti-pork insulin antibody and labeled park insulin. With the same system, reasonable levels were observed in rhesus monkeys and chimpanzees. This suggested that New World monkeys, like the New World hystricomorph rodents such as the guinea pig and the coypu, might have insulins whose sequences differ markedly from those of Old World mammals. In this report the authors describe the purification and amino acid sequences of squirrel monkey insulin and glucagon. They demonstrate that the substitutions at B29, B27, A2, A4, and A17 of squirrel monkey insulin are identical with those previously found in another New World primate, the owl monkey (Aotus trivirgatus). The immunologic cross-reactivity of this insulin in their immunoassay system is only a few percent of that of human insulin. It appears that the peptides of the New World monkeys have diverged less from those of the Old World mammals than have those of the New World hystricomorph rodents. The striking improvements in peptide purification and sequencing have the potential for adding new information concerning the evolutionary divergence of species.

  13. Quantitative sequence-function relationships in proteins based on gene ontology

    Lesk Arthur M

    2007-08-01

    Full Text Available Abstract Background The relationship between divergence of amino-acid sequence and divergence of function among homologous proteins is complex. The assumption that homologs share function – the basis of transfer of annotations in databases – must therefore be regarded with caution. Here, we present a quantitative study of sequence and function divergence, based on the Gene Ontology classification of function. We determined the relationship between sequence divergence and function divergence in 6828 protein families from the PFAM database. Within families there is a broad range of sequence similarity from very closely related proteins – for instance, orthologs in different mammals – to very distantly-related proteins at the limit of reliable recognition of homology. Results We correlated the divergence in sequences determined from pairwise alignments, and the divergence in function determined by path lengths in the Gene Ontology graph, taking into account the fact that many proteins have multiple functions. Our results show that, among homologous proteins, the proportion of divergent functions decreases dramatically above a threshold of sequence similarity at about 50% residue identity. For proteins with more than 50% residue identity, transfer of annotation between homologs will lead to an erroneous attribution with a totally dissimilar function in fewer than 6% of cases. This means that for very similar proteins (about 50 % identical residues the chance of completely incorrect annotation is low; however, because of the phenomenon of recruitment, it is still non-zero. Conclusion Our results describe general features of the evolution of protein function, and serve as a guide to the reliability of annotation transfer, based on the closeness of the relationship between a new protein and its nearest annotated relative.

  14. Generalization of entropy based divergence measures for symbolic sequence analysis.

    Miguel A Ré

    Full Text Available Entropy based measures have been frequently used in symbolic sequence analysis. A symmetrized and smoothed form of Kullback-Leibler divergence or relative entropy, the Jensen-Shannon divergence (JSD, is of particular interest because of its sharing properties with families of other divergence measures and its interpretability in different domains including statistical physics, information theory and mathematical statistics. The uniqueness and versatility of this measure arise because of a number of attributes including generalization to any number of probability distributions and association of weights to the distributions. Furthermore, its entropic formulation allows its generalization in different statistical frameworks, such as, non-extensive Tsallis statistics and higher order Markovian statistics. We revisit these generalizations and propose a new generalization of JSD in the integrated Tsallis and Markovian statistical framework. We show that this generalization can be interpreted in terms of mutual information. We also investigate the performance of different JSD generalizations in deconstructing chimeric DNA sequences assembled from bacterial genomes including that of E. coli, S. enterica typhi, Y. pestis and H. influenzae. Our results show that the JSD generalizations bring in more pronounced improvements when the sequences being compared are from phylogenetically proximal organisms, which are often difficult to distinguish because of their compositional similarity. While small but noticeable improvements were observed with the Tsallis statistical JSD generalization, relatively large improvements were observed with the Markovian generalization. In contrast, the proposed Tsallis-Markovian generalization yielded more pronounced improvements relative to the Tsallis and Markovian generalizations, specifically when the sequences being compared arose from phylogenetically proximal organisms.

  15. Species specific amino acid sequence-protein local structure relationships: An analysis in the light of a structural alphabet.

    de Brevern, Alexandre G; Joseph, Agnel Praveen

    2011-05-01

    Protein structure analysis and prediction methods are based on non-redundant data extracted from the available protein structures, regardless of the species from which the protein originates. Hence, these datasets represent the global knowledge on protein folds, which constitutes a generic distribution of amino acid sequence-protein structure (AAS-PS) relationships. In this study, we try to elucidate whether the AAS-PS relationship could possess specificities depending on the specie. For this purpose, we have chosen three different species: Saccharomyces cerevisiae, Plasmodium falciparum and Arabidopsis thaliana. We analyzed the AAS-PS behaviors of the proteins from these three species and compared it to the "expected" distribution of a classical non-redundant databank. With the classical secondary structure description, only slight differences in amino acid preferences could be observed. With a more precise description of local protein structures (Protein Blocks), significant changes could be highlighted. S. cerevisiae's AAS-PS relationship is close to the general distribution, while striking differences are observed in the case of A. thaliana. P. falciparum is the most distant one. This study presents some interesting view-points on AAS-PS relationship. Certain species exhibit unique preferences for amino acids to be associated with protein local structural elements. Thus, AAS-PS relationships are species dependent. These results can give useful insights for improving prediction methodologies which take the species specific information into account. PMID:21333657

  16. Analysis of Sequence Based Classifier Prediction for HIV Subtypes

    S. Santhosh Kumar

    2012-10-01

    Full Text Available Human immunodeficiency virus (HIV is a lent virus that causes acquired immunodeficiency syndrome (AIDS. The main drawback in HIV treatment process is its sub type prediction. The sub type and group classification of HIV is based on its genetic variability and location. HIV can be divided into two major types, HIV type 1 (HIV-1 and HIV type 2 (HIV-2. Many classifier approaches have been used to classify HIV subtypes based on their group, but some of cases are having two groups in one; in such cases the classification becomes more complex. The methodology used is this paper based on the HIV sequences. For this work several classifier approaches are used to classify the HIV1 and HIV2. For implementation of the work a real time patient database is taken and the patient records are experimented and the final best classifier is identified with quick response time and least error rate.

  17. Next-Generation Sequencing-Based Molecular Diagnosis of Choroideremia

    Kayo Shimizu

    2015-07-01

    Full Text Available We screened patients with choroideremia using next-generation sequencing (NGS and identified a novel mutation and a known mutation in the CHM gene. One patient presented an atypical fundus appearance for choroideremia. Another patient presented macular hole retinal detachment in the left eye. The present case series shows the utility of NGS-based screening in patients with choroideremia. In addition, the presence of macular hole in 1 of the 2 patients, together with a previous report, indicated the susceptibility of patients with choroideremia to macular hole.

  18. Comparison of sequencing-based methods to profile DNA methylation and identification of monoallelic epigenetic modifications

    Analysis of DNA methylation patterns relies increasingly on sequencing-based profiling methods. The four most frequently used sequencing-based technologies are the bisulfite-based methods MethylC-seq and reduced representation bisulfite sequencing (RRBS), and the enrichment-based techniques methylat...

  19. Implications of HLA sequence-based typing in transplantation

    Shankarkumar U

    2008-01-01

    Full Text Available Serology-based conventional microlymphocytotoxicity HLA typing method, which has been regarded as the gold standard in organ and hematopoietic stem cell transplantation, has been replaced now by DNA-based typing. Many laboratories all over the world have already switched over to molecular methods. Microlymphocytotoxicity-based tissue typing was done using commercial sera, while the molecular typing by genomic DNA based. DNA quality and its quantity obtained using various DNA extraction protocols was found to be an important factor in the molecular method of tissue typing in transplant outcome. Many polymerase chain reaction-based molecular techniques have been adopted with far reaching clinical outcome. The sequence-based typing (SBT has been the ultimate technique, which has been of the highest reliability in defining the HLA alleles. The nonavailability of specific HLA antisera from native populations, large number of blank alleles yet to be defined and comparable low resolution of HLA alleles in SSP or SSOP technique, suggests that highly refined DNA-based methods like SBT should be used as an adjunct to HLA serology and/or low/intermediate/high resolution HLA typing in order to achieve a better transplant outcome.

  20. Sequence-structure based phylogeny of GPCR Class A Rhodopsin receptors.

    Kakarala, Kavita Kumari; Jamil, Kaiser

    2014-05-01

    Current methods of G protein coupled receptors (GPCRs) phylogenetic classification are sequence based and therefore inappropriate for highly divergent sequences, sharing low sequence identity. In this study, sequence structure profile based alignment generated by PROMALS3D was used to understand the GPCR Class A Rhodopsin superfamily evolution using the MEGA 5 software. Phylogenetic analysis included a combination of Neighbor-Joining method and Maximum Likelihood method, with 1000 bootstrap replicates. Our study was able to identify potential ligand association for Class A Orphans and putative/unclassified Class A receptors with no cognate ligand information: GPR21 and GPR52 with fatty acids; GPR75 with Neuropeptide Y; GPR82, GPR18, GPR141 with N-arachidonylglycine; GPR176 with Free fatty acids, GPR10 with Tachykinin & Neuropeptide Y; GPR85 with ATP, ADP & UDP glucose; GPR151 with Galanin; GPR153 and GPR162 with Adrenalin, Noradrenalin; GPR146, GPR139, GPR142 with Neuromedin, Ghrelin, Neuromedin U-25 & Thyrotropin-releasing hormone; GPR171 with ATP, ADP & UDP Glucose; GPR88, GPR135, GPR161, GPR101with 11-cis-retinal; GPR83 with Tackykinin; GPR148 with Prostanoids, GPR109b, GPR81, GPR31with ATP & UTP and GPR150 with GnRH I & GnRHII. Furthermore, we suggest that this study would prove useful in re-classification of receptors, selecting templates for homology modeling and identifying ligands which may show cross reactivity with other GPCRs as signaling via multiple ligands play a significant role in disease modulation. PMID:24503482

  1. Sequence and structural features of binding site residues in protein-protein complexes: comparison with protein-nucleic acid complexes

    Selvaraj S

    2011-10-01

    Full Text Available Abstract Background Protein-protein interactions are important for several cellular processes. Understanding the mechanism of protein-protein recognition and predicting the binding sites in protein-protein complexes are long standing goals in molecular and computational biology. Methods We have developed an energy based approach for identifying the binding site residues in protein–protein complexes. The binding site residues have been analyzed with sequence and structure based parameters such as binding propensity, neighboring residues in the vicinity of binding sites, conservation score and conformational switching. Results We observed that the binding propensities of amino acid residues are specific for protein-protein complexes. Further, typical dipeptides and tripeptides showed high preference for binding, which is unique to protein-protein complexes. Most of the binding site residues are highly conserved among homologous sequences. Our analysis showed that 7% of residues changed their conformations upon protein-protein complex formation and it is 9.2% and 6.6% in the binding and non-binding sites, respectively. Specifically, the residues Glu, Lys, Leu and Ser changed their conformation from coil to helix/strand and from helix to coil/strand. Leu, Ser, Thr and Val prefer to change their conformation from strand to coil/helix. Conclusions The results obtained in this study will be helpful for understanding and predicting the binding sites in protein-protein complexes.

  2. Scanning mutagenesis of the amino acid sequences flanking phosphorylation site 1 of the mitochondrial pyruvate dehydrogenase complex

    Nagib eAhsan

    2012-07-01

    Full Text Available The mitochondrial pyruvate dehydrogenase complex is regulated by reversible seryl-phosphorylation of the E1α subunit by a dedicated, intrinsic kinase. The phospho-complex is reactivated when dephosphorylated by an intrinsic PP2C-type protein phosphatase. Both the position of the phosphorylated Ser-residue and the sequences of the flanking amino acids are highly conserved. We have used the synthetic peptide-based kinase client assay plus recombinant pyruvate dehydrogenase E1α and E1α-kinase to perform scanning mutagenesis of the residues flanking the site of phosphorylation. Consistent with the results from phylogenetic analysis of the flanking sequences, the direct peptide-based kinase assays tolerated very few changes. Even conservative changes such as Leu, Ile, or Val for Met, or Glu for Asp, gave very marked reductions in phosphorylation. Overall the results indicate that regulation of the mitochondrial pyruvate dehydrogenase complex by reversible phosphorylation is an extreme example of multiple, interdependent instances of co-evolution.

  3. Rapid and Sensitive Isothermal Detection of Nucleic-acid Sequence by Multiple Cross Displacement Amplification

    Yi Wang; Yan Wang; Ai-Jing Ma; Dong-Xun Li; Li-Juan Luo; Dong-Xin Liu; Dong Jin; Kai Liu; Chang-Yun Ye

    2015-01-01

    We have devised a novel amplification strategy based on isothermal strand-displacement polymerization reaction, which was termed multiple cross displacement amplification (MCDA). The approach employed a set of ten specially designed primers spanning ten distinct regions of target sequence and was preceded at a constant temperature (61–65 °C). At the assay temperature, the double-stranded DNAs were at dynamic reaction environment of primer-template hybrid, thus the high concentration of primer...

  4. Large scale clustering of protein sequences with FORCE -A layout based heuristic for weighted cluster editing

    Baumbach Jan

    2007-10-01

    Full Text Available Abstract Background Detecting groups of functionally related proteins from their amino acid sequence alone has been a long-standing challenge in computational genome research. Several clustering approaches, following different strategies, have been published to attack this problem. Today, new sequencing technologies provide huge amounts of sequence data that has to be efficiently clustered with constant or increased accuracy, at increased speed. Results We advocate that the model of weighted cluster editing, also known as transitive graph projection is well-suited to protein clustering. We present the FORCE heuristic that is based on transitive graph projection and clusters arbitrary sets of objects, given pairwise similarity measures. In particular, we apply FORCE to the problem of protein clustering and show that it outperforms the most popular existing clustering tools (Spectral clustering, TribeMCL, GeneRAGE, Hierarchical clustering, and Affinity Propagation. Furthermore, we show that FORCE is able to handle huge datasets by calculating clusters for all 192 187 prokaryotic protein sequences (66 organisms obtained from the COG database. Finally, FORCE is integrated into the corynebacterial reference database CoryneRegNet. Conclusion FORCE is an applicable alternative to existing clustering algorithms. Its theoretical foundation, weighted cluster editing, can outperform other clustering paradigms on protein homology clustering. FORCE is open source and implemented in Java. The software, including the source code, the clustering results for COG and CoryneRegNet, and all evaluation datasets are available at http://gi.cebitec.uni-bielefeld.de/comet/force/.

  5. Physiological roles of acid-base sensors.

    Levin, Lonny R; Buck, Jochen

    2015-01-01

    Acid-base homeostasis is essential for life. The macromolecules upon which living organisms depend are sensitive to pH changes, and physiological systems use the equilibrium between carbon dioxide, bicarbonate, and protons to buffer their pH. Biological processes and environmental insults are constantly challenging an organism's pH; therefore, to maintain a consistent and proper pH, organisms need sensors that measure pH and that elicit appropriate responses. Mammals use multiple sensors for measuring both intracellular and extracellular pH, and although some mammalian pH sensors directly measure protons, it has recently become apparent that many pH-sensing systems measure pH via bicarbonate-sensing soluble adenylyl cyclase. PMID:25340964

  6. Comparison of the chromosomal localization of murine and human glucocerebrosidase genes and of the deduced amino acid sequences

    To study structure-function relationships and molecular evolution, the authors determined the nucleotide sequence and chromosomal location of the gene encoding murine glucocerebrosidase. In the protein coding region of the murine cDNA, the nucleotide sequence and the corresponding deduced amino acid sequences were 82% and 86% identical to the respective humans sequences. All five amino acids presently known to be essential for normal enzymatic activity were conserved between mouse and man. The murine enzyme had a single deletion relative to the human enzyme at amino acid number 273. One ATG translation initiation signal was present in the mouse sequence in contrast to the human sequence, where two start codons have been reported. Nucleotide sequencing of a clone derived from murine genomic DNA revealed that the murine signal for translation initiation was located in exon 2. The locations of all 10 introns were conserved among mouse and man. They mapped the genetic locus for glucocerebrosidase to mouse chromosome 3, at a position 7.6 ± 3.2 centimorgans from the locus for the β subunit of nerve growth factor. Comparison of linkage relationships in the human and murine genome indicates that these closely linked mouse genes are also syntenic on human chromosome 1 but in positions that span the centromere

  7. Mutation-selection models of coding sequence evolution with site-heterogeneous amino acid fitness profiles.

    Rodrigue, Nicolas; Philippe, Hervé; Lartillot, Nicolas

    2010-03-01

    Modeling the interplay between mutation and selection at the molecular level is key to evolutionary studies. To this end, codon-based evolutionary models have been proposed as pertinent means of studying long-range evolutionary patterns and are widely used. However, these approaches have not yet consolidated results from amino acid level phylogenetic studies showing that selection acting on proteins displays strong site-specific effects, which translate into heterogeneous amino acid propensities across the columns of alignments; related codon-level studies have instead focused on either modeling a single selective context for all codon columns, or a separate selective context for each codon column, with the former strategy deemed too simplistic and the latter deemed overparameterized. Here, we integrate recent developments in nonparametric statistical approaches to propose a probabilistic model that accounts for the heterogeneity of amino acid fitness profiles across the coding positions of a gene. We apply the model to a dozen real protein-coding gene alignments and find it to produce biologically plausible inferences, for instance, as pertaining to site-specific amino acid constraints, as well as distributions of scaled selection coefficients. In their account of mutational features as well as the heterogeneous regimes of selection at the amino acid level, the modeling approaches studied here can form a backdrop for several extensions, accounting for other selective features, for variable population size, or for subtleties of mutational features, all with parameterizations couched within population-genetic theory. PMID:20176949

  8. Genome Sequence of Lactobacillus saerimneri 30a (Formerly Lactobacillus sp. Strain 30a), a Reference Lactic Acid Bacterium Strain Producing Biogenic Amines

    Romano, Andrea; Trip, Hein; Campbell-Sills, Hugo; Bouchez, Olivier; Sherman, David; Lolkema, Juke S.; Lucas, Patrick M

    2013-01-01

    Lactobacillus sp. strain 30a (Lactobacillus saerimneri) produces the biogenic amines histamine, putrescine, and cadaverine by decarboxylating their amino acid precursors. We report its draft genome sequence (1,634,278 bases, 42.6% G+C content) and the principal findings from its annotation, which might shed light onto the enzymatic machineries that are involved in its production of biogenic amines.

  9. The amino acid alphabet and the architecture of the protein sequence-structure map. I. Binary alphabets.

    Ferrada, Evandro

    2014-12-01

    The correspondence between protein sequences and structures, or sequence-structure map, relates to fundamental aspects of structural, evolutionary and synthetic biology. The specifics of the mapping, such as the fraction of accessible sequences and structures, or the sequences' ability to fold fast, are dictated by the type of interactions between the monomers that compose the sequences. The set of possible interactions between monomers is encapsulated by the potential energy function. In this study, I explore the impact of the relative forces of the potential on the architecture of the sequence-structure map. My observations rely on simple exact models of proteins and random samples of the space of potential energy functions of binary alphabets. I adopt a graph perspective and study the distribution of viable sequences and the structures they produce, as networks of sequences connected by point mutations. I observe that the relative proportion of attractive, neutral and repulsive forces defines types of potentials, that induce sequence-structure maps of vastly different architectures. I characterize the properties underlying these differences and relate them to the structure of the potential. Among these properties are the expected number and relative distribution of sequences associated to specific structures and the diversity of structures as a function of sequence divergence. I study the types of binary potentials observed in natural amino acids and show that there is a strong bias towards only some types of potentials, a bias that seems to characterize the folding code of natural proteins. I discuss implications of these observations for the architecture of the sequence-structure map of natural proteins, the construction of random libraries of peptides, and the early evolution of the natural amino acid alphabet. PMID:25473967

  10. Trypsin inhibitors from ridged gourd (Luffa acutangula Linn.) seeds: purification, properties, and amino acid sequences.

    Haldar, U C; Saha, S K; Beavis, R C; Sinha, N K

    1996-02-01

    Two trypsin inhibitors, LA-1 and LA-2, have been isolated from ridged gourd (Luffa acutangula Linn.) seeds and purified to homogeneity by gel filtration followed by ion-exchange chromatography. The isoelectric point is at pH 4.55 for LA-1 and at pH 5.85 for LA-2. The Stokes radius of each inhibitor is 11.4 A. The fluorescence emission spectrum of each inhibitor is similar to that of the free tyrosine. The biomolecular rate constant of acrylamide quenching is 1.0 x 10(9) M-1 sec-1 for LA-1 and 0.8 x 10(9) M-1 sec-1 for LA-2 and that of K2HPO4 quenching is 1.6 x 10(11) M-1 sec-1 for LA-1 and 1.2 x 10(11) M-1 sec-1 for LA-2. Analysis of the circular dichroic spectra yields 40% alpha-helix and 60% beta-turn for La-1 and 45% alpha-helix and 55% beta-turn for LA-2. Inhibitors LA-1 and LA-2 consist of 28 and 29 amino acid residues, respectively. They lack threonine, alanine, valine, and tryptophan. Both inhibitors strongly inhibit trypsin by forming enzyme-inhibitor complexes at a molar ratio of unity. A chemical modification study suggests the involvement of arginine of LA-1 and lysine of LA-2 in their reactive sites. The inhibitors are very similar in their amino acid sequences, and show sequence homology with other squash family inhibitors. PMID:8924202

  11. CLUSS: Clustering of protein sequences based on a new similarity measure

    Brzezinski Ryszard

    2007-08-01

    Full Text Available Abstract Background The rapid burgeoning of available protein data makes the use of clustering within families of proteins increasingly important. The challenge is to identify subfamilies of evolutionarily related sequences. This identification reveals phylogenetic relationships, which provide prior knowledge to help researchers understand biological phenomena. A good evolutionary model is essential to achieve a clustering that reflects the biological reality, and an accurate estimate of protein sequence similarity is crucial to the building of such a model. Most existing algorithms estimate this similarity using techniques that are not necessarily biologically plausible, especially for hard-to-align sequences such as proteins with different domain structures, which cause many difficulties for the alignment-dependent algorithms. In this paper, we propose a novel similarity measure based on matching amino acid subsequences. This measure, named SMS for Substitution Matching Similarity, is especially designed for application to non-aligned protein sequences. It allows us to develop a new alignment-free algorithm, named CLUSS, for clustering protein families. To the best of our knowledge, this is the first alignment-free algorithm for clustering protein sequences. Unlike other clustering algorithms, CLUSS is effective on both alignable and non-alignable protein families. In the rest of the paper, we use the term "phylogenetic" in the sense of "relatedness of biological functions". Results To show the effectiveness of CLUSS, we performed an extensive clustering on COG database. To demonstrate its ability to deal with hard-to-align sequences, we tested it on the GH2 family. In addition, we carried out experimental comparisons of CLUSS with a variety of mainstream algorithms. These comparisons were made on hard-to-align and easy-to-align protein sequences. The results of these experiments show the superiority of CLUSS in yielding clusters of proteins

  12. Characterization of N-glycosylation and amino acid sequence features of immunoglobulins from swine.

    Lopez, Paul G; Girard, Lauren; Buist, Marjorie; de Oliveira, Andrey Giovanni Gomes; Bodnar, Edward; Salama, Apolline; Soulillou, Jean-Paul; Perreault, Hélène

    2016-02-01

    The primary goal of this study was to develop a method to study the N-glycosylation of IgG from swine in order to detect epitopes containing N-glycolylneuraminic acid (Neu5Gc) and/or terminal galactose residues linked in α1-3 susceptible to cause xenograft-related problems. Samples of immunoglobulin were isolated from porcine serum using protein-A affinity chromatography. The eluate was then separated on electrophoretic gel, and bands corresponding to the N-glycosylated heavy chains were cut off the gel and subjected to tryptic digestion. Peptides and glycopeptides were separated by reversed phase liquid chromatography and fractions were collected for matrix-assisted laser desorption/ionization time-of-flight mass spectrometric (MALDI-TOF-MS) analysis. Overall no α1-3 galactose was detected, as demonstrated by complete susceptibility of terminal galactose residues to β-galactosidase digestion. Neu5Gc was detected on singly sialylated structures. Two major N-glycopeptides were found, EEQFNSTYR and EAQFNSTYR as determined by tandem MS (MS/MS), as previously reported by Butler et al. (Immunogenetics, 61, 2009, 209-230), who found 11 subclasses for porcine IgG. Out of the 11, ten include the sequence corresponding to EEQFNSTYR, and only one codes for EAQFNSTYR. In this study, glycosylation patterns associated with both chains were slightly different, in that EEQFNSTYR had a higher content of galactose. The last step of this study consisted of peptide-mapping the 11 reported porcine IgG sequences. Although there was considerable overlap, at least one unique tryptic peptide was found per IgG sequence. The workflow presented in this manuscript constitutes the first study to use MALDI-TOF-MS in the investigation of porcine IgG structural features. PMID:26586247

  13. Human Retroviruses and AIDS. A compilation and analysis of nucleic acid and amino acid sequences: I--II; III--V

    Myers, G.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States); Wain-Hobson, S. [ed.] [Laboratory of Molecular Retrovirology, Pasteur Inst.; Smith, R.F. [ed.] [Baylor Coll. of Medicine, Houston, TX (United States). Dept. of Pharmacology; Pavlakis, G.N. [ed.] [National Cancer Inst., Frederick, MD (United States). Cancer Research Facility

    1993-12-31

    This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (I) HIV and SIV Nucleotide Sequences; (II) Amino Acid Sequences; (III) Analyses; (IV) Related Sequences; and (V) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.

  14. Targeting of an Interrupted Polypurine:Polypyrimidine Sequence in Mammalian Cells by a Triplex-Forming Oligonucleotide Containing a Novel Base Analogue†

    Semenyuk, A.; Darian, E.; Liu, J; Majumdar, A; Cuenoud, B; Miller, P S; MacKerell, A.D.; Seidman, M M

    2010-01-01

    The DNA triple helix consists of a third strand of nucleic acid lying in the major groove of an intact DNA duplex. The most stable triplexes form on polypurine:polypyrimidine sequences, and pyrimidine interruptions in the purine strand are destabilizing. Sequence stringency is imparted by specific Hoogsteen hydrogen bonds between third strand bases and the purine bases in the duplex. Appropriate base and sugar modifications of triple helix-forming oligonucleotides (TFOs) confer chromosome tar...

  15. Development of Sequence-Based Microsatellite Marker for Phalaenopsis Orchid

    FATIMAH

    2011-06-01

    Full Text Available Phalaenopsis is one of the most interesting genera of orchids due to the members are often used as parents to produce hybrids. The establishment and development of highly reliable and discriminatory methods for identifying species and cultivars has become increasingly more important to plant breeders and members of the nursery industry. The aim of this research was to develop sequence-based microsatellite (eSSR markers for the Phalaenopsis orchid designed from the sequence of GenBank NCBI. Seventeen primers were designed and thirteen primers pairs could amplify the DNA giving the expected PCR product with polymorphism. A total of 51 alleles, with an average of 3 alleles per locus and polymorphism information content (PIC values at 0.674, were detected at the 16 SSR loci. Therefore, these markers could be used for identification of the Phalaenopsis orchid used in this study. Genetic similarity and principle coordinate analysis identified five major groups of Phalaenopsis sp. the first group consisted of P. amabilis, P. fuscata, P. javanica, and P. zebrine. The second group consisted of P. amabilis, P. amboinensis, P. bellina, P. floresens, and P. mannii. The third group consisted of P. bellina, P. cornucervi, P. cornucervi, P. violaceae sumatra, P. modesta. The forth group consisted of P. cornucervi and P. lueddemanniana, and the fifth group was P. amboinensis.

  16. Lactic acid production from potato peel waste by anaerobic sequencing batch fermentation using undefined mixed culture.

    Liang, Shaobo; McDonald, Armando G; Coats, Erik R

    2015-11-01

    Lactic acid (LA) is a necessary industrial feedstock for producing the bioplastic, polylactic acid (PLA), which is currently produced by pure culture fermentation of food carbohydrates. This work presents an alternative to produce LA from potato peel waste (PPW) by anaerobic fermentation in a sequencing batch reactor (SBR) inoculated with undefined mixed culture from a municipal wastewater treatment plant. A statistical design of experiments approach was employed using set of 0.8L SBRs using gelatinized PPW at a solids content range from 30 to 50 g L(-1), solids retention time of 2-4 days for yield and productivity optimization. The maximum LA production yield of 0.25 g g(-1) PPW and highest productivity of 125 mg g(-1) d(-1) were achieved. A scale-up SBR trial using neat gelatinized PPW (at 80 g L(-1) solids content) at the 3 L scale was employed and the highest LA yield of 0.14 g g(-1) PPW and a productivity of 138 mg g(-1) d(-1) were achieved with a 1 d SRT. PMID:25708409

  17. Site-directed gene mutation at mixed sequence targets by psoralen-conjugated pseudo-complementary peptide nucleic acids

    Kim, Ki-Hyun; Nielsen, Peter E.; Glazer, Peter M.

    2007-01-01

    Sequence-specific DNA-binding molecules such as triple helix-forming oligonucleotides (TFOs) provide a means for inducing site-specific mutagenesis and recombination at chromosomal sites in mammalian cells. However, the utility of TFOs is limited by the requirement for homopurine stretches in the target duplex DNA. Here, we report the use of pseudo-complementary peptide nucleic acids (pcPNAs) for intracellular gene targeting at mixed sequence sites. Due to steric hindrance, pcPNAs are unable ...

  18. Nucleotide and amino acid sequence coding for polypeptides of foot-and-mouth disease virus type A12.

    Robertson, B H; Grubman, M J; Weddell, G N; Moore, D.M.; Welsh, J D; Fischer, T.; Dowbenko, D J; Yansura, D G; Small, B.; Kleid, D G

    1985-01-01

    The coding region for the structural and nonstructural polypeptides of the type A12 foot-and-mouth disease virus genome has been identified by nucleotide sequencing of cloned DNA derived from the viral RNA. In addition, 704 nucleotides in the 5' untranslated region between the polycytidylic acid tract and the probable initiation codon of the first translated gene, P16-L, have been sequenced. This region has several potential initiation codons, one of which appears to be a low-frequency altern...

  19. Similarity Measurement of Web Sessions Based on Sequence Alignment

    LI Chaofeng; LU Yansheng

    2007-01-01

    The task of clustering Web sessions is to group Web sessions based on similarity and consists of maximizing the intra-group similarity while minimizing the inter-group similarity.The first and foremost question needed to be considered in clustering Web sessions is how to measure the similarity between Web sessions. However, there are many shortcomings in traditional measurements. This paper introduces a new method for measuring similarities between Web pages that takes into account not only the URL but also the viewing time of the visited Web page. Then we give a new method to measure the similarity of Web sessions using sequence alignment and the similarity of Web page access in detail.Experiments have proved that our method is valid and efficient.

  20. Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides

    McMillen, Chelsea L.; Wright, Patience M.; Cassady, Carolyn J.

    2016-05-01

    Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides.

  1. Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides.

    McMillen, Chelsea L; Wright, Patience M; Cassady, Carolyn J

    2016-05-01

    Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides. Graphical Abstract ᅟ. PMID:26864792

  2. Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides

    McMillen, Chelsea L.; Wright, Patience M.; Cassady, Carolyn J.

    2016-02-01

    Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides.

  3. Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

    Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution

  4. Thermochemical comparisons of homogeneous and heterogeneous acids and bases. 1. Sulfonic acid solutions and resins as prototype Broensted acids

    Arnett, E.M.; Haaksma, R.A.; Chawla, B.; Healy, M.H.

    1986-08-06

    Heats of ionization by thermometric titration for a series of bases (or acids) can be used to compare solid acids (or bases) with liquid analogues bearing the same functionalities in homogeneous solutions. The method is demonstrated for Broensted acids by reacting a series of substituted nitrogen bases with solutions of p-toluenesulfonic acid (PTSA) in acetonitrile and with suspensions of the microporous polymeric arylsulfonic acid resin-Dowex 50W-X8 in the same solvent. Under well-controlled anhydrous conditions there is a good correlation (r = 0.992) between the heats of reaction of the bases with the homogeneous and heterogeneous acid systems, but the homogeneous system gives a more exothermic interaction by 3-4 kcal mol/sup -1/ for a series of 29 substituted pyrimidines, anilines, and some other amines. This difference may be attributed to homohydrogen bonding interactions between excess acid and sulfonate anion sites which are more restricted geometrically in the resin than in solution. Other factors which affect the enthalpy change for the acid-base interaction are the acid/base ratio, the water content of the sulfonic acid, the solvent, and the resin structure (e.g., microporous vs. macroporous). Steric hindrance in the base does not differentiate solid from homogeneous acid. In addition to the use of titration calorimetry, heats of immersion are reported for the Dowex-arylsulfonic acid resins and the Nafion-perfluorinated sulfonic acid resin in a series of basic liquids. The results are compared with each other and with those from a previous study of several varieties of coal.

  5. GPCODON ALIGNMENT: A GLOBAL PAIRWISE CODON BASED SEQUENCE ALIGNMENT APPROACH

    Zeinab A. Fareed

    2016-02-01

    Full Text Available The alignment of two DNA sequences is a basic step in the analysis of biological data. Sequencing a long DNA sequence is one of the most interesting problems in bioinformatics. Several techniques have been developed to solve this sequence alignment problem like dynamic programming and heuristic algorithms. In this paper, we introduce (GPCodon alignment a pairwise DNA-DNA method for global sequence alignment that improves the accuracy of pairwise sequence alignment. We use a new scoring matrix to produce the final alignment called the empirical codon substitution matrix. Using this matrix in our technique enabled the discovery of new relationships between sequences that could not be discovered using traditional matrices. In addition, we present experimental results that show the performance of the proposed technique over eleven datasets of average length of 2967 bps. We compared the efficiency and accuracy of our techniques against a comparable tool called “Pairwise Align Codons” [1].

  6. A DNA Structure-Based Bionic Wavelet Transform and Its Application to DNA Sequence Analysis

    Fei Chen; Yuan-Ting Zhang

    2003-01-01

    DNA sequence analysis is of great significance for increasing our understanding of genomic functions. An important task facing us is the exploration of hidden structural information stored in the DNA sequence. This paper introduces a DNA structure-based adaptive wavelet transform (WT) – the bionic wavelet transform (BWT) – for DNA sequence analysis. The symbolic DNA sequence can be separated into four channels of indicator sequences. An adaptive symbol-to-number mapping, determined from the s...

  7. AbCD: arbitrary coverage design for sequencing-based genetic studies

    Kang, Jian; Huang, Kuan-Chieh; Xu, Zheng; Wang, Yunfei; Abecasis, Gonçalo R.; Li, Yun

    2013-01-01

    Summary: Recent advances in sequencing technologies have revolutionized genetic studies. Although high-coverage sequencing can uncover most variants present in the sequenced sample, low-coverage sequencing is appealing for its cost effectiveness. Here, we present AbCD (arbitrary coverage design) to aid the design of sequencing-based studies. AbCD is a user-friendly interface providing pre-estimated effective sample sizes, specific to each minor allele frequency category, for designs with arbi...

  8. ACID-BASE INTERACTIONS BETWEEN POLYMERS AND FILLERS

    WANG Qingguo; CHEN Fute; HUANG Yuanfu; ZHOU Qingli

    1987-01-01

    Inverse gas chromatography(IGC) and Fourier-transform infrared (FT-IR) techniques were applied to determining the relative acid-base strength of polymers and coupling agents. The acid-base characteristics of fillers such as CaCO3 could be altered by treatment with different coupling agents. It was shown that some mechanical properties of filled polymers were obviously associated with acid-base interactions between polymers and fillers.

  9. SIMILARITY ANALYSIS OF DNA SEQUENCES BASED ON THE CHEMICAL PROPERTIES OF NUCLEOTIDE BASES, FREQUENCY AND POSITION OF GROUP MUTATIONS

    Fatima KABLI

    2016-01-01

    Full Text Available The DNA sequences similarity analysis approaches have been based on the representation and the frequency of sequences components; however, the position inside sequence is important information for the sequence data. Whereas, insufficient information in sequences representations is important reason that causes poor similarity results. Based on three classifications of the DNA bases according to their chemical properties, the frequencies and average positions of group mutations have been grouped into two twelve-components vectors, the Euclidean distances among introduced vectors applied to compare the coding sequences of the first exon of beta globin gene of 11 species.

  10. A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome

    Kumar, Ashutosh; Singh, Himanshu N.; Pareek, Vikas; Raza, Khursheed; Dantham, Subrahamanyam; Kumar, Pavan; Mochan, Sankat; Faiq, Muneeb A.

    2016-01-01

    Owing to the reports of microcephaly as a consistent outcome in the fetuses of pregnant women infected with ZIKV in Brazil, Zika virus (ZIKV)—microcephaly etiomechanistic relationship has recently been implicated. Researchers, however, are still struggling to establish an embryological basis for this interesting causal handcuff. The present study reveals robust evidence in favor of a plausible ZIKV-microcephaly cause-effect liaison. The rationale is based on: (1) sequence homology between ZIKV genome and the response element of an early neural tube developmental marker “retinoic acid” in human DNA and (2) comprehensive similarities between the details of brain defects in ZIKV-microcephaly and retinoic acid embryopathy. Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5′–AGGTCA–3′) in promoter regions of retinoic acid-dependent genes. We screened genomic sequences of already reported virulent ZIKV strains (including those linked to microcephaly) and other viruses available in National Institute of Health genetic sequence database (GenBank) for the RARE consensus repeats and obtained results strongly bolstering our hypothesis that ZIKV strains associated with microcephaly may act through precipitation of dysregulation in retinoic acid-dependent genes by introducing extra stretches of RARE consensus sequence repeats in the genome of developing brain cells. Additional support to our hypothesis comes from our findings that screening of other viruses for RARE consensus sequence repeats is positive only for those known to display neurotropism and cause fetal brain defects (for which maternal-fetal transmission during developing stage may be required). The numbers of RARE sequence repeats appeared to match with the virulence of screened positive viruses. Although, bioinformatic evidence and

  11. Enhanced Acid/Base Catalysis in High Temperature Liquid Water

    Xiu Yang LU; Qi JING; Zhun LI; Lei YUAN; Fei GAO; Xin LIU

    2006-01-01

    Two novel and environmentally benign solvent systems, organic acids-enriched high temperature liquid water (HTLW) and NH3-enriched HTLW, were developed, which can enhance the reaction rate of acid/base-catalyzed organic reactions in HTLW. We investigated the decomposition of fructose in organic acids-enriched HTLW, hydrolysis of cinnamaldehyde and aldol condensation of phenylaldehyde with acetaldehyde in NH3-enriched HTLW. The experimental results demonstrated that organic acids-enriched or NH3-enriched HTLW can greatly accelerate acid/base-catalyzed organic reactions in HTLW.

  12. Java Implementation based Heterogeneous Video Sequence Automated Surveillance Monitoring

    Sankari Muthukarupan

    2013-04-01

    Full Text Available Automated video based surveillance monitoring is an essential and computationally challenging task to resolve issues in the secure access localities. This paper deals with some of the issues which are encountered in the integration surveillance monitoring in the real-life circumstances. We have employed video frames which are extorted from heterogeneous video formats. Each video frame is chosen to identify the anomalous events which are occurred in the sequence of time-driven process. Background subtraction is essentially required based on the optimal threshold and reference frame. Rest of the frames are ablated from reference image, hence all the foreground images paradigms are obtained. The co-ordinate existing in the deducted images is found by scanning the images horizontally until the occurrence of first black pixel. Obtained coordinate is twinned with existing co-ordinates in the primary images. The twinned co-ordinate in the primary image is considered as an active-region-of-interest. At the end, the starred images are converted to temporal video that scrutinizes the moving silhouettes of human behaviors in a static background. The proposed model is implemented in Java. Results and performance analysis are carried out in the real-life environments.

  13. Advances in nucleic acid-based detection methods.

    Wolcott, M J

    1992-01-01

    Laboratory techniques based on nucleic acid methods have increased in popularity over the last decade with clinical microbiologists and other laboratory scientists who are concerned with the diagnosis of infectious agents. This increase in popularity is a result primarily of advances made in nucleic acid amplification and detection techniques. Polymerase chain reaction, the original nucleic acid amplification technique, changed the way many people viewed and used nucleic acid techniques in cl...

  14. The Teaching of Biochemistry: An Innovative Course Sequence Based on the Logic of Chemistry

    Jakubowski, Henry V.; Owen, Whyte G.

    1998-06-01

    An innovative course sequence for the teaching of biochemistry is offered, which more truly reflects the common philosophy found in biochemistry texts: that the foundation of biological phenomena can best be understood through the logic of chemistry. Topic order is chosen to develop an emerging understanding that is based on chemical principles. Preeminent biological questions serve as a framework for the course. Lipid and lipid-aggregate structures are introduced first, since it is more logical to discuss the intermolecular association of simple amphiphiles to form micelle and bilayer formations than to discuss the complexities of protein structure/folding. Protein, nucleic acid, and carbohydrate structures are studied next. Binding, a noncovalent process and the simplest expression of macromolecular function, follows. The physical (noncovalent) transport of solute molecules across a biological membrane is studied next, followed by the chemical transformation of substrates by enzymes. These are logical extensions of the expression of molecular function, first involving a simpler (physical transport) and second, a more complex (covalent transformation) process. The final sequence involves energy and signal transduction. This unique course sequence emerges naturally when chemical logic is used as an organizing paradigm for structuring a biochemistry course. Traditional order, which seems to reflect historic trends in research, or even an order derived from the central dogma of biology can not provide this logical framework.

  15. Effect of acute acid loading on acid-base and calcium metabolism

    Osther, Palle J

    2006-01-01

    OBJECTIVE: To investigate the acid-base and calcium metabolic responses to acute non-carbonic acid loading in idiopathic calcium stone-formers and healthy males using a quantitative organ physiological approach. MATERIAL AND METHODS: Five-h ammonium chloride loading studies were performed in 12...... male recurrent idiopathic calcium stone-formers and 12 matched healthy men using a randomized, placebo-controlled, cross-over design. Arterialized capillary blood, serum and urine were collected hourly for measurement of electrolytes, ionized calcium, magnesium, phosphate, parathyroid hormone and acid-base...... status. Concentrations of non-metabolizable base (NB) and acid (NA) were calculated from measured concentrations of non-metabolizable ions. RESULTS: The extracellular acid-base status in the stone-formers during basal conditions and acid loading was comparable to the levels in the healthy controls...

  16. N-terminal amino acid sequence of Bacillus licheniformis alpha-amylase: comparison with Bacillus amyloliquefaciens and Bacillus subtilis Enzymes.

    Kuhn, H; Fietzek, P P; Lampen, J. O.

    1982-01-01

    The thermostable, liquefying alpha-amylase from Bacillus licheniformis was immunologically cross-reactive with the thermolabile, liquefying alpha-amylase from Bacillus amyloliquefaciens. Their N-terminal amino acid sequences showed extensive homology with each other, but not with the saccharifying alpha-amylases of Bacillus subtilis.

  17. Draft Genome Sequence of Lactobacillus delbrueckii subsp. bulgaricus CFL1, a Lactic Acid Bacterium Isolated from French Handcrafted Fermented Milk

    Meneghel, Julie; Irlinger, Françoise; Loux, Valentin; Vidal, Marie; Passot, Stéphanie; Béal, Catherine; Layec, Séverine

    2016-01-01

    Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) is a lactic acid bacterium widely used for the production of yogurt and cheeses. Here, we report the genome sequence of L. bulgaricus CFL1 to improve our knowledge on its stress-induced damages following production and end-use processes. PMID:26941141

  18. Draft Genome Sequence of Lactobacillus delbrueckii subsp. bulgaricus CFL1, a Lactic Acid Bacterium Isolated from French Handcrafted Fermented Milk.

    Meneghel, Julie; Dugat-Bony, Eric; Irlinger, Françoise; Loux, Valentin; Vidal, Marie; Passot, Stéphanie; Béal, Catherine; Layec, Séverine; Fonseca, Fernanda

    2016-01-01

    Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) is a lactic acid bacterium widely used for the production of yogurt and cheeses. Here, we report the genome sequence of L. bulgaricus CFL1 to improve our knowledge on its stress-induced damages following production and end-use processes. PMID:26941141

  19. Genome Sequence of Corynebacterium glutamicum ATCC 14067, Which Provides Insight into Amino Acid Biosynthesis in Coryneform Bacteria

    Lv, Yangyong; Liao, Juanjun; Wu, Zhanhong; Han, Shuangyan; Lin, Ying; Zheng, Suiping

    2012-01-01

    We report the genome sequence of Corynebacterium glutamicum ATCC 14067 (once named Brevibacterium flavum), which is useful for taxonomy research and further molecular breeding in amino acid production. Preliminary comparison with those of the reported coryneform strains revealed some notable differences that might be related to the difficulties in molecular manipulation.

  20. Complete genome sequence of Lactobacillus plantarum ZS2058, a probiotic strain with high conjugated linoleic acid production ability.

    Yang, Bo; Chen, Haiqin; Tian, Fengwei; Zhao, Jianxin; Gu, Zhennan; Zhang, Hao; Chen, Yong Q; Chen, Wei

    2015-11-20

    Lactobacillus plantarum ZS2058 was isolated from sauerkraut and identified to synthesize the beneficial metabolite conjugated linoleic acid. The genome contains a 319,7363-bp chromosome and three plasmids. The sequence will facilitate identification and characterization of the genetic determinants for its putative biological benefits. PMID:26439428

  1. Acid-Base Pairs in Lewis Acidic Zeolites Promote Direct Aldol Reactions by Soft Enolization.

    Lewis, Jennifer D; Van de Vyver, Stijn; Román-Leshkov, Yuriy

    2015-08-17

    Hf-, Sn-, and Zr-Beta zeolites catalyze the cross-aldol condensation of aromatic aldehydes with acetone under mild reaction conditions with near quantitative yields. NMR studies with isotopically labeled molecules confirm that acid-base pairs in the Si-O-M framework ensemble promote soft enolization through α-proton abstraction. The Lewis acidic zeolites maintain activity in the presence of water and, unlike traditional base catalysts, in acidic solutions. PMID:26138135

  2. Complete chloroplast genome sequence of Fritillaria unibracteata var. wabuensis based on SMRT Sequencing Technology.

    Li, Ying; Li, Qiushi; Li, Xiwen; Song, Jingyuan; Sun, Chao

    2016-09-01

    Fritillaria unibracteata var. wabuensis is an important medicinal plant used for the treatment of cough symptoms related to the respiratory system. The chloroplast genome of F. unibracteata var. wabuensis (GenBank accession no. KF769142) was assembled using the PacBio RS platform (Pacific Biosciences, Beverly, MA) as a circle sequence with 151 009 bp. The assembled genome contains 133 genes, including 88 protein-coding, 37 tRNA, and eight rRNA genes. This genome sequence will provide important resource for further studies on the evolution of Fritillaria genus and molecular identification of Fritillaria herbs and their adulterants. This work suggests that PacBio RS is a powerful tool to sequence and assemble chloroplast genomes. PMID:26370383

  3. Improved base-calling and quality scores for 454 sequencing based on a Hurdle Poisson model

    Beuf Kristof

    2012-11-01

    Full Text Available Abstract Background 454 pyrosequencing is a commonly used massively parallel DNA sequencing technology with a wide variety of application fields such as epigenetics, metagenomics and transcriptomics. A well-known problem of this platform is its sensitivity to base-calling insertion and deletion errors, particularly in the presence of long homopolymers. In addition, the base-call quality scores are not informative with respect to whether an insertion or a deletion error is more likely. Surprisingly, not much effort has been devoted to the development of improved base-calling methods and more intuitive quality scores for this platform. Results We present HPCall, a 454 base-calling method based on a weighted Hurdle Poisson model. HPCall uses a probabilistic framework to call the homopolymer lengths in the sequence by modeling well-known 454 noise predictors. Base-calling quality is assessed based on estimated probabilities for each homopolymer length, which are easily transformed to useful quality scores. Conclusions Using a reference data set of the Escherichia coli K-12 strain, we show that HPCall produces superior quality scores that are very informative towards possible insertion and deletion errors, while maintaining a base-calling accuracy that is better than the current one. Given the generality of the framework, HPCall has the potential to also adapt to other homopolymer-sensitive sequencing technologies.

  4. Ionisation constants of inorganic acids and bases in aqueous solution

    Perrin, D D

    2013-01-01

    Ionisation Constants of Inorganic Acids and Bases in Aqueous Solution, Second Edition provides a compilation of tables that summarize relevant data recorded in the literature up to the end of 1980 for the ionization constants of inorganic acids and bases in aqueous solution. This book includes references to acidity functions for strong acids and bases, as well as details about the formation of polynuclear species. This text then explains the details of each column of the tables, wherein column 1 gives the name of the substance and the negative logarithm of the ionization constant and column 2

  5. Moving Away from the Reference Genome: Evaluating a Peptide Sequencing Tagging Approach for Single Amino Acid Polymorphism Identifications in the Genus Populus

    Abraham, Paul E [ORNL; Adams, Rachel M [ORNL; Tuskan, Gerald A [ORNL; Hettich, Robert {Bob} L [ORNL

    2013-01-01

    The genetic diversity across natural populations of the model organism, Populus, is extensive, containing a single nucleotide polymorphism roughly every 200 base pairs. When deviations from the reference genome occur in coding regions, they can impact protein sequences. Rather than relying on a static reference database to profile protein expression, we employed a peptide sequence tagging (PST) approach capable of decoding the plasticity of the Populus proteome. Using shotgun proteomics data from two genotypes of P. trichocarpa, a tag-based approach enabled the detection of 6,653 unexpected sequence variants. Through manual validation, our study investigated how the most abundant chemical modification (methionine oxidation) could masquerade as a sequence variant (AlaSer) when few site-determining ions existed. In fact, precise localization of an oxidation site for peptides with more than one potential placement was indeterminate for 70% of the MS/MS spectra. We demonstrate that additional fragment ions made available by high energy collisional dissociation enhances the robustness of the peptide sequence tagging approach (81% of oxidation events could be exclusively localized to a methionine). We are confident that augmenting fragmentation processes for a PST approach will further improve the identification of single amino acid polymorphism in Populus and potentially other species as well.

  6. STING Millennium: a web-based suite of programs for comprehensive and simultaneous analysis of protein structure and sequence

    Neshich, Goran; Togawa, Roberto C.; Mancini, Adauto L.; Kuser, Paula R.; Yamagishi, Michel E. B.; Pappas, Georgios; Torres, Wellington V.; Campos, Tharsis Fonseca e; Ferreira, Leonardo L.; Luna, Fabio M.; Oliveira, Adilton G.; Miura, Ronald T.; Inoue, Marcus K.; Horita, Luiz G.; de Souza, Dimas F.; Dominiquini, Fabiana; Álvaro, Alexandre; Lima, Cleber S.; Ogawa, Fabio O.; Gomes, Gabriel B.; Palandrani, Juliana F.; dos Santos, Gabriela F.; de Freitas, Esther M.; Mattiuz, Amanda R.; Costa, Ivan C.; de Almeida, Celso L.; Souza, Savio; Baudet, Christian; Higa, Roberto H.

    2003-01-01

    STING Millennium Suite (SMS) is a new web-based suite of programs and databases providing visualization and a complex analysis of molecular sequence and structure for the data deposited at the Protein Data Bank (PDB). SMS operates with a collection of both publicly available data (PDB, HSSP, Prosite) and its own data (contacts, interface contacts, surface accessibility). Biologists find SMS useful because it provides a variety of algorithms and validated data, wrapped-up in a user friendly web interface. Using SMS it is now possible to analyze sequence to structure relationships, the quality of the structure, nature and volume of atomic contacts of intra and inter chain type, relative conservation of amino acids at the specific sequence position based on multiple sequence alignment, indications of folding essential residue (FER) based on the relationship of the residue conservation to the intra-chain contacts and Cα–Cα and Cβ–Cβ distance geometry. Specific emphasis in SMS is given to interface forming residues (IFR)—amino acids that define the interactive portion of the protein surfaces. SMS may simultaneously display and analyze previously superimposed structures. PDB updates trigger SMS updates in a synchronized fashion. SMS is freely accessible for public data at http://www.cbi.cnptia.embrapa.br, http://mirrors.rcsb.org/SMS and http://trantor.bioc.columbia.edu/SMS. PMID:12824333

  7. Determination of the acidic sites of purified single-walled carbon nanotubes by acid base titration

    Hu, H.; Bhowmik, P.; Zhao, B.; Hamon, M. A.; Itkis, M. E.; Haddon, R. C.

    2001-09-01

    We report the measurement of the acidic sites in three different samples of commercially available full-length purified single-walled carbon nanotubes (SWNTs) - as obtained from CarboLex (CLI), Carbon Solutions (CSI) and Tubes@Rice (TAR) - by simple acid-base titration methods. Titration of the purified SWNTs with NaOH and NaHCO 3 solutions was used to determine the total percentage of acidic sites and carboxylic acid groups, respectively. The total percentage of acidic sites in full length purified SWNTs from TAR, CLI and CSI are about 1-3%.

  8. Roche genome sequencer FLX based high-throughput sequencing of ancient DNA

    Alquezar-Planas, David E; Fordyce, Sarah Louise

    2012-01-01

    Since the development of so-called "next generation" high-throughput sequencing in 2005, this technology has been applied to a variety of fields. Such applications include disease studies, evolutionary investigations, and ancient DNA. Each application requires a specialized protocol to ensure tha...

  9. Amino acid sequence of the ligand-binding domain of the aryl hydrocarbon receptor 1 predicts sensitivity of wild birds to effects of dioxin-like compounds.

    Farmahin, Reza; Manning, Gillian E; Crump, Doug; Wu, Dongmei; Mundy, Lukas J; Jones, Stephanie P; Hahn, Mark E; Karchner, Sibel I; Giesy, John P; Bursian, Steven J; Zwiernik, Matthew J; Fredricks, Timothy B; Kennedy, Sean W

    2013-01-01

    The sensitivity of avian species to the toxic effects of dioxin-like compounds (DLCs) varies up to 1000-fold among species, and this variability has been associated with interspecies differences in aryl hydrocarbon receptor 1 ligand-binding domain (AHR1 LBD) sequence. We previously showed that LD(50) values, based on in ovo exposures to DLCs, were significantly correlated with in vitro EC(50) values obtained with a luciferase reporter gene (LRG) assay that measures AHR1-mediated induction of cytochrome P4501A in COS-7 cells transfected with avian AHR1 constructs. Those findings suggest that the AHR1 LBD sequence and the LRG assay can be used to predict avian species sensitivity to DLCs. In the present study, the AHR1 LBD sequences of 86 avian species were studied, and differences at amino acid sites 256, 257, 297, 324, 337, and 380 were identified. Site-directed mutagenesis, the LRG assay, and homology modeling highlighted the importance of each amino acid site in AHR1 sensitivity to 2,3,7,8-tetrachlorodibenzo-p-dioxin and other DLCs. The results of the study revealed that (1) only amino acids at sites 324 and 380 affect the sensitivity of AHR1 expression constructs of the 86 avian species to DLCs and (2) in vitro luciferase activity of AHR1 constructs containing only the LBD of the species of interest is significantly correlated (r (2) = 0.93, p toxicity data for those species. These results indicate promise for the use of AHR1 LBD amino acid sequences independently, or combined with the LRG assay, to predict avian species sensitivity to DLCs. PMID:22923492

  10. Sequence and structure-based prediction of fructosyltransferase activity for functional subclassification of fungal GH32 enzymes.

    Trollope, Kim M; van Wyk, Niël; Kotjomela, Momo A; Volschenk, Heinrich

    2015-12-01

    Sucrolytic enzymes catalyse sucrose hydrolysis or the synthesis of fructooligosaccharides (FOSs), a prebiotic in human and animal nutrition. FOS synthesis capacity differs between sucrolytic enzymes. Amino-acid-sequence-based classification of FOS synthesizing enzymes would greatly facilitate the in silico identification of novel catalysts, as large amounts of sequence data lie untapped. The development of a bioinformatics tool to rapidly distinguish between high-level FOSs synthesizing predominantly sucrose hydrolysing enzymes from fungal genomic data is presented. Sequence comparison of functionally characterized enzymes displaying low- and high-level FOS synthesis revealed conserved motifs unique to each group. New light is shed on the sequence context of active site residues in three previously identified conserved motifs. We characterized two enzymes predicted to possess low- and high-level FOS synthesis activities based on their conserved motif sequences. FOS data for the enzymes confirmed our successful prediction of their FOS synthesis capacity. Structural comparison of enzymes displaying low- and high-level FOS synthesis identified steric hindrance between nystose and a long loop region present only in low-level FOS synthesizers. This loop is proposed to limit the synthesis of FOS species with higher degrees of polymerization, a phenomenon observed among enzymes displaying low-level FOS synthesis. Conserved sequence motifs surrounding catalytic residues and a distant structural determinant were identifiers of FOS synthesis capacity and allow for functional annotation of sucrolytic enzymes directly from amino acid sequence. The tool presented may also be useful to study the structure-function relationships of β-fructofuranosidases by identifying mutations present in a group of closely related enzymes displaying similar function. PMID:26426731

  11. Connecting Acids and Bases with Encapsulation... and Chemistry with Nanotechnology

    Criswell, Brett

    2007-01-01

    The features and the development of various new acids and bases activity sets that combines chemistry with nanotechnology are being described. These sets lead to the generation of many nanotechnology-based pharmaceuticals for the treatment of various diseases.

  12. A novel chaotic based image encryption using a hybrid model of deoxyribonucleic acid and cellular automata

    Enayatifar, Rasul; Sadaei, Hossein Javedani; Abdullah, Abdul Hanan; Lee, Malrey; Isnin, Ismail Fauzi

    2015-08-01

    Currently, there are many studies have conducted on developing security of the digital image in order to protect such data while they are sending on the internet. This work aims to propose a new approach based on a hybrid model of the Tinkerbell chaotic map, deoxyribonucleic acid (DNA) and cellular automata (CA). DNA rules, DNA sequence XOR operator and CA rules are used simultaneously to encrypt the plain-image pixels. To determine rule number in DNA sequence and also CA, a 2-dimension Tinkerbell chaotic map is employed. Experimental results and computer simulations, both confirm that the proposed scheme not only demonstrates outstanding encryption, but also resists various typical attacks.

  13. Data compression of discrete sequence: A tree based approach using dynamic programming

    Shivaram, Gurusrasad; Seetharaman, Guna; Rao, T. R. N.

    1994-01-01

    A dynamic programming based approach for data compression of a ID sequence is presented. The compression of an input sequence of size N to that of a smaller size k is achieved by dividing the input sequence into k subsequences and replacing the subsequences by their respective average values. The partitioning of the input sequence is carried with the intention of reducing the mean squared error in the reconstructed sequence. The complexity involved in finding the partitions which would result in such an optimal compressed sequence is reduced by using the dynamic programming approach, which is presented.

  14. Spherical Nucleic Acids as Intracellular Agents for Nucleic Acid Based Therapeutics

    Hao, Liangliang

    Recent functional discoveries on the noncoding sequences of human genome and transcriptome could lead to revolutionary treatment modalities because the noncoding RNAs (ncRNAs) can be applied as therapeutic agents to manipulate disease-causing genes. To date few nucleic acid-based therapeutics have been translated into the clinic due to challenges in the delivery of the oligonucleotide agents in an effective, cell specific, and non-toxic fashion. Unmodified oligonucleotide agents are destroyed rapidly in biological fluids by enzymatic degradation and have difficulty crossing the plasma membrane without the aid of transfection reagents, which often cause inflammatory, cytotoxic, or immunogenic side effects. Spherical nucleic acids (SNAs), nanoparticles consisting of densely organized and highly oriented oligonucleotides, pose one possible solution to circumventing these problems in both the antisense and RNA interference (RNAi) pathways. The unique three dimensional architecture of SNAs protects the bioactive oligonucleotides from unspecific degradation during delivery and supports their targeting of class A scavenger receptors and endocytosis via a lipid-raft-dependent, caveolae-mediated pathway. Owing to their unique structure, SNAs are able to cross cell membranes and regulate target genes expression as a single entity, without triggering the cellular innate immune response. Herein, my thesis has focused on understanding the interactions between SNAs and cellular components and developing SNA-based nanostructures to improve therapeutic capabilities. Specifically, I developed a novel SNA-based, nanoscale agent for delivery of therapeutic oligonucleotides to manipulate microRNAs (miRNAs), the endogenous post-transcriptional gene regulators. I investigated the role of SNAs involving miRNAs in anti-cancer or anti-inflammation responses in cells and in in vivo murine disease models via systemic injection. Furthermore, I explored using different strategies to construct

  15. PHARMACOGENETIC TESTING OPPORTUNITIES IN CARDIOLOGY BASED ON EXOME SEQUENCING

    N. V. Shcherbakova

    2015-09-01

    Full Text Available Aim. To study what cardiac drugs currently have any comments on biomarkers and what information can be obtained by pharmacogenetic testing using data exome sequencing in patients with cardiac diseases.Material and methods. Exome sequencing in random participant of the ATEROGEN IVANOVO study and bioinformatics analysis of the data were performed. Point mutations were annotated using ANNOVAR program, as well as comparison with a number of specialized databases was done on the basis of user protocols.Results. 11 cardiac drugs and 7 genes which variants can influence cardiac drug metabolism were analyzed. According to exome sequencing of the participant we did not reveal allelic variants that require dose regime correction and careful efficacy control.Conclusion. The exome sequencing application is the next step to a wide range of personalized therapy. Future opportunities for improvement of the risk-benefit ratio in each patient are the main purpose of the collection and analysis of pharmacogenetic data.

  16. Phylogenetic relationships of Salmonella based on rRNA sequences

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    To establish the phylogenetic relationships between the subspecies of Salmonella enterica (official name Salmonella choleraesuis), Salmonella bongori and related members of Enterobacteriaceae, sequence comparison of rRNA was performed by maximum-likelihood analysis. The two Salmonella species were...

  17. Whole-genome sequence-based analysis of thyroid function

    Taylor, Peter N.; Porcu, Eleonora; Chew, Shelby;

    2015-01-01

    Normal thyroid function is essential for health, but its genetic architecture remains poorly understood. Here, for the heritable thyroid traits thyrotropin (TSH) and free thyroxine (FT4), we analyse whole-genome sequence data from the UK10K project (N = 2,287). Using additional whole-genome...... association with FT4 in NRG1. Our results demonstrate that increased coverage in whole-genome sequence association studies identifies novel variants associated with thyroid function....

  18. Test Case Generation Based on Use case and Sequence Diagram

    Santosh Kumar Swain; Durga Prasad Mohapatra; Rajib Mall

    2010-01-01

    We present a comprehensive test case generation technique from UML models. We use the features in UML 2.0 sequence diagram including conditions, iterations, asynchronous messages and concurrent components. In our approach, test cases are derived from analysis artifacts such as use cases, their corresponding sequence diagrams and constraints specified across all these artifacts. We construct Use case Dependency Graph (UDG) from use case diagram and Concurrent Control Flow Graph (CCFG) from cor...

  19. Analysis of amino acids network based on distance matrix

    Ali, Tazid; Akhtar, Adil; Gohain, Nisha

    2016-06-01

    In this paper we have constructed a distance matrix of the amino acids. The distance is defined based on the relative evolutionary importance of the base position of the corresponding codons. From this distance matrix a network of the amino acids is obtained. We have argued that this network depicts the evolutionary pattern of the amino acids. To examine the relative importance of the amino acids with respect to this network we have discussed different measures of centrality. We have also investigated the correlation coefficients between different measures of centrality. Further we have explored clustering coefficient as well as degree of distribution.

  20. SPARSE: quadratic time simultaneous alignment and folding of RNAs without sequence-based heuristics

    Will, Sebastian; Otto, Christina; Miladi, Milad; Möhl, Mathias; Backofen, Rolf

    2015-01-01

    Motivation: RNA-Seq experiments have revealed a multitude of novel ncRNAs. The gold standard for their analysis based on simultaneous alignment and folding suffers from extreme time complexity of O ( n 6 ) . Subsequently, numerous faster ‘Sankoff-style’ approaches have been suggested. Commonly, the performance of such methods relies on sequence-based heuristics that restrict the search space to optimal or near-optimal sequence alignments; however, the accuracy of sequence-based methods breaks...

  1. A locked nucleic Acid-based nanocrawler

    Astakhova, I Kira; Pasternak, Karol; Campbell, Meghan A;

    2013-01-01

    Herein we introduce a novel fluorescent LNA/DNA machine, a nanocrawler, which reversibly moves along a directionally polar complementary road controlled by affinity-enhancing locked nucleic acid (LNA) monomers and additional regulatory strands. Polyaromatic hydrocarbon (PAH) dyes attached to 2'-a...

  2. Human tyrosyl-tRNA synthetase shares amino acid sequence homology with a putative cytokine.

    Kleeman, T A; Wei, D; Simpson, K L; First, E A

    1997-05-30

    To test the hypothesis that tRNATyr recognition differs between bacterial and human tyrosyl-tRNA synthetases, we sequenced several clones identified as human tyrosyl-tRNA synthetase cDNAs by the Human Genome Project. We found that human tyrosyl-tRNA synthetase is composed of three domains: 1) an amino-terminal Rossmann fold domain that is responsible for formation of the activated E.Tyr-AMP intermediate and is conserved among bacteria, archeae, and eukaryotes; 2) a tRNA anticodon recognition domain that has not been conserved between bacteria and eukaryotes; and 3) a carboxyl-terminal domain that is unique to the human tyrosyl-tRNA synthetase and whose primary structure is 49% identical to the putative human cytokine endothelial monocyte-activating protein II, 50% identical to the carboxyl-terminal domain of methionyl-tRNA synthetase from Caenorhabditis elegans, and 43% identical to the carboxyl-terminal domain of Arc1p from Saccharomyces cerevisiae. The first two domains of the human tyrosyl-tRNA synthetase are 52, 36, and 16% identical to tyrosyl-tRNA synthetases from S. cerevisiae, Methanococcus jannaschii, and Bacillus stearothermophilus, respectively. Nine of fifteen amino acids known to be involved in the formation of the tyrosyl-adenylate complex in B. stearothermophilus are conserved across all of the organisms, whereas amino acids involved in the recognition of tRNATyr are not conserved. Kinetic analyses of recombinant human and B. stearothermophilus tyrosyl-tRNA synthetases expressed in Escherichia coli indicate that human tyrosyl-tRNA synthetase aminoacylates human but not B. stearothermophilus tRNATyr, and vice versa, supporting the original hypothesis. It is proposed that like endothelial monocyte-activating protein II and the carboxyl-terminal domain of Arc1p, the carboxyl-terminal domain of human tyrosyl-tRNA synthetase evolved from gene duplication of the carboxyl-terminal domain of methionyl-tRNA synthetase and may direct tRNA to the active site of

  3. Gastropod arginine kinases from Cellana grata and Aplysia kurodai. Isolation and cDNA-derived amino acid sequences.

    Suzuki, T; Inoue, N; Higashi, T; Mizobuchi, R; Sugimura, N; Yokouchi, K; Furukohri, T

    2000-12-01

    Arginine kinase (AK) was isolated from the radular muscle of the gastropod molluscs Cellana grata (subclass Prosobranchia) and Aplysia kurodai (subclass Opisthobranchia), respectively, by ammonium sulfate fractionation, Sephadex G-75 gel filtration and DEAE-ion exchange chromatography. The denatured relative molecular mass values were estimated to be 40 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The isolated enzyme from Aplysia gave a Km value of 0.6 mM for arginine and a Vmax value of 13 micromole Pi min(-1) mg protein(-1) for the forward reaction. These values are comparable to other molluscan AKs. The cDNAs encoding Cellana and Aplysia AKs were amplified by polymerase chain reaction, and the nucleotide sequences of 1,608 and 1,239 bp, respectively, were determined. The open reading frame for Cellana AK is 1044 nucleotides in length and encodes a protein with 347 amino acid residues, and that for A. kurodai is 1077 nucleotides and 354 residues. The cDNA-derived amino acid sequences were validated by chemical sequencing of internal lysyl endopeptidase peptides. The amino acid sequences of Cellana and Aplysia AKs showed the highest percent identity (66-73%) with those of the abalone Nordotis and turbanshell Battilus belonging to the same class Gastropoda. These AK sequences still have a strong homology (63-71%) with that of the chiton Liolophura (class Polyplacophora), which is believed to be one of the most primitive molluscs. On the other hand, these AK sequences are less homologous (55-57%) with that of the clam Pseudocardium (class Bivalvia), suggesting that the biological position of the class Polyplacophora should be reconsidered. PMID:11281267

  4. Determination of low citric acid concentrations in a mixture of weak acid/bases

    Lahav, O.; Shlafman, E.; Cochva, M.

    2005-01-01

    A titration approach was developed to measure low concentrations of citric acid (C6H8O7) in a mixture of other weak acid/ bases. Two methods were tested. The first and more practical method (a 4-point titration procedure) is applicable in conditions where volatile fatty acids (VFAs) are not normally present. The second method (a 5-point titration procedure) was developed for anaerobic environments where VFAs may be encountered. Generally, fairly accurate and repetitive results (precision > 95...

  5. Analysing humanly generated random number sequences: A pattern-based approach

    Gravenor, M B; Schulz, M A; Schmalbach, B; Brugger, P; Witt, K.

    2012-01-01

    In a random number generation task, participants are asked to generate a random sequence of numbers, most typically the digits 1 to 9. Such number sequences are not mathematically random, and both extent and type of bias allow one to characterize the brain's “internal random number generator”. We assume that certain patterns and their variations will frequently occur in humanly generated random number sequences. Thus, we introduce a pattern-based analysis of random number sequences. Twenty he...

  6. Analysing Humanly Generated Random Number Sequences: A Pattern-Based Approach

    Schulz, Marc-André; Schmalbach, Barbara; Brugger, Peter; Witt, Karsten

    2012-01-01

    In a random number generation task, participants are asked to generate a random sequence of numbers, most typically the digits 1 to 9. Such number sequences are not mathematically random, and both extent and type of bias allow one to characterize the brain's “internal random number generator”. We assume that certain patterns and their variations will frequently occur in humanly generated random number sequences. Thus, we introduce a pattern-based analysis of random number sequences. Twenty he...

  7. Autonomously generating operations sequences for a Mars Rover using AI-based planning

    Sherwood, Rob; Mishkin, Andrew; Estlin, Tara; Chien, Steve; Backes, Paul; Cooper, Brian; Maxwell, Scott; Rabideau, Gregg

    2001-01-01

    This paper discusses a proof-of-concept prototype for ground-based automatic generation of validated rover command sequences from highlevel science and engineering activities. This prototype is based on ASPEN, the Automated Scheduling and Planning Environment. This Artificial Intelligence (AI) based planning and scheduling system will automatically generate a command sequence that will execute within resource constraints and satisfy flight rules.

  8. Carbon-based strong solid acid for cornstarch hydrolysis

    Nata, Iryanti Fatyasari; Irawan, Chairul; Mardina, Primata; Lee, Cheng-Kang

    2015-10-01

    Highly sulfonated carbonaceous spheres with diameter of 100-500 nm can be generated by hydrothermal carbonization of glucose in the presence of hydroxyethylsulfonic acid and acrylic acid at 180 °C for 4 h. The acidity of the prepared carbonaceous sphere C4-SO3H can reach 2.10 mmol/g. It was used as a solid acid catalyst for the hydrolysis of cornstarch. Total reducing sugar (TRS) concentration of 19.91 mg/mL could be obtained by hydrolyzing 20 mg/mL cornstarch at 150 °C for 6 h using C4-SO3H as solid acid catalyst. The solid acid catalyst demonstrated good stability that only 9% decrease in TRS concentration was observed after five repeat uses. The as-prepared carbon-based solid acid catalyst can be an environmentally benign replacement for homogeneous catalyst.

  9. Amino acid sequences of predicted proteins and their annotation for 95 organism species. - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Full Text Available Gclust Server Amino acid sequences of predicted proteins and their annotation for 95 organism species. Data ...detail Data name Amino acid sequences of predicted proteins and their annotation for 95 organism species. De...scription of data contents Amino acid sequences of predicted proteins and their a...nnotation for 95 organism species. The data are given in a CSV format text file. Data file File name: gclust...tation in original database Annotation at the original website Species Species name Length Amino acid sequen

  10. The Research of Chaos-based M-ary Spreading Sequences

    YANG Hongye

    2012-12-01

    Full Text Available This paper is devoted to the generation and evaluation of the Chaos-based M-ary spreading sequences on communications systems. Sequences obtained by repeating a truncated and multi-ary quantized chaotic series are compared with classical m-sequences by means of the autocorrelation and cross-correlation properties and power-spectral features. Anti-noise performance of binary sequences and chaotic-based M-ary spreading sequences has been compared in the case of the same single-frequency interferences. Studies have shown that spectral features and anti-noise performance of chaotic-based M-ary spreading sequences which have great researching value are better than binary sequences.

  11. Reactive Distillation for Esterification of Bio-based Organic Acids

    Fields, Nathan; Miller, Dennis J.; Asthana, Navinchandra S.; Kolah, Aspi K.; Vu, Dung; Lira, Carl T.

    2008-09-23

    The following is the final report of the three year research program to convert organic acids to their ethyl esters using reactive distillation. This report details the complete technical activities of research completed at Michigan State University for the period of October 1, 2003 to September 30, 2006, covering both reactive distillation research and development and the underlying thermodynamic and kinetic data required for successful and rigorous design of reactive distillation esterification processes. Specifically, this project has led to the development of economical, technically viable processes for ethyl lactate, triethyl citrate and diethyl succinate production, and on a larger scale has added to the overall body of knowledge on applying fermentation based organic acids as platform chemicals in the emerging biorefinery. Organic acid esters constitute an attractive class of biorenewable chemicals that are made from corn or other renewable biomass carbohydrate feedstocks and replace analogous petroleum-based compounds, thus lessening U.S. dependence on foreign petroleum and enhancing overall biorefinery viability through production of value-added chemicals in parallel with biofuels production. Further, many of these ester products are candidates for fuel (particularly biodiesel) components, and thus will serve dual roles as both industrial chemicals and fuel enhancers in the emerging bioeconomy. The technical report from MSU is organized around the ethyl esters of four important biorenewables-based acids: lactic acid, citric acid, succinic acid, and propionic acid. Literature background on esterification and reactive distillation has been provided in Section One. Work on lactic acid is covered in Sections Two through Five, citric acid esterification in Sections Six and Seven, succinic acid in Section Eight, and propionic acid in Section Nine. Section Ten covers modeling of ester and organic acid vapor pressure properties using the SPEAD (Step Potential

  12. A homogeneous nucleic acid hybridization assay based on strand displacement.

    Vary, C P

    1987-01-01

    A homogeneous nucleic acid hybridization assay which is conducted in solution and requires no separation steps is described. The assay is based on the concept of strand displacement. In the strand displacement assay, an RNA "signal strand" is hybridized within a larger DNA strand termed the "probe strand", which is, in turn, complementary to the target nucleic acid of interest. Hybridization of the target nucleic acid with the probe strand ultimately results in displacement of the RNA signal ...

  13. Effect of benzoic acid supplementation on acid-base status and mineralmetabolism in catheterized growing pigs

    Nørgaard, Jan Værum; Fernández, José Adalberto; Sørensen, Kristina Ulrich;

    2010-01-01

    Benzoic acid (BA) in diets for growing pigs results in urinary acidification and reduced ammonia emission. The objective was to study the impact of BA supplementation on the acid-base status and mineral metabolism in pigs. Eight female 50-kg pigs, fitted with a catheter in the abdominal aorta, were...

  14. Polymerization of amino acids containing nucleotide bases

    Ben Cheikh, Azzouz; Orgel, Leslie E.

    1990-01-01

    The nucleoamino acids 1-(3'-amino,3'-carboxypropyl)uracil (3) and 9-(3'-amino,3'-carboxypropyl)adenine (4) have been prepared as (L)-en-antiomers and as racemic mixtures. When 3 or 4 is suspended in water and treated with N,N'-carbon-yldiimidazole, peptides are formed in good yield. The products formed from the (L)-enantiomers are hydrolyzed to the monomeric amino acids by pronase. Attempts to improve the efficiency of these oligomerizations by including a polyuridylate template in the reaction mixture were not successful. Similarly, oligomers derived from the (L)-enantiomer of 3 did not act as templates to facilitate the oligomerization of 4.

  15. Barley polyamine oxidase: Characterisation and analysis of the cofactor and the N-terminal amino acid sequence

    Radova, A.; Sebela, M.; Galuszka, P.; Frebort, I.; Jacobsen, Susanne; Faulhammer, H.G.; Pec, P.

    2001-01-01

    further purified to a final homogeneity (by the criteria of isoelectric focusing and SDS-PAGE) using techniques of low pressure chromatography followed by two FPLC steps. The purified yellow enzyme showed visible absorption maxima of a flavoprotein at 380 and 450 nm: the presence of FAD as the cofactor...... was further confirmed by measuring the fluorescence spectra, Barley PAO is an acidic protein (pI 5.4) containing 3% of neutral sugars: its molecular mass determined by SDS-PAGE was 56 kDa, whilst gel permeation chromatography revealed the higher value of 76 kDa. The N-terminal amino acid sequence of...

  16. Nucleic Acid-Based Approaches for Detection of Viral Hepatitis

    BEHZADI, Payam; Ranjbar, Reza; Alavian, Seyed Moayed

    2014-01-01

    Context: To determining suitable nucleic acid diagnostics for individual viral hepatitis agent, an extensive search using related keywords was done in major medical library and data were collected, categorized, and summarized in different sections. Results: Various types of molecular biology tools can be used to detect and quantify viral genomic elements and analyze the sequences. These molecular assays are proper technologies for rapidly detecting viral agents with high accuracy, high sensit...

  17. Carbon-based strong solid acid for cornstarch hydrolysis

    Nata, Iryanti Fatyasari, E-mail: yanti_tkunlam@yahoo.com [Chemical Engineering Study Program, Faculty of Engineering, Lambung Mangkurat University, Jl. A. Yani Km. 36 Banjarbaru, South Kalimantan 70714 (Indonesia); Irawan, Chairul; Mardina, Primata [Chemical Engineering Study Program, Faculty of Engineering, Lambung Mangkurat University, Jl. A. Yani Km. 36 Banjarbaru, South Kalimantan 70714 (Indonesia); Lee, Cheng-Kang, E-mail: cklee@mail.ntust.edu.tw [Department of Chemical Engineering, National Taiwan University of Science and Technology, 43 Keelung Rd. Sec.4, Taipei 106, Taiwan (China)

    2015-10-15

    Highly sulfonated carbonaceous spheres with diameter of 100–500 nm can be generated by hydrothermal carbonization of glucose in the presence of hydroxyethylsulfonic acid and acrylic acid at 180 °C for 4 h. The acidity of the prepared carbonaceous sphere C4-SO{sub 3}H can reach 2.10 mmol/g. It was used as a solid acid catalyst for the hydrolysis of cornstarch. Total reducing sugar (TRS) concentration of 19.91 mg/mL could be obtained by hydrolyzing 20 mg/mL cornstarch at 150 °C for 6 h using C4-SO{sub 3}H as solid acid catalyst. The solid acid catalyst demonstrated good stability that only 9% decrease in TRS concentration was observed after five repeat uses. The as-prepared carbon-based solid acid catalyst can be an environmentally benign replacement for homogeneous catalyst. - Highlights: • Carbon solid acid was successfully prepared by one-step hydrothermal carbonization. • The acrylic acid as monomer was effectively reduce the diameter size of particle. • The solid acid catalyst show good catalytic performance of starch hydrolysis. • The solid acid catalyst is not significantly deteriorated after repeated use.

  18. Novel Sequence Number Based Secure Authentication Scheme for Wireless LANs

    Rajeev Singh; Teek Parval Sharma

    2015-01-01

    Authentication per frame is an implicit necessity for security in wireless local area networks (WLANs). We propose a novel per frame secure authentication scheme which provides authentication to data frames in WLANs. The scheme involves no cryptographic overheads for authentication of frames. It utilizes the sequence number of the frame along with the authentication stream generators for authentication. Hence, it requires no extra bits or messages for the authentication purpose and also no change in the existing frame format is required. The scheme provides authentication by modifying the sequence number of the frame at the sender, and that the modification is verified at the receiver. The modified sequence number is protected by using the XOR operation with a random number selected from the random stream. The authentication is lightweight due to the fact that it requires only trivial arithmetic operations like the subtraction and XOR operation.

  19. Determination of Fatty Acid Composition and Total Trans Fatty Acids in Cereal-Based Turkish Foods

    DAĞLIOĞLU, Orhan; Taşan, Murat

    2002-01-01

    The fatty acid composition and trans fatty acids of 13 cereal-based foods produced by Turkish companies were analysed by capillary gas-liquid chromatography. The total fat contents of the samples ranged from 1.8 to 37.9%. Traditional Turkish white bread and bulgur had the lowest fat content (1.8% and 2.3% respectively) and wafer the highest (37.9%). The major fatty acids in the samples were C16:0, C18:0, trans C18:1, C18:1 and C18:2. Total unsaturated fatty acid contents varied bet...

  20. Nucleic Acid-Based Nanodevices in Biological Imaging.

    Chakraborty, Kasturi; Veetil, Aneesh T; Jaffrey, Samie R; Krishnan, Yamuna

    2016-06-01

    The nanoscale engineering of nucleic acids has led to exciting molecular technologies for high-end biological imaging. The predictable base pairing, high programmability, and superior new chemical and biological methods used to access nucleic acids with diverse lengths and in high purity, coupled with computational tools for their design, have allowed the creation of a stunning diversity of nucleic acid-based nanodevices. Given their biological origin, such synthetic devices have a tremendous capacity to interface with the biological world, and this capacity lies at the heart of several nucleic acid-based technologies that are finding applications in biological systems. We discuss these diverse applications and emphasize the advantage, in terms of physicochemical properties, that the nucleic acid scaffold brings to these contexts. As our ability to engineer this versatile scaffold increases, its applications in structural, cellular, and organismal biology are clearly poised to massively expand. PMID:27294440

  1. Predicting tissue-specific expressions based on sequence characteristics

    Paik, Hyojung

    2011-04-30

    In multicellular organisms, including humans, understanding expression specificity at the tissue level is essential for interpreting protein function, such as tissue differentiation. We developed a prediction approach via generated sequence features from overrepresented patterns in housekeeping (HK) and tissue-specific (TS) genes to classify TS expression in humans. Using TS domains and transcriptional factor binding sites (TFBSs), sequence characteristics were used as indices of expressed tissues in a Random Forest algorithm by scoring exclusive patterns considering the biological intuition; TFBSs regulate gene expression, and the domains reflect the functional specificity of a TS gene. Our proposed approach displayed better performance than previous attempts and was validated using computational and experimental methods.

  2. A DNA Structure-Based Bionic Wavelet Transform and Its Application to DNA Sequence Analysis

    Fei Chen

    2003-01-01

    Full Text Available DNA sequence analysis is of great significance for increasing our understanding of genomic functions. An important task facing us is the exploration of hidden structural information stored in the DNA sequence. This paper introduces a DNA structure-based adaptive wavelet transform (WT – the bionic wavelet transform (BWT – for DNA sequence analysis. The symbolic DNA sequence can be separated into four channels of indicator sequences. An adaptive symbol-to-number mapping, determined from the structural feature of the DNA sequence, was introduced into WT. It can adjust the weight value of each channel to maximise the useful energy distribution of the whole BWT output. The performance of the proposed BWT was examined by analysing synthetic and real DNA sequences. Results show that BWT performs better than traditional WT in presenting greater energy distribution. This new BWT method should be useful for the detection of the latent structural features in future DNA sequence analysis.

  3. JRC GMO-Amplicons, a collection of nucleic acid sequences related to genetically modified organisms

    PETRILLO MAURO; ANGERS ALEXANDRE; HENRIKSSON PETER; Bonfini, Laura; PATAK DENNSTEDT Alexandre; KREYSA JOACHIM

    2015-01-01

    The DNA target sequence is the key element in designing detection methods for genetically modified organisms (GMOs). Unfortunately this information is frequently lacking, especially for unauthorized GMOs. In addition, patent sequences are generally poorly annotated, buried in complex and extensive documentation and hard to link to the corresponding GM event. Here, we present the JRC GMO-Amplicons, a database of amplicons collected by screening public nucleotide sequence databanks by in silico...

  4. Identification of novel rice low phytic acid mutations via TILLING by sequencing

    Phytic acid (myo-inositol-1,2,3,4,5,6-hexakisphosphate or InsP6) accounts for 75-85% of the total phosphorus in seeds. Low phytic acid (lpa) mutants exhibit decreases in seed InsP6 with corresponding increases in inorganic P which, unlike phytic acid P, is readily utilized by humans and monogastric ...

  5. Safety assessment of Bifidobacterium longum J DM301 based on complete genome sequences

    Yan-Xia Wei; Zhuo-Yang Zhang; Chang Liu; Xiao-Kui Guo; Pradeep K Malakar

    2012-01-01

    AIM: To assess the safety of Bifidobacterium longum (B.longum) JDM301 based on complete genome sequences. METHODS: The complete genome sequences of JDM301 were determined using the GS 20 system. Putative virulence factors, putative antibiotic resistance genes and genes encoding enzymes responsible for harmful metabolites were identified by blast with virulence factors database, antibiotic resistance genes database and genes associated with harmful metabolites in previous reports. Minimum inhibitory concentration of 16 common antimicrobial agents was evaluated by E-test. RESULTS: JDM301 was shown to contain 36 genes associated with antibiotic resistance, 5 enzymes related to harmful metabolites and 162 nonspecific virulence factors mainly associated with transcriptional regulation, adhesion, sugar and amino acid transport. B. longum JDM301 was intrinsically resistant tocipro ciprofloxacin,amikacin, gentamicin and streptomycin and susceptible to vancomycin, amoxicillin, cephalothin, chloramphenicol, erythromycin, ampicillin, cefotaxime, rifampicin, imipenemandtrimethoprim and trimethoprim-sulphamethoxazol. JDM301.JDM301 was moderately resistant to bacitracin, while an earlier study showed that bifidobacteria were susceptible to this antibiotic. A tetracycline resistance gene with the risk of transfer was found in JDM301, which needs to be experimentally validated. CONCLUSION: The safety assessment of JDM301 using information derived from complete bacterial genome will contribute to a wider and deeper insight into the safety of probiotic bacteria.

  6. Nucleic acid based fluorescent sensor for mercury detection

    Lu, Yi; Liu, Juewen

    2013-02-05

    A nucleic acid enzyme comprises an oligonucleotide containing thymine bases. The nucleic acid enzyme is dependent on both Hg.sup.2+and a second ion as cofactors, to produce a product from a substrate. The substrate comprises a ribonucleotide, a deoxyribonucleotide, or both.

  7. Current and future developments in nucleic acid-based diagnostics

    The detection and characterization of specific nucleic acids of medico-veterinary pathogens have proven invaluable for diagnostic purposes. Apart from hybridization and sequencing techniques, polymerase chain reaction (PCR) and numerous other methods have contributed significantly to this process. The integration of amplification and signal detection systems, including on-line real-time devices, have increased speed and sensitivity and greatly facilitated the quantification of target nucleic acids. They have also allowed for sequence characterization using melting or hybridization curves. Rugged portable real-time instruments for field use and robotic devices for processing samples are already available commercially. Various stem-loop DNA probes have been designed to have greater specificity for target recognition during real-time PCR. Various DNA fingerprinting techniques or post amplification sequencing are used to type pathogenic strains. Characterization according to DNA sequence is becoming more readily available as automated sequencers become more widely used. Reverse hybridization and to a greater degree DNA micro-arrays, are being used for genotyping related organisms and can allow for the detection of a large variety of different pathogens simultaneously. Non-radioactive labelling of DNA, especially using fluorophores and the principles of fluorescence resonance energy transfer, is now widely used, especially in real-time detection devices. Other detection methods include the use of surface plasmon resonance and MALDI-TOF mass spectrometry. In addition to these technological advances, contributions by bioinformatics and the description of unique signatures of DNA sequences from pathogens will contribute to the development of further assays for monitoring presence of pathogens. An important goal will be the development of robust devices capable of sensitively and specifically detecting a broad spectrum of pathogens that will be applicable for point

  8. Using Triple Helix Forming Peptide Nucleic Acids for Sequence-selective Recognition of Double-stranded RNA

    Hnedzko, Dziyana; Cheruiyot, Samwel K.; Rozners, Eriks

    2014-01-01

    Non-coding RNAs play important roles in regulation of gene expression. Specific recognition and inhibition of these biologically important RNAs that form complex double-helical structures will be highly useful for fundamental studies in biology and practical applications in medicine. This protocol describes a strategy developed in our laboratory for sequence-selective recognition of double-stranded RNA (dsRNA) using triple helix forming peptide nucleic acids (PNAs) that bind in the major grov...

  9. Comparative Complete Genome Sequence Analysis of the Amino Acid Replacements Responsible for the Thermostability of Corynebacterium efficiens

    Nishio, Yousuke; Nakamura, Yoji; Kawarabayasi, Yutaka; Usuda, Yoshihiro; Kimura, Eiichiro; Sugimoto, Shinichi; Matsui, Kazuhiko; Yamagishi, Akihiko; Kikuchi, Hisashi; Ikeo, Kazuho; Gojobori, Takashi

    2003-01-01

    Corynebacterium efficiens is the closest relative of Corynebacterium glutamicum, a species widely used for the industrial production of amino acids. C. efficiens but not C. glutamicum can grow above 40°C. We sequenced the complete C. efficiens genome to investigate the basis of its thermostability by comparing its genome with that of C. glutamicum. The difference in GC content between the species was reflected in codon usage and nucleotide substitutions. Our compar...

  10. Deep sequencing of the Mexican avocado transcriptome, an ancient angiosperm with a high content of fatty acids

    Ibarra-Laclette, Enrique; Méndez-Bravo, Alfonso; Pérez-Torres, Claudia Anahí; Albert, Victor A; Mockaitis, Keithanne; Kilaru, Aruna; López-Gómez, Rodolfo; Cervantes-Luevano, Jacob Israel; Herrera-Estrella, Luis

    2015-01-01

    Background Avocado (Persea americana) is an economically important tropical fruit considered to be a good source of fatty acids. Despite its importance, the molecular and cellular characterization of biochemical and developmental processes in avocado is limited due to the lack of transcriptome and genomic information. Results The transcriptomes of seeds, roots, stems, leaves, aerial buds and flowers were determined using different sequencing platforms. Additionally, the transcriptomes of thre...

  11. Deciphering Clostridium tyrobutyricum Metabolism Based on the Whole-Genome Sequence and Proteome Analyses

    Lee, Joungmin; Jang, Yu-Sin; Han, Mee-Jung; Kim, Jin Young

    2016-01-01

    ABSTRACT Clostridium tyrobutyricum is a Gram-positive anaerobic bacterium that efficiently produces butyric acid and is considered a promising host for anaerobic production of bulk chemicals. Due to limited knowledge on the genetic and metabolic characteristics of this strain, however, little progress has been made in metabolic engineering of this strain. Here we report the complete genome sequence of C. tyrobutyricum KCTC 5387 (ATCC 25755), which consists of a 3.07-Mbp chromosome and a 63-kbp plasmid. The results of genomic analyses suggested that C. tyrobutyricum produces butyrate from butyryl-coenzyme A (butyryl-CoA) through acetate reassimilation by CoA transferase, differently from Clostridium acetobutylicum, which uses the phosphotransbutyrylase-butyrate kinase pathway; this was validated by reverse transcription-PCR (RT-PCR) of related genes, protein expression levels, in vitro CoA transferase assay, and fed-batch fermentation. In addition, the changes in protein expression levels during the course of batch fermentations on glucose were examined by shotgun proteomics. Unlike C. acetobutylicum, the expression levels of proteins involved in glycolytic and fermentative pathways in C. tyrobutyricum did not decrease even at the stationary phase. Proteins related to energy conservation mechanisms, including Rnf complex, NfnAB, and pyruvate-phosphate dikinase that are absent in C. acetobutylicum, were identified. Such features explain why this organism can produce butyric acid to a much higher titer and better tolerate toxic metabolites. This study presenting the complete genome sequence, global protein expression profiles, and genome-based metabolic characteristics during the batch fermentation of C. tyrobutyricum will be valuable in designing strategies for metabolic engineering of this strain. PMID:27302759

  12. Asynchronous symmetry-based sequences for homonuclear dipolar recoupling in solid-state nuclear magnetic resonance

    We show a theoretical framework, based on triple-mode Floquet theory, to analyze recoupling sequences derived from symmetry-based pulse sequences, which have a non-vanishing effective field and are not rotor synchronized. We analyze the properties of one such sequence, a homonuclear double-quantum recoupling sequence derived from the C721 sequence. The new asynchronous sequence outperforms the rotor-synchronized version for spin pairs with small dipolar couplings in the presence of large chemical-shift anisotropy. The resonance condition of the new sequence is analyzed using triple-mode Floquet theory. Analytical calculations of second-order effective Hamiltonian are performed to compare the efficiency in suppressing second-order cross terms. Experiments and numerical simulations are shown to corroborate the results of the theoretical analysis

  13. Robin Sequence: The road to evidence based personalized treatment

    H. Basart

    2016-01-01

    Robin Sequence (RS) is characterized by micrognathia and upper airway obstruction (UAO) caused by glossoptosis resulting in respiratory and feeding problems of varying severity. According to the original RS definition a cleft palate is associated with RS, but not part of the definition. Reported inc

  14. Phylogenetic relationships of Salmonella based on rRNA sequences

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  15. Nonparametric density estimators based on nonstationary absolutely regular random sequences

    Michel Harel

    1996-01-01

    Full Text Available In this paper, the central limit theorems for the density estimator and for the integrated square error are proved for the case when the underlying sequence of random variables is nonstationary. Applications to Markov processes and ARMA processes are provided.

  16. Syntheses and characterizations of three acid-base supramolecular complexes

    Three acid-base compounds with supramolecular architectures, namely, (1,2-H2bdc)(dmt) (1), (trans-1,4-H2ccdc)0.5(phdat) (2) and (1,3-H2bdc)(phdat) (3) (1,2-H2bdc = 1,2-benzenedicarboxylic acid, trans-1, 4-H2ccdc = trans-1, 4-cyclohexanedicarboxylic acid, 1,3-H2bdc = 1,3-benzenedicarboxylic acid, dmt = 2,4-diamino-6-methyl-s-triazine, phdat = 2,4-diamino-6-phenyl-s-triazine) have been synthesized and characterized by IR spectra, elemental analyses, single-crystal X-ray diffractions and TGA. (author)

  17. A novel T-cell-defined HLA-DR polymorphism not predicted from the linear amino acid sequence.

    Termijtelen, A; van den Elsen, P; Koning, F; de Koster, S; Schroeijers, W; Vanderkerckhove, B

    1989-09-01

    Recent investigations have shown that alloreactive T cells are capable of responding to structures defined by specific linear amino acid sequences on class II molecules. In the present study we show that also a polymorphism can be recognized that is not defined by such linear amino acid sequences. Two human T-cell clones, sensitized to DRw13 haplotypes, are described. The description of clone c50 serves to exemplify the first model. This DRB1-specific clone responds to stimulator cells that carry DR molecules, different in their DRB1 first and second hypervariable regions (HV1 and HV2) but identical in their HV3 regions (i.e., DRw13,Dw18; DRw13,Dw19; DR4,Dw10; and DRw11,LDVII). The second clone, c1443, behaves nonconventionally. It responds to DRw13,Dw18; DRw13,Dw19; and DR4,Dw4 stimulator cells, although no specific amino acid sequence is shared between these specificities. The latter pattern of reactivity suggests the existence of a novel polymorphism recognized by alloreactive T cells. This particular polymorphism may also be biologically significant. PMID:2476425

  18. Complete Genome Sequences of Escherichia coli O157:H7 Strains SRCC 1675 and 28RC, Which Vary in Acid Resistance

    Baranzoni, Gian Marco; Reichenberger, Erin R.; Kim, Gwang-Hee; Breidt, Frederick; Kay, Kathryn; Oh, Deog-Hwan

    2016-01-01

    The level of acid resistance among Escherichia coli O157:H7 strains varies, and strains with higher resistance to acid may have a lower infectious dose. The complete genome sequences belonging to two strains of Escherichia coli O157:H7 with different levels of acid resistance are presented here. PMID:27469964

  19. Towards lactic acid bacteria-based biorefineries.

    Mazzoli, Roberto; Bosco, Francesca; Mizrahi, Itzhak; Bayer, Edward A; Pessione, Enrica

    2014-11-15

    Lactic acid bacteria (LAB) have long been used in industrial applications mainly as starters for food fermentation or as biocontrol agents or as probiotics. However, LAB possess several characteristics that render them among the most promising candidates for use in future biorefineries in converting plant-derived biomass-either from dedicated crops or from municipal/industrial solid wastes-into biofuels and high value-added products. Lactic acid, their main fermentation product, is an attractive building block extensively used by the chemical industry, owing to the potential for production of polylactides as biodegradable and biocompatible plastic alternative to polymers derived from petrochemicals. LA is but one of many high-value compounds which can be produced by LAB fermentation, which also include biofuels such as ethanol and butanol, biodegradable plastic polymers, exopolysaccharides, antimicrobial agents, health-promoting substances and nutraceuticals. Furthermore, several LAB strains have ascertained probiotic properties, and their biomass can be considered a high-value product. The present contribution aims to provide an extensive overview of the main industrial applications of LAB and future perspectives concerning their utilization in biorefineries. Strategies will be described in detail for developing LAB strains with broader substrate metabolic capacity for fermentation of cheaper biomass. PMID:25087936

  20. Acid-base strengths in m-cresol

    Bos, M.; Dahmen, E.A.M.F.

    1971-01-01

    For various acids and bases dissociation constants were determined conductimetrically in m-cresol. A glass electrode was calibrated by means of some compounds with dissociation constants known from conductivity measurements. Potentiometric titrations with this calibrated glass electrode gave dissoci

  1. Teaching acid/base physiology in the laboratory

    Friis, Ulla G; Plovsing, Ronni; Hansen, Klaus;

    2010-01-01

    Acid/base homeostasis is one of the most difficult subdisciplines of physiology for medical students to master. A different approach, where theory and practice are linked, might help students develop a deeper understanding of acid/base homeostasis. We therefore set out to develop a laboratory...... exercise in acid/base physiology that would provide students with unambiguous and reproducible data that clearly would illustrate the theory in practice. The laboratory exercise was developed to include both metabolic acidosis and respiratory alkalosis. Data were collected from 56 groups of medical...... students that had participated in this laboratory exercise. The acquired data showed very consistent and solid findings after the development of both metabolic acidosis and respiratory alkalosis. All results were consistent with the appropriate diagnosis of the acid/base disorder. Not one single group...

  2. mPUMA: a computational approach to microbiota analysis by de novo assembly of operational taxonomic units based on protein-coding barcode sequences

    2013-01-01

    Background Formation of operational taxonomic units (OTU) is a common approach to data aggregation in microbial ecology studies based on amplification and sequencing of individual gene targets. The de novo assembly of OTU sequences has been recently demonstrated as an alternative to widely used clustering methods, providing robust information from experimental data alone, without any reliance on an external reference database. Results Here we introduce mPUMA (microbial Profiling Using Metagenomic Assembly, http://mpuma.sourceforge.net), a software package for identification and analysis of protein-coding barcode sequence data. It was developed originally for Cpn60 universal target sequences (also known as GroEL or Hsp60). Using an unattended process that is independent of external reference sequences, mPUMA forms OTUs by DNA sequence assembly and is capable of tracking OTU abundance. mPUMA processes microbial profiles both in terms of the direct DNA sequence as well as in the translated amino acid sequence for protein coding barcodes. By forming OTUs and calculating abundance through an assembly approach, mPUMA is capable of generating inputs for several popular microbiota analysis tools. Using SFF data from sequencing of a synthetic community of Cpn60 sequences derived from the human vaginal microbiome, we demonstrate that mPUMA can faithfully reconstruct all expected OTU sequences and produce compositional profiles consistent with actual community structure. Conclusions mPUMA enables analysis of microbial communities while empowering the discovery of novel organisms through OTU assembly. PMID:24451012

  3. Synthesis and antimicrobial activities of new higher amino acid Schiff base derivatives of 6-aminopenicillanic acid and 7-aminocephalosporanic acid

    Özdemir (nee Güngör), Özlem; Gürkan, Perihan; Özçelik, Berrin; Oyardı, Özlem

    2016-02-01

    Novel β-lactam derivatives (1c-3c) (1d-3d) were produced by using 6-aminopenicillanic acid (6-APA), 7-aminocephalosporanic acid (7-ACA) and the higher amino acid Schiff bases. The synthesized compounds were characterized by elemental analysis, IR, 1H/13C NMR and UV-vis spectra. Antibacterial activities of all the higher amino acid Schiff bases (1a-3a) (1b-3b) and β-lactam derivatives were screened against three gram negative bacteria (Escherichia coli ATCC 25922, Pseudomonas aeruginosa ATCC 27853, Acinetobacter baumannii RSKK 02026), three gram positive bacteria (Staphylococcus aureus ATCC 25923, Enterococcus faecalis ATCC 07005, Bacillus subtilis ATCC 6633) and their drug-resistant isolates by using broth microdilution method. Two fungi (Candida albicans and Candida krusei) were used for antifungal activity.

  4. Acid-base homeostasis in the human system

    White, R. J.

    1974-01-01

    Acid-base regulation is a cooperative phenomena in vivo with body fluids, extracellular and intracellular buffers, lungs, and kidneys all playing important roles. The present account is much too brief to be considered a review of present knowledge of these regulatory systems, and should be viewed, instead, as a guide to the elements necessary to construct a simple model of the mutual interactions of the acid-base regulatory systems of the body.

  5. Fad7 gene identification and fatty acids phenotypic variation in an olive collection by EcoTILLING and sequencing approaches.

    Sabetta, Wilma; Blanco, Antonio; Zelasco, Samanta; Lombardo, Luca; Perri, Enzo; Mangini, Giacomo; Montemurro, Cinzia

    2013-08-01

    The ω-3 fatty acid desaturases (FADs) are enzymes responsible for catalyzing the conversion of linoleic acid to α-linolenic acid localized in the plastid or in the endoplasmic reticulum. In this research we report the genotypic and phenotypic variation of Italian Olea europaea L. germoplasm for the fatty acid composition. The phenotypic oil characterization was followed by the molecular analysis of the plastidial-type ω-3 FAD gene (fad7) (EC 1.14.19), whose full-length sequence has been here identified in cultivar Leccino. The gene consisted of 2635 bp with 8 exons and 5'- and 3'-UTRs of 336 and 282 bp respectively, and showed a high level of heterozygousity (1/110 bp). The natural allelic variation was investigated both by a LiCOR EcoTILLING assay and the PCR product direct sequencing. Only three haplotypes were identified among the 96 analysed cultivars, highlighting the strong degree of conservation of this gene. PMID:23685785

  6. A fast sequence assembly method based on compressed data structures.

    Liang, Peifeng; Zhang, Yancong; Lin, Kui; Hu, Jinglu

    2014-01-01

    Assembling a large genome using next generation sequencing reads requires large computer memory and a long execution time. To reduce these requirements, a memory and time efficient assembler is presented from applying FM-index in JR-Assembler, called FMJ-Assembler, where FM stand for FMR-index derived from the FM-index and BWT and J for jumping extension. The FMJ-Assembler uses expanded FM-index and BWT to compress data of reads to save memory and jumping extension method make it faster in CPU time. An extensive comparison of the FMJ-Assembler with current assemblers shows that the FMJ-Assembler achieves a better or comparable overall assembly quality and requires lower memory use and less CPU time. All these advantages of the FMJ-Assembler indicate that the FMJ-Assembler will be an efficient assembly method in next generation sequencing technology. PMID:25569963

  7. Synthesis of polyacrylic-acid-based thermochromic polymers

    Srivastava, Jyoti; Alam, Sarfaraz; Mathur, G. N.

    2003-10-01

    Smart materials respond to environmental stimuli with particular changes in some variables (for example temperature, pressure and electric field etc), for that reason they are often called responsive materials. In the present work, we have synthesized thermochromic polymer based on poly acrylic acid cobalt chloride (CoCl2) and phosphoric acid (H3PO4) that visually and reversibly changes color in the temperature range (70 - 130°C). These thermochromic materials can be used as visual sensors of temperature. Thermochromic polymers are based on polyacrylic acid and CoCl2 complex.

  8. Phylogeny of Vibrio cholerae Based on recA Sequence

    Stine, O. Colin; Sozhamannan, Shanmuga; Gou, Qing; Zheng, Siqen; Morris, J. Glenn; Johnson, Judith A.

    2000-01-01

    We sequenced a 705-bp fragment of the recA gene from 113 Vibrio cholerae strains and closely related species. One hundred eighty-seven nucleotides were phylogenetically informative, 55 were phylogenetically uninformative, and 463 were invariant. Not unexpectedly, Vibrio parahaemolyticus and Vibrio vulnificus strains formed out-groups; we also identified isolates which resembled V. cholerae biochemically but which did not cluster with V. cholerae. In many instances, V. cholerae serogroup desig...

  9. Identification and Characterization of Second-Generation Invader Locked Nucleic Acids (LNAs) for Mixed-Sequence Recognition of Double-Stranded DNA

    Sau, Sujay P; Madsen, Andreas S; Podbevsek, Peter;

    2013-01-01

    The development of synthetic agents that recognize double-stranded DNA (dsDNA) is a long-standing goal that is inspired by the promise for tools that detect, regulate, and modify genes. Progress has been made with triplex-forming oligonucleotides, peptide nucleic acids, and polyamides, but...... substantial efforts are currently devoted to the development of alternative strategies that overcome the limitations observed with the classic approaches. In 2005, we introduced Invader locked nucleic acids (LNAs), i.e., double-stranded probes that are activated for mixed-sequence recognition of dsDNA through...... monomers. We compare the thermal denaturation characteristics of double-stranded probes featuring different interstrand zippers of pyrene-functionalized monomers based on 2'-amino-α-l-LNA, 2'-N-methyl-2'-amino-DNA, and RNA scaffolds. Insights from fluorescence spectroscopy, molecular modeling, and NMR...

  10. Comparison of illumina and 454 deep sequencing in participants failing raltegravir-based antiretroviral therapy.

    Jonathan Z Li

    Full Text Available The impact of raltegravir-resistant HIV-1 minority variants (MVs on raltegravir treatment failure is unknown. Illumina sequencing offers greater throughput than 454, but sequence analysis tools for viral sequencing are needed. We evaluated Illumina and 454 for the detection of HIV-1 raltegravir-resistant MVs.A5262 was a single-arm study of raltegravir and darunavir/ritonavir in treatment-naïve patients. Pre-treatment plasma was obtained from 5 participants with raltegravir resistance at the time of virologic failure. A control library was created by pooling integrase clones at predefined proportions. Multiplexed sequencing was performed with Illumina and 454 platforms at comparable costs. Illumina sequence analysis was performed with the novel snp-assess tool and 454 sequencing was analyzed with V-Phaser.Illumina sequencing resulted in significantly higher sequence coverage and a 0.095% limit of detection. Illumina accurately detected all MVs in the control library at ≥0.5% and 7/10 MVs expected at 0.1%. 454 sequencing failed to detect any MVs at 0.1% with 5 false positive calls. For MVs detected in the patient samples by both 454 and Illumina, the correlation in the detected variant frequencies was high (R2 = 0.92, P<0.001. Illumina sequencing detected 2.4-fold greater nucleotide MVs and 2.9-fold greater amino acid MVs compared to 454. The only raltegravir-resistant MV detected was an E138K mutation in one participant by Illumina sequencing, but not by 454.In participants of A5262 with raltegravir resistance at virologic failure, baseline raltegravir-resistant MVs were rarely detected. At comparable costs to 454 sequencing, Illumina demonstrated greater depth of coverage, increased sensitivity for detecting HIV MVs, and fewer false positive variant calls.

  11. INDUS - a composition-based approach for rapid and accurate taxonomic classification of metagenomic sequences

    Mohammed, Monzoorul Haque; Ghosh, Tarini Shankar; Reddy, Rachamalla Maheedhar; Reddy, Chennareddy Venkata Siva Kumar; Singh, Nitin Kumar; Sharmila S Mande

    2011-01-01

    Background Taxonomic classification of metagenomic sequences is the first step in metagenomic analysis. Existing taxonomic classification approaches are of two types, similarity-based and composition-based. Similarity-based approaches, though accurate and specific, are extremely slow. Since, metagenomic projects generate millions of sequences, adopting similarity-based approaches becomes virtually infeasible for research groups having modest computational resources. In this study, we present ...

  12. DNA Lossless Differential Compression Algorithm based on Similarity of Genomic Sequence Database

    Afify, Heba; Wahed, Manal Abdel

    2011-01-01

    Modern biological science produces vast amounts of genomic sequence data. This is fuelling the need for efficient algorithms for sequence compression and analysis. Data compression and the associated techniques coming from information theory are often perceived as being of interest for data communication and storage. In recent years, a substantial effort has been made for the application of textual data compression techniques to various computational biology tasks, ranging from storage and indexing of large datasets to comparison of genomic databases. This paper presents a differential compression algorithm that is based on production of difference sequences according to op-code table in order to optimize the compression of homologous sequences in dataset. Therefore, the stored data are composed of reference sequence, the set of differences, and differences locations, instead of storing each sequence individually. This algorithm does not require a priori knowledge about the statistics of the sequence set. The...

  13. A Parallel Non-Alignment Based Approach to Efficient Sequence Comparison using Longest Common Subsequences

    Bhowmick, S.; Shafiullah, M.; Rai, H.; Bastola, D.

    2010-11-01

    Biological sequence comparison programs have revolutionized the practice of biochemistry, and molecular and evolutionary biology. Pairwise comparison of genomic sequences is a popular method of choice for analyzing genetic sequence data. However the quality of results from most sequence comparison methods are significantly affected by small perturbations in the data and furthermore, there is a dearth of computational tools to compare sequences beyond a certain length. In this paper, we describe a parallel algorithm for comparing genetic sequences using an alignment free-method based on computing the Longest Common Subsequence (LCS) between genetic sequences. We validate the quality of our results by comparing the phylogenetic tress obtained from ClustalW and LCS. We also show through complexity analysis of the isoefficiency and by empirical measurement of the running time that our algorithm is very scalable.

  14. Human genome sequencing using unchained base reads on self-assembling DNA nanoarrays.

    Drmanac, Radoje; Sparks, Andrew B; Callow, Matthew J; Halpern, Aaron L; Burns, Norman L; Kermani, Bahram G; Carnevali, Paolo; Nazarenko, Igor; Nilsen, Geoffrey B; Yeung, George; Dahl, Fredrik; Fernandez, Andres; Staker, Bryan; Pant, Krishna P; Baccash, Jonathan; Borcherding, Adam P; Brownley, Anushka; Cedeno, Ryan; Chen, Linsu; Chernikoff, Dan; Cheung, Alex; Chirita, Razvan; Curson, Benjamin; Ebert, Jessica C; Hacker, Coleen R; Hartlage, Robert; Hauser, Brian; Huang, Steve; Jiang, Yuan; Karpinchyk, Vitali; Koenig, Mark; Kong, Calvin; Landers, Tom; Le, Catherine; Liu, Jia; McBride, Celeste E; Morenzoni, Matt; Morey, Robert E; Mutch, Karl; Perazich, Helena; Perry, Kimberly; Peters, Brock A; Peterson, Joe; Pethiyagoda, Charit L; Pothuraju, Kaliprasad; Richter, Claudia; Rosenbaum, Abraham M; Roy, Shaunak; Shafto, Jay; Sharanhovich, Uladzislau; Shannon, Karen W; Sheppy, Conrad G; Sun, Michel; Thakuria, Joseph V; Tran, Anne; Vu, Dylan; Zaranek, Alexander Wait; Wu, Xiaodi; Drmanac, Snezana; Oliphant, Arnold R; Banyai, William C; Martin, Bruce; Ballinger, Dennis G; Church, George M; Reid, Clifford A

    2010-01-01

    Genome sequencing of large numbers of individuals promises to advance the understanding, treatment, and prevention of human diseases, among other applications. We describe a genome sequencing platform that achieves efficient imaging and low reagent consumption with combinatorial probe anchor ligation chemistry to independently assay each base from patterned nanoarrays of self-assembling DNA nanoballs. We sequenced three human genomes with this platform, generating an average of 45- to 87-fold coverage per genome and identifying 3.2 to 4.5 million sequence variants per genome. Validation of one genome data set demonstrates a sequence accuracy of about 1 false variant per 100 kilobases. The high accuracy, affordable cost of $4400 for sequencing consumables, and scalability of this platform enable complete human genome sequencing for the detection of rare variants in large-scale genetic studies. PMID:19892942

  15. Pattern of acid base abnormalities in critically ill patinets

    To find out the pattern of acid base abnormalities in critically ill patients in a tertiary care health facility. Study Design: A descriptive study. Place and Duration of Study: The study was carried out in the department of pathology, Combined Military Hospital Kharian from January 2013 to June 2013. Patients and Methods: Two hundred and fifty patients suffering from various diseases and presenting with exacerbation of their clinical conditions were studied. These patients were hospitalized and managed in acute care units of the hospital. Arterial blood gases were analysed to detect acid base status and their correlation with their clinical condition. Concomitant analysis of electrolytes was carried out. Tests related to concurrent illnesses e.g. renal and liver function tests, cardiac enzymes and plasma glucose were assayed by routine end point and kinetic methods. Standard reference materials were used to ensure internal quantify control of analyses. Results: Two hundred and fifteen patients out of 250 studied suffered from acid base disorders. Gender distribution showed a higher percentage of male patients and the mean age was 70.5 ± 17.4 years. Double acid base disorders were the commonest disorders (34%) followed by metabolic acidosis (30%). Anion gap was calculated to further stratify metabolic acidosis and cases of diabetic ketoacidosis were the commonest in this category (47%). Other simple acid base disorders were relatively less frequent. Delta bicarbonate was calculated to unmask the superimposition of respiratory alkalosis or acidosis with metabolic acidosis and metabolic alkalosis. Though triple acid base disorders were noted in a small percentage of cases (05%), but were found to be the most complicated and challenging. Mixed acid base disorders were associated with high mortality. Conclusion: A large number of critically ill patients manifested acid base abnormalities over the full spectrum of these disorders. Mixed acid base disorders were

  16. Cluster-Based Multipolling Sequencing Algorithm for Collecting RFID Data in Wireless LANs

    Choi, Woo-Yong; Chatterjee, Mainak

    2015-03-01

    With the growing use of RFID (Radio Frequency Identification), it is becoming important to devise ways to read RFID tags in real time. Access points (APs) of IEEE 802.11-based wireless Local Area Networks (LANs) are being integrated with RFID networks that can efficiently collect real-time RFID data. Several schemes, such as multipolling methods based on the dynamic search algorithm and random sequencing, have been proposed. However, as the number of RFID readers associated with an AP increases, it becomes difficult for the dynamic search algorithm to derive the multipolling sequence in real time. Though multipolling methods can eliminate the polling overhead, we still need to enhance the performance of the multipolling methods based on random sequencing. To that extent, we propose a real-time cluster-based multipolling sequencing algorithm that drastically eliminates more than 90% of the polling overhead, particularly so when the dynamic search algorithm fails to derive the multipolling sequence in real time.

  17. The sequence diversity and expression among genes of the folic acid biosynthesis pathway in industrial Saccharomyces strains.

    Goncerzewicz, Anna; Misiewicz, Anna

    2015-01-01

    Folic acid is an important vitamin in human nutrition and its deficiency in pregnant women's diets results in neural tube defects and other neurological damage to the fetus. Additionally, DNA synthesis, cell division and intestinal absorption are inhibited in case of adults. Since this discovery, governments and health organizations worldwide have made recommendations concerning folic acid supplementation of food for women planning to become pregnant. In many countries this has led to the introduction of fortifications, where synthetic folic acid is added to flour. It is known that Saccharomyces strains (brewing and bakers' yeast) are one of the main producers of folic acid and they can be used as a natural source of this vitamin. Proper selection of the most efficient strains may enhance the folate content in bread, fermented vegetables, dairy products and beer by 100% and may be used in the food industry. The objective of this study was to select the optimal producing yeast strain by determining the differences in nucleotide sequences in the FOL2, FOL3 and DFR1 genes of folic acid biosynthesis pathway. The Multitemperature Single Strand Conformation Polymorphism (MSSCP) method and further nucleotide sequencing for selected strains were applied to indicate SNPs in selected gene fragments. The RT qPCR technique was also applied to examine relative expression of the FOL3 gene. Furthermore, this is the first time ever that industrial yeast strains were analysed regarding genes of the folic acid biosynthesis pathway. It was observed that a correlation exists between the folic acid amount produced by industrial yeast strains and changes in the nucleotide sequence of adequate genes. The most significant changes occur in the DFR1 gene, mostly in the first part, which causes major protein structure modifications in KKP 232, KKP 222 and KKP 277 strains. Our study shows that the large amount of SNP contributes to impairment of the selected enzymes and S. cerevisiae and S

  18. A stochastic context free grammar based framework for analysis of protein sequences

    Nebel Jean-Christophe

    2009-10-01

    Full Text Available Abstract Background In the last decade, there have been many applications of formal language theory in bioinformatics such as RNA structure prediction and detection of patterns in DNA. However, in the field of proteomics, the size of the protein alphabet and the complexity of relationship between amino acids have mainly limited the application of formal language theory to the production of grammars whose expressive power is not higher than stochastic regular grammars. However, these grammars, like other state of the art methods, cannot cover any higher-order dependencies such as nested and crossing relationships that are common in proteins. In order to overcome some of these limitations, we propose a Stochastic Context Free Grammar based framework for the analysis of protein sequences where grammars are induced using a genetic algorithm. Results This framework was implemented in a system aiming at the production of binding site descriptors. These descriptors not only allow detection of protein regions that are involved in these sites, but also provide insight in their structure. Grammars were induced using quantitative properties of amino acids to deal with the size of the protein alphabet. Moreover, we imposed some structural constraints on grammars to reduce the extent of the rule search space. Finally, grammars based on different properties were combined to convey as much information as possible. Evaluation was performed on sites of various sizes and complexity described either by PROSITE patterns, domain profiles or a set of patterns. Results show the produced binding site descriptors are human-readable and, hence, highlight biologically meaningful features. Moreover, they achieve good accuracy in both annotation and detection. In addition, findings suggest that, unlike current state-of-the-art methods, our system may be particularly suited to deal with patterns shared by non-homologous proteins. Conclusion A new Stochastic Context Free

  19. Combined sequence and sequence-structure based methods for analyzing FGF23, CYP24A1 and VDR genes.

    Nagamani, Selvaraman; Singh, Kh Dhanachandra; Muthusamy, Karthikeyan

    2016-09-01

    FGF23, CYP24A1 and VDR altogether play a significant role in genetic susceptibility to chronic kidney disease (CKD). Identification of possible causative mutations may serve as therapeutic targets and diagnostic markers for CKD. Thus, we adopted both sequence and sequence-structure based SNP analysis algorithm in order to overcome the limitations of both methods. We explore the functional significance towards the prediction of risky SNPs associated with CKD. We assessed the performance of four widely used pathogenicity prediction methods. We compared the performances of the programs using Mathews correlation Coefficient ranged from poor (MCC = 0.39) to reasonably good (MCC = 0.42). However, we got the best results for the combined sequence and structure based analysis method (MCC = 0.45). 4 SNPs from FGF23 gene, 8 SNPs from VDR gene and 13 SNPs from CYP24A1 gene were predicted to be the causative agents for human diseases. This study will be helpful in selecting potential SNPs for experimental study from the SNP pool and also will reduce the cost for identification of potential SNPs as a genetic marker. PMID:27114920

  20. Differentially Private Frequent Sequence Mining via Sampling-based Candidate Pruning

    Xu, Shengzhi; Cheng, Xiang; Li, Zhengyi; Xiong, Li

    2016-01-01

    In this paper, we study the problem of mining frequent sequences under the rigorous differential privacy model. We explore the possibility of designing a differentially private frequent sequence mining (FSM) algorithm which can achieve both high data utility and a high degree of privacy. We found, in differentially private FSM, the amount of required noise is proportionate to the number of candidate sequences. If we could effectively reduce the number of unpromising candidate sequences, the utility and privacy tradeoff can be significantly improved. To this end, by leveraging a sampling-based candidate pruning technique, we propose a novel differentially private FSM algorithm, which is referred to as PFS2. The core of our algorithm is to utilize sample databases to further prune the candidate sequences generated based on the downward closure property. In particular, we use the noisy local support of candidate sequences in the sample databases to estimate which sequences are potentially frequent. To improve the accuracy of such private estimations, a sequence shrinking method is proposed to enforce the length constraint on the sample databases. Moreover, to decrease the probability of misestimating frequent sequences as infrequent, a threshold relaxation method is proposed to relax the user-specified threshold for the sample databases. Through formal privacy analysis, we show that our PFS2 algorithm is ε-differentially private. Extensive experiments on real datasets illustrate that our PFS2 algorithm can privately find frequent sequences with high accuracy. PMID:26973430

  1. Parallel divide and conquer bio-sequence comparison based on Smith-Waterman algorithm

    ZHANG Fa; QIAO Xiangzhen; LIU Zhiyong

    2004-01-01

    Tools for pair-wise bio-sequence alignment have for long played a central role in computation biology. Several algorithms for bio-sequence alignment have been developed. The Smith-Waterman algorithm, based on dynamic programming, is considered the most fundamental alignment algorithm in bioinformatics. However the existing parallel Smith-Waterman algorithm needs large memory space, and this disadvantage limits the size of a sequence to be handled. As the data of biological sequences expand rapidly, the memory requirement of the existing parallel SmithWaterman algorithm has become a critical problem. For solving this problem, we develop a new parallel bio-sequence alignment algorithm, using the strategy of divide and conquer, named PSW-DC algorithm. In our algorithm, first, we partition the query sequence into several subsequences and distribute them to every processor respectively,then compare each subsequence with the whole subject sequence in parallel, using the Smith-Waterman algorithm, and get an interim result, finally obtain the optimal alignment between the query sequence and subject sequence, through the special combination and extension method. Memory space required in our algorithm is reduced significantly in comparison with existing ones. We also develop a key technique of combination and extension, named the C&E method, to manipulate the interim results and obtain the final sequences alignment. We implement the new parallel bio-sequences alignment algorithm,the PSW-DC, in a cluster parallel system.

  2. "De-novo" amino acid sequence elucidation of protein G'e by combined "Top-Down" and "Bottom-Up" mass spectrometry

    Yefremova, Yelena; Al-Majdoub, Mahmoud; Opuni, Kwabena F. M.; Koy, Cornelia; Cui, Weidong; Yan, Yuetian; Gross, Michael L.; Glocker, Michael O.

    2015-03-01

    Mass spectrometric de-novo sequencing was applied to review the amino acid sequence of a commercially available recombinant protein Ǵ with great scientific and economic importance. Substantial deviations to the published amino acid sequence (Uniprot Q54181) were found by the presence of 46 additional amino acids at the N-terminus, including a so-called "His-tag" as well as an N-terminal partial α- N-gluconoylation and α- N-phosphogluconoylation, respectively. The unexpected amino acid sequence of the commercial protein G' comprised 241 amino acids and resulted in a molecular mass of 25,998.9 ± 0.2 Da for the unmodified protein. Due to the higher mass that is caused by its extended amino acid sequence compared with the original protein G' (185 amino acids), we named this protein "protein G'e." By means of mass spectrometric peptide mapping, the suggested amino acid sequence, as well as the N-terminal partial α- N-gluconoylations, was confirmed with 100% sequence coverage. After the protein G'e sequence was determined, we were able to determine the expression vector pET-28b from Novagen with the Xho I restriction enzyme cleavage site as the best option that was used for cloning and expressing the recombinant protein G'e in E. coli. A dissociation constant ( K d ) value of 9.4 nM for protein G'e was determined thermophoretically, showing that the N-terminal flanking sequence extension did not cause significant changes in the binding affinity to immunoglobulins.

  3. Readjoiner: a fast and memory efficient string graph-based sequence assembler

    Gonnella Giorgio; Kurtz Stefan

    2012-01-01

    Abstract Background Ongoing improvements in throughput of the next-generation sequencing technologies challenge the current generation of de novo sequence assemblers. Most recent sequence assemblers are based on the construction of a de Bruijn graph. An alternative framework of growing interest is the assembly string graph, not necessitating a division of the reads into k-mers, but requiring fast algorithms for the computation of suffix-prefix matches among all pairs of reads. Results Here we...

  4. LookSeq: A browser-based viewer for deep sequencing data

    Manske, Heinrich Magnus; Dominic P Kwiatkowski

    2009-01-01

    Sequencing a genome to great depth can be highly informative about heterogeneity within an individual or a population. Here we address the problem of how to visualize the multiple layers of information contained in deep sequencing data. We propose an interactive AJAX-based web viewer for browsing large data sets of aligned sequence reads. By enabling seamless browsing and fast zooming, the LookSeq program assists the user to assimilate information at different levels of resolution, from an ov...

  5. Improved Channel Estimation Methods based on PN sequence for TDS-OFDM

    Liu, Ming; Crussière, Matthieu; Hélard, Jean-François

    2012-01-01

    An accurate channel estimation is crucial for the novel time domain synchronous orthogonal frequency-division multiplexing (TDS-OFDM) scheme in which pseudo noise (PN) sequences serve as both guard intervals (GI) for OFDM data symbols and training sequences for synchronization/channel estimation. This paper studies the channel estimation method based on the cross-correlation of PN sequences. A theoretical analysis of this estimator is conducted and several improved estimators are then propose...

  6. Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

    Yu Jun

    2010-11-01

    Full Text Available Abstract Background Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge. Results To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya, yielding consistent theoretical compositions across all the collected sequences. Conclusions We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms. Reviewers This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein, Guruprasad Ananda (nominated by Kateryna Makova, and Daniel Haft.

  7. Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

    Zhang, Zhang

    2010-11-08

    Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.

  8. Amino acid sequence of phospholipase A/sub 2/-. cap alpha. from the venom of Crotalus adamanteus

    Heinrikson, R.L.; Krueger, E.T.; Keim, P.S.

    1977-07-25

    The complete amino acid sequence of Crotalus adamanteus venom phospholipase A/sub 2/-..cap alpha.. has been determined by analysis of the five tryptic peptides from the citraconylated, reduced, and S-(/sup 14/C)carboxamidomethylated enzyme. Earlier studies provided the information necessary to align the tryptic fragments so that secondary cleavage procedures to establish overlaps were unnecessary. The subunit in the phospholipase A/sub 2/-..cap alpha.. dimer is a single polypeptide chain containing 122 amino acids and seven disulfide bonds. The histidine residue implicated in the active site of mammalian phospholipases is at position 47 in the C. adamanteus enzyme and is located in a domain of the molecule which is highly homologous in sequence with corresponding regions of phospholipases from a variety of venom and pancreatic sources. Comparative sequence analysis has revealed insights with regard to the function and evolution of phospholipases A/sub 2/. Primary structural relationships observed among the snake venom enzymes parallel the phylogenetic classification of the venomous reptiles from which they were derived. It is proposed that phospholipases A/sub 2/ of this general type be divided into two groups depending upon the presence or absence of distinctive structural features elucidated in this study.

  9. Amino acid sequence and posttranslational modifications of human factor VIIa from plasma and transfected baby hamster kidney cells

    Blood coagulation factor VII is a vitamin K dependent glycoprotein which in its activated form, factor VIIa, participates in the coagulation process by activating factor X and/or factor IX in the presence of Ca2+ and tissue factor. Three types of potential posttranslational modifications exist in the human factor VIIa molecule, namely, 10 γ-carboxylated, N-terminally located glutamic acid residues, 1 β-hydroxylated aspartic acid residue, and 2 N-glycosylated asparagine residues. In the present study, the amino acid sequence and posttranslational modifications of recombinant factor VIIa as purified from the culture medium of a transfected baby hamster kidney cell line have been compared to human plasma factor VIIa. By use of HPLC, amino acid analysis, peptide mapping, and automated Edman degradation, the protein backbone of recombinant factor VIIa was found to be identical with human factor VIIa. Asparagine residues 145 and 322 were found to be fully N-glycosylated in human plasma factor VIIa. In the recombinant factor VIIa, asparagine residue 322 was fully glycosylated whereas asparagine residue 145 was only partially (approximately 66%) glycosylated. Besides minor differences in the sialic acid and fucose contents, the overall carbohydrate compositions were nearly identical in recombinant factor VIIa and human plasma factor VIIa. These results show that factor VIIa as produced in the transfected baby hamster kidney cells is very similar to human plasma factor VIIa and that this cell line thus might represent an alternative source for human factor VIIa

  10. The nucleotide sequence of HLA-B{sup *}2704 reveals a new amino acid substitution in exon 4 which is also present in HLA-B{sup *}2706

    Rudwaleit, M.; Bowness, P.; Wordsworth, P. [John Radcliffe Hospital, Oxford (United Kingdom)

    1996-12-31

    The HLA-B27 subtype HLA-B{sup *}2704 is virtually absent in Caucasians but common in Orientals, where it is associated with ankylosing spondylitis. The amino acid sequence of HLA-B{sup *}2704 has been established by peptide mapping and was shown to differ by two amino acids from HLA-B{sup *}2705, HLA-B{sup *}2704 is characterized by a serine for aspartic acid substitution at position 77 and glutamic acid for valine at position 152. To date, however, no nucleotide sequence confirming these changes at the DNA level has been published. 13 refs., 2 figs.

  11. Heterodimeric l-amino acid oxidase enzymes from Egyptian Cerastes cerastes venom: Purification, biochemical characterization and partial amino acid sequencing

    A.E. El Hakim; W.H. Salama; M.B. Hamed; Ali, A. A.; N.M. Ibrahim

    2015-01-01

    Two l-amino acid oxidase enzyme isoforms, Cc-LAAOI and Cc-LAAOII were purified to apparent homogeneity from Cerastes cerastes venom in a sequential two-step chromatographic protocol including; gel filtration and anion exchange chromatography. The native molecular weights of the isoforms were 115 kDa as determined by gel filtration on calibrated Sephacryl S-200 column, while the monomeric molecular weights of the enzymes were, 60, 56 kDa and 60, 53 kDa for LAAOI and LAAOII, respectively. The t...

  12. Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus

    Chen, Chunxian; Gmitter Jr, Fred G

    2013-01-01

    Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for...

  13. Sequence-Length Requirement of Distance-Based Phylogeny Reconstruction: Breaking the Polynomial Barrier

    Roch, Sebastien

    2009-01-01

    We introduce a new distance-based phylogeny reconstruction technique which provably achieves, at sufficiently short branch lengths, a polylogarithmic sequence-length requirement -- improving significantly over previous polynomial bounds for distance-based methods. The technique is based on an averaging procedure that implicitly reconstructs ancestral sequences. In the same token, we extend previous results on phase transitions in phylogeny reconstruction to general time-reversible models. More precisely, we show that in the so-called Kesten-Stigum zone (roughly, a region of the parameter space where ancestral sequences are well approximated by ``linear combinations'' of the observed sequences) sequences of length $\\poly(\\log n)$ suffice for reconstruction when branch lengths are discretized. Here $n$ is the number of extant species. Our results challenge, to some extent, the conventional wisdom that estimates of evolutionary distances alone carry significantly less information about phylogenies than full sequ...

  14. Acid-base disturbance in patients with cirrhosis

    Henriksen, Jens H; Bendtsen, Flemming; Møller, Søren

    2015-01-01

    PURPOSE: Acid-base disturbances were investigated in patients with cirrhosis in relation to hemodynamic derangement to analyze the hyperventilatory effects and the metabolic compensation. METHODS: A total of 66 patients with cirrhosis and 44 controls were investigated during a hemodynamic study......, and effects of unidentified ions (all Pacid-base disturbances could not be identified. CONCLUSION: Hypocapnic alkalosis is related to disease severity and hyperdynamic systemic circulation in patients with cirrhosis. The metabolic compensation includes...... alterations in serum albumin and water retention that may result in a delicate acid-base balance in these patients....

  15. High-Throughput Sequencing Based Methods of RNA Structure Investigation

    Kielpinski, Lukasz Jan

    In this thesis we describe the development of four related methods for RNA structure probing that utilize massive parallel sequencing. Using them, we were able to gather structural data for multiple, long molecules simultaneously. First, we have established an easy to follow experimental and...... RTTS-Seq to detect antisense oligonucleotide binding sites within a transcriptome. In this case, we applied an enrichment strategy to greatly reduce the background. Finally, we have modified the RTTS-Seq to study the secondary structure of 3’ untranslated regions. In the course of this thesis we...... computational protocol for detecting the reverse transcription termination sites (RTTS-Seq). This protocol was subsequently applied to hydroxyl radical footprinting of three dimensional RNA structures to give a probing signal that correlates well with the RNA backbone solvent accessibility. Moreover, we applied...

  16. The coulometric titration of acids and bases in dimethylsulfoxide media

    Bos, M.; IJpma, S.T.; Dahmen, E.A.M.F.

    1976-01-01

    The coulometric titration of 20–200 μeq of acids and bases in DMSO media is described. In the titration of bases, the electro-oxidation of hydrogen at a platinized platinum electrode is used as the source of protons. The conditions for 100 % current efficiency at this electrode are low current densi

  17. Soil Studies: Applying Acid-Base Chemistry to Environmental Analysis.

    West, Donna M.; Sterling, Donna R.

    2001-01-01

    Laboratory activities for chemistry students focus attention on the use of acid-base chemistry to examine environmental conditions. After using standard laboratory procedures to analyze soil and rainwater samples, students use web-based resources to interpret their findings. Uses CBL probes and graphing calculators to gather and analyze data and…

  18. A European Acid Rain Program based on the US experience

    Brandt, U. Steiner; Svendsen, Gert Tinggaard

    2000-01-01

    The paper shows that cost-effective involvement of the source location involves utmost difficulty in practice. Based on the RAINS model, it is recommended that source location should be ignored in a European market for SO2, as is the case in the US Acid Rain Program. Based on the political target...

  19. Metal-based chemosensors for amino acids, peptides, and nucleotides

    Buryak, Andrey

    2007-01-01

    An organometallic 4d transition metal complex [Cp*RhCl2]2, together with commercially available dyes, was used to construct indicator displacement assays (IDAs) for the detection of peptides, amino acids, and nucleotides. The combination of the Cp*Rh complex with the dye azophloxine was found to form a chemosensing ensemble for the sequence-selective detection of histidine- and methionine-containing peptides in water at neutral pH. A strong interaction of the rhodium complex with peptides bea...

  20. Metal-based chemosensors for amino acids, peptides, and nucleotides

    Buryak, Andrey; Severin, Kay

    2008-01-01

    An organometallic 4d transition metal complex [Cp*RhCl2]2, together with commercially available dyes, was used to construct indicator displacement assays (IDAs) for the detection of peptides, amino acids, and nucleotides. The combination of the Cp*Rh complex with the dye azophloxine was found to form a chemosensing ensemble for the sequence-selective detection of histidine- and methionine-containing peptides in water at neutral pH. A strong interaction of the rhodium complex with peptides bea...

  1. Main: Sequences [KOME

    Full Text Available Sequences Amino Acid Sequence Amino Acid sequence of full length cDNA (Longest ORF) kome_ine_full_sequence..._amino_db.fasta.zip kome_ine_full_sequence_amino_db.zip kome_ine_full_sequence_amino_db ...

  2. A method for amplification of unknown flanking sequences based on touchdown PCR and suppression-PCR.

    Gao, Song; He, Dan; Li, Guangquan; Zhang, Yanhua; Lv, Huiying; Wang, Li

    2016-09-15

    Thermal asymmetric staggered PCR is the most widely used technique to obtain the flanking sequences. However, it has some limitations, including a low rate of positivity, and complex operation. In this study, a improved method of it was made based on suppression-PCR and touchdown PCR. The PCR fragment obtained by the amplification was used directly for sequencing after gel purification. Using this improved method, the positive rate of amplified flanking sequences of the ATMT mutants reached 99%. In addition, the time from DNA extraction to flanking sequence analysis was shortened to 2 days with about 6 dollars each sample. PMID:27393656

  3. An Approach to Assembly Sequence Plannning Based on Hierarchical Strategy and Genetic Algorithm

    Niu Xinwen; Ding Han; Xiong Youlun

    2001-01-01

    Using group and subassembly cluster methods, the hierarchical structure of a product is.generated automatically, which largely reduces the complexity of planning. Based on genetic algofithn the optimal of assembly sequence of each stracture level can be obtained by sequence-bysequence search. As a result, a better assembly sequence of the product can be generated by combining the assembly sequences of all hierarchical structures, which provides more parallelism and flexibility for assembly operations. An industrial example is solved by this new approach.

  4. THE CONSTRUCTIONS OF ALMOST BINARY SEQUENCE PAIRS WITH THREE-LEVEL CORRELATION BASED ON CYCLOTOMY

    Peng Xiuping; Xu Chengqian

    2012-01-01

    In this paper,a new class of almost binary sequence pair with a single zero element is presented.The almost binary sequence pairs with three-level correlation are constructed based on cyclotomic numbers of order 2,4,and 6.Most of them have good correlation and balance property,whose maximum nontrivial correlation magnitudes are 2 and the difference between the numbers of occurrence of +1's and -1's are 0 or 1.In addition,the corresponding binary sequence pairs are investigated as well and we can also get some kinds of binary sequence pairs with optimum balance and good correlation.

  5. Ribonuclease "XlaI," an activity from Xenopus laevis oocytes that excises intervening sequences from yeast transfer ribonucleic acid precursors.

    Otsuka, A; de Paolis, A; Tocchini-Valentini, G P

    1981-01-01

    A ribonuclease (RNase) activity, RNase "XlaI," responsible for the excision of intervening sequences from two yeast transfer ribonucleic acid (tRNA) precursors, pre-tRNA(Tyr) and pre-tRNA(3Leu), has been purified 54-fold from nuclear extracts of Xenopus laevis oocytes. The RNase preparation is essentially free of contaminating RNase. A quantitative assay for RNase XlaI was developed, and the reaction products were characterized. RNase XlaI cleavage sites in the yeast tRNA precursors were identical to those made by yeast extracts (including 3'-phosphate and 5'-hydroxyl termini). Cleavage of pre-tRNA(3Leu) by RNase XlaI and subsequent ligation of the half-tRNA molecules do not require removal of the 5' leader or 3' trailer sequences. Images PMID:6765601

  6. Phylogeny of Sym plasmids of rhizobia by PCR-based sequencing of a nodC segment.

    Ueda, T.; Suga, Y; Yahiro, N; Matsuguchi, T

    1995-01-01

    To understand the host specificity of rhizobia and the relationship between the evolution of Sym plasmids and that of host plants, we determined partial nodC sequences of 10 representative rhizobium strains and then constructed an evolutionary tree for the deduced amino acid sequences with four published sequences. These coding sequences yield a phylogenetic tree similar to that for leghemoglobin of host plants, suggesting that the evolution of common nodulation genes may be linked to host le...

  7. Sparc: a sparsity-based consensus algorithm for long erroneous sequencing reads

    2016-01-01

    Motivation. The third generation sequencing (3GS) technology generates long sequences of thousands of bases. However, its current error rates are estimated in the range of 15–40%, significantly higher than those of the prevalent next generation sequencing (NGS) technologies (less than 1%). Fundamental bioinformatics tasks such as de novo genome assembly and variant calling require high-quality sequences that need to be extracted from these long but erroneous 3GS sequences. Results. We describe a versatile and efficient linear complexity consensus algorithm Sparc to facilitate de novo genome assembly. Sparc builds a sparse k-mer graph using a collection of sequences from a targeted genomic region. The heaviest path which approximates the most likely genome sequence is searched through a sparsity-induced reweighted graph as the consensus sequence. Sparc supports using NGS and 3GS data together, which leads to significant improvements in both cost efficiency and computational efficiency. Experiments with Sparc show that our algorithm can efficiently provide high-quality consensus sequences using both PacBio and Oxford Nanopore sequencing technologies. With only 30× PacBio data, Sparc can reach a consensus with error rate NGS data. Compared with the existing approaches, Sparc calculates the consensus with higher accuracy, and uses approximately 80% less memory and time. Availability. The source code is available for download at https://github.com/yechengxi/Sparc. PMID:27330851

  8. Molecular phylogeny of endophytic isolates of Ampelomyces from Iran based on rDNA ITS sequences.

    Jamali, Samad

    2015-01-01

    During 2012, five isolates of pycnidial fungi were recovered from roots of tomato (Solanum lycopersicum) plants in Iran. Based on morphological characteristics the presence of Ampelomyces was documented. To confirm morphological identification and clarify the placement of endophytic isolates of Ampelomyces, DNA was extracted from isolates using a genomic DNA purification Kit. Region of internal transcribed spacers 1, 2 and 5.8S genes of rDNA were amplified using ITS4 and ITS1 universal primer set. Amplicons were purified, sequenced and submitted to the GenBank. The resulting sequence (600 bp) was submitted to a BLAST search to find most similar sequences in GenBank. The ITS sequences of isolates obtained in Iran were compared to those of other related authentic sequences obtained from GenBank. Iranian endophytic isolates had 100 % similarity of among themselves, while all isolates of Ampelomyces sequences analyzed had an average of 95.2 % (range 87-100 %) similarity. When Ampelomyces ITS sequences were analyzed by both distance-based and maximum parsimony methods, the Ampelomyces isolates were segregate into 11 distinct clades. The ITS sequences of endophytic isolates obtained in Iran were identical with endophytic isolates from other country including USA, Australia, Hungary and Spain. Our analyses of phylogenetic data showed that endophytic isolates from Iran and other countries are distinct group. The high ITS sequence-divergence values and the phylogenetic analysis suggested the isolates of Ampelomyces in the clades are not closely related and indeed a problematic species complex. PMID:25245955

  9. High-throughput-sequencing-based identification of a grapevine fanleaf virus satellite RNA in Vitis vinifera.

    Chiumenti, Michela; Mohorianu, Irina; Roseti, Vincenzo; Saldarelli, Pasquale; Dalmay, Tamas; Minafra, Angelantonio

    2016-05-01

    A new satellite RNA (satRNA) of grapevine fanleaf virus (GFLV) was identified by high-throughput sequencing of high-definition (HD) adapter libraries from grapevine plants of the cultivar Panse precoce (PPE) affected by enation disease. The complete nucleotide sequence was obtained by automatic sequencing using primers designed based on next-generation sequencing (NGS) data. The full-length sequence, named satGFLV-PPE, consisted of 1119 nucleotides with a single open reading frame from position 15 to 1034. This satRNA showed maximum nucleotide sequence identity of 87 % to satArMV-86 and satGFLV-R6. Symptomatic grapevines were surveyed for the presence of the satRNA, and no correlation was found between detection of the satRNA and enation symptom expression. PMID:26873812

  10. CAPS satellite spread spectrum communication blind multi-user detecting system based on chaotic sequences

    LEI LiHua; SHI HuLi; MA GuanYi

    2009-01-01

    Multiple Path Interference (MPI) and Multiple Access Interference (MAI) are Important factors that affect the performance of Chinese Area Positioning System (CAPS),These problems can be solved by using spreading sequences with ideal properties and multi-user detectors.Chaotic sequences based on Chebyshev map are studied and the satellite communication system model is set up to investigate the application of chaotic sequences for CAPS in this paper,Simulation results show that chaotic sequences have desirable correlation properties and it is easy to generate a large number of chaotic sequences with good security.It has great practical value to apply chaotic sequences to CAPS together with multi-user detecting technology and the system performance can be improved greatly.

  11. Amino Acid Sequence Requirements of the Transmembrane and Cytoplasmic Domains of Influenza Virus Hemagglutinin for Viable Membrane Fusion

    Melikyan, Grigory B.; Lin, Sasa; Roth, Michael G.; Cohen, Fredric S.

    1999-01-01

    The amino acid sequence requirements of the transmembrane (TM) domain and cytoplasmic tail (CT) of the hemagglutinin (HA) of influenza virus in membrane fusion have been investigated. Fusion properties of wild-type HA were compared with those of chimeras consisting of the ectodomain of HA and the TM domain and/or CT of polyimmunoglobulin receptor, a nonviral integral membrane protein. The presence of a CT was not required for fusion. But when a TM domain and CT were present, fusion activity w...

  12. Lipoic acid metabolism in Escherichia coli: sequencing and functional characterization of the lipA and lipB genes.

    Reed, K E; Cronan, J E

    1993-01-01

    Two genes, lipA and lipB, involved in lipoic acid biosynthesis or metabolism were characterized by DNA sequence analysis. The translational initiation site of the lipA gene was established, and the lipB gene product was identified as a 25-kDa protein. Overproduction of LipA resulted in the formation of inclusion bodies, from which the protein was readily purified. Cells grown under strictly anaerobic conditions required the lipA and lipB gene products for the synthesis of a functional glycine...

  13. Barley polyamine oxidase: Characterisation and analysis of the cofactor and the N-terminal amino acid sequence

    Radova, A.; Sebela, M.; Galuszka, P.;

    2001-01-01

    This paper reports the first purification method developed for the isolation of an homogeneous polyamine oxidase (PAO) from etiolated barley seedlings. The crude enzyme preparation was obtained after initial precipitation of the extract with protamine sulphate and ammonium sulphate. The enzyme was...... further purified to a final homogeneity (by the criteria of isoelectric focusing and SDS-PAGE) using techniques of low pressure chromatography followed by two FPLC steps. The purified yellow enzyme showed visible absorption maxima of a flavoprotein at 380 and 450 nm: the presence of FAD as the cofactor...... was further confirmed by measuring the fluorescence spectra, Barley PAO is an acidic protein (pI 5.4) containing 3% of neutral sugars: its molecular mass determined by SDS-PAGE was 56 kDa, whilst gel permeation chromatography revealed the higher value of 76 kDa. The N-terminal amino acid sequence of...

  14. An Interpretation of the Ancestral Codon from Miller’s Amino Acids and Nucleotide Correlations in Modern Coding Sequences

    Carels, Nicolas; de Leon, Miguel Ponce

    2015-01-01

    Purine bias, which is usually referred to as an “ancestral codon”, is known to result in short-range correlations between nucleotides in coding sequences, and it is common in all species. We demonstrate that RWY is a more appropriate pattern than the classical RNY, and purine bias (Rrr) is the product of a network of nucleotide compensations induced by functional constraints on the physicochemical properties of proteins. Through deductions from universal correlation properties, we also demonstrate that amino acids from Miller’s spark discharge experiment are compatible with functional primeval proteins at the dawn of living cell radiation on earth. These amino acids match the hydropathy and secondary structures of modern proteins. PMID:25922573

  15. Control allocation and management of redundant control effectors based on bases sequenced optimal method

    2010-01-01

    For an advanced aircraft, the amount of its effectors is much more than that for a traditional one, the functions of effectors are more complex and the coupling between each other is more severe. Based on the current control allocation research, this paper puts forward the concept and framework of the control allocation and management system for aircrafts with redundancy con-trol effectors. A new optimal control allocation method, bases sequenced optimal (BSO) method, is then presented. By analyz-ing the physical meaning of the allocation process of BSO method, four types of management strategies are adopted by the system, which act on the control allocation process under different flight conditions, mission requirements and effectors work-ing conditions. Simulation results show that functions of the control allocation system are extended and the system adaptability to flight status, mission requirements and effector failure conditions is improved.

  16. Mass spectrometry of nucleic acids components. Nucleotides, oligonucleotides and application to sequence determination

    The application of the various ionization techniques to the analysis of nucleotides and oligonucleotides is reviewed. The sequence determination of oligonucleotides was chosen to present the growing possibilities of mass spectrometry due to development of new ''soft ionization'' techniques. 119 refs., 6 figs., 2 tabs. (author)

  17. A comparison of single molecule and amplification based sequencing of cancer transcriptomes.

    Lee T Sam

    Full Text Available The second wave of next generation sequencing technologies, referred to as single-molecule sequencing (SMS, carries the promise of profiling samples directly without employing polymerase chain reaction steps used by amplification-based sequencing (AS methods. To examine the merits of both technologies, we examine mRNA sequencing results from single-molecule and amplification-based sequencing in a set of human cancer cell lines and tissues. We observe a characteristic coverage bias towards high abundance transcripts in amplification-based sequencing. A larger fraction of AS reads cover highly expressed genes, such as those associated with translational processes and housekeeping genes, resulting in relatively lower coverage of genes at low and mid-level abundance. In contrast, the coverage of high abundance transcripts plateaus off using SMS. Consequently, SMS is able to sequence lower- abundance transcripts more thoroughly, including some that are undetected by AS methods; however, these include many more mapping artifacts. A better understanding of the technical and analytical factors introducing platform specific biases in high throughput transcriptome sequencing applications will be critical in cross platform meta-analytic studies.

  18. Prediction of the Occurrence of the ADP-binding βαβ-fold in Proteins, Using an Amino Acid Sequence Fingerprint

    Wierenga, Rik K.; Terpstra, Peter; Hol, Wim G.J.

    1986-01-01

    An amino acid sequence "fingerprint” has been derived that can be used to test if a particular sequence will fold into a βαβ-unit with ADP-binding properties. It was deduced from a careful analysis of the known three-dimensional structures of ADP-binding βαβ-folds. This fingerprint is in fact a set

  19. Evaluation of Hybridization Capture Versus Amplicon‐Based Methods for Whole‐Exome Sequencing

    Samorodnitsky, Eric; Jewell, Benjamin M.; Hagopian, Raffi; Miya, Jharna; Wing, Michele R.; Lyon, Ezra; Damodaran, Senthilkumar; Bhatt, Darshna; Reeser, Julie W.; Datta, Jharna

    2015-01-01

    ABSTRACT Next‐generation sequencing has aided characterization of genomic variation. While whole‐genome sequencing may capture all possible mutations, whole‐exome sequencing remains cost‐effective and captures most phenotype‐altering mutations. Initial strategies for exome enrichment utilized a hybridization‐based capture approach. Recently, amplicon‐based methods were designed to simplify preparation and utilize smaller DNA inputs. We evaluated two hybridization capture‐based and two amplicon‐based whole‐exome sequencing approaches, utilizing both Illumina and Ion Torrent sequencers, comparing on‐target alignment, uniformity, and variant calling. While the amplicon methods had higher on‐target rates, the hybridization capture‐based approaches demonstrated better uniformity. All methods identified many of the same single‐nucleotide variants, but each amplicon‐based method missed variants detected by the other three methods and reported additional variants discordant with all three other technologies. Many of these potential false positives or negatives appear to result from limited coverage, low variant frequency, vicinity to read starts/ends, or the need for platform‐specific variant calling algorithms. All methods demonstrated effective copy‐number variant calling when evaluated against a single‐nucleotide polymorphism array. This study illustrates some differences between whole‐exome sequencing approaches, highlights the need for selecting appropriate variant calling based on capture method, and will aid laboratories in selecting their preferred approach. PMID:26110913

  20. Evaluation of Hybridization Capture Versus Amplicon-Based Methods for Whole-Exome Sequencing.

    Samorodnitsky, Eric; Jewell, Benjamin M; Hagopian, Raffi; Miya, Jharna; Wing, Michele R; Lyon, Ezra; Damodaran, Senthilkumar; Bhatt, Darshna; Reeser, Julie W; Datta, Jharna; Roychowdhury, Sameek

    2015-09-01

    Next-generation sequencing has aided characterization of genomic variation. While whole-genome sequencing may capture all possible mutations, whole-exome sequencing remains cost-effective and captures most phenotype-altering mutations. Initial strategies for exome enrichment utilized a hybridization-based capture approach. Recently, amplicon-based methods were designed to simplify preparation and utilize smaller DNA inputs. We evaluated two hybridization capture-based and two amplicon-based whole-exome sequencing approaches, utilizing both Illumina and Ion Torrent sequencers, comparing on-target alignment, uniformity, and variant calling. While the amplicon methods had higher on-target rates, the hybridization capture-based approaches demonstrated better uniformity. All methods identified many of the same single-nucleotide variants, but each amplicon-based method missed variants detected by the other three methods and reported additional variants discordant with all three other technologies. Many of these potential false positives or negatives appear to result from limited coverage, low variant frequency, vicinity to read starts/ends, or the need for platform-specific variant calling algorithms. All methods demonstrated effective copy-number variant calling when evaluated against a single-nucleotide polymorphism array. This study illustrates some differences between whole-exome sequencing approaches, highlights the need for selecting appropriate variant calling based on capture method, and will aid laboratories in selecting their preferred approach. PMID:26110913

  1. Lactic acid bacteria fermentations in oat-based suspensions

    Mårtensson, Olof

    2002-01-01

    This thesis deals with the fermentation characteristics of lactic acid bacteria (LAB) in oat-based suspensions, with formulation work of fermented products based on oat and with nutritional studies of these products. Changes in structure in terms of viscosity and ropiness were studied when exopolysaccharide (EPS)-producing LAB strains, namely, Lactobacillus delbrueckii subsp. bulgaricus NCFB 2772, Lactobacillus brevis G-77 and Pediococcus damnosus 2.6 were grown in these oat-based suspensions...

  2. Group Graded Associated Ideals with Flat Base Change of Rings and Short Exact Sequences

    Srinivas Behara; Shiv Datt Kumar

    2011-05-01

    This paper deals with the study of behaviour of -associated ideals and strong Krull -associated ideals with flat base change of rings and behaviour of -associated ideals with short exact sequences over rings graded by finitely generated abelian group .

  3. Design and Evaluation of a Research-Based Teaching Sequence: The Superposition of Electric Field.

    Viennot, L.; Rainson, S.

    1999-01-01

    Illustrates an approach to research-based teaching strategies and their evaluation. Addresses a teaching sequence on the superposition of electric fields implemented at the college level in an institutional framework subject to severe constraints. Contains 28 references. (DDR)

  4. Base J glucosyltransferase does not regulate the sequence specificity of J synthesis in trypanosomatid telomeric DNA.

    Bullard, Whitney; Cliffe, Laura; Wang, Pengcheng; Wang, Yinsheng; Sabatini, Robert

    2015-12-01

    Telomeric DNA of trypanosomatids possesses a modified thymine base, called base J, that is synthesized in a two-step process; the base is hydroxylated by a thymidine hydroxylase forming hydroxymethyluracil (hmU) and a glucose moiety is then attached by the J-associated glucosyltransferase (JGT). To examine the importance of JGT in modifiying specific thymine in DNA, we used a Leishmania episome system to demonstrate that the telomeric repeat (GGGTTA) stimulates J synthesis in vivo while mutant telomeric sequences (GGGTTT, GGGATT, and GGGAAA) do not. Utilizing an in vitro GT assay we find that JGT can glycosylate hmU within any sequence with no significant change in Km or kcat, even mutant telomeric sequences that are unable to be J-modified in vivo. The data suggests that JGT possesses no DNA sequence specificity in vitro, lending support to the hypothesis that the specificity of base J synthesis is not at the level of the JGT reaction. PMID:26815240

  5. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    Xie, Gary [Los Alamos National Laboratory (LANL); Dalin, Eileen [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Chertkov, Olga [Los Alamos National Laboratory (LANL); Land, Miriam L [ORNL

    2011-01-01

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer-ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this sporogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attractive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi-cellulose. This bacterium is also considered as a potential probiotic. Complete genome squence of a representative strain, B. coagulans strain 36D1, is presented and discussed.

  6. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    Rhee, Mun Su [University of Florida, Gainesville; Moritz, Brelan E. [University of Florida, Gainesville; Xie, Gary [Los Alamos National Laboratory (LANL); Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Dalin, Eileen [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Chertkov, Olga [Los Alamos National Laboratory (LANL); Brettin, Thomas S [ORNL; Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Patel, Milind [University of Florida, Gainesville; Ou, Mark [University of Florida, Gainesville; Harbrucker, Roberta [University of Florida, Gainesville; Ingram, Lonnie O. [University of Florida; Shanmugam, Keelnathan T. [University of Florida

    2011-01-01

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer- ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this spo- rogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attrac- tive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi- cellulose. This bacterium is also considered as a potential probiotic. Complete genome se- quence of a representative strain, B. coagulans strain 36D1, is presented and discussed.

  7. Cofactory: Sequence-based prediction of cofactor specificity of Rossmann folds

    Geertz-Hansen, Henrik Marcus; Blom, Nikolaj; Feist, Adam; Brunak, Søren; Petersen, Thomas Nordahl

    2014-01-01

    cofactor specificity using only primary amino acid sequence information. The algorithm identifies potential cofactor binding Rossinann folds and predicts the specificity for the cofactors FAD(H2), NAD(H), and NADP(H) The Rossmann fold sequence search is carried out using hidden Markov models whereas...... artificial neural networks are used for specificity prediction. Training was carried out using experimental data from protein cofactor structure complexes. The overall performance was benchmarked against an independent evaluation set obtaining Matthews correlation coefficients of 0.94, 0.79, and 0.65 for FAD...

  8. On Properties of Update Sequences Based on Causal Rejection

    Eiter, T.; Fink, M; Sabbatini, G; Tompits, H.

    2001-01-01

    We consider an approach to update nonmonotonic knowledge bases represented as extended logic programs under answer set semantics. New information is incorporated into the current knowledge base subject to a causal rejection principle enforcing that, in case of conflicts, more recent rules are preferred and older rules are overridden. Such a rejection principle is also exploited in other approaches to update logic programs, e.g., in dynamic logic programming by Alferes et al. We give a thoroug...

  9. Sequencing-Based Genotyping of Mixed Human Papillomavirus Infections by Use of RipSeq Software

    Tardif, Keith D.; Simmon, Keith E.; Kommedal, Øyvind; Pyne, Michael T.; Schlaberg, Robert

    2013-01-01

    Sequencing-based pathogen identification directly from clinical specimens requires time-consuming interpretation, especially with mixed chromatograms when multiple microorganisms are detected. We assessed RipSeq Mixed software for human papillomavirus (HPV) genotyping by comparison to the linear array HPV genotyping assay. RipSeq Mixed provided rapid, sequencing-based HPV typing for single-type infections and coinfections with 2 types.

  10. Assembly-free genome comparison based on next-generation sequencing reads and variable length patterns

    Comin, Matteo; Schimd, Michele

    2014-01-01

    Background With the advent of Next-Generation Sequencing technologies (NGS), a large amount of short read data has been generated. If a reference genome is not available, the assembly of a template sequence is usually challenging because of repeats and the short length of reads. When NGS reads cannot be mapped onto a reference genome alignment-based methods are not applicable. However it is still possible to study the evolutionary relationship of unassembled genomes based on NGS data. Results...

  11. Feature-Based Classification of Amino Acid Substitutions outside Conserved Functional Protein Domains

    Branislava Gemovic

    2013-01-01

    Full Text Available There are more than 500 amino acid substitutions in each human genome, and bioinformatics tools irreplaceably contribute to determination of their functional effects. We have developed feature-based algorithm for the detection of mutations outside conserved functional domains (CFDs and compared its classification efficacy with the most commonly used phylogeny-based tools, PolyPhen-2 and SIFT. The new algorithm is based on the informational spectrum method (ISM, a feature-based technique, and statistical analysis. Our dataset contained neutral polymorphisms and mutations associated with myeloid malignancies from epigenetic regulators ASXL1, DNMT3A, EZH2, and TET2. PolyPhen-2 and SIFT had significantly lower accuracies in predicting the effects of amino acid substitutions outside CFDs than expected, with especially low sensitivity. On the other hand, only ISM algorithm showed statistically significant classification of these sequences. It outperformed PolyPhen-2 and SIFT by 15% and 13%, respectively. These results suggest that feature-based methods, like ISM, are more suitable for the classification of amino acid substitutions outside CFDs than phylogeny-based tools.

  12. First-principles study of physisorption of nucleic acid bases on small-diameter carbon nanotubes

    We report the results of our first-principles study based on density functional theory on the interaction of the nucleic acid base molecules adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U), with a single-walled carbon nanotube (CNT). Specifically, the focus is on the physisorption of base molecules on the outer wall of a (5, 0) metallic CNT possessing one of the smallest diameters possible. Compared to the case for CNTs with large diameters, the physisorption energy is found to be reduced in the high-curvature case. The base molecules exhibit significantly different interaction strengths and the calculated binding energies follow the hierarchy G>A>T>C>U, which appears to be independent of the tube curvature. The stabilizing factor in the interaction between the base molecule and CNT is dominated by the molecular polarizability that allows a weakly attractive dispersion force to be induced between them. The present study provides an improved understanding of the role of the base sequence in deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) in their interactions with carbon nanotubes of varying diameters

  13. Sequence and structural features of binding site residues in protein-protein complexes: comparison with protein-nucleic acid complexes

    Selvaraj S; Jayaram B; Saranya N; Gromiha M; Fukui Kazuhiko

    2011-01-01

    Abstract Background Protein-protein interactions are important for several cellular processes. Understanding the mechanism of protein-protein recognition and predicting the binding sites in protein-protein complexes are long standing goals in molecular and computational biology. Methods We have developed an energy based approach for identifying the binding site residues in protein–protein complexes. The binding site residues have been analyzed with sequence and structure based parameters such...

  14. Complete Genome Sequence of Moraxella osloensis Strain KMC41, a Producer of 4-Methyl-3-Hexenoic Acid, a Major Malodor Compound in Laundry.

    Goto, Takatsugu; Hirakawa, Hideki; Morita, Yuji; Tomida, Junko; Sato, Jun; Matsumura, Yuta; Mitani, Asako; Niwano, Yu; Takeuchi, Kohei; Kubota, Hiromi; Kawamura, Yoshiaki

    2016-01-01

    We report the complete genome sequence of Moraxella osloensis strain KMC41, isolated from laundry with malodor. The KMC41 genome comprises a 2,445,556-bp chromosome and three plasmids. A fatty acid desaturase and at least four β-oxidation-related genes putatively associated with 4-methyl-3-hexenoic acid generation were detected in the KMC41 chromosome. PMID:27445387

  15. Antibody-Specific Model of Amino Acid Substitution for Immunological Inferences from Alignments of Antibody Sequences

    Mirsky, Alexander; Kazandjian, Linda; Anisimova, Maria

    2014-01-01

    Antibodies are glycoproteins produced by the immune system as a dynamically adaptive line of defense against invading pathogens. Very elegant and specific mutational mechanisms allow B lymphocytes to produce a large and diversified repertoire of antibodies, which is modified and enhanced throughout all adulthood. One of these mechanisms is somatic hypermutation, which stochastically mutates nucleotides in the antibody genes, forming new sequences with different properties and, eventually, hig...

  16. Complete nucleotide and derived amino acid sequence of cDNA encoding the mitochondrial uncoupling protein of rat brown adipose tissue: lack of a mitochondrial targeting presequence.

    Ridley, R. G.; Patel, H. V.; Gerber, G E; Morton, R C; Freeman, K. B.

    1986-01-01

    A cDNA clone spanning the entire amino acid sequence of the nuclear-encoded uncoupling protein of rat brown adipose tissue mitochondria has been isolated and sequenced. With the exception of the N-terminal methionine the deduced N-terminus of the newly synthesized uncoupling protein is identical to the N-terminal 30 amino acids of the native uncoupling protein as determined by protein sequencing. This proves that the protein contains no N-terminal mitochondrial targeting prepiece and that a t...

  17. Identification of a novel HMW glutenin subunit and comparison of its amino acid sequence with those of homologous subunits

    2002-01-01

    Aegilops tauschii is the donor of the D genome of common wheat (Triticum aestivum). Genetic variation of HMW glutenin subunits encoded by the Glu-1Dt locus of Ae. tauschii has been found to be higher than that specified by the Glu-1D locus in common wheat. In the present note, we report the identification of a novel HMW glutenin subunit, Dy13t, from Ae. tauschii. The newly identified subunit possessed an electrophoretic mobility that was faster than that of the Dy12 subunit of common wheat. The complete ORF of encoding the Dy13t subunit contained 624 codons (excluding the stop codons). The amino acid sequence deduced from the Dy13t gene ORF was the shortest among those of the previously reported subunits derived by the D genome. A further comparison of Dy13t amino acid sequence with those of the subunits characterized from the A, B, D, R genomes of Triticeae showed that the smaller size of the Dy13t subunit was associated with a reduction in the size of its repetitive domain.

  18. CHARGE DEVELOPMENT AND ACID-BASE CHARACTERISTICS OF SOIL AND COMPOST HUMIC ACIDS

    P. A. CAMPITELLI

    2003-09-01

    Full Text Available In previous works, the acid-base properties, charging behavior and chemical heterogeneity of humic substances have been studied using different mathematical equations to fit the experimental data. The objective of this research is to study the charge behavior, acid-base properties and analyze the chemical heterogeneity of humic acids (HA extracted from soil and composted municipal solid waste by potentiometric titrations. The humic acids extracted from compost have some characteristics and behavior similar to those obtained from soil. The negative charge development of HA extracted from composted material are lower than those extracted from soil and increase as ionic strength increase. The amount of carboxylic groups is lower in compost HA than in soil HA The heterogeneity of HA extracted from compost is higher than those extracted from soil. As the time of composting period increase the humification processes that take place trends to produce compost HA that has similar characteristics to soil HA. We suggest that HA extracted from composted material are macromolecules "like soil humic acids", i.e. "humiclike fraction"

  19. Rapid Conversion of Traditional Introductory Physics Sequences to an Activity-Based Format

    Yoder, Garett; Cook, Jerry

    2014-01-01

    The Department of Physics at EKU [Eastern Kentucky University] with support from the National Science Foundations Course Curriculum and Laboratory Improvement Program has successfully converted our entire introductory physics sequence, both algebra-based and calculus-based courses, to an activity-based format where laboratory activities,…

  20. Deciphering Clostridium tyrobutyricum Metabolism Based on the Whole-Genome Sequence and Proteome Analyses

    Lee, Joungmin; Jang, Yu-Sin; Han, Mee-Jung; Kim, Jin Young; Lee, Sang Yup

    2016-01-01

    ABSTRACT Clostridium tyrobutyricum is a Gram-positive anaerobic bacterium that efficiently produces butyric acid and is considered a promising host for anaerobic production of bulk chemicals. Due to limited knowledge on the genetic and metabolic characteristics of this strain, however, little progress has been made in metabolic engineering of this strain. Here we report the complete genome sequence of C. tyrobutyricum KCTC 5387 (ATCC 25755), which consists of a 3.07-Mbp chromosome and a 63-kb...

  1. Acid-base thermochemistry of gaseous oxygen and sulfur substituted amino acids (Ser, Thr, Cys, Met)

    Riffet, Vanessa; Frison, Gilles; Bouchoux, Guy

    2011-01-01

    Acid-base thermochemistry of isolated amino acids containing oxygen or sulfur in their side chain (serine, threonine, cysteine and methionine) have been examined by quantum chemical computations. Density functional theory (DFT) was used, with B3LYP, B97-D and M06-2X functionals using the 6-31+G(d,p) basis set for geometry optimizations and the larger 6-311++G(3df,2p) basis set for energy computations. Composite methods CBS-QB3, G3B3, G4MP2 and G4 were applied to large sets of neutral, protona...

  2. Turkish Prospective Chemistry Teachers' Alternative Conceptions about Acids and Bases

    Boz, Yezdan

    2009-01-01

    The purpose of this study was to obtain prospective chemistry teachers' conceptions about acids and bases concepts. Thirty-eight prospective chemistry teachers were the participants. Data were collected by means of an open-ended questionnaire and semi-structured interviews. Analysis of data indicated that most prospective teachers did not have…

  3. Acid-base transport in pancreas-new challenges

    Novak, Ivana; Haanes, Kristian Agmund; Wang, Jing

    2013-01-01

    to consider in pancreas are the proton pumps (H-K-ATPases), as well as the calcium-activated K and Cl channels, such as K3.1 and TMEM16A/ANO1. Local regulators, such as purinergic signaling, fine-tune, and coordinate pancreatic secretion. Lastly, we speculate whether dys-regulation of acid-base transport...

  4. Oxidation of coal-based raw materials by nitric acid

    Novák, J.; Novák, František; Madronová, L.; Machovič, V.; Kozler, J.

    New York : Nova Science Publisher, 2011 - (Madronová, L.), s. 105-123 ISBN 978-1-61668-965-0. - ( Chemistry Research and Applications ) Institutional research plan: CEZ:AV0Z60660521 Keywords : oxidation * coal-based raw materials * nitric acid Subject RIV: CB - Analytical Chemistry , Separation

  5. Complete genome sequence of probiotic Bacillus coagulans HM-08: A potential lactic acid producer.

    Yao, Guoqiang; Gao, Pengfei; Zhang, Wenyi

    2016-06-20

    Bacillus coagulans HM-08 is a commercialized probiotic strain in China. Its genome contains a 3.62Mb circular chromosome with an average GC content of 46.3%. In silico analysis revealed the presence of one xyl operon as well as several other genes that are correlated to xylose utilization. The genetic information provided here may help to expand its future biotechnology potential in lactic acid production. PMID:27130497

  6. Complete Genome Sequence of the Probiotic Lactic Acid Bacterium Lactobacillus Rhamnosus

    Samat Kozhakhmetov; Almagul Kushugulova; Adil Supiyev; Indira Tynybayeva; Ulykbek Kairov; Saule Saduakhasova; Gulnara Shakhabayeva; Kenzhebulat Bapishev; Talgat Nurgozhin; Zhaxybay Zhumadilov

    2014-01-01

    Introduction: Lactobacilli are a bacteria commonly found in the gastrointestinal tract. Some species of this genus have probiotic properties. The most common of these is Lactobacillus rhamnosus, a microoganism, generally regarded as safe (GRAS). It is also a homofermentative L-(+)-lactic acid producer. The genus Lactobacillus is characterized by an extraordinary degree of the phenotypic and genotypic diversity. However, the studies of the genus were conducted mostly with the unequally distrib...

  7. The α and β chains of human platelet glycoprotein Ib are both transmembrane proteins containing a leucine-rich amino acid sequence

    The primary structure of the β chain of human glycoprotein Ib (GPIb), the platelet receptor for von Willebrand factor, has been established by a combination of cDNA cloning and amino acid sequence analysis. A λ phage cDNA expression library prepared from human erythroleukemia cells (HEL cells) was screened with a radiolabeled affinity-purified rabbit polyclonal antibody to the β chain of GPIb. Eighteen positive clones were isolated and plaque-purified and the nucleotide sequences of three were determined. The composite sequence spanned 968 nucleotides and included a 5' untranslated region of 22 nucleotides, an open reading frame of 618 nucleotides encoding a signal peptide of 28 amino acids and a mature protein of 181 amino acids, a stop codon, and a 3' noncoding region of 307 nucleotides. The 3' noncoding sequence also contained a polyadenylylation signal (AATAAA) 14 nucleotides upstream from the poly(A) tail of 18 nucleotides. Edman degradation of the intact β chain and of peptides produced by chemical cleavage yielded amino acid sequences spanning 76 residues that were identical to those predicted from the cDNA. The amino-terminal region of the β chain contains a leucine-rich sequence of 24 amino acids that is similar to a sequence that occurs as seven tandem repeats in the α chain of GPIb and nine tandem repeats in leucine-rich α2-glycoprotein. The amino-terminal region of the β chain of GPIb is followed by a transmembrane segment of 25 amino acids and an intracellular segment of 34 amino acids at the carboxyl terminus of the protein

  8. Nucleic acid detection kits

    Hall, Jeff G.; Lyamichev, Victor I.; Mast, Andrea L.; Brow, Mary Ann; Kwiatkowski, Robert W.; Vavra, Stephanie H.

    2005-03-29

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based on charge. The present invention also provides methods for the detection of non-target cleavage products via the formation of a complete and activated protein binding region. The invention further provides sensitive and specific methods for the detection of nucleic acid from various viruses in a sample.

  9. MRI-Based Thermometry for Tumor Thermal Ablation: A Comparison of Different MR Sequences

    T. J. Vogl

    2010-05-01

    Full Text Available Background/Objective: To evaluate T1 and PRF thermometry methods utilizing fast MR sequences and fluoroptic thermometer."nMaterials and Methods: The MR-guided LITT (Laser-Induced Interstitial Thermotherapy with a laser wavelength/power of 1064nm/30W was applied to pig liver and a gel phantom. During the ablation process, the temperature was measured using a fluoroptic thermometer and MR imaging was performed applying a 1.5-Tesla tomograph with an EPI (Echo Planar Imaging sequence for PRF (Proton Resonance Frequency method and FLASH, IRTF, SRTF and TRUFI sequences for T1 method. Plotting MR signal intensity against measured temperature determined the temperature constant for each of the T1 sequences. To determine the PRF temperature constant, phase values were recorded from phase images and then plotted against temperature. The PRF temperature constant was verified comparing the MR temperature with the measured one obtained from a second LITT experiment on gel phantom."nResults: The experiments determining the temperature constant for T1 method showed that the IRTF and FLASH sequences have the highest temperature sensitivity and the most linear relationship between MR signal intensity and measured temperature. SRTF sequence presented relatively good linearity but inferior temperature sensitivity compared to IRTF and FLASH sequences. Conversely, TRUFI sequence exhibited the lowest temperature sensitivity and linearity of data points. Concerning the PRF method, the measured and the MR-based temperatures agreed up to approximately 70 C."nConclusion: To demonstrate and control temperature in target tissue during the LITT process, the PRF method with an EPI sequence is preferred for temperatures below 70 C due to its acceptable accuracy. Among the T1 sequences, FLASH is preferable as the most robust, though not the most accurate T1 sequence.

  10. Park-based and zero sequence-based relaying techniques with application to transformers protection

    Diaz, G.; Arboleya, P.; Gomez-Aleixandre, J. [University of Oviedo (Spain). Dept. of Electrical Engineering

    2004-09-01

    Two relaying techniques for protecting power transformers are presented and discussed. Very often, differential relaying is used for this purpose. A comparison between the two proposed techniques and conventional differential relaying is thus presented. The first technique, based on the measurements of zero sequence current within a delta winding, performs best in multiwinding transformers, since only measurement of the coil currents is needed. Thus, great simplicity is achieved. The second one is based on the differential procedure, but its analysis of asymmetries in the plot in Park's plane avoids problems related to spectral analysis in conventional differential relaying. The technique is justified from the analysis of symmetrical components. Misoperation in conventional differential relaying has been observed in some cases as a function of switching instant and fault location. This issue is discussed in the paper, and a statistical analysis of a large number of laboratory tests, in which both factors were controlled, is presented. As a conclusion, both relaying techniques proposed succeed in protecting the transformer. Additionally, the Park-based relay exhibits three characteristics of most importance: fastest performance, robustness and simplicity in its formulation. (author)

  11. Diversity Analysis in Cannabis sativa Based on Large-Scale Development of Expressed Sequence Tag-Derived Simple Sequence Repeat Markers

    Gao, Chunsheng; Xin, Pengfei; Cheng, Chaohua; Tang, Qing; Ping CHEN; Wang, Changbiao; Zang, Gonggu; Zhao, Lining

    2014-01-01

    Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SS...

  12. Inferences from protein and nucleic acid sequences - Early molecular evolution, divergence of kingdoms and rates of change

    Dayhoff, M. O.; Barker, W. C.; Mclaughlin, P. J.

    1974-01-01

    Description of new sensitive, objective methods for establishing the probable common ancestry of very distantly related sequences and the quantitative evolutionary change which has taken place. These methods are applied to four families of proteins and nucleic acids and evolutionary trees will be derived where possible. Of the three families containing duplications of genetic material, two are nucleic acids: transfer RNA and 5S ribosomal RNA. Both of these structures are functional in the synthesis of coded proteins, and prototypes must have been present in the cell at the inception of the fundamental coding process that all living things share. There are many types of tRNA which recognize the various nucleotide triplets and the 20 amino acids. These types are thought to have arisen as a result of many gene duplications. Relationships among these types are discussed. The 5S ribosomal RNA, presently functional in both eukaryotes and prokaryotes, is very likely descended from an early form incorporating almost a complete duplication of genetic material. The amount of evolution in the various lines can again be compared. The other two families containing duplications are proteins; ferredoxin and cytochrome c.

  13. Mass Spectrometry Analysis Coupled with de novo Sequencing Reveals Amino Acid Substitutions in Nucleocapsid Protein from Influenza A Virus

    Zijian Li

    2014-02-01

    Full Text Available Amino acid substitutions in influenza A virus are the main reasons for both antigenic shift and virulence change, which result from non-synonymous mutations in the viral genome. Nucleocapsid protein (NP, one of the major structural proteins of influenza virus, is responsible for regulation of viral RNA synthesis and replication. In this report we used LC-MS/MS to analyze tryptic digestion of nucleocapsid protein of influenza virus (A/Puerto Rico/8/1934 H1N1, which was isolated and purified by SDS poly-acrylamide gel electrophoresis. Thus, LC-MS/MS analyses, coupled with manual de novo sequencing, allowed the determination of three substituted amino acid residues R452K, T423A and N430T in two tryptic peptides. The obtained results provided experimental evidence that amino acid substitutions resulted from non-synonymous gene mutations could be directly characterized by mass spectrometry in proteins of RNA viruses such as influenza A virus.

  14. Carbon Dot Based Sensing of Dopamine and Ascorbic Acid

    Upama Baruah; Neelam Gogoi; Achyut Konwar; Manash Jyoti Deka; Devasish Chowdhury; Gitanjali Majumdar

    2014-01-01

    We demonstrate carbon dot based sensor of catecholamine, namely, dopamine and ascorbic acid. Carbon dots (CDs) were prepared from a green source: commercially available Assam tea. The carbon dots prepared from tea had particle sizes of ∼0.8 nm and are fluorescent. Fluorescence of the carbon dots was found to be quenched in the presence of dopamine and ascorbic acid with greater sensitivity for dopamine. The minimum detectable limits were determined to be 33 μM and 98 μM for dopamine and ascor...

  15. Acid-base transport in pancreas – new challenges

    Ivana eNovak

    2013-12-01

    Full Text Available Along the gastrointestinal tract a number of epithelia contribute with acid or basic secretions in order to aid digestive processes. The stomach and pancreas are the most extreme examples of acid (H+ and base (HCO3- transporters, respectively. Nevertheless, they share the same challenges of transporting acid and bases across epithelia and effectively regulating their intracellular pH. In this review, we will make use of comparative physiology to enlighten the cellular mechanisms of pancreatic HCO3- and fluid secretion, which is still challenging physiologists. Some of the novel transporters to consider in pancreas are the proton pumps (H+-K+-ATPases, as well as the calcium-activated K+ and Cl- channels, such as KCa3.1 and TMEM16A/ANO1. Local regulators, such as purinergic signalling, fine-tune and coordinate pancreatic secretion. Lastly, we speculate whether dys-regulation of acid-base transport contributes to pancreatic diseases including cystic fibrosis, pancreatitis and cancer.

  16. Performance of Correspondence Algorithms in Vision-Based Driver Assistance Using an Online Image Sequence Database

    Klette, Reinhard; Krüger, Norbert; Vaudrey, Tobi;

    2011-01-01

    This paper discusses options for testing correspondence algorithms in stereo or motion analysis that are designed or considered for vision-based driver assistance. It introduces a globally available database, with a main focus on testing on video sequences of real-world data. We suggest the......) for demonstrating ideas, difficulties, and possible ways in this future field of extensive performance tests in vision-based driver assistance, particularly for cases where the ground truth is not available. This paper shows that the complexity of real-world data does not support the identification of...... report on hours of driving, and multiple hours of long video data may be segmented into basic sequences and classified into situations. This paper prepares for this expected development. This paper uses three different evaluation approaches (prediction error, synthesized sequences, and labeled sequences...

  17. Feature Based Image Sequence Retargeting in the Uncompressed Video Domain

    Kavitha. S

    2013-01-01

    Full Text Available The system propose a video retargeting algorithmto resize images based on the extracted saliency informationfrom the compressed domain. The system utilizes DCTcoefficients in JP2 bit stream to perform saliency detectionwith the consideration of the human visual sensitivity.Valuable retargeting requires emphasize the main satisfiedwhile retain immediate context with minimal visualdeformation. A number of algorithms have been proposedfor image retargeting with image substance taken as muchas potential. But, they usually suffer from deformationresults, such as edge or structure twists. A structure andcontent preserving image retargeting technique is used thatpreserves the content and image structure. The imagecontent saliency is estimated from the structure of thecontent using probability map. A block structure energy isuse for structure conservation along both directions. Blockstructure energy uses top down strategy to constrict theimage structure consistently. However, the flexibilities ofretargeting are altered for different images. To defeat thisproblem, the patch transform is introduced, where an imageis broken into non-overlapping patches, and modificationsor constraints are applied in the “patch domain”.. Thus, theresized image is produced to preserve the structure andimage content quality.

  18. Acid-base cooperativity of heterogeneous catalyst containing acidic framework and sterically hindered base for aldol condensation

    Hua Li; Shu Tao Xu; Xiao Bing Lu; Wei Ping Zhang

    2009-01-01

    A bifunctional heterogeneous catalyst containing two mutually incompatible acidic and basic sites,which exhibits cooperative catalytic behavior in the aldol condensation of acetone and various aldehydes,was synthesized by postgrafting of 1,5,7-triazabicyclo[4.4.0]dec-5-ene(TBD,a sterically hindered organic base)onto Al-MCM-41 molecular sieve.

  19. Application of genotyping-by-sequencing on semiconductor sequencing platforms: a comparison of genetic and reference-based marker ordering in barley.

    Martin Mascher

    Full Text Available The rapid development of next-generation sequencing platforms has enabled the use of sequencing for routine genotyping across a range of genetics studies and breeding applications. Genotyping-by-sequencing (GBS, a low-cost, reduced representation sequencing method, is becoming a common approach for whole-genome marker profiling in many species. With quickly developing sequencing technologies, adapting current GBS methodologies to new platforms will leverage these advancements for future studies. To test new semiconductor sequencing platforms for GBS, we genotyped a barley recombinant inbred line (RIL population. Based on a previous GBS approach, we designed bar code and adapter sets for the Ion Torrent platforms. Four sets of 24-plex libraries were constructed consisting of 94 RILs and the two parents and sequenced on two Ion platforms. In parallel, a 96-plex library of the same RILs was sequenced on the Illumina HiSeq 2000. We applied two different computational pipelines to analyze sequencing data; the reference-independent TASSEL pipeline and a reference-based pipeline using SAMtools. Sequence contigs positioned on the integrated physical and genetic map were used for read mapping and variant calling. We found high agreement in genotype calls between the different platforms and high concordance between genetic and reference-based marker order. There was, however, paucity in the number of SNP that were jointly discovered by the different pipelines indicating a strong effect of alignment and filtering parameters on SNP discovery. We show the utility of the current barley genome assembly as a framework for developing very low-cost genetic maps, facilitating high resolution genetic mapping and negating the need for developing de novo genetic maps for future studies in barley. Through demonstration of GBS on semiconductor sequencing platforms, we conclude that the GBS approach is amenable to a range of platforms and can easily be modified as new

  20. Sequence diversity and functional conformity

    de Lange, Orlando

    2015-01-01

    At least four phylogenetically distinct groups of bacteria encode repeat proteins with the common ability to bind specific DNA sequences with a unique but conserved code. Each repeat binds a single DNA base, and specificity is determined by the amino acid residue at position 13 of each repeat. Repeats are typically 33-35 amino acids long. Comparing repeat sequences across all groups reveals that only three positions are hyper-conserved. Repeats are in most cases functionally compatible such t...

  1. Lubricity properties of additives based on higher fatty acids

    Lykov, O.P.; Sashevskii, V.V.; Vishnyakova, T.P.; Zaitseva, L.S.

    1983-03-01

    This article investigates possible lubricity additive applications for a number of products separated from a C/sub 17/-C/sub 20/ fraction and still-bottoms in synthetic fatty acids (SFA) production. Each additive (MKNK, DKK, NKK and FKKO) was dissolved in a hydrotreated T-7 fuel, and lubricity properties were evaluated by the KIIGA-2 method. Finds that the branched-chain monocarboxylic and unsaturated acids recovered from the C/sub 17/-C/sub 20/ SFA fraction, and also the fraction of acids from the SFA still-bottoms, form rather strong chemisorbed films on metal surfaces, and fuel formations based on these materials have a high level of lubricity.

  2. Statistical framework for detection of genetically modified organisms based on Next Generation Sequencing

    Willems, Sander; Fraiture, Marie-Alice; Deforce, Dieter; De Keersmaecker, Sigrid; Herman, Philippe; De Loose, Marc; Ruttink, Tom; Van Nieuwerburgh, Filip; Roosens, Nancy

    2016-01-01

    Because the number and diversity of genetically modified (GM) crops has significantly increased, their analysis based on real-time PCR (qPCR) methods is becoming increasingly complex and laborious. While several pioneers already investigated Next Generation Sequencing (NGS) as an alternative to qPCR, its practical use has not been assessed for routine analysis. In this study a statistical framework was developed to predict the number of NGS reads needed to detect transgene sequences, to prove...

  3. Switching Loss Characteristics of Sequences Involving Active State Division in Space Vector Based PWM

    Zhao, Di; Narayanan, G.; Ayyanar, Raja

    2004-01-01

    This paper analyzes the switching loss characteristics of sequences involving division of active state duration in space vector based PWM. This analysis, together with the THD performance of the different sequences, reported recently, is used to design new hybrid PWM techniques for induction motor drives, which result in simultaneous reduction in both THD as well as inverter switching losses. Experimental results are presented to demonstrate the feasibility and advantages of the proposed PWM ...

  4. PHYLOViZ: phylogenetic inference and data visualization for sequence based typing methods

    Francisco Alexandre P; Vaz Ctia; Monteiro Pedro T; Melo-Cristino José; Ramirez Mário; Carrio Joo A

    2012-01-01

    Abstract Background With the decrease of DNA sequencing costs, sequence-based typing methods are rapidly becoming the gold standard for epidemiological surveillance. These methods provide reproducible and comparable results needed for a global scale bacterial population analysis, while retaining their usefulness for local epidemiological surveys. Online databases that collect the generated allelic profiles and associated epidemiological data are available but this wealth of data remains under...

  5. CloudMap: A Cloud-Based Pipeline for Analysis of Mutant Genome Sequences

    Minevich, Gregory; Park, Danny S.; Blankenberg, Daniel; Richard J Poole; Hobert, Oliver

    2012-01-01

    Whole genome sequencing (WGS) allows researchers to pinpoint genetic differences between individuals and significantly shortcuts the costly and time-consuming part of forward genetic analysis in model organism systems. Currently, the most effort-intensive part of WGS is the bioinformatic analysis of the relatively short reads generated by second generation sequencing platforms. We describe here a novel, easily accessible and cloud-based pipeline, called CloudMap, which greatly simplifies the ...

  6. MOST: a modified MLST typing tool based on short read sequencing.

    Tewolde, Rediat; Dallman, Timothy; Schaefer, Ulf; Sheppard, Carmen L; Ashton, Philip; Pichon, Bruno; Ellington, Matthew; Swift, Craig; Green, Jonathan; Underwood, Anthony

    2016-01-01

    Multilocus sequence typing (MLST) is an effective method to describe bacterial populations. Conventionally, MLST involves Polymerase Chain Reaction (PCR) amplification of housekeeping genes followed by Sanger DNA sequencing. Public Health England (PHE) is in the process of replacing the conventional MLST methodology with a method based on short read sequence data derived from Whole Genome Sequencing (WGS). This paper reports the comparison of the reliability of MLST results derived from WGS data, comparing mapping and assembly-based approaches to conventional methods using 323 bacterial genomes of diverse species. The sensitivity of the two WGS based methods were further investigated with 26 mixed and 29 low coverage genomic data sets from Salmonella enteridis and Streptococcus pneumoniae. Of the 323 samples, 92.9% (n = 300), 97.5% (n = 315) and 99.7% (n = 322) full MLST profiles were derived by the conventional method, assembly- and mapping-based approaches, respectively. The concordance between samples that were typed by conventional (92.9%) and both WGS methods was 100%. From the 55 mixed and low coverage genomes, 89.1% (n = 49) and 67.3% (n = 37) full MLST profiles were derived from the mapping and assembly based approaches, respectively. In conclusion, deriving MLST from WGS data is more sensitive than the conventional method. When comparing WGS based methods, the mapping based approach was the most sensitive. In addition, the mapping based approach described here derives quality metrics, which are difficult to determine quantitatively using conventional and WGS-assembly based approaches. PMID:27602279

  7. Evolution of early life inferred from protein and ribonucleic acid sequences

    Dayhoff, M. O.; Schwartz, R. M.

    1978-01-01

    The chemical structures of ferredoxin, 5S ribosomal RNA, and c-type cytochrome sequences have been employed to construct a phylogenetic tree which connects all major photosynthesizing organisms: the three types of bacteria, blue-green algae, and chloroplasts. Anaerobic and aerobic bacteria, eukaryotic cytoplasmic components and mitochondria are also included in the phylogenetic tree. Anaerobic nonphotosynthesizing bacteria similar to Clostridium were the earliest organisms, arising more than 3.2 billion years ago. Bacterial photosynthesis evolved nearly 3.0 billion years ago, while oxygen-evolving photosynthesis, originating in the blue-green algal line, came into being about 2.0 billion years ago. The phylogenetic tree supports the symbiotic theory of the origin of eukaryotes.

  8. Strategy for complete NMR assignment of disordered proteins with highly repetitive sequences based on resolution-enhanced 5D experiments

    A strategy for complete backbone and side-chain resonance assignment of disordered proteins with highly repetitive sequence is presented. The protocol is based on three resolution-enhanced NMR experiments: 5D HN(CA)CONH provides sequential connectivity, 5D HabCabCONH is utilized to identify amino acid types, and 5D HC(CC-TOCSY)CONH is used to assign the side-chain resonances. The improved resolution was achieved by a combination of high dimensionality and long evolution times, allowed by non-uniform sampling in the indirect dimensions. Random distribution of the data points and Sparse Multidimensional Fourier Transform processing were used. Successful application of the assignment procedure to a particularly difficult protein, δ subunit of RNA polymerase from Bacillus subtilis, is shown to prove the efficiency of the strategy. The studied protein contains a disordered C-terminal region of 81 amino acids with a highly repetitive sequence. While the conventional assignment methods completely failed due to a very small differences in chemical shifts, the presented strategy provided a complete backbone and side-chain assignment.

  9. Nucleic acid sequences encoding D1 and D1/D2 domains of human coxsackievirus and adenovirus receptor (CAR)

    Freimuth, Paul I.

    2010-04-06

    The invention provides recombinant human CAR (coxsackievirus and adenovirus receptor) polypeptides which bind adenovirus. Specifically, polypeptides corresponding to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2 are provided. In another aspect, the invention provides nucleic acid sequences encoding these domains and expression vectors for producing the domains and bacterial cells containing such vectors. The invention also includes an isolated fusion protein comprised of the D1 polypeptide fused to a polypeptide which facilitates folding of D1 when expressed in bacteria. The functional D1 domain finds application in a therapeutic method for treating a patient infected with a CAR D1-binding virus, and also in a method for identifying an antiviral compound which interferes with viral attachment. The invention also provides a method for specifically targeting a cell for infection by a virus which binds to D1.

  10. Developing nucleic acid-based electrical detection systems

    Gabig-Ciminska Magdalena

    2006-03-01

    Full Text Available Abstract Development of nucleic acid-based detection systems is the main focus of many research groups and high technology companies. The enormous work done in this field is particularly due to the broad versatility and variety of these sensing devices. From optical to electrical systems, from label-dependent to label-free approaches, from single to multi-analyte and array formats, this wide range of possibilities makes the research field very diversified and competitive. New challenges and requirements for an ideal detector suitable for nucleic acid analysis include high sensitivity and high specificity protocol that can be completed in a relatively short time offering at the same time low detection limit. Moreover, systems that can be miniaturized and automated present a significant advantage over conventional technology, especially if detection is needed in the field. Electrical system technology for nucleic acid-based detection is an enabling mode for making miniaturized to micro- and nanometer scale bio-monitoring devices via the fusion of modern micro- and nanofabrication technology and molecular biotechnology. The electrical biosensors that rely on the conversion of the Watson-Crick base-pair recognition event into a useful electrical signal are advancing rapidly, and recently are receiving much attention as a valuable tool for microbial pathogen detection. Pathogens may pose a serious threat to humans, animal and plants, thus their detection and analysis is a significant element of public health. Although different conventional methods for detection of pathogenic microorganisms and their toxins exist and are currently being applied, improvements of molecular-based detection methodologies have changed these traditional detection techniques and introduced a new era of rapid, miniaturized and automated electrical chip detection technologies into pathogen identification sector. In this review some developments and current directions in

  11. Redox labelling of nucleic acids for analyzing nucleotide sequences and monitoring DNA-protein interactions

    Fojta, Miroslav; Havran, Luděk; Horáková Brázdilová, Petra; Pivoňková, Hana; Kostečka, Pavel; Macíčková-Cahová, Hana; Raindlová, Veronika; Vrábel, Milan; Hocek, Michal

    Praha : Institute of Organic Chemistry and Biochemistry AS CR, v. v. i., 2011 - (Hocek, M.), s. 155-158 ISBN 978-80-86241-37-1. - (Collection Symposium Series. 12). [Chemistry of Nucleic Acid Components /15./. Český Krumlov (CZ), 05.06.2011-10.06.2011] R&D Projects: GA MŠk LC512; GA MŠk(CZ) LC06035; GA AV ČR(CZ) IAA400040901; GA AV ČR(CZ) IAA400040903; GA ČR GA203/09/0317; GA AV ČR(CZ) GPP206/11/P739 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA * electrochemistry * redox labeling Subject RIV: CC - Organic Chemistry

  12. Tracer study on sulphur use efficiency in potato-barley sequence on acid soil of Shimla

    Controlled studies were conducted on acidic soil of Fagu (Shimla) to study the efficiency of labelled ammonium sulphate as effected by farmyard manure (FYM) on potato (Solanum tuberosum L.) and its residual effect on succeeding barley (Hordeum vulgare L.). The direct and residual effects of FYM and sulphur on dry matter yield and S concentration in potato and barley plants were significant. Applied FYM had a positive effect on radioassay values i.e. % Sdff and % S utilization by potato from labelled S carrier, whereas, the residual effect of applied S on barley was more than its direct effect on potato. Results indicate that combined application of S and FYM resulted in 3.4 per cent more S contribution to barley crop and was reflected in % S utilization values. (author)

  13. Cloning, nucleotide sequence, and expression of the Rhodobacter sphaeroides Y thioredoxin gene.

    Pille, S.; Chuat, J C; Breton, A M; Clément-Métral, J D; Galibert, F

    1990-01-01

    Synthetic oligodeoxynucleotide probes based on the known amino acid sequence of Rhodobacter sphaeroides Y thioredoxin were used to identify, clone, and sequence the structural gene. The amino acid sequence derived from the DNA sequence of the R. sphaeroides gene was identical to the known amino acid sequence of R. sphaeroides thioredoxin. An NcoI site was created by directed mutagenesis at the beginning of the thioredoxin gene, inducing in the encoded protein the replacement of serine in posi...

  14. Nucleic acid-based approaches to STAT inhibition.

    Sen, Malabika; Grandis, Jennifer R

    2012-10-01

    Silencing of abnormally activated genes can be accomplished in a highly specific manner using nucleic acid based approaches. The focus of this review includes the different nucleic acid based inhibition strategies such as antisense oligodeoxynucleotides, small interfering RNA (siRNA), dominant-negative constructs, G-quartet oligonucleotides and decoy oligonucleotides, their mechanism of action and the effectiveness of these approaches to targeting the STAT (signal transducer and activator of transcription) proteins in cancer. Among the STAT proteins, especially STAT3, followed by STAT5, are the most frequently activated oncogenic STATs, which have emerged as plausible therapeutic cancer targets. Both STAT3 and STAT5 have been shown to regulate numerous oncogenic signaling pathways including proliferation, survival, angiogenesis and migration/invasion. PMID:24058785

  15. Construction of a phylogenetic tree of photosynthetic prokaryotes based on average similarities of whole genome sequences.

    Soichirou Satoh

    Full Text Available Phylogenetic trees have been constructed for a wide range of organisms using gene sequence information, especially through the identification of orthologous genes that have been vertically inherited. The number of available complete genome sequences is rapidly increasing, and many tools for construction of genome trees based on whole genome sequences have been proposed. However, development of a reasonable method of using complete genome sequences for construction of phylogenetic trees has not been established. We have developed a method for construction of phylogenetic trees based on the average sequence similarities of whole genome sequences. We used this method to examine the phylogeny of 115 photosynthetic prokaryotes, i.e., cyanobacteria, Chlorobi, proteobacteria, Chloroflexi, Firmicutes and nonphotosynthetic organisms including Archaea. Although the bootstrap values for the branching order of phyla were low, probably due to lateral gene transfer and saturated mutation, the obtained tree was largely consistent with the previously reported phylogenetic trees, indicating that this method is a robust alternative to traditional phylogenetic methods.

  16. Study design requirements for RNA sequencing-based breast cancer diagnostics.

    Mer, Arvind Singh; Klevebring, Daniel; Grönberg, Henrik; Rantalainen, Mattias

    2016-01-01

    Sequencing-based molecular characterization of tumors provides information required for individualized cancer treatment. There are well-defined molecular subtypes of breast cancer that provide improved prognostication compared to routine biomarkers. However, molecular subtyping is not yet implemented in routine breast cancer care. Clinical translation is dependent on subtype prediction models providing high sensitivity and specificity. In this study we evaluate sample size and RNA-sequencing read requirements for breast cancer subtyping to facilitate rational design of translational studies. We applied subsampling to ascertain the effect of training sample size and the number of RNA sequencing reads on classification accuracy of molecular subtype and routine biomarker prediction models (unsupervised and supervised). Subtype classification accuracy improved with increasing sample size up to N = 750 (accuracy = 0.93), although with a modest improvement beyond N = 350 (accuracy = 0.92). Prediction of routine biomarkers achieved accuracy of 0.94 (ER) and 0.92 (Her2) at N = 200. Subtype classification improved with RNA-sequencing library size up to 5 million reads. Development of molecular subtyping models for cancer diagnostics requires well-designed studies. Sample size and the number of RNA sequencing reads directly influence accuracy of molecular subtyping. Results in this study provide key information for rational design of translational studies aiming to bring sequencing-based diagnostics to the clinic. PMID:26830453

  17. Triplex formation at single-stranded nucleic acid target sites of unrestricted sequence by two added strands of oligonucleotides: A proposed model

    Trapane, T.L.; Ts' o, P.O.P. (John Hopkins Univ., Baltimore, MD (United States))

    1994-11-16

    By using the standard purine nucleosides, guanosine and adenosine, and the pyrimidine C-nucleosides, pseudoisocytidine and pseudouridine, as complements on a probe strand, it is possible to construct a regular Watson-Crick helix with a single-stranded target sequence having any arrangement of the four naturally-occurring bases found in nucleic acids. The major groove of this helix will have a unique configuration of hydrogen-bonding sites on the probe strand for each of these four base pairs. By using this duplex as a framework, an ensemble of recognition patterns composed of base triads may be constructed. In these patterns, either a homopyrimidine or homopurine third strand binds in the major groove of the duplex formed by the target and probe strands. Ten distinct geometries, or motifs, are shown, each one consisting of four isomorphic base triads built upon recognition of C, G, A, or U(T) residues in the target strand. In order to maintain specific hydrogen bonding and to construct isomorphous triads, the use of several nonstandard bases is proposed. 33 refs., 9 figs., 3 tabs.

  18. An Optimal Sorting of Pulse Amplitude Sequence Based on the Phased Array Radar Beam Tasks

    Chuan Sheng∗,Yongshun Zhang; Wenlong Lu

    2016-01-01

    The study of phased array radar ( PAR) pulse amplitude sequence characteristics is the key to understand the radar’s working state and its beam’s scanning manner. According to the principle of antenna pattern formation and the searching and tracking modes of beams, this paper analyzes the characteristics and differences of pulse amplitude sequence when the radar beams work in searching and tracking modes respectively. Then an optimal sorting model of pulse amplitude sequence is established based on least⁃squares and curve⁃fitting methods. This method is helpful for acquiring the current working state of the radar and recognizing its instantaneous beam pointing by sorting the pulse amplitude sequence without the necessity to estimate the antenna pattern.

  19. Fast interactive segmentation algorithm of image sequences based on relative fuzzy connectedness

    Tian Chunna; Gao Xinbo

    2005-01-01

    A fast interactive segmentation algorithm of image-sequences based on relative fuzzy connectedness is presented. In comparison with the original algorithm, the proposed one, with the same accuracy, accelerates the segmentation speed by three times for single image. Meanwhile, this fast segmentation algorithm is extended from single object to multiple objects and from single-image to image-sequences. Thus the segmentation of multiple objects from complex background and batch segmentation of image-sequences can be achieved. In addition, a post-processing scheme is incorporated in this algorithm, which extracts smooth edge with one-pixel-width for each segmented object. The experimental results illustrate that the proposed algorithm can obtain the object regions of interest from medical image or image-sequences as well as man-made images quickly and reliably with only a little interaction.

  20. Weather data analysis based on typical weather sequence analysis. Application: energy building simulation

    David, Mathieu; Garde, Francois; Boyer, Harry

    2014-01-01

    In building studies dealing about energy efficiency and comfort, simulation software need relevant weather files with optimal time steps. Few tools generate extreme and mean values of simultaneous hourly data including correlation between the climatic parameters. This paper presents the C++ Runeole software based on typical weather sequences analysis. It runs an analysis process of a stochastic continuous multivariable phenomenon with frequencies properties applied to a climatic database. The database analysis associates basic statistics, PCA (Principal Component Analysis) and automatic classifications. Different ways of applying these methods will be presented. All the results are stored in the Runeole internal database that allows an easy selection of weather sequences. The extreme sequences are used for system and building sizing and the mean sequences are used for the determination of the annual cooling loads as proposed by Audrier-Cros (Audrier-Cros, 1984). This weather analysis was tested with the datab...

  1. Protection technique based on Delta-zero sequence voltages for generator stator ground fault

    Tai, N.L.; Ai, Q. [Shanghai Jiao Tong University (China). Dept. of Power Electrical Engineering

    2004-09-01

    A mathematical model on a coil basis is used to study the characteristics of the zero sequence voltage of a generator The proposed technique for the stator groundfault detection simultaneously takes into account the fault contributed zero sequence fundamental voltage and the fault contributed third-harmonic voltage (Delta-zero sequence voltage). The effect of the start-up component based on the wavelet transform is also highlighted. As information both on the fault contributed zero sequence fundamental voltage and the third-harmonic voltage is used simultaneously, the scheme can obtain higher sensitivity. Results from the experiment and in the field show that the proposed technique can detect the ground fault with high sensitivity and reliability during all operating conditions. (author)

  2. Wavelet Based Lossless DNA Sequence Compression for Faster Detection of Eukaryotic Protein Coding Regions

    G. N. Dash

    2012-07-01

    Full Text Available Discrimination of protein coding regions called exons from noncoding regions called introns or junk DNA in eukaryotic cell is a computationally intensive task. But the dimension of the DNA string is huge; hence it requires large computation time. Further the DNA sequences are inherently random and have vast redundancy, hidden regularities, long repeats and complementary palindromes and therefore cannot be compressed efficiently. The objective of this study is to present an integrated signal processing algorithm that considerably reduces the computational load by compressing the DNA sequence effectively and aids the problem of searching for coding regions in DNA sequences. The presented algorithm is based on the Discrete Wavelet Transform (DWT, a very fast and effective method used for data compression and followed by comb filter for effective prediction of protein coding period-3 regions in DNA sequences. This algorithm is validated using standard dataset such as HMR195, Burset and Guigo and KEGG.

  3. Molecular identification based on coat protein sequences of the Barley yellow dwarf virus from Brazil

    Talita Bernardon Mar

    2013-12-01

    Full Text Available Yellow dwarf disease, one of the most important diseases of cereal crops worldwide, is caused by virus species belonging to the Luteoviridae family. Forty-two virus isolates obtained from oat (Avena sativa L., wheat (Triticum aestivum L., barley (Hordeum vulgare L., corn (Zea mays L., and ryegrass (Lolium multiflorum Lam. collected between 2007 and 2008 from winter cereal crop regions in southern Brazil were screened by polymerase chain reaction (PCR with primers designed on ORF 3 (coat protein - CP for the presence of Barley yellow dwarf virus and Cereal yellow dwarf virus (B/CYDV. PCR products of expected size (~357 bp for subgroup II and (~831 bp for subgroup I were obtained for three and 39 samples, respectively. These products were cloned and sequenced. The subgroup II 3' partial CP amino acid deduced sequences were identified as BYDV-RMV (92 - 93 % of identity with "Illinois" Z14123 isolate. The complete CP amino acid deduced sequences of subgroup I isolates were confirmed as BYDV-PAV (94 - 99 % of identity and established a very homogeneous group (identity higher than 99 %. These results support the prevalence of BYDV-PAV in southern Brazil as previously diagnosed by Enzyme-Linked Immunosorbent Assay (ELISA and suggest that this population is very homogeneous. To our knowledge, this is the first report of BYDV-RMV in Brazil and the first genetic diversity study on B/CYDV in South America.

  4. Enhancing Students Motivation towards School Science with an Inquiry - Based Site Visit Teaching Sequence: A Design - Based Research Approach

    Anni Loukomies

    2013-01-01

    An inquiry-based site visit teaching sequence for school science was designed in co-operation with researchers and science teachers, according to the principles of Design Based Research (DBR). Out-of-school industry site visits were central in the design. Theory-based conjectures arising from the literature on motivation, interest and inquiry-based science teaching (IBST) were embodied in the design solution, and these embodied conjectures were studied in order to uncover the aspects of the d...

  5. Hyaluronic Acid Based Hydrogels for Regenerative Medicine Applications

    2015-01-01

    Hyaluronic acid (HA) hydrogels, obtained by cross-linking HA molecules with divinyl sulfone (DVS) based on a simple, reproducible, and safe process that does not employ any organic solvents, were developed. Owing to an innovative preparation method the resulting homogeneous hydrogels do not contain any detectable residual cross-linking agent and are easier to inject through a fine needle. HA hydrogels were characterized in terms of degradation and biological properties, viscoelasticity, injec...

  6. Convective mixing induced by acid-base reactions.

    Almarcha, Christophe; R'Honi, Yasmina; De Decker, Yannick; Trevelyan, Philip; Eckert, Kerstin; De Wit, Anne

    2011-01-01

    When two miscible solutions, each containing a reactive species, are put in contact in the gravity field, local variations in the density due to the reaction can induce convective motion and mixing. We characterize here both experimentally and theoretically such buoyancy-driven instabilities induced by the neutralization of a strong acid by a strong base in aqueous solutions. The diverse patterns obtained are shown to depend on the type of reactants used and on their relative concentrations. ...

  7. Synthesis and curing of alkyd enamels based on ricinoleic acid

    Jovičić Mirjana C.; Radičević Radmila Ž.; Simendić Vesna B.

    2010-01-01

    A combination of an alkyd resin with a melamine-formaldehyde resin gives a cured enamel film with the flexibility of the alkyd constituent and the high chemical resistance and hardness of the melamine resin at the same time. The melamine resin is a minor constituent and plays the role of a crosslinking agent. In this paper, alkyd resins of high hydroxyl numbers based on trimethylolpropane, ricinoleic acid and phthalic anhydride were synthesized. Two alkyds having 30 and 40 wt% of ricino...

  8. Carbonic anhydrase 5 regulates acid-base homeostasis in zebrafish.

    Ruben Postel

    Full Text Available The regulation of the acid-base balance in cells is essential for proper cellular homeostasis. Disturbed acid-base balance directly affects cellular physiology, which often results in various pathological conditions. In every living organism, the protein family of carbonic anhydrases regulate a broad variety of homeostatic processes. Here we describe the identification, mapping and cloning of a zebrafish carbonic anhydrase 5 (ca5 mutation, collapse of fins (cof, which causes initially a collapse of the medial fins followed by necrosis and rapid degeneration of the embryo. These phenotypical characteristics can be mimicked in wild-type embryos by acetazolamide treatment, suggesting that CA5 activity in zebrafish is essential for a proper development. In addition we show that CA5 regulates acid-base balance during embryonic development, since lowering the pH can compensate for the loss of CA5 activity. Identification of selective modulators of CA5 activity could have a major impact on the development of new therapeutics involved in the treatment of a variety of disorders.

  9. Acid-base actuation of [c2]daisy chains.

    Fang, Lei; Hmadeh, Mohamad; Wu, Jishan; Olson, Mark A; Spruell, Jason M; Trabolsi, Ali; Yang, Ying-Wei; Elhabiri, Mourad; Albrecht-Gary, Anne-Marie; Stoddart, J Fraser

    2009-05-27

    A versatile synthetic strategy, which was conceived and employed to prepare doubly threaded, bistable [c2]daisy chain compounds, is described. Propargyl and 1-pentenyl groups have been grafted onto the stoppers of [c2]daisy chain molecules obtained using a template-directed synthetic protocol. Such [c2]daisy chain molecules undergo reversible extension and contraction upon treatment with acid and base, respectively. The dialkyne-functionalized [c2]daisy chain (AA) was subjected to an [AA+BB] type polymerization with an appropriate diazide (BB) to afford a linear, mechanically interlocked, main-chain polymer. The macromolecular properties of this polymer were characterized by chronocoulometry, size exclusion chromatography, and static light-scattering analysis. The acid-base switching properties of both the monomers and the polymer have been studied in solution, using (1)H NMR spectroscopy, UV/vis absorption spectroscopy, and cyclic voltammetry. The experimental results demonstrate that the functionalized [c2]daisy chains, along with their polymeric derivatives, undergo quantitative, efficient, and fully reversible switching processes in solution. Kinetics measurements demonstrate that the acid/base-promoted extension/contraction movements of the polymeric [c2]daisy chain are actually faster than those of its monomeric counterpart. These observations open the door to correlated molecular motions and to changes in material properties. PMID:19419175

  10. Nuclemeter: a reaction-diffusion based method for quantifying nucleic acids undergoing enzymatic amplification.

    Liu, Changchun; Sadik, Mohamed M; Mauk, Michael G; Edelstein, Paul H; Bushman, Frederic D; Gross, Robert; Bau, Haim H

    2014-01-01

    Real-time amplification and quantification of specific nucleic acid sequences plays a major role in medical and biotechnological applications. In the case of infectious diseases, such as HIV, quantification of the pathogen-load in patient specimens is critical to assess disease progression and effectiveness of drug therapy. Typically, nucleic acid quantification requires expensive instruments, such as real-time PCR machines, which are not appropriate for on-site use and for low-resource settings. This paper describes a simple, low-cost, reaction-diffusion based method for end-point quantification of target nucleic acids undergoing enzymatic amplification. The number of target molecules is inferred from the position of the reaction-diffusion front, analogous to reading temperature in a mercury thermometer. The method was tested for HIV viral load monitoring and performed on par with conventional benchtop methods. The proposed method is suitable for nucleic acid quantification at point of care, compatible with multiplexing and high-throughput processing, and can function instrument-free. PMID:25477046

  11. Amino Acid Sequence and Structural Comparison of BACE1 and BACE2 Using Evolutionary Trace Method

    Hoda Mirsafian

    2014-01-01

    Full Text Available Beta-amyloid precursor protein cleavage enzyme 1 (BACE1 and beta-amyloid precursor protein cleavage enzyme 2 (BACE2, members of aspartyl protease family, are close homologues and have high similarity in their protein crystal structures. However, their enzymatic properties differ leading to disparate clinical consequences. In order to identify the residues that are responsible for such differences, we used evolutionary trace (ET method to compare the amino acid conservation patterns of BACE1 and BACE2 in several mammalian species. We found that, in BACE1 and BACE2 structures, most of the ligand binding sites are conserved which indicate their enzymatic property of aspartyl protease family members. The other conserved residues are more or less randomly localized in other parts of the structures. Four group-specific residues were identified at the ligand binding site of BACE1 and BACE2. We postulated that these residues would be essential for selectivity of BACE1 and BACE2 biological functions and could be sites of interest for the design of selective inhibitors targeting either BACE1 or BACE2.

  12. Temporal Extension to Exemplar-based Inpainting Applied to Scratch Correction in Damaged Image Sequences

    Forbin, G.; Besserer, B.; Boldyš, Jiří; Tschumperlé, D.

    Anaheim: ACTA Press, 2005, s. 1-5. ISBN 0-88986-528-0. [Visualization, Imaging, and Image Processing (VIIP 2005). Benidorm (ES), 07.09.2005-09.09.2005] R&D Projects: GA MŠk 1M0572 Institutional research plan: CEZ:AV0Z10750506 Keywords : image sequences * digital restoration * exemplar-based inpainting method Subject RIV: BD - Theory of Information http://library.utia.cas.cz/separaty/2009/ZOI/boldys-temporal extension to exemplar-based inpainting applied to scratch correction in damaged image sequences.pdf

  13. RNA Sequencing Identifies Upregulated Kyphoscoliosis Peptidase and Phosphatidic Acid Signaling Pathways in Muscle Hypertrophy Generated by Transgenic Expression of Myostatin Propeptide

    Yuanxin Miao

    2015-04-01

    Full Text Available Myostatin (MSTN, a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph, and zinc metallopeptidase STE24 (Zmpste24. In addition, kyphoscoliosis peptidase (Ky, which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA pathways (Dgki, Dgkz, Plcd4 were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition.

  14. RNA sequencing identifies upregulated kyphoscoliosis peptidase and phosphatidic acid signaling pathways in muscle hypertrophy generated by transgenic expression of myostatin propeptide.

    Miao, Yuanxin; Yang, Jinzeng; Xu, Zhong; Jing, Lu; Zhao, Shuhong; Li, Xinyun

    2015-01-01

    Myostatin (MSTN), a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph), and zinc metallopeptidase STE24 (Zmpste24). In addition, kyphoscoliosis peptidase (Ky), which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA) pathways (Dgki, Dgkz, Plcd4) were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition. PMID:25860951

  15. A novel polymeric herbicide based on phenoxyacetic acid derivatives

    Wimol Klaichim

    2009-01-01

    Full Text Available A novel polymeric herbicide based on phenoxyacetic acid derivatives was prepared by the reaction of epoxidised liquid natural rubber (ELNR with 2,4-dichlorophenoxyacetic acid (2,4-D or 2-methyl-4-chlorophenoxyacetic acid(MCPA. The liquid natural rubber (LNR was firstly obtained from the degradation of natural rubber latex with tert-butyl hydroperoxide and cobalt acetylacetonate at 65oC for 72 hrs. The epoxidised liquid natural rubber was prepared from thereaction of LNR with formic acid and hydrogen peroxide at 50oC for 6 hrs. The reaction of epoxidised liquid natural rubber with 2,4-D or MCPA using triethylamine as a catalyst in toluene was performed at 70, 80, and 90oC for 6, 9, 12, 18, and 24hrs. The polymeric herbicides obtained were characterized and the grafting percentage of 2,4-D or MCPA onto liquid natural rubber were also determined by FT-IR and 1H-NMR spectroscopy. It was found that the grafting percentage increased with increasing amount of reactants, temperature, and reaction time. The release of 2,4-D and MCPA from polymeric herbicides was investigated in pH 6, 7, and 8 buffers at room temperature. The results show that the slowest release of 2,4-D and MCPA was found to be constant at pH 7 for 14 and 10 days, respectively.

  16. A Model for Protein Sequence Evolution Based on Selective Pressure for Protein Stability: Application to Hemoglobins

    Lorraine Marsh

    2009-01-01

    Negative selection against protein instability is a central influence on evolution of proteins. Protein stability is maintained over evolution despite changes in underlying sequences. An empirical all-site stability-based model of evolution was developed to focus on the selection of residues arising from their contributions to protein stability. In this model, site rates could vary. A structure-based method was used to predict stationary frequencies of hemoglobin residues based on their prope...

  17. A Novel Abundance-Based Algorithm for Binning Metagenomic Sequences Using l-Tuples

    Wu, Yu-Wei; Ye, Yuzhen

    Metagenomics is the study of microbial communities sampled directly from their natural environment, without prior culturing. Among the computational tools recently developed for metagenomic sequence analysis, binning tools attempt to classify all (or most) of the sequences in a metagenomic dataset into different bins (i.e., species), based on various DNA composition patterns (e.g., the tetramer frequencies) of various genomes. Composition-based binning methods, however, cannot be used to classify very short fragments, because of the substantial variation of DNA composition patterns within a single genome. We developed a novel approach (AbundanceBin) for metagenomics binning by utilizing the different abundances of species living in the same environment. AbundanceBin is an application of the Lander-Waterman model to metagenomics, which is based on the l-tuple content of the reads. AbundanceBin achieved accurate, unsupervised, clustering of metagenomic sequences into different bins, such that the reads classified in a bin belong to species of identical or very similar abundances in the sample. In addition, AbundanceBin gave accurate estimations of species abundances, as well as their genome sizes - two important parameters for characterizing a microbial community. We also show that AbundanceBin performed well when the sequence lengths are very short (e.g. 75 bp) or have sequencing errors.

  18. DNA Sequence Optimization Based on Continuous Particle Swarm Optimization for Reliable DNA Computing and DNA Nanotechnology

    N. K. Khalid

    2008-01-01

    Full Text Available Problem statement: In DNA based computation and DNA nanotechnology, the design of good DNA sequences has turned out to be an essential problem and one of the most practical and important research topics. Basically, the DNA sequence design problem is a multi-objective problem and it can be evaluated using four objective functions, namely, Hmeasure, similarity, continuity and hairpin. Approach: There are several ways to solve multi-objective problem, however, in order to evaluate the correctness of PSO algorithm in DNA sequence design, this problem is converted into single objective problem. Particle Swarm Optimization (PSO is proposed to minimize the objective in the problem, subjected to two constraints: melting temperature and GCcontent. A model is developed to present the DNA sequence design based on PSO computation. Results: Based on experiments and researches done, 20 particles are used in the implementation of the optimization process, where the average values and the standard deviation for 100 runs are shown along with comparison to other existing methods. Conclusion: The results achieve verified that PSO can suitably solves the DNA sequence design problem using the proposed method and model, comparatively better than other approaches.

  19. Advances in nucleic acid-based diagnostics of bacterial infections

    Barken, Kim Bundvig; Haagensen, Janus Anders Juul; Tolker-Nielsen, Tim

    2007-01-01

    Methods for rapid detection of infectious bacteria and antimicrobial-resistant pathogens have evolved significantly over the last decade. Many of the new procedures are nucleic acid-based and replace conventional diagnostic methods like culturing which is time consuming especially with fastidious...... of these pathogens is important to isolate patients and prevent further spreading of the diseases. Newly developed diagnostic procedures are superior with respect to turnaround time, sensitivity and specificity. Methods like multiplex real time PCR and different array-based technologies offer the possibility...

  20. Molecular phylogeny of Pamphagidae (Acridoidea, Orthoptera) from China based on mitochondrial cytochrome oxidase Ⅱ sequences

    Dao-Chuan Zhang; Hong-Yan Han; Hong Yin; Xin-Jiang Li; Zhan Yin; Xiang-Chu Yin

    2011-01-01

    Phylogenetic relationships of Pamphagidae were examined using cytochrome oxidase subunit Ⅱ (COII) mtDNA sequences (684 bp). Twenty-seven species of Acridoidea from 20 genera were sequenced to obtain mtDNA data, along with four species from the GenBank nucleotide database. The purpose of this study was analyzing the phylogenetic relationships among subfamilies within Pamphagidae and interpreting the phylogenetic position of this family within the Acridoidea superfamily. Phylogenetic trees were reconstructed using neighbor-joining (NJ), maximum parsimony (MP) and Bayesian inference (BI) methods. The 684 bp analyzed fragment included 126 parsimony informative sites. Sequences diverged 1.0%-l1.1% between genera within subfamilies, and 8.8%-12.3% between subfamilies. Amino acid sequence diverged 0-6.1% between genera within subfamilies, and 0.4%-7.5% between subfamilies. Our phylogenetic trees revealed the monophyly of Pamphagidae and three distinct major groups within this family. Moreover, several well supported and stable clades were found in Pamphagidae. The global clustering results were similar to that obtained through classical morphological classification: Prionotropisinae, Thrinchinae and Pamphaginae were monophyletic groups. However, the current genus Filchnerella (Prionotropisinae) was not a monophyletic group and the genus Asiotmethis (Prionotropisinae) was a sister group of the genus Thrinchus (Thrinchinae). Further molecular and morphological studies are required to clarify the phylogenetic relationships of the genera Filchnerella and Asiotmethis.

  1. Comparative analysis of four essential Gracilariaceae species in China based on whole transcriptomic sequencing

    XU Jiayue; WU Shuangxiu; YU Jun; SUN Jing; YIN Jinlong; WANG Liang; WANG Xumin; LIU Tao; CHI Shan; LIU Cui; REN Lufeng

    2014-01-01

    Three Gracilaria species, G. chouae, G. blodgettii, G. vermiculophylla and a close relative species, Gracilari-opsis lemaneiformis which is now nominated as Gracilaria lemaneiformis, are the typically indigenous spe-cies which are important resources for the production of special proteins, phycobilisomes, special carbo-hydrates, and agar in China. In this study, de novo transcriptome sequencing on these four species using the next generation sequencing technology was performed for the first time. Functional annotations on assembled sequencing reads showed that the transcriptomic profiles were quite different between G. lema-neiformis and other three Gracilaria species. Comparative analysis of differential gene expression related to carbohydrate and phycobiliprotein metabolisms also showed that the expression profiles of these essential genes were different in four species. The genes encoding allophycocyanin, phycocyanin and phycoerythrin were further examined in four species and their deduced amino acid sequences were used for phylogenetic analysis to confirm that G. lemaneiformis had close relationship to genus Gracilaria, as well as that within genus Gracilaria, G. chouae had closer relationship to G. vermiculophylla rather than to G. blodgettii. The de novo transcriptome study on four species provided a valuable genomic resource for further understanding and analysis on biological and evolutionary study among marine algae.

  2. Synthesis and curing of alkyd enamels based on ricinoleic acid

    Jovičić Mirjana C.

    2010-01-01

    Full Text Available A combination of an alkyd resin with a melamine-formaldehyde resin gives a cured enamel film with the flexibility of the alkyd constituent and the high chemical resistance and hardness of the melamine resin at the same time. The melamine resin is a minor constituent and plays the role of a crosslinking agent. In this paper, alkyd resins of high hydroxyl numbers based on trimethylolpropane, ricinoleic acid and phthalic anhydride were synthesized. Two alkyds having 30 and 40 wt% of ricinoleic acid were formulated by calculation on alkyd constant. Alkyds were characterized by FTIR and by the determination of acid and hydroxyl numbers. Then synthesized alkyds were made into baking enamels by mixing with melamine-formaldehyde resins (weight ratio of 70:30 based on dried mass. Two types of commercial melamine resins were used: threeisobutoxymethyl melamine-formaldehyde resin (TIMMF and hexamethoxymethyl melamine resin (HMMMF. Prepared alkyd/melamine resin mixtures were cured in a differential scanning calorimeter (DSC under non-isothermal mode. Apparent degree of curing as a function of temperature was calculated from the curing enthalpies. Kinetic parameters of curing were calculated using Freeman-Carroll method. TIMMF resin is more reactive with synthesized alkyds than HMMMF resin what was expected. Alkyd resin with 30 wt% of ricinoleic acid is slightly more reactive than alkyd with 40 wt% of ricinoleic acid, probably because it has the high contents of free hydroxyl and acid groups. The gel content, Tg, thermal stability, hardness, elasticity and impact resistance of coated films cured at 150°C for 60 min were measured. Cured films show good thermal stability since the onset of films thermal degradation determined by thermogravimetric analysis (TGA is observed at the temperatures from 281 to 329°C. Films based on alkyd 30 are more thermal stable than those from alkyd 40, with the same melamine resin. The type of alkyd resin has no significant

  3. Bayesian prediction of bacterial growth temperature range based on genome sequences

    Jensen, Dan Børge; Vesth, Tammi Camilla; Hallin, Peter Fischer;

    2012-01-01

    genomic sequence, would thus allow for an efficient and targeted search for production organisms, reducing the need for culturing experiments. Results: This study found a total of 40 protein families useful for distinction between three thermophilicity classes (thermophiles, mesophiles and psychrophiles......). The predictive performance of these protein families were compared to those of 87 basic sequence features (relative use of amino acids and codons, genomic and 16S rDNA AT content and genome size). When using naive Bayesian inference, it was possible to correctly predict the optimal temperature range...... with a Matthews correlation coefficient of up to 0.68. The best predictive performance was always achieved by including protein families as well as structural features, compared to either of these alone. A dedicated computer program was created to perform these predictions. Conclusions: This study...

  4. Acid-base thermochemistry of gaseous oxygen and sulfur substituted amino acids (Ser, Thr, Cys, Met).

    Riffet, Vanessa; Frison, Gilles; Bouchoux, Guy

    2011-11-01

    Acid-base thermochemistry of isolated amino acids containing oxygen or sulfur in their side chain (serine, threonine, cysteine and methionine) have been examined by quantum chemical computations. Density functional theory (DFT) was used, with B3LYP, B97-D and M06-2X functionals using the 6-31+G(d,p) basis set for geometry optimizations and the larger 6-311++G(3df,2p) basis set for energy computations. Composite methods CBS-QB3, G3B3, G4MP2 and G4 were applied to large sets of neutral, protonated and deprotonated conformers. Conformational analysis of these species, based on chemical approach and AMOEBA force field calculations, has been used to identify the lowest energy conformers and to estimate the population of conformers expected to be present at thermal equilibrium at 298 K. It is observed that G4, G4MP2, G3B3, CBS-QB3 composite methods and M06-2X DFT lead to similar conformer energies. Thermochemical parameters have been computed using either the most stable conformers or equilibrium populations of conformers. Comparison of experimental and theoretical proton affinities and Δ(acid)H shows that the G4 method provides the better agreement with deviations of less than 1.5 kJ mol(-1). From this point of view, a set of evaluated thermochemical quantities for serine, threonine, cysteine and methionine may be proposed: PA = 912, 919, 903, 938; GB = 878, 886, 870, 899; Δ(acid)H = 1393, 1391, 1396, 1411; Δ(acid)G = 1363, 1362, 1367, 1382 kJ mol(-1). This study also confirms that a non-negligible ΔpS° is associated with protonation of methionine and that the most acidic hydrogen of cysteine in the gas phase is that of the SH group. In several instances new conformers were identified thus suggesting a re-examination of several IRMPD spectra. PMID:21947236

  5. Nucleic acid detection based on the use of microbeads: a review

    Microbead-based technologies represent elegant and versatile approaches for highly parallelized quantitative multiparameter assays. They also form the basis of various techniques for detection and quantification of nucleic acids and proteins. Nucleic acid-based methods include hybridization assays, solid-phase PCR, sequencing, and trapping assays. Microbead assays have been improved in the past decades and are now important tools in routine and point-of-care diagnostics as well as in life science. Its advances include low costs, low workload, high speed and high-throughput automation. The potential of microbead-based assays therefore is apparent, and commercial applications can be found in the detection and discrimination of single nucleotide polymorphism, of pathogens, and in trapping assays. This review provides an overview on microbead-based platforms for biosensing with a main focus on nucleic acid detection (including amplification strategies and on selected probe systems using fluorescent labeling). Specific sections cover chemical properties of microbeads, the coupling of targets onto solid surfaces, microbead probe systems (mainly oligonucleotide probes), microbead detection schemes (with subsections on suspension arrays, microfluidic devices, and immobilized microbeads), quantification of nucleic acids, PCR in solution and the detection of amplicons, and methods for solid-phase amplification. We discuss selected trends such as microbead-coupled amplification, heterogeneous and homogenous DNA hybridization assays, real-time assays, melting curve analysis, and digital microbead assays. We finally discuss the relevance and trends of the methods in terms of high-level multiplexed analysis and their potential in diagnosis and personalized medicine. (author)

  6. Host suppression and bioinformatics for sequence-based characterization of unknown pathogens.

    Branda, Steven S.; Lane, Todd W.; Misra, Milind; Meagher, Robert J.; Patel, Kamlesh D.; Kaiser, Julia N.

    2009-11-01

    Bioweapons and emerging infectious diseases pose formidable and growing threats to our national security. Rapid advances in biotechnology and the increasing efficiency of global transportation networks virtually guarantee that the United States will face potentially devastating infectious disease outbreaks caused by novel ('unknown') pathogens either intentionally or accidentally introduced into the population. Unfortunately, our nation's biodefense and public health infrastructure is primarily designed to handle previously characterized ('known') pathogens. While modern DNA assays can identify known pathogens quickly, identifying unknown pathogens currently depends upon slow, classical microbiological methods of isolation and culture that can take weeks to produce actionable information. In many scenarios that delay would be costly, in terms of casualties and economic damage; indeed, it can mean the difference between a manageable public health incident and a full-blown epidemic. To close this gap in our nation's biodefense capability, we will develop, validate, and optimize a system to extract nucleic acids from unknown pathogens present in clinical samples drawn from infected patients. This system will extract nucleic acids from a clinical sample, amplify pathogen and specific host response nucleic acid sequences. These sequences will then be suitable for ultra-high-throughput sequencing (UHTS) carried out by a third party. The data generated from UHTS will then be processed through a new data assimilation and Bioinformatic analysis pipeline that will allow us to characterize an unknown pathogen in hours to days instead of weeks to months. Our methods will require no a priori knowledge of the pathogen, and no isolation or culturing; therefore it will circumvent many of the major roadblocks confronting a clinical microbiologist or virologist when presented with an unknown or engineered pathogen.

  7. Biological sequence classification with multivariate string kernels.

    Kuksa, Pavel P

    2013-01-01

    String kernel-based machine learning methods have yielded great success in practical tasks of structured/sequential data analysis. They often exhibit state-of-the-art performance on many practical tasks of sequence analysis such as biological sequence classification, remote homology detection, or protein superfamily and fold prediction. However, typical string kernel methods rely on the analysis of discrete 1D string data (e.g., DNA or amino acid sequences). In this paper, we address the multiclass biological sequence classification problems using multivariate representations in the form of sequences of features vectors (as in biological sequence profiles, or sequences of individual amino acid physicochemical descriptors) and a class of multivariate string kernels that exploit these representations. On three protein sequence classification tasks, the proposed multivariate representations and kernels show significant 15-20 percent improvements compared to existing state-of-the-art sequence classification methods. PMID:24384708

  8. Mitochondrial DNA sequence-based phylogenetic relationship among flesh flies of the genus Sarcophaga (Sarcophagidae: Diptera)

    Neelam Bajpai; Raghav Ram Tewari

    2010-04-01

    The phylogenetic relationships among flesh flies of the family Sarcophagidae has been based mainly on the morphology of male genitalia. However, the male genitalic character-based relationships are far from satisfactory. Therefore, in the present study mitochondrial DNA has been used as marker to unravel genetic relatedness and to construct phylogeny among five sympatric species of the genus Sarcophaga. Two mitochondrial genes viz., cytochrome oxidase subunit 1 (COI) and NAD dehydrogenase subunit 5 (ND5) were sequenced and genetic distance values were calculated on the basis of sequence differences in both the mitochondrial genes. The data revealed very few genetic difference among the five species for the COI and ND5 gene sequences.

  9. Multi-modulus algorithm based on global artificial fish swarm intelligent optimization of DNA encoding sequences.

    Guo, Y C; Wang, H; Wu, H P; Zhang, M Q

    2015-01-01

    Aimed to address the defects of the large mean square error (MSE), and the slow convergence speed in equalizing the multi-modulus signals of the constant modulus algorithm (CMA), a multi-modulus algorithm (MMA) based on global artificial fish swarm (GAFS) intelligent optimization of DNA encoding sequences (GAFS-DNA-MMA) was proposed. To improve the convergence rate and reduce the MSE, this proposed algorithm adopted an encoding method based on DNA nucleotide chains to provide a possible solution to the problem. Furthermore, the GAFS algorithm, with its fast convergence and global search ability, was used to find the best sequence. The real and imaginary parts of the initial optimal weight vector of MMA were obtained through DNA coding of the best sequence. The simulation results show that the proposed algorithm has a faster convergence speed and smaller MSE in comparison with the CMA, the MMA, and the AFS-DNA-MMA. PMID:26782395

  10. Taxonomy and phylogeny of the genus citrus based on the nuclear ribosomal dna its region sequence

    The genus Citrus (Aurantioideae, Rutaceae) is the sole source of the citrus fruits of commerce showing high economic values. In this study, the taxonomy and phylogeny of Citrus species is evaluated using sequence analysis of the ITS region of nrDNA. This study is based on 26 plants materials belonging to 22 Citrus species having wild, domesticated, and cultivated species. Through DNA alignment of the ITS sequence, ITS1 and ITS2 regions showed relatively high variations of sequence length and nucleotide among these Citrus species. According to previous six-tribe discrimination theory by Swingle and Reece, the grouping in our ITS phylogenetic tree reconstructed by ITS sequences was not related to tribe discrimination but species discrimination. However, the molecular analysis could provide more information on citrus taxonomy. Combined with ITS sequences of other subgenera in then true citrus fruit tree group, the ITS phylogenetic tree indicated subgenera Citrus was monophyletic and nearer to Fortunella, Poncirus, and Clymenia compared to Microcitrus and Eremocitrus. Abundant sequence variations of the ITS region shown in this study would help species identification and tribe differentiation of the genus Citrus. (author)

  11. Wavelet-based multifractal analysis of DNA sequences by using chaos-game representation

    Chaos game representation (CGR) is proposed as a scale-independent representation for DNA sequences and provides information about the statistical distribution of oligonucleotides in a DNA sequence. CGR images of DNA sequences represent some kinds of fractal patterns, but the common multifractal analysis based on the box counting method cannot deal with CGR images perfectly. Here, the wavelet transform modulus maxima (WTMM) method is applied to the multifractal analysis of CGR images. The results show that the scale-invariance range of CGR edge images can be extended to three orders of magnitude, and complete singularity spectra can be calculated. Spectrum parameters such as the singularity spectrum span are extracted to describe the statistical character of DNA sequences. Compared with the singularity spectrum span, exon sequences with a minimal spectrum span have the most uniform fractal structure. Also, the singularity spectrum parameters are related to oligonucleotide length, sequence component and species, thereby providing a method of studying the length polymorphism of repeat oligonucleotides. (general)

  12. DNA LOSSLESS DIFFERENTIAL COMPRESSION ALGORITHM BASED ON SIMILARITY OF GENOMIC SEQUENCE DATABASE

    Heba Afify

    2011-09-01

    Full Text Available Modern biological science produces vast amounts of genomic sequence data. This is fuelling the need forefficient algorithms for sequence compression and analysis. Data compression and the associatedtechniques coming from information theory are often perceived as being of interest for datacommunication and storage. In recent years, a substantial effort has been made for the application oftextual data compression techniques to various computational biology tasks, ranging from storage andindexing of large datasets to comparison of genomic databases. This paper presents a differentialcompression algorithm that is based on production of difference sequences according to op-code table inorder to optimize the compression of homologous sequences in dataset. Therefore, the stored data arecomposed of reference sequence, the set of differences, and differences locations, instead of storing eachsequence individually. This algorithm does not require a priori knowledge about the statistics of thesequence set. The algorithm was applied to three different datasets of genomic sequences, it achieved upto 195-fold compression rate corresponding to 99.4% space saving.

  13. Sequence Comparison Alignment-Free Approach Based on Suffix Tree and L-Words Frequency

    Inês Soares

    2012-01-01

    Full Text Available The vast majority of methods available for sequence comparison rely on a first sequence alignment step, which requires a number of assumptions on evolutionary history and is sometimes very difficult or impossible to perform due to the abundance of gaps (insertions/deletions. In such cases, an alternative alignment-free method would prove valuable. Our method starts by a computation of a generalized suffix tree of all sequences, which is completed in linear time. Using this tree, the frequency of all possible words with a preset length L—L-words—in each sequence is rapidly calculated. Based on the L-words frequency profile of each sequence, a pairwise standard Euclidean distance is then computed producing a symmetric genetic distance matrix, which can be used to generate a neighbor joining dendrogram or a multidimensional scaling graph. We present an improvement to word counting alignment-free approaches for sequence comparison, by determining a single optimal word length and combining suffix tree structures to the word counting tasks. Our approach is, thus, a fast and simple application that proved to be efficient and powerful when applied to mitochondrial genomes. The algorithm was implemented in Python language and is freely available on the web.

  14. Histoimmunogenetics Markup Language 1.0: Reporting next generation sequencing-based HLA and KIR genotyping.

    Milius, Robert P; Heuer, Michael; Valiga, Daniel; Doroschak, Kathryn J; Kennedy, Caleb J; Bolon, Yung-Tsi; Schneider, Joel; Pollack, Jane; Kim, Hwa Ran; Cereb, Nezih; Hollenbach, Jill A; Mack, Steven J; Maiers, Martin

    2015-12-01

    We present an electronic format for exchanging data for HLA and KIR genotyping with extensions for next-generation sequencing (NGS). This format addresses NGS data exchange by refining the Histoimmunogenetics Markup Language (HML) to conform to the proposed Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING) reporting guidelines (miring.immunogenomics.org). Our refinements of HML include two major additions. First, NGS is supported by new XML structures to capture additional NGS data and metadata required to produce a genotyping result, including analysis-dependent (dynamic) and method-dependent (static) components. A full genotype, consensus sequence, and the surrounding metadata are included directly, while the raw sequence reads and platform documentation are externally referenced. Second, genotype ambiguity is fully represented by integrating Genotype List Strings, which use a hierarchical set of delimiters to represent allele and genotype ambiguity in a complete and accurate fashion. HML also continues to enable the transmission of legacy methods (e.g. site-specific oligonucleotide, sequence-specific priming, and Sequence Based Typing (SBT)), adding features such as allowing multiple group-specific sequencing primers, and fully leveraging techniques that combine multiple methods to obtain a single result, such as SBT integrated with NGS. PMID:26319908

  15. Experimental design-based functional mining and characterization of high-throughput sequencing data in the sequence read archive.

    Takeru Nakazato

    Full Text Available High-throughput sequencing technology, also called next-generation sequencing (NGS, has the potential to revolutionize the whole process of genome sequencing, transcriptomics, and epigenetics. Sequencing data is captured in a public primary data archive, the Sequence Read Archive (SRA. As of January 2013, data from more than 14,000 projects have been submitted to SRA, which is double that of the previous year. Researchers can download raw sequence data from SRA website to perform further analyses and to compare with their own data. However, it is extremely difficult to search entries and download raw sequences of interests with SRA because the data structure is complicated, and experimental conditions along with raw sequences are partly described in natural language. Additionally, some sequences are of inconsistent quality because anyone can submit sequencing data to SRA with no quality check. Therefore, as a criterion of data quality, we focused on SRA entries that were cited in journal articles. We extracted SRA IDs and PubMed IDs (PMIDs from SRA and full-text versions of journal articles and retrieved 2748 SRA ID-PMID pairs. We constructed a publication list referring to SRA entries. Since, one of the main themes of -omics analyses is clarification of disease mechanisms, we also characterized SRA entries by disease keywords, according to the Medical Subject Headings (MeSH extracted from articles assigned to each SRA entry. We obtained 989 SRA ID-MeSH disease term pairs, and constructed a disease list referring to SRA data. We previously developed feature profiles of diseases in a system called "Gendoo". We generated hyperlinks between diseases extracted from SRA and the feature profiles of it. The developed project, publication and disease lists resulting from this study are available at our web service, called "DBCLS SRA" (http://sra.dbcls.jp/. This service will improve accessibility to high-quality data from SRA.

  16. Complete Genome Sequence of the d-Amino Acid Catabolism Bacterium Phaeobacter sp. Strain JL2886, Isolated from Deep Seawater of the South China Sea.

    Fu, Yingnan; Wang, Rui; Zhang, Zilian; Jiao, Nianzhi

    2016-01-01

    Phaeobacter sp. strain JL2886, isolated from deep seawater of the South China Sea, can catabolize d-amino acids. Here, we report the complete genome sequence of Phaeobacter sp. JL2886. It comprises ~4.06 Mbp, with a G+C content of 61.52%. A total of 3,913 protein-coding genes and 10 genes related to d-amino acid catabolism were obtained. PMID:27587825

  17. Conversion of lignocellulosic biomass into its molecular components by sequential combination of organic acid and base

    Noda, Yu

    The primary objective of this research is to explore a new concept of converting lignocellulosic biomass into liquid organic products via hydrolysis by sequentially combining acid and base treatments. The concept was examined by studying two-step hydrolytic reactions of biomass (spruce) using oxialic acid (OA) and tetramethylammonium hydroxide (TMAH) at moderate reaction temperatures below 200 °C. Different selectivity of C-O bond cleavage of hemicellulose, cellulose, and lignin between the reactions with OA and TMAH was demonstrated, and the sequential combination of OA and TMAH treatments exhibited an enhancing effect on conversion of biomass, which proves the promise of the proposed concept. A similar enhancing effect of combination was further confirmed in the reactions with mineral acid and base. Interestingly, characterization of solid residue from reactions of biomass and further investigation of the reactions of commercial cellulose revealed that the A-B sequence (the first reaction with OA and the second with TMAH) enhanced the conversion of cellulose at the second step with TMAH. It was suggested from the NMR and XRD study of solid residues that this enhancement was caused by the reduction of crystallinity of cellulose by the first reaction with OA. This effect was shown to be an interesting feature of A-B treatment sequence for converting lignocellulosic biomass. To improve the yield of monomeric sugars, the effect of adding organic solvents to the system was also studied. No improvement on sugar yield was observed under the explored conditions. However, it was shown that some furans and phenols can be directly formed from the reactions of biomass in the binary solvent system, which may be beneficial for producing more value-added chemicals from biomass.

  18. Full Genome Sequence-Based Comparative Study of Wild-Type and Vaccine Strains of Infectious Laryngotracheitis Virus from Italy.

    Alessandra Piccirillo

    Full Text Available Infectious laryngotracheitis (ILT is an acute and highly contagious respiratory disease of chickens caused by an alphaherpesvirus, infectious laryngotracheitis virus (ILTV. Recently, full genome sequences of wild-type and vaccine strains have been determined worldwide, but none was from Europe. The aim of this study was to determine and analyse the complete genome sequences of five ILTV strains. Sequences were also compared to reveal the similarity of strains across time and to discriminate between wild-type and vaccine strains. Genomes of three ILTV field isolates from outbreaks occurred in Italy in 1980, 2007 and 2011, and two commercial chicken embryo origin (CEO vaccines were sequenced using the 454 Life Sciences technology. The comparison with the Serva genome showed that 35 open reading frames (ORFs differed across the five genomes. Overall, 54 single nucleotide polymorphisms (SNPs and 27 amino acid differences in 19 ORFs and two insertions in the UL52 and ORFC genes were identified. Similarity among the field strains and between the field and the vaccine strains ranged from 99.96% to 99.99%. Phylogenetic analysis revealed a close relationship among them, as well. This study generated data on genomic variation among Italian ILTV strains revealing that, even though the genetic variability of the genome is well conserved across time and between wild-type and vaccine strains, some mutations may help in differentiating among them and may be involved in ILTV virulence/attenuation. The results of this study can contribute to the understanding of the molecular bases of ILTV pathogenicity and provide genetic markers to differentiate between wild-type and vaccine strains.

  19. Full Genome Sequence-Based Comparative Study of Wild-Type and Vaccine Strains of Infectious Laryngotracheitis Virus from Italy.

    Piccirillo, Alessandra; Lavezzo, Enrico; Niero, Giulia; Moreno, Ana; Massi, Paola; Franchin, Elisa; Toppo, Stefano; Salata, Cristiano; Palù, Giorgio

    2016-01-01

    Infectious laryngotracheitis (ILT) is an acute and highly contagious respiratory disease of chickens caused by an alphaherpesvirus, infectious laryngotracheitis virus (ILTV). Recently, full genome sequences of wild-type and vaccine strains have been determined worldwide, but none was from Europe. The aim of this study was to determine and analyse the complete genome sequences of five ILTV strains. Sequences were also compared to reveal the similarity of strains across time and to discriminate between wild-type and vaccine strains. Genomes of three ILTV field isolates from outbreaks occurred in Italy in 1980, 2007 and 2011, and two commercial chicken embryo origin (CEO) vaccines were sequenced using the 454 Life Sciences technology. The comparison with the Serva genome showed that 35 open reading frames (ORFs) differed across the five genomes. Overall, 54 single nucleotide polymorphisms (SNPs) and 27 amino acid differences in 19 ORFs and two insertions in the UL52 and ORFC genes were identified. Similarity among the field strains and between the field and the vaccine strains ranged from 99.96% to 99.99%. Phylogenetic analysis revealed a close relationship among them, as well. This study generated data on genomic variation among Italian ILTV strains revealing that, even though the genetic variability of the genome is well conserved across time and between wild-type and vaccine strains, some mutations may help in differentiating among them and may be involved in ILTV virulence/attenuation. The results of this study can contribute to the understanding of the molecular bases of ILTV pathogenicity and provide genetic markers to differentiate between wild-type and vaccine strains. PMID:26890525

  20. Context based computational analysis and characterization of ARS consensus sequences (ACS) of Saccharomyces cerevisiae genome.

    Singh, Vinod Kumar; Krishnamachari, Annangarachari

    2016-09-01

    Genome-wide experimental studies in Saccharomyces cerevisiae reveal that autonomous replicating sequence (ARS) requires an essential consensus sequence (ACS) for replication activity. Computational studies identified thousands of ACS like patterns in the genome. However, only a few hundreds of these sites act as replicating sites and the rest are considered as dormant or evolving sites. In a bid to understand the sequence makeup of replication sites, a content and context-based analysis was performed on a set of replicating ACS sequences that binds to origin-recognition complex (ORC) denoted as ORC-ACS and non-replicating ACS sequences (nrACS), that are not bound by ORC. In this study, DNA properties such as base composition, correlation, sequence dependent thermodynamic and DNA structural profiles, and their positions have been considered for characterizing ORC-ACS and nrACS. Analysis reveals that ORC-ACS depict marked differences in nucleotide composition and context features in its vicinity compared to nrACS. Interestingly, an A-rich motif was also discovered in ORC-ACS sequences within its nucleosome-free region. Profound changes in the conformational features, such as DNA helical twist, inclination angle and stacking energy between ORC-ACS and nrACS were observed. Distribution of ACS motifs in the non-coding segments points to the locations of ORC-ACS which are found far away from the adjacent gene start position compared to nrACS thereby enabling an accessible environment for ORC-proteins. Our attempt is novel in considering the contextual view of ACS and its flanking region along with nucleosome positioning in the S. cerevisiae genome and may be useful for any computational prediction scheme. PMID:27508123

  1. Simultaneous genomic identification and profiling of a single cell using semiconductor-based next generation sequencing

    Manabu Watanabe

    2014-09-01

    Full Text Available Combining single-cell methods and next-generation sequencing should provide a powerful means to understand single-cell biology and obviate the effects of sample heterogeneity. Here we report a single-cell identification method and seamless cancer gene profiling using semiconductor-based massively parallel sequencing. A549 cells (adenocarcinomic human alveolar basal epithelial cell line were used as a model. Single-cell capture was performed using laser capture microdissection (LCM with an Arcturus® XT system, and a captured single cell and a bulk population of A549 cells (≈106 cells were subjected to whole genome amplification (WGA. For cell identification, a multiplex PCR method (AmpliSeq™ SNP HID panel was used to enrich 136 highly discriminatory SNPs with a genotype concordance probability of 1031–35. For cancer gene profiling, we used mutation profiling that was performed in parallel using a hotspot panel for 50 cancer-related genes. Sequencing was performed using a semiconductor-based bench top sequencer. The distribution of sequence reads for both HID and Cancer panel amplicons was consistent across these samples. For the bulk population of cells, the percentages of sequence covered at coverage of more than 100× were 99.04% for the HID panel and 98.83% for the Cancer panel, while for the single cell percentages of sequence covered at coverage of more than 100× were 55.93% for the HID panel and 65.96% for the Cancer panel. Partial amplification failure or randomly distributed non-amplified regions across samples from single cells during the WGA procedures or random allele drop out probably caused these differences. However, comparative analyses showed that this method successfully discriminated a single A549 cancer cell from a bulk population of A549 cells. Thus, our approach provides a powerful means to overcome tumor sample heterogeneity when searching for somatic mutations.

  2. Gene ontology-based protein function prediction by using sequence composition information.

    Dong, Qiwen; Zhou, Shuigeng; Deng, Lei; Guan, Jihong

    2010-06-01

    The prediction of protein function is a difficult and important problem in computational biology. In this study, an efficient method is presented to predict protein function with sequence composition information. Four kinds of basic building blocks of protein sequences are investigated, including N-grams, binary profiles, PFAM domains and InterPro domains. The protein sequences are mapped into high-dimensional vectors by using the occurrence frequencies of each kind of building blocks. The resulting vectors are then taken as input to support vector machine to predict their function based on gene ontology. Experiments are conducted over the subset of GOA database. The experimental results show that the protein function can be predicted from primary sequence information. The method based on InterPro domains outperforms the other building blocks, and gets an overall accuracy of 0.87 and ROC score is 0.93. We also demonstrate that the use of feature extraction algorithms such as latent semantic analysis and nonnegative matrix factorization, can efficiently remove noise and improve the prediction efficiency without significantly degrading the performance. The results obtained here are helpful for the prediction of protein function by using only sequence information. PMID:19995340

  3. Molecular phylogeny of western Atlantic Farfantepenaeus and Litopenaeus shrimp based on mitochondrial 16S partial sequences.

    Maggioni, R; Rogers, A D; Maclean, N; D'Incao, F

    2001-01-01

    Partial sequences for the 16S rRNA mitochondrial gene were obtained from 10 penaeid shrimp species: Farfantepenaeus paulensis, F. brasiliensis, F. subtilis, F. duorarum, F. aztecus, Litopenaeus schmitti, L. setiferus, and Xiphopenaeus kroyeri from the western Atlantic and L. vannamei and L. stylirostris from the eastern Pacific. Sequences were also obtained from an undescribed morphotype of pink shrimp (morphotype II) usually identified as F. subtilis. The phylogeny resulting from the 16S partial sequences showed that these species form two well-supported monophyletic clades consistent with the two genera proposed in a recent systematic review of the suborder Dendrobranchiata. This contrasted with conclusions drawn from recent molecular phylogenetic work on penaeid shrimps based on partial sequences of the mitochondrial COI region that failed to support recent revisions of the Dendrobranchiata based on morphological analysis. Consistent differences observed in the sequences for morphotype II, coupled with previous allozyme data, support the conclusion that this is a previously undescribed species of Farfantepenaeus. PMID:11161743

  4. DIALIGN-T: An improved algorithm for segment-based multiple sequence alignment

    Kaufmann Michael

    2005-03-01

    Full Text Available Abstract Background We present a complete re-implementation of the segment-based approach to multiple protein alignment that contains a number of improvements compared to the previous version 2.2 of DIALIGN. This previous version is superior to Needleman-Wunsch-based multi-alignment programs on locally related sequence sets. However, it is often outperformed by these methods on data sets with global but weak similarity at the primary-sequence level. Results In the present paper, we discuss strengths and weaknesses of DIALIGN in view of the underlying objective function. Based on these results, we propose several heuristics to improve the segment-based alignment approach. For pairwise alignment, we implemented a fragment-chaining algorithm that favours chains of low-scoring local alignments over isolated high-scoring fragments. For multiple alignment, we use an improved greedy procedure that is less sensitive to spurious local sequence similarities. To evaluate our method on globally related protein families, we used the well-known database BAliBASE. For benchmarking tests on locally related sequences, we created a new reference database called IRMBASE which consists of simulated conserved motifs implanted into non-related random sequences. Conclusion On BAliBASE, our new program performs significantly better than the previous version of DIALIGN and is comparable to the standard global aligner CLUSTAL W, though it is outperformed by some newly developed programs that focus on global alignment. On the locally related test sets in IRMBASE, our method outperforms all other programs that we evaluated.

  5. Detection of Sialic Acid-Utilising Bacteria in a Caecal Community Batch Culture Using RNA-Based Stable Isotope Probing

    Wayne Young

    2015-03-01

    Full Text Available Sialic acids are monosaccharides typically found on cell surfaces and attached to soluble proteins, or as essential components of ganglioside structures that play a critical role in brain development and neural transmission. Human milk also contains sialic acid conjugated to oligosaccharides, glycolipids, and glycoproteins. These nutrients can reach the large bowel where they may be metabolised by the microbiota. However, little is known about the members of the microbiota involved in this function. To identify intestinal bacteria that utilise sialic acid within a complex intestinal community, we cultured the caecal microbiota from piglets in the presence of 13C-labelled sialic acid. Using RNA-based stable isotope probing, we identified bacteria that consumed 13C-sialic acid by fractionating total RNA in isopycnic buoyant density gradients followed by 16S rRNA gene analysis. Addition of sialic acid caused significant microbial community changes. A relative rise in Prevotella and Lactobacillus species was accompanied by a corresponding reduction in the genera Escherichia/Shigella, Ruminococcus and Eubacterium. Inspection of isotopically labelled RNA sequences suggests that the labelled sialic acid was consumed by a wide range of bacteria. However, species affiliated with the genus Prevotella were clearly identified as the most prolific users, as solely their RNA showed significantly higher relative shares among the most labelled RNA species. Given the relevance of sialic acid in nutrition, this study contributes to a better understanding of their microbial transformation in the intestinal tract with potential implications for human health.

  6. Multimeric small interfering ribonucleic acid for highly efficient sequence-specific gene silencing

    Mok, Hyejung; Lee, Soo Hyeon; Park, Ji Won; Park, Tae Gwan

    2010-03-01

    Small interfering RNA (siRNA) with 19-21 base pairs has been recently recognized as a new therapeutic agent for effectively silencing a specific gene on a post-transcription level. For siRNA therapeutics, safe and efficient delivery issues are significant hurdles to clinical applications. Here we present a new class of biologically active siRNA structure based on chemically self-crosslinked and multimerized siRNA through cleavable disulphide linkages. The multimerized siRNA can produce more stable and compact polyelectrolyte complexes with less cytotoxic cationic carriers than naked siRNA because of substantially increased charge densities and the presence of flexible chemical linkers in the backbone. The cleavable and multimerized siRNA shows greatly enhanced gene-silencing efficiencies in vitro and in vivo through a target-messenger-RNA-specific RNA interference processing without significantly eliciting immune induction. This study demonstrates that the multimerized siRNA structure complexed with selected cationic condensing agents can serve as potential gene-silencing therapeutics for treating various diseases.

  7. Reproducible analysis of sequencing-based RNA structure probing data with user-friendly tools

    Kielpinski, Lukasz Jan; Sidiropoulos, Nikos; Vinther, Jeppe

    2015-01-01

    time also made analysis of the data challenging for scientists without formal training in computational biology. Here, we discuss different strategies for data analysis of massive parallel sequencing-based structure-probing data. To facilitate reproducible and standardized analysis of this type of data...

  8. Teaching Research Methodology Using a Project-Based Three Course Sequence Critical Reflections on Practice

    Braguglia, Kay H.; Jackson, Kanata A.

    2012-01-01

    This article presents a reflective analysis of teaching research methodology through a three course sequence using a project-based approach. The authors reflect critically on their experiences in teaching research methods courses in an undergraduate business management program. The introduction of a range of specific techniques including student…

  9. Magnetism Teaching Sequences Based on an Inductive Approach for First-Year Thai University Science Students

    Narjaikaew, Pattawan; Emarat, Narumon; Arayathanitkul, Kwan; Cowie, Bronwen

    2010-01-01

    The study investigated the impact on student motivation and understanding of magnetism of teaching sequences based on an inductive approach. The study was conducted in large lecture classes. A pre- and post-Conceptual Survey of Electricity and Magnetism was conducted with just fewer than 700 Thai undergraduate science students, before and after…

  10. Neural network predicts sequence of TP53 gene based on DNA chip

    Spicker, J.S.; Wikman, F.; Lu, M.L.;

    2002-01-01

    We have trained an artificial neural network to predict the sequence of the human TP53 tumor suppressor gene based on a p53 GeneChip. The trained neural network uses as input the fluorescence intensities of DNA hybridized to oligonucleotides on the surface of the chip and makes between zero and...

  11. Superabsorbent biphasic system based on poly(lactic acid) and poly(acrylic acid)

    Sartore, Luciana; Pandini, Stefano; Baldi, Francesco; Bignotti, Fabio

    2016-05-01

    In this research work, biocomposites based on crosslinked particles of poly(acrylic acid), commonly used as superabsorbent polymer (SAP), and poly-L-lactic acid (PLLA) were developed to elucidate the role of the filler (i.e., polymeric crosslinked particles) on the overall physico-mechanical behavior and to obtain superabsorbent thermoplastic products. Samples prepared by melt-blending of components in different ratios showed a biphasic system with a regular distribution of particles, with diameter ranging from 5 to 10 μm, within the PLLA polymeric matrix. The polymeric biphasic system, coded PLASA i.e. superabsorbent poly(lactic acid), showed excellent swelling properties, demonstrating that cross-linked particles retain their superabsorbent ability, as in their free counterparts, even if distributed in a thermoplastic polymeric matrix. The thermal characteristics of the biocomposites evidence enhanced thermal stability in comparison with neat PLLA and also mechanical properties are markedly modified by addition of crosslinked particles which induce regular stiffening effect. Furthermore, in aqueous environments the particles swell and are leached from PLLA matrix generating very high porosity. These new open-pore PLLA foams, produced in absence of organic solvents and chemical foaming agents, with good physico-mechanical properties appear very promising for several applications, for instance in tissue engineering for scaffold production.

  12. CGKB: an annotation knowledge base for cowpea (Vigna unguiculata L. methylation filtered genomic genespace sequences

    Spraggins Thomas A

    2007-04-01

    Full Text Available Abstract Background Cowpea [Vigna unguiculata (L. Walp.] is one of the most important food and forage legumes in the semi-arid tropics because of its ability to tolerate drought and grow on poor soils. It is cultivated mostly by poor farmers in developing countries, with 80% of production taking place in the dry savannah of tropical West and Central Africa. Cowpea is largely an underexploited crop with relatively little genomic information available for use in applied plant breeding. The goal of the Cowpea Genomics Initiative (CGI, funded by the Kirkhouse Trust, a UK-based charitable organization, is to leverage modern molecular genetic tools for gene discovery and cowpea improvement. One aspect of the initiative is the sequencing of the gene-rich region of the cowpea genome (termed the genespace recovered using methylation filtration technology and providing annotation and analysis of the sequence data. Description CGKB, Cowpea Genespace/Genomics Knowledge Base, is an annotation knowledge base developed under the CGI. The database is based on information derived from 298,848 cowpea genespace sequences (GSS isolated by methylation filtering of genomic DNA. The CGKB consists of three knowledge bases: GSS annotation and comparative genomics knowledge base, GSS enzyme and metabolic pathway knowledge base, and GSS simple sequence repeats (SSRs knowledge base for molecular marker discovery. A homology-based approach was applied for annotations of the GSS, mainly using BLASTX against four public FASTA formatted protein databases (NCBI GenBank Proteins, UniProtKB-Swiss-Prot, UniprotKB-PIR (Protein Information Resource, and UniProtKB-TrEMBL. Comparative genome analysis was done by BLASTX searches of the cowpea GSS against four plant proteomes from Arabidopsis thaliana, Oryza sativa, Medicago truncatula, and Populus trichocarpa. The possible exons and introns on each cowpea GSS were predicted using the HMM-based Genscan gene predication program and the

  13. Evolution of EF-hand calcium-modulated proteins. III. Exon sequences confirm most dendrograms based on protein sequences: calmodulin dendrograms show significant lack of parallelism

    Nakayama, S.; Kretsinger, R. H.

    1993-01-01

    In the first report in this series we presented dendrograms based on 152 individual proteins of the EF-hand family. In the second we used sequences from 228 proteins, containing 835 domains, and showed that eight of the 29 subfamilies are congruent and that the EF-hand domains of the remaining 21 subfamilies have diverse evolutionary histories. In this study we have computed dendrograms within and among the EF-hand subfamilies using the encoding DNA sequences. In most instances the dendrograms based on protein and on DNA sequences are very similar. Significant differences between protein and DNA trees for calmodulin remain unexplained. In our fourth report we evaluate the sequences and the distribution of introns within the EF-hand family and conclude that exon shuffling did not play a significant role in its evolution.

  14. Carbon nanotube-based labels for highly sensitive colorimetric and aggregation-based visual detection of nucleic acids

    A novel carbon nanotube (CNT) derived label capable of dramatic signal amplification of nucleic acid detection and direct visual detection of target hybridization has been developed. Highly sensitive colorimetric detection of human acute lymphocytic leukemia (ALL) related oncogene sequences amplified by the novel CNT-based label was demonstrated. Atomic force microscope (AFM) images confirmed that a monolayer of horseradish peroxidase and detection probe molecules was immobilized along the carboxylated CNT carrier. The resulting CNT labels significantly enhanced the nucleic acid assay sensitivity by at least 1000 times compared to that of conventional labels used in enzyme-linked oligosorbent assay (ELOSA). An excellent detection limit of 1 x 10-12 M (60 x 10-18 mol in 60 μl) and a four-order wide dynamic range of target concentration were achieved. Hybridizations using these labels were coupled to a concentration-dependent formation of visible dark aggregates. Targets can thus be detected simply with visual inspection, eliminating the need for expensive and sophisticated detection systems. The approach holds promise for ultrasensitive and low cost visual inspection and colorimetric nucleic acid detection in point-of-care and early disease diagnostic application

  15. Identification of G and P genotype-specific motifs in the predicted VP7 and VP4 amino acid sequences.

    Ma, Yongping

    2015-12-01

    Equine rotavirus (ERV) strain L338 (G13P[18]) has a unique G and P genotype. However, the evolutionary relationship of L338 with other ERVs is still unknown. Here whole genome analysis of the L338 ERV strain was independently performed. Its genotype constellations were determined as G13-P[18]-I6-R9-C9-M6-A6-N9-T12-E14-H11, confirming previous genotype assignments. The L338 strain only shared the P[18] and I6 genotypes with other ERVs. The nucleotide sequences of the other 9 RNA segments were different from those of cogent genes of all other group A rotavirus (RVA) strains including ERVs and formed unique phylogenetic lineages. The L338 evolutionary footprints were tentatively identified in both VP7 and VP4 amino acid sequences: two regions were found in VP7 and twelve in VP4. The conserved regions shared between L338 and other group A rotavirus strains (RVAs) indicated that L338 was more closely related genomically to animal and human RVAs other than ERVs, suggesting that L338 may not be an endogenous equine RV but have emerged as an interspecies reassortant with other RVA strains. Furthermore, genotype-specific motifs of all 27 G and 37 P types were identified in regions 7-1a (aa 91-100) of VP7 and regions 8-1 (aa146-151) and 8-3 (aa113-118 and 125-135) of VP4 (VP8*). PMID:26321159

  16. Use of polyphase continuous excitation based on the Frank sequence in EPR.

    Tseitlin, Mark; Quine, Richard W; Eaton, Sandra S; Eaton, Gareth R

    2011-08-01

    Polyphase continuous excitation based on the Frank sequence is suggested as an alternative to single pulse excitation in EPR. The method allows reduction of the source power, while preserving the excitation bandwidth of a single pulse. For practical EPR implementation the use of a cross-loop resonator is essential to provide isolation between the spin system and the resonator responses to the excitation. Provided that a line broadening of about 5% is acceptable, the cumulative turning angle of the magnetization vector generated by the excitation sequence can be quite large and can produce signal amplitudes that are comparable to that achieved with a higher power 90° pulse. PMID:21737326

  17. A new RF tagging pulse based on the Frank poly-phase perfect sequence

    Laustsen, Christoffer; Greferath, Marcus; Ringgaard, Steffen;

    2014-01-01

    Radio frequency (RF) spectrally selective multiband pulses or tagging pulses, are applicable in a broad range of magnetic resonance methods. We demonstrate through simulations and experiments a new phase-modulation-only RF pulse for RF tagging based on the Frank poly-phase perfect sequence. In...... addition, we introduce an extended version with a WURST modulation (Frank-WURST). The new pulses exhibit interesting and flexible spin tagging properties and are easily implemented in existing MR sequences, where they can substitute slice-selective pulses with no additional alterations....

  18. Security Analysis of a Block Encryption Algorithm Based on Dynamic Sequences of Multiple Chaotic Systems

    DU Mao-Kang; HE Bo; WANG Yong

    2011-01-01

    Recently, the cryptosystem based on chaos has attracted much attention. Wang and Yu (Commun. Nonlin. Sci. Numer. Simulat. 14(2009)574) proposed a block encryption algorithm based on dynamic sequences of multiple chaotic systems. We analyze the potential Saws in the algorithm. Then, a chosen-plaintext attack is presented. Some remedial measures are suggested to avoid the flaws effectively. Furthermore, an improved encryption algorithm is proposed to resist the attacks and to keep all the merits of the original cryptosystem.

  19. The effects of diffusion on an exonuclease/nanopore-based DNA sequencing engine

    Reiner, Joseph E.; Balijepalli, Arvind; Robertson, Joseph W. F.; Drown, Bryon S.; Burden, Daniel L.; Kasianowicz, John J.

    2012-01-01

    Over 15 years ago, the ability to electrically detect and characterize individual polynucleotides as they are driven through a single protein ion channel was suggested as a potential method for rapidly sequencing DNA, base-by-base, in a ticker tape-like fashion. More recently, a variation of this method was proposed in which a nanopore would instead detect single nucleotides cleaved sequentially by an exonuclease enzyme in close proximity to one pore entrance. We analyze the exonuclease/nanop...

  20. Defining and Evaluating a Core Genome Multilocus Sequence Typing Scheme for Whole-Genome Sequence-Based Typing of Listeria monocytogenes

    Ruppitsch, Werner; Pietzka, Ariane; Prior, Karola; Bletz, Stefan; Fernandez, Haizpea Lasa; Allerberger, Franz; Harmsen, Dag; Mellmann, Alexander

    2015-01-01

    Whole-genome sequencing (WGS) has emerged today as an ultimate typing tool to characterize Listeria monocytogenes outbreaks. However, data analysis and interlaboratory comparability of WGS data are still challenging for most public health laboratories. Therefore, we have developed and evaluated a new L. monocytogenes typing scheme based on genome-wide gene-by-gene comparisons (core genome multilocus the sequence typing [cgMLST]) to allow for a unique typing nomenclature. Initially, we determi...