WorldWideScience

Sample records for acads gene variation

  1. The ACADS gene variation spectrum in 114 patients with short-chain acyl-CoA dehydrogenase (SCAD) deficiency is dominated by missense variations leading to protein misfolding at the cellular level

    Pedersen, Christina Bak; Kølvrå, Steen; Kølvraa, Agnete;

    2008-01-01

    , 26 missense, one start codon, and two stop codon variations. In vitro import studies of variant SCAD proteins in isolated mitochondria from SCAD deficient (SCAD-/-) mice demonstrated an increased tendency of the abnormal proteins to misfold and aggregate compared to the wild-type, a phenomenon that...... often leads to gain-of-function cellular phenotypes. However, no correlation was found between the clinical phenotype and the degree of SCAD dysfunction. We propose that SCAD deficiency should be considered as a disorder of protein folding that can lead to clinical disease in combination with other...

  2. Riboflavin-responsive oxidative phosphorylation complex I deficiency caused by defective ACAD9: new function for an old gene.

    Gerards, Mike; van den Bosch, Bianca J C; Danhauser, Katharina; Serre, Valérie; van Weeghel, Michel; Wanders, Ronald J A; Nicolaes, Gerry A F; Sluiter, Wim; Schoonderwoerd, Kees; Scholte, Hans R; Prokisch, Holger; Rötig, Agnès; de Coo, Irenaeus F M; Smeets, Hubert J M

    2011-01-01

    Mitochondrial complex I deficiency is the most common oxidative phosphorylation defect. Mutations have been detected in mitochondrial and nuclear genes, but the genetics of many patients remain unresolved and new genes are probably involved. In a consanguineous family, patients presented easy fatigability, exercise intolerance and lactic acidosis in blood from early childhood. In muscle, subsarcolemmal mitochondrial proliferation and a severe complex I deficiency were observed. Exercise intolerance and complex I activity was improved by a supplement of riboflavin at high dosage. Homozygosity mapping revealed a candidate region on chromosome three containing six mitochondria-related genes. Four genes were screened for mutations and a homozygous substitution was identified in ACAD9 (c.1594 C>T), changing the highly conserved arginine-532 into tryptophan. This mutation was absent in 188 ethnically matched controls. Protein modelling suggested a functional effect due to the loss of a stabilizing hydrogen bond in an α-helix and a local flexibility change. To test whether the ACAD9 mutation caused the complex I deficiency, we transduced fibroblasts of patients with wild-type and mutant ACAD9. Wild-type, but not mutant, ACAD9 restored complex I activity. An unrelated patient with the same phenotype was compound heterozygous for c.380 G>A and c.1405 C>T, changing arginine-127 into glutamine and arginine-469 into tryptophan, respectively. These amino acids were highly conserved and the substitutions were not present in controls, making them very probably pathogenic. Our data support a new function for ACAD9 in complex I function, making this gene an important new candidate for patients with complex I deficiency, which could be improved by riboflavin treatment. PMID:20929961

  3. Variations in IBD (ACAD8) in children with elevated C4-carnitine detected by tandem mass spectrometry newborn screening

    Pedersen, Christina B; Bischoff, Claus; Christensen, Ernst; Simonsen, Henrik; Lund, Allan M; Young, Sarah P; Koeberl, Dwight D; Millington, David S; Roe, Charles R; Roe, Diane S; Wanders, Ronald J A; Ruiter, Jos P N; Keppen, Laura D; Stein, Quinn; Knudsen, Inga; Gregersen, Niels; Andresen, Brage S

    2006-01-01

    or compound heterozygous for variations in the IBD gene have been reported. We present IBD deficiency in an additional four newborns with elevated C(4)-carnitine identified by tandem mass spectrometry (MS/MS) screening in Denmark and the United States. Three showed urinary excretions of isobutyryl...

  4. Parkinson's disease and mitochondrial gene variations

    Andalib, Sasan; Vafaee, Manouchehr Seyedi; Gjedde, Albert

    2014-01-01

    Parkinson's disease (PD) is a common disorder of the central nervous system in the elderly. The pathogenesis of PD is a complex process, with genetics as an important contributing factor. This factor may stem from mitochondrial gene variations and mutations as well as from nuclear gene variations...... and mutations. More recently, a particular role of mitochondrial dysfunction has been suggested, arising from mitochondrial DNA variations or acquired mutations in PD pathogenesis. The present review summarizes and weighs the evidence in support of mitochondrial DNA (mtDNA) variations as important...

  5. Novela académica: reflexiones sobre sus orígenes en Inglaterra y Estados Unidos

    Castagnino, María Inés

    2011-01-01

    Intentar definir la novela académica como género presenta algunas dificultades. Como características básicas, no puede decirse mucho más que que se trata de novelas protagonizadas por académicos (docentes, investigadores o ambas condiciones a la vez) que se desempeñan generalmente en el área de las humanidades, a menudo en la de literatura, y cuya acción suele transcurrir en las dependencias de una universidad. Más allá de estos denominadores comunes, y a pesar de la tendencia de algunos sect...

  6. Riboflavin-responsive oxidative phosphorylation complex I deficiency caused by defective ACAD9: new function for an old gene

    M. Gerards; B.J.C. van den Bosch; K. Danhauser; V. Serre; M. van Weeghel; R.J.A. Wanders; G.A.F. Nicolaes; W. Sluiter; K. Schoonderwoerd; H.R. Scholte; H. Prokisch; A. Rötig; I.F.M. de Coo; H.J.M. Smeets

    2011-01-01

    Mitochondrial complex I deficiency is the most common oxidative phosphorylation defect. Mutations have been detected in mitochondrial and nuclear genes, but the genetics of many patients remain unresolved and new genes are probably involved. In a consanguineous family, patients presented easy fatiga

  7. Genomic variation in Salmonella enterica core genes for epidemiological typing

    Leekitcharoenphon, Pimlapas; Lukjancenko, Oksana; Rundsten, Carsten Friis; Aarestrup, Frank Møller; Ussery, David

    2012-01-01

    time. The core genes-the genes that are conserved in all (or most) members of a genus or species-are potentially good candidates for investigating genomic variation in phylogeny and epidemiology. Results: We identify a set of 2,882 core genes clusters based on 73 publicly available Salmonella enterica...

  8. Inherited variation in immune genes and pathways and glioblastoma risk

    Schwartzbaum, Judith A.; Xiao, Yuanyuan; Liu, Yanhong; Tsavachidis, Spyros; Berger, Mitchel S.; Bondy, Melissa L,; Chang, Jeffrey S.; Chang, Susan M.; Decker, Paul A.; Ding, Bo; Hepworth, Sarah J; Richard S. Houlston; Hosking, Fay J; Jenkins, Robert B.; Kosel, Matthew L.

    2010-01-01

    To determine whether inherited variations in immune function single-nucleotide polymorphisms (SNPs), genes or pathways affect glioblastoma risk, we analyzed data from recent genome-wide association studies in conjunction with predefined immune function genes and pathways. Gene and pathway analyses were conducted on two independent data sets using 6629 SNPs in 911 genes on 17 immune pathways from 525 glioblastoma cases and 602 controls from the University of California, San Francisco (UCSF) an...

  9. Population genetic variation in gene expression is associated withphenotypic variation in Saccharomyces cerevisiae

    Fay, Justin C.; McCullough, Heather L.; Sniegowski, Paul D.; Eisen, Michael B.

    2004-02-25

    The relationship between genetic variation in gene expression and phenotypic variation observable in nature is not well understood. Identifying how many phenotypes are associated with differences in gene expression and how many gene-expression differences are associated with a phenotype is important to understanding the molecular basis and evolution of complex traits. Results: We compared levels of gene expression among nine natural isolates of Saccharomyces cerevisiae grown either in the presence or absence of copper sulfate. Of the nine strains, two show a reduced growth rate and two others are rust colored in the presence of copper sulfate. We identified 633 genes that show significant differences in expression among strains. Of these genes,20 were correlated with resistance to copper sulfate and 24 were correlated with rust coloration. The function of these genes in combination with their expression pattern suggests the presence of both correlative and causative expression differences. But the majority of differentially expressed genes were not correlated with either phenotype and showed the same expression pattern both in the presence and absence of copper sulfate. To determine whether these expression differences may contribute to phenotypic variation under other environmental conditions, we examined one phenotype, freeze tolerance, predicted by the differential expression of the aquaporin gene AQY2. We found freeze tolerance is associated with the expression of AQY2. Conclusions: Gene expression differences provide substantial insight into the molecular basis of naturally occurring traits and can be used to predict environment dependent phenotypic variation.

  10. Propagation of genetic variation in gene regulatory networks

    Plahte, Erik; Gjuvsland, Arne B; Omholt, Stig W.

    2013-01-01

    A future quantitative genetics theory should link genetic variation to phenotypic variation in a causally cohesive way based on how genes actually work and interact. We provide a theoretical framework for predicting and understanding the manifestation of genetic variation in haploid and diploid regulatory networks with arbitrary feedback structures and intra-locus and inter-locus functional dependencies. Using results from network and graph theory, we define propagation functions describing h...

  11. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  12. Pathogenicity gene variations within the order Entomophthorales

    Grell, Morten Nedergaard; Jensen, Annette Bruun; Lange, Lene

    Fungi within the order Entomophthorales (subphylum Entomophthoromycotina) are obligate biotrophic pathogens of arthropods with a remarkable narrow host range. Infection takes place through the cuticle when conidia hit a susceptible host, facilitated by enzymatic and mechanical mechanisms. In the ...... pathogenicity genes within genera Entomophthora and Pandora, using fungal genomic DNA originating from field-collected, infected insect host species of dipteran (flies, mosquitoes) or hemipteran (aphid) origin....

  13. Genetic Variation in Candidate Genes Like the HMGA2 Gene in the Extremely Tall

    Hendriks, A. E. J.; Brown, M. R.; Boot, A. M.; Oostra, B. A.; Drop, S. L. S.; Parks, J. S.

    2011-01-01

    Background/Aims: Genetic variation in several candidate genes has been associated with short stature. Recently, a high-mobility group A2 (HMGA2) gene SNP has been robustly associated with height in the general population. Only few have attempted to study these genes in extremely tall stature. We the

  14. Expanding the Boundaries of Gene Variation for Crop Improvement

    Directed and undirected mutagenesis continues to offer unique opportunities for crop improvement. Mutations also occur naturally and different forms are present in each strain of plants within and among species. Modifying genes affect the expression of all mutants and examples exist where the deleterious features of a mutant can be significantly changed by selection. New technologies, including those associated with genomics such as re-sequencing, TILLING, and RNA interference, allow the detection of gene variation at an unprecedented frequency. Knowledge of genes that affect recombination among homoeologous chromosomes may lead to inducible methods regulating the exchange among chromosomes in a polyploid species. Forward and reverse genetic methods are readily available in many species, including model plant species. There are an estimated one million sites in the japonica rice genome tagged via Tos17, Ac/Ds, T-DNA, and other insertion elements. Site-specific mutagenesis and gene replacement methods may replace the need for transgenic technology in some cases. Transcriptome modification occurs via mutagen treatment, aneuploidy, and uniparental chromosome loss, and sometimes results in a mutant phenotype. The boundaries of gene variation appear to be more expansive as plant genetics knowledge and technologies increase. (author)

  15. Partitioning of genetic variation between regulatory and coding gene segments: the predominance of software variation in genes encoding introvert proteins.

    Mitchison, A

    1997-01-01

    In considering genetic variation in eukaryotes, a fundamental distinction can be made between variation in regulatory (software) and coding (hardware) gene segments. For quantitative traits the bulk of variation, particularly that near the population mean, appears to reside in regulatory segments. The main exceptions to this rule concern proteins which handle extrinsic substances, here termed extrovert proteins. The immune system includes an unusually large proportion of this exceptional category, but even so its chief source of variation may well be polymorphism in regulatory gene segments. The main evidence for this view emerges from genome scanning for quantitative trait loci (QTL), which in the case of the immune system points to a major contribution of pro-inflammatory cytokine genes. Further support comes from sequencing of major histocompatibility complex (Mhc) class II promoters, where a high level of polymorphism has been detected. These Mhc promoters appear to act, in part at least, by gating the back-signal from T cells into antigen-presenting cells. Both these forms of polymorphism are likely to be sustained by the need for flexibility in the immune response. Future work on promoter polymorphism is likely to benefit from the input from genome informatics. PMID:9148788

  16. Gene Tree Discordance Causes Apparent Substitution Rate Variation.

    Mendes, Fábio K; Hahn, Matthew W

    2016-07-01

    Substitution rates are known to be variable among genes, chromosomes, species, and lineages due to multifarious biological processes. Here, we consider another source of substitution rate variation due to a technical bias associated with gene tree discordance. Discordance has been found to be rampant in genome-wide data sets, often due to incomplete lineage sorting (ILS). This apparent substitution rate variation is caused when substitutions that occur on discordant gene trees are analyzed in the context of a single, fixed species tree. Such substitutions have to be resolved by proposing multiple substitutions on the species tree, and we therefore refer to this phenomenon as Substitutions Produced by ILS (SPILS). We use simulations to demonstrate that SPILS has a larger effect with increasing levels of ILS, and on trees with larger numbers of taxa. Specific branches of the species trees are consistently, but erroneously, inferred to be longer or shorter, and we show that these branches can be predicted based on discordant tree topologies. Moreover, we observe that fixing a species tree topology when performing tests of positive selection increases the false positive rate, particularly for genes whose discordant topologies are most affected by SPILS. Finally, we use data from multiple Drosophila species to show that SPILS can be detected in nature. Although the effects of SPILS are modest per gene, it has the potential to affect substitution rate variation whenever high levels of ILS are present, particularly in rapid radiations. The problems outlined here have implications for character mapping of any type of trait, and for any biological process that causes discordance. We discuss possible solutions to these problems, and areas in which they are likely to have caused faulty inferences of convergence and accelerated evolution. PMID:26927960

  17. Inherited variation in immune genes and pathways and glioblastoma risk.

    Schwartzbaum, Judith A; Xiao, Yuanyuan; Liu, Yanhong; Tsavachidis, Spyros; Berger, Mitchel S; Bondy, Melissa L; Chang, Jeffrey S; Chang, Susan M; Decker, Paul A; Ding, Bo; Hepworth, Sarah J; Houlston, Richard S; Hosking, Fay J; Jenkins, Robert B; Kosel, Matthew L; McCoy, Lucie S; McKinney, Patricia A; Muir, Kenneth; Patoka, Joe S; Prados, Michael; Rice, Terri; Robertson, Lindsay B; Schoemaker, Minouk J; Shete, Sanjay; Swerdlow, Anthony J; Wiemels, Joe L; Wiencke, John K; Yang, Ping; Wrensch, Margaret R

    2010-10-01

    To determine whether inherited variations in immune function single-nucleotide polymorphisms (SNPs), genes or pathways affect glioblastoma risk, we analyzed data from recent genome-wide association studies in conjunction with predefined immune function genes and pathways. Gene and pathway analyses were conducted on two independent data sets using 6629 SNPs in 911 genes on 17 immune pathways from 525 glioblastoma cases and 602 controls from the University of California, San Francisco (UCSF) and a subset of 6029 SNPs in 893 genes from 531 cases and 1782 controls from MD Anderson (MDA). To further assess consistency of SNP-level associations, we also compared data from the UK (266 cases and 2482 controls) and the Mayo Clinic (114 cases and 111 controls). Although three correlated epidermal growth factor receptor (EGFR) SNPs were consistently associated with glioblastoma in all four data sets (Mantel-Haenzel P values = 1 × 10⁻⁵ to 4 × 10⁻³), independent replication is required as genome-wide significance was not attained. In gene-level analyses, eight immune function genes were significantly (minP < 0.05) associated with glioblastoma; the IL-2RA (CD25) cytokine gene had the smallest minP values in both UCSF (minP = 0.01) and MDA (minP = 0.001) data sets. The IL-2RA receptor is found on the surface of regulatory T cells potentially contributing to immunosuppression characteristic of the glioblastoma microenvironment. In pathway correlation analyses, cytokine signaling and adhesion-extravasation-migration pathways showed similar associations with glioblastoma risk in both MDA and UCSF data sets. Our findings represent the first systematic description of immune genes and pathways that characterize glioblastoma risk. PMID:20668009

  18. Genomic and gene variation in Mycoplasma hominis strains

    Christiansen, Gunna; Andersen, H; Birkelund, Svend;

    1987-01-01

    DNAs from 14 strains of Mycoplasma hominis isolated from various habitats, including strain PG21, were analyzed for genomic heterogeneity. DNA-DNA filter hybridization values were from 51 to 91%. Restriction endonuclease digestion patterns, analyzed by agarose gel electrophoresis, revealed no...... identity or cluster formation between strains. Variation within M. hominis rRNA genes was analyzed by Southern hybridization of EcoRI-cleaved DNA hybridized with a cloned fragment of the rRNA gene from the mycoplasma strain PG50. Five of the M. hominis strains showed identical hybridization patterns. These...... hybridization patterns were compared with those of 12 other mycoplasma species, which showed a much more complex band pattern. Cloned nonribosomal RNA gene fragments of M. hominis PG21 DNA were analyzed, and the fragments were used to demonstrate heterogeneity among the strains. A monoclonal antibody against...

  19. rendimiento académico

    Ernesto Barceló Martínez

    2006-01-01

    Full Text Available Esta investigación se propuso encontrar la posible relación entre el rendimiento académico y la ausencia de ciertas habilidades cognoscitivas denominadas desde la neuropsicología como funciones ejecutivas, en un grupo de estudiantes universitarios. Se exploró entonces el estado de las funciones ejecutivas en estudiantes universitarios que presentaban bajo y alto rendimiento académico. El diseño utilizado en esta investigación fue el transeccional descriptivo. El análisis de los resultados se hizo utilizando el paquete estadístico Statistical Package for Social Sciences (spss. Estos mostraron que, en general, no existen diferencias significativas entre los estudiantes de bajo y alto rendimiento académico. Es decir, mostraron que el rendimiento académico no está directamente relacionado con déficits a nivel de las habilidades ejecutivas, pero sí podría estarlo a nivel del lenguaje y de los antecedentes familiares, psicológicos y académicos en estos estudiantes.

  20. Theories of Population Variation in Genes and Genomes

    Christiansen, Freddy

    genetics, while emphasizing the close interplay between theory and empiricism. Traditional topics such as genetic and phenotypic variation, mutation, migration, and linkage are covered and advanced by contemporary coalescent theory, which describes the genealogy of genes in a population, ultimately...... connecting them to a single common ancestor. Effects of selection, particularly genomic effects, are discussed with reference to molecular genetic variation. The book is designed for students of population genetics, bioinformatics, evolutionary biology, molecular evolution, and theoretical biology—as well as...... biologists, molecular biologists, breeders, biomathematicians, and biostatisticians. •    Up-to-date treatment of key areas in classical and modern theoretical population genetics •    In-depth coverage of coalescent theory •    Timely discussion of genomic effects of selection •    Inspired by, and with...

  1. Genome Editing of Structural Variations: Modeling and Gene Correction.

    Park, Chul-Yong; Sung, Jin Jea; Kim, Dong-Wook

    2016-07-01

    The analysis of chromosomal structural variations (SVs), such as inversions and translocations, was made possible by the completion of the human genome project and the development of genome-wide sequencing technologies. SVs contribute to genetic diversity and evolution, although some SVs can cause diseases such as hemophilia A in humans. Genome engineering technology using programmable nucleases (e.g., ZFNs, TALENs, and CRISPR/Cas9) has been rapidly developed, enabling precise and efficient genome editing for SV research. Here, we review advances in modeling and gene correction of SVs, focusing on inversion, translocation, and nucleotide repeat expansion. PMID:27016031

  2. Nucleotide variation in the Toxoplasma gondii micronemal protein 8 gene.

    Li, Z Y; Song, H Q; Wang, C R; Zhu, X Q

    2016-01-01

    Toxoplasma gondii is a successful opportunistic protozoan distributed worldwide, which can infect all vertebrates, leading to serious infection, blindness, and abortion. Micronemal (MIC) proteins are critically important for T. gondii infection, as they participate in various stages of the Toxoplasma life cycle, including invasion and attachment to host cells. MIC8 secretion relies on the concentration of intracellular calcium, and can mediate the invasion of T. gondii by interacting with soluble MIC3. To investigate genetic diversity of the MIC8 gene, 16 T. gondii strains from different hosts and geographical locations, and two reference isolates (ToxoDB: TGME49_245490 and TGVEG_245490) were examined in this study. The results showed that all the examined MIC8 genes are 2055 bp, with an A+T content ranging from 50.2 to 50.6%. Conversely, lower levels of variation were detected within their nucleotide and amino acid sequences. Phylogenetic analyses indicated that three classical genotypes of T. gondii and the ToxoDB#9 genotype did not group exclusively via Bayesian inference, maximum parsimony, neighbor joining, and/or maximum likelihood assays based on the nucleotide and amino acid sequences of the MIC8 gene. In summary, the T. gondii MIC8 gene is not a suitable marker for population genetic studies of this parasite. PMID:27173337

  3. Sequence variations in the FAD2 gene in seeded pumpkins.

    Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P

    2015-01-01

    Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2. PMID:26782391

  4. Variations in CCL3L gene cluster sequence and non-specific gene copy numbers

    Edberg Jeffrey C

    2010-03-01

    Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.

  5. Expanding the boundaries of gene variation for crop improvement

    The increased attention on genomics and the use of model species have greatly expanded the ability to detect and create variation. At least 23 plant species either have their genome sequenced or will soon be sequenced. Utilization of the TILLING technology in wheat has allowed the identification of more variation at the waxy locus than had been detected in the previous 25 years. Site-specific mutagenesis via oligonucleotide mismatches or zinc finger nucleases directed toward specific genes allows changes in a directed manner. The use of RNAi allows expression changes leading to useful variation such as root-knot resistance in Arabidopsis, reduction in cotton seed gossypol, cytoplasmic male sterility in tomato and tobacco, and delayed senescence in wheat. We have produced oat plants with individual maize chromosomes by crossing oat x maize followed by embryo rescue. Oat-maize addition lines (OMAs) are now available for all 10 maize chromosomes in various oat genetic backgrounds. OMAs also have been produced with the maize chromosomes coming from different genetic backgrounds (Seneca 60, B73 and Mo17). Monosomic OMAs have been gamma-irradiated to produce Radiation Hybrid (RH) lines with either a diminutive form of the maize chromosome addition or a translocation of a piece of the maize chromosome with an oat chromosome. Approximately 650 RH lines have been produced and defined by 40 markers for that particular chromosome. The OMA and RH lines are useful for many genetic studies, such as mapping individual sequences (polymorphisms are not required), transposable elements, and members of gene families; chromosome isolation, chromosome pairing, centromere isolation, etc. Also of interest is the evaluation of the materials for the introgression of maize characteristics into oat, such as disease resistance and C4 photosynthesis. All of these technologies expand the boundaries for more directed genomic changes enhancing the options for crop improvement. (author)

  6. Variations in ORAI1 Gene Associated with Kawasaki Disease.

    Onouchi, Yoshihiro; Fukazawa, Ryuji; Yamamura, Kenichiro; Suzuki, Hiroyuki; Kakimoto, Nobuyuki; Suenaga, Tomohiro; Takeuchi, Takashi; Hamada, Hiromichi; Honda, Takafumi; Yasukawa, Kumi; Terai, Masaru; Ebata, Ryota; Higashi, Kouji; Saji, Tsutomu; Kemmotsu, Yasushi; Takatsuki, Shinichi; Ouchi, Kazunobu; Kishi, Fumio; Yoshikawa, Tetsushi; Nagai, Toshiro; Hamamoto, Kunihiro; Sato, Yoshitake; Honda, Akihito; Kobayashi, Hironobu; Sato, Junichi; Shibuta, Shoichi; Miyawaki, Masakazu; Oishi, Ko; Yamaga, Hironobu; Aoyagi, Noriyuki; Yoshiyama, Megumi; Miyashita, Ritsuko; Murata, Yuji; Fujino, Akihiro; Ozaki, Kouichi; Kawasaki, Tomisaku; Abe, Jun; Seki, Mitsuru; Kobayashi, Tohru; Arakawa, Hirokazu; Ogawa, Shunichi; Hara, Toshiro; Hata, Akira; Tanaka, Toshihiro

    2016-01-01

    Kawasaki disease (KD; MIM#61175) is a systemic vasculitis syndrome with unknown etiology which predominantly affects infants and children. Recent findings of susceptibility genes for KD suggest possible involvement of the Ca(2+)/NFAT pathway in the pathogenesis of KD. ORAI1 is a Ca(2+) release activated Ca(2+) (CRAC) channel mediating store-operated Ca(2+) entry (SOCE) on the plasma membrane. The gene for ORAI1 is located in chromosome 12q24 where a positive linkage signal was observed in our previous affected sib-pair study of KD. A common non-synonymous single nucleotide polymorphism located within exon 2 of ORAI1 (rs3741596) was significantly associated with KD (P = 0.028 in the discovery sample set (729 KD cases and 1,315 controls), P = 0.0056 in the replication sample set (1,813 KD cases vs. 1,097 controls) and P = 0.00041 in a meta-analysis by the Mantel-Haenszel method). Interestingly, frequency of the risk allele of rs3741596 is more than 20 times higher in Japanese compared to Europeans. We also found a rare 6 base-pair in-frame insertion variant associated with KD (rs141919534; 2,544 KD cases vs. 2,414 controls, P = 0.012). These data indicate that ORAI1 gene variations are associated with KD and may suggest the potential importance of the Ca(2+)/NFAT pathway in the pathogenesis of this disorder. PMID:26789410

  7. Haplotypes and Sequence Variation in the Ovine Adiponectin Gene (ADIPOQ

    Qing-Ming An

    2015-11-01

    Full Text Available The adiponectin gene (ADIPOQ plays an important role in energy homeostasis. In this study five separate regions (regions 1 to 5 of ovine ADIPOQ were analysed using PCR-SSCP. Four different PCR-SSCP patterns (A1-D1, A2-D2 were detected in region-1 and region-2, respectively, with seven and six SNPs being revealed. In region-3, three different patterns (A3-C3 and three SNPs were observed. Two patterns (A4-B4, A5-B5 and two and one SNPs were observed in region-4 and region-5, respectively. In total, nineteen SNPs were detected, with five of them in the coding region and two (c.46T/C and c.515G/A putatively resulting in amino acid changes (p.Tyr16His and p.Lys172Arg. In region-1, -2 and -3 of 316 sheep from eight New Zealand breeds, variants A1, A2 and A3 were the most common, although variant frequencies differed in the eight breeds. Across region-1 and region-3, nine haplotypes were identified and haplotypes A1-A3, A1-C3, B1-A3 and B1-C3 were most common. These results indicate that the ADIPOQ gene is polymorphic and suggest that further analysis is required to see if the variation in the gene is associated with animal production traits.

  8. Structure and sequence variation of mink interleukin-6 gene

    Aleutian disease (AD) is the number one disease threat to the survival and future of the mink industry in Nova Scotia and the world. Several ranchers have gone out of business in recent years in Nova Scotia as a direct result of AD. Currently, the control measure for AD consists of testing and slaughtering of infected mink. This practice has not been effective in controlling the disease. Finding a means of controlling AD is the number one priority for the mink industry in Nova Scotia. An effective control measure will have a long-term positive effect on the rural economy by improving production potential of mink and reducing production cost. It has been shown that antiviral antibodies produced by activated immune system cells sometimes combine with interleukin-6 (IL-6) to form immune complexes that cause AD in mink. There is evidence of a significant relationship between nucleotide variations in IL-6 gene and the onset of certain diseases in humans, which bears similar symptoms to AD. Furthermore, pathological symptoms of AD resemble those of other conditions, such as systemic lupus erythematosus (SLE) and Castleman Diseases in humans, where overproduction of IL-6 coincides with the severity of the disease. These findings suggest that IL-6 could be a candidate gene and warrant investigation vis-a-vis differences among mink genotypes in resistance or tolerance to ADV infection. The sequence of the IL-6 gene in mink was done and identification of polymorphisms was used to evaluate the potential role of this gene in the immune system response to infections. The 4678 bp promoter region, five exons and four introns of the interleukin-6 (IL-6) gene were bi-directionally sequenced in four unrelated mink from each of the wild, black, brown, pastel and sapphire mink (Genbank accession number (EF620932). The 344 bp promoter region of the gene contained several transcription binding sites. One exonic and seven intronic single nucleotide polymorphisms (SNP) were detected by

  9. Variations of the perforin gene in patients with multiple sclerosis.

    Cappellano, G; Orilieri, E; Comi, C; Chiocchetti, A; Bocca, S; Boggio, E; Bernardone, I S; Cometa, A; Clementi, R; Barizzone, N; D'Alfonso, S; Corrado, L; Galimberti, D; Scarpini, E; Guerini, F R; Caputo, D; Paolicelli, D; Trojano, M; Figà-Talamanca, L; Salvetti, M; Perla, F; Leone, M; Monaco, F; Dianzani, U

    2008-07-01

    Perforin is involved in cell-mediated cytotoxicity and mutations of its gene (PRF1) cause familial hemophagocytic lymphohistiocytosis (FLH2). PRF1 sequencing in 190 patients with multiple sclerosis and 268 controls detected two FLH2-associated variations (A91V, N252S) in both groups and six novel mutations (C999T, G1065A, G1428A, A1620G, G719A, C1069T) in patients. All together, carriers of these variations were more frequent in patients than in controls (phenotype frequency: 17 vs 9%, P=0.0166; odds ratio (OR)=2.06, 95% confidence interval (CI): 1.13-3.77). Although A91V was the most frequent variation and displayed a trend of association with multiple sclerosis (MS) in the first population of patients and controls (frequency of the 91V allele: 0.076 vs 0.043, P=0.044), we used it as a marker to confirm PRF1 involvement in MS and assessed its frequency in a second population of 966 patients and 1520 controls. Frequency of the 91V allele was significantly higher in patients than in controls also in the second population (0.075 vs 0.058%, P=0.019). In the combined cohorts of 1156 patients and 1788 controls, presence of the 91V allele in single or double dose conferred an OR=1.38 (95% CI=1.10-1.74). These data suggest that A91V and possibly other perforin variations indicate susceptibility to MS. PMID:18496551

  10. Human beta-defensin gene copy number variation and consequences in disease and evolution

    Pala, Raquel Rodrigues

    2012-01-01

    Research on human genetic variation has shown that the human genome is not a fixed, invariant framework, but that there can be extensive structural variation. This variation includes copy number variation (CNV), which can lead to changes in DNA dosage contributing significantly to variation between individual human genomes and heritable traits. Human beta-defensins are small, secreted antimicrobial peptides encoded by DEFB genes located in a cluster of at least seven genes on 8p23.1. These...

  11. Copy number variations in alternative splicing gene networks impact lifespan.

    Joseph T Glessner

    Full Text Available Longevity has a strong genetic component evidenced by family-based studies. Lipoprotein metabolism, FOXO proteins, and insulin/IGF-1 signaling pathways in model systems have shown polygenic variations predisposing to shorter lifespan. To test the hypothesis that rare variants could influence lifespan, we compared the rates of CNVs in healthy children (0-18 years of age with individuals 67 years or older. CNVs at a significantly higher frequency in the pediatric cohort were considered risk variants impacting lifespan, while those enriched in the geriatric cohort were considered longevity protective variants. We performed a whole-genome CNV analysis on 7,313 children and 2,701 adults of European ancestry genotyped with 302,108 SNP probes. Positive findings were evaluated in an independent cohort of 2,079 pediatric and 4,692 geriatric subjects. We detected 8 deletions and 10 duplications that were enriched in the pediatric group (P=3.33×10(-8-1.6×10(-2 unadjusted, while only one duplication was enriched in the geriatric cohort (P=6.3×10(-4. Population stratification correction resulted in 5 deletions and 3 duplications remaining significant (P=5.16×10(-5-4.26×10(-2 in the replication cohort. Three deletions and four duplications were significant combined (combined P=3.7×10(-4-3.9×10(-2. All associated loci were experimentally validated using qPCR. Evaluation of these genes for pathway enrichment demonstrated ~50% are involved in alternative splicing (P=0.0077 Benjamini and Hochberg corrected. We conclude that genetic variations disrupting RNA splicing could have long-term biological effects impacting lifespan.

  12. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2014-01-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is…

  13. Looking on the bright side of serotonin transporter gene variation.

    Homberg, Judith R; Lesch, Klaus-Peter

    2011-03-15

    Converging evidence indicates an association of the short (s), low-expressing variant of the repeat length polymorphism, serotonin transporter-linked polymorphic region (5-HTTLPR), in the human serotonin transporter gene (5-HTT, SERT, SLC6A4) with anxiety-related traits and increased risk for depression in interaction with psychosocial adversity across the life span. However, genetically driven deficient serotonin transporter (5-HTT) function would not have been maintained throughout evolution if it only exerted negative effects without conveying any gain of function. Here, we review recent findings that humans and nonhuman primates carrying the s variant of the 5-HTTLPR outperform subjects carrying the long allele in an array of cognitive tasks and show increased social conformity. In addition, studies in 5-HTT knockout rodents are included that provide complementary insights in the beneficial effects of the 5-HTTLPR s-allele. We postulate that hypervigilance, mediated by hyperactivity in corticolimbic structures, may be the common denominator in the anxiety-related traits and (social) cognitive superiority of s-allele carriers and that environmental conditions determine whether a response will turn out to be negative (emotional) or positive (cognitive, in conformity with the social group). Taken together, these findings urge for a conceptual change in the current deficit-oriented connotation of the 5-HTTLPR variants. In fact, these factors may counterbalance or completely offset the negative consequences of the anxiety-related traits. This notion may not only explain the modest effect size of the 5-HTTLPR and inconsistent reports but may also lead to a more refined appreciation of allelic variation in 5-HTT function. PMID:21047622

  14. Variations in COMT Gene Interact With Parenting to Influence Attention in Early Development1

    Voelker, Pascale; Sheese, Brad E.; Rothbart, Mary K.; Posner, Michael I.

    2009-01-01

    Attention influences many aspects of cognitive development. Variations in the COMT gene, known to affect dopamine neurotransmission, have frequently been found to influence attention in adults and older children. In this paper we examined 2 year old children and found that variation in the COMT gene influenced attention in a task involving looking to a sequence of visual stimuli. Because the influence of another dopamine related gene (DRD4) has been shown to interact with parenting quality at...

  15. The Relationship between Gene Network Structure and Expression Variation among Individuals and Species.

    Sears, Karen E; Maier, Jennifer A; Rivas-Astroza, Marcelo; Poe, Rachel; Zhong, Sheng; Kosog, Kari; Marcot, Jonathan D; Behringer, Richard R; Cretekos, Chris J; Rasweiler, John J; Rapti, Zoi

    2015-08-01

    Variation among individuals is a prerequisite of evolution by natural selection. As such, identifying the origins of variation is a fundamental goal of biology. We investigated the link between gene interactions and variation in gene expression among individuals and species using the mammalian limb as a model system. We first built interaction networks for key genes regulating early (outgrowth; E9.5-11) and late (expansion and elongation; E11-13) limb development in mouse. This resulted in an Early (ESN) and Late (LSN) Stage Network. Computational perturbations of these networks suggest that the ESN is more robust. We then quantified levels of the same key genes among mouse individuals and found that they vary less at earlier limb stages and that variation in gene expression is heritable. Finally, we quantified variation in gene expression levels among four mammals with divergent limbs (bat, opossum, mouse and pig) and found that levels vary less among species at earlier limb stages. We also found that variation in gene expression levels among individuals and species are correlated for earlier and later limb development. In conclusion, results are consistent with the robustness of the ESN buffering among-individual variation in gene expression levels early in mammalian limb development, and constraining the evolution of early limb development among mammalian species. PMID:26317994

  16. Variation in the Trichothecene Mycotoxin Biosynthetic Gene Cluster in Fusarium

    Trichothecene mycotoxins are produced by some plant pathogenic species of the fungus Fusarium and can contribute to its virulence on some plants. In Fusarium graminearum and F. sporotrichioides trichothecene biosynthetic enzymes are encoded at three loci: the single-gene TRI101 locus; the two-gene ...

  17. Toward the discovery of itemsets with significant variations in gene expression matrices

    Kaytoue-Uberall, Mehdi; Duplessis, Sébastien; Napoli, Amedeo

    2008-01-01

    This paper presents new syntactic constraints for itemset mining in gene expression matrices. Biologists are interested in identifying gene expression profiles which present similar quantitative variation features. A two dimensional gene expression profile representation is introduced and adapted to itemset mining allowing to control gene expression. Syntactic constraints introduce expert knowledge at the beginning of the Knowledge Discovery in Databases process and are used to discover items...

  18. Genetic variation in a member of the laminin gene family affects variation in body composition in Drosophila and humans

    Hunter Gary R

    2008-08-01

    Full Text Available Abstract Background The objective of the present study was to map candidate loci influencing naturally occurring variation in triacylglycerol (TAG storage using quantitative complementation procedures in Drosophila melanogaster. Based on our results from Drosophila, we performed a human population-based association study to investigate the effect of natural variation in LAMA5 gene on body composition in humans. Results We identified four candidate genes that contributed to differences in TAG storage between two strains of D. melanogaster, including Laminin A (LanA, which is a member of the α subfamily of laminin chains. We confirmed the effects of this gene using a viable LanA mutant and showed that female flies homozygous for the mutation had significantly lower TAG storage, body weight, and total protein content than control flies. Drosophila LanA is closely related to human LAMA5 gene, which maps to the well-replicated obesity-linkage region on chromosome 20q13.2-q13.3. We tested for association between three common single nucleotide polymorphisms (SNPs in the human LAMA5 gene and variation in body composition and lipid profile traits in a cohort of unrelated women of European American (EA and African American (AA descent. In both ethnic groups, we found that SNP rs659822 was associated with weight (EA: P = 0.008; AA: P = 0.05 and lean mass (EA: P= 0.003; AA: P = 0.03. We also found this SNP to be associated with height (P = 0.01, total fat mass (P = 0.01, and HDL-cholesterol (P = 0.003 but only in EA women. Finally, significant associations of SNP rs944895 with serum TAG levels (P = 0.02 and HDL-cholesterol (P = 0.03 were observed in AA women. Conclusion Our results suggest an evolutionarily conserved role of a member of the laminin gene family in contributing to variation in weight and body composition.

  19. Transcriptome analysis reveals novel patterning and pigmentation genes underlying Heliconius butterfly wing pattern variation

    Hines Heather M

    2012-06-01

    Full Text Available Abstract Background Heliconius butterfly wing pattern diversity offers a unique opportunity to investigate how natural genetic variation can drive the evolution of complex adaptive phenotypes. Positional cloning and candidate gene studies have identified a handful of regulatory and pigmentation genes implicated in Heliconius wing pattern variation, but little is known about the greater developmental networks within which these genes interact to pattern a wing. Here we took a large-scale transcriptomic approach to identify the network of genes involved in Heliconius wing pattern development and variation. This included applying over 140 transcriptome microarrays to assay gene expression in dissected wing pattern elements across a range of developmental stages and wing pattern morphs of Heliconius erato. Results We identified a number of putative early prepattern genes with color-pattern related expression domains. We also identified 51 genes differentially expressed in association with natural color pattern variation. Of these, the previously identified color pattern “switch gene” optix was recovered as the first transcript to show color-specific differential expression. Most differentially expressed genes were transcribed late in pupal development and have roles in cuticle formation or pigment synthesis. These include previously undescribed transporter genes associated with ommochrome pigmentation. Furthermore, we observed upregulation of melanin-repressing genes such as ebony and Dat1 in non-melanic patterns. Conclusions This study identifies many new genes implicated in butterfly wing pattern development and provides a glimpse into the number and types of genes affected by variation in genes that drive color pattern evolution.

  20. Variation of Dominance of Newly Arisen Adaptive Genes

    Bourguet, D; Lenormand, T; Guillemaud, T; Marcel, V.; Fournier, D.; M. Raymond

    1997-01-01

    Newly arisen adaptive alleles such as insecticide resistance genes represent a good opportunity to investigate the theories put forth to explain the molecular basis of dominance and its possible evolution. Dominance levels of insecticide resistance conferred by insensitive alleles of the acetylcholinesterase gene were analyzed in five resistant strains of the mosquito Culex pipiens. Dominance levels were found to differ between strains, varying from partial recessivity to complete dominance. ...

  1. Theoretical studies of gene substitution, geographic variation, and speciation

    Felsenstein, J.

    1977-07-31

    Brief comments are given on the results of a research program dealing with population genetics of evolutionary processes. The various subjects studied included genetic variation in clines; speciation and disruptive selection; parapatric speciation in clines; macroevolutionary laws in a model ecosystem; migration matrices; lethal allelism; estimation of number of loci in quantitative inheritance; numerical taxonomy methods; and new mutants in Lesch-Nyhan disease.

  2. Intra- and interspecific variation in primate gene expression patterns.

    Enard, Wolfgang; Khaitovich, Philipp; Klose, Joachim; Zöllner, Sebastian; Heissig, Florian; Giavalisco, Patrick; Nieselt-Struwe, Kay; Muchmore, Elaine; Varki, Ajit; Ravid, Rivka; Doxiadis, Gaby M; Bontrop, Ronald E; Pääbo, Svante

    2002-04-12

    Although humans and their closest evolutionary relatives, the chimpanzees, are 98.7% identical in their genomic DNA sequences, they differ in many morphological, behavioral, and cognitive aspects. The underlying genetic basis of many of these differences may be altered gene expression. We have compared the transcriptome in blood leukocytes, liver, and brain of humans, chimpanzees, orangutans, and macaques using microarrays, as well as protein expression patterns of humans and chimpanzees using two-dimensional gel electrophoresis. We also studied three mouse species that are approximately as related to each other as are humans, chimpanzees, and orangutans. We identified species-specific gene expression patterns indicating that changes in protein and gene expression have been particularly pronounced in the human brain. PMID:11951044

  3. Copy number variation analysis identifies novel CAKUT candidate genes in children with a solitary functioning kidney

    Westland, R.; Verbitsky, M.; Vukojevic, K.; Perry, B.J.; Fasel, D.A.; Zwijnenburg, P.J.; Bokenkamp, A.; Gille, J.J.P.; Saraga-Babic, M.; Ghiggeri, G.M.; D'Agati, V.D.; Schreuder, M.F.; Gharavi, A.G.; Wijk, J.A. van; Sanna-Cherchi, S.

    2015-01-01

    Copy number variations associate with different developmental phenotypes and represent a major cause of congenital anomalies of the kidney and urinary tract (CAKUT). Because rare pathogenic copy number variations are often large and contain multiple genes, identification of the underlying genetic dr

  4. Natural variation of rice blast resistance gene Pi-d2

    Studying natural variation of rice resistance (R) genes in cultivated and wild rice relatives can predict resistance stability to rice blast fungus. In the present study, the protein coding regions of rice R gene Pi-d2 in 35 rice accessions of subgroups, aus (AUS), indica (IND), temperate japonica (...

  5. Genetic Variation at the N-acetyltransferase (NAT) Genes in Global Populations

    Functional variability at the N-acetyltransferase (NAT) genes is associated with adverse drug reactions and cancer susceptibility in humans. Previous studies of small sets of ethnic groups have indicated that the NAT genes have high levels of amino acid variation that differ in f...

  6. Genetic variation in mitotic regulatory pathway genes is associated with breast tumor grade

    Purrington, Kristen S; Slettedahl, Seth; Bolla, Manjeet K;

    2014-01-01

    Mitotic index is an important component of histologic grade and has an etiologic role in breast tumorigenesis. Several small candidate gene studies have reported associations between variation in mitotic genes and breast cancer risk. We measured associations between 2156 single nucleotide polymor...

  7. Analysis of human genetic variation in candidate genes under positive selections on the human linage

    Moreno Estrada, Andr??s

    2009-01-01

    Natural selection has played an important role in shaping human genetic variation, thus, finding variants that have been targeted by positive selection can provide insights about which genes influence human phenotypic variability. In this work we conduct a genome-wide survey of protein-coding genes comparing humans, chimpanzees, and closely related species in order to detect the fraction of genes undergoing positive selection on the human lineage, and further investigate intraspecific variati...

  8. Indexing Effects of Copy Number Variation on Genes Involved in Developmental Delay

    Mohammed Uddin; Giovanna Pellecchia; Bhooma Thiruvahindrapuram; Lia D’Abate; Daniele Merico; Ada Chan; Mehdi Zarrei; Kristiina Tammimies; Susan Walker; Gazzellone, Matthew J.; Thomas Nalpathamkalam; Yuen, Ryan K.C.; Koenraad Devriendt; Géraldine Mathonnet; Emmanuelle Lemyre

    2016-01-01

    A challenge in clinical genomics is to predict whether copy number variation (CNV) affecting a gene or multiple genes will manifest as disease. Increasing recognition of gene dosage effects in neurodevelopmental disorders prompted us to develop a computational approach based on critical-exon (highly expressed in brain, highly conserved) examination for potential etiologic effects. Using a large CNV dataset, our updated analyses revealed significant (P 

  9. Serotonergic gene variation in substance use pharmacotherapy: a systematic review.

    Bauer, Isabelle E; Graham, David P; Soares, Jair C; Nielsen, David A

    2015-01-01

    Drug addiction is a serious disease with damaging effects on the brain and physical health. Despite the increase in the number of affected individuals, there are few effective pharmacological treatment options for substance use disorders. The study of the influence of an individual's genetic features on the treatment response may help to identify more efficacious treatment options. This systematic review focuses on the serotonergic system because of its relevant role in mood and impulse control disorders, and its contribution to the development and maintenance of drug use disorders. In particular, we examine the role of serotonergic genes in the response to pharmacotherapy for alcohol, cocaine and nicotine addiction. Current evidence suggests that genetic variability of the serotonergic biosynthesis enzyme tryptophan hydroxylase 2 (TPH2) and the serotonin transporter (SLC6A4) genes mediates the efficacy of several addiction treatments, such as ondansetron and disulfiram, and the antidepressants bupropion, nortriptyline and sertraline. PMID:26265436

  10. nef gene sequence variation among HIV-1-infected African children

    Chakraborty, R.; Reiniš, Milan; Rostron, T.; Philpott, S.; Dong, T.; D'Agostino, A.; Musoke, R.; de Silva, E.; Stumpf, M.; Weiser, B.; Burger, H.; Rowland-Jones, S.L.

    2006-01-01

    Roč. 7, č. 2 (2006), s. 75-84. ISSN 1464-2662 Grant ostatní: Fogarty International Center, NIH(US) 3D43TW00915; NIH(US) RO1 AI 42555 Institutional research plan: CEZ:AV0Z50520514 Keywords : HIV-1 nef gene * non-clade B * Kenya Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.674, year: 2006

  11. Rare structural variation of synapse and neurotransmission genes in autism

    Gai, X; Xie, H M; Perin, J C; Takahashi, N; Murphy, K.; Wenocur, A S; D'arcy, M; O'Hara, R J; Goldmuntz, E; Grice, D. E.; Shaikh, T H; Hakonarson, H.; Buxbaum, J D; Elia, J.; White, P S

    2011-01-01

    Autism spectrum disorders (ASDs) comprise a constellation of highly heritable neuropsychiatric disorders. Genome-wide studies of autistic individuals have implicated numerous minor risk alleles but few common variants, suggesting a complex genetic model with many contributing loci. To assess commonality of biological function among rare risk alleles, we compared functional knowledge of genes overlapping inherited structural variants in idiopathic ASD subjects relative to healthy controls. In ...

  12. Intraspecific DNA variation in nuclear genes of the mosquito Aedes aegypti.

    Morlais, I; Severson, D W

    2003-12-01

    Single nucleotide polymorphisms (SNPs) are an abundant source of genetic variation among individual organisms. To assess the usefulness of SNPs for genome analysis in the yellow fever mosquito, Aedes aegypti, we sequenced 25 nuclear genes in each of three strains and analysed nucleotide diversity. The average frequency of nucleotide variation was 12 SNPs per kilobase, indicating that nucleotide variation in Ae. aegypti is similar to that in other organisms, including Drosophila and the malaria vector Anopheles gambiae. Transition polymorphisms outnumbered transversion polymorphisms, at a ratio of about 2:1. We examined codon usage and confirmed that mutational bias favours G and C ending codons. Codon bias was most pronounced in highly expressed genes. Nucleotide diversity estimates indicated that substitution rates are positively correlated in coding and non-coding regions. Nucleotide diversity varied from one gene to another. The unequal distribution of SNPs among Ae. aegypti nuclear genes suggests that single base variations are non-neutral and are subject to selective constraints. Our analysis showed that ubiquitously expressed genes have lower polymorphism rates and are likely under strong purifying selection, whereas tissue specific genes and genes with a putative role in parasite defence exhibit higher levels of polymorphism that may be associated with diversifying selection. PMID:14986924

  13. Dramatic Number Variation of R Genes in Solanaceae Species Accounted for by a Few R Gene Subfamilies

    Wei, Chunhua; Chen, Jiongjiong; Kuang, Hanhui

    2016-01-01

    Most disease resistance genes encode nucleotide-binding-site (NBS) and leucine-rich-repeat (LRR) domains, and the NBS-LRR encoding genes are often referred to as R genes. Using newly developed approach, 478, 485, 1,194, 1,665, 2,042 and 374 R genes were identified from the genomes of tomato Heinz1706, wild tomato LA716, potato DM1-3, pepper Zunla-1 and wild pepper Chiltepin and tobacco TN90, respectively. The majority of R genes from Solanaceae were grouped into 87 subfamilies, including 16 TIR-NBS-LRR (TNL) and 71 non-TNL subfamilies. Each subfamily was annotated manually, including identification of intron/exon structure and intron phase. Interestingly, TNL subfamilies have similar intron phase patterns, while the non-TNL subfamilies have diverse intron phase due to frequent gain of introns. Prevalent presence/absence polymorphic R gene loci were found among Solanaceae species, and an integrated map with 427 R loci was constructed. The pepper genome (2,042 in Chiltepin) has at least four times of R genes as in tomato (478 in Heinz1706). The high number of R genes in pepper genome is due to the amplification of R genes in a few subfamilies, such as the Rpi-blb2 and BS2 subfamilies. The mechanism underlying the variation of R gene number among different plant genomes is discussed. PMID:26849045

  14. Diel variation in gene expression of the CO2-concentrating mechanism during a harmful cyanobacterial bloom

    Giovanni eSandrini

    2016-04-01

    Full Text Available Dense phytoplankton blooms in eutrophic waters often experience large daily fluctuations in environmental conditions. We investigated how this diel variation affects in situ gene expression of the CO2-concentrating mechanism (CCM and other selected genes of the harmful cyanobacterium Microcystis aeruginosa. Photosynthetic activity of the cyanobacterial bloom depleted the dissolved CO2 concentration, raised pH to 10, and caused large diel fluctuations in the bicarbonate and O2 concentration. The Microcystis population consisted of three Ci uptake genotypes that differed in the presence of the low-affinity and high-affinity bicarbonate uptake genes bicA and sbtA. Expression of the bicarbonate uptake genes bicA, sbtA and cmpA (encoding a subunit of the high-affinity bicarbonate uptake system BCT1, the CCM transcriptional regulator gene ccmR and the photoprotection gene flv4 increased at first daylight and was negatively correlated with the bicarbonate concentration. In contrast, genes of the two CO2 uptake systems were constitutively expressed, whereas expression of the RuBisCO chaperone gene rbcX, the carboxysome gene ccmM, and the photoprotection gene isiA was highest at night and down-regulated during daytime. In total, our results show that the harmful cyanobacterium Microcystis is very responsive to the large diel variations in carbon and light availability often encountered in dense cyanobacterial blooms.

  15. Natural Genetic Variation and Candidate Genes for Morphological Traits in Drosophila melanogaster.

    Carreira, Valeria Paula; Mensch, Julián; Hasson, Esteban; Fanara, Juan José

    2016-01-01

    Body size is a complex character associated to several fitness related traits that vary within and between species as a consequence of environmental and genetic factors. Latitudinal and altitudinal clines for different morphological traits have been described in several species of Drosophila and previous work identified genomic regions associated with such variation in D. melanogaster. However, the genetic factors that orchestrate morphological variation have been barely studied. Here, our main objective was to investigate genetic variation for different morphological traits associated to the second chromosome in natural populations of D. melanogaster along latitudinal and altitudinal gradients in Argentina. Our results revealed weak clinal signals and a strong population effect on morphological variation. Moreover, most pairwise comparisons between populations were significant. Our study also showed important within-population genetic variation, which must be associated to the second chromosome, as the lines are otherwise genetically identical. Next, we examined the contribution of different candidate genes to natural variation for these traits. We performed quantitative complementation tests using a battery of lines bearing mutated alleles at candidate genes located in the second chromosome and six second chromosome substitution lines derived from natural populations which exhibited divergent phenotypes. Results of complementation tests revealed that natural variation at all candidate genes studied, invected, Fasciclin 3, toucan, Reticulon-like1, jing and CG14478, affects the studied characters, suggesting that they are Quantitative Trait Genes for morphological traits. Finally, the phenotypic patterns observed suggest that different alleles of each gene might contribute to natural variation for morphological traits. However, non-additive effects cannot be ruled out, as wild-derived strains differ at myriads of second chromosome loci that may interact

  16. Biovar diversity is reflected by variations of genes encoding urease of Ureaplasma urealyticum.

    Ruifu, Y; Minli, Z; Guo, Z; Wang, X

    1997-01-01

    Five oligonucleotide primers derived from the gene encoding urease of Ureaplasma urealyticum were designed to evaluate the relationship between the urease gene and biovar diversity of this organism. Five combinations of these primers were tested by PCR and the result revealed that there were variations in urease genes among different serovars of U. urealyticum. This result, in agreement with other PCRs based on other functionally unrelated (rRNA and MB antigen) genes, may reflect the phylogenetic relationship among organisms taxonomically classified as U. urealyticum. PMID:9310943

  17. Inter- and intraspecific variation in Drosophila genes with sex-biased expression.

    Müller, Lena; Grath, Sonja; von Heckel, Korbinian; Parsch, John

    2012-01-01

    Genes with sexually dimorphic expression (sex-biased genes) often evolve rapidly and are thought to make an important contribution to reproductive isolation between species. We examined the molecular evolution of sex-biased genes in Drosophila melanogaster and D. ananassae, which represent two independent lineages within the melanogaster group. We find that strong purifying selection limits protein sequence variation within species, but that a considerable fraction of divergence between species can be attributed to positive selection. In D. melanogaster, the proportion of adaptive substitutions between species is greatest for male-biased genes and is especially high for those on the X chromosome. In contrast, male-biased genes do not show unusually high variation within or between populations. A similar pattern is seen at the level of gene expression, where sex-biased genes show high expression divergence between species, but low divergence between populations. In D. ananassae, there is no increased rate of adaptation of male-biased genes, suggesting that the type or strength of selection acting on sex-biased genes differs between lineages. PMID:22315698

  18. Variation of vlhA gene in Mycoplasma synoviae clones isolated from chickens.

    Slavec, Brigita; Berčič, Rebeka Lucijana; Cizelj, Ivanka; Narat, Mojca; Zorman-Rojs, Olga; Dovč, Peter; Benčina, Dušan

    2011-10-01

    Mycoplasma synoviae synthesizes haemagglutinin VlhA, which cleaves into the N-terminal part, a lipoprotein MSPB, and a C-terminal part MSPA. Previous studies have shown that the 3'-end of the expressed vlhA gene can recombine with vlhA pseudogenes in a process called gene conversion, but there have been no data about diversification of the expressed vlhA gene in M. synoviae populations replicating in chickens. Following intratracheal inoculation with the M. synoviae strain ULB 02/T6, which showed only minor vlhA gene variation prior to inoculation, we investigated temporal changes in MSPB epitopes defined by monoclonal antibodies (mAbs) 3B4 and 50, as well as diversification of the vlhA gene sequence in M. synoviae populations recovered from chicken tracheas. In cultures isolated 8 and 18 days post inoculation (p.i.), most colonies showed variation of MSPB epitopes for mAbs 3B4 and 50. They also changed 3'-end vlhA gene sequences. Further diversity of the vlhA gene occurred in cultures isolated 8 weeks and 5 months p.i. The vlhA gene sequences from isolated cultures shared only 65 to 80% sequence identity with vlhA gene of the inoculated ULB 02/T6 culture. Notably, in most of those cultures their vlhA gene sequences contained stop codons potentially causing premature terminations of translation. Interestingly, in one culture isolated 8 weeks p.i. (clone T6-8W/IT2A) the 3'-vlhA gene sequence was identical in the last 1140 bases to that of the first vlhA pseudogene positioned the most far (upstream) of the expressed vlhA gene. This is the first demonstration of temporal diversity of the vlhA gene in M. synoviae populations isolated from chicken tracheas. PMID:21830862

  19. Extensive Copy-Number Variation of the Human Olfactory Receptor Gene Family

    Janet M Young; Endicott, RaeLynn M.; Parghi, Sean S; Walker, Megan; Kidd, Jeffrey M.; Trask, Barbara J.

    2008-01-01

    As much as a quarter of the human genome has been reported to vary in copy number between individuals, including regions containing about half of the members of the olfactory receptor (OR) gene family. We have undertaken a detailed study of copy-number variation of ORs to elucidate the selective and mechanistic forces acting on this gene family and the true impact of copy-number variation on human OR repertoires. We argue that the properties of copy-number variants (CNVs) and other sets of la...

  20. Positive Association of Vitamin D Receptor Gene Variations with Multiple Sclerosis in South East Iranian Population

    Mehrnaz Narooie-Nejad; Maryam Moossavi; Adam Torkamanzehi; Ali Moghtaderi

    2015-01-01

    Among the factors postulated to play a role in MS susceptibility, the role of vitamin D is outstanding. Since the function of vitamin D receptor (VDR) represents the effect of vitamin D on the body and genetic variations in VDR gene may affect its function, we aim to highlight the association of two VDR gene polymorphisms with MS susceptibility. In current study, we recruited 113 MS patients and 122 healthy controls. TaqI (rs731236) and ApaI (rs7975232) genetic variations in these two groups ...

  1. Variation in genes involved in epigenetic processes offers insights into tropically adapted cattle diversity.

    Porto-Neto, Laercio R; Fortes, Marina R S; McWilliam, Sean M; Lehnert, Sigrid A; Reverter, Antonio

    2014-01-01

    We evaluated the relevance of the BovineHD Illumina SNP chip with respect to genes involved in epigenetic processes. Genotypes for 729,068 SNP on two tropical cattle breeds of Australia were used: Brahman (n = 2112) and Tropical Composite (n = 2550). We used data mining approaches to compile a list of bovine protein-coding genes involved in epigenetic processes. These genes represent 9 functional categories that contain between one (histone demethylases) and 99 (chromatin remodeling factors) genes. A total of 3091 SNP mapped to positions within 3000 bp of the 193 coding regions of those genes, including 113 SNP in transcribed regions, 2738 in intronic regions and 240 in up- or down-stream regions. For all these SNP categories, we observed differences in the allelic frequencies between Brahman and Tropical Composite cattle. These differences were larger than those observed for the entire set of 729,068 SNP (P = 1.79 x 10(-5)). A multidimensional scaling analysis using only the 113 SNP in transcribed regions allowed for the separation of the two populations and this separation was comparable to the one obtained with a random set of 113 SNP (Principal Component 1 r (2) > 0.84). To further characterize the differences between the breeds we defined a gene-differentiation metric based on the average genotypic frequencies of SNP connected to each gene and compared both cattle populations. The 10% most differentiated genes were distributed across 10 chromosomes, with significant (P < 0.05) enrichment on BTA 3 and 10. The 10% most conserved genes were located in 12 chromosomes. We conclude that there is variation between cattle populations in genes connected to epigenetic processes, and this variation can be used to differentiate cattle breeds. More research is needed to fully characterize the use of these SNP and its potential as means to further our understanding of biological variation and epigenetic processes. PMID:24795751

  2. Variation in genes involved in epigenetic processes offers insights into tropically adapted cattle diversity

    Laercio R Porto-Neto

    2014-04-01

    Full Text Available We evaluated the relevance of the BovineHD Illumina SNP chip with respect to genes involved in epigenetic processes. Genotypes for 729,068 SNP on two tropical cattle breeds of Australia were used: Brahman (n = 2,112 and Tropical Composite (n = 2,550. We used data mining approaches to compile a list of bovine protein-coding genes involved in epigenetic processes. These genes represent 9 functional categories that contain between one (histone demethylases and 99 (chromatin remodelling factors genes. A total of 3,091 SNP mapped to positions within 3,000 bp of the 193 coding regions of those genes, including 113 SNP in transcribed regions, 2,738 in intronic regions and 240 in up- or down-stream regions. For all these SNP categories, we observed differences in the allelic frequencies between Brahman and Tropical Composite cattle. These differences were larger than those observed for the entire set of 729,068 SNP (P = 1.79 x 10-5. A multidimensional scaling analysis using only the 113 SNP in transcribed regions allowed for the separation of the two populations and this separation was comparable to the one obtained with a random set of 113 SNP (Principal Component 1 r2 > 0.84. To further characterise the differences between the breeds we defined a gene-differentiation metric based on the average genotypic frequencies of SNP connected to each gene and compared both cattle populations. The 10% most differentiated genes were distributed across 10 chromosomes, with significant (P < 0.05 enrichment on BTA 3 and 10. The 10% most conserved genes were located in 12 chromosomes. We conclude that there is variation between cattle populations in genes connected to epigenetic processes, and this variation can be used to differentiate cattle breeds. More research is needed to fully characterise the use of these SNP and its potential as means to further our understanding of biological variation and epigenetic processes.

  3. Candidate gene study to investigate the genetic determinants of normal variation in central corneal thickness

    Dimasi, David P.; Kathryn P Burdon; Hewitt, Alex W; Savarirayan, Ravi; Healey, Paul R.; Mitchell, Paul; Mackey, David A.; Craig, Jamie E

    2010-01-01

    Purpose The genetic component underlying variation in central corneal thickness (CCT) in the normal population remains largely unknown. As CCT is an identified risk factor for open-angle glaucoma, understanding the genes involved in CCT determination could improve our understanding of the mechanisms involved in this association. Methods To identify novel CCT genes, we selected eight different candidates based on a range of criteria. These included; aquaporin 1 (AQ1), aquaporin 5 (AQ5), decori...

  4. Genetic variation in the immunosuppression pathway genes and breast cancer susceptibility

    Lei, Jieping; Rudolph, Anja; Moysich, Kirsten B;

    2016-01-01

    Immunosuppression plays a pivotal role in assisting tumors to evade immune destruction and promoting tumor development. We hypothesized that genetic variation in the immunosuppression pathway genes may be implicated in breast cancer tumorigenesis. We included 42,510 female breast cancer cases and.......5 × 10(-4) and 0.63, respectively). Our data provide evidence that the immunosuppression pathway genes STAT3, IL5, and GM-CSF may be novel susceptibility loci for breast cancer in women of European ancestry....

  5. Estimating variation within the genes and inferring the phylogeny of 186 sequenced diverse Escherichia coli genomes

    Kaas Rolf S

    2012-10-01

    Full Text Available Abstract Background Escherichia coli exists in commensal and pathogenic forms. By measuring the variation of individual genes across more than a hundred sequenced genomes, gene variation can be studied in detail, including the number of mutations found for any given gene. This knowledge will be useful for creating better phylogenies, for determination of molecular clocks and for improved typing techniques. Results We find 3,051 gene clusters/families present in at least 95% of the genomes and 1,702 gene clusters present in 100% of the genomes. The former 'soft core' of about 3,000 gene families is perhaps more biologically relevant, especially considering that many of these genome sequences are draft quality. The E. coli pan-genome for this set of isolates contains 16,373 gene clusters. A core-gene tree, based on alignment and a pan-genome tree based on gene presence/absence, maps the relatedness of the 186 sequenced E. coli genomes. The core-gene tree displays high confidence and divides the E. coli strains into the observed MLST type clades and also separates defined phylotypes. Conclusion The results of comparing a large and diverse E. coli dataset support the theory that reliable and good resolution phylogenies can be inferred from the core-genome. The results further suggest that the resolution at the isolate level may, subsequently be improved by targeting more variable genes. The use of whole genome sequencing will make it possible to eliminate, or at least reduce, the need for several typing steps used in traditional epidemiology.

  6. Interindividual variation in gene expression responses and metabolite formation in acetaminophen-exposed primary human hepatocytes.

    Jetten, Marlon J A; Ruiz-Aracama, Ainhoa; Coonen, Maarten L J; Claessen, Sandra M; van Herwijnen, Marcel H M; Lommen, Arjen; van Delft, Joost H M; Peijnenburg, Ad A C M; Kleinjans, Jos C S

    2016-05-01

    Acetaminophen (APAP) is a readily available over-the-counter drug and is one of the most commonly used analgesics/antipyretics worldwide. Large interindividual variation in susceptibility toward APAP-induced liver failure has been reported. However, the exact underlying factors causing this variability in susceptibility are still largely unknown. The aim of this study was to better understand this variability in response to APAP by evaluating interindividual differences in gene expression changes and APAP metabolite formation in primary human hepatocytes (PHH) from several donors (n = 5) exposed in vitro to a non-toxic to toxic APAP dose range. To evaluate interindividual variation, gene expression data/levels of metabolites were plotted against APAP dose/donor. The correlation in APAP dose response between donors was calculated by comparing data points from one donor to the data points of all other donors using a Pearson-based correlation analysis. From that, a correlation score/donor for each gene/metabolite was defined, representing the similarity of the omics response to APAP in PHH of a particular donor to all other donors. The top 1 % highest variable genes were selected for further evaluation using gene set overrepresentation analysis. The biological processes in which the genes with high interindividual variation in expression were involved include liver regeneration, inflammatory responses, mitochondrial stress responses, hepatocarcinogenesis, cell cycle, and drug efficacy. Additionally, the interindividual variation in the expression of these genes could be associated with the variability in expression levels of hydroxyl/methoxy-APAP and C8H13O5N-APAP-glucuronide. The before-mentioned metabolites or their derivatives have also been reported in blood of humans exposed to therapeutic APAP doses. Possibly these findings can contribute to elucidating the causative factors of interindividual susceptibility toward APAP. PMID:26104854

  7. Heritable genome-wide variation of gene expression and promoter methylation between wild and domesticated chickens

    Nätt Daniel

    2012-02-01

    Full Text Available Abstract Background Variations in gene expression, mediated by epigenetic mechanisms, may cause broad phenotypic effects in animals. However, it has been debated to what extent expression variation and epigenetic modifications, such as patterns of DNA methylation, are transferred across generations, and therefore it is uncertain what role epigenetic variation may play in adaptation. Results In Red Junglefowl, ancestor of domestic chickens, gene expression and methylation profiles in thalamus/hypothalamus differed substantially from that of a domesticated egg laying breed. Expression as well as methylation differences were largely maintained in the offspring, demonstrating reliable inheritance of epigenetic variation. Some of the inherited methylation differences were tissue-specific, and the differential methylation at specific loci were little changed after eight generations of intercrossing between Red Junglefowl and domesticated laying hens. There was an over-representation of differentially expressed and methylated genes in selective sweep regions associated with chicken domestication. Conclusions Our results show that epigenetic variation is inherited in chickens, and we suggest that selection of favourable epigenomes, either by selection of genotypes affecting epigenetic states, or by selection of methylation states which are inherited independently of sequence differences, may have been an important aspect of chicken domestication.

  8. Geographic Variation in Advertisement Calls in a Tree Frog Species: Gene Flow and Selection Hypotheses

    Jang, Yikweon; Hahm, Eun Hye; Lee, Hyun-Jung; Park, Soyeon; Won, Yong-Jin; Choe, Jae C.

    2011-01-01

    Background In a species with a large distribution relative to its dispersal capacity, geographic variation in traits may be explained by gene flow, selection, or the combined effects of both. Studies of genetic diversity using neutral molecular markers show that patterns of isolation by distance (IBD) or barrier effect may be evident for geographic variation at the molecular level in amphibian species. However, selective factors such as habitat, predator, or interspecific interactions may be critical for geographic variation in sexual traits. We studied geographic variation in advertisement calls in the tree frog Hyla japonica to understand patterns of variation in these traits across Korea and provide clues about the underlying forces for variation. Methodology We recorded calls of H. japonica in three breeding seasons from 17 localities including localities in remote Jeju Island. Call characters analyzed were note repetition rate (NRR), note duration (ND), and dominant frequency (DF), along with snout-to-vent length. Results The findings of a barrier effect on DF and a longitudinal variation in NRR seemed to suggest that an open sea between the mainland and Jeju Island and mountain ranges dominated by the north-south Taebaek Mountains were related to geographic variation in call characters. Furthermore, there was a pattern of IBD in mitochondrial DNA sequences. However, no comparable pattern of IBD was found between geographic distance and call characters. We also failed to detect any effects of habitat or interspecific interaction on call characters. Conclusions Geographic variations in call characters as well as mitochondrial DNA sequences were largely stratified by geographic factors such as distance and barriers in Korean populations of H. japoinca. Although we did not detect effects of habitat or interspecific interaction, some other selective factors such as sexual selection might still be operating on call characters in conjunction with restricted gene

  9. Geographic variation in advertisement calls in a tree frog species: gene flow and selection hypotheses.

    Yikweon Jang

    Full Text Available BACKGROUND: In a species with a large distribution relative to its dispersal capacity, geographic variation in traits may be explained by gene flow, selection, or the combined effects of both. Studies of genetic diversity using neutral molecular markers show that patterns of isolation by distance (IBD or barrier effect may be evident for geographic variation at the molecular level in amphibian species. However, selective factors such as habitat, predator, or interspecific interactions may be critical for geographic variation in sexual traits. We studied geographic variation in advertisement calls in the tree frog Hyla japonica to understand patterns of variation in these traits across Korea and provide clues about the underlying forces for variation. METHODOLOGY: We recorded calls of H. japonica in three breeding seasons from 17 localities including localities in remote Jeju Island. Call characters analyzed were note repetition rate (NRR, note duration (ND, and dominant frequency (DF, along with snout-to-vent length. RESULTS: The findings of a barrier effect on DF and a longitudinal variation in NRR seemed to suggest that an open sea between the mainland and Jeju Island and mountain ranges dominated by the north-south Taebaek Mountains were related to geographic variation in call characters. Furthermore, there was a pattern of IBD in mitochondrial DNA sequences. However, no comparable pattern of IBD was found between geographic distance and call characters. We also failed to detect any effects of habitat or interspecific interaction on call characters. CONCLUSIONS: Geographic variations in call characters as well as mitochondrial DNA sequences were largely stratified by geographic factors such as distance and barriers in Korean populations of H. japonica. Although we did not detect effects of habitat or interspecific interaction, some other selective factors such as sexual selection might still be operating on call characters in conjunction with

  10. Copy number variations in IL22 gene are associated with Psoriasis vulgaris.

    Prans, Ele; Kingo, Külli; Traks, Tanel; Silm, Helgi; Vasar, Eero; Kõks, Sulev

    2013-06-01

    Psoriasis vulgaris (PsV) is a frequent, chronically relapsing, immune-mediated systemic disease with characteristic skin changes. IL22 is a cytokine of IL10 family, with significant proliferative effect on different cell lines. Copy number variations (CNV) have been discovered to have phenotypic consequences and are associated with various types of diseases. In the work presented here we analyzed the copy number variations in IL22 gene of exon1 and exon5. Our results showed that the IL22 gene exon1 was significantly associated with psoriasis severity (P<0.0001). However, the association between IL22 gene exon5 copy numbers and psoriasis was not detected. PMID:23395647

  11. Gene variation, population differentiation, and sociogenetic structure of nests of Partamona seridoensis (Hymenoptera: Apidae, Meliponini).

    Fernandes, Carlo Rivero Moura; Martins, Celso Feitosa; Ferreira, Kátia Maria; Del Lama, Marco Antonio

    2012-06-01

    Gene variation and the differentiation of two populations of Partamona seridoensis (Hymenoptera: Apidae: Meliponini) from the Caatinga biome, a semiarid ecosystem unique to Brazil, were estimated through allozymic and microsatellite analyses. These populations exhibited similar low degrees of enzyme gene variation. Observed genotype frequencies at the allozyme and microsatellite loci were in accordance with Hardy-Weinberg equilibrium in the two populations. Both markers demonstrated that the two populations are not genetically homogeneous and must be considered distinct populations. The occurrence of private alleles at the allozyme and microsatellite loci corroborates this differentiation, sustaining the hypothesis of a low level of interpopulation gene flow. The phenotypic segregations clearly demonstrated that the progeny inside each nest were the result of mating between the queen of the colony and only one male. PMID:21938561

  12. Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

    Epplen Jörg T

    2008-11-01

    Full Text Available Abstract Background Atopic dermatitis (AD is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP, eosinophil-derived neurotoxin (EDN, eosinophil peroxidase (EPO and major basic protein (MBP. Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.

  13. Gene co-expression network analysis identifies porcine genes associated with variation in Salmonella shedding

    Kommadath, Arun; Bao, Hua; Arantes, Adriano S; Plastow, Graham S.; Christopher K Tuggle; Bearson, Shawn MD; Luo Guan, Le; Stothard, Paul

    2014-01-01

    Background Salmonella enterica serovar Typhimurium is a gram-negative bacterium that can colonise the gut of humans and several species of food producing farm animals to cause enteric or septicaemic salmonellosis. While many studies have looked into the host genetic response to Salmonella infection, relatively few have used correlation of shedding traits with gene expression patterns to identify genes whose variable expression among different individuals may be associated with differences in ...

  14. Splice site and Germline variations of the MGMT gene in Esophageal cancer from Kashmir Valley: India

    Shah, Mohd Amin; Shaffi, Sheikh M.; Lone, Ghulam Nabi; Jan, Syed Mudassar

    2013-01-01

    Objectives The aim of our investigation was to detect mutation or genetic polymorphisms in MGMT gene of esophageal cancer patients from Kashmir Valley (India) Methodology The genetic polymorphisms or mutations in the coding exons 2, 3, 4 and 5 of MGMT gene were searched for in DNA samples from the frozen tumor tissues of 30 esophageal cancer patients from Kashmir. The PCR products were sequenced with fluorescently labelled terminators and separated on automatic sequencer. We developed a new PCR based RFLP approach for genotyping c.459A>G (p.Gly153Gly) variation in 71 esophageal cancer patients and 60 healthy controls. Results Two somatic variations c.274 +4G>A and c.274 + 22G>A were identified in Exon3-intron 4 boundary. A novel germline variation c.459A>G (p.Gly153Gly) was found in the exon 5 of an esophageal cancer patient. This germline variation was not found in any of the studied esophageal cancer patients and healthy controls except the patient where it has been found by direct sequencing. Conclusion We identified novel sequence variants of the MGMT gene in esophageal cancer patients from Kashmir valley-India. PMID:24533020

  15. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Melanie G Mayer

    2015-06-01

    Full Text Available Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as

  16. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Mayer, Melanie G; Rödelsperger, Christian; Witte, Hanh; Riebesell, Metta; Sommer, Ralf J

    2015-06-01

    Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as major target for

  17. Genetic variation in genes of the fatty acid synthesis pathway and breast cancer risk

    Campa, Daniele; McKay, James; Sinilnikova, Olga;

    2009-01-01

    FASN) is related to breast cancer risk and body-mass index (BMI) by studying 1,294 breast cancer cases and 2,452 controls from the European Prospective Investigation on Cancer (EPIC). We resequenced the FAS gene and combined information of SNPs found by resequencing and SNPs from public databases....... Using a tagging approach and selecting 20 SNPs, we covered all the common genetic variation of these genes. In this study we were not able to find any statistically significant association between the SNPs in the FAS, ChREBP and SREPB-1 genes and an increased risk of breast cancer overall and by......Fatty acid synthase (FAS) is the major enzyme of lipogenesis. It catalyzes the NADPH-dependent condensation of acetyl-CoA and malonyl-CoA to produce palmitic acid. Transcription of the FAS gene is controlled synergistically by the transcription factors ChREBP (carbohydrate response element...

  18. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  19. Understanding gene sequence variation in the context of transcription regulation in yeast.

    Irit Gat-Viks

    2010-01-01

    Full Text Available DNA sequence polymorphism in a regulatory protein can have a widespread transcriptional effect. Here we present a computational approach for analyzing modules of genes with a common regulation that are affected by specific DNA polymorphisms. We identify such regulatory-linkage modules by integrating genotypic and expression data for individuals in a segregating population with complementary expression data of strains mutated in a variety of regulatory proteins. Our procedure searches simultaneously for groups of co-expressed genes, for their common underlying linkage interval, and for their shared regulatory proteins. We applied the method to a cross between laboratory and wild strains of S. cerevisiae, demonstrating its ability to correctly suggest modules and to outperform extant approaches. Our results suggest that middle sporulation genes are under the control of polymorphism in the sporulation-specific tertiary complex Sum1p/Rfm1p/Hst1p. In another example, our analysis reveals novel inter-relations between Swi3 and two mitochondrial inner membrane proteins underlying variation in a module of aerobic cellular respiration genes. Overall, our findings demonstrate that this approach provides a useful framework for the systematic mapping of quantitative trait loci and their role in gene expression variation.

  20. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    DWINITA WIKAN UTAMI; KALIA BARNITA; SITI YURIAH; IDA HANARIDA

    2011-01-01

    Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufip...

  1. Oxytocin and Vasopressin Receptor Gene Variation as a Proximate Base for Inter- and Intraspecific Behavioral Differences in Bonobos and Chimpanzees

    Staes, Nicky; Stevens, Jeroen M. G.; Helsen, Philippe; Hillyer, Mia; Korody, Marisa; Eens, Marcel

    2014-01-01

    Recent literature has revealed the importance of variation in neuropeptide receptor gene sequences in the regulation of behavioral phenotypic variation. Here we focus on polymorphisms in the oxytocin receptor gene (OXTR) and vasopressin receptor gene 1a (Avpr1a) in chimpanzees and bonobos. In humans, a single nucleotide polymorphism (SNP) in the third intron of OXTR (rs53576 SNP (A/G)) is linked with social behavior, with the risk allele (A) carriers showing reduced levels of empathy and pros...

  2. Identification of genes for bone mineral density variation by computational disease gene identification strategy.

    Li, Gloria H Y; Deng, Hong-Wen; Kung, Annie W C; Huang, Qing-Yang

    2011-11-01

    We previously used five freely available bioinformatics tools (Prioritizer, Geneseeker, PROSPECTR and SUSPECTS, Disease Gene Prediction, and Endeavour) to analyze the thirteen well-replicated osteoporosis susceptibility loci and identify a subset of most likely candidate osteoporosis susceptibility genes (Huang et al. in J Hum Genet 53:644-655, 2008). In the current study, we experimentally tested the association between bone mineral density (BMD) and the 9 most likely candidate genes [LAMC2(1q25-q31), MATN3(2p24-p23), ITGAV(2q31-q32), ACVR1(2q23-q24), TDGF1(3p21.31), EGF(4q25), IGF1(12q22-q23), ZIC2(13q32), BMP2(20p12)] which were pinpointed by 4 or more bioinformatics tools. Forty tag SNPs in nine candidate genes were genotyped in a southern Chinese female case-control cohort consisting of 1643 subjects. Single- and multi-marker association analyses were performed using logistic regression analysis implemented by PLINK. Potential transcription factor binding sites were predicted by MatInspector. The strongest association was observed between rs10178256 (MATN3) and trochanter (P rs6214 (IGF1) showed consistent association with BMD at all the four measured skeletal sites (P = 0.005-0.044). Prediction of transcription factor binding suggested that the minor allele G of rs10178256 might abolish the binding of MESP1 and MESP2 which play vital roles in bone homeostasis, whereas the minor allele G of rs6214 might create an additional binding site for XBP1, a constitutive regulator of endoplasmic reticulum stress response. Our data suggested that variants in MATN3 and IGF1 were involved in BMD regulation in southern Chinese women. PMID:21638018

  3. Effects of common germ-line genetic variation in cell cycle genes on ovarian cancer survival

    Song, H.; Hogdall, E.; Ramus, S.J.;

    2008-01-01

    PURPOSE: Somatic alterations have been shown to correlate with ovarian cancer prognosis and survival, but less is known about the effects on survival of common inherited genetic variation. Of particular interest are genes involved in cell cycle pathways, which regulate cell division and could...... plausibly influence clinical characteristics of multiple tumors types. EXPERIMENTAL DESIGN: We examined associations between common germ-line genetic variation in 14 genes involved in cell cycle pathway (CCND1, CCND2, CCND3, CCNE1, CDKN1A, CDKN1B, CDKN2A, CDKN2B, CDKN2C, CDKN2D, CDK2, CDK4, CDK6, and RB1......) and survival among women with invasive ovarian cancer participating in a multicenter case-control study from United Kingdom, Denmark, and United States. DNAs from up to 1,499 women were genotyped for 97 single-nucleotide polymorphisms that tagged the known common variants (minor allele frequency > or = 0...

  4. Fertility variation and its effects on gene diversity in forest tree populations

    Bila, A.D. [Swedish Univ. of Agricultural Sciences, Umeaa (Sweden). Dept. of Forest Genetics and Plant Physiology

    2000-07-01

    Differences in fertility among parents influence progeny relatedness, inbreeding and diversity, they should therefore be evaluated and their impacts mitigated. Flower, pollen, fruit and seed production were used to estimate fertility variation from observations in natural stands, plantations and seed orchards. Fertility variation was also compiled from the literature. Differences in fertility are described by the power function y = x{sup a} (a {>=} 1), where y is the accumulative parental contribution to the progeny and x the ranked proportion of parents. Fertility variations were also described by the sibling coefficient A, which expresses how parents vary in fertility and the likelihood for sibs to occur compared with the situation when parents contribute equally to the gamete pool. A=a=1 when all individuals in the population have the same fertility, and both parameters increase with unbalanced parental contributions to the progeny. Tree fertility varied widely with some parents over- and others under- represented in the gamete pool. The power function exponent and the sibling coefficient were higher than 1 in most populations studied. Fertility variation was higher in stands than in seed orchards, and in both cases only about 15% of observations had A values close to 1. Age and flowering abundance appear to have a great impact on fertility variation, higher A values were observed in young populations and during poor flowering years. The increase on group coancestry and the reduction in gene diversity with increasing differences in fertility among parents was quantified. It was also described how relatedness accumulates over generation shifts as a function of differences in fertility. Making parents contribute as uniformly as possible to the progeny, e.g., by collecting the same amount of seed across the population, reduced relatedness and gene diversity was better preserved. The loss of gene diversity at generation shifts is inversely proportional to the number

  5. Sex bias in copy number variation of olfactory receptor gene family depends on ethnicity

    Farideh eShadravan

    2013-01-01

    Gender plays a pivotal role in the human genetic identity and is also manifested in many genetic disorders particularly mental retardation. In this study its effect on copy number variation (CNV), known to cause genetic disorders was explored. As the olfactory receptor (OR) repertoire comprises the largest human gene family, it was selected for this study, which was carried out within and between three populations, derived from 150 individuals from the 1000 Genome Project. Analysis of 3872 CN...

  6. Melanopsin Gene Variations Interact With Season to Predict Sleep Onset and Chronotype

    Roecklein, Kathryn A.; Wong, Patricia M.; Franzen, Peter L.; HASLER, BRANT P.; Wood-Vasey, W. Michael; Nimgaonkar, Vishwajit L.; Miller, Megan A.; Kepreos, Kyle M.; Ferrell, Robert E.; Manuck, Stephen B.

    2012-01-01

    The human melanopsin gene has been reported to mediate risk for seasonal affective disorder (SAD), which is hypothesized to be caused by decreased photic input during winter when light levels fall below threshold, resulting in differences in circadian phase and/or sleep. However, it is unclear if melanopsin increases risk of SAD by causing differences in sleep or circadian phase, or if those differences are symptoms of the mood disorder. To determine if melanopsin sequence variations are asso...

  7. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation.

    Macke, J. P.; Hu, N; S. Hu; Bailey, M.; King, V L; Brown, T.; Hamer, D; Nathans, J

    1993-01-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, we have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the the entire androgen receptor cod...

  8. Variation of the Oxytocin/Neurophysin I (OXT) gene in four human populations

    Xu, Yang; Xue, Yali; Asan,; Daly, Allan; Wu, Lijie; Tyler-Smith, Chris

    2008-01-01

    Oxytocin is a short peptide with multiple functions in human biology and has been implicated in the disorder autism. We set out to determine the normal pattern of variation around the oxytocin gene and have resequenced it and its flanking regions in 91 individuals from four HapMap populations and one chimpanzee. We identified 14 SNPs, all non-coding, including eight that were novel. Population-genetic analyses were largely consistent with a neutral evolutionary history, but an HKA test reveal...

  9. Oxytocin receptor gene variation predicts empathic concern and autonomic arousal while perceiving harm to others

    Karen E. Smith; Porges, Eric C.; Norman, Greg J.; Connelly, Jessica J.; Decety, Jean

    2013-01-01

    Recent research indicates that the neuropeptide oxytocin and the gene for the oxytocin receptor (OXTR) have been implicated in the modulation of various social behaviors, including those related to empathy and sensitivity to others. In this study, we examine the hypothesis that genetic variation in OXTR is associated with autonomic reactions when perceiving others in distress. We also explore the possibility that individual disposition in empathic concern would differ by OXTR genotype. To add...

  10. Cytokine gene variations associated with trait and state anxiety in oncology patients and their family caregivers

    Miaskowski, C; Cataldo, JK; Baggott, CR; West, C; Dunn, LB; Dhruva, A; Merriman, JD; Langford, DJ; Kober, KM; Paul, SM; Cooper, BA; Aouizerat, BE

    2015-01-01

    © 2014, Springer-Verlag Berlin Heidelberg. Purpose: Anxiety is common among cancer patients and their family caregivers (FCs) and is associated with poorer outcomes. Recently, associations between inflammation and anxiety were identified. However, the relationship between variations in cytokine genes and anxiety warrants investigation. Therefore, phenotypic and genotypic characteristics associated with trait and state anxiety were evaluated in a sample of 167 oncology patients with breast, pr...

  11. Sweet Taste Receptor Gene Variation and Aspartame Taste in Primates and Other Species

    Xia LI; Bachmanov, Alexander A.; Maehashi, Kenji; LI, Weihua; Lim, Raymond; Brand, Joseph G.; Beauchamp, Gary K.; Reed, Danielle R.; Thai, Chloe; Floriano, Wely B.

    2011-01-01

    Aspartame is a sweetener added to foods and beverages as a low-calorie sugar replacement. Unlike sugars, which are apparently perceived as sweet and desirable by a range of mammals, the ability to taste aspartame varies, with humans, apes, and Old World monkeys perceiving aspartame as sweet but not other primate species. To investigate whether the ability to perceive the sweetness of aspartame correlates with variations in the DNA sequence of the genes encoding sweet taste receptor proteins, ...

  12. Genetic Variation in Cell Cycle Regulatory Gene AURKA and Association With Intrinsic Breast Cancer Subtype

    Taylor, Nicholas J.; Bensen, Jeannette T.; Poole, Charles; Troester, Melissa A.; Gammon, Marilie D.; Luo, Jingchun; Millikan, Robert C.; Olshan, Andrew F.

    2014-01-01

    AURKA is a putative low-penetrance tumor susceptibility gene due to its prominent role in cell cycle regulation and centrosomal function. Germline variation in AURKA was evaluated for association with breast cancer and intrinsic breast cancer subtypes in the Carolina Breast Cancer Study (CBCS), a population-based case-control study of African Americans (AA) and Caucasians (Cau). Tag and candidate single nucleotide polymorphisms (SNPs) on AURKA were genotyped in 1946 cases and 1747 controls. I...

  13. Constitutional genetic variation at the human aromatase gene (Cyp19) and breast cancer risk

    Siegelmann-Danieli, N; Buetow, K H

    1999-01-01

    The activity of the aromatase enzyme, which converts androgens into oestrogens and has a major role in regulating oestrogen levels in the breast, is thought to be a contributing factor in the development of breast cancer. We undertook this study to assess the role of constitutional genetic variation in the human aromatase gene (Cyp19) in the development of this disease. Our genotyping of 348 cases with breast cancer and 145 controls (all Caucasian women) for a published tetranucleotide repeat...

  14. Sequence variation of the amelogenin gene on the Y-chromosome / by Irma Ferreira

    Ferreira, Irma

    2010-01-01

    The accurate determination of gender of biological samples has valuable applications in medical and forensic investigations. Gender determination based on length variations in the X-Y homologous amelogenin gene, is part of most commercial multiplex DNA profiling kits. The first report of a failure of the amelogenin sex test was in 1998 when two normal males were typed as female. Subsequently, several amelogenin Y (AMELY) negative males have been reported. This study repre...

  15. Identification of QTL genes for BMD variation using both linkage and gene-based association approaches

    Li, Gloria Hoi-Yee; Cheung, Ching-Lung; Xiao, Su-Mei; Lau, Kam-Shing; Gao, Yi; Bow, Cora H.; Huang, Qing-Yang; Sham, Pak-Chung; Kung, Annie Wai-Chee

    2011-01-01

    Low bone mineral density (BMD) is a risk factor for osteoporotic fracture with a high heritability. Previous large scale linkage study in Northern Chinese has identified four significant quantitative trait loci (QTL) for BMD variation on chromosome 2q24, 5q21, 7p21 and 13q21. We performed a replication study of these four QTL in 1,459 Southern Chinese from 306 pedigrees. Successful replication was observed on chromosome 5q21 for femoral neck BMD with a LOD score of 1.38 (nominal p value = 0.0...

  16. Tissue-specific effects of genetic and epigenetic variation on gene regulation and splicing.

    Maria Gutierrez-Arcelus

    2015-01-01

    Full Text Available Understanding how genetic variation affects distinct cellular phenotypes, such as gene expression levels, alternative splicing and DNA methylation levels, is essential for better understanding of complex diseases and traits. Furthermore, how inter-individual variation of DNA methylation is associated to gene expression is just starting to be studied. In this study, we use the GenCord cohort of 204 newborn Europeans' lymphoblastoid cell lines, T-cells and fibroblasts derived from umbilical cords. The samples were previously genotyped for 2.5 million SNPs, mRNA-sequenced, and assayed for methylation levels in 482,421 CpG sites. We observe that methylation sites associated to expression levels are enriched in enhancers, gene bodies and CpG island shores. We show that while the correlation between DNA methylation and gene expression can be positive or negative, it is very consistent across cell-types. However, this epigenetic association to gene expression appears more tissue-specific than the genetic effects on gene expression or DNA methylation (observed in both sharing estimations based on P-values and effect size correlations between cell-types. This predominance of genetic effects can also be reflected by the observation that allele specific expression differences between individuals dominate over tissue-specific effects. Additionally, we discover genetic effects on alternative splicing and interestingly, a large amount of DNA methylation correlating to alternative splicing, both in a tissue-specific manner. The locations of the SNPs and methylation sites involved in these associations highlight the participation of promoter proximal and distant regulatory regions on alternative splicing. Overall, our results provide high-resolution analyses showing how genome sequence variation has a broad effect on cellular phenotypes across cell-types, whereas epigenetic factors provide a secondary layer of variation that is more tissue-specific. Furthermore

  17. Redefining the expressed prototype SICAvar gene involved in Plasmodium knowlesi antigenic variation

    Galinski Mary R

    2009-07-01

    Full Text Available Abstract Background The SICAvar gene family, expressed at the surface of infected erythrocytes, is critical for antigenic variation in Plasmodium knowlesi. When this family was discovered, a prototypic SICAvar gene was characterized and defined by a 10-exon structure. The predicted 205-kDa protein lacked a convincing signal peptide, but included a series of variable cysteine-rich modules, a transmembrane domain encoded by the penultimate exon, and a cytoplasmic domain encoded by the final highly conserved exon. The 205 SICAvar gene and its family with up to 108 possible family members, was identified prior to the sequencing of the P. knowlesi genome. However, in the published P. knowlesi database this gene remains disjointed in five fragments. This study addresses a number of structural and functional questions that are critical for understanding SICAvar gene expression. Methods Database mining, bioinformatics, and traditional genomic and post-genomic experimental methods including proteomic technologies are used here to confirm the genomic context and expressed structure of the prototype 205 SICAvar gene. Results This study reveals that the 205 SICAvar gene reported previously to have a 10-exon expressed gene structure has, in fact, 12 exons, with an unusually large and repeat-laden intron separating two newly defined upstream exons and the bona fide 5'UTR from the remainder of the gene sequence. The initial exon encodes a PEXEL motif, which may function to localize the SICA protein in the infected erythrocyte membrane. This newly defined start of the 205 SICAvar sequence is positioned on chromosome 5, over 340 kb upstream from the rest of the telomerically positioned SICAvar gene sequence in the published genome assembly. This study, however, verifies the continuity of these sequences, a 9.5 kb transcript, and provides evidence that the 205 SICAvar gene is located centrally on chromosome 5. Conclusion The prototype 205 SICAvar gene has been

  18. Common Genetic Variation in Circadian Rhythm Genes and Risk of Epithelial Ovarian Cancer (EOC)

    Jim, Heather S.L.; Lin, Hui-Yi; Tyrer, Jonathan P.; Lawrenson, Kate; Dennis, Joe; Chornokur, Ganna; Chen, Zhihua; Chen, Ann Y.; Permuth-Wey, Jennifer; Aben, Katja KH.; Anton-Culver, Hoda; Antonenkova, Natalia; Bruinsma, Fiona; Bandera, Elisa V.; Bean, Yukie T.; Beckmann, Matthias W.; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A.; Brooks-Wilson, Angela; Bunker, Clareann H.; Butzow, Ralf; Campbell, Ian G.; Carty, Karen; Chang-Claude, Jenny; Cook, Linda S.; Cramer, Daniel W.; Cunningham, Julie M.; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; du Bois, Andreas; Despierre, Evelyn; Sieh, Weiva; Doherty, Jennifer A.; Dörk, Thilo; Dürst, Matthias; Easton, Douglas F.; Eccles, Diana M.; Edwards, Robert P.; Ekici, Arif B.; Fasching, Peter A.; Fridley, Brooke L.; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G.; Glasspool, Rosalind; Goodman, Marc T.; Gronwald, Jacek; Harter, Philipp; Hasmad, Hanis N.; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A.T.; Hillemanns, Peter; Hogdall, Claus K.; Hogdall, Estrid; Hosono, Satoyo; Iversen, Edwin S.; Jakubowska, Anna; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y.; Kellar, Melissa; Kiemeney, Lambertus A.; Krakstad, Camilla; Kjaer, Susanne K.; Kupryjanczyk, Jolanta; Vierkant, Robert A.; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D.; Lee, Alice W.; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A.; Liang, Dong; Lim, Boon Kiong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F.A.G.; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R.; McNeish, Ian; Menon, Usha; Milne, Roger L.; Modugno, Francesmary; Thomsen, Lotte; Moysich, Kirsten B.; Ness, Roberta B.; Nevanlinna, Heli; Eilber, Ursula; Odunsi, Kunle; Olson, Sara H.; Orlow, Irene; Orsulic, Sandra; Palmieri Weber, Rachel; Paul, James; Pearce, Celeste L.; Pejovic, Tanja; Pelttari, Liisa M.; Pike, Malcolm C.; Poole, Elizabeth M.; Schernhammer, Eva; Risch, Harvey A.; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H.; Rudolph, Anja; Runnebaum, Ingo B.; Rzepecka, Iwona K.; Salvesen, Helga B.; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B.; Siddiqui, Nadeem; Song, Honglin; Southey, Melissa C.; Spiewankiewicz, Beata; Sucheston-Campbell, Lara; Teo, Soo-Hwang; Terry, Kathryn L.; Thompson, Pamela J.; Tangen, Ingvild L.; Tworoger, Shelley S.; van Altena, Anne M.; Vergote, Ignace; Walsh, Christine S.; Wang-Gohrke, Shan; Wentzensen, Nicolas; Whittemore, Alice S.; Wicklund, Kristine G.; Wilkens, Lynne R.; Wu, Anna H.; Wu, Xifeng; Woo, Yin-Ling; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Amankwah, Ernest; Berchuck, Andrew; Schildkraut, Joellen M.; Kelemen, Linda E.; Ramus, Susan J.; Monteiro, Alvaro N.A.; Goode, Ellen L.; Narod, Steven A.; Gayther, Simon A.; Pharoah, Paul D. P.; Sellers, Thomas A.; Phelan, Catherine M.

    2016-01-01

    Disruption in circadian gene expression, whether due to genetic variation or environmental factors (e.g., light at night, shiftwork), is associated with increased incidence of breast, prostate, gastrointestinal and hematologic cancers and gliomas. Circadian genes are highly expressed in the ovaries where they regulate ovulation; circadian disruption is associated with several ovarian cancer risk factors (e.g., endometriosis). However, no studies have examined variation in germline circadian genes as predictors of ovarian cancer risk and invasiveness. The goal of the current study was to examine single nucleotide polymorphisms (SNPs) in circadian genes BMAL1, CRY2, CSNK1E, NPAS2, PER3, REV1 and TIMELESS and downstream transcription factors KLF10 and SENP3 as predictors of risk of epithelial ovarian cancer (EOC) and histopathologic subtypes. The study included a test set of 3,761 EOC cases and 2,722 controls and a validation set of 44,308 samples including 18,174 (10,316 serous) cases and 26,134 controls from 43 studies participating in the Ovarian Cancer Association Consortium (OCAC). Analysis of genotype data from 36 genotyped SNPs and 4600 imputed SNPs indicated that the most significant association was rs117104877 in BMAL1 (OR = 0.79, 95% CI = 0.68–0.90, p = 5.59 × 10−4]. Functional analysis revealed a significant down regulation of BMAL1 expression following cMYC overexpression and increasing transformation in ovarian surface epithelial (OSE) cells as well as alternative splicing of BMAL1 exons in ovarian and granulosa cells. These results suggest that variation in circadian genes, and specifically BMAL1, may be associated with risk of ovarian cancer, likely through disruption of hormonal pathways. PMID:26807442

  19. Associations between dopamine D4 receptor gene variation with both infidelity and sexual promiscuity.

    Justin R Garcia

    Full Text Available BACKGROUND: Human sexual behavior is highly variable both within and between populations. While sex-related characteristics and sexual behavior are central to evolutionary theory (sexual selection, little is known about the genetic bases of individual variation in sexual behavior. The variable number tandem repeats (VNTR polymorphism in exon III of the human dopamine D4 receptor gene (DRD4 has been correlated with an array of behavioral phenotypes and may be predicatively responsible for variation in motivating some sexual behaviors, particularly promiscuity and infidelity. METHODOLOGY/PRINCIPAL FINDINGS: We administered an anonymous survey on personal history of sexual behavior and intimate relationships to 181 young adults. We also collected buccal wash samples and genotyped the DRD4 VNTR. Here we show that individuals with at least one 7-repeat allele (7R+ report a greater categorical rate of promiscuous sexual behavior (i.e., having ever had a "one-night stand" and report a more than 50% increase in instances of sexual infidelity. CONCLUSIONS/SIGNIFICANCE: DRD4 VNTR genotype varies considerably within and among populations and has been subject to relatively recent, local selective pressures. Individual differences in sexual behavior are likely partially mediated by individual genetic variation in genes coding for motivation and reward in the brain. Conceptualizing these findings in terms of r/K selection theory suggests a mechanism for selective pressure for and against the 7R+ genotype that may explain the considerable global allelic variation for this polymorphism.

  20. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation

    Macke, J.P.; Nathans, J.; King, V.L. (Johns Hopkins Univ., Baltimore, MD (United States)); Hu, N.; Hu, S.; Hamer, D.; Bailey, M. (Northwestern Univ., Evanston, IL (United States)); Brown, T. (Johns Hopkins Univ. School of Hygiene and Public Health, Baltimore, MD (United States))

    1993-10-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, the authors have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the entire androgen receptor coding region for sequence variation by PCR and denaturing gradient-gel electrophoresis (DGGE) and/or single-strand conformation polymorphism analysis in 20 homosexual males with homosexual or bisexual brothers and one homosexual male with no homosexual brothers, and screened the amino-terminal domain of the receptor for sequence variation in an additional 44 homosexual males, 37 of whom had one or more first- or second-degree male relatives who were either homosexual or bisexual. These analyses show that (1) homosexual brothers are as likely to be discordant as concordant for androgen receptor alleles; (2) there are no large-scale differences between the distributions of polyglycine or polyglutamine tract lengths in the homosexual and control groups; and (3) coding region sequence variation is not commonly found within the androgen receptor gene of homosexual men. The DGGE screen identified two rare amino acid substitutions, ser[sup 205] -to-arg and glu[sup 793]-to-asp, the biological significance of which is unknown. 32 refs., 2 figs., 2 tabs.

  1. Indexing Effects of Copy Number Variation on Genes Involved in Developmental Delay.

    Uddin, Mohammed; Pellecchia, Giovanna; Thiruvahindrapuram, Bhooma; D'Abate, Lia; Merico, Daniele; Chan, Ada; Zarrei, Mehdi; Tammimies, Kristiina; Walker, Susan; Gazzellone, Matthew J; Nalpathamkalam, Thomas; Yuen, Ryan K C; Devriendt, Koenraad; Mathonnet, Géraldine; Lemyre, Emmanuelle; Nizard, Sonia; Shago, Mary; Joseph-George, Ann M; Noor, Abdul; Carter, Melissa T; Yoon, Grace; Kannu, Peter; Tihy, Frédérique; Thorland, Erik C; Marshall, Christian R; Buchanan, Janet A; Speevak, Marsha; Stavropoulos, Dimitri J; Scherer, Stephen W

    2016-01-01

    A challenge in clinical genomics is to predict whether copy number variation (CNV) affecting a gene or multiple genes will manifest as disease. Increasing recognition of gene dosage effects in neurodevelopmental disorders prompted us to develop a computational approach based on critical-exon (highly expressed in brain, highly conserved) examination for potential etiologic effects. Using a large CNV dataset, our updated analyses revealed significant (P < 1.64 × 10(-15)) enrichment of critical-exons within rare CNVs in cases compared to controls. Separately, we used a weighted gene co-expression network analysis (WGCNA) to construct an unbiased protein module from prenatal and adult tissues and found it significantly enriched for critical exons in prenatal (P < 1.15 × 10(-50), OR = 2.11) and adult (P < 6.03 × 10(-18), OR = 1.55) tissues. WGCNA yielded 1,206 proteins for which we prioritized the corresponding genes as likely to have a role in neurodevelopmental disorders. We compared the gene lists obtained from critical-exon and WGCNA analysis and found 438 candidate genes associated with CNVs annotated as pathogenic, or as variants of uncertain significance (VOUS), from among 10,619 developmental delay cases. We identified genes containing CNVs previously considered to be VOUS to be new candidate genes for neurodevelopmental disorders (GIT1, MVB12B and PPP1R9A) demonstrating the utility of this strategy to index the clinical effects of CNVs. PMID:27363808

  2. Unlocking naturally occurring variation for starch quality by gene-tagged markers in rice

    Quantitative trait loci (QTLs) mapping and association mapping are currently used to dissect the natural occurring variations for traits of agronomical importance. We found that the major QTLs for starch quality co-locate at the starch-synthesizing gene loci, e.g. Wx locus controls the genetic basis of amylose content, pasting viscosity, gel texture and retrogradation properties, while starch synthase IIa (SSIIa) locus controls the gelatinization temperature (GT) and amylopectin structure. Some of other genes involved in starch biosynthesis and other minor QTLs were also detected. Gene tagged markers such as simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) that were inside or close to those starch-synthesizing genes were designed. Among 499 nonwaxy rice accessions, polymorphisms of SSR in the Waxy gene, soluble starch synthase I gene (SS1) and starch branching enzyme I gene (SBE1), SNPs in Waxy and starch branching enzyme III gene (SBE3) and SSIIa, and a sequence tagged site (STS) in SBEI were surveyed. Ten SSR alleles were found at the Wx locus and four SSR alleles were found at the SBE1 and SS1, respectively. Two continuous SNPs (GC/TT) alone can differentiate rice with high or intermediate GT (possessing GC SNPs) from those with low GT (possessing the TT SNPs). Association test was conducted using all starch gene markers, results indicated that Wx SSR and SNPs were strongly associated with amylose content, pasting viscosities, gel hardness, and retrogradation properties, whereas the SSIIa GC/TT SNPs were strongly associated with the pasting temperature and retrogradation properties, which confirmed the findings from QTL mapping. These markers are useful in molecular breeding for improvement of rice eating and cooking qualities. This study was jointly supported by funds from NSFC (30771327), 863 project (2006AA10Z193), Science and Technology Department of Zhejiang Province (2007C32014) and IAEA (12847). (author)

  3. Diversity and population-genetic properties of copy number variations and multicopy genes in cattle.

    Bickhart, Derek M; Xu, Lingyang; Hutchison, Jana L; Cole, John B; Null, Daniel J; Schroeder, Steven G; Song, Jiuzhou; Garcia, Jose Fernando; Sonstegard, Tad S; Van Tassell, Curtis P; Schnabel, Robert D; Taylor, Jeremy F; Lewin, Harris A; Liu, George E

    2016-06-01

    The diversity and population genetics of copy number variation (CNV) in domesticated animals are not well understood. In this study, we analysed 75 genomes of major taurine and indicine cattle breeds (including Angus, Brahman, Gir, Holstein, Jersey, Limousin, Nelore, and Romagnola), sequenced to 11-fold coverage to identify 1,853 non-redundant CNV regions. Supported by high validation rates in array comparative genomic hybridization (CGH) and qPCR experiments, these CNV regions accounted for 3.1% (87.5 Mb) of the cattle reference genome, representing a significant increase over previous estimates of the area of the genome that is copy number variable (∼2%). Further population genetics and evolutionary genomics analyses based on these CNVs revealed the population structures of the cattle taurine and indicine breeds and uncovered potential diversely selected CNVs near important functional genes, including AOX1, ASZ1, GAT, GLYAT, and KRTAP9-1 Additionally, 121 CNV gene regions were found to be either breed specific or differentially variable across breeds, such as RICTOR in dairy breeds and PNPLA3 in beef breeds. In contrast, clusters of the PRP and PAG genes were found to be duplicated in all sequenced animals, suggesting that subfunctionalization, neofunctionalization, or overdominance play roles in diversifying those fertility-related genes. These CNV results provide a new glimpse into the diverse selection histories of cattle breeds and a basis for correlating structural variation with complex traits in the future. PMID:27085184

  4. Targeted capture and resequencing of 1040 genes reveal environmentally driven functional variation in grey wolves.

    Schweizer, Rena M; Robinson, Jacqueline; Harrigan, Ryan; Silva, Pedro; Galverni, Marco; Musiani, Marco; Green, Richard E; Novembre, John; Wayne, Robert K

    2016-01-01

    In an era of ever-increasing amounts of whole-genome sequence data for individuals and populations, the utility of traditional single nucleotide polymorphisms (SNPs) array-based genome scans is uncertain. We previously performed a SNP array-based genome scan to identify candidate genes under selection in six distinct grey wolf (Canis lupus) ecotypes. Using this information, we designed a targeted capture array for 1040 genes, including all exons and flanking regions, as well as 5000 1-kb nongenic neutral regions, and resequenced these regions in 107 wolves. Selection tests revealed striking patterns of variation within candidate genes relative to noncandidate regions and identified potentially functional variants related to local adaptation. We found 27% and 47% of candidate genes from the previous SNP array study had functional changes that were outliers in sweed and bayenv analyses, respectively. This result verifies the use of genomewide SNP surveys to tag genes that contain functional variants between populations. We highlight nonsynonymous variants in APOB, LIPG and USH2A that occur in functional domains of these proteins, and that demonstrate high correlation with precipitation seasonality and vegetation. We find Arctic and High Arctic wolf ecotypes have higher numbers of genes under selection, which highlight their conservation value and heightened threat due to climate change. This study demonstrates that combining genomewide genotyping arrays with large-scale resequencing and environmental data provides a powerful approach to discern candidate functional variants in natural populations. PMID:26562361

  5. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk

    Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P;

    2015-01-01

    BACKGROUND: Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As...... DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC), we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk. METHODS: In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and...... imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4). CONCLUSION: These results, generated on a large cohort of women, revealed associations between inherited cellular transport gene variants and risk of EOC histologic subtypes....

  6. Identification of Genes Responsible for Natural Variation in Volatile Content Using Next-Generation Sequencing Technology.

    Amaya, Iraida; Pillet, Jeremy; Folta, Kevin M

    2016-01-01

    Identification of the genes controlling the variation of key traits remains a challenge for plant researchers and represents a goal for the development of functional markers and their implementation in marker-assisted crop breeding. As an example we describe the identification of volatile organic compounds (VOCs) that segregate as single locus or mayor quantitative trait loci (QTL) in strawberry F1 segregating populations. Next, we describe a fast and efficient method for RNA extraction in strawberry that yields high-quality RNA for downstream RNA-seq analysis. Finally, two alternative methods for analysis of global transcript expression in contrasting lines will be described in order to identify the candidate gene and genes with differential expression using RNA-seq. PMID:26577779

  7. Variation in Telangiectasia Predisposing Genes Is Associated With Overall Radiation Toxicity

    Tanteles, George A. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Murray, Robert J.S. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Mills, Jamie [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Barwell, Julian [Department of Genetics, University of Leicester, Leicester (United Kingdom); Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Chakraborti, Prabir [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Chan, Steve [Department of Clinical Oncology, Nottingham University Hospitals NHS Trust, Nottingham (United Kingdom); Cheung, Kwok-Leung [Division of Breast Surgery, University of Nottingham, Nottingham (United Kingdom); Ennis, Dawn [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Khurshid, Nazish [Department of Genetics, University of Leicester, Leicester (United Kingdom); Lambert, Kelly [Department of Breast Surgery, University Hospitals of Leicester, Glenfield Hospital, Leicester (United Kingdom); Machhar, Rohan; Meisuria, Mitul [Department of Genetics, University of Leicester, Leicester (United Kingdom); Osman, Ahmed; Peat, Irene [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Sahota, Harjinder [Department of Genetics, University of Leicester, Leicester (United Kingdom); Woodings, Pamela [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Talbot, Christopher J., E-mail: cjt14@le.ac.uk [Department of Genetics, University of Leicester, Leicester (United Kingdom); and others

    2012-11-15

    Purpose: In patients receiving radiotherapy for breast cancer where the heart is within the radiation field, cutaneous telangiectasiae could be a marker of potential radiation-induced heart disease. We hypothesized that single nucleotide polymorphisms (SNPs) in genes known to cause heritable telangiectasia-associated disorders could predispose to such late, normal tissue vascular damage. Methods and Materials: The relationship between cutaneous telangiectasia as a late normal tissue radiation injury phenotype in 633 breast cancer patients treated with radiotherapy was examined. Patients were clinically assessed for the presence of cutaneous telangiectasia and genotyped at nine SNPs in three candidate genes. Candidate SNPs were within the endoglin (ENG) and activin A receptor, type II-like 1 (ACVRL1) genes, mutations in which cause hereditary hemorrhagic telangiectasia and the ataxia-telangiectasia mutated (ATM) gene associated with ataxia-telangiectasia. Results: A total of 121 (19.1%) patients exhibited a degree of cutaneous telangiectasiae on clinical examination. Regression was used to examine the associations between the presence of telangiectasiae in patients who underwent breast-conserving surgery, controlling for the effects of boost and known brassiere size (n=388), and individual geno- or haplotypes. Inheritance of ACVRL1 SNPs marginally contributed to the risk of cutaneous telangiectasiae. Haplotypic analysis revealed a stronger association between inheritance of a ATM haplotype and the presence of cutaneous telangiectasiae, fibrosis and overall toxicity. No significant association was observed between telangiectasiae and the coinheritance of the candidate ENG SNPs. Conclusions: Genetic variation in the ATM gene influences reaction to radiotherapy through both vascular damage and increased fibrosis. The predisposing variation in the ATM gene will need to be better defined to optimize it as a predictive marker for assessing radiotherapy late effects.

  8. AB162. Genes variation in three families of Vietnamese dioxin victim

    Ton, Nguyen Dang; Ha, Nguyen Hai; Nhung, Vu Phuong; Khoi, Pham Nhat; Duong, Nguyen Thuy; Hue, Huynh Thi Thu; Hien, Le Thi Thu; Hoang, Nguyen Huy; Van Hai, Nong

    2015-01-01

    Dioxins are a class of chemical contaminants that are formed during combustion processes such as herbicide manufacturing, waste incineration, forest fires, and backyard trash burning. The most toxic chemical in the class is 2,3,7,8-tetrachlorodibenzo-para-dioxin (TCDD). Approximately 18 million gallons of Agent Orange were sprayed by US Airforce on southern of Vietnam from 1962 to 1971. About 0.3% of Agent Orange consisted of TCDD. Dioxins have been considered highly toxic and able to cause cancer, reproductive and developmental problems, damage the immune system, and interfere with hormones. In this paper we studied gene variation in some families of dioxin victims of Vietnamese army veterans who have been exposed directly under sprays or carried out missions for at least 2 years in the heavily sprayed regions. Of the first family, we found 21 nucleotide variants in TP53 gene, 13 nucleotide variants in AhR gene. All of theme leading to amino acid change. We also found R554K in ThB4.VT16 and ThB4.VT17. This mutation changes activity for CYP1A1 induction in lymphocytes. In the second family, we identified 29 nucleotide variants in TP53 gene. Although we could not found any variant associated with phenotype of the family members but previous studies have found P295L associated with gastric carcinoma, L299P associated with pancreatic cancer, G279E associated with colorectal carcinoma and cancer of male sex cells. In the third family, we found 22 nucleotide variants in TP53 gene and 9 variants in CYP1B1 gene. For understanding of whole genome sequence variation, whole genome of 3 member of each family has been sequenced by Illumina HiSeq 2000/2500 platform. The whole genome sequence data have started analysing.

  9. Phase variation leads to the misidentification of a Neisseria gonorrhoeae virulence gene.

    Mark T Anderson

    Full Text Available Neisseria gonorrhoeae is the causative agent of gonorrhea and an obligate pathogen of humans. The Opa proteins of these bacteria are known to mediate attachment and internalization by host cells, including neutrophils. The Opa protein repertoire of a typical N. gonorrhoeae isolate is encoded on ~11 genes distributed throughout the chromosome and is subject to stochastic changes in expression through phase variation. Together, these characteristics make Opa proteins a critical yet unpredictable aspect of any experimental investigation into the interaction of N. gonorrhoeae with host cells. The goal of this study was to identify novel virulence factors of N. gonorrhoeae by assessing the contribution of a set of uncharacterized hydrogen peroxide-induced genes to bacterial survival against neutrophil-mediated killing. To this end, a strain harboring an engineered mutation in the NGO0322 gene was identified that exhibited increased sensitivity to neutrophil-mediated killing, enhanced internalization by neutrophils, and the ability to induce high levels of neutrophil-generated reactive oxygen species. Each of these phenotypes reverted to near wild-type levels following genetic complementation of the NGO0322 mutation. However, after immunoblot analysis of Opa proteins expressed by the isogenic parent, mutant, and genetically complemented strains, it was determined that phase variation had resulted in a disparity between the Opa profiles of these strains. To determine whether Opa phase variation, rather than NGO0322 mutation, was the cause of the observed neutrophil-related phenotypes, NGO0322 function was investigated in N. gonorrhoeae strains lacking all Opa proteins or constitutively expressing the OpaD variant. In both cases, mutation of NGO0322 did not alter survival of gonococci in the presence of neutrophils. These results demonstrate the importance of controlling for the frequent and random variation in Opa protein production by N. gonorrhoeae

  10. A general scenario of Hox gene inventory variation among major sarcopterygian lineages

    Wang Chaolin

    2011-01-01

    Full Text Available Abstract Background Hox genes are known to play a key role in shaping the body plan of metazoans. Evolutionary dynamics of these genes is therefore essential in explaining patterns of evolutionary diversity. Among extant sarcopterygians comprising both lobe-finned fishes and tetrapods, our knowledge of the Hox genes and clusters has largely been restricted in several model organisms such as frogs, birds and mammals. Some evolutionary gaps still exist, especially for those groups with derived body morphology or occupying key positions on the tree of life, hindering our understanding of how Hox gene inventory varied along the sarcopterygian lineage. Results We determined the Hox gene inventory for six sarcopterygian groups: lungfishes, caecilians, salamanders, snakes, turtles and crocodiles by comprehensive PCR survey and genome walking. Variable Hox genes in each of the six sarcopterygian group representatives, compared to the human Hox gene inventory, were further validated for their presence/absence by PCR survey in a number of related species representing a broad evolutionary coverage of the group. Turtles, crocodiles, birds and placental mammals possess the same 39 Hox genes. HoxD12 is absent in snakes, amphibians and probably lungfishes. HoxB13 is lost in frogs and caecilians. Lobe-finned fishes, amphibians and squamate reptiles possess HoxC3. HoxC1 is only present in caecilians and lobe-finned fishes. Similar to coelacanths, lungfishes also possess HoxA14, which is only found in lobe-finned fishes to date. Our Hox gene variation data favor the lungfish-tetrapod, turtle-archosaur and frog-salamander relationships and imply that the loss of HoxD12 is not directly related to digit reduction. Conclusions Our newly determined Hox inventory data provide a more complete scenario for evolutionary dynamics of Hox genes along the sarcopterygian lineage. Limbless, worm-like caecilians and snakes possess similar Hox gene inventories to animals with

  11. Antigen-presenting genes and genomic copy number variations in the Tasmanian devil MHC

    Cheng Yuanyuan

    2012-03-01

    Full Text Available Abstract Background The Tasmanian devil (Sarcophilus harrisii is currently under threat of extinction due to an unusual fatal contagious cancer called Devil Facial Tumour Disease (DFTD. DFTD is caused by a clonal tumour cell line that is transmitted between unrelated individuals as an allograft without triggering immune rejection due to low levels of Major Histocompatibility Complex (MHC diversity in Tasmanian devils. Results Here we report the characterization of the genomic regions encompassing MHC Class I and Class II genes in the Tasmanian devil. Four genomic regions approximately 960 kb in length were assembled and annotated using BAC contigs and physically mapped to devil Chromosome 4q. 34 genes and pseudogenes were identified, including five Class I and four Class II loci. Interestingly, when two haplotypes from two individuals were compared, three genomic copy number variants with sizes ranging from 1.6 to 17 kb were observed within the classical Class I gene region. One deletion is particularly important as it turns a Class Ia gene into a pseudogene in one of the haplotypes. This deletion explains the previously observed variation in the Class I allelic number between individuals. The frequency of this deletion is highest in the northwestern devil population and lowest in southeastern areas. Conclusions The third sequenced marsupial MHC provides insights into the evolution of this dynamic genomic region among the diverse marsupial species. The two sequenced devil MHC haplotypes revealed three copy number variations that are likely to significantly affect immune response and suggest that future work should focus on the role of copy number variations in disease susceptibility in this species.

  12. Recombination in pe/ppe genes contributes to genetic variation in Mycobacterium tuberculosis lineages

    Phelan, Jody E.

    2016-02-29

    Background Approximately 10 % of the Mycobacterium tuberculosis genome is made up of two families of genes that are poorly characterized due to their high GC content and highly repetitive nature. The PE and PPE families are typified by their highly conserved N-terminal domains that incorporate proline-glutamate (PE) and proline-proline-glutamate (PPE) signature motifs. They are hypothesised to be important virulence factors involved with host-pathogen interactions, but their high genetic variability and complexity of analysis means they are typically disregarded in genome studies. Results To elucidate the structure of these genes, 518 genomes from a diverse international collection of clinical isolates were de novo assembled. A further 21 reference M. tuberculosis complex genomes and long read sequence data were used to validate the approach. SNP analysis revealed that variation in the majority of the 168 pe/ppe genes studied was consistent with lineage. Several recombination hotspots were identified, notably pe_pgrs3 and pe_pgrs17. Evidence of positive selection was revealed in 65 pe/ppe genes, including epitopes potentially binding to major histocompatibility complex molecules. Conclusions This, the first comprehensive study of the pe and ppe genes, provides important insight into M. tuberculosis diversity and has significant implications for vaccine development.

  13. Adaptive variation regulates the expression of the human SGK1 gene in response to stress.

    Francesca Luca

    2009-05-01

    Full Text Available The Serum and Glucocorticoid-regulated Kinase1 (SGK1 gene is a target of the glucocorticoid receptor (GR and is central to the stress response in many human tissues. Because environmental stress varies across habitats, we hypothesized that natural selection shaped the geographic distribution of genetic variants regulating the level of SGK1 expression following GR activation. By combining population genetics and molecular biology methods, we identified a variant (rs9493857 with marked allele frequency differences between populations of African and European ancestry and with a strong correlation between allele frequency and latitude in worldwide population samples. This SNP is located in a GR-binding region upstream of SGK1 that was identified using a GR ChIP-chip. SNP rs9493857 also lies within a predicted binding site for Oct1, a transcription factor known to cooperate with the GR in the transactivation of target genes. Using ChIP assays, we show that both GR and Oct1 bind to this region and that the ancestral allele at rs9493857 binds the GR-Oct1 complex more efficiently than the derived allele. Finally, using a reporter gene assay, we demonstrate that the ancestral allele is associated with increased glucocorticoid-dependent gene expression when compared to the derived allele. Our results suggest a novel paradigm in which hormonal responsiveness is modulated by sequence variation in the regulatory regions of nuclear receptor target genes. Identifying such functional variants may shed light on the mechanisms underlying inter-individual variation in response to environmental stressors and to hormonal therapy, as well as in the susceptibility to hormone-dependent diseases.

  14. Evaluation of bovine chemerin (RARRES2 gene variation on beef cattle production traits

    Amanda K Lindholm-Perry

    2012-03-01

    Full Text Available A previous study in cattle based on >48,000 markers identified markers on chromosome 4 near the chemerin gene associated with average daily feed intake (ADFI in steers (P<0.008. Chemerin is an adipokine associated with obesity and metabolic syndrome in humans, representing a strong candidate gene potentially underlying the observed association. To evaluate whether the bovine chemerin gene is involved in feed intake, 16 markers within and around the gene were tested for association in the same resource population. Eleven were nominally significant for ADFI (P<0.05 and two were significant after Bonferroni correction. Two and five SNP in this region were nominally significant for the related traits of average daily gain (ADG and residual feed intake (RFI, respectively. All markers were evaluated for effects on meat quality and carcass phenotypes. Many of the markers associated with ADFI were associated with hot carcass weight (HCW, adjusted fat thickness (AFT, and marbling (P<0.05. Marker alleles that were associated with lower ADFI were also associated with lower HCW, AFT, and marbling. Markers associated with ADFI were genotyped in a validation population of steers representing 14 breeds to determine predictive merit across populations. No consistent relationships for ADFI were detected. To determine whether cattle feed intake or growth phenotypes might be related to chemerin transcript abundance, the expression of chemerin was evaluated in adipose of 114 heifers that were siblings of the steers in the discovery population. Relative chemerin transcript abundance was not correlated with ADFI, ADG, or RFI, but associations with body condition score and yearling weight were observed. We conclude that variation in the chemerin gene may underlie observed association in the resource population, but that additional research is required to determine if this variation is widespread among breeds and to develop robust markers with predictive merit across

  15. The identification of additional zebrafish DICP genes reveals haplotype variation and linkage to MHC class I genes.

    Rodriguez-Nunez, Ivan; Wcisel, Dustin J; Litman, Ronda T; Litman, Gary W; Yoder, Jeffrey A

    2016-04-01

    Bony fish encode multiple multi-gene families of membrane receptors that are comprised of immunoglobulin (Ig) domains and are predicted to function in innate immunity. One of these families, the diverse immunoglobulin (Ig) domain-containing protein (DICP) genes, maps to three chromosomal loci in zebrafish. Most DICPs possess one or two Ig ectodomains and include membrane-bound and secreted forms. Membrane-bound DICPs include putative inhibitory and activating receptors. Recombinant DICP Ig domains bind lipids with varying specificity, a characteristic shared with mammalian CD300 and TREM family members. Numerous DICP transcripts amplified from different lines of zebrafish did not match the zebrafish reference genome sequence suggesting polymorphic and haplotypic variation. The expression of DICPs in three different lines of zebrafish has been characterized employing PCR-based strategies. Certain DICPs exhibit restricted expression in adult tissues whereas others are expressed ubiquitously. Transcripts of a subset of DICPs can be detected during embryonic development suggesting roles in embryonic immunity or other developmental processes. Transcripts representing 11 previously uncharacterized DICP sequences were identified. The assignment of two of these sequences to an unplaced genomic scaffold resulted in the identification of an alternative DICP haplotype that is linked to a MHC class I Z lineage haplotype on zebrafish chromosome 3. The linkage of DICP and MHC class I genes also is observable in the genomes of the related grass carp (Ctenopharyngodon idellus) and common carp (Cyprinus carpio) suggesting that this is a shared character with the last common Cyprinidae ancestor. PMID:26801775

  16. Common Variation in the DOPA Decarboxylase (DDC) Gene and Human Striatal DDC Activity In Vivo.

    Eisenberg, Daniel P; Kohn, Philip D; Hegarty, Catherine E; Ianni, Angela M; Kolachana, Bhaskar; Gregory, Michael D; Masdeu, Joseph C; Berman, Karen F

    2016-08-01

    The synthesis of multiple amine neurotransmitters, such as dopamine, norepinephrine, serotonin, and trace amines, relies in part on DOPA decarboxylase (DDC, AADC), an enzyme that is required for normative neural operations. Because rare, loss-of-function mutations in the DDC gene result in severe enzymatic deficiency and devastating autonomic, motor, and cognitive impairment, DDC common genetic polymorphisms have been proposed as a source of more moderate, but clinically important, alterations in DDC function that may contribute to risk, course, or treatment response in complex, heritable neuropsychiatric illnesses. However, a direct link between common genetic variation in DDC and DDC activity in the living human brain has never been established. We therefore tested for this association by conducting extensive genotyping across the DDC gene in a large cohort of 120 healthy individuals, for whom DDC activity was then quantified with [(18)F]-FDOPA positron emission tomography (PET). The specific uptake constant, Ki, a measure of DDC activity, was estimated for striatal regions of interest and found to be predicted by one of five tested haplotypes, particularly in the ventral striatum. These data provide evidence for cis-acting, functional common polymorphisms in the DDC gene and support future work to determine whether such variation might meaningfully contribute to DDC-mediated neural processes relevant to neuropsychiatric illness and treatment. PMID:26924680

  17. Natural variation and gene regulatory basis for the responses of asparagus beans to soil drought.

    Xu, Pei; Moshelion, Menachem; Wu, XiaoHua; Halperin, Ofer; Wang, BaoGen; Luo, Jie; Wallach, Rony; Wu, Xinyi; Lu, Zhongfu; Li, Guojing

    2015-01-01

    Asparagus bean (Vigna unguiculata ssp. sesquipedalis) is the Asian subspecies of cowpea, a drought-resistant legume crop native to Africa. In order to explore the genetic variation of drought responses in asparagus bean, we conducted multi-year phenotyping of drought resistance traits across the Chinese asparagus bean mini-core. The phenotypic distribution indicated that the ssp. sesquipedalis subgene pool has maintained high natural variation in drought responses despite known domestic bottleneck. Thirty-nine SNP loci were found to show an association with drought resistance via a genome-wide association study (GWAS). Whole-plant water relations were compared among four genotypes by lysimetric assay. Apparent genotypic differences in transpiration patterns and the critical soil water threshold in relation to dehydration avoidance were observed, indicating a delicate adaptive mechanism for each genotype to its own climate. Microarray gene expression analyses revealed that known drought resistance pathways such as the ABA and phosphate lipid signaling pathways are conserved between different genotypes, while differential regulation of certain aquaporin genes and hormonal genes may be important for the genotypic differences. Our results suggest that divergent sensitivity to soil water content is an important mechanism configuring the genotypic specific responses to water deficit. The SNP markers identified provide useful resources for marker-assisted breeding. PMID:26579145

  18. Natural variation and gene regulatory basis for the responses of asparagus beans to soil drought

    Pei eXu

    2015-10-01

    Full Text Available Asparagus bean (Vigna unguiculata ssp. sesquipedalis is the Asian subspecies of cowpea, a drought-resistant legume crop native to Africa. In order to explore the genetic variation of drought responses in asparagus bean, we conducted multi-year phenotyping of drought resistance traits across the Chinese asparagus bean mini-core. The phenotypic distribution indicated that the ssp. sesquipedalis subgene pool has maintained high natural variation in drought responses despite known domestic bottleneck. Thirty-nine SNP loci were found to show an association with drought resistance via a genome-wide association study (GWAS. Whole-plant water relations were compared among four genotypes by lysimetric assay. Apparent genotypic differences in transpiration patterns and the critical soil water threshold in relation to dehydration avoidance were observed, indicating a delicate adaptive mechanism for each genotype to its own climate. Microarray gene expression analyses revealed that known drought resistance pathways such as the ABA and phosphate lipid signaling pathways are conserved between genotypes, while differential regulation of certain aquaporin genes and hormonal genes may be important for the genotypic differences. Our results suggest that divergent sensitivity to soil water content is an important mechanism configuring the genotypic specific responses to water deficit. The SNP markers identified provide useful resources for marker-assisted breeding.

  19. The Role of Genetic Variation in the Lamin A/C Gene in the Etiology of Polycystic Ovary Syndrome

    Urbanek, Margrit; Nampiaparampil, Geetha; D'Souza, Janine; Sefton, Elizabeth; Ackerman, Christine; Legro, Richard S.; Dunaif, Andrea

    2009-01-01

    Objective: We performed this study to test the hypothesis that variation in the lamin a/c gene (LMNA) contributes to milder phenotypes of insulin resistance, hyperandrogenism, and/or metabolic syndrome associated with polycystic ovary syndrome (PCOS).

  20. Evaluando el rendimiento académico

    Correa, Adriana; Chahar, Berta; Nieva, María Esther; Figueroa, Gregorio; Gallo, Ricardo Raúl; Holgado, Lisa

    2009-01-01

    En las universidades la deserción estudiantil ha originado numerosos estudios y no pocos debates. El informe de la Comisión ad hoc (2005) de la UNT, revela excesiva permanencia y alta deserción. En una primera etapa, se analizó el rendimiento académico en el ciclo básico de la Facultad de Bioquímica de la UNT (Correa Zeballos, Chahar, Holgado, Figueroa, Sued, Nieva, 2006) identificándose factores asociados a esta problemática. En una segunda etapa se plantea como objetivo mostrar una metodolo...

  1. Neandertal origin of genetic variation at the cluster of OAS immunity genes.

    Mendez, Fernando L; Watkins, Joseph C; Hammer, Michael F

    2013-04-01

    Analyses of ancient DNA from extinct humans reveal signals of at least two independent hybridization events in the history of non-African populations. To date, there are very few examples of specific genetic variants that have been rigorously identified as introgressive. Here, we survey DNA sequence variation in the OAS gene cluster on chromosome 12 and provide strong evidence that a haplotype extending for ~185 kb introgressed from Neandertals. This haplotype is nearly restricted to Eurasians and is estimated to have diverged from the Neandertal sequence ~125 kya. Despite the potential for novel functional variation, the observed frequency of this haplotype is consistent with neutral introgression. This is the second locus in the human genome, after STAT2, carrying distinct haplotypes that appear to have introgressed separately from both Neandertals and Denisova. PMID:23315957

  2. Effects of sequence variation on differential allelic transcription factor occupancy and gene expression.

    Reddy, Timothy E; Gertz, Jason; Pauli, Florencia; Kucera, Katerina S; Varley, Katherine E; Newberry, Kimberly M; Marinov, Georgi K; Mortazavi, Ali; Williams, Brian A; Song, Lingyun; Crawford, Gregory E; Wold, Barbara; Willard, Huntington F; Myers, Richard M

    2012-05-01

    A complex interplay between transcription factors (TFs) and the genome regulates transcription. However, connecting variation in genome sequence with variation in TF binding and gene expression is challenging due to environmental differences between individuals and cell types. To address this problem, we measured genome-wide differential allelic occupancy of 24 TFs and EP300 in a human lymphoblastoid cell line GM12878. Overall, 5% of human TF binding sites have an allelic imbalance in occupancy. At many sites, TFs clustered in TF-binding hubs on the same homolog in especially open chromatin. While genetic variation in core TF binding motifs generally resulted in large allelic differences in TF occupancy, most allelic differences in occupancy were subtle and associated with disruption of weak or noncanonical motifs. We also measured genome-wide differential allelic expression of genes with and without heterozygous exonic variants in the same cells. We found that genes with differential allelic expression were overall less expressed both in GM12878 cells and in unrelated human cell lines. Comparing TF occupancy with expression, we found strong association between allelic occupancy and expression within 100 bp of transcription start sites (TSSs), and weak association up to 100 kb from TSSs. Sites of differential allelic occupancy were significantly enriched for variants associated with disease, particularly autoimmune disease, suggesting that allelic differences in TF occupancy give functional insights into intergenic variants associated with disease. Our results have the potential to increase the power and interpretability of association studies by targeting functional intergenic variants in addition to protein coding sequences. PMID:22300769

  3. Variation in the human cannabinoid receptor CNR1 gene modulates gaze duration for happy faces

    Chakrabarti Bhismadev

    2011-06-01

    Full Text Available Abstract Background From an early age, humans look longer at preferred stimuli and also typically look longer at facial expressions of emotion, particularly happy faces. Atypical gaze patterns towards social stimuli are common in autism spectrum conditions (ASC. However, it is unknown whether gaze fixation patterns have any genetic basis. In this study, we tested whether variations in the cannabinoid receptor 1 (CNR1 gene are associated with gaze duration towards happy faces. This gene was selected because CNR1 is a key component of the endocannabinoid system, which is involved in processing reward, and in our previous functional magnetic resonance imaging (fMRI study, we found that variations in CNR1 modulate the striatal response to happy (but not disgust faces. The striatum is involved in guiding gaze to rewarding aspects of a visual scene. We aimed to validate and extend this result in another sample using a different technique (gaze tracking. Methods A total of 30 volunteers (13 males and 17 females from the general population observed dynamic emotional expressions on a screen while their eye movements were recorded. They were genotyped for the identical four single-nucleotide polymorphisms (SNPs in the CNR1 gene tested in our earlier fMRI study. Results Two SNPs (rs806377 and rs806380 were associated with differential gaze duration for happy (but not disgust faces. Importantly, the allelic groups associated with a greater striatal response to happy faces in the fMRI study were associated with longer gaze duration at happy faces. Conclusions These results suggest that CNR1 variations modulate the striatal function that underlies the perception of signals of social reward, such as happy faces. This suggests that CNR1 is a key element in the molecular architecture of perception of certain basic emotions. This may have implications for understanding neurodevelopmental conditions marked by atypical eye contact and facial emotion processing

  4. Assortative mating and gene flow generate clinal phenological variation in trees

    Soularue Jean-Paul

    2012-06-01

    Full Text Available Abstract Background On-going climate change is shifting the timing of bud burst (TBB of broad leaf and conifer trees in temperate areas, raising concerns about the abilities of natural populations to respond to these shifts. The level of expected evolutionary change depends on the level and distribution of genetic variation of TBB. While numerous experimental studies have highlighted the role of divergent selection in promoting clinal TBB differentiation, we explored whether the observed patterns of variation could be generated by the joint effects of assortative mating for TBB and gene flow among natural populations. We tested this hypothesis using an in silico approach based on quantitative genetic models. Results Our simulations showed that genetic clines can develop even without divergent selection. Assortative mating in association with environmental gradients substantially shifted the mean genetic values of populations. Owing to assortative mating, immigrant alleles were screened for proximal or distant populations depending on the strength of the environmental cline. Furthermore, we confirmed that assortative mating increases the additive genetic variance within populations. However, we observed also a rapid decline of the additive genetic variance caused by restricted gene flow between neighboring populations resulting from preferential matings between phenologically-matching phenotypes. Conclusions We provided evidence that the patterns of genetic variation of phenological traits observed in forest trees can be generated solely by the effects of assortative mating and gene flow. We anticipate that predicted temperature increases due to climate change will further enhance genetic differentiation across the landscape. These trends are likely to be reinforced or counteracted by natural selection if phenological traits are correlated to fitness.

  5. Genetic variation in bitter taste receptor genes influences the foraging behavior of plateau zokor (Eospalax baileyi).

    Zhao, Fang; Zhang, Tongzuo; Xie, Jiuxiang; Zhang, Shoudong; Nevo, Eviatar; Su, Jianping; Lin, Gonghua

    2016-04-01

    The ability to detect bitter tastes is important for animals; it can help them to avoid ingesting harmful substances. Bitter taste perception is mainly mediated by bitter taste receptor proteins, which are encoded by members of the Tas2r gene family and vary with the dietary preference of a specific species. Although individuals with different genotypes differ in bitterness recognition capability, little is known about the relationship between genetic variation and food selection tendencies at the intraspecific level. In this study, we examined the relationship between genotypes and diet in plateau zokor (Eospalax baileyi), a subterranean rodent endemic to the Qinghai-Tibet Plateau that caches food for the winter. We assayed the composition and taste profile of each plant contained in temporary caches and vicinity quadrats, which were representative of selected and available food, respectively. Bitter plant selection indices (E bitter) were estimated. We also sequenced 26 candidate Tas2r genes from zokors and determined their relationships with the E bitter of their caches. We identified four key results: (1) zokors varied considerably in both bitter food preference and Tas2r sequences; (2) five genes (zTas2r115,zTas2r119,zTas2r126,zTas2r134, and zTas2r136) exhibited allelic variation that was significantly associated with E bitter; (3) synonymous SNPs, nonsynonymous SNPs, and pseudogenization are involved in the genotype-phenotype relationship; (4) the minor genotypes of zTas2r115,zTas2r134, and zTas2r136 and the major genotypes of zTas2r119 and zTas2r126 cached more bitter plants. Our results link Tas2r variation with food selection behavior at the population level for the first time. PMID:27110349

  6. Sequence variation and differential splicing of the midgut cadherin gene in Trichoplusia ni.

    Zhang, Xin; Kain, Wendy; Wang, Ping

    2013-08-01

    The insect midgut cadherin serves as an important receptor for the Cry toxins from Bacillus thuringiensis (Bt). Variation of the cadherin in insect populations provides a genetic potential for development of cadherin-based Bt resistance in insect populations. Sequence analysis of the cadherin from the cabbage looper, Trichoplusia ni, together with cadherins from 18 other lepidopterans showed a similar phylogenetic relationship of the cadherins to the phylogeny of Lepidoptera. The midgut cadherin in three laboratory populations of T. ni exhibited high variability, although the resistance to Bt toxin Cry1Ac in the T. ni strain is not genetically associated with cadherin gene mutations. A total of 142 single nucleotide polymorphisms (SNPs) were identified in the cadherin cDNAs from the T. ni strains, including 20 missense mutations. In addition, insertion and deletion polymorphisms (indels) were also identified in the cadherin alleles in T. ni. More interestingly, the results from this study reveal that differential splicing of mRNA also occurs in the cadherin gene expression. Therefore, variation of the midgut cadherin in insects may not only be caused by cadherin gene mutations, but could also result from alternative splicing of its mRNA regulated by factors acting in trans. Analysis of cadherin gene alleles in F2, F3 and F4 progenies from the cross between the Cry1Ac resistant and the susceptible strain after consecutive selections with Cry1Ac for three generations showed that selection with Cry1Ac did not result in an increase of frequencies of the cadherin alleles originated from the resistant strain. PMID:23743444

  7. Gene regulatory variation mediates flowering responses to vernalization along an altitudinal gradient in Arabidopsis.

    Suter, Léonie; Rüegg, Marlene; Zemp, Niklaus; Hennig, Lars; Widmer, Alex

    2014-12-01

    Steep environmental gradients provide ideal settings for studies of potentially adaptive phenotypic and genetic variation in plants. The accurate timing of flowering is crucial for reproductive success and is regulated by several pathways, including the vernalization pathway. Among the numerous genes known to enable flowering in response to vernalization, the most prominent is FLOWERING LOCUS C (FLC). FLC and other genes of the vernalization pathway vary extensively among natural populations and are thus candidates for the adaptation of flowering time to environmental gradients such as altitude. We used 15 natural Arabidopsis (Arabidopsis thaliana) genotypes originating from an altitudinal gradient (800-2,700 m above sea level) in the Swiss Alps to test whether flowering time correlated with altitude under different vernalization scenarios. Additionally, we measured the expression of 12 genes of the vernalization pathway and its downstream targets. Flowering time correlated with altitude in a nonlinear manner for vernalized plants. Flowering time could be explained by the expression and regulation of the vernalization pathway, most notably by AGAMOUS LIKE19 (AGL19), FLOWERING LOCUS T (FT), and FLC. The expression of AGL19, FT, and VERNALIZATION INSENSITIVE3 was associated with altitude, and the regulation of MADS AFFECTING FLOWERING2 (MAF2) and MAF3 differed between low- and high-altitude genotypes. In conclusion, we found clinal variation across an altitudinal gradient both in flowering time and the expression and regulation of genes in the flowering time control network, often independent of FLC, suggesting that the timing of flowering may contribute to altitudinal adaptation. PMID:25339407

  8. Clinal variation at phenology-related genes in spruce: parallel evolution in FTL2 and Gigantea?

    Chen, Jun; Tsuda, Yoshiaki; Stocks, Michael; Källman, Thomas; Xu, Nannan; Kärkkäinen, Katri; Huotari, Tea; Semerikov, Vladimir L; Vendramin, Giovanni G; Lascoux, Martin

    2014-07-01

    Parallel clines in different species, or in different geographical regions of the same species, are an important source of information on the genetic basis of local adaptation. We recently detected latitudinal clines in SNPs frequencies and gene expression of candidate genes for growth cessation in Scandinavian populations of Norway spruce (Picea abies). Here we test whether the same clines are also present in Siberian spruce (P. obovata), a close relative of Norway spruce with a different Quaternary history. We sequenced nine candidate genes and 27 control loci and genotyped 14 SSR loci in six populations of P. obovata located along the Yenisei river from latitude 56°N to latitude 67°N. In contrast to Scandinavian Norway spruce that both departs from the standard neutral model (SNM) and shows a clear population structure, Siberian spruce populations along the Yenisei do not depart from the SNM and are genetically unstructured. Nonetheless, as in Norway spruce, growth cessation is significantly clinal. Polymorphisms in photoperiodic (FTL2) and circadian clock (Gigantea, GI, PRR3) genes also show significant clinal variation and/or evidence of local selection. In GI, one of the variants is the same as in Norway spruce. Finally, a strong cline in gene expression is observed for FTL2, but not for GI. These results, together with recent physiological studies, confirm the key role played by FTL2 and circadian clock genes in the control of growth cessation in spruce species and suggest the presence of parallel adaptation in these two species. PMID:24814465

  9. Variations of the perforin gene in patients with autoimmunity/lymphoproliferation and defective Fas function.

    Clementi, Rita; Chiocchetti, Annalisa; Cappellano, Giuseppe; Cerutti, Elisa; Ferretti, Massimo; Orilieri, Elisabetta; Dianzani, Irma; Ferrarini, Marina; Bregni, Marco; Danesino, Cesare; Bozzi, Valeria; Putti, Maria Caterina; Cerutti, Franco; Cometa, Angela; Locatelli, Franco; Maccario, Rita; Ramenghi, Ugo; Dianzani, Umberto

    2006-11-01

    Mutations decreasing function of the Fas death receptor cause the autoimmune lymphoproliferative syndrome (ALPS) with autoimmune manifestations, spleen/lymph node enlargement, and expansion of CD4/CD8-negative T cells. Dianzani Autoimmune Lymphoproliferative Disease (DALD) is a variant lacking this expansion. Perforin is involved in cell-mediated cytotoxicity and its biallelic mutations cause familial hemophagocytic lymphohistiocytosis (HLH). We previously described an ALPS patient carrying heterozygous mutations of the Fas and perforin genes and suggested that they concurred in ALPS. This work extends the analysis to 14 ALPS, 28 DALD, and 816 controls, and detects an N252S amino acid substitution in 2 ALPS, and an A91V amino acid substitution in 6 DALD. N252S conferred an OR = 62.7 (P = .0016) for ALPS and A91V conferred an OR = 3 (P = .016) for DALD. Copresence of A91V and variations of the osteopontin gene previously associated with DALD conferred an OR = 17 (P = .0007) for DALD. In one N252S patient, NK activity was strikingly defective in early childhood, but became normal in late childhood. A91V patients displayed lower NK activity than controls. These data suggest that perforin variations are a susceptibility factor for ALPS/DALD development in subjects with defective Fas function and may influence disease expression. PMID:16720836

  10. Allelic variation of bile salt hydrolase genes in Lactobacillus salivarius does not determine bile resistance levels.

    Fang, Fang

    2009-09-01

    Commensal lactobacilli frequently produce bile salt hydrolase (Bsh) enzymes whose roles in intestinal survival are unclear. Twenty-six Lactobacillus salivarius strains from different sources all harbored a bsh1 allele on their respective megaplasmids. This allele was related to the plasmid-borne bsh1 gene of the probiotic strain UCC118. A second locus (bsh2) was found in the chromosomes of two strains that had higher bile resistance levels. Four Bsh1-encoding allele groups were identified, defined by truncations or deletions involving a conserved residue. In vitro analyses showed that this allelic variation was correlated with widely varying bile deconjugation phenotypes. Despite very low activity of the UCC118 Bsh1 enzyme, a mutant lacking this protein had significantly lower bile resistance, both in vitro and during intestinal transit in mice. However, the overall bile resistance phenotype of this and other strains was independent of the bsh1 allele type. Analysis of the L. salivarius transcriptome upon exposure to bile and cholate identified a multiplicity of stress response proteins and putative efflux proteins that appear to broadly compensate for, or mask, the effects of allelic variation of bsh genes. Bsh enzymes with different bile-degrading kinetics, though apparently not the primary determinants of bile resistance in L. salivarius, may have additional biological importance because of varying effects upon bile as a signaling molecule in the host.

  11. Variation in the oxytocin receptor gene is associated with behavioral and neural correlates of empathic accuracy

    Hartwig Roman Siebner

    2014-12-01

    Full Text Available The neuromodulators oxytocin and serotonin have been implicated in regulating affective processes underlying empathy. Understanding this dependency, however, has been limited by a lack of objective metrics for measuring empathic performance. Here we employ a novel psychophysical method for measuring empathic performance that quantitatively measures the ability of subjects to decode the experience of another person’s pain. In 50 female subjects, we acquired functional magnetic resonance imaging data as they were exposed to a target subject experiencing variable degrees of pain, whilst performing an irrelevant attention-demanding task. We investigated the effect of variation in the oxytocin receptor gene (OXTR and the serotonin transporter gene (SLC6A4 on the psychophysical and neurometric variability associated with empathic performance. The OXTR rs2268498 and rs53576 polymorphisms, but not the SLC6A4 5-HTTLPR, were associated with significant differences in empathic accuracy, with CC- and AA-carriers, respectively, displaying higher empathic accuracy. For OXTR rs2268498 there was also a genotype difference in the correlation between empathic accuracy and activity in the superior temporal sulcus (STS. In OXTR rs2268498 CC-carriers, high empathic accuracy was associated with stronger responsiveness of the right STS to the observed pain. Together, the results show that genetic variation in the OXTR has significant influence on empathic accuracy and that this may be linked to variable responsivity of the STS.

  12. Genetic variation and population structure of interleukin genes among seven ethnic populations from Karnataka, India

    Srilakshmi M. Raj; Diddahally R. Govindaraju; Ranajit Chakraborty

    2007-12-01

    The extent of genetic variation and the degree of genetic differentiation among seven ethnic populations from Karnataka, India (Bunt, Havyak, Iyengar, Lingayath, Smartha, Vaishya, Vokkaliga), was investigated using four single nucleotide polymorphisms (SNPs: IL-1A 4845, IL-1B 3954, IL-1B 511 and IL-1RA 2018) of the interleukin gene cluster. Allele frequencies varied by threefold among these populations, which also differed for gene diversity and heterozygosity levels. The average degree of population subdivision among these castes was low ($F_{ST} = 0.02$). However, pair-wise interpopulation differentiation ranged from 0–7%, indicating no detectable differentiation to moderate differentiation between specific populations. The results of phylogenetic analysis based on genetic distances between populations agreed with known social and cultural data on these ethnic groups. Variation in the allele frequencies, as well as differentiation, may be attributed to differential selection and demographic factors including consanguinity among the ethnic groups. Information on the distribution of functionally relevant polymorphisms among ethnic populations may be important towards developing community medicine and public health policies.

  13. Nucleotide variation at the dopa decarboxylase (Ddc) gene in natural populations of Drosophila melanogaster

    Andrey Tatarenkov; Francisco J. Ayala

    2007-08-01

    We studied nucleotide sequence variation at the gene coding for dopa decarboxylase (Ddc) in seven populations of Drosophila melanogaster. Strength and pattern of linkage disequilibrium are somewhat distinct in the extensively sampled Spanish and Raleigh populations. In the Spanish population, a few sites are in strong positive association, whereas a large number of sites in the Raleigh population are associated nonrandomly but the association is not strong. Linkage disequilibrium analysis shows presence of two groups of haplotypes in the populations, each of which is fairly diverged, suggesting epistasis or inversion polymorphism. There is evidence of two forms of natural selection acting on Ddc. The McDonald–Kreitman test indicates a deficit of fixed amino acid differences between D. melanogaster and D. simulans, which may be due to negative selection. An excess of derived alleles at high frequency, significant according to the -test, is consistent with the effect of hitchhiking. The hitchhiking may have been caused by directional selection downstream of the locus studied, as suggested by a gradual decrease of the polymorphism-to-divergence ratio. Altogether, the Ddc locus exhibits a complicated pattern of variation apparently due to several evolutionary forces. Such a complex pattern may be a result of an unusually high density of functionally important genes.

  14. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk

    Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P.; Lawrenson, Kate; Dennis, Joe; Amankwah, Ernest K.; Qu, Xiaotao; Tsai, Ya-Yu; Jim, Heather S. L.; Chen, Zhihua; Chen, Ann Y.; Permuth-Wey, Jennifer; Aben, Katja KH.; Anton-Culver, Hoda; Antonenkova, Natalia; Bruinsma, Fiona; Bandera, Elisa V.; Bean, Yukie T.; Beckmann, Matthias W.; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A.; Brooks-Wilson, Angela; Bunker, Clareann H.; Butzow, Ralf; Campbell, Ian G.; Carty, Karen; Chang-Claude, Jenny; Cook, Linda S.; Cramer, Daniel W.; Cunningham, Julie M.; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; du Bois, Andreas; Despierre, Evelyn; Dicks, Ed; Doherty, Jennifer A.; Dörk, Thilo; Dürst, Matthias; Easton, Douglas F.; Eccles, Diana M.; Edwards, Robert P.; Ekici, Arif B.; Fasching, Peter A.; Fridley, Brooke L.; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G.; Glasspool, Rosalind; Goodman, Marc T.; Gronwald, Jacek; Harrington, Patricia; Harter, Philipp; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A. T.; Hillemanns, Peter; Hogdall, Claus K.; Hogdall, Estrid; Hosono, Satoyo; Jakubowska, Anna; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y.; Kelemen, Linda E.; Kellar, Mellissa; Kiemeney, Lambertus A.; Krakstad, Camilla; Kjaer, Susanne K.; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D.; Lee, Alice W.; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A.; Liang, Dong; Lim, Boon Kiong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F. A. G.; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R.; McNeish, Iain; Menon, Usha; Milne, Roger L.; Modugno, Francesmary; Moysich, Kirsten B.; Ness, Roberta B.; Nevanlinna, Heli; Eilber, Ursula; Odunsi, Kunle; Olson, Sara H.; Orlow, Irene; Orsulic, Sandra; Weber, Rachel Palmieri; Paul, James; Pearce, Celeste L.; Pejovic, Tanja; Pelttari, Liisa M.; Pike, Malcolm C.; Poole, Elizabeth M.; Risch, Harvey A.; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H.; Rudolph, Anja; Runnebaum, Ingo B.; Rzepecka, Iwona K.; Salvesen, Helga B.; Schernhammer, Eva; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B.; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C.; Spiewankiewicz, Beata; Sucheston, Lara; Teo, Soo-Hwang; Terry, Kathryn L.; Thompson, Pamela J.; Thomsen, Lotte; Tangen, Ingvild L.; Tworoger, Shelley S.; van Altena, Anne M.; Vierkant, Robert A.; Vergote, Ignace; Walsh, Christine S.; Wang-Gohrke, Shan; Wentzensen, Nicolas; Whittemore, Alice S.; Wicklund, Kristine G.; Wilkens, Lynne R.; Wu, Anna H.; Wu, Xifeng; Woo, Yin-Ling; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Hasmad, Hanis N.; Berchuck, Andrew; Iversen, Edwin S.; Schildkraut, Joellen M.; Ramus, Susan J.; Goode, Ellen L.; Monteiro, Alvaro N. A.; Gayther, Simon A.; Narod, Steven A.; Pharoah, Paul D. P.; Sellers, Thomas A.; Phelan, Catherine M.

    2015-01-01

    Background Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC), we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk. Methods In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC). Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS). SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons. Results The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020); this SNP was also associated with the borderline/low malignant potential (LMP) tumors (P = 0.021). Other genes significantly associated with EOC histological subtypes (p<0.05) included the UGT1A (endometrioid), SLC25A45 (mucinous), SLC39A11 (low malignant potential), and SERPINA7 (clear cell carcinoma). In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A) were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4). Conclusion These results, generated on a large cohort of women, revealed associations

  15. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC Risk.

    Ganna Chornokur

    Full Text Available Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC, we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk.In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC. Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS. SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons.The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020; this SNP was also associated with the borderline/low malignant potential (LMP tumors (P = 0.021. Other genes significantly associated with EOC histological subtypes (p<0.05 included the UGT1A (endometrioid, SLC25A45 (mucinous, SLC39A11 (low malignant potential, and SERPINA7 (clear cell carcinoma. In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4.These results, generated on a large cohort of women, revealed associations between inherited cellular

  16. Identification of additive, dominant, and epistatic variation conferred by key genes in cellulose biosynthesis pathway in Populus tomentosa

    Du, Qingzhang; Tian, Jiaxing; Yang, Xiaohui; Pan, Wei; Xu, Baohua; Li, Bailian; Pär K Ingvarsson; Zhang, Deqiang

    2015-01-01

    Economically important traits in many species generally show polygenic, quantitative inheritance. The components of genetic variation (additive, dominant and epistatic effects) of these traits conferred by multiple genes in shared biological pathways remain to be defined. Here, we investigated 11 full-length genes in cellulose biosynthesis, on 10 growth and wood-property traits, within a population of 460 unrelated Populus tomentosa individuals, via multi-gene association. To validate positiv...

  17. Exploiting CpG hypermutability to identify phenotypically significant variation within human protein-coding genes.

    Ying, Hua; Huttley, Gavin

    2011-01-01

    The CpG dinucleotide is disproportionately represented in human genetic variation due to the hypermutability of 5-methyl-cytosine (5mC). We exploit this hypermutability and a novel codon substitution model to identify candidate functionally important exonic nucleotides. Population genetic theory suggests that codon positions with high cross-species CpG frequency will derive from stronger purifying selection. Using the phylogeny-based maximum likelihood inference framework, we applied codon substitution models with context-dependent parameters to measure the mutagenic and selective processes affecting CpG dinucleotides within exonic sequence. The suitability of these models was validated on >2,000 protein coding genes from a naturally occurring biological control, four yeast species that do not methylate their DNA. As expected, our analyses of yeast revealed no evidence for an elevated CpG transition rate or for substitution suppression affecting CpG-containing codons. Our analyses of >12,000 protein-coding genes from four primate lineages confirm the systemic influence of 5mC hypermutability on the divergence of these genes. After adjusting for confounding influences of mutation and the properties of the encoded amino acids, we confirmed that CpG-containing codons are under greater purifying selection in primates. Genes with significant evidence of enhanced suppression of nonsynonymous CpG changes were also shown to be significantly enriched in Online Mendelian Inheritance in Man. We developed a method for ranking candidate phenotypically influential CpG positions in human genes. Application of this method indicates that of the ∼1 million exonic CpG dinucleotides within humans, ∼20% are strong candidates for both hypermutability and disease association. PMID:21398426

  18. Evaluating of VDR Gene Variation and its Interaction with Immune Regulatory Molecules in Osteoporosis

    A Hossein-nezhad

    2009-06-01

    Full Text Available "nBackground: To evaluate VDR gene variation and its interaction with immune regulatory molecules in osteoporosis."nMethods: Totally 205 pre and postmenopausal women were recruited in the study. After an overnight fast, peripheral blood was taken and centrifuged to sprat serum for measurement of serum parathyroid hormone, 25 hydroxyvitamin D, osteocal­cin and cross laps. The FokI polymorphism in exon 2 of the VDR gene was detected by PCR-RFLP. Expression of osteopro­tegrin, vitamin D receptor (VDR and β-actin genes were quantified by quantitative real-time reverse transcriptase. To design the experimental model we randomly selected five participants of each genotype groups. PBMC were cultured and induced with vitamin D. At several times, cells were harvested and total RNA was extracted .Then expression of target genes evaluated by real time PCR."nResults: The frequencies of Ff, FF and ff genotypes were 34.2%, 56.5% and 9.2%. The mean of bone mineral density in FF genotype was higher than other genotypes. Also in this genotype, mean of serum inflammatory cytokines was lower than other genotypes. The expressions of the VDR and osteoprotegrin were up regulated by 1, 25(OH2D3 in PBMC from participants with FF genotype. PBMC from healthy control comparison to osteoporotic patients had a clearly better response to vitamin D3 incubation."nConclusion: Inflammation may important role in osteoporosis whereas osteoporotic patients have elevated pro-inflamma­tory profile. This cytokine profile and gene expressions of VDR and Osteoprotegrin were different in VDR genotype groups.  

  19. Variation in the autism candidate gene GABRB3 modulates tactile sensitivity in typically developing children

    Tavassoli Teresa

    2012-07-01

    Full Text Available Abstract Background Autism spectrum conditions have a strong genetic component. Atypical sensory sensitivities are one of the core but neglected features of autism spectrum conditions. GABRB3 is a well-characterised candidate gene for autism spectrum conditions. In mice, heterozygous Gabrb3 deletion is associated with increased tactile sensitivity. However, no study has examined if tactile sensitivity is associated with GABRB3 genetic variation in humans. To test this, we conducted two pilot genetic association studies in the general population, analysing two phenotypic measures of tactile sensitivity (a parent-report and a behavioural measure for association with 43 SNPs in GABRB3. Findings Across both tactile sensitivity measures, three SNPs (rs11636966, rs8023959 and rs2162241 were nominally associated with both phenotypes, providing a measure of internal validation. Parent-report scores were nominally associated with six SNPs (P Conclusions This is the first human study to show an association between GABRB3 variation and tactile sensitivity. This provides support for the evidence from animal models implicating the role of GABRB3 variation in the atypical sensory sensitivity in autism spectrum conditions. Future research is underway to directly test this association in cases of autism spectrum conditions.

  20. SNP variation in ADRB3 gene reflects the breed difference of sheep populations.

    Wu, Jianliang; Qiao, Liying; Liu, Jianhua; Yuan, Yanan; Liu, Wenzhong

    2012-08-01

    The β3-adrenergic receptor (ADRB3), a G-protein coupled receptor, plays a major role in energy metabolism and regulation of lipolysis and homeostasis. We detect the single nucleotide polymorphism (SNP) variation in full-length sequence of ovine ADRB3 gene in 12 domestic sheep populations within four types by polymerase chain reaction-single strand conformation polymorphism and sequencing to reveal the breed difference. Twenty-two SNPs, 12 of which in the exon 1 and ten in the intron, were detected, and 12 new exonic and four new intronic SNPs were found. Most SNPs presented in Shanxi Dam Line and least ones in Dorset. The average SNP number in both meat and dual purpose for meat and wool breeds was significantly higher than general and dual purpose breeds for wool and meat. Frequency of each SNP in studied breeds or types was different. The 18C Del and 1617T Ins majorly existed in dual purpose breeds for wool and meat. The 25A Del, 119C>G and 130C>T were mostly found in the meat and dual purpose for meat and wool breeds. The 1764C>A more frequently presented in meat than in other types. The majority of variations came from within the populations as suggested by analysis of molecular variance. Close relationship presented among the Chinese and western breeds, respectively. In conclusion, SNPs of ovine ADRB3 gene can reflect the breed difference and within- and between-population variations, and to a great extent, the breed relationship. PMID:22711302

  1. Mentalidades de gobierno, subjetividad y conocimiento académico: nuevas formas de gobierno de la producción de conocimiento académico en la universidad pública española

    Reyes Lara, Daniel

    2012-01-01

    Este trabajo es acerca de los cambios en el Gobierno de la producción de conocimiento académico y su relación con los procesos de formación de subjetividades, que suponen la aplicación de las reformas universitarias en el sistema universitario español para la integración del Espacio Europeo de Educación Superior. A partir de una descripción sobre las condiciones actuales de la producción de conocimiento académico, plantea la revisión del curso del proceso Bolonia desde una perspectiva gene...

  2. Stage-specific effects of candidate heterochronic genes on variation in developmental time along an altitudinal cline of Drosophila melanogaster.

    Julián Mensch

    Full Text Available BACKGROUND: Previously, we have shown there is clinal variation for egg-to-adult developmental time along geographic gradients in Drosophila melanogaster. Further, we also have identified mutations in genes involved in metabolic and neurogenic pathways that affect development time (heterochronic genes. However, we do not know whether these loci affect variation in developmental time in natural populations. METHODOLOGY/PRINCIPAL FINDINGS: Here, we constructed second chromosome substitution lines from natural populations of Drosophila melanogaster from an altitudinal cline, and measured egg-adult development time for each line. We found not only a large amount of genetic variation for developmental time, but also positive associations of the development time with thermal amplitude and altitude. We performed genetic complementation tests using substitution lines with the longest and shortest developmental times and heterochronic mutations. We identified segregating variation for neurogenic and metabolic genes that largely affected the duration of the larval stages but had no impact on the timing of metamorphosis. CONCLUSIONS/SIGNIFICANCE: Altitudinal clinal variation in developmental time for natural chromosome substitution lines provides a unique opportunity to dissect the response of heterochronic genes to environmental gradients. Ontogenetic stage-specific variation in invected, mastermind, cricklet and CG14591 may affect natural variation in development time and thermal evolution.

  3. Genetic Variation Analyses of nsp2 Gene of PRRSV in Ningxia Hui Autonomous Region of China

    Hong TIAN; Jing-yan WU; Shuang-hui YIN; You-jun SHANG; Zi-ping MAN; Na ZHAO; Ye JIN; Xiang-tao LIU

    2009-01-01

    To gain a better understanding of the genetic diversity and evolution of PRRSV in the Ningxia Hui Nationality Autonomous Region (Ningxia) of China, the nsp2 genes from a series of PRRSV strains collected from the region in 2007 were partially sequenced. These sequences were then analyzed along with the classical strain (ch-la) and two other epidemic strains SD (3) and SD2006. Comparison of the nucleotide sequence with ch-la indicated that nsp2 genes of seventeen Ningxia isolates (NX strain) have deletions of 87 nucleotides. Sequence analysis indicated that homology between the Ningxia strain and ch-la was 60.3%-79.9% in the nucleotide sequence, and homology between the NX strains and SD strains was 80.3%-98.8% in the nucleotide sequence. The nsp2 genes of the seventeen isolates had 74.9%-100% nucleotide sequence identities with each other. This study was undertaken to assess the regional variation of prevalent PRRSV and to establish a sequence database for PRRSV molecular epidemiological studies.

  4. Adaptive variation in beach mice produced by two interacting pigmentation genes.

    Cynthia C Steiner

    2007-09-01

    Full Text Available Little is known about the genetic basis of ecologically important morphological variation such as the diverse color patterns of mammals. Here we identify genetic changes contributing to an adaptive difference in color pattern between two subspecies of oldfield mice (Peromyscus polionotus. One mainland subspecies has a cryptic dark brown dorsal coat, while a younger beach-dwelling subspecies has a lighter coat produced by natural selection for camouflage on pale coastal sand dunes. Using genome-wide linkage mapping, we identified three chromosomal regions (two of major and one of minor effect associated with differences in pigmentation traits. Two candidate genes, the melanocortin-1 receptor (Mc1r and its antagonist, the Agouti signaling protein (Agouti, map to independent regions that together are responsible for most of the difference in pigmentation between subspecies. A derived mutation in the coding region of Mc1r, rather than change in its expression level, contributes to light pigmentation. Conversely, beach mice have a derived increase in Agouti mRNA expression but no changes in protein sequence. These two genes also interact epistatically: the phenotypic effects of Mc1r are visible only in genetic backgrounds containing the derived Agouti allele. These results demonstrate that cryptic coloration can be based largely on a few interacting genes of major effect.

  5. A Molecular Epidemiology Analysis of HIV in Shenzhen and HIV Env Gene Variation Replication Analysis

    CHEN Lin(陈琳); FENG Tiejian(冯铁建); LI Liangcheng(李良成); HE Jianfan(何建凡)

    2002-01-01

    Objective: To analyze molecular trends of the HIV epidemic in Shenzhen.Methods: Serum collected from Shenzhen AIDS patientsbetween 1992-1999 was analyzed using molecular techniques.DNA fragments of the HIV-1 Env gene were amplified bynested PCR from uncultured peripheral blood mononuclearcells (PBMCs) from these serum samples. The C2-C3 region ofthe Env gene was sequenced and analyzed. Specific high-riskbehaviors were also analyzed.Results: We found that the transmission of HIV in the citywas mainly through sexual behaviors (46.0%). There werefour HIV-1 subtypes: B', B, C and E with 6.31%, 7.95%,3.09% and 8.92% gene divergence inside each subtype inShenzhen. These results suggested that epidemic times were 6,8, 3 and 9 respectively. The main epidemic subtypes were Eand B strains. AIDS patient's antigenic variation was slightlyhigher than that of HIV infected individuals.Conclusion: Surveillance data reflect trends and theepidemic time of HIV, which will be useful for policy makersto formulate effective strategies of HIV/AIDS prevention andcontrol in Shenzhen.

  6. Gene

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  7. Personalidad y rendimiento académico

    Nácher Carda, Verónica

    1996-01-01

    Segones Jornades de Foment de la Investigació de la FCHS (Any 1996-1997) Cincuenta y siete sujetos (31 niños y 26 niñas) de 8º curso de E.G.B. participaron en un estudio diseñado para investigar la relación que existe entre personalidad y rendimiento académico. Para la evaluación de la personalidad se utilizó el cuestionario de personalidad EPQ-J de Eysenck. La evaluación del rendimiento se realizó a través de las calificaciones escolares del curso anterior: 7º de E.G.B. En genera...

  8. Genetic variation at hair length candidate genes in elephants and the extinct woolly mammoth

    Tisdale Michele

    2009-09-01

    Full Text Available Abstract Background Like humans, the living elephants are unusual among mammals in being sparsely covered with hair. Relative to extant elephants, the extinct woolly mammoth, Mammuthus primigenius, had a dense hair cover and extremely long hair, which likely were adaptations to its subarctic habitat. The fibroblast growth factor 5 (FGF5 gene affects hair length in a diverse set of mammalian species. Mutations in FGF5 lead to recessive long hair phenotypes in mice, dogs, and cats; and the gene has been implicated in hair length variation in rabbits. Thus, FGF5 represents a leading candidate gene for the phenotypic differences in hair length notable between extant elephants and the woolly mammoth. We therefore sequenced the three exons (except for the 3' UTR and a portion of the promoter of FGF5 from the living elephantid species (Asian, African savanna and African forest elephants and, using protocols for ancient DNA, from a woolly mammoth. Results Between the extant elephants and the mammoth, two single base substitutions were observed in FGF5, neither of which alters the amino acid sequence. Modeling of the protein structure suggests that the elephantid proteins fold similarly to the human FGF5 protein. Bioinformatics analyses and DNA sequencing of another locus that has been implicated in hair cover in humans, type I hair keratin pseudogene (KRTHAP1, also yielded negative results. Interestingly, KRTHAP1 is a pseudogene in elephantids as in humans (although fully functional in non-human primates. Conclusion The data suggest that the coding sequence of the FGF5 gene is not the critical determinant of hair length differences among elephantids. The results are discussed in the context of hairlessness among mammals and in terms of the potential impact of large body size, subarctic conditions, and an aquatic ancestor on hair cover in the Proboscidea.

  9. Genomic variation in the vomeronasal receptor gene repertoires of inbred mice

    Wynn Elizabeth H

    2012-08-01

    Full Text Available Abstract Background Vomeronasal receptors (VRs, expressed in sensory neurons of the vomeronasal organ, are thought to bind pheromones and mediate innate behaviours. The mouse reference genome has over 360 functional VRs arranged in highly homologous clusters, but the vast majority are of unknown function. Differences in these receptors within and between closely related species of mice are likely to underpin a range of behavioural responses. To investigate these differences, we interrogated the VR gene repertoire from 17 inbred strains of mice using massively parallel sequencing. Results Approximately half of the 6222 VR genes that we investigated could be successfully resolved, and those that were unambiguously mapped resulted in an extremely accurate dataset. Collectively VRs have over twice the coding sequence variation of the genome average; but we identify striking non-random distribution of these variants within and between genes, clusters, clades and functional classes of VRs. We show that functional VR gene repertoires differ considerably between different Mus subspecies and species, suggesting these receptors may play a role in mediating behavioural adaptations. Finally, we provide evidence that widely-used, highly inbred laboratory-derived strains have a greatly reduced, but not entirely redundant capacity for differential pheromone-mediated behaviours. Conclusions Together our results suggest that the unusually variable VR repertoires of mice have a significant role in encoding differences in olfactory-mediated responses and behaviours. Our dataset has expanded over nine fold the known number of mouse VR alleles, and will enable mechanistic analyses into the genetics of innate behavioural differences in mice.

  10. Novel sequence variations in LAMA2 and SGCG genes modulating cis-acting regulatory elements and RNA secondary structure

    Olfa Siala

    2010-01-01

    Full Text Available In this study, we detected new sequence variations in LAMA2 and SGCG genes in 5 ethnic populations, and analysed their effect on enhancer composition and mRNA structure. PCR amplification and DNA sequencing were performed and followed by bioinformatics analyses using ESEfinder as well as MFOLD software. We found 3 novel sequence variations in the LAMA2 (c.3174+22_23insAT and c.6085 +12delA and SGCG (c.*102A/C genes. These variations were present in 210 tested healthy controls from Tunisian, Moroccan, Algerian, Lebanese and French populations suggesting that they represent novel polymorphisms within LAMA2 and SGCG genes sequences. ESEfinder showed that the c.*102A/C substitution created a new exon splicing enhancer in the 3'UTR of SGCG genes, whereas the c.6085 +12delA deletion was situated in the base pairing region between LAMA2 mRNA and the U1snRNA spliceosomal components. The RNA structure analyses showed that both variations modulated RNA secondary structure. Our results are suggestive of correlations between mRNA folding and the recruitment of spliceosomal components mediating splicing, including SR proteins. The contribution of common sequence variations to mRNA structural and functional diversity will contribute to a better study of gene expression.

  11. Association of Variation in the MC4R Gene with Meat Quality Traits in a Commercial Pig Population

    Kwon, Kang; Cahyadi, Muhammad; Park, Hee–Bok; Seo, Dong Won; Jin, Shil; Kim, Sang–Wook; Choi, Yang–Il; Kim, Kwan Suk; Gotoh, Takafumi; Goto, Takafumi; Lee, Jun Heon

    2015-01-01

    The melanocortin–4 receptor (MC4R) gene is known to encode a membrane–bound receptor protein and is a member of the melanocortin receptor family of genes. In mammals, these genes are involved in energy homeostasis and in regulating feeding behavior and body weight. The objective of the present study was to examine if there were any associations between variations in the MC4R gene with meat quality traits in a commercial pig population in Korea. Among the total of 593 commercial pigs, sire inf...

  12. Uncovering Gene Regulatory Networks from Time-Series Microarray Data with Variational Bayesian Structural Expectation Maximization

    Huang Yufei

    2007-01-01

    Full Text Available We investigate in this paper reverse engineering of gene regulatory networks from time-series microarray data. We apply dynamic Bayesian networks (DBNs for modeling cell cycle regulations. In developing a network inference algorithm, we focus on soft solutions that can provide a posteriori probability (APP of network topology. In particular, we propose a variational Bayesian structural expectation maximization algorithm that can learn the posterior distribution of the network model parameters and topology jointly. We also show how the obtained APPs of the network topology can be used in a Bayesian data integration strategy to integrate two different microarray data sets. The proposed VBSEM algorithm has been tested on yeast cell cycle data sets. To evaluate the confidence of the inferred networks, we apply a moving block bootstrap method. The inferred network is validated by comparing it to the KEGG pathway map.

  13. Uncovering Gene Regulatory Networks from Time-Series Microarray Data with Variational Bayesian Structural Expectation Maximization

    Isabel Tienda Luna

    2007-06-01

    Full Text Available We investigate in this paper reverse engineering of gene regulatory networks from time-series microarray data. We apply dynamic Bayesian networks (DBNs for modeling cell cycle regulations. In developing a network inference algorithm, we focus on soft solutions that can provide a posteriori probability (APP of network topology. In particular, we propose a variational Bayesian structural expectation maximization algorithm that can learn the posterior distribution of the network model parameters and topology jointly. We also show how the obtained APPs of the network topology can be used in a Bayesian data integration strategy to integrate two different microarray data sets. The proposed VBSEM algorithm has been tested on yeast cell cycle data sets. To evaluate the confidence of the inferred networks, we apply a moving block bootstrap method. The inferred network is validated by comparing it to the KEGG pathway map.

  14. Considerations in the construction of an instrument to assess attitudes regarding critical illness gene variation research.

    Freeman, Bradley D; Kennedy, Carie R; Bolcic-Jankovic, Dragana; Eastman, Alexander; Iverson, Ellen; Shehane, Erica; Celious, Aaron; Barillas, Jennifer; Clarridge, Brian

    2012-02-01

    Clinical studies conducted in intensive care units are associated with logistical and ethical challenges. Diseases investigated are precipitous and life-threatening, care is highly technological, and patients are often incapacitated and decision-making is provided by surrogates. These investigations increasingly involve collection of genetic data. The manner in which the exigencies of critical illness impact attitudes regarding genetic data collection is unstudied. Given interest in understanding stakeholder preferences as a foundation for the ethical conduct of research, filling this knowledge gap is timely. The conduct of opinion research in the critical care arena is novel. This brief report describes the development of parallel patient/surrogate decision-maker quantitative survey instruments for use in this environment. Future research employing this instrument or a variant of it with diverse populations promises to inform research practices in critical illness gene variation research. PMID:22378135

  15. Plasma Fetuin-A concentration, genetic variation in the AHSG gene and risk of colorectal cancer

    Nimptsch, Katharina; Aleksandrova, Krasimira; Boeing, Heiner;

    2015-01-01

    women, 1.13 (1.00-1.27) for colon cancer and 1.12 (0.94-1.32) for rectal cancer. To improve causal inference in a Mendelian Randomization approach, five tagging single nucleotide polymorphisms of the AHSG gene were genotyped in a subset of 456 case-control pairs. The AHSG allele-score explained 21% of...... the interindividual variation in plasma fetuin-A concentrations. In instrumental variable analysis, genetically raised fetuin-A was not associated with colorectal cancer risk (relative risk per 40 µg/mL genetically determined higher fetuin-A was 0.98, 95% confidence interval: 0.73-1.33). The findings...... of our study indicate a modest linear association between fetuin-A concentrations and risk of colorectal cancer but suggest that fetuin-A may not be causally related to colorectal cancer development....

  16. Evidence that Natural Selection is the Primary Cause of the Guanine-cytosine Content Variation in Rice Genes

    Xiaoli Shi; Xiyin Wang; Zhe Li; Qihui Zhu; Ji Yang; Song Ge; Jingchu Luo

    2007-01-01

    Cereal genes are classified into two distinct classes according to the guanine-cytosine (GC) content at the third codon sites (GC3). Natural selection and mutation bias have been proposed to affect the GC content. However, there has been controversy about the cause of GC variation. Here, we characterized the GC content of 1 092 paralogs and other single-copy genes in the duplicated chromosomal regions of the rice genome (ssp. indica) and classified the paralogs into GC3-rich and GC3-poor groups. By referring to out-group sequences from Arabidopsis and maize, we confirmed that the average synonymous substitution rate of the GC3-rich genes is significantly lower than that of the GC3-poor genes. Furthermore,we explored the other possible factors corresponding to the GC variation including the length of coding sequences, the number of exons in each gene, the number of genes in each family, the location of genes on chromosomes and the protein functions. Consequently, we propose that natural selection rather than mutation bias was the primary cause of the GC variation.

  17. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    DWINITA WIKAN UTAMI

    2011-09-01

    Full Text Available Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufipogon and CT13432 crossing. DNA of five rice lines were amplified using the spesific primer for Pi33, G1010. Amplification results purified through Exonuclease 1 and Shrimp Alkaline Phosphatase protocols. Labelling using fluorescent dyes done before sequencing nucleotide base using CEQ8000 instrument. The results showed that lines number 28 showed introgesion of the three control parent genome (subspecies of Indica, subspecies of Japonica, and O. rufipogon while the Lines number 79, 136, and 143 were identical to Indica genome. Strain number 195 was identical to Japonica genome. These broad genetic background lines promise as durable performance to attack the expansion of the dynamic nature of the pathogen to blast. The result of ortholog sequence analysis found conserved nucleotide base sequence (CAGCAGCC which involved in heterotrimeric G-protein group. This protein has role as plant receptor for recognizing pathogen elicitor in interaction of rice and blast pathogen.

  18. Capturing sequence variation among flowering-time regulatory gene homologs in the allopolyploid crop species Brassica napus.

    Schiessl, Sarah; Samans, Birgit; Hüttel, Bruno; Reinhard, Richard; Snowdon, Rod J

    2014-01-01

    Flowering, the transition from the vegetative to the generative phase, is a decisive time point in the lifecycle of a plant. Flowering is controlled by a complex network of transcription factors, photoreceptors, enzymes and miRNAs. In recent years, several studies gave rise to the hypothesis that this network is also strongly involved in the regulation of other important lifecycle processes ranging from germination and seed development through to fundamental developmental and yield-related traits. In the allopolyploid crop species Brassica napus, (genome AACC), homoeologous copies of flowering time regulatory genes are implicated in major phenological variation within the species, however the extent and control of intraspecific and intergenomic variation among flowering-time regulators is still unclear. To investigate differences among B. napus morphotypes in relation to flowering-time gene variation, we performed targeted deep sequencing of 29 regulatory flowering-time genes in four genetically and phenologically diverse B. napus accessions. The genotype panel included a winter-type oilseed rape, a winter fodder rape, a spring-type oilseed rape (all B. napus ssp. napus) and a swede (B. napus ssp. napobrassica), which show extreme differences in winter-hardiness, vernalization requirement and flowering behavior. A broad range of genetic variation was detected in the targeted genes for the different morphotypes, including non-synonymous SNPs, copy number variation and presence-absence variation. The results suggest that this broad variation in vernalization, clock and signaling genes could be a key driver of morphological differentiation for flowering-related traits in this recent allopolyploid crop species. PMID:25202314

  19. Capturing sequence variation among flowering-time regulatory gene homologues in the allopolyploid crop species Brassica napus

    Sarah eSchiessl

    2014-08-01

    Full Text Available Flowering, the transition from the vegetative to the generative phase, is a decisive time point in the lifecycle of a plant. Flowering is controlled by a complex network of transcription factors, photoreceptors, enzymes and miRNAs. In recent years, several studies gave rise to the hypothesis that this network is also strongly involved in the regulation of other important lifecycle processes ranging from germination and seed development through to fundamental developmental and yield-related traits. In the allopolyploid crop species Brassica napus, (genome AACC, homoeologous copies of flowering time regulatory genes are implicated in major phenological variation within the species, however the extent and control of intraspecific and intergenomic variation among flowering-time regulators is still unclear. To investigate differences among B. napus morphotypes in relation to flowering-time gene variation, we performed targeted deep sequencing of 29 regulatory flowering-time genes in four genetically and phenologically diverse B. napus accessions. The genotype panel included a winter-type oilseed rape, a winter fodder rape, a spring-type oilseed rape (all B. napus ssp. napus and a swede (B. napus ssp. napobrassica, which show extreme differences in winter-hardiness, vernalization requirement and flowering behaviour. A broad range of genetic variation was detected in the targeted genes for the different morphotypes, including non-synonymous SNPs, copy number variation and presence-absence variation. The results suggest that this broad variation in vernalisation, clock and signaling genes could be a key driver of morphological differentiation for flowering-related traits in this recent allopolyploid crop species.

  20. Gene-related strain variation of Staphylococcus aureus for homologous resistance response to acid stress.

    Lee, Soomin; Ahn, Sooyeon; Lee, Heeyoung; Kim, Won-Il; Kim, Hwang-Yong; Ryu, Jae-Gee; Kim, Se-Ri; Choi, Kyoung-Hee; Yoon, Yohan

    2014-10-01

    This study investigated the effect of adaptation of Staphylococcus aureus strains to the acidic condition of tomato in response to environmental stresses, such as heat and acid. S. aureus ATCC 13565, ATCC 14458, ATCC 23235, ATCC 27664, and NCCP10826 habituated in tomato extract at 35°C for 24 h were inoculated in tryptic soy broth. The culture suspensions were then subjected to heat challenge or acid challenge at 60°C and pH 3.0, respectively, for 60 min. In addition, transcriptional analysis using quantitative real-time PCR was performed to evaluate the expression level of acid-shock genes, such as clpB, zwf, nuoF, and gnd, from five S. aureus strains after the acid habituation of strains in tomato at 35°C for 15 min and 60 min in comparison with that of the nonhabituated strains. In comparison with the nonhabituated strains, the five tomato-habituated S. aureus strains did not show cross protection to heat, but tomato-habituated S. aureus ATCC 23235 showed acid resistance. In quantitative real-time-PCR analysis, the relative expression levels of acid-shock genes (clpB, zwf, nuoF, and gnd) were increased the most in S. aureus ATCC 23235 after 60 min of tomato habituation, but there was little difference in the expression levels among the five S. aureus strains after 15 min of tomato habituation. These results indicate that the variation of acid resistance of S. aureus is related to the expression of acid-shock genes during acid habituation. PMID:25285500

  1. Extensive sequence variation in rice blast resistance gene Pi54 makes it broad spectrum in nature

    Shallu eThakur

    2015-05-01

    Full Text Available Rice blast resistant gene, Pi54 cloned from rice line, Tetep, is effective against diverse isolates of Magnaporthe oryzae. In this study, we prospected the allelic variants of the dominant blast resistance gene from a set of 92 rice lines to determine the nucleotide diversity, pattern of its molecular evolution, phylogenetic relationships and evolutionary dynamics, and to develop allele specific markers. High quality sequences were generated for homologs of Pi54 gene. Using comparative sequence analysis, InDels of variable sizes in all the alleles were observed. Profiling of the selected sites of SNP (Single Nucleotide Polymorphism and amino acids (N sites ≥ 10 exhibited constant frequency distribution of mutational and substitutional sites between the resistance and susceptible rice lines, respectively. A total of 50 new haplotypes based on the nucleotide polymorphism was also identified. A unique haplotype (H_3 was found to be linked to all the resistant alleles isolated from indica rice lines. Unique leucine zipper and tyrosine sulfation sites were identified in the predicted Pi54 proteins. Selection signals were observed in entire coding sequence of resistance alleles, as compared to LRR domains for susceptible alleles. This is a maiden report of extensive variability of Pi54 alleles in different landraces and cultivated varieties, possibly, attributing broad-spectrum resistance to Magnaporthe oryzae. The sequence variation in two consensus region: 163 bp and 144 bp were used for the development of allele specific DNA markers. Validated markers can be used for the selection and identification of better allele(s and their introgression in commercial rice cultivars employing marker assisted selection.

  2. Clinical features associated with copy number variations of the 14q32 imprinted gene cluster.

    Rosenfeld, Jill A; Fox, Joyce E; Descartes, Maria; Brewer, Fallon; Stroud, Tracy; Gorski, Jerome L; Upton, Sheila J; Moeschler, John B; Monteleone, Berrin; Neill, Nicholas J; Lamb, Allen N; Ballif, Blake C; Shaffer, Lisa G; Ravnan, J Britt

    2015-02-01

    Uniparental disomy (UPD) for imprinted chromosomes can cause abnormal phenotypes due to absent or overexpression of imprinted genes. UPD(14)pat causes a unique constellation of features including thoracic skeletal anomalies, polyhydramnios, placentomegaly, and limited survival; its hypothesized cause is overexpression of paternally expressed RTL1, due to absent regulatory effects of maternally expressed RTL1as. UPD(14)mat causes a milder condition with hypotonia, growth failure, and precocious puberty; its hypothesized cause is absence of paternally expressed DLK1. To more clearly establish how gains and losses of imprinted genes can cause disease, we report six individuals with copy number variations of the imprinted 14q32 region identified through clinical microarray-based comparative genomic hybridization. Three individuals presented with UPD(14)mat-like phenotypes (Temple syndrome) and had apparently de novo deletions spanning the imprinted region, including DLK1. One of these deletions was shown to be on the paternal chromosome. Two individuals with UPD(14)pat-like phenotypes had 122-154kb deletions on their maternal chromosomes that included RTL1as but not the differentially methylated regions that regulate imprinted gene expression, providing further support for RTL1 overexpression as a cause for the UPD(14)pat phenotype. The sixth individual is tetrasomic for a 1.7Mb segment, including the imprinted region, and presents with intellectual disability and seizures but lacks significant phenotypic overlap with either UPD(14) syndrome. Therefore, the 14q32 imprinted region is dosage sensitive, with deletions of different critical regions causing UPD(14)mat- and UPD(14)pat-like phenotypes, while copy gains are likely insufficient to recapitulate these phenotypes. PMID:25756153

  3. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity

    Knoll, Nadja; Jarick, Ivonne; Volckmar, Anna-Lena; Klingenspor, Martin; Illig, Thomas; Grallert, Harald; Gieger, Christian; Wichmann, Heinz-Erich; Peters, Annette; Hebebrand, Johannes; Scherag, André; Hinney, Anke

    2013-01-01

    There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1) 16 nuclear regulators of mitochondrial genes, (2) 91 genes for oxidative phosphorylation and (3) 966 nuclear-encoded mitochondrial genes). Gene set enrichment analysis (GSEA) showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide assoc...

  4. CNTN6 copy number variations in 14 patients: a possible candidate gene for neurodevelopmental and neuropsychiatric disorders

    Hu, Jie; Liao, Jun; Sathanoori, Malini; Kochmar, Sally; Sebastian, Jessica; Yatsenko, Svetlana A.; Surti, Urvashi

    2015-01-01

    Background Neurodevelopmental disorders are impairments of brain function that affect emotion, learning, and memory. Copy number variations of contactin genes (CNTNs), including CNTN3, CNTN4, CNTN5, and CNTN6, have been suggested to be associated with these disorders. However, phenotypes have been reported in only a handful of patients with copy number variations involving CNTNs. Methods From January 2009 to January 2013, 3724 patients ascertained through the University of Pittsburgh Medical ...

  5. Polymorphisms in the WNK1 Gene Are Associated with Blood Pressure Variation and Urinary Potassium Excretion

    Newhouse, Stephen; Farrall, Martin; Wallace, Chris; Hoti, Mimoza; Burke, Beverley; Howard, Philip; Onipinla, Abiodun; Lee, Kate; Shaw-Hawkins, Sue; Dobson, Richard; Brown, Morris; Samani, Nilesh J.; Dominiczak, Anna F.; Connell, John M.; Lathrop, G. Mark; Kooner, Jaspal; Chambers, John; Elliott, Paul; Clarke, Robert; Collins, Rory; Laan, Maris; Org, Elin; Juhanson, Peeter; Veldre, Gudrun; Viigimaa, Margus; Eyheramendy, Susana; Cappuccio, Francesco P.; Ji, Chen; Iacone, Roberto; Strazzullo, Pasquale; Kumari, Meena; Marmot, Michael; Brunner, Eric; Caulfield, Mark; Munroe, Patricia B.

    2009-01-01

    WNK1 - a serine/threonine kinase involved in electrolyte homeostasis and blood pressure (BP) control - is an excellent candidate gene for essential hypertension (EH). We and others have previously reported association between WNK1 and BP variation. Using tag SNPs (tSNPs) that capture 100% of common WNK1 variation in HapMap, we aimed to replicate our findings with BP and to test for association with phenotypes relating to WNK1 function in the British Genetics of Hypertension (BRIGHT) study case-control resource (1700 hypertensive cases and 1700 normotensive controls). We found multiple variants to be associated with systolic blood pressure, SBP (7/28 tSNPs min-p = 0.0005), diastolic blood pressure, DBP (7/28 tSNPs min-p = 0.002) and 24 hour urinary potassium excretion (10/28 tSNPs min-p = 0.0004). Associations with SBP and urine potassium remained significant after correction for multiple testing (p = 0.02 and p = 0.01 respectively). The major allele (A) of rs765250, located in intron 1, demonstrated the strongest evidence for association with SBP, effect size 3.14 mmHg (95%CI:1.23–4.9), DBP 1.9 mmHg (95%CI:0.7–3.2) and hypertension, odds ratio (OR: 1.3 [95%CI: 1.0–1.7]).We genotyped this variant in six independent populations (n = 14,451) and replicated the association between rs765250 and SBP in a meta-analysis (p = 7×10−3, combined with BRIGHT data-set p = 2×10−4, n = 17,851). The associations of WNK1 with DBP and EH were not confirmed. Haplotype analysis revealed striking associations with hypertension and BP variation (global permutation p10 mmHg reduction) and risk for hypertension (OR<0.60). Our data indicates that multiple rare and common WNK1 variants contribute to BP variation and hypertension, and provide compelling evidence to initiate further genetic and functional studies to explore the role of WNK1 in BP regulation and EH. PMID:19347040

  6. Polymorphisms in the WNK1 gene are associated with blood pressure variation and urinary potassium excretion.

    Stephen Newhouse

    Full Text Available WNK1--a serine/threonine kinase involved in electrolyte homeostasis and blood pressure (BP control--is an excellent candidate gene for essential hypertension (EH. We and others have previously reported association between WNK1 and BP variation. Using tag SNPs (tSNPs that capture 100% of common WNK1 variation in HapMap, we aimed to replicate our findings with BP and to test for association with phenotypes relating to WNK1 function in the British Genetics of Hypertension (BRIGHT study case-control resource (1700 hypertensive cases and 1700 normotensive controls. We found multiple variants to be associated with systolic blood pressure, SBP (7/28 tSNPs min-p = 0.0005, diastolic blood pressure, DBP (7/28 tSNPs min-p = 0.002 and 24 hour urinary potassium excretion (10/28 tSNPs min-p = 0.0004. Associations with SBP and urine potassium remained significant after correction for multiple testing (p = 0.02 and p = 0.01 respectively. The major allele (A of rs765250, located in intron 1, demonstrated the strongest evidence for association with SBP, effect size 3.14 mmHg (95%CI:1.23-4.9, DBP 1.9 mmHg (95%CI:0.7-3.2 and hypertension, odds ratio (OR: 1.3 [95%CI: 1.0-1.7].We genotyped this variant in six independent populations (n = 14,451 and replicated the association between rs765250 and SBP in a meta-analysis (p = 7 x 10(-3, combined with BRIGHT data-set p = 2 x 10(-4, n = 17,851. The associations of WNK1 with DBP and EH were not confirmed. Haplotype analysis revealed striking associations with hypertension and BP variation (global permutation p10 mmHg reduction and risk for hypertension (OR<0.60. Our data indicates that multiple rare and common WNK1 variants contribute to BP variation and hypertension, and provide compelling evidence to initiate further genetic and functional studies to explore the role of WNK1 in BP regulation and EH.

  7. Phenotypic variations in a family with retinal dystrophy as result of different mutations in the ABCR gene

    Klevering, B; van Driel, M.; van de Pol, D. J R; Pinckers, A; Cremers, F; Hoyng, C.

    1999-01-01

    AIMS—To describe two phenotypic variations of autosomal recessive retinal dystrophy occurring in a consanguineous family in a pseudodominant pattern, resulting from mutations in the ATP binding cassette transporter (ABCR) gene.
METHODS—Patients of this family underwent an extensive ophthalmic evaluation, including fundus photography, fluorescein angiography, and electroretinography (ERG). Genetic analysis comprised sequence analysis of the retina specific ABCR gene.
RESULTS—Five patients pres...

  8. [Sequence variation of mitochondrial cytochrome b gene and phylogenetic relationships among twelve species of Charadriiformes].

    Chen, Xiao-Fang; Wang, Xiang; Yuan, Xiao-Dong; Tang, Min-Qian; Li, Yu-Xiang; Guo, Yu-Mei; Li, Qing-Wei

    2003-05-01

    Studies of the phylogenetic relationships of the Charadriiformes have been largely based on conservative morphological characters. During the past 10 years, many studies on the evolutionary biology of birds adopted phylogenetic information obtained from mitochondrial DNA, but few work on the Charadriiformes has been reported to date. Therefore, phylogenetic relationships and classification of the Charadriiformes remains controversial. In this study, we try to shed light on these relationships via DNA sequence analysis of the mitochondrial Cyt b gene in 12 species of Charadriiformes. It was a preliminary study of the origin and evolution of the species by using nucleotide sequence data. Using the well-known PCR techniques, the complete mitochondrial Cyt b gene sequences were amplified and sequenced respectively from Charadrius mongolus, Charadrius alexandrinus, Numenius madagascariensis, Numenius arquat, Numenius phaeopus, Tringa totanus, Tringa glareola, Xenus cineres, Arenaria interpres, Calidris tenuirostris, Recurvirostra avosetts and Haematopus ostralensis. The 1143 bp long DNA sequences of the gene from these species were obtained, in which 381 variable sites were identified without insertions or deletions. The nucleic acid sequence variation of the mitochondrial Cyt b gene was 5.16%-16.01% among these species. Phylogenetic trees constructed using the NJ method, MP method and ML method with Ciconia ciconia as the outgroup indicate that the 12 species of Charadriiformes examined in this study are clustered in two major clades. The first clade includes T. totanus, T. glareola, A. interpres, C. tenuirostris, X. cineres, N. madagascariensis, N. arquata and N. phaeopus. The second one includes C. mongolus, C. alexandrinus, R. avosetts and H. ostralensis. Our molecular data show that the phylogenetic relationships among species of Scolopacidae are consistent with the classification based on morphological studies; R. avosetts and H. ostralensis are relatively closer

  9. De académico o vernacular a lo vernacular y lo académico

    Ferrarese, José Francisco

    2007-01-01

    Existe un desarrollo paralelo entre el mobiliario, y objetos en general, fundamentado y producido académicamente y aquel producido y apropiado fuera de estos ámbitos. Ahora ¿cómo se da la evolución del mobiliario vernacular1 en paralelo a lo legitimado por vanguardias y la academia?, ¿cuál/es son los lineamientos para su creación y características? A partir del análisis, en principio de objetos situados en el living, que luego, por razones prácticas, se puntualizó en los sillones y aquello...

  10. Association of genetic variations of the prostasin gene with essential hypertension in the Xinjiang Kazakh population

    LI Nan-fang; ZHANG Ju-hong; CHANG Jian-hang; YANG Jin; WANG Hong-mei; ZHOU Ling; LUO Wen-li

    2011-01-01

    Background Transgenic overexpression of human prostasin in rats disturbs salt balance and causes hypertension. We investigated whether genetic variations in prostasin were implicated in hypertension or related phenotypes in the Xinjiang Kazakh population.Methods We sequenced all exons and the promoter regions of the prostasin gene in 94 hypertensive individuals, and the genotype identification was performed by the TaqMan polymerase chain reaction method. Case-control studies were conducted in 938 Kazakh subjects.Results E342K and 2827G>A, which are novel variants, were successfully genotyped in the general Xinjiang Kazakh population with a sample size of 938 individuals (406 men and 532 women). Only one hypertensive patient was identified with the E342K mutation. No significant association was observed between 2827G>A and hypertension. However,quantitative traits of hypertensive intermediate phenotypes were significantly associated with the A allele; P=-0.041 and 0.034 for body mass index (BMI) in the additive and recessive models, P=0.042 and 0.018 for OGTT-2h glucose in the additive and recessive models, P=0.031 for IRT-3h insulin in the recessive model, and P=0.038 for serum potassium in the dominant model.Conclusions This study does not provide evidence of a major role of prostasin variation in blood pressure modulation.However, association of prostasin polymorphisms with hypertension and metabolic effects can be observed in our population. Further investigation is warranted to clarify the relevance of prostasin polymorphisms to blood pressure regulation.

  11. Lack of sequence variation in sporadic bovine leucosis in regions of tumour suppressor genes p53 and p16.

    Mayr, B; Grüneis, C; Brem, G; Reifinger, M; Schaffner, G; Hochsteiner, W

    2001-08-01

    Regions of the promoter and exons 5-8 of the tumour suppressor gene p53 were analysed in 25 cases of sporadic bovine leucosis. The study included 17 cases of juvenile leucosis, five cases of adult leucosis and three cases of skin leucosis. Exon 2 of tumour suppressor gene p16 was also investigated in the same samples. No sequence variations were present in the analysed areas of the genes. In p53, this fact represents a clear difference in comparison with enzootic bovine leucosis. In p16, no comparative data are available. PMID:11554494

  12. Neuropeptide S receptor gene variation modulates anterior cingulate cortex Glx levels during CCK-4 induced panic.

    Ruland, Tillmann; Domschke, Katharina; Schütte, Valerie; Zavorotnyy, Maxim; Kugel, Harald; Notzon, Swantje; Vennewald, Nadja; Ohrmann, Patricia; Arolt, Volker; Pfleiderer, Bettina; Zwanzger, Peter

    2015-10-01

    An excitatory-inhibitory neurotransmitter dysbalance has been suggested in pathogenesis of panic disorder. The neuropeptide S (NPS) system has been implicated in modulating GABA and glutamate neurotransmission in animal models and to genetically drive altered fear circuit function and an increased risk of panic disorder in humans. Probing a multi-level imaging genetic risk model of panic, in the present magnetic resonance spectroscopy (MRS) study brain glutamate+glutamine (Glx) levels in the bilateral anterior cingulate cortex (ACC) during a pharmacological cholecystokinin tetrapeptide (CCK-4) panic challenge were assessed depending on the functional neuropeptide S receptor gene (NPSR1) rs324981 A/T variant in a final sample of 35 healthy male subjects. The subjective panic response (Panic Symptom Scale; PSS) as well as cortisol and ACTH levels were ascertained throughout the experiment. CCK-4 injection was followed by a strong panic response. A significant time×genotype interaction was detected (p=.008), with significantly lower ACC Glx/Cr levels in T allele carriers as compared to AA homozygotes 5min after injection (p=.003). CCK-4 induced significant HPA axis stimulation, but no effect of genotype was discerned. The present pilot data suggests NPSR1 gene variation to modulate Glx levels in the ACC during acute states of stress and anxiety, with blunted, i.e. possibly maladaptive ACC glutamatergic reactivity in T risk allele carriers. Our results underline the notion of a genetically driven rapid and dynamic response mechanism in the neural regulation of human anxiety and further strengthen the emerging role of the NPS system in anxiety. PMID:26235955

  13. Allelic variation in the squirrel monkey x-linked color vision gene: biogeographical and behavioral correlates.

    Cropp, Susan; Boinski, Sue; Li, Wen-Hsiung

    2002-06-01

    Most Neotropical primate species possess a polymorphic X-linked and a monomorphic autosomal color vision gene. Consequently, populations are composed of both dichromatics and trichromatics. Most theories on the maintenance of this genetic system revolve around possible advantages for foraging ecology. To examine the issue from a different angle, we compared the numbers and relative frequencies of alleles at the X-linked locus among three species of Saimiri representing a wide range of geographical and behavioral variation in the genus. Exons 3, 4, and 5 of the X-linked opsin gene were sequenced for a large number of X chromosomes for all three species. Several synonymous mutations were detected in exons 4 and 5 for the originally reported alleles but only a single nonsynonymous change was detected. Two alleles were found that appeared to be the result of recombination events. The low occurrence of recombinant alleles and absence of mutations in the amino acids critical for spectral tuning indicates that stabilizing selection acts to maintain the combinations of critical sites specific to each allele. Allele frequencies were approximately the same for all Saimiri species, with a slight but significant difference between S. boliviensis and S. oerstedii. No apparent correlation exists between allele frequencies and behavioral or biogeographical differences between species, casting doubt on the speculation that the spectral sensitivities of the alleles have been maintained because they are specifically well-tuned to Saimiri visual ecology. Rather, the spectral tuning peaks might have been maintained because they are as widely spaced as possible within the limited range of middlewave to longwave spectra useful to all primates. This arrangement creates a balance between maximizing the distance between spectral tuning peaks (allowing the color opponency of the visual system to distinguish between peaks) and maximizing the number of alleles within a limited range (yielding

  14. The association between common genetic variation in the FTO gene and metabolic syndrome in Han Chinese

    WANG Tong; ZHANG Li-li; ZHANG Yun; SUN Xiao-fang; ZHANG Qian; HUANG Yi; XIAO Xin-hua; WANG Duen-mei; DIAO Cheng-ming; ZHANG Feng; XU Ling-ling; ZHANG Yong-biao; LI Wen-hui

    2010-01-01

    Background Genome-wide association studies for type 2 diabetes mellitus (T2DM) identified FTO gene as a locus conferring increased risk for common obesity in many populations with European ancestry. However, the involvement of FTO gene in obesity or T2DM related metabolic traits has not been consistently established in Chinese populations. The objective of this study was to investigate the association of FTO genetic polymorphisms with metabolic syndrome (MetS) in Han Chinese.Methods We tested 41 FTO single nucleotide polymorphisms (SNPs) for association between FTO and MetS-related traits. There were a total of 236 unrelated subjects (108 cases and 128 controls), grouped according to the International Diabetes Federation (IDF) criteria.Results Of the 41 SNPs examined, only SNP rs8047395 exhibited statistical significance (P=0.026) under a recessive model, after Bonferroni adjustment for multiple testing (OR 1.64, 95% CI 1.11-2.42; P=0.014). The common distributions of this polymorphism among Chinese-with a minor allele frequency (MAF) of 36% in the control group versus 48% in the MetS group-greatly improved our test power in a relatively small sample size for an association study. Previously identified obesity-(or T2DM-) associated FTO SNPs were less common in Han Chinese and were not associated with MetS in this study. No significant associations were found between our FTO SNPs and any endophenotypes of MetS.Conclusions A more common risk-conferring variant of FTO for MetS was identified in Han Chinese. Our study substantiated that genetic variations in FTO locus are involved in the pathogenesis of MetS.

  15. Gene structure variation in segmental duplication block C of human chromosome 7q 11.23 during primate evolution.

    Kim, Yun-Ji; Ahn, Kung; Gim, Jeong-An; Oh, Man Hwan; Han, Kyudong; Kim, Heui-Soo

    2015-12-01

    Segmental duplication, or low-copy repeat (LCR) event, occurs during primate evolution and is an important source of genomic diversity, including gain or loss of gene function. The human chromosome 7q 11.23 is related to the William-Beuren syndrome and contains large region-specific LCRs composed of blocks A, B, and C that have different copy numbers in humans and different primates. We analyzed the structure of POM121, NSUN5, FKBP6, and TRIM50 genes in the LCRs of block C. Based on computational analysis, POM121B created by a segmental duplication acquired a new exonic region, whereas NSUN5B (NSUN5C) showed structural variation by integration of HERV-K LTR after duplication from the original NSUN5 gene. The TRIM50 gene originally consists of seven exons, whereas the duplicated TRIM73 and TRIM74 genes present five exons because of homologous recombination-mediated deletion. In addition, independent duplication events of the FKBP6 gene generated two pseudogenes at different genomic locations. In summary, these clustered genes are created by segmental duplication, indicating that they show dynamic evolutionary events, leading to structure variation in the primate genome. PMID:26196062

  16. Natural variation in rosette size under salt stress conditions corresponds to developmental differences between Arabidopsis accessions and allelic variation in the LRR-KISS gene

    Julkowska, Magdalena M.

    2016-02-11

    Natural variation among Arabidopsis accessions is an important genetic resource to identify mechanisms underlying plant development and stress tolerance. To evaluate the natural variation in salinity stress tolerance, two large-scale experiments were performed on two populations consisting of 160 Arabidopsis accessions each. Multiple traits, including projected rosette area, and fresh and dry weight were collected as an estimate for salinity tolerance. Our results reveal a correlation between rosette size under salt stress conditions and developmental differences between the accessions grown in control conditions, suggesting that in general larger plants were more salt tolerant. This correlation was less pronounced when plants were grown under severe salt stress conditions. Subsequent genome wide association study (GWAS) revealed associations with novel candidate genes for salinity tolerance such as LRR-KISS (At4g08850), flowering locus KH-domain containing protein and a DUF1639-containing protein. Accessions with high LRR-KISS expression developed larger rosettes under salt stress conditions. Further characterization of allelic variation in candidate genes identified in this study will provide more insight into mechanisms of salt stress tolerance due to enhanced shoot growth.

  17. Genetic variations in the CLU and PICALM genes are associated with cognitive function in the oldest old

    Mengel-From, Jonas; Christensen, Kaare; McGue, Matt;

    2011-01-01

    (PICALM) gene and one variation, rs6656401, in the complement component (3b/4b) receptor 1 (CR) gene were associated with AD. Here, we replicate these associations with cognitive functioning in 1380 individuals from the Danish (1905) birth cohort study of the oldest old (92-93 years at intake) using...... measures of Mini Mental State Examination (MMSE) and a cognitive composite score. We found a significant association between the highly frequent CLU rs11136000 T allele (38%) and better performance on the cognitive composite score (p = 0.016) explaining 0.5% of the mean variation in cognitive composite...... score, and for men a significant association between the highly frequent PICALM rs3851179 A allele (38%). Better performance was found (p = 0.024), explaining 1.4% of the mean variation in cognitive composite score in men. These alleles correspond to the minor alleles initially found more frequent...

  18. Heritable variation in heat shock gene expression: a potential mechanism for adaptation to thermal stress in embryos of sea turtles.

    Tedeschi, J N; Kennington, W J; Tomkins, J L; Berry, O; Whiting, S; Meekan, M G; Mitchell, N J

    2016-01-13

    The capacity of species to respond adaptively to warming temperatures will be key to their survival in the Anthropocene. The embryos of egg-laying species such as sea turtles have limited behavioural means for avoiding high nest temperatures, and responses at the physiological level may be critical to coping with predicted global temperature increases. Using the loggerhead sea turtle (Caretta caretta) as a model, we used quantitative PCR to characterise variation in the expression response of heat-shock genes (hsp60, hsp70 and hsp90; molecular chaperones involved in cellular stress response) to an acute non-lethal heat shock. We show significant variation in gene expression at the clutch and population levels for some, but not all hsp genes. Using pedigree information, we estimated heritabilities of the expression response of hsp genes to heat shock and demonstrated both maternal and additive genetic effects. This is the first evidence that the heat-shock response is heritable in sea turtles and operates at the embryonic stage in any reptile. The presence of heritable variation in the expression of key thermotolerance genes is necessary for sea turtles to adapt at a molecular level to warming incubation environments. PMID:26763709

  19. Variations in host genes encoding adhesion molecules and susceptibility to falciparum malaria in India

    Tyagi Prajesh K

    2008-12-01

    Full Text Available Abstract Background Host adhesion molecules play a significant role in the pathogenesis of Plasmodium falciparum malaria and changes in their structure or levels in individuals can influence the outcome of infection. The aim of this study was to investigate the association of SNPs of three adhesion molecule genes, ICAM1, PECAM1 and CD36, with severity of falciparum malaria in a malaria-endemic and a non-endemic region of India. Methods The frequency distribution of seven selected SNPs of ICAM1, PECAM1 and CD36 was determined in 552 individuals drawn from 24 populations across India. SNP-disease association was analysed in a case-control study format. Genotyping of the population panel was performed by Sequenom mass spectroscopy and patient/control samples were genotyped by SNaPshot method. Haplotypes and linkage disequilibrium (LD plots were generated using PHASE and Haploview, respectively. Odds-ratio (OR for risk assessment was estimated using EpiInfo™ version 3.4. Results Association of the ICAM1 rs5498 (exon 6 G allele and the CD36 exon 1a A allele with increased risk of severe malaria was observed (severe versus control, OR = 1.91 and 2.66, P = 0.02 and 0.0012, respectively. The CD36 rs1334512 (-53 T allele as well as the TT genotype associated with protection from severe disease (severe versus control, TT versus GG, OR = 0.37, P = 0.004. Interestingly, a SNP of the PECAM1 gene (rs668, exon 3, C/G with low minor allele frequency in populations of the endemic region compared to the non-endemic region exhibited differential association with disease in these regions; the G allele was a risk factor for malaria in the endemic region, but exhibited significant association with protection from disease in the non-endemic region. Conclusion The data highlights the significance of variations in the ICAM1, PECAM1 and CD36 genes in the manifestation of falciparum malaria in India. The PECAM1 exon 3 SNP exhibits altered association with disease in the

  20. Genetic variation in selenoprotein genes, lifestyle, and risk of colon and rectal cancer.

    Martha L Slattery

    Full Text Available BACKGROUND: Associations between selenium and cancer have directed attention to role of selenoproteins in the carcinogenic process. METHODS: We used data from two population-based case-control studies of colon (n = 1555 cases, 1956 controls and rectal (n = 754 cases, 959 controls cancer. We evaluated the association between genetic variation in TXNRD1, TXNRD2, TXNRD3, C11orf31 (SelH, SelW, SelN1, SelS, SepX, and SeP15 with colorectal cancer risk. RESULTS: After adjustment for multiple comparisons, several associations were observed. Two SNPs in TXNRD3 were associated with rectal cancer (rs11718498 dominant OR 1.42 95% CI 1.16,1.74 pACT 0.0036 and rs9637365 recessive 0.70 95% CI 0.55,0.90 pACT 0.0208. Four SNPs in SepN1 were associated with rectal cancer (rs11247735 recessive OR 1.30 95% CI 1.04,1.63 pACT 0.0410; rs2072749 GGvsAA OR 0.53 95% CI 0.36,0.80 pACT 0.0159; rs4659382 recessive OR 0.58 95% CI 0.39,0.86 pACT 0.0247; rs718391 dominant OR 0.76 95% CI 0.62,0.94 pACT 0.0300. Interaction between these genes and exposures that could influence these genes showed numerous significant associations after adjustment for multiple comparisons. Two SNPs in TXNRD1 and four SNPs in TXNRD2 interacted with aspirin/NSAID to influence colon cancer; one SNP in TXNRD1, two SNPs in TXNRD2, and one SNP in TXNRD3 interacted with aspirin/NSAIDs to influence rectal cancer. Five SNPs in TXNRD2 and one in SelS, SeP15, and SelW1 interacted with estrogen to modify colon cancer risk; one SNP in SelW1 interacted with estrogen to alter rectal cancer risk. Several SNPs in this candidate pathway influenced survival after diagnosis with colon cancer (SeP15 and SepX1 increased HRR and rectal cancer (SepX1 increased HRR. CONCLUSIONS: Findings support an association between selenoprotein genes and colon and rectal cancer development and survival after diagnosis. Given the interactions observed, it is likely that the impact of cancer susceptibility from genotype is

  1. Assessment of PD-1 gene variation in patients with multiple sclerosis

    Shadmehri AA

    2010-05-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: Multiple sclerosis (MS is a chronic inflammatory demyelinating disease of the central nervous system with presumed autoimmune origin. T cells are considered to play a pivotal role in orchestrating the self-reactive immune responses in multiple sclerosis (MS. This study was performed to investigate the role of polymorphisms of the programmed cell death 1 (PD-1 gene on susceptibility to ankylosing spondylitis. This gene codes an immunoreceptor named PD-1, which has a cytoplasmic domain containing two tyrosine residues located within immunoreceptor tyrosine-based inhibitory and switch motifs (ITIM and ITSM, suggesting that PD-1 is predominantly inhibitory which responsible for the negative regulation in T cell activation and peripheral tolerance. We investigated whether PD-1 gene polymorphism is a genetic modifier for risk and progression of MS."n"n Methods: Blood samples from 150 Iranian Relapsing-Remitting MS patients (mean age, 34.98 years and 202 healthy controls (mean age, 30 years were enrolled in this study. The PD-1.3 (7146 G/A Intron 4 and PD-1.9 (7625 C/T Exon 5 polymorphisms were detected by Polymerase Chain Reaction and Restriction Enzyme digestion or Restriction Fragment Length Polymorphism (PCR

  2. Haplotype variation of Green Revolution gene Rht-D1 during wheat domestication and improvement

    Chihong Zhang; Lifeng Gao; Jiaqiang Sun; Jizeng Jia; Zhenglong Ren

    2014-01-01

    Green Revolution made a substantial contribution to wheat yields worldwide in the 1960s and 1970s. It is of great importance to analyze the haplotype variation of Rht-D1, the Green Revolution gene, during wheat (Triticum aestivum L.) domestication and breeding to understand its evolution and function in wheat breeding history. In this study, the Rht-D1 and its flanking regions were sequenced and single nucleotide polymorphisms were detected based on a panel of 45 accessions of Aegilops tauschi , 51 accessions of landraces and 80 accessions of commercial varieties. Genetic diversity in the wild accessions was much higher than that in the varieties and higher than that reported previously. Seven haplotypes (Hapl I to Hapl VII) of Rht-D1 were identified and their evolutionary relationships were proposed. In addition to the wel-known Green Revolution al ele Rht-D1b, Hapl VII (an al ele Rht-D1k) was identified in early breeding varieties, which reduced plant height by 16%. The results suggested that Rht-D1k had been used in breeding before the Green Revolution and made a great contribution to wheat production worldwide. Based on the breeding history and molecular evidence, we proposed that the wheat Green Revolution in China and International Maize and Wheat Improvement Center (CIMMYT) occurred independently.

  3. Allelic distributions of CYP2D6 gene copy number variation in the Eastern Han Chinese population

    Hai-hui SHENG; Yun-lan DU; Jian SUN; Hua-sheng XIAO; Ai-ping ZENG; Wen-xiang ZHU; Ren-fang ZHU; Hong-mei LI; Zhi-dong ZHU; Ying QIN; Wei JIN; Yan LIU

    2007-01-01

    Aim: The human cytochrome P450 2D6 (CYP2D6) gene copy number variation, involving CYP2D6 gene deletion (CYP2D6*5) and duplication or multiduplication (CYP2D6*×N), can result in reduced or increased metabolism of many clinically used drugs. The identification of CYP2D6*5 and CYP2D6*×N and the investigation of their allelic distributions in ethnic populations can be important in deter-mining the right drug and dosage for each patient. Methods: The CYP2D6*5 andCYP2D6 genes, and CYP2D6 gene duplication were identified by 2 modified long PCR, respectively. To determine duplicated alleles, a novel long PCR was developed to amplify the entire duplicated CYP2D6 gene which was used as template for subsequent PCR amplification. A total of 363 unrelated Eastern Han Chinese individuals were analyzed for CYP2D6 gene copy number variation. Results: The frequency of CYP2D6*5 and CYP2D6*×N were 4.82% (n=35) and 0.69% (n=5) in the Eastern Han Chinese population, respectively. Of the 5 duplicated alleles, 3were CYP2D6*1×N and 2 were CYP2D6*10×N. One individual was a carrier of both CYP2D6*5 and CYP2D6*1×N. Taken together, the CYP2D6 gene rear-rangements were present in 10.74% of subjects. Conclusion: Allelic distributions of the CYP2D6 gene copy number variation differ among Chinese from different regions, indicating ethnic variety in Chinese. Long PCR are convenient, cost effective, specific and semiquantitative for the detection of the CYP2D6 gene copy number variation, and amplification of the entire duplicated CYP2D6 gene is necessary for the accurate identification of duplicated alleles.

  4. Variation in the MC4R gene is associated with bone phenotypes in elderly Swedish women.

    Gaurav Garg

    Full Text Available Osteoporosis is characterized by reduced bone mineral density (BMD and increased fracture risk. Fat mass is a determinant of bone strength and both phenotypes have a strong genetic component. In this study, we examined the association between obesity associated polymorphisms (SNPs with body composition, BMD, Ultrasound (QUS, fracture and biomarkers (Homocysteine (Hcy, folate, Vitamin D and Vitamin B12 for obesity and osteoporosis. Five common variants: rs17782313 and rs1770633 (melanocortin 4 receptor (MC4R; rs7566605 (insulin induced gene 2 (INSIG2; rs9939609 and rs1121980 (fat mass and obesity associated (FTO were genotyped in 2 cohorts of Swedish women: PEAK-25 (age 25, n = 1061 and OPRA (age 75, n = 1044. Body mass index (BMI, total body fat and lean mass were strongly positively correlated with QUS and BMD in both cohorts (r(2 = 0.2-0.6. MC4R rs17782313 was associated with QUS in the OPRA cohort and individuals with the minor C-allele had higher values compared to T-allele homozygotes (TT vs. CT vs.100 vs. 103 vs. 103; p = 0.002; (SOS: 1521 vs. 1526 vs. 1524; p = 0.008; (Stiffness index: 69 vs. 73 vs. 74; p = 0.0006 after adjustment for confounders. They also had low folate (18 vs. 17 vs. 16; p = 0.03 and vitamin D (93 vs. 91 vs. 90; p = 0.03 and high Hcy levels (13.7 vs 14.4 vs. 14.5; p = 0.06. Fracture incidence was lower among women with the C-allele, (52% vs. 58%; p = 0.067. Variation in MC4R was not associated with BMD or body composition in either OPRA or PEAK-25. SNPs close to FTO and INSIG2 were not associated with any bone phenotypes in either cohort and FTO SNPs were only associated with body composition in PEAK-25 (p≤0.001. Our results suggest that genetic variation close to MC4R is associated with quantitative ultrasound and risk of fracture.

  5. Genetic variation in the HSD17B1 gene and risk of prostate cancer.

    Peter Kraft

    2005-11-01

    Full Text Available Steroid hormones are believed to play an important role in prostate carcinogenesis, but epidemiological evidence linking prostate cancer and steroid hormone genes has been inconclusive, in part due to small sample sizes or incomplete characterization of genetic variation at the locus of interest. Here we report on the results of a comprehensive study of the association between HSD17B1 and prostate cancer by the Breast and Prostate Cancer Cohort Consortium, a large collaborative study. HSD17B1 encodes 17beta-hydroxysteroid dehydrogenase 1, an enzyme that converts dihydroepiandrosterone to the testosterone precursor Delta5-androsterone-3beta,17beta-diol and converts estrone to estradiol. The Breast and Prostate Cancer Cohort Consortium researchers systematically characterized variation in HSD17B1 by targeted resequencing and dense genotyping; selected haplotype-tagging single nucleotide polymorphisms (htSNPs that efficiently predict common variants in U.S. and European whites, Latinos, Japanese Americans, and Native Hawaiians; and genotyped these htSNPs in 8,290 prostate cancer cases and 9,367 study-, age-, and ethnicity-matched controls. We found no evidence that HSD17B1 htSNPs (including the nonsynonymous coding SNP S312G or htSNP haplotypes were associated with risk of prostate cancer or tumor stage in the pooled multiethnic sample or in U.S. and European whites. Analyses stratified by age, body mass index, and family history of disease found no subgroup-specific associations between these HSD17B1 htSNPs and prostate cancer. We found significant evidence of heterogeneity in associations between HSD17B1 haplotypes and prostate cancer across ethnicity: one haplotype had a significant (p < 0.002 inverse association with risk of prostate cancer in Latinos and Japanese Americans but showed no evidence of association in African Americans, Native Hawaiians, or whites. However, the smaller numbers of Latinos and Japanese Americans in this study makes

  6. Genetic variation in the HSD17B1 gene and risk of prostate cancer.

    Kraft, Peter; Pharoah, Paul; Chanock, Stephen J; Albanes, Demetrius; Kolonel, Laurence N; Hayes, Richard B; Altshuler, David; Andriole, Gerald; Berg, Christine; Boeing, Heiner; Burtt, Noel P; Bueno-de-Mesquita, Bas; Calle, Eugenia E; Cann, Howard; Canzian, Federico; Chen, Yen-Ching; Crawford, David E; Dunning, Alison M; Feigelson, Heather S; Freedman, Matthew L; Gaziano, John M; Giovannucci, Ed; Gonzalez, Carlos Alberto; Haiman, Christopher A; Hallmans, Goran; Henderson, Brian E; Hirschhorn, Joel N; Hunter, David J; Kaaks, Rudolf; Key, Timothy; Le Marchand, Loic; Ma, Jing; Overvad, Kim; Palli, Domenico; Pike, Malcolm C; Riboli, Elio; Rodriguez, Carmen; Setiawan, Wendy V; Stampfer, Meir J; Stram, Daniel O; Thomas, Gilles; Thun, Michael J; Travis, Ruth; Trichopoulou, Antonia; Virtamo, Jarmo; Wacholder, Sholom

    2005-11-01

    Steroid hormones are believed to play an important role in prostate carcinogenesis, but epidemiological evidence linking prostate cancer and steroid hormone genes has been inconclusive, in part due to small sample sizes or incomplete characterization of genetic variation at the locus of interest. Here we report on the results of a comprehensive study of the association between HSD17B1 and prostate cancer by the Breast and Prostate Cancer Cohort Consortium, a large collaborative study. HSD17B1 encodes 17beta-hydroxysteroid dehydrogenase 1, an enzyme that converts dihydroepiandrosterone to the testosterone precursor Delta5-androsterone-3beta,17beta-diol and converts estrone to estradiol. The Breast and Prostate Cancer Cohort Consortium researchers systematically characterized variation in HSD17B1 by targeted resequencing and dense genotyping; selected haplotype-tagging single nucleotide polymorphisms (htSNPs) that efficiently predict common variants in U.S. and European whites, Latinos, Japanese Americans, and Native Hawaiians; and genotyped these htSNPs in 8,290 prostate cancer cases and 9,367 study-, age-, and ethnicity-matched controls. We found no evidence that HSD17B1 htSNPs (including the nonsynonymous coding SNP S312G) or htSNP haplotypes were associated with risk of prostate cancer or tumor stage in the pooled multiethnic sample or in U.S. and European whites. Analyses stratified by age, body mass index, and family history of disease found no subgroup-specific associations between these HSD17B1 htSNPs and prostate cancer. We found significant evidence of heterogeneity in associations between HSD17B1 haplotypes and prostate cancer across ethnicity: one haplotype had a significant (p < 0.002) inverse association with risk of prostate cancer in Latinos and Japanese Americans but showed no evidence of association in African Americans, Native Hawaiians, or whites. However, the smaller numbers of Latinos and Japanese Americans in this study makes these subgroup

  7. Immune gene expression in Bombus terrestris: signatures of infection despite strong variation among populations, colonies, and sister workers.

    Franziska S Brunner

    Full Text Available Ecological immunology relies on variation in resistance to parasites. Colonies of the bumblebee Bombus terrestris vary in their susceptibility to the trypanosome gut parasite Crithidia bombi, which reduces colony fitness. To understand the possible origin of this variation in resistance we assayed the expression of 28 immunologically important genes in foraging workers. We deliberately included natural variation of the host "environment" by using bees from colonies collected in two locations and sampling active foraging workers that were not age controlled. Immune gene expression patterns in response to C. bombi showed remarkable variability even among genetically similar sisters. Nevertheless, expression varied with parasite exposure, among colonies and, perhaps surprisingly, strongly among populations (collection sites. While only the antimicrobial peptide abaecin is universally up regulated upon exposure, linear discriminant analysis suggests that the overall exposure effect is driven by a combination of several immune pathways and further immune functions such as ROS regulation. Also, the differences among colonies in their immune gene expression profiles provide clues to the mechanistic basis of well-known inter-colony variation in susceptibility to this parasite. Our results show that transcriptional responses to parasite exposure can be detected in ecologically heterogeneous groups despite strong background noise.

  8. Rendimiento académico y ambiente social Rendimiento académico y ambiente social

    Jesús Ruíz Herrero

    2011-03-01

    Full Text Available El presente artículo evalúa, mediante procedimientos estadísticos, la influencia que el nivel educativo y la profesión de los progenitores, la renta per cápita del distrito o el tipo de centro pudieran tener sobre el rendimiento académico. La tesis de la que se parte considera que tales factores condicionan los esquemas perceptivos y cognitivos (habitus con los que los alumnos hacen frente a su etapa académica, y que explican su éxito o fracaso. Para demostrarlo, hemos analizado los resultados en la prueba CDI del año 2008 para 6º de Primaria, que la Consejería de Educación de la Comunidad de Madrid organiza desde hace unos años a fin de evaluar el rendimiento académico del alumnado y si su nivel de conocimientos se ajusta a lo esperado para su curso. La perspectiva presentada aquí contrasta con la que sostienen otros discursos, como es el caso del discurso dominante en el sistema educativo, que sólo tienden a enfatizar los factores puramente individuales o psicológicos, o a desligarlos de las condiciones sociales que los han producido.The present article analyzes the influence that variables such as parent´s educational level of attainment or occupation, level of income associated to the family´s area of residence, or kind of school (private vs. factors could account for the differenciated cognitive and perceptive schemata (habitus that children develop to meet “the educational challenge”. To demonstrate such relations, statistical procedures are used. The data tested here has been collected from the average results that different schools taking part in CDI exam obtained in 2008 in the region of Madrid. This exam is held every academic year and organized by Consejería de Educación de Madrid (Madrid Office of Education to evaluate if pupils under test match the official academic level required for the grade they are in. Our perspective is further different than that which only tends to stress psicological factors as the

  9. Variation of PRLR gene copy number in duck%鸭PRLR基因拷贝数的变异

    叶炎; 汪稳; 张金耀; 黄守婷; 钟志新; 周世业; 肖天放

    2016-01-01

    Copy number variation ( CNV) merges to be an effective tool in poultry breeding. To elucidate the correlation between productive performance and polymorphism, gene of Brown Tsaiya ducks were amplified by fluorescence quantitative PCR, and fol-lowed by being transferred into CNV via 2-ΔΔCt method. Subsequent production traits responses to different CNV of PRLR gene were investigated. Results showed that correlation coefficients of standard curve for PRLR and Ldh-B were 0.991 and 0.990, with slopes of standard curves being-3.070 and-3.135, respectively. Amplification efficiency of PRLR and Ldh-B target gene were 111.68% and 108.429%, which were approximately at the same level with reference gene. Traits of Brown Tsaiya ducks were correlated with CNV ( P0.05).因此,PRLR基因拷贝变异区域可能影响蛋壳厚度和蛋形指数.

  10. Quantitative variation in obesity-related traits and insulin precursors linked to the OB gene region on human chromosome 7

    Duggirala, R.; Stern, M.P.; Reinhart, L.J. [Univ. of Texas Health Science Center, San Antonio, TX (United States)] [and others

    1996-09-01

    Despite the evidence that human obesity has strong genetic determinants, efforts at identifying specific genes that influence human obesity have largely been unsuccessful. Using the sibship data obtained from 32 low-income Mexican American pedigrees ascertained on a type II diabetic proband and a multipoint variance-components method, we tested for linkage between various obesity-related traits plus associated metabolic traits and 15 markers on human chromosome 7. We found evidence for linkage between markers in the OB gene region and various traits, as follows: D7S514 and extremity skinfolds (LOD = 3.1), human carboxypeptidase A1 (HCPA1) and 32,33-split proinsulin level (LOD = 4.2), and HCPA1 and proinsulin level (LOD = 3.2). A putative susceptibility locus linked to the marker D7S514 explained 56% of the total phenotypic variation in extremity skinfolds. Variation at the HCPA1 locus explained 64% of phenotypic variation in proinsulin level and {approximately}73% of phenotypic variation in split proinsulin concentration, respectively. Weaker evidence for linkage to several other obesity-related traits (e.g., waist circumference, body-mass index, fat mass by bioimpedance, etc.) was observed for a genetic location, which is {approximately}15 cM telomeric to OB. In conclusion, our study reveals that the OB region plays a significant role in determining the phenotypic variation of both insulin precursors and obesity-related traits, at least in Mexican Americans. 66 refs., 3 figs., 4 tabs.

  11. Natural variation of heterokaryon incompatibility gene het-c in Podospora anserina reveals diversifying selection.

    Bastiaans, Eric; Debets, Alfons J M; Aanen, Duur K; van Diepeningen, Anne D; Saupe, Sven J; Paoletti, Mathieu

    2014-04-01

    In filamentous fungi, allorecognition takes the form of heterokaryon incompatibility, a cell death reaction triggered when genetically distinct hyphae fuse. Heterokaryon incompatibility is controlled by specific loci termed het-loci. In this article, we analyzed the natural variation in one such fungal allorecognition determinant, the het-c heterokaryon incompatibility locus of the filamentous ascomycete Podospora anserina. The het-c locus determines an allogenic incompatibility reaction together with two unlinked loci termed het-d and het-e. Each het-c allele is incompatible with a specific subset of the het-d and het-e alleles. We analyzed variability at the het-c locus in a population of 110 individuals, and in additional isolates from various localities. We identified a total of 11 het-c alleles, which define 7 distinct incompatibility specificity classes in combination with the known het-d and het-e alleles. We found that the het-c allorecognition gene of P. anserina is under diversifying selection. We find a highly unequal allele distribution of het-c in the population, which contrasts with the more balanced distribution of functional groups of het-c based on their allorecognition function. One explanation for the observed het-c diversity in the population is its function in allorecognition. However, alleles that are most efficient in allorecognition are rare. An alternative and not exclusive explanation for the observed diversity is that het-c is involved in pathogen recognition. In Arabidopsis thaliana, a homolog of het-c is a pathogen effector target, supporting this hypothesis. We hypothesize that the het-c diversity in P. anserina results from both its functions in pathogen-defense, and allorecognition. PMID:24448643

  12. Investigation of the effect of ionizing radiation on gene expression variation by the 'DNA chips': feasibility of a biological dosimeter

    After having described the different biological effects of ionizing radiation and the different approaches to biological dosimetry, and introduced 'DNA chips' or DNA micro-arrays, the author reports the characterization of gene expression variations in the response of cells to a gamma irradiation. Both main aspects of the use DNA chips are investigated: fundamental research and diagnosis. This research thesis thus proposes an analysis of the effect of ionizing radiation using DNA chips, notably by comparing gene expression modifications measured in mouse irradiated lung, heart and kidney. It reports a feasibility study of bio-dosimeter based on expression profiles

  13. Genetic Variation in the EGFR Gene and the Risk of Glioma in a Chinese Han Population

    Hou, Wu-Gang; Ai, Wen-Bo; Bai, Xiao-Guang; Dong, Hai-long; Li, Zhen; Zhang, Yuan-Qiang; Xiong, Li-Ze

    2012-01-01

    Previous studies have shown that regulation of the epidermal growth factor gene (EGFR) pathway plays a role in glioma progression. Certain genotypes of the EGFR gene may be related to increased glioblastoma risk, indicating that germ line EGFR polymorphisms may have implications in carcinogenesis. To examine whether and how variants in the EGFR gene contribute to glioma susceptibility, we evaluated nine tagging single-nucleotide polymorphisms (tSNPs) of the EGFR gene in a case–control study f...

  14. Natural variation of rice blast resistant gene Pi-ta in Oryza species

    The Pi-ta gene in rice is a putative NBS type cytoplasmic receptor conferring resistance to races of Magnaporthe oryzae in a gene-for-gene manner. A Functional Nucleotide Polymorphism (FNP) change resulting in an amino acid substitution of Alanine to Serine at position 918 (nucleotide G to T at posi...

  15. Genetic Variation and Divergence of Genes Involved in Leaf Adaxial-Abaxial Polarity Establishment in Brassica rapa.

    Liang, Jianli; Liu, Bo; Wu, Jian; Cheng, Feng; Wang, Xiaowu

    2016-01-01

    Alterations in leaf adaxial-abaxial (ad-ab) polarity are one of the main factors that influence leaf curvature. In Chinese cabbage, leaf incurvature is an essential prerequisite to the formation of a leafy head. Identifying ad-ab patterning genes and investigating their genetic variation may facilitate elucidation of the mechanisms underlying leaf incurvature during head formation. Comparative genomic analysis of 45 leaf ad-ab patterning genes in Brassica rapa based on 26 homologs of Arabidopsis thaliana indicated that these genes underwent expansion and were retained after whole genome triplication (WGT). We also assessed the nucleotide diversity and selection footprints of these 45 genes in a collection of 94 Brassica rapa accessions that were composed of heading and non-heading morphotypes. Six of the 45 genes showed significant negative Tajima's D indices and nucleotide diversity reduction in heading accessions compared to those in non-heading accessions, indicating that they underwent purifying selection. Further testing of the BrARF3.1 gene, which was one of the selection signals from a larger collection, confirmed that purifying selection did occur. Our results provide genetic evidence that ad-ab patterning genes are involved in leaf incurvature, which is associated with formation of a leafy head, as well as promote an understanding of the genetic mechanism underlying leafy head formation in Chinese cabbage. PMID:26904064

  16. Genetic Variation and Divergence of Genes Involved in Leaf Adaxial-abaxial Polarity Establishment in Brassica rapa

    Jianli eLiang

    2016-02-01

    Full Text Available Alterations in leaf adaxial–abaxial (ad-ab polarity are one of the main factors that are responsible for leaf curvature. In Chinese cabbage, to form a leafy head, leaf incurvature is an essential prerequisite. Identifying ad-ab patterning genes and investigating its genetic variations will facilitate in elucidating the mechanism underlying leaf incurvature during head formation. In the present study we conducted comparative genomic analysis of the identification of 45 leaf ad-ab patterning genes in Brassica rapa based on 26 homologs in Arabidopsis thaliana, indicating that these genes underwent expansion and were retained after whole genome triplication (WGT. We also assessed the nucleotide diversity and selection footprints of these 45 genes in a collection of 94 Brassica rapa accessions that were composed of heading and non-heading morphotypes. Six of the 45 genes showed significant negative Tajima’s D indices and nucleotide diversity reduction in heading accessions compared to that in non-heading accessions, indicating that these underwent purifying selection. Further testing of the BrARF3.1 gene, which was one of the selection signals from a larger collection, confirmed that purifying selection did occur. Our results provide genetic evidence that ad-ab patterning genes are involved in leaf incurvature that is associated in the formation of a leafy head, as well as promote an understanding of the genetic mechanism underlying leafy head formation in Chinese cabbage.

  17. Robust assignment of cancer subtypes from expression data using a uni-variate gene expression average as classifier

    Genome wide gene expression data is a rich source for the identification of gene signatures suitable for clinical purposes and a number of statistical algorithms have been described for both identification and evaluation of such signatures. Some employed algorithms are fairly complex and hence sensitive to over-fitting whereas others are more simple and straight forward. Here we present a new type of simple algorithm based on ROC analysis and the use of metagenes that we believe will be a good complement to existing algorithms. The basis for the proposed approach is the use of metagenes, instead of collections of individual genes, and a feature selection using AUC values obtained by ROC analysis. Each gene in a data set is assigned an AUC value relative to the tumor class under investigation and the genes are ranked according to these values. Metagenes are then formed by calculating the mean expression level for an increasing number of ranked genes, and the metagene expression value that optimally discriminates tumor classes in the training set is used for classification of new samples. The performance of the metagene is then evaluated using LOOCV and balanced accuracies. We show that the simple uni-variate gene expression average algorithm performs as well as several alternative algorithms such as discriminant analysis and the more complex approaches such as SVM and neural networks. The R package rocc is freely available at http://cran.r-project.org/web/packages/rocc/index.html

  18. Screening of the FcεRI-β-Gene in a Swiss Population of Asthmatic Children: No Association with E237G and Identification of New Sequence Variations

    M. Rohrbach

    1998-01-01

    Full Text Available Background: The gene of the beta subunit of the high affinity receptor for IgE (FcεRI-β encoded on chromosome 11q13 has recently been identified as a candidate gene for asthma and atopy. Two coding variations, E237G and I181L have been described as being associated with asthma and atopy. Our aim was to investigate a Swiss population of atopic and asthmatic children for variations in this gene.

  19. Copy number variation analysis implicates the cell polarity gene glypican 5 as a human spina bifida candidate gene.

    Bassuk, Alexander G; Muthuswamy, Lakshmi B; Boland, Riley; Smith, Tiffany L; Hulstrand, Alissa M; Northrup, Hope; Hakeman, Matthew; Dierdorff, Jason M; Yung, Christina K; Long, Abby; Brouillette, Rachel B; Au, Kit Sing; Gurnett, Christina; Houston, Douglas W; Cornell, Robert A; Manak, J Robert

    2013-03-15

    Neural tube defects (NTDs) are common birth defects of complex etiology. Family and population-based studies have confirmed a genetic component to NTDs. However, despite more than three decades of research, the genes involved in human NTDs remain largely unknown. We tested the hypothesis that rare copy number variants (CNVs), especially de novo germline CNVs, are a significant risk factor for NTDs. We used array-based comparative genomic hybridization (aCGH) to identify rare CNVs in 128 Caucasian and 61 Hispanic patients with non-syndromic lumbar-sacral myelomeningocele. We also performed aCGH analysis on the parents of affected individuals with rare CNVs where parental DNA was available (42 sets). Among the eight de novo CNVs that we identified, three generated copy number changes of entire genes. One large heterozygous deletion removed 27 genes, including PAX3, a known spina bifida-associated gene. A second CNV altered genes (PGPD8, ZC3H6) for which little is known regarding function or expression. A third heterozygous deletion removed GPC5 and part of GPC6, genes encoding glypicans. Glypicans are proteoglycans that modulate the activity of morphogens such as Sonic Hedgehog (SHH) and bone morphogenetic proteins (BMPs), both of which have been implicated in NTDs. Additionally, glypicans function in the planar cell polarity (PCP) pathway, and several PCP genes have been associated with NTDs. Here, we show that GPC5 orthologs are expressed in the neural tube, and that inhibiting their expression in frog and fish embryos results in NTDs. These results implicate GPC5 as a gene required for normal neural tube development. PMID:23223018

  20. No association between type 1 diabetes and genetic variation in vitamin D metabolism genes

    Thorsen, Steffen U; Mortensen, Henrik B; Carstensen, Bendix; Fenger, Mogens; Thuesen, Betina H; Husemoen, Lotte; Bergholdt, Regine; Brorsson, Caroline; Pociot, Flemming; Linneberg, Allan; Svensson, Jannet

    2014-01-01

    BACKGROUND: Vitamin D, certain single nucleotide polymorphisms (SNPs) in the vitamin D-receptor (VDR) gene and vitamin D metabolism genes have been associated with type 1 diabetes (T1D). OBJECTIVE: We wanted to examine if the most widely studied SNPs in genes important for production, transport...... siblings). RESULTS: We did not demonstrate association with T1D for SNPs in the following genes: CYP27B1, VDR, GC, CYP2R1, DHCR7, and CYP24A1. Though, variants in the GC gene were significantly associated with 25(OH)D levels in the joint model. CONCLUSION: Some of the most examined SNPs in vitamin D...

  1. SNP and gene networks construction and analysis from classification of copy number variations data

    Liu, Yang; Lee, Yiu Fai; Ng, Michael K.

    2011-01-01

    Background Detection of genomic DNA copy number variations (CNVs) can provide a complete and more comprehensive view of human disease. It is interesting to identify and represent relevant CNVs from a genome-wide data due to high data volume and the complexity of interactions. Results In this paper, we incorporate the DNA copy number variation data derived from SNP arrays into a computational shrunken model and formalize the detection of copy number variations as a case-control classification ...

  2. S-SCAM, A Rare Copy Number Variation Gene, Induces Schizophrenia-Related Endophenotypes in Transgenic Mouse Model

    Zhang, Nanyan; Zhong, PENG; Shin, Seung Min; Metallo, Jacob; Danielson, Eric; Olsen, Christopher M.; Liu, Qing-song; Lee, Sang H.

    2015-01-01

    Accumulating genetic evidence suggests that schizophrenia (SZ) is associated with individually rare copy number variations (CNVs) of diverse genes, often specific to single cases. However, the causality of these rare mutations remains unknown. One of the rare CNVs found in SZ cohorts is the duplication of Synaptic Scaffolding Molecule (S-SCAM, also called MAGI-2), which encodes a postsynaptic scaffolding protein controlling synaptic AMPA receptor levels, and thus the strength of excitatory sy...

  3. Genetic Variations in Xenobiotic Metabolic Pathway Genes, Personal Hair Dye Use, and Risk of Non-Hodgkin Lymphoma

    Zhang, Yawei; Hughes, Kathryn J.; Zahm, Shelia Hoar; Zhang, Yaqun; Holford, Theodore R.; Dai, Li; Bai, Yana; Han, Xuesong; Qin, Qin; Lan, Qing; Rothman, Nathaniel; Zhu, Yong; Leaderer, Brian; Zheng, Tongzhang

    2009-01-01

    From 1996 to 2000, the authors conducted a population-based case-control study among Connecticut women to test the hypothesis that genetic variation in xenobiotic metabolic pathway genes modifies the relation between hair dye use and risk of non-Hodgkin lymphoma. No effect modifications were found for women who started using hair dyes in 1980 or afterward. For women who started using hair dye before 1980 as compared with never users, a statistically significantly increased risk of non-Hodgkin...

  4. The Effects of Sequence Variation on Genome-wide NRF2 Binding—New Target Genes and Regulatory SNPs

    Kuosmanen, Suvi; Viitala, Sari; Laitinen, Tuomo; Peräkylä, Mikael; Pölönen, Petri; Kansanen, Emilia; Leinonen, Hanna; Raju, Suresh; Wienecke, Anke; Närvänen, Ale; Poso, Antti; Heinäniemi, Merja; Heikkinen, Sami; Levonen, Anna-Liisa

    2016-01-01

    Transcription factor binding specificity is crucial for proper target gene regulation. Motif discovery algorithms identify the main features of the binding patterns, but the accuracy on the lower affinity sites is often poor. Nuclear factor E2-related factor 2 (NRF2) is a ubiquitous redox-activated transcription factor having a key protective role against endogenous and exogenous oxidant and electrophile stress. Herein, we decipher the effects of sequence variation on the DNA binding s...

  5. Genome-wide association implicates numerous genes and pleiotropy underlying ecological trait variation in natural populations of Populus trichocarpa

    McKown, Athena [University of British Columbia, Vancouver; Klapste, Jaroslav [University of British Columbia, Vancouver; Guy, Robert [University of British Columbia, Vancouver; Geraldes, Armando [University of British Columbia, Vancouver; Porth, Ilga [University of British Columbia, Vancouver; Hannemann, Jan [University of Victoria, Canada; Friedmann, Michael [University of British Columbia, Vancouver; Muchero, Wellington [ORNL; Tuskan, Gerald A [ORNL; Ehlting, Juergen [University of Victoria, Canada; Cronk, Quentin [University of British Columbia, Vancouver; El-Kassaby, Yousry [University of British Columbia, Vancouver; Mansfield, Shawn [University of British Columbia, Vancouver; Douglas, Carl [University of British Columbia, Vancouver

    2014-01-01

    To uncover the genetic basis of phenotypic trait variation, we used 448 unrelated wild accessions of black cottonwood (Populus trichocarpa Torr. & Gray) from natural populations throughout western North America. Extensive information from large-scale trait phenotyping (with spatial and temporal replications within a common garden) and genotyping (with a 34K Populus SNP array) of all accessions were used for gene discovery in a genome-wide association study (GWAS).

  6. Identification of a New Variable Sequence in the P1 Cytadhesin Gene of Mycoplasma pneumoniae: Evidence for the Generation of Antigenic Variation by DNA Recombination between Repetitive Sequences

    Kenri, Tsuyoshi; Taniguchi, Rie; Sasaki, Yuko; Okazaki, Norio; Narita, Mitsuo; Izumikawa, Kinichi; Umetsu, Masao; Sasaki, Tsuguo

    1999-01-01

    A Mycoplasma pneumoniae cytadhesin P1 gene with novel nucleotide sequence variation has been identified. Four clinical strains of M. pneumoniae were found to carry this type of P1 gene. This new P1 gene is similar to the known group II P1 genes but possesses novel sequence variation of approximately 300 bp in the RepMP2/3 region. The position of the new variable region is distant from the previously reported variable regions known to differ between group I and II P1 genes. Two sequences close...

  7. Oxytocin and vasopressin receptor gene variation as a proximate base for inter- and intraspecific behavioral differences in bonobos and chimpanzees.

    Staes, Nicky; Stevens, Jeroen M G; Helsen, Philippe; Hillyer, Mia; Korody, Marisa; Eens, Marcel

    2014-01-01

    Recent literature has revealed the importance of variation in neuropeptide receptor gene sequences in the regulation of behavioral phenotypic variation. Here we focus on polymorphisms in the oxytocin receptor gene (OXTR) and vasopressin receptor gene 1a (Avpr1a) in chimpanzees and bonobos. In humans, a single nucleotide polymorphism (SNP) in the third intron of OXTR (rs53576 SNP (A/G)) is linked with social behavior, with the risk allele (A) carriers showing reduced levels of empathy and prosociality. Bonobos and chimpanzees differ in these same traits, therefore we hypothesized that these differences might be reflected in variation at the rs53576 position. We sequenced a 320 bp region surrounding rs53576 but found no indications of this SNP in the genus Pan. However, we identified previously unreported SNP variation in the chimpanzee OXTR sequence that differs from both humans and bonobos. Humans and bonobos have previously been shown to have a more similar 5' promoter region of Avpr1a when compared to chimpanzees, who are polymorphic for the deletion of ∼ 360 bp in this region (+/- DupB) which includes a microsatellite (RS3). RS3 has been linked with variation in levels of social bonding, potentially explaining part of the interspecies behavioral differences found in bonobos, chimpanzees and humans. To date, results for bonobos have been based on small sample sizes. Our results confirmed that there is no DupB deletion in bonobos with a sample size comprising approximately 90% of the captive founder population, whereas in chimpanzees the deletion of DupB had the highest frequency. Because of the higher frequency of DupB alleles in our bonobo population, we suggest that the presence of this microsatellite may partly reflect documented differences in levels of sociability found in bonobos and chimpanzees. PMID:25405348

  8. Molecular Evolution and Genetic Variation of G2-Like Transcription Factor Genes in Maize.

    Liu, Fang; Xu, Yunjian; Han, Guomin; Zhou, Lingyan; Ali, Asif; Zhu, Suwen; Li, Xiaoyu

    2016-01-01

    The productivity of maize (Zea mays L.) depends on the development of chloroplasts, and G2-like transcription factors play a central role in regulating chloroplast development. In this study, we identified 59 G2-like genes in the B73 maize genome and systematically analyzed these genes at the molecular and evolutionary levels. Based on gene structure character, motif compositions and phylogenetic analysis, maize G2-like genes (ZmG1- ZmG59) were divided into seven groups (I-VII). By synteny analysis, 18 collinear gene pairs and strongly conserved microsyntny among regions hosting G2-like genes across maize and sorghum were found. Here, we showed that the vast majority of ZmG gene duplications resulted from whole genome duplication events rather than tandem duplications. After gene duplication events, some ZmG genes were silenced. The functions of G2-like genes were multifarious and most genes that are expressed in green tissues may relate to maize photosynthesis. The qRT-PCR showed that the expression of these genes was sensitive to low temperature and drought. Furthermore, we analyzed differences of ZmGs specific to cultivars in temperate and tropical regions at the population level. Interestingly, the single nucleotide polymorphism (SNP) analysis revealed that nucleotide polymorphism associated with different temperature zones. Above all, G2-like genes were highly conserved during evolution, but polymorphism could be caused due to a different geographical location. Moreover, G2-like genes might be related to cold and drought stresses. PMID:27560803

  9. Genetic Variation of the Borrelia burgdorferi Gene vlsE Involves Cassette-Specific, Segmental Gene Conversion

    Zhang, Jing-Ren; Norris, Steven J

    1998-01-01

    The Lyme disease spirochete Borrelia burgdorferi possesses 15 silent vls cassettes and a vls expression site (vlsE) encoding a surface-exposed lipoprotein. Segments of the silent vls cassettes have been shown to recombine with the vlsE cassette region in the mammalian host, resulting in combinatorial antigenic variation. Despite promiscuous recombination within the vlsE cassette region, the 5′ and 3′ coding sequences of vlsE that flank the cassette region are not subject to sequence variation...

  10. Gene Expression Variation Resolves Species and Individual Strains among Coral-Associated Dinoflagellates within the Genus Symbiodinium.

    Parkinson, John E; Baumgarten, Sebastian; Michell, Craig T; Baums, Iliana B; LaJeunesse, Todd C; Voolstra, Christian R

    2016-03-01

    Reef-building corals depend on symbiotic mutualisms with photosynthetic dinoflagellates in the genus Symbiodinium. This large microalgal group comprises many highly divergent lineages ("Clades A-I") and hundreds of undescribed species. Given their ecological importance, efforts have turned to genomic approaches to characterize the functional ecology of Symbiodinium. To date, investigators have only compared gene expression between representatives from separate clades-the equivalent of contrasting genera or families in other dinoflagellate groups-making it impossible to distinguish between clade-level and species-level functional differences. Here, we examined the transcriptomes of four species within one Symbiodinium clade (Clade B) at ∼20,000 orthologous genes, as well as multiple isoclonal cell lines within species (i.e., cultured strains). These species span two major adaptive radiations within Clade B, each encompassing both host-specialized and ecologically cryptic taxa. Species-specific expression differences were consistently enriched for photosynthesis-related genes, likely reflecting selection pressures driving niche diversification. Transcriptional variation among strains involved fatty acid metabolism and biosynthesis pathways. Such differences among individuals are potentially a major source of physiological variation, contributing to the functional diversity of coral holobionts composed of unique host-symbiont genotype pairings. Our findings expand the genomic resources available for this important symbiont group and emphasize the power of comparative transcriptomics as a method for studying speciation processes and interindividual variation in nonmodel organisms. PMID:26868597

  11. Gene expression variation resolves species and individual strains among coral-associated dinoflagellates within the genus Symbiodinium

    Parkinson, John Everett

    2016-02-11

    Reef-building corals depend on symbiotic mutualisms with photosynthetic dinoflagellates in the genus Symbiodinium. This large microalgal group comprises many highly divergent lineages (“Clades A-I”) and hundreds of undescribed species. Given their ecological importance, efforts have turned to genomic approaches to characterize the functional ecology of Symbiodinium. To date, investigators have only compared gene expression between representatives from separate clades—the equivalent of contrasting genera or families in other dinoflagellate groups—making it impossible to distinguish between clade-level and species-level functional differences. Here, we examined the transcriptomes of four species within one Symbiodinium clade (Clade B) at ~20,000 orthologous genes, as well as multiple isoclonal cell lines within species (i.e. cultured strains). These species span two major adaptive radiations within Clade B, each encompassing both host-specialized and ecologically cryptic taxa. Species-specific expression differences were consistently enriched for photosynthesis-related genes, likely reflecting selection pressures driving niche diversification. Transcriptional variation among strains involved fatty acid metabolism and biosynthesis pathways. Such differences among individuals are potentially a major source of physiological variation, contributing to the functional diversity of coral holobionts composed of unique host-symbiont genotype pairings. Our findings expand the genomic resources available for this important symbiont group and emphasize the power of comparative transcriptomics as a method for studying speciation processes and inter-individual variation in non-model organisms.

  12. académicos consolidados del área educativa

    Juan Carlos Mijangos Noh

    2012-01-01

    Full Text Available A partir de una revisión del concepto de gestión del conocimiento, mediante la cual se establece una concepción acerca del término, examinamos las acciones emprendidas y productos logrados por tres cuerpos académicos consolidados en el área de educación, todos ellos ubicados en universidades públicas mexicanas de provincia y reconocidos por el Programa de Mejoramiento del Profesorado, instituido por la Subsecretaría de Educación Superior de la Secretaría de Educación Pública de México. El análisis de los procesos de los tres cuerpos académicos consolidados se hace examinando las características de la gestión de conocimiento emprendida por los profesores involucrados, en los siguientes aspectos: el marco institucional y normativo en el que se efectuó la gestión, los objetivos, acciones y resultados de dicha gestión, y la trayectoria de cada uno de los cuerpos académicos, en materia de organización, que permitió la catálisis de sus procesos hacia el logro de productos que han sido evaluados y reconocidos como de buena calidad por los pares académicos. Las conclusiones permiten ubicar los patrones seguidos por los tres cuerpos académicos estudiados que, finalmente, podrán emplearse en el reconocimiento de pautas que sirvan a otros cuerpos académicos para catalizar sus procesos hacia la consolidación, mediante la gestión apropiada del conocimiento.

  13. Differentially expressed genes linked to natural variation in long-term memory formation in Cotesia parasitic wasps

    Joke J. F. A. Van Vugt

    2015-09-01

    Full Text Available Even though learning and memory are universal traits in the Animal Kingdom, closely related species reveal substantial variation in learning rate and memory dynamics. To determine the genetic background of this natural variation, we studied two congeneric parasitic wasp species, Cotesia glomerata and C. rubecula, which lay their eggs in caterpillars of the large and small cabbage white butterfly. A successful egg laying event serves as an unconditioned stimulus in a classical conditioning paradigm, where plant odors become associated to the encounter of a suitable host caterpillar. Depending on the host species, the number of conditioning trials and the parasitic wasp species, three different types of transcription-dependent long-term memory (LTM and one type of transcription-independent, anesthesia-resistant memory (ARM can be distinguished. To identify transcripts underlying these differences in memory formation, we isolated mRNA from parasitic wasp heads at three different time points between induction and consolidation of each of the four memory types, and for each sample three biological replicates, where after strand-specific paired-end 100 bp deep sequencing. Transcriptomes were assembled de novo and differential expression was determined for each memory type and time point after conditioning, compared to unconditioned wasps. Most differentially expressed (DE genes and antisense transcripts were only DE in one of the LTM types. Among the DE genes that were DE in two or more LTM types, were many protein kinases and phosphatases, small GTPases, receptors and ion channels. Some genes were DE in opposing directions between any of the LTM memory types and ARM, suggesting that ARM in Cotesia requires the transcription of genes inhibiting LTM or vice versa. We discuss our findings in the context of neuronal functioning, including RNA splicing and transport, epigenetic regulation, neurotransmitter/peptide synthesis and antisense transcription. In

  14. Global Survey of Variation in a Human Olfactory Receptor Gene Reveals Signatures of Non-Neutral Evolution.

    Hoover, Kara C; Gokcumen, Omer; Qureshy, Zoya; Bruguera, Elise; Savangsuksa, Aulaphan; Cobb, Matthew; Matsunami, Hiroaki

    2015-09-01

    Allelic variation at 4 loci in the human olfactory receptor gene OR7D4 is associated with perceptual variation in the sex steroid-derived odorants, androstenone, and androstadienone. Androstadienone has been linked with chemosensory identification whereas androstenone makes pork from uncastrated pigs distasteful ("boar taint"). In a sample of 2224 individuals from 43 populations, we identified 45 OR7D4 single nucleotide polymorphisms. Coalescent modeling of frequency-site-spectrum-based statistics identified significant deviation from neutrality in human OR7D4; individual populations with statistically significant deviations from neutrality include Gujarati, Beijing Han, Great Britain, Iberia, and Puerto Rico. Analysis of molecular variation values indicated statistically significant population differentiation driven mainly by the 4 alleles associated with androstenone perception variation; however, fixation values were low suggesting that genetic structure may not have played a strong role in creating these group divisions. We also studied OR7D4 in the genomes of extinct members of the human lineage: Altai Neandertal and Denisovan. No variants were identified in Altai but 2 were in Denisova, one of which is shared by modern humans and one of which is novel. A functional test of modern human and a synthesized mutant Denisova OR7D4 indicated no statistically significant difference in responses to androstenone between the 2 species. Our results suggest non-neutral evolution for an olfactory receptor gene. PMID:26072518

  15. Multi-allelic major effect genes interact with minor effect QTLs to control adaptive color pattern variation in Heliconius erato.

    Riccardo Papa

    Full Text Available Recent studies indicate that relatively few genomic regions are repeatedly involved in the evolution of Heliconius butterfly wing patterns. Although this work demonstrates a number of cases where homologous loci underlie both convergent and divergent wing pattern change among different Heliconius species, it is still unclear exactly how many loci underlie pattern variation across the genus. To address this question for Heliconius erato, we created fifteen independent crosses utilizing the four most distinct color pattern races and analyzed color pattern segregation across a total of 1271 F2 and backcross offspring. Additionally, we used the most variable brood, an F2 cross between H. himera and the east Ecuadorian H. erato notabilis, to perform a quantitative genetic analysis of color pattern variation and produce a detailed map of the loci likely involved in the H. erato color pattern radiation. Using AFLP and gene based markers, we show that fewer major genes than previously envisioned control the color pattern variation in H. erato. We describe for the first time the genetic architecture of H. erato wing color pattern by assessing quantitative variation in addition to traditional linkage mapping. In particular, our data suggest three genomic intervals modulate the bulk of the observed variation in color. Furthermore, we also identify several modifier loci of moderate effect size that contribute to the quantitative wing pattern variation. Our results are consistent with the two-step model for the evolution of mimetic wing patterns in Heliconius and support a growing body of empirical data demonstrating the importance of major effect loci in adaptive change.

  16. Social context-induced song variation affects female behavior and gene expression.

    Sarah C Woolley

    2008-03-01

    Full Text Available Social cues modulate the performance of communicative behaviors in a range of species, including humans, and such changes can make the communication signal more salient. In songbirds, males use song to attract females, and song organization can differ depending on the audience to which a male sings. For example, male zebra finches (Taeniopygia guttata change their songs in subtle ways when singing to a female (directed song compared with when they sing in isolation (undirected song, and some of these changes depend on altered neural activity from a specialized forebrain-basal ganglia circuit, the anterior forebrain pathway (AFP. In particular, variable activity in the AFP during undirected song is thought to actively enable syllable variability, whereas the lower and less-variable AFP firing during directed singing is associated with more stereotyped song. Consequently, directed song has been suggested to reflect a "performance" state, and undirected song a form of vocal motor "exploration." However, this hypothesis predicts that directed-undirected song differences, despite their subtlety, should matter to female zebra finches, which is a question that has not been investigated. We tested female preferences for this natural variation in song in a behavioral approach assay, and we found that both mated and socially naive females could discriminate between directed and undirected song-and strongly preferred directed song. These preferences, which appeared to reflect attention especially to aspects of song variability controlled by the AFP, were enhanced by experience, as they were strongest for mated females responding to their mate's directed songs. We then measured neural activity using expression of the immediate early gene product ZENK, and found that social context and song familiarity differentially modulated the number of ZENK-expressing cells in telencephalic auditory areas. Specifically, the number of ZENK-expressing cells in the

  17. Spin-offs académicas em Portugal

    Valente, Fernando Manuel

    2015-01-01

    Doutoramento em Gestão A literatura de empreendedorismo académico tem abordado uma grande diversidade de temas, nomeadamente: (i) estudos sobre o papel dos governos em processos de spin-off incluindo formas de apoiar a sua criação e desenvolvimento como mecanismo para transferir conhecimento para o mercado; (ii) estudos sobre o papel das universidades no processo de transferência de conhecimento, tais como as formas de incentivar a criação e desenvolvimento de novas empresas pelos académic...

  18. Lateralidad, procesos perceptivos y rendimiento académico.

    Mera-Tapia, Guadalupe

    2013-01-01

    Es frecuente que factores neuropsicológicos alterados sean responsables en casos de alumnos con bajo rendimiento académico que fracasan en nuestro sistema educativo. En este trabajo se estudia si existen diferencias, entre alumnos con alto y bajo rendimiento académico en relación con los procesos perceptivos y la lateralidad. Se evalúan los procesos perceptivos (visión, y audición) y la lateralidad en dos muestras de 30 alumnos cada una, de alto y bajo rendimento respectivamente. Los alumnos ...

  19. Autoeficacia, ansiedad y rendimiento académico en adolescentes

    Francoise Contreras; Juan Carlos Espinosa; Gustavo Esguerra; Andrea Haikal; Alejandra Polanía; Adriana Rodríguez

    2005-01-01

    Este estudio tuvo como propósito determinar si las variables psicológicas percepción de autoeficacia y ansiedad guardan relación con el rendimiento académico en un grupo de 120 estudiantes de secundaria de un colegio privado de Bogotá. Para ello, se aplicó la Escala de Autoeficacia Generalizada [EAG] y el Cuestionario de Ansiedad Estado - Rasgo [STAI]. Los resultados evidenciaron que la autoeficacia está asociada directamente con el rendimiento académico general, mi...

  20. No Association between Variation in Longevity Candidate Genes and Aging-related Phenotypes in Oldest-old Danes.

    Soerensen, Mette; Nygaard, Marianne; Debrabant, Birgit; Mengel-From, Jonas; Dato, Serena; Thinggaard, Mikael; Christensen, Kaare; Christiansen, Lene

    2016-06-01

    In this study we explored the association between aging-related phenotypes previously reported to predict survival in old age and variation in 77 genes from the DNA repair pathway, 32 genes from the growth hormone 1/ insulin-like growth factor 1/insulin (GH/IGF-1/INS) signalling pathway and 16 additional genes repeatedly considered as candidates for human longevity: APOE, APOA4, APOC3, ACE, CETP, HFE, IL6, IL6R, MTHFR, TGFB1, SIRTs 1, 3, 6; and HSPAs 1A, 1L, 14. Altogether, 1,049 single nucleotide polymorphisms (SNPs) were genotyped in 1,088 oldest-old (age 92-93 years) Danes and analysed with phenotype data on physical functioning (hand grip strength), cognitive functioning (mini mental state examination and a cognitive composite score), activity of daily living and self-rated health. Five SNPs showed association to one of the phenotypes; however, none of these SNPs were associated with a change in the relevant phenotype over time (7 years of follow-up) and none of the SNPs could be confirmed in a replication sample of 1,281 oldest-old Danes (age 94-100). Hence, our study does not support association between common variation in the investigated longevity candidate genes and aging-related phenotypes consistently shown to predict survival. It is possible that larger sample sizes are needed to robustly reveal associations with small effect sizes. PMID:26946122

  1. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    Abildgaard, L; Engberg, RM; Pedersen, Karl;

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio...... different a-toxin sequence types among the 60 strains. Moreover, a type II intron of 834 non-coding nucleotides was identified in the pic gene of three of the investigated strains. The in vitro alpha-toxin production investigated in 45 of the strains, including the three harbouring the intron, revealed no...... correlation between PFGE type, alpha-toxin sequence type, health status of the host chickens and level of a-toxin production. It is therefore concluded that neither pic gene type nor alpha-toxin production level seems to correlate to origin (healthy or diseased chicken) of the C perfringens strains. (C) 2008...

  2. Allelic variation in human mitochondrial genes based on patterns of restriction site polymorphism.

    Whittam, T S; Clark, A. G.; Stoneking, M; Cann, R. L.; Wilson, A. C.

    1986-01-01

    Restriction maps of 145 human mtDNAs representing samples from five geographic regions were used to construct multilocus genotypes for 28 genetic loci of the mitochondrial genome. Alleles were defined as distinct combinations of the presence or absence of polymorphic restriction sites within each locus. The 28 loci included 13 genes encoding proteins, 10 genes specifying tRNAs, 2 genes specifying rRNAs, and 3 noncoding regions consisting of the D loop, the light strand origin of replication, ...

  3. Genetic Variation in Cell Death Genes and Risk of Non-Hodgkin Lymphoma

    Johanna M. Schuetz; Denise Daley; Jinko Graham; Berry, Brian R.; Gallagher, Richard P.; Connors, Joseph M; Gascoyne, Randy D.; Spinelli, John J.; Angela R Brooks-Wilson

    2012-01-01

    BACKGROUND: Non-Hodgkin lymphomas are a heterogeneous group of solid tumours that constitute the 5(th) highest cause of cancer mortality in the United States and Canada. Poor control of cell death in lymphocytes can lead to autoimmune disease or cancer, making genes involved in programmed cell death of lymphocytes logical candidate genes for lymphoma susceptibility. MATERIALS AND METHODS: We tested for genetic association with NHL and NHL subtypes, of SNPs in lymphocyte cell death genes using...

  4. Estimating variation within the genes and inferring the phylogeny of 186 sequenced diverse Escherichia coli genomes

    Kaas, Rolf Sommer; Rundsten, Carsten Friis; Ussery, David;

    2012-01-01

    creating better phylogenies, for determination of molecular clocks and for improved typing techniques. Results We find 3,051 gene clusters/families present in at least 95% of the genomes and 1,702 gene clusters present in 100% of the genomes. The former 'soft core' of about 3,000 gene families is perhaps...... 186 sequenced E. coli genomes. The core-gene tree displays high confidence and divides the E. coli strains into the observed MLST type clades and also separates defined phylotypes. Conclusion The results of comparing a large and diverse E. coli dataset support the theory that reliable and good...

  5. Balancing selection at the tomato RCR3 Guardee gene family maintains variation in strength of pathogen defense.

    Anja C Hörger

    Full Text Available Coevolution between hosts and pathogens is thought to occur between interacting molecules of both species. This results in the maintenance of genetic diversity at pathogen antigens (or so-called effectors and host resistance genes such as the major histocompatibility complex (MHC in mammals or resistance (R genes in plants. In plant-pathogen interactions, the current paradigm posits that a specific defense response is activated upon recognition of pathogen effectors via interaction with their corresponding R proteins. According to the "Guard-Hypothesis," R proteins (the "guards" can sense modification of target molecules in the host (the "guardees" by pathogen effectors and subsequently trigger the defense response. Multiple studies have reported high genetic diversity at R genes maintained by balancing selection. In contrast, little is known about the evolutionary mechanisms shaping the guardee, which may be subject to contrasting evolutionary forces. Here we show that the evolution of the guardee RCR3 is characterized by gene duplication, frequent gene conversion, and balancing selection in the wild tomato species Solanum peruvianum. Investigating the functional characteristics of 54 natural variants through in vitro and in planta assays, we detected differences in recognition of the pathogen effector through interaction with the guardee, as well as substantial variation in the strength of the defense response. This variation is maintained by balancing selection at each copy of the RCR3 gene. Our analyses pinpoint three amino acid polymorphisms with key functional consequences for the coevolution between the guardee (RCR3 and its guard (Cf-2. We conclude that, in addition to coevolution at the "guardee-effector" interface for pathogen recognition, natural selection acts on the "guard-guardee" interface. Guardee evolution may be governed by a counterbalance between improved activation in the presence and prevention of auto-immune responses in

  6. The effect of genetic variation in the type 1 deiodinase gene on the inter-individual variation in serum thyroid hormone levels. An investigation in healthy Danish twins

    van der Deure, Wendy M; Hansen, Pia Skov; Peeters, Robin P; Uitterlinden, André G; Fenger, Mogens; Kyvik, Kirsten Ohm; Hegedüs, Laszlo; Visser, Theo J

    2008-01-01

    -785T allele had 3.8% higher FT4 and 14.3 % higher rT3 levels, resulting in a lower T3/T4 and T3/rT3 ratio and a higher rT3/T4 ratio. This polymorphism explained 0.87% and 1.79%, respectively, of the variation in serum FT4 and rT3. The D1-A1814G polymorphism was not associated with serum thyroid hormone......Introduction: Genetic factors have a considerable influence on serum thyroid hormone levels. The C785T and A1814G polymorphisms, located in the 3' untranslated region of the type 1 deiodinase (D1) gene have been associated with serum FT4 and rT3 levels. Objective: In healthy Danish twins, we...

  7. The effect of genetic variation in the type 1 deiodinase gene on the inter-individual variation in serum thyroid hormone levels. An investigation in healthy Danish twins

    van der Deure, Wendy M; Hansen, Pia Skov; Peeters, Robin P; Uitterlinden, André G; Fenger, Mogens; Kyvik, Kirsten Ohm; Hegedüs, Laszlo; Visser, Theo J

    2009-01-01

    -785T allele had 3.8% higher FT4 and 14.3 % higher rT3 levels, resulting in a lower T3/T4 and T3/rT3 ratio and a higher rT3/T4 ratio. This polymorphism explained 0.87% and 1.79%, respectively, of the variation in serum FT4 and rT3. The D1-A1814G polymorphism was not associated with serum thyroid hormone......Introduction: Genetic factors have a considerable influence on serum thyroid hormone levels. The C785T and A1814G polymorphisms, located in the 3' untranslated region of the type 1 deiodinase (D1) gene have been associated with serum FT4 and rT3 levels. Objective: In healthy Danish twins, we...

  8. Association between genetic variation in the oxytocin receptor gene and emotional withdrawal, but not between oxytocin pathway genes and diagnosis in psychotic disorders.

    Marit eHaram

    2015-01-01

    Full Text Available Social dysfunction is common in patients with psychotic disorders. Oxytocin is a neuropeptide with a central role in social behaviour. This study aims to explore the relationship between oxytocin pathway genes and symptoms related to social dysfunction in patients with psychotic disorders. We performed association analyses between four oxytocin pathway genes (OXT, OXTR, AVP, CD38 and four areas of social behaviour-related psychopathology as measured by Positive and Negative Syndrome Scale (PANSS. For this purpose, we used both a polygenic risk score (PGRS and single OXTR candidate SNPs previously reported in the literature (rs53576, rs237902, rs2254298. A total of 734 subjects with DSM-IV psychotic spectrum disorders and 420 healthy controls were included. Oxytocin pathway PGRSs were calculated based on the independent Psychiatric Genomics Consortium study sample. There was a significant association between symptom of Emotional Withdrawal and the previously reported OXTR risk allele A in rs53576. No significant associations between oxytocin pathway gene variants and a diagnosis of psychotic disorder were found. Our findings indicate that while oxytocin pathway genes do not appear to contribute to the susceptibility to psychotic disorders, variations in the OXTR gene might play a role in the development of impaired social behaviour.

  9. Variation in the Williams syndrome GTF2I gene and anxiety proneness interactively affect prefrontal cortical response to aversive stimuli.

    Jabbi, M; Chen, Q; Turner, N; Kohn, P; White, M; Kippenhan, J S; Dickinson, D; Kolachana, B; Mattay, V; Weinberger, D R; Berman, K F

    2015-01-01

    Characterizing the molecular mechanisms underlying the heritability of complex behavioral traits such as human anxiety remains a challenging endeavor for behavioral neuroscience. Copy-number variation (CNV) in the general transcription factor gene, GTF2I, located in the 7q11.23 chromosomal region that is hemideleted in Williams syndrome and duplicated in the 7q11.23 duplication syndrome (Dup7), is associated with gene-dose-dependent anxiety in mouse models and in both Williams syndrome and Dup7. Because of this recent preclinical and clinical identification of a genetic influence on anxiety, we examined whether sequence variation in GTF2I, specifically the single-nucleotide polymorphism rs2527367, interacts with trait and state anxiety to collectively impact neural response to anxiety-laden social stimuli. Two hundred and sixty healthy adults completed the Tridimensional Personality Questionnaire Harm Avoidance (HA) subscale, a trait measure of anxiety proneness, and underwent functional magnetic resonance imaging (fMRI) while matching aversive (fearful or angry) facial identity. We found an interaction between GTF2I allelic variations and HA that affects brain response: in individuals homozygous for the major allele, there was no correlation between HA and whole-brain response to aversive cues, whereas in heterozygotes and individuals homozygous for the minor allele, there was a positive correlation between HA sub-scores and a selective dorsolateral prefrontal cortex (DLPFC) responsivity during the processing of aversive stimuli. These results demonstrate that sequence variation in the GTF2I gene influences the relationship between trait anxiety and brain response to aversive social cues in healthy individuals, supporting a role for this neurogenetic mechanism in anxiety. PMID:26285132

  10. Conserved variation: identifying patterns of stability and variability in BCR and TCR V genes with different diversity and richness metrics

    The immune system can detect most invading pathogens. The potential for detection of pathogens is dependent on the somatic diversity of the immune repertoires. While it is known that this somatic diversity is carefully generated, it is unclear how the diversity is distributed in the different genes encoding receptors of immune cells. Utilizing different metrics for richness and diversity at the level of small sequence fragments, we present here an analysis of the entire known human germline repertoire as represented by the sequences from the ImMunoGeneTics database of immune receptors. We have developed a fragment sequence quantification analysis to track variation of repertoires with different degrees of precision. Somatic diversity has previously been functionally characterized mostly by division of the V gene sequences into the more conserved and invariant framework (FR) of the receptor and more varied complementarity determining regions (CDR), that interact with the antigen. We find that CDR and FR can be explicitly identified with our sequence fragment diversity quantification technique. In terms of diversity, CDR and FR are especially distinct in B cell V genes. T cell V genes show less of the CDR/FR periodicity but are more diverse overall. Our analysis further shows that there are other areas of diversity outside the CDR and FR that are found widely dispersed in T cell receptor V genes and more tightly focused in FR1 and FR3 in the B cell receptor V genes. The diversity we observe is not dependent on allelic differences nor is this diversity segregated by individual V gene families. We would thus expect that each individual exhibit a diversity equivalent to that of the entire potential repertoire. (paper)

  11. Looking at the origin of phenotypic variation from pattern formation gene networks

    Isaac Salazar-Ciudad

    2009-10-01

    This article critically reviews some widespread views about the overall functioning of development. Special attention is devoted to views in developmental genetics about the superstructure of developmental gene networks. According to these views gene networks are hierarchic and multilayered. The highest layers partition the embryo in large coarse areas and control downstream genes that subsequently subdivide the embryo into smaller and smaller areas. These views are criticized on the bases of developmental and evolutionary arguments. First, these views, although detailed at the level of gene identities, do not incorporate morphogenetic mechanisms nor do they try to explain how morphology changes during development. Often, they assume that morphogenetic mechanisms are subordinate to cell signaling events. This is in contradiction to the evidence reviewed herein. Experimental evidence on pattern formation also contradicts the view that developmental gene networks are hierarchically multilayered and that their functioning is decodable from promoter analysis. Simple evolutionary arguments suggest that, indeed, developmental gene networks tend to be non-hierarchic. Re-use leads to extensive modularity in gene networks while developmental drift blurs this modularity. Evolutionary opportunism makes developmental gene networks very dependent on epigenetic factors.

  12. Natural Genetic Variation in Cassava (Manihot esculenta Crantz) Landraces: A Tool for Gene Discovery

    Cassava landraces are the earliest form of the modern cultivars and represent the first step in cassava domestication. Our forward genetic analysis uses this resource to discover spontaneous mutations in the sucrose/ starch and carotenoid synthesis/accumulation and to develop both an evolutionary and breeding perspective of gene function related to those traits. Biochemical phenotype variants for the synthesis and accumulation of carotenoid, free sugar and starch were identified. Six subtractive cDNA libraries were prepared to construct a high quality (phred > 20) EST database with 1,645 entries. Macroarray and micro-array analysis was performed to identify differentially expressed genes aiming to identify candidate genes related to sugary phenotype and carotenoid diversity. cDNA sequence for gene coding for specific enzymes in the two pathways was obtained. Gene expression analysis for coding specific enzymes was performed by RNA blot and Real Time PCR analysis. Chromoplast-associated proteins of yellow storage root were fractionated and a peptide sequence database with 906 entries sequences (MASCOT validated) was constructed. For the sucrose/starch, metabolism a sugary class of cassava was identified, carrying a mutation in the BEI and GBSS genes. For the pigmented cassava, a pink color phenotype showed absence of expression of the gene CasLYB, while an intense yellow phenotype showed a down regulation of the gene CasHYb. Heat shock proteins were identified as the major proteins associated with carotenoid. Genetic diversity for the GBSS gene in the natural population identified 22 haplotypes and a large nucleotide diversity in four subsets of population. Single segregating population derived from F2, half-sibling and S1 population showed segregation for sugary phenotype (93% of individuals), waxy phenotype (38% of individuals) and glycogen like starch (2% of individuals). Here we summarize our current results for the genetic analysis of these variants and recent

  13. Copy number variation analysis implicates the cell polarity gene glypican 5 as a human spina bifida candidate gene

    Bassuk, Alexander G.; Muthuswamy, Lakshmi B.; Boland, Riley; Smith, Tiffany L.; Hulstrand, Alissa M.; Northrup, Hope; Hakeman, Matthew; Dierdorff, Jason M.; Yung, Christina K.; Long, Abby; Brouillette, Rachel B.; Au, Kit Sing; Gurnett, Christina; Houston, Douglas W.; Cornell, Robert A

    2012-01-01

    Neural tube defects (NTDs) are common birth defects of complex etiology. Family and population-based studies have confirmed a genetic component to NTDs. However, despite more than three decades of research, the genes involved in human NTDs remain largely unknown. We tested the hypothesis that rare copy number variants (CNVs), especially de novo germline CNVs, are a significant risk factor for NTDs. We used array-based comparative genomic hybridization (aCGH) to identify rare CNVs in 128 Cauca...

  14. Genome-wide copy number variation study associates metabotropic glutamate receptor gene networks with attention deficit hyperactivity disorder

    Elia, Josephine; Glessner, Joseph T; Wang, Kai; Takahashi, Nagahide; Shtir, Corina J; Hadley, Dexter; Sleiman, Patrick M A; Zhang, Haitao; Kim, Cecilia E; Robison, Reid; Lyon, Gholson J; Flory, James H; Bradfield, Jonathan P; Imielinski, Marcin; Hou, Cuiping; Frackelton, Edward C; Chiavacci, Rosetta M; Sakurai, Takeshi; Rabin, Cara; Middleton, Frank A; Thomas, Kelly A; Garris, Maria; Mentch, Frank; Freitag, Christine M; Steinhausen, Hans-Christoph; Todorov, Alexandre A; Reif, Andreas; Rothenberger, Aribert; Franke, Barbara; Mick, Eric O; Roeyers, Herbert; Buitelaar, Jan; Lesch, Klaus-Peter; Banaschewski, Tobias; Ebstein, Richard P; Mulas, Fernando; Oades, Robert D; Sergeant, Joseph; Sonuga-Barke, Edmund; Renner, Tobias J; Romanos, Marcel; Romanos, Jasmin; Warnke, Andreas; Walitza, Susanne; Meyer, Jobst; Pálmason, Haukur; Seitz, Christiane; Loo, Sandra K; Smalley, Susan L; Biederman, Joseph; Kent, Lindsey; Asherson, Philip; Anney, Richard J L; Gaynor, J William; Shaw, Philip; Devoto, Marcella; White, Peter S; Grant, Struan F A; Buxbaum, Joseph D; Rapoport, Judith L; Williams, Nigel M; Nelson, Stanley F; Faraone, Stephen V; Hakonarson, Hakon

    2014-01-01

    Attention deficit hyperactivity disorder (ADHD) is a common, heritable neuropsychiatric disorder of unknown etiology. We performed a whole-genome copy number variation (CNV) study on 1,013 cases with ADHD and 4,105 healthy children of European ancestry using 550,000 SNPs. We evaluated statistically significant findings in multiple independent cohorts, with a total of 2,493 cases with ADHD and 9,222 controls of European ancestry, using matched platforms. CNVs affecting metabotropic glutamate receptor genes were enriched across all cohorts (P = 2.1 × 10−9). We saw GRM5 (encoding glutamate receptor, metabotropic 5) deletions in ten cases and one control (P = 1.36 × 10−6). We saw GRM7 deletions in six cases, and we saw GRM8 deletions in eight cases and no controls. GRM1 was duplicated in eight cases. We experimentally validated the observed variants using quantitative RT-PCR. A gene network analysis showed that genes interacting with the genes in the GRM family are enriched for CNVs in ~10% of the cases (P = 4.38 × 10−10) after correction for occurrence in the controls. We identified rare recurrent CNVs affecting glutamatergic neurotransmission genes that were overrepresented in multiple ADHD cohorts. PMID:22138692

  15. Natural genetic variation in cassava (Manihot esculenta Crantz) landraces as a tool for gene discovery

    Cassava landraces are the earliest form of the modern cultivars and represents the first step in cassava domestication. Our forward genetic analysis uses this resource to discover spontaneous mutations in the sucrose/starch and carotenoid synthesis/accumulation and to develop both evolutionary and breeding perspective of gene function related to those traits. Biochemical phenotype variants for the synthesis and accumulation of carotenoid, free sugar and starch were identified. Six subtractive cDNA libraries were prepared to construct a high quality (phred > 20) EST database with 1645 entries. Macroarray analysis was performed to identify differentially expressed gene aiming to identify candidate gene related to sugary phenotype. cDNA sequence for gene coding for specific enzymes in the two pathways were obtained. Gene expression analysis for coding specific enzymes was performed by RNA blot and Real Time PCR analysis. Chromoplastassociated proteins of yellow storage root were fractionated and a peptide sequence data base with 906 entries sequences (MASCOT validated) was constructed. For the sucrose/starch metabolism a sugary class of cassava was identified carrying mutation in the BEI and GBSS mutation. For the pigmented cassava a pink color phenotype showed absence of expression of the gene CasLYB while an intense yellow phenotype showed a down regulation of the gene CasHYb. Heat shock proteins were identified as the major proteins associated with chromoplast. Genetic diversity for the GBSS gene in the natural population identified 22 haplotype and a large nucleotide diversity in four subset of population. Single segregating population derived from F2, half sib and S1 population showed segregation for sugary phenotype (93% of the individuals), waxy phenotype (38% of the individuals) and glycogen like starch (2% of the individuals). Here we summarize our current results for the genetic analysis of this variants and recent progress in the direction of mapping of

  16. [Nucleotide variation in the mitochondrial DNA cytochrome oxidase 1 gene in the Siberian sucker (Catostomus catostomus rostratus) from Kolyma River].

    Bachevskaja, L T; Pereverzeva, V V; Ivanova, G D; Agapova, G A

    2014-10-01

    This study presents the data of the first molecular genetic analysis of the Siberian sucker from Kolyma River. Polymorphism of the mtDNA cytochrome oxidase 1 gene was established. Comparative sequence analysis of the gene examined and the GenBank variants characterizing suckers from the rivers of Canada enabled the suggestion that the sucker penetrated to Asia from North America approximately at the end of Early and the beginning of the Middle Pleistocene. It was demonstrated that intrapopulation genetic variation in the Siberian sucker accounted for 11.63% of total variation, while the proportion of the intergroup, component (Fst) constituted 88.37%. It seems likely that a considerable proportion of intergroup variation was caused by the long period of isolation of the Siberian sucker in Kolyma River. The prevalence of one common haplotype, CH-COI 1, in the sample examined indicates that the founder effect played an importaht role in the history of the formation of the Kolyma population. PMID:25720253

  17. Genetic variation in the tryptophan hydroxylase 2 gene moderates depressive symptom trajectories and remission over 8 weeks of escitalopram treatment.

    Su, Yun-Ai; Li, Ji-Tao; Dai, Wen-Ji; Liao, Xue-Mei; Dong, Li-Cai; Lu, Tian-Lan; Bousman, Chad; Si, Tian-Mei

    2016-05-01

    The serotonin system plays an important role in the pathogenesis of major depressive disorder (MDD) and genetic variations in serotonin-related genes affect the efficacy of antidepressants. The aim of this study was to investigate the relationship between genotypic variation in six candidate serotonergic genes (ADCY9, HTR1B, GNB3, HTR2A, TPH2, SLC6A4) and depressive and anxiety symptom severity trajectories as well as remission following escitalopram treatment. A total of 166 Chinese patients with MDD were treated with escitalopram (open-label) for 8 weeks. TPH2 rs4570625 GG carriers were more likely to achieve depressive and anxiety symptom remission compared with T-allele carriers. At the trend level (Pcorrected=0.05), depressive symptom severity trajectories were moderated by TPH2 rs4570625. Patients with the GT or the GG genotype showed more favorable depressive symptom severity trajectories compared with TT genotype carriers. Polymorphisms in ADCY9, HTR1B, and HTR2A were nominally associated with symptom remission, but did not withstand correction for multiple comparisons. The HTTLPR polymorphism was not included in our final analysis because of a high percentage of missing data. These results suggested that genotypic variation in TPH2 may moderate the therapeutic response to esciatlopram among Chinese patients with MDD. PMID:26745768

  18. Genetic variation in the oxytocin receptor gene is associated with a social phenotype in autism spectrum disorders.

    Harrison, Ashley J; Gamsiz, Ece D; Berkowitz, Isaac C; Nagpal, Shailender; Jerskey, Beth A

    2015-12-01

    Oxytocin regulates social behavior in animal models. Research supports an association between genetic variation in the oxytocin receptor gene (OXTR) and autism spectrum disorders (ASD). In this study, we examine the association between the OXTR gene and a specific social phenotype within ASD. This genotype-phenotype investigation may provide insight into how OXTR conveys risk for social impairment. The current study investigated 10 SNPS in the OXTR gene that have been previously shown to be associated with ASD. We examine the association of these SNPs with both a social phenotype and a repetitive behavior phenotype comprised of behaviors commonly impaired in ASD in the Simons simplex collection (SSC). Using a large sample to examine the association between OXTR and ASD (n = range: 485-1002), we find evidence to support a relation between two OXTR SNPs and the examined social phenotype among children diagnosed with ASD. Greater impairment on the social responsiveness scale standardized total score and on several subdomains was observed among individuals with one or more copies of the minor frequency allele in both rs7632287 and rs237884. Linkage disequilibrium (LD) mapping suggests that these two SNPs are in LD within and overlapping the 3' untranslated region (3'-UTR) of the OXTR gene. These two SNPs were also associated with greater impairment on the repetitive behavior scale. Results of this study indicate that social impairment and repetitive behaviors in ASD are associated with genomic variation in the 3'UTR of the OXTR gene. These variants may be linked to an allele that alters stability of the mRNA message although further work is necessary to test this hypothesis. PMID:26365303

  19. SLC26A4 gene copy number variations in Chinese patients with non-syndromic enlarged vestibular aqueduct

    Zhao Jiandong

    2012-05-01

    Full Text Available Abstract Background Many patients with enlarged vestibular aqueduct (EVA have either only one allelic mutant of the SLC26A4 gene or lack any detectable mutation. In this study, multiplex ligation-dependent probe amplification (MLPA was used to screen for copy number variations (CNVs of SLC26A4 and to reveal the pathogenic mechanisms of non-syndromic EVA (NSEVA. Methods Between January 2003 and March 2010, 923 Chinese patients (481 males, 442 females with NSEVA were recruited. Among these, 68 patients (7.4% were found to carry only one mutant allele of SLC26A4 and 39 patients (4.2% lacked any detectable mutation in SLC26A4; these 107 patients without double mutant alleles were assigned to the patient group. Possible copy number variations in SLC26A4 were detected by SALSA MLPA. Results Using GeneMapper, no significant difference was observed between the groups, as compared with the standard probe provided in the assay. The results of the capillary electrophoresis showed no significant difference between the patients and controls. Conclusion Our results suggest that CNVs and the exon deletion in SLC26A4 are not important factors in NSEVA. However, it would be premature to conclude that CNVs have no role in EVA. Genome-wide studies to explore CNVs within non-coding regions of the SLC26A4 gene and neighboring regions are warranted, to elucidate their roles in NSEVA etiology.

  20. Fad7 gene identification and fatty acids phenotypic variation in an olive collection by EcoTILLING and sequencing approaches.

    Sabetta, Wilma; Blanco, Antonio; Zelasco, Samanta; Lombardo, Luca; Perri, Enzo; Mangini, Giacomo; Montemurro, Cinzia

    2013-08-01

    The ω-3 fatty acid desaturases (FADs) are enzymes responsible for catalyzing the conversion of linoleic acid to α-linolenic acid localized in the plastid or in the endoplasmic reticulum. In this research we report the genotypic and phenotypic variation of Italian Olea europaea L. germoplasm for the fatty acid composition. The phenotypic oil characterization was followed by the molecular analysis of the plastidial-type ω-3 FAD gene (fad7) (EC 1.14.19), whose full-length sequence has been here identified in cultivar Leccino. The gene consisted of 2635 bp with 8 exons and 5'- and 3'-UTRs of 336 and 282 bp respectively, and showed a high level of heterozygousity (1/110 bp). The natural allelic variation was investigated both by a LiCOR EcoTILLING assay and the PCR product direct sequencing. Only three haplotypes were identified among the 96 analysed cultivars, highlighting the strong degree of conservation of this gene. PMID:23685785

  1. Bardet-Biedl syndrome in Denmark-report of 13 novel sequence variations in six genes

    Hjortshøj, Tina Duelund; Grønskov, Karen; Philp, Alisdair R; Nishimura, Darryl Y; Riise, Ruth; Sheffield, Val C; Rosenberg, Thomas; Brøndum-Nielsen, Karen

    2010-01-01

    Bardet-Biedl syndrome (BBS) is an autosomal recessive disease characterized by retinal dystrophy, polydactyly, obesity, learning disabilities, renal involvement, and male hypogenitalism. BBS is genetically heterogeneous with mutations of 14 genes, accounting for approximately 70% of cases...

  2. Clinal Variation at Phenology-Related Genes in Spruce: Parallel Evolution in FTL2 and Gigantea?

    Chen, Jun; Tsuda, Yoshiaki; Stocks, Michael; Källman, Thomas; Xu, Nannan; Kärkkäinen, Katri; Huotari, Tea; Semerikov, Vladimir L.; Vendramin, Giovanni G.; Lascoux, Martin

    2014-01-01

    Parallel clines in different species, or in different geographical regions of the same species, are an important source of information on the genetic basis of local adaptation. We recently detected latitudinal clines in SNPs frequencies and gene expression of candidate genes for growth cessation in Scandinavian populations of Norway spruce (Picea abies). Here we test whether the same clines are also present in Siberian spruce (P. obovata), a close relative of Norway spruce with a different Qu...

  3. INSR gene variation is associated with decreased insulin sensitivity in Iraqi women with PCOs

    Manal T. Mutib; Farqad B. Hamdan; Anam R. Al-Salihi

    2014-01-01

    Background: Polycystic ovarian syndrome (PCOS) is a complex, heterogeneous disorder of uncertain etiology with strong genetic background. Insulin resistance is present in the majority of PCOS cases with linkage and association between single nucleotide polymorphisms of insulin receptor (INSR) gene and PCOS. Objective: To examine whether the exon 17 of INSR gene contributes to genetic susceptibility to PCOS in Iraqi women and its effects on glucose tolerance test and lipid profile. Mater...

  4. Genetic Variation in FADS Genes and Plasma Cholesterol Levels in 2-Year-Old Infants

    Moltó-Puigmartí, Carolina; Jansen, Eugène; Heinrich, Joachim; Standl, Marie; Ronald P. Mensink; Plat, Jogchum; Penders, John; Mommers, Monique; Koppelman, Gerard H.; Postma, Dirkje S.; Thijs, Carel

    2013-01-01

    Single nucleotide polymorphisms (SNPs) in genes involved in fatty acid metabolism (FADS1 FADS2 gene cluster) are associated with plasma lipid levels. We aimed to investigate whether these associations are already present early in life and compare the relative contribution of FADS SNPs vs traditional (non-genetic) factors as determinants of plasma lipid levels. Information on infants' plasma total cholesterol levels, genotypes of five FADS SNPs (rs174545, rs174546, rs174556, rs174561, and rs38...

  5. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  6. Expression profiles of sugarcane under drought conditions: Variation in gene regulation

    Júlio César Farias de Andrade

    2015-01-01

    Full Text Available AbstractDrought is a major factor in decreased sugarcane productivity because of the resulting morphophysiological effects that it causes. Gene expression studies that have examined the influence of water stress in sugarcane have yielded divergent results, indicating the absence of a fixed pattern of changes in gene expression. In this work, we investigated the expression profiles of 12 genes in the leaves of a drought-tolerant genotype (RB72910 of sugarcane and compared the results with those of other studies. The genotype was subjected to 80–100% water availability (control condition and 0–20% water availability (simulated drought. To analyze the physiological status, the SPAD index, Fv/Fm ratio, net photosynthesis (A, stomatal conductance (gs and stomatal transpiration (E were measured. Total RNA was extracted from leaves and the expression of SAMDC, ZmPIP2-1 protein, ZmTIP4-2 protein, WIP protein, LTP protein, histone H3, DNAj, ferredoxin I, β-tubulin, photosystem I, gene 1 and gene 2 was analyzed by quantitative real-time PCR (RT-PCR. Important differences in the expression profiles of these genes were observed when compared with other genotypes, suggesting that complex defense mechanisms are activated in response to water stress. However, there was no recognizable pattern for the changes in expression of the different proteins associated with tolerance to drought stress.

  7. Simple sequence repeat variations expedite phage divergence: Mechanisms of indels and gene mutations.

    Lin, Tiao-Yin

    2016-07-01

    Phages are the most abundant biological entities and influence prokaryotic communities on Earth. Comparing closely related genomes sheds light on molecular events shaping phage evolution. Simple sequence repeat (SSR) variations impart over half of the genomic changes between T7M and T3, indicating an important role of SSRs in accelerating phage genetic divergence. Differences in coding and noncoding regions of phages infecting different hosts, coliphages T7M and T3, Yersinia phage ϕYeO3-12, and Salmonella phage ϕSG-JL2, frequently arise from SSR variations. Such variations modify noncoding and coding regions; the latter efficiently changes multiple amino acids, thereby hastening protein evolution. Four classes of events are found to drive SSR variations: insertion/deletion of SSR units, expansion/contraction of SSRs without alteration of genome length, changes of repeat motifs, and generation/loss of repeats. The categorization demonstrates the ways SSRs mutate in genomes during phage evolution. Indels are common constituents of genome variations and human diseases, yet, how they occur without preexisting repeat sequence is less understood. Non-repeat-unit-based misalignment-elongation (NRUBME) is proposed to be one mechanism for indels without adjacent repeats. NRUBME or consecutive NRUBME may also change repeat motifs or generate new repeats. NRUBME invoking a non-Watson-Crick base pair explains insertions that initiate mononucleotide repeats. Furthermore, NRUBME successfully interprets many inexplicable human di- to tetranucleotide repeat generations. This study provides the first evidence of SSR variations expediting phage divergence, and enables insights into the events and mechanisms of genome evolution. NRUBME allows us to emulate natural evolution to design indels for various applications. PMID:27133219

  8. Phase variation of a Type IIG restriction-modification enzyme alters site-specific methylation patterns and gene expression in Campylobacter jejuni strain NCTC11168

    Anjum, Awais; Kelly, Brathwaite; Aidley, Jack B; Connerton, Phillippa L.; Cummings, Nicola J; Parkhill, Julian; Ian F Connerton; Bayliss, Christopher D

    2016-01-01

    Phase-variable restriction-modification systems are a feature of a diverse range of bacterial species. Stochastic, reversible switches in expression of the methyltransferase produces variation in methylation of specific sequences. Phase-variable methylation by both Type I and Type III methyltransferases is associated with altered gene expression and phenotypic variation. One phase-variable gene of Campylobacter jejuni encodes a homologue of an unusual Type IIG restriction-modification system ...

  9. A Multiple Interaction Analysis Reveals ADRB3 as a Potential Candidate for Gallbladder Cancer Predisposition via a Complex Interaction with Other Candidate Gene Variations

    Rajani Rai; Jong Joo Kim; Sanjeev Misra; Ashok Kumar; Balraj Mittal

    2015-01-01

    Gallbladder cancer is the most common and a highly aggressive biliary tract malignancy with a dismal outcome. The pathogenesis of the disease is multifactorial, comprising the combined effect of multiple genetic variations of mild consequence along with numerous dietary and environmental risk factors. Previously, we demonstrated the association of several candidate gene variations with GBC risk. In this study, we aimed to identify the combination of gene variants and their possible interactio...

  10. Genetic variation in cell death genes and risk of non-Hodgkin lymphoma.

    Johanna M Schuetz

    Full Text Available BACKGROUND: Non-Hodgkin lymphomas are a heterogeneous group of solid tumours that constitute the 5(th highest cause of cancer mortality in the United States and Canada. Poor control of cell death in lymphocytes can lead to autoimmune disease or cancer, making genes involved in programmed cell death of lymphocytes logical candidate genes for lymphoma susceptibility. MATERIALS AND METHODS: We tested for genetic association with NHL and NHL subtypes, of SNPs in lymphocyte cell death genes using an established population-based study. 17 candidate genes were chosen based on biological function, with 123 SNPs tested. These included tagSNPs from HapMap and novel SNPs discovered by re-sequencing 47 cases in genes for which SNP representation was judged to be low. The main analysis, which estimated odds ratios by fitting data to an additive logistic regression model, used European ancestry samples that passed quality control measures (569 cases and 547 controls. A two-tiered approach for multiple testing correction was used: correction for number of tests within each gene by permutation-based methodology, followed by correction for the number of genes tested using the false discovery rate. RESULTS: Variant rs928883, near miR-155, showed an association (OR per A-allele: 2.80 [95% CI: 1.63-4.82]; p(F = 0.027 with marginal zone lymphoma that is significant after correction for multiple testing. CONCLUSIONS: This is the first reported association between a germline polymorphism at a miRNA locus and lymphoma.

  11. Contribution of Myostatin gene polymorphisms to normal variation in lean mass, fat mass and peak BMD in Chinese male offspring

    Hua YUE; Miao LI; Yu-juan LIU; Song-hua WU; Zhen-lin ZHANG; Jin-wei HE; Hao ZHANG; Chun WANG; Wei-wei HU; Jie-mei GU; Yao-hua KE; Wen-zhen FU; Yun-qiu HU

    2012-01-01

    Myostatin gene is a member of the transforming growth factor-β (TGF-β) family that negatively regulates skeletal muscle growth.Genetic polymorphisms in Myostatin were found to be associated with the peak bone mineral density (BMD) in Chinese women.The purpose of this study was to investigate whether Myostatin played a role in the normal variation in peak BMD,lean mass (LM),and fat mass (FM) of Chinese men.Methods:Four hundred male-offspring nuclear families of Chinese Han ethnic group were recruited.Anthropometric measurements,includingthe peak BMD,body LM and FM were measured using dual-energy X-ray absorptiometry (DXA).The single nucleotide polymorphisms (SNPs) studied were tag-SNPs selected by sequencing.Both rs2293284 and +2278G>A were genotyped using TaqMan assay,and rs3791783 was genotyped with PCR-restriction fragment length polymorphism (RFLP) analysis.The associations of the SNPs with anthropometfic variations were analyzed using the quantitative transmission disequilibrium test (QTDT).Results:Using QTDT to detect within-family associations,neither single SNP nor haplotype was found to be associated with peak BMD at any bone site.However,rs3791783 was found to be significantly associated with fat mass of the trunk (P<0.001).Moreover,for within-family associations,haplotypes AGG,AAA,and TGG were found to be significantly associated with the trunk fat mass (all P<0.001).Conclusion:Our results suggest that genetic variation within Myostatin may play a role in regulating the variation in fat mass in Chinese males.Additionally,the Myostatin gene may be a candidate that determines body fat mass in Chinese men.

  12. Natural variation in maternal care and cross-tissue patterns of oxytocin receptor gene methylation in rats.

    Beery, Annaliese K; McEwen, Lisa M; MacIsaac, Julia L; Francis, Darlene D; Kobor, Michael S

    2016-01-01

    This article is part of a Special Issue "Parental Care". Since the first report of maternal care effects on DNA methylation in rats, epigenetic modifications of the genome in response to life experience have become the subject of intense focus across many disciplines. Oxytocin receptor expression varies in response to early experience, and both oxytocin signaling and methylation status of the oxytocin receptor gene (Oxtr) in blood have been related to disordered social behavior. It is unknown whether Oxtr DNA methylation varies in response to early life experience, and whether currently employed peripheral measures of Oxtr methylation reflect variation in the brain. We examined the effects of early life rearing experience via natural variation in maternal licking and grooming during the first week of life on behavior, physiology, gene expression, and epigenetic regulation of Oxtr across blood and brain tissues (mononucleocytes, hippocampus, striatum, and hypothalamus). Rats reared by "high" licking-grooming (HL) and "low" licking-grooming (LL) rat dams exhibited differences across study outcomes: LL offspring were more active in behavioral arenas, exhibited lower body mass in adulthood, and showed reduced corticosterone responsivity to a stressor. Oxtr DNA methylation was significantly lower at multiple CpGs in the blood of LL versus HL males, but no differences were found in the brain. Across groups, Oxtr transcript levels in the hypothalamus were associated with reduced corticosterone secretion in response to stress, congruent with the role of oxytocin signaling in this region. Methylation of specific CpGs at a high or low level was consistent across tissues, especially within the brain. However, individual variation in DNA methylation relative to these global patterns was not consistent across tissues. These results suggest that blood Oxtr DNA methylation may reflect early experience of maternal care, and that Oxtr methylation across tissues is highly concordant

  13. Association of Genetic Variation in Genes Implicated in the β–Catenin Destruction Complex with Risk of Breast Cancer

    Wang, Xianshu; Goode, Ellen L.; Fredericksen, Zachary S.; Vierkant, Robert A; Pankratz, V. Shane; Rider, David N.; Vachon, Celine M.; Cerhan, James R.; Olson, Janet E.; Couch, Fergus J

    2008-01-01

    Aberrant Wnt/β-catenin signaling leading to nuclear accumulation of the oncogene product β-catenin is observed in a wide spectrum of human malignancies. The destruction complex in the Wnt/β-catenin pathway is critical for regulating the level of β-catenin in the cytoplasm and in the nucleus. Here we report a comprehensive study of the contribution of genetic variation in six genes encoding the β-catenin destruction complex (APC, AXIN1, AXIN2, CSNK1D, CSNK1E and GSK3B) to breast cancer using a...

  14. Common genetic variations in the CYP2R1 and GC genes are determinants of vitamin D status in Danes

    Nissen, Ioanna

    ultraviolet (UV)-B) on vitamin D status. This was done by assessing the association between 25 SNPs located in the CYP2R1, CYP24A1, CYP27B1, C10orf88, DHCR7/NADSYN1, GC and VDR genes and vitamin D status in 756 participants in the VitmaD study in late summer (paper I), at the end of a winter season (paper II......), after 6 months intake of vitamin D3-fortified bread and milk (paper II) and in 92 participants in the VitDgen study after artificial UVB irradiation during winter (paper III). Common genetic variations in the CYP2R1 and GC genes were found to be important determinants of vitamin D status in three out of...

  15. Refining analyses of copy number variation identifies specific genes associated with developmental delay.

    Coe, Bradley P; Witherspoon, Kali; Rosenfeld, Jill A; van Bon, Bregje W M; Vulto-van Silfhout, Anneke T; Bosco, Paolo; Friend, Kathryn L; Baker, Carl; Buono, Serafino; Vissers, Lisenka E L M; Schuurs-Hoeijmakers, Janneke H; Hoischen, Alex; Pfundt, Rolph; Krumm, Nik; Carvill, Gemma L; Li, Deana; Amaral, David; Brown, Natasha; Lockhart, Paul J; Scheffer, Ingrid E; Alberti, Antonino; Shaw, Marie; Pettinato, Rosa; Tervo, Raymond; de Leeuw, Nicole; Reijnders, Margot R F; Torchia, Beth S; Peeters, Hilde; O'Roak, Brian J; Fichera, Marco; Hehir-Kwa, Jayne Y; Shendure, Jay; Mefford, Heather C; Haan, Eric; Gécz, Jozef; de Vries, Bert B A; Romano, Corrado; Eichler, Evan E

    2014-10-01

    Copy number variants (CNVs) are associated with many neurocognitive disorders; however, these events are typically large, and the underlying causative genes are unclear. We created an expanded CNV morbidity map from 29,085 children with developmental delay in comparison to 19,584 healthy controls, identifying 70 significant CNVs. We resequenced 26 candidate genes in 4,716 additional cases with developmental delay or autism and 2,193 controls. An integrated analysis of CNV and single-nucleotide variant (SNV) data pinpointed 10 genes enriched for putative loss of function. Follow-up of a subset of affected individuals identified new clinical subtypes of pediatric disease and the genes responsible for disease-associated CNVs. These genetic changes include haploinsufficiency of SETBP1 associated with intellectual disability and loss of expressive language and truncations of ZMYND11 in individuals with autism, aggression and complex neuropsychiatric features. This combined CNV and SNV approach facilitates the rapid discovery of new syndromes and genes involved in neuropsychiatric disease despite extensive genetic heterogeneity. PMID:25217958

  16. Sequence Variation and Expression of the Gimap Gene Family in the BB Rat

    Elizabeth A. Rutledge

    2009-01-01

    Full Text Available Positional cloning of lymphopenia (lyp in the BB rat revealed a frameshift mutation in Gimap5, a member of at least seven related GTPase Immune Associated Protein genes located on rat chromosome 4q24. Our aim was to clone and sequence the cDNA of the BB diabetes prone (DP and diabetes resistant (DR alleles of all seven Gimap genes in the congenic DR.lyp rat line with 2 Mb of BB DP DNA introgressed onto the DR genetic background. All (100% DR.lyp/lyp rats are lymphopenic and develop type 1 diabetes (T1D by 84 days of age while DR.+/+ rats remain T1D and lyp resistant. Among the seven Gimap genes, the Gimap5 frameshift mutation, a mutant allele that produces no protein, had the greatest impact on lymphopenia in the DR.lyp/lyp rat. Gimap4 and Gimap1 each had one amino acid substitution of unlikely significance for lymphopenia. Quantitative RT-PCR analysis showed a reduction in expression of all seven Gimap genes in DR.lyp/lyp spleen and mesenteric lymph nodes when compared to DR.+/+. Only four; Gimap1, Gimap4, Gimap5, and Gimap9 were reduced in thymus. Our data substantiates the Gimap5 frameshift mutation as the primary defect with only limited contributions to lymphopenia from the remaining Gimap genes.

  17. Gene expression profiling of Spodoptera frugiperda hemocytes and fat body using cDNA microarray reveals polydnavirus-associated variations in lepidopteran host genes transcript levels

    Feyereisen R

    2006-06-01

    Full Text Available Abstract Background Genomic approaches provide unique opportunities to study interactions of insects with their pathogens. We developed a cDNA microarray to analyze the gene transcription profile of the lepidopteran pest Spodoptera frugiperda in response to injection of the polydnavirus HdIV associated with the ichneumonid wasp Hyposoter didymator. Polydnaviruses are associated with parasitic ichneumonoid wasps and are required for their development within the lepidopteran host, in which they act as potent immunosuppressive pathogens. In this study, we analyzed transcriptional variations in the two main effectors of the insect immune response, the hemocytes and the fat body, after injection of filter-purified HdIV. Results Results show that 24 hours post-injection, about 4% of the 1750 arrayed host genes display changes in their transcript levels with a large proportion (76% showing a decrease. As a comparison, in S. frugiperda fat body, after injection of the pathogenic JcDNV densovirus, 8 genes display significant changes in their transcript level. They differ from the 7 affected by HdIV and, as opposed to HdIV injection, are all up-regulated. Interestingly, several of the genes that are modulated by HdIV injection have been shown to be involved in lepidopteran innate immunity. Levels of transcripts related to calreticulin, prophenoloxidase-activating enzyme, immulectin-2 and a novel lepidopteran scavenger receptor are decreased in hemocytes of HdIV-injected caterpillars. This was confirmed by quantitative RT-PCR analysis but not observed after injection of heat-inactivated HdIV. Conversely, an increased level of transcripts was found for a galactose-binding lectin and, surprisingly, for the prophenoloxidase subunits. The results obtained suggest that HdIV injection affects transcript levels of genes encoding different components of the host immune response (non-self recognition, humoral and cellular responses. Conclusion This analysis of the

  18. LOESS correction for length variation in gene set-based genomic sequence analysis

    Aboukhalil, Anton; Bulyk, Martha L.

    2012-01-01

    Motivation: Sequence analysis algorithms are often applied to sets of DNA, RNA or protein sequences to identify common or distinguishing features. Controlling for sequence length variation is critical to properly score sequence features and identify true biological signals rather than length-dependent artifacts.

  19. Schooling and Variation in the "COMT" Gene: The Devil Is in the Details

    Campbell, Daniel; Bick, Johanna; Yrigollen, Carolyn M.; Lee, Maria; Joseph, Antony; Chang, Joseph T.; Grigorenko, Elena L.

    2013-01-01

    Background: Schooling is considered one of the major contributors to the development of intelligence within societies and individuals. Genetic variation might modulate the impact of schooling and explain, at least partially, the presence of individual differences in classrooms. Method: We studied a sample of 1,502 children (mean age = 11.7 years)…

  20. Whole-genome sequencing reveals the diversity of cattle copy number variations and multicopy genes

    Structural and functional impacts of copy number variations (CNVs) on livestock genomes are not yet well understood. We identified 1853 CNV regions using population-scale sequencing data generated from 75 cattle representing 8 breeds (Angus, Brahman, Gir, Holstein, Jersey, Limousin, Nelore, Romagnol...

  1. In vivo phase variation of MR/P fimbrial gene expression in Proteus mirabilis infecting the urinary tract.

    Zhao, H; Li, X; Johnson, D E; Blomfield, I; Mobley, H L

    1997-03-01

    Proteus mirabilis, associated with complicated urinary tract infection, expresses mannose-resistant/Proteus-like (MR/P) fimbriae. Expression of these surface structures, which mediate haemagglutination and have a demonstrated role in virulence, undergoes phase variation. By DNA sequence analysis, a 252 bp invertible element was found in the intergenic region between mrpl, the putative site-specific recombinase gene, and mrpA, the primary structural subunit gene. The invertible segment is flanked by identical 21 bp inverted repeats and the presumptive half-sites for recombinase binding show homology to those recognized by FimB and FimE encoded by the Escherichia coli fim (Type 1 fimbriae) gene cluster. When amplified by the polymerase chain reaction (PCR) from static broth cultures expressing MR/P fimbriae, the switch region was found in both ON and OFF positions. When PCR was used to amplify agar cultures which do not express the fimbriae, the switch region was OFF only. A canonical sigma 70 promoter inside the invertible element drives the transcription of mrpA when in the ON position; in the OFF position it is directed away from mrpA but does not appear to drive expression of mrpI. The mrpI gene was able to confer inversion of the mrp switch region in trans from both ON to OFF and OFF to ON. To examine the position of the switch in vivo, urine, bladder, and kidneys from mice transurethrally infected with P. mirabilis were used to prepare template DNA for PCR amplification. In the absence of urolithiasis (urease-mediated stone formation), the switch was found 100% in the ON position, a condition never observed following in vitro culture. We conclude that MR/P phase variation is regulated at the transcriptional level by the action of MrpI on an invertible element and that there is strong selective pressure for the expression of MR/P fimbriae in vivo. PMID:9076737

  2. Variation at the Calpain 3 gene is associated with meat tenderness in zebu and composite breeds of cattle

    Bunch Rowan J

    2008-07-01

    Full Text Available Abstract Background Quantitative Trait Loci (QTL affecting meat tenderness have been reported on Bovine chromosome 10. Here we examine variation at the Calpain 3 (CAPN3 gene in cattle, a gene located within the confidence interval of the QTL, and which is a positional candidate gene based on the biochemical activity of the protein. Results We identified single nucleotide polymorphisms (SNP in the genomic sequence of the CAPN3 gene and tested three of these in a sample of 2189 cattle. Of the three SNP genotyped, the CAPN3:c.1538+225G>T had the largest significant additive effect, with an allele substitution effect in the Brahman of α = -0.144 kg, SE = 0.060, P = 0.016, and the polymorphism explained 1.7% of the residual phenotypic variance in that sample of the breed. Significant haplotype substitution effects were found for all three breeds, the Brahman, the Belmont Red, and the Santa Gertrudis. For the common haplotype, the haplotype substitution effect in the Brahman was α = 0.169 kg, SE = 0.056, P = 0.003. The effect of this gene was compared to Calpastatin in the same sample. The SNP show negligible frequencies in taurine breeds and low to moderate minor allele frequencies in zebu or composite animals. Conclusion These associations confirm the location of a QTL for meat tenderness in this region of bovine chromosome 10. SNP in or near this gene may be responsible for part of the overall difference between taurine and zebu breeds in meat tenderness, and the greater variability in meat tenderness found in zebu and composite breeds. The evidence provided so far suggests that none of these tested SNP are causative mutations.

  3. The thermostable direct hemolysin-related hemolysin (trh) gene of Vibrio parahaemolyticus: Sequence variation and implications for detection and function.

    Nilsson, William B; Turner, Jeffrey W

    2016-07-01

    Vibrio parahaemolyticus is a leading cause of bacterial food-related illness associated with the consumption of undercooked seafood. Only a small subset of strains is pathogenic. Most clinical strains encode for the thermostable direct hemolysin (TDH) and/or the TDH-related hemolysin (TRH). In this work, we amplify and sequence the trh gene from over 80 trh+strains of this bacterium and identify thirteen genetically distinct alleles, most of which have not been deposited in GenBank previously. Sequence data was used to design new primers for more reliable detection of trh by endpoint PCR. We also designed a new quantitative PCR assay to target a more conserved gene that is genetically-linked to trh. This gene, ureR, encodes the transcriptional regulator for the urease gene cluster immediately upstream of trh. We propose that this ureR assay can be a useful screening tool as a surrogate for direct detection of trh that circumvents challenges associated with trh sequence variation. PMID:27094247

  4. Variations in Multiple Syndromic Deafness Genes Mimic Non-syndromic Hearing Loss.

    Bademci, G; Cengiz, F B; Foster Ii, J; Duman, D; Sennaroglu, L; Diaz-Horta, O; Atik, T; Kirazli, T; Olgun, L; Alper, H; Menendez, I; Loclar, I; Sennaroglu, G; Tokgoz-Yilmaz, S; Guo, S; Olgun, Y; Mahdieh, N; Bonyadi, M; Bozan, N; Ayral, A; Ozkinay, F; Yildirim-Baylan, M; Blanton, S H; Tekin, M

    2016-01-01

    The genetics of both syndromic (SHL) and non-syndromic hearing loss (NSHL) is characterized by a high degree of genetic heterogeneity. We analyzed whole exome sequencing data of 102 unrelated probands with apparently NSHL without a causative variant in known NSHL genes. We detected five causative variants in different SHL genes (SOX10, MITF, PTPN11, CHD7, and KMT2D) in five (4.9%) probands. Clinical re-evaluation of these probands shows that some of them have subtle syndromic findings, while none of them meets clinical criteria for the diagnosis of the associated syndrome (Waardenburg (SOX10 and MITF), Kallmann (CHD7 and SOX10), Noonan/LEOPARD (PTPN11), CHARGE (CHD7), or Kabuki (KMT2D). This study demonstrates that individuals who are evaluated for NSHL can have pathogenic variants in SHL genes that are not usually considered for etiologic studies. PMID:27562378

  5. Serotonin and Early Cognitive Development: Variation in the Tryptophan Hydroxylase 2 Gene Is Associated with Visual Attention in 7-Month-Old Infants

    Leppanen, Jukka M.; Peltola, Mikko J.; Puura, Kaija; Mantymaa, Mirjami; Mononen, Nina; Lehtimaki, Terho

    2011-01-01

    Background: Allelic variation in the promoter region of a gene that encodes tryptophan hydroxylase isoform 2 (TPH2), a rate-limiting enzyme of serotonin synthesis in the central nervous system, has been associated with variations in cognitive function and vulnerability to affective spectrum disorders. Little is known about the effects of this gene…

  6. Natural variation in four human collagen genes across an ethnically diverse population

    Chan, Ting-Fung; Poon, Annie; Basu, Analabha; Addleman, Nick R.; Chen, Justin; Phong, Angie; Byers, Peter H; Klein, Teri E.; Kwok, Pui-Yan

    2008-01-01

    Collagens are members of one of the most important families of structural proteins in higher organisms. There are 28 types of collagens encoded by 43 genes in humans that fall into several different functional protein classes. Mutations in the major fibrillar collagen genes lead to osteogenesis imperfecta (COL1A1 and COL1A2 encoding the chains of Type I collagen), chondrodysplasias (COL2A1 encoding the chains of Type II collagen), and vascular Ehlers-Danlos syndrome (COL3A1 encoding the chain...

  7. Age-related cognitive decline : the role of allelic variations in two genes (COMT and APOE)

    2011-01-01

    The catechol-O-methyltransferase (COMT) gene codes for the COMT enzyme, which has a role in the degradation of dopamine in the prefrontal cortex. The dopaminergic system declines with age, and aging might increase the effects of COMT on cognition. It is in particular the COMT Val158Met single nucleotide polymorphism (SNP) that has been investigated in association with cognition, but other COMT SNPs have also been studied. The ε4 allele of the Apolipoprotein E (APOE) gene is a known risk facto...

  8. Transcriptional regulation of the VEGF gene in dependence of individual genomic variations.

    Metzger, Carmen S; Koutsimpelas, Dimitrios; Brieger, Juergen

    2015-12-01

    Overexpression of the vascular endothelial growth factor (VEGF) gene has been associated with advanced stage and poor survival in several cancers. The majority of disease-associated VEGF-single nucleotide polymorphisms (SNPs) locate within regulatory regions. Therefore, an influence of SNPs located in the promoter/5'-untranslated region (5'UTR) on transcription factor binding (TFB) and gene expression seems feasible. We reviewed the literature investigating a potential connection of VEGF-SNPs and transcriptional regulation of the VEGF gene. In addition, we employed transcription factor databases to search for VEGF-SNPs which have already been associated with diseases. The objective of this review is to gain an overview about an association of VEGF-SNPs and the transcription factor dependent regulation of the VEGF gene. A decreasing binding specificity of the transcription factor MZF1 in presence of the VEGF-SNP +405 C-allele has been reported. TF databases indicated a potential HIF binding site for the -2578 C-allele representing an important potential inducer of VEGF expression. Additionally, linkage disequilibrium of the -2578 A-allele and an 18 bp insertion increases the number of potential TFB sites. For the VEGF promoter SNP -1154 A/G an interaction with the HRE under participation of the SNP +405 C/G was supposed. The comprehension of the association of specific SNPs and TFB could be an essential part in our understanding of individual differences of VEGF regulation and course of diseases. PMID:26209503

  9. Dopamine Receptor D4 Gene Variation Predicts Preschoolers' Developing Theory of Mind

    Lackner, Christine; Sabbagh, Mark A.; Hallinan, Elizabeth; Liu, Xudong; Holden, Jeanette J. A.

    2012-01-01

    Individual differences in preschoolers' understanding that human action is caused by internal mental states, or representational theory of mind (RTM), are heritable, as are developmental disorders such as autism in which RTM is particularly impaired. We investigated whether polymorphisms of genes affecting dopamine (DA) utilization and metabolism…

  10. Variation in Sequence and Location of the Fumonisin Mycotoxin Biosynthetic Gene Cluster in Fusarium

    Several Fusarium species in the Gibberella fujikuroi species complex (GFSC) and rare strains of F. oxysporum can produce fumonisins, a family of mycotoxins associated with multiple health disorders in humans and animals. In Fusarium, the ability to produce fumonisins is governed by a 17-gene fumoni...

  11. Genetic Variation in the Leptin Receptor Gene, Leptin, and Weight Gain in Young Dutch Adults

    Rossum, van C.T.M.; Hoebee, B.; Baak, van M.A.; Mars, M.; Saris, W.H.M.; Seidell, J.C.

    2003-01-01

    Objective: To investigate the association between leptin levels, polymorphisms in the leptin receptor (LEPR) gene, and weight gain. Research Methods and Procedures: From two large prospective cohorts in The Netherlands (n = 17, 500), we compared the baseline leptin of 259 subjects who had gained an

  12. CNTNAP2 gene dosage variation is associated with schizophrenia and epilepsy

    Friedman, J. I.; Vrijenhoek, T.; Markx, S.; Janssen, I. M.; Van der Vliet, W. A.; Faas, B. H. W.; Knoers, N. V.; Cahn, W.; Kahn, R. S.; Edelmann, L.; Davis, K. L.; Silverman, J. M.; Brunner, H. G.; Van Kessel, A. Geurts; Wijmenga, C.; Ophoff, R. A.; Veltman, J. A.

    2008-01-01

    A homozygous mutation of the CNTNAP2 gene has been associated with a syndrome of focal epilepsy, mental retardation, language regression and other neuropsychiatric problems in children of the Old Order Amish community. Here we report genomic rearrangements resulting in haploinsufficiency of the CNTN

  13. Proteomic changes resulting from gene copy number variations in cancer cells.

    Tamar Geiger

    2010-09-01

    Full Text Available Along the transformation process, cells accumulate DNA aberrations, including mutations, translocations, amplifications, and deletions. Despite numerous studies, the overall effects of amplifications and deletions on the end point of gene expression--the level of proteins--is generally unknown. Here we use large-scale and high-resolution proteomics combined with gene copy number analysis to investigate in a global manner to what extent these genomic changes have a proteomic output and therefore the ability to affect cellular transformation. We accurately measure expression levels of 6,735 proteins and directly compare them to the gene copy number. We find that the average effect of these alterations on the protein expression is only a few percent. Nevertheless, by using a novel algorithm, we find the combined impact that many of these regional chromosomal aberrations have at the protein level. We show that proteins encoded by amplified oncogenes are often overexpressed, while adjacent amplified genes, which presumably do not promote growth and survival, are attenuated. Furthermore, regulation of biological processes and molecular complexes is independent of general copy number changes. By connecting the primary genome alteration to their proteomic consequences, this approach helps to interpret the data from large-scale cancer genomics efforts.

  14. Growth Media Induces Variation in Cell Wall Associated Gene Expression in Arabidopsis thaliana Pollen Tube

    Mário Luís da Costa

    2013-06-01

    Full Text Available The influence of three different pollen germination media on the transcript profile of Arabidopsis pollen tubes has been assessed by real-time PCR on a selection of cell wall related genes, and by a statistical analysis of microarray Arabidopsis pollen tube data sets. The qPCR assays have shown remarkable differences on the transcript levels of specific genes depending upon the formulation of the germination medium used. With the aid of principal component analysis performed on existing microarray data, a subset of genes has been identified that is more prone to produce diverging transcript levels. A functional classification of those genes showed that the clusters with higher number of members were those for hydrolase activity (based in molecular function and for cell wall (based in cellular component. Taken together, these results may indicate that the nutrient composition of the pollen germination media influences pollen tube metabolism and that caution must be taken when interpreting transcriptomic data of pollen tubes.

  15. Investigating the potential role of genetic and epigenetic variation of DNA methyltransferase genes in hyperplastic polyposis syndrome.

    Musa Drini

    Full Text Available BACKGROUND: Hyperplastic Polyposis Syndrome (HPS is a condition associated with multiple serrated polyps, and an increased risk of colorectal cancer (CRC. At least half of CRCs arising in HPS show a CpG island methylator phenotype (CIMP, potentially linked to aberrant DNA methyltransferase (DNMT activity. CIMP is associated with methylation of tumor suppressor genes including regulators of DNA mismatch repair (such as MLH1, MGMT, and negative regulators of Wnt signaling (such as WIF1. In this study, we investigated the potential for interaction of genetic and epigenetic variation in DNMT genes, in the aetiology of HPS. METHODS: We utilized high resolution melting (HRM analysis to screen 45 cases with HPS for novel sequence variants in DNMT1, DNMT3A, DNMT3B, and DNMT3L. 21 polyps from 13 patients were screened for BRAF and KRAS mutations, with assessment of promoter methylation in the DNMT1, DNMT3A, DNMT3B, DNMT3L MLH1, MGMT, and WIF1 gene promoters. RESULTS: No pathologic germline mutations were observed in any DNA-methyltransferase gene. However, the T allele of rs62106244 (intron 10 of DNMT1 gene was over-represented in cases with HPS (p<0.01 compared with population controls. The DNMT1, DNMT3A and DNMT3B promoters were unmethylated in all instances. Interestingly, the DNMT3L promoter showed low levels of methylation in polyps and normal colonic mucosa relative to matched disease free cells with methylation level negatively correlated to expression level in normal colonic tissue. DNMT3L promoter hypomethylation was more often found in polyps harbouring KRAS mutations (p = 0.0053. BRAF mutations were common (11 out of 21 polyps, whilst KRAS mutations were identified in 4 of 21 polyps. CONCLUSIONS: Genetic or epigenetic alterations in DNMT genes do not appear to be associated with HPS, but further investigation of genetic variation at rs62106244 is justified given the high frequency of the minor allele in this case series.

  16. Variation in the Dicer and RAN Genes Are Associated with Survival in Patients with Hepatocellular Carcinoma.

    Kim, Mi Na; Kim, Jung Oh; Lee, Seung Min; Park, Hana; Lee, Ju Ho; Rim, Kyu Sung; Hwang, Seong Gyu; Kim, Nam Keun

    2016-01-01

    Single-nucleotide polymorphisms (SNPs) in microRNA machinery genes might affect microRNA processing and subsequently impact tumorigenesis. The aim of this study was to investigate the associations between SNPs in microRNA machinery genes and hepatocellular carcinoma (HCC) in a Korean population. Genotyping of six SNPs in microRNA machinery genes was performed using blood samples from 147 patients with HCC and 209 healthy control subjects. None of the six SNPs in microRNA machinery genes were significantly associated with HCC development. However, among the models for six polymorphic loci-DICER (rs3742330 and rs13078), DROSHA (rs10719 and rs6877842), RAN (rs14035) and XPO5 (rs11077)-one allele combination (A-A-T-C-C-C) showed synergistic effects in terms of an increased risk of HCC development (odds ratio = 8.881, 95% confidence interval [CI] = 1.889-41.750; P = 0.002). Multivariate Cox proportional hazard regression analysis showed a significant survival benefit for the DICER rs3742330 GG compared with the AA type (hazard ratio [HR], 0.314; 95% CI, 0.135-0.730; P = 0.007) and for the RAN rs14035 CT compared with the CC genotype (HR, 0.587; 95% CI, 0.349-0.987; P = 0.044). Although we found no direct association between DICER (rs3742330 and rs13078), DROSHA (rs10719 and rs6877842), RAN (rs14035) or XPO5 (rs11077) polymorphisms and HCC risk, we demonstrated that DICER (rs3742330) and RAN (rs14035) were associated with the survival of HCC patients. Future studies with larger samples are needed to determine associations of SNPs in microRNA machinery genes with HCC risk and prognosis. PMID:27611467

  17. Sources of variation in baseline gene expression levels from toxicogenomics study control animals across multiple laboratories

    Lee Janice S

    2008-06-01

    Full Text Available Abstract Background The use of gene expression profiling in both clinical and laboratory settings would be enhanced by better characterization of variance due to individual, environmental, and technical factors. Meta-analysis of microarray data from untreated or vehicle-treated animals within the control arm of toxicogenomics studies could yield useful information on baseline fluctuations in gene expression, although control animal data has not been available on a scale and in a form best served for data-mining. Results A dataset of control animal microarray expression data was assembled by a working group of the Health and Environmental Sciences Institute's Technical Committee on the Application of Genomics in Mechanism Based Risk Assessment in order to provide a public resource for assessments of variability in baseline gene expression. Data from over 500 Affymetrix microarrays from control rat liver and kidney were collected from 16 different institutions. Thirty-five biological and technical factors were obtained for each animal, describing a wide range of study characteristics, and a subset were evaluated in detail for their contribution to total variability using multivariate statistical and graphical techniques. Conclusion The study factors that emerged as key sources of variability included gender, organ section, strain, and fasting state. These and other study factors were identified as key descriptors that should be included in the minimal information about a toxicogenomics study needed for interpretation of results by an independent source. Genes that are the most and least variable, gender-selective, or altered by fasting were also identified and functionally categorized. Better characterization of gene expression variability in control animals will aid in the design of toxicogenomics studies and in the interpretation of their results.

  18. Interplay Between Environment and Genes on Morphological Variation in Perch – Implications for Resource Polymorphisms

    Olsson, Jens

    2006-01-01

    Recent research has suggested that individual specialization within populations could be substantial and more common than previously acknowledged. Eurasian perch is one of many species of fish in lakes of postglacial origin that displays a morphological and dietary variation tightly coupled to the littoral and pelagic habitats of the lake. The occurrence of such resource polymorphisms might have important consequences for local adaptation and might also be an important initial step in speciat...

  19. MHC gene copy number variation in Tasmanian devils: implications for the spread of a contagious cancer

    Siddle, Hannah V; Marzec, Jolanta; Cheng, Yuanyuan; Jones, Menna; Belov, Katherine

    2010-01-01

    Tasmanian devils face extinction owing to the emergence of a contagious cancer. Devil facial tumour disease (DFTD) is a clonal cancer spread owing to a lack of major histocompatibility complex (MHC) barriers in Tasmanian devil populations. We present a comprehensive screen of MHC diversity in devils and identify 25 MHC types and 53 novel sequences, but conclude that overall levels of MHC diversity at the sequence level are low. The majority of MHC Class I variation can be explained by allelic...

  20. Naturally Occurring Variations in the Human Cholinesterase Genes: Heritability and Association with Cardiovascular and Metabolic Traits

    Valle, Anne M.; Radić, Zoran; Rana, Brinda K.; Mahboubi, Vafa; Wessel, Jennifer; Shih, Pei-an Betty; Rao, Fangwen; O'Connor, Daniel T.; Taylor, Palmer

    2011-01-01

    Cholinergic neurotransmission in the central and autonomic nervous systems regulates immediate variations in and longer-term maintenance of cardiovascular function with acetylcholinesterase (AChE) activity that is critical to temporal responsiveness. Butyrylcholinesterase (BChE), largely confined to the liver and plasma, subserves metabolic functions. AChE and BChE are found in hematopoietic cells and plasma, enabling one to correlate enzyme levels in whole blood with hereditary traits in twi...

  1. Assortative mating and gene flow generate clinal phenological variation in trees

    Soularue Jean-Paul; Kremer Antoine

    2012-01-01

    Abstract Background On-going climate change is shifting the timing of bud burst (TBB) of broad leaf and conifer trees in temperate areas, raising concerns about the abilities of natural populations to respond to these shifts. The level of expected evolutionary change depends on the level and distribution of genetic variation of TBB. While numerous experimental studies have highlighted the role of divergent selection in promoting clinal TBB differentiation, we explored whether the observed pat...

  2. The Effects of Sequence Variation on Genome-wide NRF2 Binding—New Target Genes and Regulatory SNPs

    Kuosmanen, Suvi M.; Viitala, Sari; Laitinen, Tuomo; Peräkylä, Mikael; Pölönen, Petri; Kansanen, Emilia; Leinonen, Hanna; Raju, Suresh; Wienecke-Baldacchino, Anke; Närvänen, Ale; Poso, Antti; Heinäniemi, Merja; Heikkinen, Sami; Levonen, Anna-Liisa

    2016-01-01

    Transcription factor binding specificity is crucial for proper target gene regulation. Motif discovery algorithms identify the main features of the binding patterns, but the accuracy on the lower affinity sites is often poor. Nuclear factor E2-related factor 2 (NRF2) is a ubiquitous redox-activated transcription factor having a key protective role against endogenous and exogenous oxidant and electrophile stress. Herein, we decipher the effects of sequence variation on the DNA binding sequence of NRF2, in order to identify both genome-wide binding sites for NRF2 and disease-associated regulatory SNPs (rSNPs) with drastic effects on NRF2 binding. Interactions between NRF2 and DNA were studied using molecular modelling, and NRF2 chromatin immunoprecipitation-sequence datasets together with protein binding microarray measurements were utilized to study binding sequence variation in detail. The binding model thus generated was used to identify genome-wide binding sites for NRF2, and genomic binding sites with rSNPs that have strong effects on NRF2 binding and reside on active regulatory elements in human cells. As a proof of concept, miR-126–3p and -5p were identified as NRF2 target microRNAs, and a rSNP (rs113067944) residing on NRF2 target gene (Ferritin, light polypeptide, FTL) promoter was experimentally verified to decrease NRF2 binding and result in decreased transcriptional activity. PMID:26826707

  3. Mechanism and Effect of Temperature on Variations in Antibiotic Resistance Genes during Anaerobic Digestion of Dairy Manure

    Sun, Wei; Qian, Xun; Gu, Jie; Wang, Xiao-Juan; Duan, Man-Li

    2016-07-01

    Animal manure comprises an important reservoir for antibiotic resistance genes (ARGs), but the variation in ARGs during anaerobic digestion at various temperatures and its underlying mechanism remain unclear. Thus, we performed anaerobic digestion using dairy manure at three temperature levels (moderate: 20 °C, mesophilic: 35 °C, and thermophilic: 55 °C), to analyze the dynamics of ARGs and bacterial communities by quantitative PCR and 16S rRNA gene sequencing. We found that 8/10 detected ARGs declined and 5/10 decreased more than 1.0 log during thermophilic digestion, whereas only four and five ARGs decreased during moderate and mesophilic digestion, respectively. The changes in ARGs and bacterial communities were similar under the moderate and mesophilic treatments, but distinct from those in the thermophilic system. Potential pathogens such as Bacteroidetes, Proteobacteria, and Corynebacterium were removed by thermophilic digestion but not by moderate and mesophilic digestion. The bacterial community succession was the dominant mechanism that influenced the variation in ARGs and integrons during anaerobic digestion. Thermophilic digestion decreased the amount of mesophilic bacteria (Bacteroidetes and Proteobacteria) carrying ARGs. Anaerobic digestion generally decreased the abundance of integrons by eliminating the aerobic hosts of integrons (Actinomycetales and Bacilli). Thermophilic anaerobic digestion is recommended for the treatment and reuse of animal manure.

  4. Social Media marketing nas bibliotecas académicas portuguesas

    Armanda Salgado, Maria; Pacios Lozano, Ana Reyes

    2016-01-01

    Apresentam-se as perceções dos profissionais da informação das bibliotecas académicas portuguesas face à adoção do conceito social media marketing. Os resultados foram obtidos, através da aplicação de um questionário online à Rede de Informação do Instituto Nacional de Estatística em Bibliotecas do Ensino Superior (Portugal). Conclui-se que apesar dos profissionais da informação reconhecerem o valor da participação das bibliotecas académicas na web social e da sua utilização visando o marketi...

  5. Association of variation in the LAMA3 gene, encoding the alpha-chain of laminin 5, with atopic dermatitis in a German case-control cohort

    Stemmler, Susanne; Parwez, Qumar; Petrasch-Parwez, Elisabeth; Epplen, Jörg T; Hoffjan, Sabine

    2014-01-01

    Background Atopic dermatitis (AD) is a chronic inflammatory skin disorder caused by complex interaction of genetic and environmental factors. Besides mutations in the filaggrin gene, leading to impaired skin barrier function, variation in genes encoding additional skin proteins has been suggested to contribute to disease risk. Laminin 5, playing an important role in skin integrity, is composed of three subunits encoded by the LAMA3, LAMB3 and LAMC2 genes in which biallelic mutations cause epi...

  6. Risk stratification of T-cell Acute Lymphoblastic Leukemia patients based on gene expression, mutations and copy number variation.

    Mirji, Gauri; Bhat, Jaydeep; Kode, Jyoti; Banavali, Shripad; Sengar, Manju; Khadke, Prashant; Sait, Osama; Chiplunkar, Shubhada

    2016-06-01

    Gene expression, copy number variations (CNV), mutations and survival were studied to delineate TCRγδ+T-cell acute lymphoblastic leukemia (T-ALL) as a distinct subgroup from TCRαβ+T-ALL. Gene Ontology analysis showed that differential regulation of genes involved in pathways for leukemogenesis, apoptosis, cytokine-cytokine receptor interaction and antigen processing/presentation may offer a survival benefit to TCRγδ+T-ALL patients. Genes involved in disease biology and having equal expression in both the subgroups, were further analysed for mutations and CNV using droplet digital PCR. TCRγδ+T-ALL patients exhibited differential level of mutations for NOTCH1 and IKZF3; however BRAF mutations were detected at equal levels in both the subgroups. Although TCRγδ+T-ALL patients with these mutations demonstrated improved disease-free survival (DFS) as compared TCRαβ+T-ALL patients, it was not statistically significant. Patients with homozygous deletion of CDKN2A/CDKN2B showed poor DFS in each subgroup. TCRγδ+T-ALL patients with wild type/heterozygous deletion of CDKN2A/CDKN2B possess significantly better DFS over TCRαβ+T-ALL patients (p=0.017 and 0.045, respectively). Thus, the present study has for the first time demonstrated TCRγδ clonality and CDKN2A/CDKN2B CNV together as potential prognostic markers in management of T-ALL. Further understanding the functional significance of differentially regulated genes in T-ALL patients would aid in designing risk based treatment strategies in subset specific manner. PMID:27070758

  7. Genetic variation in the Catechol-O-Methyltransferase (COMT gene and morphine requirements in cancer patients with pain

    Kaasa Stein

    2008-12-01

    Full Text Available Abstract Background Genetic variation contributes to differences in pain sensitivity and response to different analgesics. Catecholamines are involved in the modulation of pain and are partly metabolized by the catechol-O-methyltransferase (COMT enzyme. Genetic variability in the COMT gene may therefore contribute to differences in pain sensitivity and response to analgesics. It is shown that a polymorphism in the COMT gene, Rs4680 (Val158Met, influence pain sensitivity in human experimental pain and the efficacy for morphine in cancer pain treatment. In this study we wanted to investigate if variability in other regions in the COMT gene also contributes to interindividual variability in morphine efficacy. Results We genotyped 11 single nucleotide polymorphisms (SNPs throughout the COMT gene, and constructed haplotypes from these 11 SNPs, which were in Hardy-Weinberg equilibrium. We compared both genotypes and haplotypes against pharmacological, demographical and patient symptoms measurements in a Caucasian cancer patient cohort (n = 197 receiving oral morphine treatment for cancer pain. There were two frequent haplotypes (34.5% and 17.8% in our cohort. Multivariate analyses showed that patients carrying the most frequent haplotype (34.5% needed lower morphine doses than patients not carrying the haplotype, with a reduction factor of 0.71 (p = 0.005. On the allele level, carriers of alleles for six of the SNPs show weak associations in respect to morphine dose and the alleles associated with the lowest morphine doses constitute part of the most frequent haplotype. Conclusion This study suggests that genetic variability in the COMT gene influence the efficacy of morphine in cancer patients with pain, and that increased understanding of this variability is reached by expanding from analyses of single SNPs to haplotype construction and analyses.

  8. Plagio e integridad académica en Alemania

    2016-07-01

    Full Text Available Alemania es quizá uno de los países europeos que, ya desde el siglo XVIII, ha mantenido un debate público más intenso sobre prácticas científicas y académicas deshonestas, relacionadas especialmente con tesis doctorales. Este debate fue especialmente productivo a finales del siglo XIX, dando lugar desde entonces, para evitar estas prácticas inaceptables, a la obligatoriedad de publicar todas las tesis doctorales, como requisito previo a la expedición del título de doctor por cualquier universidad alemana. Este trabajo analiza los avances más importantes en plagio e integridad académica en Alemania, especialmente después del escándalo surgido en 2011 a raíz del plagio de la tesis doctoral del Ministro de Defensa Guttenberg, como son la creación de una eficaz metodología colaborativa de investigación del plagio en trabajos científicos o académicos utilizando Internet y las redes sociales, materializada en la Wiki «VroniPlag». También se describe someramente en este trabajo la consolidación definitiva de la figura del «Defensor de la Ciencia», como instrumento de ámbito nacional para prevenir, gestionar y combatir la deshonestidad científica, aparte de la publicación en 2013 de una nueva versión del manual de referencia al respecto «Sicherung guter wissenschaftlicher Praxis». Por último se analizan las conclusiones de la experiencia alemana relacionada con la ética académica, también desde una perspectiva histórica, pues sus recientes logros y avances pueden servir de referencia a otros países europeos.

  9. Sequence variation in three mitochondrial DNA genes among isolates of Ascaridia galli originating from Guangdong, Hunan and Yunnan provinces, China.

    Li, J Y; Liu, G H; Wang, Y; Song, H Q; Lin, R Q; Zou, F C; Liu, W; Xu, M J; Zhu, X Q

    2013-09-01

    The present study examined sequence variation in three mitochondrial DNA (mtDNA) genes, namely cytochrome c oxidase subunit 3 (cox3) and NADH dehydrogenase subunits 1 and 4 (nad1 and nad4), among Ascaridia galli isolates from different geographical localities in China. A portion of cox3 (pcox3), nad1 (pnad1) and nad4 (pnad4) genes were amplified by polymerase chain reaction (PCR) separately from adult A. galli individuals and the amplicons were subjected to sequencing from both directions. The length of the sequences of pcox3, pnad1 and pnad4 were 408 bp, 471 bp and 333 bp, respectively. The intraspecific sequence variations within A. galli were 0-1.7% for pcox3, 0-2.8% for pnad1 and 0-3.4% for pnad4. The A+T contents of the sequences were 67.16-67.65% (pcox3), 67.09-67.94% (pnad1) and 69.91-71.77% (pnad4). The interspecific sequence differences among members of the Ascaridida were significantly higher, being 13.2-30.9%, 12.8-29.0% and 15.1-34.1% for pcox3, pnad1 and pnad4, respectively. Phylogenetic analyses using combined sequences of pcox3, pnad1 and pnad4, with three different computational algorithms (Bayesian analysis, maximum likelihood and maximum parsimony), all revealed distinct groups with high statistical support. These findings demonstrated the existence of intraspecific variation in mitochondrial DNA (mtDNA) sequences among A. galli isolates from different geographical regions in China, and have implications for studying molecular epidemiology and population genetics of A. galli. PMID:23046568

  10. Association of interleukin-1 gene variations with moderate to severe chronic periodontitis in multiple ethnicities

    Wu, X.; Offenbacher, S; Lόpez, N J; Chen, D.; Wang, H-Y; Rogus, J.; Zhou, J.; Beck, J.; Jiang, S; X. Bao; Wilkins, L; Doucette-Stamm, L.; Kornman, K

    2014-01-01

    Background and Objective Genetic markers associated with disease are often non-functional and generally tag one or more functional “causative” variants in linkage disequilibrium. Markers may not show tight linkage to the causative variants across multiple ethnicities due to evolutionary divergence, and therefore may not be informative across different population groups. Validated markers of disease suggest causative variants exist in the gene and, if the causative variants can be identified, ...

  11. Gene Transfer Efficiency in Gonococcal Biofilms: Role of Biofilm Age, Architecture, and Pilin Antigenic Variation

    Kouzel, Nadzeya; Oldewurtel, Enno R.; Maier, Berenike

    2015-01-01

    Extracellular DNA is an important structural component of many bacterial biofilms. It is unknown, however, to which extent external DNA is used to transfer genes by means of transformation. Here, we quantified the acquisition of multidrug resistance and visualized its spread under selective and nonselective conditions in biofilms formed by Neisseria gonorrhoeae. The density and architecture of the biofilms were controlled by microstructuring the substratum for bacterial adhesion. Horizontal t...

  12. Genetic variations and haplotype diversity of the UGT1 gene cluster in the Chinese population.

    Jing Yang

    Full Text Available Vertebrates require tremendous molecular diversity to defend against numerous small hydrophobic chemicals. UDP-glucuronosyltransferases (UGTs are a large family of detoxification enzymes that glucuronidate xenobiotics and endobiotics, facilitating their excretion from the body. The UGT1 gene cluster contains a tandem array of variable first exons, each preceded by a specific promoter, and a common set of downstream constant exons, similar to the genomic organization of the protocadherin (Pcdh, immunoglobulin, and T-cell receptor gene clusters. To assist pharmacogenomics studies in Chinese, we sequenced nine first exons, promoter and intronic regions, and five common exons of the UGT1 gene cluster in a population sample of 253 unrelated Chinese individuals. We identified 101 polymorphisms and found 15 novel SNPs. We then computed allele frequencies for each polymorphism and reconstructed their linkage disequilibrium (LD map. The UGT1 cluster can be divided into five linkage blocks: Block 9 (UGT1A9, Block 9/7/6 (UGT1A9, UGT1A7, and UGT1A6, Block 5 (UGT1A5, Block 4/3 (UGT1A4 and UGT1A3, and Block 3' UTR. Furthermore, we inferred haplotypes and selected their tagSNPs. Finally, comparing our data with those of three other populations of the HapMap project revealed ethnic specificity of the UGT1 genetic diversity in Chinese. These findings have important implications for future molecular genetic studies of the UGT1 gene cluster as well as for personalized medical therapies in Chinese.

  13. 17q21 gene variation is not associated with asthma in adulthood

    Kreiner-Møller, E.; Strachan, D P; Linneberg, A;

    2015-01-01

    BACKGROUND: 17q21 gene variants are the strongest known genetic determinants for childhood asthma and have been reported to interact with environmental tobacco smoke exposure in childhood. It remains unclear whether individuals with 17q21 risk variants have increased risk of asthma or reduced lun....... This contrasts the findings in children and suggests that this locus is associated with a childhood-specific asthma endotype....

  14. Variation in dopamine genes influences responsivity of the human reward system

    Dreher, Jean-Claude; Kohn, Philip; Kolachana, Bhaskar; Weinberger, Daniel R.; Berman, Karen Faith

    2008-01-01

    In humans, dopamine neurotransmission is influenced by functional polymorphisms in the dopamine transporter (DAT1) and catechol-O-methyltransferase (COMT) genes. Here, we used event-related functional magnetic resonance imaging to directly investigate the neurofunctional effects of the Val158Met COMT and variable number of tandem repeat DAT1 polymorphisms on distinct components of the reward system in humans. The results revealed a main effect of COMT genotype in the ventral striatum and late...

  15. Nucleotide sequence variation of the envelope protein gene identifies two distinct genotypes of yellow fever virus.

    Chang, G J; Cropp, B. C.; Kinney, R M; Trent, D W; Gubler, D. J.

    1995-01-01

    The evolution of yellow fever virus over 67 years was investigated by comparing the nucleotide sequences of the envelope (E) protein genes of 20 viruses isolated in Africa, the Caribbean, and South America. Uniformly weighted parsimony algorithm analysis defined two major evolutionary yellow fever virus lineages designated E genotypes I and II. E genotype I contained viruses isolated from East and Central Africa. E genotype II viruses were divided into two sublineages: IIA viruses from West A...

  16. Natural variation of histone modification and its impact on gene expression in the rat genome

    Rintisch, C.; Heinig, M.; Bauerfeind, A.; Schafer, S.; Mieth, Ch.; Patone, G.; Hummel, O.; Chen, W.; Cook, S.; Cuppen, E.; Colomé-Tatché, M.; Johannes, F.; Jansen, R. C.; Neil, H.; Werner, M.; Pravenec, Michal; Vingron, M.; Hubner, N.

    2014-01-01

    Roč. 24, JUN (2014), s. 942-953. ISSN 1088-9051 R&D Projects: GA MŠk(CZ) 7E10067; GA ČR(CZ) GAP301/10/0290; GA MŠk(CZ) LL1204 Institutional support: RVO:67985823 Keywords : ChIP-seq * histone modification * gene expression * genetic linkage analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 14.630, year: 2014

  17. Autism Risk Gene MET Variation and Cortical Thickness in Typically Developing Children and Adolescents

    Hedrick, Alexis; Lee, Yohan; Wallace, Gregory L.; Greenstein, Deanna; Clasen, Liv; Giedd, Jay N.; Raznahan, Armin

    2012-01-01

    MET receptor tyrosine kinase (MET) has been proposed as a candidate risk gene for autism spectrum disorder (ASD) based on associations between MET polymorphisms and ASD diagnosis, as well as evidence from animal studies that MET protein may regulate early development of cortical regions implicated in the neurobiology of ASD. The relevance of differences in MET signaling for human cortical development remains unexamined, however. We sought to address this issue by relating genotype at a functi...

  18. Genetic variation in the oxytocin receptor (OXTR) gene is associated with Asperger Syndrome

    Di Napoli, Agnese; Warrier, Varun; Baron-Cohen, Simon; Chakrabarti, Bhismadev

    2014-01-01

    Background Autism Spectrum Conditions (ASC) are a group of neurodevelopmental conditions characterized by impairments in communication and social interaction, alongside unusually repetitive behaviors and narrow interests. ASC are highly heritable and have complex patterns of inheritance where multiple genes are involved, alongside environmental and epigenetic factors. Asperger Syndrome (AS) is a subgroup of these conditions, where there is no history of language or cognitive delay. Animal ...

  19. Genetic variation in the oxytocin receptor (OXTR) gene is associated with Asperger Syndrome

    Di Napoli, Agnese; Warrier, Varun; Baron-Cohen, Simon; Chakrabarti, Bhismadev

    2014-01-01

    Background Autism Spectrum Conditions (ASC) are a group of neurodevelopmental conditions characterized by impairments in communication and social interaction, alongside unusually repetitive behaviors and narrow interests. ASC are highly heritable and have complex patterns of inheritance where multiple genes are involved, alongside environmental and epigenetic factors. Asperger Syndrome (AS) is a subgroup of these conditions, where there is no history of language or cognitive delay. Animal mod...

  20. Rapid Detection of Positive Selection in Genes and Genomes Through Variation Clusters

    Wagner, Andreas

    2007-01-01

    Positive selection in genes and genomes can point to the evolutionary basis for differences among species and among races within a species. The detection of positive selection can also help identify functionally important protein regions and thus guide protein engineering. Many existing tests for positive selection are excessively conservative, vulnerable to artifacts caused by demographic population history, or computationally very intensive. I here propose a simple and rapid test that is co...

  1. Metagenomic approach reveals variation of microbes with arsenic and antimony metabolism genes from highly contaminated soil.

    Jinming Luo

    Full Text Available Microbes have great potential for arsenic (As and antimony (Sb bioremediation in heavily contaminated soil because they have the ability to biotransform As and Sb to species that have less toxicity or are more easily removed. In this study, we integrated a metagenomic method with physicochemical characterization to elucidate the composition of microbial community and functional genes (related to As and Sb in a high As (range from 34.11 to 821.23 mg kg-1 and Sb (range from 226.67 to 3923.07 mg kg-1 contaminated mine field. Metagenomic analysis revealed that microbes from 18 phyla were present in the 5 samples of soil contaminated with high As and Sb. Moreover, redundancy analysis (RDA of the relationship between the 18 phyla and the concentration of As and Sb demonstrated that 5 phyla of microbes, i.e. Actinobacteria, Firmicutes, Nitrospirae, Tenericutes and Gemmatimonadetes were positively correlated with As and Sb concentration. The distribution, diversity and abundance of functional genes (including arsC, arrA, aioA, arsB and ACR3 were much higher for the samples containing higher As and Sb concentrations. Based on correlation analysis, the results showed a positive relationship between arsC-like (R2 = 0.871 and aioA-like (R2 = 0.675 gene abundance and As concentration, and indicated that intracellular As(V reduction and As(III oxidation could be the dominant As detoxification mechanism enabling the microbes to survive in the environment. This study provides a direct and reliable reference on the diversity of microbial community and functional genes in an extremely high concentration As- and Sb-contaminated environment.

  2. Variations in mismatch repair genes and colorectal cancer risk and clinical outcome

    Vymetálková, Veronika; Pardini, B.; Rosa, F.; Di Gaetano, C.; Novotný, J.; Levý, M.; Buchler, T.; Slyšková, Jana; Vodičková, Ludmila; Naccarati, Alessio; Vodička, Pavel

    2014-01-01

    Roč. 29, č. 4 (2014), s. 259-265. ISSN 0267-8357 R&D Projects: GA ČR GPP304/11/P715; GA ČR GAP304/10/1286; GA MZd NT12025 Institutional support: RVO:68378041 Keywords : colorectal cancer, , * mismatch repair genes * miRNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.793, year: 2014

  3. Genetic variation of the transthyretin gene in wild-type transthyretin amyloidosis (ATTRwt)

    Sikora, Jacquelyn L.; Logue, Mark W.; Chan, Gloria G.; Spencer, Brian H.; Prokaeva, Tatiana B.; Baldwin, Clinton T.; Seldin, David C.; Connors, Lawreen H.

    2014-01-01

    Wild-type transthyretin amyloidosis (ATTRwt), typically diagnosed as congestive heart failure in elderly Caucasian men, features myocardial amyloid deposits of wild-type plasma protein transthyretin (TTR). ATTRwt is sporadic, its pathogenesis is poorly understood, and currently there are no biomarkers for diagnosis or prognosis. Genetic studies of variant-associated transthyretin amyloidosis (ATTRm) have suggested that non-coding TTR gene variants modulate disease. We hypothesized that cis-ac...

  4. A Common Variation in the Promoter Region of Interleukin-6 Gene Shows Association with Exercise Performance

    Antti Huuskonen; Minna Tanskanen; Jani Lappalainen; Niku Oksala; Heikki Kyröläinen; Mustafa Atalay

    2009-01-01

    Skeletal muscle-derived interleukin-6 (IL-6) is a pleiotropic cytokine which regulates body metabolism during strenuous physical exercise. OBJECTIVE: The effect of a potentially functional single nucleotide polymorphism (SNP) -174G/C of the IL6 gene (rs1800795) promoter was examined on maximal oxygen uptake (VO2max), body mass index (BMI) and plasma IL-6 levels in response to physical training. Fifty four male military conscripts were studied for 8 weeks during their basic training. At weeks ...

  5. Variation of the major histocompatibility complex genes in the Grey Partridge (Perdix perdix; Galliformes)

    Králová, Tereza; Promerová, Marta; Bryjová, Anna; Albrecht, Tomáš; Bryja, Josef

    Brno: Ústav biologie obratlovců AV ČR, 2012 - (Bryja, J.; Albrechtová, J.; Tkadlec, E.). s. 110-111 ISBN 978-80-87189-11-5. [Zoologické dny. 09.02.2012-10.02.2012, Olomouc] R&D Projects: GA ČR GA206/08/1281 Institutional research plan: CEZ:AV0Z60930519 Keywords : Major histocompatibility complex (MHC) genes * Grey Partridge Subject RIV: EG - Zoology

  6. Adaptive variation regulates the expression of the human SGK1 gene in response to stress.

    Francesca Luca; Sonal Kashyap; Catherine Southard; Min Zou; David Witonsky; Anna Di Rienzo; Conzen, Suzanne D.

    2009-01-01

    The Serum and Glucocorticoid-regulated Kinase1 (SGK1) gene is a target of the glucocorticoid receptor (GR) and is central to the stress response in many human tissues. Because environmental stress varies across habitats, we hypothesized that natural selection shaped the geographic distribution of genetic variants regulating the level of SGK1 expression following GR activation. By combining population genetics and molecular biology methods, we identified a variant (rs9493857) with marked allel...

  7. Seasonal variations in developmental competence and relative abundance of gene transcripts in buffalo (Bubalus bubalis) oocytes.

    Abdoon, Ahmed S; Gabler, Christoph; Holder, Christoph; Kandil, Omaima M; Einspanier, Ralf

    2014-11-01

    Hot season is a major constraint to production and reproduction in buffaloes. The present work aimed to investigate the effect of season on ovarian function, developmental competence, and the relative abundance of gene expression in buffalo oocytes. Three experiments were conducted. In experiment 1, pairs of buffalo ovaries were collected during cold season (CS, autumn and winter) and hot season (HS, spring and summer), and the number of antral follicles was recorded. Cumulus oocyte complexes (COCs) were aspirated and evaluated according to their morphology into four Grades. In experiment 2, Grade A and B COCs collected during CS and HS were in vitro matured (IVM) for 24 hours under standard conditions at 38.5 °C in a humidified air of 5% CO2. After IVM, cumulus cells were removed and oocytes were fixed, stained with 1% aceto-orcein, and evaluated for nuclear configuration. In vitro matured buffalo oocytes harvested during CS or HS were in vitro fertilized (IVF) using frozen-thawed buffalo semen and cultured in vitro to the blastocyst stage. In experiment 3, buffalo COCs and in vitro matured oocytes were collected during CS and HS, and then snap frozen in liquid nitrogen for gene expression analysis. Total RNA was extracted from COCs and in vitro matured oocytes, and complementary DNA was synthesized; quantitative Reverse Transcription-Polymerase Chain Reaction was performed for eight candidate genes including GAPDH, ACTB, B2M, GDF9, BMP15, HSP70, and SOD2. The results indicated that HS significantly (P ovary. The number of Grade A, B, and C COCs was lower (P quality. In vitro maturation of buffalo oocytes during HS impairs their nuclear and cytoplasmic maturation, fertilization, and subsequent embryo development to the morula and blastocyst stages. This could be in part because of the altered gene expression found in COCs and in vitro matured oocytes. PMID:25156970

  8. Gene expression profiling in the Cynomolgus macaque Macaca fascicularis shows variation within the normal birth range

    Vickers Mark H

    2011-10-01

    Full Text Available Abstract Background Although an adverse early-life environment has been linked to an increased risk of developing the metabolic syndrome, the molecular mechanisms underlying altered disease susceptibility as well as their relevance to humans are largely unknown. Importantly, emerging evidence suggests that these effects operate within the normal range of birth weights and involve mechanisms of developmental palsticity rather than pathology. Method To explore this further, we utilised a non-human primate model Macaca fascicularis (Cynomolgus macaque which shares with humans the same progressive history of the metabolic syndrome. Using microarray we compared tissues from neonates in the average birth weight (50-75th centile to those of lower birth weight (5-25th centile and studied the effect of different growth trajectories within the normal range on gene expression levels in the umbilical cord, neonatal liver and skeletal muscle. Results We identified 1973 genes which were differentially expressed in the three tissue types between average and low birth weight animals (P Conclusion These differences in gene expression levels between animals in the upper and lower percentiles of the normal birth weight range may point towards early life metabolic adaptations that in later life result in differences in disease risk.

  9. Nicotinic Acetylcholine Receptor α4 Subunit Gene Variation Associated with Attention Deficit Hyperactivity Disorder

    HUANG Xuezhu; XU Yong; LI Qianqian; LIU Pozi; YANG Yuan; ZHANG Fuquan; GUO Tianyou; YANG Chuang; GUO Lanting

    2009-01-01

    Previous pharmacological, human genetics, and animal models have implicated the nicotinic ace-tylcholine receptor a4 subunit (CHRNA4) gene in the pathogenesis of attention deficit/hyperactivity disorder (ADHD). The objective of this study is to examine the genetic association between single nucleotide poly-morphisms in the CHRNA4 gene (rs2273502, rs1044396, rs1044397, and rs3827020 loci) and ADHD. Both case-control and family-based designs are used. Children aged 6 to 16 years were interviewed and as-sessed with the children behavior checklist and the revised conner' parent rating scale to identify probands. No significant differences in the frequency distribution of genotypes or alleles were found between the case and control groups. However, further haplotype analyses showed the CCGG haplotype on dsk for ADHD in 164 case-control samples and the standard transmission disequilibrium test analyses suggest that the allele C of rs2273502 was over-transferred in 98 ADHD parent-offspring tdos. These findings suggest that the CHRNA4 gene may play a role in the pathogenesis of ADHD.

  10. rendimiento académico en estudiantes de secundaria

    Francisco Javier Tejedor-Tejedor

    2008-01-01

    Full Text Available Este trabajo tenía como objetivos comprobar la relación entre variables atencionales y rendimiento académico en la Educación Secundaria Obligatoria y averiguar si el uso de estrategias atencionales varía en función de la edad, grado académico o género de los alumnos. Se aplicó la Escala de Estrategias de Aprendizaje (ACRA a una muestra de 602 sujetos, y se recogieron sus notas finales en junio. Los resultados confirman que las variables atencionales exploración, subrayado lineal, fragmentación y atención, son las que parecen influir más en el rendimiento académico. El análisis correlacional señala un ligero decremento en el uso de las estrategias atencionales a lo largo de esta etapa educativa; y las comparaciones por género, indican que las chicas las utilizan más frecuentemente.

  11. Mouse Models of Mutations and Variations in Autism Spectrum Disorder-Associated Genes: Mice Expressing Caps2/Cadps2 Copy Number and Alternative Splicing Variants

    Tetsushi Sadakata

    2013-11-01

    Full Text Available Autism spectrum disorder (ASD is a neurodevelopmental disorder characterized by disturbances in interpersonal relationships and behavior. Although the prevalence of autism is high, effective treatments have not yet been identified. Recently, genome-wide association studies have identified many mutations or variations associated with ASD risk on many chromosome loci and genes. Identification of the biological roles of these mutations or variations is necessary to identify the mechanisms underlying ASD pathogenesis and to develop clinical treatments. At present, mice harboring genetic modifications of ASD-associated gene candidates are the best animal models to analyze hereditary factors involved in autism. In this report, the biological significance of ASD-associated genes is discussed by examining the phenotypes of mouse models with ASD-associated mutations or variations in mouse homologs, with a focus on mice harboring genetic modifications of the Caps2/Cadps2 (Ca2+-dependent activator protein for secretion 2 gene.

  12. Genetic Variation in Selenoprotein Genes, Lifestyle, and Risk of Colon and Rectal Cancer

    Martha L Slattery; Lundgreen, Abbie; Welbourn, Bill; Corcoran, Christopher; Wolff, Roger K.

    2012-01-01

    Background Associations between selenium and cancer have directed attention to role of selenoproteins in the carcinogenic process. Methods We used data from two population-based case-control studies of colon (n = 1555 cases, 1956 controls) and rectal (n = 754 cases, 959 controls) cancer. We evaluated the association between genetic variation in TXNRD1, TXNRD2, TXNRD3, C11orf31 (SelH), SelW, SelN1, SelS, SepX, and SeP15 with colorectal cancer risk. Results After adjustment for multiple compari...

  13. Variations in genes involved in immune response checkpoints and association with outcomes in patients with resected colorectal liver metastases.

    Stremitzer, S; Sunakawa, Y; Zhang, W; Yang, D; Ning, Y; Stintzing, S; Sebio, A; Yamauchi, S; Matsusaka, S; El-Khoueiry, R; Stift, J; Wrba, F; Gruenberger, T; Lenz, H-J

    2015-12-01

    In patients with colorectal liver metastases (CLM), liver resection offers the possibility of cure and long-term survival. The liver is a highly immunogenic organ harboring ~80% of the body's tissue macrophages. Emerging data demonstrate a critical role of the immune response for cancer treatment. We investigated variations within genes involved in immune response checkpoints and their association with outcomes in patients with CLM who underwent neoadjuvant chemotherapy including bevacizumab and liver resection. Single-nucleotide polymorphisms (SNPs) in nine genes (CCL2, CCR2, LAG3, NT5E, PDCD1, CD274, IDO1, CTLA4 and CD24) were analyzed in genomic DNA from 149 patients with resected bevacizumab-pretreated CLM by direct Sanger DNA sequencing, and correlated with response, recurrence-free survival (RFS), overall survival (OS), probability of cure and recurrence patterns. IDO1 (indoleamine 2, 3-dioxygenase) rs3739319 G>A and CD24 rs8734 G>A showed a significant difference in 3-year OS rates. In addition, IDO1 rs3739319 G>A was significantly associated with extrahepatic recurrence. Recursive partitioning analyses revealed that IDO1 rs3739319 G>A was the dominant SNP predicting RFS and OS. Our data suggest that variants within genes involved in immune response checkpoints are associated with outcomes in patients with resected CLM and might lead to improved treatment strategies modulating anti-tumor immune response by targeting novel immune checkpoints. PMID:25752522

  14. Gene copy number variations in the leukocyte genome of hepatocellular carcinoma patients with integrated hepatitis B virus DNA

    Xu, Guixia; Cheng, Kai; Cao, Guangwen; Wu, Mengchao; Cheng, Shuqun; Liu, Shanrong

    2016-01-01

    Integration of hepatitis B virus (HBV) DNA into the human liver cell genome is believed to promote HBV-related carcinogenesis. This study aimed to quantify the integration of HBV DNA into the leukocyte genome in hepatocellular carcinoma (HCC) patients in order to identify potential biomarkers for HBV-related diseases. Whole-genome comparative genomic hybridization (CGH) chip array analyses were performed to screen gene copy number variations (CNV) in the leukocyte genome, and the results were confirmed by quantitative polymerase chain reaction (qPCR). The commonly detected regions included chromosome arms 19p, 5q, 1q and 15p, where 200 copy number gain events and 270 copy number loss events were noted. In particular, gains were observed in 5q35.3 (OR4F3) and 19p13.3 (OR4F17) in 90% of the samples. Successful homologous recombination of OR4F3 and the HBV P gene was demonstrated, and the amplification at 5q35.3 is potentially associated with the integration of HBV P gene into natural killer cells isolated from peripheral blood mononuclear cells (PBMCs). Receiver operating characteristic (ROC) curve analysis indicated that the combination of OR4F3 and OR4F17 a novel potential biomarker of HBV-related diseases. PMID:26769853

  15. Association between genetic variations in tumor necrosis factor receptor genes and survival of patients with T-cell lymphoma

    Kan Zhai; Jiang Chang; Chen Wu; Ning Lu; Li-Ming Huang; Tong-Wen Zhang; Dian-Ke Yu; Wen Tan; Dong-Xin Lin

    2012-01-01

    The prognosis of T-cell lymphoma (TCL) has been shown to be associated with the clinical characteristics of patients.However,there is little knowledge of whether genetic variations also affect the prognosis of TCL.This study investigated the associations between single nucleotide polymorphisms (SNPs) in tumor necrosis factor receptor superfamily (TNFRSF) genes and the survival of patients with TCL.A total of 38tag SNPs in 18 TNFRSF genes were genotyped using Sequenom platform in 150 patients with TCL.Kaplan-Meier survival estimates were plotted and significance was assessed using log-rank tests.Cox proportional hazard models were used to analyze each of these 38 SNPs with adjustment for covariates that might influence patient survival,including sex and international prognostic Index score.Hazard ratios (HRs) and their 95% confidence intervals (Cls) were calculated.Among the 38 SNPs tested,3 were significantly associated with the survival of patients with TCL.These SNPs were located at LTβR (rs3759333C>T) and TNFRSF17 (rs2017662C >T and rs2071336C>T).The 5-year survival rates were significantly different among patients carrying different genotypes and the HRs for death between the different genotypes ranged from 0.45 to 2.46.These findings suggest that the SNPs in TNFRSF genes might be important determinants for the survival of TCL patients.

  16. Nucleotide variation and balancing selection at the Ckma gene in Atlantic cod: analysis with multiple merger coalescent models

    Einar Árnason

    2015-02-01

    Full Text Available High-fecundity organisms, such as Atlantic cod, can withstand substantial natural selection and the entailing genetic load of replacing alleles at a number of loci due to their excess reproductive capacity. High-fecundity organisms may reproduce by sweepstakes leading to highly skewed heavy-tailed offspring distribution. Under such reproduction the Kingman coalescent of binary mergers breaks down and models of multiple merger coalescent are more appropriate. Here we study nucleotide variation at the Ckma (Creatine Kinase Muscle type A gene in Atlantic cod. The gene shows extreme differentiation between the North (Canada, Greenland, Iceland, Norway, Barents Sea and the South (Faroe Islands, North-, Baltic-, Celtic-, and Irish Seas with FST > 0.8 between regions whereas neutral loci show no differentiation. This is evidence of natural selection. The protein sequence is conserved by purifying selection whereas silent and non-coding sites show extreme differentiation. The unfolded site-frequency spectrum has three modes, a mode at singleton sites and two high frequency modes at opposite frequencies representing divergent branches of the gene genealogy that is evidence for balancing selection. Analysis with multiple-merger coalescent models can account for the high frequency of singleton sites and indicate reproductive sweepstakes. Coalescent time scales vary with population size and with the inverse of variance in offspring number. Parameter estimates using multiple-merger coalescent models show that times scales are faster than under the Kingman coalescent.

  17. Genetic variation in the NBS1, MRE11, RAD50 and BLM genes and susceptibility to non-Hodgkin lymphoma

    Gascoyne Randy D

    2009-11-01

    Full Text Available Abstract Background Translocations are hallmarks of non-Hodgkin lymphoma (NHL genomes. Because lymphoid cell development processes require the creation and repair of double stranded breaks, it is not surprising that disruption of this type of DNA repair can cause cancer. The members of the MRE11-RAD50-NBS1 (MRN complex and BLM have central roles in maintenance of DNA integrity. Severe mutations in any of these genes cause genetic disorders, some of which are characterized by increased risk of lymphoma. Methods We surveyed the genetic variation in these genes in constitutional DNA of NHL patients by means of gene re-sequencing, then conducted genetic association tests for susceptibility to NHL in a population-based collection of 797 NHL cases and 793 controls. Results 114 SNPs were discovered in our sequenced samples, 61% of which were novel and not previously reported in dbSNP. Although four variants, two in RAD50 and two in NBS1, showed association results suggestive of an effect on NHL, they were not significant after correction for multiple tests. Conclusion These results suggest an influence of RAD50 and NBS1 on susceptibility to diffuse large B-cell lymphoma and marginal zone lymphoma. Larger association and functional studies could confirm such a role.

  18. De Novo Assembly of Bitter Gourd Transcriptomes: Gene Expression and Sequence Variations in Gynoecious and Monoecious Lines.

    Shukla, Anjali; Singh, V K; Bharadwaj, D R; Kumar, Rajesh; Rai, Ashutosh; Rai, A K; Mugasimangalam, Raja; Parameswaran, Sriram; Singh, Major; Naik, P S

    2015-01-01

    Bitter gourd (Momordica charantia L.) is a nutritious vegetable crop of Asian origin, used as a medicinal herb in Indian and Chinese traditional medicine. Molecular breeding in bitter gourd is in its infancy, due to limited molecular resources, particularly on functional markers for traits such as gynoecy. We performed de novo transcriptome sequencing of bitter gourd using Illumina next-generation sequencer, from root, flower buds, stem and leaf samples of gynoecious line (Gy323) and a monoecious line (DRAR1). A total of 65,540 transcripts for Gy323 and 61,490 for DRAR1 were obtained. Comparisons revealed SNP and SSR variations between these lines and, identification of gene classes. Based on available transcripts we identified 80 WRKY transcription factors, several reported in responses to biotic and abiotic stresses; 56 ARF genes which play a pivotal role in auxin-regulated gene expression and development. The data presented will be useful in both functions studies and breeding programs in bitter gourd. PMID:26047102

  19. Prediction model for sequence variation in the glycoprotein gene of infectious hematopoietic necrosis virus in California, U.S.A.

    Kelley, Garry O; Garabed, Rebecca; Branscum, Adam; Perez, Andres; Thurmond, Mark

    2007-12-13

    The influence of spatio-temporal factors on genetic variation of infectious hematopoietic necrosis virus (IHNV) is an active area of research. Using host-isolate pairs collected from 1966 to 2004 for 237 IHNV isolates from California and southern Oregon, we examined genetic variation of the mid-G gene of IHNV that could be quantified across times and geographic locations. Information hypothesized to influence genetic variation was environmental and/or fish host demographic factors, viz. location (inland or coastal), year of isolation, habitat (river, lake, or hatchery), the agent factors of subgroup (LI or LII) and serotype (1, 2, or 3), and the host factors of fish age (juvenile or adult), sex (male or female), and season of spawning run (spring, fall, late fall, winter). Inverse distance weighting (IDW) was performed to create isopleth maps of the genetic distances of each subgroup. IDW maps showed that more genetic divergence was predicted for isolates found inland (for both subgroups: LI and LII) than for coastal watershed isolates. A mixed-effect beta regression with a logit link function was used to seek associations between genetic distances and hypothesized explanatory factors. The model that best described genetic distance contained the factors of location, year of isolation, and the interaction between location and year. Our model suggests that genetic distance was greater for isolates collected from 1966 to 2004 at inland locations than for isolates found in coastal watersheds during the same years. The agreement between the IDW and beta regression analyses quantitatively supports our conclusion that, during this time period, more genetic variation existed within subgroup LII in inland watersheds than within coastal LI isolates. PMID:18286806

  20. MHC gene copy number variation in Tasmanian devils: implications for the spread of a contagious cancer.

    Siddle, Hannah V; Marzec, Jolanta; Cheng, Yuanyuan; Jones, Menna; Belov, Katherine

    2010-07-01

    Tasmanian devils face extinction owing to the emergence of a contagious cancer. Devil facial tumour disease (DFTD) is a clonal cancer spread owing to a lack of major histocompatibility complex (MHC) barriers in Tasmanian devil populations. We present a comprehensive screen of MHC diversity in devils and identify 25 MHC types and 53 novel sequences, but conclude that overall levels of MHC diversity at the sequence level are low. The majority of MHC Class I variation can be explained by allelic copy number variation with two to seven sequence variants identified per individual. MHC sequences are divided into two distinct groups based on sequence similarity. DFTD cells and most devils have sequences from both groups. Twenty per cent of individuals have a restricted MHC repertoire and contain only group I or only group II sequences. Counterintuitively, we postulate that the immune system of individuals with a restricted MHC repertoire may recognize foreign MHC antigens on the surface of the DFTD cell. The implication of these results for management of DFTD and this endangered species are discussed. PMID:20219742

  1. Genetic variation of the transthyretin gene in wild-type transthyretin amyloidosis (ATTRwt).

    Sikora, Jacquelyn L; Logue, Mark W; Chan, Gloria G; Spencer, Brian H; Prokaeva, Tatiana B; Baldwin, Clinton T; Seldin, David C; Connors, Lawreen H

    2015-01-01

    Wild-type transthyretin amyloidosis (ATTRwt), typically diagnosed as congestive heart failure in elderly Caucasian men, features myocardial amyloid deposits of wild-type plasma protein transthyretin (TTR). ATTRwt is sporadic, its pathogenesis is poorly understood, and currently there are no biomarkers for diagnosis or prognosis. Genetic studies of variant-associated transthyretin amyloidosis have suggested that non-coding TTR gene variants modulate disease. We hypothesized that cis-acting regulatory elements in the TTR gene non-coding regions may modify expression, affecting ATTRwt onset and progression. We studied an ATTRwt cohort consisting of 108 Caucasian males ranging in age from 59 to 87 years with cardiomyopathy due to wild-type TTR deposition; results were compared to 118 anonymous controls matched by age, sex, and race. Four predicted non-coding regulatory regions and all exons in the TTR gene were sequenced using the Sanger method. Eleven common variants were identified; three variants were significantly associated with ATTRwt (p < 0.05), though only one, rs72922940, remained near significance (p corrected = 0.083) after multiple testing correction. Exon analyses demonstrated the occurrence of the p.G26S (G6S) polymorphism in 7 % of ATTRwt subjects and 12 % of controls; this variant was predicted to be a protective factor (p = 0.051). Four variants were significantly associated with age at onset and survival. In this first genetic study of a large, well-characterized cohort of ATTRwt, non-coding and coding variants associated with disease, age at onset, and survival were identified. Further investigation is warranted to determine the prevalence of these variants in ATTRwt, their regulatory function, and potential role in assessing disease risk. PMID:25367359

  2. Genetic variations in the human cannabinoid receptor gene are associated with happiness.

    Masahiro Matsunaga

    Full Text Available Happiness has been viewed as a temporary emotional state (e.g., pleasure and a relatively stable state of being happy (subjective happiness level. As previous studies demonstrated that individuals with high subjective happiness level rated their current affective states more positively when they experience positive events, these two aspects of happiness are interrelated. According to a recent neuroimaging study, the cytosine to thymine single-nucleotide polymorphism of the human cannabinoid receptor 1 gene is associated with sensitivity to positive emotional stimuli. Thus, we hypothesized that our genetic traits, such as the human cannabinoid receptor 1 genotypes, are closely related to the two aspects of happiness. In Experiment 1, 198 healthy volunteers were used to compare the subjective happiness level between cytosine allele carriers and thymine-thymine carriers of the human cannabinoid receptor 1 gene. In Experiment 2, we used positron emission tomography with 20 healthy participants to compare the brain responses to positive emotional stimuli of cytosine allele carriers to that of thymine-thymine carriers. Compared to thymine-thymine carriers, cytosine allele carriers have a higher subjective happiness level. Regression analysis indicated that the cytosine allele is significantly associated with subjective happiness level. The positive mood after watching a positive film was significantly higher for the cytosine allele carriers compared to the thymine-thymine carriers. Positive emotion-related brain region such as the medial prefrontal cortex was significantly activated when the cytosine allele carriers watched the positive film compared to the thymine-thymine carriers. Thus, the human cannabinoid receptor 1 genotypes are closely related to two aspects of happiness. Compared to thymine-thymine carriers, the cytosine allele carriers of the human cannabinoid receptor 1 gene, who are sensitive to positive emotional stimuli, exhibited greater

  3. Variation in genes related to hepatic lipid metabolism and changes in waist circumference and body weight

    Meidtner, Karina; Fisher, Eva; Angquist, Lars;

    2014-01-01

    We analysed single nucleotide polymorphisms (SNPs) tagging the genetic variability of six candidate genes (ATF6, FABP1, LPIN2, LPIN3, MLXIPL and MTTP) involved in the regulation of hepatic lipid metabolism, an important regulatory site of energy balance for associations with body mass index (BMI......) and changes in weight and waist circumference. We also investigated effect modification by sex and dietary intake. Data of 6,287 individuals participating in the European prospective investigation into cancer and nutrition were included in the analyses. Data on weight and waist circumference were...

  4. Non-Steroidal Anti-Inflammatory Drugs, Variation in Inflammatory Genes, and Aggressive Prostate Cancer

    John S. Witte

    2010-10-01

    Full Text Available Increasing evidence suggests that prostatic inflammation plays a key role in the development of prostate cancer. It remains controversial whether non-steroidal anti-inflammatory drugs (NSAIDs reduce the risk of prostate cancer. Here, we investigate how a previously reported inverse association between NSAID use and the risk of aggressive prostate cancer is modulated by variants in several inflammatory genes. We found that NSAIDs may have differential effects on prostate cancer development, depending on one’s genetic makeup. Further study of these inflammatory pathways may clarify the mechanisms through which NSAIDs impact prostate cancer risk.

  5. Genetic variation of Aflatoxin B(1) aldehyde reductase genes (AFAR) in human tumour cells

    Praml, Christian; Schulz, Wolfgang; Claas, Andreas;

    2008-01-01

    AFAR genes play a key role in the detoxification of the carcinogen Aflatoxin B(1) (AFB(1)). In the rat, Afar1 induction can prevent AFB(1)-induced liver cancer. It has been proposed that AFAR enzymes can metabolise endogenous diketones and dialdehydes that may be cytotoxic and/or genotoxic. Furth...... many aldo-keto reductases. This polarity change may have an effect on the proposed substrate binding amino acids nearby (Met(47), Tyr(48), Asp(50)). Further population analyses and functional studies of the nine variants detected may show if these variants are disease-related....

  6. Seasonal variations in antibiotic resistance gene transport in the Almendares River, Havana, Cuba

    Charles W Knapp

    2012-11-01

    Full Text Available Numerous studies have quantified antibiotic resistance genes (ARG in rivers and streams around the world, and significant relationships have been shown that relate different pollutant outputs and increased local ARG levels. However, most studies have not considered ambient flow conditions, which can vary dramatically especially in tropical countries. Here, ARG were quantified in water-column and sediment samples during the dry-and wet-seasons to assess how seasonal and other factors influence ARG transport down the Almendares River (Havana, Cuba. Eight locations were sampled and stream flow estimated during both seasons; qPCR was used to quantify four tetracycline, two erythromycin, and three beta-lactam resistance genes. ARG concentrations were higher in wet-season versus dry-season samples, which combined with higher flows, indicated greater ARG transport downstream during the wet season. Water-column ARG levels were more spatially variable in the dry-season than the wet-season, with the proximity of waste outfalls strongly influencing local ARG levels. Results confirm that dry-season sampling provides a useful picture of the impact of individual waste inputs on local stream ARG levels, whereas, the majority of ARGs in this tropical river were transported downstream during the wet season, possibly due to re-entrainment of ARG from sediments.

  7. Variation in the Coat Protein Gene of Papaya ringspot Virus Isolates from Multiple Locations of China

    2007-01-01

    The potyvirus Papaya ringspot virus (PRSV) is an important pathogen of papaya that causes severe losses in economic crops for papaya production globally. The coat protein (CP) genes of five PRSV isolates originating from different locations in China were cloned and sequenced. The CP-coding region varied in size from 864-873 nucleotides, encoding proteins of 288-291 amino acids. The five Chinese isolates of PRSV have been characterized as papaya-infecting (PRSV-P). The CP sequences of the Chinese isolates were compared with those of previously published PRSV isolates originating from different countries at amino acid levels. A number of KE repeat boxes in the N terminus of the PRSV-CP were found in all Chinese isolates. The phylogenetic branching pattern revealed that there was certain extended grouping between geographic locations, and the Asian type probably represents the oldest population of PRSV. The information of CP genes will be useful in designing and developing durable virus resistant-PRSV transgenic papaya in China. Meanwhile broad-spectrum-virus resistant, strongly resistant-PRSV and good safe papaya lines are required.

  8. The Relationship Between Genetic Variations of the Cholesteryl Ester Transfer Protein Gene and Coronary Artery Disease in Turkish Subjects

    Gundogdu, Fuat; Gurlertop, Yekta; Pirim, Ibrahim; Sevimli, Serdar; Dogan, Hasan; Arslan, Sakir; Aksoy, Hulya; Karakelloglu, Sule; Senocak, Huseyin

    2009-01-01

    Objective Although the relationship between cholesteryl ester transfer protein (CETP) and cholesterol metabolism has been characterized in recent years, the effect of CETP genetic variants associated with coronary artery disease (CAD) is still unclear. Therefore, we investigated the association between CETP gene polymorphism and levels of lipid in patients with CAD. Materials and Methods We conducted a case-control study that included 194 unrelated subjects who underwent coronary angiography for suspected ischemic heart disease. This group was divided into 96 patients with angiographically documented CAD and 98 subjects (individuals matched for age and gender) without angiographically documented CAD (CAD-free subjects), all of whom were studied to examine the genotypic distribution of the CETP gene polymorphism in CAD. Genotyping was performed via polymerase chain reaction. Results Of the 96 patients with CAD, 38 (40%) were B1B1, 42 (44%) B1B2 and 16 (16%) B2B2, compared with the control subjects, of which 35 (36%) were B1B1, 44 (45%) B1B2 and 19 (19%) B2B2. There were no significant differences between patients with CAD and control subjects in the distribution of the CETP gene polymorphism. Patients with the B1B1 genotype had lower high-density lipoprotein-cholesterol (HDL-C) and higher triglyceride (TG) levels than patients with the B2B2 genotype (p<0.05). In addition, among control subjects HDL-C levels were significantly higher in subjects with the B2B2 genotype than in subjects with the B1B1 genotype (p<0.01). Conclusion Our results suggest that genetic variations of the CTEP gene may be responsible for low HDL-C levels but may not be considered as a risk factor for CAD in the Turkish population. PMID:25610061

  9. Variation and Characterization Analysis of Partial Fragment of Fibroin Gene From Silkworm, Antheraea pernyi

    Li Wenli(李文利); Jin Liji; An Lijia

    2003-01-01

    A 1.4Kb DNA fragment containing 3' flanking sequence of fibroin gene of silkworm, Antheraea pernyi, was obtained from the silk gland's mRNA of 5th larva. Analysis of this sequence with another A.pernyi fibroin protein (accession No. D83241) revealed that it consists of a completely open reading frame (ORF), which includes 14 polyalanine-containing units (motifs) and 100bp 3'-UTR. The sequence of the predicted amino acid reveals the highest level of overall identity (90%) with D83241. It was found that it loses a repeat region at the upstream of TAA codon and some mutations. A putative polyadenylation signal AATAAA tail was found in position 1300, which follows the termination codon.

  10. Oxytocin receptor gene variation and differential susceptibility to family environment in predicting youth borderline symptoms.

    Hammen, Constance; Bower, Julienne E; Cole, Steven W

    2015-04-01

    Oxytocin appears to be centrally involved in socioemotional functioning, and is hypothesized to be relevant to the severe disruption in close relationships characteristic of borderline personality pathology. We examined whether a polymorphism of the oxytocin receptor gene (OXTR rs53576) interacts with quality of family functioning to predict borderline personality disorder (BPD) symptomatology in a sample of youth at age 20. A total of 385 youth from a longitudinal study of offspring of depressed or nondepressed mothers who were well characterized with respect to their family conditions and BPD symptomatology provided DNA for genotyping. Analyses revealed a significant moderation of the link between early family quality and later BPD symptoms by OXTR rs53576, and the pattern was consistent with differential susceptibility (plasticity). Whereas A-allele carriers had high levels of BPD symptoms under negative family conditions and low levels under positive conditions, GG homozygotes had average levels of BPD symptoms regardless of their family quality. PMID:25102084

  11. Allelic variation at a single gene increases food value in a drought-tolerant staple cereal.

    Gilding, Edward K; Frère, Celine H; Cruickshank, Alan; Rada, Anna K; Prentis, Peter J; Mudge, Agnieszka M; Mace, Emma S; Jordan, David R; Godwin, Ian D

    2013-01-01

    The production of adequate agricultural outputs to support the growing human population places great demands on agriculture, especially in light of ever-greater restrictions on input resources. Sorghum is a drought-adapted cereal capable of reliable production where other cereals fail, and thus represents a good candidate to address food security as agricultural inputs of water and arable land grow scarce. A long-standing issue with sorghum grain is that it has an inherently lower digestibility. Here we show that a low-frequency allele type in the starch metabolic gene, pullulanase, is associated with increased digestibility, regardless of genotypic background. We also provide evidence that the beneficial allele type is not associated with deleterious pleiotropic effects in the modern field environment. We argue that increasing the digestibility of an adapted crop is a viable way forward towards addressing food security while maximizing water and land-use efficiency. PMID:23403584

  12. Endostatin gene variation and protein levels in breast cancer susceptibility and severity

    Endostatin is a potent endogenous anti-angiogenic agent which inhibits tumour growth. A non-synonymous coding polymorphism in the Endostatin gene is thought to affect Endostatin activity. We aimed to determine the role of this Endostatin polymorphism in breast cancer pathogenesis and any influence on serum Endostatin levels in healthy volunteers. Endostatin protein expression on a breast cancer micro array was also studied to determine any relationship to genotype and to breast cancer prognosis. The 4349G > A (coding non-synonymous) polymorphism in exon 42 of the Endostatin gene was genotyped in approximately 846 breast cancer cases and 707 appropriate controls. In a separate healthy cohort of 57 individuals, in addition to genotyping, serum Endostatin levels were measured using enzyme linked immunosorbant assay (ELISA). A semi-quantitative assessment of Endostatin protein expression on immunostained tissue micro arrays (TMA) constructed from breast cancer samples of patients with genotype data was performed. The rare allele (A) was significantly associated with invasive breast cancers compared to non-invasive tumours (p = 0.03), but there was no association with tumour grade, nodal status, vascular invasion or overall survival. There was no association with breast cancer susceptibility. Serum Endostatin levels and Endostatin protein expression on the tissue micro array were not associated with genotype. The Endostatin 4349A allele is associated with invasive breast cancer. The Endostatin 4349G > A polymorphism however does not appear to be associated with breast cancer susceptibility or severity in invasive disease. By studying circulating levels and tumour Endostatin protein expression, we have shown that any influence of this polymorphism is unlikely to be through an effect on the levels of protein produced

  13. Association of ABO and Colton Blood Group Gene Polymorphisms With Hematological Traits Variation.

    Shahbazi, Shirin; Mashayekhi, Amir; Fatahi, Neda; Mahdavi, Mohammad-Reza

    2015-12-01

    Hematological parameters are appraised routinely to determine overall human health and to diagnose and monitor certain diseases. In GWASs, more than 30 loci carrying common deoxyribonucleic acid (DNA) polymorphisms have been identified related to hematological traits. In this study, we investigated the contribution of ABO rs2073823 along with AQP1 rs1049305 and rs10244884 polymorphisms in hematological traits variation in a cohort of Iranian healthy individuals.Genomic DNA was extracted from peripheral blood of 168 healthy volunteer. Genotyping was performed by ARMS-PCR or PCR-RFLP and confirmed by DNA sequencing. Complete blood analyses were conducted for the participants. Significant association was observed between AQP1 rs1049305 and the hematological traits including hemoglobin, hematocrit, and platelet count (P = 0.012, 0.008, and 0.011, respectively). The AQP1 rs10244884 status was also significantly linked to hemoglobin and hematocrit levels in the study cohort (P = 0.015 and 0.041, respectively). Furthermore, ABO rs2073823 polymorphism was identified as a hemoglobin and hematocrit levels modifier (both with P = 0.004).AQP1 and ABO variants appear to predict hemoglobin and hematocrit levels but not other erythrocyte phenotype parameters including red blood cell counts and red blood cell indices. PMID:26632894

  14. Oxytocin receptor gene sequences in owl monkeys and other primates show remarkable interspecific regulatory and protein coding variation.

    Babb, Paul L; Fernandez-Duque, Eduardo; Schurr, Theodore G

    2015-10-01

    The oxytocin (OT) hormone pathway is involved in numerous physiological processes, and one of its receptor genes (OXTR) has been implicated in pair bonding behavior in mammalian lineages. This observation is important for understanding social monogamy in primates, which occurs in only a small subset of taxa, including Azara's owl monkey (Aotus azarae). To examine the potential relationship between social monogamy and OXTR variation, we sequenced its 5' regulatory (4936bp) and coding (1167bp) regions in 25 owl monkeys from the Argentinean Gran Chaco, and examined OXTR sequences from 1092 humans from the 1000 Genomes Project. We also assessed interspecific variation of OXTR in 25 primate and rodent species that represent a set of phylogenetically and behaviorally disparate taxa. Our analysis revealed substantial variation in the putative 5' regulatory region of OXTR, with marked structural differences across primate taxa, particularly for humans and chimpanzees, which exhibited unique patterns of large motifs of dinucleotide A+T repeats upstream of the OXTR 5' UTR. In addition, we observed a large number of amino acid substitutions in the OXTR CDS region among New World primate taxa that distinguish them from Old World primates. Furthermore, primate taxa traditionally defined as socially monogamous (e.g., gibbons, owl monkeys, titi monkeys, and saki monkeys) all exhibited different amino acid motifs for their respective OXTR protein coding sequences. These findings support the notion that monogamy has evolved independently in Old World and New World primates, and that it has done so through different molecular mechanisms, not exclusively through the oxytocin pathway. PMID:26025428

  15. Variation in the interleukin-6 receptor gene associates with type 2 diabetes in Danish whites

    Hamid, Yasmin H; Urhammer, Søren A; Jensen, Dorit P; Glümer, Charlotte; Borch-Johnsen, Knut; Jørgensen, Torben; Hansen, Torben; Pedersen, Oluf

    2004-01-01

    ). The IL6R gene maps to an important candidate locus for type 2 diabetes on chromosome 1q21. An Asp358Ala polymorphism of the IL6R has been reported to associate with obesity in Pima Indians. We investigated the Asp358Ala polymorphism in relation to type 2 diabetes, obesity, and other pre-diabetic...... quantitative traits among Danish whites. By applying a recessive genetic model in a case-control study of 1,349 type 2 diabetic patients and 4,596 glucose-tolerant control subjects, we found a significant difference in genotype distribution (P = 0.008) and in allele frequency (Ala-allele 38.3% [95% CI 36......Interleukin-6 (IL-6) is a pleiotropic cytokine involved in the pathophysiology of various human diseases such as type 2 diabetes and obesity. IL-6 signals via a heterodimeric receptor complex consisting of a soluble IL-6 alpha-subunit (IL-6 receptor [IL6R]) and a signal transducing subunit (gp130...

  16. Genes: Interactions with Language on Three Levels—Inter-Individual Variation, Historical Correlations and Genetic Biasing

    Dediu, Dan

    The complex inter-relationships between genetics and linguistics encompass all four scales highlighted by the contributions to this book and, together with cultural transmission, the genetics of language holds the promise to offer a unitary understanding of this fascinating phenomenon. There are inter-individual differences in genetic makeup which contribute to the obvious fact that we are not identical in the way we understand and use language and, by studying them, we will be able to both better treat and enhance ourselves. There are correlations between the genetic configuration of human groups and their languages, reflecting the historical processes shaping them, and there also seem to exist genes which can influence some characteristics of language, biasing it towards or against certain states by altering the way language is transmitted across generations. Besides the joys of pure knowledge, the understanding of these three aspects of genetics relevant to language will potentially trigger advances in medicine, linguistics, psychology or the understanding of our own past and, last but not least, a profound change in the way we regard one of the emblems of being human: our capacity for language.

  17. A COMMON VARIATION IN THE PROMOTER REGION OF INTERLEUKIN-6 GENE SHOWS ASSOCIATION WITH EXERCISE PERFORMANCE

    Antti Huuskonen

    2009-06-01

    Full Text Available Skeletal muscle-derived interleukin-6 (IL-6 is a pleiotropic cytokine which regulates body metabolism during strenuous physical exercise. OBJECTIVE: The effect of a potentially functional single nucleotide polymorphism (SNP -174G/C of the IL6 gene (rs1800795 promoter was examined on maximal oxygen uptake (VO2max, body mass index (BMI and plasma IL-6 levels in response to physical training. Fifty four male military conscripts were studied for 8 weeks during their basic training. At weeks 1, 5 and 8, VO2max and anthropometrics were measured, and blood samples collected before and after acute aerobic exercise. Acute exercise increased plasma IL-6 in subjects with genotype CG. Moreover, during the 8-week training period, a tendency for increased plasma IL-6 was observed in subjects with this genotype. VO2max values increased in all genotype groups, but subjects with genotype CG made the greatest gains in VO2max. Training significantly decreased BMI only in subjects with genotype CG. Our findings suggest that the allele C may have an effect on plasma IL-6 response to acute exercise in healthy male subjects. Exercise training has a favourable effect on VO2max and BMI, with the most prominent effects in subjects with genotype CG. Thus we conclude that this SNP may account for individual response to exercise training.

  18. Copy number variations in the amylase gene (AMY2B) in Japanese native dog breeds.

    Tonoike, A; Hori, Y; Inoue-Murayama, M; Konno, A; Fujita, K; Miyado, M; Fukami, M; Nagasawa, M; Mogi, K; Kikusui, T

    2015-10-01

    A recent study suggested that increased copy numbers of the AMY2B gene might be a crucial genetic change that occurred during the domestication of dogs. To investigate AMY2B expansion in ancient breeds, which are highly divergent from modern breeds of presumed European origins, we analysed copy numbers in native Japanese dog breeds. Copy numbers in the Akita and Shiba, two ancient breeds in Japan, were higher than those in wolves. However, compared to a group of various modern breeds, Akitas had fewer copy numbers, whereas Shibas exhibited the same level of expansion as modern breeds. Interestingly, average AMY2B copy numbers in the Jomon-Shiba, a unique line of the Shiba that has been bred to maintain their appearance resembling ancestors of native Japanese dogs and that originated in the same region as the Akita, were lower than those in the Shiba. These differences may have arisen from the earlier introduction of rice farming to the region in which the Shiba originated compared to the region in which the Akita and the Jomon-Shiba originated. Thus, our data provide insights into the relationship between the introduction of agriculture and AMY2B expansion in dogs. PMID:26358734

  19. SSADH variation in primates: intra- and interspecific data on a gene with a potential role in human cognitive functions.

    Blasi, Paola; Palmerio, Francesca; Aiello, Aurora; Rocchi, Mariano; Malaspina, Patrizia; Novelletto, Andrea

    2006-07-01

    In the present study we focus on the nucleotide and the inferred amino acid variation occurring in humans and other primate species for mitochondrial NAD(+)-dependent succinic semialdehyde dehydrogenase, a gene recently supposed to contribute to cognitive performance in humans. We determined 2527 bp of coding, intronic, and flanking sequences from chimpanzee, bonobo, gorilla, orangutan, gibbon, and macaque. We also resequenced the entire coding sequence on 39 independent chromosomes from Italian families. Four variable coding sites were genotyped in additional populations from Europe, Africa, and Asia. A test for constancy of the nonsynonymous vs. synonymous rates of nucleotide changes revealed that primates are characterized by largely variable d(N)/d(S) ratios. On a background of strong conservation, probably controlled by selective constraints, the lineage leading to humans showed a ratio increased to 0.42. Human polymorphic levels fall in the range reported for other genes, with a pattern of frequency and haplotype structure strongly suggestive of nonneutrality. The comparison with the primate sequences allowed inferring the ancestral state at all variable positions, suggesting that the c.538(C) allele and the associated functional variant is indeed a derived state that is proceeding to fixation. The unexpected pattern of human polymorphism compared to interspecific findings outlines the possibility of a recent positive selection on some variants relevant to new cognitive capabilities unique to humans. PMID:16786440

  20. Copy number variation of a gene cluster encoding endopolygalacturonase mediates flesh texture and stone adhesion in peach.

    Gu, Chao; Wang, Lu; Wang, Wei; Zhou, Hui; Ma, Baiquan; Zheng, Hongyu; Fang, Ting; Ogutu, Collins; Vimolmangkang, Sornkanok; Han, Yuepeng

    2016-04-01

    Texture is an important attribute affecting consumer perception of fruit quality. Peach melting flesh and flesh adhesion to stone (endocarp) are simply inherited and controlled by the F-M locus on linkage group (LG) 4. Here, we report that two genes encoding endopolygalacturonase (endoPG) in the F-M locus, designated PpendoPGF and PpendoPGM, are associated with the melting flesh and stone adhesion traits. PpendoPGM controls melting flesh while PpendoPGF has pleiotropic effects on both melting flesh and stone adhesion. The F-M locus has three allelic copy number variants of endoPG, H1 (PpendoPGF and PpendoPGM), H2 (PpendoPGM), and H3 (null). The H2 haplotype represents the ancestral one while the H1 and H3 haplotypes are two variants due to duplication and deletion of PpendoPGM, respectively. Accessions with H1H1, H1H2, or H1H3 genotypes show the freestone or semi-freestone and melting flesh phenotype, while both H2H2 and H2H3 accessions have the clingstone and melting flesh phenotype. The H3H3 accessions have the clingstone and non-melting flesh phenotype. Our study not only demonstrates a driving role of gene copy number variations in flesh texture diversification in fruit trees, but also provides a useful diagnostic tool for early seedling selection in peach breeding programmes. PMID:26850878

  1. Variation in the vitamin D receptor gene is not associated with risk of colorectal cancer in the Czech Republic.

    Hughes, David J

    2012-02-01

    PURPOSE: Increased levels of vitamin D may protect against colorectal cancer (CRC) development and recurrence. Accumulating epidemiologic evidence suggests these effects may be partly mediated by genetic variants of the vitamin D receptor (VDR) proposed to be associated with altered risk of CRC. We wished to determine if common VDR polymorphisms affected CRC risk in the Czech Republic, a homogenous European population with a high CRC incidence rate. METHODS: Frequencies of the common VDR gene polymorphisms rs2238136, rs1544410 (BsmI), rs7975232 (ApaI), and rs731236 (TaqI) were determined using allele-specific PCR in a case control analysis of a series of 754 CRC patients and 627 patients without malignant disease recruited from centers throughout the Czech Republic. Unconditional logistic regression was used to calculate odds ratios and 95% confidence intervals for the association between these variants and risk of CRC. RESULTS: None of the four polymorphisms tested had any significant effect on CRC risk. No significant differences were observed in susceptibility when the population was stratified by anatomical sub-site, sex, BMI, smoking, alcohol, or presence of polyps. CONCLUSIONS: We conclude that common variation in the VDR gene had little effect on its own on predisposition to sporadic CRC in the Czech population.

  2. Cloning of the promoter of NDE1, a gene implicated in psychiatric and neurodevelopmental disorders through copy number variation.

    Bradshaw, N J

    2016-06-01

    Copy number variation at 16p13.11 has been associated with a range of neurodevelopmental and psychiatric conditions, with duplication of this region being more common in individuals with schizophrenia. A prominent candidate gene within this locus is NDE1 (Nuclear Distribution Element 1) given its known importance for neurodevelopment, previous associations with mental illness and its well characterized interaction with the Disrupted in Schizophrenia 1 (DISC1) protein. In order to accurately model the effect of NDE1 duplication, it is important to first gain an understanding of how the gene is expressed. The complex promoter system of NDE1, which produces three distinct transcripts, each encoding for the same full-length NDE1 protein (also known as NudE), was therefore cloned and tested in human cell lines. The promoter for the longest of these three NDE1 transcripts was found to be responsible for the majority of expression in these systems, with its extended 5' untranslated region (UTR) having a limiting effect on its expression. These results thus highlight and clone the promoter elements required to generate systems in which the NDE1 protein is exogenously expressed under its native promoter, providing a biologically relevant model of 16p13.11 duplication in major mental illness. PMID:26975893

  3. Common variation in oxidative phosphorylation genes is not a major cause of insulin resistance or type 2 diabetes

    Snogdal, L S; Wod, M; Grarup, N;

    2012-01-01

    AIMS/HYPOTHESIS: There is substantial evidence that mitochondrial dysfunction is linked to insulin resistance and is present in several tissues relevant to the pathogenesis of type 2 diabetes. Here, we examined whether common variation in genes involved in oxidative phosphorylation (Ox......Phos) contributes to type 2 diabetes susceptibility or influences diabetes-related metabolic traits. METHODS: OxPhos gene variants (n = 10) that had been nominally associated (p < 0.01) with type 2 diabetes in a recent genome-wide meta-analysis (n = 10,108) were selected for follow-up in 3,599 type 2 diabetic and 4......,956 glucose-tolerant Danish individuals. A meta-analysis of these variants was performed in 11,729 type 2 diabetic patients and 43,943 non-diabetic individuals. The impact on OGTT-derived metabolic traits was evaluated in 5,869 treatment-naive individuals from the Danish Inter99 study. RESULTS: The minor...

  4. A common variation within the STEAP4 gene exons is associated with obesity in Uygur general population

    GUO Yan-ying; LI Nan-fang; ZHOU Ling; YAO Xiao-guang; WANG Hong-mei; ZHANG Ju-hong; LUO Wen-li

    2011-01-01

    Background Coordinated regulation of nutrient and inflammatory responses by six transmembrane epithelial antigen of prostate 4 (STEAP4) was essential for metabolic homeostasis. STEAP4 expression in human white adipose tissuewas associated with obesity. This study aimed to evaluate association between STEAP4 genetic polymorphisms and obesity in Uygur Chinese general population.Methods The functional regions of STEAP4 gene were sequenced in 96 Uygur with obesity (body mass index (BMI)>30 kg/m2). Representative variations were selected according to the function and linkage disequilibrium and genotyped in 1507 obesity (BMI ≥25 kg/m2) and 825 non-obesity control (BMI <25 kg/m2), all of whom were selected from epidemiology study of obesity-related diseases during January to February 2007 among Uygur population in Hetian area of Xinjiang Uygur Autonomous Region.Results Fourteen novel and 6 known single nucleotide polymorphism (SNPs), including 2 nonsynonymous SNPs (nsSNPs), in the STEAP4 gene were identified. Of the 3 representative SNPs, the nsSNP rs1981529 (Gly75Asp, 224A/G)was significantly associated with obesity phenotype (additive P/Pc=0.001/0.006, dominant P/Pc=0.003/0.018, odds ratio (OR) and 95% confidence interval (CI) adjusted for age, gender and drinking 0.755 (0.641-0.890) and 0.750(0.621-0.907), respectively). By the multiple linear regression analysis, the quantitative phenotypes of BMI (P/Pc=0.002/0.004) and waist circumference (P/Pc=0.004/0.008) were found to be significantly associated with the genotypes of rs1981529 (Gly75Asp, 224A/G) in Uygur general population, and effect size (beta value) of one allele G of rs1981529 (Gly75Asp, 224A/G) was-0.553 kg/m2 for BMI and -1.311 cm for waist circumference after controlling age,gender and drinking factors.Conclusions The present study shows an association of the common variation rs1981529 (Gly75Asp, 224A/G) in the STEAP4 gene with obesity in Uygur general population. Further studies should replicate the

  5. Allelic Variation in Developmental Genes and Effects on Winter Wheat Heading Date in the U.S. Great Plains.

    Grogan, Sarah M; Brown-Guedira, Gina; Haley, Scott D; McMaster, Gregory S; Reid, Scott D; Smith, Jared; Byrne, Patrick F

    2016-01-01

    Heading date in wheat (Triticum aestivum L.) and other small grain cereals is affected by the vernalization and photoperiod pathways. The reduced-height loci also have an effect on growth and development. Heading date, which occurs just prior to anthesis, was evaluated in a population of 299 hard winter wheat entries representative of the U.S. Great Plains region, grown in nine environments during 2011-2012 and 2012-2013. The germplasm was evaluated for candidate genes at vernalization (Vrn-A1, Vrn-B1, and Vrn-D1), photoperiod (Ppd-A1, Ppd-B1 and Ppd-D1), and reduced-height (Rht-B1 and Rht-D1) loci using polymerase chain reaction (PCR) and Kompetitive Allele Specific PCR (KASP) assays. Our objectives were to determine allelic variants known to affect flowering time, assess the effect of allelic variants on heading date, and investigate changes in the geographic and temporal distribution of alleles and haplotypes. Our analyses enhanced understanding of the roles developmental genes have on the timing of heading date in wheat under varying environmental conditions, which could be used by breeding programs to improve breeding strategies under current and future climate scenarios. The significant main effects and two-way interactions between the candidate genes explained an average of 44% of variability in heading date at each environment. Among the loci we evaluated, most of the variation in heading date was explained by Ppd-D1, Ppd-B1, and their interaction. The prevalence of the photoperiod sensitive alleles Ppd-A1b, Ppd-B1b, and Ppd-D1b has gradually decreased in U.S. Great Plains germplasm over the past century. There is also geographic variation for photoperiod sensitive and reduced-height alleles, with germplasm from breeding programs in the northern Great Plains having greater incidences of the photoperiod sensitive alleles and lower incidence of the semi-dwarf alleles than germplasm from breeding programs in the central or southern plains. PMID:27058239

  6. Revistas académicas mexicanas: panorama y prospectiva

    José Octavio Alonso Gamboa; Felipe Rafael Reyna Espinosa

    2015-01-01

    Se analiza un conjunto de revistas académicas mexicanas registradas en Latindex con el objetivo de conocer sus caracteristicas principales y plantear una prospectiva. Se revisan datos proporcionados por el Directorio, de calidad editorial, identificados en el Catálogo, así como las formas de acceso y distribución para las revistas en linea. Los principales resultados destacan una proliferación de revistas, el papel de las instituciones de educación superior como editoras, la preeminencia de r...

  7. Plagio e integridad académica en Alemania

    2016-01-01

    Alemania es quizá uno de los países europeos que, ya desde el siglo XVIII, ha mantenido un debate público más intenso sobre prácticas científicas y académicas deshonestas, relacionadas especialmente con tesis doctorales. Este debate fue especialmente productivo a finales del siglo XIX, dando lugar desde entonces, para evitar estas prácticas inaceptables, a la obligatoriedad de publicar todas las tesis doctorales, como requisito previo a la expedición del título de doctor por cualquier univers...

  8. Gestión Académica

    García Sánchez,Óscar

    2007-01-01

    Els objectius fonamentals del TFC són els de desenvolupar una aplicació de caràcter professional, la qual pugui ser integrada a qualsevol empresa en la qual la seva activitat requereixi una gestió acadèmica com a funcionalitat principal. Per a això s'empraran les últimes tecnologies que envolten la plataforma .NET, com a ADO.NET, ASP.NET, Formularis Web, Formularis Windows, Dispositius mòbils (Compact Framework).

  9. Estilo intelectual y rendimiento académico

    Sternberg, Robert J.; Castejón, Juan L.; María R. Bermejo

    2015-01-01

    El trabajo presenta los resultados de un estudio acerca del papel que juegan los estilos intelectuales en el rendimiento académico en distintas áreas de la Educación Primaria (Primary School) obligatoria. Como variables predictoras se incluyen: una medida de la inteligencia abstracta de tipo analítico, el cociente intelectual en el Sternberg Triarchic Abilities Test (STAT-forma E), y cada uno de los trece estilos intelectuales definidos por Sternberg y colaboradores. Los resultados, obtenidos...

  10. La brecha de rendimiento académico de Barranquilla

    Juan D. Barón

    2010-01-01

    Los estudiantes de la ciudad de Barranquilla presentan un rendimiento académico inferior al de los estudiantes de ciudades como Bogotá y Bucaramanga. Estas brechas de rendimiento son importantes y persistentes a través del proceso de formación de capital humano (grado quinto, noveno, undécimo y superior). Usando diferentes pruebas realizadas por el ICFES (SABER 5, 9, 11 y ECAES) en el 2009, el presente documento cuantifica dichas brechas de rendimiento y profundiza en las causas de estas dife...

  11. Variation in siderophore biosynthetic gene distribution and production across environmental and faecal populations of Escherichia coli.

    Laura J Searle

    Full Text Available Iron is essential for Escherichia coli growth and survival in the host and the external environment, but its availability is generally low due to the poor solubility of its ferric form in aqueous environments and the presence of iron-withholding proteins in the host. Most E. coli can increase access to iron by excreting siderophores such as enterobactin, which have a very strong affinity for Fe3+. A smaller proportion of isolates can generate up to 3 additional siderophores linked with pathogenesis; aerobactin, salmochelin, and yersiniabactin. However, non-pathogenic E. coli are also able to synthesise these virulence-associated siderophores. This raises questions about their role in the ecology of E. coli, beyond virulence, and whether specific siderophores might be linked with persistence in the external environment. Under the assumption that selection favours phenotypes that confer a fitness advantage, we compared siderophore production and gene distribution in E. coli isolated either from agricultural plants or the faeces of healthy mammals. This population-level comparison has revealed that under iron limiting growth conditions plant-associated isolates produced lower amounts of siderophores than faecal isolates. Additionally, multiplex PCR showed that environmental isolates were less likely to contain loci associated with aerobactin and yersiniabactin synthesis. Although aerobactin was linked with strong siderophore excretion, a significant difference in production was still observed between plant and faecal isolates when the analysis was restricted to strains only able to synthesise enterobactin. This finding suggests that the regulatory response to iron limitation may be an important trait associated with adaptation to the non-host environment. Our findings are consistent with the hypothesis that the ability to produce multiple siderophores facilitates E. coli gut colonisation and plays an important role in E. coli commensalism.

  12. Genes belonging to the insulin and ecdysone signaling pathways can contribute to developmental time, lifespan and abdominal size variation in Drosophila americana.

    Micael Reis

    Full Text Available Even within a single genus, such as Drosophila, cases of lineage-specific adaptive evolution have been found. Therefore, the molecular basis of phenotypic variation must be addressed in more than one species group, in order to infer general patterns. In this work, we used D. americana, a species distantly-related to D. melanogaster, to perform an F2 association study for developmental time (DT, chill-coma recovery time (CRT, abdominal size (AS and lifespan (LS involving the two strains (H5 and W11 whose genomes have been previously sequenced. Significant associations were found between the 43 large indel markers developed here and DT, AS and LS but not with CRT. Significant correlations are also found between DT and LS, and between AS and LS, that might be explained by variation at genes belonging to the insulin and ecdysone signaling pathways. Since, in this F2 association study a single marker, located close to the Ecdysone receptor (EcR gene, explained as much as 32.6% of the total variation in DT, we performed a second F2 association study, to determine whether large differences in DT are always due to variation in this genome region. No overlapping signal was observed between the two F2 association studies. Overall, these results illustrate that, in D. americana, pleiotropic genes involved in the highly-conserved insulin and ecdysone signaling pathways are likely responsible for variation observed in ecologically relevant phenotypic traits, although other genes are also involved.

  13. Variations in genome-wide gene expression in identical twins – a study of primary osteoblast-like culture from female twins discordant for osteoporosis

    Beresford Jon N

    2004-06-01

    Full Text Available Abstract Background Monozygotic twin pairs who are genetically identical would be potentially useful in gene expression study for specific traits as cases and controls, because there would be much less gene expression variation within pairs compared to two unrelated individuals. However the twin pair has to be discordant for the particular trait or phenotype excluding those resulting from known confounders. Such discordant monozygotic twin pairs are rare and very few studies have explored the potential usefulness of this approach. Results We studied genome-wide gene expression in primary osteoblast-like culture from marrow aspirates obtained from three pairs of monozygotic twins. We used the latest Affymetrix microchip contains probe sets for more than 20,000 genes. Two pairs were discordant for bone mineral density at the hip by more than one standard deviation, and the third pair was unrelated concordant and used as control. Only 1.5% on average of genes showed variation in expression within pairs as compared to 5% between pairs or over 15% from the literature. Importantly we identified several groups of genes showing variations within the discordant pairs and not within the concordant pair such as chondroitin beta 1,4 N-acetylgalactosaminyltransferase, inhibin beta A, interleukin 1 beta and colony stimulating factor 1 macrophage. These genes are known to have potential roles in bone physiology relating to bone density, osteoporosis and osteoarthritis. Conclusion Using the example of osteoblast-like cells in our monozygotic discordant twins for osteoporosis, we identified genes showing differential expression. Although without further experiment, we cannot confirm or conclude these are genes definitely related to bone physiology, we believe we have shown the potential and cost-effectiveness of further gene expression studies in discordant monozygotic twin pairs. A replication study for confirmation is essential.

  14. Genetic Variations of Kinase Inserts Domain Receptor (KDR) Gene Are Associated with the Risk of Astrocytomas.

    Gao, Yufei; Ma, Piyong; He, Yichun; Liu, Yan; Jiang, Yang

    2016-05-01

    2071559*C and rs2305948*T might significantly elevate the risk of astrocytomas, while mutants of rs1870377*A was associated with the decreased risk of astrocytomas. Further studies about ethnically diverse populations with larger sample size should be performed to confirm the correlation between KDR gene polymorphisms and risk of astrocytomas. PMID:26081139

  15. Indirect Effect of Corticotropin-Releasing Hormone Receptor 1 Gene Variation on Negative Emotionality and Alcohol Use via Right Ventrolateral Prefrontal Cortex

    Glaser, Yi G.; Zubieta, Jon-Kar; Hsu, David T.; Villafuerte, Sandra; Mickey, Brian J.; Trucco, Elisa M.; Burmeister, Margit; ZUCKER, ROBERT A.; Heitzeg, Mary M.

    2014-01-01

    Variations in the corticotropin-releasing hormone receptor 1 (CRHR1) gene have been found to interact with stress in modulating excessive alcohol consumption. However, the neural mechanisms through which CRHR1 influences this risk in humans is largely unknown. This study examined the influence of an intronic CRHR1 gene variant, rs110402, on brain responses to negative emotional words, negative emotional traits, and alcohol use in adolescents and young adults at high risk for alcoholism. Child...

  16. Characterization of genomic variations in SNPs of PE_PGRS genes reveals deletions and insertions in extensively drug resistant (XDR) M. tuberculosis strains from Pakistan

    Kanji, Akbar

    2015-03-01

    Background: Mycobacterium tuberculosis (MTB) PE_PGRS genes belong to the PE multi-gene family. Although the function of the members of the PE_PGRS multi-gene family is not yet known, it is hypothesized that the PE_PGRS genes may be associated with genetic variability. Material and methods: Whole genome sequencing analysis was performed on (n= 37) extensively drug resistant (XDR) MTB strains from Pakistan which included Central Asian (n= 23), East African Indian (n= 2), X3 (n= 1), T group (n= 3) and Orphan (n= 8) MTB strains. Results: By analyzing 42 PE_PGRS genes, 111 SNPs were identified, of which 13 were non-synonymous SNPs (nsSNPs). The nsSNPs identified in the PE_PGRS genes were as follows: 6, 9, 10 and 55 present in each of the CAS, EAI, Orphan, T1 and X3 XDR MTB strains studied. Deletions in PE_PGRS genes: 19, 21 and 23 were observed in 7 (35.0%) CAS1 and 3 (37.5%) in Orphan XDR MTB strains, while deletions in the PE_PGRS genes: 49 and 50 were observed in 36 (95.0%) CAS1 and all CAS, CAS2 and Orphan XDR MTB strains. An insertion in PE_PGRS6 gene was observed in all CAS, EAI3 and Orphan, while insertions in the PE_PGRS genes 19 and 33 were observed in 19 (95%) CAS1 and all CAS, CAS2, EAI3 and Orphan XDR MTB strains. Conclusion: Genetic diversity in PE_PGRS genes contributes to antigenic variability and may result in increased immunogenicity of strains. This is the first study identifying variations in nsSNPs, Insertions and Deletions in the PE_PGRS genes of XDR-TB strains from Pakistan. It highlights common genetic variations which may contribute to persistence.

  17. Natural variation of the rice blast resistance gene Pi-ta in Oryza species and its corresponding avirulence gene AVR-Pita in Magnaporthe oryzae

    The Pi-ta gene prevents the infections of M. oryzae races containing the corresponding avirulence gene AVR-Pita in a gene-for-gene manner. Pi-ta is a putative NBS type major resistance gene, and can directly recognize the AVR-Pita putative metalloprotease in triggering effective resistance. We hav...

  18. Low variation in the polymorphic Clock gene poly-Q region despite population genetic structure across barn swallow (Hirundo rustica populations.

    Roi Dor

    Full Text Available Recent studies of several species have reported a latitudinal cline in the circadian clock gene, Clock, which influences rhythms in both physiology and behavior. Latitudinal variation in this gene may hence reflect local adaptation to seasonal variation. In some bird populations, there is also an among-individual association between Clock poly-Q genotype and clutch initiation date and incubation period. We examined Clock poly-Q allele variation in the Barn Swallow (Hirundo rustica, a species with a cosmopolitan geographic distribution and considerable variation in life-history traits that may be influenced by the circadian clock. We genotyped Barn Swallows from five populations (from three subspecies and compared variation at the Clock locus to that at microsatellite loci and mitochondrial DNA (mtDNA. We found very low variation in the Clock poly-Q region, as >96% of individuals were homozygous, and the two other alleles at this locus were globally rare. Genetic differentiation based on the Clock poly-Q locus was not correlated with genetic differentiation based on either microsatellite loci or mtDNA sequences. Our results show that high diversity in Clock poly-Q is not general across avian species. The low Clock variation in the background of heterogeneity in microsatellite and mtDNA loci in Barn Swallows may be an outcome of stabilizing selection on the Clock locus.

  19. Low Variation in the Polymorphic Clock Gene Poly-Q Region Despite Population Genetic Structure across Barn Swallow (Hirundo rustica) Populations

    Dor, Roi; Lovette, Irby J.; Safran, Rebecca J.; Billerman, Shawn M.; Huber, Gernot H.; Vortman, Yoni; Lotem, Arnon; McGowan, Andrew; Evans, Matthew R.; Cooper, Caren B.; Winkler, David W.

    2011-01-01

    Recent studies of several species have reported a latitudinal cline in the circadian clock gene, Clock, which influences rhythms in both physiology and behavior. Latitudinal variation in this gene may hence reflect local adaptation to seasonal variation. In some bird populations, there is also an among-individual association between Clock poly-Q genotype and clutch initiation date and incubation period. We examined Clock poly-Q allele variation in the Barn Swallow (Hirundo rustica), a species with a cosmopolitan geographic distribution and considerable variation in life-history traits that may be influenced by the circadian clock. We genotyped Barn Swallows from five populations (from three subspecies) and compared variation at the Clock locus to that at microsatellite loci and mitochondrial DNA (mtDNA). We found very low variation in the Clock poly-Q region, as >96% of individuals were homozygous, and the two other alleles at this locus were globally rare. Genetic differentiation based on the Clock poly-Q locus was not correlated with genetic differentiation based on either microsatellite loci or mtDNA sequences. Our results show that high diversity in Clock poly-Q is not general across avian species. The low Clock variation in the background of heterogeneity in microsatellite and mtDNA loci in Barn Swallows may be an outcome of stabilizing selection on the Clock locus. PMID:22216124

  20. Variation in regulator of G-protein signaling 17 gene (RGS17 is associated with multiple substance dependence diagnoses

    Zhang Huiping

    2012-05-01

    Full Text Available Abstract Background RGS17 and RGS20 encode two members of the regulator of G-protein signaling RGS-Rz subfamily. Variation in these genes may alter their transcription and thereby influence the function of G protein-coupled receptors, including opioid receptors, and modify risk for substance dependence. Methods The association of 13 RGS17 and eight RGS20 tag single nucleotide polymorphisms (SNPs was examined with four substance dependence diagnoses (alcohol (AD, cocaine (CD, opioid (OD or marijuana (MjD] in 1,905 African Americans (AAs: 1,562 cases and 343 controls and 1,332 European Americans (EAs: 981 cases and 351 controls. Analyses were performed using both χ2 tests and logistic regression analyses that covaried sex, age, and ancestry proportion. Correlation of genotypes and mRNA expression levels was assessed by linear regression analyses. Results Seven RGS17 SNPs showed a significant association with at least one of the four dependence traits after a permutation-based correction for multiple testing (0.003≤Pempirical≤0.037. The G allele of SNP rs596359, in the RGS17 promoter region, was associated with AD, CD, OD, or MjD in both populations (0.005≤Pempirical≤0.019. This allele was also associated with significantly lower mRNA expression levels of RGS17 in YRI subjects (P = 0.002 and non-significantly lower mRNA expression levels of RGS17 in CEU subjects (P = 0.185. No RGS20 SNPs were associated with any of the four dependence traits in either population. Conclusions This study demonstrated that variation in RGS17 was associated with risk for substance dependence diagnoses in both AA and EA populations.

  1. Analysis of molecular intra-patient variation and delineation of a prognostic 12-gene signature in non-muscle invasive bladder cancer; technology transfer from microarrays to PCR

    Andersen, Lars Dyrskjøt; Reinert, Thomas; Novoradovsky, A; Zuiverloon, T C M; Beukers, W; Zwarthoff, E; Malats, N; Real, F X; Segersten, U; Malmström, P-U; Knowles, M; Hurst, C; Sorge, J; Borre, M; Orntoft, T F

    : Analysis of intra-patient variation of the molecular markers showed 71% similar classification results. A final panel of 12 genes was selected, showing significant correlation with outcome. In multivariate Cox regression analysis, we found that the 12-gene signature was an independent prognostic factor......Background: Multiple clinical risk factors and genetic profiles have been demonstrated to predict progression of non-muscle invasive bladder cancer; however, no easily clinical applicable gene signature has been developed to predict disease progression independent of disease stage and grade...

  2. An LTR Retrotransposon-Derived Gene Displays Lineage-Specific Structural and Putative Species-Specific Functional Variations in Eutherians.

    Irie, Masahito; Koga, Akihiko; Kaneko-Ishino, Tomoko; Ishino, Fumitoshi

    2016-01-01

    Amongst the 11 eutherian-specific genes acquired from a sushi-ichi retrotransposon is the CCHC type zinc-finger protein-encoding gene SIRH11/ZCCHC16. Its contribution to eutherian brain evolution is implied because of its involvement in cognitive function in mice, possibly via the noradrenergic system. Although, the possibility that Sirh11/Zcchc16 functions as a non-coding RNA still remains, dN/dS ratios in pairwise comparisons between its orthologs have provided supportive evidence that it acts as a protein. It became a pseudogene in armadillos (Cingulata) and sloths (Pilosa), the only two extant orders of xenarthra, which prompted us to examine the lineage-specific variations of SIRH11/ZCCHC16 in eutherians. We examined the predicted SIRH11/ZCCHC16 open reading frame (ORF) in 95 eutherian species based on the genomic DNA information in GenBank. A large variation in the SIRH11/ZCCHC16 ORF was detected in several lineages. These include a lack of a CCHC RNA-binding domain in its C-terminus, observed in gibbons (Hylobatidae: Primates) and megabats (Megachiroptera: Chiroptera). A lack of the N-terminal half, on the other hand, was observed in New World monkeys (Platyrrhini: Primates) and species belonging to New World and African Hystricognaths (Caviomorpha and Bathyergidae: Rodents) along with Cetacea and Ruminantia (Cetartiodactyla). Among the hominoids, interestingly, three out of four genera of gibbons have lost normal SIRH11/ZCCHC16 function by deletion or the lack of the CCHC RNA-binding domain. Our extensive dN/dS analysis suggests that such truncated SIRH11/ZCCHC16 ORFs are functionally diversified even within lineages. Combined, our results show that SIRH11/ZCCHC16 may contribute to the diversification of eutherians by lineage-specific structural changes after its domestication in the common eutherian ancestor, followed by putative species-specific functional changes that enhanced fitness and occurred as a consequence of complex natural selection events

  3. Clock gene variation is associated with breeding phenology and maybe under directional selection in the migratory barn swallow.

    Manuela Caprioli

    Full Text Available BACKGROUND: In diverse taxa, photoperiodic responses that cause seasonal physiological and behavioural shifts are controlled by genes, including the vertebrate Clock orthologues, that encode for circadian oscillator mechanisms. While the genetic network behind circadian rhythms is well described, relatively few reports exist of the phenological consequences of and selection on Clock genes in the wild. Here, we investigated variation in breeding phenology in relation to Clock genetic diversity in a long-distance migratory bird, the barn swallow (Hirundo rustica. METHODOLOGY/PRINCIPAL FINDINGS: In a sample of 922 adult barn swallows from a single population breeding in Italy we found one very common (Q(7 and three rare (Q(5, Q(6, Q(8 length variants of a functionally significant polyglutamine repeat. Rare (2.9% Q(7/Q(8 heterozygous females, but not males, bred significantly later than common (91.5% Q(7/Q(7 females, consistent with the expectation that 'long' alleles cause late breeding, as observed in a resident population of another bird species. Because breeding date depends on arrival date from migration, present results suggest that the association between breeding date and Clock might be mediated by migration phenology. In addition, fecundity selection appears to be operating against Q(7/Q(8 because late migrating/breeding swallows have fewer clutches per season, and late breeding has additional negative selection effects via reduced offspring longevity. Genotype frequencies varied marginally non-significantly with age, as Q(7/Q(8 frequency showed a 4-fold reduction in old individuals. This result suggests negative viability selection against Q(7/Q(8, possibly mediated by costs of late breeding. CONCLUSIONS/SIGNIFICANCE: This is the first study of migratory birds showing an association between breeding phenology and Clock genotype and suggesting that negative selection occurs on a phenologically deviant genotype. Low polymorphism at Clock may

  4. Genetic variation in FADS genes and plasma cholesterol levels in 2-year-old infants: KOALA Birth Cohort Study.

    Carolina Moltó-Puigmartí

    Full Text Available OBJECTIVE: Single nucleotide polymorphisms (SNPs in genes involved in fatty acid metabolism (FADS1 FADS2 gene cluster are associated with plasma lipid levels. We aimed to investigate whether these associations are already present early in life and compare the relative contribution of FADS SNPs vs traditional (non-genetic factors as determinants of plasma lipid levels. METHODS: Information on infants' plasma total cholesterol levels, genotypes of five FADS SNPs (rs174545, rs174546, rs174556, rs174561, and rs3834458, anthropometric data, maternal characteristics, and breastfeeding history was available for 521 2-year-old children from the KOALA Birth Cohort Study. For 295 of these 521 children, plasma HDLc and non-HDLc levels were also known. Multivariable linear regression analysis was used to study the associations of genetic and non-genetic determinants with cholesterol levels. RESULTS: All FADS SNPs were significantly associated with total cholesterol levels. Heterozygous and homozygous for the minor allele children had about 4% and 8% lower total cholesterol levels than major allele homozygotes. In addition, homozygous for the minor allele children had about 7% lower HDLc levels. This difference reached significance for the SNPs rs174546 and rs3834458. The associations went in the same direction for non-HDLc, but statistical significance was not reached. The percentage of total variance of total cholesterol levels explained by FADS SNPs was relatively low (lower than 3% but of the same order as that explained by gender and the non-genetic determinants together. CONCLUSIONS: FADS SNPs are associated with plasma total cholesterol and HDLc levels in preschool children. This brings a new piece of evidence to explain how blood lipid levels may track from childhood to adulthood. Moreover, the finding that these SNPs explain a similar amount of variance in total cholesterol levels as the non-genetic determinants studied reveals the potential

  5. Copy number variation of lipocalin family genes for male-specific proteins in tilapia and its association with gender.

    Shirak, A; Golik, M; Lee, B-Y; Howe, A E; Kocher, T D; Hulata, G; Ron, M; Seroussi, E

    2008-11-01

    Lipocalins are involved in the binding of small molecules like sex steroids. We show here that the previously reported tilapia male-specific protein (MSP) is a lipocalin encoded by a variety of paralogous and homologous genes in different tilapia species. Exon-intron boundaries of MSP genes were typical of the six-exon genomic structure of lipocalins, and the transcripts were capable of encoding 200 amino-acid polypeptides that consisted of a putative signal peptide and a lipocalin domain. Cysteine residues are conserved in positions analogous to those forming the three disulfide bonds characteristic of the ligand pocket. The calculated molecular mass of the secreted MSP (20.4 kDa) was less than half of that observed, suggesting that it is highly glycosylated like its homologue tributyltin-binding protein. Analysis of sequence variations revealed three types of paralogs MSPA, MSPB and MSPC. Expression of both MSPA and MSPB was detected in testis. In haploid Oreochromis niloticus embryos, each of these types consisted of two closely related paralogs, and asymmetry between MSP copy numbers on the maternal (six copies) and the paternal (three copies) chromosomes was observed. Using this polymorphism we mapped MSPA and MSPC to linkage group 12 of an F(2) mapping family derived from a cross between O. niloticus and Oreochromis aureus. Females with high MSP copy number were more frequent by more than twofold than males. Gender-MSPC combinations showed significant deviation from expected Mendelian segregation (P=0.009) suggesting elimination of males with MSPC copies. We discuss different hypotheses to explain this elimination, including possibility for allelic conflict resulted by the hybridization. PMID:18648387

  6. Growth Hormone (GH1) Gene Variation, the Growth Hormone Receptor (GHR) Exon 3 Deletion Polymorphism in a West-African Population

    Millar, David S.; Lewis, Mark D.; Horan, Martin; Newsway, Vicky; Rees, D Aled; Easter, Tammy E.; Pepe, Guglielmina; Rickards, Olga; Norin, Martin; Scanlon, Maurice F.; Krawczak, Michael; Cooper, David N.

    2008-01-01

    Growth Hormone (GH1) Gene Variation, the Growth Hormone Receptor (GHR) Exon 3 Deletion Polymorphism in a West-African Population UNITED KINGDOM (Millar, David S.) UNITED KINGDOM Received: 2008-05-29 Revised: 2008-08-21 Accepted: 2008-09-22

  7. Determination of the key innate genes related to individual variation in carbon tetrachloride-induced hepatotoxicity using a pre-biopsy procedure

    High inter-individual variation in chemical-induced liver injury is a frequent observation with many hepatotoxic chemicals, yet the mechanism underlying it remains poorly understood. Even with carbon tetrachloride (CCl4), a well-known model hepatotoxicant, substantial individual variations are observed in the severity of liver injury. Using microarray, many attempts have been made to identify the key genes in CCl4-induced liver injury but mostly, they examined the gene expression of liver after CCl4 exposure, unable to dissect out the complicating factors from pathological changes secondary to liver injury. To more accurately identify the genes for the individual variation in CCl4-induced hepatotoxicity, we compared the innate gene expression of the individual liver samples pre-biopsied prior to CCl4-treatment with the severity of liver injury after CCl4-treatment. Effect of biopsy procedure and 3 week recovery period on liver function and gene expression were confirmed to be insignificant. Using this design, we found that the expression of genes associated with immunity and defense, lipid metabolism, transport and complement-mediated immunity, which are previously known to be suppressed by CCl4-treatment, were innately lower in the susceptible animals than resistant animals. Moreover, we demonstrated that the genes such as Gsta2, Sult2a1, Fgl1 and C6 were newly found to be innately lower in the susceptible animals to CCl4-hepatotoxicity. These naturally lower gene expression patterns were further confirmed by RT-PCR. We believe that this pre-biopsy design may provide a useful tool for understanding the cause of variability of hepatotoxicity and for the prediction and pre-screening of the susceptible individual to drug-induced hepatotoxicity.

  8. Characterization of genomic variations in SNPs of PE_PGRS genes reveals deletions and insertions in extensively drug resistant (XDR) M. tuberculosis strains from Pakistan

    Kanji, Akbar

    2015-01-21

    Background Mycobacterium tuberculosis (MTB) PE_PGRS genes belong to the PE multigene family. Although the function of PE_PGRS genes is unknown, it is hypothesized that the PE_PGRS genes may be associated with antigenic variability in MTB. Material and methods Whole genome sequencing analysis was performed on (n = 37) extensively drug-resistant (XDR) MTB strains from Pakistan, which included Lineage 1 (East African Indian, n = 2); Other lineage 1 (n = 3); Lineage 3 (Central Asian, n = 24); Other lineage 3 (n = 4); Lineage 4 (X3, n = 1) and T group (n = 3) MTB strains. Results There were 107 SNPs identified from the analysis of 42 PE_PGRS genes; of these, 13 were non-synonymous SNPs (nsSNPs). The nsSNPs identified in PE_PGRS genes – 6, 9 and 10 – were common in all EAI, CAS, Other lineages (1 and 3), T1 and X3. Deletions (DELs) in PE_PGRS genes – 3 and 19 – were observed in 17 (80.9%) CAS1 and 6 (85.7%) in Other lineages (1 and 3) XDR MTB strains, while DELs in the PE_PGRS49 were observed in all CAS1, CAS, CAS2 and Other lineages (1 and 3) XDR MTB strains. All CAS, EAI and Other lineages (1 and 3) strains showed insertions (INS) in PE_PGRS6 gene, while INS in the PE_PGRS genes 19 and 33 were observed in 20 (95.2%) CAS1, all CAS, CAS2, EAI and Other lineages (1 and 3) XDR MTB strains. Conclusion Genetic diversity in PE_PGRS genes contributes to antigenic variability and may result in increased immunogenicity of strains. This is the first study identifying variations in nsSNPs and INDELs in the PE_PGRS genes of XDR-TB strains from Pakistan. It highlights common genetic variations which may contribute to persistence.

  9. Large-Scale Evaluation of Common Variation in Regulatory T Cell–Related Genes and Ovarian Cancer Outcome

    Charbonneau, Bridget; Moysich, Kirsten B; Kalli, Kimberly R;

    2014-01-01

    The presence of regulatory T cells (Treg) in solid tumors is known to play a role in patient survival in ovarian cancer and other malignancies. We assessed inherited genetic variations via 749 tag single-nucleotide polymorphisms (SNP) in 25 Treg-associated genes (CD28, CTLA4, FOXP3, IDO1, IL10, IL......10RA, IL15, 1L17RA, IL23A, IL23R, IL2RA, IL6, IL6R, IL8, LGALS1, LGALS9, MAP3K8, STAT5A, STAT5B, TGFB1, TGFB2, TGFB3, TGFBR1, TGRBR2, and TGFBR3) in relation to ovarian cancer survival. We analyzed genotype and overall survival in 10,084 women with invasive epithelial ovarian cancer, including 5......,248 high-grade serous, 1,452 endometrioid, 795 clear cell, and 661 mucinous carcinoma cases of European descent across 28 studies from the Ovarian Cancer Association Consortium (OCAC). The strongest associations were found for endometrioid carcinoma and IL2RA SNPs rs11256497 [HR, 1.42; 95% confidence...

  10. Preliminary evidence that allelic variation in the LMX1A gene influences training-related working memory improvement.

    Bellander, Martin; Brehmer, Yvonne; Westerberg, Helena; Karlsson, Sari; Fürth, Daniel; Bergman, Olle; Eriksson, Elias; Bäckman, Lars

    2011-06-01

    LMX1A is a transcription factor involved in the development of dopamine (DA)-producing neurons in midbrain. Previous research has shown that allelic variations in three LMX1A single nucleotide polymorphisms (SNPs) were related to risk of Parkinson's disease (PD), suggesting that these SNPs may influence the number of mesencephalic DA neurons. Prompted by the established link between striatal DA functions and working memory (WM) performance, we examined two of these SNPs in relation to the ability to benefit from 4 weeks of WM training. One SNP (rs4657412) was strongly associated with the magnitude of training-related gains in verbal WM. The allele linked to larger gains has previously been suggested to be associated with higher dopaminergic nerve cell density. No differential gains of either SNP were observed for spatial WM, and the genotype groups were also indistinguishable in tests of attention, interference control, episodic memory, perceptual speed, and reasoning for both SNPs. This pattern of data is in agreement with previous findings from our group, suggesting that cognitive effects of DA-related genes may be more easily detected in a training context than for single-assessment performance scores. PMID:21435346

  11. Genetic diversity and its seasonal variation of Jiaozhou Bay phytoplankton determined by rbcL gene sequencing

    LIU Yongjian; YANG Guanpin; GUAN Xiaojing; MEN Rongxin

    2006-01-01

    Ribulose-1, 5-bisphosphate carboxynase/oxygenase large subunit gene (rbcL) of Jiaozhou Bay phytoplankton was amplified from spring, summer and autumn surface seawater DNAs and cloned respectively. About 50 clones were randomly selected from each library and sequenced. If identical amino acid sequences are considered as the same operational taxonomy unit (OTU), 61 OTUs are identified according to inferred amino acid sequences, among them, 21 from spring seawater, 15 from summer seawater and 25 from autumn seawater. Shannon index calculated from OTU abundances reflects the genetic diversity of a community. The indexes of spring, summer and autumn surface seawater phytoplankton are 2.69, 2.44 and 2.76 respectively, indicating that phytoplankton genetic diversity of autumn seawater is the richest. Seasonal variation of phytoplankton community is significant; the community compositions of three seasons are almost completely different except for the two OTUs shared by summer and autumn. Surface seawater phytoplankton communities are possibly metacommunities different spatially and temporally.

  12. Genome-wide analysis of ZmDREB genes and their association with natural variation in drought tolerance at seedling stage of Zea mays L.

    Shengxue Liu

    Full Text Available The worldwide production of maize (Zea mays L. is frequently impacted by water scarcity and as a result, increased drought tolerance is a priority target in maize breeding programs. While DREB transcription factors have been demonstrated to play a central role in desiccation tolerance, whether or not natural sequence variations in these genes are associated with the phenotypic variability of this trait is largely unknown. In the present study, eighteen ZmDREB genes present in the maize B73 genome were cloned and systematically analyzed to determine their phylogenetic relationship, synteny with rice, maize and sorghum genomes; pattern of drought-responsive gene expression, and protein transactivation activity. Importantly, the association between the nucleic acid variation of each ZmDREB gene with drought tolerance was evaluated using a diverse population of maize consisting of 368 varieties from tropical and temperate regions. A significant association between the genetic variation of ZmDREB2.7 and drought tolerance at seedling stage was identified. Further analysis found that the DNA polymorphisms in the promoter region of ZmDREB2.7, but not the protein coding region itself, was associated with different levels of drought tolerance among maize varieties, likely due to distinct patterns of gene expression in response to drought stress. In vitro, protein-DNA binding assay demonstrated that ZmDREB2.7 protein could specifically interact with the target DNA sequences. The transgenic Arabidopsis overexpressing ZmDREB2.7 displayed enhanced tolerance to drought stress. Moreover, a favorable allele of ZmDREB2.7, identified in the drought-tolerant maize varieties, was effective in imparting plant tolerance to drought stress. Based upon these findings, we conclude that natural variation in the promoter of ZmDREB2.7 contributes to maize drought tolerance, and that the gene and its favorable allele may be an important genetic resource for the genetic

  13. Aula de videojuegos, un proyecto académico

    Navarrete Cardero, José Luis; Barrientos Bueno, Mónica

    2012-01-01

    Aula de Videojuegos es un proyecto académico multidisciplinar de investigación, formación y desarro­llo de la Facultad de Comunicación de la Universidad de Sevilla, en el que también participan la de Be­llas Artes y la Escuela Técnica Superior de Ingeniería Informática. Las variadas actividades desempeñadas se expanden más allá de los límites característicos de un proyecto de investigación al uso; tienen por propósito la formación práctica de sus integrantes en destrezas relacionadas con el d...

  14. Patterns of nucleotide sequence variation in ICAM1 and TNF genes in twelve ethnic groups of India: roles of demographic history and natural selection

    Sanghamitra Sengupta; Shabana Farheen; Neelanjana Mukherjee; Partha P. Majumder

    2007-12-01

    We have studied DNA sequence variation in and around the genes ICAM1 and TNF, which play functional and correlated roles in inflammatory processes and immune cell responses, in 12 diverse ethnic groups of India, with a view to investigating the relative roles of demographic history and natural selection in shaping the observed patterns of variation. The total numbers of single nucleotide polymorphisms (SNPs) detected at the ICAM1 and TNF loci were 29 and 12, respectively. Haplotype and allele frequencies differed significantly across populations. The site frequency spectra at these loci were significantly different from those expected under neutrality, and showed an excess of intermediate-frequency variants consistent with balancing selection. However, as expected under balancing selection, there was no significant reduction of $F_{ST}$ values compared to neutral autosomal loci. Mismatch distributions were consistent with population expansion for both loci. On the other hand, the phylogenetic network among haplotypes for the TNF locus was similar to expectations under population expansion, while that for the ICAM1 was as expected under balancing selection. Nucleotide diversity at the ICAM1 locus was an order of magnitude lower in the promoter region, compared to the introns or exons, but no such difference was noted for the TNF gene. Thus, we conclude that the pattern of nucleotide variation in these genes has been modulated by both demographic history and selection. This is not surprising in view of the known allelic associations of several polymorphisms in these genes with various diseases, both infectious and noninfectious.

  15. Phase variation of a Type IIG restriction-modification enzyme alters site-specific methylation patterns and gene expression in Campylobacter jejuni strain NCTC11168.

    Anjum, Awais; Brathwaite, Kelly J; Aidley, Jack; Connerton, Phillippa L; Cummings, Nicola J; Parkhill, Julian; Connerton, Ian; Bayliss, Christopher D

    2016-06-01

    Phase-variable restriction-modification systems are a feature of a diverse range of bacterial species. Stochastic, reversible switches in expression of the methyltransferase produces variation in methylation of specific sequences. Phase-variable methylation by both Type I and Type III methyltransferases is associated with altered gene expression and phenotypic variation. One phase-variable gene of Campylobacter jejuni encodes a homologue of an unusual Type IIG restriction-modification system in which the endonuclease and methyltransferase are encoded by a single gene. Using both inhibition of restriction and PacBio-derived methylome analyses of mutants and phase-variants, the cj0031c allele in C. jejuni strain NCTC11168 was demonstrated to specifically methylate adenine in 5'CCCGA and 5'CCTGA sequences. Alterations in the levels of specific transcripts were detected using RNA-Seq in phase-variants and mutants of cj0031c but these changes did not correlate with observed differences in phenotypic behaviour. Alterations in restriction of phage growth were also associated with phase variation (PV) of cj0031c and correlated with presence of sites in the genomes of these phages. We conclude that PV of a Type IIG restriction-modification system causes changes in site-specific methylation patterns and gene expression patterns that may indirectly change adaptive traits. PMID:26786317

  16. Sequence variation and expression analysis of seed dormancy- and germination-associated ABA- and GA-related genes in rice cultivars

    Fei eLiu

    2011-06-01

    Full Text Available Abscisic acid (ABA and Gibberellic acid (GA play key roles in regulating seed dormancy and germination. First, when examining germination of different rice cultivars, we found that their germination timing and dormancy status are rather distinct, coupled with different GA/ABA ratio. Second, we studied genomic sequences of ABA and GA dormancy- and germination-associated genes in rice and discovered single nucleotide polymorphisms (SNPs and insertions/deletions (Indels in both coding and regulatory sequences. We aligned all these variations to the genome assemblies of 9311 and PA64s and demonstrated their relevance to seed dormancy both quantitatively and qualitatively based on gene expression data. Third, we surveyed and compared differentially-expressed genes in dry seeds between 9311 and PA64s to show that these differentially-expressed genes may play roles in seed dormancy and germination.

  17. Mulher, maternidade e trabalho acadê Mujer, maternidad y trabajo académico Women, maternity and academic work

    Márcia Regina Cangiani Fabbro

    2010-07-01

    Full Text Available Objetivo. Descrever a vivência do trabalho acadêmico e da maternidade das professoras universitárias. Metodologia. A investigação se realizou de dezembro de 2003 a dezembro de 2005 e se coletou informação das histórias de vida e das entrevistas reflexivas a cinco professoras de uma universidade pública de São Paulo (Brasil. Resultados. A análise dos dados compreendeu dois eixos: a história de cada "uma" e a história de todas "elas", que levou às categorias empíricas: maternidade, relações de gênero e trabalho acadêmico. Os resultados assinalaram que o trabalho proporciona a realização profissional, ao afirmarse como profissional e ao poder prover a manutenção da família, mas essa afirmação poderia ser secundária ao universo familiar e relacional que apóia as realizações individuais. Conclusão. A maternidade foi o elemento desencadeador de questionamentos do caráter mítico de mulher "realizada", o que levou a reflexionar sobre si mesmas, o trabalho e sua relação com os filhos e esposo.Objetivo. Describir la vivencia del trabajo académico y de la maternidad de las profesoras universitarias. Metodología. La investigación se realizó de diciembre de 2003 a diciembre de 2005 y se recolectó información de las historias de vida y de las entrevistas reflexivas a cinco profesoras de una universidad pública de São Paulo (Brasil. Resultados. El análisis de los datos comprendió dos ejes: la historia de "cada una" y la historia de "todas ellas", que llevó a las categorías empíricas: maternidad, relaciones de género y trabajo académico. Los resultados señalaron que el trabajo proporciona la realización profesional, al afirmarse como profesional y al poder proveer la manutención de la familia, pero esa afirmación podría ser secundaria al universo familiar y relacional que apoya las realizaciones individuales. Conclusión. La maternidad fue el elemento desencadenador de cuestionamientos del carácter m

  18. Genetic variation in the CYP1A1 gene is related to circulating PCB118 levels in a population-based sample

    Several of the polychlorinated biphenyls (PCBs), i.e. the dioxin-like PCBs, are known to induce the P450 enzymes CYP1A1, CYP1A2 and CYP1B1 by activating the aryl hydrocarbon receptor (Ah)-receptor. We evaluated if circulating levels of PCBs in a population sample were related to genetic variation in the genes encoding these CYPs. In the population-based Prospective Investigation of the Vasculature in Uppsala Seniors (PIVUS) study (1016 subjects all aged 70), 21 SNPs in the CYP1A1, CYP1A2 and CYP1B1 genes were genotyped. Sixteen PCB congeners were analysed by high-resolution chromatography coupled to high-resolution mass spectrometry (HRGC/ HRMS). Of the investigated relationships between SNPs in the CYP1A1, CYP1A2 and CYP1B1 and six PCBs (congeners 118, 126, 156, 169, 170 and 206) that captures >80% of the variation of all PCBs measured, only the relationship between CYP1A1 rs2470893 was significantly related to PCB118 levels following strict adjustment for multiple testing (p=0.00011). However, there were several additional SNPs in the CYP1A2 and CYP1B1 that showed nominally significant associations with PCB118 levels (p-values in the 0.003–0.05 range). Further, several SNPs in the CYP1B1 gene were related to both PCB156 and PCB206 with p-values in the 0.005–0.05 range. Very few associations with p<0.05 were seen for PCB126, PCB169 or PCB170. Genetic variation in the CYP1A1 was related to circulating PCB118 levels in the general elderly population. Genetic variation in CYP1A2 and CYP1B1 might also be associated with other PCBs. - Highlights: • We studied the relationship between PCBs and the genetic variation in the CYP genes. • Cross sectional data from a cohort of elderly were analysed. • The PCB levels were evaluated versus 21 SNPs in three CYP genes. • PCB 118 was related to variation in the CYP1A1 gene

  19. Genetic variation in the CYP1A1 gene is related to circulating PCB118 levels in a population-based sample

    Lind, Lars [Department of Medical Sciences, Cardiovascular Epidemiology, Uppsala University, Uppsala (Sweden); Penell, Johanna [Department of Medical Sciences, Occupational and Environmental Medicine, Uppsala University, Uppsala (Sweden); Syvänen, Anne-Christine; Axelsson, Tomas [Department of Medical Sciences, Molecular Medicine and Science for Life Laboratory, Uppsala University, Uppsala (Sweden); Ingelsson, Erik [Department of Medical Sciences, Molecular Epidemiology and Science for Life Laboratory, Uppsala University, Uppsala (Sweden); Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford (United Kingdom); Morris, Andrew P.; Lindgren, Cecilia [Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford (United Kingdom); Salihovic, Samira; Bavel, Bert van [MTM Research Centre, School of Science and Technology, Örebro University, Örebro (Sweden); Lind, P. Monica, E-mail: monica.lind@medsci.uu.se [Department of Medical Sciences, Occupational and Environmental Medicine, Uppsala University, Uppsala (Sweden)

    2014-08-15

    Several of the polychlorinated biphenyls (PCBs), i.e. the dioxin-like PCBs, are known to induce the P450 enzymes CYP1A1, CYP1A2 and CYP1B1 by activating the aryl hydrocarbon receptor (Ah)-receptor. We evaluated if circulating levels of PCBs in a population sample were related to genetic variation in the genes encoding these CYPs. In the population-based Prospective Investigation of the Vasculature in Uppsala Seniors (PIVUS) study (1016 subjects all aged 70), 21 SNPs in the CYP1A1, CYP1A2 and CYP1B1 genes were genotyped. Sixteen PCB congeners were analysed by high-resolution chromatography coupled to high-resolution mass spectrometry (HRGC/ HRMS). Of the investigated relationships between SNPs in the CYP1A1, CYP1A2 and CYP1B1 and six PCBs (congeners 118, 126, 156, 169, 170 and 206) that captures >80% of the variation of all PCBs measured, only the relationship between CYP1A1 rs2470893 was significantly related to PCB118 levels following strict adjustment for multiple testing (p=0.00011). However, there were several additional SNPs in the CYP1A2 and CYP1B1 that showed nominally significant associations with PCB118 levels (p-values in the 0.003–0.05 range). Further, several SNPs in the CYP1B1 gene were related to both PCB156 and PCB206 with p-values in the 0.005–0.05 range. Very few associations with p<0.05 were seen for PCB126, PCB169 or PCB170. Genetic variation in the CYP1A1 was related to circulating PCB118 levels in the general elderly population. Genetic variation in CYP1A2 and CYP1B1 might also be associated with other PCBs. - Highlights: • We studied the relationship between PCBs and the genetic variation in the CYP genes. • Cross sectional data from a cohort of elderly were analysed. • The PCB levels were evaluated versus 21 SNPs in three CYP genes. • PCB 118 was related to variation in the CYP1A1 gene.

  20. Variation in Stability of Endogenous Reference Genes in Fallopian Tubes and Endometrium from Healthy and Ectopic Pregnant Women

    Konje, Justin C.; Willets, Jonathon M; Marczylo, Emma L.; Amoako, Akwasi A.; Gebeh, Alpha K.

    2012-01-01

    RT-qPCR is commonly employed in gene expression studies in ectopic pregnancy. Most use RN18S1, β-actin or GAPDH as internal controls without validation of their suitability as reference genes. A systematic study of the suitability of endogenous reference genes for gene expression studies in ectopic pregnancy is lacking. The aims of this study were therefore to evaluate the stability of 12 reference genes and suggest those that are stable for use as internal control genes in fallopian tubes an...

  1. S-SCAM, a rare copy number variation gene, induces schizophrenia-related endophenotypes in transgenic mouse model.

    Zhang, Nanyan; Zhong, Peng; Shin, Seung Min; Metallo, Jacob; Danielson, Eric; Olsen, Christopher M; Liu, Qing-song; Lee, Sang H

    2015-02-01

    Accumulating genetic evidence suggests that schizophrenia (SZ) is associated with individually rare copy number variations (CNVs) of diverse genes, often specific to single cases. However, the causality of these rare mutations remains unknown. One of the rare CNVs found in SZ cohorts is the duplication of Synaptic Scaffolding Molecule (S-SCAM, also called MAGI-2), which encodes a postsynaptic scaffolding protein controlling synaptic AMPA receptor levels, and thus the strength of excitatory synaptic transmission. Here we report that, in a transgenic mouse model simulating the duplication conditions, elevation of S-SCAM levels in excitatory neurons of the forebrain was sufficient to induce multiple SZ-related endophenotypes. S-SCAM transgenic mice showed an increased number of lateral ventricles and a reduced number of parvalbumin-stained neurons. In addition, the mice exhibited SZ-like behavioral abnormalities, including hyperlocomotor activity, deficits in prepulse inhibition, increased anxiety, impaired social interaction, and working memory deficit. Notably, the S-SCAM transgenic mice showed a unique sex difference in showing these behavioral symptoms, which is reminiscent of human conditions. These behavioral abnormalities were accompanied by hyperglutamatergic function associated with increased synaptic AMPA receptor levels and impaired long-term potentiation. Importantly, reducing glutamate release by the group 2 metabotropic glutamate receptor agonist LY379268 ameliorated the working memory deficits in the transgenic mice, suggesting that hyperglutamatergic function underlies the cognitive functional deficits. Together, these results contribute to validate a causal relationship of the rare S-SCAM CNV and provide supporting evidence for the rare CNV hypothesis in SZ pathogenesis. Furthermore, the S-SCAM transgenic mice provide a valuable new animal model for studying SZ pathogenesis. PMID:25653350

  2. In silico structure-function analysis of pathological variation in the HSD11B2 gene sequence.

    Manning, Jonathan R; Bailey, Matthew A; Soares, Dinesh C; Dunbar, Donald R; Mullins, John J

    2010-08-01

    11beta-Hydroxysteroid dehydrogenase type 2 (11betaHSD2) is a short-chain dehydrogenase/reductase (SDR) responsible for inactivating cortisol and preventing its binding to the mineralocorticoid receptor (MR). Nonfunctional mutations in HSD11B2, the gene encoding 11betaHSD2, cause the hypertensive syndrome of apparent mineralocorticoid excess (AME). Like other such Mendelian disorders, AME is rare but has nevertheless helped to illuminate principles fundamental to the regulation of blood pressure. Furthermore, polymorphisms in HSD11B2 have been associated with salt sensitivity, a major risk factor for cardiovascular mortality. It is therefore highly likely that sequence variation in HSD11B2, having subtle functional ramifications, will affect blood pressure in the wider population. In this study, a three-dimensional homology model of 11betaHSD2 was created and used to hypothesize the functional consequences in terms of protein structure of published mutations in HSD11B2. This approach underscored the strong genotype-phenotype correlation of AME: severe forms of the disease, associated with little in vivo enzyme activity, arise from mutations occurring in invariant alignment positions. These were predicted to exert gross structural changes in the protein. In contrast, those mutations causing a mild clinical phenotype were in less conserved regions of the protein that were predicted to be relatively more tolerant to substitution. Finally, a number of pathogenic mutations are shown to be associated with regions predicted to participate in dimer formation, and in protein stabilization, which may therefore suggest molecular mechanisms of disease. PMID:20571110

  3. Cylindrotheca closterium Is a Species Complex as Was Evidenced by the Variations of rbcL Gene and SSU rDNA

    LI Haitao; YANG Guanpin; SUN Ying; WU Suihan; ZHANG Xiufang

    2007-01-01

    The genus Cylindrotheca consists of a small group of marine diatoms with a few species described. Eleven isolates of diatoms identified as Cylindrotheca closterium morphologically were obtained from Jiaozhou Bay with their nuclear-encoded small-subunit ribosomal RNA (SSU rDNA) and chloroplast-encoded rbcL gene sequences determined in this study. Interestingly, very high sequence divergences of SSU rDNA and rbcL gene were found among these isolates, and numerous nucleotide variation of rbcL gene caused relatively few variation of deduced amino acid sequence. Phylogenetic analyses based on SSU rDNA and rbcL gene, respectively, grouped the isolates into 6 clades. Phylogenetic tree of SSU rDNA placed all the Cylindrotheca isolates together, separating them into two lineages clearly. LineageⅠ was composed of the eleven C. closterium isolates obtained in this study together with another C. closterium isolate, but some clades were not well supported. LineageⅡ contained two C. closterium isolates and one C. fusiformis isolate. Phylogenetic analysis of rbcL gene also separated the Cylindrotheca isolates into two well-defined lineages. The eleven C. closterium isolates formed a lineage and all clades were supported strongly. Statistical comparisons of SSU rDNA indicated that the average distance within lineage Ⅰ was significantly higher than that of other microalgae species (P < 0.01). These results suggested the existence of cryptic species within C. closterium.

  4. A Multiple Interaction Analysis Reveals ADRB3 as a Potential Candidate for Gallbladder Cancer Predisposition via a Complex Interaction with Other Candidate Gene Variations.

    Rai, Rajani; Kim, Jong Joo; Misra, Sanjeev; Kumar, Ashok; Mittal, Balraj

    2015-01-01

    Gallbladder cancer is the most common and a highly aggressive biliary tract malignancy with a dismal outcome. The pathogenesis of the disease is multifactorial, comprising the combined effect of multiple genetic variations of mild consequence along with numerous dietary and environmental risk factors. Previously, we demonstrated the association of several candidate gene variations with GBC risk. In this study, we aimed to identify the combination of gene variants and their possible interactions contributing towards genetic susceptibility of GBC. Here, we performed Multifactor-Dimensionality Reduction (MDR) and Classification and Regression Tree Analysis (CRT) to investigate the gene-gene interactions and the combined effect of 14 SNPs in nine genes (DR4 (rs20576, rs6557634); FAS (rs2234767); FASL (rs763110); DCC (rs2229080, rs4078288, rs7504990, rs714); PSCA (rs2294008, rs2978974); ADRA2A (rs1801253); ADRB1 (rs1800544); ADRB3 (rs4994); CYP17 (rs2486758)) involved in various signaling pathways. Genotyping was accomplished by PCR-RFLP or Taqman allelic discrimination assays. SPSS software version 16.0 and MDR software version 2.0 were used for all the statistical analysis. Single locus investigation demonstrated significant association of DR4 (rs20576, rs6557634), DCC (rs714, rs2229080, rs4078288) and ADRB3 (rs4994) polymorphisms with GBC risk. MDR analysis revealed ADRB3 (rs4994) to be crucial candidate in GBC susceptibility that may act either alone (p ADRB3 rs4994 as candidate influencing GBC susceptibility. PMID:26602921

  5. Sequence Variations in the Bovine Growth Hormone Gene Characterized by Single-Strand Conformation Polymorphism (Sscp) Analysis and Their Association with Milk Production Traits in Holsteins

    Yao, J; Aggrey, S E; Zadworny, D.; Hayes, J. F.; Kuhnlein, U

    1996-01-01

    Sequence variations in the bovine growth hormone (GH) gene were investigated by single strand conformation polymorphism (SSCP) analysis of seven amplified fragments covering almost the entire gene (2.7 kb). SSCPs were detected in four of these fragments and a total of six polymorphisms were found in a sample of 128 Holstein bulls. Two polymorphisms, a T->C transition in the third intron (designated GH4.1) and an A->C transversion in the fifth exon (designated GH6.2), were shown to be associat...

  6. Escala de Estresores Académicos para la evaluación de los estresores académicos en estudiantes universitarios

    Ramón G. Cabanach

    2016-07-01

    Full Text Available Este estudio tiene por objeto la evaluación de los estresores en el entorno académico. Los instrumentos empleados con este objetivo no siempre están adecuadamente adaptados al contexto universitario o son lo suficientemente exhaustivos como para englobar el elevado número de fuentes generadoras de estrés académico. El presente estudio utiliza una muestra de 1.196 estudiantes universitarios de diferentes titulaciones para describir y analizar la fiabilidad y validez de la Escala de Estresores Académicos, que forma parte del Cuestionario de Estrés Académico. Los resultados mostraron una escala compuesta por 54 ítems y 8 factores, que explican un 66% de la varianza, y que se mostró fiable tanto para el total de la escala ( = 0,96 como para cada uno de los factores, oscilando entre 0,81 y 0,94. Los factores identificados fueron deficiencias metodológicas del profesorado, sobrecarga académica, creencias sobre el rendimiento, intervenciones en público, clima social negativo, exámenes, carencia de valor de los contenidos y dificultades de participación.

  7. Competencias profesionales de los académicos en la educación superior

    Guillermo Yáber Oltra; Carmen Alfonzo

    2011-01-01

    El desarrollo profesional de los profesores y los líderes universitarios es un proceso continuo en la educación superior. Docencia, investigación, servicio, desarrollo personal y gestión son las competencias profesionales que un académico puede desarrollar durante su carrera. Se desarrolló un instrumento de auto-reporte que permite analizar la discrepancia entre la maestría que el personal académico y directivo aprecia de sus competencias académicas, personales y de gestión así como la import...

  8. Ansiedad, personalidad y rendimiento académico en alumnado de Educación primaria

    Domblas García, Andrés

    2016-01-01

    La investigación que se presenta en esta tesis doctoral es un estudio descriptivo y correlacional situado en el ámbito escolar. En primer lugar, se lleva a cabo un análisis minucioso de cada una de las variables objeto de estudio: la ansiedad, la personalidad y el rendimiento académico. En segundo lugar, se analizan las interacciones entre las variables estudiadas: ansiedad y personalidad, ansiedad y rendimiento académico, personalidad y rendimiento académico. En tercer luga...

  9. La evaluación de la alfabetización académica

    Guzmán-Simón, Fernando; García-Jiménez, Eduardo

    2015-01-01

    La alfabetización académica se ha convertido en uno de los objetivos de la Educación Superior, donde la escritura se transforma en una herramienta de aprendizaje. El Marco Español de Cualificaciones para la Educación Superior (MECES) gradúa los resultados de aprendizaje esperados en los estudiantes universitarios en relación a la alfabetización académica en los títulos oficiales de Grado, Máster y Doctorado. La evaluación de la alfabetización académica se plantea como una comunidad de discurs...

  10. La escritura académica : 30 errores habituales y cómo abordarlos

    Bassi Follari, Javier Ernesto

    2016-01-01

    En este trabajo discuto 30 errores habituales en la escritura académica, presentes en textos de estudiantes, tesistas y algunos/as académicos/as. A nivel teórico, distingo entre una escritura conscientemente refractaria a las normas lingüísticas, que opera como una declaración política, y otra simplemente errónea, que expresa desconocimiento de tales normas. Observo que dicho desconocimiento es esperable dada la virtual ausencia de la escritura académica en la formación universitaria regular....

  11. Actividades extraescolares y rendimiento académico: diferencias en autoncocepto y género

    Sánchez Delgado, María Purificación; Carmona Rodríguez, Carmen; Bakieva, Margarita

    2011-01-01

    El propósito de este estudio fue examinar la relación entre tipo de autoconcepto (académico y general) y realización de actividades extraescolares en el rendimiento académico en alumnos de Educación Primaria (N = 1708), así como determinar las diferencias de esta relación en cuanto al género. Se utilizó un sistema de muestreo por conglomerados y estratificado en dos etapas, administrando pruebas estandarizadas de rendimiento y un instrumento diseñado ad-hoc para autoconcepto académico, genera...

  12. Actividades extraescolares y rendimiento académico: diferencias en autoconcepto y género

    Carmona Rodríguez, Carmen; Sánchez Delgado, María Purificación; Bakieva, Margarita

    2011-01-01

    El propósito de este estudio fue examinar la relación entre tipo de autoconcepto (académico y general) y realización de actividades extraescolares en el rendimiento académico en alumnos de Educación Primaria (N = 1708), así como determinar las diferencias de esta relación en cuanto al género. Se utilizó un sistema de muestreo por conglomerados y estratificado en dos etapas, administrando pruebas estandarizadas de rendimiento y un instrumento diseñado ad-hoc para autoconcepto académico, genera...

  13. Inteligencia Emocional y rendimiento académico: análisis de variables mediadoras

    Alonso Tamayo, Leticia

    2015-01-01

    [ES]Este trabajo se centra en la Inteligencia Emocional y su relación con el Rendimiento Académico en adolescentes. Sabemos que la Inteligencia Emocional guarda relación con unas adecuadas relaciones personales, bienestar psicológico y menores conductas disruptivas y de riesgo; sin embargo dentro del rendimiento académico quedan algunas cuestiones por resolver, ¿La IE está directamente relacionada con el rendimiento? o el hecho de que en el rendimiento académico sea un resultado complejo en e...

  14. Capacidad predictiva de la autoeficacia académica sobre las dimensiones del autoconcepto en una muestra de adolescentes chilenos

    García-Fernández, J.M.; Díaz-Herrero, A. (Ángela); Inglés, C.J. (Cándido J.); Torregrosa, M.S. (María Soledad); Lagos-San-Martín, N. (Nelly); Gonzálvez, C. (Carolina)

    2016-01-01

    El objetivo de este estudio fue analizar la capacidad predictiva de la autoefi cacia académica sobre las dimensiones del autoconcepto en una muestra de 860 estudiantes chilenos. El análisis de regresión logística reveló que la autoefi cacia académica fue un predictor positivo y signifi cativo de las escalas académicas (Matemáticas, Verbal y Académica General), no académicas (Habilidades Físicas, Apariencia Física, Relaciones con el Sexo Opuesto, Relaciones con el Mi...

  15. Diurnal Expression Pattern, Allelic Variation, and Association Analysis Reveal Functional Features of the E1 Gene in Control of Photoperiodic Flowering in Soybean

    Wu, Hongyan; Zhang, Yupeng; Zhang, Xingzheng; Yang, Jiayin; Wang, Yaying; Yang, Guang; Qiu, Hongmei; Cui, Tingting; Xia, Zhengjun

    2015-01-01

    Although four maturity genes, E1 to E4, in soybean have been successfully cloned, their functional mechanisms and the regulatory network of photoperiodic flowering remain to be elucidated. In this study, we investigated how the diurnal expression pattern of the E1 gene is related to photoperiodic length; and to what extent allelic variation in the B3-like domain of the E1 gene is associated with flowering time phenotype. The bimodal expression of the E1 gene peaked first at around 2 hours after dawn in long-day condition. The basal expression level of E1 was enhanced by the long light phase, and decreased by duration of dark. We identified a 5bp (3 SNP and 2-bp deletion) mutation, referred to an e1-b3a, which occurs in the middle of B3 domain of the E1 gene in the early flowering cultivar Yanhuang 3. Subcellular localization analysis showed that the putative truncated e1-b3a protein was predominately distributed in nuclei, indicating the distribution pattern of e1-b3a was similar to that of E1, but not to that of e1-as. Furthermore, genetic analysis demonstrated allelic variations at the E1 locus significantly underlay flowering time in three F2 populations. Taken together, we can conclude the legume specific E1 gene confers some special features in photoperiodic control of flowering in soybean. Further characterization of the E1 gene will extend our understanding of the soybean flowering pathway in soybean. PMID:26275311

  16. Common variation in the SERPING1 gene is not associated with age-related macular degeneration in two independent groups of subjects

    Park, Kyu Hyung; Ryu, Euijung; Tosakulwong, Nirubol; Wu, Yanhong; Edwards, Albert O.

    2009-01-01

    Purpose Common genetic variation in the complement component 1 inhibitor gene ( SERPING1 ) was recently reported to increase the risk of developing age-related macular degeneration (AMD). This study was performed to replicate the association between SERPING1 and AMD. Methods Seven single nucleotide polymorphisms (SNPs) tagging common haplotypes across SERPING1 were genotyped on 786 (The Mayo Clinic) subjects and the association with AMD studied using single SNP and haplotype association analy...

  17. Exon Dosage Variations in Brazilian Patients with Parkinson’s Disease: Analysis of SNCA, PARKIN, PINK1 and DJ-1 Genes

    Karla Cristina Vasconcelos Moura; Mário Campos Junior; Ana Lúcia Zuma de Rosso; Denise Hack Nicaretta; João Santos Pereira; Delson José Silva; Cíntia Barros Santos-Rebouças; Márcia Mattos Gonçalves Pimentel

    2012-01-01

    Parkinson’s disease is one of the most common neurodegenerative disorders associated with aging, reaching ∼ 2% of individuals over 65 years. Knowledge achieved in the last decade about the genetic basis of Parkinson’s disease clearly shows that genetic factors play an important role in the etiology of this disorder. Exon dosage variations account for a high proportion of Parkinson’s disease mutations, mainly for PARKIN gene. In the present study, we screened genomic rearrangements in SNCA, PA...

  18. Dynamic DNA cytosine methylation in the Populus trichocarpa genome: tissue-level variation and relationship to gene expression

    Vining Kelly J

    2012-01-01

    Full Text Available Abstract Background DNA cytosine methylation is an epigenetic modification that has been implicated in many biological processes. However, large-scale epigenomic studies have been applied to very few plant species, and variability in methylation among specialized tissues and its relationship to gene expression is poorly understood. Results We surveyed DNA methylation from seven distinct tissue types (vegetative bud, male inflorescence [catkin], female catkin, leaf, root, xylem, phloem in the reference tree species black cottonwood (Populus trichocarpa. Using 5-methyl-cytosine DNA immunoprecipitation followed by Illumina sequencing (MeDIP-seq, we mapped a total of 129,360,151 36- or 32-mer reads to the P. trichocarpa reference genome. We validated MeDIP-seq results by bisulfite sequencing, and compared methylation and gene expression using published microarray data. Qualitative DNA methylation differences among tissues were obvious on a chromosome scale. Methylated genes had lower expression than unmethylated genes, but genes with methylation in transcribed regions ("gene body methylation" had even lower expression than genes with promoter methylation. Promoter methylation was more frequent than gene body methylation in all tissues except male catkins. Male catkins differed in demethylation of particular transposable element categories, in level of gene body methylation, and in expression range of genes with methylated transcribed regions. Tissue-specific gene expression patterns were correlated with both gene body and promoter methylation. Conclusions We found striking differences among tissues in methylation, which were apparent at the chromosomal scale and when genes and transposable elements were examined. In contrast to other studies in plants, gene body methylation had a more repressive effect on transcription than promoter methylation.

  19. Gibberellin-Regulation and Genetic Variations in Leaf Elongation for Tall Fescue in Association with Differential Gene Expression Controlling Cell Expansion.

    Xu, Qian; Krishnan, Sanalkumar; Merewitz, Emily; Xu, Jichen; Huang, Bingru

    2016-01-01

    Leaf elongation rate (LER) is an important factor controlling plant growth and productivity. The objective of this study was to determine whether genetic variation in LER for a fast-growing ('K-31'), and a dwarf cultivar ('Bonsai') of tall fescue (Festuca arundinacea) and gibberellic acid (GA) regulation of LER were associated with differential expression of cell-expansion genes. Plants were treated with GA3, trinexapac-ethyl (TE) (GA inhibitor), or water (untreated control) in a hydroponic system. LER of 'K-31' was 63% greater than that of 'Bonsai', which corresponded with 32% higher endogenous GA4 content in leaf and greater cell elongation and production rates under the untreated control condition. Exogenous application of GA3 significantly enhanced LER while TE treatment inhibited leaf elongation due to GA3-stimulation or TE-inhibition of cell elongation and production rate in leaves for both cultivars. Real-time quantitative polymerase chain reaction analysis revealed that three α-expansins, one β-expansin, and three xyloglucan endotransglycosylase (XET) genes were associated with GA-stimulation of leaf elongation, of which, the differential expression of EXPA4 and EXPA7 was related to the genotypic variation in LER of two cultivars. Those differentially-expressed expansin and XET genes could play major roles in genetic variation and GA-regulated leaf elongation in tall fescue. PMID:27457585

  20. Variations in the coding and regulatory sequences of the angiogenin (ANG) gene are not associated to ALS (amyotrophic lateral sclerosis) in the Italian population.

    Corrado, Lucia; Battistini, Stefania; Penco, Silvana; Bergamaschi, Laura; Testa, Lucia; Ricci, Claudia; Giannini, Fabio; Greco, Giuseppe; Patrosso, Maria Cristina; Pileggi, Simona; Causarano, Renzo; Mazzini, Letizia; Momigliano-Richiardi, Patricia; D'Alfonso, Sandra

    2007-07-15

    Potentially causative missense variations in the ANG gene and a positive association with the synonymous rs11701-G substitution was detected mainly in Irish and Scottish ALS patients. We screened 262 Italian SOD1 negative ALS patients (250 sporadic) and 415 matched controls for sequence variations in the coding, 3'/5' UTR and 5' flanking (642 bp) regions of the ANG gene. We identified 53 sequence variations of which 46 new, 20 with a minor allele frequency (MAF) >or=0.01 and only three localised in the coding sequence, namely the missense I46V, identified in one patient and two controls, and the synonymous G86G and T97T corresponding to rs11701 and rs2228653. None of the detected SNPs or of their haplotypic combinations was significantly associated with ALS susceptibility or clinical features. In conclusion, we did not detect the association with rs11701-G or with any other newly detected variation in the ANG regulatory region. Furthermore we did not identify potentially causal mutations in the coding region. PMID:17462671

  1. Variation in the ovine hormone-sensitive lipase gene (HSL) and its association with growth and carcass traits in New Zealand Suffolk sheep.

    Yang, Guo; Forrest, Rachel; Zhou, Huitong; Hickford, Jonathan

    2014-01-01

    The hormone-sensitive lipase (HSL) plays an important role in the regulation of lipolysis in adipose tissues, by catalysing a rate-limiting step in triglyceride hydrolysis. Variation within the human HSL gene (HSL) has been associated with an increased risk of obesity. In this study, variation within three regions (exon 3-4, exon 5-6 and exon 9) of ovine HSL was investigated in 538 Suffolk lambs bred from 13 independent sires using PCR-SSCP. Four sequence variants of intron 5 (designated A-D) and two variants of exon 9 (designated a and b) of ovine HSL were detected. No variation was found in exon 3-4 of the gene. The associations of the variation within ovine HSL with post-weaning growth and carcass traits including eye muscle depth (EMD), eye muscle width (EMW) and fat depth above the eye muscle (FDM) were assessed in 262 of the above 538 lambs using general linear mixed-effects models. In the single variant models, the presence of intron 5 A in a lamb's genotype was associated with reduced EMD (P = 0.036) and EMW (P = 0.018), whereas the presence of intron 5 C was associated with increased EMD (P growth, or between HSL exon 9 variants, post-weaning growth or carcass traits, were found. PMID:24443229

  2. Variation in Stability of Endogenous Reference Genes in Fallopian Tubes and Endometrium from Healthy and Ectopic Pregnant Women

    Justin C. Konje

    2012-03-01

    Full Text Available RT-qPCR is commonly employed in gene expression studies in ectopic pregnancy. Most use RN18S1, β-actin or GAPDH as internal controls without validation of their suitability as reference genes. A systematic study of the suitability of endogenous reference genes for gene expression studies in ectopic pregnancy is lacking. The aims of this study were therefore to evaluate the stability of 12 reference genes and suggest those that are stable for use as internal control genes in fallopian tubes and endometrium from ectopic pregnancy and healthy non-pregnant controls. Analysis of the results showed that the genes consistently ranked in the top six by geNorm and NormFinder algorithms, were UBC, GAPDH, CYC1 and EIF4A2 (fallopian tubes and UBC and ATP5B (endometrium. mRNA expression of NAPE-PLD as a test gene of interest varied between the groups depending on which of the 12 reference genes was used as internal controls. This study demonstrates that arbitrary selection of reference genes for normalisation in RT-qPCR studies in ectopic pregnancy without validation, risk producing inaccurate data and should therefore be discouraged.

  3. Variation of chemosensory receptor content of Campylobacter jejuni strains and modulation of receptor gene expression under different in vivo and in vitro growth conditions

    Day Christopher J

    2012-06-01

    Full Text Available Abstract Background Chemotaxis is crucial for the colonisation/infection of hosts with Campylobacter jejuni. Central to chemotaxis are the group A chemotaxis genes that are responsible for sensing the external environment. The distribution of group A chemoreceptor genes, as found in the C. jejuni sequenced strains, tlp1-4, 7, 10 and 11 were determined in 33 clinical human and avian isolates. Results Group A tlp gene content varied among the strains with genes encoding tlp1 (aspartate receptor, ccaA and tlp7 present in all strains tested, where as tlp11 was present in only one of our international collection clinical isolates, C. jejuni 520, but was more prevalent (9/13 in the freshly isolated clinical stains from patients who required hospitalisation due to C. jejuni infection (GCH1-17. Relative expression levels of the group A tlp genes were also determined in C. jejuni reference strains NCTC 11168-GS, 11168-O and 81116 using cells grown in vitro at 37°C, 42°C and maintained at room temperature and with cells isolated directly from murine and avian hosts by immune magnetic separation without subsequent culture. Gene expression of tlp genes was varied based on strain, growth conditions and in vivo isolation source. Tlp1, although the most conserved, showed the lowest and most varied mRNA expression and protein production under laboratory conditions. Tlp7 was highly expressed at most conditions tested, and gene expression was not influenced by the tlp7 gene encoding a full length protein or one expressed as separate periplasmic and cytoplasmic domains. Conclusion We have shown that chemosensory receptor set variation exists among C. jejuni strains, but is not dependent on the isolation source.

  4. Design of a Comprehensive Biochemistry and Molecular Biology Experiment: Phase Variation Caused by Recombinational Regulation of Bacterial Gene Expression

    Sheng, Xiumei; Xu, Shungao; Lu, Renyun; Isaac, Dadzie; Zhang, Xueyi; Zhang, Haifang; Wang, Huifang; Qiao, Zheng; Huang, Xinxiang

    2014-01-01

    Scientific experiments are indispensable parts of Biochemistry and Molecular Biology. In this study, a comprehensive Biochemistry and Molecular Biology experiment about "Salmonella enterica" serovar Typhi Flagellar phase variation has been designed. It consisted of three parts, namely, inducement of bacterial Flagellar phase variation,…

  5. currículo académico

    Róger Martínez Castillo

    2006-01-01

    Full Text Available El sistema de desarrollo socio-económico dominante, con sus políticas neoliberales y enfoques mercado-céntricos contribuyen a agravar los problemas socio-ambientales. No hay conciencia política de que el propio modelo de desarrollo vigente es el que genera la degradación socio-ambiental. Este tipo de temas no ha sido fácilmente comprendido o aceptado en el ámbito educativo formal, debido a la resistencia de la educación oficial para integrarlos en sus marcos académicos. Ante la crisis socio-económica y ambiental que vive nuestra sociedad, la educación ambiental representa una opción viable a la problemática general, para promover cambios sociales, nuevos conocimientos, permitir la participación ciudadana y un desarrollo sustentable, que estimulen una sociedad más justa, democrática y solidaria.

  6. entorno virtual de red académica

    CLAUDIA JIMÉNEZ

    2007-01-01

    Full Text Available Este trabajo presenta un modelo conceptual para el armado de cursos flexibles, donde al estudiante se le permite realizar diferentes actividades para cumplir con los objetivos educativos de los mismos. El caso de estudio es la plataforma virtual de la red académica FORHUM (acrónimo de FORmación HUMana. Dicha plataforma fue concebida para facilitar el intercambio de conocimiento y la colaboración entre los miembros de una red de instituciones de Perú, Ecuador, Bolivia y Colombia que trabajan en temáticas del Hábitat. El modelo propuesto surgió de la evaluación del diseño de la central de ensamblaje de cursos en la plataforma virtual, en su primera versión, y del estudio de este proceso en otros entornos virtuales para la educación. El modelo de ensamblaje de cursos, aquí propuesto, permite la personalización de los mismos según diferentes estilos de aprendizaje, transferir el control del aprendizaje al estudiante y facilita la reutilización de objetos de aprendizaje creados por otros miembros de la red.

  7. Geographical variation in the presence of genes encoding superantigenic exotoxins and beta-hemolysin among Staphylococcus aureus isolated from bovine mastitis in Europe and USA

    Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.

    2002-01-01

    The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined for the...... individual exotoxins. The genes encoding enterotoxin C, TSST-1, and enterotoxin D were the most common superantigens. The present and earlier studies demonstrate that the superantigenic exotoxins that were investigated in this study, do not play a role in the pathogenesis of bovine S. aureus mastitis. In...... regions in the beta-hemolysin encoding gene of the Norwegian isolates is suggested, and should be investigated further. The consistent presence of beta-hemolysin suggests that this factor, or a co-existing gene correlated to beta-hemolysin, may be an active virulence factor in the pathogenesis of bovine S...

  8. Expression conservation within the circadian clock of a monocot: natural variation at barley Ppd-H1 affects circadian expression of flowering time genes, but not clock orthologs

    Campoli Chiara

    2012-06-01

    Full Text Available Abstract Background The circadian clock is an endogenous mechanism that coordinates biological processes with daily changes in the environment. In plants, circadian rhythms contribute to both agricultural productivity and evolutionary fitness. In barley, the photoperiod response regulator and flowering-time gene Ppd-H1 is orthologous to the Arabidopsis core-clock gene PRR7. However, relatively little is known about the role of Ppd-H1 and other components of the circadian clock in temperate crop species. In this study, we identified barley clock orthologs and tested the effects of natural genetic variation at Ppd-H1 on diurnal and circadian expression of clock and output genes from the photoperiod-response pathway. Results Barley clock orthologs HvCCA1, HvGI, HvPRR1, HvPRR37 (Ppd-H1, HvPRR73, HvPRR59 and HvPRR95 showed a high level of sequence similarity and conservation of diurnal and circadian expression patterns, when compared to Arabidopsis. The natural mutation at Ppd-H1 did not affect diurnal or circadian cycling of barley clock genes. However, the Ppd-H1 mutant was found to be arrhythmic under free-running conditions for the photoperiod-response genes HvCO1, HvCO2, and the MADS-box transcription factor and vernalization responsive gene Vrn-H1. Conclusion We suggest that the described eudicot clock is largely conserved in the monocot barley. However, genetic differentiation within gene families and differences in the function of Ppd-H1 suggest evolutionary modification in the angiosperm clock. Our data indicates that natural variation at Ppd-H1 does not affect the expression level of clock genes, but controls photoperiodic output genes. Circadian control of Vrn-H1 in barley suggests that this vernalization responsive gene is also controlled by the photoperiod-response pathway. Structural and functional characterization of the barley circadian clock will set the basis for future studies of the adaptive significance of the circadian clock in

  9. Competències argumentatives en l'alfabetització acadèmica

    Constanza Padilla; Silvina Douglas; Esther A. Lopez

    2010-01-01

    Este trabajo se enmarca en las numerosas investigaciones sobre escritura académica que vienen desarrollándose en diversos países. Dentro de ellas, buscamos articular líneas de investigación que se ocupan de la alfabetización académica, de los géneros académicos y del papel de la argumentación en los mismos. Para ello, implementamos desde 2005 un programa de alfabetización académica en una asignatura de Humanidades de una universidad argentina, cuyo tramo final es la elaboración y exposición d...

  10. Competencias argumentativas en la alfabetización académica

    Padilla, Constanza; Douglas, Silvina; Esther A. Lopez

    2010-01-01

    Este trabajo se enmarca en las numerosas investigaciones sobre escritura académica que vienen desarrollándose en diversos países. Dentro de ellas, buscamos articular líneas de investigación que se ocupan de la alfabetización académica, de los géneros académicos y del papel de la argumentación en los mismos. Para ello, implementamos desde 2005 un programa de alfabetización académica en una asignatura de Humanidades de una universidad argentina, cuyo tramo final es la elaboración y exposición d...

  11. Deep sequencing of the viral phoH gene reveals temporal variation, depth-specific composition, and persistent dominance of the same viral phoH genes in the Sargasso Sea

    Goldsmith, Dawn B.; Parsons, Rachel J; Damitu Beyene; Peter Salamon; Mya Breitbart

    2015-01-01

    Deep sequencing of the viral phoH gene, a host-derived auxiliary metabolic gene, was used to track viral diversity throughout the water column at the Bermuda Atlantic Time-series Study (BATS) site in the summer (September) and winter (March) of three years. Viral phoH sequences reveal differences in the viral communities throughout a depth profile and between seasons in the same year. Variation was also detected between the same seasons in subsequent years, though these differences were not a...

  12. Escala de Estresores Académicos para la evaluación de los estresores académicos en estudiantes universitarios

    Cabanach, Ramón G.; Antonio Souto-Gestal; Victoria Franco

    2016-01-01

    Este estudio tiene por objeto la evaluación de los estresores en el entorno académico. Los instrumentos empleados con este objetivo no siempre están adecuadamente adaptados al contexto universitario o son lo suficientemente exhaustivos como para englobar el elevado número de fuentes generadoras de estrés académico. El presente estudio utiliza una muestra de 1.196 estudiantes universitarios de diferentes titulaciones para describir y analizar la fiabilidad y validez de la Escala de Estresores ...

  13. Estrategias metacognitivas, motivación académica y rendimiento académico en alumnos ingresantes a una universidad de Lima metropolitana

    Gaby Thornberry Noriega

    2008-01-01

    Se estudió la relación entre el uso de estrategias metacognitivas, la mo ti vación aca démica y el rendimiento académico en estudiantes universitarios. La muestra estuvo compuesta por 116 alumnos ingresantes al primer ciclo de estudios de una universidad privada en Lima metropolitana. Se elaboró la Escala de Motivación Académica, instrumento de tipo cues tio nario en el que se evalúan las dimensiones motivacionales de auto eficaciaacadémica, atribuciones causales y motivación de logro. Los re...

  14. Variables influyentes en el rendimiento académico de los estudiantes

    Álvaro Muelas; Jesús, A. Beltrán

    2011-01-01

    El objetivo de este estudio fue doble: conocer la influencia de tres variables: inteligencia, estrategias de aprendizaje y personalidad sobre el rendimiento académico, y comprobar el descenso del rendimiento académico de los alumnos cuando pasan de la ESO al Bachillerato. 1.100 estudiantes de la Comunidad de Madrid incidentalmente seleccionados participaron en el estudio. Los resultados muestran que mientras la inteligencia y las estrategias de aprendizaje correlacionan positivamente con el r...

  15. Actitudes, aptitudes y rendimiento académico en matemáticas

    Pérez, Luis Eduardo; Niño, Diana Liceth; Páez, Laura Carolina

    2010-01-01

    El grupo MUSA.IMA1, de la Escuela de Matemáticas de la Universidad Sergio Arboleda decidió trabajar sobre las actitudes, las aptitudes y el rendimiento académico en el marco de la línea de investigación en Meta-Matemáticas. La finalidad es conocer mejor a los estudiantes y su rendimiento académico.

  16. Factores que intervienen en el rendimiento académico universitario: un estudio de caso

    Mora García, Raúl Tomás

    2015-01-01

    Conocer los factores intervinientes en el rendimiento académico de los estudiantes es de vital importancia para mejorar el proceso de enseñanza-aprendizaje y la calidad universitaria. Esta investigación busca identificar los posibles factores que intervienen en el rendimiento académico de los estudiantes universitarios del grado en Arquitectura Técnica de la Universidad de Alicante. El estudio pretende determinar el poder explicativo y predictivo de nueve variables para pronosticar el rendimi...

  17. Determination of cis/trans phase of variations in the MC1R gene with allele-specific PCR and single base extension

    Mengel-From, Jonas; Børsting, Claus; Sanchez, Juan J;

    2008-01-01

    The MC1R gene encodes a protein with key regulatory functions in the melanin synthesis. A multiplex PCR and a multiplex single base extension protocol were established for genotyping six exonic MC1R variations highly penetrant for red hair (R), four exonic MC1R variations weakly penetrant for red...... hair (r), two frameshift variations highly penetrant for red hair (R) and three variations in the promoter region. We genotyped 600 individuals from Denmark using either CE or MALDI-TOF MS as the detection platform. A total of 62 individuals were genotyped R/R and among the 62 individuals, 57 had red...... hair and five had blond hair colour. Two different R alleles may be located in cis (RR/-) position or trans (R/R) position, and the phenotype associated with RR/- and R/R may be different. Two allele-specific PCRs were established with primers targeting the -G445A variation in the MC1R promoter and the...

  18. Bovine Host Genetic Variation Influences Rumen Microbial Methane Production with Best Selection Criterion for Low Methane Emitting and Efficiently Feed Converting Hosts Based on Metagenomic Gene Abundance.

    Rainer Roehe

    2016-02-01

    Full Text Available Methane produced by methanogenic archaea in ruminants contributes significantly to anthropogenic greenhouse gas emissions. The host genetic link controlling microbial methane production is unknown and appropriate genetic selection strategies are not developed. We used sire progeny group differences to estimate the host genetic influence on rumen microbial methane production in a factorial experiment consisting of crossbred breed types and diets. Rumen metagenomic profiling was undertaken to investigate links between microbial genes and methane emissions or feed conversion efficiency. Sire progeny groups differed significantly in their methane emissions measured in respiration chambers. Ranking of the sire progeny groups based on methane emissions or relative archaeal abundance was consistent overall and within diet, suggesting that archaeal abundance in ruminal digesta is under host genetic control and can be used to genetically select animals without measuring methane directly. In the metagenomic analysis of rumen contents, we identified 3970 microbial genes of which 20 and 49 genes were significantly associated with methane emissions and feed conversion efficiency respectively. These explained 81% and 86% of the respective variation and were clustered in distinct functional gene networks. Methanogenesis genes (e.g. mcrA and fmdB were associated with methane emissions, whilst host-microbiome cross talk genes (e.g. TSTA3 and FucI were associated with feed conversion efficiency. These results strengthen the idea that the host animal controls its own microbiota to a significant extent and open up the implementation of effective breeding strategies using rumen microbial gene abundance as a predictor for difficult-to-measure traits on a large number of hosts. Generally, the results provide a proof of principle to use the relative abundance of microbial genes in the gastrointestinal tract of different species to predict their influence on traits e

  19. Bovine Host Genetic Variation Influences Rumen Microbial Methane Production with Best Selection Criterion for Low Methane Emitting and Efficiently Feed Converting Hosts Based on Metagenomic Gene Abundance.

    Roehe, Rainer; Dewhurst, Richard J; Duthie, Carol-Anne; Rooke, John A; McKain, Nest; Ross, Dave W; Hyslop, Jimmy J; Waterhouse, Anthony; Freeman, Tom C; Watson, Mick; Wallace, R John

    2016-02-01

    Methane produced by methanogenic archaea in ruminants contributes significantly to anthropogenic greenhouse gas emissions. The host genetic link controlling microbial methane production is unknown and appropriate genetic selection strategies are not developed. We used sire progeny group differences to estimate the host genetic influence on rumen microbial methane production in a factorial experiment consisting of crossbred breed types and diets. Rumen metagenomic profiling was undertaken to investigate links between microbial genes and methane emissions or feed conversion efficiency. Sire progeny groups differed significantly in their methane emissions measured in respiration chambers. Ranking of the sire progeny groups based on methane emissions or relative archaeal abundance was consistent overall and within diet, suggesting that archaeal abundance in ruminal digesta is under host genetic control and can be used to genetically select animals without measuring methane directly. In the metagenomic analysis of rumen contents, we identified 3970 microbial genes of which 20 and 49 genes were significantly associated with methane emissions and feed conversion efficiency respectively. These explained 81% and 86% of the respective variation and were clustered in distinct functional gene networks. Methanogenesis genes (e.g. mcrA and fmdB) were associated with methane emissions, whilst host-microbiome cross talk genes (e.g. TSTA3 and FucI) were associated with feed conversion efficiency. These results strengthen the idea that the host animal controls its own microbiota to a significant extent and open up the implementation of effective breeding strategies using rumen microbial gene abundance as a predictor for difficult-to-measure traits on a large number of hosts. Generally, the results provide a proof of principle to use the relative abundance of microbial genes in the gastrointestinal tract of different species to predict their influence on traits e.g. human metabolism

  20. Variation in bleomycin hydrolase gene is associated with reduced survival after chemotherapy for testicular germ cell cancer

    de Haas, Esther C; Zwart, Nynke; Meijer, Coby; Nuver, Janine; Suurmeijer, Albert J H; Hoekstra, Harald J; van der Steege, Gerrit; Sleijfer, Dirk Th; Gietema, Jourik A; Boezen, Hendrika

    2008-01-01

    PURPOSE: Response to chemotherapy may be determined by gene polymorphisms involved in metabolism of cytotoxic drugs. A plausible candidate is the gene for bleomycin hydrolase (BLMH), an enzyme that inactivates bleomycin, an essential component of chemotherapy regimens for disseminated testicular ger

  1. A nine-nucleotide deletion and splice variation in the coding region of the interferon induced ISG12 gene

    Smidt, Kamille; Hansen, Lise Lotte; Søgaard, T Max M;

    2003-01-01

    Interferons (IFNs) are a family of cytokines with growth inhibitory, and antiviral functions. IFNs exert their biological actions through the expression of more than 1000 IFN stimulated genes, ISGs. ISG12 is an IFN type I induced gene encoding a protein of Mr 12,000. We have identified a novel, IFN...

  2. Combined epigenetic and intraspecific variation of the DRD4 and SERT genes influence novelty seeking behavior in great tit Parus major.

    Riyahi, Sepand; Sánchez-Delgado, Marta; Calafell, Francesc; Monk, David; Senar, Juan Carlos

    2015-01-01

    DNA methylation is one of the main epigenetic mechanisms that can regulate gene expression and is an important means for creating phenotypic variation. In the present study, we performed methylation profiling of 2 candidate genes for personality traits, namely DRD4 and SERT, in the great tit Parus major to ascertain whether personality traits and behavior within different habitats have evolved with the aid of epigenetic variation. We applied bisulphite PCR and strand-specific sequencing to determine the methylation profile of the CpG dinucleotides in the DRD4 and SERT promoters and also in the CpG island overlapping DRD4 exon 3. Furthermore, we performed pyrosequencing to quantify the total methylation levels at each CpG location. Our results indicated that methylation was ∼1-4% higher in urban than in forest birds, for all loci and tissues analyzed, suggesting that this epigenetic modification is influenced by environmental conditions. Screening of genomic DNA sequence revealed that the SERT promoter is CpG poor region. The methylation at a single CpG dinucleotide located 288 bp from the transcription start site was related to exploration score in urban birds. In addition, the genotypes of the SERT polymorphism SNP234 located within the minimal promoter were significantly correlated with novelty seeking behavior in captivity, with the allele increasing this behavior being more frequent in urban birds. As a conclusion, it seems that both genetic and methylation variability of the SERT gene have an important role in shaping personality traits in great tits, whereas genetic and methylation variation at the DRD4 gene is not strongly involved in behavior and personality traits. PMID:25933062

  3. Natural variation in expression of genes associated with biosynthesis and accumulation in cassava (Manihot esculenta Crantz) storage root

    Several groups have reported on massive accumulation of total carotenoids in cassava storage root (CSR). Naturally occurring color variation associated with carotenoid accumulation was observed in cassava (Manihot esculenta Crantz) storage root of landraces from Amazon. Here carotenoid profiles from...

  4. Clinical and molecular spectra in galactosemic patients from neonatal screening in northeastern Italy: structural and functional characterization of new variations in the galactose-1-phosphate uridyltransferase (GALT) gene.

    Viggiano, E; Marabotti, A; Burlina, A P; Cazzorla, C; D'Apice, M R; Giordano, L; Fasan, I; Novelli, G; Facchiano, A; Burlina, A B

    2015-04-01

    Classical galactosemia is an autosomal recessive inborn error of metabolism due to mutations of the GALT gene leading to toxic accumulation of galactose and derived metabolites. With the benefit of early diagnosis by neonatal screening and early therapy, the acute presentation of classical galactosemia can be prevented. However, despite early diagnosis and treatment, the long term outcome for these patients is still unpredictable because they may go on to develop cognitive disability, speech problems, neurological and/or movement disorders and, in females, ovarian dysfunction. The objectives of the current study were to report our experience with a group of galactosemic patients identified through the neonatal screening programs in northeastern Italy during the last 30years. No neonatal deaths due to galactosemia complications occurred after the introduction of the neonatal screening program. However, despite the early diagnosis and dietary treatment, the patients with classical galactosemia showed one or more long-term complications. A total of 18 different variations in the GALT gene were found in the patient cohort: 12 missense, 2 frameshift, 1 nonsense, 1 deletion, 1 silent variation, and 1 intronic. Six (p.R33P, p.G83V, p.P244S, p.L267R, p.L267V, p.E271D) were new variations. The most common variation was p.Q188R (12 alleles, 31.5%), followed by p.K285N (6 alleles, 15.7%) and p.N314D (6 alleles, 15.7%). The other variations comprised 1 or 2 alleles. In the patients carrying a new mutation, the biochemical analysis of GALT activity in erythrocytes showed an activity of galactosemia and underlines the importance of molecular diagnostic testing prior to making any treatment. PMID:25592817

  5. Association between genetic variation in the oxytocin receptor gene and emotional withdrawal, but not between oxytocin pathway genes and diagnosis in psychotic disorders

    2015-01-01

    Social dysfunction is common in patients with psychotic disorders. Oxytocin is a neuropeptide with a central role in social behavior. This study aims to explore the relationship between oxytocin pathway genes and symptoms related to social dysfunction in patients with psychotic disorders. We performed association analyses between four oxytocin pathway genes (OXT, OXTR, AVP, and CD38) and four areas of social behavior-related psychopathology as measured by Positive and Negative Syndrome Scale....

  6. Association between Genetic Variation in the Oxytocin Receptor Gene and Emotional Withdrawal, but not between Oxytocin Pathway Genes and Diagnosis in Psychotic Disorders

    Martin Tesli

    2015-01-01

    Social dysfunction is common in patients with psychotic disorders. Oxytocin is a neuropeptide with a central role in social behavior. This study aims to explore the relationship between oxytocin pathway genes and symptoms related to social dysfunction in patients with psychotic disorders. We performed association analyses between four oxytocin pathway genes (OXT, OXTR, AVP, and CD38) and four areas of social behavior-related psychopathology as measured by Positive and Negative Syndrome Scale....

  7. [Genetic variation and association of prostaglandin F2alpha receptor (PTGFR) gene with sow maternal behaviors in a White Duroc x Erhualian resource population].

    Yang, Zhu-Qing; Ren, Jun; Zhang, Zhi-Yan; Chen, Cong-Ying

    2010-11-01

    Maternal behaviors of sows around parturition are important for survival of newborn offspring. Failure to establish normal maternal bonds such as maternal infanticide and crushing often occurs in some individuals. It causes both significant economic losses to the pig industry and severe problems of piglet welfare. Prostaglandin F2-alpha not only can stimulate the nest-building behavior of sows before parturition but also plays an important role in reproductive process and maternal behavior through protein FP encoded by the prostaglandin F receptor gene (PTGFR) as its receptor. In this study, genetic variation and association study of PTGFR gene with nest-building behavior, maternal infanticide, and crushing behavior was carried out in a White Duroc x Erhualian resource population. As a result, five synonymous mutations were identified on exon 1 and exon 2. Exon 1 g .250 A>G, Exon 1 g.619 G>A and Exon 2 g.483 T>C were chosen for genotyping in individuals of F0, F1 and 289 F2 sows. Family-based transmission disequilibrium test (TDT) demonstrated that there were no significant associations of 3 SNPs and haplotypes of PTGFR gene with sow nest-building, maternal infanticide and crushing behavior (P > 0.05). Therefore, it can be concluded that PTGFR gene is not the causative candidate gene for sow maternal behaviors. PMID:21513166

  8. Multiplex Ligation-Dependent Probe Amplification Analysis of GATA4 Gene Copy Number Variations in Patients with Isolated Congenital Heart Disease

    Valentina Guida

    2010-01-01

    Full Text Available GATA4 mutations are found in patients with different isolated congenital heart defects (CHDs, mostly cardiac septal defects and tetralogy of Fallot. In addition, GATA4 is supposed to be the responsible gene for the CHDs in the chromosomal 8p23 deletion syndrome, which is recognized as a malformation syndrome with clinical symptoms of facial anomalies, microcephaly, mental retardation, and congenital heart defects. Thus far, no study has been carried out to investigate the role of GATA4 copy number variations (CNVs in non-syndromic CHDs. To explore the possible occurrence of GATA4 gene CNVs in isolated CHDs, we analyzed by multiplex ligation-dependent probe amplification (MLPA a cohort of 161 non-syndromic patients with cardiac anomalies previously associated with GATA4 gene mutations. The patients were mutation-negative for GATA4, NKX2.5, and FOG2 genes after screening with denaturing high performance liquid chromatography. MLPA analysis revealed that normalized MLPA signals were all found within the normal range values for all exons in all patients, excluding a major contribution of GATA4 gene CNVs in CHD pathogenesis.

  9. Variation in WNT genes is associated with non-syndromic cleft lip with or without cleft palate.

    Chiquet, Brett T; Blanton, Susan H; Burt, Amber; Ma, Deqiong; Stal, Samuel; Mulliken, John B; Hecht, Jacqueline T

    2008-07-15

    Non-syndromic cleft lip with or without cleft palate (NSCLP) is a common birth defect. Genetic and environmental factors have been causally implicated and studies have begun to delineate genetic contributions. The Wnt genes are involved in regulating mid-face development and upper lip fusion and are therefore strong candidates for an etiological role in NSCLP. Furthermore, the clf1 region in A/WyN clefting susceptible mice contains the Wnt3 and Wnt9B genes. To assess the role of the Wnt family of genes in NSCLP, we interrogated seven Wnt genes (Wnt3, Wnt3A, Wnt5A, Wnt7A, Wnt8A, Wnt9B and Wnt11) in our well-defined NSCLP dataset. Thirty-eight single nucleotide polymorphisms were genotyped in 132 multiplex NSCLP families and 354 simplex parent-child trios. In the entire dataset, single-nucleotide polymorphisms (SNPs) in three genes, Wnt3A (P = 0.006), Wnt 5A (P = 0.002) and Wnt11 (P = 0.0001) were significantly associated with NSCLP after correction for multiple testing. When stratified by ethnicity, the strongest associations were found for SNPs in Wnt3A (P = 0.0007), Wnt11 (P = 0.0012) and Wnt8A (P = 0.0013). Multiple haplotypes in Wnt genes were associated with NSCLP, and gene-gene interactions were observed between Wnt3A and both Wnt3 and Wnt5A (P = 0.004 and P = 0.039, respectively). This data suggests that alteration in Wnt gene function may perturb formation and/or fusion of the facial processes and predispose to NSCLP. PMID:18413325

  10. Genetic variation in the Cytb gene of human cerebral Taenia solium cysticerci recovered from clinically and radiologically heterogeneous patients with neurocysticercosis

    Hector Palafox-Fonseca

    2013-11-01

    Full Text Available Neurocysticercosis (NC is a clinically and radiologically heterogeneous parasitic disease caused by the establishment of larval Taenia solium in the human central nervous system. Host and/or parasite variations may be related to this observed heterogeneity. Genetic differences between pig and human-derived T. solium cysticerci have been reported previously. In this study, 28 cysticerci were surgically removed from 12 human NC patients, the mitochondrial gene that encodes cytochrome b was amplified from the cysticerci and genetic variations that may be related to NC heterogeneity were characterised. Nine different haplotypes (Ht, which were clustered in four haplogroups (Hg, were identified. Hg 3 and 4 exhibited a tendency to associate with age and gender, respectively. However, no significant associations were found between NC heterogeneity and the different T. solium cysticerci Ht or Hg. Parasite variants obtained from patients with similar NC clinical or radiological features were genetically closer than those found in groups of patients with a different NC profile when using the Mantel test. Overall, this study establishes the presence of genetic differences in the Cytb gene of T. solium isolated from human cysticerci and suggests that parasite variation could contribute to NC heterogeneity.

  11. Sequence variation in the melanocortin-1 receptor (MC1R pigmentation gene and its role in the cryptic coloration of two South American sand lizards

    Josmael Corso

    2012-01-01

    Full Text Available In reptiles, dorsal body darkness often varies with substrate color or temperature environment, and is generally presumed to be an adaptation for crypsis or thermoregulation. However, the genetic basis of pigmentation is poorly known in this group. In this study we analyzed the coding region of the melanocortin-1-receptor (MC1R gene, and therefore its role underlying the dorsal color variation in two sympatric species of sand lizards (Liolaemus that inhabit the southeastern coast of South America: L. occipitalis and L. arambarensis. The first is light-colored and occupies aeolic pale sand dunes, while the second is brownish and lives in a darker sandy habitat. We sequenced 630 base pairs of MC1R in both species. In total, 12 nucleotide polymorphisms were observed, and four amino acid replacement sites, but none of them could be associated with a color pattern. Comparative analysis indicated that these taxa are monomorphic for amino acid sites that were previously identified as functionally important in other reptiles. Thus, our results indicate that MC1R is not involved in the pigmentation pattern observed in Liolaemus lizards. Therefore, structural differences in other genes, such as ASIP, or variation in regulatory regions of MC1R may be responsible for this variation. Alternatively, the phenotypic differences observed might be a consequence of non-genetic factors, such as thermoregulatory mechanisms.

  12. Association between variations in the fat mass and obesity-associated gene and pancreatic cancer risk: a case–control study in Japan

    It is clear that genetic variations in the fat mass and obesity-associated (FTO) gene affect body mass index and the risk of obesity. Given the mounting evidence showing a positive association between obesity and pancreatic cancer, this study aimed to investigate the relation between variants in the FTO gene, obesity and pancreatic cancer risk. We conducted a hospital-based case–control study in Japan to investigate whether genetic variations in the FTO gene were associated with pancreatic cancer risk. We genotyped rs9939609 in the FTO gene of 360 cases and 400 control subjects. An unconditional logistic model was used to estimate the odds ratio (OR) and 95% confidence interval (CI) for the association between rs9939609 and pancreatic cancer risk. The minor allele frequency of rs9939609 was 0.18 among control subjects. BMI was not associated with pancreatic cancer risk. Compared with individuals with the common homozygous TT genotype, those with the heterozygous TA genotype and the minor homozygous AA genotype had a 48% (OR=1.48; 95%CI: 1.07–2.04), and 66% increased risk (OR=1.66; 95%CI: 0.70–3.90), respectively, of pancreatic cancer after adjustment for sex, age, body mass index, cigarette smoking and history of diabetes. The per-allele OR was 1.41 (95%CI: 1.07–1.85). There were no significant interactions between TA/AA genotypes and body mass index. Our findings indicate that rs9939609 in the FTO gene is associated with pancreatic cancer risk in Japanese subjects, possibly through a mechanism that is independent of obesity. Further investigation and replication of our results is required in other independent samples

  13. The Effect of Genetic Variation of the Retinoic Acid Receptor-Related Orphan Receptor C Gene on Fatness in Cattle

    Barendse, W.; Bunch, R. J.; Kijas, J. W.; M. B. Thomas

    2007-01-01

    Genotypes at the retinoic acid receptor-related orphan receptor C (RORC) gene were associated with fatness in 1750 cattle. Ten SNPs were genotyped in RORC and the adjacent gene leucine-rich repeat neuronal 6D (LRRN6D) to map the QTL, 7 of which are in a 4.2-kb sequence around the ligand-binding domain of the RORC gene. Of the 29 inferred haplotypes for these SNPs, 2 have a combined frequency of 54.6% while the top 5 haplotypes have a combined frequency of 85.3%. The average D′ value of linkag...

  14. Germline DNA copy number variation in individuals with Argyrophilic grain disease reveals CTNS as a plausible candidate gene.

    Villela, Darine; Kimura, Lilian; Schlesinger, David; Gonçalves, Amanda; Pearson, Peter L; Suemoto, Claudia K; Pasqualucci, Carlos; Krepischi, Ana Cristina; Grinberg, Lea T; Rosenberg, Carla

    2013-12-01

    Argyrophilic grain disease (AGD) is a progressive neurodegenerative disease of the human brain that has never been associated to a particular gene locus. In the present study, we report the results of a CNV investigation in 29 individuals whose anatomopathologic investigation of the brain showed AGD. Rare CNVs were identified in six patients (21%), in particular a 40 kb deletion at 17p13.2 encompassing the CTNS gene. Homozygote mutations in CTNS are known to cause cystinosis, a disorder characterized by the intralysosomal accumulation of cystine in all tissues. We present the first CNV results in individuals presenting AGD and a possible candidate gene implicated in the disorder. PMID:24385851

  15. Germline DNA copy number variation in individuals with Argyrophilic grain disease reveals CTNS as a plausible candidate gene

    Darine Villela

    2013-01-01

    Full Text Available Argyrophilic grain disease (AGD is a progressive neurodegenerative disease of the human brain that has never been associated to a particular gene locus. In the present study, we report the results of a CNV investigation in 29 individuals whose anatomopathologic investigation of the brain showed AGD. Rare CNVs were identified in six patients (21%, in particular a 40 kb deletion at 17p13.2 encompassing the CTNS gene. Homozygote mutations in CTNS are known to cause cystinosis, a disorder characterized by the intralysosomal accumulation of cystine in all tissues. We present the first CNV results in individuals presenting AGD and a possible candidate gene implicated in the disorder.

  16. Variation suggestive of horizontal gene transfer at a lipopolysaccharide (lps biosynthetic locus in Xanthomonas oryzae pv. oryzae, the bacterial leaf blight pathogen of rice

    Sonti Ramesh V

    2004-10-01

    Full Text Available Abstract Background In animal pathogenic bacteria, horizontal gene transfer events (HGT have been frequently observed in genomic regions that encode functions involved in biosynthesis of the outer membrane located lipopolysaccharide (LPS. As a result, different strains of the same pathogen can have substantially different lps biosynthetic gene clusters. Since LPS is highly antigenic, the variation at lps loci is attributed to be of advantage in evading the host immune system. Although LPS has been suggested as a potentiator of plant defense responses, interstrain variation at lps biosynthetic gene clusters has not been reported for any plant pathogenic bacterium. Results We report here the complete sequence of a 12.2 kb virulence locus of Xanthomonas oryzae pv. oryzae (Xoo encoding six genes whose products are homologous to functions involved in LPS biosynthesis and transport. All six open reading frames (ORFs have atypical G+C content and altered codon usage, which are the hallmarks of genomic islands that are acquired by horizontal gene transfer. The lps locus is flanked by highly conserved genes, metB and etfA, respectively encoding cystathionine gamma lyase and electron transport flavoprotein. Interestingly, two different sets of lps genes are present at this locus in the plant pathogens, Xanthomonas campestris pv. campestris (Xcc and Xanthomonas axonopodis pv. citri (Xac. The genomic island is present in a number of Xoo strains from India and other Asian countries but is not present in two strains, one from India (BXO8 and another from Nepal (Nepal624 as well as the closely related rice pathogen, Xanthomonas oryzae pv. oryzicola (Xoor. TAIL-PCR analysis indicates that sequences related to Xac are present at the lps locus in both BXO8 and Nepal624. The Xoor strain has a hybrid lps gene cluster, with sequences at the metB and etfA ends, being most closely related to sequences from Xac and the tomato pathogen, Pseudomonas syringae pv. tomato

  17. Sequence polymorphism of GroEL gene in natural population of Bacillus and Brevibacillus spp. that showed variation in thermal tolerance capacity and mRNA expression.

    Sen, R; Tripathy, S; Padhi, S K; Mohanty, S; Maiti, N K

    2014-10-01

    GroEL, a class I chaperonin, plays an important role in the thermal adaptation of the cell and helps to maintain the viability of the cell under heat shock condition. Function of groEL in vivo depends on the maintenance of proper structure of the protein which in turn depends on the nucleotide and amino acid sequence of the gene. In this study, we investigated the changes in nucleotide and amino acid sequences of the partial groEL gene that may affect the thermotolerance capacity as well as mRNA expression of bacterial isolates. Sequences among the same species having differences in the amino acid level were identified as different alleles. The effect of allelic variation on the groEL gene expression was analyzed by comparison and relative quantification in each allele under thermal shock condition by RT-PCR. Evaluation of K a/K s ratio among the strains of same species showed that the groEL gene of all the species had undergone similar functional constrain during evolution. The strains showing similar thermotolerance capacity was found to carry same allele of groEL gene. The isolates carrying allele having amino acid substitution inside the highly ATP/ADP or Mg(2+)-binding region could not tolerate thermal stress and showed lower expression of the groEL gene. Our results indicate that during evolution of these bacterial species the groEL gene has undergone the process of natural selection, and the isolates have evolved with the groEL allelic sequences that help them to withstand the thermal stress during their interaction with the environment. PMID:24894903

  18. Genetic variation in angiotensin-converting enzyme 2 gene is associated with extent of left ventricular hypertrophy in hypertrophic cardiomyopathy

    van der Merwe, Lize; Cloete, Ruben; Revera, Miriam; Heradien, Marshall; Goosen, Althea; Corfield, Valerie A.; Paul A Brink; Moolman-Smook, Johanna C

    2008-01-01

    Hypertrophic cardiomyopathy, a common, inherited cardiac muscle disease, is primarily caused by mutations in sarcomeric protein-encoding genes and is characterized by overgrowth of ventricular muscle that is highly variable in extent and location. This variability has been partially attributed to locus and allelic heterogeneity of the disease-causing gene, but other factors, including unknown genetic factors, also modulate the extent of hypertrophy that develops in response to the defective s...

  19. A tandem segmental duplication (TSD) in the green revolution gene Rht-D1b region underlies plant height variation

    Semi-dwarfing genes Rht-B1b (Rht1) and Rht-D1b (Rht2), known as the “Green revolution” genes, have made a significant contribution to wheat production worldwide. Rht-D1c (Rht10) carried by Chinese wheat line Aibian 1 is an allele at the Rht-D1 locus. It has the strongest effect among all dwarfing...

  20. Genetic Variation in FADS Genes and Plasma Cholesterol Levels in 2-Year-Old Infants: KOALA Birth Cohort Study

    Moltó-Puigmartí, Carolina; Jansen, Eugène; Heinrich, Joachim; Standl, Marie; Ronald P. Mensink; Plat, Jogchum; Penders, John; Mommers, Monique; Koppelman, Gerard H.; Postma, Dirkje S.; Thijs, Carel

    2013-01-01

    Objective Single nucleotide polymorphisms (SNPs) in genes involved in fatty acid metabolism (FADS1 FADS2 gene cluster) are associated with plasma lipid levels. We aimed to investigate whether these associations are already present early in life and compare the relative contribution of FADS SNPs vs traditional (non-genetic) factors as determinants of plasma lipid levels. Methods Information on infants’ plasma total cholesterol levels, genotypes of five FADS SNPs (rs174545, rs174546, rs174556, ...

  1. Germline DNA copy number variation in individuals with Argyrophilic grain disease reveals CTNS as a plausible candidate gene

    Darine Villela; Lilian Kimura; David Schlesinger; Amanda Gonçalves; Pearson, Peter L; Suemoto, Claudia K.; Carlos Pasqualucci; Ana Cristina Krepischi; Lea T. Grinbergand; Carla Rosenberg

    2013-01-01

    Argyrophilic grain disease (AGD) is a progressive neurodegenerative disease of the human brain that has never been associated to a particular gene locus. In the present study, we report the results of a CNV investigation in 29 individuals whose anatomopathologic investigation of the brain showed AGD. Rare CNVs were identified in six patients (21%), in particular a 40 kb deletion at 17p13.2 encompassing the CTNS gene. Homozygote mutations in CTNS are known to cause cystinosis, a disorder chara...

  2. Comparative genomics of bacteria from the genus Collimonas: linking (dis)similarities in gene content to phenotypic variation and conservation.

    Mela, F; Fritsche, K; de Boer, W; van den Berg, M; van Veen, J A; Maharaj, N N; Leveau, J H J

    2012-08-01

    Collimonas is a genus of soil bacteria comprising three recognized species: C. fungivorans, C. pratensis and C. arenae. Collimonads share the ability to degrade chitin (chitinolysis), feed on living fungal hyphae (mycophagy), and dissolve minerals (weathering), but vary in their inhibition of fungi (fungistasis). To better understand this phenotypic variability, we analysed the genomic content of four strains representing three Collimonas species (Ter14, Ter6, Ter91 and Ter10) by hybridization to a microarray based on reference strain C. fungivorans Ter331. The analysis revealed genes unique to strain Ter331 (e.g. those on the extrachromosomal element pTer331) and genes present in some but not all of the tested strains. Among the latter were several candidates that may contribute to fungistasis, including genes for the production and secretion of antifungals. We hypothesize that differential possession of these genes underlies the specialization of Collimonas strains towards different fungal hosts. We identified a set of 136 genes that were common in all tested Collimonas strains, but absent from the genomes of three other members of the family Oxalobacteraceae. Predicted products of these 'Collimonas core' genes include lytic, secreted enzymes such as chitinases, peptidases, nucleases and phosphatases with a putative role in mycophagy and weathering. PMID:23760828

  3. Phylogeny and mitochondrial gene order variation in Lophotrochozoa in the light of new mitogenomic data from Nemertea

    von Döhren Jörn

    2009-08-01

    Full Text Available Abstract Background The new animal phylogeny established several taxa which were not identified by morphological analyses, most prominently the Ecdysozoa (arthropods, roundworms, priapulids and others and Lophotrochozoa (molluscs, annelids, brachiopods and others. Lophotrochozoan interrelationships are under discussion, e.g. regarding the position of Nemertea (ribbon worms, which were discussed to be sister group to e.g. Mollusca, Brachiozoa or Platyhelminthes. Mitochondrial genomes contributed well with sequence data and gene order characters to the deep metazoan phylogeny debate. Results In this study we present the first complete mitochondrial genome record for a member of the Nemertea, Lineus viridis. Except two trnP and trnT, all genes are located on the same strand. While gene order is most similar to that of the brachiopod Terebratulina retusa, sequence based analyses of mitochondrial genes place nemerteans close to molluscs, phoronids and entoprocts without clear preference for one of these taxa as sister group. Conclusion Almost all recent analyses with large datasets show good support for a taxon comprising Annelida, Mollusca, Brachiopoda, Phoronida and Nemertea. But the relationships among these taxa vary between different studies. The analysis of gene order differences gives evidence for a multiple independent occurrence of a large inversion in the mitochondrial genome of Lophotrochozoa and a re-inversion of the same part in gastropods. We hypothesize that some regions of the genome have a higher chance for intramolecular recombination than others and gene order data have to be analysed carefully to detect convergent rearrangement events.

  4. Allelic Variation in the Perennial Ryegrass FLOWERING LOCUS T Gene is Associated with Changes in Flowering Time across a Range of Populations

    Skøt, Leif; Sanderson, Ruth; Thomas, Ann;

    2011-01-01

    The Arabidopsis (Arabidopsis thaliana) FLOWERING LOCUS T (FT) gene and its orthologs in other plant species (e.g. rice [Oryza sativa] OsFTL2/Hd3a) have an established role in the photoperiodic induction of flowering response. The genomic and phenotypic variations associated with the perennial...... ryegrass (Lolium perenne) ortholog of FT, designated LpFT3, was assessed in a diverse collection of nine European germplasm populations, which together constituted an association panel of 864 plants. Sequencing and genotyping of a series of amplicons derived from the nine populations, containing the...... complete exon and intron sequences as well as 5' and 3' noncoding sequences of LpFT3, identified a total of seven haplotypes. Genotyping assays designed to detect the genomic variation showed that three haplotypes were present in approximately equal proportions and represented 84% of the total, with a...

  5. Aperturas epistémicas y transformaciones intersubjetivas: haciendo acompañamiento académico a tesis de maestría

    Dora Inés Munévar M.

    2012-01-01

    Antecedentes. Se retoman los orígenes individuales e interesados de los recorridos registrados por quienes hacen tesis de maestría. Objetivo. Repensar los nexos entre las formas de hacer investigación y acompañamiento académico a tesis de posgrado. Materiales y métodos. Remiten a los procesos investigativos de cuatro tesistas en tres maestrías de la Universidad Nacional de Colombia: discapacidad e inclusión social (2), estudios de género (1) y educación con énfasis en comunicación (1), recurr...

  6. Copy number variation of CCL3-like genes affects rate of progression to simian-AIDS in Rhesus Macaques (Macaca mulatta.

    Jeremiah D Degenhardt

    2009-01-01

    Full Text Available Variation in genes underlying host immunity can lead to marked differences in susceptibility to HIV infection among humans. Despite heavy reliance on non-human primates as models for HIV/AIDS, little is known about which host factors are shared and which are unique to a given primate lineage. Here, we investigate whether copy number variation (CNV at CCL3-like genes (CCL3L, a key genetic host factor for HIV/AIDS susceptibility and cell-mediated immune response in humans, is also a determinant of time until onset of simian-AIDS in rhesus macaques. Using a retrospective study of 57 rhesus macaques experimentally infected with SIVmac, we find that CCL3L CNV explains approximately 18% of the variance in time to simian-AIDS (p<0.001 with lower CCL3L copy number associating with more rapid disease course. We also find that CCL3L copy number varies significantly (p<10(-6 among rhesus subpopulations, with Indian-origin macaques having, on average, half as many CCL3L gene copies as Chinese-origin macaques. Lastly, we confirm that CCL3L shows variable copy number in humans and chimpanzees and report on CCL3L CNV within and among three additional primate species. On the basis of our findings we suggest that (1 the difference in population level copy number may explain previously reported observations of longer post-infection survivorship of Chinese-origin rhesus macaques, (2 stratification by CCL3L copy number in rhesus SIV vaccine trials will increase power and reduce noise due to non-vaccine-related differences in survival, and (3 CCL3L CNV is an ancestral component of the primate immune response and, therefore, copy number variation has not been driven by HIV or SIV per se.

  7. Daily rhythm variations of the clock gene PER1 and cancer-related genes during various stages of carcinogenesis in a golden hamster model of buccal mucosa carcinoma

    Ye H

    2015-06-01

    Full Text Available Hua Ye, Kai Yang, Xue-Mei Tan, Xiao-Juan Fu, Han-Xue LiDepartment of Oral and Maxillofacial Surgery, The First Affiliated Hospital of Chongqing Medical University, Chongqing, People’s Republic of ChinaBackground: Recent studies have demonstrated that the clock gene PER1 regulates various tumor-related genes. Abnormal expressions and circadian rhythm alterations of PER1 are closely related to carcinogenesis. However, the dynamic circadian variations of PER1 and tumor-related genes at different stages of carcinogenesis remain unknown. This study was conducted to investigate the daily rhythm variation of PER1 and expression of tumor-related genes VEGF, KI67, C-MYC, and P53 in different stages of carcinogenesis.Materials and methods: Dimethylbenzanthracene was used to establish a golden hamster model of buccal mucosa carcinogenesis. Hamsters with normal buccal mucosa, precancerous lesion, and cancerous lesion were sacrificed at six different time points during a 24-hour period of a day. Pathological examination was conducted using routine hematoxylin and eosin staining. PER1, VEGF, KI67, C-MYC, and P53 mRNAs were detected by real-time reverse transcriptase polymerase chain reaction, and a cosinor analysis was applied to analyze the daily rhythm.Results: PER1, VEGF, C-MYC, and P53 mRNA exhibited daily rhythmic expression in three carcinogenesis stages, and KI67 mRNA exhibited daily rhythmic expression in the normal and precancerous stages. The daily rhythmic expression of KI67 was not observed in cancerous stages. The mesor and amplitude of PER1 and P53 mRNA expression decreased upon the development of cancer (P<0.05, whereas the mesor and amplitude of VEGF, KI67, and C-MYC mRNA increased upon the development of cancer (P<0.05. Compared with the normal tissues, the acrophases of PER1, VEGF, and C-MYC mRNA occurred earlier, whereas the acrophases of P53 and KI67 mRNA lagged remarkably in the precancerous lesions. In the cancer stage, the acrophases

  8. Allelic variations of a light harvesting chlorophyll a/b-binding protein gene (Lhcb1 associated with agronomic traits in barley.

    Yanshi Xia

    Full Text Available Light-harvesting chlorophyll a/b-binding protein (LHCP is one of the most abundant chloroplast proteins in plants. Its main function is to collect and transfer light energy to photosynthetic reaction centers. However, the roles of different LHCPs in light-harvesting antenna systems remain obscure. Exploration of nucleotide variation in the genes encoding LHCP can facilitate a better understanding of the functions of LHCP. In this study, nucleotide variations in Lhcb1, a LHCP gene in barley, were investigated across 292 barley accessions collected from 35 different countries using EcoTILLING technology, a variation of the Targeting Induced Local Lesions In Genomes (TILLING. A total of 23 nucleotide variations were detected including three insert/deletions (indels and 20 single nucleotide polymorphisms (SNPs. Among them, 17 SNPs were in the coding region with nine missense changes. Two SNPs with missense changes are predicted to be deleterious to protein function. Seventeen SNP formed 31 distinguishable haplotypes in the barley collection. The levels of nucleotide diversity in the Lhcb1 locus differed markedly with geographic origins and species of accessions. The accessions from Middle East Asia exhibited the highest nucleotide and haplotype diversity. H. spontaneum showed greater nucleotide diversity than H. vulgare. Five SNPs in Lhcb1 were significantly associated with at least one of the six agronomic traits evaluated, namely plant height, spike length, number of grains per spike, thousand grain weight, flag leaf area and leaf color, and these SNPs may be used as potential markers for improvement of these barley traits.

  9. [Genetic structure of the Siberian Sucker (Catostomus catostomus rostratus) according to data on sequence variation of the mtDNA cytochrome B gene].

    Bachevskaia, L T; Pereverzeva, V V; Ivanova, G D; Agapova, G A; Primak, A A

    2014-01-01

    Data regarding the structure and variation of the nucleotide sequence of the cytochrome b gene of mitochondrial DNA of the Siberian Sucker from the Kolyma River were obtained. Analysis of the median network revealed that evolutionary lines diverged from a common ancestor. Penetration of the sucker into Asia from Northern America took place between the Early and Middle Pleistocene. Prolonged reproductive isolation of the Siberian and Northern American suckers led to interspecies divergence with the appearance of amino acid substitutions, which, apparently, fixed due to positive selection. The Siberian Sucker appeared to have three modifications of the Cytb protein. PMID:25735175

  10. A critical update on endothelial nitric oxide synthase gene variations in women with idiopathic recurrent spontaneous abortion: genetic association study, systematic review and meta-analyses.

    Pereza, N; Peterlin, B; Volk, M; Kapović, M; Ostojić, S

    2015-05-01

    A number of case-control studies investigated the association between idiopathic recurrent spontaneous abortion (IRSA) and variations in the gene encoding endothelial nitric oxide synthase (NOS3), but yielded contradictory results. Our aim was to test the association of the NOS3 variable number of tandem repeats (VNTR) in intron 4 and +894 G/T single-nucleotide polymorphism (SNP) with IRSA in Slovenian women (148 IRSA and 149 control women), conduct a systematic review of literature on the association between NOS3 gene variations and IRSA, and perform meta-analyses of studies that met the inclusion criteria, defined by virtue of the European Society for Human Reproduction and Embryology evidence-based guidelines for recurrent spontaneous abortion. Genotyping was performed using PCR and restriction fragment length polymorphism methods. The systematic review of literature (English language) was conducted using PubMed and Scopus databases, to 1 November 2014. We determined no association of IRSA with the VNTR in intron 4 and +894 G/T SNP in Slovenian women. Furthermore, 16 case-control studies were identified on the association between 15 NOS3 gene variations and IRSA. However, significant inconsistencies exist in the selection criteria of patients and controls between studies. The meta-analysis of VNTR in intron 4 was performed on five studies (894 patients, 944 controls), whereas the meta-analysis of +894 G/T SNP included six studies (1111 patients, 1121 controls). The association with IRSA was significant for the +894 G/T SNP under the dominant genetic model (GT+TT versus GG) based on fixed (odds ratio (OR) = 1.54, 95% confidence interval (CI) = 1.28-1.86, P = <0.01) and random effects models (OR = 1.54, 95% CI = 1.03-2.31, P = 0.03). In conclusion, the GT and TT genotypes of the +894 G/T SNP in women might contribute to a predisposition to IRSA. Additional genetic association and functional studies in different populations with larger numbers of participants and a

  11. Allelic variation of polyphenol oxidase (PPO) genes located on chromosomes 2A and 2D and development of functional markers for the PPO genes in common wheat.

    Polyphenol oxidase (PPO) activity is highly related to the undesirable browning of wheat-based end products, especially Asian noodles. Characterization of PPO genes and the development of their functional markers are of great importance for marker-assisted selection in wheat breeding. In the prese...

  12. Disentangling the effect of genes, the environment and chance on sex ratio variation in a wild bird population.

    Postma, Erik; Heinrich, Franziska; Koller, Ursina; Sardell, Rebecca J; Reid, Jane M; Arcese, Peter; Keller, Lukas F

    2011-10-01

    Sex ratio theory proposes that the equal sex ratio typically observed in birds and mammals is the result of natural selection. However, in species with chromosomal sex determination, the same 1 : 1 sex ratio is expected under random Mendelian segregation. Here, we present an analysis of 14 years of sex ratio data for a population of song sparrows (Melospiza melodia) on Mandarte Island, at the nestling stage and at independence from parental care. We test for the presence of variance in sex ratio over and above the binomial variance expected under Mendelian segregation, and thereby quantify the potential for selection to shape sex ratio. Furthermore, if sex ratio variation is to be shaped by selection, we expect some of this extra-binomial variation to have a genetic basis. Despite ample statistical power, we find no evidence for the existence of either genetic or environmentally induced variation in sex ratio, in the nest or at independence. Instead, the sex ratio variation observed matches that expected under random Mendelian segregation. Using one of the best datasets of its kind, we conclude that female song sparrows do not, and perhaps cannot, adjust the sex of their offspring. We discuss the implications of this finding and make suggestions for future research. PMID:21345862

  13. Allelic variation of the inducible costimulator (ICOS) gene: detection of polymorphisms, analysis of the promoter region, and extended haplotype estimation

    Andersen, A.D.H.; Lange, Marianne; Lillevang, S.T.

    2003-01-01

    which two resided in putative NF-kB and Sp1 sites In accordance with. previous studies we detected no variations in the coding regions except for a rare polymorphism that was found in one donor in the last codon of exon 5, which lead to a heterozygous genotype, but no amino acid change. This suggests...

  14. A Multiple Interaction Analysis Reveals ADRB3 as a Potential Candidate for Gallbladder Cancer Predisposition via a Complex Interaction with Other Candidate Gene Variations

    Rajani Rai

    2015-11-01

    Full Text Available Gallbladder cancer is the most common and a highly aggressive biliary tract malignancy with a dismal outcome. The pathogenesis of the disease is multifactorial, comprising the combined effect of multiple genetic variations of mild consequence along with numerous dietary and environmental risk factors. Previously, we demonstrated the association of several candidate gene variations with GBC risk. In this study, we aimed to identify the combination of gene variants and their possible interactions contributing towards genetic susceptibility of GBC. Here, we performed Multifactor-Dimensionality Reduction (MDR and Classification and Regression Tree Analysis (CRT to investigate the gene–gene interactions and the combined effect of 14 SNPs in nine genes (DR4 (rs20576, rs6557634; FAS (rs2234767; FASL (rs763110; DCC (rs2229080, rs4078288, rs7504990, rs714; PSCA (rs2294008, rs2978974; ADRA2A (rs1801253; ADRB1 (rs1800544; ADRB3 (rs4994; CYP17 (rs2486758 involved in various signaling pathways. Genotyping was accomplished by PCR-RFLP or Taqman allelic discrimination assays. SPSS software version 16.0 and MDR software version 2.0 were used for all the statistical analysis. Single locus investigation demonstrated significant association of DR4 (rs20576, rs6557634, DCC (rs714, rs2229080, rs4078288 and ADRB3 (rs4994 polymorphisms with GBC risk. MDR analysis revealed ADRB3 (rs4994 to be crucial candidate in GBC susceptibility that may act either alone (p < 0.0001, CVC = 10/10 or in combination with DCC (rs714 and rs2229080, p < 0.0001, CVC = 9/10. Our CRT results are in agreement with the above findings. Further, in-silico results of studied SNPs advocated their role in splicing, transcriptional and/or protein coding regulation. Overall, our result suggested complex interactions amongst the studied SNPs and ADRB3 rs4994 as candidate influencing GBC susceptibility.

  15. Repetitive DNA and Plant Domestication: Variation in Copy Number and Proximity to Genes of LTR-Retrotransposons among Wild and Cultivated Sunflower (Helianthus annuus) Genotypes.

    Mascagni, Flavia; Barghini, Elena; Giordani, Tommaso; Rieseberg, Loren H; Cavallini, Andrea; Natali, Lucia

    2015-12-01

    The sunflower (Helianthus annuus) genome contains a very large proportion of transposable elements, especially long terminal repeat retrotransposons. However, knowledge on the retrotransposon-related variability within this species is still limited. We used next-generation sequencing (NGS) technologies to perform a quantitative and qualitative survey of intraspecific variation of the retrotransposon fraction of the genome across 15 genotypes--7 wild accessions and 8 cultivars--of H. annuus. By mapping the Illumina reads of the 15 genotypes onto a library of sunflower long terminal repeat retrotransposons, we observed considerable variability in redundancy among genotypes, at both superfamily and family levels. In another analysis, we mapped Illumina paired reads to two sets of sequences, that is, long terminal repeat retrotransposons and protein-encoding sequences, and evaluated the extent of retrotransposon proximity to genes in the sunflower genome by counting the number of paired reads in which one read mapped to a retrotransposon and the other to a gene. Large variability among genotypes was also ascertained for retrotransposon proximity to genes. Both long terminal repeat retrotransposon redundancy and proximity to genes varied among retrotransposon families and also between cultivated and wild genotypes. Such differences are discussed in relation to the possible role of long terminal repeat retrotransposons in the domestication of sunflower. PMID:26608057

  16. Dynamics of membrane potential variation and gene expression induced by Spodoptera littoralis, Myzus persicae, and Pseudomonas syringae in Arabidopsis.

    Irene Bricchi

    Full Text Available BACKGROUND: Biotic stress induced by various herbivores and pathogens invokes plant responses involving different defense mechanisms. However, we do not know whether different biotic stresses share a common response or which signaling pathways are involved in responses to different biotic stresses. We investigated the common and specific responses of Arabidopsis thaliana to three biotic stress agents: Spodoptera littoralis, Myzus persicae, and the pathogen Pseudomonas syringae. METHODOLOGY/PRINCIPAL FINDINGS: We used electrophysiology to determine the plasma membrane potential (V(m and we performed a gene microarray transcriptome analysis on Arabidopsis upon either herbivory or bacterial infection. V(m depolarization was induced by insect attack; however, the response was much more rapid to S. littoralis (30 min -2 h than to M. persicae (4-6 h. M. persicae differentially regulated almost 10-fold more genes than by S. littoralis with an opposite regulation. M. persicae modulated genes involved in flavonoid, fatty acid, hormone, drug transport and chitin metabolism. S. littoralis regulated responses to heat, transcription and ion transport. The latest Vm depolarization (16 h was found for P. syringae. The pathogen regulated responses to salicylate, jasmonate and to microorganisms. Despite this late response, the number of genes differentially regulated by P. syringae was closer to those regulated by S. littoralis than by M. persicae. CONCLUSIONS/SIGNIFICANCE: Arabidopsis plasma membranes respond with a V(m depolarization at times depending on the nature of biotic attack which allow setting a time point for comparative genome-wide analysis. A clear relationship between V(m depolarization and gene expression was found. At V(m depolarization timing, M. persicae regulates a wider array of Arabidopsis genes with a clear and distinct regulation than S. littoralis. An almost completely opposite regulation was observed between the aphid and the pathogen

  17. Variation of gene expression associated with colonisation of an anthropized environment: comparison between African and European populations of Drosophila simulans.

    François Wurmser

    Full Text Available The comparison of transcriptome profiles among populations is a powerful tool for investigating the role of gene expression change in adaptation to new environments. In this study, we use massively parallel sequencing of 3' cDNAs obtained from large samples of adult males, to compare a population of Drosophila simulans from a natural reserve within its ancestral range (eastern Africa with a derived population collected in the strongly anthropized Rhône valley (France. The goal was to scan for adaptation linked to the invasion of new environments by the species. Among 15,090 genes retained for the analysis, 794 were found to be differentially expressed between the two populations. We observed an increase in expression of reproduction-related genes in eastern Africa, and an even stronger increase in expression of Cytochrome P450, Glutathione transferase and Glucuronosyl transferase genes in the derived population. These three gene families are involved in detoxification processes, which suggests that pesticides are a major environmental pressure for the species in this area. The survey of the Cyp6g1 upstream region revealed the insertion of a transposable element, Juan, in the regulatory sequence that is almost fixed in the Rhône Valley, but barely present in Mayotte. This shows that Cyp6g1 has undergone parallel evolution in derived populations of D. simulans as previously shown for D. melanogaster. The increasing amount of data produced by comparative population genomics and transcriptomics should permit the identification of additional genes associated with functional divergence among those differentially expressed.

  18. Analysis of sequence variations in low-density lipoprotein receptor gene among Malaysian patients with familial hypercholesterolemia

    Yusof Zurkurnai

    2011-03-01

    Full Text Available Abstract Background Familial hypercholesterolemia is a genetic disorder mainly caused by defects in the low-density lipoprotein receptor gene. Few and limited analyses of familial hypercholesterolemia have been performed in Malaysia, and the underlying mutations therefore remain largely unknown. We studied a group of 154 unrelated FH patients from a northern area of Malaysia (Kelantan. The promoter region and exons 2-15 of the LDLR gene were screened by denaturing high-performance liquid chromatography to detect short deletions and nucleotide substitutions, and by multiplex ligation-dependent probe amplification to detect large rearrangements. Results A total of 29 gene sequence variants were reported in 117(76.0% of the studied subjects. Eight different mutations (1 large rearrangement, 1 short deletion, 5 missense mutations, and 1 splice site mutation, and 21 variants. Eight gene sequence variants were reported for the first time and they were noticed in familial hypercholesterolemic patients, but not in controls (p.Asp100Asp, p.Asp139His, p.Arg471Gly, c.1705+117 T>G, c.1186+41T>A, 1705+112C>G, Dup exon 12 and p.Trp666ProfsX45. The incidence of the p.Arg471Gly variant was 11%. Patients with pathogenic mutations were younger, had significantly higher incidences of cardiovascular disease, xanthomas, and family history of hyperlipidemia, together with significantly higher total cholesterol and low density lipoprotein levels than patients with non-pathogenic variants. Conclusions Twenty-nine gene sequence variants occurred among FH patients; those with predicted pathogenicity were associated with higher incidences of cardiovascular diseases, tendon xanthomas, and higher total and low density lipoprotein levels compared to the rest. These results provide preliminary information on the mutation spectrum of this gene among patients with FH in Malaysia.

  19. Effects of Pax3 modifier genes on craniofacial morphology, pigmentation, and viability: A murine model of Waardenburg syndrome variation

    Asher, J.H. Jr.; Harrison, R.W.; Morell, R.; Carey, M.L. [Michigan State Univ., East Lansing, MI (United States)] [and others

    1996-06-15

    Waardenburg syndrome type 1 is caused by mutations in PAX3. Over 50 human PAX3 mutations that lead to hearing, craniofacial, limb, and pigmentation anomalies have been identified. A PAX3 mutant allele, segregating in a family, can show reduced penetrance and variable expressivity that cannot be explained by the nature of the mutation alone. The Mus musculus Pax3 mutation Sp{sup d} (Splotch-delayed, Pax3{sup Sd}p), coisogenic on the C57BL/6J (B{sub 6}) genetic background, produces in heterozygotes a white belly spot with 100% penetrance and very few other anomalies. By contrast, many Sp{sup d}/+ BC{sub 1} progeny [F{sub 1} {female} Sp{sup d}/+ ({female} Sp{sup d}/+ B{sub 6} x {male} +/+ Mus spretus) x {male} +/+ B{sub 6}] exhibit highly variable craniofacial and pigmentary anomalies. Of the BC{sub 1} Sp{sup d}/+ progeny, 23.9% are estimated to be nonviable, and 32.1% are nonpenetrant for the white belly spot. The penetrance and expressivity of the Sp{sup d}/+ genotype are controlled in part by the genetic background and the sex of the individual. A minimum of two genes interact with Sp{sup d} to influence the craniofacial features of these mice. One of these genes may be either X-linked or sex-influenced, while the other is autosomal. The A-locus (Agouti) or a gene closely linked to A also plays a role in determining craniofacial features. At least one additional gene, possibly the A-locus or a gene linked to A, interacts with Sp{sup d} and determines the presence and size of the white belly spot. The viability of BC{sub 1} mice is influenced by at least three factors: Sp{sup d}, A-locus alleles or a gene closely linked to the A-locus, and the sex of the mouse. The BC{sub 1} mice provide an opportunity to identify genes that interact with and modify the expression of Pax3 and serve as a model to identify the genes that modify the expression of human PAX3 mutations. 65 refs., 3 figs., 6 tabs.

  20. Rapid evolution and copy number variation of primate RHOXF2, an X-linked homeobox gene involved in male reproduction and possibly brain function

    Zhang Rui

    2011-10-01

    Full Text Available Abstract Background Homeobox genes are the key regulators during development, and they are in general highly conserved with only a few reported cases of rapid evolution. RHOXF2 is an X-linked homeobox gene in primates. It is highly expressed in the testicle and may play an important role in spermatogenesis. As male reproductive system is often the target of natural and/or sexual selection during evolution, in this study, we aim to dissect the pattern of molecular evolution of RHOXF2 in primates and its potential functional consequence. Results We studied sequences and copy number variation of RHOXF2 in humans and 16 nonhuman primate species as well as the expression patterns in human, chimpanzee, white-browed gibbon and rhesus macaque. The gene copy number analysis showed that there had been parallel gene duplications/losses in multiple primate lineages. Our evidence suggests that 11 nonhuman primate species have one RHOXF2 copy, and two copies are present in humans and four Old World monkey species, and at least 6 copies in chimpanzees. Further analysis indicated that the gene duplications in primates had likely been mediated by endogenous retrovirus (ERV sequences flanking the gene regions. In striking contrast to non-human primates, humans appear to have homogenized their two RHOXF2 copies by the ERV-mediated non-allelic recombination mechanism. Coding sequence and phylogenetic analysis suggested multi-lineage strong positive selection on RHOXF2 during primate evolution, especially during the origins of humans and chimpanzees. All the 8 coding region polymorphic sites in human populations are non-synonymous, implying on-going selection. Gene expression analysis demonstrated that besides the preferential expression in the reproductive system, RHOXF2 is also expressed in the brain. The quantitative data suggests expression pattern divergence among primate species. Conclusions RHOXF2 is a fast-evolving homeobox gene in primates. The rapid

  1. Passage of Campylobacter jejuni through the chicken reservoir or mice promotes phase variation in contingency genes Cj0045 and Cj0170 that strongly associates with colonization and disease in a mouse model.

    Kim, Joo-Sung; Artymovich, Katherine A; Hall, David F; Smith, Eric J; Fulton, Richard; Bell, Julia; Dybas, Leslie; Mansfield, Linda S; Tempelman, Robert; Wilson, David L; Linz, John E

    2012-05-01

    Human illness due to Camplyobacter jejuni infection is closely associated with consumption of poultry products. We previously demonstrated a 50 % shift in allele frequency (phase variation) in contingency gene Cj1139 (wlaN) during passage of C. jejuni NCTC11168 populations through Ross 308 broiler chickens. We hypothesized that phase variation in contingency genes during chicken passage could promote subsequent colonization and disease in humans. To test this hypothesis, we passaged C. jejuni strains NCTC11168, 33292, 81-176, KanR4 and CamR2 through broiler chickens and analysed the ability of passaged and non-passaged populations to colonize C57BL6 IL-10-deficient mice, our model for human colonization and disease. We utilized fragment analysis and nucleotide sequence analysis to measure phase variation in contingency genes. Passage through the chicken reservoir promoted phase variation in five specific contingency genes, and these 'successful' populations colonized mice. When phase variation did not occur in these same five contingency genes during chicken passage, these 'unsuccessful' populations failed to colonize mice. Phase variation during chicken passage generated small insertions or deletions (indels) in the homopolymeric tract (HT) in contingency genes. Single-colony isolates of C. jejuni strain KanR4 carrying an allele of contingency gene Cj0170 with a10G HT colonized mice at high frequency and caused disease symptoms, whereas single-colony isolates carrying the 9G allele failed to colonize mice. Supporting results were observed for the successful 9G allele of Cj0045 in strain 33292. These data suggest that phase variation in Cj0170 and Cj0045 is strongly associated with mouse colonization and disease, and that the chicken reservoir can play an active role in natural selection, phase variation and disease. PMID:22343355

  2. Variation of five major glucosinolate genes in Brassica rapa in relation to Brassica oleracea and Arabidopsis thaliana

    Yang, B.; Qiu, D.; Quiros, F.

    2010-07-01

    Glucosinolates and their derivatives isothiocyanates are important secondary metabolites in the Brassica cea that has biological activity, such as cancer protecting and bio fumigant properties. The putative ortho logs of five major genes in the glucosinolate biosynthetic pathway, Bra.GSELONG.a, Bra.GSALK.a, Bra.CYP83B1, Bra.SUR1.a and Bra.ST5.a, were cloned from both cDNA and genomic DNA from different subspecies of Brassica rapa. Inter species comparative analysis disclosed high conservation of exon number and size for GS-Elong, GS-Alk, GS-CYP83B1 and GS-ST5a among B. rapa, B. oleracea and A. thaliana. Splice site mutations caused the differences observed for exon numbers and sizes in GS-SUR1 among the three species. However, the exonic sequences were highly conserved for this gene. There were not major differences of intronic sizes among the three species for these genes, except for intron 1 for GS-Elong in two subspecies of B. rapa. The cloning of the putative ortho logs of all these major genes involved in the glucosinolate biosynthesis pathway of B. rapa and sequence analysis provide a useful base for their genetic manipulation and functional analysis. (Author) 31 refs.

  3. Differential transcript abundance and genotypic variation of four putative allergen-encoding gene families in melting peach

    Yang, Z.; Ma, Y.; Chen, L.; Xie, R.; Zhang, X.; Zhang, B.; Lu, M.; Wu, S.; Gilissen, L.J.W.J.; Ree, van R.; Gao, Z.

    2011-01-01

    We analysed the temporal and spatial transcript expression of the panel of 18 putative isoallergens from four gene families (Pru p 1–4) in the peach fruit, anther and leaf of two melting cultivars, to gain insight into their expression profiles and to identify the key family members. Genotypic varia

  4. Human Lipoxygenase Pathway Gene Variation and Association with Markers of Subclinical Atherosclerosis in the Diabetes Heart Study

    Kathryn P. Burdon

    2010-01-01

    Conclusions. Polymorphisms within ALOX12, ALOX5, and ALOX5AP are genetically associated with subclinical atherosclerosis and with biomarkers of disease in families with type 2 diabetes. These results suggest that variants in lipoxygenase pathway genes may have pleiotropic effects on multiple components that determine risk of cardiovascular disease.

  5. Allelic variation in porcine resistin (RETN) gene is associated with fatness traits in a Wild Boar x Meishan reference family

    Čepica, Stanislav; Knoll, A.; Masopust, Martin; Vykoukalová, Z.; Bartenschlager, H.; Nonneman, D.; Rohrer, G. A.; Geldermann, H.

    Porto Seguro : ISAG, 2006, s. 72. ISBN 85-85584-02-5. [30th International Conference on Animal Genetics. Porto Seguro (BR), 20.08.2006-25.08.2006] R&D Projects: GA ČR GA523/04/0106 Institutional research plan: CEZ:AV0Z50450515 Keywords : RETN gene Subject RIV: EB - Genetics ; Molecular Biology

  6. Variation near the hepatocyte nuclear factor (HNF)-4alpha gene associates with type 2 diabetes in the Danish population

    Hansen, S K; Rose, C S; Glümer, C;

    2005-01-01

    The hepatocyte nuclear factor (HNF)-4alpha is an orphan nuclear receptor, which plays crucial roles in regulating hepatic gluconeogenesis and insulin secretion. The gene encoding HNF-4alpha (HNF4A) is located on chromosome 20q12-q13 in a region that in several studies has shown linkage with type 2...

  7. THE SOLUBLE EPOXIDE HYDROLASE GENE HARBORS SEQUENCE VARIATIONS ASSOCIATED WITH SUSCEPTIBILITY TO AND PROTECTION FROM INCIDENT ISCHEMIC STROKE

    Stroke is the leading cause of severe disability and the third leading cause of death, accounting for one of every 15 deaths in the USA. We investigated the association of polymorphisms in the soluble epoxide hydrolase gene (EPHX2) with incident ischemic stroke in African-Americans and Whites. Twelv...

  8. Gene expression profiling of Spodoptera frugiperda hemocytes and fat body using cDNA microarray reveals polydnavirus-associated variations in lepidopteran host genes transcript levels

    Barat-Houari, M; Hilliou, F.; Jousset, F-X; Sofer, L; Deleury, E.; Rocher, J.; Ravallec, M.; Galibert, L; Delobel, P; Feyereisen, R.; Fournier, P.; Volkoff, A-N.

    2006-01-01

    Background Genomic approaches provide unique opportunities to study interactions of insects with their pathogens. We developed a cDNA microarray to analyze the gene transcription profile of the lepidopteran pest Spodoptera frugiperda in response to injection of the polydnavirus HdIV associated with the ichneumonid wasp Hyposoter didymator. Polydnaviruses are associated with parasitic ichneumonoid wasps and are required for their development within the lepidopteran host, in which they act as p...

  9. Contrasting signals of positive selection in genes involved in human skin-color variation from tests based on SNP scans and resequencing

    de Gruijter Johanna

    2011-12-01

    Full Text Available Abstract Background Numerous genome-wide scans conducted by genotyping previously ascertained single-nucleotide polymorphisms (SNPs have provided candidate signatures for positive selection in various regions of the human genome, including in genes involved in pigmentation traits. However, it is unclear how well the signatures discovered by such haplotype-based test statistics can be reproduced in tests based on full resequencing data. Four genes (oculocutaneous albinism II (OCA2, tyrosinase-related protein 1 (TYRP1, dopachrome tautomerase (DCT, and KIT ligand (KITLG implicated in human skin-color variation, have shown evidence for positive selection in Europeans and East Asians in previous SNP-scan data. In the current study, we resequenced 4.7 to 6.7 kb of DNA from each of these genes in Africans, Europeans, East Asians, and South Asians. Results Applying all commonly used neutrality-test statistics for allele frequency distribution to the newly generated sequence data provided conflicting results regarding evidence for positive selection. Previous haplotype-based findings could not be clearly confirmed. Although some tests were marginally significant for some populations and genes, none of them were significant after multiple-testing correction. Combined P values for each gene-population pair did not improve these results. Application of Approximate Bayesian Computation Markov chain Monte Carlo based to these sequence data using a simple forward simulator revealed broad posterior distributions of the selective parameters for all four genes, providing no support for positive selection. However, when we applied this approach to published sequence data on SLC45A2, another human pigmentation candidate gene, we could readily confirm evidence for positive selection, as previously detected with sequence-based and some haplotype-based tests. Conclusions Overall, our data indicate that even genes that are strong biological candidates for positive

  10. Integrating genome-wide genetic variations and monocyte expression data reveals trans-regulated gene modules in humans.

    Maxime Rotival

    2011-12-01

    Full Text Available One major expectation from the transcriptome in humans is to characterize the biological basis of associations identified by genome-wide association studies. So far, few cis expression quantitative trait loci (eQTLs have been reliably related to disease susceptibility. Trans-regulating mechanisms may play a more prominent role in disease susceptibility. We analyzed 12,808 genes detected in at least 5% of circulating monocyte samples from a population-based sample of 1,490 European unrelated subjects. We applied a method of extraction of expression patterns-independent component analysis-to identify sets of co-regulated genes. These patterns were then related to 675,350 SNPs to identify major trans-acting regulators. We detected three genomic regions significantly associated with co-regulated gene modules. Association of these loci with multiple expression traits was replicated in Cardiogenics, an independent study in which expression profiles of monocytes were available in 758 subjects. The locus 12q13 (lead SNP rs11171739, previously identified as a type 1 diabetes locus, was associated with a pattern including two cis eQTLs, RPS26 and SUOX, and 5 trans eQTLs, one of which (MADCAM1 is a potential candidate for mediating T1D susceptibility. The locus 12q24 (lead SNP rs653178, which has demonstrated extensive disease pleiotropy, including type 1 diabetes, hypertension, and celiac disease, was associated to a pattern strongly correlating to blood pressure level. The strongest trans eQTL in this pattern was CRIP1, a known marker of cellular proliferation in cancer. The locus 12q15 (lead SNP rs11177644 was associated with a pattern driven by two cis eQTLs, LYZ and YEATS4, and including 34 trans eQTLs, several of them tumor-related genes. This study shows that a method exploiting the structure of co-expressions among genes can help identify genomic regions involved in trans regulation of sets of genes and can provide clues for understanding the

  11. Highly conserved gene order and numerous novel repetitive elements in genomic regions linked to wing pattern variation in Heliconius butterflies

    Halder Georg

    2008-07-01

    Full Text Available Abstract Background With over 20 parapatric races differing in their warningly colored wing patterns, the butterfly Heliconius erato provides a fascinating example of an adaptive radiation. Together with matching races of its co-mimic Heliconius melpomene, H. erato also represents a textbook case of Müllerian mimicry, a phenomenon where common warning signals are shared amongst noxious organisms. It is of great interest to identify the specific genes that control the mimetic wing patterns of H. erato and H. melpomene. To this end we have undertaken comparative mapping and targeted genomic sequencing in both species. This paper reports on a comparative analysis of genomic sequences linked to color pattern mimicry genes in Heliconius. Results Scoring AFLP polymorphisms in H. erato broods allowed us to survey loci at approximately 362 kb intervals across the genome. With this strategy we were able to identify markers tightly linked to two color pattern genes: D and Cr, which were then used to screen H. erato BAC libraries in order to identify clones for sequencing. Gene density across 600 kb of BAC sequences appeared relatively low, although the number of predicted open reading frames was typical for an insect. We focused analyses on the D- and Cr-linked H. erato BAC sequences and on the Yb-linked H. melpomene BAC sequence. A comparative analysis between homologous regions of H. erato (Cr-linked BAC and H. melpomene (Yb-linked BAC revealed high levels of sequence conservation and microsynteny between the two species. We found that repeated elements constitute 26% and 20% of BAC sequences from H. erato and H. melpomene respectively. The majority of these repetitive sequences appear to be novel, as they showed no significant similarity to any other available insect sequences. We also observed signs of fine scale conservation of gene order between Heliconius and the moth Bombyx mori, suggesting that lepidopteran genome architecture may be conserved

  12. Allelic variation of the COMT gene in a despotic primate society: A haplotype is related to cortisol excretion in Macaca fuscata.

    Pflüger, Lena S; Gutleb, Daria R; Hofer, Martin; Fieder, Martin; Wallner, Bernard; Steinborn, Ralf

    2016-02-01

    Sequence variations in genes of the monoamine neurotransmitter system and their common function in human and non-human primate species are an ongoing issue of investigation. However, the COMT gene, coding for the catechol-O-methyltransferase, has not yet attracted much scientific attention regarding its functional role in non-human primates. Considering that a polymorphism of the human COMT gene affects the enzyme activity and cortisol level in response to a social stressor, this study investigated the impact of COMT on endocrine stress and behavioural parameters in Japanese macaques (Macaca fuscata). The species exemplifies a despotic hierarchy in which males' social rank positions require an adaptation of behaviour strategies. During the mating period steroid secretion and the frequency of aggressive encounters between males increase. We addressed i) whether this species exhibits potential functional COMT variants, ii) whether these variants are associated with faecal cortisol excretion of males, iii) how they are distributed among different social rank positions and iv) whether they are associated with behavioural strategies during times of mate competition. By genotyping 26 males we identified three COMT haplotypes (HT), including a putative splice mutant (HT3). This variant was associated with increased cortisol excretion. Given the observed inverse correlation between cortisol and physical aggression, we assume that different COMT haplotypes may predispose individuals to pursue more or less aggressive strategies. How these gene-stress effects might favour a specific social role is discussed. Our study of non-invasive genotyping in combination with behavioural and endocrine parameters represents an important step towards the understanding of gene-stress effects in a hierarchically organised primate society. PMID:26657779

  13. Genetic structure and evolutionary history of a diploid hybrid pine Pinus densata inferred from the nucleotide variation at seven gene loci.

    Ma, Xiao-Fei; Szmidt, Alfred E; Wang, Xiao-Ru

    2006-04-01

    Although homoploid hybridization is increasingly recognized as an important phenomenon in plant evolution, its evolutionary genetic mechanisms are poorly documented and understood. Pinus densata, a pine native to the Tibetan Plateau, represents a good example of a homoploid hybrid speciation facilitated by adaptation to extreme environment and ecological isolation from the parents. Its ecologically and reproductively stabilized nature offers excellent opportunity for studying genetic processes associated with hybrid speciation. In this study, we investigated the levels and patterns of nucleotide variation in P. densata and its putative parents. Haplotype composition, gene genealogies, and the levels and patterns of nucleotide variation gave further support to the hybrid nature of P. densata. Allelic history, as revealed by our data, suggests the ancient nature of the hybrid preceding elevation of the Tibetan Plateau. We detected more deviations from neutrality in P. densata than in the parental species. Thus, at least some of the evolutionary forces that have shaped the genetic variation in P. densata are likely to be different from those acting upon parental species. We speculate that when populations of P. densata invaded new territories, they had elevated rates of response to selection in order to develop traits that help them to survive and adapt in the new environments. PMID:16446291

  14. Molecular characterization, homology modeling and docking studies of the R2787H missense variation in BRCA2 gene: Association with breast cancer.

    Riahi, Aouatef; Messaoudi, Abdelmonem; Mrad, Ridha; Fourati, Asma; Chabouni-Bouhamed, Habiba; Kharrat, Maher

    2016-08-21

    The significance of many BRCA unclassified variants (UVs) has not been evaluated. Classification of these variations as neutral or pathogenic presents a significant challenge and has important implications for breast and ovarian cancer genetic counseling. Here we report a combined molecular and computational approach to classify BRCA UVs missense variations. By using the LOH (Loss of heterozygosity) analysis at the BRCA1/BRCA2 loci, five bioinformatics approaches namely fathmm, PhD-SNP, SNAP, MutationTaster and Human Splicing Finder and the association with the clinico-pathological characteristics related to BRCA tumors, we were able to classify the R2787H (in BRCA2 gene) variant as pathogenic. Then, to investigate the functional role of the R2787H variation in altering BRCA2 structure, the homology model of this variant was constructed using the Rattus norvegicus BRCA2 (PDB ID: 1IYJ) as a template. The predicted model was then assessed for stereochemical quality and side chain environment. Furthermore, docking and binding free energy simulations were performed to investigate the ssDNA-BRCA2 complex interaction. Binding energy value calculation proves that this substitution affects the complex stability. Moreover, this alteration was not found in one hundred healthy controls. These findings suggest that R2787H variant could have potential functional impact. Our approach might be useful for evaluation of BRCA unclassified variants. However additional functional analyzes may provide appropriate assessment to classify such variants. PMID:27211102

  15. Melanocortin 1 receptor (MC1R) gene sequence variation and melanism in the gray (Sciurus carolinensis), fox (Sciurus niger), and red (Sciurus vulgaris) squirrel.

    McRobie, Helen R; King, Linda M; Fanutti, Cristina; Coussons, Peter J; Moncrief, Nancy D; Thomas, Alison P M

    2014-01-01

    Sequence variations in the melanocortin 1 receptor (MC1R) gene are associated with melanism in many different species of mammals, birds, and reptiles. The gray squirrel (Sciurus carolinensis), found in the British Isles, was introduced from North America in the late 19th century. Melanism in the British gray squirrel is associated with a 24-bp deletion in the MC1R. To investigate the origin of this mutation, we sequenced the MC1R of 95 individuals including 44 melanic gray squirrels from both the British Isles and North America. Melanic gray squirrels of both populations had the same 24-bp deletion associated with melanism. Given the significant deletion associated with melanism in the gray squirrel, we sequenced the MC1R of both wild-type and melanic fox squirrels (Sciurus niger) (9 individuals) and red squirrels (Sciurus vulgaris) (39 individuals). Unlike the gray squirrel, no association between sequence variation in the MC1R and melanism was found in these 2 species. We conclude that the melanic gray squirrel found in the British Isles originated from one or more introductions of melanic gray squirrels from North America. We also conclude that variations in the MC1R are not associated with melanism in the fox and red squirrels. PMID:24534267

  16. Deep sequencing of the viral phoH gene reveals temporal variation, depth-specific composition, and persistent dominance of the same viral phoH genes in the Sargasso Sea.

    Goldsmith, Dawn B; Parsons, Rachel J; Beyene, Damitu; Salamon, Peter; Breitbart, Mya

    2015-01-01

    Deep sequencing of the viral phoH gene, a host-derived auxiliary metabolic gene, was used to track viral diversity throughout the water column at the Bermuda Atlantic Time-series Study (BATS) site in the summer (September) and winter (March) of three years. Viral phoH sequences reveal differences in the viral communities throughout a depth profile and between seasons in the same year. Variation was also detected between the same seasons in subsequent years, though these differences were not as great as the summer/winter distinctions. Over 3,600 phoH operational taxonomic units (OTUs; 97% sequence identity) were identified. Despite high richness, most phoH sequences belong to a few large, common OTUs whereas the majority of the OTUs are small and rare. While many OTUs make sporadic appearances at just a few times or depths, a small number of OTUs dominate the community throughout the seasons, depths, and years. PMID:26157645

  17. Deep sequencing of the viral phoH gene reveals temporal variation, depth-specific composition, and persistent dominance of the same viral phoH genes in the Sargasso Sea

    Dawn B. Goldsmith

    2015-06-01

    Full Text Available Deep sequencing of the viral phoH gene, a host-derived auxiliary metabolic gene, was used to track viral diversity throughout the water column at the Bermuda Atlantic Time-series Study (BATS site in the summer (September and winter (March of three years. Viral phoH sequences reveal differences in the viral communities throughout a depth profile and between seasons in the same year. Variation was also detected between the same seasons in subsequent years, though these differences were not as great as the summer/winter distinctions. Over 3,600 phoH operational taxonomic units (OTUs; 97% sequence identity were identified. Despite high richness, most phoH sequences belong to a few large, common OTUs whereas the majority of the OTUs are small and rare. While many OTUs make sporadic appearances at just a few times or depths, a small number of OTUs dominate the community throughout the seasons, depths, and years.

  18. Allelic variation, alternative splicing and expression analysis of Psy1 gene in Hordeum chilense Roem. et Schult.

    Cristina Rodríguez-Suárez

    Full Text Available BACKGROUND: The wild barley Hordeum chilense Roem. et Schult. is a valuable source of genes for increasing carotenoid content in wheat. Tritordeums, the amphiploids derived from durum or common wheat and H. chilense, systematically show higher values of yellow pigment colour and carotenoid content than durum wheat. Phytoene synthase 1 gene (Psy1 is considered a key step limiting the carotenoid biosynthesis, and the correlation of Psy1 transcripts accumulation and endosperm carotenoid content has been demonstrated in the main grass species. METHODOLOGY/PRINCIPAL FINDINGS: We analyze the variability of Psy1 alleles in three lines of H. chilense (H1, H7 and H16 representing the three ecotypes described in this species. Moreover, we analyze Psy1 expression in leaves and in two seed developing stages of H1 and H7, showing mRNA accumulation patterns similar to those of wheat. Finally, we identify thirty-six different transcripts forms originated by alternative splicing of the 5' UTR and/or exons 1 to 5 of Psy1 gene. Transcripts function is tested in a heterologous complementation assay, revealing that from the sixteen different predicted proteins only four types (those of 432, 370, 364 and 271 amino acids, are functional in the bacterial system. CONCLUSIONS/SIGNIFICANCE: The large number of transcripts originated by alternative splicing of Psy1, and the coexistence of functional and non functional forms, suggest a fine regulation of PSY activity in H. chilense. This work is the first analysis of H. chilense Psy1 gene and the results reported here are the bases for its potential use in carotenoid enhancement in durum wheat.

  19. Gene expression variation between African Americans and whites is associated with coronary artery calcification: the multiethnic study of atherosclerosis

    Huang, Chiang-Ching; Lloyd-Jones, Donald M.; Guo, Xiuqing; Rajamannan, Nalini M.; Lin, Simon; Du, Pan; Huang, QiQuan; Hou, Lifang; Liu, Kiang

    2011-01-01

    Coronary artery calcium (CAC) is a strong indicator of total atherosclerosis burden. Epidemiological data have shown substantial differences in CAC prevalence and severity between African Americans and whites. However, little is known about the molecular mechanisms underlying initiation and progression of CAC. Microarray gene expression profiling of peripheral blood leucocytes was performed from 119 healthy women aged 50 yr or above in the Multi-Ethnic Study of Atherosclerosis cohort; 48 wome...

  20. In silico structure-function analysis of pathological variation in the HSD11B2 gene sequence

    Manning, Jonathan R.; Bailey, Matthew A; Soares, Dinesh C.; Dunbar, Donald R.; Mullins, John J.

    2010-01-01

    11β-Hydroxysteroid dehydrogenase type 2 (11βHSD2) is a short-chain dehydrogenase/reductase (SDR) responsible for inactivating cortisol and preventing its binding to the mineralocorticoid receptor (MR). Nonfunctional mutations in HSD11B2, the gene encoding 11βHSD2, cause the hypertensive syndrome of apparent mineralocorticoid excess (AME). Like other such Mendelian disorders, AME is rare but has nevertheless helped to illuminate principles fundamental to the regulation of blood pressure. Furth...

  1. C-B3-01: Variation in Seven Obesity-Related Genes and Risk of Postmenopausal Breast Cancer

    Feigelson, Heather S.; Teras, Lauren R.; Diver, W Ryan; Tang, Weining; Patel, Alpa V.; Eugenia E Calle; Bouzyk, Mark

    2010-01-01

    Background/Aims: Obesity has been consistently associated with postmenopausal breast cancer risk. Proteins secreted by adipose tissue or involved in regulating obesity may play a role in breast tumor development. We conducted a nested case- control study among white, postmenopausal women from the American Cancer Society Cancer Prevention Study II (CPS -II) Nutrition Cohort to determine whether genes associated with obesity increase risk of breast cancer.

  2. Nucleotide sequence variation within the human tyrosine kinase B neurotrophin receptor gene (NTRK2): association with antisocial alcohol dependence

    Xu, K; Anderson, T. R.; Neyer, K. M.; Lamparella, N.; Jenkins, G.; Zhou, Z; Yuan, Q.; Virkkunen, M; Lipsky, R H

    2007-01-01

    To identify sequence variants in genes that may have roles in neuronal responses to alcohol, we resequenced the 5′ region of NTRK2 and determined linkage disequilibrium (LD) values, haplotype structure, and performed association analyses using 43 single nucleotide polymorphisms (SNPs) covering the entire NTRK2 region in a Finnish Caucasian sample of 229 alcohol dependent subjects with antisocial personality disorder and 287 healthy controls. Individually, three SNPs were associated with alcoh...

  3. Investigating the Potential Role of Genetic and Epigenetic Variation of DNA Methyltransferase Genes in Hyperplastic Polyposis Syndrome

    Drini, Musa; Nicholas C. Wong; Hamish S Scott; Craig, Jeffrey M; Dobrovic, Alexander; Chelsee A Hewitt; Dow, Christofer; Young, Joanne P; Jenkins, Mark A; Saffery, Richard; Macrae, Finlay A.

    2011-01-01

    Background Hyperplastic Polyposis Syndrome (HPS) is a condition associated with multiple serrated polyps, and an increased risk of colorectal cancer (CRC). At least half of CRCs arising in HPS show a CpG island methylator phenotype (CIMP), potentially linked to aberrant DNA methyltransferase (DNMT) activity. CIMP is associated with methylation of tumor suppressor genes including regulators of DNA mismatch repair (such as MLH1, MGMT), and negative regulators of Wnt signaling (such as WIF1). In...

  4. The influence of genetic variation in thirty selected genes on the clinical characteristics of early onset breast cancer

    Tapper, William; Hammond, Victoria; Gerty, Sue; Ennis, Sarah; Simmonds, Peter; Collins, Andrew; Eccles, Diana

    2008-01-01

    Introduction: common variants that alter breast cancer risk are being discovered. Here, we determine how these variants influence breast cancer prognosis, risk and tumour characteristics. Methods: we selected 1,001 women with early onset nonfamilial invasive breast cancer from the Prospective study of Outcomes in Sporadic versus Hereditary breast cancer (POSH) cohort and genotyped 206 single nucleotide polymorphisms (SNPs) across 30 candidate genes. After quality control, 899 cases and 13...

  5. The relationship of Bradykinin B2 receptor gene variation with obesity, hypertension and lipid variables in obese patients

    Nur Bakir

    2014-11-01

    Full Text Available Objective. This study examined the association of C-58T genotypes with obesity/hypertension related parameters and serum lipids in obese (n=108 and non-obese (n=80 patients. Materials and methods. Bradykinin receptor (B2R C-58T genotypes were determined by PCR–RFLP. Results. B2R gene C-58T frequencies for T/T (homozygous wild type, T/C (heterozygous and C/C (homozygous polymorphic genotypes for obese and non-obese patients were respectively: 36.1%, 37.5%; 45.4%, 52.5% and 18.5%, 10%. Obese patients using diuretic medication had lower C/C genotype frequency compared to T/T and T/C genotypes. Total cholesterol (T-Chol (p=0.035 levels were found to be associated with B2R C-58T polymorphism, where the T/T genotype had higher total cholesterol levels compared to the T/C genotype in obese patients. Non-obese patients using oral antidiabetic medication had higher C/C genotype frequency than that of T/T and T/C genotypes. Waist circumference (p=0.016 and diastolic blood pressure (p=0.01 levels were elevated in the non-obese subjects with the C/C genotype compared to T/C and T/T. Conclusion. Although B2R C-58T gene polymorphism was not found to be effective on obesity with logistic regression analysis in the whole study population in obese subjects, the T-Chol decreasing effect of the B2R gene C allele and the higher waist circumference measurements in the non-obese subjects may indicate there may be a link between B2R gene C-58T polymorphism and obesity in study populations of higher numbers.

  6. Network-Based Meta-Analyses of Associations of Multiple Gene Expression Profiles with Bone Mineral Density Variations in Women

    He, Hao; Cao, Shaolong; Niu, Tianhua; Zhou, Yu; Zhang, Lan; Zeng, Yong; Zhu, Wei; Wang, Yu-Ping; Deng, Hong-Wen

    2016-01-01

    Background Existing microarray studies of bone mineral density (BMD) have been critical for understanding the pathophysiology of osteoporosis, and have identified a number of candidate genes. However, these studies were limited by their relatively small sample sizes and were usually analyzed individually. Here, we propose a novel network-based meta-analysis approach that combines data across six microarray studies to identify functional modules from human protein-protein interaction (PPI) dat...

  7. Serotonin and Dopamine Gene Variation and Theory of Mind Decoding Accuracy in Major Depression: A Preliminary Investigation

    Zahavi, Arielle Y.; Sabbagh, Mark A.; Dustin Washburn; Raegan Mazurka; R. Michael Bagby; John Strauss; Kennedy, James L.; Arun Ravindran; Harkness, Kate L.

    2016-01-01

    Theory of mind-the ability to decode and reason about others' mental states-is a universal human skill and forms the basis of social cognition. Theory of mind accuracy is impaired in clinical conditions evidencing social impairment, including major depressive disorder. The current study is a preliminary investigation of the association of polymorphisms of the serotonin transporter (SLC6A4), dopamine transporter (DAT1), dopamine receptor D4 (DRD4), and catechol-O-methyl transferase (COMT) gene...

  8. Genetic variation at the NPC1L1 gene locus, plasma lipoproteins, and heart disease risk in the elderly

    Niemann-Pick C1-like 1 protein (NPC1L1) plays a critical role in intestinal cholesterol absorption. Our objective was to examine whether five variants (-133A>G, -18A>C, L272L, V1296V, and U3_28650A>G) at the NPC1L1 gene have effects on lipid levels, prevalence, and incidence of coronary heart diseas...

  9. Genetic variation in the NBS1, MRE11, RAD50 and BLM genes and susceptibility to non-Hodgkin lymphoma

    Gascoyne Randy D; Connors Joseph M; Gallagher Richard P; Lai Agnes S; Leach Stephen; MacArthur Amy C; Schuetz Johanna M; Spinelli John J; Brooks-Wilson Angela R

    2009-01-01

    Abstract Background Translocations are hallmarks of non-Hodgkin lymphoma (NHL) genomes. Because lymphoid cell development processes require the creation and repair of double stranded breaks, it is not surprising that disruption of this type of DNA repair can cause cancer. The members of the MRE11-RAD50-NBS1 (MRN) complex and BLM have central roles in maintenance of DNA integrity. Severe mutations in any of these genes cause genetic disorders, some of which are characterized by increased risk ...

  10. Serotonin and Dopamine Gene Variation and Theory of Mind Decoding Accuracy in Major Depression: A Preliminary Investigation.

    Arielle Y Zahavi

    Full Text Available Theory of mind-the ability to decode and reason about others' mental states-is a universal human skill and forms the basis of social cognition. Theory of mind accuracy is impaired in clinical conditions evidencing social impairment, including major depressive disorder. The current study is a preliminary investigation of the association of polymorphisms of the serotonin transporter (SLC6A4, dopamine transporter (DAT1, dopamine receptor D4 (DRD4, and catechol-O-methyl transferase (COMT genes with theory of mind decoding in a sample of adults with major depression. Ninety-six young adults (38 depressed, 58 non-depressed completed the 'Reading the Mind in the Eyes task' and a non-mentalistic control task. Genetic associations were only found for the depressed group. Specifically, superior accuracy in decoding mental states of a positive valence was seen in those homozygous for the long allele of the serotonin transporter gene, 9-allele carriers of DAT1, and long-allele carriers of DRD4. In contrast, superior accuracy in decoding mental states of a negative valence was seen in short-allele carriers of the serotonin transporter gene and 10/10 homozygotes of DAT1. Results are discussed in terms of their implications for integrating social cognitive and neurobiological models of etiology in major depression.

  11. Nucleotide sequence variation within the human tyrosine kinase B neurotrophin receptor gene: association with antisocial alcohol dependence.

    Xu, K; Anderson, T R; Neyer, K M; Lamparella, N; Jenkins, G; Zhou, Z; Yuan, Q; Virkkunen, M; Lipsky, R H

    2007-12-01

    To identify sequence variants in genes that may have roles in neuronal responses to alcohol, we resequenced the 5' region of tyrosine kinase B neurotrophin receptor gene (NTRK2) and determined linkage disequilibrium (LD) values, haplotype structure, and performed association analyses using 43 single nucleotide polymorphisms (SNPs) covering the entire NTRK2 region in a Finnish Caucasian sample of 229 alcohol-dependent subjects with antisocial personality disorder (ASPD) and 287 healthy controls. Individually, three SNPs were associated with alcohol dependence and alcohol abuse (AD) (P-value from 0.0019 to 0.0059, significance level was set at Pgene in addiction in a Caucasian population with AD and a subtype of ASPD. PMID:17200667

  12. Serotonin and Dopamine Gene Variation and Theory of Mind Decoding Accuracy in Major Depression: A Preliminary Investigation

    Zahavi, Arielle Y.; Sabbagh, Mark A.; Washburn, Dustin; Mazurka, Raegan; Bagby, R. Michael; Strauss, John; Kennedy, James L.; Ravindran, Arun; Harkness, Kate L.

    2016-01-01

    Theory of mind–the ability to decode and reason about others’ mental states–is a universal human skill and forms the basis of social cognition. Theory of mind accuracy is impaired in clinical conditions evidencing social impairment, including major depressive disorder. The current study is a preliminary investigation of the association of polymorphisms of the serotonin transporter (SLC6A4), dopamine transporter (DAT1), dopamine receptor D4 (DRD4), and catechol-O-methyl transferase (COMT) genes with theory of mind decoding in a sample of adults with major depression. Ninety-six young adults (38 depressed, 58 non-depressed) completed the ‘Reading the Mind in the Eyes task’ and a non-mentalistic control task. Genetic associations were only found for the depressed group. Specifically, superior accuracy in decoding mental states of a positive valence was seen in those homozygous for the long allele of the serotonin transporter gene, 9-allele carriers of DAT1, and long-allele carriers of DRD4. In contrast, superior accuracy in decoding mental states of a negative valence was seen in short-allele carriers of the serotonin transporter gene and 10/10 homozygotes of DAT1. Results are discussed in terms of their implications for integrating social cognitive and neurobiological models of etiology in major depression. PMID:26974654

  13. Usos de Internet y éxito académico en estudiantes universitarios

    2016-07-01

    Full Text Available El uso de la tecnología provoca cambios sociales. Esto incluye el trabajo en el ámbito universitario en donde está cambiando tanto la forma de ejercer la docencia como la forma de aprender y se requiere conocer el efecto del uso de la tecnología sobre el rendimiento del alumnado. En este trabajo se investigó la incidencia del uso de Internet sobre el éxito académico del alumnado de cinco universidades de Ecuador. Se levantó una muestra aleatoria de 4.697 personas y se las categorizó en perfiles de uso de Internet para actividades académicas y para entretenimiento, utilizando análisis factorial y análisis clúster. Las categorías resultantes se utilizaron como variables independientes en modelos de regresión logística multinomial que buscaban determinar si el uso de Internet tenía incidencia sobre el éxito académico. Los resultados muestran que quienes realizan actividades interactivas con pares y profesores o quienes utilizan de forma balanceada las distintas herramientas de Internet tienden a un mayor éxito académico que aquellos que solo buscan información. En lo referente al entretenimiento, se encontró una incidencia positiva del uso de Internet sobre el éxito académico. Los estudiantes que realizan descargas de contenido de audio, video y software, y quienes utilizan todas las posibilidades de entretenimiento, presentan menor tendencia a suspender que los estudiantes que utilizan mínimamente Internet. En cuanto al género se presentan diferencias en los usos académicos y de entretenimiento.

  14. Indicadores de desempeño clave para unidades académicas universitarias

    Guillermo Yáber

    2002-01-01

    Full Text Available El propósito de este trabajo es aplicar el modelo de Gerencia de Sistemas Conductuales (G.S.C. y el enfoque sistémico de organización y gestión en una unidad académica universitaria. Se emplearon en el diseño, desarrollo, aplicación y evaluación de indicadores de desempeño clave en una unidad académica universitaria venezolana. Se utilizaron indicadores para las siguientes categorías de gestión:efecto, impacto, eficacia, eficiencia, calidad y economía. Los resultados obtenidos sugieren que la unidad académica mejora sus indicadores de efecto, impacto, y eficiencia a través del tiempo y tiene oportunidad de mejoras en las categorías de calidad y economía. Los datos para analizar la eficacia no estuvieron disponibles para el momento del estudio. Los resultados proporcionan pautas tanto para la formulación de políticas académicas como para la toma de decisiones y ejecución de acciones destinadas a corregir y mejorar el desempeño de esa dependencia universitaria. Estos indicadores y los enfoques de donde se derivan, pueden aplicarse a otras unidades académicas en la misma universidad o a otras instituciones de educación superior que ofrezcan títulos o grados académicos. Se concluye que medir y evaluar indicadores de gestión constituyen prácticas para instrumentar la autorregulación y el control de la gestión en las instituciones de educación superior.

  15. No association between variation in the NR4A1 gene locus and metabolic traits in white subjects at increased risk for type 2 diabetes

    Fritsche Andreas

    2010-06-01

    Full Text Available Abstract Background The nuclear receptor NR4A1 is implicated in metabolic regulation in insulin-sensitive tissues, such as liver, adipose tissue, and skeletal muscle. Functional loss of NR4A1 results in insulin resistance and enhanced intramuscular and hepatic lipid content. Therefore, we investigated in a cohort of white European subjects at increased risk for type 2 diabetes whether genetic variation within the NR4A1 gene locus contributes to prediabetic phenotypes, such as insulin resistance, ectopic fat distribution, or β-cell dysfunction. Methods We genotyped 1495 subjects (989 women, 506 men for five single nucleotide polymorphisms (SNPs tagging 100% of common variants (MAF = 0.05 within the NR4A1 gene locus with an r2 = 0.8. All subjects underwent an oral glucose tolerance test (OGTT, a subset additionally had a hyperinsulinemic-euglycemic clamp (n = 506. Ectopic hepatic (n = 296 and intramyocellular (n = 264 lipids were determined by magnetic resonance spectroscopy. Peak aerobic capacity, a surrogate parameter for oxidative capacity of skeletal muscle, was measured by an incremental exercise test on a motorized treadmill (n = 270. Results After appropriate adjustment and Bonferroni correction for multiple comparisons, none of the five SNPs was reliably associated with insulin sensitivity, ectopic fat distribution, peak aerobic capacity, or indices of insulin secretion (all p ≥ 0.05. Conclusions Our data suggest that common genetic variation within the NR4A1 gene locus may not play a major role in the development of prediabetic phenotypes in our white European population.

  16. Obesity and Cardiovascular Risk: Variations in Visfatin Gene Can Modify the Obesity Associated Cardiovascular Risk. Results from the Segovia Population Based-Study. Spain

    Martínez Larrad, María Teresa; Corbatón Anchuelo, Arturo; Fernández Pérez, Cristina; Pérez Barba, Milagros; Lazcano Redondo, Yera; Serrano Ríos, Manuel

    2016-01-01

    Objectives Our aim was to investigate if genetic variations in the visfatin gene (SNPs rs7789066/ rs11977021/rs4730153) could modify the cardiovascular-risk (CV-risk) despite the metabolic phenotype (obesity and glucose tolerance). In addition, we investigated the relationship between insulin sensitivity and variations in visfatin gene. Material and Methods A population-based study in rural and urban areas of the Province of Segovia, Spain, was carried out in the period of 2001–2003 years. A total of 587 individuals were included, 25.4% subjects were defined as obese (BMI ≥30 Kg/m2). Results Plasma visfatin levels were significantly higher in obese subjects with DM2 than in other categories of glucose tolerance. The genotype AA of the rs4730153 SNP was significantly associated with fasting glucose, fasting insulin and HOMA-IR (Homeostasis model assessment-insulin resistance) after adjustment for gender, age, BMI and waist circumference. The obese individuals carrying the CC genotype of the rs11977021 SNP showed higher circulating levels of fasting proinsulin after adjustment for the same variables. The genotype AA of the rs4730153 SNP seems to be protective from CV-risk either estimated by Framingham or SCORE charts in general population; and in obese and non-obese individuals. No associations with CV-risk were observed for other studied SNPs (rs11977021/rs7789066). Conclusions In summary, this is the first study which concludes that the genotype AA of the rs4730153 SNP appear to protect against CV-risk in obese and non–obese individuals, estimated by Framingham and SCORE charts. Our results confirm that the different polymorphisms in the visfatin gene might be influencing the glucose homeostasis in obese individuals. PMID:27166797

  17. Obesity and Cardiovascular Risk: Variations in Visfatin Gene Can Modify the Obesity Associated Cardiovascular Risk. Results from the Segovia Population Based-Study. Spain.

    María Teresa Martínez Larrad

    Full Text Available Our aim was to investigate if genetic variations in the visfatin gene (SNPs rs7789066/ rs11977021/rs4730153 could modify the cardiovascular-risk (CV-risk despite the metabolic phenotype (obesity and glucose tolerance. In addition, we investigated the relationship between insulin sensitivity and variations in visfatin gene.A population-based study in rural and urban areas of the Province of Segovia, Spain, was carried out in the period of 2001-2003 years. A total of 587 individuals were included, 25.4% subjects were defined as obese (BMI ≥30 Kg/m2.Plasma visfatin levels were significantly higher in obese subjects with DM2 than in other categories of glucose tolerance. The genotype AA of the rs4730153 SNP was significantly associated with fasting glucose, fasting insulin and HOMA-IR (Homeostasis model assessment-insulin resistance after adjustment for gender, age, BMI and waist circumference. The obese individuals carrying the CC genotype of the rs11977021 SNP showed higher circulating levels of fasting proinsulin after adjustment for the same variables. The genotype AA of the rs4730153 SNP seems to be protective from CV-risk either estimated by Framingham or SCORE charts in general population; and in obese and non-obese individuals. No associations with CV-risk were observed for other studied SNPs (rs11977021/rs7789066.In summary, this is the first study which concludes that the genotype AA of the rs4730153 SNP appear to protect against CV-risk in obese and non-obese individuals, estimated by Framingham and SCORE charts. Our results confirm that the different polymorphisms in the visfatin gene might be influencing the glucose homeostasis in obese individuals.

  18. Promoter polymorphisms in the MATP (SLC45A2) gene are associated with normal human skin color variation.

    Graf, Justin; Voisey, Joanne; Hughes, Ian; van Daal, Angela

    2007-07-01

    Human pigmentation is a complex physical trait in which the membrane-associated transporter protein (MATP) plays an important role as it is involved in intracellular processing and trafficking of melanosomal proteins. Recently, pathogenic mutations in MATP have been shown to cause oculocutaneous albinism type 4, while other polymorphisms are known to have a role in normal pigmentation variation. We previously reported significant associations of two coding region polymorphisms with hair, skin, and eye color in Caucasians. Here we characterize the promoter region of MATP identifying two new transcription start sites and a novel duplication (c.-1176_-1174dupAAT). A total of 700 individuals from five different population groups (529 Caucasians, 38 Asians, 46 African Americans, 47 Australian Aborigines, and 40 Spanish Basques) were genotyped for known promoter polymorphisms c.-1721C>G (rs13289) and c.-1169G>A (rs6867641), as well as c.-1176_-1174dupAAT. Allele frequencies of all three polymorphisms were significantly different between population groups. In Caucasians, the -1721G, +dup, and -1169A alleles were significantly associated with olive skin color. The three promoter polymorphisms were found to be in linkage disequilibrium with each other but not with the two previously reported coding region polymorphisms. Functional analyses in a melanoma cell line showed that the promoter haplotype -1721G, +dup, -1169A significantly decreased MATP transcription. This report provides further evidence for the involvement of MATP in normal pigmentation variation by identifying associations between MATP alleles and skin color variation in Caucasians and demonstrating a functional significance of these polymorphisms. PMID:17358008

  19. Aprendizaje autorregulado, metas académicas y rendimiento en evaluaciones de estudiantes universitarios

    Marcela Valencia Serrano

    2013-01-01

    Full Text Available Objetivo. Explorar la relación entre aprendizaje autorregulado, metas académicas y rendimiento en una evaluación académica de ocho estudiantes universitarias. Método. Se realizó una entrevista semi- estructurada, una observación directa de una sesión de estudio y protocolos verbales durante y después de la sesión. Resultados. En relación con las metas académicas, se encontró que tres estudiantes tuvieron u na única orientación a metas de dominio por aproximación, mientras que cinco orien taron a múltiples metas académicas. Respecto al aprendizaje autorregulado, se encontraron estudiantes con b ajos y altos niveles. En la relación entre aprendizaje autorregulado, metas académicas y rendimiento en la evaluación fue posible identificar tres grupos de estudiantes: (a altos niveles de autorregulación y orientación única a metas de dominio por aproximación, (b bajos niveles de autorregulación y múltipl e orientación a metas de dominio y ejecución en tendencias de aproximación y evitación, y (c variaciones en el nivel de autorregulación con múltiple orientación a metas académicas. Todas las estudiantes obtuvieron cali ficaciones aprobatorias en la evaluación, independientemente de su nivel de autorregulación y de la orientaci ón a metas académicas. Conclusión. El abordaje procedimental del aprendizaje autorregulado, en función de las metas académicas, permitió obtener información relevante para la comprensión de este proceso, por lo que se recomienda seguir realizando este tipo de estudios para dar cuenta de los diferentes fu ncionamientos de las estudiantes universitarias en tiempo real, de sus variaciones y relación con otros aspectos motivacionales involucrados en sus procesos de aprendizaje.

  20. El plagio académico: formar en competencias y buenas prácticas universitarias

    Alfaro Torres, Paloma; Juan Juárez, Teresa de

    2014-01-01

    El plagio académico es una práctica demasiado frecuente entre los estudiantes universitarios ya que las nuevas tecnologías, y en especial, Internet permiten realizarlo con facilidad. Se analiza el concepto de plagio desde diversos puntos de vista y se profundiza en las competencias informacionales del uso ético y legal de la información que debe ser acometido desde diversos frentes para inculcar la honestidad académica en la enseñanza superior