WorldWideScience

Sample records for acads gene variation

  1. The ACADS gene variation spectrum in 114 patients with short-chain acyl-CoA dehydrogenase (SCAD) deficiency is dominated by missense variations leading to protein misfolding at the cellular level

    Pedersen, Christina Bak; Kølvrå, Steen; Kølvraa, Agnete;

    2008-01-01

    , 26 missense, one start codon, and two stop codon variations. In vitro import studies of variant SCAD proteins in isolated mitochondria from SCAD deficient (SCAD-/-) mice demonstrated an increased tendency of the abnormal proteins to misfold and aggregate compared to the wild-type, a phenomenon that...... often leads to gain-of-function cellular phenotypes. However, no correlation was found between the clinical phenotype and the degree of SCAD dysfunction. We propose that SCAD deficiency should be considered as a disorder of protein folding that can lead to clinical disease in combination with other...

  2. Riboflavin-responsive oxidative phosphorylation complex I deficiency caused by defective ACAD9: new function for an old gene.

    Gerards, Mike; van den Bosch, Bianca J C; Danhauser, Katharina; Serre, Valérie; van Weeghel, Michel; Wanders, Ronald J A; Nicolaes, Gerry A F; Sluiter, Wim; Schoonderwoerd, Kees; Scholte, Hans R; Prokisch, Holger; Rötig, Agnès; de Coo, Irenaeus F M; Smeets, Hubert J M

    2011-01-01

    Mitochondrial complex I deficiency is the most common oxidative phosphorylation defect. Mutations have been detected in mitochondrial and nuclear genes, but the genetics of many patients remain unresolved and new genes are probably involved. In a consanguineous family, patients presented easy fatigability, exercise intolerance and lactic acidosis in blood from early childhood. In muscle, subsarcolemmal mitochondrial proliferation and a severe complex I deficiency were observed. Exercise intolerance and complex I activity was improved by a supplement of riboflavin at high dosage. Homozygosity mapping revealed a candidate region on chromosome three containing six mitochondria-related genes. Four genes were screened for mutations and a homozygous substitution was identified in ACAD9 (c.1594 C>T), changing the highly conserved arginine-532 into tryptophan. This mutation was absent in 188 ethnically matched controls. Protein modelling suggested a functional effect due to the loss of a stabilizing hydrogen bond in an α-helix and a local flexibility change. To test whether the ACAD9 mutation caused the complex I deficiency, we transduced fibroblasts of patients with wild-type and mutant ACAD9. Wild-type, but not mutant, ACAD9 restored complex I activity. An unrelated patient with the same phenotype was compound heterozygous for c.380 G>A and c.1405 C>T, changing arginine-127 into glutamine and arginine-469 into tryptophan, respectively. These amino acids were highly conserved and the substitutions were not present in controls, making them very probably pathogenic. Our data support a new function for ACAD9 in complex I function, making this gene an important new candidate for patients with complex I deficiency, which could be improved by riboflavin treatment. PMID:20929961

  3. Variations in IBD (ACAD8) in children with elevated C4-carnitine detected by tandem mass spectrometry newborn screening

    Pedersen, Christina B; Bischoff, Claus; Christensen, Ernst; Simonsen, Henrik; Lund, Allan M; Young, Sarah P; Koeberl, Dwight D; Millington, David S; Roe, Charles R; Roe, Diane S; Wanders, Ronald J A; Ruiter, Jos P N; Keppen, Laura D; Stein, Quinn; Knudsen, Inga; Gregersen, Niels; Andresen, Brage S

    2006-01-01

    or compound heterozygous for variations in the IBD gene have been reported. We present IBD deficiency in an additional four newborns with elevated C(4)-carnitine identified by tandem mass spectrometry (MS/MS) screening in Denmark and the United States. Three showed urinary excretions of isobutyryl...

  4. Parkinson's disease and mitochondrial gene variations

    Andalib, Sasan; Vafaee, Manouchehr Seyedi; Gjedde, Albert

    2014-01-01

    Parkinson's disease (PD) is a common disorder of the central nervous system in the elderly. The pathogenesis of PD is a complex process, with genetics as an important contributing factor. This factor may stem from mitochondrial gene variations and mutations as well as from nuclear gene variations...... and mutations. More recently, a particular role of mitochondrial dysfunction has been suggested, arising from mitochondrial DNA variations or acquired mutations in PD pathogenesis. The present review summarizes and weighs the evidence in support of mitochondrial DNA (mtDNA) variations as important...

  5. Novela académica: reflexiones sobre sus orígenes en Inglaterra y Estados Unidos

    Castagnino, María Inés

    2011-01-01

    Intentar definir la novela académica como género presenta algunas dificultades. Como características básicas, no puede decirse mucho más que que se trata de novelas protagonizadas por académicos (docentes, investigadores o ambas condiciones a la vez) que se desempeñan generalmente en el área de las humanidades, a menudo en la de literatura, y cuya acción suele transcurrir en las dependencias de una universidad. Más allá de estos denominadores comunes, y a pesar de la tendencia de algunos sect...

  6. Riboflavin-responsive oxidative phosphorylation complex I deficiency caused by defective ACAD9: new function for an old gene

    M. Gerards; B.J.C. van den Bosch; K. Danhauser; V. Serre; M. van Weeghel; R.J.A. Wanders; G.A.F. Nicolaes; W. Sluiter; K. Schoonderwoerd; H.R. Scholte; H. Prokisch; A. Rötig; I.F.M. de Coo; H.J.M. Smeets

    2011-01-01

    Mitochondrial complex I deficiency is the most common oxidative phosphorylation defect. Mutations have been detected in mitochondrial and nuclear genes, but the genetics of many patients remain unresolved and new genes are probably involved. In a consanguineous family, patients presented easy fatiga

  7. Genomic variation in Salmonella enterica core genes for epidemiological typing

    Leekitcharoenphon, Pimlapas; Lukjancenko, Oksana; Rundsten, Carsten Friis; Aarestrup, Frank Møller; Ussery, David

    2012-01-01

    time. The core genes-the genes that are conserved in all (or most) members of a genus or species-are potentially good candidates for investigating genomic variation in phylogeny and epidemiology. Results: We identify a set of 2,882 core genes clusters based on 73 publicly available Salmonella enterica...

  8. Inherited variation in immune genes and pathways and glioblastoma risk

    Schwartzbaum, Judith A.; Xiao, Yuanyuan; Liu, Yanhong; Tsavachidis, Spyros; Berger, Mitchel S.; Bondy, Melissa L,; Chang, Jeffrey S.; Chang, Susan M.; Decker, Paul A.; Ding, Bo; Hepworth, Sarah J; Richard S. Houlston; Hosking, Fay J; Jenkins, Robert B.; Kosel, Matthew L.

    2010-01-01

    To determine whether inherited variations in immune function single-nucleotide polymorphisms (SNPs), genes or pathways affect glioblastoma risk, we analyzed data from recent genome-wide association studies in conjunction with predefined immune function genes and pathways. Gene and pathway analyses were conducted on two independent data sets using 6629 SNPs in 911 genes on 17 immune pathways from 525 glioblastoma cases and 602 controls from the University of California, San Francisco (UCSF) an...

  9. Population genetic variation in gene expression is associated withphenotypic variation in Saccharomyces cerevisiae

    Fay, Justin C.; McCullough, Heather L.; Sniegowski, Paul D.; Eisen, Michael B.

    2004-02-25

    The relationship between genetic variation in gene expression and phenotypic variation observable in nature is not well understood. Identifying how many phenotypes are associated with differences in gene expression and how many gene-expression differences are associated with a phenotype is important to understanding the molecular basis and evolution of complex traits. Results: We compared levels of gene expression among nine natural isolates of Saccharomyces cerevisiae grown either in the presence or absence of copper sulfate. Of the nine strains, two show a reduced growth rate and two others are rust colored in the presence of copper sulfate. We identified 633 genes that show significant differences in expression among strains. Of these genes,20 were correlated with resistance to copper sulfate and 24 were correlated with rust coloration. The function of these genes in combination with their expression pattern suggests the presence of both correlative and causative expression differences. But the majority of differentially expressed genes were not correlated with either phenotype and showed the same expression pattern both in the presence and absence of copper sulfate. To determine whether these expression differences may contribute to phenotypic variation under other environmental conditions, we examined one phenotype, freeze tolerance, predicted by the differential expression of the aquaporin gene AQY2. We found freeze tolerance is associated with the expression of AQY2. Conclusions: Gene expression differences provide substantial insight into the molecular basis of naturally occurring traits and can be used to predict environment dependent phenotypic variation.

  10. Propagation of genetic variation in gene regulatory networks

    Plahte, Erik; Gjuvsland, Arne B; Omholt, Stig W.

    2013-01-01

    A future quantitative genetics theory should link genetic variation to phenotypic variation in a causally cohesive way based on how genes actually work and interact. We provide a theoretical framework for predicting and understanding the manifestation of genetic variation in haploid and diploid regulatory networks with arbitrary feedback structures and intra-locus and inter-locus functional dependencies. Using results from network and graph theory, we define propagation functions describing h...

  11. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  12. Pathogenicity gene variations within the order Entomophthorales

    Grell, Morten Nedergaard; Jensen, Annette Bruun; Lange, Lene

    Fungi within the order Entomophthorales (subphylum Entomophthoromycotina) are obligate biotrophic pathogens of arthropods with a remarkable narrow host range. Infection takes place through the cuticle when conidia hit a susceptible host, facilitated by enzymatic and mechanical mechanisms. In the ...... pathogenicity genes within genera Entomophthora and Pandora, using fungal genomic DNA originating from field-collected, infected insect host species of dipteran (flies, mosquitoes) or hemipteran (aphid) origin....

  13. Genetic Variation in Candidate Genes Like the HMGA2 Gene in the Extremely Tall

    Hendriks, A. E. J.; Brown, M. R.; Boot, A. M.; Oostra, B. A.; Drop, S. L. S.; Parks, J. S.

    2011-01-01

    Background/Aims: Genetic variation in several candidate genes has been associated with short stature. Recently, a high-mobility group A2 (HMGA2) gene SNP has been robustly associated with height in the general population. Only few have attempted to study these genes in extremely tall stature. We the

  14. Expanding the Boundaries of Gene Variation for Crop Improvement

    Directed and undirected mutagenesis continues to offer unique opportunities for crop improvement. Mutations also occur naturally and different forms are present in each strain of plants within and among species. Modifying genes affect the expression of all mutants and examples exist where the deleterious features of a mutant can be significantly changed by selection. New technologies, including those associated with genomics such as re-sequencing, TILLING, and RNA interference, allow the detection of gene variation at an unprecedented frequency. Knowledge of genes that affect recombination among homoeologous chromosomes may lead to inducible methods regulating the exchange among chromosomes in a polyploid species. Forward and reverse genetic methods are readily available in many species, including model plant species. There are an estimated one million sites in the japonica rice genome tagged via Tos17, Ac/Ds, T-DNA, and other insertion elements. Site-specific mutagenesis and gene replacement methods may replace the need for transgenic technology in some cases. Transcriptome modification occurs via mutagen treatment, aneuploidy, and uniparental chromosome loss, and sometimes results in a mutant phenotype. The boundaries of gene variation appear to be more expansive as plant genetics knowledge and technologies increase. (author)

  15. Partitioning of genetic variation between regulatory and coding gene segments: the predominance of software variation in genes encoding introvert proteins.

    Mitchison, A

    1997-01-01

    In considering genetic variation in eukaryotes, a fundamental distinction can be made between variation in regulatory (software) and coding (hardware) gene segments. For quantitative traits the bulk of variation, particularly that near the population mean, appears to reside in regulatory segments. The main exceptions to this rule concern proteins which handle extrinsic substances, here termed extrovert proteins. The immune system includes an unusually large proportion of this exceptional category, but even so its chief source of variation may well be polymorphism in regulatory gene segments. The main evidence for this view emerges from genome scanning for quantitative trait loci (QTL), which in the case of the immune system points to a major contribution of pro-inflammatory cytokine genes. Further support comes from sequencing of major histocompatibility complex (Mhc) class II promoters, where a high level of polymorphism has been detected. These Mhc promoters appear to act, in part at least, by gating the back-signal from T cells into antigen-presenting cells. Both these forms of polymorphism are likely to be sustained by the need for flexibility in the immune response. Future work on promoter polymorphism is likely to benefit from the input from genome informatics. PMID:9148788

  16. Gene Tree Discordance Causes Apparent Substitution Rate Variation.

    Mendes, Fábio K; Hahn, Matthew W

    2016-07-01

    Substitution rates are known to be variable among genes, chromosomes, species, and lineages due to multifarious biological processes. Here, we consider another source of substitution rate variation due to a technical bias associated with gene tree discordance. Discordance has been found to be rampant in genome-wide data sets, often due to incomplete lineage sorting (ILS). This apparent substitution rate variation is caused when substitutions that occur on discordant gene trees are analyzed in the context of a single, fixed species tree. Such substitutions have to be resolved by proposing multiple substitutions on the species tree, and we therefore refer to this phenomenon as Substitutions Produced by ILS (SPILS). We use simulations to demonstrate that SPILS has a larger effect with increasing levels of ILS, and on trees with larger numbers of taxa. Specific branches of the species trees are consistently, but erroneously, inferred to be longer or shorter, and we show that these branches can be predicted based on discordant tree topologies. Moreover, we observe that fixing a species tree topology when performing tests of positive selection increases the false positive rate, particularly for genes whose discordant topologies are most affected by SPILS. Finally, we use data from multiple Drosophila species to show that SPILS can be detected in nature. Although the effects of SPILS are modest per gene, it has the potential to affect substitution rate variation whenever high levels of ILS are present, particularly in rapid radiations. The problems outlined here have implications for character mapping of any type of trait, and for any biological process that causes discordance. We discuss possible solutions to these problems, and areas in which they are likely to have caused faulty inferences of convergence and accelerated evolution. PMID:26927960

  17. Inherited variation in immune genes and pathways and glioblastoma risk.

    Schwartzbaum, Judith A; Xiao, Yuanyuan; Liu, Yanhong; Tsavachidis, Spyros; Berger, Mitchel S; Bondy, Melissa L; Chang, Jeffrey S; Chang, Susan M; Decker, Paul A; Ding, Bo; Hepworth, Sarah J; Houlston, Richard S; Hosking, Fay J; Jenkins, Robert B; Kosel, Matthew L; McCoy, Lucie S; McKinney, Patricia A; Muir, Kenneth; Patoka, Joe S; Prados, Michael; Rice, Terri; Robertson, Lindsay B; Schoemaker, Minouk J; Shete, Sanjay; Swerdlow, Anthony J; Wiemels, Joe L; Wiencke, John K; Yang, Ping; Wrensch, Margaret R

    2010-10-01

    To determine whether inherited variations in immune function single-nucleotide polymorphisms (SNPs), genes or pathways affect glioblastoma risk, we analyzed data from recent genome-wide association studies in conjunction with predefined immune function genes and pathways. Gene and pathway analyses were conducted on two independent data sets using 6629 SNPs in 911 genes on 17 immune pathways from 525 glioblastoma cases and 602 controls from the University of California, San Francisco (UCSF) and a subset of 6029 SNPs in 893 genes from 531 cases and 1782 controls from MD Anderson (MDA). To further assess consistency of SNP-level associations, we also compared data from the UK (266 cases and 2482 controls) and the Mayo Clinic (114 cases and 111 controls). Although three correlated epidermal growth factor receptor (EGFR) SNPs were consistently associated with glioblastoma in all four data sets (Mantel-Haenzel P values = 1 × 10⁻⁵ to 4 × 10⁻³), independent replication is required as genome-wide significance was not attained. In gene-level analyses, eight immune function genes were significantly (minP < 0.05) associated with glioblastoma; the IL-2RA (CD25) cytokine gene had the smallest minP values in both UCSF (minP = 0.01) and MDA (minP = 0.001) data sets. The IL-2RA receptor is found on the surface of regulatory T cells potentially contributing to immunosuppression characteristic of the glioblastoma microenvironment. In pathway correlation analyses, cytokine signaling and adhesion-extravasation-migration pathways showed similar associations with glioblastoma risk in both MDA and UCSF data sets. Our findings represent the first systematic description of immune genes and pathways that characterize glioblastoma risk. PMID:20668009

  18. Genomic and gene variation in Mycoplasma hominis strains

    Christiansen, Gunna; Andersen, H; Birkelund, Svend;

    1987-01-01

    DNAs from 14 strains of Mycoplasma hominis isolated from various habitats, including strain PG21, were analyzed for genomic heterogeneity. DNA-DNA filter hybridization values were from 51 to 91%. Restriction endonuclease digestion patterns, analyzed by agarose gel electrophoresis, revealed no...... identity or cluster formation between strains. Variation within M. hominis rRNA genes was analyzed by Southern hybridization of EcoRI-cleaved DNA hybridized with a cloned fragment of the rRNA gene from the mycoplasma strain PG50. Five of the M. hominis strains showed identical hybridization patterns. These...... hybridization patterns were compared with those of 12 other mycoplasma species, which showed a much more complex band pattern. Cloned nonribosomal RNA gene fragments of M. hominis PG21 DNA were analyzed, and the fragments were used to demonstrate heterogeneity among the strains. A monoclonal antibody against...

  19. rendimiento académico

    Ernesto Barceló Martínez

    2006-01-01

    Full Text Available Esta investigación se propuso encontrar la posible relación entre el rendimiento académico y la ausencia de ciertas habilidades cognoscitivas denominadas desde la neuropsicología como funciones ejecutivas, en un grupo de estudiantes universitarios. Se exploró entonces el estado de las funciones ejecutivas en estudiantes universitarios que presentaban bajo y alto rendimiento académico. El diseño utilizado en esta investigación fue el transeccional descriptivo. El análisis de los resultados se hizo utilizando el paquete estadístico Statistical Package for Social Sciences (spss. Estos mostraron que, en general, no existen diferencias significativas entre los estudiantes de bajo y alto rendimiento académico. Es decir, mostraron que el rendimiento académico no está directamente relacionado con déficits a nivel de las habilidades ejecutivas, pero sí podría estarlo a nivel del lenguaje y de los antecedentes familiares, psicológicos y académicos en estos estudiantes.

  20. Theories of Population Variation in Genes and Genomes

    Christiansen, Freddy

    genetics, while emphasizing the close interplay between theory and empiricism. Traditional topics such as genetic and phenotypic variation, mutation, migration, and linkage are covered and advanced by contemporary coalescent theory, which describes the genealogy of genes in a population, ultimately...... connecting them to a single common ancestor. Effects of selection, particularly genomic effects, are discussed with reference to molecular genetic variation. The book is designed for students of population genetics, bioinformatics, evolutionary biology, molecular evolution, and theoretical biology—as well as...... biologists, molecular biologists, breeders, biomathematicians, and biostatisticians. •    Up-to-date treatment of key areas in classical and modern theoretical population genetics •    In-depth coverage of coalescent theory •    Timely discussion of genomic effects of selection •    Inspired by, and with...

  1. Genome Editing of Structural Variations: Modeling and Gene Correction.

    Park, Chul-Yong; Sung, Jin Jea; Kim, Dong-Wook

    2016-07-01

    The analysis of chromosomal structural variations (SVs), such as inversions and translocations, was made possible by the completion of the human genome project and the development of genome-wide sequencing technologies. SVs contribute to genetic diversity and evolution, although some SVs can cause diseases such as hemophilia A in humans. Genome engineering technology using programmable nucleases (e.g., ZFNs, TALENs, and CRISPR/Cas9) has been rapidly developed, enabling precise and efficient genome editing for SV research. Here, we review advances in modeling and gene correction of SVs, focusing on inversion, translocation, and nucleotide repeat expansion. PMID:27016031

  2. Nucleotide variation in the Toxoplasma gondii micronemal protein 8 gene.

    Li, Z Y; Song, H Q; Wang, C R; Zhu, X Q

    2016-01-01

    Toxoplasma gondii is a successful opportunistic protozoan distributed worldwide, which can infect all vertebrates, leading to serious infection, blindness, and abortion. Micronemal (MIC) proteins are critically important for T. gondii infection, as they participate in various stages of the Toxoplasma life cycle, including invasion and attachment to host cells. MIC8 secretion relies on the concentration of intracellular calcium, and can mediate the invasion of T. gondii by interacting with soluble MIC3. To investigate genetic diversity of the MIC8 gene, 16 T. gondii strains from different hosts and geographical locations, and two reference isolates (ToxoDB: TGME49_245490 and TGVEG_245490) were examined in this study. The results showed that all the examined MIC8 genes are 2055 bp, with an A+T content ranging from 50.2 to 50.6%. Conversely, lower levels of variation were detected within their nucleotide and amino acid sequences. Phylogenetic analyses indicated that three classical genotypes of T. gondii and the ToxoDB#9 genotype did not group exclusively via Bayesian inference, maximum parsimony, neighbor joining, and/or maximum likelihood assays based on the nucleotide and amino acid sequences of the MIC8 gene. In summary, the T. gondii MIC8 gene is not a suitable marker for population genetic studies of this parasite. PMID:27173337

  3. Sequence variations in the FAD2 gene in seeded pumpkins.

    Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P

    2015-01-01

    Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2. PMID:26782391

  4. Variations in CCL3L gene cluster sequence and non-specific gene copy numbers

    Edberg Jeffrey C

    2010-03-01

    Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.

  5. Expanding the boundaries of gene variation for crop improvement

    The increased attention on genomics and the use of model species have greatly expanded the ability to detect and create variation. At least 23 plant species either have their genome sequenced or will soon be sequenced. Utilization of the TILLING technology in wheat has allowed the identification of more variation at the waxy locus than had been detected in the previous 25 years. Site-specific mutagenesis via oligonucleotide mismatches or zinc finger nucleases directed toward specific genes allows changes in a directed manner. The use of RNAi allows expression changes leading to useful variation such as root-knot resistance in Arabidopsis, reduction in cotton seed gossypol, cytoplasmic male sterility in tomato and tobacco, and delayed senescence in wheat. We have produced oat plants with individual maize chromosomes by crossing oat x maize followed by embryo rescue. Oat-maize addition lines (OMAs) are now available for all 10 maize chromosomes in various oat genetic backgrounds. OMAs also have been produced with the maize chromosomes coming from different genetic backgrounds (Seneca 60, B73 and Mo17). Monosomic OMAs have been gamma-irradiated to produce Radiation Hybrid (RH) lines with either a diminutive form of the maize chromosome addition or a translocation of a piece of the maize chromosome with an oat chromosome. Approximately 650 RH lines have been produced and defined by 40 markers for that particular chromosome. The OMA and RH lines are useful for many genetic studies, such as mapping individual sequences (polymorphisms are not required), transposable elements, and members of gene families; chromosome isolation, chromosome pairing, centromere isolation, etc. Also of interest is the evaluation of the materials for the introgression of maize characteristics into oat, such as disease resistance and C4 photosynthesis. All of these technologies expand the boundaries for more directed genomic changes enhancing the options for crop improvement. (author)

  6. Haplotypes and Sequence Variation in the Ovine Adiponectin Gene (ADIPOQ

    Qing-Ming An

    2015-11-01

    Full Text Available The adiponectin gene (ADIPOQ plays an important role in energy homeostasis. In this study five separate regions (regions 1 to 5 of ovine ADIPOQ were analysed using PCR-SSCP. Four different PCR-SSCP patterns (A1-D1, A2-D2 were detected in region-1 and region-2, respectively, with seven and six SNPs being revealed. In region-3, three different patterns (A3-C3 and three SNPs were observed. Two patterns (A4-B4, A5-B5 and two and one SNPs were observed in region-4 and region-5, respectively. In total, nineteen SNPs were detected, with five of them in the coding region and two (c.46T/C and c.515G/A putatively resulting in amino acid changes (p.Tyr16His and p.Lys172Arg. In region-1, -2 and -3 of 316 sheep from eight New Zealand breeds, variants A1, A2 and A3 were the most common, although variant frequencies differed in the eight breeds. Across region-1 and region-3, nine haplotypes were identified and haplotypes A1-A3, A1-C3, B1-A3 and B1-C3 were most common. These results indicate that the ADIPOQ gene is polymorphic and suggest that further analysis is required to see if the variation in the gene is associated with animal production traits.

  7. Variations in ORAI1 Gene Associated with Kawasaki Disease.

    Onouchi, Yoshihiro; Fukazawa, Ryuji; Yamamura, Kenichiro; Suzuki, Hiroyuki; Kakimoto, Nobuyuki; Suenaga, Tomohiro; Takeuchi, Takashi; Hamada, Hiromichi; Honda, Takafumi; Yasukawa, Kumi; Terai, Masaru; Ebata, Ryota; Higashi, Kouji; Saji, Tsutomu; Kemmotsu, Yasushi; Takatsuki, Shinichi; Ouchi, Kazunobu; Kishi, Fumio; Yoshikawa, Tetsushi; Nagai, Toshiro; Hamamoto, Kunihiro; Sato, Yoshitake; Honda, Akihito; Kobayashi, Hironobu; Sato, Junichi; Shibuta, Shoichi; Miyawaki, Masakazu; Oishi, Ko; Yamaga, Hironobu; Aoyagi, Noriyuki; Yoshiyama, Megumi; Miyashita, Ritsuko; Murata, Yuji; Fujino, Akihiro; Ozaki, Kouichi; Kawasaki, Tomisaku; Abe, Jun; Seki, Mitsuru; Kobayashi, Tohru; Arakawa, Hirokazu; Ogawa, Shunichi; Hara, Toshiro; Hata, Akira; Tanaka, Toshihiro

    2016-01-01

    Kawasaki disease (KD; MIM#61175) is a systemic vasculitis syndrome with unknown etiology which predominantly affects infants and children. Recent findings of susceptibility genes for KD suggest possible involvement of the Ca(2+)/NFAT pathway in the pathogenesis of KD. ORAI1 is a Ca(2+) release activated Ca(2+) (CRAC) channel mediating store-operated Ca(2+) entry (SOCE) on the plasma membrane. The gene for ORAI1 is located in chromosome 12q24 where a positive linkage signal was observed in our previous affected sib-pair study of KD. A common non-synonymous single nucleotide polymorphism located within exon 2 of ORAI1 (rs3741596) was significantly associated with KD (P = 0.028 in the discovery sample set (729 KD cases and 1,315 controls), P = 0.0056 in the replication sample set (1,813 KD cases vs. 1,097 controls) and P = 0.00041 in a meta-analysis by the Mantel-Haenszel method). Interestingly, frequency of the risk allele of rs3741596 is more than 20 times higher in Japanese compared to Europeans. We also found a rare 6 base-pair in-frame insertion variant associated with KD (rs141919534; 2,544 KD cases vs. 2,414 controls, P = 0.012). These data indicate that ORAI1 gene variations are associated with KD and may suggest the potential importance of the Ca(2+)/NFAT pathway in the pathogenesis of this disorder. PMID:26789410

  8. Structure and sequence variation of mink interleukin-6 gene

    Aleutian disease (AD) is the number one disease threat to the survival and future of the mink industry in Nova Scotia and the world. Several ranchers have gone out of business in recent years in Nova Scotia as a direct result of AD. Currently, the control measure for AD consists of testing and slaughtering of infected mink. This practice has not been effective in controlling the disease. Finding a means of controlling AD is the number one priority for the mink industry in Nova Scotia. An effective control measure will have a long-term positive effect on the rural economy by improving production potential of mink and reducing production cost. It has been shown that antiviral antibodies produced by activated immune system cells sometimes combine with interleukin-6 (IL-6) to form immune complexes that cause AD in mink. There is evidence of a significant relationship between nucleotide variations in IL-6 gene and the onset of certain diseases in humans, which bears similar symptoms to AD. Furthermore, pathological symptoms of AD resemble those of other conditions, such as systemic lupus erythematosus (SLE) and Castleman Diseases in humans, where overproduction of IL-6 coincides with the severity of the disease. These findings suggest that IL-6 could be a candidate gene and warrant investigation vis-a-vis differences among mink genotypes in resistance or tolerance to ADV infection. The sequence of the IL-6 gene in mink was done and identification of polymorphisms was used to evaluate the potential role of this gene in the immune system response to infections. The 4678 bp promoter region, five exons and four introns of the interleukin-6 (IL-6) gene were bi-directionally sequenced in four unrelated mink from each of the wild, black, brown, pastel and sapphire mink (Genbank accession number (EF620932). The 344 bp promoter region of the gene contained several transcription binding sites. One exonic and seven intronic single nucleotide polymorphisms (SNP) were detected by

  9. Variations of the perforin gene in patients with multiple sclerosis.

    Cappellano, G; Orilieri, E; Comi, C; Chiocchetti, A; Bocca, S; Boggio, E; Bernardone, I S; Cometa, A; Clementi, R; Barizzone, N; D'Alfonso, S; Corrado, L; Galimberti, D; Scarpini, E; Guerini, F R; Caputo, D; Paolicelli, D; Trojano, M; Figà-Talamanca, L; Salvetti, M; Perla, F; Leone, M; Monaco, F; Dianzani, U

    2008-07-01

    Perforin is involved in cell-mediated cytotoxicity and mutations of its gene (PRF1) cause familial hemophagocytic lymphohistiocytosis (FLH2). PRF1 sequencing in 190 patients with multiple sclerosis and 268 controls detected two FLH2-associated variations (A91V, N252S) in both groups and six novel mutations (C999T, G1065A, G1428A, A1620G, G719A, C1069T) in patients. All together, carriers of these variations were more frequent in patients than in controls (phenotype frequency: 17 vs 9%, P=0.0166; odds ratio (OR)=2.06, 95% confidence interval (CI): 1.13-3.77). Although A91V was the most frequent variation and displayed a trend of association with multiple sclerosis (MS) in the first population of patients and controls (frequency of the 91V allele: 0.076 vs 0.043, P=0.044), we used it as a marker to confirm PRF1 involvement in MS and assessed its frequency in a second population of 966 patients and 1520 controls. Frequency of the 91V allele was significantly higher in patients than in controls also in the second population (0.075 vs 0.058%, P=0.019). In the combined cohorts of 1156 patients and 1788 controls, presence of the 91V allele in single or double dose conferred an OR=1.38 (95% CI=1.10-1.74). These data suggest that A91V and possibly other perforin variations indicate susceptibility to MS. PMID:18496551

  10. Human beta-defensin gene copy number variation and consequences in disease and evolution

    Pala, Raquel Rodrigues

    2012-01-01

    Research on human genetic variation has shown that the human genome is not a fixed, invariant framework, but that there can be extensive structural variation. This variation includes copy number variation (CNV), which can lead to changes in DNA dosage contributing significantly to variation between individual human genomes and heritable traits. Human beta-defensins are small, secreted antimicrobial peptides encoded by DEFB genes located in a cluster of at least seven genes on 8p23.1. These...

  11. Copy number variations in alternative splicing gene networks impact lifespan.

    Joseph T Glessner

    Full Text Available Longevity has a strong genetic component evidenced by family-based studies. Lipoprotein metabolism, FOXO proteins, and insulin/IGF-1 signaling pathways in model systems have shown polygenic variations predisposing to shorter lifespan. To test the hypothesis that rare variants could influence lifespan, we compared the rates of CNVs in healthy children (0-18 years of age with individuals 67 years or older. CNVs at a significantly higher frequency in the pediatric cohort were considered risk variants impacting lifespan, while those enriched in the geriatric cohort were considered longevity protective variants. We performed a whole-genome CNV analysis on 7,313 children and 2,701 adults of European ancestry genotyped with 302,108 SNP probes. Positive findings were evaluated in an independent cohort of 2,079 pediatric and 4,692 geriatric subjects. We detected 8 deletions and 10 duplications that were enriched in the pediatric group (P=3.33×10(-8-1.6×10(-2 unadjusted, while only one duplication was enriched in the geriatric cohort (P=6.3×10(-4. Population stratification correction resulted in 5 deletions and 3 duplications remaining significant (P=5.16×10(-5-4.26×10(-2 in the replication cohort. Three deletions and four duplications were significant combined (combined P=3.7×10(-4-3.9×10(-2. All associated loci were experimentally validated using qPCR. Evaluation of these genes for pathway enrichment demonstrated ~50% are involved in alternative splicing (P=0.0077 Benjamini and Hochberg corrected. We conclude that genetic variations disrupting RNA splicing could have long-term biological effects impacting lifespan.

  12. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2014-01-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is…

  13. Looking on the bright side of serotonin transporter gene variation.

    Homberg, Judith R; Lesch, Klaus-Peter

    2011-03-15

    Converging evidence indicates an association of the short (s), low-expressing variant of the repeat length polymorphism, serotonin transporter-linked polymorphic region (5-HTTLPR), in the human serotonin transporter gene (5-HTT, SERT, SLC6A4) with anxiety-related traits and increased risk for depression in interaction with psychosocial adversity across the life span. However, genetically driven deficient serotonin transporter (5-HTT) function would not have been maintained throughout evolution if it only exerted negative effects without conveying any gain of function. Here, we review recent findings that humans and nonhuman primates carrying the s variant of the 5-HTTLPR outperform subjects carrying the long allele in an array of cognitive tasks and show increased social conformity. In addition, studies in 5-HTT knockout rodents are included that provide complementary insights in the beneficial effects of the 5-HTTLPR s-allele. We postulate that hypervigilance, mediated by hyperactivity in corticolimbic structures, may be the common denominator in the anxiety-related traits and (social) cognitive superiority of s-allele carriers and that environmental conditions determine whether a response will turn out to be negative (emotional) or positive (cognitive, in conformity with the social group). Taken together, these findings urge for a conceptual change in the current deficit-oriented connotation of the 5-HTTLPR variants. In fact, these factors may counterbalance or completely offset the negative consequences of the anxiety-related traits. This notion may not only explain the modest effect size of the 5-HTTLPR and inconsistent reports but may also lead to a more refined appreciation of allelic variation in 5-HTT function. PMID:21047622

  14. Variations in COMT Gene Interact With Parenting to Influence Attention in Early Development1

    Voelker, Pascale; Sheese, Brad E.; Rothbart, Mary K.; Posner, Michael I.

    2009-01-01

    Attention influences many aspects of cognitive development. Variations in the COMT gene, known to affect dopamine neurotransmission, have frequently been found to influence attention in adults and older children. In this paper we examined 2 year old children and found that variation in the COMT gene influenced attention in a task involving looking to a sequence of visual stimuli. Because the influence of another dopamine related gene (DRD4) has been shown to interact with parenting quality at...

  15. The Relationship between Gene Network Structure and Expression Variation among Individuals and Species.

    Sears, Karen E; Maier, Jennifer A; Rivas-Astroza, Marcelo; Poe, Rachel; Zhong, Sheng; Kosog, Kari; Marcot, Jonathan D; Behringer, Richard R; Cretekos, Chris J; Rasweiler, John J; Rapti, Zoi

    2015-08-01

    Variation among individuals is a prerequisite of evolution by natural selection. As such, identifying the origins of variation is a fundamental goal of biology. We investigated the link between gene interactions and variation in gene expression among individuals and species using the mammalian limb as a model system. We first built interaction networks for key genes regulating early (outgrowth; E9.5-11) and late (expansion and elongation; E11-13) limb development in mouse. This resulted in an Early (ESN) and Late (LSN) Stage Network. Computational perturbations of these networks suggest that the ESN is more robust. We then quantified levels of the same key genes among mouse individuals and found that they vary less at earlier limb stages and that variation in gene expression is heritable. Finally, we quantified variation in gene expression levels among four mammals with divergent limbs (bat, opossum, mouse and pig) and found that levels vary less among species at earlier limb stages. We also found that variation in gene expression levels among individuals and species are correlated for earlier and later limb development. In conclusion, results are consistent with the robustness of the ESN buffering among-individual variation in gene expression levels early in mammalian limb development, and constraining the evolution of early limb development among mammalian species. PMID:26317994

  16. Variation in the Trichothecene Mycotoxin Biosynthetic Gene Cluster in Fusarium

    Trichothecene mycotoxins are produced by some plant pathogenic species of the fungus Fusarium and can contribute to its virulence on some plants. In Fusarium graminearum and F. sporotrichioides trichothecene biosynthetic enzymes are encoded at three loci: the single-gene TRI101 locus; the two-gene ...

  17. Toward the discovery of itemsets with significant variations in gene expression matrices

    Kaytoue-Uberall, Mehdi; Duplessis, Sébastien; Napoli, Amedeo

    2008-01-01

    This paper presents new syntactic constraints for itemset mining in gene expression matrices. Biologists are interested in identifying gene expression profiles which present similar quantitative variation features. A two dimensional gene expression profile representation is introduced and adapted to itemset mining allowing to control gene expression. Syntactic constraints introduce expert knowledge at the beginning of the Knowledge Discovery in Databases process and are used to discover items...

  18. Genetic variation in a member of the laminin gene family affects variation in body composition in Drosophila and humans

    Hunter Gary R

    2008-08-01

    Full Text Available Abstract Background The objective of the present study was to map candidate loci influencing naturally occurring variation in triacylglycerol (TAG storage using quantitative complementation procedures in Drosophila melanogaster. Based on our results from Drosophila, we performed a human population-based association study to investigate the effect of natural variation in LAMA5 gene on body composition in humans. Results We identified four candidate genes that contributed to differences in TAG storage between two strains of D. melanogaster, including Laminin A (LanA, which is a member of the α subfamily of laminin chains. We confirmed the effects of this gene using a viable LanA mutant and showed that female flies homozygous for the mutation had significantly lower TAG storage, body weight, and total protein content than control flies. Drosophila LanA is closely related to human LAMA5 gene, which maps to the well-replicated obesity-linkage region on chromosome 20q13.2-q13.3. We tested for association between three common single nucleotide polymorphisms (SNPs in the human LAMA5 gene and variation in body composition and lipid profile traits in a cohort of unrelated women of European American (EA and African American (AA descent. In both ethnic groups, we found that SNP rs659822 was associated with weight (EA: P = 0.008; AA: P = 0.05 and lean mass (EA: P= 0.003; AA: P = 0.03. We also found this SNP to be associated with height (P = 0.01, total fat mass (P = 0.01, and HDL-cholesterol (P = 0.003 but only in EA women. Finally, significant associations of SNP rs944895 with serum TAG levels (P = 0.02 and HDL-cholesterol (P = 0.03 were observed in AA women. Conclusion Our results suggest an evolutionarily conserved role of a member of the laminin gene family in contributing to variation in weight and body composition.

  19. Transcriptome analysis reveals novel patterning and pigmentation genes underlying Heliconius butterfly wing pattern variation

    Hines Heather M

    2012-06-01

    Full Text Available Abstract Background Heliconius butterfly wing pattern diversity offers a unique opportunity to investigate how natural genetic variation can drive the evolution of complex adaptive phenotypes. Positional cloning and candidate gene studies have identified a handful of regulatory and pigmentation genes implicated in Heliconius wing pattern variation, but little is known about the greater developmental networks within which these genes interact to pattern a wing. Here we took a large-scale transcriptomic approach to identify the network of genes involved in Heliconius wing pattern development and variation. This included applying over 140 transcriptome microarrays to assay gene expression in dissected wing pattern elements across a range of developmental stages and wing pattern morphs of Heliconius erato. Results We identified a number of putative early prepattern genes with color-pattern related expression domains. We also identified 51 genes differentially expressed in association with natural color pattern variation. Of these, the previously identified color pattern “switch gene” optix was recovered as the first transcript to show color-specific differential expression. Most differentially expressed genes were transcribed late in pupal development and have roles in cuticle formation or pigment synthesis. These include previously undescribed transporter genes associated with ommochrome pigmentation. Furthermore, we observed upregulation of melanin-repressing genes such as ebony and Dat1 in non-melanic patterns. Conclusions This study identifies many new genes implicated in butterfly wing pattern development and provides a glimpse into the number and types of genes affected by variation in genes that drive color pattern evolution.

  20. Variation of Dominance of Newly Arisen Adaptive Genes

    Bourguet, D; Lenormand, T; Guillemaud, T; Marcel, V.; Fournier, D.; M. Raymond

    1997-01-01

    Newly arisen adaptive alleles such as insecticide resistance genes represent a good opportunity to investigate the theories put forth to explain the molecular basis of dominance and its possible evolution. Dominance levels of insecticide resistance conferred by insensitive alleles of the acetylcholinesterase gene were analyzed in five resistant strains of the mosquito Culex pipiens. Dominance levels were found to differ between strains, varying from partial recessivity to complete dominance. ...

  1. Theoretical studies of gene substitution, geographic variation, and speciation

    Felsenstein, J.

    1977-07-31

    Brief comments are given on the results of a research program dealing with population genetics of evolutionary processes. The various subjects studied included genetic variation in clines; speciation and disruptive selection; parapatric speciation in clines; macroevolutionary laws in a model ecosystem; migration matrices; lethal allelism; estimation of number of loci in quantitative inheritance; numerical taxonomy methods; and new mutants in Lesch-Nyhan disease.

  2. Intra- and interspecific variation in primate gene expression patterns.

    Enard, Wolfgang; Khaitovich, Philipp; Klose, Joachim; Zöllner, Sebastian; Heissig, Florian; Giavalisco, Patrick; Nieselt-Struwe, Kay; Muchmore, Elaine; Varki, Ajit; Ravid, Rivka; Doxiadis, Gaby M; Bontrop, Ronald E; Pääbo, Svante

    2002-04-12

    Although humans and their closest evolutionary relatives, the chimpanzees, are 98.7% identical in their genomic DNA sequences, they differ in many morphological, behavioral, and cognitive aspects. The underlying genetic basis of many of these differences may be altered gene expression. We have compared the transcriptome in blood leukocytes, liver, and brain of humans, chimpanzees, orangutans, and macaques using microarrays, as well as protein expression patterns of humans and chimpanzees using two-dimensional gel electrophoresis. We also studied three mouse species that are approximately as related to each other as are humans, chimpanzees, and orangutans. We identified species-specific gene expression patterns indicating that changes in protein and gene expression have been particularly pronounced in the human brain. PMID:11951044

  3. Copy number variation analysis identifies novel CAKUT candidate genes in children with a solitary functioning kidney

    Westland, R.; Verbitsky, M.; Vukojevic, K.; Perry, B.J.; Fasel, D.A.; Zwijnenburg, P.J.; Bokenkamp, A.; Gille, J.J.P.; Saraga-Babic, M.; Ghiggeri, G.M.; D'Agati, V.D.; Schreuder, M.F.; Gharavi, A.G.; Wijk, J.A. van; Sanna-Cherchi, S.

    2015-01-01

    Copy number variations associate with different developmental phenotypes and represent a major cause of congenital anomalies of the kidney and urinary tract (CAKUT). Because rare pathogenic copy number variations are often large and contain multiple genes, identification of the underlying genetic dr

  4. Genetic Variation at the N-acetyltransferase (NAT) Genes in Global Populations

    Functional variability at the N-acetyltransferase (NAT) genes is associated with adverse drug reactions and cancer susceptibility in humans. Previous studies of small sets of ethnic groups have indicated that the NAT genes have high levels of amino acid variation that differ in f...

  5. Natural variation of rice blast resistance gene Pi-d2

    Studying natural variation of rice resistance (R) genes in cultivated and wild rice relatives can predict resistance stability to rice blast fungus. In the present study, the protein coding regions of rice R gene Pi-d2 in 35 rice accessions of subgroups, aus (AUS), indica (IND), temperate japonica (...

  6. Genetic variation in mitotic regulatory pathway genes is associated with breast tumor grade

    Purrington, Kristen S; Slettedahl, Seth; Bolla, Manjeet K;

    2014-01-01

    Mitotic index is an important component of histologic grade and has an etiologic role in breast tumorigenesis. Several small candidate gene studies have reported associations between variation in mitotic genes and breast cancer risk. We measured associations between 2156 single nucleotide polymor...

  7. Analysis of human genetic variation in candidate genes under positive selections on the human linage

    Moreno Estrada, Andr??s

    2009-01-01

    Natural selection has played an important role in shaping human genetic variation, thus, finding variants that have been targeted by positive selection can provide insights about which genes influence human phenotypic variability. In this work we conduct a genome-wide survey of protein-coding genes comparing humans, chimpanzees, and closely related species in order to detect the fraction of genes undergoing positive selection on the human lineage, and further investigate intraspecific variati...

  8. Indexing Effects of Copy Number Variation on Genes Involved in Developmental Delay

    Mohammed Uddin; Giovanna Pellecchia; Bhooma Thiruvahindrapuram; Lia D’Abate; Daniele Merico; Ada Chan; Mehdi Zarrei; Kristiina Tammimies; Susan Walker; Gazzellone, Matthew J.; Thomas Nalpathamkalam; Yuen, Ryan K.C.; Koenraad Devriendt; Géraldine Mathonnet; Emmanuelle Lemyre

    2016-01-01

    A challenge in clinical genomics is to predict whether copy number variation (CNV) affecting a gene or multiple genes will manifest as disease. Increasing recognition of gene dosage effects in neurodevelopmental disorders prompted us to develop a computational approach based on critical-exon (highly expressed in brain, highly conserved) examination for potential etiologic effects. Using a large CNV dataset, our updated analyses revealed significant (P 

  9. Serotonergic gene variation in substance use pharmacotherapy: a systematic review.

    Bauer, Isabelle E; Graham, David P; Soares, Jair C; Nielsen, David A

    2015-01-01

    Drug addiction is a serious disease with damaging effects on the brain and physical health. Despite the increase in the number of affected individuals, there are few effective pharmacological treatment options for substance use disorders. The study of the influence of an individual's genetic features on the treatment response may help to identify more efficacious treatment options. This systematic review focuses on the serotonergic system because of its relevant role in mood and impulse control disorders, and its contribution to the development and maintenance of drug use disorders. In particular, we examine the role of serotonergic genes in the response to pharmacotherapy for alcohol, cocaine and nicotine addiction. Current evidence suggests that genetic variability of the serotonergic biosynthesis enzyme tryptophan hydroxylase 2 (TPH2) and the serotonin transporter (SLC6A4) genes mediates the efficacy of several addiction treatments, such as ondansetron and disulfiram, and the antidepressants bupropion, nortriptyline and sertraline. PMID:26265436

  10. nef gene sequence variation among HIV-1-infected African children

    Chakraborty, R.; Reiniš, Milan; Rostron, T.; Philpott, S.; Dong, T.; D'Agostino, A.; Musoke, R.; de Silva, E.; Stumpf, M.; Weiser, B.; Burger, H.; Rowland-Jones, S.L.

    2006-01-01

    Roč. 7, č. 2 (2006), s. 75-84. ISSN 1464-2662 Grant ostatní: Fogarty International Center, NIH(US) 3D43TW00915; NIH(US) RO1 AI 42555 Institutional research plan: CEZ:AV0Z50520514 Keywords : HIV-1 nef gene * non-clade B * Kenya Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.674, year: 2006

  11. Rare structural variation of synapse and neurotransmission genes in autism

    Gai, X; Xie, H M; Perin, J C; Takahashi, N; Murphy, K.; Wenocur, A S; D'arcy, M; O'Hara, R J; Goldmuntz, E; Grice, D. E.; Shaikh, T H; Hakonarson, H.; Buxbaum, J D; Elia, J.; White, P S

    2011-01-01

    Autism spectrum disorders (ASDs) comprise a constellation of highly heritable neuropsychiatric disorders. Genome-wide studies of autistic individuals have implicated numerous minor risk alleles but few common variants, suggesting a complex genetic model with many contributing loci. To assess commonality of biological function among rare risk alleles, we compared functional knowledge of genes overlapping inherited structural variants in idiopathic ASD subjects relative to healthy controls. In ...

  12. Intraspecific DNA variation in nuclear genes of the mosquito Aedes aegypti.

    Morlais, I; Severson, D W

    2003-12-01

    Single nucleotide polymorphisms (SNPs) are an abundant source of genetic variation among individual organisms. To assess the usefulness of SNPs for genome analysis in the yellow fever mosquito, Aedes aegypti, we sequenced 25 nuclear genes in each of three strains and analysed nucleotide diversity. The average frequency of nucleotide variation was 12 SNPs per kilobase, indicating that nucleotide variation in Ae. aegypti is similar to that in other organisms, including Drosophila and the malaria vector Anopheles gambiae. Transition polymorphisms outnumbered transversion polymorphisms, at a ratio of about 2:1. We examined codon usage and confirmed that mutational bias favours G and C ending codons. Codon bias was most pronounced in highly expressed genes. Nucleotide diversity estimates indicated that substitution rates are positively correlated in coding and non-coding regions. Nucleotide diversity varied from one gene to another. The unequal distribution of SNPs among Ae. aegypti nuclear genes suggests that single base variations are non-neutral and are subject to selective constraints. Our analysis showed that ubiquitously expressed genes have lower polymorphism rates and are likely under strong purifying selection, whereas tissue specific genes and genes with a putative role in parasite defence exhibit higher levels of polymorphism that may be associated with diversifying selection. PMID:14986924

  13. Dramatic Number Variation of R Genes in Solanaceae Species Accounted for by a Few R Gene Subfamilies

    Wei, Chunhua; Chen, Jiongjiong; Kuang, Hanhui

    2016-01-01

    Most disease resistance genes encode nucleotide-binding-site (NBS) and leucine-rich-repeat (LRR) domains, and the NBS-LRR encoding genes are often referred to as R genes. Using newly developed approach, 478, 485, 1,194, 1,665, 2,042 and 374 R genes were identified from the genomes of tomato Heinz1706, wild tomato LA716, potato DM1-3, pepper Zunla-1 and wild pepper Chiltepin and tobacco TN90, respectively. The majority of R genes from Solanaceae were grouped into 87 subfamilies, including 16 TIR-NBS-LRR (TNL) and 71 non-TNL subfamilies. Each subfamily was annotated manually, including identification of intron/exon structure and intron phase. Interestingly, TNL subfamilies have similar intron phase patterns, while the non-TNL subfamilies have diverse intron phase due to frequent gain of introns. Prevalent presence/absence polymorphic R gene loci were found among Solanaceae species, and an integrated map with 427 R loci was constructed. The pepper genome (2,042 in Chiltepin) has at least four times of R genes as in tomato (478 in Heinz1706). The high number of R genes in pepper genome is due to the amplification of R genes in a few subfamilies, such as the Rpi-blb2 and BS2 subfamilies. The mechanism underlying the variation of R gene number among different plant genomes is discussed. PMID:26849045

  14. Diel variation in gene expression of the CO2-concentrating mechanism during a harmful cyanobacterial bloom

    Giovanni eSandrini

    2016-04-01

    Full Text Available Dense phytoplankton blooms in eutrophic waters often experience large daily fluctuations in environmental conditions. We investigated how this diel variation affects in situ gene expression of the CO2-concentrating mechanism (CCM and other selected genes of the harmful cyanobacterium Microcystis aeruginosa. Photosynthetic activity of the cyanobacterial bloom depleted the dissolved CO2 concentration, raised pH to 10, and caused large diel fluctuations in the bicarbonate and O2 concentration. The Microcystis population consisted of three Ci uptake genotypes that differed in the presence of the low-affinity and high-affinity bicarbonate uptake genes bicA and sbtA. Expression of the bicarbonate uptake genes bicA, sbtA and cmpA (encoding a subunit of the high-affinity bicarbonate uptake system BCT1, the CCM transcriptional regulator gene ccmR and the photoprotection gene flv4 increased at first daylight and was negatively correlated with the bicarbonate concentration. In contrast, genes of the two CO2 uptake systems were constitutively expressed, whereas expression of the RuBisCO chaperone gene rbcX, the carboxysome gene ccmM, and the photoprotection gene isiA was highest at night and down-regulated during daytime. In total, our results show that the harmful cyanobacterium Microcystis is very responsive to the large diel variations in carbon and light availability often encountered in dense cyanobacterial blooms.

  15. Natural Genetic Variation and Candidate Genes for Morphological Traits in Drosophila melanogaster.

    Carreira, Valeria Paula; Mensch, Julián; Hasson, Esteban; Fanara, Juan José

    2016-01-01

    Body size is a complex character associated to several fitness related traits that vary within and between species as a consequence of environmental and genetic factors. Latitudinal and altitudinal clines for different morphological traits have been described in several species of Drosophila and previous work identified genomic regions associated with such variation in D. melanogaster. However, the genetic factors that orchestrate morphological variation have been barely studied. Here, our main objective was to investigate genetic variation for different morphological traits associated to the second chromosome in natural populations of D. melanogaster along latitudinal and altitudinal gradients in Argentina. Our results revealed weak clinal signals and a strong population effect on morphological variation. Moreover, most pairwise comparisons between populations were significant. Our study also showed important within-population genetic variation, which must be associated to the second chromosome, as the lines are otherwise genetically identical. Next, we examined the contribution of different candidate genes to natural variation for these traits. We performed quantitative complementation tests using a battery of lines bearing mutated alleles at candidate genes located in the second chromosome and six second chromosome substitution lines derived from natural populations which exhibited divergent phenotypes. Results of complementation tests revealed that natural variation at all candidate genes studied, invected, Fasciclin 3, toucan, Reticulon-like1, jing and CG14478, affects the studied characters, suggesting that they are Quantitative Trait Genes for morphological traits. Finally, the phenotypic patterns observed suggest that different alleles of each gene might contribute to natural variation for morphological traits. However, non-additive effects cannot be ruled out, as wild-derived strains differ at myriads of second chromosome loci that may interact

  16. Biovar diversity is reflected by variations of genes encoding urease of Ureaplasma urealyticum.

    Ruifu, Y; Minli, Z; Guo, Z; Wang, X

    1997-01-01

    Five oligonucleotide primers derived from the gene encoding urease of Ureaplasma urealyticum were designed to evaluate the relationship between the urease gene and biovar diversity of this organism. Five combinations of these primers were tested by PCR and the result revealed that there were variations in urease genes among different serovars of U. urealyticum. This result, in agreement with other PCRs based on other functionally unrelated (rRNA and MB antigen) genes, may reflect the phylogenetic relationship among organisms taxonomically classified as U. urealyticum. PMID:9310943

  17. Inter- and intraspecific variation in Drosophila genes with sex-biased expression.

    Müller, Lena; Grath, Sonja; von Heckel, Korbinian; Parsch, John

    2012-01-01

    Genes with sexually dimorphic expression (sex-biased genes) often evolve rapidly and are thought to make an important contribution to reproductive isolation between species. We examined the molecular evolution of sex-biased genes in Drosophila melanogaster and D. ananassae, which represent two independent lineages within the melanogaster group. We find that strong purifying selection limits protein sequence variation within species, but that a considerable fraction of divergence between species can be attributed to positive selection. In D. melanogaster, the proportion of adaptive substitutions between species is greatest for male-biased genes and is especially high for those on the X chromosome. In contrast, male-biased genes do not show unusually high variation within or between populations. A similar pattern is seen at the level of gene expression, where sex-biased genes show high expression divergence between species, but low divergence between populations. In D. ananassae, there is no increased rate of adaptation of male-biased genes, suggesting that the type or strength of selection acting on sex-biased genes differs between lineages. PMID:22315698

  18. Variation of vlhA gene in Mycoplasma synoviae clones isolated from chickens.

    Slavec, Brigita; Berčič, Rebeka Lucijana; Cizelj, Ivanka; Narat, Mojca; Zorman-Rojs, Olga; Dovč, Peter; Benčina, Dušan

    2011-10-01

    Mycoplasma synoviae synthesizes haemagglutinin VlhA, which cleaves into the N-terminal part, a lipoprotein MSPB, and a C-terminal part MSPA. Previous studies have shown that the 3'-end of the expressed vlhA gene can recombine with vlhA pseudogenes in a process called gene conversion, but there have been no data about diversification of the expressed vlhA gene in M. synoviae populations replicating in chickens. Following intratracheal inoculation with the M. synoviae strain ULB 02/T6, which showed only minor vlhA gene variation prior to inoculation, we investigated temporal changes in MSPB epitopes defined by monoclonal antibodies (mAbs) 3B4 and 50, as well as diversification of the vlhA gene sequence in M. synoviae populations recovered from chicken tracheas. In cultures isolated 8 and 18 days post inoculation (p.i.), most colonies showed variation of MSPB epitopes for mAbs 3B4 and 50. They also changed 3'-end vlhA gene sequences. Further diversity of the vlhA gene occurred in cultures isolated 8 weeks and 5 months p.i. The vlhA gene sequences from isolated cultures shared only 65 to 80% sequence identity with vlhA gene of the inoculated ULB 02/T6 culture. Notably, in most of those cultures their vlhA gene sequences contained stop codons potentially causing premature terminations of translation. Interestingly, in one culture isolated 8 weeks p.i. (clone T6-8W/IT2A) the 3'-vlhA gene sequence was identical in the last 1140 bases to that of the first vlhA pseudogene positioned the most far (upstream) of the expressed vlhA gene. This is the first demonstration of temporal diversity of the vlhA gene in M. synoviae populations isolated from chicken tracheas. PMID:21830862

  19. Extensive Copy-Number Variation of the Human Olfactory Receptor Gene Family

    Janet M Young; Endicott, RaeLynn M.; Parghi, Sean S; Walker, Megan; Kidd, Jeffrey M.; Trask, Barbara J.

    2008-01-01

    As much as a quarter of the human genome has been reported to vary in copy number between individuals, including regions containing about half of the members of the olfactory receptor (OR) gene family. We have undertaken a detailed study of copy-number variation of ORs to elucidate the selective and mechanistic forces acting on this gene family and the true impact of copy-number variation on human OR repertoires. We argue that the properties of copy-number variants (CNVs) and other sets of la...

  20. Positive Association of Vitamin D Receptor Gene Variations with Multiple Sclerosis in South East Iranian Population

    Mehrnaz Narooie-Nejad; Maryam Moossavi; Adam Torkamanzehi; Ali Moghtaderi

    2015-01-01

    Among the factors postulated to play a role in MS susceptibility, the role of vitamin D is outstanding. Since the function of vitamin D receptor (VDR) represents the effect of vitamin D on the body and genetic variations in VDR gene may affect its function, we aim to highlight the association of two VDR gene polymorphisms with MS susceptibility. In current study, we recruited 113 MS patients and 122 healthy controls. TaqI (rs731236) and ApaI (rs7975232) genetic variations in these two groups ...

  1. Variation in genes involved in epigenetic processes offers insights into tropically adapted cattle diversity.

    Porto-Neto, Laercio R; Fortes, Marina R S; McWilliam, Sean M; Lehnert, Sigrid A; Reverter, Antonio

    2014-01-01

    We evaluated the relevance of the BovineHD Illumina SNP chip with respect to genes involved in epigenetic processes. Genotypes for 729,068 SNP on two tropical cattle breeds of Australia were used: Brahman (n = 2112) and Tropical Composite (n = 2550). We used data mining approaches to compile a list of bovine protein-coding genes involved in epigenetic processes. These genes represent 9 functional categories that contain between one (histone demethylases) and 99 (chromatin remodeling factors) genes. A total of 3091 SNP mapped to positions within 3000 bp of the 193 coding regions of those genes, including 113 SNP in transcribed regions, 2738 in intronic regions and 240 in up- or down-stream regions. For all these SNP categories, we observed differences in the allelic frequencies between Brahman and Tropical Composite cattle. These differences were larger than those observed for the entire set of 729,068 SNP (P = 1.79 x 10(-5)). A multidimensional scaling analysis using only the 113 SNP in transcribed regions allowed for the separation of the two populations and this separation was comparable to the one obtained with a random set of 113 SNP (Principal Component 1 r (2) > 0.84). To further characterize the differences between the breeds we defined a gene-differentiation metric based on the average genotypic frequencies of SNP connected to each gene and compared both cattle populations. The 10% most differentiated genes were distributed across 10 chromosomes, with significant (P < 0.05) enrichment on BTA 3 and 10. The 10% most conserved genes were located in 12 chromosomes. We conclude that there is variation between cattle populations in genes connected to epigenetic processes, and this variation can be used to differentiate cattle breeds. More research is needed to fully characterize the use of these SNP and its potential as means to further our understanding of biological variation and epigenetic processes. PMID:24795751

  2. Variation in genes involved in epigenetic processes offers insights into tropically adapted cattle diversity

    Laercio R Porto-Neto

    2014-04-01

    Full Text Available We evaluated the relevance of the BovineHD Illumina SNP chip with respect to genes involved in epigenetic processes. Genotypes for 729,068 SNP on two tropical cattle breeds of Australia were used: Brahman (n = 2,112 and Tropical Composite (n = 2,550. We used data mining approaches to compile a list of bovine protein-coding genes involved in epigenetic processes. These genes represent 9 functional categories that contain between one (histone demethylases and 99 (chromatin remodelling factors genes. A total of 3,091 SNP mapped to positions within 3,000 bp of the 193 coding regions of those genes, including 113 SNP in transcribed regions, 2,738 in intronic regions and 240 in up- or down-stream regions. For all these SNP categories, we observed differences in the allelic frequencies between Brahman and Tropical Composite cattle. These differences were larger than those observed for the entire set of 729,068 SNP (P = 1.79 x 10-5. A multidimensional scaling analysis using only the 113 SNP in transcribed regions allowed for the separation of the two populations and this separation was comparable to the one obtained with a random set of 113 SNP (Principal Component 1 r2 > 0.84. To further characterise the differences between the breeds we defined a gene-differentiation metric based on the average genotypic frequencies of SNP connected to each gene and compared both cattle populations. The 10% most differentiated genes were distributed across 10 chromosomes, with significant (P < 0.05 enrichment on BTA 3 and 10. The 10% most conserved genes were located in 12 chromosomes. We conclude that there is variation between cattle populations in genes connected to epigenetic processes, and this variation can be used to differentiate cattle breeds. More research is needed to fully characterise the use of these SNP and its potential as means to further our understanding of biological variation and epigenetic processes.

  3. Candidate gene study to investigate the genetic determinants of normal variation in central corneal thickness

    Dimasi, David P.; Kathryn P Burdon; Hewitt, Alex W; Savarirayan, Ravi; Healey, Paul R.; Mitchell, Paul; Mackey, David A.; Craig, Jamie E

    2010-01-01

    Purpose The genetic component underlying variation in central corneal thickness (CCT) in the normal population remains largely unknown. As CCT is an identified risk factor for open-angle glaucoma, understanding the genes involved in CCT determination could improve our understanding of the mechanisms involved in this association. Methods To identify novel CCT genes, we selected eight different candidates based on a range of criteria. These included; aquaporin 1 (AQ1), aquaporin 5 (AQ5), decori...

  4. Genetic variation in the immunosuppression pathway genes and breast cancer susceptibility

    Lei, Jieping; Rudolph, Anja; Moysich, Kirsten B;

    2016-01-01

    Immunosuppression plays a pivotal role in assisting tumors to evade immune destruction and promoting tumor development. We hypothesized that genetic variation in the immunosuppression pathway genes may be implicated in breast cancer tumorigenesis. We included 42,510 female breast cancer cases and.......5 × 10(-4) and 0.63, respectively). Our data provide evidence that the immunosuppression pathway genes STAT3, IL5, and GM-CSF may be novel susceptibility loci for breast cancer in women of European ancestry....

  5. Estimating variation within the genes and inferring the phylogeny of 186 sequenced diverse Escherichia coli genomes

    Kaas Rolf S

    2012-10-01

    Full Text Available Abstract Background Escherichia coli exists in commensal and pathogenic forms. By measuring the variation of individual genes across more than a hundred sequenced genomes, gene variation can be studied in detail, including the number of mutations found for any given gene. This knowledge will be useful for creating better phylogenies, for determination of molecular clocks and for improved typing techniques. Results We find 3,051 gene clusters/families present in at least 95% of the genomes and 1,702 gene clusters present in 100% of the genomes. The former 'soft core' of about 3,000 gene families is perhaps more biologically relevant, especially considering that many of these genome sequences are draft quality. The E. coli pan-genome for this set of isolates contains 16,373 gene clusters. A core-gene tree, based on alignment and a pan-genome tree based on gene presence/absence, maps the relatedness of the 186 sequenced E. coli genomes. The core-gene tree displays high confidence and divides the E. coli strains into the observed MLST type clades and also separates defined phylotypes. Conclusion The results of comparing a large and diverse E. coli dataset support the theory that reliable and good resolution phylogenies can be inferred from the core-genome. The results further suggest that the resolution at the isolate level may, subsequently be improved by targeting more variable genes. The use of whole genome sequencing will make it possible to eliminate, or at least reduce, the need for several typing steps used in traditional epidemiology.

  6. Interindividual variation in gene expression responses and metabolite formation in acetaminophen-exposed primary human hepatocytes.

    Jetten, Marlon J A; Ruiz-Aracama, Ainhoa; Coonen, Maarten L J; Claessen, Sandra M; van Herwijnen, Marcel H M; Lommen, Arjen; van Delft, Joost H M; Peijnenburg, Ad A C M; Kleinjans, Jos C S

    2016-05-01

    Acetaminophen (APAP) is a readily available over-the-counter drug and is one of the most commonly used analgesics/antipyretics worldwide. Large interindividual variation in susceptibility toward APAP-induced liver failure has been reported. However, the exact underlying factors causing this variability in susceptibility are still largely unknown. The aim of this study was to better understand this variability in response to APAP by evaluating interindividual differences in gene expression changes and APAP metabolite formation in primary human hepatocytes (PHH) from several donors (n = 5) exposed in vitro to a non-toxic to toxic APAP dose range. To evaluate interindividual variation, gene expression data/levels of metabolites were plotted against APAP dose/donor. The correlation in APAP dose response between donors was calculated by comparing data points from one donor to the data points of all other donors using a Pearson-based correlation analysis. From that, a correlation score/donor for each gene/metabolite was defined, representing the similarity of the omics response to APAP in PHH of a particular donor to all other donors. The top 1 % highest variable genes were selected for further evaluation using gene set overrepresentation analysis. The biological processes in which the genes with high interindividual variation in expression were involved include liver regeneration, inflammatory responses, mitochondrial stress responses, hepatocarcinogenesis, cell cycle, and drug efficacy. Additionally, the interindividual variation in the expression of these genes could be associated with the variability in expression levels of hydroxyl/methoxy-APAP and C8H13O5N-APAP-glucuronide. The before-mentioned metabolites or their derivatives have also been reported in blood of humans exposed to therapeutic APAP doses. Possibly these findings can contribute to elucidating the causative factors of interindividual susceptibility toward APAP. PMID:26104854

  7. Heritable genome-wide variation of gene expression and promoter methylation between wild and domesticated chickens

    Nätt Daniel

    2012-02-01

    Full Text Available Abstract Background Variations in gene expression, mediated by epigenetic mechanisms, may cause broad phenotypic effects in animals. However, it has been debated to what extent expression variation and epigenetic modifications, such as patterns of DNA methylation, are transferred across generations, and therefore it is uncertain what role epigenetic variation may play in adaptation. Results In Red Junglefowl, ancestor of domestic chickens, gene expression and methylation profiles in thalamus/hypothalamus differed substantially from that of a domesticated egg laying breed. Expression as well as methylation differences were largely maintained in the offspring, demonstrating reliable inheritance of epigenetic variation. Some of the inherited methylation differences were tissue-specific, and the differential methylation at specific loci were little changed after eight generations of intercrossing between Red Junglefowl and domesticated laying hens. There was an over-representation of differentially expressed and methylated genes in selective sweep regions associated with chicken domestication. Conclusions Our results show that epigenetic variation is inherited in chickens, and we suggest that selection of favourable epigenomes, either by selection of genotypes affecting epigenetic states, or by selection of methylation states which are inherited independently of sequence differences, may have been an important aspect of chicken domestication.

  8. Geographic Variation in Advertisement Calls in a Tree Frog Species: Gene Flow and Selection Hypotheses

    Jang, Yikweon; Hahm, Eun Hye; Lee, Hyun-Jung; Park, Soyeon; Won, Yong-Jin; Choe, Jae C.

    2011-01-01

    Background In a species with a large distribution relative to its dispersal capacity, geographic variation in traits may be explained by gene flow, selection, or the combined effects of both. Studies of genetic diversity using neutral molecular markers show that patterns of isolation by distance (IBD) or barrier effect may be evident for geographic variation at the molecular level in amphibian species. However, selective factors such as habitat, predator, or interspecific interactions may be critical for geographic variation in sexual traits. We studied geographic variation in advertisement calls in the tree frog Hyla japonica to understand patterns of variation in these traits across Korea and provide clues about the underlying forces for variation. Methodology We recorded calls of H. japonica in three breeding seasons from 17 localities including localities in remote Jeju Island. Call characters analyzed were note repetition rate (NRR), note duration (ND), and dominant frequency (DF), along with snout-to-vent length. Results The findings of a barrier effect on DF and a longitudinal variation in NRR seemed to suggest that an open sea between the mainland and Jeju Island and mountain ranges dominated by the north-south Taebaek Mountains were related to geographic variation in call characters. Furthermore, there was a pattern of IBD in mitochondrial DNA sequences. However, no comparable pattern of IBD was found between geographic distance and call characters. We also failed to detect any effects of habitat or interspecific interaction on call characters. Conclusions Geographic variations in call characters as well as mitochondrial DNA sequences were largely stratified by geographic factors such as distance and barriers in Korean populations of H. japoinca. Although we did not detect effects of habitat or interspecific interaction, some other selective factors such as sexual selection might still be operating on call characters in conjunction with restricted gene

  9. Geographic variation in advertisement calls in a tree frog species: gene flow and selection hypotheses.

    Yikweon Jang

    Full Text Available BACKGROUND: In a species with a large distribution relative to its dispersal capacity, geographic variation in traits may be explained by gene flow, selection, or the combined effects of both. Studies of genetic diversity using neutral molecular markers show that patterns of isolation by distance (IBD or barrier effect may be evident for geographic variation at the molecular level in amphibian species. However, selective factors such as habitat, predator, or interspecific interactions may be critical for geographic variation in sexual traits. We studied geographic variation in advertisement calls in the tree frog Hyla japonica to understand patterns of variation in these traits across Korea and provide clues about the underlying forces for variation. METHODOLOGY: We recorded calls of H. japonica in three breeding seasons from 17 localities including localities in remote Jeju Island. Call characters analyzed were note repetition rate (NRR, note duration (ND, and dominant frequency (DF, along with snout-to-vent length. RESULTS: The findings of a barrier effect on DF and a longitudinal variation in NRR seemed to suggest that an open sea between the mainland and Jeju Island and mountain ranges dominated by the north-south Taebaek Mountains were related to geographic variation in call characters. Furthermore, there was a pattern of IBD in mitochondrial DNA sequences. However, no comparable pattern of IBD was found between geographic distance and call characters. We also failed to detect any effects of habitat or interspecific interaction on call characters. CONCLUSIONS: Geographic variations in call characters as well as mitochondrial DNA sequences were largely stratified by geographic factors such as distance and barriers in Korean populations of H. japonica. Although we did not detect effects of habitat or interspecific interaction, some other selective factors such as sexual selection might still be operating on call characters in conjunction with

  10. Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

    Epplen Jörg T

    2008-11-01

    Full Text Available Abstract Background Atopic dermatitis (AD is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP, eosinophil-derived neurotoxin (EDN, eosinophil peroxidase (EPO and major basic protein (MBP. Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.

  11. Copy number variations in IL22 gene are associated with Psoriasis vulgaris.

    Prans, Ele; Kingo, Külli; Traks, Tanel; Silm, Helgi; Vasar, Eero; Kõks, Sulev

    2013-06-01

    Psoriasis vulgaris (PsV) is a frequent, chronically relapsing, immune-mediated systemic disease with characteristic skin changes. IL22 is a cytokine of IL10 family, with significant proliferative effect on different cell lines. Copy number variations (CNV) have been discovered to have phenotypic consequences and are associated with various types of diseases. In the work presented here we analyzed the copy number variations in IL22 gene of exon1 and exon5. Our results showed that the IL22 gene exon1 was significantly associated with psoriasis severity (P<0.0001). However, the association between IL22 gene exon5 copy numbers and psoriasis was not detected. PMID:23395647

  12. Gene variation, population differentiation, and sociogenetic structure of nests of Partamona seridoensis (Hymenoptera: Apidae, Meliponini).

    Fernandes, Carlo Rivero Moura; Martins, Celso Feitosa; Ferreira, Kátia Maria; Del Lama, Marco Antonio

    2012-06-01

    Gene variation and the differentiation of two populations of Partamona seridoensis (Hymenoptera: Apidae: Meliponini) from the Caatinga biome, a semiarid ecosystem unique to Brazil, were estimated through allozymic and microsatellite analyses. These populations exhibited similar low degrees of enzyme gene variation. Observed genotype frequencies at the allozyme and microsatellite loci were in accordance with Hardy-Weinberg equilibrium in the two populations. Both markers demonstrated that the two populations are not genetically homogeneous and must be considered distinct populations. The occurrence of private alleles at the allozyme and microsatellite loci corroborates this differentiation, sustaining the hypothesis of a low level of interpopulation gene flow. The phenotypic segregations clearly demonstrated that the progeny inside each nest were the result of mating between the queen of the colony and only one male. PMID:21938561

  13. Gene co-expression network analysis identifies porcine genes associated with variation in Salmonella shedding

    Kommadath, Arun; Bao, Hua; Arantes, Adriano S; Plastow, Graham S.; Christopher K Tuggle; Bearson, Shawn MD; Luo Guan, Le; Stothard, Paul

    2014-01-01

    Background Salmonella enterica serovar Typhimurium is a gram-negative bacterium that can colonise the gut of humans and several species of food producing farm animals to cause enteric or septicaemic salmonellosis. While many studies have looked into the host genetic response to Salmonella infection, relatively few have used correlation of shedding traits with gene expression patterns to identify genes whose variable expression among different individuals may be associated with differences in ...

  14. Splice site and Germline variations of the MGMT gene in Esophageal cancer from Kashmir Valley: India

    Shah, Mohd Amin; Shaffi, Sheikh M.; Lone, Ghulam Nabi; Jan, Syed Mudassar

    2013-01-01

    Objectives The aim of our investigation was to detect mutation or genetic polymorphisms in MGMT gene of esophageal cancer patients from Kashmir Valley (India) Methodology The genetic polymorphisms or mutations in the coding exons 2, 3, 4 and 5 of MGMT gene were searched for in DNA samples from the frozen tumor tissues of 30 esophageal cancer patients from Kashmir. The PCR products were sequenced with fluorescently labelled terminators and separated on automatic sequencer. We developed a new PCR based RFLP approach for genotyping c.459A>G (p.Gly153Gly) variation in 71 esophageal cancer patients and 60 healthy controls. Results Two somatic variations c.274 +4G>A and c.274 + 22G>A were identified in Exon3-intron 4 boundary. A novel germline variation c.459A>G (p.Gly153Gly) was found in the exon 5 of an esophageal cancer patient. This germline variation was not found in any of the studied esophageal cancer patients and healthy controls except the patient where it has been found by direct sequencing. Conclusion We identified novel sequence variants of the MGMT gene in esophageal cancer patients from Kashmir valley-India. PMID:24533020

  15. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Melanie G Mayer

    2015-06-01

    Full Text Available Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as

  16. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Mayer, Melanie G; Rödelsperger, Christian; Witte, Hanh; Riebesell, Metta; Sommer, Ralf J

    2015-06-01

    Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as major target for

  17. Genetic variation in genes of the fatty acid synthesis pathway and breast cancer risk

    Campa, Daniele; McKay, James; Sinilnikova, Olga;

    2009-01-01

    FASN) is related to breast cancer risk and body-mass index (BMI) by studying 1,294 breast cancer cases and 2,452 controls from the European Prospective Investigation on Cancer (EPIC). We resequenced the FAS gene and combined information of SNPs found by resequencing and SNPs from public databases....... Using a tagging approach and selecting 20 SNPs, we covered all the common genetic variation of these genes. In this study we were not able to find any statistically significant association between the SNPs in the FAS, ChREBP and SREPB-1 genes and an increased risk of breast cancer overall and by......Fatty acid synthase (FAS) is the major enzyme of lipogenesis. It catalyzes the NADPH-dependent condensation of acetyl-CoA and malonyl-CoA to produce palmitic acid. Transcription of the FAS gene is controlled synergistically by the transcription factors ChREBP (carbohydrate response element...

  18. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  19. Understanding gene sequence variation in the context of transcription regulation in yeast.

    Irit Gat-Viks

    2010-01-01

    Full Text Available DNA sequence polymorphism in a regulatory protein can have a widespread transcriptional effect. Here we present a computational approach for analyzing modules of genes with a common regulation that are affected by specific DNA polymorphisms. We identify such regulatory-linkage modules by integrating genotypic and expression data for individuals in a segregating population with complementary expression data of strains mutated in a variety of regulatory proteins. Our procedure searches simultaneously for groups of co-expressed genes, for their common underlying linkage interval, and for their shared regulatory proteins. We applied the method to a cross between laboratory and wild strains of S. cerevisiae, demonstrating its ability to correctly suggest modules and to outperform extant approaches. Our results suggest that middle sporulation genes are under the control of polymorphism in the sporulation-specific tertiary complex Sum1p/Rfm1p/Hst1p. In another example, our analysis reveals novel inter-relations between Swi3 and two mitochondrial inner membrane proteins underlying variation in a module of aerobic cellular respiration genes. Overall, our findings demonstrate that this approach provides a useful framework for the systematic mapping of quantitative trait loci and their role in gene expression variation.

  20. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    DWINITA WIKAN UTAMI; KALIA BARNITA; SITI YURIAH; IDA HANARIDA

    2011-01-01

    Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufip...

  1. Oxytocin and Vasopressin Receptor Gene Variation as a Proximate Base for Inter- and Intraspecific Behavioral Differences in Bonobos and Chimpanzees

    Staes, Nicky; Stevens, Jeroen M. G.; Helsen, Philippe; Hillyer, Mia; Korody, Marisa; Eens, Marcel

    2014-01-01

    Recent literature has revealed the importance of variation in neuropeptide receptor gene sequences in the regulation of behavioral phenotypic variation. Here we focus on polymorphisms in the oxytocin receptor gene (OXTR) and vasopressin receptor gene 1a (Avpr1a) in chimpanzees and bonobos. In humans, a single nucleotide polymorphism (SNP) in the third intron of OXTR (rs53576 SNP (A/G)) is linked with social behavior, with the risk allele (A) carriers showing reduced levels of empathy and pros...

  2. Identification of genes for bone mineral density variation by computational disease gene identification strategy.

    Li, Gloria H Y; Deng, Hong-Wen; Kung, Annie W C; Huang, Qing-Yang

    2011-11-01

    We previously used five freely available bioinformatics tools (Prioritizer, Geneseeker, PROSPECTR and SUSPECTS, Disease Gene Prediction, and Endeavour) to analyze the thirteen well-replicated osteoporosis susceptibility loci and identify a subset of most likely candidate osteoporosis susceptibility genes (Huang et al. in J Hum Genet 53:644-655, 2008). In the current study, we experimentally tested the association between bone mineral density (BMD) and the 9 most likely candidate genes [LAMC2(1q25-q31), MATN3(2p24-p23), ITGAV(2q31-q32), ACVR1(2q23-q24), TDGF1(3p21.31), EGF(4q25), IGF1(12q22-q23), ZIC2(13q32), BMP2(20p12)] which were pinpointed by 4 or more bioinformatics tools. Forty tag SNPs in nine candidate genes were genotyped in a southern Chinese female case-control cohort consisting of 1643 subjects. Single- and multi-marker association analyses were performed using logistic regression analysis implemented by PLINK. Potential transcription factor binding sites were predicted by MatInspector. The strongest association was observed between rs10178256 (MATN3) and trochanter (P rs6214 (IGF1) showed consistent association with BMD at all the four measured skeletal sites (P = 0.005-0.044). Prediction of transcription factor binding suggested that the minor allele G of rs10178256 might abolish the binding of MESP1 and MESP2 which play vital roles in bone homeostasis, whereas the minor allele G of rs6214 might create an additional binding site for XBP1, a constitutive regulator of endoplasmic reticulum stress response. Our data suggested that variants in MATN3 and IGF1 were involved in BMD regulation in southern Chinese women. PMID:21638018

  3. Effects of common germ-line genetic variation in cell cycle genes on ovarian cancer survival

    Song, H.; Hogdall, E.; Ramus, S.J.;

    2008-01-01

    PURPOSE: Somatic alterations have been shown to correlate with ovarian cancer prognosis and survival, but less is known about the effects on survival of common inherited genetic variation. Of particular interest are genes involved in cell cycle pathways, which regulate cell division and could...... plausibly influence clinical characteristics of multiple tumors types. EXPERIMENTAL DESIGN: We examined associations between common germ-line genetic variation in 14 genes involved in cell cycle pathway (CCND1, CCND2, CCND3, CCNE1, CDKN1A, CDKN1B, CDKN2A, CDKN2B, CDKN2C, CDKN2D, CDK2, CDK4, CDK6, and RB1......) and survival among women with invasive ovarian cancer participating in a multicenter case-control study from United Kingdom, Denmark, and United States. DNAs from up to 1,499 women were genotyped for 97 single-nucleotide polymorphisms that tagged the known common variants (minor allele frequency > or = 0...

  4. Fertility variation and its effects on gene diversity in forest tree populations

    Bila, A.D. [Swedish Univ. of Agricultural Sciences, Umeaa (Sweden). Dept. of Forest Genetics and Plant Physiology

    2000-07-01

    Differences in fertility among parents influence progeny relatedness, inbreeding and diversity, they should therefore be evaluated and their impacts mitigated. Flower, pollen, fruit and seed production were used to estimate fertility variation from observations in natural stands, plantations and seed orchards. Fertility variation was also compiled from the literature. Differences in fertility are described by the power function y = x{sup a} (a {>=} 1), where y is the accumulative parental contribution to the progeny and x the ranked proportion of parents. Fertility variations were also described by the sibling coefficient A, which expresses how parents vary in fertility and the likelihood for sibs to occur compared with the situation when parents contribute equally to the gamete pool. A=a=1 when all individuals in the population have the same fertility, and both parameters increase with unbalanced parental contributions to the progeny. Tree fertility varied widely with some parents over- and others under- represented in the gamete pool. The power function exponent and the sibling coefficient were higher than 1 in most populations studied. Fertility variation was higher in stands than in seed orchards, and in both cases only about 15% of observations had A values close to 1. Age and flowering abundance appear to have a great impact on fertility variation, higher A values were observed in young populations and during poor flowering years. The increase on group coancestry and the reduction in gene diversity with increasing differences in fertility among parents was quantified. It was also described how relatedness accumulates over generation shifts as a function of differences in fertility. Making parents contribute as uniformly as possible to the progeny, e.g., by collecting the same amount of seed across the population, reduced relatedness and gene diversity was better preserved. The loss of gene diversity at generation shifts is inversely proportional to the number

  5. Melanopsin Gene Variations Interact With Season to Predict Sleep Onset and Chronotype

    Roecklein, Kathryn A.; Wong, Patricia M.; Franzen, Peter L.; HASLER, BRANT P.; Wood-Vasey, W. Michael; Nimgaonkar, Vishwajit L.; Miller, Megan A.; Kepreos, Kyle M.; Ferrell, Robert E.; Manuck, Stephen B.

    2012-01-01

    The human melanopsin gene has been reported to mediate risk for seasonal affective disorder (SAD), which is hypothesized to be caused by decreased photic input during winter when light levels fall below threshold, resulting in differences in circadian phase and/or sleep. However, it is unclear if melanopsin increases risk of SAD by causing differences in sleep or circadian phase, or if those differences are symptoms of the mood disorder. To determine if melanopsin sequence variations are asso...

  6. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation.

    Macke, J. P.; Hu, N; S. Hu; Bailey, M.; King, V L; Brown, T.; Hamer, D; Nathans, J

    1993-01-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, we have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the the entire androgen receptor cod...

  7. Variation of the Oxytocin/Neurophysin I (OXT) gene in four human populations

    Xu, Yang; Xue, Yali; Asan,; Daly, Allan; Wu, Lijie; Tyler-Smith, Chris

    2008-01-01

    Oxytocin is a short peptide with multiple functions in human biology and has been implicated in the disorder autism. We set out to determine the normal pattern of variation around the oxytocin gene and have resequenced it and its flanking regions in 91 individuals from four HapMap populations and one chimpanzee. We identified 14 SNPs, all non-coding, including eight that were novel. Population-genetic analyses were largely consistent with a neutral evolutionary history, but an HKA test reveal...

  8. Oxytocin receptor gene variation predicts empathic concern and autonomic arousal while perceiving harm to others

    Karen E. Smith; Porges, Eric C.; Norman, Greg J.; Connelly, Jessica J.; Decety, Jean

    2013-01-01

    Recent research indicates that the neuropeptide oxytocin and the gene for the oxytocin receptor (OXTR) have been implicated in the modulation of various social behaviors, including those related to empathy and sensitivity to others. In this study, we examine the hypothesis that genetic variation in OXTR is associated with autonomic reactions when perceiving others in distress. We also explore the possibility that individual disposition in empathic concern would differ by OXTR genotype. To add...

  9. Sex bias in copy number variation of olfactory receptor gene family depends on ethnicity

    Farideh eShadravan

    2013-01-01

    Gender plays a pivotal role in the human genetic identity and is also manifested in many genetic disorders particularly mental retardation. In this study its effect on copy number variation (CNV), known to cause genetic disorders was explored. As the olfactory receptor (OR) repertoire comprises the largest human gene family, it was selected for this study, which was carried out within and between three populations, derived from 150 individuals from the 1000 Genome Project. Analysis of 3872 CN...

  10. Sequence variation of the amelogenin gene on the Y-chromosome / by Irma Ferreira

    Ferreira, Irma

    2010-01-01

    The accurate determination of gender of biological samples has valuable applications in medical and forensic investigations. Gender determination based on length variations in the X-Y homologous amelogenin gene, is part of most commercial multiplex DNA profiling kits. The first report of a failure of the amelogenin sex test was in 1998 when two normal males were typed as female. Subsequently, several amelogenin Y (AMELY) negative males have been reported. This study repre...

  11. Genetic Variation in Cell Cycle Regulatory Gene AURKA and Association With Intrinsic Breast Cancer Subtype

    Taylor, Nicholas J.; Bensen, Jeannette T.; Poole, Charles; Troester, Melissa A.; Gammon, Marilie D.; Luo, Jingchun; Millikan, Robert C.; Olshan, Andrew F.

    2014-01-01

    AURKA is a putative low-penetrance tumor susceptibility gene due to its prominent role in cell cycle regulation and centrosomal function. Germline variation in AURKA was evaluated for association with breast cancer and intrinsic breast cancer subtypes in the Carolina Breast Cancer Study (CBCS), a population-based case-control study of African Americans (AA) and Caucasians (Cau). Tag and candidate single nucleotide polymorphisms (SNPs) on AURKA were genotyped in 1946 cases and 1747 controls. I...

  12. Constitutional genetic variation at the human aromatase gene (Cyp19) and breast cancer risk

    Siegelmann-Danieli, N; Buetow, K H

    1999-01-01

    The activity of the aromatase enzyme, which converts androgens into oestrogens and has a major role in regulating oestrogen levels in the breast, is thought to be a contributing factor in the development of breast cancer. We undertook this study to assess the role of constitutional genetic variation in the human aromatase gene (Cyp19) in the development of this disease. Our genotyping of 348 cases with breast cancer and 145 controls (all Caucasian women) for a published tetranucleotide repeat...

  13. Cytokine gene variations associated with trait and state anxiety in oncology patients and their family caregivers

    Miaskowski, C; Cataldo, JK; Baggott, CR; West, C; Dunn, LB; Dhruva, A; Merriman, JD; Langford, DJ; Kober, KM; Paul, SM; Cooper, BA; Aouizerat, BE

    2015-01-01

    © 2014, Springer-Verlag Berlin Heidelberg. Purpose: Anxiety is common among cancer patients and their family caregivers (FCs) and is associated with poorer outcomes. Recently, associations between inflammation and anxiety were identified. However, the relationship between variations in cytokine genes and anxiety warrants investigation. Therefore, phenotypic and genotypic characteristics associated with trait and state anxiety were evaluated in a sample of 167 oncology patients with breast, pr...

  14. Sweet Taste Receptor Gene Variation and Aspartame Taste in Primates and Other Species

    Xia LI; Bachmanov, Alexander A.; Maehashi, Kenji; LI, Weihua; Lim, Raymond; Brand, Joseph G.; Beauchamp, Gary K.; Reed, Danielle R.; Thai, Chloe; Floriano, Wely B.

    2011-01-01

    Aspartame is a sweetener added to foods and beverages as a low-calorie sugar replacement. Unlike sugars, which are apparently perceived as sweet and desirable by a range of mammals, the ability to taste aspartame varies, with humans, apes, and Old World monkeys perceiving aspartame as sweet but not other primate species. To investigate whether the ability to perceive the sweetness of aspartame correlates with variations in the DNA sequence of the genes encoding sweet taste receptor proteins, ...

  15. Identification of QTL genes for BMD variation using both linkage and gene-based association approaches

    Li, Gloria Hoi-Yee; Cheung, Ching-Lung; Xiao, Su-Mei; Lau, Kam-Shing; Gao, Yi; Bow, Cora H.; Huang, Qing-Yang; Sham, Pak-Chung; Kung, Annie Wai-Chee

    2011-01-01

    Low bone mineral density (BMD) is a risk factor for osteoporotic fracture with a high heritability. Previous large scale linkage study in Northern Chinese has identified four significant quantitative trait loci (QTL) for BMD variation on chromosome 2q24, 5q21, 7p21 and 13q21. We performed a replication study of these four QTL in 1,459 Southern Chinese from 306 pedigrees. Successful replication was observed on chromosome 5q21 for femoral neck BMD with a LOD score of 1.38 (nominal p value = 0.0...

  16. Tissue-specific effects of genetic and epigenetic variation on gene regulation and splicing.

    Maria Gutierrez-Arcelus

    2015-01-01

    Full Text Available Understanding how genetic variation affects distinct cellular phenotypes, such as gene expression levels, alternative splicing and DNA methylation levels, is essential for better understanding of complex diseases and traits. Furthermore, how inter-individual variation of DNA methylation is associated to gene expression is just starting to be studied. In this study, we use the GenCord cohort of 204 newborn Europeans' lymphoblastoid cell lines, T-cells and fibroblasts derived from umbilical cords. The samples were previously genotyped for 2.5 million SNPs, mRNA-sequenced, and assayed for methylation levels in 482,421 CpG sites. We observe that methylation sites associated to expression levels are enriched in enhancers, gene bodies and CpG island shores. We show that while the correlation between DNA methylation and gene expression can be positive or negative, it is very consistent across cell-types. However, this epigenetic association to gene expression appears more tissue-specific than the genetic effects on gene expression or DNA methylation (observed in both sharing estimations based on P-values and effect size correlations between cell-types. This predominance of genetic effects can also be reflected by the observation that allele specific expression differences between individuals dominate over tissue-specific effects. Additionally, we discover genetic effects on alternative splicing and interestingly, a large amount of DNA methylation correlating to alternative splicing, both in a tissue-specific manner. The locations of the SNPs and methylation sites involved in these associations highlight the participation of promoter proximal and distant regulatory regions on alternative splicing. Overall, our results provide high-resolution analyses showing how genome sequence variation has a broad effect on cellular phenotypes across cell-types, whereas epigenetic factors provide a secondary layer of variation that is more tissue-specific. Furthermore

  17. Redefining the expressed prototype SICAvar gene involved in Plasmodium knowlesi antigenic variation

    Galinski Mary R

    2009-07-01

    Full Text Available Abstract Background The SICAvar gene family, expressed at the surface of infected erythrocytes, is critical for antigenic variation in Plasmodium knowlesi. When this family was discovered, a prototypic SICAvar gene was characterized and defined by a 10-exon structure. The predicted 205-kDa protein lacked a convincing signal peptide, but included a series of variable cysteine-rich modules, a transmembrane domain encoded by the penultimate exon, and a cytoplasmic domain encoded by the final highly conserved exon. The 205 SICAvar gene and its family with up to 108 possible family members, was identified prior to the sequencing of the P. knowlesi genome. However, in the published P. knowlesi database this gene remains disjointed in five fragments. This study addresses a number of structural and functional questions that are critical for understanding SICAvar gene expression. Methods Database mining, bioinformatics, and traditional genomic and post-genomic experimental methods including proteomic technologies are used here to confirm the genomic context and expressed structure of the prototype 205 SICAvar gene. Results This study reveals that the 205 SICAvar gene reported previously to have a 10-exon expressed gene structure has, in fact, 12 exons, with an unusually large and repeat-laden intron separating two newly defined upstream exons and the bona fide 5'UTR from the remainder of the gene sequence. The initial exon encodes a PEXEL motif, which may function to localize the SICA protein in the infected erythrocyte membrane. This newly defined start of the 205 SICAvar sequence is positioned on chromosome 5, over 340 kb upstream from the rest of the telomerically positioned SICAvar gene sequence in the published genome assembly. This study, however, verifies the continuity of these sequences, a 9.5 kb transcript, and provides evidence that the 205 SICAvar gene is located centrally on chromosome 5. Conclusion The prototype 205 SICAvar gene has been

  18. Common Genetic Variation in Circadian Rhythm Genes and Risk of Epithelial Ovarian Cancer (EOC)

    Jim, Heather S.L.; Lin, Hui-Yi; Tyrer, Jonathan P.; Lawrenson, Kate; Dennis, Joe; Chornokur, Ganna; Chen, Zhihua; Chen, Ann Y.; Permuth-Wey, Jennifer; Aben, Katja KH.; Anton-Culver, Hoda; Antonenkova, Natalia; Bruinsma, Fiona; Bandera, Elisa V.; Bean, Yukie T.; Beckmann, Matthias W.; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A.; Brooks-Wilson, Angela; Bunker, Clareann H.; Butzow, Ralf; Campbell, Ian G.; Carty, Karen; Chang-Claude, Jenny; Cook, Linda S.; Cramer, Daniel W.; Cunningham, Julie M.; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; du Bois, Andreas; Despierre, Evelyn; Sieh, Weiva; Doherty, Jennifer A.; Dörk, Thilo; Dürst, Matthias; Easton, Douglas F.; Eccles, Diana M.; Edwards, Robert P.; Ekici, Arif B.; Fasching, Peter A.; Fridley, Brooke L.; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G.; Glasspool, Rosalind; Goodman, Marc T.; Gronwald, Jacek; Harter, Philipp; Hasmad, Hanis N.; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A.T.; Hillemanns, Peter; Hogdall, Claus K.; Hogdall, Estrid; Hosono, Satoyo; Iversen, Edwin S.; Jakubowska, Anna; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y.; Kellar, Melissa; Kiemeney, Lambertus A.; Krakstad, Camilla; Kjaer, Susanne K.; Kupryjanczyk, Jolanta; Vierkant, Robert A.; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D.; Lee, Alice W.; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A.; Liang, Dong; Lim, Boon Kiong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F.A.G.; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R.; McNeish, Ian; Menon, Usha; Milne, Roger L.; Modugno, Francesmary; Thomsen, Lotte; Moysich, Kirsten B.; Ness, Roberta B.; Nevanlinna, Heli; Eilber, Ursula; Odunsi, Kunle; Olson, Sara H.; Orlow, Irene; Orsulic, Sandra; Palmieri Weber, Rachel; Paul, James; Pearce, Celeste L.; Pejovic, Tanja; Pelttari, Liisa M.; Pike, Malcolm C.; Poole, Elizabeth M.; Schernhammer, Eva; Risch, Harvey A.; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H.; Rudolph, Anja; Runnebaum, Ingo B.; Rzepecka, Iwona K.; Salvesen, Helga B.; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B.; Siddiqui, Nadeem; Song, Honglin; Southey, Melissa C.; Spiewankiewicz, Beata; Sucheston-Campbell, Lara; Teo, Soo-Hwang; Terry, Kathryn L.; Thompson, Pamela J.; Tangen, Ingvild L.; Tworoger, Shelley S.; van Altena, Anne M.; Vergote, Ignace; Walsh, Christine S.; Wang-Gohrke, Shan; Wentzensen, Nicolas; Whittemore, Alice S.; Wicklund, Kristine G.; Wilkens, Lynne R.; Wu, Anna H.; Wu, Xifeng; Woo, Yin-Ling; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Amankwah, Ernest; Berchuck, Andrew; Schildkraut, Joellen M.; Kelemen, Linda E.; Ramus, Susan J.; Monteiro, Alvaro N.A.; Goode, Ellen L.; Narod, Steven A.; Gayther, Simon A.; Pharoah, Paul D. P.; Sellers, Thomas A.; Phelan, Catherine M.

    2016-01-01

    Disruption in circadian gene expression, whether due to genetic variation or environmental factors (e.g., light at night, shiftwork), is associated with increased incidence of breast, prostate, gastrointestinal and hematologic cancers and gliomas. Circadian genes are highly expressed in the ovaries where they regulate ovulation; circadian disruption is associated with several ovarian cancer risk factors (e.g., endometriosis). However, no studies have examined variation in germline circadian genes as predictors of ovarian cancer risk and invasiveness. The goal of the current study was to examine single nucleotide polymorphisms (SNPs) in circadian genes BMAL1, CRY2, CSNK1E, NPAS2, PER3, REV1 and TIMELESS and downstream transcription factors KLF10 and SENP3 as predictors of risk of epithelial ovarian cancer (EOC) and histopathologic subtypes. The study included a test set of 3,761 EOC cases and 2,722 controls and a validation set of 44,308 samples including 18,174 (10,316 serous) cases and 26,134 controls from 43 studies participating in the Ovarian Cancer Association Consortium (OCAC). Analysis of genotype data from 36 genotyped SNPs and 4600 imputed SNPs indicated that the most significant association was rs117104877 in BMAL1 (OR = 0.79, 95% CI = 0.68–0.90, p = 5.59 × 10−4]. Functional analysis revealed a significant down regulation of BMAL1 expression following cMYC overexpression and increasing transformation in ovarian surface epithelial (OSE) cells as well as alternative splicing of BMAL1 exons in ovarian and granulosa cells. These results suggest that variation in circadian genes, and specifically BMAL1, may be associated with risk of ovarian cancer, likely through disruption of hormonal pathways. PMID:26807442

  19. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation

    Macke, J.P.; Nathans, J.; King, V.L. (Johns Hopkins Univ., Baltimore, MD (United States)); Hu, N.; Hu, S.; Hamer, D.; Bailey, M. (Northwestern Univ., Evanston, IL (United States)); Brown, T. (Johns Hopkins Univ. School of Hygiene and Public Health, Baltimore, MD (United States))

    1993-10-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, the authors have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the entire androgen receptor coding region for sequence variation by PCR and denaturing gradient-gel electrophoresis (DGGE) and/or single-strand conformation polymorphism analysis in 20 homosexual males with homosexual or bisexual brothers and one homosexual male with no homosexual brothers, and screened the amino-terminal domain of the receptor for sequence variation in an additional 44 homosexual males, 37 of whom had one or more first- or second-degree male relatives who were either homosexual or bisexual. These analyses show that (1) homosexual brothers are as likely to be discordant as concordant for androgen receptor alleles; (2) there are no large-scale differences between the distributions of polyglycine or polyglutamine tract lengths in the homosexual and control groups; and (3) coding region sequence variation is not commonly found within the androgen receptor gene of homosexual men. The DGGE screen identified two rare amino acid substitutions, ser[sup 205] -to-arg and glu[sup 793]-to-asp, the biological significance of which is unknown. 32 refs., 2 figs., 2 tabs.

  20. Associations between dopamine D4 receptor gene variation with both infidelity and sexual promiscuity.

    Justin R Garcia

    Full Text Available BACKGROUND: Human sexual behavior is highly variable both within and between populations. While sex-related characteristics and sexual behavior are central to evolutionary theory (sexual selection, little is known about the genetic bases of individual variation in sexual behavior. The variable number tandem repeats (VNTR polymorphism in exon III of the human dopamine D4 receptor gene (DRD4 has been correlated with an array of behavioral phenotypes and may be predicatively responsible for variation in motivating some sexual behaviors, particularly promiscuity and infidelity. METHODOLOGY/PRINCIPAL FINDINGS: We administered an anonymous survey on personal history of sexual behavior and intimate relationships to 181 young adults. We also collected buccal wash samples and genotyped the DRD4 VNTR. Here we show that individuals with at least one 7-repeat allele (7R+ report a greater categorical rate of promiscuous sexual behavior (i.e., having ever had a "one-night stand" and report a more than 50% increase in instances of sexual infidelity. CONCLUSIONS/SIGNIFICANCE: DRD4 VNTR genotype varies considerably within and among populations and has been subject to relatively recent, local selective pressures. Individual differences in sexual behavior are likely partially mediated by individual genetic variation in genes coding for motivation and reward in the brain. Conceptualizing these findings in terms of r/K selection theory suggests a mechanism for selective pressure for and against the 7R+ genotype that may explain the considerable global allelic variation for this polymorphism.

  1. Unlocking naturally occurring variation for starch quality by gene-tagged markers in rice

    Quantitative trait loci (QTLs) mapping and association mapping are currently used to dissect the natural occurring variations for traits of agronomical importance. We found that the major QTLs for starch quality co-locate at the starch-synthesizing gene loci, e.g. Wx locus controls the genetic basis of amylose content, pasting viscosity, gel texture and retrogradation properties, while starch synthase IIa (SSIIa) locus controls the gelatinization temperature (GT) and amylopectin structure. Some of other genes involved in starch biosynthesis and other minor QTLs were also detected. Gene tagged markers such as simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) that were inside or close to those starch-synthesizing genes were designed. Among 499 nonwaxy rice accessions, polymorphisms of SSR in the Waxy gene, soluble starch synthase I gene (SS1) and starch branching enzyme I gene (SBE1), SNPs in Waxy and starch branching enzyme III gene (SBE3) and SSIIa, and a sequence tagged site (STS) in SBEI were surveyed. Ten SSR alleles were found at the Wx locus and four SSR alleles were found at the SBE1 and SS1, respectively. Two continuous SNPs (GC/TT) alone can differentiate rice with high or intermediate GT (possessing GC SNPs) from those with low GT (possessing the TT SNPs). Association test was conducted using all starch gene markers, results indicated that Wx SSR and SNPs were strongly associated with amylose content, pasting viscosities, gel hardness, and retrogradation properties, whereas the SSIIa GC/TT SNPs were strongly associated with the pasting temperature and retrogradation properties, which confirmed the findings from QTL mapping. These markers are useful in molecular breeding for improvement of rice eating and cooking qualities. This study was jointly supported by funds from NSFC (30771327), 863 project (2006AA10Z193), Science and Technology Department of Zhejiang Province (2007C32014) and IAEA (12847). (author)

  2. Indexing Effects of Copy Number Variation on Genes Involved in Developmental Delay.

    Uddin, Mohammed; Pellecchia, Giovanna; Thiruvahindrapuram, Bhooma; D'Abate, Lia; Merico, Daniele; Chan, Ada; Zarrei, Mehdi; Tammimies, Kristiina; Walker, Susan; Gazzellone, Matthew J; Nalpathamkalam, Thomas; Yuen, Ryan K C; Devriendt, Koenraad; Mathonnet, Géraldine; Lemyre, Emmanuelle; Nizard, Sonia; Shago, Mary; Joseph-George, Ann M; Noor, Abdul; Carter, Melissa T; Yoon, Grace; Kannu, Peter; Tihy, Frédérique; Thorland, Erik C; Marshall, Christian R; Buchanan, Janet A; Speevak, Marsha; Stavropoulos, Dimitri J; Scherer, Stephen W

    2016-01-01

    A challenge in clinical genomics is to predict whether copy number variation (CNV) affecting a gene or multiple genes will manifest as disease. Increasing recognition of gene dosage effects in neurodevelopmental disorders prompted us to develop a computational approach based on critical-exon (highly expressed in brain, highly conserved) examination for potential etiologic effects. Using a large CNV dataset, our updated analyses revealed significant (P < 1.64 × 10(-15)) enrichment of critical-exons within rare CNVs in cases compared to controls. Separately, we used a weighted gene co-expression network analysis (WGCNA) to construct an unbiased protein module from prenatal and adult tissues and found it significantly enriched for critical exons in prenatal (P < 1.15 × 10(-50), OR = 2.11) and adult (P < 6.03 × 10(-18), OR = 1.55) tissues. WGCNA yielded 1,206 proteins for which we prioritized the corresponding genes as likely to have a role in neurodevelopmental disorders. We compared the gene lists obtained from critical-exon and WGCNA analysis and found 438 candidate genes associated with CNVs annotated as pathogenic, or as variants of uncertain significance (VOUS), from among 10,619 developmental delay cases. We identified genes containing CNVs previously considered to be VOUS to be new candidate genes for neurodevelopmental disorders (GIT1, MVB12B and PPP1R9A) demonstrating the utility of this strategy to index the clinical effects of CNVs. PMID:27363808

  3. Diversity and population-genetic properties of copy number variations and multicopy genes in cattle.

    Bickhart, Derek M; Xu, Lingyang; Hutchison, Jana L; Cole, John B; Null, Daniel J; Schroeder, Steven G; Song, Jiuzhou; Garcia, Jose Fernando; Sonstegard, Tad S; Van Tassell, Curtis P; Schnabel, Robert D; Taylor, Jeremy F; Lewin, Harris A; Liu, George E

    2016-06-01

    The diversity and population genetics of copy number variation (CNV) in domesticated animals are not well understood. In this study, we analysed 75 genomes of major taurine and indicine cattle breeds (including Angus, Brahman, Gir, Holstein, Jersey, Limousin, Nelore, and Romagnola), sequenced to 11-fold coverage to identify 1,853 non-redundant CNV regions. Supported by high validation rates in array comparative genomic hybridization (CGH) and qPCR experiments, these CNV regions accounted for 3.1% (87.5 Mb) of the cattle reference genome, representing a significant increase over previous estimates of the area of the genome that is copy number variable (∼2%). Further population genetics and evolutionary genomics analyses based on these CNVs revealed the population structures of the cattle taurine and indicine breeds and uncovered potential diversely selected CNVs near important functional genes, including AOX1, ASZ1, GAT, GLYAT, and KRTAP9-1 Additionally, 121 CNV gene regions were found to be either breed specific or differentially variable across breeds, such as RICTOR in dairy breeds and PNPLA3 in beef breeds. In contrast, clusters of the PRP and PAG genes were found to be duplicated in all sequenced animals, suggesting that subfunctionalization, neofunctionalization, or overdominance play roles in diversifying those fertility-related genes. These CNV results provide a new glimpse into the diverse selection histories of cattle breeds and a basis for correlating structural variation with complex traits in the future. PMID:27085184

  4. Targeted capture and resequencing of 1040 genes reveal environmentally driven functional variation in grey wolves.

    Schweizer, Rena M; Robinson, Jacqueline; Harrigan, Ryan; Silva, Pedro; Galverni, Marco; Musiani, Marco; Green, Richard E; Novembre, John; Wayne, Robert K

    2016-01-01

    In an era of ever-increasing amounts of whole-genome sequence data for individuals and populations, the utility of traditional single nucleotide polymorphisms (SNPs) array-based genome scans is uncertain. We previously performed a SNP array-based genome scan to identify candidate genes under selection in six distinct grey wolf (Canis lupus) ecotypes. Using this information, we designed a targeted capture array for 1040 genes, including all exons and flanking regions, as well as 5000 1-kb nongenic neutral regions, and resequenced these regions in 107 wolves. Selection tests revealed striking patterns of variation within candidate genes relative to noncandidate regions and identified potentially functional variants related to local adaptation. We found 27% and 47% of candidate genes from the previous SNP array study had functional changes that were outliers in sweed and bayenv analyses, respectively. This result verifies the use of genomewide SNP surveys to tag genes that contain functional variants between populations. We highlight nonsynonymous variants in APOB, LIPG and USH2A that occur in functional domains of these proteins, and that demonstrate high correlation with precipitation seasonality and vegetation. We find Arctic and High Arctic wolf ecotypes have higher numbers of genes under selection, which highlight their conservation value and heightened threat due to climate change. This study demonstrates that combining genomewide genotyping arrays with large-scale resequencing and environmental data provides a powerful approach to discern candidate functional variants in natural populations. PMID:26562361

  5. Identification of Genes Responsible for Natural Variation in Volatile Content Using Next-Generation Sequencing Technology.

    Amaya, Iraida; Pillet, Jeremy; Folta, Kevin M

    2016-01-01

    Identification of the genes controlling the variation of key traits remains a challenge for plant researchers and represents a goal for the development of functional markers and their implementation in marker-assisted crop breeding. As an example we describe the identification of volatile organic compounds (VOCs) that segregate as single locus or mayor quantitative trait loci (QTL) in strawberry F1 segregating populations. Next, we describe a fast and efficient method for RNA extraction in strawberry that yields high-quality RNA for downstream RNA-seq analysis. Finally, two alternative methods for analysis of global transcript expression in contrasting lines will be described in order to identify the candidate gene and genes with differential expression using RNA-seq. PMID:26577779

  6. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk

    Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P;

    2015-01-01

    BACKGROUND: Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As...... DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC), we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk. METHODS: In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and...... imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4). CONCLUSION: These results, generated on a large cohort of women, revealed associations between inherited cellular transport gene variants and risk of EOC histologic subtypes....

  7. Variation in Telangiectasia Predisposing Genes Is Associated With Overall Radiation Toxicity

    Tanteles, George A. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Murray, Robert J.S. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Mills, Jamie [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Barwell, Julian [Department of Genetics, University of Leicester, Leicester (United Kingdom); Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Chakraborti, Prabir [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Chan, Steve [Department of Clinical Oncology, Nottingham University Hospitals NHS Trust, Nottingham (United Kingdom); Cheung, Kwok-Leung [Division of Breast Surgery, University of Nottingham, Nottingham (United Kingdom); Ennis, Dawn [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Khurshid, Nazish [Department of Genetics, University of Leicester, Leicester (United Kingdom); Lambert, Kelly [Department of Breast Surgery, University Hospitals of Leicester, Glenfield Hospital, Leicester (United Kingdom); Machhar, Rohan; Meisuria, Mitul [Department of Genetics, University of Leicester, Leicester (United Kingdom); Osman, Ahmed; Peat, Irene [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Sahota, Harjinder [Department of Genetics, University of Leicester, Leicester (United Kingdom); Woodings, Pamela [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Talbot, Christopher J., E-mail: cjt14@le.ac.uk [Department of Genetics, University of Leicester, Leicester (United Kingdom); and others

    2012-11-15

    Purpose: In patients receiving radiotherapy for breast cancer where the heart is within the radiation field, cutaneous telangiectasiae could be a marker of potential radiation-induced heart disease. We hypothesized that single nucleotide polymorphisms (SNPs) in genes known to cause heritable telangiectasia-associated disorders could predispose to such late, normal tissue vascular damage. Methods and Materials: The relationship between cutaneous telangiectasia as a late normal tissue radiation injury phenotype in 633 breast cancer patients treated with radiotherapy was examined. Patients were clinically assessed for the presence of cutaneous telangiectasia and genotyped at nine SNPs in three candidate genes. Candidate SNPs were within the endoglin (ENG) and activin A receptor, type II-like 1 (ACVRL1) genes, mutations in which cause hereditary hemorrhagic telangiectasia and the ataxia-telangiectasia mutated (ATM) gene associated with ataxia-telangiectasia. Results: A total of 121 (19.1%) patients exhibited a degree of cutaneous telangiectasiae on clinical examination. Regression was used to examine the associations between the presence of telangiectasiae in patients who underwent breast-conserving surgery, controlling for the effects of boost and known brassiere size (n=388), and individual geno- or haplotypes. Inheritance of ACVRL1 SNPs marginally contributed to the risk of cutaneous telangiectasiae. Haplotypic analysis revealed a stronger association between inheritance of a ATM haplotype and the presence of cutaneous telangiectasiae, fibrosis and overall toxicity. No significant association was observed between telangiectasiae and the coinheritance of the candidate ENG SNPs. Conclusions: Genetic variation in the ATM gene influences reaction to radiotherapy through both vascular damage and increased fibrosis. The predisposing variation in the ATM gene will need to be better defined to optimize it as a predictive marker for assessing radiotherapy late effects.

  8. AB162. Genes variation in three families of Vietnamese dioxin victim

    Ton, Nguyen Dang; Ha, Nguyen Hai; Nhung, Vu Phuong; Khoi, Pham Nhat; Duong, Nguyen Thuy; Hue, Huynh Thi Thu; Hien, Le Thi Thu; Hoang, Nguyen Huy; Van Hai, Nong

    2015-01-01

    Dioxins are a class of chemical contaminants that are formed during combustion processes such as herbicide manufacturing, waste incineration, forest fires, and backyard trash burning. The most toxic chemical in the class is 2,3,7,8-tetrachlorodibenzo-para-dioxin (TCDD). Approximately 18 million gallons of Agent Orange were sprayed by US Airforce on southern of Vietnam from 1962 to 1971. About 0.3% of Agent Orange consisted of TCDD. Dioxins have been considered highly toxic and able to cause cancer, reproductive and developmental problems, damage the immune system, and interfere with hormones. In this paper we studied gene variation in some families of dioxin victims of Vietnamese army veterans who have been exposed directly under sprays or carried out missions for at least 2 years in the heavily sprayed regions. Of the first family, we found 21 nucleotide variants in TP53 gene, 13 nucleotide variants in AhR gene. All of theme leading to amino acid change. We also found R554K in ThB4.VT16 and ThB4.VT17. This mutation changes activity for CYP1A1 induction in lymphocytes. In the second family, we identified 29 nucleotide variants in TP53 gene. Although we could not found any variant associated with phenotype of the family members but previous studies have found P295L associated with gastric carcinoma, L299P associated with pancreatic cancer, G279E associated with colorectal carcinoma and cancer of male sex cells. In the third family, we found 22 nucleotide variants in TP53 gene and 9 variants in CYP1B1 gene. For understanding of whole genome sequence variation, whole genome of 3 member of each family has been sequenced by Illumina HiSeq 2000/2500 platform. The whole genome sequence data have started analysing.

  9. Phase variation leads to the misidentification of a Neisseria gonorrhoeae virulence gene.

    Mark T Anderson

    Full Text Available Neisseria gonorrhoeae is the causative agent of gonorrhea and an obligate pathogen of humans. The Opa proteins of these bacteria are known to mediate attachment and internalization by host cells, including neutrophils. The Opa protein repertoire of a typical N. gonorrhoeae isolate is encoded on ~11 genes distributed throughout the chromosome and is subject to stochastic changes in expression through phase variation. Together, these characteristics make Opa proteins a critical yet unpredictable aspect of any experimental investigation into the interaction of N. gonorrhoeae with host cells. The goal of this study was to identify novel virulence factors of N. gonorrhoeae by assessing the contribution of a set of uncharacterized hydrogen peroxide-induced genes to bacterial survival against neutrophil-mediated killing. To this end, a strain harboring an engineered mutation in the NGO0322 gene was identified that exhibited increased sensitivity to neutrophil-mediated killing, enhanced internalization by neutrophils, and the ability to induce high levels of neutrophil-generated reactive oxygen species. Each of these phenotypes reverted to near wild-type levels following genetic complementation of the NGO0322 mutation. However, after immunoblot analysis of Opa proteins expressed by the isogenic parent, mutant, and genetically complemented strains, it was determined that phase variation had resulted in a disparity between the Opa profiles of these strains. To determine whether Opa phase variation, rather than NGO0322 mutation, was the cause of the observed neutrophil-related phenotypes, NGO0322 function was investigated in N. gonorrhoeae strains lacking all Opa proteins or constitutively expressing the OpaD variant. In both cases, mutation of NGO0322 did not alter survival of gonococci in the presence of neutrophils. These results demonstrate the importance of controlling for the frequent and random variation in Opa protein production by N. gonorrhoeae

  10. A general scenario of Hox gene inventory variation among major sarcopterygian lineages

    Wang Chaolin

    2011-01-01

    Full Text Available Abstract Background Hox genes are known to play a key role in shaping the body plan of metazoans. Evolutionary dynamics of these genes is therefore essential in explaining patterns of evolutionary diversity. Among extant sarcopterygians comprising both lobe-finned fishes and tetrapods, our knowledge of the Hox genes and clusters has largely been restricted in several model organisms such as frogs, birds and mammals. Some evolutionary gaps still exist, especially for those groups with derived body morphology or occupying key positions on the tree of life, hindering our understanding of how Hox gene inventory varied along the sarcopterygian lineage. Results We determined the Hox gene inventory for six sarcopterygian groups: lungfishes, caecilians, salamanders, snakes, turtles and crocodiles by comprehensive PCR survey and genome walking. Variable Hox genes in each of the six sarcopterygian group representatives, compared to the human Hox gene inventory, were further validated for their presence/absence by PCR survey in a number of related species representing a broad evolutionary coverage of the group. Turtles, crocodiles, birds and placental mammals possess the same 39 Hox genes. HoxD12 is absent in snakes, amphibians and probably lungfishes. HoxB13 is lost in frogs and caecilians. Lobe-finned fishes, amphibians and squamate reptiles possess HoxC3. HoxC1 is only present in caecilians and lobe-finned fishes. Similar to coelacanths, lungfishes also possess HoxA14, which is only found in lobe-finned fishes to date. Our Hox gene variation data favor the lungfish-tetrapod, turtle-archosaur and frog-salamander relationships and imply that the loss of HoxD12 is not directly related to digit reduction. Conclusions Our newly determined Hox inventory data provide a more complete scenario for evolutionary dynamics of Hox genes along the sarcopterygian lineage. Limbless, worm-like caecilians and snakes possess similar Hox gene inventories to animals with

  11. Antigen-presenting genes and genomic copy number variations in the Tasmanian devil MHC

    Cheng Yuanyuan

    2012-03-01

    Full Text Available Abstract Background The Tasmanian devil (Sarcophilus harrisii is currently under threat of extinction due to an unusual fatal contagious cancer called Devil Facial Tumour Disease (DFTD. DFTD is caused by a clonal tumour cell line that is transmitted between unrelated individuals as an allograft without triggering immune rejection due to low levels of Major Histocompatibility Complex (MHC diversity in Tasmanian devils. Results Here we report the characterization of the genomic regions encompassing MHC Class I and Class II genes in the Tasmanian devil. Four genomic regions approximately 960 kb in length were assembled and annotated using BAC contigs and physically mapped to devil Chromosome 4q. 34 genes and pseudogenes were identified, including five Class I and four Class II loci. Interestingly, when two haplotypes from two individuals were compared, three genomic copy number variants with sizes ranging from 1.6 to 17 kb were observed within the classical Class I gene region. One deletion is particularly important as it turns a Class Ia gene into a pseudogene in one of the haplotypes. This deletion explains the previously observed variation in the Class I allelic number between individuals. The frequency of this deletion is highest in the northwestern devil population and lowest in southeastern areas. Conclusions The third sequenced marsupial MHC provides insights into the evolution of this dynamic genomic region among the diverse marsupial species. The two sequenced devil MHC haplotypes revealed three copy number variations that are likely to significantly affect immune response and suggest that future work should focus on the role of copy number variations in disease susceptibility in this species.

  12. Recombination in pe/ppe genes contributes to genetic variation in Mycobacterium tuberculosis lineages

    Phelan, Jody E.

    2016-02-29

    Background Approximately 10 % of the Mycobacterium tuberculosis genome is made up of two families of genes that are poorly characterized due to their high GC content and highly repetitive nature. The PE and PPE families are typified by their highly conserved N-terminal domains that incorporate proline-glutamate (PE) and proline-proline-glutamate (PPE) signature motifs. They are hypothesised to be important virulence factors involved with host-pathogen interactions, but their high genetic variability and complexity of analysis means they are typically disregarded in genome studies. Results To elucidate the structure of these genes, 518 genomes from a diverse international collection of clinical isolates were de novo assembled. A further 21 reference M. tuberculosis complex genomes and long read sequence data were used to validate the approach. SNP analysis revealed that variation in the majority of the 168 pe/ppe genes studied was consistent with lineage. Several recombination hotspots were identified, notably pe_pgrs3 and pe_pgrs17. Evidence of positive selection was revealed in 65 pe/ppe genes, including epitopes potentially binding to major histocompatibility complex molecules. Conclusions This, the first comprehensive study of the pe and ppe genes, provides important insight into M. tuberculosis diversity and has significant implications for vaccine development.

  13. Evaluation of bovine chemerin (RARRES2 gene variation on beef cattle production traits

    Amanda K Lindholm-Perry

    2012-03-01

    Full Text Available A previous study in cattle based on >48,000 markers identified markers on chromosome 4 near the chemerin gene associated with average daily feed intake (ADFI in steers (P<0.008. Chemerin is an adipokine associated with obesity and metabolic syndrome in humans, representing a strong candidate gene potentially underlying the observed association. To evaluate whether the bovine chemerin gene is involved in feed intake, 16 markers within and around the gene were tested for association in the same resource population. Eleven were nominally significant for ADFI (P<0.05 and two were significant after Bonferroni correction. Two and five SNP in this region were nominally significant for the related traits of average daily gain (ADG and residual feed intake (RFI, respectively. All markers were evaluated for effects on meat quality and carcass phenotypes. Many of the markers associated with ADFI were associated with hot carcass weight (HCW, adjusted fat thickness (AFT, and marbling (P<0.05. Marker alleles that were associated with lower ADFI were also associated with lower HCW, AFT, and marbling. Markers associated with ADFI were genotyped in a validation population of steers representing 14 breeds to determine predictive merit across populations. No consistent relationships for ADFI were detected. To determine whether cattle feed intake or growth phenotypes might be related to chemerin transcript abundance, the expression of chemerin was evaluated in adipose of 114 heifers that were siblings of the steers in the discovery population. Relative chemerin transcript abundance was not correlated with ADFI, ADG, or RFI, but associations with body condition score and yearling weight were observed. We conclude that variation in the chemerin gene may underlie observed association in the resource population, but that additional research is required to determine if this variation is widespread among breeds and to develop robust markers with predictive merit across

  14. Adaptive variation regulates the expression of the human SGK1 gene in response to stress.

    Francesca Luca

    2009-05-01

    Full Text Available The Serum and Glucocorticoid-regulated Kinase1 (SGK1 gene is a target of the glucocorticoid receptor (GR and is central to the stress response in many human tissues. Because environmental stress varies across habitats, we hypothesized that natural selection shaped the geographic distribution of genetic variants regulating the level of SGK1 expression following GR activation. By combining population genetics and molecular biology methods, we identified a variant (rs9493857 with marked allele frequency differences between populations of African and European ancestry and with a strong correlation between allele frequency and latitude in worldwide population samples. This SNP is located in a GR-binding region upstream of SGK1 that was identified using a GR ChIP-chip. SNP rs9493857 also lies within a predicted binding site for Oct1, a transcription factor known to cooperate with the GR in the transactivation of target genes. Using ChIP assays, we show that both GR and Oct1 bind to this region and that the ancestral allele at rs9493857 binds the GR-Oct1 complex more efficiently than the derived allele. Finally, using a reporter gene assay, we demonstrate that the ancestral allele is associated with increased glucocorticoid-dependent gene expression when compared to the derived allele. Our results suggest a novel paradigm in which hormonal responsiveness is modulated by sequence variation in the regulatory regions of nuclear receptor target genes. Identifying such functional variants may shed light on the mechanisms underlying inter-individual variation in response to environmental stressors and to hormonal therapy, as well as in the susceptibility to hormone-dependent diseases.

  15. The identification of additional zebrafish DICP genes reveals haplotype variation and linkage to MHC class I genes.

    Rodriguez-Nunez, Ivan; Wcisel, Dustin J; Litman, Ronda T; Litman, Gary W; Yoder, Jeffrey A

    2016-04-01

    Bony fish encode multiple multi-gene families of membrane receptors that are comprised of immunoglobulin (Ig) domains and are predicted to function in innate immunity. One of these families, the diverse immunoglobulin (Ig) domain-containing protein (DICP) genes, maps to three chromosomal loci in zebrafish. Most DICPs possess one or two Ig ectodomains and include membrane-bound and secreted forms. Membrane-bound DICPs include putative inhibitory and activating receptors. Recombinant DICP Ig domains bind lipids with varying specificity, a characteristic shared with mammalian CD300 and TREM family members. Numerous DICP transcripts amplified from different lines of zebrafish did not match the zebrafish reference genome sequence suggesting polymorphic and haplotypic variation. The expression of DICPs in three different lines of zebrafish has been characterized employing PCR-based strategies. Certain DICPs exhibit restricted expression in adult tissues whereas others are expressed ubiquitously. Transcripts of a subset of DICPs can be detected during embryonic development suggesting roles in embryonic immunity or other developmental processes. Transcripts representing 11 previously uncharacterized DICP sequences were identified. The assignment of two of these sequences to an unplaced genomic scaffold resulted in the identification of an alternative DICP haplotype that is linked to a MHC class I Z lineage haplotype on zebrafish chromosome 3. The linkage of DICP and MHC class I genes also is observable in the genomes of the related grass carp (Ctenopharyngodon idellus) and common carp (Cyprinus carpio) suggesting that this is a shared character with the last common Cyprinidae ancestor. PMID:26801775

  16. Natural variation and gene regulatory basis for the responses of asparagus beans to soil drought

    Pei eXu

    2015-10-01

    Full Text Available Asparagus bean (Vigna unguiculata ssp. sesquipedalis is the Asian subspecies of cowpea, a drought-resistant legume crop native to Africa. In order to explore the genetic variation of drought responses in asparagus bean, we conducted multi-year phenotyping of drought resistance traits across the Chinese asparagus bean mini-core. The phenotypic distribution indicated that the ssp. sesquipedalis subgene pool has maintained high natural variation in drought responses despite known domestic bottleneck. Thirty-nine SNP loci were found to show an association with drought resistance via a genome-wide association study (GWAS. Whole-plant water relations were compared among four genotypes by lysimetric assay. Apparent genotypic differences in transpiration patterns and the critical soil water threshold in relation to dehydration avoidance were observed, indicating a delicate adaptive mechanism for each genotype to its own climate. Microarray gene expression analyses revealed that known drought resistance pathways such as the ABA and phosphate lipid signaling pathways are conserved between genotypes, while differential regulation of certain aquaporin genes and hormonal genes may be important for the genotypic differences. Our results suggest that divergent sensitivity to soil water content is an important mechanism configuring the genotypic specific responses to water deficit. The SNP markers identified provide useful resources for marker-assisted breeding.

  17. Natural variation and gene regulatory basis for the responses of asparagus beans to soil drought.

    Xu, Pei; Moshelion, Menachem; Wu, XiaoHua; Halperin, Ofer; Wang, BaoGen; Luo, Jie; Wallach, Rony; Wu, Xinyi; Lu, Zhongfu; Li, Guojing

    2015-01-01

    Asparagus bean (Vigna unguiculata ssp. sesquipedalis) is the Asian subspecies of cowpea, a drought-resistant legume crop native to Africa. In order to explore the genetic variation of drought responses in asparagus bean, we conducted multi-year phenotyping of drought resistance traits across the Chinese asparagus bean mini-core. The phenotypic distribution indicated that the ssp. sesquipedalis subgene pool has maintained high natural variation in drought responses despite known domestic bottleneck. Thirty-nine SNP loci were found to show an association with drought resistance via a genome-wide association study (GWAS). Whole-plant water relations were compared among four genotypes by lysimetric assay. Apparent genotypic differences in transpiration patterns and the critical soil water threshold in relation to dehydration avoidance were observed, indicating a delicate adaptive mechanism for each genotype to its own climate. Microarray gene expression analyses revealed that known drought resistance pathways such as the ABA and phosphate lipid signaling pathways are conserved between different genotypes, while differential regulation of certain aquaporin genes and hormonal genes may be important for the genotypic differences. Our results suggest that divergent sensitivity to soil water content is an important mechanism configuring the genotypic specific responses to water deficit. The SNP markers identified provide useful resources for marker-assisted breeding. PMID:26579145

  18. Common Variation in the DOPA Decarboxylase (DDC) Gene and Human Striatal DDC Activity In Vivo.

    Eisenberg, Daniel P; Kohn, Philip D; Hegarty, Catherine E; Ianni, Angela M; Kolachana, Bhaskar; Gregory, Michael D; Masdeu, Joseph C; Berman, Karen F

    2016-08-01

    The synthesis of multiple amine neurotransmitters, such as dopamine, norepinephrine, serotonin, and trace amines, relies in part on DOPA decarboxylase (DDC, AADC), an enzyme that is required for normative neural operations. Because rare, loss-of-function mutations in the DDC gene result in severe enzymatic deficiency and devastating autonomic, motor, and cognitive impairment, DDC common genetic polymorphisms have been proposed as a source of more moderate, but clinically important, alterations in DDC function that may contribute to risk, course, or treatment response in complex, heritable neuropsychiatric illnesses. However, a direct link between common genetic variation in DDC and DDC activity in the living human brain has never been established. We therefore tested for this association by conducting extensive genotyping across the DDC gene in a large cohort of 120 healthy individuals, for whom DDC activity was then quantified with [(18)F]-FDOPA positron emission tomography (PET). The specific uptake constant, Ki, a measure of DDC activity, was estimated for striatal regions of interest and found to be predicted by one of five tested haplotypes, particularly in the ventral striatum. These data provide evidence for cis-acting, functional common polymorphisms in the DDC gene and support future work to determine whether such variation might meaningfully contribute to DDC-mediated neural processes relevant to neuropsychiatric illness and treatment. PMID:26924680

  19. The Role of Genetic Variation in the Lamin A/C Gene in the Etiology of Polycystic Ovary Syndrome

    Urbanek, Margrit; Nampiaparampil, Geetha; D'Souza, Janine; Sefton, Elizabeth; Ackerman, Christine; Legro, Richard S.; Dunaif, Andrea

    2009-01-01

    Objective: We performed this study to test the hypothesis that variation in the lamin a/c gene (LMNA) contributes to milder phenotypes of insulin resistance, hyperandrogenism, and/or metabolic syndrome associated with polycystic ovary syndrome (PCOS).

  20. Neandertal origin of genetic variation at the cluster of OAS immunity genes.

    Mendez, Fernando L; Watkins, Joseph C; Hammer, Michael F

    2013-04-01

    Analyses of ancient DNA from extinct humans reveal signals of at least two independent hybridization events in the history of non-African populations. To date, there are very few examples of specific genetic variants that have been rigorously identified as introgressive. Here, we survey DNA sequence variation in the OAS gene cluster on chromosome 12 and provide strong evidence that a haplotype extending for ~185 kb introgressed from Neandertals. This haplotype is nearly restricted to Eurasians and is estimated to have diverged from the Neandertal sequence ~125 kya. Despite the potential for novel functional variation, the observed frequency of this haplotype is consistent with neutral introgression. This is the second locus in the human genome, after STAT2, carrying distinct haplotypes that appear to have introgressed separately from both Neandertals and Denisova. PMID:23315957

  1. Evaluando el rendimiento académico

    Correa, Adriana; Chahar, Berta; Nieva, María Esther; Figueroa, Gregorio; Gallo, Ricardo Raúl; Holgado, Lisa

    2009-01-01

    En las universidades la deserción estudiantil ha originado numerosos estudios y no pocos debates. El informe de la Comisión ad hoc (2005) de la UNT, revela excesiva permanencia y alta deserción. En una primera etapa, se analizó el rendimiento académico en el ciclo básico de la Facultad de Bioquímica de la UNT (Correa Zeballos, Chahar, Holgado, Figueroa, Sued, Nieva, 2006) identificándose factores asociados a esta problemática. En una segunda etapa se plantea como objetivo mostrar una metodolo...

  2. Variation in the human cannabinoid receptor CNR1 gene modulates gaze duration for happy faces

    Chakrabarti Bhismadev

    2011-06-01

    Full Text Available Abstract Background From an early age, humans look longer at preferred stimuli and also typically look longer at facial expressions of emotion, particularly happy faces. Atypical gaze patterns towards social stimuli are common in autism spectrum conditions (ASC. However, it is unknown whether gaze fixation patterns have any genetic basis. In this study, we tested whether variations in the cannabinoid receptor 1 (CNR1 gene are associated with gaze duration towards happy faces. This gene was selected because CNR1 is a key component of the endocannabinoid system, which is involved in processing reward, and in our previous functional magnetic resonance imaging (fMRI study, we found that variations in CNR1 modulate the striatal response to happy (but not disgust faces. The striatum is involved in guiding gaze to rewarding aspects of a visual scene. We aimed to validate and extend this result in another sample using a different technique (gaze tracking. Methods A total of 30 volunteers (13 males and 17 females from the general population observed dynamic emotional expressions on a screen while their eye movements were recorded. They were genotyped for the identical four single-nucleotide polymorphisms (SNPs in the CNR1 gene tested in our earlier fMRI study. Results Two SNPs (rs806377 and rs806380 were associated with differential gaze duration for happy (but not disgust faces. Importantly, the allelic groups associated with a greater striatal response to happy faces in the fMRI study were associated with longer gaze duration at happy faces. Conclusions These results suggest that CNR1 variations modulate the striatal function that underlies the perception of signals of social reward, such as happy faces. This suggests that CNR1 is a key element in the molecular architecture of perception of certain basic emotions. This may have implications for understanding neurodevelopmental conditions marked by atypical eye contact and facial emotion processing

  3. Genetic variation in bitter taste receptor genes influences the foraging behavior of plateau zokor (Eospalax baileyi).

    Zhao, Fang; Zhang, Tongzuo; Xie, Jiuxiang; Zhang, Shoudong; Nevo, Eviatar; Su, Jianping; Lin, Gonghua

    2016-04-01

    The ability to detect bitter tastes is important for animals; it can help them to avoid ingesting harmful substances. Bitter taste perception is mainly mediated by bitter taste receptor proteins, which are encoded by members of the Tas2r gene family and vary with the dietary preference of a specific species. Although individuals with different genotypes differ in bitterness recognition capability, little is known about the relationship between genetic variation and food selection tendencies at the intraspecific level. In this study, we examined the relationship between genotypes and diet in plateau zokor (Eospalax baileyi), a subterranean rodent endemic to the Qinghai-Tibet Plateau that caches food for the winter. We assayed the composition and taste profile of each plant contained in temporary caches and vicinity quadrats, which were representative of selected and available food, respectively. Bitter plant selection indices (E bitter) were estimated. We also sequenced 26 candidate Tas2r genes from zokors and determined their relationships with the E bitter of their caches. We identified four key results: (1) zokors varied considerably in both bitter food preference and Tas2r sequences; (2) five genes (zTas2r115,zTas2r119,zTas2r126,zTas2r134, and zTas2r136) exhibited allelic variation that was significantly associated with E bitter; (3) synonymous SNPs, nonsynonymous SNPs, and pseudogenization are involved in the genotype-phenotype relationship; (4) the minor genotypes of zTas2r115,zTas2r134, and zTas2r136 and the major genotypes of zTas2r119 and zTas2r126 cached more bitter plants. Our results link Tas2r variation with food selection behavior at the population level for the first time. PMID:27110349

  4. Effects of sequence variation on differential allelic transcription factor occupancy and gene expression.

    Reddy, Timothy E; Gertz, Jason; Pauli, Florencia; Kucera, Katerina S; Varley, Katherine E; Newberry, Kimberly M; Marinov, Georgi K; Mortazavi, Ali; Williams, Brian A; Song, Lingyun; Crawford, Gregory E; Wold, Barbara; Willard, Huntington F; Myers, Richard M

    2012-05-01

    A complex interplay between transcription factors (TFs) and the genome regulates transcription. However, connecting variation in genome sequence with variation in TF binding and gene expression is challenging due to environmental differences between individuals and cell types. To address this problem, we measured genome-wide differential allelic occupancy of 24 TFs and EP300 in a human lymphoblastoid cell line GM12878. Overall, 5% of human TF binding sites have an allelic imbalance in occupancy. At many sites, TFs clustered in TF-binding hubs on the same homolog in especially open chromatin. While genetic variation in core TF binding motifs generally resulted in large allelic differences in TF occupancy, most allelic differences in occupancy were subtle and associated with disruption of weak or noncanonical motifs. We also measured genome-wide differential allelic expression of genes with and without heterozygous exonic variants in the same cells. We found that genes with differential allelic expression were overall less expressed both in GM12878 cells and in unrelated human cell lines. Comparing TF occupancy with expression, we found strong association between allelic occupancy and expression within 100 bp of transcription start sites (TSSs), and weak association up to 100 kb from TSSs. Sites of differential allelic occupancy were significantly enriched for variants associated with disease, particularly autoimmune disease, suggesting that allelic differences in TF occupancy give functional insights into intergenic variants associated with disease. Our results have the potential to increase the power and interpretability of association studies by targeting functional intergenic variants in addition to protein coding sequences. PMID:22300769

  5. Assortative mating and gene flow generate clinal phenological variation in trees

    Soularue Jean-Paul

    2012-06-01

    Full Text Available Abstract Background On-going climate change is shifting the timing of bud burst (TBB of broad leaf and conifer trees in temperate areas, raising concerns about the abilities of natural populations to respond to these shifts. The level of expected evolutionary change depends on the level and distribution of genetic variation of TBB. While numerous experimental studies have highlighted the role of divergent selection in promoting clinal TBB differentiation, we explored whether the observed patterns of variation could be generated by the joint effects of assortative mating for TBB and gene flow among natural populations. We tested this hypothesis using an in silico approach based on quantitative genetic models. Results Our simulations showed that genetic clines can develop even without divergent selection. Assortative mating in association with environmental gradients substantially shifted the mean genetic values of populations. Owing to assortative mating, immigrant alleles were screened for proximal or distant populations depending on the strength of the environmental cline. Furthermore, we confirmed that assortative mating increases the additive genetic variance within populations. However, we observed also a rapid decline of the additive genetic variance caused by restricted gene flow between neighboring populations resulting from preferential matings between phenologically-matching phenotypes. Conclusions We provided evidence that the patterns of genetic variation of phenological traits observed in forest trees can be generated solely by the effects of assortative mating and gene flow. We anticipate that predicted temperature increases due to climate change will further enhance genetic differentiation across the landscape. These trends are likely to be reinforced or counteracted by natural selection if phenological traits are correlated to fitness.

  6. Sequence variation and differential splicing of the midgut cadherin gene in Trichoplusia ni.

    Zhang, Xin; Kain, Wendy; Wang, Ping

    2013-08-01

    The insect midgut cadherin serves as an important receptor for the Cry toxins from Bacillus thuringiensis (Bt). Variation of the cadherin in insect populations provides a genetic potential for development of cadherin-based Bt resistance in insect populations. Sequence analysis of the cadherin from the cabbage looper, Trichoplusia ni, together with cadherins from 18 other lepidopterans showed a similar phylogenetic relationship of the cadherins to the phylogeny of Lepidoptera. The midgut cadherin in three laboratory populations of T. ni exhibited high variability, although the resistance to Bt toxin Cry1Ac in the T. ni strain is not genetically associated with cadherin gene mutations. A total of 142 single nucleotide polymorphisms (SNPs) were identified in the cadherin cDNAs from the T. ni strains, including 20 missense mutations. In addition, insertion and deletion polymorphisms (indels) were also identified in the cadherin alleles in T. ni. More interestingly, the results from this study reveal that differential splicing of mRNA also occurs in the cadherin gene expression. Therefore, variation of the midgut cadherin in insects may not only be caused by cadherin gene mutations, but could also result from alternative splicing of its mRNA regulated by factors acting in trans. Analysis of cadherin gene alleles in F2, F3 and F4 progenies from the cross between the Cry1Ac resistant and the susceptible strain after consecutive selections with Cry1Ac for three generations showed that selection with Cry1Ac did not result in an increase of frequencies of the cadherin alleles originated from the resistant strain. PMID:23743444

  7. Gene regulatory variation mediates flowering responses to vernalization along an altitudinal gradient in Arabidopsis.

    Suter, Léonie; Rüegg, Marlene; Zemp, Niklaus; Hennig, Lars; Widmer, Alex

    2014-12-01

    Steep environmental gradients provide ideal settings for studies of potentially adaptive phenotypic and genetic variation in plants. The accurate timing of flowering is crucial for reproductive success and is regulated by several pathways, including the vernalization pathway. Among the numerous genes known to enable flowering in response to vernalization, the most prominent is FLOWERING LOCUS C (FLC). FLC and other genes of the vernalization pathway vary extensively among natural populations and are thus candidates for the adaptation of flowering time to environmental gradients such as altitude. We used 15 natural Arabidopsis (Arabidopsis thaliana) genotypes originating from an altitudinal gradient (800-2,700 m above sea level) in the Swiss Alps to test whether flowering time correlated with altitude under different vernalization scenarios. Additionally, we measured the expression of 12 genes of the vernalization pathway and its downstream targets. Flowering time correlated with altitude in a nonlinear manner for vernalized plants. Flowering time could be explained by the expression and regulation of the vernalization pathway, most notably by AGAMOUS LIKE19 (AGL19), FLOWERING LOCUS T (FT), and FLC. The expression of AGL19, FT, and VERNALIZATION INSENSITIVE3 was associated with altitude, and the regulation of MADS AFFECTING FLOWERING2 (MAF2) and MAF3 differed between low- and high-altitude genotypes. In conclusion, we found clinal variation across an altitudinal gradient both in flowering time and the expression and regulation of genes in the flowering time control network, often independent of FLC, suggesting that the timing of flowering may contribute to altitudinal adaptation. PMID:25339407

  8. Clinal variation at phenology-related genes in spruce: parallel evolution in FTL2 and Gigantea?

    Chen, Jun; Tsuda, Yoshiaki; Stocks, Michael; Källman, Thomas; Xu, Nannan; Kärkkäinen, Katri; Huotari, Tea; Semerikov, Vladimir L; Vendramin, Giovanni G; Lascoux, Martin

    2014-07-01

    Parallel clines in different species, or in different geographical regions of the same species, are an important source of information on the genetic basis of local adaptation. We recently detected latitudinal clines in SNPs frequencies and gene expression of candidate genes for growth cessation in Scandinavian populations of Norway spruce (Picea abies). Here we test whether the same clines are also present in Siberian spruce (P. obovata), a close relative of Norway spruce with a different Quaternary history. We sequenced nine candidate genes and 27 control loci and genotyped 14 SSR loci in six populations of P. obovata located along the Yenisei river from latitude 56°N to latitude 67°N. In contrast to Scandinavian Norway spruce that both departs from the standard neutral model (SNM) and shows a clear population structure, Siberian spruce populations along the Yenisei do not depart from the SNM and are genetically unstructured. Nonetheless, as in Norway spruce, growth cessation is significantly clinal. Polymorphisms in photoperiodic (FTL2) and circadian clock (Gigantea, GI, PRR3) genes also show significant clinal variation and/or evidence of local selection. In GI, one of the variants is the same as in Norway spruce. Finally, a strong cline in gene expression is observed for FTL2, but not for GI. These results, together with recent physiological studies, confirm the key role played by FTL2 and circadian clock genes in the control of growth cessation in spruce species and suggest the presence of parallel adaptation in these two species. PMID:24814465

  9. Genetic variation and population structure of interleukin genes among seven ethnic populations from Karnataka, India

    Srilakshmi M. Raj; Diddahally R. Govindaraju; Ranajit Chakraborty

    2007-12-01

    The extent of genetic variation and the degree of genetic differentiation among seven ethnic populations from Karnataka, India (Bunt, Havyak, Iyengar, Lingayath, Smartha, Vaishya, Vokkaliga), was investigated using four single nucleotide polymorphisms (SNPs: IL-1A 4845, IL-1B 3954, IL-1B 511 and IL-1RA 2018) of the interleukin gene cluster. Allele frequencies varied by threefold among these populations, which also differed for gene diversity and heterozygosity levels. The average degree of population subdivision among these castes was low ($F_{ST} = 0.02$). However, pair-wise interpopulation differentiation ranged from 0–7%, indicating no detectable differentiation to moderate differentiation between specific populations. The results of phylogenetic analysis based on genetic distances between populations agreed with known social and cultural data on these ethnic groups. Variation in the allele frequencies, as well as differentiation, may be attributed to differential selection and demographic factors including consanguinity among the ethnic groups. Information on the distribution of functionally relevant polymorphisms among ethnic populations may be important towards developing community medicine and public health policies.

  10. Allelic variation of bile salt hydrolase genes in Lactobacillus salivarius does not determine bile resistance levels.

    Fang, Fang

    2009-09-01

    Commensal lactobacilli frequently produce bile salt hydrolase (Bsh) enzymes whose roles in intestinal survival are unclear. Twenty-six Lactobacillus salivarius strains from different sources all harbored a bsh1 allele on their respective megaplasmids. This allele was related to the plasmid-borne bsh1 gene of the probiotic strain UCC118. A second locus (bsh2) was found in the chromosomes of two strains that had higher bile resistance levels. Four Bsh1-encoding allele groups were identified, defined by truncations or deletions involving a conserved residue. In vitro analyses showed that this allelic variation was correlated with widely varying bile deconjugation phenotypes. Despite very low activity of the UCC118 Bsh1 enzyme, a mutant lacking this protein had significantly lower bile resistance, both in vitro and during intestinal transit in mice. However, the overall bile resistance phenotype of this and other strains was independent of the bsh1 allele type. Analysis of the L. salivarius transcriptome upon exposure to bile and cholate identified a multiplicity of stress response proteins and putative efflux proteins that appear to broadly compensate for, or mask, the effects of allelic variation of bsh genes. Bsh enzymes with different bile-degrading kinetics, though apparently not the primary determinants of bile resistance in L. salivarius, may have additional biological importance because of varying effects upon bile as a signaling molecule in the host.

  11. Variation in the oxytocin receptor gene is associated with behavioral and neural correlates of empathic accuracy

    Hartwig Roman Siebner

    2014-12-01

    Full Text Available The neuromodulators oxytocin and serotonin have been implicated in regulating affective processes underlying empathy. Understanding this dependency, however, has been limited by a lack of objective metrics for measuring empathic performance. Here we employ a novel psychophysical method for measuring empathic performance that quantitatively measures the ability of subjects to decode the experience of another person’s pain. In 50 female subjects, we acquired functional magnetic resonance imaging data as they were exposed to a target subject experiencing variable degrees of pain, whilst performing an irrelevant attention-demanding task. We investigated the effect of variation in the oxytocin receptor gene (OXTR and the serotonin transporter gene (SLC6A4 on the psychophysical and neurometric variability associated with empathic performance. The OXTR rs2268498 and rs53576 polymorphisms, but not the SLC6A4 5-HTTLPR, were associated with significant differences in empathic accuracy, with CC- and AA-carriers, respectively, displaying higher empathic accuracy. For OXTR rs2268498 there was also a genotype difference in the correlation between empathic accuracy and activity in the superior temporal sulcus (STS. In OXTR rs2268498 CC-carriers, high empathic accuracy was associated with stronger responsiveness of the right STS to the observed pain. Together, the results show that genetic variation in the OXTR has significant influence on empathic accuracy and that this may be linked to variable responsivity of the STS.

  12. Variations of the perforin gene in patients with autoimmunity/lymphoproliferation and defective Fas function.

    Clementi, Rita; Chiocchetti, Annalisa; Cappellano, Giuseppe; Cerutti, Elisa; Ferretti, Massimo; Orilieri, Elisabetta; Dianzani, Irma; Ferrarini, Marina; Bregni, Marco; Danesino, Cesare; Bozzi, Valeria; Putti, Maria Caterina; Cerutti, Franco; Cometa, Angela; Locatelli, Franco; Maccario, Rita; Ramenghi, Ugo; Dianzani, Umberto

    2006-11-01

    Mutations decreasing function of the Fas death receptor cause the autoimmune lymphoproliferative syndrome (ALPS) with autoimmune manifestations, spleen/lymph node enlargement, and expansion of CD4/CD8-negative T cells. Dianzani Autoimmune Lymphoproliferative Disease (DALD) is a variant lacking this expansion. Perforin is involved in cell-mediated cytotoxicity and its biallelic mutations cause familial hemophagocytic lymphohistiocytosis (HLH). We previously described an ALPS patient carrying heterozygous mutations of the Fas and perforin genes and suggested that they concurred in ALPS. This work extends the analysis to 14 ALPS, 28 DALD, and 816 controls, and detects an N252S amino acid substitution in 2 ALPS, and an A91V amino acid substitution in 6 DALD. N252S conferred an OR = 62.7 (P = .0016) for ALPS and A91V conferred an OR = 3 (P = .016) for DALD. Copresence of A91V and variations of the osteopontin gene previously associated with DALD conferred an OR = 17 (P = .0007) for DALD. In one N252S patient, NK activity was strikingly defective in early childhood, but became normal in late childhood. A91V patients displayed lower NK activity than controls. These data suggest that perforin variations are a susceptibility factor for ALPS/DALD development in subjects with defective Fas function and may influence disease expression. PMID:16720836

  13. Nucleotide variation at the dopa decarboxylase (Ddc) gene in natural populations of Drosophila melanogaster

    Andrey Tatarenkov; Francisco J. Ayala

    2007-08-01

    We studied nucleotide sequence variation at the gene coding for dopa decarboxylase (Ddc) in seven populations of Drosophila melanogaster. Strength and pattern of linkage disequilibrium are somewhat distinct in the extensively sampled Spanish and Raleigh populations. In the Spanish population, a few sites are in strong positive association, whereas a large number of sites in the Raleigh population are associated nonrandomly but the association is not strong. Linkage disequilibrium analysis shows presence of two groups of haplotypes in the populations, each of which is fairly diverged, suggesting epistasis or inversion polymorphism. There is evidence of two forms of natural selection acting on Ddc. The McDonald–Kreitman test indicates a deficit of fixed amino acid differences between D. melanogaster and D. simulans, which may be due to negative selection. An excess of derived alleles at high frequency, significant according to the -test, is consistent with the effect of hitchhiking. The hitchhiking may have been caused by directional selection downstream of the locus studied, as suggested by a gradual decrease of the polymorphism-to-divergence ratio. Altogether, the Ddc locus exhibits a complicated pattern of variation apparently due to several evolutionary forces. Such a complex pattern may be a result of an unusually high density of functionally important genes.

  14. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC Risk.

    Ganna Chornokur

    Full Text Available Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC, we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk.In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC. Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS. SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons.The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020; this SNP was also associated with the borderline/low malignant potential (LMP tumors (P = 0.021. Other genes significantly associated with EOC histological subtypes (p<0.05 included the UGT1A (endometrioid, SLC25A45 (mucinous, SLC39A11 (low malignant potential, and SERPINA7 (clear cell carcinoma. In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4.These results, generated on a large cohort of women, revealed associations between inherited cellular

  15. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk

    Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P.; Lawrenson, Kate; Dennis, Joe; Amankwah, Ernest K.; Qu, Xiaotao; Tsai, Ya-Yu; Jim, Heather S. L.; Chen, Zhihua; Chen, Ann Y.; Permuth-Wey, Jennifer; Aben, Katja KH.; Anton-Culver, Hoda; Antonenkova, Natalia; Bruinsma, Fiona; Bandera, Elisa V.; Bean, Yukie T.; Beckmann, Matthias W.; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A.; Brooks-Wilson, Angela; Bunker, Clareann H.; Butzow, Ralf; Campbell, Ian G.; Carty, Karen; Chang-Claude, Jenny; Cook, Linda S.; Cramer, Daniel W.; Cunningham, Julie M.; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; du Bois, Andreas; Despierre, Evelyn; Dicks, Ed; Doherty, Jennifer A.; Dörk, Thilo; Dürst, Matthias; Easton, Douglas F.; Eccles, Diana M.; Edwards, Robert P.; Ekici, Arif B.; Fasching, Peter A.; Fridley, Brooke L.; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G.; Glasspool, Rosalind; Goodman, Marc T.; Gronwald, Jacek; Harrington, Patricia; Harter, Philipp; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A. T.; Hillemanns, Peter; Hogdall, Claus K.; Hogdall, Estrid; Hosono, Satoyo; Jakubowska, Anna; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y.; Kelemen, Linda E.; Kellar, Mellissa; Kiemeney, Lambertus A.; Krakstad, Camilla; Kjaer, Susanne K.; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D.; Lee, Alice W.; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A.; Liang, Dong; Lim, Boon Kiong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F. A. G.; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R.; McNeish, Iain; Menon, Usha; Milne, Roger L.; Modugno, Francesmary; Moysich, Kirsten B.; Ness, Roberta B.; Nevanlinna, Heli; Eilber, Ursula; Odunsi, Kunle; Olson, Sara H.; Orlow, Irene; Orsulic, Sandra; Weber, Rachel Palmieri; Paul, James; Pearce, Celeste L.; Pejovic, Tanja; Pelttari, Liisa M.; Pike, Malcolm C.; Poole, Elizabeth M.; Risch, Harvey A.; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H.; Rudolph, Anja; Runnebaum, Ingo B.; Rzepecka, Iwona K.; Salvesen, Helga B.; Schernhammer, Eva; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B.; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C.; Spiewankiewicz, Beata; Sucheston, Lara; Teo, Soo-Hwang; Terry, Kathryn L.; Thompson, Pamela J.; Thomsen, Lotte; Tangen, Ingvild L.; Tworoger, Shelley S.; van Altena, Anne M.; Vierkant, Robert A.; Vergote, Ignace; Walsh, Christine S.; Wang-Gohrke, Shan; Wentzensen, Nicolas; Whittemore, Alice S.; Wicklund, Kristine G.; Wilkens, Lynne R.; Wu, Anna H.; Wu, Xifeng; Woo, Yin-Ling; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Hasmad, Hanis N.; Berchuck, Andrew; Iversen, Edwin S.; Schildkraut, Joellen M.; Ramus, Susan J.; Goode, Ellen L.; Monteiro, Alvaro N. A.; Gayther, Simon A.; Narod, Steven A.; Pharoah, Paul D. P.; Sellers, Thomas A.; Phelan, Catherine M.

    2015-01-01

    Background Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC), we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk. Methods In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC). Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS). SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons. Results The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020); this SNP was also associated with the borderline/low malignant potential (LMP) tumors (P = 0.021). Other genes significantly associated with EOC histological subtypes (p<0.05) included the UGT1A (endometrioid), SLC25A45 (mucinous), SLC39A11 (low malignant potential), and SERPINA7 (clear cell carcinoma). In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A) were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4). Conclusion These results, generated on a large cohort of women, revealed associations

  16. Identification of additive, dominant, and epistatic variation conferred by key genes in cellulose biosynthesis pathway in Populus tomentosa

    Du, Qingzhang; Tian, Jiaxing; Yang, Xiaohui; Pan, Wei; Xu, Baohua; Li, Bailian; Pär K Ingvarsson; Zhang, Deqiang

    2015-01-01

    Economically important traits in many species generally show polygenic, quantitative inheritance. The components of genetic variation (additive, dominant and epistatic effects) of these traits conferred by multiple genes in shared biological pathways remain to be defined. Here, we investigated 11 full-length genes in cellulose biosynthesis, on 10 growth and wood-property traits, within a population of 460 unrelated Populus tomentosa individuals, via multi-gene association. To validate positiv...

  17. Exploiting CpG hypermutability to identify phenotypically significant variation within human protein-coding genes.

    Ying, Hua; Huttley, Gavin

    2011-01-01

    The CpG dinucleotide is disproportionately represented in human genetic variation due to the hypermutability of 5-methyl-cytosine (5mC). We exploit this hypermutability and a novel codon substitution model to identify candidate functionally important exonic nucleotides. Population genetic theory suggests that codon positions with high cross-species CpG frequency will derive from stronger purifying selection. Using the phylogeny-based maximum likelihood inference framework, we applied codon substitution models with context-dependent parameters to measure the mutagenic and selective processes affecting CpG dinucleotides within exonic sequence. The suitability of these models was validated on >2,000 protein coding genes from a naturally occurring biological control, four yeast species that do not methylate their DNA. As expected, our analyses of yeast revealed no evidence for an elevated CpG transition rate or for substitution suppression affecting CpG-containing codons. Our analyses of >12,000 protein-coding genes from four primate lineages confirm the systemic influence of 5mC hypermutability on the divergence of these genes. After adjusting for confounding influences of mutation and the properties of the encoded amino acids, we confirmed that CpG-containing codons are under greater purifying selection in primates. Genes with significant evidence of enhanced suppression of nonsynonymous CpG changes were also shown to be significantly enriched in Online Mendelian Inheritance in Man. We developed a method for ranking candidate phenotypically influential CpG positions in human genes. Application of this method indicates that of the ∼1 million exonic CpG dinucleotides within humans, ∼20% are strong candidates for both hypermutability and disease association. PMID:21398426

  18. Evaluating of VDR Gene Variation and its Interaction with Immune Regulatory Molecules in Osteoporosis

    A Hossein-nezhad

    2009-06-01

    Full Text Available "nBackground: To evaluate VDR gene variation and its interaction with immune regulatory molecules in osteoporosis."nMethods: Totally 205 pre and postmenopausal women were recruited in the study. After an overnight fast, peripheral blood was taken and centrifuged to sprat serum for measurement of serum parathyroid hormone, 25 hydroxyvitamin D, osteocal­cin and cross laps. The FokI polymorphism in exon 2 of the VDR gene was detected by PCR-RFLP. Expression of osteopro­tegrin, vitamin D receptor (VDR and β-actin genes were quantified by quantitative real-time reverse transcriptase. To design the experimental model we randomly selected five participants of each genotype groups. PBMC were cultured and induced with vitamin D. At several times, cells were harvested and total RNA was extracted .Then expression of target genes evaluated by real time PCR."nResults: The frequencies of Ff, FF and ff genotypes were 34.2%, 56.5% and 9.2%. The mean of bone mineral density in FF genotype was higher than other genotypes. Also in this genotype, mean of serum inflammatory cytokines was lower than other genotypes. The expressions of the VDR and osteoprotegrin were up regulated by 1, 25(OH2D3 in PBMC from participants with FF genotype. PBMC from healthy control comparison to osteoporotic patients had a clearly better response to vitamin D3 incubation."nConclusion: Inflammation may important role in osteoporosis whereas osteoporotic patients have elevated pro-inflamma­tory profile. This cytokine profile and gene expressions of VDR and Osteoprotegrin were different in VDR genotype groups.  

  19. Variation in the autism candidate gene GABRB3 modulates tactile sensitivity in typically developing children

    Tavassoli Teresa

    2012-07-01

    Full Text Available Abstract Background Autism spectrum conditions have a strong genetic component. Atypical sensory sensitivities are one of the core but neglected features of autism spectrum conditions. GABRB3 is a well-characterised candidate gene for autism spectrum conditions. In mice, heterozygous Gabrb3 deletion is associated with increased tactile sensitivity. However, no study has examined if tactile sensitivity is associated with GABRB3 genetic variation in humans. To test this, we conducted two pilot genetic association studies in the general population, analysing two phenotypic measures of tactile sensitivity (a parent-report and a behavioural measure for association with 43 SNPs in GABRB3. Findings Across both tactile sensitivity measures, three SNPs (rs11636966, rs8023959 and rs2162241 were nominally associated with both phenotypes, providing a measure of internal validation. Parent-report scores were nominally associated with six SNPs (P Conclusions This is the first human study to show an association between GABRB3 variation and tactile sensitivity. This provides support for the evidence from animal models implicating the role of GABRB3 variation in the atypical sensory sensitivity in autism spectrum conditions. Future research is underway to directly test this association in cases of autism spectrum conditions.

  20. SNP variation in ADRB3 gene reflects the breed difference of sheep populations.

    Wu, Jianliang; Qiao, Liying; Liu, Jianhua; Yuan, Yanan; Liu, Wenzhong

    2012-08-01

    The β3-adrenergic receptor (ADRB3), a G-protein coupled receptor, plays a major role in energy metabolism and regulation of lipolysis and homeostasis. We detect the single nucleotide polymorphism (SNP) variation in full-length sequence of ovine ADRB3 gene in 12 domestic sheep populations within four types by polymerase chain reaction-single strand conformation polymorphism and sequencing to reveal the breed difference. Twenty-two SNPs, 12 of which in the exon 1 and ten in the intron, were detected, and 12 new exonic and four new intronic SNPs were found. Most SNPs presented in Shanxi Dam Line and least ones in Dorset. The average SNP number in both meat and dual purpose for meat and wool breeds was significantly higher than general and dual purpose breeds for wool and meat. Frequency of each SNP in studied breeds or types was different. The 18C Del and 1617T Ins majorly existed in dual purpose breeds for wool and meat. The 25A Del, 119C>G and 130C>T were mostly found in the meat and dual purpose for meat and wool breeds. The 1764C>A more frequently presented in meat than in other types. The majority of variations came from within the populations as suggested by analysis of molecular variance. Close relationship presented among the Chinese and western breeds, respectively. In conclusion, SNPs of ovine ADRB3 gene can reflect the breed difference and within- and between-population variations, and to a great extent, the breed relationship. PMID:22711302

  1. Stage-specific effects of candidate heterochronic genes on variation in developmental time along an altitudinal cline of Drosophila melanogaster.

    Julián Mensch

    Full Text Available BACKGROUND: Previously, we have shown there is clinal variation for egg-to-adult developmental time along geographic gradients in Drosophila melanogaster. Further, we also have identified mutations in genes involved in metabolic and neurogenic pathways that affect development time (heterochronic genes. However, we do not know whether these loci affect variation in developmental time in natural populations. METHODOLOGY/PRINCIPAL FINDINGS: Here, we constructed second chromosome substitution lines from natural populations of Drosophila melanogaster from an altitudinal cline, and measured egg-adult development time for each line. We found not only a large amount of genetic variation for developmental time, but also positive associations of the development time with thermal amplitude and altitude. We performed genetic complementation tests using substitution lines with the longest and shortest developmental times and heterochronic mutations. We identified segregating variation for neurogenic and metabolic genes that largely affected the duration of the larval stages but had no impact on the timing of metamorphosis. CONCLUSIONS/SIGNIFICANCE: Altitudinal clinal variation in developmental time for natural chromosome substitution lines provides a unique opportunity to dissect the response of heterochronic genes to environmental gradients. Ontogenetic stage-specific variation in invected, mastermind, cricklet and CG14591 may affect natural variation in development time and thermal evolution.

  2. Mentalidades de gobierno, subjetividad y conocimiento académico: nuevas formas de gobierno de la producción de conocimiento académico en la universidad pública española

    Reyes Lara, Daniel

    2012-01-01

    Este trabajo es acerca de los cambios en el Gobierno de la producción de conocimiento académico y su relación con los procesos de formación de subjetividades, que suponen la aplicación de las reformas universitarias en el sistema universitario español para la integración del Espacio Europeo de Educación Superior. A partir de una descripción sobre las condiciones actuales de la producción de conocimiento académico, plantea la revisión del curso del proceso Bolonia desde una perspectiva gene...

  3. Gene

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  4. Adaptive variation in beach mice produced by two interacting pigmentation genes.

    Cynthia C Steiner

    2007-09-01

    Full Text Available Little is known about the genetic basis of ecologically important morphological variation such as the diverse color patterns of mammals. Here we identify genetic changes contributing to an adaptive difference in color pattern between two subspecies of oldfield mice (Peromyscus polionotus. One mainland subspecies has a cryptic dark brown dorsal coat, while a younger beach-dwelling subspecies has a lighter coat produced by natural selection for camouflage on pale coastal sand dunes. Using genome-wide linkage mapping, we identified three chromosomal regions (two of major and one of minor effect associated with differences in pigmentation traits. Two candidate genes, the melanocortin-1 receptor (Mc1r and its antagonist, the Agouti signaling protein (Agouti, map to independent regions that together are responsible for most of the difference in pigmentation between subspecies. A derived mutation in the coding region of Mc1r, rather than change in its expression level, contributes to light pigmentation. Conversely, beach mice have a derived increase in Agouti mRNA expression but no changes in protein sequence. These two genes also interact epistatically: the phenotypic effects of Mc1r are visible only in genetic backgrounds containing the derived Agouti allele. These results demonstrate that cryptic coloration can be based largely on a few interacting genes of major effect.

  5. A Molecular Epidemiology Analysis of HIV in Shenzhen and HIV Env Gene Variation Replication Analysis

    CHEN Lin(陈琳); FENG Tiejian(冯铁建); LI Liangcheng(李良成); HE Jianfan(何建凡)

    2002-01-01

    Objective: To analyze molecular trends of the HIV epidemic in Shenzhen.Methods: Serum collected from Shenzhen AIDS patientsbetween 1992-1999 was analyzed using molecular techniques.DNA fragments of the HIV-1 Env gene were amplified bynested PCR from uncultured peripheral blood mononuclearcells (PBMCs) from these serum samples. The C2-C3 region ofthe Env gene was sequenced and analyzed. Specific high-riskbehaviors were also analyzed.Results: We found that the transmission of HIV in the citywas mainly through sexual behaviors (46.0%). There werefour HIV-1 subtypes: B', B, C and E with 6.31%, 7.95%,3.09% and 8.92% gene divergence inside each subtype inShenzhen. These results suggested that epidemic times were 6,8, 3 and 9 respectively. The main epidemic subtypes were Eand B strains. AIDS patient's antigenic variation was slightlyhigher than that of HIV infected individuals.Conclusion: Surveillance data reflect trends and theepidemic time of HIV, which will be useful for policy makersto formulate effective strategies of HIV/AIDS prevention andcontrol in Shenzhen.

  6. Genetic Variation Analyses of nsp2 Gene of PRRSV in Ningxia Hui Autonomous Region of China

    Hong TIAN; Jing-yan WU; Shuang-hui YIN; You-jun SHANG; Zi-ping MAN; Na ZHAO; Ye JIN; Xiang-tao LIU

    2009-01-01

    To gain a better understanding of the genetic diversity and evolution of PRRSV in the Ningxia Hui Nationality Autonomous Region (Ningxia) of China, the nsp2 genes from a series of PRRSV strains collected from the region in 2007 were partially sequenced. These sequences were then analyzed along with the classical strain (ch-la) and two other epidemic strains SD (3) and SD2006. Comparison of the nucleotide sequence with ch-la indicated that nsp2 genes of seventeen Ningxia isolates (NX strain) have deletions of 87 nucleotides. Sequence analysis indicated that homology between the Ningxia strain and ch-la was 60.3%-79.9% in the nucleotide sequence, and homology between the NX strains and SD strains was 80.3%-98.8% in the nucleotide sequence. The nsp2 genes of the seventeen isolates had 74.9%-100% nucleotide sequence identities with each other. This study was undertaken to assess the regional variation of prevalent PRRSV and to establish a sequence database for PRRSV molecular epidemiological studies.

  7. Personalidad y rendimiento académico

    Nácher Carda, Verónica

    1996-01-01

    Segones Jornades de Foment de la Investigació de la FCHS (Any 1996-1997) Cincuenta y siete sujetos (31 niños y 26 niñas) de 8º curso de E.G.B. participaron en un estudio diseñado para investigar la relación que existe entre personalidad y rendimiento académico. Para la evaluación de la personalidad se utilizó el cuestionario de personalidad EPQ-J de Eysenck. La evaluación del rendimiento se realizó a través de las calificaciones escolares del curso anterior: 7º de E.G.B. En genera...

  8. Genomic variation in the vomeronasal receptor gene repertoires of inbred mice

    Wynn Elizabeth H

    2012-08-01

    Full Text Available Abstract Background Vomeronasal receptors (VRs, expressed in sensory neurons of the vomeronasal organ, are thought to bind pheromones and mediate innate behaviours. The mouse reference genome has over 360 functional VRs arranged in highly homologous clusters, but the vast majority are of unknown function. Differences in these receptors within and between closely related species of mice are likely to underpin a range of behavioural responses. To investigate these differences, we interrogated the VR gene repertoire from 17 inbred strains of mice using massively parallel sequencing. Results Approximately half of the 6222 VR genes that we investigated could be successfully resolved, and those that were unambiguously mapped resulted in an extremely accurate dataset. Collectively VRs have over twice the coding sequence variation of the genome average; but we identify striking non-random distribution of these variants within and between genes, clusters, clades and functional classes of VRs. We show that functional VR gene repertoires differ considerably between different Mus subspecies and species, suggesting these receptors may play a role in mediating behavioural adaptations. Finally, we provide evidence that widely-used, highly inbred laboratory-derived strains have a greatly reduced, but not entirely redundant capacity for differential pheromone-mediated behaviours. Conclusions Together our results suggest that the unusually variable VR repertoires of mice have a significant role in encoding differences in olfactory-mediated responses and behaviours. Our dataset has expanded over nine fold the known number of mouse VR alleles, and will enable mechanistic analyses into the genetics of innate behavioural differences in mice.

  9. Genetic variation at hair length candidate genes in elephants and the extinct woolly mammoth

    Tisdale Michele

    2009-09-01

    Full Text Available Abstract Background Like humans, the living elephants are unusual among mammals in being sparsely covered with hair. Relative to extant elephants, the extinct woolly mammoth, Mammuthus primigenius, had a dense hair cover and extremely long hair, which likely were adaptations to its subarctic habitat. The fibroblast growth factor 5 (FGF5 gene affects hair length in a diverse set of mammalian species. Mutations in FGF5 lead to recessive long hair phenotypes in mice, dogs, and cats; and the gene has been implicated in hair length variation in rabbits. Thus, FGF5 represents a leading candidate gene for the phenotypic differences in hair length notable between extant elephants and the woolly mammoth. We therefore sequenced the three exons (except for the 3' UTR and a portion of the promoter of FGF5 from the living elephantid species (Asian, African savanna and African forest elephants and, using protocols for ancient DNA, from a woolly mammoth. Results Between the extant elephants and the mammoth, two single base substitutions were observed in FGF5, neither of which alters the amino acid sequence. Modeling of the protein structure suggests that the elephantid proteins fold similarly to the human FGF5 protein. Bioinformatics analyses and DNA sequencing of another locus that has been implicated in hair cover in humans, type I hair keratin pseudogene (KRTHAP1, also yielded negative results. Interestingly, KRTHAP1 is a pseudogene in elephantids as in humans (although fully functional in non-human primates. Conclusion The data suggest that the coding sequence of the FGF5 gene is not the critical determinant of hair length differences among elephantids. The results are discussed in the context of hairlessness among mammals and in terms of the potential impact of large body size, subarctic conditions, and an aquatic ancestor on hair cover in the Proboscidea.

  10. Novel sequence variations in LAMA2 and SGCG genes modulating cis-acting regulatory elements and RNA secondary structure

    Olfa Siala

    2010-01-01

    Full Text Available In this study, we detected new sequence variations in LAMA2 and SGCG genes in 5 ethnic populations, and analysed their effect on enhancer composition and mRNA structure. PCR amplification and DNA sequencing were performed and followed by bioinformatics analyses using ESEfinder as well as MFOLD software. We found 3 novel sequence variations in the LAMA2 (c.3174+22_23insAT and c.6085 +12delA and SGCG (c.*102A/C genes. These variations were present in 210 tested healthy controls from Tunisian, Moroccan, Algerian, Lebanese and French populations suggesting that they represent novel polymorphisms within LAMA2 and SGCG genes sequences. ESEfinder showed that the c.*102A/C substitution created a new exon splicing enhancer in the 3'UTR of SGCG genes, whereas the c.6085 +12delA deletion was situated in the base pairing region between LAMA2 mRNA and the U1snRNA spliceosomal components. The RNA structure analyses showed that both variations modulated RNA secondary structure. Our results are suggestive of correlations between mRNA folding and the recruitment of spliceosomal components mediating splicing, including SR proteins. The contribution of common sequence variations to mRNA structural and functional diversity will contribute to a better study of gene expression.

  11. Association of Variation in the MC4R Gene with Meat Quality Traits in a Commercial Pig Population

    Kwon, Kang; Cahyadi, Muhammad; Park, Hee–Bok; Seo, Dong Won; Jin, Shil; Kim, Sang–Wook; Choi, Yang–Il; Kim, Kwan Suk; Gotoh, Takafumi; Goto, Takafumi; Lee, Jun Heon

    2015-01-01

    The melanocortin–4 receptor (MC4R) gene is known to encode a membrane–bound receptor protein and is a member of the melanocortin receptor family of genes. In mammals, these genes are involved in energy homeostasis and in regulating feeding behavior and body weight. The objective of the present study was to examine if there were any associations between variations in the MC4R gene with meat quality traits in a commercial pig population in Korea. Among the total of 593 commercial pigs, sire inf...

  12. Uncovering Gene Regulatory Networks from Time-Series Microarray Data with Variational Bayesian Structural Expectation Maximization

    Huang Yufei

    2007-01-01

    Full Text Available We investigate in this paper reverse engineering of gene regulatory networks from time-series microarray data. We apply dynamic Bayesian networks (DBNs for modeling cell cycle regulations. In developing a network inference algorithm, we focus on soft solutions that can provide a posteriori probability (APP of network topology. In particular, we propose a variational Bayesian structural expectation maximization algorithm that can learn the posterior distribution of the network model parameters and topology jointly. We also show how the obtained APPs of the network topology can be used in a Bayesian data integration strategy to integrate two different microarray data sets. The proposed VBSEM algorithm has been tested on yeast cell cycle data sets. To evaluate the confidence of the inferred networks, we apply a moving block bootstrap method. The inferred network is validated by comparing it to the KEGG pathway map.

  13. Uncovering Gene Regulatory Networks from Time-Series Microarray Data with Variational Bayesian Structural Expectation Maximization

    Isabel Tienda Luna

    2007-06-01

    Full Text Available We investigate in this paper reverse engineering of gene regulatory networks from time-series microarray data. We apply dynamic Bayesian networks (DBNs for modeling cell cycle regulations. In developing a network inference algorithm, we focus on soft solutions that can provide a posteriori probability (APP of network topology. In particular, we propose a variational Bayesian structural expectation maximization algorithm that can learn the posterior distribution of the network model parameters and topology jointly. We also show how the obtained APPs of the network topology can be used in a Bayesian data integration strategy to integrate two different microarray data sets. The proposed VBSEM algorithm has been tested on yeast cell cycle data sets. To evaluate the confidence of the inferred networks, we apply a moving block bootstrap method. The inferred network is validated by comparing it to the KEGG pathway map.

  14. Considerations in the construction of an instrument to assess attitudes regarding critical illness gene variation research.

    Freeman, Bradley D; Kennedy, Carie R; Bolcic-Jankovic, Dragana; Eastman, Alexander; Iverson, Ellen; Shehane, Erica; Celious, Aaron; Barillas, Jennifer; Clarridge, Brian

    2012-02-01

    Clinical studies conducted in intensive care units are associated with logistical and ethical challenges. Diseases investigated are precipitous and life-threatening, care is highly technological, and patients are often incapacitated and decision-making is provided by surrogates. These investigations increasingly involve collection of genetic data. The manner in which the exigencies of critical illness impact attitudes regarding genetic data collection is unstudied. Given interest in understanding stakeholder preferences as a foundation for the ethical conduct of research, filling this knowledge gap is timely. The conduct of opinion research in the critical care arena is novel. This brief report describes the development of parallel patient/surrogate decision-maker quantitative survey instruments for use in this environment. Future research employing this instrument or a variant of it with diverse populations promises to inform research practices in critical illness gene variation research. PMID:22378135

  15. Plasma Fetuin-A concentration, genetic variation in the AHSG gene and risk of colorectal cancer

    Nimptsch, Katharina; Aleksandrova, Krasimira; Boeing, Heiner;

    2015-01-01

    women, 1.13 (1.00-1.27) for colon cancer and 1.12 (0.94-1.32) for rectal cancer. To improve causal inference in a Mendelian Randomization approach, five tagging single nucleotide polymorphisms of the AHSG gene were genotyped in a subset of 456 case-control pairs. The AHSG allele-score explained 21% of...... the interindividual variation in plasma fetuin-A concentrations. In instrumental variable analysis, genetically raised fetuin-A was not associated with colorectal cancer risk (relative risk per 40 µg/mL genetically determined higher fetuin-A was 0.98, 95% confidence interval: 0.73-1.33). The findings...... of our study indicate a modest linear association between fetuin-A concentrations and risk of colorectal cancer but suggest that fetuin-A may not be causally related to colorectal cancer development....

  16. Evidence that Natural Selection is the Primary Cause of the Guanine-cytosine Content Variation in Rice Genes

    Xiaoli Shi; Xiyin Wang; Zhe Li; Qihui Zhu; Ji Yang; Song Ge; Jingchu Luo

    2007-01-01

    Cereal genes are classified into two distinct classes according to the guanine-cytosine (GC) content at the third codon sites (GC3). Natural selection and mutation bias have been proposed to affect the GC content. However, there has been controversy about the cause of GC variation. Here, we characterized the GC content of 1 092 paralogs and other single-copy genes in the duplicated chromosomal regions of the rice genome (ssp. indica) and classified the paralogs into GC3-rich and GC3-poor groups. By referring to out-group sequences from Arabidopsis and maize, we confirmed that the average synonymous substitution rate of the GC3-rich genes is significantly lower than that of the GC3-poor genes. Furthermore,we explored the other possible factors corresponding to the GC variation including the length of coding sequences, the number of exons in each gene, the number of genes in each family, the location of genes on chromosomes and the protein functions. Consequently, we propose that natural selection rather than mutation bias was the primary cause of the GC variation.

  17. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    DWINITA WIKAN UTAMI

    2011-09-01

    Full Text Available Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufipogon and CT13432 crossing. DNA of five rice lines were amplified using the spesific primer for Pi33, G1010. Amplification results purified through Exonuclease 1 and Shrimp Alkaline Phosphatase protocols. Labelling using fluorescent dyes done before sequencing nucleotide base using CEQ8000 instrument. The results showed that lines number 28 showed introgesion of the three control parent genome (subspecies of Indica, subspecies of Japonica, and O. rufipogon while the Lines number 79, 136, and 143 were identical to Indica genome. Strain number 195 was identical to Japonica genome. These broad genetic background lines promise as durable performance to attack the expansion of the dynamic nature of the pathogen to blast. The result of ortholog sequence analysis found conserved nucleotide base sequence (CAGCAGCC which involved in heterotrimeric G-protein group. This protein has role as plant receptor for recognizing pathogen elicitor in interaction of rice and blast pathogen.

  18. Capturing sequence variation among flowering-time regulatory gene homologs in the allopolyploid crop species Brassica napus.

    Schiessl, Sarah; Samans, Birgit; Hüttel, Bruno; Reinhard, Richard; Snowdon, Rod J

    2014-01-01

    Flowering, the transition from the vegetative to the generative phase, is a decisive time point in the lifecycle of a plant. Flowering is controlled by a complex network of transcription factors, photoreceptors, enzymes and miRNAs. In recent years, several studies gave rise to the hypothesis that this network is also strongly involved in the regulation of other important lifecycle processes ranging from germination and seed development through to fundamental developmental and yield-related traits. In the allopolyploid crop species Brassica napus, (genome AACC), homoeologous copies of flowering time regulatory genes are implicated in major phenological variation within the species, however the extent and control of intraspecific and intergenomic variation among flowering-time regulators is still unclear. To investigate differences among B. napus morphotypes in relation to flowering-time gene variation, we performed targeted deep sequencing of 29 regulatory flowering-time genes in four genetically and phenologically diverse B. napus accessions. The genotype panel included a winter-type oilseed rape, a winter fodder rape, a spring-type oilseed rape (all B. napus ssp. napus) and a swede (B. napus ssp. napobrassica), which show extreme differences in winter-hardiness, vernalization requirement and flowering behavior. A broad range of genetic variation was detected in the targeted genes for the different morphotypes, including non-synonymous SNPs, copy number variation and presence-absence variation. The results suggest that this broad variation in vernalization, clock and signaling genes could be a key driver of morphological differentiation for flowering-related traits in this recent allopolyploid crop species. PMID:25202314

  19. Capturing sequence variation among flowering-time regulatory gene homologues in the allopolyploid crop species Brassica napus

    Sarah eSchiessl

    2014-08-01

    Full Text Available Flowering, the transition from the vegetative to the generative phase, is a decisive time point in the lifecycle of a plant. Flowering is controlled by a complex network of transcription factors, photoreceptors, enzymes and miRNAs. In recent years, several studies gave rise to the hypothesis that this network is also strongly involved in the regulation of other important lifecycle processes ranging from germination and seed development through to fundamental developmental and yield-related traits. In the allopolyploid crop species Brassica napus, (genome AACC, homoeologous copies of flowering time regulatory genes are implicated in major phenological variation within the species, however the extent and control of intraspecific and intergenomic variation among flowering-time regulators is still unclear. To investigate differences among B. napus morphotypes in relation to flowering-time gene variation, we performed targeted deep sequencing of 29 regulatory flowering-time genes in four genetically and phenologically diverse B. napus accessions. The genotype panel included a winter-type oilseed rape, a winter fodder rape, a spring-type oilseed rape (all B. napus ssp. napus and a swede (B. napus ssp. napobrassica, which show extreme differences in winter-hardiness, vernalization requirement and flowering behaviour. A broad range of genetic variation was detected in the targeted genes for the different morphotypes, including non-synonymous SNPs, copy number variation and presence-absence variation. The results suggest that this broad variation in vernalisation, clock and signaling genes could be a key driver of morphological differentiation for flowering-related traits in this recent allopolyploid crop species.

  20. Clinical features associated with copy number variations of the 14q32 imprinted gene cluster.

    Rosenfeld, Jill A; Fox, Joyce E; Descartes, Maria; Brewer, Fallon; Stroud, Tracy; Gorski, Jerome L; Upton, Sheila J; Moeschler, John B; Monteleone, Berrin; Neill, Nicholas J; Lamb, Allen N; Ballif, Blake C; Shaffer, Lisa G; Ravnan, J Britt

    2015-02-01

    Uniparental disomy (UPD) for imprinted chromosomes can cause abnormal phenotypes due to absent or overexpression of imprinted genes. UPD(14)pat causes a unique constellation of features including thoracic skeletal anomalies, polyhydramnios, placentomegaly, and limited survival; its hypothesized cause is overexpression of paternally expressed RTL1, due to absent regulatory effects of maternally expressed RTL1as. UPD(14)mat causes a milder condition with hypotonia, growth failure, and precocious puberty; its hypothesized cause is absence of paternally expressed DLK1. To more clearly establish how gains and losses of imprinted genes can cause disease, we report six individuals with copy number variations of the imprinted 14q32 region identified through clinical microarray-based comparative genomic hybridization. Three individuals presented with UPD(14)mat-like phenotypes (Temple syndrome) and had apparently de novo deletions spanning the imprinted region, including DLK1. One of these deletions was shown to be on the paternal chromosome. Two individuals with UPD(14)pat-like phenotypes had 122-154kb deletions on their maternal chromosomes that included RTL1as but not the differentially methylated regions that regulate imprinted gene expression, providing further support for RTL1 overexpression as a cause for the UPD(14)pat phenotype. The sixth individual is tetrasomic for a 1.7Mb segment, including the imprinted region, and presents with intellectual disability and seizures but lacks significant phenotypic overlap with either UPD(14) syndrome. Therefore, the 14q32 imprinted region is dosage sensitive, with deletions of different critical regions causing UPD(14)mat- and UPD(14)pat-like phenotypes, while copy gains are likely insufficient to recapitulate these phenotypes. PMID:25756153

  1. Extensive sequence variation in rice blast resistance gene Pi54 makes it broad spectrum in nature

    Shallu eThakur

    2015-05-01

    Full Text Available Rice blast resistant gene, Pi54 cloned from rice line, Tetep, is effective against diverse isolates of Magnaporthe oryzae. In this study, we prospected the allelic variants of the dominant blast resistance gene from a set of 92 rice lines to determine the nucleotide diversity, pattern of its molecular evolution, phylogenetic relationships and evolutionary dynamics, and to develop allele specific markers. High quality sequences were generated for homologs of Pi54 gene. Using comparative sequence analysis, InDels of variable sizes in all the alleles were observed. Profiling of the selected sites of SNP (Single Nucleotide Polymorphism and amino acids (N sites ≥ 10 exhibited constant frequency distribution of mutational and substitutional sites between the resistance and susceptible rice lines, respectively. A total of 50 new haplotypes based on the nucleotide polymorphism was also identified. A unique haplotype (H_3 was found to be linked to all the resistant alleles isolated from indica rice lines. Unique leucine zipper and tyrosine sulfation sites were identified in the predicted Pi54 proteins. Selection signals were observed in entire coding sequence of resistance alleles, as compared to LRR domains for susceptible alleles. This is a maiden report of extensive variability of Pi54 alleles in different landraces and cultivated varieties, possibly, attributing broad-spectrum resistance to Magnaporthe oryzae. The sequence variation in two consensus region: 163 bp and 144 bp were used for the development of allele specific DNA markers. Validated markers can be used for the selection and identification of better allele(s and their introgression in commercial rice cultivars employing marker assisted selection.

  2. Gene-related strain variation of Staphylococcus aureus for homologous resistance response to acid stress.

    Lee, Soomin; Ahn, Sooyeon; Lee, Heeyoung; Kim, Won-Il; Kim, Hwang-Yong; Ryu, Jae-Gee; Kim, Se-Ri; Choi, Kyoung-Hee; Yoon, Yohan

    2014-10-01

    This study investigated the effect of adaptation of Staphylococcus aureus strains to the acidic condition of tomato in response to environmental stresses, such as heat and acid. S. aureus ATCC 13565, ATCC 14458, ATCC 23235, ATCC 27664, and NCCP10826 habituated in tomato extract at 35°C for 24 h were inoculated in tryptic soy broth. The culture suspensions were then subjected to heat challenge or acid challenge at 60°C and pH 3.0, respectively, for 60 min. In addition, transcriptional analysis using quantitative real-time PCR was performed to evaluate the expression level of acid-shock genes, such as clpB, zwf, nuoF, and gnd, from five S. aureus strains after the acid habituation of strains in tomato at 35°C for 15 min and 60 min in comparison with that of the nonhabituated strains. In comparison with the nonhabituated strains, the five tomato-habituated S. aureus strains did not show cross protection to heat, but tomato-habituated S. aureus ATCC 23235 showed acid resistance. In quantitative real-time-PCR analysis, the relative expression levels of acid-shock genes (clpB, zwf, nuoF, and gnd) were increased the most in S. aureus ATCC 23235 after 60 min of tomato habituation, but there was little difference in the expression levels among the five S. aureus strains after 15 min of tomato habituation. These results indicate that the variation of acid resistance of S. aureus is related to the expression of acid-shock genes during acid habituation. PMID:25285500

  3. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity

    Knoll, Nadja; Jarick, Ivonne; Volckmar, Anna-Lena; Klingenspor, Martin; Illig, Thomas; Grallert, Harald; Gieger, Christian; Wichmann, Heinz-Erich; Peters, Annette; Hebebrand, Johannes; Scherag, André; Hinney, Anke

    2013-01-01

    There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1) 16 nuclear regulators of mitochondrial genes, (2) 91 genes for oxidative phosphorylation and (3) 966 nuclear-encoded mitochondrial genes). Gene set enrichment analysis (GSEA) showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide assoc...

  4. CNTN6 copy number variations in 14 patients: a possible candidate gene for neurodevelopmental and neuropsychiatric disorders

    Hu, Jie; Liao, Jun; Sathanoori, Malini; Kochmar, Sally; Sebastian, Jessica; Yatsenko, Svetlana A.; Surti, Urvashi

    2015-01-01

    Background Neurodevelopmental disorders are impairments of brain function that affect emotion, learning, and memory. Copy number variations of contactin genes (CNTNs), including CNTN3, CNTN4, CNTN5, and CNTN6, have been suggested to be associated with these disorders. However, phenotypes have been reported in only a handful of patients with copy number variations involving CNTNs. Methods From January 2009 to January 2013, 3724 patients ascertained through the University of Pittsburgh Medical ...

  5. Polymorphisms in the WNK1 Gene Are Associated with Blood Pressure Variation and Urinary Potassium Excretion

    Newhouse, Stephen; Farrall, Martin; Wallace, Chris; Hoti, Mimoza; Burke, Beverley; Howard, Philip; Onipinla, Abiodun; Lee, Kate; Shaw-Hawkins, Sue; Dobson, Richard; Brown, Morris; Samani, Nilesh J.; Dominiczak, Anna F.; Connell, John M.; Lathrop, G. Mark; Kooner, Jaspal; Chambers, John; Elliott, Paul; Clarke, Robert; Collins, Rory; Laan, Maris; Org, Elin; Juhanson, Peeter; Veldre, Gudrun; Viigimaa, Margus; Eyheramendy, Susana; Cappuccio, Francesco P.; Ji, Chen; Iacone, Roberto; Strazzullo, Pasquale; Kumari, Meena; Marmot, Michael; Brunner, Eric; Caulfield, Mark; Munroe, Patricia B.

    2009-01-01

    WNK1 - a serine/threonine kinase involved in electrolyte homeostasis and blood pressure (BP) control - is an excellent candidate gene for essential hypertension (EH). We and others have previously reported association between WNK1 and BP variation. Using tag SNPs (tSNPs) that capture 100% of common WNK1 variation in HapMap, we aimed to replicate our findings with BP and to test for association with phenotypes relating to WNK1 function in the British Genetics of Hypertension (BRIGHT) study case-control resource (1700 hypertensive cases and 1700 normotensive controls). We found multiple variants to be associated with systolic blood pressure, SBP (7/28 tSNPs min-p = 0.0005), diastolic blood pressure, DBP (7/28 tSNPs min-p = 0.002) and 24 hour urinary potassium excretion (10/28 tSNPs min-p = 0.0004). Associations with SBP and urine potassium remained significant after correction for multiple testing (p = 0.02 and p = 0.01 respectively). The major allele (A) of rs765250, located in intron 1, demonstrated the strongest evidence for association with SBP, effect size 3.14 mmHg (95%CI:1.23–4.9), DBP 1.9 mmHg (95%CI:0.7–3.2) and hypertension, odds ratio (OR: 1.3 [95%CI: 1.0–1.7]).We genotyped this variant in six independent populations (n = 14,451) and replicated the association between rs765250 and SBP in a meta-analysis (p = 7×10−3, combined with BRIGHT data-set p = 2×10−4, n = 17,851). The associations of WNK1 with DBP and EH were not confirmed. Haplotype analysis revealed striking associations with hypertension and BP variation (global permutation p10 mmHg reduction) and risk for hypertension (OR<0.60). Our data indicates that multiple rare and common WNK1 variants contribute to BP variation and hypertension, and provide compelling evidence to initiate further genetic and functional studies to explore the role of WNK1 in BP regulation and EH. PMID:19347040

  6. Polymorphisms in the WNK1 gene are associated with blood pressure variation and urinary potassium excretion.

    Stephen Newhouse

    Full Text Available WNK1--a serine/threonine kinase involved in electrolyte homeostasis and blood pressure (BP control--is an excellent candidate gene for essential hypertension (EH. We and others have previously reported association between WNK1 and BP variation. Using tag SNPs (tSNPs that capture 100% of common WNK1 variation in HapMap, we aimed to replicate our findings with BP and to test for association with phenotypes relating to WNK1 function in the British Genetics of Hypertension (BRIGHT study case-control resource (1700 hypertensive cases and 1700 normotensive controls. We found multiple variants to be associated with systolic blood pressure, SBP (7/28 tSNPs min-p = 0.0005, diastolic blood pressure, DBP (7/28 tSNPs min-p = 0.002 and 24 hour urinary potassium excretion (10/28 tSNPs min-p = 0.0004. Associations with SBP and urine potassium remained significant after correction for multiple testing (p = 0.02 and p = 0.01 respectively. The major allele (A of rs765250, located in intron 1, demonstrated the strongest evidence for association with SBP, effect size 3.14 mmHg (95%CI:1.23-4.9, DBP 1.9 mmHg (95%CI:0.7-3.2 and hypertension, odds ratio (OR: 1.3 [95%CI: 1.0-1.7].We genotyped this variant in six independent populations (n = 14,451 and replicated the association between rs765250 and SBP in a meta-analysis (p = 7 x 10(-3, combined with BRIGHT data-set p = 2 x 10(-4, n = 17,851. The associations of WNK1 with DBP and EH were not confirmed. Haplotype analysis revealed striking associations with hypertension and BP variation (global permutation p10 mmHg reduction and risk for hypertension (OR<0.60. Our data indicates that multiple rare and common WNK1 variants contribute to BP variation and hypertension, and provide compelling evidence to initiate further genetic and functional studies to explore the role of WNK1 in BP regulation and EH.

  7. Phenotypic variations in a family with retinal dystrophy as result of different mutations in the ABCR gene

    Klevering, B; van Driel, M.; van de Pol, D. J R; Pinckers, A; Cremers, F; Hoyng, C.

    1999-01-01

    AIMS—To describe two phenotypic variations of autosomal recessive retinal dystrophy occurring in a consanguineous family in a pseudodominant pattern, resulting from mutations in the ATP binding cassette transporter (ABCR) gene.
METHODS—Patients of this family underwent an extensive ophthalmic evaluation, including fundus photography, fluorescein angiography, and electroretinography (ERG). Genetic analysis comprised sequence analysis of the retina specific ABCR gene.
RESULTS—Five patients pres...

  8. [Sequence variation of mitochondrial cytochrome b gene and phylogenetic relationships among twelve species of Charadriiformes].

    Chen, Xiao-Fang; Wang, Xiang; Yuan, Xiao-Dong; Tang, Min-Qian; Li, Yu-Xiang; Guo, Yu-Mei; Li, Qing-Wei

    2003-05-01

    Studies of the phylogenetic relationships of the Charadriiformes have been largely based on conservative morphological characters. During the past 10 years, many studies on the evolutionary biology of birds adopted phylogenetic information obtained from mitochondrial DNA, but few work on the Charadriiformes has been reported to date. Therefore, phylogenetic relationships and classification of the Charadriiformes remains controversial. In this study, we try to shed light on these relationships via DNA sequence analysis of the mitochondrial Cyt b gene in 12 species of Charadriiformes. It was a preliminary study of the origin and evolution of the species by using nucleotide sequence data. Using the well-known PCR techniques, the complete mitochondrial Cyt b gene sequences were amplified and sequenced respectively from Charadrius mongolus, Charadrius alexandrinus, Numenius madagascariensis, Numenius arquat, Numenius phaeopus, Tringa totanus, Tringa glareola, Xenus cineres, Arenaria interpres, Calidris tenuirostris, Recurvirostra avosetts and Haematopus ostralensis. The 1143 bp long DNA sequences of the gene from these species were obtained, in which 381 variable sites were identified without insertions or deletions. The nucleic acid sequence variation of the mitochondrial Cyt b gene was 5.16%-16.01% among these species. Phylogenetic trees constructed using the NJ method, MP method and ML method with Ciconia ciconia as the outgroup indicate that the 12 species of Charadriiformes examined in this study are clustered in two major clades. The first clade includes T. totanus, T. glareola, A. interpres, C. tenuirostris, X. cineres, N. madagascariensis, N. arquata and N. phaeopus. The second one includes C. mongolus, C. alexandrinus, R. avosetts and H. ostralensis. Our molecular data show that the phylogenetic relationships among species of Scolopacidae are consistent with the classification based on morphological studies; R. avosetts and H. ostralensis are relatively closer

  9. De académico o vernacular a lo vernacular y lo académico

    Ferrarese, José Francisco

    2007-01-01

    Existe un desarrollo paralelo entre el mobiliario, y objetos en general, fundamentado y producido académicamente y aquel producido y apropiado fuera de estos ámbitos. Ahora ¿cómo se da la evolución del mobiliario vernacular1 en paralelo a lo legitimado por vanguardias y la academia?, ¿cuál/es son los lineamientos para su creación y características? A partir del análisis, en principio de objetos situados en el living, que luego, por razones prácticas, se puntualizó en los sillones y aquello...

  10. Association of genetic variations of the prostasin gene with essential hypertension in the Xinjiang Kazakh population

    LI Nan-fang; ZHANG Ju-hong; CHANG Jian-hang; YANG Jin; WANG Hong-mei; ZHOU Ling; LUO Wen-li

    2011-01-01

    Background Transgenic overexpression of human prostasin in rats disturbs salt balance and causes hypertension. We investigated whether genetic variations in prostasin were implicated in hypertension or related phenotypes in the Xinjiang Kazakh population.Methods We sequenced all exons and the promoter regions of the prostasin gene in 94 hypertensive individuals, and the genotype identification was performed by the TaqMan polymerase chain reaction method. Case-control studies were conducted in 938 Kazakh subjects.Results E342K and 2827G>A, which are novel variants, were successfully genotyped in the general Xinjiang Kazakh population with a sample size of 938 individuals (406 men and 532 women). Only one hypertensive patient was identified with the E342K mutation. No significant association was observed between 2827G>A and hypertension. However,quantitative traits of hypertensive intermediate phenotypes were significantly associated with the A allele; P=-0.041 and 0.034 for body mass index (BMI) in the additive and recessive models, P=0.042 and 0.018 for OGTT-2h glucose in the additive and recessive models, P=0.031 for IRT-3h insulin in the recessive model, and P=0.038 for serum potassium in the dominant model.Conclusions This study does not provide evidence of a major role of prostasin variation in blood pressure modulation.However, association of prostasin polymorphisms with hypertension and metabolic effects can be observed in our population. Further investigation is warranted to clarify the relevance of prostasin polymorphisms to blood pressure regulation.

  11. Lack of sequence variation in sporadic bovine leucosis in regions of tumour suppressor genes p53 and p16.

    Mayr, B; Grüneis, C; Brem, G; Reifinger, M; Schaffner, G; Hochsteiner, W

    2001-08-01

    Regions of the promoter and exons 5-8 of the tumour suppressor gene p53 were analysed in 25 cases of sporadic bovine leucosis. The study included 17 cases of juvenile leucosis, five cases of adult leucosis and three cases of skin leucosis. Exon 2 of tumour suppressor gene p16 was also investigated in the same samples. No sequence variations were present in the analysed areas of the genes. In p53, this fact represents a clear difference in comparison with enzootic bovine leucosis. In p16, no comparative data are available. PMID:11554494

  12. The association between common genetic variation in the FTO gene and metabolic syndrome in Han Chinese

    WANG Tong; ZHANG Li-li; ZHANG Yun; SUN Xiao-fang; ZHANG Qian; HUANG Yi; XIAO Xin-hua; WANG Duen-mei; DIAO Cheng-ming; ZHANG Feng; XU Ling-ling; ZHANG Yong-biao; LI Wen-hui

    2010-01-01

    Background Genome-wide association studies for type 2 diabetes mellitus (T2DM) identified FTO gene as a locus conferring increased risk for common obesity in many populations with European ancestry. However, the involvement of FTO gene in obesity or T2DM related metabolic traits has not been consistently established in Chinese populations. The objective of this study was to investigate the association of FTO genetic polymorphisms with metabolic syndrome (MetS) in Han Chinese.Methods We tested 41 FTO single nucleotide polymorphisms (SNPs) for association between FTO and MetS-related traits. There were a total of 236 unrelated subjects (108 cases and 128 controls), grouped according to the International Diabetes Federation (IDF) criteria.Results Of the 41 SNPs examined, only SNP rs8047395 exhibited statistical significance (P=0.026) under a recessive model, after Bonferroni adjustment for multiple testing (OR 1.64, 95% CI 1.11-2.42; P=0.014). The common distributions of this polymorphism among Chinese-with a minor allele frequency (MAF) of 36% in the control group versus 48% in the MetS group-greatly improved our test power in a relatively small sample size for an association study. Previously identified obesity-(or T2DM-) associated FTO SNPs were less common in Han Chinese and were not associated with MetS in this study. No significant associations were found between our FTO SNPs and any endophenotypes of MetS.Conclusions A more common risk-conferring variant of FTO for MetS was identified in Han Chinese. Our study substantiated that genetic variations in FTO locus are involved in the pathogenesis of MetS.

  13. Allelic variation in the squirrel monkey x-linked color vision gene: biogeographical and behavioral correlates.

    Cropp, Susan; Boinski, Sue; Li, Wen-Hsiung

    2002-06-01

    Most Neotropical primate species possess a polymorphic X-linked and a monomorphic autosomal color vision gene. Consequently, populations are composed of both dichromatics and trichromatics. Most theories on the maintenance of this genetic system revolve around possible advantages for foraging ecology. To examine the issue from a different angle, we compared the numbers and relative frequencies of alleles at the X-linked locus among three species of Saimiri representing a wide range of geographical and behavioral variation in the genus. Exons 3, 4, and 5 of the X-linked opsin gene were sequenced for a large number of X chromosomes for all three species. Several synonymous mutations were detected in exons 4 and 5 for the originally reported alleles but only a single nonsynonymous change was detected. Two alleles were found that appeared to be the result of recombination events. The low occurrence of recombinant alleles and absence of mutations in the amino acids critical for spectral tuning indicates that stabilizing selection acts to maintain the combinations of critical sites specific to each allele. Allele frequencies were approximately the same for all Saimiri species, with a slight but significant difference between S. boliviensis and S. oerstedii. No apparent correlation exists between allele frequencies and behavioral or biogeographical differences between species, casting doubt on the speculation that the spectral sensitivities of the alleles have been maintained because they are specifically well-tuned to Saimiri visual ecology. Rather, the spectral tuning peaks might have been maintained because they are as widely spaced as possible within the limited range of middlewave to longwave spectra useful to all primates. This arrangement creates a balance between maximizing the distance between spectral tuning peaks (allowing the color opponency of the visual system to distinguish between peaks) and maximizing the number of alleles within a limited range (yielding

  14. Neuropeptide S receptor gene variation modulates anterior cingulate cortex Glx levels during CCK-4 induced panic.

    Ruland, Tillmann; Domschke, Katharina; Schütte, Valerie; Zavorotnyy, Maxim; Kugel, Harald; Notzon, Swantje; Vennewald, Nadja; Ohrmann, Patricia; Arolt, Volker; Pfleiderer, Bettina; Zwanzger, Peter

    2015-10-01

    An excitatory-inhibitory neurotransmitter dysbalance has been suggested in pathogenesis of panic disorder. The neuropeptide S (NPS) system has been implicated in modulating GABA and glutamate neurotransmission in animal models and to genetically drive altered fear circuit function and an increased risk of panic disorder in humans. Probing a multi-level imaging genetic risk model of panic, in the present magnetic resonance spectroscopy (MRS) study brain glutamate+glutamine (Glx) levels in the bilateral anterior cingulate cortex (ACC) during a pharmacological cholecystokinin tetrapeptide (CCK-4) panic challenge were assessed depending on the functional neuropeptide S receptor gene (NPSR1) rs324981 A/T variant in a final sample of 35 healthy male subjects. The subjective panic response (Panic Symptom Scale; PSS) as well as cortisol and ACTH levels were ascertained throughout the experiment. CCK-4 injection was followed by a strong panic response. A significant time×genotype interaction was detected (p=.008), with significantly lower ACC Glx/Cr levels in T allele carriers as compared to AA homozygotes 5min after injection (p=.003). CCK-4 induced significant HPA axis stimulation, but no effect of genotype was discerned. The present pilot data suggests NPSR1 gene variation to modulate Glx levels in the ACC during acute states of stress and anxiety, with blunted, i.e. possibly maladaptive ACC glutamatergic reactivity in T risk allele carriers. Our results underline the notion of a genetically driven rapid and dynamic response mechanism in the neural regulation of human anxiety and further strengthen the emerging role of the NPS system in anxiety. PMID:26235955

  15. Gene structure variation in segmental duplication block C of human chromosome 7q 11.23 during primate evolution.

    Kim, Yun-Ji; Ahn, Kung; Gim, Jeong-An; Oh, Man Hwan; Han, Kyudong; Kim, Heui-Soo

    2015-12-01

    Segmental duplication, or low-copy repeat (LCR) event, occurs during primate evolution and is an important source of genomic diversity, including gain or loss of gene function. The human chromosome 7q 11.23 is related to the William-Beuren syndrome and contains large region-specific LCRs composed of blocks A, B, and C that have different copy numbers in humans and different primates. We analyzed the structure of POM121, NSUN5, FKBP6, and TRIM50 genes in the LCRs of block C. Based on computational analysis, POM121B created by a segmental duplication acquired a new exonic region, whereas NSUN5B (NSUN5C) showed structural variation by integration of HERV-K LTR after duplication from the original NSUN5 gene. The TRIM50 gene originally consists of seven exons, whereas the duplicated TRIM73 and TRIM74 genes present five exons because of homologous recombination-mediated deletion. In addition, independent duplication events of the FKBP6 gene generated two pseudogenes at different genomic locations. In summary, these clustered genes are created by segmental duplication, indicating that they show dynamic evolutionary events, leading to structure variation in the primate genome. PMID:26196062

  16. Natural variation in rosette size under salt stress conditions corresponds to developmental differences between Arabidopsis accessions and allelic variation in the LRR-KISS gene

    Julkowska, Magdalena M.

    2016-02-11

    Natural variation among Arabidopsis accessions is an important genetic resource to identify mechanisms underlying plant development and stress tolerance. To evaluate the natural variation in salinity stress tolerance, two large-scale experiments were performed on two populations consisting of 160 Arabidopsis accessions each. Multiple traits, including projected rosette area, and fresh and dry weight were collected as an estimate for salinity tolerance. Our results reveal a correlation between rosette size under salt stress conditions and developmental differences between the accessions grown in control conditions, suggesting that in general larger plants were more salt tolerant. This correlation was less pronounced when plants were grown under severe salt stress conditions. Subsequent genome wide association study (GWAS) revealed associations with novel candidate genes for salinity tolerance such as LRR-KISS (At4g08850), flowering locus KH-domain containing protein and a DUF1639-containing protein. Accessions with high LRR-KISS expression developed larger rosettes under salt stress conditions. Further characterization of allelic variation in candidate genes identified in this study will provide more insight into mechanisms of salt stress tolerance due to enhanced shoot growth.

  17. Genetic variations in the CLU and PICALM genes are associated with cognitive function in the oldest old

    Mengel-From, Jonas; Christensen, Kaare; McGue, Matt;

    2011-01-01

    (PICALM) gene and one variation, rs6656401, in the complement component (3b/4b) receptor 1 (CR) gene were associated with AD. Here, we replicate these associations with cognitive functioning in 1380 individuals from the Danish (1905) birth cohort study of the oldest old (92-93 years at intake) using...... measures of Mini Mental State Examination (MMSE) and a cognitive composite score. We found a significant association between the highly frequent CLU rs11136000 T allele (38%) and better performance on the cognitive composite score (p = 0.016) explaining 0.5% of the mean variation in cognitive composite...... score, and for men a significant association between the highly frequent PICALM rs3851179 A allele (38%). Better performance was found (p = 0.024), explaining 1.4% of the mean variation in cognitive composite score in men. These alleles correspond to the minor alleles initially found more frequent...

  18. Heritable variation in heat shock gene expression: a potential mechanism for adaptation to thermal stress in embryos of sea turtles.

    Tedeschi, J N; Kennington, W J; Tomkins, J L; Berry, O; Whiting, S; Meekan, M G; Mitchell, N J

    2016-01-13

    The capacity of species to respond adaptively to warming temperatures will be key to their survival in the Anthropocene. The embryos of egg-laying species such as sea turtles have limited behavioural means for avoiding high nest temperatures, and responses at the physiological level may be critical to coping with predicted global temperature increases. Using the loggerhead sea turtle (Caretta caretta) as a model, we used quantitative PCR to characterise variation in the expression response of heat-shock genes (hsp60, hsp70 and hsp90; molecular chaperones involved in cellular stress response) to an acute non-lethal heat shock. We show significant variation in gene expression at the clutch and population levels for some, but not all hsp genes. Using pedigree information, we estimated heritabilities of the expression response of hsp genes to heat shock and demonstrated both maternal and additive genetic effects. This is the first evidence that the heat-shock response is heritable in sea turtles and operates at the embryonic stage in any reptile. The presence of heritable variation in the expression of key thermotolerance genes is necessary for sea turtles to adapt at a molecular level to warming incubation environments. PMID:26763709

  19. Genetic variation in selenoprotein genes, lifestyle, and risk of colon and rectal cancer.

    Martha L Slattery

    Full Text Available BACKGROUND: Associations between selenium and cancer have directed attention to role of selenoproteins in the carcinogenic process. METHODS: We used data from two population-based case-control studies of colon (n = 1555 cases, 1956 controls and rectal (n = 754 cases, 959 controls cancer. We evaluated the association between genetic variation in TXNRD1, TXNRD2, TXNRD3, C11orf31 (SelH, SelW, SelN1, SelS, SepX, and SeP15 with colorectal cancer risk. RESULTS: After adjustment for multiple comparisons, several associations were observed. Two SNPs in TXNRD3 were associated with rectal cancer (rs11718498 dominant OR 1.42 95% CI 1.16,1.74 pACT 0.0036 and rs9637365 recessive 0.70 95% CI 0.55,0.90 pACT 0.0208. Four SNPs in SepN1 were associated with rectal cancer (rs11247735 recessive OR 1.30 95% CI 1.04,1.63 pACT 0.0410; rs2072749 GGvsAA OR 0.53 95% CI 0.36,0.80 pACT 0.0159; rs4659382 recessive OR 0.58 95% CI 0.39,0.86 pACT 0.0247; rs718391 dominant OR 0.76 95% CI 0.62,0.94 pACT 0.0300. Interaction between these genes and exposures that could influence these genes showed numerous significant associations after adjustment for multiple comparisons. Two SNPs in TXNRD1 and four SNPs in TXNRD2 interacted with aspirin/NSAID to influence colon cancer; one SNP in TXNRD1, two SNPs in TXNRD2, and one SNP in TXNRD3 interacted with aspirin/NSAIDs to influence rectal cancer. Five SNPs in TXNRD2 and one in SelS, SeP15, and SelW1 interacted with estrogen to modify colon cancer risk; one SNP in SelW1 interacted with estrogen to alter rectal cancer risk. Several SNPs in this candidate pathway influenced survival after diagnosis with colon cancer (SeP15 and SepX1 increased HRR and rectal cancer (SepX1 increased HRR. CONCLUSIONS: Findings support an association between selenoprotein genes and colon and rectal cancer development and survival after diagnosis. Given the interactions observed, it is likely that the impact of cancer susceptibility from genotype is

  20. Variations in host genes encoding adhesion molecules and susceptibility to falciparum malaria in India

    Tyagi Prajesh K

    2008-12-01

    Full Text Available Abstract Background Host adhesion molecules play a significant role in the pathogenesis of Plasmodium falciparum malaria and changes in their structure or levels in individuals can influence the outcome of infection. The aim of this study was to investigate the association of SNPs of three adhesion molecule genes, ICAM1, PECAM1 and CD36, with severity of falciparum malaria in a malaria-endemic and a non-endemic region of India. Methods The frequency distribution of seven selected SNPs of ICAM1, PECAM1 and CD36 was determined in 552 individuals drawn from 24 populations across India. SNP-disease association was analysed in a case-control study format. Genotyping of the population panel was performed by Sequenom mass spectroscopy and patient/control samples were genotyped by SNaPshot method. Haplotypes and linkage disequilibrium (LD plots were generated using PHASE and Haploview, respectively. Odds-ratio (OR for risk assessment was estimated using EpiInfo™ version 3.4. Results Association of the ICAM1 rs5498 (exon 6 G allele and the CD36 exon 1a A allele with increased risk of severe malaria was observed (severe versus control, OR = 1.91 and 2.66, P = 0.02 and 0.0012, respectively. The CD36 rs1334512 (-53 T allele as well as the TT genotype associated with protection from severe disease (severe versus control, TT versus GG, OR = 0.37, P = 0.004. Interestingly, a SNP of the PECAM1 gene (rs668, exon 3, C/G with low minor allele frequency in populations of the endemic region compared to the non-endemic region exhibited differential association with disease in these regions; the G allele was a risk factor for malaria in the endemic region, but exhibited significant association with protection from disease in the non-endemic region. Conclusion The data highlights the significance of variations in the ICAM1, PECAM1 and CD36 genes in the manifestation of falciparum malaria in India. The PECAM1 exon 3 SNP exhibits altered association with disease in the

  1. Assessment of PD-1 gene variation in patients with multiple sclerosis

    Shadmehri AA

    2010-05-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: Multiple sclerosis (MS is a chronic inflammatory demyelinating disease of the central nervous system with presumed autoimmune origin. T cells are considered to play a pivotal role in orchestrating the self-reactive immune responses in multiple sclerosis (MS. This study was performed to investigate the role of polymorphisms of the programmed cell death 1 (PD-1 gene on susceptibility to ankylosing spondylitis. This gene codes an immunoreceptor named PD-1, which has a cytoplasmic domain containing two tyrosine residues located within immunoreceptor tyrosine-based inhibitory and switch motifs (ITIM and ITSM, suggesting that PD-1 is predominantly inhibitory which responsible for the negative regulation in T cell activation and peripheral tolerance. We investigated whether PD-1 gene polymorphism is a genetic modifier for risk and progression of MS."n"n Methods: Blood samples from 150 Iranian Relapsing-Remitting MS patients (mean age, 34.98 years and 202 healthy controls (mean age, 30 years were enrolled in this study. The PD-1.3 (7146 G/A Intron 4 and PD-1.9 (7625 C/T Exon 5 polymorphisms were detected by Polymerase Chain Reaction and Restriction Enzyme digestion or Restriction Fragment Length Polymorphism (PCR

  2. Haplotype variation of Green Revolution gene Rht-D1 during wheat domestication and improvement

    Chihong Zhang; Lifeng Gao; Jiaqiang Sun; Jizeng Jia; Zhenglong Ren

    2014-01-01

    Green Revolution made a substantial contribution to wheat yields worldwide in the 1960s and 1970s. It is of great importance to analyze the haplotype variation of Rht-D1, the Green Revolution gene, during wheat (Triticum aestivum L.) domestication and breeding to understand its evolution and function in wheat breeding history. In this study, the Rht-D1 and its flanking regions were sequenced and single nucleotide polymorphisms were detected based on a panel of 45 accessions of Aegilops tauschi , 51 accessions of landraces and 80 accessions of commercial varieties. Genetic diversity in the wild accessions was much higher than that in the varieties and higher than that reported previously. Seven haplotypes (Hapl I to Hapl VII) of Rht-D1 were identified and their evolutionary relationships were proposed. In addition to the wel-known Green Revolution al ele Rht-D1b, Hapl VII (an al ele Rht-D1k) was identified in early breeding varieties, which reduced plant height by 16%. The results suggested that Rht-D1k had been used in breeding before the Green Revolution and made a great contribution to wheat production worldwide. Based on the breeding history and molecular evidence, we proposed that the wheat Green Revolution in China and International Maize and Wheat Improvement Center (CIMMYT) occurred independently.

  3. Allelic distributions of CYP2D6 gene copy number variation in the Eastern Han Chinese population

    Hai-hui SHENG; Yun-lan DU; Jian SUN; Hua-sheng XIAO; Ai-ping ZENG; Wen-xiang ZHU; Ren-fang ZHU; Hong-mei LI; Zhi-dong ZHU; Ying QIN; Wei JIN; Yan LIU

    2007-01-01

    Aim: The human cytochrome P450 2D6 (CYP2D6) gene copy number variation, involving CYP2D6 gene deletion (CYP2D6*5) and duplication or multiduplication (CYP2D6*×N), can result in reduced or increased metabolism of many clinically used drugs. The identification of CYP2D6*5 and CYP2D6*×N and the investigation of their allelic distributions in ethnic populations can be important in deter-mining the right drug and dosage for each patient. Methods: The CYP2D6*5 andCYP2D6 genes, and CYP2D6 gene duplication were identified by 2 modified long PCR, respectively. To determine duplicated alleles, a novel long PCR was developed to amplify the entire duplicated CYP2D6 gene which was used as template for subsequent PCR amplification. A total of 363 unrelated Eastern Han Chinese individuals were analyzed for CYP2D6 gene copy number variation. Results: The frequency of CYP2D6*5 and CYP2D6*×N were 4.82% (n=35) and 0.69% (n=5) in the Eastern Han Chinese population, respectively. Of the 5 duplicated alleles, 3were CYP2D6*1×N and 2 were CYP2D6*10×N. One individual was a carrier of both CYP2D6*5 and CYP2D6*1×N. Taken together, the CYP2D6 gene rear-rangements were present in 10.74% of subjects. Conclusion: Allelic distributions of the CYP2D6 gene copy number variation differ among Chinese from different regions, indicating ethnic variety in Chinese. Long PCR are convenient, cost effective, specific and semiquantitative for the detection of the CYP2D6 gene copy number variation, and amplification of the entire duplicated CYP2D6 gene is necessary for the accurate identification of duplicated alleles.

  4. Immune gene expression in Bombus terrestris: signatures of infection despite strong variation among populations, colonies, and sister workers.

    Franziska S Brunner

    Full Text Available Ecological immunology relies on variation in resistance to parasites. Colonies of the bumblebee Bombus terrestris vary in their susceptibility to the trypanosome gut parasite Crithidia bombi, which reduces colony fitness. To understand the possible origin of this variation in resistance we assayed the expression of 28 immunologically important genes in foraging workers. We deliberately included natural variation of the host "environment" by using bees from colonies collected in two locations and sampling active foraging workers that were not age controlled. Immune gene expression patterns in response to C. bombi showed remarkable variability even among genetically similar sisters. Nevertheless, expression varied with parasite exposure, among colonies and, perhaps surprisingly, strongly among populations (collection sites. While only the antimicrobial peptide abaecin is universally up regulated upon exposure, linear discriminant analysis suggests that the overall exposure effect is driven by a combination of several immune pathways and further immune functions such as ROS regulation. Also, the differences among colonies in their immune gene expression profiles provide clues to the mechanistic basis of well-known inter-colony variation in susceptibility to this parasite. Our results show that transcriptional responses to parasite exposure can be detected in ecologically heterogeneous groups despite strong background noise.

  5. Genetic variation in the HSD17B1 gene and risk of prostate cancer.

    Peter Kraft

    2005-11-01

    Full Text Available Steroid hormones are believed to play an important role in prostate carcinogenesis, but epidemiological evidence linking prostate cancer and steroid hormone genes has been inconclusive, in part due to small sample sizes or incomplete characterization of genetic variation at the locus of interest. Here we report on the results of a comprehensive study of the association between HSD17B1 and prostate cancer by the Breast and Prostate Cancer Cohort Consortium, a large collaborative study. HSD17B1 encodes 17beta-hydroxysteroid dehydrogenase 1, an enzyme that converts dihydroepiandrosterone to the testosterone precursor Delta5-androsterone-3beta,17beta-diol and converts estrone to estradiol. The Breast and Prostate Cancer Cohort Consortium researchers systematically characterized variation in HSD17B1 by targeted resequencing and dense genotyping; selected haplotype-tagging single nucleotide polymorphisms (htSNPs that efficiently predict common variants in U.S. and European whites, Latinos, Japanese Americans, and Native Hawaiians; and genotyped these htSNPs in 8,290 prostate cancer cases and 9,367 study-, age-, and ethnicity-matched controls. We found no evidence that HSD17B1 htSNPs (including the nonsynonymous coding SNP S312G or htSNP haplotypes were associated with risk of prostate cancer or tumor stage in the pooled multiethnic sample or in U.S. and European whites. Analyses stratified by age, body mass index, and family history of disease found no subgroup-specific associations between these HSD17B1 htSNPs and prostate cancer. We found significant evidence of heterogeneity in associations between HSD17B1 haplotypes and prostate cancer across ethnicity: one haplotype had a significant (p < 0.002 inverse association with risk of prostate cancer in Latinos and Japanese Americans but showed no evidence of association in African Americans, Native Hawaiians, or whites. However, the smaller numbers of Latinos and Japanese Americans in this study makes

  6. Variation in the MC4R gene is associated with bone phenotypes in elderly Swedish women.

    Gaurav Garg

    Full Text Available Osteoporosis is characterized by reduced bone mineral density (BMD and increased fracture risk. Fat mass is a determinant of bone strength and both phenotypes have a strong genetic component. In this study, we examined the association between obesity associated polymorphisms (SNPs with body composition, BMD, Ultrasound (QUS, fracture and biomarkers (Homocysteine (Hcy, folate, Vitamin D and Vitamin B12 for obesity and osteoporosis. Five common variants: rs17782313 and rs1770633 (melanocortin 4 receptor (MC4R; rs7566605 (insulin induced gene 2 (INSIG2; rs9939609 and rs1121980 (fat mass and obesity associated (FTO were genotyped in 2 cohorts of Swedish women: PEAK-25 (age 25, n = 1061 and OPRA (age 75, n = 1044. Body mass index (BMI, total body fat and lean mass were strongly positively correlated with QUS and BMD in both cohorts (r(2 = 0.2-0.6. MC4R rs17782313 was associated with QUS in the OPRA cohort and individuals with the minor C-allele had higher values compared to T-allele homozygotes (TT vs. CT vs.100 vs. 103 vs. 103; p = 0.002; (SOS: 1521 vs. 1526 vs. 1524; p = 0.008; (Stiffness index: 69 vs. 73 vs. 74; p = 0.0006 after adjustment for confounders. They also had low folate (18 vs. 17 vs. 16; p = 0.03 and vitamin D (93 vs. 91 vs. 90; p = 0.03 and high Hcy levels (13.7 vs 14.4 vs. 14.5; p = 0.06. Fracture incidence was lower among women with the C-allele, (52% vs. 58%; p = 0.067. Variation in MC4R was not associated with BMD or body composition in either OPRA or PEAK-25. SNPs close to FTO and INSIG2 were not associated with any bone phenotypes in either cohort and FTO SNPs were only associated with body composition in PEAK-25 (p≤0.001. Our results suggest that genetic variation close to MC4R is associated with quantitative ultrasound and risk of fracture.

  7. Genetic variation in the HSD17B1 gene and risk of prostate cancer.

    Kraft, Peter; Pharoah, Paul; Chanock, Stephen J; Albanes, Demetrius; Kolonel, Laurence N; Hayes, Richard B; Altshuler, David; Andriole, Gerald; Berg, Christine; Boeing, Heiner; Burtt, Noel P; Bueno-de-Mesquita, Bas; Calle, Eugenia E; Cann, Howard; Canzian, Federico; Chen, Yen-Ching; Crawford, David E; Dunning, Alison M; Feigelson, Heather S; Freedman, Matthew L; Gaziano, John M; Giovannucci, Ed; Gonzalez, Carlos Alberto; Haiman, Christopher A; Hallmans, Goran; Henderson, Brian E; Hirschhorn, Joel N; Hunter, David J; Kaaks, Rudolf; Key, Timothy; Le Marchand, Loic; Ma, Jing; Overvad, Kim; Palli, Domenico; Pike, Malcolm C; Riboli, Elio; Rodriguez, Carmen; Setiawan, Wendy V; Stampfer, Meir J; Stram, Daniel O; Thomas, Gilles; Thun, Michael J; Travis, Ruth; Trichopoulou, Antonia; Virtamo, Jarmo; Wacholder, Sholom

    2005-11-01

    Steroid hormones are believed to play an important role in prostate carcinogenesis, but epidemiological evidence linking prostate cancer and steroid hormone genes has been inconclusive, in part due to small sample sizes or incomplete characterization of genetic variation at the locus of interest. Here we report on the results of a comprehensive study of the association between HSD17B1 and prostate cancer by the Breast and Prostate Cancer Cohort Consortium, a large collaborative study. HSD17B1 encodes 17beta-hydroxysteroid dehydrogenase 1, an enzyme that converts dihydroepiandrosterone to the testosterone precursor Delta5-androsterone-3beta,17beta-diol and converts estrone to estradiol. The Breast and Prostate Cancer Cohort Consortium researchers systematically characterized variation in HSD17B1 by targeted resequencing and dense genotyping; selected haplotype-tagging single nucleotide polymorphisms (htSNPs) that efficiently predict common variants in U.S. and European whites, Latinos, Japanese Americans, and Native Hawaiians; and genotyped these htSNPs in 8,290 prostate cancer cases and 9,367 study-, age-, and ethnicity-matched controls. We found no evidence that HSD17B1 htSNPs (including the nonsynonymous coding SNP S312G) or htSNP haplotypes were associated with risk of prostate cancer or tumor stage in the pooled multiethnic sample or in U.S. and European whites. Analyses stratified by age, body mass index, and family history of disease found no subgroup-specific associations between these HSD17B1 htSNPs and prostate cancer. We found significant evidence of heterogeneity in associations between HSD17B1 haplotypes and prostate cancer across ethnicity: one haplotype had a significant (p < 0.002) inverse association with risk of prostate cancer in Latinos and Japanese Americans but showed no evidence of association in African Americans, Native Hawaiians, or whites. However, the smaller numbers of Latinos and Japanese Americans in this study makes these subgroup

  8. Rendimiento académico y ambiente social Rendimiento académico y ambiente social

    Jesús Ruíz Herrero

    2011-03-01

    Full Text Available El presente artículo evalúa, mediante procedimientos estadísticos, la influencia que el nivel educativo y la profesión de los progenitores, la renta per cápita del distrito o el tipo de centro pudieran tener sobre el rendimiento académico. La tesis de la que se parte considera que tales factores condicionan los esquemas perceptivos y cognitivos (habitus con los que los alumnos hacen frente a su etapa académica, y que explican su éxito o fracaso. Para demostrarlo, hemos analizado los resultados en la prueba CDI del año 2008 para 6º de Primaria, que la Consejería de Educación de la Comunidad de Madrid organiza desde hace unos años a fin de evaluar el rendimiento académico del alumnado y si su nivel de conocimientos se ajusta a lo esperado para su curso. La perspectiva presentada aquí contrasta con la que sostienen otros discursos, como es el caso del discurso dominante en el sistema educativo, que sólo tienden a enfatizar los factores puramente individuales o psicológicos, o a desligarlos de las condiciones sociales que los han producido.The present article analyzes the influence that variables such as parent´s educational level of attainment or occupation, level of income associated to the family´s area of residence, or kind of school (private vs. factors could account for the differenciated cognitive and perceptive schemata (habitus that children develop to meet “the educational challenge”. To demonstrate such relations, statistical procedures are used. The data tested here has been collected from the average results that different schools taking part in CDI exam obtained in 2008 in the region of Madrid. This exam is held every academic year and organized by Consejería de Educación de Madrid (Madrid Office of Education to evaluate if pupils under test match the official academic level required for the grade they are in. Our perspective is further different than that which only tends to stress psicological factors as the

  9. Variation of PRLR gene copy number in duck%鸭PRLR基因拷贝数的变异

    叶炎; 汪稳; 张金耀; 黄守婷; 钟志新; 周世业; 肖天放

    2016-01-01

    Copy number variation ( CNV) merges to be an effective tool in poultry breeding. To elucidate the correlation between productive performance and polymorphism, gene of Brown Tsaiya ducks were amplified by fluorescence quantitative PCR, and fol-lowed by being transferred into CNV via 2-ΔΔCt method. Subsequent production traits responses to different CNV of PRLR gene were investigated. Results showed that correlation coefficients of standard curve for PRLR and Ldh-B were 0.991 and 0.990, with slopes of standard curves being-3.070 and-3.135, respectively. Amplification efficiency of PRLR and Ldh-B target gene were 111.68% and 108.429%, which were approximately at the same level with reference gene. Traits of Brown Tsaiya ducks were correlated with CNV ( P0.05).因此,PRLR基因拷贝变异区域可能影响蛋壳厚度和蛋形指数.

  10. Quantitative variation in obesity-related traits and insulin precursors linked to the OB gene region on human chromosome 7

    Duggirala, R.; Stern, M.P.; Reinhart, L.J. [Univ. of Texas Health Science Center, San Antonio, TX (United States)] [and others

    1996-09-01

    Despite the evidence that human obesity has strong genetic determinants, efforts at identifying specific genes that influence human obesity have largely been unsuccessful. Using the sibship data obtained from 32 low-income Mexican American pedigrees ascertained on a type II diabetic proband and a multipoint variance-components method, we tested for linkage between various obesity-related traits plus associated metabolic traits and 15 markers on human chromosome 7. We found evidence for linkage between markers in the OB gene region and various traits, as follows: D7S514 and extremity skinfolds (LOD = 3.1), human carboxypeptidase A1 (HCPA1) and 32,33-split proinsulin level (LOD = 4.2), and HCPA1 and proinsulin level (LOD = 3.2). A putative susceptibility locus linked to the marker D7S514 explained 56% of the total phenotypic variation in extremity skinfolds. Variation at the HCPA1 locus explained 64% of phenotypic variation in proinsulin level and {approximately}73% of phenotypic variation in split proinsulin concentration, respectively. Weaker evidence for linkage to several other obesity-related traits (e.g., waist circumference, body-mass index, fat mass by bioimpedance, etc.) was observed for a genetic location, which is {approximately}15 cM telomeric to OB. In conclusion, our study reveals that the OB region plays a significant role in determining the phenotypic variation of both insulin precursors and obesity-related traits, at least in Mexican Americans. 66 refs., 3 figs., 4 tabs.

  11. Natural variation of heterokaryon incompatibility gene het-c in Podospora anserina reveals diversifying selection.

    Bastiaans, Eric; Debets, Alfons J M; Aanen, Duur K; van Diepeningen, Anne D; Saupe, Sven J; Paoletti, Mathieu

    2014-04-01

    In filamentous fungi, allorecognition takes the form of heterokaryon incompatibility, a cell death reaction triggered when genetically distinct hyphae fuse. Heterokaryon incompatibility is controlled by specific loci termed het-loci. In this article, we analyzed the natural variation in one such fungal allorecognition determinant, the het-c heterokaryon incompatibility locus of the filamentous ascomycete Podospora anserina. The het-c locus determines an allogenic incompatibility reaction together with two unlinked loci termed het-d and het-e. Each het-c allele is incompatible with a specific subset of the het-d and het-e alleles. We analyzed variability at the het-c locus in a population of 110 individuals, and in additional isolates from various localities. We identified a total of 11 het-c alleles, which define 7 distinct incompatibility specificity classes in combination with the known het-d and het-e alleles. We found that the het-c allorecognition gene of P. anserina is under diversifying selection. We find a highly unequal allele distribution of het-c in the population, which contrasts with the more balanced distribution of functional groups of het-c based on their allorecognition function. One explanation for the observed het-c diversity in the population is its function in allorecognition. However, alleles that are most efficient in allorecognition are rare. An alternative and not exclusive explanation for the observed diversity is that het-c is involved in pathogen recognition. In Arabidopsis thaliana, a homolog of het-c is a pathogen effector target, supporting this hypothesis. We hypothesize that the het-c diversity in P. anserina results from both its functions in pathogen-defense, and allorecognition. PMID:24448643

  12. Investigation of the effect of ionizing radiation on gene expression variation by the 'DNA chips': feasibility of a biological dosimeter

    After having described the different biological effects of ionizing radiation and the different approaches to biological dosimetry, and introduced 'DNA chips' or DNA micro-arrays, the author reports the characterization of gene expression variations in the response of cells to a gamma irradiation. Both main aspects of the use DNA chips are investigated: fundamental research and diagnosis. This research thesis thus proposes an analysis of the effect of ionizing radiation using DNA chips, notably by comparing gene expression modifications measured in mouse irradiated lung, heart and kidney. It reports a feasibility study of bio-dosimeter based on expression profiles

  13. Genetic Variation in the EGFR Gene and the Risk of Glioma in a Chinese Han Population

    Hou, Wu-Gang; Ai, Wen-Bo; Bai, Xiao-Guang; Dong, Hai-long; Li, Zhen; Zhang, Yuan-Qiang; Xiong, Li-Ze

    2012-01-01

    Previous studies have shown that regulation of the epidermal growth factor gene (EGFR) pathway plays a role in glioma progression. Certain genotypes of the EGFR gene may be related to increased glioblastoma risk, indicating that germ line EGFR polymorphisms may have implications in carcinogenesis. To examine whether and how variants in the EGFR gene contribute to glioma susceptibility, we evaluated nine tagging single-nucleotide polymorphisms (tSNPs) of the EGFR gene in a case–control study f...

  14. Natural variation of rice blast resistant gene Pi-ta in Oryza species

    The Pi-ta gene in rice is a putative NBS type cytoplasmic receptor conferring resistance to races of Magnaporthe oryzae in a gene-for-gene manner. A Functional Nucleotide Polymorphism (FNP) change resulting in an amino acid substitution of Alanine to Serine at position 918 (nucleotide G to T at posi...

  15. Genetic Variation and Divergence of Genes Involved in Leaf Adaxial-abaxial Polarity Establishment in Brassica rapa

    Jianli eLiang

    2016-02-01

    Full Text Available Alterations in leaf adaxial–abaxial (ad-ab polarity are one of the main factors that are responsible for leaf curvature. In Chinese cabbage, to form a leafy head, leaf incurvature is an essential prerequisite. Identifying ad-ab patterning genes and investigating its genetic variations will facilitate in elucidating the mechanism underlying leaf incurvature during head formation. In the present study we conducted comparative genomic analysis of the identification of 45 leaf ad-ab patterning genes in Brassica rapa based on 26 homologs in Arabidopsis thaliana, indicating that these genes underwent expansion and were retained after whole genome triplication (WGT. We also assessed the nucleotide diversity and selection footprints of these 45 genes in a collection of 94 Brassica rapa accessions that were composed of heading and non-heading morphotypes. Six of the 45 genes showed significant negative Tajima’s D indices and nucleotide diversity reduction in heading accessions compared to that in non-heading accessions, indicating that these underwent purifying selection. Further testing of the BrARF3.1 gene, which was one of the selection signals from a larger collection, confirmed that purifying selection did occur. Our results provide genetic evidence that ad-ab patterning genes are involved in leaf incurvature that is associated in the formation of a leafy head, as well as promote an understanding of the genetic mechanism underlying leafy head formation in Chinese cabbage.

  16. Genetic Variation and Divergence of Genes Involved in Leaf Adaxial-Abaxial Polarity Establishment in Brassica rapa.

    Liang, Jianli; Liu, Bo; Wu, Jian; Cheng, Feng; Wang, Xiaowu

    2016-01-01

    Alterations in leaf adaxial-abaxial (ad-ab) polarity are one of the main factors that influence leaf curvature. In Chinese cabbage, leaf incurvature is an essential prerequisite to the formation of a leafy head. Identifying ad-ab patterning genes and investigating their genetic variation may facilitate elucidation of the mechanisms underlying leaf incurvature during head formation. Comparative genomic analysis of 45 leaf ad-ab patterning genes in Brassica rapa based on 26 homologs of Arabidopsis thaliana indicated that these genes underwent expansion and were retained after whole genome triplication (WGT). We also assessed the nucleotide diversity and selection footprints of these 45 genes in a collection of 94 Brassica rapa accessions that were composed of heading and non-heading morphotypes. Six of the 45 genes showed significant negative Tajima's D indices and nucleotide diversity reduction in heading accessions compared to those in non-heading accessions, indicating that they underwent purifying selection. Further testing of the BrARF3.1 gene, which was one of the selection signals from a larger collection, confirmed that purifying selection did occur. Our results provide genetic evidence that ad-ab patterning genes are involved in leaf incurvature, which is associated with formation of a leafy head, as well as promote an understanding of the genetic mechanism underlying leafy head formation in Chinese cabbage. PMID:26904064

  17. Robust assignment of cancer subtypes from expression data using a uni-variate gene expression average as classifier

    Genome wide gene expression data is a rich source for the identification of gene signatures suitable for clinical purposes and a number of statistical algorithms have been described for both identification and evaluation of such signatures. Some employed algorithms are fairly complex and hence sensitive to over-fitting whereas others are more simple and straight forward. Here we present a new type of simple algorithm based on ROC analysis and the use of metagenes that we believe will be a good complement to existing algorithms. The basis for the proposed approach is the use of metagenes, instead of collections of individual genes, and a feature selection using AUC values obtained by ROC analysis. Each gene in a data set is assigned an AUC value relative to the tumor class under investigation and the genes are ranked according to these values. Metagenes are then formed by calculating the mean expression level for an increasing number of ranked genes, and the metagene expression value that optimally discriminates tumor classes in the training set is used for classification of new samples. The performance of the metagene is then evaluated using LOOCV and balanced accuracies. We show that the simple uni-variate gene expression average algorithm performs as well as several alternative algorithms such as discriminant analysis and the more complex approaches such as SVM and neural networks. The R package rocc is freely available at http://cran.r-project.org/web/packages/rocc/index.html

  18. Screening of the FcεRI-β-Gene in a Swiss Population of Asthmatic Children: No Association with E237G and Identification of New Sequence Variations

    M. Rohrbach

    1998-01-01

    Full Text Available Background: The gene of the beta subunit of the high affinity receptor for IgE (FcεRI-β encoded on chromosome 11q13 has recently been identified as a candidate gene for asthma and atopy. Two coding variations, E237G and I181L have been described as being associated with asthma and atopy. Our aim was to investigate a Swiss population of atopic and asthmatic children for variations in this gene.

  19. Copy number variation analysis implicates the cell polarity gene glypican 5 as a human spina bifida candidate gene.

    Bassuk, Alexander G; Muthuswamy, Lakshmi B; Boland, Riley; Smith, Tiffany L; Hulstrand, Alissa M; Northrup, Hope; Hakeman, Matthew; Dierdorff, Jason M; Yung, Christina K; Long, Abby; Brouillette, Rachel B; Au, Kit Sing; Gurnett, Christina; Houston, Douglas W; Cornell, Robert A; Manak, J Robert

    2013-03-15

    Neural tube defects (NTDs) are common birth defects of complex etiology. Family and population-based studies have confirmed a genetic component to NTDs. However, despite more than three decades of research, the genes involved in human NTDs remain largely unknown. We tested the hypothesis that rare copy number variants (CNVs), especially de novo germline CNVs, are a significant risk factor for NTDs. We used array-based comparative genomic hybridization (aCGH) to identify rare CNVs in 128 Caucasian and 61 Hispanic patients with non-syndromic lumbar-sacral myelomeningocele. We also performed aCGH analysis on the parents of affected individuals with rare CNVs where parental DNA was available (42 sets). Among the eight de novo CNVs that we identified, three generated copy number changes of entire genes. One large heterozygous deletion removed 27 genes, including PAX3, a known spina bifida-associated gene. A second CNV altered genes (PGPD8, ZC3H6) for which little is known regarding function or expression. A third heterozygous deletion removed GPC5 and part of GPC6, genes encoding glypicans. Glypicans are proteoglycans that modulate the activity of morphogens such as Sonic Hedgehog (SHH) and bone morphogenetic proteins (BMPs), both of which have been implicated in NTDs. Additionally, glypicans function in the planar cell polarity (PCP) pathway, and several PCP genes have been associated with NTDs. Here, we show that GPC5 orthologs are expressed in the neural tube, and that inhibiting their expression in frog and fish embryos results in NTDs. These results implicate GPC5 as a gene required for normal neural tube development. PMID:23223018

  20. No association between type 1 diabetes and genetic variation in vitamin D metabolism genes

    Thorsen, Steffen U; Mortensen, Henrik B; Carstensen, Bendix; Fenger, Mogens; Thuesen, Betina H; Husemoen, Lotte; Bergholdt, Regine; Brorsson, Caroline; Pociot, Flemming; Linneberg, Allan; Svensson, Jannet

    2014-01-01

    BACKGROUND: Vitamin D, certain single nucleotide polymorphisms (SNPs) in the vitamin D-receptor (VDR) gene and vitamin D metabolism genes have been associated with type 1 diabetes (T1D). OBJECTIVE: We wanted to examine if the most widely studied SNPs in genes important for production, transport...... siblings). RESULTS: We did not demonstrate association with T1D for SNPs in the following genes: CYP27B1, VDR, GC, CYP2R1, DHCR7, and CYP24A1. Though, variants in the GC gene were significantly associated with 25(OH)D levels in the joint model. CONCLUSION: Some of the most examined SNPs in vitamin D...

  1. SNP and gene networks construction and analysis from classification of copy number variations data

    Liu, Yang; Lee, Yiu Fai; Ng, Michael K.

    2011-01-01

    Background Detection of genomic DNA copy number variations (CNVs) can provide a complete and more comprehensive view of human disease. It is interesting to identify and represent relevant CNVs from a genome-wide data due to high data volume and the complexity of interactions. Results In this paper, we incorporate the DNA copy number variation data derived from SNP arrays into a computational shrunken model and formalize the detection of copy number variations as a case-control classification ...

  2. Genome-wide association implicates numerous genes and pleiotropy underlying ecological trait variation in natural populations of Populus trichocarpa

    McKown, Athena [University of British Columbia, Vancouver; Klapste, Jaroslav [University of British Columbia, Vancouver; Guy, Robert [University of British Columbia, Vancouver; Geraldes, Armando [University of British Columbia, Vancouver; Porth, Ilga [University of British Columbia, Vancouver; Hannemann, Jan [University of Victoria, Canada; Friedmann, Michael [University of British Columbia, Vancouver; Muchero, Wellington [ORNL; Tuskan, Gerald A [ORNL; Ehlting, Juergen [University of Victoria, Canada; Cronk, Quentin [University of British Columbia, Vancouver; El-Kassaby, Yousry [University of British Columbia, Vancouver; Mansfield, Shawn [University of British Columbia, Vancouver; Douglas, Carl [University of British Columbia, Vancouver

    2014-01-01

    To uncover the genetic basis of phenotypic trait variation, we used 448 unrelated wild accessions of black cottonwood (Populus trichocarpa Torr. & Gray) from natural populations throughout western North America. Extensive information from large-scale trait phenotyping (with spatial and temporal replications within a common garden) and genotyping (with a 34K Populus SNP array) of all accessions were used for gene discovery in a genome-wide association study (GWAS).

  3. S-SCAM, A Rare Copy Number Variation Gene, Induces Schizophrenia-Related Endophenotypes in Transgenic Mouse Model

    Zhang, Nanyan; Zhong, PENG; Shin, Seung Min; Metallo, Jacob; Danielson, Eric; Olsen, Christopher M.; Liu, Qing-song; Lee, Sang H.

    2015-01-01

    Accumulating genetic evidence suggests that schizophrenia (SZ) is associated with individually rare copy number variations (CNVs) of diverse genes, often specific to single cases. However, the causality of these rare mutations remains unknown. One of the rare CNVs found in SZ cohorts is the duplication of Synaptic Scaffolding Molecule (S-SCAM, also called MAGI-2), which encodes a postsynaptic scaffolding protein controlling synaptic AMPA receptor levels, and thus the strength of excitatory sy...

  4. Genetic Variations in Xenobiotic Metabolic Pathway Genes, Personal Hair Dye Use, and Risk of Non-Hodgkin Lymphoma

    Zhang, Yawei; Hughes, Kathryn J.; Zahm, Shelia Hoar; Zhang, Yaqun; Holford, Theodore R.; Dai, Li; Bai, Yana; Han, Xuesong; Qin, Qin; Lan, Qing; Rothman, Nathaniel; Zhu, Yong; Leaderer, Brian; Zheng, Tongzhang

    2009-01-01

    From 1996 to 2000, the authors conducted a population-based case-control study among Connecticut women to test the hypothesis that genetic variation in xenobiotic metabolic pathway genes modifies the relation between hair dye use and risk of non-Hodgkin lymphoma. No effect modifications were found for women who started using hair dyes in 1980 or afterward. For women who started using hair dye before 1980 as compared with never users, a statistically significantly increased risk of non-Hodgkin...

  5. The Effects of Sequence Variation on Genome-wide NRF2 Binding—New Target Genes and Regulatory SNPs

    Kuosmanen, Suvi; Viitala, Sari; Laitinen, Tuomo; Peräkylä, Mikael; Pölönen, Petri; Kansanen, Emilia; Leinonen, Hanna; Raju, Suresh; Wienecke, Anke; Närvänen, Ale; Poso, Antti; Heinäniemi, Merja; Heikkinen, Sami; Levonen, Anna-Liisa

    2016-01-01

    Transcription factor binding specificity is crucial for proper target gene regulation. Motif discovery algorithms identify the main features of the binding patterns, but the accuracy on the lower affinity sites is often poor. Nuclear factor E2-related factor 2 (NRF2) is a ubiquitous redox-activated transcription factor having a key protective role against endogenous and exogenous oxidant and electrophile stress. Herein, we decipher the effects of sequence variation on the DNA binding s...

  6. Identification of a New Variable Sequence in the P1 Cytadhesin Gene of Mycoplasma pneumoniae: Evidence for the Generation of Antigenic Variation by DNA Recombination between Repetitive Sequences

    Kenri, Tsuyoshi; Taniguchi, Rie; Sasaki, Yuko; Okazaki, Norio; Narita, Mitsuo; Izumikawa, Kinichi; Umetsu, Masao; Sasaki, Tsuguo

    1999-01-01

    A Mycoplasma pneumoniae cytadhesin P1 gene with novel nucleotide sequence variation has been identified. Four clinical strains of M. pneumoniae were found to carry this type of P1 gene. This new P1 gene is similar to the known group II P1 genes but possesses novel sequence variation of approximately 300 bp in the RepMP2/3 region. The position of the new variable region is distant from the previously reported variable regions known to differ between group I and II P1 genes. Two sequences close...

  7. Oxytocin and vasopressin receptor gene variation as a proximate base for inter- and intraspecific behavioral differences in bonobos and chimpanzees.

    Staes, Nicky; Stevens, Jeroen M G; Helsen, Philippe; Hillyer, Mia; Korody, Marisa; Eens, Marcel

    2014-01-01

    Recent literature has revealed the importance of variation in neuropeptide receptor gene sequences in the regulation of behavioral phenotypic variation. Here we focus on polymorphisms in the oxytocin receptor gene (OXTR) and vasopressin receptor gene 1a (Avpr1a) in chimpanzees and bonobos. In humans, a single nucleotide polymorphism (SNP) in the third intron of OXTR (rs53576 SNP (A/G)) is linked with social behavior, with the risk allele (A) carriers showing reduced levels of empathy and prosociality. Bonobos and chimpanzees differ in these same traits, therefore we hypothesized that these differences might be reflected in variation at the rs53576 position. We sequenced a 320 bp region surrounding rs53576 but found no indications of this SNP in the genus Pan. However, we identified previously unreported SNP variation in the chimpanzee OXTR sequence that differs from both humans and bonobos. Humans and bonobos have previously been shown to have a more similar 5' promoter region of Avpr1a when compared to chimpanzees, who are polymorphic for the deletion of ∼ 360 bp in this region (+/- DupB) which includes a microsatellite (RS3). RS3 has been linked with variation in levels of social bonding, potentially explaining part of the interspecies behavioral differences found in bonobos, chimpanzees and humans. To date, results for bonobos have been based on small sample sizes. Our results confirmed that there is no DupB deletion in bonobos with a sample size comprising approximately 90% of the captive founder population, whereas in chimpanzees the deletion of DupB had the highest frequency. Because of the higher frequency of DupB alleles in our bonobo population, we suggest that the presence of this microsatellite may partly reflect documented differences in levels of sociability found in bonobos and chimpanzees. PMID:25405348

  8. Molecular Evolution and Genetic Variation of G2-Like Transcription Factor Genes in Maize.

    Liu, Fang; Xu, Yunjian; Han, Guomin; Zhou, Lingyan; Ali, Asif; Zhu, Suwen; Li, Xiaoyu

    2016-01-01

    The productivity of maize (Zea mays L.) depends on the development of chloroplasts, and G2-like transcription factors play a central role in regulating chloroplast development. In this study, we identified 59 G2-like genes in the B73 maize genome and systematically analyzed these genes at the molecular and evolutionary levels. Based on gene structure character, motif compositions and phylogenetic analysis, maize G2-like genes (ZmG1- ZmG59) were divided into seven groups (I-VII). By synteny analysis, 18 collinear gene pairs and strongly conserved microsyntny among regions hosting G2-like genes across maize and sorghum were found. Here, we showed that the vast majority of ZmG gene duplications resulted from whole genome duplication events rather than tandem duplications. After gene duplication events, some ZmG genes were silenced. The functions of G2-like genes were multifarious and most genes that are expressed in green tissues may relate to maize photosynthesis. The qRT-PCR showed that the expression of these genes was sensitive to low temperature and drought. Furthermore, we analyzed differences of ZmGs specific to cultivars in temperate and tropical regions at the population level. Interestingly, the single nucleotide polymorphism (SNP) analysis revealed that nucleotide polymorphism associated with different temperature zones. Above all, G2-like genes were highly conserved during evolution, but polymorphism could be caused due to a different geographical location. Moreover, G2-like genes might be related to cold and drought stresses. PMID:27560803

  9. Genetic Variation of the Borrelia burgdorferi Gene vlsE Involves Cassette-Specific, Segmental Gene Conversion

    Zhang, Jing-Ren; Norris, Steven J

    1998-01-01

    The Lyme disease spirochete Borrelia burgdorferi possesses 15 silent vls cassettes and a vls expression site (vlsE) encoding a surface-exposed lipoprotein. Segments of the silent vls cassettes have been shown to recombine with the vlsE cassette region in the mammalian host, resulting in combinatorial antigenic variation. Despite promiscuous recombination within the vlsE cassette region, the 5′ and 3′ coding sequences of vlsE that flank the cassette region are not subject to sequence variation...

  10. Gene Expression Variation Resolves Species and Individual Strains among Coral-Associated Dinoflagellates within the Genus Symbiodinium.

    Parkinson, John E; Baumgarten, Sebastian; Michell, Craig T; Baums, Iliana B; LaJeunesse, Todd C; Voolstra, Christian R

    2016-03-01

    Reef-building corals depend on symbiotic mutualisms with photosynthetic dinoflagellates in the genus Symbiodinium. This large microalgal group comprises many highly divergent lineages ("Clades A-I") and hundreds of undescribed species. Given their ecological importance, efforts have turned to genomic approaches to characterize the functional ecology of Symbiodinium. To date, investigators have only compared gene expression between representatives from separate clades-the equivalent of contrasting genera or families in other dinoflagellate groups-making it impossible to distinguish between clade-level and species-level functional differences. Here, we examined the transcriptomes of four species within one Symbiodinium clade (Clade B) at ∼20,000 orthologous genes, as well as multiple isoclonal cell lines within species (i.e., cultured strains). These species span two major adaptive radiations within Clade B, each encompassing both host-specialized and ecologically cryptic taxa. Species-specific expression differences were consistently enriched for photosynthesis-related genes, likely reflecting selection pressures driving niche diversification. Transcriptional variation among strains involved fatty acid metabolism and biosynthesis pathways. Such differences among individuals are potentially a major source of physiological variation, contributing to the functional diversity of coral holobionts composed of unique host-symbiont genotype pairings. Our findings expand the genomic resources available for this important symbiont group and emphasize the power of comparative transcriptomics as a method for studying speciation processes and interindividual variation in nonmodel organisms. PMID:26868597

  11. Gene expression variation resolves species and individual strains among coral-associated dinoflagellates within the genus Symbiodinium

    Parkinson, John Everett

    2016-02-11

    Reef-building corals depend on symbiotic mutualisms with photosynthetic dinoflagellates in the genus Symbiodinium. This large microalgal group comprises many highly divergent lineages (“Clades A-I”) and hundreds of undescribed species. Given their ecological importance, efforts have turned to genomic approaches to characterize the functional ecology of Symbiodinium. To date, investigators have only compared gene expression between representatives from separate clades—the equivalent of contrasting genera or families in other dinoflagellate groups—making it impossible to distinguish between clade-level and species-level functional differences. Here, we examined the transcriptomes of four species within one Symbiodinium clade (Clade B) at ~20,000 orthologous genes, as well as multiple isoclonal cell lines within species (i.e. cultured strains). These species span two major adaptive radiations within Clade B, each encompassing both host-specialized and ecologically cryptic taxa. Species-specific expression differences were consistently enriched for photosynthesis-related genes, likely reflecting selection pressures driving niche diversification. Transcriptional variation among strains involved fatty acid metabolism and biosynthesis pathways. Such differences among individuals are potentially a major source of physiological variation, contributing to the functional diversity of coral holobionts composed of unique host-symbiont genotype pairings. Our findings expand the genomic resources available for this important symbiont group and emphasize the power of comparative transcriptomics as a method for studying speciation processes and inter-individual variation in non-model organisms.

  12. Differentially expressed genes linked to natural variation in long-term memory formation in Cotesia parasitic wasps

    Joke J. F. A. Van Vugt

    2015-09-01

    Full Text Available Even though learning and memory are universal traits in the Animal Kingdom, closely related species reveal substantial variation in learning rate and memory dynamics. To determine the genetic background of this natural variation, we studied two congeneric parasitic wasp species, Cotesia glomerata and C. rubecula, which lay their eggs in caterpillars of the large and small cabbage white butterfly. A successful egg laying event serves as an unconditioned stimulus in a classical conditioning paradigm, where plant odors become associated to the encounter of a suitable host caterpillar. Depending on the host species, the number of conditioning trials and the parasitic wasp species, three different types of transcription-dependent long-term memory (LTM and one type of transcription-independent, anesthesia-resistant memory (ARM can be distinguished. To identify transcripts underlying these differences in memory formation, we isolated mRNA from parasitic wasp heads at three different time points between induction and consolidation of each of the four memory types, and for each sample three biological replicates, where after strand-specific paired-end 100 bp deep sequencing. Transcriptomes were assembled de novo and differential expression was determined for each memory type and time point after conditioning, compared to unconditioned wasps. Most differentially expressed (DE genes and antisense transcripts were only DE in one of the LTM types. Among the DE genes that were DE in two or more LTM types, were many protein kinases and phosphatases, small GTPases, receptors and ion channels. Some genes were DE in opposing directions between any of the LTM memory types and ARM, suggesting that ARM in Cotesia requires the transcription of genes inhibiting LTM or vice versa. We discuss our findings in the context of neuronal functioning, including RNA splicing and transport, epigenetic regulation, neurotransmitter/peptide synthesis and antisense transcription. In

  13. Global Survey of Variation in a Human Olfactory Receptor Gene Reveals Signatures of Non-Neutral Evolution.

    Hoover, Kara C; Gokcumen, Omer; Qureshy, Zoya; Bruguera, Elise; Savangsuksa, Aulaphan; Cobb, Matthew; Matsunami, Hiroaki

    2015-09-01

    Allelic variation at 4 loci in the human olfactory receptor gene OR7D4 is associated with perceptual variation in the sex steroid-derived odorants, androstenone, and androstadienone. Androstadienone has been linked with chemosensory identification whereas androstenone makes pork from uncastrated pigs distasteful ("boar taint"). In a sample of 2224 individuals from 43 populations, we identified 45 OR7D4 single nucleotide polymorphisms. Coalescent modeling of frequency-site-spectrum-based statistics identified significant deviation from neutrality in human OR7D4; individual populations with statistically significant deviations from neutrality include Gujarati, Beijing Han, Great Britain, Iberia, and Puerto Rico. Analysis of molecular variation values indicated statistically significant population differentiation driven mainly by the 4 alleles associated with androstenone perception variation; however, fixation values were low suggesting that genetic structure may not have played a strong role in creating these group divisions. We also studied OR7D4 in the genomes of extinct members of the human lineage: Altai Neandertal and Denisovan. No variants were identified in Altai but 2 were in Denisova, one of which is shared by modern humans and one of which is novel. A functional test of modern human and a synthesized mutant Denisova OR7D4 indicated no statistically significant difference in responses to androstenone between the 2 species. Our results suggest non-neutral evolution for an olfactory receptor gene. PMID:26072518

  14. académicos consolidados del área educativa

    Juan Carlos Mijangos Noh

    2012-01-01

    Full Text Available A partir de una revisión del concepto de gestión del conocimiento, mediante la cual se establece una concepción acerca del término, examinamos las acciones emprendidas y productos logrados por tres cuerpos académicos consolidados en el área de educación, todos ellos ubicados en universidades públicas mexicanas de provincia y reconocidos por el Programa de Mejoramiento del Profesorado, instituido por la Subsecretaría de Educación Superior de la Secretaría de Educación Pública de México. El análisis de los procesos de los tres cuerpos académicos consolidados se hace examinando las características de la gestión de conocimiento emprendida por los profesores involucrados, en los siguientes aspectos: el marco institucional y normativo en el que se efectuó la gestión, los objetivos, acciones y resultados de dicha gestión, y la trayectoria de cada uno de los cuerpos académicos, en materia de organización, que permitió la catálisis de sus procesos hacia el logro de productos que han sido evaluados y reconocidos como de buena calidad por los pares académicos. Las conclusiones permiten ubicar los patrones seguidos por los tres cuerpos académicos estudiados que, finalmente, podrán emplearse en el reconocimiento de pautas que sirvan a otros cuerpos académicos para catalizar sus procesos hacia la consolidación, mediante la gestión apropiada del conocimiento.

  15. Multi-allelic major effect genes interact with minor effect QTLs to control adaptive color pattern variation in Heliconius erato.

    Riccardo Papa

    Full Text Available Recent studies indicate that relatively few genomic regions are repeatedly involved in the evolution of Heliconius butterfly wing patterns. Although this work demonstrates a number of cases where homologous loci underlie both convergent and divergent wing pattern change among different Heliconius species, it is still unclear exactly how many loci underlie pattern variation across the genus. To address this question for Heliconius erato, we created fifteen independent crosses utilizing the four most distinct color pattern races and analyzed color pattern segregation across a total of 1271 F2 and backcross offspring. Additionally, we used the most variable brood, an F2 cross between H. himera and the east Ecuadorian H. erato notabilis, to perform a quantitative genetic analysis of color pattern variation and produce a detailed map of the loci likely involved in the H. erato color pattern radiation. Using AFLP and gene based markers, we show that fewer major genes than previously envisioned control the color pattern variation in H. erato. We describe for the first time the genetic architecture of H. erato wing color pattern by assessing quantitative variation in addition to traditional linkage mapping. In particular, our data suggest three genomic intervals modulate the bulk of the observed variation in color. Furthermore, we also identify several modifier loci of moderate effect size that contribute to the quantitative wing pattern variation. Our results are consistent with the two-step model for the evolution of mimetic wing patterns in Heliconius and support a growing body of empirical data demonstrating the importance of major effect loci in adaptive change.

  16. Social context-induced song variation affects female behavior and gene expression.

    Sarah C Woolley

    2008-03-01

    Full Text Available Social cues modulate the performance of communicative behaviors in a range of species, including humans, and such changes can make the communication signal more salient. In songbirds, males use song to attract females, and song organization can differ depending on the audience to which a male sings. For example, male zebra finches (Taeniopygia guttata change their songs in subtle ways when singing to a female (directed song compared with when they sing in isolation (undirected song, and some of these changes depend on altered neural activity from a specialized forebrain-basal ganglia circuit, the anterior forebrain pathway (AFP. In particular, variable activity in the AFP during undirected song is thought to actively enable syllable variability, whereas the lower and less-variable AFP firing during directed singing is associated with more stereotyped song. Consequently, directed song has been suggested to reflect a "performance" state, and undirected song a form of vocal motor "exploration." However, this hypothesis predicts that directed-undirected song differences, despite their subtlety, should matter to female zebra finches, which is a question that has not been investigated. We tested female preferences for this natural variation in song in a behavioral approach assay, and we found that both mated and socially naive females could discriminate between directed and undirected song-and strongly preferred directed song. These preferences, which appeared to reflect attention especially to aspects of song variability controlled by the AFP, were enhanced by experience, as they were strongest for mated females responding to their mate's directed songs. We then measured neural activity using expression of the immediate early gene product ZENK, and found that social context and song familiarity differentially modulated the number of ZENK-expressing cells in telencephalic auditory areas. Specifically, the number of ZENK-expressing cells in the

  17. Lateralidad, procesos perceptivos y rendimiento académico.

    Mera-Tapia, Guadalupe

    2013-01-01

    Es frecuente que factores neuropsicológicos alterados sean responsables en casos de alumnos con bajo rendimiento académico que fracasan en nuestro sistema educativo. En este trabajo se estudia si existen diferencias, entre alumnos con alto y bajo rendimiento académico en relación con los procesos perceptivos y la lateralidad. Se evalúan los procesos perceptivos (visión, y audición) y la lateralidad en dos muestras de 30 alumnos cada una, de alto y bajo rendimento respectivamente. Los alumnos ...

  18. Spin-offs académicas em Portugal

    Valente, Fernando Manuel

    2015-01-01

    Doutoramento em Gestão A literatura de empreendedorismo académico tem abordado uma grande diversidade de temas, nomeadamente: (i) estudos sobre o papel dos governos em processos de spin-off incluindo formas de apoiar a sua criação e desenvolvimento como mecanismo para transferir conhecimento para o mercado; (ii) estudos sobre o papel das universidades no processo de transferência de conhecimento, tais como as formas de incentivar a criação e desenvolvimento de novas empresas pelos académic...

  19. Autoeficacia, ansiedad y rendimiento académico en adolescentes

    Francoise Contreras; Juan Carlos Espinosa; Gustavo Esguerra; Andrea Haikal; Alejandra Polanía; Adriana Rodríguez

    2005-01-01

    Este estudio tuvo como propósito determinar si las variables psicológicas percepción de autoeficacia y ansiedad guardan relación con el rendimiento académico en un grupo de 120 estudiantes de secundaria de un colegio privado de Bogotá. Para ello, se aplicó la Escala de Autoeficacia Generalizada [EAG] y el Cuestionario de Ansiedad Estado - Rasgo [STAI]. Los resultados evidenciaron que la autoeficacia está asociada directamente con el rendimiento académico general, mi...

  20. No Association between Variation in Longevity Candidate Genes and Aging-related Phenotypes in Oldest-old Danes.

    Soerensen, Mette; Nygaard, Marianne; Debrabant, Birgit; Mengel-From, Jonas; Dato, Serena; Thinggaard, Mikael; Christensen, Kaare; Christiansen, Lene

    2016-06-01

    In this study we explored the association between aging-related phenotypes previously reported to predict survival in old age and variation in 77 genes from the DNA repair pathway, 32 genes from the growth hormone 1/ insulin-like growth factor 1/insulin (GH/IGF-1/INS) signalling pathway and 16 additional genes repeatedly considered as candidates for human longevity: APOE, APOA4, APOC3, ACE, CETP, HFE, IL6, IL6R, MTHFR, TGFB1, SIRTs 1, 3, 6; and HSPAs 1A, 1L, 14. Altogether, 1,049 single nucleotide polymorphisms (SNPs) were genotyped in 1,088 oldest-old (age 92-93 years) Danes and analysed with phenotype data on physical functioning (hand grip strength), cognitive functioning (mini mental state examination and a cognitive composite score), activity of daily living and self-rated health. Five SNPs showed association to one of the phenotypes; however, none of these SNPs were associated with a change in the relevant phenotype over time (7 years of follow-up) and none of the SNPs could be confirmed in a replication sample of 1,281 oldest-old Danes (age 94-100). Hence, our study does not support association between common variation in the investigated longevity candidate genes and aging-related phenotypes consistently shown to predict survival. It is possible that larger sample sizes are needed to robustly reveal associations with small effect sizes. PMID:26946122

  1. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    Abildgaard, L; Engberg, RM; Pedersen, Karl;

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio...... different a-toxin sequence types among the 60 strains. Moreover, a type II intron of 834 non-coding nucleotides was identified in the pic gene of three of the investigated strains. The in vitro alpha-toxin production investigated in 45 of the strains, including the three harbouring the intron, revealed no...... correlation between PFGE type, alpha-toxin sequence type, health status of the host chickens and level of a-toxin production. It is therefore concluded that neither pic gene type nor alpha-toxin production level seems to correlate to origin (healthy or diseased chicken) of the C perfringens strains. (C) 2008...

  2. Allelic variation in human mitochondrial genes based on patterns of restriction site polymorphism.

    Whittam, T S; Clark, A. G.; Stoneking, M; Cann, R. L.; Wilson, A. C.

    1986-01-01

    Restriction maps of 145 human mtDNAs representing samples from five geographic regions were used to construct multilocus genotypes for 28 genetic loci of the mitochondrial genome. Alleles were defined as distinct combinations of the presence or absence of polymorphic restriction sites within each locus. The 28 loci included 13 genes encoding proteins, 10 genes specifying tRNAs, 2 genes specifying rRNAs, and 3 noncoding regions consisting of the D loop, the light strand origin of replication, ...

  3. Genetic Variation in Cell Death Genes and Risk of Non-Hodgkin Lymphoma

    Johanna M. Schuetz; Denise Daley; Jinko Graham; Berry, Brian R.; Gallagher, Richard P.; Connors, Joseph M; Gascoyne, Randy D.; Spinelli, John J.; Angela R Brooks-Wilson

    2012-01-01

    BACKGROUND: Non-Hodgkin lymphomas are a heterogeneous group of solid tumours that constitute the 5(th) highest cause of cancer mortality in the United States and Canada. Poor control of cell death in lymphocytes can lead to autoimmune disease or cancer, making genes involved in programmed cell death of lymphocytes logical candidate genes for lymphoma susceptibility. MATERIALS AND METHODS: We tested for genetic association with NHL and NHL subtypes, of SNPs in lymphocyte cell death genes using...

  4. Estimating variation within the genes and inferring the phylogeny of 186 sequenced diverse Escherichia coli genomes

    Kaas, Rolf Sommer; Rundsten, Carsten Friis; Ussery, David;

    2012-01-01

    creating better phylogenies, for determination of molecular clocks and for improved typing techniques. Results We find 3,051 gene clusters/families present in at least 95% of the genomes and 1,702 gene clusters present in 100% of the genomes. The former 'soft core' of about 3,000 gene families is perhaps...... 186 sequenced E. coli genomes. The core-gene tree displays high confidence and divides the E. coli strains into the observed MLST type clades and also separates defined phylotypes. Conclusion The results of comparing a large and diverse E. coli dataset support the theory that reliable and good...

  5. Balancing selection at the tomato RCR3 Guardee gene family maintains variation in strength of pathogen defense.

    Anja C Hörger

    Full Text Available Coevolution between hosts and pathogens is thought to occur between interacting molecules of both species. This results in the maintenance of genetic diversity at pathogen antigens (or so-called effectors and host resistance genes such as the major histocompatibility complex (MHC in mammals or resistance (R genes in plants. In plant-pathogen interactions, the current paradigm posits that a specific defense response is activated upon recognition of pathogen effectors via interaction with their corresponding R proteins. According to the "Guard-Hypothesis," R proteins (the "guards" can sense modification of target molecules in the host (the "guardees" by pathogen effectors and subsequently trigger the defense response. Multiple studies have reported high genetic diversity at R genes maintained by balancing selection. In contrast, little is known about the evolutionary mechanisms shaping the guardee, which may be subject to contrasting evolutionary forces. Here we show that the evolution of the guardee RCR3 is characterized by gene duplication, frequent gene conversion, and balancing selection in the wild tomato species Solanum peruvianum. Investigating the functional characteristics of 54 natural variants through in vitro and in planta assays, we detected differences in recognition of the pathogen effector through interaction with the guardee, as well as substantial variation in the strength of the defense response. This variation is maintained by balancing selection at each copy of the RCR3 gene. Our analyses pinpoint three amino acid polymorphisms with key functional consequences for the coevolution between the guardee (RCR3 and its guard (Cf-2. We conclude that, in addition to coevolution at the "guardee-effector" interface for pathogen recognition, natural selection acts on the "guard-guardee" interface. Guardee evolution may be governed by a counterbalance between improved activation in the presence and prevention of auto-immune responses in

  6. The effect of genetic variation in the type 1 deiodinase gene on the inter-individual variation in serum thyroid hormone levels. An investigation in healthy Danish twins

    van der Deure, Wendy M; Hansen, Pia Skov; Peeters, Robin P; Uitterlinden, André G; Fenger, Mogens; Kyvik, Kirsten Ohm; Hegedüs, Laszlo; Visser, Theo J

    2008-01-01

    -785T allele had 3.8% higher FT4 and 14.3 % higher rT3 levels, resulting in a lower T3/T4 and T3/rT3 ratio and a higher rT3/T4 ratio. This polymorphism explained 0.87% and 1.79%, respectively, of the variation in serum FT4 and rT3. The D1-A1814G polymorphism was not associated with serum thyroid hormone......Introduction: Genetic factors have a considerable influence on serum thyroid hormone levels. The C785T and A1814G polymorphisms, located in the 3' untranslated region of the type 1 deiodinase (D1) gene have been associated with serum FT4 and rT3 levels. Objective: In healthy Danish twins, we...

  7. The effect of genetic variation in the type 1 deiodinase gene on the inter-individual variation in serum thyroid hormone levels. An investigation in healthy Danish twins

    van der Deure, Wendy M; Hansen, Pia Skov; Peeters, Robin P; Uitterlinden, André G; Fenger, Mogens; Kyvik, Kirsten Ohm; Hegedüs, Laszlo; Visser, Theo J

    2009-01-01

    -785T allele had 3.8% higher FT4 and 14.3 % higher rT3 levels, resulting in a lower T3/T4 and T3/rT3 ratio and a higher rT3/T4 ratio. This polymorphism explained 0.87% and 1.79%, respectively, of the variation in serum FT4 and rT3. The D1-A1814G polymorphism was not associated with serum thyroid hormone......Introduction: Genetic factors have a considerable influence on serum thyroid hormone levels. The C785T and A1814G polymorphisms, located in the 3' untranslated region of the type 1 deiodinase (D1) gene have been associated with serum FT4 and rT3 levels. Objective: In healthy Danish twins, we...

  8. Association between genetic variation in the oxytocin receptor gene and emotional withdrawal, but not between oxytocin pathway genes and diagnosis in psychotic disorders.

    Marit eHaram

    2015-01-01

    Full Text Available Social dysfunction is common in patients with psychotic disorders. Oxytocin is a neuropeptide with a central role in social behaviour. This study aims to explore the relationship between oxytocin pathway genes and symptoms related to social dysfunction in patients with psychotic disorders. We performed association analyses between four oxytocin pathway genes (OXT, OXTR, AVP, CD38 and four areas of social behaviour-related psychopathology as measured by Positive and Negative Syndrome Scale (PANSS. For this purpose, we used both a polygenic risk score (PGRS and single OXTR candidate SNPs previously reported in the literature (rs53576, rs237902, rs2254298. A total of 734 subjects with DSM-IV psychotic spectrum disorders and 420 healthy controls were included. Oxytocin pathway PGRSs were calculated based on the independent Psychiatric Genomics Consortium study sample. There was a significant association between symptom of Emotional Withdrawal and the previously reported OXTR risk allele A in rs53576. No significant associations between oxytocin pathway gene variants and a diagnosis of psychotic disorder were found. Our findings indicate that while oxytocin pathway genes do not appear to contribute to the susceptibility to psychotic disorders, variations in the OXTR gene might play a role in the development of impaired social behaviour.

  9. Variation in the Williams syndrome GTF2I gene and anxiety proneness interactively affect prefrontal cortical response to aversive stimuli.

    Jabbi, M; Chen, Q; Turner, N; Kohn, P; White, M; Kippenhan, J S; Dickinson, D; Kolachana, B; Mattay, V; Weinberger, D R; Berman, K F

    2015-01-01

    Characterizing the molecular mechanisms underlying the heritability of complex behavioral traits such as human anxiety remains a challenging endeavor for behavioral neuroscience. Copy-number variation (CNV) in the general transcription factor gene, GTF2I, located in the 7q11.23 chromosomal region that is hemideleted in Williams syndrome and duplicated in the 7q11.23 duplication syndrome (Dup7), is associated with gene-dose-dependent anxiety in mouse models and in both Williams syndrome and Dup7. Because of this recent preclinical and clinical identification of a genetic influence on anxiety, we examined whether sequence variation in GTF2I, specifically the single-nucleotide polymorphism rs2527367, interacts with trait and state anxiety to collectively impact neural response to anxiety-laden social stimuli. Two hundred and sixty healthy adults completed the Tridimensional Personality Questionnaire Harm Avoidance (HA) subscale, a trait measure of anxiety proneness, and underwent functional magnetic resonance imaging (fMRI) while matching aversive (fearful or angry) facial identity. We found an interaction between GTF2I allelic variations and HA that affects brain response: in individuals homozygous for the major allele, there was no correlation between HA and whole-brain response to aversive cues, whereas in heterozygotes and individuals homozygous for the minor allele, there was a positive correlation between HA sub-scores and a selective dorsolateral prefrontal cortex (DLPFC) responsivity during the processing of aversive stimuli. These results demonstrate that sequence variation in the GTF2I gene influences the relationship between trait anxiety and brain response to aversive social cues in healthy individuals, supporting a role for this neurogenetic mechanism in anxiety. PMID:26285132

  10. Conserved variation: identifying patterns of stability and variability in BCR and TCR V genes with different diversity and richness metrics

    The immune system can detect most invading pathogens. The potential for detection of pathogens is dependent on the somatic diversity of the immune repertoires. While it is known that this somatic diversity is carefully generated, it is unclear how the diversity is distributed in the different genes encoding receptors of immune cells. Utilizing different metrics for richness and diversity at the level of small sequence fragments, we present here an analysis of the entire known human germline repertoire as represented by the sequences from the ImMunoGeneTics database of immune receptors. We have developed a fragment sequence quantification analysis to track variation of repertoires with different degrees of precision. Somatic diversity has previously been functionally characterized mostly by division of the V gene sequences into the more conserved and invariant framework (FR) of the receptor and more varied complementarity determining regions (CDR), that interact with the antigen. We find that CDR and FR can be explicitly identified with our sequence fragment diversity quantification technique. In terms of diversity, CDR and FR are especially distinct in B cell V genes. T cell V genes show less of the CDR/FR periodicity but are more diverse overall. Our analysis further shows that there are other areas of diversity outside the CDR and FR that are found widely dispersed in T cell receptor V genes and more tightly focused in FR1 and FR3 in the B cell receptor V genes. The diversity we observe is not dependent on allelic differences nor is this diversity segregated by individual V gene families. We would thus expect that each individual exhibit a diversity equivalent to that of the entire potential repertoire. (paper)

  11. Looking at the origin of phenotypic variation from pattern formation gene networks

    Isaac Salazar-Ciudad

    2009-10-01

    This article critically reviews some widespread views about the overall functioning of development. Special attention is devoted to views in developmental genetics about the superstructure of developmental gene networks. According to these views gene networks are hierarchic and multilayered. The highest layers partition the embryo in large coarse areas and control downstream genes that subsequently subdivide the embryo into smaller and smaller areas. These views are criticized on the bases of developmental and evolutionary arguments. First, these views, although detailed at the level of gene identities, do not incorporate morphogenetic mechanisms nor do they try to explain how morphology changes during development. Often, they assume that morphogenetic mechanisms are subordinate to cell signaling events. This is in contradiction to the evidence reviewed herein. Experimental evidence on pattern formation also contradicts the view that developmental gene networks are hierarchically multilayered and that their functioning is decodable from promoter analysis. Simple evolutionary arguments suggest that, indeed, developmental gene networks tend to be non-hierarchic. Re-use leads to extensive modularity in gene networks while developmental drift blurs this modularity. Evolutionary opportunism makes developmental gene networks very dependent on epigenetic factors.

  12. Natural Genetic Variation in Cassava (Manihot esculenta Crantz) Landraces: A Tool for Gene Discovery

    Cassava landraces are the earliest form of the modern cultivars and represent the first step in cassava domestication. Our forward genetic analysis uses this resource to discover spontaneous mutations in the sucrose/ starch and carotenoid synthesis/accumulation and to develop both an evolutionary and breeding perspective of gene function related to those traits. Biochemical phenotype variants for the synthesis and accumulation of carotenoid, free sugar and starch were identified. Six subtractive cDNA libraries were prepared to construct a high quality (phred > 20) EST database with 1,645 entries. Macroarray and micro-array analysis was performed to identify differentially expressed genes aiming to identify candidate genes related to sugary phenotype and carotenoid diversity. cDNA sequence for gene coding for specific enzymes in the two pathways was obtained. Gene expression analysis for coding specific enzymes was performed by RNA blot and Real Time PCR analysis. Chromoplast-associated proteins of yellow storage root were fractionated and a peptide sequence database with 906 entries sequences (MASCOT validated) was constructed. For the sucrose/starch, metabolism a sugary class of cassava was identified, carrying a mutation in the BEI and GBSS genes. For the pigmented cassava, a pink color phenotype showed absence of expression of the gene CasLYB, while an intense yellow phenotype showed a down regulation of the gene CasHYb. Heat shock proteins were identified as the major proteins associated with carotenoid. Genetic diversity for the GBSS gene in the natural population identified 22 haplotypes and a large nucleotide diversity in four subsets of population. Single segregating population derived from F2, half-sibling and S1 population showed segregation for sugary phenotype (93% of individuals), waxy phenotype (38% of individuals) and glycogen like starch (2% of individuals). Here we summarize our current results for the genetic analysis of these variants and recent

  13. Copy number variation analysis implicates the cell polarity gene glypican 5 as a human spina bifida candidate gene

    Bassuk, Alexander G.; Muthuswamy, Lakshmi B.; Boland, Riley; Smith, Tiffany L.; Hulstrand, Alissa M.; Northrup, Hope; Hakeman, Matthew; Dierdorff, Jason M.; Yung, Christina K.; Long, Abby; Brouillette, Rachel B.; Au, Kit Sing; Gurnett, Christina; Houston, Douglas W.; Cornell, Robert A

    2012-01-01

    Neural tube defects (NTDs) are common birth defects of complex etiology. Family and population-based studies have confirmed a genetic component to NTDs. However, despite more than three decades of research, the genes involved in human NTDs remain largely unknown. We tested the hypothesis that rare copy number variants (CNVs), especially de novo germline CNVs, are a significant risk factor for NTDs. We used array-based comparative genomic hybridization (aCGH) to identify rare CNVs in 128 Cauca...

  14. Genome-wide copy number variation study associates metabotropic glutamate receptor gene networks with attention deficit hyperactivity disorder

    Elia, Josephine; Glessner, Joseph T; Wang, Kai; Takahashi, Nagahide; Shtir, Corina J; Hadley, Dexter; Sleiman, Patrick M A; Zhang, Haitao; Kim, Cecilia E; Robison, Reid; Lyon, Gholson J; Flory, James H; Bradfield, Jonathan P; Imielinski, Marcin; Hou, Cuiping; Frackelton, Edward C; Chiavacci, Rosetta M; Sakurai, Takeshi; Rabin, Cara; Middleton, Frank A; Thomas, Kelly A; Garris, Maria; Mentch, Frank; Freitag, Christine M; Steinhausen, Hans-Christoph; Todorov, Alexandre A; Reif, Andreas; Rothenberger, Aribert; Franke, Barbara; Mick, Eric O; Roeyers, Herbert; Buitelaar, Jan; Lesch, Klaus-Peter; Banaschewski, Tobias; Ebstein, Richard P; Mulas, Fernando; Oades, Robert D; Sergeant, Joseph; Sonuga-Barke, Edmund; Renner, Tobias J; Romanos, Marcel; Romanos, Jasmin; Warnke, Andreas; Walitza, Susanne; Meyer, Jobst; Pálmason, Haukur; Seitz, Christiane; Loo, Sandra K; Smalley, Susan L; Biederman, Joseph; Kent, Lindsey; Asherson, Philip; Anney, Richard J L; Gaynor, J William; Shaw, Philip; Devoto, Marcella; White, Peter S; Grant, Struan F A; Buxbaum, Joseph D; Rapoport, Judith L; Williams, Nigel M; Nelson, Stanley F; Faraone, Stephen V; Hakonarson, Hakon

    2014-01-01

    Attention deficit hyperactivity disorder (ADHD) is a common, heritable neuropsychiatric disorder of unknown etiology. We performed a whole-genome copy number variation (CNV) study on 1,013 cases with ADHD and 4,105 healthy children of European ancestry using 550,000 SNPs. We evaluated statistically significant findings in multiple independent cohorts, with a total of 2,493 cases with ADHD and 9,222 controls of European ancestry, using matched platforms. CNVs affecting metabotropic glutamate receptor genes were enriched across all cohorts (P = 2.1 × 10−9). We saw GRM5 (encoding glutamate receptor, metabotropic 5) deletions in ten cases and one control (P = 1.36 × 10−6). We saw GRM7 deletions in six cases, and we saw GRM8 deletions in eight cases and no controls. GRM1 was duplicated in eight cases. We experimentally validated the observed variants using quantitative RT-PCR. A gene network analysis showed that genes interacting with the genes in the GRM family are enriched for CNVs in ~10% of the cases (P = 4.38 × 10−10) after correction for occurrence in the controls. We identified rare recurrent CNVs affecting glutamatergic neurotransmission genes that were overrepresented in multiple ADHD cohorts. PMID:22138692

  15. Natural genetic variation in cassava (Manihot esculenta Crantz) landraces as a tool for gene discovery

    Cassava landraces are the earliest form of the modern cultivars and represents the first step in cassava domestication. Our forward genetic analysis uses this resource to discover spontaneous mutations in the sucrose/starch and carotenoid synthesis/accumulation and to develop both evolutionary and breeding perspective of gene function related to those traits. Biochemical phenotype variants for the synthesis and accumulation of carotenoid, free sugar and starch were identified. Six subtractive cDNA libraries were prepared to construct a high quality (phred > 20) EST database with 1645 entries. Macroarray analysis was performed to identify differentially expressed gene aiming to identify candidate gene related to sugary phenotype. cDNA sequence for gene coding for specific enzymes in the two pathways were obtained. Gene expression analysis for coding specific enzymes was performed by RNA blot and Real Time PCR analysis. Chromoplastassociated proteins of yellow storage root were fractionated and a peptide sequence data base with 906 entries sequences (MASCOT validated) was constructed. For the sucrose/starch metabolism a sugary class of cassava was identified carrying mutation in the BEI and GBSS mutation. For the pigmented cassava a pink color phenotype showed absence of expression of the gene CasLYB while an intense yellow phenotype showed a down regulation of the gene CasHYb. Heat shock proteins were identified as the major proteins associated with chromoplast. Genetic diversity for the GBSS gene in the natural population identified 22 haplotype and a large nucleotide diversity in four subset of population. Single segregating population derived from F2, half sib and S1 population showed segregation for sugary phenotype (93% of the individuals), waxy phenotype (38% of the individuals) and glycogen like starch (2% of the individuals). Here we summarize our current results for the genetic analysis of this variants and recent progress in the direction of mapping of

  16. [Nucleotide variation in the mitochondrial DNA cytochrome oxidase 1 gene in the Siberian sucker (Catostomus catostomus rostratus) from Kolyma River].

    Bachevskaja, L T; Pereverzeva, V V; Ivanova, G D; Agapova, G A

    2014-10-01

    This study presents the data of the first molecular genetic analysis of the Siberian sucker from Kolyma River. Polymorphism of the mtDNA cytochrome oxidase 1 gene was established. Comparative sequence analysis of the gene examined and the GenBank variants characterizing suckers from the rivers of Canada enabled the suggestion that the sucker penetrated to Asia from North America approximately at the end of Early and the beginning of the Middle Pleistocene. It was demonstrated that intrapopulation genetic variation in the Siberian sucker accounted for 11.63% of total variation, while the proportion of the intergroup, component (Fst) constituted 88.37%. It seems likely that a considerable proportion of intergroup variation was caused by the long period of isolation of the Siberian sucker in Kolyma River. The prevalence of one common haplotype, CH-COI 1, in the sample examined indicates that the founder effect played an importaht role in the history of the formation of the Kolyma population. PMID:25720253

  17. Genetic variation in the tryptophan hydroxylase 2 gene moderates depressive symptom trajectories and remission over 8 weeks of escitalopram treatment.

    Su, Yun-Ai; Li, Ji-Tao; Dai, Wen-Ji; Liao, Xue-Mei; Dong, Li-Cai; Lu, Tian-Lan; Bousman, Chad; Si, Tian-Mei

    2016-05-01

    The serotonin system plays an important role in the pathogenesis of major depressive disorder (MDD) and genetic variations in serotonin-related genes affect the efficacy of antidepressants. The aim of this study was to investigate the relationship between genotypic variation in six candidate serotonergic genes (ADCY9, HTR1B, GNB3, HTR2A, TPH2, SLC6A4) and depressive and anxiety symptom severity trajectories as well as remission following escitalopram treatment. A total of 166 Chinese patients with MDD were treated with escitalopram (open-label) for 8 weeks. TPH2 rs4570625 GG carriers were more likely to achieve depressive and anxiety symptom remission compared with T-allele carriers. At the trend level (Pcorrected=0.05), depressive symptom severity trajectories were moderated by TPH2 rs4570625. Patients with the GT or the GG genotype showed more favorable depressive symptom severity trajectories compared with TT genotype carriers. Polymorphisms in ADCY9, HTR1B, and HTR2A were nominally associated with symptom remission, but did not withstand correction for multiple comparisons. The HTTLPR polymorphism was not included in our final analysis because of a high percentage of missing data. These results suggested that genotypic variation in TPH2 may moderate the therapeutic response to esciatlopram among Chinese patients with MDD. PMID:26745768

  18. Genetic variation in the oxytocin receptor gene is associated with a social phenotype in autism spectrum disorders.

    Harrison, Ashley J; Gamsiz, Ece D; Berkowitz, Isaac C; Nagpal, Shailender; Jerskey, Beth A

    2015-12-01

    Oxytocin regulates social behavior in animal models. Research supports an association between genetic variation in the oxytocin receptor gene (OXTR) and autism spectrum disorders (ASD). In this study, we examine the association between the OXTR gene and a specific social phenotype within ASD. This genotype-phenotype investigation may provide insight into how OXTR conveys risk for social impairment. The current study investigated 10 SNPS in the OXTR gene that have been previously shown to be associated with ASD. We examine the association of these SNPs with both a social phenotype and a repetitive behavior phenotype comprised of behaviors commonly impaired in ASD in the Simons simplex collection (SSC). Using a large sample to examine the association between OXTR and ASD (n = range: 485-1002), we find evidence to support a relation between two OXTR SNPs and the examined social phenotype among children diagnosed with ASD. Greater impairment on the social responsiveness scale standardized total score and on several subdomains was observed among individuals with one or more copies of the minor frequency allele in both rs7632287 and rs237884. Linkage disequilibrium (LD) mapping suggests that these two SNPs are in LD within and overlapping the 3' untranslated region (3'-UTR) of the OXTR gene. These two SNPs were also associated with greater impairment on the repetitive behavior scale. Results of this study indicate that social impairment and repetitive behaviors in ASD are associated with genomic variation in the 3'UTR of the OXTR gene. These variants may be linked to an allele that alters stability of the mRNA message although further work is necessary to test this hypothesis. PMID:26365303

  19. SLC26A4 gene copy number variations in Chinese patients with non-syndromic enlarged vestibular aqueduct

    Zhao Jiandong

    2012-05-01

    Full Text Available Abstract Background Many patients with enlarged vestibular aqueduct (EVA have either only one allelic mutant of the SLC26A4 gene or lack any detectable mutation. In this study, multiplex ligation-dependent probe amplification (MLPA was used to screen for copy number variations (CNVs of SLC26A4 and to reveal the pathogenic mechanisms of non-syndromic EVA (NSEVA. Methods Between January 2003 and March 2010, 923 Chinese patients (481 males, 442 females with NSEVA were recruited. Among these, 68 patients (7.4% were found to carry only one mutant allele of SLC26A4 and 39 patients (4.2% lacked any detectable mutation in SLC26A4; these 107 patients without double mutant alleles were assigned to the patient group. Possible copy number variations in SLC26A4 were detected by SALSA MLPA. Results Using GeneMapper, no significant difference was observed between the groups, as compared with the standard probe provided in the assay. The results of the capillary electrophoresis showed no significant difference between the patients and controls. Conclusion Our results suggest that CNVs and the exon deletion in SLC26A4 are not important factors in NSEVA. However, it would be premature to conclude that CNVs have no role in EVA. Genome-wide studies to explore CNVs within non-coding regions of the SLC26A4 gene and neighboring regions are warranted, to elucidate their roles in NSEVA etiology.

  20. Fad7 gene identification and fatty acids phenotypic variation in an olive collection by EcoTILLING and sequencing approaches.

    Sabetta, Wilma; Blanco, Antonio; Zelasco, Samanta; Lombardo, Luca; Perri, Enzo; Mangini, Giacomo; Montemurro, Cinzia

    2013-08-01

    The ω-3 fatty acid desaturases (FADs) are enzymes responsible for catalyzing the conversion of linoleic acid to α-linolenic acid localized in the plastid or in the endoplasmic reticulum. In this research we report the genotypic and phenotypic variation of Italian Olea europaea L. germoplasm for the fatty acid composition. The phenotypic oil characterization was followed by the molecular analysis of the plastidial-type ω-3 FAD gene (fad7) (EC 1.14.19), whose full-length sequence has been here identified in cultivar Leccino. The gene consisted of 2635 bp with 8 exons and 5'- and 3'-UTRs of 336 and 282 bp respectively, and showed a high level of heterozygousity (1/110 bp). The natural allelic variation was investigated both by a LiCOR EcoTILLING assay and the PCR product direct sequencing. Only three haplotypes were identified among the 96 analysed cultivars, highlighting the strong degree of conservation of this gene. PMID:23685785

  1. Bardet-Biedl syndrome in Denmark-report of 13 novel sequence variations in six genes

    Hjortshøj, Tina Duelund; Grønskov, Karen; Philp, Alisdair R; Nishimura, Darryl Y; Riise, Ruth; Sheffield, Val C; Rosenberg, Thomas; Brøndum-Nielsen, Karen

    2010-01-01

    Bardet-Biedl syndrome (BBS) is an autosomal recessive disease characterized by retinal dystrophy, polydactyly, obesity, learning disabilities, renal involvement, and male hypogenitalism. BBS is genetically heterogeneous with mutations of 14 genes, accounting for approximately 70% of cases...

  2. INSR gene variation is associated with decreased insulin sensitivity in Iraqi women with PCOs

    Manal T. Mutib; Farqad B. Hamdan; Anam R. Al-Salihi

    2014-01-01

    Background: Polycystic ovarian syndrome (PCOS) is a complex, heterogeneous disorder of uncertain etiology with strong genetic background. Insulin resistance is present in the majority of PCOS cases with linkage and association between single nucleotide polymorphisms of insulin receptor (INSR) gene and PCOS. Objective: To examine whether the exon 17 of INSR gene contributes to genetic susceptibility to PCOS in Iraqi women and its effects on glucose tolerance test and lipid profile. Mater...

  3. Clinal Variation at Phenology-Related Genes in Spruce: Parallel Evolution in FTL2 and Gigantea?

    Chen, Jun; Tsuda, Yoshiaki; Stocks, Michael; Källman, Thomas; Xu, Nannan; Kärkkäinen, Katri; Huotari, Tea; Semerikov, Vladimir L.; Vendramin, Giovanni G.; Lascoux, Martin

    2014-01-01

    Parallel clines in different species, or in different geographical regions of the same species, are an important source of information on the genetic basis of local adaptation. We recently detected latitudinal clines in SNPs frequencies and gene expression of candidate genes for growth cessation in Scandinavian populations of Norway spruce (Picea abies). Here we test whether the same clines are also present in Siberian spruce (P. obovata), a close relative of Norway spruce with a different Qu...

  4. Genetic Variation in FADS Genes and Plasma Cholesterol Levels in 2-Year-Old Infants

    Moltó-Puigmartí, Carolina; Jansen, Eugène; Heinrich, Joachim; Standl, Marie; Ronald P. Mensink; Plat, Jogchum; Penders, John; Mommers, Monique; Koppelman, Gerard H.; Postma, Dirkje S.; Thijs, Carel

    2013-01-01

    Single nucleotide polymorphisms (SNPs) in genes involved in fatty acid metabolism (FADS1 FADS2 gene cluster) are associated with plasma lipid levels. We aimed to investigate whether these associations are already present early in life and compare the relative contribution of FADS SNPs vs traditional (non-genetic) factors as determinants of plasma lipid levels. Information on infants' plasma total cholesterol levels, genotypes of five FADS SNPs (rs174545, rs174546, rs174556, rs174561, and rs38...

  5. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  6. Expression profiles of sugarcane under drought conditions: Variation in gene regulation

    Júlio César Farias de Andrade

    2015-01-01

    Full Text Available AbstractDrought is a major factor in decreased sugarcane productivity because of the resulting morphophysiological effects that it causes. Gene expression studies that have examined the influence of water stress in sugarcane have yielded divergent results, indicating the absence of a fixed pattern of changes in gene expression. In this work, we investigated the expression profiles of 12 genes in the leaves of a drought-tolerant genotype (RB72910 of sugarcane and compared the results with those of other studies. The genotype was subjected to 80–100% water availability (control condition and 0–20% water availability (simulated drought. To analyze the physiological status, the SPAD index, Fv/Fm ratio, net photosynthesis (A, stomatal conductance (gs and stomatal transpiration (E were measured. Total RNA was extracted from leaves and the expression of SAMDC, ZmPIP2-1 protein, ZmTIP4-2 protein, WIP protein, LTP protein, histone H3, DNAj, ferredoxin I, β-tubulin, photosystem I, gene 1 and gene 2 was analyzed by quantitative real-time PCR (RT-PCR. Important differences in the expression profiles of these genes were observed when compared with other genotypes, suggesting that complex defense mechanisms are activated in response to water stress. However, there was no recognizable pattern for the changes in expression of the different proteins associated with tolerance to drought stress.

  7. Simple sequence repeat variations expedite phage divergence: Mechanisms of indels and gene mutations.

    Lin, Tiao-Yin

    2016-07-01

    Phages are the most abundant biological entities and influence prokaryotic communities on Earth. Comparing closely related genomes sheds light on molecular events shaping phage evolution. Simple sequence repeat (SSR) variations impart over half of the genomic changes between T7M and T3, indicating an important role of SSRs in accelerating phage genetic divergence. Differences in coding and noncoding regions of phages infecting different hosts, coliphages T7M and T3, Yersinia phage ϕYeO3-12, and Salmonella phage ϕSG-JL2, frequently arise from SSR variations. Such variations modify noncoding and coding regions; the latter efficiently changes multiple amino acids, thereby hastening protein evolution. Four classes of events are found to drive SSR variations: insertion/deletion of SSR units, expansion/contraction of SSRs without alteration of genome length, changes of repeat motifs, and generation/loss of repeats. The categorization demonstrates the ways SSRs mutate in genomes during phage evolution. Indels are common constituents of genome variations and human diseases, yet, how they occur without preexisting repeat sequence is less understood. Non-repeat-unit-based misalignment-elongation (NRUBME) is proposed to be one mechanism for indels without adjacent repeats. NRUBME or consecutive NRUBME may also change repeat motifs or generate new repeats. NRUBME invoking a non-Watson-Crick base pair explains insertions that initiate mononucleotide repeats. Furthermore, NRUBME successfully interprets many inexplicable human di- to tetranucleotide repeat generations. This study provides the first evidence of SSR variations expediting phage divergence, and enables insights into the events and mechanisms of genome evolution. NRUBME allows us to emulate natural evolution to design indels for various applications. PMID:27133219

  8. Phase variation of a Type IIG restriction-modification enzyme alters site-specific methylation patterns and gene expression in Campylobacter jejuni strain NCTC11168

    Anjum, Awais; Kelly, Brathwaite; Aidley, Jack B; Connerton, Phillippa L.; Cummings, Nicola J; Parkhill, Julian; Ian F Connerton; Bayliss, Christopher D

    2016-01-01

    Phase-variable restriction-modification systems are a feature of a diverse range of bacterial species. Stochastic, reversible switches in expression of the methyltransferase produces variation in methylation of specific sequences. Phase-variable methylation by both Type I and Type III methyltransferases is associated with altered gene expression and phenotypic variation. One phase-variable gene of Campylobacter jejuni encodes a homologue of an unusual Type IIG restriction-modification system ...

  9. A Multiple Interaction Analysis Reveals ADRB3 as a Potential Candidate for Gallbladder Cancer Predisposition via a Complex Interaction with Other Candidate Gene Variations

    Rajani Rai; Jong Joo Kim; Sanjeev Misra; Ashok Kumar; Balraj Mittal

    2015-01-01

    Gallbladder cancer is the most common and a highly aggressive biliary tract malignancy with a dismal outcome. The pathogenesis of the disease is multifactorial, comprising the combined effect of multiple genetic variations of mild consequence along with numerous dietary and environmental risk factors. Previously, we demonstrated the association of several candidate gene variations with GBC risk. In this study, we aimed to identify the combination of gene variants and their possible interactio...

  10. Genetic variation in cell death genes and risk of non-Hodgkin lymphoma.

    Johanna M Schuetz

    Full Text Available BACKGROUND: Non-Hodgkin lymphomas are a heterogeneous group of solid tumours that constitute the 5(th highest cause of cancer mortality in the United States and Canada. Poor control of cell death in lymphocytes can lead to autoimmune disease or cancer, making genes involved in programmed cell death of lymphocytes logical candidate genes for lymphoma susceptibility. MATERIALS AND METHODS: We tested for genetic association with NHL and NHL subtypes, of SNPs in lymphocyte cell death genes using an established population-based study. 17 candidate genes were chosen based on biological function, with 123 SNPs tested. These included tagSNPs from HapMap and novel SNPs discovered by re-sequencing 47 cases in genes for which SNP representation was judged to be low. The main analysis, which estimated odds ratios by fitting data to an additive logistic regression model, used European ancestry samples that passed quality control measures (569 cases and 547 controls. A two-tiered approach for multiple testing correction was used: correction for number of tests within each gene by permutation-based methodology, followed by correction for the number of genes tested using the false discovery rate. RESULTS: Variant rs928883, near miR-155, showed an association (OR per A-allele: 2.80 [95% CI: 1.63-4.82]; p(F = 0.027 with marginal zone lymphoma that is significant after correction for multiple testing. CONCLUSIONS: This is the first reported association between a germline polymorphism at a miRNA locus and lymphoma.