WorldWideScience

Sample records for abs

  1. Fotfavoriten AB

    Søilen, Klaus Solberg; HUBER, Stefan

    2004-01-01

    Fotfavoriten AB, a foot care company located in Sollefttå in Northern Sweden, is an example of how local government fires staff only to reengage them as entrepreneurs delivering similar service. The case is typical for the social sector and may mark a trend. The result is often felt to be positive both by the entrepreneur, who is now more directly in charge of her or his earnings, and the end consumer. The CEO of Fotfavoriten AB, Eva Wörmann, waited a long time before she dared to take the ne...

  2. Verdivurdering av SAS AB

    Gangås, Silje Garberg

    2013-01-01

    Formålet med denne mastergradsavhandlingen har vært å beregne den teoretiske verdien på det børsnoterte selskapet SAS AB og på bakgrunn av denne gi en handlingsanbefaling på selskapets aksje. Forskningsspørsmålet for oppgaven er utledet som følger: ”Hva er verdien av SAS AB?” SAS AB er inne i en fundamental omstillingsprosses hvor den nye strategien, 4XNG, ble presentert og påbegynt november 2012. Omstillingsprosessen innebærer blant annet en omfattende omstrukturering i organisasjonen ...

  3. ABS 415 Course Tutorial / tutorialrank

    welcome1257

    2015-01-01

                     For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 4 Times, Rating: A+   ASHFORD ABS 415 Week 1 DQ 1Discovering Strengths in Leadership ASHFORD ABS 415 Week 1 DQ 2 Ethical Leadership ASHFORD ABS 415 Week 2 DQ 1 Developing Emotional Intelligence in Leadership ASHFORD ABS 415 Week 2 DQ 2 Elements of Emotional Intelligence in Leadership ASHFORD ABS 415 Week 3 DQ 1 Motivational...

  4. The AB Staff Plan

    Boillot, J; Delahaye, J P; Myers, S; CERN. Geneva. AB Department

    2003-01-01

    The present report summarises the staff plan of the newly created Accelerators and Beams (AB) Division following the restructuring of the Accelerator Sector and covering the period 2003 to 2010. It underlines the refocusing of the staff on priority work, especially the LHC Project and is coherent with the recently adopted CERN Long Term Plan (LTP). It compares the requested and available manpower (both staff and industrial support) for each Project, Programme and Activity (PPA) split in work packages and highlights the missing manpower for each category of personnel.

  5. AB Manpower Plan 2007

    Myers, Stephen

    2007-01-01

    The present exercise is not as such a "manpower plan" but a purely budgetary comparison of known plus requested resources with the known commitments over the period 2007-2012. From a purely budgetary point of view, AB will have the capacity to maintain all those recently hired staff who fulfill the criteria for long term employment at CERN. Following this budgetary exercise, AB proposes to perform a CERN-wide staff work plan so as to compare the manpower available to the quantity of work to be done in the totality of the work-packages. If there is a significant mismatch between these two quantities then we propose the following measures which would create personnel economies and allow us to redress the mismatch by increased recruitment: a new job severance scheme; CERN restructuring; use of the new CERN-ITER agreement; more flexibility in transfers from Materials to Personnel budgets. Failing this a re-examination of possible closure of lower priority facilities may be needed.

  6. ABS 415 ASH Course Tutorial / Tutorialrank

    charles

    2015-01-01

    For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 4 Times, Rating: A+   ASHFORD ABS 415 Week 1 DQ 1Discovering Strengths in Leadership ASHFORD ABS 415 Week 1 DQ 2 Ethical Leadership ASHFORD ABS 415 Week 2 DQ 1 Developing Emotional Intelligence in Leadership ASHFORD ABS 415 Week 2 DQ 2 Elements of Emotional Intelligence in Leadership ASHFORD ABS 415 Week 3 DQ 1 Motivational Techniques ASHFORD ABS 415 Week 3 DQ 2 Leadership in a Cr...

  7. Clinical significance of combined detection of multiple serum antibodies (AsAb, EmAb, AcAb, AoAb, ToxAb) in infertile women

    Objective: To determine the clinical significance of combined detection of multiple serum antibodies in infertile women. Methods; Serum multiple antibodies were examined in 120 infertile women, including 88 failed to get pregnancy and 32 with repeated spontaneous abortion. The antibodies tested were: (1) anti-sperm antibody (AsAb) (2) endometrial antibody (EmAb) (3) anti-cardiophospholipid antibody (AcAb) (4) Anti-ovarian antibody (AoAb) and Toxoplasmosis antibody (ToxAb). Results: In 48 of the infertile women, none of the five antibodies were positive (40% of 120). The rest were: one antibody positive--38/120 or 31.6%; two antibodies positive--31/120 or 25.83%, three and four antibodies positive--4/120 or 3.33%. None of the women were positive with all five antibodies. Conclusion: Immune factor was the chief cause of infertility in women. (authors)

  8. Equity valuation : Atlas Copco AB

    Santos, Ricardo Manuel Castro Lopes Alba

    2016-01-01

    This Dissertation presents a literature review of some of the most appraised theories on equity valuation models. A thoughtful analysis is made, presenting the main advantages and restrictions of each model and setting the path for a discussion about improvements to be made on this field of study. A practical implementation follows, proposing a fair value estimation of Atlas Copco AB shares. Atlas Copco is a Swedish-based capital goods company, operating across four differen...

  9. AB Levitator and Electricity Storage

    Bolonkin, Alexander

    2007-01-01

    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative...

  10. Thermonuclear Reflect AB-Reactor

    Bolonkin, Alexander

    2008-01-01

    The author offers a new kind of thermonuclear reflect reactor. The remarkable feature of this new reactor is a three net AB reflector, which confines the high temperature plasma. The plasma loses part of its energy when it contacts with the net but this loss can be compensated by an additional permanent plasma heating. When the plasma is rarefied (has a small density), the heat flow to the AB reflector is not large and the temperature in the triple reflector net is lower than 2000 - 3000 K. This offered AB-reactor has significantly less power then the currently contemplated power reactors with magnetic or inertial confinement (hundreds-thousands of kW, not millions of kW). But it is enough for many vehicles and ships and particularly valuable for tunnelers, subs and space apparatus, where air to burn chemical fuel is at a premium or simply not available. The author has made a number of innovations in this reactor, researched its theory, developed methods of computation, made a sample computation of typical pr...

  11. AB Levitator and Electricity Storage

    Bolonkin, A

    2007-01-01

    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative weight ratio of this engine is 0.01 - 0.1 (from thrust). For some types of AB engine (toroidal form) the thrust easily may be changed in any direction without turning of engine. The author computed many projects using different versions of offered AB engine: small device for levitation-flight of a human (including flight from Earth to Outer Space), fly VTOL car (track), big VTOL aircrat, suspended low altitude stationary satellite, powerful Space Shuttle-like booster for travel to the Moon and Mars without spending energ...

  12. AP calculus AB/BC

    Schwartz, Stu

    2013-01-01

    All Access for the AP® Calculus AB & BC Exams Book + Web + Mobile Everything you need to prepare for the Advanced Placement® exam, in a study system built around you! There are many different ways to prepare for an Advanced Placement® exam. What's best for you depends on how much time you have to study and how comfortable you are with the subject matter. To score your highest, you need a system that can be customized to fit you: your schedule, your learning style, and your current level of knowledge. This book, and the free online tools that come with it, will help you personalize your AP® Cal

  13. ABS: Sequence alignment by scanning

    Bonny, Mohamed Talal

    2011-08-01

    Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  14. Ab-Initio Molecular Dynamics

    Kühne, Thomas D

    2012-01-01

    Computer simulations and molecular dynamics in particular, is a very powerful method to provide detailed and essentially exact informations of classical many-body problems. With the advent of \\textit{ab-initio} molecular dynamics, where the forces are computed on-the-fly by accurate electronic structure calculations, the scope of either method has been greatly extended. This new approach, which unifies Newton's and Schr\\"odinger's equations, allows for complex simulations without relying on any adjustable parameter. This review is intended to outline the basic principles as well as a survey of the field. Beginning with the derivation of Born-Oppenheimer molecular dynamics, the Car-Parrinello method as well as novel hybrid scheme that unifies best of either approach are discussed. The predictive power is demonstrated by a series of applications ranging from insulators to semiconductors and even metals in condensed phases.

  15. GINGA Observations of AB Doradus

    Vilhu, O.; Tsuru, T.; Collier Cameron, A.

    We report GINGA observations of the pre main sequence star AB Doradus (HD 36705), performed during 8 - 12 January, 1990. Some rotational modulation might be present. four X-ray flares were detected. Three of these events were similar to the EINSTEIN HRI-flare (Vilhu and Linsky, 1987), with decay times around 25 min. The last flare had long rise and decay times (100 min), resembling the EXOSAT flares observed by Collier Cameron et.al. (1988). The mean flare spectrum can be fitted by a thermal bremstrahlung with temperature 5.0 keV, or by a power-law model with photon index 2.2. The 3 upper limit of the Iron line equivalent width in the flare spectrum is 1 keV, weaker than predicted by thermal models. This Iron line anomaly was first discussed in the case of UX Ari by Tsuru et. al. (1989). However, normal equivalent widths can be derived from several EXOSAT spectra of active cool stars (Pallavicini and Tagliaferri, 1990). We discuss the possibility that the continuum from non-thermal electrons (producing also the microwave emission) could occasionally lower the apparent equivalent width. The mechanism works for reasonably low magnetic field strengths and electon power-law indexes. However, a large population of non-thermal electrons is needed (comparable to the thermal one). Stronger magnetic fields could explain the radio emission with less electrons, but then the non-thermal X-ray continuum remains small.

  16. AP calculus AB & BC crash course

    Rosebush, J

    2012-01-01

    AP Calculus AB & BC Crash Course - Gets You a Higher Advanced Placement Score in Less Time Crash Course is perfect for the time-crunched student, the last-minute studier, or anyone who wants a refresher on the subject. AP Calculus AB & BC Crash Course gives you: Targeted, Focused Review - Study Only What You Need to Know Crash Course is based on an in-depth analysis of the AP Calculus AB & BC course description outline and actual AP test questions. It covers only the information tested on the exams, so you can make the most of your valuable study time. Written by experienced math teachers, our

  17. Main: DREDR1ATRD29AB [PLACE

    Full Text Available DREDR1ATRD29AB S000152 23-June-2006 (last modified) kehi Related to responsiveness ...dependent in the ABA-responsive expression of the rd29A in Arabidopsis; DRE; drought; water stress; oxidativ

  18. Ab initio valence calculations in chemistry

    Cook, D B

    1974-01-01

    Ab Initio Valence Calculations in Chemistry describes the theory and practice of ab initio valence calculations in chemistry and applies the ideas to a specific example, linear BeH2. Topics covered include the Schrödinger equation and the orbital approximation to atomic orbitals; molecular orbital and valence bond methods; practical molecular wave functions; and molecular integrals. Open shell systems, molecular symmetry, and localized descriptions of electronic structure are also discussed. This book is comprised of 13 chapters and begins by introducing the reader to the use of the Schrödinge

  19. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    Souto, F.J.; Haskin, F.E. [Univ. of New Mexico, Albuquerque, NM (United States). Dept. of Chemical and Nuclear Engineering; Kmetyk, L.N. [Sandia National Labs., Albuquerque, NM (United States)

    1994-10-01

    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS.

  20. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS

  1. Improved age constraints for the AB Dor quadruple system - The binary nature of AB Dor B

    Janson, M; Lenzen, R; Close, L; Nielsen, E; Hartung, M; Henning, T; Bouy, H; Janson, Markus; Brandner, Wolfgang; Lenzen, Rainer; Close, Laird; Nielsen, Eric; Hartung, Markus; Henning, Thomas; Bouy, Herve

    2006-01-01

    We present resolved NACO photometry of the close binary AB Dor B in H- and Ks-band. AB Dor B is itself known to be a wide binary companion to AB Dor A, which in turn has a very low-mass close companion named AB Dor C. These four known components make up the young and dynamically interesting system AB Dor, which will likely become a benchmark system for calibrating theoretical pre-main sequence evolutionary mass tracks for low-mass stars. However, for this purpose the actual age has to be known, and this subject has been a matter of discussion in the recent scientific literature. We compare our resolved photometry of AB Dor Ba and Bb with theoretical and empirical isochrones in order to constrain the age of the system. This leads to an age estimate of about 50 to 100 Myr. We discuss the implications of such an age range for the case of AB Dor C, and compare with other results in the literature.

  2. Ab interno trabeculectomy: A comprehensive review

    Ting Ting Liu

    2013-07-01

    Full Text Available PURPOSE To summarize the original literature on ab interno trabeculectomy with the Trabectome system and to review its efficacy and safety in the treatment of glaucoma. METHOD A literature search in PubMed was performed on ab interno trabeculectomy with the Trabectome system, and clinical relevant information was reviewed and summarized. RESULTS Ab interno trabeculectomy with the Trabectome system on average lowered intraocular pressure (IOP to the mid-teens, and decreased the number of required glaucoma medications. Greater preoperative IOP correlated to a greater percent reduction in IOP. The success rates varied among studies, and the definition of success differed by authors. Intraoperative blood reflux was found in nearly all cases. Incidences of early hypotony and IOP spikes were low. No cases of endophthalmitis, wound leak, aqueous misdirection, choroidal hemorrhage or effusions, and irreversible visual acuity decrease (≥2 Snellen lines have been reported. Available studies had a significant amount of data overlap. Only limited data on long-term results was available. There was no randomized controlled trial to date. CONCLUSIONS Ab interno trabeculectomy with the Trabectome system is an effective and safe surgical approach for patients with various types of open angle glaucoma. On average, the procedure at least in the short term lowers IOP to the mid teens regardless of preoperative IOP with or without the aid of topical medications.

  3. Reference: DREDR1ATRD29AB [PLACE

    Full Text Available DREDR1ATRD29AB Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, N... ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant J. 34: 137-148 (2003) PubMed: 12694590; ...

  4. Preparation of national standard product of Anti-TgAb and Anti-TpoAb in our laboratory

    Objective: To standardize the China-made quantitative immunoassay kits of Anti-TgAb and Anti-TpoAb with a national standdized product of Anti-TgAb and And-TpoAb developed in our laboratory. Methods and Results: Higher titer Anti - TgAb and Anti-TpoAb serum specimens were pooled and treated with centrifuging and filtering, then freeze-dried and packaged into 2ml anpoules for preparing the national standard candidate. The results of the collaborative study showed that, the immuno-activity of the Anti-TgAb was 3916 IU/Amp in term of the 65/093, and the immuno-activity of the Anti-TpoAb was 434 IU/Amp in term of the 66/387. Conclusion: On the basis of the present study, it is proposed that the candidate standard be established as the National Standard for Anti-TgAb and Anti-TpoAb for immunoassay, the immunoactivity of the Anti-TgAb 4000IU/Amp, and that of Anti - TpoAb is 430IU/Amp. A comparative study on the quality of immunoassay kits of Anti-TgAb and Anti-TpoAb by Axsym System, Immulite 1000, Modular Analytics El70, ADVIA Centaur Assay (the most commonly used types in China) is also presented. (authors)

  5. On the Strain Rate Sensitivity of Abs and Abs Plus Fused Deposition Modeling Parts

    Vairis, A.; Petousis, M.; Vidakis, N.; Savvakis, K.

    2016-06-01

    In this work the effect of strain rate on the tensile strength of fused deposition modeling parts built with Acrylonitrile-butadiene-styrene (ABS) and ABS plus material is presented. ASTM D638-02a specimens were built with ABS and ABS plus and they were tested on a Schenck Trebel Co. tensile test machine at three different test speeds, equal, lower, and higher to the test speed required by the ASTM D638-02a standard. The experimental tensile strength results were compared and evaluated. The fracture surfaces of selected specimens were examined with a scanning electron microscope, to determine failure mode of the filament strands. It was found that, as the test speed increases, specimens develop higher tensile strength and have higher elastic modulus. Specimens tested in the highest speed of the experiment had on average about 10% higher elastic modulus and developed on average about 11% higher tensile strength.

  6. KINETIC ANALYSIS OF CO-CONDENSATION POLYMERIZATION OF AB2 AND AB MONOMERS

    Min-qiang Yu; Zhi-ping Zhou; De-yue Yan

    2004-01-01

    This work deals with the kinetics of co-condensation polymerization of AB2 and AB monomers, giving expressions of the two-dimensional molecular weight distribution function and the number/weight average molecular weights of the resulting copolymers. The two-dimensional molecular weight distribution depends on two indices, n and l, which are the respective numbers of AB2 and AB units in a copolymer species. The evolution of the two-dimensional weight and z distributions during the co-condensation polymerization has been evaluated systematically. Finally, the two-dimensional distribution was transformed into a one-dimensional molecular weight distribution with only one variable (the molecular weight of the products instead of the degree of polymerization). The calculated results show that the highly branched copolymer has a very broad molecular weight distribution when the co-condensation polymerization approaches completion.

  7. Leaching behaviour of the Swedish KBS-glasses ABS 39 and ABS 41

    The planned Swedish KBS glass corrosion investigation program comprises experiments with inactive glasses containing simulated waste, prolonged in-situ tests, the characterization of corrosion products, immiscibility studies, and corrosion experiments with hot glass. This presentation gives a short description of the entire program. It focuses thereafter on some recent leaching results with the inactive KBS glass qualities ABS 39 and ABS 41, which were leached in a manner similar to the PNL MCC-1 test procedure. 5 figures, 9 tables

  8. Thermomechanical properties of ABS/PA AND ABS/PC blends

    GUINAULT, Alain; Sollogoub, Cyrille

    2009-01-01

    International audience The significant increase of Waste Electric and Electronic Equipment (WEEE) has led to an important research in upgrading recycled engineering plastics by means of a blending technique. Classical twin-screw extrusion is compared to a new blending technique, where two polymers are combined together and then flow in several static mixers. This technique allows to obtain different morphologies of compatibilized ABS/PA or ABS/PC blends and the aim of this work is to evalu...

  9. AB077. Relationship of TPO-Ab and TSH with in vitro fertilization and embryo transfer

    Wang, Liyun

    2015-01-01

    Objective Study of thyroid peroxidase antibodies and thyroid stimulating effect on in vitro fertilization embryo transfer ending. Methods From March 2011 to October 2013 in the reproductive center in Qinghai Province People’s Hospital in vitro fertilization embryo transfer a total of 378 cycles were analyzed. (I) Basis for TPO-Ab grouping: research group is thyroid peroxidase antibody positive and thyroid function in patients with normal 69 cycles (TPO-Ab+ group), control group is thyroid per...

  10. Genetics Home Reference: GM2-gangliosidosis, AB variant

    ... of GM2-gangliosidosis, AB variant: Genetic Testing Registry: Tay-Sachs disease, variant AB These resources from MedlinePlus offer ... AB variant Activator Deficiency/GM2 Gangliosidosis Activator-deficient Tay-Sachs disease GM2 Activator Deficiency Disease GM2 gangliosidosis, type ...

  11. Investigation of high level of AsAb, EmAb in fertility female serum infected by chlamydia trachomatis

    Objective: To investigate the mechanism of chlamydia trachomatis. AsAb, EmAb in female fertility. Methods: LPS antigen of chlamydia in reproduction tract of fertility female was detected by monoclonal antibody and immunology chromatography; the content of AsAb, EmAb in serum of fertility female was detected by ELISA. Results: Infections rate of chlamydia trachomatis in fertility female was higher than that in the control AsAb, EmAb in serum of the fertility patients who were infected with chlamydia trachomatis showed a significant difference from that in the control group. Conclusion: The level of AsAb, EmAb increases in patients who have been infected with chlamydia trachomatis and these cytokines is involved in the course of female fertility

  12. Ab initio mass tensor molecular dynamics

    Tsuchida, Eiji

    2010-01-01

    Mass tensor molecular dynamics was first introduced by Bennett [J. Comput. Phys. 19, 267 (1975)] for efficient sampling of phase space through the use of generalized atomic masses. Here, we show how to apply this method to ab initio molecular dynamics simulations with minimal computational overhead. Test calculations on liquid water show a threefold reduction in computational effort without making the fixed geometry approximation. We also present a simple recipe for estimating the optimal ato...

  13. Discovering chemistry with an ab initio nanoreactor

    Wang, Lee-Ping; Titov, Alexey; McGibbon, Robert; Liu, Fang; Pande, Vijay S.; Martínez, Todd J.

    2014-01-01

    Chemical understanding is driven by the experimental discovery of new compounds and reactivity, and is supported by theory and computation that provides detailed physical insight. While theoretical and computational studies have generally focused on specific processes or mechanistic hypotheses, recent methodological and computational advances harken the advent of their principal role in discovery. Here we report the development and application of the ab initio nanoreactor – a highly accelerat...

  14. Ab initio vel ex eventu. II

    Thiessen, P. A.; Treder, H.-J.

    Jedes initium wird durch experimenta crucis zum eventus. Jedes theoretisch interpretierbare ex-eventu-Resultat führt auf ein neues Initium. Gerade dies ist die gemeinsame Aussage von Atomistik, Quantenmechanik und Relativitätstheorie.Translated AbstractAb initio vel ex eventu. IIEvery initium becomes an eventus by experimenta crucis. Every theoretically interpretable ex-eventu result leads to a new initium. Right this is the joint assertion of atomism, quantum mechanics, and relativity.

  15. Highly scalable Ab initio genomic motif identification

    Marchand, Benoît

    2011-01-01

    We present results of scaling an ab initio motif family identification system, Dragon Motif Finder (DMF), to 65,536 processor cores of IBM Blue Gene/P. DMF seeks groups of mutually similar polynucleotide patterns within a set of genomic sequences and builds various motif families from them. Such information is of relevance to many problems in life sciences. Prior attempts to scale such ab initio motif-finding algorithms achieved limited success. We solve the scalability issues using a combination of mixed-mode MPI-OpenMP parallel programming, master-slave work assignment, multi-level workload distribution, multi-level MPI collectives, and serial optimizations. While the scalability of our algorithm was excellent (94% parallel efficiency on 65,536 cores relative to 256 cores on a modest-size problem), the final speedup with respect to the original serial code exceeded 250,000 when serial optimizations are included. This enabled us to carry out many large-scale ab initio motiffinding simulations in a few hours while the original serial code would have needed decades of execution time. Copyright 2011 ACM.

  16. Undoing Gender Through Legislation and Schooling: the Case of AB 537 and AB 394 IN California, USA

    Knotts, Greg

    2009-11-01

    This article investigates California laws AB 537: The Student Safety and Violence Prevention Act of 2000, and the recently enacted AB 394: Safe Place to Learn Act. Both demand that gender identity and sexual orientation be added to the lexicon of anti-harassment protection in public education. However, despite these progressive measures, schools have an unconscious acceptance of heteronormativity and gendered norms, which undermines both the spirit and language of these laws. This paper examines how California schools can both change standard practices and realise the transformative social change that laws like AB 537 and AB 394 can instigate. I assert that the systemic implementation of these laws, through the adoption, enforcement and evaluation of existing AB 537 Task Force Recommendations, is necessary for their success. My second assertion is that AB 537 and AB 394 have the potential to change and reconstitute gender-based and heteronormative standards at school sites.

  17. 汽车ABS/ASR/ACC集成化系统%Integrated ABS/ASR/ACC System for the Car

    刘昭度; 卢江; 时开斌; 安巍

    2001-01-01

    叙述了ACC系统和ABS/ASR系统在改善汽车高速行驶主动安全性方面的功用,阐述了ACC系统是ABS/ASR系统功能的延伸、逻辑的发展及它们之间的内在联系,指出了在ABS/ASR的基础上只需增加测距装置和添加巡航控制子程序,就可方便地实现ABS/ASR/ACC集成化系统,并给出了集成化系统的控制框图和控制方法,论述了ABS/ASR/ACC集成化系统比孤立的ABS/ASR和ACC系统的优越性.%The individual functions of ACC and ABS/ASR are described in the improvements of active safety while the road vehicles travel at a high speed. Being a logic extension of and many inherent connections with ABS/BSR, ACC is easily integrated with ABS/ASR to form an integrated system by adding the headway distance*$-detecting device to the existing ABS/ASR system and expanding the ABS/ASR software. The algorithm flowcharts and control methods of the ABS/ASR/ACC are given. The advantages of the ABS/ASR/ACC system compared with those using the stand alone systems ABS, ASR and ACC are mentioned in details.

  18. Germacrene D Cyclization: An Ab Initio Investigation

    William N. Setzer

    2008-01-01

    Full Text Available Essential oils that contain large concentrations of germacrene D are typically accompanied by cadinane sesquiterpenoids. The acid-catalyzed cyclization of germacrene D to give cadinane and selinane sesquiterpenes has been computationally investigated using both density functional (B3LYP/6-31G* and post Hartree-Fock (MP2/6-31G** ab initio methods. The calculated energies are in general agreement with experimentally observed product distributions, both from acid-catalyzed cyclizations as well as distribution of the compounds in essential oils.

  19. Ab initio calculations of material strength

    Šob, Mojmír; Friák, Martin; Vitek, V.

    Tokyo : The Japan Society of Mechanical Engineers, 2003, s. 467-475. [International Symposium on Micro-Mechanical Engineering - Heat Transfer, Fluid Dynamics, Reliability and Mechanotronics.. Tsuchiura and Tsukuba (JP), 01.12.2003-03.12.2003] R&D Projects: GA AV ČR IAA1041302; GA ČR GA202/03/1351; GA MŠk OC 523.90 Institutional research plan: CEZ:AV0Z2041904 Keywords : ab initio calculations * electronic structure * theoretical tensile strength Subject RIV: BM - Solid Matter Physics ; Magnetism

  20. Ab Initio Molecular Dynamics: A Virtual Laboratory

    Hobbi Mobarhan, Milad

    2014-01-01

    In this thesis, we perform ab initio molecular dynamics (MD) simulations at the Hartree-Fock level, where the forces are computed on-the-fly using the Born-Oppenheimer approximation. The theory behind the Hartree-Fock method is discussed in detail and an implementation of this method based on Gaussian basis functions is explained. We also demonstrate how to calculate the analytic energy derivatives needed for obtaining the forces acting on the nuclei. Hartree-Fock calculations on the ground s...

  1. Asiakassuhdehallinnan kehityssuunnitelma : Case: Oy Combi Cool Ab

    Puikkonen, Touko

    2011-01-01

    Tässä insinöörityössä tutustuttiin Oy Combi Cool Ab:n asiakassuhdehallintaan ja siinä havaittuihin puutteisiin ja kehitystarpeisiin. Työn tarkoituksena oli luoda yritykselle ajan tasalla oleva asiakasrekisteri ja sen pohjalta kehittää asiakassuhdehallintaa etenkin myynnin, oston ja johdon henkilöstön tarpeita ajatellen muovaamalla siitä henkilöstön myynti- ja asiakaspalvelutyöskentelyä tehostava toimiva kokonaisuus. Combi Cool on vuonna 1985 perustettu kylmäalan tukkuliike, joka on vajaan 30 ...

  2. Testing Distributed ABS System with Fault Injection

    Trawczyński, Dawid; Sosnowski, Janusz; Gawkowski, Piotr

    The paper deals with the problem of adapting software implemented fault injection technique (SWIFI) to evaluate dependability of reactive microcontroller systems. We present an original methodology of disturbing controller operation and analyzing fault effects taking into account reactions of the controlled object and the impact of the system environment. Faults can be injected randomly (in space and time) or targeted at the most sensitive elements of the controller to check it at high stresses. This approach allows identifying rarely encountered problems, usually missed in classical approaches. The developed methodology has been used successfully to verify dependability of ABS system. Experimental results are commented in the paper.

  3. Elastic properties of intermetallic AB2 and AB5 hydrogen-absorbing compounds

    The elastic properties of AB2 and AB5 hydrogen-absorbing intermetallic compounds are reviewed. The relevance of these properties to hydrogen absorption is discussed briefly. In many cases the temperature dependence of the elastic constants of the AB2 compounds is anomalous in that the moduli do not decrease monotonically with increasing temperature. This unusual behavior appears to be associated with electronic structure effects in a number of cases. The absorption of hydrogen by polycrystalline TaV2 has a profound effect on the aggregate shear modulus, changing both the magnitude and temperature dependence significantly. This effect of hydrogen on the mechanical properties appears to occur via effects on the electronic structure. Few measurements of elastic properties have been reported for hydrogen-absorbing AB5 intermetallic compounds. The LaAlxNi5-x system has been investigated by means of measurements on polycrystals prepared by hot isostatic pressing. The moduli decrease about 8% as x increases from 0 to 1

  4. Biosorption of Acid Blue 290 (AB 290) and Acid Blue 324 (AB 324) dyes on Spirogyra rhizopus

    In this study, the biosorption of Acid Blue 290 and Acid Blue 324 on Spirogyra rhizopus, a green algae growing on fresh water, was studied with respect to initial pH, temperature, initial dye concentration and biosorbent concentration. The optimum initial pH and temperature values for AB 290 and AB 324 biosorption were found to be 2.0, 30 deg. C and 3.0, 25 deg. C, respectively. It was observed that the adsorbed AB 290 and AB 324 amounts increased with increasing the initial dye concentration up to 1500 and 750 mg/L, respectively. The Langmuir, Freundlich, Redlich-Peterson and Koble-Corrigan isotherm models were applied to the experimental equilibrium data and the isotherm constants were determined by using Polymath 4.1 software. The monolayer coverage capacities of S. rhizopus for AB 290 and AB 324 dyes were found as 1356.6 mg/g and 367.0 mg/g, respectively. The intraparticle diffusion model and the pseudo-second order kinetic model were applied to the experimental data in order to describe the removal mechanism of these acidic dyes by S. rhizopus. The pseudo-second order kinetic model described very well the biosorption kinetics of AB 290 and AB 324 dyes. Thermodynamic studies showed that the biosorption of AB 290 and AB 324 on S. rhizopus was exothermic in nature

  5. Ab initio non-relativistic spin dynamics

    Ding, Feizhi; Goings, Joshua J.; Li, Xiaosong, E-mail: xsli@uw.edu [Department of Chemistry, University of Washington, Seattle, Washington 98195 (United States); Frisch, Michael J. [Gaussian, Inc., 340 Quinnipiac St, Bldg 40, Wallingford, Connecticut 06492 (United States)

    2014-12-07

    Many magnetic materials do not conform to the (anti-)ferromagnetic paradigm where all electronic spins are aligned to a global magnetization axis. Unfortunately, most electronic structure methods cannot describe such materials with noncollinear electron spin on account of formally requiring spin alignment. To overcome this limitation, it is necessary to generalize electronic structure methods and allow each electron spin to rotate freely. Here, we report the development of an ab initio time-dependent non-relativistic two-component spinor (TDN2C), which is a generalization of the time-dependent Hartree-Fock equations. Propagating the TDN2C equations in the time domain allows for the first-principles description of spin dynamics. A numerical tool based on the Hirshfeld partitioning scheme is developed to analyze the time-dependent spin magnetization. In this work, we also introduce the coupling between electron spin and a homogenous magnetic field into the TDN2C framework to simulate the response of the electronic spin degrees of freedom to an external magnetic field. This is illustrated for several model systems, including the spin-frustrated Li{sub 3} molecule. Exact agreement is found between numerical and analytic results for Larmor precession of hydrogen and lithium atoms. The TDN2C method paves the way for the ab initio description of molecular spin transport and spintronics in the time domain.

  6. Ab initio no core full configuration approach for light nuclei

    Kim, Youngman; Shin, Ik Jae; Maris, Pieter; Vary, James P.; Forssén, Christian; Rotureau, Jimmy

    2015-10-01

    Comprehensive understanding of the structure and reactions of light nuclei poses theoretical and computational challenges. Still, a number of ab initio approaches have been developed to calculate the properties of atomic nuclei using fundamental interactions among nucleons. Among them, we work with the ab initio no core full configuration (NCFC) method and ab initio no core Gamow Shell Model (GSM). We first review these approaches and present some recent results.

  7. Workshop on automated beam steering and shaping (ABS). Proceedings

    A workshop on Automated Beam Steering and Shaping (ABS) was held at CERN in December 1998. This was the first workshop dedicated to this subject. The workshop had two major goals: to review the present status of ABS algorithms and systems around the world and to create a worldwide ABS community. These proceedings contain summary reports from all sessions, contributions from several presentations held at the workshop, and a complete set of abstracts for all presentations. (orig.)

  8. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 interactions with western corn rootworm midgut membrane binding sites.

    Huarong Li

    Full Text Available BACKGROUND: Bacillus thuringiensis (Bt Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interactions are one line of evidence that Bt protein mechanisms of action differ and that the probability of receptor-mediated cross-resistance is low. METHODOLOGY/PRINCIPAL FINDINGS: Binding site interactions were investigated between Cry34Ab1/Cry35Ab1 and coleopteran active insecticidal proteins Cry3Aa, Cry6Aa, and Cry8Ba on western corn rootworm midgut brush border membrane vesicles (BBMV. Competitive binding of radio-labeled proteins to western corn rootworm BBMV was used as a measure of shared binding sites. Our work shows that (125I-Cry35Ab1 binds to rootworm BBMV, Cry34Ab1 enhances (125I-Cry35Ab1 specific binding, and that (125I-Cry35Ab1 with or without unlabeled Cry34Ab1 does not share binding sites with Cry3Aa, Cry6Aa, or Cry8Ba. Two primary lines of evidence presented here support the lack of shared binding sites between Cry34Ab1/Cry35Ab1 and the aforementioned proteins: 1 No competitive binding to rootworm BBMV was observed for competitor proteins when used in excess with (125I-Cry35Ab1 alone or combined with unlabeled Cry34Ab1, and 2 No competitive binding to rootworm BBMV was observed for unlabeled Cry34Ab1 and Cry35Ab1, or a combination of the two, when used in excess with (125I-Cry3Aa, or (125I-Cry8Ba. CONCLUSIONS/SIGNIFICANCE: Combining two or more insecticidal proteins active against the same target pest is one tactic to delay the onset of resistance to either protein. We conclude that Cry34Ab1/Cry35Ab1 are compatible with Cry3Aa, Cry6Aa, or Cry8Ba

  9. Ising and Heisenberg models on ferrimagnetic AB sub 2 chains

    Vitoriano, C; Raposo, E P

    2002-01-01

    We study the Ising and Heisenberg models on one-dimensional ferrimagnetic bipartite chains with the special AB sub 2 unit-cell topology and experimental motivation in inorganic and organic magnetic polymers. The spin-1/2 AB sub 2 Ising case is exactly solved in the presence of an external magnetic field. We also derive asymptotical low- and high-temperature limits of several thermodynamical quantities of the zero-field classical AB sub 2 Heisenberg model. Further, the quantum spin-1/2 AB sub 2 Heisenberg model in a field is studied using a mean-field approach.

  10. Guiding ab initio calculations by alchemical derivatives

    to Baben, M.; Achenbach, J. O.; von Lilienfeld, O. A.

    2016-03-01

    We assess the concept of alchemical transformations for predicting how a further and not-tested change in composition would change materials properties. This might help to guide ab initio calculations through multidimensional property-composition spaces. Equilibrium volumes, bulk moduli, and relative lattice stability of fcc and bcc 4d transition metals Zr, Nb, Mo, Tc, Ru, Rh, Pd, and Ag are calculated using density functional theory. Alchemical derivatives predict qualitative trends in lattice stability while equilibrium volumes and bulk moduli are predicted with less than 9% and 28% deviation, respectively. Predicted changes in equilibrium volume and bulk moduli for binary and ternary mixtures of Rh-Pd-Ag are in qualitative agreement even for predicted bulk modulus changes as large as +100% or -50%. Based on these results, it is suggested that alchemical transformations could be meaningful for enhanced sampling in the context of virtual high-throughput materials screening projects.

  11. Ab Initio Path to Heavy Nuclei

    Binder, Sven; Calci, Angelo; Roth, Robert

    2014-01-01

    We present the first ab initio calculations of nuclear ground states up into the domain of heavy nuclei, spanning the range from 16-O to 132-Sn based on two- plus three-nucleon interactions derived within chiral effective field theory. We employ the similarity renormalization group for preparing the Hamiltonian and use coupled-cluster theory to solve the many-body problem for nuclei with closed sub-shells. Through an analysis of theoretical uncertainties resulting from various truncations in this framework, we identify and eliminate the technical hurdles that previously inhibited the step beyond medium-mass nuclei, allowing for reliable validations of nuclear Hamiltonians in the heavy regime. Following this path we show that chiral Hamiltonians qualitatively reproduce the systematics of nuclear ground-state energies up to the neutron-rich Sn isotopes.

  12. Operator evolution for ab initio nuclear theory

    Schuster, Micah D; Johnson, Calvin W; Jurgenson, Eric D; Navratil, Petr

    2014-01-01

    The past two decades have seen a revolution in ab initio calculations of nuclear properties. One key element has been the development of a rigorous effective interaction theory, applying unitary transformations to soften the nuclear Hamiltonian and hence accelerate the convergence as a function of the model space size. For consistency, however, one ought to apply the same transformation to other operators when calculating transitions and mean values from the eigenstates of the renormalized Hamiltonian. Working in a translationally-invariant harmonic oscillator basis for the two- and three-nucleon systems, we evolve the Hamiltonian, square-radius and total dipole strength operators by the similarity renormalization group (SRG). The inclusion of up to three-body matrix elements in the 4He nucleus all but completely restores the invariance of the expectation values under the transformation. We also consider a Gaussian operator with adjustable range and find at short ranges an increased contribution from such ind...

  13. Discovering chemistry with an ab initio nanoreactor

    Martinez, Todd

    Traditional approaches for modeling chemical reaction networks such as those involved in combustion have focused on identifying individual reactions and using theoretical approaches to explore the underlying mechanisms. Recent advances involving graphical processing units (GPUs), commodity products developed for the videogaming industry, have made it possible to consider a distinct approach wherein one attempts to discover chemical reactions and mechanisms. We provide a brief summary of these developments and then discuss the concept behind the ``ab initio nanoreactor'' which explores the space of possible chemical reactions and molecular species for a given stoichiometry. The nanoreactor concept is exemplified with an example to the Urey-Miller reaction network which has been previously advanced as a potential model for prebiotic chemistry. We briefly discuss some of the future directions envisioned for the development of this nanoreactor concept.

  14. Ab initio molar volumes and Gaussian radii.

    Parsons, Drew F; Ninham, Barry W

    2009-02-12

    Ab initio molar volumes are calculated and used to derive radii for ions and neutral molecules using a spatially diffuse model of the electron distribution with Gaussian spread. The Gaussian radii obtained can be used for computation of nonelectrostatic ion-ion dispersion forces that underlie Hofmeister specific ion effects. Equivalent hard-sphere radii are also derived, and these are in reasonable agreement with crystalline ionic radii. The Born electrostatic self-energy is derived for a Gaussian model of the electronic charge distribution. It is shown that the ionic volumes used in electrostatic calculations of strongly hydrated cosmotropic ions ought best to include the first hydration shell. Ionic volumes for weakly hydrated chaotropic metal cations should exclude electron overlap (in electrostatic calculations). Spherical radii are calculated as well as nonisotropic ellipsoidal radii for nonspherical ions, via their nonisotropic static polarizability tensors. PMID:19140766

  15. Ab initio alpha-alpha scattering.

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  16. Ab initio alpha-alpha scattering

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Luu, Thomas; Meißner, Ulf-G.

    2015-12-01

    Processes such as the scattering of alpha particles (4He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei—nuclei with even and equal numbers of protons and neutrons—is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the ‘adiabatic projection method’ to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  17. Ablation dynamics in laser sclerotomy ab externo

    Brinkmann, Ralf; Droege, Gerit; Mohrenstecher, Dirk; Scheu, M.; Birngruber, Reginald

    1996-01-01

    Laser sclerostomy ab externo with flashlamp excited mid-IR laser systems emitting in the 2-3 micrometer spectral range is in phase II clinical trials. Although acutely high success rates were achieved, the restenosis rate after several months is about 40%. Laser pulses of several hundreds of microseconds, known to induce thermo-mechanical explosive evaporation were used for this procedure. We investigated the ablation dynamics in tissue and the cavitation bubble dynamics in water by means of an Er:YAG laser system to estimate the extent of mechanical damage zones in the sclera and in the anterior chamber, which may contribute to the clinical failure. We found substantial mechanical tissue deformation during the ablation process caused by the cavitation effects. Stress waves up to several bar generated by explosive evaporization were measured. The fast mechanical stretching and collapsing of the scleral tissue induced by cavitation resulted in tissue dissection as could be proved by flash photography and histology. The observed high restenosis might be a result of a subsequent enhanced wound healing process. Early fistula occlusions due to iris adherences, observed in about 20% of the clinical cases may be attributed to intraocular trauma induced by vapor bubble expansion through the anterior chamber after scleral perforation. An automatic feedback system minimizing adverse effects by steering and terminating the laser process during scleral fistulization is demonstrated. Moreover, a new approach in laser sclerostomy ab externo is presented using a cw-IR laser diode system emitting at the 1.94 micrometer mid-IR water absorption peak. This system was used in vitro and showed smaller damage zones compared to the pulsed laser radiation.

  18. Dicty_cDB: FCL-AB06 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AB06 (Link to dictyBase) - - - Contig-U15603-1 FCL-AB06P ...(Link to Original site) FCL-AB06F 694 FCL-AB06Z 573 FCL-AB06P 1267 - - Show FCL-AB06 Library FCL (Link to library) Clone ID FCL-...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AB/FCL-AB06Q....Seq.d/ Representative seq. ID FCL-AB06P (Link to Original site) Representative DNA sequence >FCL-AB06 (FCL-AB06Q) /CSM/FCL/FCL-...AB/FCL-AB06Q.Seq.d/ CAATTTTATCGGAACCATCAATTCATGCAGGTTCTGTATTTAGTATTAATTTAACCAAAT CTAGACA

  19. A Case of Laptop Computer-Induced Erythema Ab Igne

    Nurettin Özgür Doğan

    2014-12-01

    Full Text Available Erythema ab igne, also known as toasted skin syndrome, is a skin reaction characterized by reticulate erythema, brown pigmentation, and telangiectasia. In some cases, epidermal atrophy and scaling are also identified. The condition is usually caused by prolonged exposure to a source of heat or infrared radiation. Here, we report a case of erythema ab igne associated with laptop computer use.

  20. Kopplung von Dichtefunktional- und ab-initio-Methoden

    Goll, Erich

    2008-01-01

    Im Rahmen der Doktorarbeit wurde untersucht, inwieweit die Kopplung von Dichtefunktionalmethoden und ab-initio-Korrelationsmethoden der Quantenchemie eine Verbesserung bezüglich beider Grenzmethoden erbringt. Die Kopplung erfolgt durch eine Aufspaltung des interelektronischen Hamiltonoperators (abstoßende Coulombwechselwirkung). Die kurzreichweitige Wechselwirkung wird mit Dichtefunktionaltheorie behandelt, die langreichweitige mit Hilfe von ab-initio-Methoden. Diese Aufteilung soll dazu dien...

  1. Effects of Cry1F and Cry34Ab1/35Ab1 on storage pests

    Two crystalline protoxins from Bacillus thuringiensis (Bt), Cry1Fa1 and Cry34Ab1/Cry35Ab1 (Cry1F, Cry34/35), were evaluated for efficacy against lepidopteran and coleopteran storage pests. Cry1F was tested against the lepidopterans Sitotroga cerealella (Angoumois grain moth) and colonies of the lep...

  2. Preparation of grafted ABS and compatibilization of r-PET/ABS blends by the grafted ABS%ABS接枝物的制备及其对r-PET/ABS的增容作用

    陈智军; 王益龙; 郑辰

    2012-01-01

    Two kinds of grafted acrylonitrile-butadiene-styrene copolymer(ABS), i.e. maleic anhydride (MAH) grafted ABS(ABS-g-MAH) and glycidyl methacrylate (GMA) grafted ABS (ABS-g-GMA), were prepared via reactive extrusion and were used as compatibilizer for recycled polyethylene glycol terephthalate (r-PET)/ABS blends. The results show that ABS-g-MAH and ABS-g-GMA can greatly improve the impact strength of the blends. ABS-g-MAH is superior to ABS-g-GMA in compatibilization effect. The optimal compatibilization effect is acquired when the grafting ratio of ABS-g-MAH is 1.35% and the mass content of the copolymer is 5%. Under such conditions, the notched and unnotched *Charpy impact strength of the r-PET/ABS/ABS-g--MAH blends rise by 42% and 23%, respectively, in comparison with those of r-PET/ ABS. The observation by scanning electron microscope(SEM) shows that adding grafted ABS can make ABS be dispersed more homogeneously in the r-PET continuous phase and make particle size more even.%通过反应挤出法制备马来酸酐(MAH)接枝丙烯腈-丁二烯-苯乙烯三元共聚物(ABS)(ABS-g-MAH)和甲基丙烯酸缩水甘油酯(GMA)接枝ABS(ABS-g-GMA),将其用于增容回收聚对苯二甲酸乙二酯(PET)瓶片(r-PET)/ABS共混物,发现能显著提高其混物的冲击强度.ABS-g-MAH的增容效果优于ABS-g-GMA;ABS-g-MAH的接枝率为1.35%,w(ABS-g-MAH)为5%时对r-PET/ABS的增容作用最佳,此时r-PET/ABS/ABS-g-MAH的简支梁缺口冲击强度和无缺口冲击强度比r-PET/ABS分别提高了42%和23%.扫描电子显微镜观察表明,加入ABS接枝物能使ABS在r-PET连续相中的分散更均匀,粒径尺寸更均一.

  3. Structural and biophysical characterization of Bacillus thuringiensis insecticidal proteins Cry34Ab1 and Cry35Ab1.

    Matthew S Kelker

    Full Text Available Bacillus thuringiensis strains are well known for the production of insecticidal proteins upon sporulation and these proteins are deposited in parasporal crystalline inclusions. The majority of these insect-specific toxins exhibit three domains in the mature toxin sequence. However, other Cry toxins are structurally and evolutionarily unrelated to this three-domain family and little is known of their three dimensional structures, limiting our understanding of their mechanisms of action and our ability to engineer the proteins to enhance their function. Among the non-three domain Cry toxins, the Cry34Ab1 and Cry35Ab1 proteins from B. thuringiensis strain PS149B1 are required to act together to produce toxicity to the western corn rootworm (WCR Diabrotica virgifera virgifera Le Conte via a pore forming mechanism of action. Cry34Ab1 is a protein of ∼14 kDa with features of the aegerolysin family (Pfam06355 of proteins that have known membrane disrupting activity, while Cry35Ab1 is a ∼44 kDa member of the toxin_10 family (Pfam05431 that includes other insecticidal proteins such as the binary toxin BinA/BinB. The Cry34Ab1/Cry35Ab1 proteins represent an important seed trait technology having been developed as insect resistance traits in commercialized corn hybrids for control of WCR. The structures of Cry34Ab1 and Cry35Ab1 have been elucidated to 2.15 Å and 1.80 Å resolution, respectively. The solution structures of the toxins were further studied by small angle X-ray scattering and native electrospray ion mobility mass spectrometry. We present here the first published structure from the aegerolysin protein domain family and the structural comparisons of Cry34Ab1 and Cry35Ab1 with other pore forming toxins.

  4. Ab initio gene identification in metagenomic sequences.

    Zhu, Wenhan; Lomsadze, Alexandre; Borodovsky, Mark

    2010-07-01

    We describe an algorithm for gene identification in DNA sequences derived from shotgun sequencing of microbial communities. Accurate ab initio gene prediction in a short nucleotide sequence of anonymous origin is hampered by uncertainty in model parameters. While several machine learning approaches could be proposed to bypass this difficulty, one effective method is to estimate parameters from dependencies, formed in evolution, between frequencies of oligonucleotides in protein-coding regions and genome nucleotide composition. Original version of the method was proposed in 1999 and has been used since for (i) reconstructing codon frequency vector needed for gene finding in viral genomes and (ii) initializing parameters of self-training gene finding algorithms. With advent of new prokaryotic genomes en masse it became possible to enhance the original approach by using direct polynomial and logistic approximations of oligonucleotide frequencies, as well as by separating models for bacteria and archaea. These advances have increased the accuracy of model reconstruction and, subsequently, gene prediction. We describe the refined method and assess its accuracy on known prokaryotic genomes split into short sequences. Also, we show that as a result of application of the new method, several thousands of new genes could be added to existing annotations of several human and mouse gut metagenomes. PMID:20403810

  5. Ab initio two-component Ehrenfest dynamics

    We present an ab initio two-component Ehrenfest-based mixed quantum/classical molecular dynamics method to describe the effect of nuclear motion on the electron spin dynamics (and vice versa) in molecular systems. The two-component time-dependent non-collinear density functional theory is used for the propagation of spin-polarized electrons while the nuclei are treated classically. We use a three-time-step algorithm for the numerical integration of the coupled equations of motion, namely, the velocity Verlet for nuclear motion, the nuclear-position-dependent midpoint Fock update, and the modified midpoint and unitary transformation method for electronic propagation. As a test case, the method is applied to the dissociation of H2 and O2. In contrast to conventional Ehrenfest dynamics, this two-component approach provides a first principles description of the dynamics of non-collinear (e.g., spin-frustrated) magnetic materials, as well as the proper description of spin-state crossover, spin-rotation, and spin-flip dynamics by relaxing the constraint on spin configuration. This method also holds potential for applications to spin transport in molecular or even nanoscale magnetic devices

  6. On the hierarchical parallelization of ab initio simulations

    Ruiz-Barragan, Sergi; Shiga, Motoyuki

    2016-01-01

    A hierarchical parallelization has been implemented in a new unified code PIMD-SMASH for ab initio simulation where the replicas and the Born-Oppenheimer forces are parallelized. It is demonstrated that ab initio path integral molecular dynamics simulations can be carried out very efficiently for systems up to a few tens of water molecules. The code was then used to study a Diels-Alder reaction of cyclopentadiene and butenone by ab initio string method. A reduction in the reaction energy barrier is found in the presence of hydrogen-bonded water, in accordance with experiment.

  7. Tensile deformation mechanisms of ABS/PMMA/EMA blends

    Wang, S. H.; Gao, J.; Lin, S. X.; Zhang, P.; Huang, J.; Xu, L. L.

    2014-08-01

    The tensile deformation mechanisms of acrylonitrile - butadiene - styrene (ABS) / polymethyl methacrylate (PMMA) blends toughened by ethylene methacrylate (EMA) copolymer was investigated by analysing the fracture morphology. ABS/PMMA was blended with EMA copolymer by melt mixing technique using co-rotating twin extruder. Tensile tests show that the elongation at break of ABS/PMMA blends can be efficiently improved with the increase in EMA content. Fracture morphology of ABS/PMMA/EMA blends reveals that the material yield induced by hollowing-out of EMA particles and its propagation into yield zone is the main toughening mechanism. Moreover, the appearance that EMA particles in the central area are given priority to hollowing-out may be related to the skin-core structure of the injection moulded parts caused by the different cooling rate between surface and inside in the process of injection moulding.

  8. Ab-initio study of thermoelectricity of layered tellurium compounds

    Ibarra Hernández, Wilfredo

    2015-01-01

    In this thesis, we explore the electronic, dynamic and thermoelectric properties of different tellurium-based compounds. We perform ab-initio calculations within the Vienna Ab-initio Simulation Package (VASP) that works in the framework of Density Functional Theory (DFT). For the thermoelectric properties, we use the Boltztrap code that solves the Boltzmann Transport Equations (BTE) for electrons within the Constant Relaxation Time Approximation (CRTA). This computational pa...

  9. Evaluation of the Urotest AB antibacterial substance detection test.

    Blondeau, J. M.; Yaschuk, Y; Galenzoski, D; Hrabok, D; Isaacson, M; Lee, L.(Department of Physics, Yale University, New Haven, CT, USA); Link, H; Walshaw, L

    1994-01-01

    The Urotest AB was used to detect antimicrobial substances in urine samples. Of 1022 urine specimens evaluated, Urotest AB detected inhibitors in 38.9%. Of 159 urine specimens from patients thought to be taking an antibiotic, inhibitors were detected in 80.5%. This test may help to explain culture negative urine samples from symptomatic patients, and could help elucidate treatment failures and the epidemiology of antibiotic resistance.

  10. Toward ab initio density functional theory for nuclei

    Drut, J. E.; Furnstahl, R. J.; Platter, L.

    2009-01-01

    We survey approaches to nonrelativistic density functional theory (DFT) for nuclei using progress toward ab initio DFT for Coulomb systems as a guide. Ab initio DFT starts with a microscopic Hamiltonian and is naturally formulated using orbital-based functionals, which generalize the conventional local-density-plus-gradients form. The orbitals satisfy single-particle equations with multiplicative (local) potentials. The DFT functionals can be developed starting from internucleon forces using ...

  11. Deriving conservation laws for ABS lattice equations from Lax pairs

    In this paper we derive infinitely many conservation laws for ABS lattice equations from their Lax pairs. These conservation laws can be algebraically expressed by means of some known polynomials. For each equation, the infinitely many conservation laws are not equivalent and are nontrivial. We also show that the (H1), (H2), (H3), (Q1), (Q2), (Q3) and (A1) equations in the ABS list share a generic discrete Riccati equation. (paper)

  12. 基于ABS的ABS/ASR集成液压系统设计%ABS/ASR Integrated Hydraulic System Based on ABS

    马岳峰; 刘昭度; 吴利军; 王国业

    2004-01-01

    介绍一种基于JETTA GTX轿车ABS液压系统的ABS/ASR集成液压系统改造方案,该ABS/ASR集成液压系统在原有ABS液压系统的基础上增加较少的液压元件实现全部ABS功能和ASR制动干预控制功能,改造后的集成系统工作可靠,不影响原有的常规制动和ABS制动过程.

  13. Ab Initio No-Core Shell Model

    Barrett, B R; Navratil, P; Vary, J P

    2011-04-11

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory ({chi}EFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The

  14. Ab Initio No-Core Shell Model

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory (χEFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The resulting NN

  15. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 Interactions with Western Corn Rootworm Midgut Membrane Binding Sites

    Huarong Li; Monica Olson; Gaofeng Lin; Timothy Hey; Sek Yee Tan; Narva, Kenneth E.

    2013-01-01

    BACKGROUND: Bacillus thuringiensis (Bt) Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry) proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interact...

  16. Comparisons of metallic clusters imbedded in the surface oxide of AB2, AB5, and A2B7 alloys

    Research highlights: Different growth mechanisms have been found on the metallic inclusions imbedded in the surface oxides of AB2, AN5, and A2B7. The high power performance has been correlated to the size and distribution of these inclusions. - Abstract: In order to clarify the relationship between the saturation magnetization of the activated metal hydride material and electrode performance, the specific power measured at both low temperature (-30 oC) and operating temperature (35 oC) of a nickel metal hydride battery were compared with magnetization measurements. It is found specific powers measured at both temperatures correlate well with the saturated magnetic susceptibility, which is proportional to the total amount of metallic nickel clusters distributed within the surface oxide layer after activation. Both the gas phase storage and electrochemical properties of the activated AB2, AB5, and A2B7 alloys were investigated. While the AB2 alloy has the highest storage capacity, it also has the lowest high-rate dischargeability among the three alloys. This suggests a competition between storage capacity and rate capability in these materials. In an alkaline etching experiment, it is established the saturation magnetization increases with etching time in these AB2, AB5, and A2B7 alloys. The saturation magnetization after a 4 h etches track the changes in the high-rate dischargeability. The increase is attributed to the growth in size of the metallic inclusions for the AB2 and Nd-A2B7 samples, and from an increase in the number of metallic inclusion in the case of AB5 and La-A2B7. Transmission electron microscope studies calibrate the size inferred from magnetic susceptibility studies and also the Ni-dominated FCC structure of the metallic clusters.

  17. Study on Exothermic Oxidation of Acrylonitrile-butadiene-styrene (ABS Resin Powder with Application to ABS Processing Safety

    Jenq-Renn Chen

    2010-08-01

    Full Text Available Oxidative degradation of commercial grade ABS (Acrylonitrile-butadiene-styrene resin powders was studied by thermal analysis. The instabilities of ABS containing different polybutadiene (PB contents with respect to temperature were studied by Differential Scanning Calorimeter (DSC. Thermograms of isothermal test and dynamic scanning were performed. Three exothermic peaks were observed and related to auto-oxidation, degradation and oxidative decomposition, respectively. Onset temperature of the auto-oxidation was determined to be around 193 °C. However, threshold temperature of oxidation was found to be as low as 140 °C by DSC isothermal testing. Another scan of the powder after degeneration in air showed an onset temperature of 127 °C. Reactive hazards of ABS powders were verified to be the exothermic oxidation of unsaturated PB domains, not the SAN (poly(styrene-acrylonitrile matrix. Heat of oxidation was first determined to be 2,800 ± 40 J per gram of ABS or 4,720 ± 20 J per gram of PB. Thermal hazards of processing ABS powder are assessed by adiabatic temperature rise at process conditions. IR spectroscopy associated with heat of oxidation verified the oxidative mechanism, and these evidences excluded the heat source from the degradation of SAN. A specially prepared powder of ABS without adding anti-oxidant was analyzed by DSC for comparing the exothermic behaviors. Exothermic onset temperatures were determined to be 120 °C and 80 °C by dynamic scanning and isothermal test, respectively. The assessment successfully explained fires and explosions in an ABS powder dryer and an ABS extruder.

  18. Dicty_cDB: FC-AB09 [Dicty_cDB

    Full Text Available /dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AB/FC-AB09Q.Seq.d/ Representative seq. ID ...FC-AB09F (Link to Original site) Representative DNA sequence >FC-AB09 (FC-AB09Q) /CSM/FC/FC-AB/FC-AB09Q.Seq....QNQKKKKKKKKKKKKKKKKKK Translated Amino Acid sequence (All Frames) Frame A: desashkqlckiynkihyliifinfvlvvdlyp...0.00 m_ : 1.00 72.0 %: nuclear 16.0 %: cytoplasmic 8.0 %: mitochondrial 4.0 %: cytoskeletal >> prediction fo...kkkrkktkpkekkkkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits)

  19. Dicty_cDB: FCL-AB19 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AB19 (Link to dictyBase) - - - Contig-U15232-1 FCL-AB19Z ...(Link to Original site) - - FCL-AB19Z 697 - - - - Show FCL-AB19 Library FCL (Link to library) Clone ID FCL-A... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AB/FCL-AB19Q.Seq.d/ Representative seq. ID FCL-...AB19Z (Link to Original site) Representative DNA sequence >FCL-AB19 (FCL-AB19Q) /CSM/FCL/FCL-AB/FCL-...KLINFSIFQ* Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value FCL-

  20. Hydrogenation of AB5 and AB2 metal hydride alloys studied by in situ X-ray diffraction

    Highlights: • Hydrogenation process of an AB5 alloy and two AB2 alloys were studied by quasi in-situ XRD. • In both AB5 and AB2 metal alloy, hydrogen occupation sites on the half-plane were taken first. • In the C14/C15 mixed alloy, C14 phase is the main hydrogen storage phase with a lower equilibrium pressure. • In the C14/C15 mixed alloy, C15 phase is the catalyst hydrogen storage phase with a higher equilibrium pressure. • Small amount of C15 was hydrided first but not completed until C14 phase was fully hydrided. - Abstract: The evolution of lattice constants and abundances of metal (α) and metal hydride (β) phases during the hydrogenation process of an AB5 alloy with a CaCu5 crystal structure, an AB2 alloy with a predominating C14 structure, and a C14/C15-mixed AB2 alloy were reported. The preferred hydrogen insertion sites at different states of charge in both the α and β phases were studied based on the lattice parameter changes during hydrogenation. During the hydrogenation of the AB5 alloy, the ratio between lattice parameters a and c (a/c ratio) in the α phase decreases, stabilizes, and then decreases again while that in the β phase decreases and then stabilizes. The trends in unit cell volume changes are increasing, plateauing, and increasing again in the α phase and increasing followed by plateauing in the β phase as the hydrogenation level increases. In the C14-predominant AB2 alloy, the a/c ratio in the α phase increases at the beginning and then stabilizes while that in the β phase remains about the same and then increases during the addition of hydrogen. Moreover, the unit cell volume in the α phase increases slightly during hydrogenation, comparing to the increasing, decreasing, and then increasing trend in the β phase. In the C14/C15 mixed AB2 alloy, hydrogenation of the C15 phase starts at the beginning and promotes the hydrogenation of the C14 phase. The C14 phase, as the main hydrogen storage phase, completes hydrogenation

  1. Study of the mechanical properties of recycled abs and recovery throught mixing with SEBS

    Peydro, M. A.; Juárez Varón, David; Samuel SANCHEZ-CABALLERO; Pla-Ferrando, R

    2014-01-01

    Recovery of recycled acrylonitrile butadiene styrene (ABS) through mixing with styrene-ethylene/butylene- styrene (SEBS) has been studied in this paper. To simulate recycled ABS, virgin ABS was processed through 5 cycles, at extreme processing temperatures, 220 oC and 260 oC. The virgin ABS, the virgin SEBS, the recycled ABS and the mixtures were mechanically characterized after the various cycles of reprocessing in order to evaluate their corresponding properties and correlate them with the...

  2. Ab Initio Studies of Stratospheric Ozone Depletion Chemistry

    Lee, Timothy J.; Head-Gordon, Martin; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    An overview of the current understanding of ozone depletion chemistry, particularly with regards the formation of the so-called Antarctic ozone hole, will be presented together with an outline as to how ab initio quantum chemistry can be used to further our understanding of stratospheric chemistry. The ability of modern state-of-the art ab initio quantum chemical techniques to characterize reliably the gas-phase molecular structure, vibrational spectrum, electronic spectrum, and thermal stability of fluorine, chlorine, bromine and nitrogen oxide species will be demonstrated by presentation of some example studies. The ab initio results will be shown to be in excellent agreement with the available experimental data, and where the experimental data are either not known or are inconclusive, the theoretical results are shown to fill in the gaps and to resolve experimental controversies. In addition, ab initio studies in which the electronic spectra and the characterization of excited electronic states of halogen oxide species will also be presented. Again where available, the ab initio results are compared to experimental observations, and are used to aid in the interpretation of experimental studies.

  3. The over-expression of two transcription factors, ABS5/bHLH30 and ABS7/MYB101, leads to upwardly curly leaves.

    Rui An

    Full Text Available Proper leaf development is essential for plant growth and development, and leaf morphogenesis is under the control of intricate networks of genetic and environmental cues. We are interested in dissecting these regulatory circuits genetically and report here the isolation of two Arabidopsis dominant mutants, abnormal shoot5-1D (abs5-1D and abs7-1D identified through activation tagging screens. Both abs5-1D and abs7-1D display an intriguing upwardly curly leaf phenotype. Molecular cloning showed that the elevated expression of a bHLH transcription factor ABS5/T5L1/bHLH30 or a MYB transcription factor ABS7/MYB101 is the cause for the abnormal leaf phenotypes found in abs5-1D or abs7-1D, respectively. Protoplast transient expression assays confirmed that both ABS5/T5L1 and ABS7/MYB101 are targeted to the nucleus. Interestingly, the expression domains of auxin response reporter DR5::GUS were abnormal in leaves of abs5-1D and ABS5/T5L1 over-expression lines. Moreover, cotyledon venation analysis showed that more areoles and free-ending veins are formed in abs5-1D. We found that the epidermis-specific expressions of ABS5/T5L1 or ABS7/MYB101 driven by the Arabidopsis Meristem Layer 1 promoter (PAtML1 were sufficient to recapitulate the curly leaf phenotype of abs5-1D or abs7-1D. In addition, PAtML1::ABS5 lines exhibited similar changes in DR5::GUS expression patterns as those found in 35S-driven ABS5/T5L1 over-expression lines. Our work demonstrated that enhanced expressions of two transcription factors, ABS5/T5L1 and ABS7/MYB101, are able to alter leaf lamina development and reinforce the notion that leaf epidermis plays critical roles in regulating plant organ morphogenesis.

  4. Ab initio simulation of transport phenomena in rarefied gases.

    Sharipov, Felix; Strapasson, José L

    2012-09-01

    Ab initio potentials are implemented into the direct simulation Monte Carlo (DSMC) method. Such an implementation allows us to model transport phenomena in rarefied gases without any fitting parameter of intermolecular collisions usually extracted from experimental data. Applying the method proposed by Sharipov and Strapasson [Phys. Fluids 24, 011703 (2012)], the use of ab initio potentials in the DSMC requires the same computational efforts as the widely used potentials such as hard spheres, variable hard sphere, variable soft spheres, etc. At the same time, the ab initio potentials provide more reliable results than any other one. As an example, the transport coefficients of a binary mixture He-Ar, viz., viscosity, thermal conductivity, and thermal diffusion factor, have been calculated for several values of the mole fraction. PMID:23030889

  5. Surface Modification of AB2. and AB5 Hydrogen Storage Alloy Electrodes by the Hot-Charging Treatment

    2001-01-01

    The effect of the hot-charging treatment on the performance ofAB2 and AB5 hydrogen storage alloy electrodes was investigated. The result showed that the treatment can markedly improve the voltage plateau ratio (VPR), the high rate discharge ability (HRDA), the diffusion coefficient of hydrogen DH and the discharge capacity of the AB2 hydrogen storage alloy electrode. The SEM analysis showed that the hot-charging treatment brings about a Ni-rich surface due to the dissolution of Zr oxides. It is also very helpful for the improvement of the kinetic properties of AB2 hydrogen storage alloy electrode because the microcracking o.f the surface results in fresh surface. This can be the basic modification treatment for NiMH battery used in electric vehicles (EVs) in the future. But for AB5 type alloys, the treatment has the disadvantage of impairing the comprehensive electrochemical properties, because the surface of the alloy may be corroded during the treatment. The mechanism of the surface modification of the electrode is also proposed.

  6. Stimulation of UvrD helicase by UvrAB.

    Atkinson, John; Guy, Colin P; Cadman, Chris J; Moolenaar, Geri F; Goosen, Nora; McGlynn, Peter

    2009-04-01

    Helicases play critical roles in all aspects of nucleic acid metabolism by catalyzing the remodeling of DNA and RNA structures. UvrD is an abundant helicase in Escherichia coli with well characterized functions in mismatch and nucleotide excision repair and a possible role in displacement of proteins such as RecA from single-stranded DNA. The mismatch repair protein MutL is known to stimulate UvrD. Here we show that the nucleotide excision repair proteins UvrA and UvrB can together stimulate UvrD-catalyzed unwinding of a range of DNA substrates containing strand discontinuities, including forked DNA substrates. The stimulation is specific for UvrD, as UvrAB failed to stimulate Rep helicase, a UvrD homologue. Moreover, although UvrAB can promote limited strand displacement, stimulation of UvrD did not require the strand displacement function of UvrAB. We conclude that UvrAB, like MutL, modulate UvrD helicase activity. This stimulation likely plays a role in DNA strand and protein displacement by UvrD in nucleotide excision repair. Promotion of UvrD-catalyzed unwinding of nicked duplexes by UvrAB may also explain the need for UvrAB and UvrD in Okazaki fragment processing in cells lacking DNA polymerase I. More generally, these data support the idea that helicase activity is regulated in vivo, with helicases acting as part of multisubunit complexes rather than in isolation. PMID:19208629

  7. Simplest AB-Thermonuclear Space Propulsion and Electric Generator

    Bolonkin, Alexander

    2007-01-01

    The author applies, develops and researches mini-sized Micro- AB Thermonuclear Reactors for space propulsion and space power systems. These small engines directly convert the high speed charged particles produced in the thermonuclear reactor into vehicle thrust or vehicle electricity with maximum efficiency. The simplest AB-thermonuclear propulsion offered allows spaceships to reach speeds of 20,000 50,000 km/s (1/6 of light speed) for fuel ratio 0.1 and produces a huge amount of useful elect...

  8. Utveckling av ergoterapitjänster vid Helsingfors ergoterapi Ab

    Sandells, Linn

    2015-01-01

    Syftet med examensarbetet är att ta fram kvalitativa rekommendationer på ergoterapitjänster för barn i behov av särskilt stöd. Det har gjorts genom en processinriktad metod, rekommendationerna på ergoterapitjänster har tagits fram för Helsingfors ergoterapi Ab. Aktivitetsrättvisa är den teoretiska referensramen i arbetet. Den frågeställning som besvarats är vilka ergoterapitjänster kan rekommenderas till Helsingfors ergoterapi Ab. För att uppnå resultatet har materialinsamling och intervjuer ...

  9. Towards new horizons in ab initio nuclear structure theory

    We review recent advances in ab initio nuclear structure theory, which have changed the horizons of this field. Starting from chiral effective field theory to construct the nuclear Hamiltonian and the similarity renormalization group to further soften it, we address several many-body approaches that have seen major developments over the past few years. We show that the domain of ab initio nuclear structure theory has been pushed well beyond the p-shell and that quantitative QCD-based predictions are becoming possible all the way from the proton to the neutron drip line up into the medium-mass regime. (authors)

  10. Use of ab initio quantum chemical methods in battery technology

    Deiss, E. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1997-06-01

    Ab initio quantum chemistry can nowadays predict physical and chemical properties of molecules and solids. An attempt should be made to use this tool more widely for predicting technologically favourable materials. To demonstrate the use of ab initio quantum chemistry in battery technology, the theoretical energy density (energy per volume of active electrode material) and specific energy (energy per mass of active electrode material) of a rechargeable lithium-ion battery consisting of a graphite electrode and a nickel oxide electrode has been calculated with this method. (author) 1 fig., 1 tab., 7 refs.

  11. P-V Relation for Mercuric Calcogenides: Ab Initio Method

    G. Misra

    2011-01-01

    Full Text Available Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P, volume (V and temperature (T that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This ab initio method is extended to derive the equation of state for Mercuric Calcogenides. The present equation of state has also been tested for the prediction of End Point. The computed results compare well with Quantum statistical data.

  12. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1962. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses (≥ 100 mrem/quarter) is for the whole of AB Atomenergi during this year 74. 2 manrem corresponding to about 50 mrem/year and person or 1 % of the maximum permissible dose. 32500 gamma films and 6200 neutron films have been evaluated. The total number of urine analyses is 2700 and of whole body measurements 10

  13. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1963. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses during the year is for AB Atomenergi 64.2 manrem which, distributed over the whole company personnel, corresponds to about 40 mrem per year and person or about 1 % of the maximum permissible dose. 37800 gamma films and 6700 neutron films have been evaluated. The total number of urine analyses is 3603 and of whole body measurements 211

  14. Intern kontroll : - En studie om Schroff Scandinavia ABs interna kontroll

    Huldt, Martin; Björksved, Patrick

    2014-01-01

    Sammanfattning: ”Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll” Datum:  2014-06-11 Nivå: Kandidatuppsats i företagsekonomi, 15 ECTS Institution: Akademin för Ekonomi, Samhälle och Teknik, EST,                 Mälardalen Högskola Författare: Patrick Björksved, Martin Huldt Titel: Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll Handledare : Magnus Linderström Nyckelord: Intern kontroll, intern revision, intern styrning, COSO-modellen, Lean product...

  15. Bruksmakt och maktbruk : Robertsfors AB 1897-1968

    Holmström, Per

    1988-01-01

    This thesis studies seven strategic decisions made in the family-owned forestry company Robertsfors AB, in Northern Sweden. During the present century Ro­bertsfors AB has developed from a patriarchally concern controlled into a capi­talistic industrial company. This also meant a radical change in the decision­making process. Two factors were decisive in this process: the managing direc­tor's values, and altered power relationships both within the company and exter­nally in relation to e g sta...

  16. The optimal placement of up and ab – a comparison

    Dehé, Nicole

    2005-01-01

    The particle verb construction (PVC), also referred to in the literature as phrasal verb or separable complex verb, occurs in most if not all of the Germanic languages. The work presented here deals with a comparison of the transitive PVC in English and German. In English, the construction occurs in two alternating word orders (They called off the concert vs. They called the concert off ). In German, on the other hand, only one order is possible (Sie sagten das Konzert ab vs. *Sie sagten ab das...

  17. Recent achievements in ab initio modelling of liquid water

    Khaliullin, Rustam Z

    2013-01-01

    The application of newly developed first-principle modeling techniques to liquid water deepens our understanding of the microscopic origins of its unusual macroscopic properties and behaviour. Here, we review two novel ab initio computational methods: second-generation Car-Parrinello molecular dynamics and decomposition analysis based on absolutely localized molecular orbitals. We show that these two methods in combination not only enable ab initio molecular dynamics simulations on previously inaccessible time and length scales, but also provide unprecedented insights into the nature of hydrogen bonding between water molecules. We discuss recent applications of these methods to water clusters and bulk water.

  18. Comparative study of intact A7 MoAb and F(ab')2 fragments for radioimmunoimaging of human colon cancer in nude mice

    Differences of pharmacokinetics and tumor imaging ability between intact monoclonal antibody A7 (A7 MoAb) and F(ab')2 fragments were studied in human colon cancer (LS-174T)-bearing nude mouse. First of all, we examined the yield and the immunoreactivity of F(ab')2 fragments after treatment with ficin as a function of time. The yield of F(ab')2 fragments reached about 50% after ficin treatment for 8 h, and the F(ab')2 retained about 80% of the immunoreactivity of the corresponding MoAb. Longer digestion with ficin produced smaller fragments (less than 92 kDa) with a lower yield and most of the immunoreactivity was lost. In pharmacokinetics studies, the F(ab')2 was preferentially taken up by the tumor, was cleared more rapidly from the blood circulation and seemed to have less non-specific tissue binding than intact A7 MoAb. In addition, the tumor image obtained at an early time using 131I-F(ab')2 was much superior in quality to that with intact 131I-A7 MoAb. The use of F(ab')2 fragments may be effective for tumor diagnosis and therapy. (author)

  19. GJ 282 AB (WDS 07400-0336 AB = BGH 3 AB) and GICLAS 112-29: A Very Wide System in Process of Dissociation

    Rica, F. M.; Benavides, R.

    2016-04-01

    Very wide binaries are interesting objects that shed light on the binary formation process and their dynamical evolution. Poveda et al. (2009) studied the possible physical relation of the near (14.2 pc) and wide (~58") binary star GJ 282 AB and the extremely wide (1.09º; ~55,000 AU) companion, NLTT 18149, and they concluded that this very wide system is in the process of dynamical disintegration. In this work, we confirm the same conclusion but using a different method. We first study dynamically GJ 282 AB, confirmed that it is a bound system and then we determine possible orbital solutions. Later, we calculate the relative velocity of NLTT 18149 with respect to the GJ 282 AB's center mass using their (U, V, W) galactocentric velocity. The relative velocity, Vrel = 1.98 ± 0.16 km s-1, is much larger than the escape velocity (0.25 ± 0.01 km s-1). Therefore, with a significance level of 11s, we also conclude that this very wide system is in a process of dynamical disintegration.

  20. Ab initio calculations of mechanical properties: Methods and applications

    Pokluda, J.; Černý, Miroslav; Šob, Mojmír; Umeno, Y.

    2015-01-01

    Roč. 73, AUG (2015), s. 127-158. ISSN 0079-6425 R&D Projects: GA ČR(CZ) GAP108/12/0311 Institutional support: RVO:68081723 Keywords : Ab initio methods * Elastic moduli * Intrinsic hardness * Stability analysis * Theoretical strength * Intrinsic brittleness/ductility Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 27.417, year: 2014

  1. Discovery of New Substrates for LuxAB Bacterial Bioluminescence.

    Jiang, Tianyu; Wang, Weishan; Wu, Xingkang; Wu, Wenxiao; Bai, Haixiu; Ma, Zhao; Shen, Yuemao; Yang, Keqian; Li, Minyong

    2016-08-01

    In this article, four novel substrates with long halftime have been designed and synthesized successfully for luxAB bacterial bioluminescence. After in vitro and in vivo biological evaluation, these molecules can emit obvious bioluminescence emission with known bacterial luciferase, thus indicating a new promising approach to developing the bacterial bioluminescent system. PMID:26896339

  2. Cyanogen Azide. Ionization Potentials and Ab Initio SCF MO Calculation

    Bak, Börge; Jansen, Peter; Stafast, Herbert

    1975-01-01

    The Ne(I) and He(I) photoelectron(PE) spectra of cyanogen azide, NCN3, have been recorded at high resolution. Their interpretation is achieved by comparison with the PE spectrum of HN3 and an ab initio LCGO SCF MO calculation. Deviations from Koopmans' theorem of quite different magnitudes are fo...

  3. Relaxation of Small Molecules: an ab initio Study

    CAO Yi-Gang; JIAO Zheng-Kuan; A. Antons; K. Schroeder; S. Blügel2

    2002-01-01

    Using an ab initio total energy and force method, we have relaxed several group IV and group V elementalclusters, in detail the arsenic and antimony dimers, silicon, phosphorus, arsenic and antimony tetramers. The obtainedbond lengths and cohesive energies are more accurate than other calculating methods, and in excellent agreement withthe experimental results.

  4. Relaxation of Small Molecules:an ab initio Study

    CAOYi-Gang; A.Antons; 等

    2002-01-01

    Using an ab inito total energy and force method,we have relaxed several group IV and group V elemental clusters,in detail the arsenic and antimony dimers,silicon,phosphorus,arsenic and antimony tetraners,The obtained bond lengths and cohesive energies are more accurate than other calculating methods,and in excellent agreement with the experimental results.

  5. Ab initio study of phase equilibria in TiCx

    Korzhavyi, P.A.; Pourovskii, L.V.; Hugosson, H.W.;

    2002-01-01

    The phase diagram for the vacancy-ordered structures in the substoichiometric TiCx (x = 0.5-1.0) has been established from Monte Carlo simulations with the long-range pair and multisite effective interactions obtained from ab initio calculations. Three ordered superstructures of vacancies (Ti2C, ...

  6. Environmentally friendly process for nickel electroplating of ABS

    Bazzaoui, M.; Martins, J. I.; Bazzaoui, E. A.; Albourine, A.

    2012-08-01

    Nickel electroplating of acrylonitrile butadiene styrene (ABS) plastic has been achieved successfully without any chromium or palladium pretreatment. Once the ABS is coated with polypyrrole (PPy), the sample may be electroplated. The process is fast, economic and involves three stages. Firstly, chemical deposition of PPy on ABS, secondly, copper deposition and finally nickel electroplating. A homogenous and adherent PPy has been synthesized chemically on ABS plate by using pyrrole as monomer and iron (III) chloride as oxidant. Copper and nickel were deposited galvanostatically from industrial plating baths. The metallic coatings were homogeneous and the adherence was estimated at 100%. The thickness of copper and nickel depend on the electrolysis time. As the current density increases, the Cu and Ni thickness raises. This result was confirmed from SEM characterization and RX map. The Ni coating is characterized by a globular structure with globules of different sizes. Energy dispersive X-ray spectroscopy (EDS) analysis shows the presence of Ni with some amount of carbon and oxygen due to the nickel oxides and contaminant from the bath solution.

  7. A-B Distinction in a Sample of Prominent Psychotherapists

    Geller, Jesse D.; Berzins, Juris I.

    1976-01-01

    A sample of prominent psychotherapists were asked to fill out the A-B therapist "type" scale and comment on their possible differential effectiveness in treating schizoid/schizophrenic versus neurotic patients. The data suggest that B therapists desire and seek more complex and exciting sensory-cognitive inputs during therapy hours than A…

  8. AB 1725 Model Accountability System. California Community Colleges. Revised.

    California Community Colleges, Sacramento. Board of Governors.

    This report proposes a model accountability system for the California community colleges to comply with the directives of Assembly Bill 1725 (AB 1725). The purpose of the accountability system is to provide colleges and districts, the board of governors, and the California legislature with information that will allow for the continued improvement…

  9. Ultra-Low Voltage Class AB Switched Current Memory Cell

    Igor, Mucha

    1996-01-01

    This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process with...

  10. Protective mAbs and Cross-Reactive mAbs Raised by Immunization with Engineered Marburg Virus GPs.

    Marnie L Fusco

    2015-06-01

    Full Text Available The filoviruses, which include the marburg- and ebolaviruses, have caused multiple outbreaks among humans this decade. Antibodies against the filovirus surface glycoprotein (GP have been shown to provide life-saving therapy in nonhuman primates, but such antibodies are generally virus-specific. Many monoclonal antibodies (mAbs have been described against Ebola virus. In contrast, relatively few have been described against Marburg virus. Here we present ten mAbs elicited by immunization of mice using recombinant mucin-deleted GPs from different Marburg virus (MARV strains. Surprisingly, two of the mAbs raised against MARV GP also cross-react with the mucin-deleted GP cores of all tested ebolaviruses (Ebola, Sudan, Bundibugyo, Reston, but these epitopes are masked differently by the mucin-like domains themselves. The most efficacious mAbs in this panel were found to recognize a novel "wing" feature on the GP2 subunit that is unique to Marburg and does not exist in Ebola. Two of these anti-wing antibodies confer 90 and 100% protection, respectively, one hour post-exposure in mice challenged with MARV.

  11. Preparation, biodistribution, and dosimetry of 188Re-Labeled MoAb ior cea1 and its f(ab')2 fragments by avidin-biotin strategy

    The biotinylated monoclonal antibody (MoAb) ior cea1 and its F(ab')2 fragments were labeled with Re-188 by combination of avidin-biotin strategy. 188Re-MoAb, 188Re-MoAb-biotin, 188Re-F(ab')2, and 188Re-F(ab')2-biotin preparations were produced for these studies with specific activities of 1.30±0.18 GBq/mg and from instant freeze-dried kit formulations using ethane-1-hydroxy-1,1-diphosphonic acid (EHDP) as a weak competing ligand. There were no significant differences (p>0.05) between the biodistribution in mice of biotinylated and unbiotinylated 188Re-labeled immunoconjugates. When avidin was injected as a chase after injection of 188Re-MoAb-biotin or 188Re-F(ab')2-biotin, the blood radioactivity level decreased approximately 75% (cumulated activity) and the effective dose decreased almost 25% with respect to that of the radioimmunoconjugates in which the chase effect was not used. Our results suggest that 188Re-labeled biotinylated MoAb ior cea1 and its F(ab')2 fragments prepared by this method are stable complexes in vivo

  12. Solar Powered Vapor Absorption System Using Propane And Alkylated Benzene Ab300 Oil

    Al-Dadah, R.K.; Jackson, G.; Rezk, Ahmed

    2011-01-01

    Abstract This paper describes experimental work on a solar assisted vapour absorption air conditioning system using Propane (refrigerant) and Alkylated Benzene (AB300?refrigeration lubrication oil, absorbent). Preliminary experiments to assess the miscibility of propane in various lubricating oils namely Shell Clavus oils 32 and 64 and Alkylated Benzene oils AB150 and AB300 indicated that Propane is most miscible in Alkylated Benzene AB300. The vapour absorption system is a single ...

  13. Augmented wave ab initio EFG calculations: some methodological warnings

    Errico, Leonardo A. [Departamento de Fisica-IFLP (CONICET), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CC67 (1900) La Plata (Argentina); Renteria, Mario [Departamento de Fisica-IFLP (CONICET), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CC67 (1900) La Plata (Argentina); Petrilli, Helena M. [Instituto de Fisica-DFMT, Universidade de Sao Paulo, C.P. 66318, 05315-970 Sao Paulo, SP (Brazil)]. E-mail: hmpetril@macbeth.if.usp.br

    2007-02-01

    We discuss some accuracy aspects inherent to ab initio electronic structure calculations in the understanding of nuclear quadrupole interactions. We use the projector augmented wave method to study the electric-field gradient (EFG) at both Sn and O sites in the prototype cases SnO and SnO{sub 2}. The term ab initio is used in the standard context of the also called first principles methods in the framework of the Density Functional Theory. As the main contributions of EFG calculations to problems in condensed matter physics are related to structural characterizations on the atomic scale, we discuss the 'state of the art' on theoretical EFG calculations and make a brief critical review on the subject, calling attention to some fundamental theoretical aspects.

  14. Augmented wave ab initio EFG calculations: some methodological warnings

    We discuss some accuracy aspects inherent to ab initio electronic structure calculations in the understanding of nuclear quadrupole interactions. We use the projector augmented wave method to study the electric-field gradient (EFG) at both Sn and O sites in the prototype cases SnO and SnO2. The term ab initio is used in the standard context of the also called first principles methods in the framework of the Density Functional Theory. As the main contributions of EFG calculations to problems in condensed matter physics are related to structural characterizations on the atomic scale, we discuss the 'state of the art' on theoretical EFG calculations and make a brief critical review on the subject, calling attention to some fundamental theoretical aspects

  15. Chemical and Electrochemical Metallic Covering of ABS polymers

    Florentina Cziple

    2009-10-01

    Full Text Available The aim of this paper is the deposition of metallic layers on the surface of ABS plastic material, by means of two consecutive procedures, namely: the first is represented by the conductibility through chemical or electro-chemical metallic covering of the polymeric support and the second procedure is the electrodeposition of the metal through galvanization. The chemical mehtod consists in the submission of ABS polymers to some conductibility operations of the plastic material surface through chemical copper plating (chemical roughing, degreasing with ultra-sounds, chemical sensitivation, activation and proper conductibility of the material surface. The electrochemical deposition of nickel was made on the plastic material activated in the mixture solution of graphite with potassium carbonate.

  16. Ab Initio Nuclear Structure Theory: From Few to Many

    We summarize recent advances in ab initio nuclear structure theory, aiming to connect few- and many-body systems in a coherent theoretical framework. Starting from chiral effective field theory to construct the nuclear Hamiltonian and the similarity renormalization group to soften it, we address several many-body approaches that have seen major developments over the past few years. We show that the domain of ab initio nuclear structure theory has been pushed well beyond the p-shell and that quantitative predictions connected to QCD via chiral effective field theory are becoming possible all the way from the proton to the neutron drip line up into the medium-mass regime. (author)

  17. Serine Proteases an Ab Initio Molecular Dynamics Study

    De Santis, L

    1999-01-01

    In serine proteases (SP's), the H-bond between His-57 and Asp-102, and that between Gly-193 and the transition state intermediate play a crucial role for enzymatic function. To shed light on the nature of these interactions, we have carried out ab initio molecular dynamics simulations on complexes representing adducts between the reaction intermediate and elastase (one protein belonging to the SP family). Our calculations indicate the presence of a low--barrier H-bond between His-57 and Asp-102, in complete agreement with NMR experiments on enzyme--transition state analog complexes. Comparison with an ab initio molecular dynamics simulation on a model of the substrate--enzyme adduct indicates that the Gly-193--induced strong stabilization of the intermediate is accomplished by charge/dipole interactions and not by H-bonding as previously suggested. Inclusion of the protein electric field in the calculations does not affect significantly the charge distribution.

  18. Understanding phonon transport in thermoelectric materials using ab initio approaches

    Broido, David

    Good thermoelectric materials have low phonon thermal conductivity, kph. Accurate theories to describe kph are important components in developing predictive models of thermoelectric efficiency that can help guide synthesis and measurement efforts. We have developed ab initio approaches to calculate kph, in which phonon modes and phonon scattering rates are computed using interatomic force constants determined from density functional theory, and a full solution of the Boltzmann transport equation for phonons is implemented. A recent approach to calculate interatomic force constants using ab initio molecular dynamics has yielded a good description of the thermal properties of Bi2Te3. But, the complexity of new promising candidate thermoelectric materials introduces computational challenges in assessing their thermal properties. An example is germanane, a germanium based hydrogen-terminated layered semiconductor, which we will discuss in this talk.

  19. The density matrix renormalization group for ab initio quantum chemistry

    Wouters, Sebastian

    2014-01-01

    During the past 15 years, the density matrix renormalization group (DMRG) has become increasingly important for ab initio quantum chemistry. Its underlying wavefunction ansatz, the matrix product state (MPS), is a low-rank decomposition of the full configuration interaction tensor. The virtual dimension of the MPS, the rank of the decomposition, controls the size of the corner of the many-body Hilbert space that can be reached with the ansatz. This parameter can be systematically increased until numerical convergence is reached. The MPS ansatz naturally captures exponentially decaying correlation functions. Therefore DMRG works extremely well for noncritical one-dimensional systems. The active orbital spaces in quantum chemistry are however often far from one-dimensional, and relatively large virtual dimensions are required to use DMRG for ab initio quantum chemistry (QC-DMRG). The QC-DMRG algorithm, its computational cost, and its properties are discussed. Two important aspects to reduce the computational co...

  20. Ab-initio calculations on melting of thorium

    Mukherjee, D.; Sahoo, B. D.; Joshi, K. D.; Kaushik, T. C.; Gupta, Satish C.

    2016-05-01

    Ab-initio molecular dynamics study has been performed on face centered cubic structured thorium to determine its melting temperature at room pressure. The ion-electron interaction potential energy calculated as a function of temperature for three volumes (a0)3 and (1.02a0)3 and (1.04a0)3 increases gradually with temperature and undergoes a sharp jump at ~2200 K, ~2100 K and ~1800 K, respectively. Here, a0 = 5.043 Å is the equilibrium lattice parameter at 0 K obtained from ab-initio calculations. These jumps in interaction energy are treated as due to the onset of melting and corresponding temperatures as melting point. The melting point of 2100 K is close to the experimental value of 2023K. Further, the same has been verified by plotting the atomic arrangement evolved at various temperatures and corresponding pair correlation functions.

  1. Kostnadseffektivering av logistikkostnader : Rolls-Royce Oy Ab

    Nordlund, Lucas

    2013-01-01

    Rolls-Royce Oy Ab som fungerar som uppdragsgivare i detta examensarbete, är ett företag med internationell verksamhet. Företaget hör till det globala Rolls-Royce plc som verkar inom många olika delområden i länder runt om i hela världen. Enheten i Karleby verkar inom Rolls-Royce Marine koncernen och tillverkar vattenjetaggregat. I och med att Rolls-Royce Oy Ab hör till Marine koncernen, medför det att man följer bestämmelser och standarder som följs i hela Marine koncernen. Till dessa gem...

  2. Molexpl: a tool for ab initio data exploration and visualization

    Wang, Xueying; Onofrio, Nicolas,; Strachan, Alejandro

    2015-01-01

    Density functional theory (DFT) based on ab initio theory, is a powerful method to resolve the electronic structure of atoms, molecules and solids. However, in practical, DFT is limited to few hundreds of atoms. To overcome this limitation, researchers have developed empirical interatomic potentials implemented in molecular dynamics (MD) simulations. MD ignores the movements of electrons and describes bonding and non-bonding interaction as a function of the distance between atoms called force...

  3. Ab initio molecular dynamics simulation of laser melting of silicon

    Silvestrelli, P.-L.; Alavi, A; Parrinello, M.; Frenkel, D

    1996-01-01

    The method of ab initio molecular dynamics, based on finite temperature density functional theory, is used to simulate laser heating of crystal silicon. We have found that a high concentration of excited electrons dramatically weakens the covalent bond. As a result, the system undergoes a melting transition to a metallic state. In contrast to ordinary liquid silicon, the new liquid is characterized by a high coordination number and a strong reduction of covalent bonding effects.

  4. Towards an ab initio description of magnetism in ionic solids

    Illas, F.; Casanovas, J.; García-Bach, M. A.; Caballol, R.; Castell, O.

    1993-11-01

    The physical contributions to the KNiF3 magnetic exchange coupling integral have been obtained from specially designed ab initio cluster model calculations. Three important mechanisms have been identified. These are the delocalization of the magnetic orbitals into the anion ``p'' band, the variational contribution of the second-order interactions, and the many-body terms ``hidden'' in the two-body operator and the Heisenberg Hamiltonian.

  5. Social Media Marketing : CASE: OY SUOMEN LYYRA AB

    Eriksson, Irene

    2012-01-01

    This bachelor thesis was commissioned by Oy Suomen Lyyra Ab, the largest student online media and student card producer for higher education students in Finland. The the-sis objective was to understanding the current social media situation and activity among the students of higher education in Finland, the social media networks that the case company currently uses as well as understanding how to use these networks for successful marketing activities. The quantitative research was conducted in...

  6. Ab initio simulation of helium inside carbon nanotubes

    In present work we consider the complex behaviour of quantum liquids like liquid He-4 inside carbon nanotubes. Interactions between helium atoms and carbon atoms of the short-length atomistic model and model with periodical boundary conditions of carbon nanotube were studied via ab initio quantum simulations. Effects of geometrical confinement of the tube on the He behaviour inside CNT (13,0) have been explored. Nanotubes with typical average diameter of 10 angstroms are under consideration.

  7. The density matrix renormalization group for ab initio quantum chemistry

    Wouters, Sebastian

    2015-01-01

    During the past 15 years, the density matrix renormalization group (DMRG) has become increasingly important for ab initio quantum chemistry. It is used as a numerically exact solver for highly correlated regions in molecules. While the method works extremely well for one-dimensional systems, the correlated regions of interest are often far from one-dimensional. In this introductory talk, I will discuss the DMRG algorithm from a quantum information perspective, how quantum information theory h...

  8. Ab Initio Modeling of Ecosystems with Artificial Life

    Adami, C.

    2002-01-01

    Artificial Life provides the opportunity to study the emergence and evolution of simple ecosystems in real time. We give an overview of the advantages and limitations of such an approach, as well as its relation to individual-based modeling techniques. The Digital Life system Avida is introduced and prospects for experiments with ab initio evolution (evolution "from scratch"), maintenance, as well as stability of ecosystems are discussed.

  9. P-V Relation for Mercuric Calcogenides: Ab Initio Method

    G. Misra; S. Tenguria; Gautam, M.

    2011-01-01

    Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P), volume (V) and temperature (T) that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This a...

  10. Erythema Ab Igne in Three Girls with Anorexia Nervosa.

    Dessinioti, Clio; Katsambas, Andreas; Tzavela, Eleni; Karountzos, Vasileios; Tsitsika, Artemis K

    2016-03-01

    We present three girls with the eating disorder anorexia nervosa (AN) presenting with erythema ab igne (EAI), a benign, reticular, erythematous dermatosis caused by repeated prolonged skin exposure to mild heat. AN has been associated with abnormal peripheral vascular response to cold, vasoconstriction of the limbs, low hand blood flow, exaggerated response to cold stimuli, subnormal core temperature, and a general feeling of cold that may encourage prolonged heat exposure and induce EAI. PMID:26822102

  11. Structure models: from shell model to ab initio methods

    Bacca, Sonia

    2016-01-01

    A brief review of models to describe nuclear structure and reactions properties is presented, starting from the historical shell model picture and encompassing modern ab initio approaches. A selection of recent theoretical results on observables for exotic light and medium-mass nuclei is shown. Emphasis is given to the comparison with experiment and to what can be learned about three-body forces and continuum properties.

  12. Ab-initio calculations for dilute magnetic semiconductors

    Belhadji, Brahim

    2008-01-01

    This thesis focusses on ab-initio calculations for the electronic structure and the magnetic properties of dilute magnetic semiconductors (DMS). In particular we aim at the understanding of the complex exchange interactions in these systems. Our calculations are based on density functional theory, being ideally suited for a description of the material specific properties of the considered DMS. Moreover we use the KKR Green function method in connection with the coherent potential approximatio...

  13. Integrated Design of Antibodies for Systems Biology Using Ab Designer

    Pisitkun, Trairak; Dummer, Patrick; Somparn, Poorichaya; Hirankarn, Nattiya; Kopp, Jeffrey B.; Knepper, Mark A.

    2014-01-01

    In the current era of large-scale biology, systems biology has evolved as a powerful approach to identify complex interactions within biological systems. In addition to high throughput identification and quantification techniques, methods based on high-quality mono-specific antibodies remain an essential element of the approach. To assist the large-scale design and production of peptide-directed antibodies for systems biology studies, we developed a fully integrated online application, AbDesi...

  14. Innovativeness and innovations utilizations : Oy LM Ericsson Ab

    Saarinen, Vesa

    2010-01-01

    The aim of this action research was to improve the innovativeness amongst the R&D personnel at LM Ericsson Ab in Finland. The main purpose of this study was to understand the background of innovativeness and to practically compare the research results with the actual company situation. Innovativeness is predominantly a personal, internal matter and it is based on the intrinsic motivation of an individual. Creativity, courage and persistent effort are the key elements of innovativeness...

  15. GAUSSIAN 76: An ab initio Molecular Orbital Program

    Binkley, J. S.; Whiteside, R.; Hariharan, P. C.; Seeger, R.; Hehre, W. J.; Lathan, W. A.; Newton, M. D.; Ditchfield, R.; Pople, J. A.

    1978-01-01

    Gaussian 76 is a general-purpose computer program for ab initio Hartree-Fock molecular orbital calculations. It can handle basis sets involving s, p and d-type Gaussian functions. Certain standard sets (STO-3G, 4-31G, 6-31G*, etc.) are stored internally for easy use. Closed shell (RHF) or unrestricted open shell (UHF) wave functions can be obtained. Facilities are provided for geometry optimization to potential minima and for limited potential surface scans.

  16. GAUSSIAN 76: an ab initio molecular orbital program

    Binkley, J. S.; Whiteside, R.; Hariharan, P. C.; Seeger, R.; Hehre, W. J.; Lathan, W. A.; Newton, M. D.; Ditchfield, R.; Pople, J. A.

    1978-06-01

    Gaussian 76 is a general-purpose computer program for ab initio Hartree-Fock molecular orbital calculations. It can handle basis sets involving s, p and d-type gaussian functions. Certain standard sets (STO-3G, 4-31G, 6-31G*, etc.) are stored internally for easy use. Closed shell (RHF) or unrestricted open shell (UHF) wave functions can be obtained. Facilities are provided for geometry optimization to potential minima and for limited potential surface scans.

  17. Der halbunendliche Kristall - Elektronische und optische Eigenschaften ab-initio

    Brodersen, Sven

    2002-01-01

    Es werden die elektronischen und optischen Eigenschaften eines kristallinen Festkörpers unter Berücksichtigung der Oberfläche mit ab-initio Methoden berechnet. Die Behandlung der Oberflächeneffekte in einer Halbraum-Geometrie erzwingt die Darstellung der Wellenfunktionen und der Dielektrischen Funktion (DK) in einer lokalen Basis. Anhand von Volumenkristallen wird die Effizienz von LCAO- Basisfunktionen demonstriert. Die Erweiterung der atomaren Orbitale mit unbesetzten Orbitalen und 'off-sit...

  18. Pressure tracking control of vehicle ABS using piezo valve modulator

    Jeon, Juncheol; Choi, Seung-Bok

    2011-03-01

    This paper presents a wheel slip control for the ABS(anti-lock brake system) of a passenger vehicle using a controllable piezo valve modulator. The ABS is designed to optimize for braking effectiveness and good steerability. As a first step, the principal design parameters of the piezo valve and pressure modulator are appropriately determined by considering the braking pressure variation during the ABS operation. The proposed piezo valve consists of a flapper, pneumatic circuit and a piezostack actuator. In order to get wide control range of the pressure, the pressure modulator is desired. The modulator consists of a dual-type cylinder filled with different substances (fluid and gas) and a piston rod moving vertical axis to transmit the force. Subsequently, a quarter car wheel slip model is formulated and integrated with the governing equation of the piezo valve modulator. A sliding mode controller to achieve the desired slip rate is then designed and implemented. Braking control performances such as brake pressure and slip rate are evaluated via computer simulations.

  19. Monte Carlo simulation of AB-copolymers with saturating bonds

    Chertovich, A V; Khokhlov, A R; Bohr, J

    2003-01-01

    Structural transitions in a single AB-copolymer chain where saturating bonds can be formed between A-and B-units are studied by means of Monte Carlo computer simulations using the bond fluctuation model. Three transitions are found, coil-globule, coil-hairpin and globule-hairpin, depending on the nature of a particular AB-sequence: statistical random sequence, diblock sequence and 'random-complementary' sequence (one-half of such an AB-sequence is random with Bernoulli statistics while the other half is complementary to the first one). The properties of random-complementary sequences are closer to those of diblock sequences than to the properties of random sequences. The model (although quite rough) is expected to represent some basic features of real RNA molecules, i.e. the formation of secondary structure of RNA due to hydrogen bonding of corresponding bases and stacking interactions of the base pairs in helixes. We introduce the notation of RNA-like copolymers and discuss in what sense the sequences studie...

  20. Ab Initio Nuclear Structure and Reaction Calculations for Rare Isotopes

    We have developed a novel ab initio symmetry-adapted no-core shell model (SA-NCSM), which has opened the intermediate-mass region for ab initio investigations, thereby providing an opportunity for first-principle symmetry-guided applications to nuclear structure and reactions for nuclear isotopes from the lightest p-shell systems to intermediate-mass nuclei. This includes short-lived proton-rich nuclei on the path of X-ray burst nucleosynthesis and rare neutron-rich isotopes to be produced by the Facility for Rare Isotope Beams (FRIB). We have provided ab initio descriptions of high accuracy for low-lying (including collectivity-driven) states of isotopes of Li, He, Be, C, O, Ne, Mg, Al, and Si, and studied related strong- and weak-interaction driven reactions that are important, in astrophysics, for further understanding stellar evolution, X-ray bursts and triggering of s, p, and rp processes, and in applied physics, for electron and neutrino-nucleus scattering experiments as well as for fusion ignition at the National Ignition Facility (NIF).

  1. Ab Initio Nuclear Structure and Reaction Calculations for Rare Isotopes

    Draayer, Jerry P. [Louisiana State Univ., Baton Rouge, LA (United States)

    2014-09-28

    We have developed a novel ab initio symmetry-adapted no-core shell model (SA-NCSM), which has opened the intermediate-mass region for ab initio investigations, thereby providing an opportunity for first-principle symmetry-guided applications to nuclear structure and reactions for nuclear isotopes from the lightest p-shell systems to intermediate-mass nuclei. This includes short-lived proton-rich nuclei on the path of X-ray burst nucleosynthesis and rare neutron-rich isotopes to be produced by the Facility for Rare Isotope Beams (FRIB). We have provided ab initio descriptions of high accuracy for low-lying (including collectivity-driven) states of isotopes of Li, He, Be, C, O, Ne, Mg, Al, and Si, and studied related strong- and weak-interaction driven reactions that are important, in astrophysics, for further understanding stellar evolution, X-ray bursts and triggering of s, p, and rp processes, and in applied physics, for electron and neutrino-nucleus scattering experiments as well as for fusion ignition at the National Ignition Facility (NIF).

  2. Studies on the runaway reaction of ABS polymerization process

    Hu, K.-H. [Department of Occupational Safety and Health, Jen-Teh Junior College of Medicine, Nursing and Management, Miaoli, Taiwan (China); Kao, C.-S. [Department of Safety, Health and Environmental Engineering, National United University, Taiwan (China); Duh, Y.-S. [Department of Occupational Safety and Health, Jen-Teh Junior College of Medicine, Nursing and Management, Miaoli, Taiwan (China)], E-mail: yihshingduh@yahoo.com.tw

    2008-11-15

    Taiwan has the largest acrylonitrile-butadiene-styrene (ABS) copolymer production in the world. Preventing on unexpected exothermic reactions and related emergency relief hazard is essential in the safety control of ABS emulsion polymerization. A VSP2 (Vent Sizing Package 2) apparatus is capable of studying both normal and abnormal conditions (e.g., cooling failure, mischarge, etc.) of industrial process. In this study, the scenarios were verified from the following abnormal conditions: loss of cooling, double charge of initiator, overcharge of monomer, without charge of solvent, and external fire. An external fire with constant heating will promote higher self-heat rate and this is recommended as the worst case scenario of emulsion polymerization on butadiene. Cooling failure coupled with bulk system of reactant was determined to be the credible worst case in ABS emulsion polymerization. Finally, the emergency vent sizing based on thermokinetics from VSP associated with DIERS methodology were used for evaluating the vent sizing and compared to that of the industrial plants.

  3. Ab initio calculations for industrial materials engineering: successes and challenges

    Wimmer, Erich; Freeman, Clive; Christensen, Mikael; Wolf, Walter; Saxe, Paul [Materials Design, Inc., PO Box 2000, Angel Fire, NM 87710 (United States); Najafabadi, Reza; Young Jr, George A; Ballard, Jake D; Angeliu, Thomas M; Vollmer, James [Knolls Atomic Power Laboratory, PO Box 1072, Schenectady, NY 12301-1072 (United States); Chambers, James J; Niimi, Hiroaki; Shaw, Judy B, E-mail: ewimmer@materialsdesign.co [Advanced CMOS, Texas Instruments Incorporated, Dallas, TX 75243 (United States)

    2010-09-29

    Computational materials science based on ab initio calculations has become an important partner to experiment. This is demonstrated here for the effect of impurities and alloying elements on the strength of a Zr twist grain boundary, the dissociative adsorption and diffusion of iodine on a zirconium surface, the diffusion of oxygen atoms in a Ni twist grain boundary and in bulk Ni, and the dependence of the work function of a TiN-HfO{sub 2} junction on the replacement of N by O atoms. In all of these cases, computations provide atomic-scale understanding as well as quantitative materials property data of value to industrial research and development. There are two key challenges in applying ab initio calculations, namely a higher accuracy in the electronic energy and the efficient exploration of large parts of the configurational space. While progress in these areas is fueled by advances in computer hardware, innovative theoretical concepts combined with systematic large-scale computations will be needed to realize the full potential of ab initio calculations for industrial applications.

  4. Ab initio calculations for industrial materials engineering: successes and challenges

    Computational materials science based on ab initio calculations has become an important partner to experiment. This is demonstrated here for the effect of impurities and alloying elements on the strength of a Zr twist grain boundary, the dissociative adsorption and diffusion of iodine on a zirconium surface, the diffusion of oxygen atoms in a Ni twist grain boundary and in bulk Ni, and the dependence of the work function of a TiN-HfO2 junction on the replacement of N by O atoms. In all of these cases, computations provide atomic-scale understanding as well as quantitative materials property data of value to industrial research and development. There are two key challenges in applying ab initio calculations, namely a higher accuracy in the electronic energy and the efficient exploration of large parts of the configurational space. While progress in these areas is fueled by advances in computer hardware, innovative theoretical concepts combined with systematic large-scale computations will be needed to realize the full potential of ab initio calculations for industrial applications.

  5. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as “cloning,” in analogy to the “spawning” procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, “trains,” as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions

  6. Converting of Matter to Nuclear Energy by AB-Generator

    Alexander Bolonkin

    2009-01-01

    Full Text Available Problem statement: Researcher offered a new nuclear generator which allowed to convert any matter to nuclear energy in accordance with Einstein equation E = mc2. The method was based upon tapping the energy potential of a Micro Black Hole (MBH and Hawking radiation created by this MBH. Researcher did not meet the idea and its research in literature to develop the method for getting a cheap energy. Approach: As is well-known, vacuum continuously produced virtual pairs of particles and antiparticles, in particular, photons and anti-photons. MBH event horizon allowed separating them. Anti-photons can be moved to MBH and be annihilated, decreasing mass of MBH, resulting photons leave the MBH neighborhood as Hawking radiation. The offered nuclear generator (named by Researcher as AB-generator utilized Hawking radiation and injected the matter into MBH and kept MBH in a stable state with near-constant mass. Results: AB-generator can be produced gigantic energy outputs and should be cheaper than a conventional electric station by a factor of hundreds of times. One also may be used in aerospace as a photon rocket or as a power source for many vehicles. Conclusion: Many scientists expect Large Hadron Collider at CERN may be produced one MBH every second. A technology to capture them may be developed; than they may be used for the AB-generator.

  7. Ab initio calculations of reactions with light nuclei

    Quaglioni, Sofia; Hupin, Guillaume; Calci, Angelo; Navrátil, Petr; Roth, Robert

    2016-03-01

    An ab initio (i.e., from first principles) theoretical framework capable of providing a unified description of the structure and low-energy reaction properties of light nuclei is desirable to further our understanding of the fundamental interactions among nucleons, and provide accurate predictions of crucial reaction rates for nuclear astrophysics, fusion-energy research, and other applications. In this contribution we review ab initio calculations for nucleon and deuterium scattering on light nuclei starting from chiral two- and three-body Hamiltonians, obtained within the framework of the ab initio no-core shell model with continuum. This is a unified approach to nuclear bound and scattering states, in which square-integrable energy eigenstates of the A-nucleon system are coupled to (A-a)+a target-plus-projectile wave functions in the spirit of the resonating group method to obtain an efficient description of the many-body nuclear dynamics both at short and medium distances and at long ranges.

  8. A Complete and Accurate Ab Initio Repeat Finding Algorithm.

    Lian, Shuaibin; Chen, Xinwu; Wang, Peng; Zhang, Xiaoli; Dai, Xianhua

    2016-03-01

    It has become clear that repetitive sequences have played multiple roles in eukaryotic genome evolution including increasing genetic diversity through mutation, changes in gene expression and facilitating generation of novel genes. However, identification of repetitive elements can be difficult in the ab initio manner. Currently, some classical ab initio tools of finding repeats have already presented and compared. The completeness and accuracy of detecting repeats of them are little pool. To this end, we proposed a new ab initio repeat finding tool, named HashRepeatFinder, which is based on hash index and word counting. Furthermore, we assessed the performances of HashRepeatFinder with other two famous tools, such as RepeatScout and Repeatfinder, in human genome data hg19. The results indicated the following three conclusions: (1) The completeness of HashRepeatFinder is the best one among these three compared tools in almost all chromosomes, especially in chr9 (8 times of RepeatScout, 10 times of Repeatfinder); (2) in terms of detecting large repeats, HashRepeatFinder also performed best in all chromosomes, especially in chr3 (24 times of RepeatScout and 250 times of Repeatfinder) and chr19 (12 times of RepeatScout and 60 times of Repeatfinder); (3) in terms of accuracy, HashRepeatFinder can merge the abundant repeats with high accuracy. PMID:26272474

  9. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    Makhov, Dmitry V.; Glover, William J.; Martinez, Todd J.; Shalashilin, Dmitrii V.

    2014-08-01

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as "cloning," in analogy to the "spawning" procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, "trains," as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions.

  10. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    Makhov, Dmitry V.; Shalashilin, Dmitrii V. [Department of Chemistry, University of Leeds, Leeds LS2 9JT (United Kingdom); Glover, William J.; Martinez, Todd J. [Department of Chemistry and The PULSE Institute, Stanford University, Stanford, California 94305, USA and SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States)

    2014-08-07

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as “cloning,” in analogy to the “spawning” procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, “trains,” as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions.

  11. Ab initio nuclear structure - the large sparse matrix eigenvalue problem

    The structure and reactions of light nuclei represent fundamental and formidable challenges for microscopic theory based on realistic strong interaction potentials. Several ab initio methods have now emerged that provide nearly exact solutions for some nuclear properties. The ab initio no core shell model (NCSM) and the no core full configuration (NCFC) method, frame this quantum many-particle problem as a large sparse matrix eigenvalue problem where one evaluates the Hamiltonian matrix in a basis space consisting of many-fermion Slater determinants and then solves for a set of the lowest eigenvalues and their associated eigenvectors. The resulting eigenvectors are employed to evaluate a set of experimental quantities to test the underlying potential. For fundamental problems of interest, the matrix dimension often exceeds 1010 and the number of nonzero matrix elements may saturate available storage on present-day leadership class facilities. We survey recent results and advances in solving this large sparse matrix eigenvalue problem. We also outline the challenges that lie ahead for achieving further breakthroughs in fundamental nuclear theory using these ab initio approaches.

  12. A ProActive Backend for ABS: from Modelling to Deployment

    Rochas, Justine; Henrio, Ludovic

    2014-01-01

    ABS is an object-oriented modeling language that is based on a concurrent object group model, derived itself from the active object model. Its goal is to describe distributed and concurrent applications in order to verify their properties and make them safer. Thanks to the ABS Tool Suite, ABS programs can be translated into the Java programming language (among others), and executed in the JVM. This paper presents a new ABS backend that translates ABS programs into ProActive programs. ProActiv...

  13. Towards hydrogen metallization: an Ab initio approach; Vers la metallisation de l`hydrogene: approche AB initio

    Bernard, St

    1998-12-31

    The quest for metallic hydrogen is a major goal for both theoretical and experimental condensed matter physics. Hydrogen and deuterium have been compressed up to 200 GPa in diamond anvil cells, without any clear evidence for a metallic behaviour. Loubeyere has recently suggested that hydrogen could metallize, at pressures within experimental range, in a new Van der Waals compound: Ar(H{sub 2}){sub 2} which is characterized at ambient pressure by an open and anisotropic sublattice of hydrogen molecules, stabilized by an argon skeleton. This thesis deals with a detailed ab initio investigation, by Car-Parrinello molecular dynamics methods, of the evolution under pressure of this compound. In a last chapter, we go to much higher pressures and temperatures, in order to compare orbital and orbital free ab initio methods for the dense hydrogen plasma. (author) 109 refs.

  14. 40 CFR 174.506 - Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of...

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. 174.506 Section 174.506 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED...

  15. GQ Lup Ab Visible & Near-Infrared Photometric Analysis

    Marois, C; Macintosh, B; Barman, T

    2006-08-07

    We have re-analyzed archival HST R and I band images and Subaru CH{sub 4}, H, Ks and L{prime} data of the recently discovered planetary mass companion (PMC) GQ Lup Ab. With these we produce the first R and I band photometry of the companion and fit a radius and effective temperature using detailed model atmospheres. We find an effective temperature of 2338 {+-} 100K, and a radius of 0.37 {+-} 0.05R{sub {circle_dot}} and luminosity of log(L/L{sub {circle_dot}}) = -2.43 {+-} 0.07 (at 140pc). Since we fit wavelengths that span most of the emitted radiation from GQ Lup this luminosity estimate is robust, with uncertainty dominated by the distance uncertainty. The radius obtained for 140pc (0.37R{sub {circle_dot}}) is significantly larger than the one originally derived. The mass of the object is much more model-dependent than the radiative properties, but for the GAIA dusty models we find a mass between 9-20 M{sub Jup}, in the range of the brown dwarf and PMC deuterium burning boundary. Assuming a distance of 140pc, observations fit to 1{sigma} the Baraffe evolution model for a {approx} 15 M{sub Jup} brown dwarf. Additionally, the F606W photometric band is significantly overluminous compared to model predictions. Such overluminosity could be explained by a bright H{alpha} emission from chromospheric activity, interaction with another undetected companion, or accretion. Assuming that GQ Lup Ab has a bright H{alpha} emission line, its H{alpha} emission strength is 10{sup -1.71 {+-} 0.10} L{sub bol}, significantly larger than field late-type dwarfs. GQ Lup Ab might be strongly accreting and still be in its formation phase.

  16. Ab-initio study of napthelene based conducting polymer

    Ruhela, Ankur [Advanced Materials Research Group, Computational Nanoscience and Technology Lab (CNTL), ABV-Indian Institute of Information Technology and Management, Gwalior -474010, India and Amity Institute of Nanotechnology, Amity University, Noida-201303 (India); Kanchan, Reena, E-mail: reena.kanchan1977@gmail.com [Department of Chemistry, Jiwaji University, Gwalior-474001 (India); Srivastava, Anurag [Advanced Materials Research Group, Computational Nanoscience and Technology Lab (CNTL), ABV-Indian Institute of Information Technology and Management, Gwalior -474010 (India); Sinha, O. P. [Amity Institute of Nanotechnology, Amity University, Noida-201303 (India)

    2014-04-24

    In this paper, we have identified structural and electronic properties of conducting polymers by using DFT based ATK-VNL ab-initio tool. Naphthalene derivative structures were stabilized by varying the bond length between two atoms of the molecule C-N and C-C. We have also studied the molecular energy spectrum of naphthalene derivatives and found the HOMOLUMO for the same. A comparison of structural and electronic properties of naphthalene derivatives by attaching the functional group of amine, have been performed and found that they show good semi conducting properties.

  17. Ab-initio study of napthelene based conducting polymer

    In this paper, we have identified structural and electronic properties of conducting polymers by using DFT based ATK-VNL ab-initio tool. Naphthalene derivative structures were stabilized by varying the bond length between two atoms of the molecule C-N and C-C. We have also studied the molecular energy spectrum of naphthalene derivatives and found the HOMOLUMO for the same. A comparison of structural and electronic properties of naphthalene derivatives by attaching the functional group of amine, have been performed and found that they show good semi conducting properties

  18. Equations of state of heavy metals: ab initio approaches

    The determination of equations of states of heavy metals through ab initio calculation, i.e. without any adjustable parameter, allows to access to pressure and temperature thermodynamic conditions sometimes inaccessible to experiment. To perform such calculations, density functional theory (DFT) is a good starting point: when electronic densities are homogeneous enough, the local density approximation (LDA) remarkably accounts for thermodynamic properties of heavy metals, such as tantalum, or the light actinides, as well for static properties - equilibrium volume, elastic constants - as for dynamical quantities like phonon spectra. For heavier elements, like neptunium or plutonium, relativistic effects and strong electronic interactions must be taken into account, which requires more sophisticated theoretical approaches. (authors)

  19. Ab initio study of neutron drops with chiral Hamiltonians

    H.D. Potter

    2014-12-01

    Full Text Available We report ab initio calculations for neutron drops in a 10 MeV external harmonic-oscillator trap using chiral nucleon–nucleon plus three-nucleon interactions. We present total binding energies, internal energies, radii and odd–even energy differences for neutron numbers N=2–18 using the no-core shell model with and without importance truncation. Furthermore, we present total binding energies for N=8,16,20,28,40,50 obtained in a coupled-cluster approach. Comparisons with quantum Monte Carlo results, where available, using Argonne v8′ with three-nucleon interactions reveal important dependences on the chosen Hamiltonian.

  20. Tailoring magnetoresistance at the atomic level: An ab initio study

    Tao, Kun

    2012-01-05

    The possibility of manipulating the tunneling magnetoresistance (TMR) of antiferromagnetic nanostructures is predicted in the framework of ab initio calculations. By the example of a junction composed of an antiferromagnetic dimer and a spin-polarized scanning tunneling microscopy tip we show that the TMR can be tuned and even reversed in sign by lateral and vertical movements of the tip. Moreover, our finite-bias calculations demonstrate that the magnitude and the sign of the TMR can also be tuned by an external voltage. © 2012 American Physical Society.

  1. Ab initio calculation of tensile strength in iron

    Friák, Martin; Šob, Mojmír; Vitek, V.

    2003-01-01

    Roč. 83, 31-34 (2003), s. 3529-3537. ISSN 1478-6435. [Multiscale Materials Modelling: Working Theory for Industry /1./. London, 17.06.2002-20.06.2002] R&D Projects: GA AV ČR IAA1041302; GA ČR GA202/03/1351; GA MŠk OC 523.90 Institutional research plan: CEZ:AV0Z2041904 Keywords : ab initio calculations * electronic structure * theoretical tensile strength Subject RIV: BM - Solid Matter Physics ; Magnetism

  2. Arbetsprocess för materialanskaffning vid Forsmarks Kraftgrupp AB

    Westbom, Johan

    2013-01-01

    This thesis has been made on behalf of Forsmarks Kraftgrupp AB and is the final part of the education of Bachelor of Engineering in – Innovation, production and logistics atMälardalens Högskola.Forsmark nuclear power plant is located in Östhammars municipality at the coast of Uppland. The three nuclear reactors in Forsmark together produces approximately one-sixth of Sweden’s electricity consumption each year.The background of this study is that a large number of requests come to the purchasi...

  3. Escolha de formas de barragens abóbada

    Meliço, José Alberto Garcia

    2010-01-01

    Sendo Portugal um dos países europeus com maior potencial hidroeléctrico por explorar, e atendendo à sua dependência energética do exterior, o governo lançou, em 2007, um programa visando o aproveitamento racional dos recursos hídricos disponíveis. Está-se, em 2010, na fase de projecto de um conjunto de barragens abóbada integradas nesses aproveitamentos. Existindo uma vasta experiência da engenharia portuguesa neste tipo de estruturas, de que são exemplo o projecto e a construção de ob...

  4. Ab initio study of neutron drops with chiral Hamiltonians

    We report ab initio calculations for neutron drops in a 10 MeV external harmonic-oscillator trap using chiral nucleon–nucleon plus three-nucleon interactions. We present total binding energies, internal energies, radii and odd–even energy differences for neutron numbers N=2–18 using the no-core shell model with and without importance truncation. Furthermore, we present total binding energies for N=8,16,20,28,40,50 obtained in a coupled-cluster approach. Comparisons with quantum Monte Carlo results, where available, using Argonne v8′ with three-nucleon interactions reveal important dependences on the chosen Hamiltonian

  5. Ab initio vibrational and dielectric properties of Y V O

    Vali, R.

    2009-10-01

    For the yttrium orthovanadate Y V O with a tetragonal zircon-type structure, the first complete set of Raman-active and IR-active phonon modes has been calculated using ab initio density functional perturbation theory. The calculated IR reflectivity spectra are in good agreement with available experimental data. We report the calculated frequencies of three Raman-active modes that could not be detected experimentally and a new assignment of the experimental Raman data. The contributions of each IR-active phonon modes to static dielectric tensor have been determined.

  6. Ab initio and kinetic modeling studies of formic acid oxidation

    Marshall, Paul; Glarborg, Peter

    2015-01-01

    A detailed chemical kinetic model for oxidation of formic acid (HOCHO) in flames has been developed, based on theoretical work and data from literature. Ab initio calculations were used to obtain rate coefficients for reactions of HOCHO with H, O, and HO2. Modeling predictions with the mechanism...... on calculations with the kinetic model. Formic acid is consumed mainly by reaction with OH, yielding OCHO, which dissociates rapidly to CO2 + H, and HOCO, which may dissociate to CO + OH or CO2 + H, or react with H, OH, or O2 to form more stable products. The branching fraction of the HOCHO + OH...

  7. Accelerating Ab Initio Nuclear Physics Calculations with GPUs

    Potter, Hugh; Maris, Pieter; Sosonkina, Masha; Vary, James; Binder, Sven; Calci, Angelo; Langhammer, Joachim; Roth, Robert; Çatalyürek, Ümit; Saule, Erik

    2014-01-01

    This paper describes some applications of GPU acceleration in ab initio nuclear structure calculations. Specifically, we discuss GPU acceleration of the software package MFDn, a parallel nuclear structure eigensolver. We modify the matrix construction stage to run partly on the GPU. On the Titan supercomputer at the Oak Ridge Leadership Computing Facility, this produces a speedup of approximately 2.2x - 2.7x for the matrix construction stage and 1.2x - 1.4x for the entire run.

  8. Ab initio structure determination via powder X-ray diffraction

    Digamber G Porob; T N Guru Row

    2001-10-01

    Structure determination by powder X-ray diffraction data has gone through a recent surge since it has become important to get to the structural information of materials which do not yield good quality single crystals. Although the method of structure completion when once the starting model is provided is facile through the Rietveld refinement technique, the structure solution ab initio os still not push-button technology. In this article a survey of the recent development in this area is provided with an illustration of the structure determination of -NaBi3V2O10.

  9. Pharmacokinetics of radioimmunotherapeutic agent of direct labeling mAb 188Re-HAb18

    Chao Lou; Zhi-Nan Chen; Hui-Jie Bian; Jie Li; Shou-Bo Zhou

    2002-01-01

    AIM: To labed Anti-hepatoma monoclonal antibody (mAb)fragment HAb18 F (ab')2 was labeled with 188 Re for thepharmacokinetic model of 188 Re-HAb18 F (ab')2 and toevaluate its pharmacokinetic parameters in hepatoma-bearing nude mice.METHODS: HAb18 F(ab')2 was directly labeled with 188Reusing 2-mercaptoethanol (2-ME) as reducing agents.Labeling efficiency and immunoreactivity of 188 Re-HAb18 F( ab')2 were evaluated by Whatman 3MM paperchromatography and live cell assay, respectively.Biodiatribution analysis was also conducted in nude micebearing human hepatoma in which animals were sacrificed atdifferent time points(1, 4, 18, 24 and 24h) after 188Re-HAb18F(ab' )2 was injected through tail-vein into hepatoma-bearingnude mice. The blood and radioactivity of organs and masswere measured. The concentrations of 188 Re-HAb18 F(ab')2were evaluated with a pharmacokinetic 3P97 software.RESULTS: The optimum labeling efficiency andimmunoreactive fraction were 91.7% and 0.78%,respectively. The parameters of 188Re-HAb18 F(ab')2 were:T1/2, 2.29h; Vd, 1.49 × 10-9L@ Bq- 1; AUC, 20.49 × 109Bq@ h@L-1 ;CL, 0.45 × 10-3L@ h- 1. 188Re- HAb18 F(ab')2 could locatespecially in hepatoma with high selective reactivity of HAb18F(ab')2. 188 Re-HAb18 F(ab')2 was mainly eliminated bykidney. The maximal tumor to blood ratio was at 48h, andmaximal tumor to liver ratio was at 18h.CONCLUTION: The pharmacokinetics of 188Re-HAb18 F(ab')2fit a I-compartment model. 188 Re-HAb18 F(ab')2 can beuptaken selectively at the hepatoma site.

  10. TITRATION METHOD OF AB0 ANTIBODIES WITH THE USE OF MODERN GEL TECHNOLOGY IN AB0-INCOMPATIBLE TRANSPLANTATION

    A. K. Porunova; Morozova, V.V.; I. E. Tsiroulnikova; O. M. Tsiroulnikova; S. V. Gautier

    2014-01-01

    It is shown that developed method of titrating AB0 antibodies allows defi ning the titer of the investigational antibodies more precisely on 1–3 dilution of serum compared to the prototype method (titration method of antibodiesin saline medium on the plane). It is more obvious as it excludes hardly interpretable results due to the possibility of conducting visual assessment of agglutination reaction in the gel card thick column and requires less time foranalysis. The results can be saved for ...

  11. Electrocatalytic reduction of nitrate and selenate by NapAB.

    Gates, Andrew J; Butler, Clive S; Richardson, David J; Butt, Julea N

    2011-01-01

    Bacterial cellular metabolism is renowned for its metabolic diversity and adaptability. However, certain environments present particular challenges. Aerobic metabolism of highly reduced carbon substrates by soil bacteria such as Paracoccus pantotrophus presents one such challenge since it may result in excessive electron delivery to the respiratory redox chain when compared with the availability of terminal oxidant, O2. The level of a periplasmic ubiquinol-dependent nitrate reductase, NAP, is up-regulated in the presence of highly reduced carbon substrates. NAP oxidizes ubiquinol at the periplasmic face of the cytoplasmic membrane and reduces nitrate in the periplasm. Thus its activity counteracts the accumulation of excess reducing equivalents in ubiquinol, thereby maintaining the redox poise of the ubiquinone/ubiquinol pool without contributing to the protonmotive force across the cytoplasmic membrane. Although P. pantotrophus NapAB shows a high level of substrate specificity towards nitrate, the enzyme has also been reported to reduce selenate in spectrophotometric solution assays. This transaction draws on our current knowledge concerning the bacterial respiratory nitrate reductases and extends the application of PFE (protein film electrochemistry) to resolve and quantify the selenate reductase activity of NapAB. PMID:21265780

  12. AB INITIO SIMULATIONS FOR MATERIAL PROPERTIES ALONG THE JUPITER ADIABAT

    We determine basic thermodynamic and transport properties of hydrogen-helium-water mixtures for the extreme conditions along Jupiter's adiabat via ab initio simulations, which are compiled in an accurate and consistent data set. In particular, we calculate the electrical and thermal conductivity, the shear and longitudinal viscosity, and diffusion coefficients of the nuclei. We present results for associated quantities like the magnetic and thermal diffusivity and the kinematic shear viscosity along an adiabat that is taken from a state-of-the-art interior structure model. Furthermore, the heat capacities, the thermal expansion coefficient, the isothermal compressibility, the Grüneisen parameter, and the speed of sound are calculated. We find that the onset of dissociation and ionization of hydrogen at about 0.9 Jupiter radii marks a region where the material properties change drastically. In the deep interior, where the electrons are degenerate, many of the material properties remain relatively constant. Our ab initio data will serve as a robust foundation for applications that require accurate knowledge of the material properties in Jupiter's interior, e.g., models for the dynamo generation.

  13. Ab Initio Thermodynamic Model for Magnesium Carbonates and Hydrates

    Chaka, Anne M.; Felmy, Andrew R.

    2014-03-28

    An ab initio thermodynamic framework for predicting properties of hydrated magnesium carbonate minerals has been developed using density-functional theory linked to macroscopic thermodynamics through the experimental chemical potentials for MgO, water, and CO2. Including semiempirical dispersion via the Grimme method and small corrections to the generalized gradient approximation of Perdew, Burke, and Ernzerhof for the heat of formation yields a model with quantitative agreement for the benchmark minerals brucite, magnesite, nesquehonite, and hydromagnesite. The model shows how small differences in experimental conditions determine whether nesquehonite, hydromagnesite, or magnesite is the result of laboratory synthesis from carbonation of brucite, and what transformations are expected to occur on geological time scales. Because of the reliance on parameter-free first principles methods, the model is reliably extensible to experimental conditions not readily accessible to experiment and to any mineral composition for which the structure is known or can be hypothesized, including structures containing defects, substitutions, or transitional structures during solid state transformations induced by temperature changes or processes such as water, CO2, or O2 diffusion. Demonstrated applications of the ab initio thermodynamic framework include an independent means to evaluate differences in thermodynamic data for lansfordite, predicting the properties of Mg analogs of Ca-based hydrated carbonates monohydrocalcite and ikaite which have not been observed in nature, and an estimation of the thermodynamics of barringtonite from the stoichiometry and a single experimental observation.

  14. Three-cluster dynamics within an ab initio framework

    Quaglioni, S; Navrátil, P

    2013-01-01

    We introduce a fully antisymmetrized treatment of three-cluster dynamics within the ab initio framework of the no-core shell model/resonating-group method (NCSM/RGM). Energy-independent non-local interactions among the three nuclear fragments are obtained from realistic nucleon-nucleon interactions and consistent ab initio many-body wave functions of the clusters. The three-cluster Schr\\"odinger equation is solved with bound-state boundary conditions by means of the hyperspherical-harmonic method on a Lagrange mesh. We discuss the formalism in detail and give algebraic expressions for systems of two single nucleons plus a nucleus. Using a soft similarity-renormalization-group evolved chiral nucleon-nucleon potential, we apply the method to an $^4$He+$n+n$ description of $^6$He and compare the results to experiment and to a six-body diagonalization of the Hamiltonian performed within the harmonic-oscillator expansions of the NCSM. Differences between the two calculations provide a measure of core ($^4$He) pola...

  15. Ab Initio Protein Structure Prediction Using Pathway Models

    Christopher Bystroff

    2006-04-01

    Full Text Available Ab initio prediction is the challenging attempt to predict protein structures based only on sequence information and without using templates. It is often divided into two distinct sub-problems: (a the scoring function that can distinguish native, or native-like structures, from non-native ones; and (b the method of searching the conformational space. Currently, there is no reliable scoring function that can always drive a search to the native fold, and there is no general search method that can guarantee a significant sampling of near-natives. Pathway models combine the scoring function and the search. In this short review, we explore some of the ways pathway models are used in folding, in published works since 2001, and present a new pathway model, HMMSTR-CM, that uses a fragment library and a set of nucleation/propagation-based rules. The new method was used for ab initio predictions as part of CASP5. This work was presented at the Winter School in Bioinformatics, Bologna, Italy, 10–14 February 2003.

  16. Unified ab initio approaches to nuclear structure and reactions

    Navrátil, Petr; Quaglioni, Sofia; Hupin, Guillaume; Romero-Redondo, Carolina; Calci, Angelo

    2016-05-01

    The description of nuclei starting from the constituent nucleons and the realistic interactions among them has been a long-standing goal in nuclear physics. In addition to the complex nature of the nuclear forces, with two-, three- and possibly higher many-nucleon components, one faces the quantum-mechanical many-nucleon problem governed by an interplay between bound and continuum states. In recent years, significant progress has been made in ab initio nuclear structure and reaction calculations based on input from QCD-employing Hamiltonians constructed within chiral effective field theory. After a brief overview of the field, we focus on ab initio many-body approaches—built upon the no-core shell model—that are capable of simultaneously describing both bound and scattering nuclear states, and present results for resonances in light nuclei, reactions important for astrophysics and fusion research. In particular, we review recent calculations of resonances in the 6He halo nucleus, of five- and six-nucleon scattering, and an investigation of the role of chiral three-nucleon interactions in the structure of 9Be. Further, we discuss applications to the 7Be {({{p}},γ )}8{{B}} radiative capture. Finally, we highlight our efforts to describe transfer reactions including the 3H{({{d}},{{n}})}4He fusion.

  17. Unified ab initio approaches to nuclear structure and reactions

    Navratil, Petr; Hupin, Guillaume; Romero-Redondo, Carolina; Calci, Angelo

    2016-01-01

    The description of nuclei starting from the constituent nucleons and the realistic interactions among them has been a long-standing goal in nuclear physics. In addition to the complex nature of the nuclear forces, with two-, three- and possibly higher many-nucleon components, one faces the quantum-mechanical many-nucleon problem governed by an interplay between bound and continuum states. In recent years, significant progress has been made in {\\em ab initio} nuclear structure and reaction calculations based on input from QCD-employing Hamiltonians constructed within chiral effective field theory. After a brief overview of the field, we focus on ab initio many-body approaches - built upon the No-Core Shell Model - that are capable of simultaneously describing both bound and scattering nuclear states, and present results for resonances in light nuclei, reactions important for astrophysics and fusion research. In particular, we review recent calculations of resonances in the $^6$He halo nucleus, of five- and six...

  18. Ab initio dynamics of the cytochrome P450 hydroxylation reaction

    Elenewski, Justin E.; Hackett, John C, E-mail: jchackett@vcu.edu [Department of Physiology and Biophysics and The Massey Cancer Center, School of Medicine, Virginia Commonwealth University, 401 College Street, Richmond, Virginia 23219-1540 (United States)

    2015-02-14

    The iron(IV)-oxo porphyrin π-cation radical known as Compound I is the primary oxidant within the cytochromes P450, allowing these enzymes to affect the substrate hydroxylation. In the course of this reaction, a hydrogen atom is abstracted from the substrate to generate hydroxyiron(IV) porphyrin and a substrate-centered radical. The hydroxy radical then rebounds from the iron to the substrate, yielding the hydroxylated product. While Compound I has succumbed to theoretical and spectroscopic characterization, the associated hydroxyiron species is elusive as a consequence of its very short lifetime, for which there are no quantitative estimates. To ascertain the physical mechanism underlying substrate hydroxylation and probe this timescale, ab initio molecular dynamics simulations and free energy calculations are performed for a model of Compound I catalysis. Semiclassical estimates based on these calculations reveal the hydrogen atom abstraction step to be extremely fast, kinetically comparable to enzymes such as carbonic anhydrase. Using an ensemble of ab initio simulations, the resultant hydroxyiron species is found to have a similarly short lifetime, ranging between 300 fs and 3600 fs, putatively depending on the enzyme active site architecture. The addition of tunneling corrections to these rates suggests a strong contribution from nuclear quantum effects, which should accelerate every step of substrate hydroxylation by an order of magnitude. These observations have strong implications for the detection of individual hydroxylation intermediates during P450 catalysis.

  19. ABS polymer electroless plating through a one-step poly(acrylic acid) covalent grafting.

    Garcia, Alexandre; Berthelot, Thomas; Viel, Pascal; Mesnage, Alice; Jégou, Pascale; Nekelson, Fabien; Roussel, Sébastien; Palacin, Serge

    2010-04-01

    A new, efficient, palladium- and chromium-free process for the electroless plating of acrylonitrile-butadiene-styrene (ABS) polymers has been developed. The process is based on the ion-exchange properties of poly(acrylic acid) (PAA) chemically grafted onto ABS via a simple and one-step method that prevents using classical surface conditioning. Hence, ABS electroless plating can be obtained in three steps, namely: (i) the grafting of PAA onto ABS, (ii) the copper Cu(0) seeding of the ABS surface, and (iii) the nickel or copper metallization using commercial-like electroless plating bath. IR, XPS, and SEM were used to characterize each step of the process, and the Cu loading was quantified by atomic absorption spectroscopy. This process successfully compares with the commercial one based on chromic acid etching and palladium-based seed layer, because the final metallic layer showed excellent adhesion with the ABS substrate. PMID:20361751

  20. Cry1Ab protein from Bacillus thuringiensis and MON810 cry1Ab-transgenic maize exerts no adjuvant effect after airway exposure.

    Andreassen, M; Bøhn, T; Wikmark, O-G; Van den Berg, J; Løvik, M; Traavik, T; Nygaard, U C

    2015-03-01

    The genetically modified (GM) maize event MON810 has been inserted with a processed version of the transgene, cry1Ab, derived from the soil bacterium Bacillus thuringiensis (Bt) to express proteins with insecticidal properties. Such proteins may introduce new allergens and also act as adjuvants that promote allergic responses. While focus has been on safe consumption and hence the oral exposure to GM food and feed, little is known regarding inhalation of pollen and desiccated airborne plant material from GM crops. The aim of this study was to investigate whether plant material from the Cry1Ab-expressing maize variety MON810, or trypsin-activated Cry1Ab (trypCry1Ab) protein produced in recombinant bacteria, may act as adjuvants against the allergen ovalbumin (OVA) in a mouse model of airway allergy. A clear proallergic adjuvant effect of the mucosal adjuvant cholera toxin (CT) was demonstrated, determined as increased specific IgE, eosinophils and Th2 cytokines in MLN cell supernates, while no elevation in OVA-specific antibodies or cytokine release from MLN cells after stimulation with OVA were observed in mice receiving Cry1Ab-containing plant materials or the trypCry1Ab protein. Our data suggest that Cry1Ab proteins had no detectable systemic adjuvant effect in mice after airway exposure. Further experiments with purified plant proteins, as well as long-term exposures needs be conducted to further evaluate exposures experienced in real-life situations. PMID:25564738

  1. Phosphoric acid doped AB-PBI membranes and its applications in high temperature PEMFC

    He, Ronghuan; Qingfeng, Li; Bjerrum, Niels

    2005-01-01

    Poly(2,5-benzimidazole) (ab-PBI) was prepared from 3,4-diaminobenzoic acid via a polymerisation reaction. The obtained polymer exhibits excellent thermal stability in a temperature range ….. The membrane of ab-PBI when doped with phosphoric acid at room temperaturepresents high proton conductivity......C with phosphoric acid doped ab-PBI as the electrolyte under atmospheric pressure at 200°C without humidification....

  2. Living with an imperfect cell wall: compensation of femAB inactivation in Staphylococcus aureus.

    Bierbaum Gabriele; Harris Llinos G; Majcherczyk Paul A; Schäfer Juliane; Kotte Oliver; Jansen Andrea; Hübscher Judith; Heinemann Matthias; Berger-Bächi Brigitte

    2007-01-01

    Abstract Background Synthesis of the Staphylococcus aureus peptidoglycan pentaglycine interpeptide bridge is catalyzed by the nonribosomal peptidyl transferases FemX, FemA and FemB. Inactivation of the femAB operon reduces the interpeptide to a monoglycine, leading to a poorly crosslinked peptidoglycan. femAB mutants show a reduced growth rate and are hypersusceptible to virtually all antibiotics, including methicillin, making FemAB a potential target to restore β-lactam susceptibility in met...

  3. Performance of the Molecular Alere i Influenza A&B Test Compared to That of the Xpert Flu A/B Assay

    Chapin, Kimberle C.; Flores-Cortez, Estefany J.

    2014-01-01

    Data on the performance of rapid molecular point-of-care use platforms for diagnosis of influenza are lacking. We validated nasopharyngeal (NP) flocked specimens in universal transport medium (UTM) and evaluated the clinical sensitivity and specificity of the Alere i influenza A&B test compared to those of the Xpert flu A/B assay. The Alere i influenza A&B test had an overall sensitivity and specificity of 93.8% and 62.5% for influenza A, respectively, and of 91.8% and 53.6% for influenza B, ...

  4. Comparative Study of Electroless Copper Film on Different Self-Assembled Monolayers Modified ABS Substrate

    Jiushuai Xu

    2014-04-01

    Full Text Available Copper films were grown on (3-Mercaptopropyltrimethoxysilane (MPTMS, (3-Aminopropyltriethoxysilane (APTES and 6-(3-(triethoxysilylpropylamino-1,3,5- triazine-2,4-dithiol monosodium (TES self-assembled monolayers (SAMs modified acrylonitrile-butadiene-styrene (ABS substrate via electroless copper plating. The copper films were examined using scanning electron microscopy (SEM and X-ray diffraction (XRD. Their individual deposition rate and contact angle were also investigated to compare the properties of SAMs and electroless copper films. The results indicated that the formation of copper nuclei on the TES-SAMs modified ABS substrate was faster than those on the MPTMS-SAMs and APTES-SAMs modified ABS substrate. SEM images revealed that the copper film on TES-SAM modified ABS substrate was smooth and uniform, and the density of copper nuclei was much higher. Compared with that of TES-SAMs modified resin, the coverage of copper nuclei on MPTMS and APTES modified ABS substrate was very limited and the copper particle size was too big. The adhesion property test demonstrated that all the SAMs enhanced the interfacial interaction between copper plating and ABS substrate. XRD analysis showed that the copper film deposited on SAM-modified ABS substrate had a structure with Cu(111 preferred orientation, and the copper film deposited on TES-SAMs modified ABS substrate is better than that deposited on MPTMS-SAMs or APTES-SAMs modified ABS resins in electromigrtion resistance.

  5. Heat Shock Protein 90AB1 and Hyperthermia Rescue Infectivity of HIV with Defective Cores

    Joshi, Pheroze; Sloan, Barbara; Torbett, Bruce E.; Stoddart, Cheryl A.

    2012-01-01

    We previously showed that reduced infectivity of HIV with incompletely processed capsid-spacer protein 1 (CA-SP1) is rescued by cellular activation or increased expression of HSP90AB1, a member of the cytosolic heat shock protein 90 family. Here we show that HSP90AB1 is present in HIV virions and that HSP90AB1, but not nonfunctional mutated HSP90AB1E42A+D88A, restores infectivity to HIV with mutations in CA that alter core stability. Further, the CA mutants were hypersensitive to pharmacologi...

  6. Adsorption of insecticidal Cry1Ab protein to humic substances. 1. Experimental approach and mechanistic aspects.

    Sander, Michael; Tomaszewski, Jeanne E; Madliger, Michael; Schwarzenbach, René P

    2012-09-18

    Adsorption is a key process affecting the fate of insecticidal Cry proteins (Bt toxins), produced by genetically modified Bt crops, in soils. However, the mechanisms of adsorption to soil organic matter (SOM) remain poorly understood. This work assesses the forces driving the adsorption of Cry1Ab to Leonardite humic acid (LHA), used as a model for SOM. We studied the effects of solution pH and ionic strength (I) on adsorption using a quartz crystal microbalance with dissipation monitoring and optical waveguide lightmode spectroscopy. Initial Cry1Ab adsorption rates were close to diffusion-limited and resulted in extensive adsorption, even at pH >6, at which LHA and Cry1Ab carry negative net charges. Adsorption increased with decreasing I at pH >6, indicating Cry1Ab-LHA patch-controlled electrostatic attraction via positively charged domains of Cry1Ab. Upon rinsing, only a fraction of Cry1Ab desorbed, suggesting a range of interaction energies of Cry1Ab with LHA. Different interaction energies likely resulted from nonuniformity in the LHA surface polarity, with higher Cry1Ab affinities to more apolar LHA regions due to the hydrophobic effect. Contributions from the hydrophobic effect were substantiated by comparison of the adsorption of Cry1Ab and the reference proteins albumin and lysozyme to LHA and to apolar and polar model surfaces. PMID:22862304

  7. Effect of Rapid Quenching on Electrochemical Properties of AB5 and AB3.5-Type Hydrogen Storage Alloys

    Li Ping; Zheng Xueping; An Fuqiang; Islam S. Humail; Qu Xuanhui

    2007-01-01

    Effect of rapid quenching on the electrochemical properties of AB5 and AB3.5-type hydrogen storage alloys was studied. The results indicated that the discharge capacities of the rapid quenching MmNi3.55 Co0.75 Mn0.4Al0.3 alloys decrease under 25 and -35℃ with the increase of the quenching rate. Comparatively, the decrease extent of the quenching alloys at -35℃ is lower than that at 25℃. The result on the study of the cycle life indicated that the quenching process was favorable to improve the cycle stabilities of the MmNi3.55Co0.75-Mn0.4Al0.3alloys under 25 and -35℃. Whereas, the effect of the quenching process on the La0.7Mg0.3(Ni0.85Co0.15)3.5 alloy was different at 25℃ from at -35℃. Under 25℃, the cycle life of the alloy was obviously improved by the quenching process, however, the quenching process did not improve but decreased slightly the cycle life at -35℃.

  8. Ab initio study of II-(VI){sub 2} dichalcogenides

    Olsson, P; Vidal, J; Lincot, D, E-mail: polsson@kth.se [Institut de R and D sur l' energie photovoltaique (IRDEP), UMR 7174-EDF-CNRS-ENSCP, 6 quai Watier, 78401 Chatou Cedex (France)

    2011-10-12

    The structural stabilities of the (Zn,Cd)(S,Se,Te){sub 2} dichalcogenides have been determined ab initio. These compounds are shown to be stable in the pyrite phase, in agreement with available experiments. Structural parameters for the ZnTe{sub 2} pyrite semiconductor compound proposed here are presented. The opto-electronic properties of these dichalcogenide compounds have been calculated using quasiparticle GW theory. Bandgaps, band structures and effective masses are proposed as well as absorption coefficients and refraction indices. The compounds are all indirect semiconductors with very flat conduction band dispersion and high absorption coefficients. The work functions and surface properties are predicted. The Te and Se based compounds could be of interest as absorber materials in photovoltaic applications. (paper)

  9. Ab initio calculations of grain boundaries in bcc metals

    Scheiber, Daniel; Pippan, Reinhard; Puschnig, Peter; Romaner, Lorenz

    2016-03-01

    In this study, we compute grain boundary (GB) properties for a large set of GBs in bcc transition metals with a special focus on W, Mo and Fe using ab initio density functional theory (DFT) and semi-empirical second nearest neighbour modified embedded atom method (2NN-MEAM) potentials. The GB properties include GB energies, surface energies, GB excess volume and work of separation, which we analyse and then compare to experimental data. We find that the used 2NN-MEAM potentials can predict general trends of GB properties, but do not always reproduce the GB ground state structure and energy found with DFT. In particular, our results explain the experimental finding that W and Mo prefer intergranular fracture, while other bcc metals prefer transgranular cleavage.

  10. Ab initio quantum dynamics using coupled-cluster

    Kvaal, Simen

    2012-01-01

    The curse of dimensionality (COD) limits the current state-of-the-art {\\it ab initio} propagation methods for non-relativistic quantum mechanics to relatively few particles. For stationary structure calculations, the coupled-cluster (CC) method overcomes the COD in the sense that the method scales polynomially with the number of particles while still being size-consistent and extensive. We generalize the CC method to the time domain while allowing the single-particle functions to vary in an adaptive fashion as well, thereby creating a highly flexible, polynomially scaling approximation to the time-dependent Schr\\"odinger equation. The method inherits size-consistency and extensivity from the CC method. The method is dubbed orbital-adaptive time-dependent coupled-cluster (OATDCC), and is a hierarchy of approximations to the now standard multi-configurational time-dependent Hartree method for fermions. A numerical experiment is also given.

  11. Ab initio study of the transition-metal carbene cations

    李吉海; 冯大诚; 冯圣玉

    1999-01-01

    The geometries and bonding characteristics of the first-row transition-metal carbene cations MCH2+ were investigated by ab initio molecular orbital theory (HF/LANL2DZ). All of MCH2+ are coplanar. In the closed shell structures the C bonds to M with double bonds; while in the open shell structures the partial double bonds are formed, because one of the σ and π orbitals is singly occupied. It is mainly the π-type overlap between the 2px orbital of C and 4px, 3dxz, orbitals of M+ that forms the π orbitals. The dissociation energies of C—M bond appear in periodic trend from Sc to Cu. Most of the calculated bond dissociation energies are close to the experimental ones.

  12. Ab initio electronic stopping power of protons in bulk materials

    Shukri, Abdullah Atef; Bruneval, Fabien; Reining, Lucia

    2016-01-01

    The electronic stopping power is a crucial quantity for ion irradiation: it governs the deposited heat, the damage profile, and the implantation depth. Whereas experimental data are readily available for elemental solids, the data are much more scarce for compounds. Here we develop a fully ab initio computational scheme based on linear response time-dependent density-functional theory to predict the random electronic stopping power (RESP) of materials without any empirical fitting. We show that the calculated RESP compares well with experimental data, when at full convergence, with the inclusion of the core states and of the exchange correlation. We evaluate the unexpectedly limited magnitude of the nonlinear terms in the RESP by comparing with other approaches based on the time propagation of time-dependent density-functional theory. Finally, we check the validity of a few empirical rules of thumbs that are commonly used to estimate the electronic stopping power.

  13. High-throughput ab-initio dilute solute diffusion database.

    Wu, Henry; Mayeshiba, Tam; Morgan, Dane

    2016-01-01

    We demonstrate automated generation of diffusion databases from high-throughput density functional theory (DFT) calculations. A total of more than 230 dilute solute diffusion systems in Mg, Al, Cu, Ni, Pd, and Pt host lattices have been determined using multi-frequency diffusion models. We apply a correction method for solute diffusion in alloys using experimental and simulated values of host self-diffusivity. We find good agreement with experimental solute diffusion data, obtaining a weighted activation barrier RMS error of 0.176 eV when excluding magnetic solutes in non-magnetic alloys. The compiled database is the largest collection of consistently calculated ab-initio solute diffusion data in the world. PMID:27434308

  14. Transport coefficients in diamond from ab-initio calculations

    Löfâs, Henrik; Grigoriev, Anton; Isberg, Jan; Ahuja, Rajeev

    2013-03-01

    By combining the Boltzmann transport equation with ab-initio electronic structure calculations, we obtain transport coefficients for boron-doped diamond. We find the temperature dependence of the resistivity and the hall coefficients in good agreement with experimental measurements. Doping in the samples is treated via the rigid band approximation and scattering is treated in the relaxation time approximation. In contrast to previous results, the acoustic phonon scattering is the dominating scattering mechanism for the considered doping range. At room temperature, we find the thermopower, S, in the range 1-1.6 mV/K and the power factor, S2σ, in the range 0.004-0.16 μW /cm K2.

  15. Ab-initio melting curve and principal Hugoniot of tantalum

    We report first principles calculations of the melting curve and principal Hugoniot (P - V curve) of body centered cubic (bcc) tantalum in the pressure range 0-300 GPa. A description of lattice dynamics and thermal properties of bcc Ta using finite temperature density functional theory (DFT) is presented. The approach works within the projector augmented wave (PAW) implementation of DFT and explicitly treats in valence the 5p, 6s and 5d electrons. The principal Hugoniot (P - V curve), obtained using the Rankine-Hugoniot equation, is investigated using the generalized gradient approximations (GGA). Very good agreement with the shock experiments is obtained with GGA in all the range of pressure. We also report the temperature-pressure relation on the shock Hugoniot and the full ab-initio melting curve of Ta

  16. Diode laser welding of ABS: Experiments and process modeling

    Ilie, Mariana; Mattei, Simone; Cicala, Eugen; Stoica, Virgil; 10.1016/j.optlastec.2008.10.005

    2010-01-01

    The laser beam weldability of acrylonitrile/butadiene/styrene (ABS) plates is determined by combining both experimental and theoretical aspects. In modeling the process, an optical model is used to determine how the laser beam is attenuated by the first material and to obtain the laser beam profile at the interface. Using this information as the input data to a thermal model, the evolution of the temperature field within the two components can be estimated. The thermal model is based on the first principles of heat transfer and utilizes the temperature variation laws of material properties. Corroborating the numerical results with the experimental results, some important insights concerning the fundamental phenomena that govern the process could be extracted. This approach proved to be an efficient tool in determining the weldability of polimeric materials and assures a significant reduction of time and costs with the experimental exploration.

  17. Socialiai atsakingo verslo koncepcijos įgyvendinimas AB "Lietuvos draudimas"

    Žukauskienė, Justina

    2010-01-01

    Bakalauro baigiamajame darbe nagrinėjama socialiai atsakingo verslo koncepcija, pateikiami socialinės atsakomybės modeliai, kuriais remiantis įmonės gali įgyvendinti socialinę atsakomybę. Apžvelgiama Lietuvos patirtis socialinės atsakomybės srityje. Pateikiama ne tik socialinės atsakomybės nauda įmonei ir visuomenei, bet ir kritiškas požiūris į socialinę atsakomybę. Darbe analizuojamas AB „Lietuvos draudimas“ įgyvendinamas socialinės atsakomybės modelis. Nustatyta, kad įmonė socialinę atsakom...

  18. Ab initio methods for electron-molecule collisions

    This review concentrates on the recent advances in treating the electronic aspect of the electron-molecule interaction and leaves to other articles the description of the rotational and vibrational motions. Those methods which give the most complete treatment of the direct, exchange, and correlation effects are focused on. Such full treatments are generally necessary at energies below a few Rydbergs (≅ 60 eV). This choice unfortunately necessitates omission of those active and vital areas devoted to the development of model potentials and approximate scattering formulations. The ab initio and model approaches complement each other and are both extremely important to the full explication of the electron-scattering process. Due to the rapid developments of recent years, the approaches that provide the fullest treatment are concentrated on. 81 refs

  19. Ab initio electronic structure and optical conductivity of bismuth tellurohalides

    Schwalbe, Sebastian; Starke, Ronald; Schober, Giulio A H; Kortus, Jens

    2016-01-01

    We investigate the electronic structure, dielectric and optical properties of bismuth tellurohalides BiTeX (X = I, Cl, Br) by means of all-electron density functional theory. In particular, we present the ab initio conductivities and dielectric tensors calculated over a wide frequency range, and compare our results with the recent measurements by Akrap et al. , Makhnev et al. , and Rusinov et al. . We show how the low-frequency branch of the optical conductivity can be used to identify characteristic intra- and interband transitions between the Rashba spin-split bands in all three bismuth tellurohalides. We further calculate the refractive indices and dielectric constants, which in turn are systematically compared to previous predictions and measurements. We expect that our quantitative analysis will contribute to the general assessment of bulk Rashba materials for their potential use in spintronics devices.

  20. Relativistic ab initio calculations for ion-atom collisions

    Within the independent particle model we solve the time---dependent single-particle equation using ab initio SCF-DIRAC-FOCK-SLATER wavefunctions as a basis. To reinstate the many-particle aspect of the collision system we use the inclusive probability formalism to answer experimental questions. As an example we show an application to the case of S15+ on Ar where experimental data on the K-K charge transfer are available for a wide range of impact energies from 4.7 to 90 MeV. Our molecular adiabatic calculations and the evaluation using the inclusive probability formalism show good results in the low energy range from 4.7 to 16 MeV impact energy

  1. Ab Initio Calculations of Co Shielding in Model Complexes

    Elaine A. Moore

    2002-08-01

    Full Text Available Abstract: Recent ab initio calculations of cobalt NMR shielding show that DFT-GIAO calculations using hybrid functionals are found to reproduce experimental values well. This method is used to calculate the variation of the cobalt NMR shielding tensor of sqaure pyramidal nitrosyl complexes with respect to the CoNO geometry and to differing basal ligands. The isotropic shielding is shown to have a large negative derivative with respect to CoX distance where X is a ligating atom.; the derivative with respect to NO distance is smaller but still significant. The zz component where z is along the CoN(NO bond is more sensitive to the basal ligands but the other two principal components are sensitive to the CoNO geometry.

  2. Ab initio H2O in realistic hydrophilic confinement.

    Allolio, Christoph; Klameth, Felix; Vogel, Michael; Sebastiani, Daniel

    2014-12-15

    A protocol for the ab initio construction of a realistic cylindrical pore in amorphous silica, serving as a geometric nanoscale confinement for liquids and solutions, is presented. Upon filling the pore with liquid water at different densities, the structure and dynamics of the liquid inside the confinement can be characterized. At high density, the pore introduces long-range oscillations into the water density profile, which makes the water structure unlike that of the bulk across the entire pore. The tetrahedral structure of water is also affected up to the second solvation shell of the pore wall. Furthermore, the effects of the confinement on hydrogen bonding and diffusion, resulting in a weakening and distortion of the water structure at the pore walls and a slowdown in diffusion, are characterized. PMID:25208765

  3. Ab initio design of laser pulse for controlling photochemical reactions

    With high level ab initio description of molecule-field interaction, we have developed an optimal control algorithm for manipulating molecular transformation and quantum populations. High order molecule-field interactions are fully taken into account through the use of electric-nuclear Born-Oppenheimer (ENBO) approximation. The present algorithm is demonstrated on the control of molecular post-pulse (transient)alignment and orientation. High degrees of alignment and orientation are achieved in a vibrationally selective manner by optimized infrared laser pulses of duration on the order one rotational period of molecule. To reveal the control mechanism behind the complicated optimal pulses, an analytical pulse design method is developed within the ENBO approximation, which is based on a two-state treatment of the dynamics in a Floquet picture. This analytical method is also illustrated on the control of the alignment of homonuclear diatomics. (author)

  4. Highly anisotropic thermal conductivity of arsenene: An ab initio study

    Zeraati, Majid; Vaez Allaei, S. Mehdi; Abdolhosseini Sarsari, I.; Pourfath, Mahdi; Donadio, Davide

    2016-02-01

    Elemental two-dimensional (2D) materials exhibit intriguing heat transport and phononic properties. Here we have investigated the lattice thermal conductivity of newly proposed arsenene, the 2D honeycomb structure of arsenic, using ab initio calculations. Solving the Boltzmann transport equation for phonons, we predict a highly anisotropic thermal conductivity of 30.4 and 7.8 W/mK along the zigzag and armchair directions, respectively, at room temperature. Our calculations reveal that phonons with mean free paths between 20 nm and 1 μ m provide the main contribution to the large thermal conductivity in the zigzag direction; mean free paths of phonons contributing to heat transport in the armchair directions range between 20 and 100 nm. The obtained anisotropic thermal conductivity and feasibility of synthesis, in addition to high electron mobility reported elsewhere, make arsenene a promising material for nanoelectronic applications and thermal management.

  5. Efficient Ab initio Modeling of Random Multicomponent Alloys

    Jiang, Chao; Uberuaga, Blas P.

    2016-03-01

    We present in this Letter a novel small set of ordered structures (SSOS) method that allows extremely efficient ab initio modeling of random multicomponent alloys. Using inverse II-III spinel oxides and equiatomic quinary bcc (so-called high entropy) alloys as examples, we demonstrate that a SSOS can achieve the same accuracy as a large supercell or a well-converged cluster expansion, but with significantly reduced computational cost. In particular, because of this efficiency, a large number of quinary alloy compositions can be quickly screened, leading to the identification of several new possible high-entropy alloy chemistries. The SSOS method developed here can be broadly useful for the rapid computational design of multicomponent materials, especially those with a large number of alloying elements, a challenging problem for other approaches.

  6. Molecular ion LiHe+: ab initio study

    Highlights: ► Excited electronic states of LiHe+ are studied. ► Potential energy curves of thirteen states are calculated. ► Dipole moment and transition dipole moment functions are determined. ► Basic spectroscopic properties of the electronic states are derived. - Abstract: High level ab initio calculations are performed on the molecular ion LiHe+. Potential energy curves for the low-lying singlet and triplet electronic states are calculated using the multi-reference configuration interaction and single-reference coupled cluster methods with large basis sets. The corresponding dipole moments and transition dipole moments functions are also determined. The basic spectroscopic properties and excitation energies of the electronic states are derived from rovibrational bound state calculations.

  7. OPTIMIZATION STUDY IN MANUFACTURING PROCESS FOR PC/ABS BLENDS

    Huang Chenghung; Fung Chinping; Chang Shihhsing; Hwang Jiunren; Doong Jiliang

    2003-01-01

    The optimization of injection molding process for polycarbonate/acrylonitrile-butadiene-styrene (PC/ABS) blends is studied using Taguchi method and principal component analysis (PCA). Four controllable process factors are studied at three levels each in the manufacturing process. The L9 orthogonal array is conducted to determine the optimum process factor/level combination for single quality of mechanical properties. In addition, the principal component analysis is employed to transform the correlated mechanical properties to a set of uncorrelated components and to evaluate a comprehensive index for multi-response cases. Then the optimum process factor/level combination for multiple qualities can be determined. Finally, the analysis of variance is used to find out the most influential injection molding parameter for single and multiple qualities problems.

  8. AB "DNB" banko įvaizdžio valdymas

    Vaškelytė, Virginija

    2012-01-01

    Šio darbo tikslas - išnagrinėji AB „DNB“ banko įvaizdžio formavimą ir valdymą teoriniu bei praktiniu aspektu ir konstatavus įvaizdžio formavimo bei valdymo problemas sukurti banko įvaizdžio tobulinimo modelį. Teorinėje darbo dalyje analizuojama organizacijos įvaizdžio samprata, kūrimo lygiai, pagrindiniai veiksniai, formuojantys organizacijos įvaizdį. Taip pat teorinėje dalyje analizuojami, lyginami organizacijos įvaizdžio kūrimo modeliai bei banko įvaizdžio valdymas. Analitinėje baigiamojo d...

  9. Ab initio potential energy surface and rovibrational states of HBO

    Ha, Tae-Kyu; Makarewicz, Jan

    1999-01-01

    The potential energy surface describing the large-amplitude motion of H around the BO core in the HBO molecule has been determined from ab initio calculations. This surface has been sampled by a set of 170 grid points from a two-dimensional space defined by the stretching and the bending coordinates of the H nucleus. At each grid point, the BO bond length has been optimized using the second-order Møller-Plesset perturbation theory with the basis set aug-cc-pVTZ. The surface has a local minimum for the linear as well as the bent configuration of HBO. A low energy barrier to the linear configuration BOH causes a large-amplitude motion and a strong rovibrational interaction in the molecule. Its rovibrational dynamics is different from the dynamics in bent or quasilinear triatomic molecules.

  10. Ab initio quantum dynamics using coupled-cluster.

    Kvaal, Simen

    2012-05-21

    The curse of dimensionality (COD) limits the current state-of-the-art ab initio propagation methods for non-relativistic quantum mechanics to relatively few particles. For stationary structure calculations, the coupled-cluster (CC) method overcomes the COD in the sense that the method scales polynomially with the number of particles while still being size-consistent and extensive. We generalize the CC method to the time domain while allowing the single-particle functions to vary in an adaptive fashion as well, thereby creating a highly flexible, polynomially scaling approximation to the time-dependent Schrödinger equation. The method inherits size-consistency and extensivity from the CC method. The method is dubbed orbital-adaptive time-dependent coupled-cluster, and is a hierarchy of approximations to the now standard multi-configurational time-dependent Hartree method for fermions. A numerical experiment is also given. PMID:22612082

  11. A Review on Ab Initio Approaches for Multielectron Dynamics

    Ishikawa, Kenichi L

    2015-01-01

    In parallel with the evolution of femtosecond and attosecond laser as well as free-electron laser technology, a variety of theoretical methods have been developed to describe the behavior of atoms, molecules, clusters, and solids under the action of those laser pulses. Here we review major ab initio wave-function-based numerical approaches to simulate multielectron dynamics in atoms and molecules driven by intense long-wavelength and/or ultrashort short-wavelength laser pulses. Direct solution of the time-dependent Schr\\"odinger equation (TDSE), though its applicability is limited to He, ${\\rm H}_2$, and Li, can provide an exact description and has been greatly contributing to the understanding of dynamical electron-electron correlation. Multiconfiguration self-consistent-field (MCSCF) approach offers a flexible framework from which a variety of methods can be derived to treat both atoms and molecules, with possibility to systematically control the accuracy. The equations of motion of configuration interactio...

  12. Energiutredning på Chips AB, Åland

    Renström, Thom; Sundbäck, Henrik

    2013-01-01

    En energikartläggning har gjorts hos Chips AB för att undersöka hur energin fördelas över de olika produktionslinjerna. Energianvändningen från processer som är gemensamma för alla produktionslinjer har också undersökts. Energianvändningen för dessa har fördelats över pro- duktionslinjerna eftersom produkterna även ska bära upp dessa energikostnader. Där det vi- sade sig att chipslinjen använder överlägset mest energi under ett år, 13 200 MWh, men den linjen körs mest o...

  13. Ab initio engineering of materials with stacked hexagonal tin frameworks

    Shao, Junping; Beaufils, Clément; Kolmogorov, Aleksey N.

    2016-01-01

    The group-IV tin has been hypothesized to possess intriguing electronic properties in an atom-thick hexagonal form. An attractive pathway of producing sizable 2D crystallites of tin is based on deintercalation of bulk compounds with suitable tin frameworks. Here, we have identified a new synthesizable metal distannide, NaSn2, with a 3D stacking of flat hexagonal layers and examined a known compound, BaSn2, with buckled hexagonal layers. Our ab initio results illustrate that despite being an exception to the 8-electron rule, NaSn2 should form under pressures easily achievable in multi-anvil cells and remain (meta)stable under ambient conditions. Based on calculated Z2 invariants, the predicted NaSn2 may display topologically non-trivial behavior and the known BaSn2 could be a strong topological insulator. PMID:27387140

  14. Ab initio Potential Energy Surface for H-H2

    Partridge, Harry; Bauschlicher, Charles W., Jr.; Stallcop, James R.; Levin, Eugene

    1993-01-01

    Ab initio calculations employing large basis sets are performed to determine an accurate potential energy surface for H-H2 interactions for a broad range of separation distances. At large distances, the spherically averaged potential determined from the calculated energies agrees well with the corresponding results determined from dispersion coefficients; the van der Waals well depth is predicted to be 75 +/- (mu)E(sub h). Large basis sets have also been applied to reexamine the accuracy of theoretical repulsive potential energy surfaces. Multipolar expansions of the computed H-H2 potential energy surface are reported for four internuclear separation distances (1.2, 1.401, 1.449, and 1.7a(sub 0) of the hydrogen molecule. The differential elastic scattering cross section calculated from the present results is compared with the measurements from a crossed beam experiment.

  15. An Efficient Approach to Ab Initio Monte Carlo Simulation

    Leiding, Jeff

    2013-01-01

    We present a Nested Markov Chain Monte Carlo (NMC) scheme for building equilibrium averages based on accurate potentials such as density functional theory. Metropolis sampling of a reference system, defined by an inexpensive but approximate potential, is used to substantially decorrelate configurations at which the potential of interest is evaluated, thereby dramatically reducing the number needed to build ensemble averages at a given level of precision. The efficiency of this procedure is maximized on-the-fly through variation of the reference system thermodynamic state (characterized here by its inverse temperature \\beta^0), which is otherwise unconstrained. Local density approximation (LDA) results are presented for shocked states in argon at pressures from 4 to 60 GPa. Depending on the quality of the reference potential, the acceptance probability is enhanced by factors of 1.2-28 relative to unoptimized NMC sampling, and the procedure's efficiency is found to be competitive with that of standard ab initio...

  16. Internetmarknadsföring inom turismen : Case Esbo Turism Ab

    Gothoni, Jenny

    2010-01-01

    I detta arbetet behandlas kundförnöjsamheten med Esbo Turism Abs hemsidor, och ifall dessa kan förbättras ytterligare. Teorin baserar sig mycket på marknadsföring samt kundens beteende och behov, internetsidor samt kvalitet och segmentering. Undersökningen har genomförts med hjälp av webbenkäter och litet djupare e-post intervjuer under våren 2010. I undersökningen deltog 30 personer i enkäterna och tre stycken i intervjuerna. Störst svarskvot bildades av 15-25 åringar från Helsingfors. ...

  17. Interatomic Coulombic decay widths of helium trimer: Ab initio calculations

    Kolorenč, Přemysl, E-mail: kolorenc@mbox.troja.mff.cuni.cz [Charles University in Prague, Faculty of Mathematics and Physics, Institute of Theoretical Physics, V Holešovičkách 2, 180 00 Prague (Czech Republic); Sisourat, Nicolas [Sorbonne Universités, UPMC Univ Paris 06, UMR 7614, Laboratoire de Chimie Physique Matière et Rayonnement, F-75005 Paris (France); CNRS, UMR 7614, Laboratoire de Chimie Physique Matière et Rayonnement, F-75005 Paris (France)

    2015-12-14

    We report on an extensive study of interatomic Coulombic decay (ICD) widths in helium trimer computed using a fully ab initio method based on the Fano theory of resonances. Algebraic diagrammatic construction for one-particle Green’s function is utilized for the solution of the many-electron problem. An advanced and universal approach to partitioning of the configuration space into discrete states and continuum subspaces is described and employed. Total decay widths are presented for all ICD-active states of the trimer characterized by one-site ionization and additional excitation of an electron into the second shell. Selected partial decay widths are analyzed in detail, showing how three-body effects can qualitatively change the character of certain relaxation transitions. Previously unreported type of three-electron decay processes is identified in one class of the metastable states.

  18. Effect of gamma irradiation on nutritional components and Cry1Ab protein in the transgenic rice with a synthetic cry1Ab gene from Bacillus thuringiensis

    The effects of gamma irradiation on the transgenic rice containing a synthetic cry1Ab gene from Bacillus thuringiensis were investigated. There was almost no difference in the content of the major nutritional components, i.e. crude protein, crude lipid, eight essential amino acids and total ash between the irradiated grains and the non-irradiated transgenic rice. However, the amounts of Cry1Ab protein and apparent amylose in the irradiated transgenic rice were reduced significantly by the doses higher than 200 Gy. In vivo observation showed that Cry1Ab protein contents also decreased in the fresh leaf tissues of survival seedlings after irradiation with 200 Gy or higher doses and showed inhibition of seedling growth. The results indicate that gamma irradiation might improve the quality of transgenic rice due to removal of the toxic Cry1Ab protein

  19. 一种AB PLC与Profibus DP网络通信的方法%A Solution for Communication between AB PLC and Profibus DP Network

    李学治

    2015-01-01

    Industrial automation communication network is variousness. This paper presents a solution for communication be-tween AB PLC and Profibus DP network, introduces an example that an AB PLC system communicates with Siemens S120 drives through Profibus DP network by using MVI56-PDPMV1 module.%工业自动化通信网络具有多样性的特点, wenz对AB PLC与Profibus DP网络通信的方法进行探究,用设计实例探讨AB PLC系统通过MVI56-PDPMV1通信模块与西门子S120驱动系统构建Profibus-DP通信网络的设计与编程设置。

  20. Effect of gamma irradiation on nutritional components and Cry1Ab protein in the transgenic rice with a synthetic cry1Ab gene from Bacillus thuringiensis

    Wu, Dianxing; Ye, Qingfu; Wang, Zhonghua; Xia, Yingwu

    2004-01-01

    The effects of gamma irradiation on the transgenic rice containing a synthetic cry1Ab gene from Bacillus thuringiensis were investigated. There was almost no difference in the content of the major nutritional components, i.e. crude protein, crude lipid, eight essential amino acids and total ash between the irradiated grains and the non-irradiated transgenic rice. However, the amounts of Cry1Ab protein and apparent amylose in the irradiated transgenic rice were reduced significantly by the doses higher than 200 Gy. In vivo observation showed that Cry1Ab protein contents also decreased in the fresh leaf tissues of survival seedlings after irradiation with 200 Gy or higher doses and showed inhibition of seedling growth. The results indicate that gamma irradiation might improve the quality of transgenic rice due to removal of the toxic Cry1Ab protein.

  1. Expression of Cry1Ab and Cry2Ab by a polycistronic transgene with a self-cleavage peptide in rice.

    Qichao Zhao

    Full Text Available Insect resistance to Bacillus thuringiensis (Bt crystal protein is a major threat to the long-term use of transgenic Bt crops. Gene stacking is a readily deployable strategy to delay the development of insect resistance while it may also broaden insecticidal spectrum. Here, we report the creation of transgenic rice expressing discrete Cry1Ab and Cry2Ab simultaneously from a single expression cassette using 2A self-cleaving peptides, which are autonomous elements from virus guiding the polycistronic viral gene expression in eukaryotes. The synthetic coding sequences of Cry1Ab and Cry2Ab, linked by the coding sequence of a 2A peptide from either foot and mouth disease virus or porcine teschovirus-1, regardless of order, were all expressed as discrete Cry1Ab and Cry2Ab at high levels in the transgenic rice. Insect bioassays demonstrated that the transgenic plants were highly resistant to lepidopteran pests. This study suggested that 2A peptide can be utilized to express multiple Bt genes at high levels in transgenic crops.

  2. Dicty_cDB: FC-AB36 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AB36 (Link to dictyBase) - - - Contig-U15455-1 FC-AB36Z (Link to Origina ... yk*nnkknkkklkkkkktk*n*ikkqkqnkkkk Frame C: ---*icp*risk *kefineiikkikkn*krkkkqnkik*knknktkkk Homology vs CS ...

  3. Prediction on Antigenic Epitope Characteristics of Bt Cry2Ab Protein in Transgenic Crops

    Jierong GAO; Ying HE; Zehong ZOU; Ailin TAO; Yuncan AI

    2012-01-01

    Abstract [Objective] This study aimed to predict the structural characteristics of Bt Cry2Ab protein in transgenic crops with bioinformatic analysis to provide the theoreti- cal clues for design of antibody Cry2Ab. [Method] The amino acid sequence of Cry2Ab protein was searched from NCBI database. The B cell epitopes were pre- dicted with DNAStar. The binding affinity between Cry2Ab protein and MHC-II molecules was analyzed with NetMHCII 2.2 Server to predict the T cell epitopes. [Result] Prediction result suggested the potential B cell epitope of Cry2Ab locating in the region of 208-215. Analysis of the binding affinity between Cry2Ab and MHC-II molecules suggested the regions of 177-185, 299-307 and 255-263 were the po- tential T cell epitopes. Human with HLA-DRB10101 alleles and HLA-DRB10701 al- leles were more sensitive to Cry2Ab protein. [Conclusion] This study facilitates to un- derstand the structural characteristics of Cry2Ab protein and provides a new clue to improve the assessment method for potential allergenicity of genetically modified food.

  4. Leonid Apananski müüs AB Grupi maa oma firmale / Silva Männik

    Männik, Silva, 1974-

    1999-01-01

    Ilmunud ka: Den za Dnjom Nov/26 lk. 8. Apananski müüs AB Kindlustuse Grupile kuulunud Maakri tänava kinnistu. Skeem: AB Grupist on välja viidud ligikaudu 70 milj. krooni. Ilmunud ka: Den za Dnjom 23. nov. lk. 3

  5. InterProScan Result: AB047925 [KAIKOcDNA[Archive

    Full Text Available AB047925 AB047925_1_ORF1 537628749FFCB8C5 SUPERFAMILY SSF81321 SSF81321 4.1E-6 T IPR000856 unint ... ng pathway (GO:0007186)|Biological Process: visual perception ... (GO:0007601)|Biological Process: phototransduction ...

  6. InterProScan Result: AB047925 [KAIKOcDNA[Archive

    Full Text Available AB047925 AB047925_1_ORF1 537628749FFCB8C5 PANTHER PTHR19264:SF17 Opsin_RH3/RH4 3.099999458993759 ... ng pathway (GO:0007186)|Biological Process: visual perception ... (GO:0007601)|Biological Process: phototransduction ...

  7. InterProScan Result: AB047925 [KAIKOcDNA[Archive

    Full Text Available AB047925 AB047925_1_ORF1 537628749FFCB8C5 PANTHER PTHR19264 PTHR19264 3.0999994589937598E-30 T I ... ng pathway (GO:0007186)|Biological Process: visual perception ... (GO:0007601)|Biological Process: phototransduction ...

  8. Dicty_cDB: FCL-AB15 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AB15 (Link to dictyBase) - - - Contig-U15231-1 FCL-AB15E (Link to Orig ... ifliicqk*eidleatllnlkkllkrin*idyhslvklnfsmqchy*kle vtl *iisilnqlmpkqsvnlkny*iislnk*sk**iiiiiskykicnpsncwss ...

  9. Towards a fair and equitable abs regime: is Nagoya leading us in the right direction?

    Jonge, de B.

    2013-01-01

    A historical overview of the concept of Access and Benefit Sharing (ABS) suggests that ABS is all about compensation, i.e. a benefit sharing mechanism that provides one with compensation for allowing access to one’s resources. The principles of entitlement (based on sovereign rights) and desert (bas

  10. InterProScan Result: AB474577 [KAIKOcDNA[Archive

    Full Text Available AB474577 AB474577_2_ORF1 55017EA0D2FBC672 SMART SM00051 DSL 4.0999959904578364E-24 T IPR001774 D ... rrate/lag-2 (DSL) protein Biological Process: cell communication ... (GO:0007154)|Cellular Component: membrane (GO:0016 ...

  11. InterProScan Result: AB474577 [KAIKOcDNA[Archive

    Full Text Available AB474577 AB474577_2_ORF1 55017EA0D2FBC672 PFAM PF01414 DSL 2.7000000000000042E-20 T IPR001774 De ... rrate/lag-2 (DSL) protein Biological Process: cell communication ... (GO:0007154)|Cellular Component: membrane (GO:0016 ...

  12. InterProScan Result: AB474577 [KAIKOcDNA[Archive

    Full Text Available AB474577 AB474577_2_ORF1 55017EA0D2FBC672 PROFILE PS51051 DSL 0.0 T IPR001774 Delta/Serrate/lag- ... 2 (DSL) protein Biological Process: cell communication ... (GO:0007154)|Cellular Component: membrane (GO:0016 ...

  13. ABS/PET合金的相容化研究%Study on the Compatibility of ABS/PET Alloy

    刘辉辉; 杜一凡; 谷志杰; 许海燕

    2014-01-01

    以苯乙烯-丙烯腈-甲基丙烯酸缩水甘油酯(SAG)和苯乙烯-丙烯腈-马来酸酐(SMA)为相容剂对丙烯腈-丁二烯-苯乙烯(ABS)/聚对苯二甲酸乙二醇酯(PET)合金进行增容.并从拉伸性能、弯曲性能、冲击性能、熔体质量流动速率(MFR)等方面对SAG和SMA的增容效果进行了比较.结果表明,含有GMA基团的SAG比含有MAH基团的SAM的增容效果更好.

  14. Influence of Cellulose on the Mechanical and Thermal Stability of ABS Plastic Composites

    K. Crews

    2016-01-01

    Full Text Available Microcrystalline cellulose was explored as possible biodegradable fillers in the fabrication of ABS plastic composites. TGA indicates that upon inclusion of cellulose microcrystals the thermal stability of the ABS plastics was improved significantly when compared to the neat ABS plastic counterparts. Furthermore, inclusion of extracted cellulose from plant biomass showed a higher thermal stability with maximum decomposition temperatures around 131.95°C and 124.19°C for cellulose from cotton and Hibiscus sabdariffa, respectively, when compared to that of the purchased cellulose. In addition, TMA revealed that the average CTE value for the neat ABS and 1 : 1 ratio of cellulose to ABS fabricated in this study was significantly lower than the reported CTE (ca. 73.8 μm/m°C.

  15. Hydrogenation of AB{sub 5} and AB{sub 2} metal hydride alloys studied by in situ X-ray diffraction

    Wang, L. [Department of Chemical Engineering and Materials Science, Wayne State University, Detroit, MI 48202 (United States); BASF – Battery Materials Ovonic, 2983 Waterview Drive, Rochester Hills, MI 48309 (United States); Young, K., E-mail: kwo.young@basf.com [BASF – Battery Materials Ovonic, 2983 Waterview Drive, Rochester Hills, MI 48309 (United States); Nei, J.; Pawlik, D. [BASF – Battery Materials Ovonic, 2983 Waterview Drive, Rochester Hills, MI 48309 (United States); Ng, K.Y.S. [Department of Chemical Engineering and Materials Science, Wayne State University, Detroit, MI 48202 (United States)

    2014-12-15

    Highlights: • Hydrogenation process of an AB{sub 5} alloy and two AB{sub 2} alloys were studied by quasi in-situ XRD. • In both AB{sub 5} and AB{sub 2} metal alloy, hydrogen occupation sites on the half-plane were taken first. • In the C14/C15 mixed alloy, C14 phase is the main hydrogen storage phase with a lower equilibrium pressure. • In the C14/C15 mixed alloy, C15 phase is the catalyst hydrogen storage phase with a higher equilibrium pressure. • Small amount of C15 was hydrided first but not completed until C14 phase was fully hydrided. - Abstract: The evolution of lattice constants and abundances of metal (α) and metal hydride (β) phases during the hydrogenation process of an AB{sub 5} alloy with a CaCu{sub 5} crystal structure, an AB{sub 2} alloy with a predominating C14 structure, and a C14/C15-mixed AB{sub 2} alloy were reported. The preferred hydrogen insertion sites at different states of charge in both the α and β phases were studied based on the lattice parameter changes during hydrogenation. During the hydrogenation of the AB{sub 5} alloy, the ratio between lattice parameters a and c (a/c ratio) in the α phase decreases, stabilizes, and then decreases again while that in the β phase decreases and then stabilizes. The trends in unit cell volume changes are increasing, plateauing, and increasing again in the α phase and increasing followed by plateauing in the β phase as the hydrogenation level increases. In the C14-predominant AB{sub 2} alloy, the a/c ratio in the α phase increases at the beginning and then stabilizes while that in the β phase remains about the same and then increases during the addition of hydrogen. Moreover, the unit cell volume in the α phase increases slightly during hydrogenation, comparing to the increasing, decreasing, and then increasing trend in the β phase. In the C14/C15 mixed AB{sub 2} alloy, hydrogenation of the C15 phase starts at the beginning and promotes the hydrogenation of the C14 phase. The C14

  16. Performance Study of ABS/Graphite/NBR Thermal Conductive Composites%ABS/石墨/NBR导热复合材料性能的研究

    傅伟宁; 张云灿; 韦亚兵; 成敏

    2013-01-01

    采用熔融共混法制备丙烯腈-丁二烯-苯乙烯共聚物(ABS)/石墨/丁腈橡胶(NBR)导热复合材料,通过热常数分析仪、同步热分析仪、扫描电子显微镜、力学性能测试等手段研究了NBR、ABS高胶粉及石墨(G)的添加量对ABS复合材料导热性能及力学性能的影响.结果表明,ABS高胶粉和NBR均能明显提高ABS的热导率和缺口冲击强度,但是丁腈胶粉的改性效果优于高胶粉.以NBR作为ABS复合材料的增韧剂,随着石墨含量的增大,增韧效果下降,ABS复合材料的热导率提高到纯ABS的5倍,热分解温度提高40℃左右,热膨胀系数下降.当ABS/G/NBR复合材料的质量比为60/15/25时,其热导率为纯ABS的2倍,缺口冲击强度达21.8 kJ/m2,明显高于纯ABS(2.6 kJ/m2).%Thermally conductive ABS/graphite/nitrile butadiene rubber (NBR) composites were prepared by melt bleding method.The effects of NBR,ABS and graphite content on the thermal conductivity and mechanical property of the ABS composites were studied respectively by the thermal constant analyzer,synchronous thermal analysis,scanning electron microscopy and mechanical properties testing means.The results showed that ABS high glue powder and NBR could increase the thermal conductivity and Notched impact strength of ABS,but NBR was more suitable as a toughening agent for ABS composite.The toughening effect decreased as the graphite content increased.Meanwhile the thermal conductivity of the ABS composite was up to five times than that of the pure ABS.The thermal decomposition temperature of the composite increased by about 40 ℃ and the thermal expansion coefficient failed.When the mass ratio of ABS/G/NBR was 60/15/25,the thermal conductivity was two times than that of pure ABS and the impact strength was up to 21.8 kJ/m2 which was larger than that of pure ABS (2.6 kJ/m2).

  17. Ab initio molecular crystal structures, spectra, and phase diagrams.

    Hirata, So; Gilliard, Kandis; He, Xiao; Li, Jinjin; Sode, Olaseni

    2014-09-16

    Conspectus Molecular crystals are chemists' solids in the sense that their structures and properties can be understood in terms of those of the constituent molecules merely perturbed by a crystalline environment. They form a large and important class of solids including ices of atmospheric species, drugs, explosives, and even some organic optoelectronic materials and supramolecular assemblies. Recently, surprisingly simple yet extremely efficient, versatile, easily implemented, and systematically accurate electronic structure methods for molecular crystals have been developed. The methods, collectively referred to as the embedded-fragment scheme, divide a crystal into monomers and overlapping dimers and apply modern molecular electronic structure methods and software to these fragments of the crystal that are embedded in a self-consistently determined crystalline electrostatic field. They enable facile applications of accurate but otherwise prohibitively expensive ab initio molecular orbital theories such as Møller-Plesset perturbation and coupled-cluster theories to a broad range of properties of solids such as internal energies, enthalpies, structures, equation of state, phonon dispersion curves and density of states, infrared and Raman spectra (including band intensities and sometimes anharmonic effects), inelastic neutron scattering spectra, heat capacities, Gibbs energies, and phase diagrams, while accounting for many-body electrostatic (namely, induction or polarization) effects as well as two-body exchange and dispersion interactions from first principles. They can fundamentally alter the role of computing in the studies of molecular crystals in the same way ab initio molecular orbital theories have transformed research practices in gas-phase physical chemistry and synthetic chemistry in the last half century. In this Account, after a brief summary of formalisms and algorithms, we discuss applications of these methods performed in our group as compelling

  18. AB-8大孔树脂对蓝莓花色苷的纯化研究%The purification study of blueberry anthocyanin on resin AB-8

    黄月鹏; 黄翠贤

    2012-01-01

    花色苷是一种水溶性的安全的天然色素。本论文以蓝莓花色苷提取液为原料。使用AB-8树脂对蓝莓花色苷精制工艺进行了研究。结果表明:AB-8树脂吸附流速为10mL/min,用40%乙醇洗脱,解吸流速为5mL/min。AB-8树脂饱和吸附量1.25mg/mL,树脂量是蓝莓花色苷量的3BV。蓝莓花色苷的纯度为38.1%。%Anthocyanin was a water-soluble, safe and natural pigment. Extraction of blueberry anthocyanin was used as raw material in this paper.lt was studied that technology of purifing resin AB-8 to blueberry anthocyanin. The results showed that the absorption speed of resin AB-8 was 10ml/min,the anthocyanin from blueberry was eluted with 40% ethanol at the flow rate of 5mL/min.The absorption capacity of the resin AB-8 was determined to be 1.25mg/mL. It revealed that ratio of resinAB-8 to blueberry anthocyanin solvent were 3BV. The purification of blueberry anthocyanin was 38.1%.

  19. Ab initio evaluations of the He solubility in liquid Li

    Sedano, Luis A. [EURATOM-CIEMAT Assoc., Materials for Fusion Program, Bd. 43 P0.04, Avda. Complutense 22, 28040 Madrid (Spain)]. E-mail: luis.sedano@ciemat.es; Hassanein, Ahmed [Argonne Nat. Lab, 9700 South Class Av., Argonne, IL (United States)]. E-mail: hassanein@anl.gov; Sanz, Javier [ETSII-UNED, c/Juan del Rosal, 12, 28040 Madrid (E) (Spain)]. E-mail: jsanz@ind.UNED.es

    2005-11-15

    Modified embedding atom methods (MEAM) are developed to have predictions of the partial molar heat of solution (-H{sub s}) by direct simulation of metal cohesion, He-metal and He-He interaction. Transitions from crystalline Li to configurations, having the liquid Li structure's factors (h-bar (q)), are simulated ab initio. Once h-bar (q) reproduced, He atoms are added, one by one, to the Li system. Parallel lines for each case, with slopes clearly independent on the number of He atoms in the system, are obtained for energy versus pressure at given temperatures. Average differences between two adjacent parallels at zero pressure, once kinetic energy of the system discounted, represents the energy gained by an He atom when added to the Li system, related to the solution energy -H{sub s}. The molar excess entropy of gas in solution (S-bar {sub l}{sup ex}) is previously evaluated following diverse fundamental approaches: a 'thermodynamic liquid-hole' (TL-H) model for alkali liquids and a statistical-mechanics (Neff and McQuarrie's) model (SMM). Between 600 and 900 deg. C, a typical range of interest for the use of Li in fusion technology, the computed values for the (He) Henry's constant in Li range from 8x10{sup -14} to 10{sup -13} at. fr. Pa{sup -1}.

  20. Volumic omit maps in ab initio dual-space phasing.

    Oszlányi, Gábor; Sütő, András

    2016-07-01

    Alternating-projection-type dual-space algorithms have a clear construction, but are susceptible to stagnation and, thus, inefficient for solving the phase problem ab initio. To improve this behaviour new omit maps are introduced, which are real-space perturbations applied periodically during the iteration process. The omit maps are called volumic, because they delete some predetermined subvolume of the unit cell without searching for atomic regions or analysing the electron density in any other way. The basic algorithms of positivity, histogram matching and low-density elimination are tested by their solution statistics. It is concluded that, while all these algorithms based on weak constraints are practically useless in their pure forms, appropriate volumic omit maps can transform them to practically useful methods. In addition, the efficiency of the already useful reflector-type charge-flipping algorithm can be further improved. It is important that these results are obtained by using non-sharpened structure factors and without any weighting scheme or reciprocal-space perturbation. The mathematical background of volumic omit maps and their expected applications are also discussed. PMID:27357850

  1. Engineering Room-temperature Superconductors Via ab-initio Calculations

    Gulian, Mamikon; Melkonyan, Gurgen; Gulian, Armen

    The BCS, or bosonic model of superconductivity, as Little and Ginzburg have first argued, can bring in superconductivity at room temperatures in the case of high-enough frequency of bosonic mode. It was further elucidated by Kirzhnitset al., that the condition for existence of high-temperature superconductivity is closely related to negative values of the real part of the dielectric function at finite values of the reciprocal lattice vectors. In view of these findings, the task is to calculate the dielectric function for real materials. Then the poles of this function will indicate the existence of bosonic excitations which can serve as a "glue" for Cooper pairing, and if the frequency is high enough, and the dielectric matrix is simultaneously negative, this material is a good candidate for very high-Tc superconductivity. Thus, our approach is to elaborate a methodology of ab-initio calculation of the dielectric function of various materials, and then point out appropriate candidates. We used the powerful codes (TDDF with the DP package in conjunction with ABINIT) for computing dielectric responses at finite values of the wave vectors in the reciprocal lattice space. Though our report is concerned with the particular problem of superconductivity, the application range of the data processing methodology is much wider. The ability to compute the dielectric function of existing and still non-existing (though being predicted!) materials will have many more repercussions not only in fundamental sciences but also in technology and industry.

  2. Ab initio simulations of peptide-mineral interactions

    Hug, Susanna; Hunter, Graeme K.; Goldberg, Harvey; Karttunen, Mikko

    We performed Car-Parrinello Molecular Dynamics (CPMD) simulations of two amino acids, aspartic acid (Asp) and phophoserine (pSer), on a calcium oxalate monohydrate (COM) surface as a model of the interactions of phosphoproteins with biominerals. In our earlier work using in vitro experiments and classical Molecular Dynamics (MD) simulations we have demonstrated the importance of phosphorylation of serine on the interactions of osteopontin (OPN) with COM. We used configurations from our previous classical MD simulations as a starting point for the ab initio simulations. In the case of Asp we found that the α-carboxyl and amine groups form temporary close contacts with the surface. For the dipeptide Asp-pSer the carboxyl groups form permanent close contacts with the surface and the distances of its other functional groups do not vary much. We show how the interaction of carboxyl groups with COM crystal is established and confirm the importance of phosphorylation in mediating the interactions between COM surfaces and OPN.

  3. Ab initio transport across bismuth selenide surface barriers

    Narayan, Awadhesh

    2014-11-24

    © 2014 American Physical Society. We investigate the effect of potential barriers in the form of step edges on the scattering properties of Bi2Se3(111) topological surface states by means of large-scale ab initio transport simulations. Our results demonstrate the suppression of perfect backscattering, while all other scattering processes, which do not entail a complete spin and momentum reversal, are allowed. Furthermore, we find that the spin of the surface state develops an out-of-plane component as it traverses the barrier. Our calculations reveal the existence of quasibound states in the vicinity of the surface barriers, which appear in the form of an enhanced density of states in the energy window corresponding to the topological state. For double barriers we demonstrate the formation of quantum well states. To complement our first-principles results we construct a two-dimensional low-energy effective model and illustrate its shortcomings. Our findings are discussed in the context of a number of recent experimental works.

  4. Accurate ab initio vibrational energies of methyl chloride

    Two new nine-dimensional potential energy surfaces (PESs) have been generated using high-level ab initio theory for the two main isotopologues of methyl chloride, CH335Cl and CH337Cl. The respective PESs, CBS-35 HL, and CBS-37 HL, are based on explicitly correlated coupled cluster calculations with extrapolation to the complete basis set (CBS) limit, and incorporate a range of higher-level (HL) additive energy corrections to account for core-valence electron correlation, higher-order coupled cluster terms, scalar relativistic effects, and diagonal Born-Oppenheimer corrections. Variational calculations of the vibrational energy levels were performed using the computer program TROVE, whose functionality has been extended to handle molecules of the form XY 3Z. Fully converged energies were obtained by means of a complete vibrational basis set extrapolation. The CBS-35 HL and CBS-37 HL PESs reproduce the fundamental term values with root-mean-square errors of 0.75 and 1.00 cm−1, respectively. An analysis of the combined effect of the HL corrections and CBS extrapolation on the vibrational wavenumbers indicates that both are needed to compute accurate theoretical results for methyl chloride. We believe that it would be extremely challenging to go beyond the accuracy currently achieved for CH3Cl without empirical refinement of the respective PESs

  5. Accurate ab initio vibrational energies of methyl chloride

    Owens, Alec, E-mail: owens@mpi-muelheim.mpg.de [Max-Planck-Institut für Kohlenforschung, Kaiser-Wilhelm-Platz 1, 45470 Mülheim an der Ruhr (Germany); Department of Physics and Astronomy, University College London, Gower Street, WC1E 6BT London (United Kingdom); Yurchenko, Sergei N.; Yachmenev, Andrey; Tennyson, Jonathan [Department of Physics and Astronomy, University College London, Gower Street, WC1E 6BT London (United Kingdom); Thiel, Walter [Max-Planck-Institut für Kohlenforschung, Kaiser-Wilhelm-Platz 1, 45470 Mülheim an der Ruhr (Germany)

    2015-06-28

    Two new nine-dimensional potential energy surfaces (PESs) have been generated using high-level ab initio theory for the two main isotopologues of methyl chloride, CH{sub 3}{sup 35}Cl and CH{sub 3}{sup 37}Cl. The respective PESs, CBS-35{sup  HL}, and CBS-37{sup  HL}, are based on explicitly correlated coupled cluster calculations with extrapolation to the complete basis set (CBS) limit, and incorporate a range of higher-level (HL) additive energy corrections to account for core-valence electron correlation, higher-order coupled cluster terms, scalar relativistic effects, and diagonal Born-Oppenheimer corrections. Variational calculations of the vibrational energy levels were performed using the computer program TROVE, whose functionality has been extended to handle molecules of the form XY {sub 3}Z. Fully converged energies were obtained by means of a complete vibrational basis set extrapolation. The CBS-35{sup  HL} and CBS-37{sup  HL} PESs reproduce the fundamental term values with root-mean-square errors of 0.75 and 1.00 cm{sup −1}, respectively. An analysis of the combined effect of the HL corrections and CBS extrapolation on the vibrational wavenumbers indicates that both are needed to compute accurate theoretical results for methyl chloride. We believe that it would be extremely challenging to go beyond the accuracy currently achieved for CH{sub 3}Cl without empirical refinement of the respective PESs.

  6. Ab-initio calculations for dilute magnetic semiconductors

    Belhadji, Brahim

    2008-03-03

    This thesis focusses on ab-initio calculations for the electronic structure and the magnetic properties of dilute magnetic semiconductors (DMS). In particular we aim at the understanding of the complex exchange interactions in these systems. Our calculations are based on density functional theory, being ideally suited for a description of the material specific properties of the considered DMS. Moreover we use the KKR Green function method in connection with the coherent potential approximation (CPA), which allows to include the random substitutional disorder in a mean field-like approximation for the electronic structure. Finally we calculate the exchange coupling constants J{sub ij} between two impurities in a CPA medium by using the Lichtenstein formula and from this calculate the Curie temperature by a numerically exact Monte Carlo method. Based on this analysis we found and investigated four different exchange mechanisms being of importance in DMS systems: Double exchange, p-d exchange, antiferromagnetic superexchanges, and ferromagnetic superexchange. A second topic we have investigated in this thesis is the pressure dependence of the exchange interactions and the Curie temperatures in (Ga,Mn)As and (In,Mn)As, using the LDA and the LDA+U approximations. Exact calculations of T{sub C} by Monte Carlo simulations show a somehow different behavior. (orig.)

  7. Ab initio no-core solutions for $^6$Li

    Shin, Ik Jae; Maris, Pieter; Vary, James P; Forssén, Christian; Rotureau, Jimmy; Michel, Nicolas

    2016-01-01

    We solve for properties of $^6$Li in the ab initio No-Core Full Configuration approach and we separately solve for its ground state and $J^{\\pi}=2_{2}^{+}$ resonance with the Gamow Shell Model in the Berggren basis. We employ both the JISP16 and chiral NNLO$_{opt}$ realistic nucleon-nucleon interactions and investigate the ground state energy, excitation energies, point proton root-mean-square radius and a suite of electroweak observables. We also extend and test methods to extrapolate the ground state energy, point proton root-mean-square radius, and electric quadrupole moment. We attain improved estimates of these observables in the No-Core Full Configuration approach by using basis spaces up through N$_{max}$=18 that enable more definitive comparisons with experiment. Using the Density Matrix Renormalization Group approach with the JISP16 interaction, we find that we can significantly improve the convergence of the Gamow Shell Model treatment of the $^6$Li ground state and $J^{\\pi}=2_{2}^{+}$ resonance by ...

  8. Ab initio studies of phoshorene island single electron transistor.

    Ray, S J; Venkata Kamalakar, M; Chowdhury, R

    2016-05-18

    Phosphorene is a newly unveiled two-dimensional crystal with immense potential for nanoelectronic and optoelectronic applications. Its unique electronic structure and two dimensionality also present opportunities for single electron devices. Here we report the behaviour of a single electron transistor (SET) made of a phosphorene island, explored for the first time using ab initio calculations. We find that the band gap and the charging energy decrease monotonically with increasing layer numbers due to weak quantum confinement. When compared to two other novel 2D crystals such as graphene and MoS2, our investigation reveals larger adsorption energies of gas molecules on phosphorene, which indicates better a sensing ability. The calculated charge stability diagrams show distinct changes in the presence of an individual molecule which can be applied to detect the presence of different molecules with sensitivity at a single molecular level. The higher charging energies of the molecules within the SET display operational viability at room temperature, which is promising for possible ultra sensitive detection applications. PMID:27093536

  9. Ab initio studies of phosphorene island single electron transistor

    Ray, S. J.; Venkata Kamalakar, M.; Chowdhury, R.

    2016-05-01

    Phosphorene is a newly unveiled two-dimensional crystal with immense potential for nanoelectronic and optoelectronic applications. Its unique electronic structure and two dimensionality also present opportunities for single electron devices. Here we report the behaviour of a single electron transistor (SET) made of a phosphorene island, explored for the first time using ab initio calculations. We find that the band gap and the charging energy decrease monotonically with increasing layer numbers due to weak quantum confinement. When compared to two other novel 2D crystals such as graphene and MoS2, our investigation reveals larger adsorption energies of gas molecules on phosphorene, which indicates better a sensing ability. The calculated charge stability diagrams show distinct changes in the presence of an individual molecule which can be applied to detect the presence of different molecules with sensitivity at a single molecular level. The higher charging energies of the molecules within the SET display operational viability at room temperature, which is promising for possible ultra sensitive detection applications.

  10. Ab initio study of MoS2 nanotube bundles

    Verstraete, Matthieu; Charlier, Jean-Christophe

    2003-07-01

    Recently, the synthesis of a new phase of MoS2I1/3 stoichiometry was reported [M. Remskar, A. Mrzel, Z. Skraba, A. Jesih, M. Ceh, J. Demšar, P. Stadelmann, F. Lévy, and D. Mihailovic, Science 292, 479 (2001)]. Electron microscope images and diffraction data were interpreted to indicate bundles of sub-nanometer-diameter single-wall MoS2 nanotubes. After experimental characterization, the structure was attributed to an assembly of “armchair” nanotubes with interstitial iodine. Using first-principles total-energy calculations, bundles of MoS2 nanotubes with different topologies and stoichiometries are investigated. All of the systems are strongly metallic. Configurations with “zigzag” structures are found to be more stable energetically than the “armchair” ones, though all of the structures have similar stabilities. After relaxation, there remain several candidates which give a lattice parameter in relative agreement with experiment. Further, spin-polarized calculations indicate that a structure with armchair tubes iodine atoms in their center acquires a very large spontaneous magnetic moment of 12μB, while the other structures are nonmagnetic. Our ab initio calculations show that in most of the other structures, the tubes are very strongly bound together, and that the compounds should be considered as a crystal, rather than as a bundle of tubes in the habitual sense.

  11. Atmospheric Characterization of the Hot Jupiter Kepler-13Ab

    Shporer, Avi; Knutson, Heather A; Szabo, Gyula M; Zhao, Ming; Burrows, Adam; Fortney, Jonathan; Agol, Eric; Cowan, Nicolas B; Desert, Jean-Michel; Howard, Andrew W; Isaacson, Howard; Lewis, Nikole A; Showman, Adam P; Todorov, Kamen O

    2014-01-01

    (abridged) Kepler-13Ab (= KOI-13.01) is one of very few known short-period (1.76 day) transiting planets orbiting a bright A-type star. The availability of Kepler data allows a measurement of the planet's occultation (secondary eclipse) and orbital phase curve, which we combine with occultations observed by Spitzer at 3.6 micron and 4.5 micron and a ground-based occultation observation in the $Ks$ band (2.1 micron). For the day-side hemisphere we derive a temperate of 2,750 $\\pm$ 160 K as the effective temperature of a black body that will show the same occultation depths, and a high geometric albedo $A_g$ = 0.33$^{+0.04}_{-0.06}$. Comparing the occultation depths with one-dimensional planetary atmosphere models suggests the presence of an atmospheric temperature inversion. The Kepler mid-occultation time measured here is 34.0 $\\pm$ 6.9 s earlier than expected based on the mid-transit time reported in the literature and the expected time delay due to light travel time. This could be due to a small orbital ecc...

  12. Ab initio molecular dynamics calculations of ion hydration free energies

    We apply ab initio molecular dynamics (AIMD) methods in conjunction with the thermodynamic integration or 'λ-path' technique to compute the intrinsic hydration free energies of Li+, Cl-, and Ag+ ions. Using the Perdew-Burke-Ernzerhof functional, adapting methods developed for classical force field applications, and with consistent assumptions about surface potential (φ) contributions, we obtain absolute AIMD hydration free energies (ΔGhyd) within a few kcal/mol, or better than 4%, of Tissandier et al.'s [J. Phys. Chem. A 102, 7787 (1998)] experimental values augmented with the SPC/E water model φ predictions. The sums of Li+/Cl- and Ag+/Cl- AIMD ΔGhyd, which are not affected by surface potentials, are within 2.6% and 1.2 % of experimental values, respectively. We also report the free energy changes associated with the transition metal ion redox reaction Ag++Ni+→Ag+Ni2+ in water. The predictions for this reaction suggest that existing estimates of ΔGhyd for unstable radiolysis intermediates such as Ni+ may need to be extensively revised.

  13. Exploring the free energy surface using ab initio molecular dynamics

    Samanta, Amit; Morales, Miguel A.; Schwegler, Eric

    2016-04-01

    Efficient exploration of configuration space and identification of metastable structures in condensed phase systems are challenging from both computational and algorithmic perspectives. In this regard, schemes that utilize a set of pre-defined order parameters to sample the relevant parts of the configuration space [L. Maragliano and E. Vanden-Eijnden, Chem. Phys. Lett. 426, 168 (2006); J. B. Abrams and M. E. Tuckerman, J. Phys. Chem. B 112, 15742 (2008)] have proved useful. Here, we demonstrate how these order-parameter aided temperature accelerated sampling schemes can be used within the Born-Oppenheimer and the Car-Parrinello frameworks of ab initio molecular dynamics to efficiently and systematically explore free energy surfaces, and search for metastable states and reaction pathways. We have used these methods to identify the metastable structures and reaction pathways in SiO2 and Ti. In addition, we have used the string method [W. E, W. Ren, and E. Vanden-Eijnden, Phys. Rev. B 66, 052301 (2002); L. Maragliano et al., J. Chem. Phys. 125, 024106 (2006)] within the density functional theory to study the melting pathways in the high pressure cotunnite phase of SiO2 and the hexagonal closed packed to face centered cubic phase transition in Ti.

  14. Exploring the free energy surface using ab initio molecular dynamics.

    Samanta, Amit; Morales, Miguel A; Schwegler, Eric

    2016-04-28

    Efficient exploration of configuration space and identification of metastable structures in condensed phase systems are challenging from both computational and algorithmic perspectives. In this regard, schemes that utilize a set of pre-defined order parameters to sample the relevant parts of the configuration space [L. Maragliano and E. Vanden-Eijnden, Chem. Phys. Lett. 426, 168 (2006); J. B. Abrams and M. E. Tuckerman, J. Phys. Chem. B 112, 15742 (2008)] have proved useful. Here, we demonstrate how these order-parameter aided temperature accelerated sampling schemes can be used within the Born-Oppenheimer and the Car-Parrinello frameworks of ab initio molecular dynamics to efficiently and systematically explore free energy surfaces, and search for metastable states and reaction pathways. We have used these methods to identify the metastable structures and reaction pathways in SiO2 and Ti. In addition, we have used the string method [W. E, W. Ren, and E. Vanden-Eijnden, Phys. Rev. B 66, 052301 (2002); L. Maragliano et al., J. Chem. Phys. 125, 024106 (2006)] within the density functional theory to study the melting pathways in the high pressure cotunnite phase of SiO2 and the hexagonal closed packed to face centered cubic phase transition in Ti. PMID:27131525

  15. Ab initio study of optical excitations in VO2

    Coulter, John; Gali, Adam; Manousakis, Efstratios

    2014-03-01

    Motivated by recent experimental efforts to fabricate p-n junctions from transition metal oxides (TMOs) and a recent theoretical study claiming TMOs to be good absorbers and promising materials for efficient carrier multiplication, we study the optical properties of a prototypical TMO, the insulator M1 phase of vanadium dioxide (VO2), by ab initio methods. We applied the Bethe-Salpeter equations (BSE) to calculate the optical properties, starting from self-consistent GW quasi-particle energy levels and states. In contrast to expectations, the exciton binding energy obtained by BSE is in good agreement with the experiment. We find that the electron-electron interaction is very strong which makes this material promising for efficient carrier multiplication that might lead to an enhanced efficiency in photo-voltaics applications. To illustrate this more quantitatively, we calculated the impact ionization rate within the independent quasiparticle approximation, and find that the rate is significantly higher than silicon in the region of highest solar intensity, due to the strong multiple carrier excitations.

  16. A coupled "AB" system: Rogue waves and modulation instabilities

    Wu, C. F.; Grimshaw, R. H. J.; Chow, K. W.; Chan, H. N.

    2015-10-01

    Rogue waves are unexpectedly large and localized displacements from an equilibrium position or an otherwise calm background. For the nonlinear Schrödinger (NLS) model widely used in fluid mechanics and optics, these waves can occur only when dispersion and nonlinearity are of the same sign, a regime of modulation instability. For coupled NLS equations, rogue waves will arise even if dispersion and nonlinearity are of opposite signs in each component as new regimes of modulation instability will appear in the coupled system. The same phenomenon will be demonstrated here for a coupled "AB" system, a wave-current interaction model describing baroclinic instability processes in geophysical flows. Indeed, the onset of modulation instability correlates precisely with the existence criterion for rogue waves for this system. Transitions from "elevation" rogue waves to "depression" rogue waves are elucidated analytically. The dispersion relation as a polynomial of the fourth order may possess double pairs of complex roots, leading to multiple configurations of rogue waves for a given set of input parameters. For special parameter regimes, the dispersion relation reduces to a cubic polynomial, allowing the existence criterion for rogue waves to be computed explicitly. Numerical tests correlating modulation instability and evolution of rogue waves were conducted.

  17. Ab initio simulations on rutile-based titania nanowires

    Zhukovskii, Yu F.; Evarestov, R. A.

    2012-08-01

    The rod symmetry groups for monoperiodic (1D) nanostructures have been applied for construction of models for bulk-like TiO2 nanowires (NWs) cut from a rutile-based 3D crystal along the chosen [001] and [110] directions of crystallographic axes. In this study, we have considered nanowires described by both the Ti-atom centered rotation axes as well as the hollow site centered axes passing through the interstitial positions between the Ti and O atoms closest to the axes. The most stable [001]-oriented TiO2 NWs with rhombic cross sections are found to display the energetically preferable {110} facets only while the nanowires with quasi-square sections across the [110] axis are formed by the alternating { 1bar 10 } and {001} facets. For simulations on rutile-based nanowires possessing different diameters for each NW type, we have performed large-scale ab initio Density Functional Theory (DFT) and hybrid DFT-Hartree Fock (DFT-HF) calculations with total geometry optimization within the Generalized Gradient Approximation (GGA) in the form of the Perdew-Becke-Ernzenhof (PBE) exchange-correlation functionals (PBE and PBE0, respectively), using the formalism of linear combination of localized atomic functions (LCAO). We have simulated both structural and electronic properties of TiO2 NWs depending both on orientation and position of symmetry axes as well as on diameter and morphology of nanowires.

  18. The wonderful complexity of the Mira AB system

    Ramstedt, S; Vlemmings, W H T; Maercker, M; Montez, R; Baudry, A; De Beck, E; Lindqvist, M; Olofsson, H; Humphreys, E M L; Jorissen, A; Kerschbaum, F; Mayer, A; Wittkowski, M; Cox, N L J; Lagadec, E; Leal-Ferreira, M L; Paladini, C; Pérez-Sánchez, A; Sacuto, S

    2014-01-01

    We have mapped the CO(3-2) line emission around the Mira AB system at 0.5 resolution using the Atacama Large Millimeter/submillimeter Array (ALMA). The CO map shows amazing complexity. The circumstellar gas has been shaped by different dynamical actors during the evolution of the system and several morphological components can be identified. The companion is marginally resolved in continuum emission and is currently at 0.487$\\pm$0.006 separation. In the main line component, centered on the stellar velocity, spiral arcs around Mira A are found. The spiral appears to be relatively flat and oriented in the orbital plane. An accretion wake behind the companion is clearly visible and the projected arc separation is of order 5''. In the blue wing of the line emission, offset from the main line, several large ($\\sim$5-10''), opposing arcs are found. We tentatively suggest that this structure is created by the wind of Mira B blowing a bubble in the expanding envelope of Mira A.

  19. Development of materials science by Ab initio powder diffraction analysis

    Crystal structure is most important information to understand properties and behavior of target materials. Technique to analyze unknown crystal structures from powder diffraction data (ab initio powder diffraction analysis) enables us to reveal crystal structures of target materials even we cannot obtain a single crystal. In the present article, three examples are introduced to show the power of this technique in the field of materials sciences. The first example is dehydration/hydration of the pharmaceutically relevant material erythrocycin A. In this example, crystal structures of two anhydrous phases were determined from synchrotron X-ray powder diffraction data and their different dehydration/hydration properties were understood from the crystal structures. In the second example, a crystal structure of a three dimensional metal-organic-framework prepared by a mechanochemical reaction was determined from laboratory X-ray powder diffraction data and the reaction scheme has been revealed. In the third example, a crystal structure of a novel oxide-ion conductor of a new structure family was determined from synchrotron X-ray and neutron powder diffraction data which gave an important information to understand the mechanism of the oxide-ion conduction. (author)

  20. Experimental, ab initio and density functional theory studies on sulfadiazine

    Ogruc-Ildiz, Gulce; Akyuz, Sevim; Ozel, Aysen E.

    2009-04-01

    In the present study, combined experimental and computational study on molecular vibrations of free sulfadiazine has been reported. The theoretically possible stable conformers of free sulfadiazine molecule in electronically ground state were searched by means of torsion potential energy surfaces scan studies through C1 sbnd C7 sbnd S8 sbnd N8, C7 sbnd S8 sbnd N9 sbnd C10 and S8 sbnd N9 sbnd C10 sbnd N11 dihedral angles, at both semi-empirical PM3 and B3LYP/3-21G levels of theory. The final geometrical parameters for the obtained stable conformers were determined by means of geometry optimization carried out at ab initio HF/6-31G++(d,p) and DFT/B3LYP/6-31G++(d,p) theory levels. The harmonic and anharmonic vibrational wavenumbers and IR intensities were calculated at the same theory levels used in geometry optimization. The modes of the fundamental vibrations were characterized depending on their the total energy distribution (TED%). In order to fit the calculated harmonic wavenumbers to experimental ones, dual scale factors were used. The experimental infrared and Raman spectra of sulfadiazine in solid phase have been measured and compared with the calculated vibrational spectra of each conformer.

  1. The Solar-System-Scale Disk Around AB Aurigae

    Oppenheimer, Ben R; Hinkley, Sasha; Zimmerman, Neil; Sivaramakrishnan, Anand; Soummer, Remi; Kuhn, Jeffrey; Graham, James R; Perrin, Marshall; Lloyd, James P; Roberts, Lewis C Jr; Harrington, David M

    2008-01-01

    The young star AB Aurigae is surrounded by a complex combination of gas-rich and dust dominated structures. The inner disk which has not been studied previously at sufficient resolution and imaging dynamic range seems to contain very little gas inside a radius of least 130 astronomical units (AU) from the star. Using adaptive-optics coronagraphy and polarimetry we have imaged the dust in an annulus between 43 and 302 AU from the star, a region never seen before. An azimuthal gap in an annulus of dust at a radius of 102 AU, along with a clearing at closer radii inside this annulus, suggests the formation of at least one small body at an orbital distance of about 100 AU. This structure seems consistent with crude models of mean motion resonances, or accumulation of material at two of the Lagrange points relative to the putative object and the star. We also report a low significance detection of a point source in this outer annulus of dust. This source may be an overdensity in the disk due to dust accreting onto...

  2. Heat shock protein 90AB1 and hyperthermia rescue infectivity of HIV with defective cores.

    Joshi, Pheroze; Sloan, Barbara; Torbett, Bruce E; Stoddart, Cheryl A

    2013-02-01

    We previously showed that reduced infectivity of HIV with incompletely processed capsid-spacer protein 1 (CA-SP1) is rescued by cellular activation or increased expression of HSP90AB1, a member of the cytosolic heat shock protein 90 family. Here we show that HSP90AB1 is present in HIV virions and that HSP90AB1, but not nonfunctional mutated HSP90AB1(E42A+D88A), restores infectivity to HIV with mutations in CA that alter core stability. Further, the CA mutants were hypersensitive to pharmacological inhibition of HSP90AB1. In agreement with Roesch et al. (2012), we found that culturing HIV at 39.5°C enhanced viral infectivity up to 30-fold in human peripheral blood mononuclear cells (p=0.002) and rescued CA-mutant infectivity in nonactivated cells, concurrent with elevated expression of HSP90AB1 during hyperthermia. In sum, the transdominant effect of HSP90AB1 on CA-mutant HIV infectivity suggests a potential role for this class of cellular chaperones in HIV core stability and uncoating. PMID:23200770

  3. Effect of Compatibilizers on the Morphological Properties of ABS and LCP Blends

    C. K. Das

    2007-12-01

    Full Text Available The blends of acrylonitrile butadiene styrene (ABS polymer and liquid crystalline polymer (LCP were prepared using a melt-blending technique in presence and absence of different types of nanosilica. The effect of Zn++ coated nanosilica on thermal, dynamic mechanical, and morphological properties of ABS/LCP blends was studied. The Zn++ coated nanosilica showed a significant effect on the above-mentioned properties of ABS/LCP blends by reacting at the interface between ABS and LCP. A substantial improvement in storage modulus of ABS/LCP blends was observed in presence of Zn++ coated nanosilica. Epoxy encapsulated nanosilica was also used as a compatibilizer in this blend system. It is known that the epoxy end group reacts with the LCP reacting groups. But in this case, we cannot find desirable results, may be due to the presence of ABS as the matrix. So Zn-ion-coated nanosilica proved to be better than that epoxy encapsulated nanosilica for the ABS/LCP containing blends. The SEM morphology also corroborates the above-mentioned argument.

  4. Stacking stability of MoS2 bilayer: An ab initio study

    Tao, Peng; Guo, Huai-Hong; Yang, Teng; Zhang, Zhi-Dong

    2014-10-01

    The study of the stacking stability of bilayer MoS2 is essential since a bilayer has exhibited advantages over single layer MoS2 in many aspects for nanoelectronic applications. We explored the relative stability, optimal sliding path between different stacking orders of bilayer MoS2, and (especially) the effect of inter-layer stress, by combining first-principles density functional total energy calculations and the climbing-image nudge-elastic-band (CI-NEB) method. Among five typical stacking orders, which can be categorized into two kinds (I: AA, AB and II: AA', AB', A'B), we found that stacking orders with Mo and S superposing from both layers, such as AA' and AB, is more stable than the others. With smaller computational efforts than potential energy profile searching, we can study the effect of inter-layer stress on the stacking stability. Under isobaric condition, the sliding barrier increases by a few eV/(ucGPa) from AA' to AB', compared to 0.1 eV/(ucGPa) from AB to [AB]. Moreover, we found that interlayer compressive stress can help enhance the transport properties of AA'. This study can help understand why inter-layer stress by dielectric gating materials can be an effective means to improving MoS2 on nanoelectronic applications.

  5. On Maintenance of Electronic Anti-lock Braking System (ABS)%电控防抱死制动系统(ABS)的检修

    吴继刚

    2015-01-01

    随着汽车制动系统技术的不断改进,电控防抱死ABS系统已逐渐成为汽车的标准配件,了解电控防抱死ABS系统的维修技术对汽车制动系统的维修和故障诊断工作十分重要.ABS主要部件的检修包括:ABS ECU的检修、轮速传感器的检修、液压控制装置的检修、制动压力调节器的检修.%With the continuous improvement of technology related to automobile braking system,electronic anti-lock ABS system has gradually become one of the standard fittings of automobile,to learn maintenance technology related to electronic anti-lock ABS system is of great importance to maintain and fault diagnosing of automobile braking system.The maintenance for main components of ABS includes the maintenance for ABS ECU,wheel speed sensor,hydraulic controlled devices,braking pressure regulator,etc.

  6. The adnAB Locus, Encoding a Putative Helicase-Nuclease Activity, Is Essential in Streptomyces

    Zhang, Lingli; Nguyen, Hoang Chuong; Chipot, Ludovic; Piotrowski, Emilie; Bertrand, Claire; Thibessard, Annabelle; Leblond, Pierre

    2014-01-01

    Homologous recombination is a crucial mechanism that repairs a wide range of DNA lesions, including the most deleterious ones, double-strand breaks (DSBs). This multistep process is initiated by the resection of the broken DNA ends by a multisubunit helicase-nuclease complex exemplified by Escherichia coli RecBCD, Bacillus subtilis AddAB, and newly discovered Mycobacterium tuberculosis AdnAB. Here we show that in Streptomyces, neither recBCD nor addAB homologues could be detected. The only pu...

  7. AdnAB: a new DSB-resecting motor–nuclease from mycobacteria

    Sinha, Krishna Murari; Unciuleac, Mihaela-Carmen; Glickman, Michael S.; Shuman, Stewart

    2009-01-01

    The resection of DNA double-strand breaks (DSBs) in bacteria is a motor-driven process performed by a multisubunit helicase–nuclease complex: either an Escherichia coli-type RecBCD enzyme or a Bacillus-type AddAB enzyme. Here we identify mycobacterial AdnAB as the founder of a new family of heterodimeric helicase–nucleases with distinctive properties. The AdnA and AdnB subunits are each composed of an N-terminal UvrD-like motor domain and a C-terminal nuclease module. The AdnAB ATPase is trig...

  8. Studies on Synthesis and Antitumor Activity of Phosphorylated Achyranthes bidentata Polysaccharide (P-AbPS)

    CHEN,Xiao-Ming(陈晓明); ZHANG,Jian(张健); TIAN,Geng-Yuan(田庚元)

    2002-01-01

    The synthesis of phosphorylated Achyranthes bidentata polysaccharide (P-AbPS) was reported based on different strategies.The P-AbPS with high degree of substitution (D.S. >0.5) was obtained when phosphorus oxychloride (POCl3) was used as a phosphorylating agent and trimethyl phosphate-pyridine or dimethyl formamide was used as solvent. The influences of different solvents and reaction conditins were discussed. Thepharmacology assay shows that P-AbPS possesses antitumor activity against sarcoma 180 and Lewis lung carner in mice.

  9. Emergence of rotational bands in ab initio no-core configuration interaction calculations

    Caprio, M A; Vary, J P; Smith, R

    2015-01-01

    Rotational bands have been observed to emerge in ab initio no-core configuration interaction (NCCI) calculations for p-shell nuclei, as evidenced by rotational patterns for excitation energies, electromagnetic moments, and electromagnetic transitions. We investigate the ab initio emergence of nuclear rotation in the Be isotopes, focusing on 9Be for illustration, and make use of basis extrapolation methods to obtain ab initio predictions of rotational band parameters for comparison with experiment. We find robust signatures for rotational motion, which reproduce both qualitative and quantitative features of the experimentally observed bands.

  10. STUDIES ON FLAME-RETARDANT PC/ABS MULTIPLE-ELEMENT ALLOY

    Ying Quan; Ming-shah Yang; Qing Yah

    2001-01-01

    The preparation technology of flame-retardant PC/ABS alloys was studied in this paper. Using a high-efficiency flame retardant system and by means of multiple-ingredient compatibilizing, PC/ABS alloys with excellent impact strength and flame retardant property were prepared. The experimental results showed that by using PS-g-MAH and SMA as synergistic compatibilizers, the notched Izod impact strength and flammability of PC/ABS alloy obtained in the present work can be up to 175 J/m and UL-94 V0, respectively.

  11. Immunogenicity of mAbs in non-human primates during nonclinical safety assessment

    2013-01-01

    The immunogenicity of biopharmaceuticals used in clinical practice remains an unsolved challenge in drug development. Non-human primates (NHPs) are often the only relevant animal model for the development of monoclonal antibodies (mAbs), but the immune response of NHPs to therapeutic mAbs is not considered to be predictive of the response in humans because of species differences. In this study, we accessed the drug registration files of all mAbs registered in the European Union to establish t...

  12. SatR Is a Repressor of Fluoroquinolone Efflux Pump SatAB

    Escudero, Jose Antonio; San Millan, Alvaro; Montero, Natalia; Gutierrez, Belen; Ovejero, Cristina Martinez; Carrilero, Laura; González-Zorn, Bruno

    2013-01-01

    Streptococcus suis is an emerging zoonotic agent responsible for high-mortality outbreaks among the human population in China. In this species, the ABC transporter SatAB mediates fluoroquinolone resistance when overexpressed. Here, we describe and characterize satR, an open reading frame (ORF) encoding a MarR superfamily regulator that acts as a repressor of satAB. satR is cotranscribed with satAB, and its interruption entails the overexpression of the pump, leading to a clinically relevant i...

  13. Preparación y caracterización de mezclas REX-PLA / ABS

    Constans Solé, Nil

    2015-01-01

    El presente proyecto se centra en la producción y caracterización de mezclas de poli(ácido láctico) modificado mediante un extensor de cadena (REX-PLA) con Acrilonitrilo-Butadieno- Estireno (ABS), usando ABS injertado con ácido anhídrido maleico (ABS-g-MAH) como compatibilizante. La primera etapa de la preparación de las mezclas consiste en la obtención de REX-PLA por extrusión reactiva en una extrusora de doble husillo. Se llevan a cabo acciones de mejora del proceso produc...

  14. Performance of the molecular Alere I influenza A&B test compared to that of the xpert flu A/B assay.

    Chapin, Kimberle C; Flores-Cortez, Estefany J

    2015-02-01

    Data on the performance of rapid molecular point-of-care use platforms for diagnosis of influenza are lacking. We validated nasopharyngeal (NP) flocked specimens in universal transport medium (UTM) and evaluated the clinical sensitivity and specificity of the Alere i influenza A&B test compared to those of the Xpert flu A/B assay. The Alere i influenza A&B test had an overall sensitivity and specificity of 93.8% and 62.5% for influenza A, respectively, and of 91.8% and 53.6% for influenza B, respectively. The poor specificity was due to influenza virus samples determined positive for both type A and B. PMID:25502527

  15. Performance of the Molecular Alere i Influenza A&B Test Compared to That of the Xpert Flu A/B Assay

    Flores-Cortez, Estefany J.

    2014-01-01

    Data on the performance of rapid molecular point-of-care use platforms for diagnosis of influenza are lacking. We validated nasopharyngeal (NP) flocked specimens in universal transport medium (UTM) and evaluated the clinical sensitivity and specificity of the Alere i influenza A&B test compared to those of the Xpert flu A/B assay. The Alere i influenza A&B test had an overall sensitivity and specificity of 93.8% and 62.5% for influenza A, respectively, and of 91.8% and 53.6% for influenza B, respectively. The poor specificity was due to influenza virus samples determined positive for both type A and B. PMID:25502527

  16. Novel human anti-claudin 1 mAbs inhibit hepatitis C virus infection and may synergize with anti-SRB1 mAb.

    Paciello, Rolando; Urbanowicz, Richard A; Riccio, Gennaro; Sasso, Emanuele; McClure, C Patrick; Zambrano, Nicola; Ball, Jonathan K; Cortese, Riccardo; Nicosia, Alfredo; De Lorenzo, Claudia

    2016-01-01

    Hepatitis C virus (HCV) is a major cause of chronic hepatitis and liver carcinoma and new therapies based on novel targets are needed. The tight junction protein claudin 1 (CLDN-1) is essential for HCV cell entry and spread, and anti-CLDN-1 rat and mouse mAbs are safe and effective in preventing and treating HCV infection in a human liver chimeric mouse model. To accelerate translation of these observations into a novel approach to treat HCV infection and disease in humans, we screened a phage display library of human single-chain antibody fragments by using a panel of CLDN-1-positive and -negative cell lines and identified phage specifically binding to CLDN-1. The 12 clones showing the highest levels of binding were converted into human IgG4. Some of these mAbs displayed low-nanomolar affinity, and inhibited infection of human hepatoma Huh7.5 cells by different HCV isolates in a dose-dependent manner. Cross-competition experiments identified six inhibitory mAbs that recognized distinct epitopes. Combination of the human anti-SRB1 mAb C-1671 with these anti-CLDN-1 mAbs could either increase or reduce inhibition of cell culture-derived HCV infection in vitro. These novel human anti-CLDN-1 mAbs are potentially useful to develop a new strategy for anti-HCV therapy and lend support to the combined use of antibodies targeting the HCV receptors CLDN-1 and SRB1, but indicate that care must be taken in selecting the proper combination. PMID:26519290

  17. Ab initio no-core shell model with continuum

    Navratil, Petr

    2008-04-01

    The ab initio no-core shell model (NCSM) is a many-body approach to nuclear structure of light nuclei. The NCSM adopts an effective interaction theory to transform fundamental inter-nucleon interactions into effective interactions for a specified nucleus in a selected harmonic oscillator basis space [1]. The method is capable of predicting nuclear structure from inter-nucleon forces derived from quantum chromodynamics by means of chiral effective field theory [2]. NCSM extensions to the microscopic description of nuclear reactions are now under development. In my talk, I will first discuss our recent calculations of the ^4He total photo-absorption cross section using two- and three-nucleon interactions from chiral effective field theory [3]. I will then outline our effort to augment the NCSM by the resonating group method (RGM) technique to develop a new method capable of describing simultaneously both bound states and nuclear reactions on light nuclei [4]. This approach, which preserves translational symmetry and the Pauli principle, will allow us to calculate cross sections of reactions important for astrophysics and describe weakly-bound systems from first principles. I will present our first phase shift results for neutron scattering off ^3H, ^4He and ^7Li and proton scattering off ^3He, ^4He and ^7Be using realistic nucleon-nucleon potentials. 3mm [1] P. Navr'atil, J. P. Vary and B. R. Barrett, Phys. Rev. C 62, 054311 (2000). [2] P. Navr'atil and V. G. Gueorguiev and J. P. Vary, W. E. Ormand and A. Nogga, Phys. Rev. Lett. 99, 042501 (2007). [3] S. Quaglioni and P. Navr'atil, Phys. Lett. B 652, 370 (2007). [4] S. Quaglioni and P. Navr'atil, arXiv:0712.0855.

  18. Ab initio quantum transport calculations using plane waves

    Garcia-Lekue, A.; Vergniory, M. G.; Jiang, X. W.; Wang, L. W.

    2015-08-01

    We present an ab initio method to calculate elastic quantum transport at the nanoscale. The method is based on a combination of density functional theory using plane wave nonlocal pseudopotentials and the use of auxiliary periodic boundary conditions to obtain the scattering states. The method can be applied to any applied bias voltage and the charge density and potential profile can either be calculated self-consistently, or using an approximated self-consistent field (SCF) approach. Based on the scattering states one can straightforwardly calculate the transmission coefficients and the corresponding electronic current. The overall scheme allows us to obtain accurate and numerically stable solutions for the elastic transport, with a computational time similar to that of a ground state calculation. This method is particularly suitable for calculations of tunneling currents through vacuum, that some of the nonequilibrium Greens function (NEGF) approaches based on atomic basis sets might have difficulty to deal with. Several examples are provided using this method from electron tunneling, to molecular electronics, to electronic devices: (i) On a Au nanojunction, the tunneling current dependence on the electrode-electrode distance is investigated. (ii) The tunneling through field emission resonances (FERs) is studied via an accurate description of the surface vacuum states. (iii) Based on quantum transport calculations, we have designed a molecular conformational switch, which can turn on and off a molecular junction by applying a perpendicular electric field. (iv) Finally, we have used the method to simulate tunnel field-effect transistors (TFETs) based on two-dimensional transition-metal dichalcogenides (TMDCs), where we have studied the performance and scaling limits of such nanodevices and proposed atomic doping to enhance the transistor performance.

  19. An ab initio study of plutonium oxides surfaces

    By means of first-principles calculations, we have studied the atomic structure as well as the thermodynamic stability of various plutonium dioxide surfaces in function of their environment (in terms of oxygen partial pressure and temperature). All these simulations have been performed with the ABINIT code. It is well known that DFT fails to describe correctly plutonium-based materials since 5f electrons in such systems are strongly correlated. In order to go beyond DFT, we have treated PuO2 and β-Pu2O3 in a DFT+U framework. We show that the couple of parameters (U,J) that works well for pure Pu is also well designed for describing ground state (GS) properties of these two oxides. The major improvement with respect with DFT is that we are able to predict an insulating GS in agreement with experiments. The presence of a gap in the DOS (Density of States) of plutonium oxides should play a significant role in the predicted surface reactivity. However, performing DFT+U calculations on surfaces of plutonium oxide from scratch was too ambitious. That is why we decided, as a first step, to study the stability of the (100), (110) and (111) surfaces of PuO2 in a DFT-GGA framework. For each of these orientations, we considered various terminations. These ab initio results have been introduced in a thermodynamic model which allows us to predict the relative stability of the different terminations as a function of temperature and oxygen partial pressure (pO2). We conclude that at room temperature and for pO2∼10 atm., the polar O2-(100) termination is favoured. The stabilization of such a polar stoichiometric surface is surprising and should be confirmed by DFT+U calculations before any final conclusion. (authors)

  20. Atmospheric characterization of the hot Jupiter Kepler-13Ab

    Kepler-13Ab (= KOI-13.01) is a unique transiting hot Jupiter. It is one of very few known short-period planets orbiting a hot A-type star, making it one of the hottest planets currently known. The availability of Kepler data allows us to measure the planet's occultation (secondary eclipse) and phase curve in the optical, which we combine with occultations observed by warm Spitzer at 4.5 μm and 3.6 μm and a ground-based occultation observation in the Ks band (2.1 μm). We derive a day-side hemisphere temperature of 2750 ± 160 K as the effective temperature of a black body showing the same occultation depths. Comparing the occultation depths with one-dimensional planetary atmosphere models suggests the presence of an atmospheric temperature inversion. Our analysis shows evidence for a relatively high geometric albedo, A g = 0.33−0.06+0.04. While measured with a simplistic method, a high A g is supported also by the fact that the one-dimensional atmosphere models underestimate the occultation depth in the optical. We use stellar spectra to determine the dilution, in the four wide bands where occultation was measured, due to the visual stellar binary companion 1.''15 ± 0.''05 away. The revised stellar parameters measured using these spectra are combined with other measurements, leading to revised planetary mass and radius estimates of Mp = 4.94-8.09 M J and Rp = 1.406 ± 0.038 R J. Finally, we measure a Kepler midoccultation time that is 34.0 ± 6.9 s earlier than expected based on the midtransit time and the delay due to light-travel time and discuss possible scenarios.

  1. Atmospheric Characterization of the Hot Jupiter Kepler-13Ab

    Shporer, Avi; O'Rourke, Joseph G.; Knutson, Heather A.; Szabó, Gyula M.; Zhao, Ming; Burrows, Adam; Fortney, Jonathan; Agol, Eric; Cowan, Nicolas B.; Desert, Jean-Michel; Howard, Andrew W.; Isaacson, Howard; Lewis, Nikole K.; Showman, Adam P.; Todorov, Kamen O.

    2014-06-01

    Kepler-13Ab (= KOI-13.01) is a unique transiting hot Jupiter. It is one of very few known short-period planets orbiting a hot A-type star, making it one of the hottest planets currently known. The availability of Kepler data allows us to measure the planet's occultation (secondary eclipse) and phase curve in the optical, which we combine with occultations observed by warm Spitzer at 4.5 μm and 3.6 μm and a ground-based occultation observation in the Ks band (2.1 μm). We derive a day-side hemisphere temperature of 2750 ± 160 K as the effective temperature of a black body showing the same occultation depths. Comparing the occultation depths with one-dimensional planetary atmosphere models suggests the presence of an atmospheric temperature inversion. Our analysis shows evidence for a relatively high geometric albedo, A g = 0.33^{+0.04}_{-0.06}. While measured with a simplistic method, a high A g is supported also by the fact that the one-dimensional atmosphere models underestimate the occultation depth in the optical. We use stellar spectra to determine the dilution, in the four wide bands where occultation was measured, due to the visual stellar binary companion 1.''15 ± 0.''05 away. The revised stellar parameters measured using these spectra are combined with other measurements, leading to revised planetary mass and radius estimates of Mp = 4.94-8.09 M J and Rp = 1.406 ± 0.038 R J. Finally, we measure a Kepler midoccultation time that is 34.0 ± 6.9 s earlier than expected based on the midtransit time and the delay due to light-travel time and discuss possible scenarios.

  2. Lithium Insertion In Silicon Nanowires: An ab Initio Study

    Zhang, Qianfan

    2010-09-08

    The ultrahigh specific lithium ion storage capacity of Si nanowires (SiNWs) has been demonstrated recently and has opened up exciting opportunities for energy storage. However, a systematic theoretical study on lithium insertion in SiNWs remains a challenge, and as a result, understanding of the fundamental interaction and microscopic dynamics during lithium insertion is still lacking. This paper focuses on the study of single Li atom insertion into SiNWs with different sizes and axis orientations by using full ab initio calculations. We show that the binding energy of interstitial Li increases as the SiNW diameter grows. The binding energies at different insertion sites, which can be classified as surface, intermediate, and core sites, are quite different. We find that surface sites are energetically the most favorable insertion positions and that intermediate sites are the most unfavorable insertion positions. Compared with the other growth directions, the [110] SiNWs with different diameters always present the highest binding energies on various insertion locations, which indicates that [110] SiNWs are more favorable by Li doping. Furthermore, we study Li diffusion inside SiNWs. The results show that the Li surface diffusion has a much higher chance to occur than the surface to core diffusion, which is consistent with the experimental observation that the Li insertion in SiNWs is layer by layer from surface to inner region. After overcoming a large barrier crossing surface-to-intermediate region, the diffusion toward center has a higher possibility to occur than the inverse process. © 2010 American Chemical Society.

  3. Ab-initio molecular dynamics for metallic systems

    This thesis deals with the problem of performing first-principles electronic structure calculations in metallic systems, with the goal of bringing ab-initio quantum-mechanical molecular dynamics simulations for these systems to the same level of computational cost, efficiency and accuracy that are now obtained for semiconductors and insulators. The problem is first reviewed from the theoretical and methodological point of view, with a presentation of the current state of research. In particular, the formulation of the electronic structure problem as a Density-Functional-Theory constrained minimization is examined in detail, as well as the description of metallic systems via generalized electronic free energy functionals. A novel reformulation of the problem is here proposed, using the language of Ensemble Density Functional Theory, and a variational realization of it is developed and implemented. The dramatic improvement in the efficiency for the convergence to the electronic ground-state is discussed and explained. The role of the fictitious electronic temperature is examined, as well as its contribution to controlling the errors originating from inadequate sampling of the Brillouin Zone. The associated systematic errors are also examined, and non-selfconsistent and self-consistent estimates for these errors in the energies and the ionic forces are made explicit. The novel technique of cold smearing is introduced. The new method of Ensemble Density Functional Theory, in conjunction with the cold smearing, is shown to reach the proposed goal of greatly improving our current efficiency and accuracy for molecular dynamics simulations, making them affordable at the level of currently available computational power. The method is applied to the study of the finite temperature properties of bulk aluminium and aluminium surfaces, to identify the microscopical processes that give rise to the premelting of the (110) surface and to show evidence for the different phase

  4. Atmospheric characterization of the hot Jupiter Kepler-13Ab

    Shporer, Avi; O' Rourke, Joseph G.; Knutson, Heather A. [Division of Geological and Planetary Sciences, California Institute of Technology, Pasadena, CA 91125 (United States); Szabó, Gyula M. [ELTE Gothard Astrophysical Observatory, H-9704 Szombathely, Szent Imre herceg út 112 (Hungary); Zhao, Ming [Department of Astronomy and Astrophysics, 525 Davey Laboratory, The Pennsylvania State University, University Park, PA 16802 (United States); Burrows, Adam [Department of Astrophysical Sciences, Princeton University, Princeton, NJ 08544 (United States); Fortney, Jonathan [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Agol, Eric [Department of Astronomy, University of Washington, Seattle, WA 98195 (United States); Cowan, Nicolas B. [Center for Interdisciplinary Exploration and Research in Astrophysics and Department of Physics and Astronomy, Northwestern University, 2131 Tech Drive, Evanston, IL 60208 (United States); Desert, Jean-Michel [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado, 389-UCB, Boulder, CO 80309 (United States); Howard, Andrew W. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); Isaacson, Howard [University of California, Berkeley, CA 94720 (United States); Lewis, Nikole K.; Showman, Adam P. [Department of Planetary Sciences and Lunar and Planetary Laboratory, The University of Arizona, Tucson, AZ 85721 (United States); Todorov, Kamen O. [Institute for Astronomy, ETH Zürich, Wolfgang-Pauli-Strasse 27, 8093 Zürich (Switzerland)

    2014-06-10

    Kepler-13Ab (= KOI-13.01) is a unique transiting hot Jupiter. It is one of very few known short-period planets orbiting a hot A-type star, making it one of the hottest planets currently known. The availability of Kepler data allows us to measure the planet's occultation (secondary eclipse) and phase curve in the optical, which we combine with occultations observed by warm Spitzer at 4.5 μm and 3.6 μm and a ground-based occultation observation in the K{sub s} band (2.1 μm). We derive a day-side hemisphere temperature of 2750 ± 160 K as the effective temperature of a black body showing the same occultation depths. Comparing the occultation depths with one-dimensional planetary atmosphere models suggests the presence of an atmospheric temperature inversion. Our analysis shows evidence for a relatively high geometric albedo, A {sub g} = 0.33{sub −0.06}{sup +0.04}. While measured with a simplistic method, a high A {sub g} is supported also by the fact that the one-dimensional atmosphere models underestimate the occultation depth in the optical. We use stellar spectra to determine the dilution, in the four wide bands where occultation was measured, due to the visual stellar binary companion 1.''15 ± 0.''05 away. The revised stellar parameters measured using these spectra are combined with other measurements, leading to revised planetary mass and radius estimates of M{sub p} = 4.94-8.09 M {sub J} and R{sub p} = 1.406 ± 0.038 R {sub J}. Finally, we measure a Kepler midoccultation time that is 34.0 ± 6.9 s earlier than expected based on the midtransit time and the delay due to light-travel time and discuss possible scenarios.

  5. Cosmic-ray modulation: an ab initio approach

    A better understanding of cosmic-ray modulation in the heliosphere can only be gained through a proper understanding of the effects of turbulence on the diffusion and drift of cosmic rays. We present an ab initio model for cosmic-ray modulation, incorporating for the first time the results yielded by a two-component turbulence transport model. This model is solved for periods of minimum solar activity, utilizing boundary values chosen so that model results are in fair to good agreement with spacecraft observations of turbulence quantities, not only in the solar ecliptic plane but also along the out-of-ecliptic trajectory of the Ulysses spacecraft. These results are employed as inputs for modelled slab and 2D turbulence energy spectra. The latter spectrum is chosen based on physical considerations, with a drop-off at the very lowest wavenumbers commencing at the 2D outerscale. There currently exist no models or observations for this quantity, and it is the only free parameter in this study. The modelled turbulence spectra are used as inputs for parallel mean free path expressions based on those derived from quasi-linear theory and perpendicular mean free paths from extended nonlinear guiding center theory. Furthermore, the effects of turbulence on cosmic-ray drifts are modelled in a self-consistent way, employing a recently developed model for drift along the wavy current sheet. The resulting diffusion coefficients and drift expressions are applied to the study of galactic cosmic-ray protons and antiprotons using a three dimensional, steady-state cosmic-ray modulation code, and sample solutions in fair agreement with multiple spacecraft observations are presented. (author)

  6. Rapid Solidification of AB{sub 5} Hydrogen Storage Alloys

    Gulbrandsen-Dahl, Sverre

    2002-01-01

    This doctoral thesis is concerned with rapid solidification of AB{sub 5} materials suitable for electrochemical hydrogen storage. The primary objective of the work has been to characterise the microstructure and crystal structure of the produced AB{sub 5} materials as a function of the process parameters, e.g. the cooling rate during rapid solidification, the determination of which has been paid special attention to. The thesis is divided into 6 parts, of which Part I is a literature review, starting with a short presentation of energy storage alternatives. Then a general review of metal hydrides and their utilisation as energy carriers is presented. This part also includes more detailed descriptions of the crystal structure, the chemical composition and the hydrogen storage properties of AB{sub 5} materials. Furthermore, a description of the chill-block melt spinning process and the gas atomisation process is given. In Part II of the thesis a digital photo calorimetric technique has been developed and applied for obtaining in situ temperature measurements during chill-block melt spinning of a Mm(NiCoMnA1){sub 5} hydride forming alloy (Mm = Mischmetal of rare earths). Compared with conventional colour transmission temperature measurements, this technique offers a special advantage in terms of a high temperature resolutional and positional accuracy, which under the prevailing experimental conditions were found to be {+-}29 K and {+-} 0.1 mm, respectively. Moreover, it is shown that the cooling rate in solid state is approximately 2.5 times higher than that observed during solidification, indicating that the solid ribbon stayed in intimate contact with the wheel surface down to very low metal temperatures before the bond was broken. During this contact period the cooling regime shifted from near ideal in the melt puddle to near Newtonian towards the end, when the heat transfer from the solid ribbon to the wheel became the rate controlling step. In Part III of the

  7. Hydrogen adsorption on boron doped graphene: an {\\it ab initio} study

    Miwa, R. H.; Martins, T B; Fazzio, A.

    2007-01-01

    The electronic and structural properties of (i) boron doped graphene sheets, and (ii) the chemisorption processes of hydrogen adatoms on the boron doped graphene sheets have been examined by {\\it ab initio} total energy calculations.

  8. Inheritance of anthracnose resistance in common bean genotypes P.I. 207262 and AB 136

    Gonçalves-Vidigal M.C.

    1997-01-01

    Full Text Available Bean (Phaseolus vulgaris lines P.I. 207262 and AB 136, both resistant to delta and kappa races of Colletotrichum lindemuthianum, were crossed with Michelite, Dark Red Kidney, and Perry Marrow, susceptible to both races, and with Cornell 49-242, resistant to delta and susceptible to kappa. F1 and F2 reactions demonstrated that P.I. 207262 carries duplicate dominant genes for resistance to the delta race; AB 136 carries a dominant gene. These resistance genes are independent of the Are gene from Cornell 49-242. With respect to the kappa race, F1 and F2 data showed that the resistance controlled by P.I. 207262 and by AB 136 depends on a single dominant gene. Complementary factors were involved with AB 136 resistance to the delta race and with P.I. 207262 resistance to kappa.

  9. Time-resolved photoelectron spectroscopy and ab initio multiple spawning studies of hexamethylcyclopentadiene

    Wolf, T. J. A.; Kuhlman, Thomas Scheby; Schalk, O.;

    2014-01-01

    Time-resolved photoelectron spectroscopy and ab initio multiple spawning were applied to the ultrafast non-adiabatic dynamics of hexamethylcyclopentadiene. The high level of agreement between experiment and theory associates wavepacket motion with a distinct degree of freedom....

  10. Ab Initio Studies of Halogen and Nitrogen Oxide Species of Interest in Stratospheric Chemistry

    Lee, Timothy J.; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    The ability of modern state-of-the art ab initio quantum chemical techniques to characterize reliably the gas-phase molecular structure, vibrational spectrum, electronic spectrum, and thermal stability of fluorine, chlorine, bromine and nitrogen oxide species will be demonstrated by presentation of some example studies. The ab initio results are shown to be in excellent agreement with the available experimental data, and where the experimental data are either not known or are inconclusive, the theoretical results are shown to fill in the gaps and to resolve experimental controversies. In addition, ab initio studies in which the electronic spectra and the characterization of excited electronic states of halogen oxide species will also be presented. Again where available, the ab initio results are compared to experimental observations, and are used to aid in the interpretation of experimental studies.

  11. Effects of alloying side B on Ti-based AB2 hydrogen storage alloys

    王家淳; 于荣海; 刘庆

    2004-01-01

    Ti-based AB2-type hydrogen storage alloys are a group of promising materials, which will probably replace the prevalent rare earth-based AB5-type alloys and be adopted as the main cathode materials of nickelmetal hydride (Ni-MH) batteries in the near future. Alloying in side B is a major way to improve the performance of Ti-based AB2-type alloys. Based on recent studies, the effects of alloying elements in side B upon the performance of Ti-based AB2 -type hydrogen storage alloys are systematically reviewed here. These performances are divided into two categories, namely PCI characteristics, including hydrogen storage capacity (HSC), plateau pressure (PP), pressure hysteresis (PH) and pressure plateau sloping (PPS) , and electrochemical properties, including discharge capacity (DC), activation property (AP), cycling stability (CS) and high-rate dischargeability (HRD). Furthermore, the existing problems in these investigations and some suggestions for future research are proposed.

  12. AdnAB: a new DSB-resecting motor-nuclease from mycobacteria.

    Sinha, Krishna Murari; Unciuleac, Mihaela-Carmen; Glickman, Michael S; Shuman, Stewart

    2009-06-15

    The resection of DNA double-strand breaks (DSBs) in bacteria is a motor-driven process performed by a multisubunit helicase-nuclease complex: either an Escherichia coli-type RecBCD enzyme or a Bacillus-type AddAB enzyme. Here we identify mycobacterial AdnAB as the founder of a new family of heterodimeric helicase-nucleases with distinctive properties. The AdnA and AdnB subunits are each composed of an N-terminal UvrD-like motor domain and a C-terminal nuclease module. The AdnAB ATPase is triggered by dsDNA with free ends and the energy of ATP hydrolysis is coupled to DSB end resection by the AdnAB nuclease. The mycobacterial nonhomologous end-joining (NHEJ) protein Ku protects DSBs from resection by AdnAB. We find that AdnAB incises ssDNA by measuring the distance from the free 5' end to dictate the sites of cleavage, which are predominantly 5 or 6 nucleotides (nt) from the 5' end. The "molecular ruler" of AdnAB is regulated by ATP, which elicits an increase in ssDNA cleavage rate and a distal displacement of the cleavage sites 16-17 nt from the 5' terminus. AdnAB is a dual nuclease with a clear division of labor between the subunits. Mutations in the nuclease active site of the AdnB subunit ablate the ATP-inducible cleavages; the corresponding changes in AdnA abolish ATP-independent cleavage. Complete suppression of DSB end resection requires simultaneous mutation of both subunit nucleases. The nuclease-null AdnAB is a helicase that unwinds linear plasmid DNA without degrading the displaced single strands. Mutations of the phosphohydrolase active site of the AdnB subunit ablate DNA-dependent ATPase activity, DSB end resection, and ATP-inducible ssDNA cleavage; the equivalent mutations of the AdnA subunit have comparatively little effect. AdnAB is a novel signature of the Actinomycetales taxon. Mycobacteria are exceptional in that they encode both AdnAB and RecBCD, suggesting the existence of alternative end-resecting motor-nuclease complexes. PMID:19470566

  13. Isolation and Characterization of a Virulent Bacteriophage AB1 of Acinetobacter baumannii

    Jia Shiru

    2010-04-01

    Full Text Available Abstract Background Acinetobacter baumannii is an emerging nosocomial pathogen worldwide with increasing prevalence of multi-drug and pan-drug resistance. A. baumannii exists widely in natural environment, especially in health care settings, and has been shown difficult to be eradicated. Bacteriophages are often considered alternative agent for controlling bacterial infection and contamination. In this study, we described the isolation and characterization of one virulent bacteriophage AB1 capable of specifically infecting A. baumannii. Results A virulent bacteriophage AB1, specific for infecting a clinical strain A. baumannii KD311, was first isolated from marine sediment sample. Restriction analysis indicated that phage AB1 was a dsDNA virus with an approximate genome size of 45.2 kb to 46.9 kb. Transmission electron microscopy showed that phage AB1 had an icosahedral head with a non-contractile tail and collar or whisker structures, and might be tentatively classified as a member of the Siphoviridae family. Proteomic pattern of phage AB1, generated by SDS-PAGE using purified phage particles, revealed five major bands and six minor bands with molecular weight ranging from 14 to 80 kilo-dalton. Also determined was the adsorption rate of phage AB1 to the host bacterium, which was significantly enhanced by addition of 10 mM CaCl2. In a single step growth test, phage AB1 was shown having a latent period of 18 minutes and a burst size of 409. Moreover, pH and thermal stability of phage AB1 were also investigated. At the optimal pH 6.0, 73.2% of phages survived after 60 min incubation at 50°C. When phage AB1 was used to infect four additional clinical isolates of A. baumannii, one clinical isolate of Stenotrophomonas maltophilia, and Pseudomonas aeruginosa lab strains PAK and PAO1, none of the tested strains was found susceptible, indicating a relatively narrow host range for phage AB1. Conclusion Phage AB1 was capable of eliciting efficient lysis

  14. Improving the control of work-in-process at VSM Group AB

    Karlsson, Per-Johan; Porto, Mariana

    2008-01-01

    Today many companies face problems with inventory management. The importance of adequate inventory management has become more evident, while organizations try to reduce their costs and increase their service level. This master thesis was conducted at VSM Group AB in Huskvarna, which is a manufacturer that produces and delivers sewing machines to a worldwide market. VSM Group AB has problems with the management and the refilling of the work-in-process (WIP) inventories and also with lack of in...

  15. Explicit Polarization (X-Pol) Potential Using ab Initio Molecular Orbital Theory and Density Functional Theory†

    Song, Lingchun; Han, Jaebeom; Lin, Yen-lin; Xie, Wangshen; Gao, Jiali

    2009-01-01

    The explicit polarization (X-Pol) method has been examined using ab initio molecular orbital theory and density functional theory. The X-Pol potential was designed to provide a novel theoretical framework for developing next-generation force fields for biomolecular simulations. Importantly, the X-Pol potential is a general method, which can be employed with any level of electronic structure theory. The present study illustrates the implementation of the X-Pol method using ab initio Hartree—Fo...

  16. Toward a Library Synthesis of the Natural Dipeptide Antibiotic TAN 1057 A,B

    Jochen Krüger; Nuria Aguilar

    2002-01-01

    The natural dipeptide antibiotic TAN 1057 A,B represents a promising new antibiotic entity. In this communication we report a novel approach for the synthesis of TAN 1057 A,B analogs bearing variations in the β-arginine side chain. This approach involves a combination of liquid and solid phase methods and allows for a library synthesis of analogs of the natural product.

  17. GORDITA, a young paralog of Arabidopsis thaliana Bsister MADS-box gene ABS, has undergone neofunctionalization

    Erdmann, Robert

    2010-01-01

    Bsister genes, a clade with close relationships to the class B floral homeotic genes, have been conserved for more than 300 million years. Bsister genes in Arabidopsis thaliana underwent gene duplication probably before the diversification of Brassicaceae leading to the paralogue genes ARABIDOPSIS BSISTER (ABS) and GORDITA (GOA). The phenotype of the abs mutant, however, is rather mild as it shows only reduced seed coloration and defects in endothelium development. This thesis focuses on the ...

  18. Effects of POSS nanoparticles on ABS-g-Ma thermo oxidation resistance

    Vilà Ramirez, N.; Sánchez Soto, Miguel

    2012-01-01

    Thermo oxidative degradation at and beyond process- ing temperatures has been carried out on ABS copoly- mer grafted with Maleic Anhydride (ABS- g -Ma) and three nanocomposites with the above material melt-blended with different types of POSS, being amino-propyl isobutyl (APOSS), glycidyl (GPOSS), and trisilanol (TPOSS). The incorporation adequacy of the nanofillers into the matrix has been assessed with scanning electron microscopy (SEM) and differential scan...

  19. MANAGING CUSTOMER LIFE-CYCLE : Case company: OY GOLDEN CROP AB

    He, Yao

    2016-01-01

    Oy Golden Crop Ab has been founded in 2012 February and is food trading company in Finland which supplies the Asian restaurants all over the Finland. For example, Chinese restaurants, Sushi restaurants, Thai restaurants, Indian restaurants and Vietnamese restaurants. Due to the high competition in the Helsinki region, the company needs to improve its system from customer perspective The aim of this thesis is to generate models to manage customer life-cycle for Oy Golden Crop Ab. Therefor...

  20. AbCD: arbitrary coverage design for sequencing-based genetic studies

    Kang, Jian; Huang, Kuan-Chieh; Xu, Zheng; Wang, Yunfei; Abecasis, Gonçalo R.; Li, Yun

    2013-01-01

    Summary: Recent advances in sequencing technologies have revolutionized genetic studies. Although high-coverage sequencing can uncover most variants present in the sequenced sample, low-coverage sequencing is appealing for its cost effectiveness. Here, we present AbCD (arbitrary coverage design) to aid the design of sequencing-based studies. AbCD is a user-friendly interface providing pre-estimated effective sample sizes, specific to each minor allele frequency category, for designs with arbi...

  1. URHEILUN SPONSOROINTI JA LUMILAUTAILU : FOREX Bank Ab:n mahdollisuudet lumilautailun sponsorointiin

    Autio, Suvi

    2011-01-01

    FOREX Bank Ab on Pohjoismaiden suurin valuutanvaihtoon erikoistunut yritys. FOREXin liikeideana on tarjota maasta lähteville ja maahan saapuville matkailijoille valuuttaa joustaviin kellonaikoihin, keskeisillä paikoilla, sekä kilpailukykyisillä kursseilla ja toimitusmaksuilla. Opinnäytetyön aiheena oli urheilun sponsorointi ja lumilautailu. Opinnäytetyön tarkoituksena oli selvittää FOREX Bank Ab:n sponsoroinnin nykytilaa ja lumilautailun sopivuutta FOREXin sponsorointikohteeksi. Teoriaosu...

  2. Hidroponik Tanaman Sayuran Sawi Beda Varietas Dengan Formulasi Nurtisi Ab Mix Dan Formulasi Racikan

    Siagian, Vyvian W.

    2016-01-01

    Vyvian W Siagian, research “Hydroponics of Mustard Vegetable Crops Different Varieties with AB Mix Nutrient and Self-made Nutrient Formulation”, supervised by Ir. Bintang, MP and Ir. Fauzi, MP. This research is aimed to find a differences production from hydroponics of mustard vegetable crops which is have a different varity within AB Mix nutrient and self-made nutrient formulation. It was located at Kompleks Citra Arkadia Jl. Bunga Wijaya Padang Bulan, Medan on June 2015 until September 2015...

  3. High Yield Chemical Vapor Deposition Growth of High Quality Large-Area AB Stacked Bilayer Graphene

    Liu, Lixin; Zhou, Hailong; Cheng, Rui; Yu, Woo Jong; Liu, Yuan; Chen, Yu; Shaw, Jonathan; Zhong, Xing; Huang, Yu; Duan, Xiangfeng

    2012-01-01

    Bernal stacked (AB stacked) bilayer graphene is of significant interest for functional electronic and photonic devices due to the feasibility to continuously tune its band gap with a vertical electrical field. Mechanical exfoliation can be used to produce AB stacked bilayer graphene flakes but typically with the sizes limited to a few micrometers. Chemical vapor deposition (CVD) has been recently explored for the synthesis of bilayer graphene but usually with limited coverage and a mixture of...

  4. Discrimination of Transgenic Rice containing the Cry1Ab Protein using Terahertz Spectroscopy and Chemometrics

    Wendao Xu; Lijuan Xie; Zunzhong Ye; Weilu Gao; Yang Yao; Min Chen; Jianyuan Qin; Yibin Ying

    2015-01-01

    Spectroscopic techniques combined with chemometrics methods have proven to be effective tools for the discrimination of objects with similar properties. In this work, terahertz time-domain spectroscopy (THz-TDS) combined with discriminate analysis (DA) and principal component analysis (PCA) with derivative pretreatments was performed to differentiate transgenic rice (Hua Hui 1, containing the Cry1Ab protein) from its parent (Ming Hui 63). Both rice samples and the Cry1Ab protein were ground a...

  5. Realistic modelling of water/solid interfaces from ab Initio molecular dynamics

    Tocci, G.

    2014-01-01

    Water/solid interfaces are of utmost importance to a number of technological processes. Theoretical studies, based on ab initio approaches are suitable to unveil processes occurring at water/solid interfaces and can therefore be instrumental to delineate guidelines to improve the efficiency of these processes. In this thesis we study several systems of current interest using ab initio methods based on density functional theory (DFT). By going often beyond the use of standard DFT methods and a...

  6. A Novel Variant in CMAH Is Associated with Blood Type AB in Ragdoll Cats

    Gandolfi, Barbara; Grahn, Robert A.; Gustafson, Nicholas A.; Proverbio, Daniela; Spada, Eva; Adhikari, Badri; Cheng, Janling; Andrews, Gordon; Lyons, Leslie A.; Helps, Chris R.

    2016-01-01

    The enzyme cytidine monophospho-N-acetylneuraminic acid hydroxylase is associated with the production of sialic acids on cat red blood cells. The cat has one major blood group with three serotypes; the most common blood type A being dominant to type B. A third rare blood type is known as AB and has an unclear mode of inheritance. Cat blood type antigens are defined, with N-glycolylneuraminic acid being associated with type A and N-acetylneuraminic acid with type B. Blood type AB is serologically characterized by agglutination using typing reagents directed against both A and B epitopes. While a genetic characterization of blood type B has been achieved, the rare type AB serotype remains genetically uncharacterized. A genome-wide association study in Ragdoll cats (22 cases and 15 controls) detected a significant association between blood type AB and SNPs on cat chromosome B2, with the most highly associated SNP being at position 4,487,432 near the candidate gene cytidine monophospho-N-acetylneuraminic acid hydroxylase. A novel variant, c.364C>T, was identified that is highly associated with blood type AB in Ragdoll cats and, to a lesser degree, with type AB in random bred cats. The newly identified variant is probably linked with blood type AB in Ragdoll cats, and is associated with the expression of both antigens (N-glycolylneuraminic acid and N-acetylneuraminic acid) on the red blood cell membrane. Other variants, not identified by this work, are likely to be associated with blood type AB in other breeds of cat. PMID:27171395

  7. An ab initio study of plutonium oxides surfaces; Etude ab initio des surfaces d'oxydes de Pu

    Jomard, G.; Bottin, F.; Amadon, B

    2007-07-01

    By means of first-principles calculations, we have studied the atomic structure as well as the thermodynamic stability of various plutonium dioxide surfaces in function of their environment (in terms of oxygen partial pressure and temperature). All these simulations have been performed with the ABINIT code. It is well known that DFT fails to describe correctly plutonium-based materials since 5f electrons in such systems are strongly correlated. In order to go beyond DFT, we have treated PuO{sub 2} and {beta}-Pu{sub 2}O{sub 3} in a DFT+U framework. We show that the couple of parameters (U,J) that works well for pure Pu is also well designed for describing ground state (GS) properties of these two oxides. The major improvement with respect with DFT is that we are able to predict an insulating GS in agreement with experiments. The presence of a gap in the DOS (Density of States) of plutonium oxides should play a significant role in the predicted surface reactivity. However, performing DFT+U calculations on surfaces of plutonium oxide from scratch was too ambitious. That is why we decided, as a first step, to study the stability of the (100), (110) and (111) surfaces of PuO{sub 2} in a DFT-GGA framework. For each of these orientations, we considered various terminations. These ab initio results have been introduced in a thermodynamic model which allows us to predict the relative stability of the different terminations as a function of temperature and oxygen partial pressure (p{sub O{sub 2}}). We conclude that at room temperature and for p{sub O{sub 2}}{approx}10 atm., the polar O{sub 2}-(100) termination is favoured. The stabilization of such a polar stoichiometric surface is surprising and should be confirmed by DFT+U calculations before any final conclusion. (authors)

  8. Treatment with Anti-EGF Ab Ameliorates Experimental Autoimmune Encephalomyelitis via Induction of Neurogenesis and Oligodendrogenesis

    Yifat Amir-Levy

    2014-01-01

    Full Text Available Background. The neural stem cells (NSCs migrate to the damaged sites in multiple sclerosis (MS and in experimental autoimmune encephalomyelitis (EAE. However, the differentiation into neurons or oligodendrocytes is blocked. Epidermal growth factor (EGF stimulates NSC proliferation and mobilization to demyelinated lesions but also induces astrogenesis and glial scar. Objective. To examine the clinical and histopathological effects of EGF neutralization on EAE. Methods. EAE-induced SJL mice were intravenously treated with either anti-EGF neutralizing antibody (Ab or isotype control or PBS. On day 9 after immunization, 3 mice of each group were daily treated for 9 days with BrdU and then sacrificed for immunohistochemical analysis. Results. Treatment with anti-EGF Ab significantly ameliorated EAE symptoms during the second relapse. Anti-EGF Ab induced a shift from BrdU+GFAP+ NSCs to BrdU+DCX+ neuroblasts in the subventricular zone (SVZ, increased BrdU+NeuN+ neurons in the granular cell layer of the dentate gyrus, and increased BrdU+O4+ oligodendrocytes in the SVZ. There was no change in the inflammatory infiltrates in response to anti-EGF Ab. Conclusions. Therapy with anti-EGF Ab ameliorates EAE via induction of neurogenesis and oligodendrogenesis. No immunosuppressive effect was found. Further investigation is needed to support these notions of beneficial effect of anti-EGF Ab in MS.

  9. Cry1Ab protein from Bt transgenic rice does not residue in rhizosphere soil

    Expression of Cry1Ab protein in Bt transgenic rice (KMD) and its residue in the rhizosphere soil during the whole growth in field, as well as degradation of the protein from KMD straw in five soils under laboratory incubation were studied. The residue of Cry1Ab protein in KMD rhizosphere soil was undetectable (below the limit of 0.5 ng/g air-dried soil). The Cry1Ab protein contents in the shoot and root of KMD were 3.23-8.22 and 0.68-0.89 μg/g (fresh weight), respectively. The half-lives of the Cry1Ab protein in the soils amended with KMD straw (4%, w/w) ranged from 11.5 to 34.3 d. The residence time of the protein varied significantly in a Fluvio-marine yellow loamy soil amended with KMD straw at the rate of 3, 4 and 7%, with half-lives of 9.9, 13.8 and 18 d, respectively. In addition, an extraction method for Cry1Ab protein in soil was developed, with extraction efficiencies of 46.4-82.3%. - Cry1Ab protein was not detected in the rhizosphere soil of field-grown Bt transgenic rice

  10. Formation of reflective and conductive silver film on ABS surface via covalent grafting and solution spray

    Chen, Dexin; Zhang, Yan [School of Mechanical and Automotive Engineering, South China University of Technology, 381 Wushan, Guangzhou 510640 (China); Bessho, Takeshi [Higashifuji Technical Center, Toyota Motor Corporation, 1200 Mishuku, Susono, Shizuoka 410-1193 (Japan); Kudo, Takahiro; Sang, Jing; Hirahara, Hidetoshi; Mori, Kunio [Faculty of Engineering, Iwate University, 4-3-5 Ueda, Morioka 020-8551 (Japan); Kang, Zhixin, E-mail: zxkang@scut.edu.cn [School of Mechanical and Automotive Engineering, South China University of Technology, 381 Wushan, Guangzhou 510640 (China)

    2015-09-15

    Highlights: • A pure and homogenous silver film was deposited by spray-style plating technique. • The mechanism of covalent bonding between coating and substrate was studied. • The silver coating is highly reflective and conductive. • UV light was used to activate the ABS surface with triazine azide derivative. - Abstract: Conductive and reflective silver layers on acrylonitrile butadiene styrene (ABS) plastics have been prepared by photo grafting of triazine azides upon ultraviolet activation, self-assembling of triazine dithiols and silver electroless plating by solution spray based on silver mirror reaction. The as-prepared silver film exhibited excellent adhesion with ABS owing to covalent bonds between coating and substrate, and the detailed bonding mechanism have been investigated by X-ray photoelectron spectroscopy (XPS). X-ray diffraction (XRD) result revealed that silver film on ABS was pure and with a nanocrystalline structure. Atomic force microscope (AFM) analysis demonstrated that massive silver particles with sizes varying from 80 to 120 nm were deposited on ABS and formed a homogenous and smooth coating, resulting in highly reflective surface. Furthermore, silver maintained its unique conductivity even as film on ABS surface in term of four-point probe method.

  11. Studies of the distribution of intrathecally injected 125I-tetanus antitoxin-F(ab')2

    Overall F(ab')2 and antitetanus-f(ab')2 - fragments were labelled with 125I and injected i.th. into normal juvenile cats and adult rats. One group of rats was normal; in the other, unilateral local tetanus had been induced by injection of tetanus toxin into a M. gastrocnemius. The animals were sacrificed 24 h after the i.th. injection, and tissue samples were taken for histoautoradiography. 125I-antitetanus-F(ab')2 permeated into the extracellular space of the spinal cord, roots, and ganglia but not into the neuronal intracellular space. 125I-overall-F(ab') showed identical permeation behaviour. 125I-antitetanus-F(ab')2 reacted with tetanus toxin issuing from the motoneurons after i.th. injection, forming an immunocomplex around the motorneurons. The immunocomplex was not formed around pseudo-unipolar ganglian cells in the spinal ganglia even though some of the ganglian cells contained tetanus toxin, and 125I-antitetanus-F(ab')2 was present in the extracellular space. As an explanation, it was suggested that tetanus toxin does not permeate into the extracellular space through the membrane of the pseudo-unipolar ganglian cells so that immune reactions will not occur. These findings help to explain the widely divergent results of tetanus therapy by means of i.th. injection of tetanus antitoxin. Recommendations for future therapy measures are derived from the findings. (orig./MG)

  12. Formation of reflective and conductive silver film on ABS surface via covalent grafting and solution spray

    Highlights: • A pure and homogenous silver film was deposited by spray-style plating technique. • The mechanism of covalent bonding between coating and substrate was studied. • The silver coating is highly reflective and conductive. • UV light was used to activate the ABS surface with triazine azide derivative. - Abstract: Conductive and reflective silver layers on acrylonitrile butadiene styrene (ABS) plastics have been prepared by photo grafting of triazine azides upon ultraviolet activation, self-assembling of triazine dithiols and silver electroless plating by solution spray based on silver mirror reaction. The as-prepared silver film exhibited excellent adhesion with ABS owing to covalent bonds between coating and substrate, and the detailed bonding mechanism have been investigated by X-ray photoelectron spectroscopy (XPS). X-ray diffraction (XRD) result revealed that silver film on ABS was pure and with a nanocrystalline structure. Atomic force microscope (AFM) analysis demonstrated that massive silver particles with sizes varying from 80 to 120 nm were deposited on ABS and formed a homogenous and smooth coating, resulting in highly reflective surface. Furthermore, silver maintained its unique conductivity even as film on ABS surface in term of four-point probe method

  13. Stacking stability of MoS2 bilayer: An ab initio study

    The study of the stacking stability of bilayer MoS2 is essential since a bilayer has exhibited advantages over single layer MoS2 in many aspects for nanoelectronic applications. We explored the relative stability, optimal sliding path between different stacking orders of bilayer MoS2, and (especially) the effect of inter-layer stress, by combining first-principles density functional total energy calculations and the climbing-image nudge-elastic-band (CI-NEB) method. Among five typical stacking orders, which can be categorized into two kinds (I: AA, AB and II: AA', AB', A'B), we found that stacking orders with Mo and S superposing from both layers, such as AA' and AB, is more stable than the others. With smaller computational efforts than potential energy profile searching, we can study the effect of inter-layer stress on the stacking stability. Under isobaric condition, the sliding barrier increases by a few eV/(ucGPa) from AA' to AB', compared to 0.1 eV/(ucGPa) from AB to [AB]. Moreover, we found that interlayer compressive stress can help enhance the transport properties of AA'. This study can help understand why inter-layer stress by dielectric gating materials can be an effective means to improving MoS2 on nanoelectronic applications. (condensed matter: structural, mechanical, and thermal properties)

  14. Yeast killer toxin-like candidacidal Ab6 antibodies elicited through the manipulation of the idiotypic cascade.

    Polonelli, Luciano; Beninati, Concetta; Teti, Giuseppe; Felici, Franco; Ciociola, Tecla; Giovati, Laura; Sperindè, Martina; Lo Passo, Carla; Pernice, Ida; Domina, Maria; Arigò, Milena; Papasergi, Salvatore; Mancuso, Giuseppe; Conti, Stefania; Magliani, Walter

    2014-01-01

    A mouse anti-anti-anti-idiotypic (Id) IgM monoclonal antibody (mAb K20, Ab4), functionally mimicking a Wyckerhamomyces anomalus (Pichia anomala) killer toxin (KT) characterized by fungicidal activity against yeasts presenting specific cell wall receptors (KTR) mainly constituted by β-1,3-glucan, was produced from animals presenting anti-KT Abs (Ab3) following immunization with a rat IgM anti-Id KT-like mAb (mAb K10, Ab2). MAb K10 was produced by immunization with a KT-neutralizing mAb (mAb KT4, Ab1) bearing the internal image of KTR. MAb K20, likewise mAb K10, proved to be fungicidal in vitro against KT-sensitive Candida albicans cells, an activity neutralized by mAb KT4, and was capable of binding to β-1,3-glucan. MAb K20 and mAb K10 competed with each other and with KT for binding to C. albicans KTR. MAb K20 was used to identify peptide mimics of KTR by the selection of phage clones from random peptide phage display libraries. Using this strategy, four peptides (TK 1-4) were selected and used as immunogen in mice in the form of either keyhole limpet hemocyanin (KLH) conjugates or peptide-encoding minigenes. Peptide and DNA immunization could induce serum Abs characterized by candidacidal activity, which was inhibited by laminarin, a soluble β-1,3-glucan, but not by pustulan, a β-1,6-glucan. These findings show that the idiotypic cascade can not only overcome the barrier of animal species but also the nature of immunogens and the type of technology adopted. PMID:25162681

  15. Yeast killer toxin-like candidacidal Ab6 antibodies elicited through the manipulation of the idiotypic cascade.

    Luciano Polonelli

    Full Text Available A mouse anti-anti-anti-idiotypic (Id IgM monoclonal antibody (mAb K20, Ab4, functionally mimicking a Wyckerhamomyces anomalus (Pichia anomala killer toxin (KT characterized by fungicidal activity against yeasts presenting specific cell wall receptors (KTR mainly constituted by β-1,3-glucan, was produced from animals presenting anti-KT Abs (Ab3 following immunization with a rat IgM anti-Id KT-like mAb (mAb K10, Ab2. MAb K10 was produced by immunization with a KT-neutralizing mAb (mAb KT4, Ab1 bearing the internal image of KTR. MAb K20, likewise mAb K10, proved to be fungicidal in vitro against KT-sensitive Candida albicans cells, an activity neutralized by mAb KT4, and was capable of binding to β-1,3-glucan. MAb K20 and mAb K10 competed with each other and with KT for binding to C. albicans KTR. MAb K20 was used to identify peptide mimics of KTR by the selection of phage clones from random peptide phage display libraries. Using this strategy, four peptides (TK 1-4 were selected and used as immunogen in mice in the form of either keyhole limpet hemocyanin (KLH conjugates or peptide-encoding minigenes. Peptide and DNA immunization could induce serum Abs characterized by candidacidal activity, which was inhibited by laminarin, a soluble β-1,3-glucan, but not by pustulan, a β-1,6-glucan. These findings show that the idiotypic cascade can not only overcome the barrier of animal species but also the nature of immunogens and the type of technology adopted.

  16. Ab initio calculation of molecular energies including parity violating interactions

    A new approach, RHF-CIS, based on the perturbation of the ground state RHF wave function by the CIS excitations, has been implemented for evaluation of energy of parity violating interaction in molecules, Epv. The earlier approach, RHF-SDE, was based on the perturbation of the RHF ground states by the single-determinant ''excitations'' (SDE). The results obtained show the dramatic difference between Epv values in the RHF-CIS framework and those in the RHF-SDE framework: the Epv values of the RHF-CIS formalism are more than one order of magnitude greater compared to the RHF-SDE formalism as well as the corresponding tensor components. The maximal total value obtained for hydrogen peroxide in the RHF-CIS framework is 3.661 X 10-19 EH (DZ** basis set) while the maximal Epv value for the RHF-SDE formalism is just 3.635 X 10-20 EH (TZ basis set). It is remarkable that both in the RFH-CIS and in the RHF-SDE approaches the diagonal tensor components of Epv strictly follow the geometry of a molecule and are always different from zero at chiral conformations. The zeros of the total Epv at chiral geometries are now found to be the results of the interplay between the diagonal tensor components values. We have carried out exhaustive analysis of the RHF-SDE formalism and found that it is not sufficiently accurate for studies of Epv. To this end, we have completely reproduced the previous work, which has been done in the RHF-SDE frame-work, and developed it further, studying how the RHF-SDE results vary when changing size and quality of basis sets. This last resource does not save the RHF-SDE formalism for evaluations of Epv from the general failure. Packages of FORTRAN routines called ENWEAK/RHFSDE-93 and ENWEAK/RHFCIS-94 have been developed which run on top of an ab initio MO package. We used 6-31G and 6-31G**, DZ and DZ**, TZ and TZ**, and (10s, 6p,**) basis sets. We will discuss the importance of the present results for possible measurement of the parity violating energy

  17. Ab Initio Computation of Dynamical Properties: Pressure Broadening

    Wiesenfeld, Laurent; Drouin, Brian

    2014-06-01

    Rotational spectroscopy of polar molecules is the main observational tool in many areas of astrophysics, for gases of low densities (n ˜ 102 - 108 cm-3). Spectral line shapes in astrophysical media are largely dominated by turbulence-induced Doppler effects and natural line broadening are negligible. However line broadening remains an important tool for denser gases, like planetary high atmospheres. Understanding the excitation schemes of polar molecules requires the knowledge of excitation transfer rate due to collisional excitation, between the polar molecule and the ambient gas, usually H2. Transport properties in ionized media also require a precise knowledge of momentum transfer rates by elastic collisions. In order to assess the theoretically computed cross section and energy/momentum transfer rates, direct absolute experiments are scarce. The best way is to measure not individual scattering events but rather the global effect of the buffer gas, thanks to the pressure broadening cross sections, whose magnitude can be measured without any scaling parameters. At low temperatures, both elastic and inelastic scattering amplitudes are tested. At higher temperature, depending on the interaction strength, only inelastic scattering cross section are shown to play a significant role 1 ,2. Thanks to the advances of computer capabilities, it has become practical to compute spectral line parameters fromab initio quantum chemistry. In particular, the theory of rotational line broadening is readily incorporated into scattering quantum dynamical theory, like close-coupling schemes. The only approximations used in the computation are the isolated collision/isolated line approximations. We compute the non-binding interaction potential with high precision quantum chemistry and fit the resulting ab initio points onto a suitable functional. We have recently computed several such systems, for molecules in H2 buffer gas: H2O,3 H2CO,4 HCO+ .5 Detailed computations taking into

  18. Different evolutionary stages in S235A-B

    Felli, Marcello; Massi, Fabrizio; Cesaroni, Riccardo

    The star forming region S235A-B has been studied at high resolution with radio (IRAM Interferometer and VLA) and infrared (JCMT and Spitzer) observations. The region was mapped in HCO^+, C^34S, H[2]CS, SO[2] and CH[3]CN as well as in the 1.2 and 3.3 continuum, in the cm continuum at 6, 3.6, 1.3 and 0.7 cm and in the 22 GHz water maser line, in the far infrared at 450 and 850 micron and in the mid infrared from 3.6 to 8 micron. Use was made of the Medicina water maser patrol, from 1987 to 2005, to study the maser variability. S235A is a classical HII region, well resolved and with a very good match between radio and infrared images. To the south of it, molecular and continuum mm observations as well as infrared observations reveal the presence of newly formed YSOs placed in between S235A and S235B: a molecular core and an unresolved mm source centred on one maser component, with indication of mass infall onto the core. Two bipolar outflows and a jet originate from the same position. No cm radio continuum emission is detected either from the compact molecular core or from the jet-like structure, suggesting emission from dust in both cases. Evidence is found for a molecular rotating disk perpendicular to the main bipolar outflow. The derived parameters indicate that the YSO is an intermediate luminosity object in a very early evolutionary phase. Its main source of energy could come from gravitational infall thus making this YSO a rare link between the earliest evolutionary phases of massive stars and low mass protostars of class 0-I. Two compact radio continuum sources (VLA-1 and VLA-2) and three separate maser spots were found. VLA-1 coincides with one of the maser spots and with an IR source (M1). VLA-2 lies towards S235B and represents the first radio detection from this peculiar nebula. The two other maser spots coincide with the rotating disk perpendicular to the bipolar molecular outflow. The Spitzer images reveal a red object towards the molecular core which is

  19. Characterization of the mechanism of action of the genetically modified Cry1AbMod toxin that is active against Cry1Ab-resistant insects.

    Muñóz-Garay, Carlos; Portugal, Leivi; Pardo-López, Liliana; Jiménez-Juárez, Nuria; Arenas, Ivan; Gómez, Isabel; Sánchez-López, Rosana; Arroyo, Raquel; Holzenburg, Andreas; Savva, Christos G; Soberón, Mario; Bravo, Alejandra

    2009-10-01

    Bacillus thuringiensis Cry toxins are used in the control of insect pests. They are pore-forming toxins with a complex mechanism that involves the sequential interaction with receptors. They are produced as protoxins, which are activated by midgut proteases. Activated toxin binds to cadherin receptor, inducing an extra cleavage including helix alpha-1, facilitating the formation of a pre-pore oligomer. The toxin oligomer binds to secondary receptors such as aminopeptidase and inserts into lipid rafts forming pores and causing larval death. The primary threat to efficacy of Bt-toxins is the evolution of insect resistance. Engineered Cry1AMod toxins, devoid of helix alpha-1, could be used for the control of resistance in lepidopterans by bypassing the altered cadherin receptor, killing resistant insects affected in this receptor. Here we analyzed the mechanism of action of Cry1AbMod. We found that alkaline pH and the presence of membrane lipids facilitates the oligomerization of Cry1AbMod. In addition, tryptophan fluorescence emission spectra, ELISA binding to pure aminopeptidase receptor, calcein release assay and analysis of ionic-conductance in planar lipid bilayers, indicated that the secondary steps in mode of action that take place after interaction with cadherin receptor such as oligomerization, receptor binding and pore formation are similar in the Cry1AbMod and in the wild type Cry1Ab. Finally, the membrane-associated structure of Cry1AbMod oligomer was analyzed by electron crystallography showing that it forms a complex with a trimeric organization. PMID:19559004

  20. Budding yeast cDNA sequencing project: Y053_E12_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y053_E12_F.ab1 Y053_E12_F.ab1 - - Show Y053_E12_F.ab1 Seqid Y053_E12_F.ab1 Link to SGD Y053_E12_ ... 0 753 ABI TCTTCTGCTCTAAGCTGCTCGAGTGTAAACGACTTACACTACAT AGTTAA TACGACTCACTATTTGGCAT TCCTTAAGATTTGATCGAAATAGA ... TATTAA GAAAAACAAACTGTACAATCAATCAATCAATCAT CACAT AAAATGTTCAG CGAATTAATTAACTTCCAAAATGAAGGTCAT GAG ...

  1. Budding yeast cDNA sequencing project: Y004_M09_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y004_M09_F.ab1 Y004_M09_F.ab1 DB652777 DB652777 Show Y004_M09_F.ab1 Seqid Y004_M09_F.ab1 Link to ... TAGACGATGAGGTGTTTCCCTTATCTTTTGCCAATTA TCAATTTACCGAGCAT GTGTCACTTGGTGAGCAT TATTCACTCAATACTT CGGAAGATGCCAAATA ... ACTGT GTTCTCGTTAGATAACCCTCAAGAAAACAACTACAAACACCAAGCCAT GA ATAACGTCCAGGATTGTCGCAT GGCCGTCGCGGCCAAAACTACCCAGT ...

  2. Budding yeast cDNA sequencing project: Y045_B09_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y045_B09_F.ab1 Y045_B09_F.ab1 - - Show Y045_B09_F.ab1 Seqid Y045_B09_F.ab1 Link to SGD Y045_B09_ ... b1 753 0 753 ABI ATTCTGCTTAAGCTGCTCGAGTGTAAACGACGGCCAT TCCCCAT TAAAGA CGACTCACTATAGGGAATTCCTTAAGATTTGGAGCAC ... TCACAACAAATAGCCAAAAATGCCCGTAAAGCAGGGA ATATTTTGAAAACCAT CTCAAACGAGGGCAGATCAGATATTTTATACAAA ATTCACGATGCCCTGA ...

  3. Budding yeast cDNA sequencing project: Y072_P20_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y072_P20_F.ab1 Y072_P20_F.ab1 DB661654 DB661654 Show Y072_P20_F.ab1 Seqid Y072_P20_F.ab1 Link to ... AATGCTGAGAT CGTTATTGCAAAGCGGCCACCGCAGGGTGGTTGCTTCTTCAT GTGCTACC AT GGTGCGTTGCAGTTCCTCGTCGACCTCCGCGTTGGCGTAC ... TCCCTTGCCCACACTAGACACTCCTTCCT GGAATGCCAACAGTGCCGTTTCAT CCATCAT TTACGAAACACCAGCGCCT TCTCGTCAACCAAGAAAACAGCAT ...

  4. Budding yeast cDNA sequencing project: Y102_E19_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y102_E19_F.ab1 - - - Show Y102_E19_F.ab1 Seqid Y102_E19_F.ab1 Link to SGD - Link to dbEST - Link ... _F.ab1 753 0 753 ABI GCTCTAAGCTGCTCGAGTGTAAACGACGGCCAT TACGTATTTTATACGAC TCACTATAGGGAATTCCTTAAGATTAAATGTGG ... AAACTGGATAAAAACCTTTGAA GAATTTGGAACAACCCCCACCTAAATGGCAT GGAAAAAAAGGCTTTATTT GTAAAATTTGTGAGGCTATTGCTTTATTTGT ...

  5. Budding yeast cDNA sequencing project: Y114_D11_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y114_D11_F.ab1 Y114_D11_F.ab1 DB668015 DB668015 Show Y114_D11_F.ab1 Seqid Y114_D11_F.ab1 Link to ... CGAGTGTNNNAAGAGGNCATCTCTNAAATAGGG GANTNANNATAGGGAATTCC TTAAGATTTGGCGAGCAAATTAACAGACCT AATTGAACTGGAAAACATGT ... AAACCCATTGACAACTACATCACGA ACAGTGTTCGCCTTTTTGAGGTGAATCC ATCTCAAACGCTCTTCTCC ATA TCGTATAAACCACCAACACAGAAGACAG ... ACACCAAAGTGTCC TTTAGAAC TCATAACTCGCATTTATCC TTGAACTATAAATTTACTACTAA ... GATGTTTCAAGATTACTTAGTGCATTAGGCCCACGAGGCGTATCTATA ACTCC AGGTAAAATTGAAAAAATAGCACAGTCGAAGAAGAAAAATAACAA AATAA ...

  6. Budding yeast cDNA sequencing project: Y077_A07_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y077_A07_F.ab1 - - - Show Y077_A07_F.ab1 Seqid Y077_A07_F.ab1 Link to SGD - Link to dbEST - Link ... GGGGGGG GGGGGGGGGGGGGTATTCGTTTTAAAGGAATAAATTCGGGGTTTCC CCTT TCC ... Quality >Y077_A07_F.ab1 203 0 203 ABI 7 7 ...

  7. Budding yeast cDNA sequencing project: Y086_E03_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y086_E03_F.ab1 Y086_E03_F.ab1 DB663490 DB663490 Show Y086_E03_F.ab1 Seqid Y086_E03_F.ab1 Link to ... CGAGTGTAAAAGTACGGATACAAAAGAGGGGAC GACTCACTATAGTTACTTCC TTAAGATTTGAGCGATGAGAGCAGCTACAT AACACATAGTAAATCACACA ... TCTACGCAACACACACACACACGCATACAC TCACCCTCATGACAGATCC CCACTTGAACACGCCCCAAGTGAGCACGTCA CCCACATTTGAAAGATCAC ... AGGACTTCC TCAACATCGACGAACCGCCCTG TGCACAGGAAACACCTAGTGTTTCTACA ... TTCAACCTCC CGGGTCC AAGCG CTCC CGCTCAAAGCGTAGACAAGCCAGTCC CCATGATT ...

  8. Budding yeast cDNA sequencing project: Y108_J23_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y108_J23_F.ab1 Y108_J23_F.ab1 - - Show Y108_J23_F.ab1 Seqid Y108_J23_F.ab1 Link to SGD Y108_J23_ ... GAGTGTAAACGACGGCCATAACTTATTTAAT ACGACTCACTATAGGGAATTCC TTAAGATTTTAGGGATGCTGTGGAAAAG GCTCTTAAACAGACTAACGGAA ... ATGCAGAATTTGCTGCATCC CTCC TTTT CC AATGAGCAACCACTGATATTGTGATCGGCCTCTACTTATG ... CTGTTAATATATAATATGCA TAGTTGTATTTGTGCCTCAATGTGCGCCATTCC TGTGTTGGACAAAGCCG CAAGGGCCAAGGCAAGATCC CAGTTTGAAAACG ... ACCCCCGGCCGCTAGAT GCTCC CTTTAGTGACGGTAAATTGCATCC GCACTGACAAGATACTTTGAC GAGTT ...

  9. Budding yeast cDNA sequencing project: Y094_K12_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y094_K12_F.ab1 Y094_K12_F.ab1 DB664754 DB664754 Show Y094_K12_F.ab1 Seqid Y094_K12_F.ab1 Link to ... GAGTGTAAACGACGGCCAGTACGTATTTAATA CGACTCACTATAGGGAATTCC TTAAGATTTGAACCACGTCACATTATACT CATAACCATAGAATTCACAGA ... TATATTACACCTTG GTTTTTGCCATTCTAGTGGTGGAGATTTTCATGTTCTCC ATTCTAGCCCT ACCAATCC CTTCTAGATACCGTAGGCCTCTCACCTTACT ... GTTATTAAAGC CGTTCAAATCCTCC ACAGTGCAAGTTGCGATCAAGTGTGTACTTGGGTTC ATTCTTTTGCT ... GGGCTAGTCATAGAACTTTTAACCATGAAAGACATATACAGAGCATCGC CTCC AGTAGCCTCC AGCGATGTCAAGAAGAACGACTCTGTTACTGCCGAA GCTG ...

  10. Budding yeast cDNA sequencing project: Y102_K19_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y102_K19_F.ab1 Y102_K19_F.ab1 - - Show Y102_K19_F.ab1 Seqid Y102_K19_F.ab1 Link to SGD Y102_K19_ ... GAGTGTAAACGACGGCCAGCACGTATTTAATACGA CTCACTATAGGGAATTCC TTAAGATTTATCAAGAACTTGGTTTGATATTT CACCAACACACACAAAAA ... T TGAGATTGGCTTTGCAAAGAAAAGACATTGAGGTTGTTGCTGTCAACGAT CC ATTTATCTCTAACGATTATGCTGCTTACATGGTCAAGTACGATTCTAC T ... CATGGTAGATACAAGGGTACTGTTTCC CATGACGACAAGCACATCATCA TTGATGGTGTCAAGATCGCTACCTACCA ... ACCCAGCTAACTTG CCATGGGGTTCTCTAAAGATCGATGTCGCTGTTGACTCC ACTGGTGTTTT CAAGGAATTGGACACCGCTCAAAAGCACATTGACGCTGG ...

  11. Budding yeast cDNA sequencing project: Y016_M23_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y016_M23_F.ab1 Y016_M23_F.ab1 - - Show Y016_M23_F.ab1 Seqid Y016_M23_F.ab1 Link to SGD Y016_M23_ ... GAGTGTAAACGACGGCCAGTATCTATTTAATA CGACTCACTATAGGGAATTCC TTAAGATTTACTCC TCTCAGCCTCAGTCA TCATCC GCTCAAACCCAGCCG ... TCGTTCC AACCTAAAGAAAACCTTTTCGT ACCACGGGTAAAAATTTTGCATCGTGAT ... TAAAATAATA AGAATTATATATTTTATGATTATATTATTACATAAAGTATTCC CCATTAT AAATTCTGAGTTTCGTAAAAAAAAAAAAAAAAAAAAAAAAAAA ... AAAAAAA AAAAAAAAAAAAAAAAAAGTACCGCGGCCGCGGATCTCC CTTTAGGGAGG GTTAATTGGATCC AAACATGATAAAATACATTGATGAGT ...

  12. Generation of Monoclonal Antibodies against Non-structural Protein 3AB of Foot-and-Mouth Disease Virus

    Tong Lin; Junjun Shao; Huiyun Chang; Shandian Gao; Guozheng Cong; Junzheng Du

    2012-01-01

    To identify linear epitopes on the non-structural protein 3AB of foot-and-mouth disease virus (FMDV),BABL/c mice were immunized with the 3AB protein and splenocytes of BALB/c mice were fused with myeloma Sp2/0 cells.Two hybridoma monoclonal antibodies (mAbs) cell lines against the 3AB protein of foot-and-mouth disease virus (FMDV) were obtained,named C6 and E7 respectively.The microneutralization titer was 1∶1024 for mAb C6,and 1∶512 for E7.Both mAbs contain kappa light chains,and were of subclass IgG2b.In order to define the mAbs binding epitopes,the reactivity of these mAbs against FMDV were examined by indirect ELISA.The results showed that both mAbs can react with FMDV,but had no cross-reactivity with Swine Vesicular Disease (SVD) antigens.The titers in abdomen liquor were 1∶5×106 for C6 and 1∶2×106 for E7.In conclusion,the mAbs obtained from this study are specific for the detection of FMDV,can be used for etiological and immunological researches on FMDV,and have potential use in diagnosis and future vaccine designs.

  13. Islet biology, the CDKN2A/B locus and type 2 diabetes risk.

    Kong, Yahui; Sharma, Rohit B; Nwosu, Benjamin U; Alonso, Laura C

    2016-08-01

    Type 2 diabetes, fuelled by the obesity epidemic, is an escalating worldwide cause of personal hardship and public cost. Diabetes incidence increases with age, and many studies link the classic senescence and ageing protein p16(INK4A) to diabetes pathophysiology via pancreatic islet biology. Genome-wide association studies (GWASs) have unequivocally linked the CDKN2A/B locus, which encodes p16 inhibitor of cyclin-dependent kinase (p16(INK4A)) and three other gene products, p14 alternate reading frame (p14(ARF)), p15(INK4B) and antisense non-coding RNA in the INK4 locus (ANRIL), with human diabetes risk. However, the mechanism by which the CDKN2A/B locus influences diabetes risk remains uncertain. Here, we weigh the evidence that CDKN2A/B polymorphisms impact metabolic health via islet biology vs effects in other tissues. Structured in a bedside-to-bench-to-bedside approach, we begin with a summary of the evidence that the CDKN2A/B locus impacts diabetes risk and a brief review of the basic biology of CDKN2A/B gene products. The main emphasis of this work is an in-depth look at the nuanced roles that CDKN2A/B gene products and related proteins play in the regulation of beta cell mass, proliferation and insulin secretory function, as well as roles in other metabolic tissues. We finish with a synthesis of basic biology and clinical observations, incorporating human physiology data. We conclude that it is likely that the CDKN2A/B locus influences diabetes risk through both islet and non-islet mechanisms. PMID:27155872

  14. An investigation of ab initio shell-model interactions derived by no-core shell model

    Wang, XiaoBao; Dong, GuoXiang; Li, QingFeng; Shen, CaiWan; Yu, ShaoYing

    2016-09-01

    The microscopic shell-model effective interactions are mainly based on the many-body perturbation theory (MBPT), the first work of which can be traced to Brown and Kuo's first attempt in 1966, derived from the Hamada-Johnston nucleon-nucleon potential. However, the convergence of the MBPT is still unclear. On the other hand, ab initio theories, such as Green's function Monte Carlo (GFMC), no-core shell model (NCSM), and coupled-cluster theory with single and double excitations (CCSD), have made many progress in recent years. However, due to the increasing demanding of computing resources, these ab initio applications are usually limited to nuclei with mass up to A = 16. Recently, people have realized the ab initio construction of valence-space effective interactions, which is obtained through a second-time renormalization, or to be more exactly, projecting the full-manybody Hamiltonian into core, one-body, and two-body cluster parts. In this paper, we present the investigation of such ab initio shell-model interactions, by the recent derived sd-shell effective interactions based on effective J-matrix Inverse Scattering Potential (JISP) and chiral effective-field theory (EFT) through NCSM. In this work, we have seen the similarity between the ab initio shellmodel interactions and the interactions obtained by MBPT or by empirical fitting. Without the inclusion of three-body (3-bd) force, the ab initio shell-model interactions still share similar defects with the microscopic interactions by MBPT, i.e., T = 1 channel is more attractive while T = 0 channel is more repulsive than empirical interactions. The progress to include more many-body correlations and 3-bd force is still badly needed, to see whether such efforts of ab initio shell-model interactions can reach similar precision as the interactions fitted to experimental data.

  15. Living with an imperfect cell wall: compensation of femAB inactivation in Staphylococcus aureus

    Bierbaum Gabriele

    2007-09-01

    Full Text Available Abstract Background Synthesis of the Staphylococcus aureus peptidoglycan pentaglycine interpeptide bridge is catalyzed by the nonribosomal peptidyl transferases FemX, FemA and FemB. Inactivation of the femAB operon reduces the interpeptide to a monoglycine, leading to a poorly crosslinked peptidoglycan. femAB mutants show a reduced growth rate and are hypersusceptible to virtually all antibiotics, including methicillin, making FemAB a potential target to restore β-lactam susceptibility in methicillin-resistant S. aureus (MRSA. Cis-complementation with wild type femAB only restores synthesis of the pentaglycine interpeptide and methicillin resistance, but the growth rate remains low. This study characterizes the adaptations that ensured survival of the cells after femAB inactivation. Results In addition to slow growth, the cis-complemented femAB mutant showed temperature sensitivity and a higher methicillin resistance than the wild type. Transcriptional profiling paired with reporter metabolite analysis revealed multiple changes in the global transcriptome. A number of transporters for sugars, glycerol, and glycine betaine, some of which could serve as osmoprotectants, were upregulated. Striking differences were found in the transcription of several genes involved in nitrogen metabolism and the arginine-deiminase pathway, an alternative for ATP production. In addition, microarray data indicated enhanced expression of virulence factors that correlated with premature expression of the global regulators sae, sarA, and agr. Conclusion Survival under conditions preventing normal cell wall formation triggered complex adaptations that incurred a fitness cost, showing the remarkable flexibility of S. aureus to circumvent cell wall damage. Potential FemAB inhibitors would have to be used in combination with other antibiotics to prevent selection of resistant survivors.

  16. THE EFFECT OF BLENDING SEQUENCE ON PHASE MORPHOLOGY OF NYLON 6/ABS/SMA BLENDS

    2008-01-01

    The preparation process-dependent phase morphology of blends composed of nylon 6 and acryionitrile-butadienestyrene(ABS)over a composition range of 30-70 wt% using a styrene-maleic anhydride(SMA)copolymer as the compatibilizing agent with a constant content(5phr)was investigated.The results of the scanning electron microscope (SEM)observation revealed that compared with the binary blends of nylon 6 and ABS,the existence of SMA caused a composition shift of phase inversion to a higher weight fraction of nylon 6 when ABS was blended with the preblended nylon 6/SMA blend,while the co-continuous structures could be observed over a considerably narrower composition range when nylon 6 was blended with the pre-blended ABS/SMA blend.An examination through dynamic mechanical analysis (DMA)tests confirmed the results obtained with SEM.It is found that near the phase inversion region a remarkable change in the dynamic storage modulus(G')and the loss tangent(tanδ)appears.Moreover,the influence of blending sequence on the size of dispersed particles has been probed for uncompatibilized and compatibilized blends of nylon 6 and ABS over a wide range of compositions below or beyond the phase inversion points.For the blends of ABS dispersed in a nylon 6 matrix,little discernible effects of blending sequence on particle size could be observed.Furthermore,there exists a significant difference in morphologies of the blends prepared by nylon 6 particles dispersing in a ABS matrix in cases of different blending sequences used.Some possible factors responsible for the above asymmetric behaviors have been proposed.

  17. Physical and Mechanical Characteristics of Kevlar Fiber-Reinforced PC/ABS Composites

    Kuljira Sujirote

    2012-01-01

    Full Text Available In this research, the composites between polycarbonate (PC and acrylonitrile-butadiene-styrene (ABS alloy and Kevlar fiber were prepared. The flexural and tensile properties of PC/ABS alloy and its composites were determined using a universal testing machine. The synergistic behavior of flexural modulus was observed for all regions of PC contents, while the synergism of flexural strength and tensile strength were found in some PC contents. It was found that the optimum weight ratio of PC:ABS was 60:40. In the Kevlar Fiber-reinforced PC/ABS composite system at PC:ABS of 60:40, both flexural modulus and strength were increased with matrix contents. Additionally, the flexural strength drastically increased with the matrix content and then reached the maximum value of 167 MPa at the matrix content of 33.4 wt%. The results from peel test, water contact measurement, and scanning electron microscopy (SEM reveal that the interfacial adhesion between the Kevlar fiber and the polymer matrix could be improved by increasing the PC content in the matrix.

  18. Differential screening of phage-ab libraries by oligonucleotide microarray technology.

    Paolo Monaci

    Full Text Available A novel and efficient tagArray technology was developed that allows rapid identification of antibodies which bind to receptors with a specific expression profile, in the absence of biological information. This method is based on the cloning of a specific, short nucleotide sequence (tag in the phagemid coding for each phage-displayed antibody fragment (phage-Ab present in a library. In order to set up and validate the method we identified about 10,000 different phage-Abs binding to receptors expressed in their native form on the cell surface (10 k Membranome collection and tagged each individual phage-Ab. The frequency of each phage-Ab in a given population can at this point be inferred by measuring the frequency of its associated tag sequence through standard DNA hybridization methods. Using tiny amounts of biological samples we identified phage-Abs binding to receptors preferentially expressed on primary tumor cells rather than on cells obtained from matched normal tissues. These antibodies inhibited cell proliferation in vitro and tumor development in vivo, thus representing therapeutic lead candidates.

  19. Visual search is postponed during the period of the AB: An event-related potential study.

    Lagroix, Hayley E P; Grubert, Anna; Spalek, Thomas M; Di Lollo, Vincent; Eimer, Martin

    2015-08-01

    In the phenomenon known as the attentional blink (AB), perception of the second of two rapidly sequential targets (T2) is impaired when presented shortly after the first (T1). Studies in which T2 consisted of a pop-out search array provided evidence suggesting that visual search is postponed during the AB. In the present work, we used behavioral and electrophysiological measures to test this postponement hypothesis. The behavioral measure was reaction time (RT) to T2; the electrophysiological measure was the onset latency of an ERP index of attentional selection, known as the N2pc. Consistent with the postponement hypothesis, both measures were delayed during the AB. The delay in N2pc was substantially shorter than that in RT, pointing to multiple sources of delay in the chain of processing events, as distinct from the single source postulated in current theories of the AB. Finally, the finding that the N2pc was delayed during the AB strongly suggests that attention is involved in the processing of pop-out search arrays. PMID:25871502

  20. EVIDENCE FOR RADIOGENIC SULFUR-32 IN TYPE AB PRESOLAR SILICON CARBIDE GRAINS?

    We report C, Si, and S isotope measurements on 34 presolar silicon carbide grains of Type AB, characterized by 12C/13C 32S excesses, a signature that has been previously observed for grains from supernovae (SNe). Enrichments in 32S may be due to contributions from the Si/S zone and the result of S molecule chemistry in still unmixed SN ejecta or due to incorporation of radioactive 32Si from C-rich explosive He shell ejecta. However, a SN origin remains unlikely for the three AB grains considered here, because of missing evidence for 44Ti, relatively low 26Al/27Al ratios (a few times 10–3), and radiogenic 32S along with low 12C/13C ratios. Instead, we show that born-again asymptotic giant branch (AGB) stars that have undergone a very-late thermal pulse (VLTP), known to have low 12C/13C ratios and enhanced abundances of the light s-process elements, can produce 32Si, which makes such stars attractive sources for AB grains with 32S excesses. This lends support to the proposal that at least some AB grains originate from born-again AGB stars, although uncertainties in the born-again AGB star models and possible variations of initial S-isotopic compositions in the parent stars of AB grains make it difficult to draw a definitive conclusion

  1. AB Blanket for Cities (for continual pleasant weather and protection from chemical, biological and radioactive weapons)

    Bolonkin, Alexander

    2009-01-01

    In a series of previous articles (see references) the author offered to cover a city or other important large installations or subregions by a transparent thin film supported by a small additional air overpressure under the form of an AB Dome. The building of a gigantic inflatable AB Dome over an empty flat surface is not difficult. However, if we want to cover a city, garden, forest or other obstacle course we cannot easily deploy the thin film over building or trees. In this article is suggested a new method which solves this problem. The idea is to design a double film blanket filled by light gas (for example, methane, hydrogen, or helium). Sections of this AB Blanket are lighter then air and fly in atmosphere. They can be made on a flat area (serving as an assembly area) and delivered by dirigible or helicopter to station at altitude over the city. Here they connect to the already assembled AB Blanket subassemblies, cover the city in an AB Dome and protect it from bad weather, chemical, biological and rad...

  2. Generation of Monoclonal Antibodies (mAbs) Against Breast Cancer Antigen

    Breast cancer is the most common type of cancer seen in women worldwide. Early detection and monitoring progress of treatment of the disease improves the outcome and prognosis. This study is a report on work in generating specific mAbs against breast cancer antigen, CA 15-3, with a view for use in research. Hybridoma cells that produce monoclonal antibody (mAb) against breast cancer antigen were generated by the fusion of mouse splenocytes with P3X63.Ag8.653 myeloma cell line. Four stable hybridoma clones expressing mAbs against CA15-3; D2, F11, E12 and E3, were successfully developed and were scaled up in CELLine CL 350 bioreactors. The mAbs bound to breast cancer cells in vitro; however, they did not react significantly with normal cells. These locally generated mAbs can be used for future work especially in human breast cancerous tissues and therefore can be used for in vivo tumor targeting and imaging. (author)

  3. A Kine-Chemical Investigation of the AB Dor Moving Group "Stream"

    Barenfeld, Scott A; Mamajek, Eric E; Young, Patrick A

    2013-01-01

    The AB Dor Moving Group consists of a "nucleus" of ~10 stars at d ~ 20 pc, along with dozens of purported "stream" members distributed across the sky. We perform a chemical and kinematic analysis of a subsample of AB Dor stream stars to test whether they constitute a physical stellar group. We use the NEMO Galactic kinematic code to investigate the orbits of the stream members, and perform a chemical abundance analysis using high resolution spectra taken with the Magellan Clay 6.5-m telescope. Using a chi^2 test with the measured abundances for 10 different elements, we find that only half of the purported AB Dor stream members could possibly constitute a statistically chemically homogeneous sample. Some stream members with 3D velocities were hundreds of parsecs from the AB Dor nucleus ~10^8 yr ago, and hence were unlikely to share a common origin. We conclude that the published lists of AB Dor moving group stream members are unlikely to represent the dispersed remnant of a single star formation episode. A su...

  4. The load capacity of PC/ABS spur gears and investigation of gear damage

    M.T. Demirci

    2009-11-01

    Full Text Available Purpose: Recently, Polyamide 66 and Teflon as plastic materials have been widely used at the manufacturing of gear mechanism. The purpose of the paper is to examinee the load capacity of PC/ABS spur gears and investigation of gear damage.Design/methodology/approach: In this study, usability of PC/ABS composite plastic materials as spur gear was investigated. PC/ABS gears were tested by applying three different loading at two different numbers of revolutions on the FZG experiment set.Findings: As a result of the experiments, load capability of PC/ABS materials was seen rather high, if one of the spur gear pair was steel (AISI 8620.Practical implications: In fact that, PC/ABS materials are durable against flame, air, ultraviolet lights and holding lower moisture than PA66 GFR 30 materials, the usage of them brings an advantage in many industrial areas.Originality/value: Using PC/ ABC materials provides many advantages due to fire, air and ultraviolet light durability and low moisture holding properties.

  5. Electrochemical hydrogen storage performance of AB_5-CoB composites synthesized by a simple mixing method

    SONG Dawei; WANG Yijing; WANG Yaping; JIAO Lifang; YUAN Huatang

    2009-01-01

    AB5 (MINi_(4.0)Al_(0.3)Cu_(0.5)Zn_(0.2)) alloy and CoB alloy were prepared by arc melting. AB_5-CoB composites were synthesized by simple mixing of AB_5 alloy powders and CoB alloy powders, and their electrochemical hydrogen storage properties were studied as negative electrodes in KOH aqueous solution. The maximum discharge capacity of the AB_5-CoB(50%) composite (the content of CoB in the composite is 50 wt.%) reached 365.3 mAh·g~(-1). After 100 charge-discharge cycles, the discharge capacity of the AB_5-CoB(50%) composite was still much higher than that of the AB5 alloy. The high rate discharge capability (HRD) and potentiodynamic polarzafion were also tested.

  6. 汽车ABS/ASR性能检测试验台的初步设计%A Preliminary Design for Test-bed for the Detection of Automobile ABS/ASR Performance

    陆森兴

    2015-01-01

    Automobile ABS/ASR performance test-bed (performance test-bed for automotive anti-lock braking system/acceleration slip regulation system ), aimed at solving the problem that there is no corresponding automobile ABS/ASR performance testing equipment in respect to current technology.%汽车ABS/ASR性能检测试验台(汽车防抱死制动系统/驱动防滑控制系统性能检测试验台),旨在解决现有技术中没有相应汽车ABS/ASR性能检测设备的问题。

  7. Transport and optical properties of warm dense aluminum in the two-temperature regime: Ab initio calculation and semiempirical approximation

    Knyazev, D. V.; Levashov, P. R.

    2014-01-01

    This work is devoted to the investigation of transport and optical properties of liquid aluminum in the two-temperature case. At first optical properties, static electrical and thermal conductivities were obtained in the \\textit{ab initio} calculation. The \\textit{ab initio} calculation is based on the quantum molecular dynamics, density functional theory and the Kubo-Greenwood formula. The semiempirical approximation was constructed based on the results of the \\textit{ab initio} caculation. ...

  8. Reassessment of the cancer mortality risk among Hiroshima atomic-bomb survivors using a new dosimetry system, ABS2000D, compared with ABS93D

    The aim of the present study was to examine the excess relative risk for leukemia mortality and all cancers, except leukemia, among Hiroshima atomic-bomb survivors by applying ABS93D and ABS2000D. Particular attention was given to any difference in the neutron-dose estimates between the two dosimetry systems. The study subjects were 51,532 atomic-bomb survivors registered in a database of the Research Institute for Radiation Biology and Medicine of Hiroshima University (RIRBM). The results obtained by both dosimetry systems are similar: the excess relative risk per Sv for leukemia mortality and all cancers except leukemia is significantly higher compared to the control group. In addition, the difference in the excess relative risks between the two systems is not significant. Therefore, it is indicated that a modification of the neutron-dose estimates would not markedly change the conclusions about the cancer mortality risk. (author)

  9. Reassessment of the cancer mortality risk among Hiroshima atomic-bomb survivors using a new dosimetry system, ABS2000D, compared with ABS93D.

    Katayama, Hiroaki; Matsuura, Masaaki; Endo, Satoru; Hoshi, Masaharu; Ohtaki, Megu; Hayakawa, Norihiko

    2002-03-01

    The aim of the present study was to examine the excess relative risk for leukemia mortality and all cancers, except leukemia, among Hiroshima atomic-bomb survivors by applying ABS93D and ABS2000D. Particular attention was given to any difference in the neutron-dose estimates between the two dosimetry systems. The study subjects were 51,532 atomic-bomb survivors registered in a database of the Research Institute for Radiation Biology and Medicine of Hiroshima University (RIRBM). The results obtained by both dosimetry systems are similar: the excess relative risk per Sv for leukemia mortality and all cancers except leukemia is significantly higher compared to the control group. In addition, the difference in the excess relative risks between the two systems is not significant. Therefore, it is indicated that a modification of the neutron-dose estimates would not markedly change the conclusions about the cancer mortality risk. PMID:12056330

  10. 马自达626ABS/TCS系统故障自诊断与测试

    韩双庆

    2003-01-01

    @@ 1.预诊断检查 马自达626轿车制动防抱死系统(Anti-Lock Braking System,简称ABS)和牵引力控制系统(Traction Control System,简称TCS)的控制模块是集成于一体的,记为ABS/TCS控制模块.直观检查ABS/TCS系统部件有助于识别出简单故障的原因,确保ABS/TCS警告指示灯工作正常.

  11. Efficient ab initio free energy calculations by classically assisted trajectory sampling

    Wilson, Hugh F.

    2015-12-01

    A method for efficiently performing ab initio free energy calculations based on coupling constant thermodynamic integration is demonstrated. By the use of Boltzmann-weighted sums over states generated from a classical ensemble, the free energy difference between the classical and ab initio ensembles is readily available without the need for time-consuming integration over molecular dynamics trajectories. Convergence and errors in this scheme are discussed and characterised in terms of a quantity representing the degree of misfit between the classical and ab initio systems. Smaller but still substantial efficiency gains over molecular dynamics are also demonstrated for the calculation of average properties such as pressure and total energy for systems in equilibrium.

  12. Measurement of Ab at the Z0 resonance using a jet-charge technique

    The authors present a new preliminary measurement of the parity-violation parameter Ab using a self-calibrating jet-charge technique. In the SLD experiment they observe hadronic decays of Z0 bosons produced in collisions between longitudinally polarized electrons and unpolarized positrons a the SLAC Linear Collider. A sample of b anti b events is selected using the topologically reconstructed mass of B hadrons. From the 1997--1998 data sample of approximately 200,000 hadronic Z0 decays, they obtain Ab = 0.824 ± 0.031(stat) ± 0.032(syst). Together with the previous 1993--1995 result, it yields a preliminary combined SLD jet-charge measurement of: Ab = 0.849 ± 0.026(stat) ± 0.031(syst)

  13. Hardware-in the-loop Simulator for ABS based on MATLAB/Simulink

    Pan,Wei; Gao,jinghui; Zhou,Yafu; Song,Zhenhuan

    2003-01-01

    A method for building a Hardware-in the-loop Simulator of ABS base on MATLAB/Simulink is presented in this paper. In this method, the vehicle transmission model, the AT model and ABS algorithm is built in Simulink. This system can simulate a vehicle system in the Simulink environment. Further more, the Hardware-in the-loop Simulator system can be connected with the real ABS by I/O boards to observe the algorithm is reasonable or not. At the same time, user can simulate some different conditions by changing the parameter. The system help the user heightening the efficiency when developing the electronic device. Also, the system can be used as teaching demo software.

  14. Ab initio calculations of phosphorus and arsenic clustering parameters for the improvement of process simulation models

    Sahli, Beat [Integrated Systems Laboratory, ETH Zurich, Gloriastrasse 35, 8092 Zurich (Switzerland)], E-mail: sahli@iis.ee.ethz.ch; Vollenweider, Kilian [Integrated Systems Laboratory, ETH Zurich, Gloriastrasse 35, 8092 Zurich (Switzerland); Zographos, Nikolas; Zechner, Christoph [Synopsys Switzerland LLC, Affolternstrasse 52, 8050 Zurich (Switzerland)

    2008-12-05

    We present the results of extensive ab initio simulations for phosphorus clusters, arsenic clusters and mixed phosphorus/arsenic clusters in silicon. The specific defects and the parameters that are investigated are selected according to the needs of state-of-the-art diffusion and activation models, taking into account the availability of experimental data, the capabilities of current ab initio methods and the requirements for advanced technology development. The calculated binding energies are used to determine a good starting point for the calibration of a new clustering model implemented in an atomistic process simulator. The defect species V, I, P, PV, PI, As, AsV, AsI and clusters containing up to four dopant atoms and up to one V or I are considered in all relevant charge states. The ab initio results are discussed as well as the challenges arising in the transfer of this information into the process simulation model.

  15. Electrical resistivity of NaPb compound-forming liquid alloy using ab initio pseudopotentials

    Anil Thakur; N S Negi; P K Ahluwalla

    2005-08-01

    The study of electrical resistivity of compound-forming liquid alloy, NaPb, is presented as a function of concentration. Hard sphere diameters of Na and Pb are obtained through the interionic pair potentials evaluated using Troullier and Martins ab initio pseudopotential, which have been used to calculate the partial structure factors (). Considering the liquid alloy to be a ternary mixture, Ziman formula, modified for complex formation has been used for calculating resistivity of binary liquid alloys. Form factors are calculated using ab initio pseudopotentials. The results suggest that Ziman formalism, when used with ab initio pseudopotentials, are quite successful in explaining the electrical resistivity data of compound-forming binary liquid alloys.

  16. Semirational solutions and baseband modulational instability of the AB system in fluid mechanics

    Wang, Lei; Wang, Zi-Zhe; Jiang, Dong-Yang; Qi, Feng-Hua; Guo, Rui

    2015-10-01

    Under investigation in this paper is the AB system describing marginally unstable baroclinic wave packets in geophysical fluids. By means of the n -fold modified Darboux transformation, the semirational solutions in terms of the determinants of the AB system are derived. These solutions, which are a combination of rational and exponential functions, can be used to model the nonlinear superposition of the Akhmediev breathers (or the Kuznetsov-Ma breathers) and the rogue waves. The k -order rogue wave of the AB system is produced by the interaction between the l-order rogue wave with 1/2(k-l)(k+l+1) neighboring elements in the (k-l)-order breathers (0

  17. Crystallization of BMP receptor type IA bound to the antibody Fab fragment AbD1556

    The crystallization of BMP receptor type IA bound to the neutralizing antibody Fab fragment AbD1556 obtained by phage-display selection is reported. An antibody Fab fragment, AbD1556, was selected against the extracellular domain of BMP receptor type IA, which blocks the binding of BMP-2 to BMPR-IA and thereby neutralizes BMP-2 activity. To study the mechanism by which BMPR-IA is recognized and bound by the Fab fragment, the complex of AbD1556 bound to BMPR-IA was prepared and crystallized. Crystals of this binary complex belonged to the monoclinic space group P21, with unit-cell parameters a = 89.32, b = 129.25, c = 100.24 Å, β = 92.27°

  18. Direct measurement of Ab at the Z0 pole using a lepton tag

    Abe, T; Akimoto, H; Aston, D; Baird, K G; Baltay, C; Band, H R; Barklow, Timothy L; Bauer, J M; Bellodi, G; Berger, R; Blaylock, G; Bogart, J R; Bower, G R; Brau, J E; Breidenbach, M; Bugg, W M; Burke, D; Burnett, T H; Burrows, P N; Calcaterra, A; Cassell, R; Chou, A; Cohn, H O; Coller, J A; Convery, M R; Cook, V; Cowan, R F; Crawford, G; Damerell, C J S; Daoudi, M; Dasu, S; De Groot, N; De Sangro, R; Dong, D N; Doser, Michael; Dubois, R; Erofeeva, I; Eschenburg, V; Etzion, E; Fahey, S; Falciai, D; Fernández, J P; Flood, K; Frey, R; Hart, E L; Hasuko, K; Hertzbach, S S; Huffer, M E; Huynh, X; Iwasaki, M; Jackson, D J; Jacques, P; Jaros, J A; Jiang, Z Y; Johnson, A S; Johnson, J R; Kajikawa, R; Kalelkar, M S; Kang, H J; Kofler, R R; Kroeger, R S; Langston, M; Leith, D W G S; Lia, V; Lin, C; Mancinelli, G; Manly, S L; Mantovani, G C; Markiewicz, T W; Maruyama, T; McKemey, A K; Messner, R; Moffeit, K C; Moore, T B; Morii, M; Müller, D; Murzin, V S; Narita, S; Nauenberg, U; Neal, H; Nesom, G; Oishi, N; Onoprienko, D V; Osborne, L S; Panvini, R S; Park, C H; Peruzzi, I; Piccolo, M; Piemontese, L; Plano, R J; Prepost, R; Prescott, C Y; Ratcliff, B N; Reidy, J; Reinertsen, P L; Rochester, L S; Rowson, P C; Russell, J J; Saxton, O H; Schalk, T L; Schumm, B A; Schwiening, J; Serbo, V V; Shapiro, G; Sinev, N B; Snyder, J A; Stängle, H; Stahl, A; Stamer, P E; Steiner, H; Su, D; Suekane, F; Sugiyama, A; Suzuki, A; Swartz, M; Taylor, F E; Thom, J; Torrence, E; Usher, T; Vavra, J; Verdier, R; Wagner, D L; Waite, A P; Walston, S; Weidemann, A W; Weiss, E R; Whitaker, J S; Williams, S H; Willocq, S; Wilson, R J; Wisniewski, W J; Wittlin, J L; Woods, M; Wright, T R; Yamamoto, R K; Yashima, J; Yellin, S J; Young, C C; Yuta, H

    2000-01-01

    We present a direct measurement of the parity violation parameter Ab, derived from the left-right forward-backward asymmetry of b quarks tagged via leptons from semileptonic decays. The lepton identification algorithm combines information from tracking, calorimetry and from the SLD Cherenkov Ring Imaging Detector. The value of Ab is extracted using a maximum likelihood fit to the differential cross section for fermion production. Vertexing information and decay kinematics have been used to discriminate among the different sources of tagged leptons. A new treatment of mixing effects and of background contamination has been introduced and a new vertexing algorithm has been used in the muon analysis. Based on the 1993-1998 SLD sample of 550K hadronic Z0 decays with highly polarized electron beams, we have measured Ab with a ~3% statistical error.

  19. Numerical Simulation of the Microtron Electron Beam Absorption by the Modified ABS-Plastic

    Stuchebrov, S. G.; Miloichikova, I. A.; Melnikov, A. L.; Pereverzeva, M. A.

    2016-01-01

    Each specific task of the electron beam application imposes requirements for the beam profile and shape. One of the methods allows achieving high accuracy and low cost of the filters production is the 3D print method. The required properties of the electron beam interaction with the material can be achieved by using the modified plastic filaments. In this paper, the results of the model creation of the electron beams interaction with the ABS-plastic doped with different concentrations are presented. The depth dose distributions of the electron beam in the modified ABS-plastic are sown. The electron beam profiles and the electron beam distribution in the modified ABS-plastic are illustrated.

  20. Quantitative MS analysis of therapeutic mAbs and their glycosylation for pharmacokinetics study.

    Cong, Yuting; Zhang, Zhang; Zhang, Shen; Hu, Lianghai; Gu, Jingkai

    2016-04-01

    Therapeutic mAbs play an important role in the treatment of a wide range of diseases. Due to their complexity, comprehensive evaluation of their pharmacokinetics has yet to be fully achieved. It is crucial to develop sensitive, accurate, reliable, and reproducible methods for quantitation of mAbs in complex samples. In addition, it is also important to evaluate the PTMs which can affect their safety and/or effectiveness. MS-based methods provide an emerging approach for quantitation of proteins and their modification forms. In this review, we give a brief overview of quantification analysis of mAbs in complex biological samples and the characterization of N-glycosylation by biological MS. PMID:26548570

  1. Sportsligt pris - ekonomisk kris? : En kvalitativ studie om svenska idrottsAB och deras ekonomiska situation.

    Björnfot, Erik; Wright, Kim

    2014-01-01

    TitelSportsligt pris – Ekonomisk kris? En studie om svenska idrottsAB och deras ekonomiska situation.ProblemformuleringIdrott har idag gått från att vara lek och spel till att bli en ekonomisk marknad med stora möjligheter. Svenska idrottsföreningar har överlag visat dåliga ekonomiska resultat de senaste åren. Detta gäller även de idrottsföreningar som valt att bilda ett idrottsAB, varav nästan alla visat dåliga ekonomiska resultat. Studien undersöker vilka åtgärder svenska idrottsAB kan vidt...

  2. Periodic arrays of intercalated atoms in twisted bilayer graphene: An ab initio investigation

    Miwa, R. H.; Venezuela, P.; Morell, Eric Suárez

    2015-09-01

    We have performed an ab initio investigation of transition metals (TMs =Mo ,Ru ,Co ,andPt ) embedded in twisted bilayer graphene (tBG) layers. Our total energy results reveal that, triggered by the misalignment between the graphene layers, Mo and Ru atoms may form a quasiperiodic (triangular) array of intercalated atoms. In contrast, the formation of those structures is not expected for the other TMs, the Co and Pt atoms. The net magnetic moment (m ) of Mo and Ru atoms may be quenched upon intercalation, depending on the stacking region (AA or AB). For instance, we find a magnetic moment of 0.3 μB(1.8 μB) for Ru atoms intercalated between the AA (AB) regions of the stacked twisted layers. Through simulated scanning tunneling microscopy (STM) images, we verify that the presence of intercalated TMs can be identified by the formation of bright (hexagonal) spots lying on the graphene surface.

  3. An Efficient Time-Stepping Scheme for Ab Initio Molecular Dynamics Simulations

    Tsuchida, Eiji

    2016-08-01

    In ab initio molecular dynamics simulations of real-world problems, the simple Verlet method is still widely used for integrating the equations of motion, while more efficient algorithms are routinely used in classical molecular dynamics. We show that if the Verlet method is used in conjunction with pre- and postprocessing, the accuracy of the time integration is significantly improved with only a small computational overhead. We also propose several extensions of the algorithm required for use in ab initio molecular dynamics. The validity of the processed Verlet method is demonstrated in several examples including ab initio molecular dynamics simulations of liquid water. The structural properties obtained from the processed Verlet method are found to be sufficiently accurate even for large time steps close to the stability limit. This approach results in a 2× performance gain over the standard Verlet method for a given accuracy. We also show how to generate a canonical ensemble within this approach.

  4. Matrix Product Operators, Matrix Product States, and ab initio Density Matrix Renormalization Group algorithms

    Chan, Garnet Kin-Lic; Nakatani, Naoki; Li, Zhendong; White, Steven R

    2016-01-01

    Current descriptions of the ab initio DMRG algorithm use two superficially different languages: an older language of the renormalization group and renormalized operators, and a more recent language of matrix product states and matrix product operators. The same algorithm can appear dramatically different when written in the two different vocabularies. In this work, we carefully describe the translation between the two languages in several contexts. First, we describe how to efficiently implement the ab-initio DMRG sweep using a matrix product operator based code, and the equivalence to the original renormalized operator implementation. Next we describe how to implement the general matrix product operator/matrix product state algebra within a pure renormalized operator-based DMRG code. Finally, we discuss two improvements of the ab initio DMRG sweep algorithm motivated by matrix product operator language: Hamiltonian compression, and a sum over operators representation that allows for perfect computational par...

  5. Exploring the speed and performance of molecular replacement with AMPLE using QUARK ab initio protein models

    Keegan, Ronan M. [STFC Rutherford Appleton Laboratory, Didcot OX11 0FA (United Kingdom); Bibby, Jaclyn; Thomas, Jens [University of Liverpool, Liverpool L69 7ZB (United Kingdom); Xu, Dong [Sanford-Burnham Medical Research Institute, 10901 North Torrey Pines Road, La Jolla, CA 92037 (United States); Zhang, Yang [University of Michigan, Ann Arbor, MI 48109 (United States); Mayans, Olga [University of Liverpool, Liverpool L69 7ZB (United Kingdom); Winn, Martyn D. [Science and Technology Facilities Council Daresbury Laboratory, Warrington WA4 4AD (United Kingdom); Rigden, Daniel J., E-mail: drigden@liv.ac.uk [University of Liverpool, Liverpool L69 7ZB (United Kingdom); STFC Rutherford Appleton Laboratory, Didcot OX11 0FA (United Kingdom)

    2015-02-01

    Two ab initio modelling programs solve complementary sets of targets, enhancing the success of AMPLE with small proteins. AMPLE clusters and truncates ab initio protein structure predictions, producing search models for molecular replacement. Here, an interesting degree of complementarity is shown between targets solved using the different ab initio modelling programs QUARK and ROSETTA. Search models derived from either program collectively solve almost all of the all-helical targets in the test set. Initial solutions produced by Phaser after only 5 min perform surprisingly well, improving the prospects for in situ structure solution by AMPLE during synchrotron visits. Taken together, the results show the potential for AMPLE to run more quickly and successfully solve more targets than previously suspected.

  6. 基于CAN的城市客车ABS/ASR/ECB集中控制系统%ABS/ASR/ECB Integrated Control System Based on CAN for City Bus

    匡珑; 李刚炎; 胡剑

    2008-01-01

    在分析基于CAN的ABS(Anti-Lock Braking System,防抱死制动系统)、ASR(Anti-Slide Retractor,驱动防滑控制)和ECB(Eddy Current Brake,电涡流缓速器)集中控制系统CAN总线接口的基础上,实现了基于CAN的ABS、ASR和ECB集中控制.

  7. The Mechanochemical Cycle of Mammalian Kinesin-2 KIF3A/B under Load.

    Andreasson, Johan O L; Shastry, Shankar; Hancock, William O; Block, Steven M

    2015-05-01

    The response of motor proteins to external loads underlies their ability to work in teams and determines the net speed and directionality of cargo transport. The mammalian kinesin-2, KIF3A/B, is a heterotrimeric motor involved in intraflagellar transport and vesicle motility in neurons. Bidirectional cargo transport is known to result from the opposing activities of KIF3A/B and dynein bound to the same cargo, but the load-dependent properties of kinesin-2 are poorly understood. We used a feedback-controlled optical trap to probe the velocity, run length, and unbinding kinetics of mouse KIF3A/B under various loads and nucleotide conditions. The kinesin-2 motor velocity is less sensitive than kinesin-1 to external forces, but its processivity diminishes steeply with load, and the motor was observed occasionally to slip and reattach. Each motor domain was characterized by studying homodimeric constructs, and a global fit to the data resulted in a comprehensive pathway that quantifies the principal force-dependent kinetic transitions. The properties of the KIF3A/B heterodimer are intermediate between the two homodimers, and the distinct load-dependent behavior is attributable to the properties of the motor domains and not to the neck linkers or the coiled-coil stalk. We conclude that the force-dependent movement of KIF3A/B differs significantly from conventional kinesin-1. Against opposing dynein forces, KIF3A/B motors are predicted to rapidly unbind and rebind, resulting in qualitatively different transport behavior from kinesin-1. PMID:25866395

  8. Some effects of multiple injection moulding on selected properties of ABS

    M. Żenkiewicz

    2009-12-01

    Full Text Available Purpose: The purpose of this work was to investigate the influence of multiple (up to 10 times injection moulding of acrylonitrile butadiene styrene (ABS on some properties of the obtained moulded pieces.Design/methodology/approach: The investigated samples were obtained during the industrial injection moulding. There were determined the sample mechanical properties (by a tensile test, melt flow rate, temperatures of phase transitions (by differential scanning calorimetry, DSC, temperatures of thermal degradation (by thermogravimetric analysis, TGA, as well as storage modulus and damping coefficient (both by dynamic mechanical analysis, DMA.Findings: After the first injection mouldings, minor decreases (ca. 2.0 % in the tensile strength were observed. After the next injection mouldings, this quantity did not change much. The melt flow rate increased along with the number of injection mouldings. The glass transition temperatures (from DSC of butadiene and acrylonitrile styrene fractions don’t vary with the number of injection mouldings and are ca. 61 and +104ºC, respectively.Research limitations/implications: In order to confirm that degradation process occurs in ABS during injection mouldings, further investigation is necessary, mostly that on variations in the mean molecular weight of ABS.Practical implications: The studies carried out by now indicate that there are no arguments not to subject the ABS technological waste to the management by material recycling.Originality/value: It has been observed that the largest changes in the tensile strength and melt flow rate of ABS occur during its first injection moulding and a melt flow rate increases slightly with the number of injection mouldings. The temperatures of phase transitions and thermal as well as the storage modulus and damping coefficient of ABS do not essentially change after repeated injection mouldings.

  9. Biodistribution of charged F(ab')2 photoimmunoconjugates in a xenograft model of ovarian cancer.

    Duska, L R; Hamblin, M R; Bamberg, M P; Hasan, T

    1997-01-01

    The effect of charge modification of photoimmunoconjugates (PICs) on their biodistribution in a xenograft model of ovarian cancer was investigated. Chlorin(e6)c(e6) was attached site specifically to the F(ab')2 fragment of the murine monoclonal antibody OC125, directed against human ovarian cancer cells, via poly-1-lysine linkers carrying cationic or anionic charges. Preservation of immunoreactivity was checked by enzyme-linked immunosorbent assay (ELISA). PICs were radiolabelled with 125I and compared with non-specific rabbit IgG PICs after intraperitoneal (i.p.) injection into nude mice. Samples were taken from normal organs and tumour at 3 h and 24 h. Tumour to normal 125I ratios showed that the cationic OC125F(ab')2 PIC had the highest tumour selectivity. Ratios for c(e6) were uniformly higher than for 125I, indicating that c(e6) became separated from 125I. OC125F(ab')2 gave highest tissue values of 125I, followed by cationic OC125F(ab')2 PIC; other species were much lower. The amounts of c(e6) delivered per gram of tumour were much higher for cationic OC125F(ab')2 PIC than for other species. The results indicate that cationic charge stimulates the endocytosis and lysosomal degradation of the OC125F(ab')2-pl-c(e6) that has bound to the i.p. tumour. Positively charged PICs may have applications in the i.p. photoimmunotherapy of minimal residual ovarian cancer. PMID:9062404

  10. ORBITAL AND PHYSICAL PROPERTIES OF THE σ Ori Aa, Ab, B TRIPLE SYSTEM

    Simón-Díaz, S. [Instituto de Astrofísica de Canarias, E-38200 La Laguna, Tenerife (Spain); Caballero, J. A.; Apellániz, J. Maíz [Centro de Astrobiología (CSIC-INTA), ESAC Campus, P.O. Box 78, E-28691 Villanueva de la Cañada, Madrid (Spain); Lorenzo, J.; Negueruela, I.; Dorda, R.; Marco, A. [Departamento de Física, Ingeniería de Sistemas y Teoría de la Señal, Escuela Politécnica Superior, University of Alicante, Apdo. 99, E-03080 Alicante (Spain); Schneider, F. R. N. [Argelander-Institut für Astronomie der Universität Bonn, Auf dem Hügel 71, D-53121 Bonn (Germany); Barbá, R. H. [Departamento de Física, Universidad de La Serena, Benavente 980, La Serena (Chile); Montes, D. [Departamento Astrofísica, Facultad de Ciencias Físicas, Universidad Complutense de Madrid, E-28040 Madrid (Spain); Pellerin, A. [Department of Physics and Astronomy, State University of New York at Geneseo, 1 College Circle, Geneseo, NY 14454 (United States); Sanchez-Bermudez, J.; Sota, A. [Instituto de Astrofísica de Andalucía (CSIC), Glorieta de la Astronomía s/n, E-18008 Granada (Spain); Sódor, Á., E-mail: ssimon@iac.es [Konkoly Observatory, Research Centre for Astronomy and Earth Sciences, Hungarian Academy of Sciences, H-01121 Budapest (Hungary)

    2015-02-01

    We provide a complete characterization of the astrophysical properties of the σ Ori Aa, Ab, B hierarchical triple system and an improved set of orbital parameters for the highly eccentric σ Ori Aa, Ab spectroscopic binary. We compiled a spectroscopic data set comprising 90 high-resolution spectra covering a total time span of 1963 days. We applied the Lehman-Filhés method for a detailed orbital analysis of the radial velocity curves and performed a combined quantitative spectroscopic analysis of the σ Ori Aa, Ab, B system by means of the stellar atmosphere code FASTWIND. We used our own plus other available information on photometry and distance to the system for measuring the radii, luminosities, and spectroscopic masses of the three components. We also inferred evolutionary masses and stellar ages using the Bayesian code BONNSAI. The orbital analysis of the new radial velocity curves led to a very accurate orbital solution of the σ Ori Aa, Ab pair. We provided indirect arguments indicating that σ Ori B is a fast-rotating early B dwarf. The FASTWIND+BONNSAI analysis showed that the Aa, Ab pair contains the hottest and most massive components of the triple system while σ Ori B is a bit cooler and less massive. The derived stellar ages of the inner pair are intriguingly younger than the one widely accepted for the σ Orionis cluster, at 3 ± 1 Ma. The outcome of this study will be of key importance for a precise determination of the distance to the σ Orionis cluster, the interpretation of the strong X-ray emission detected for σ Ori Aa, Ab, B, and the investigation of the formation and evolution of multiple massive stellar systems and substellar objects.

  11. Modelling of nuclear glasses by classical and ab initio molecular dynamics; Modelisation de verres intervenant dans le conditionnement des dechets radioactifs par dynamiques moleculaires classique et ab initio

    Ganster, P

    2004-10-15

    A calcium aluminosilicate glass of molar composition 67 % SiO{sub 2} - 12 % Al{sub 2}O{sub 3} - 21 % CaO was modelled by classical and ab initio molecular dynamics. The size effect study in classical MD shows that the systems of 100 atoms are more ordered than the larger ones. These effects are mainly due to the 3-body terms in the empirical potentials. Nevertheless, these effects are small and the structures generated are in agreement with experimental data. In such kind of glass, we denote an aluminium avoidance and an excess of non bridging oxygens which can be compensated by tri coordinated oxygens. When the dynamics of systems of 100 and 200 atoms is followed by ab initio MD, some local arrangements occurs (bond length, angular distributions). Thus, more realistic vibrational properties are obtained in ab initio MD. The modelling of thin films shows that aluminium atoms extend to the most external part of the surface and they are all tri-coordinated. Calcium atoms are set in the sub layer part of the surface and they produce a depolymerization of the network. In classical MD, tri-coordinated aluminium atoms produce an important electric field above the surface. With non bridging oxygens, they constitute attractive sites for single water molecules. (author)

  12. Caracterización de las propiedades de mezclas de PC/ABS recicladas

    Hierso, Axel

    2006-01-01

    Doble titulació El objetivo de este PFC ha sido de estudiar la evolución de las propiedades de dos mezclas muy diferentes de PC/ABS. Una ha sido preparada en el CCP (Centro Catalán del plástico) denominada material A y la otra es una mezcla Bayblend PC/ABS FR 2000 producida por Bayer que se denomina material B en este estudio. Las letras FR significan "Flame Retardant" (retardante de llama). Estas mezclas han sido inyectadas cinco veces cada una. Después de cada ciclo de iny...

  13. Design of Zr-based AB2 type hydrogen storage alloys

    文明芬; 王秋萍; 王兴海; 翟玉春; 陈廉

    2003-01-01

    The influences of the ratio of the radius of atom A(rA)to radius of atom B(rB),electronegativity and electron number were discussed on the Laves phase formation and the characteristics of Zr-based AB2 type hydrogen storage alloy.An enthalpy model of Zr-based AB2 alloy was obtained from known data and twelve Zr-based alloys were designed to test the model.The results show that the predicted values are in good agreement with the experimental values.The model can be used for predicting enthalpy values of Zr-based hydrogen storage alloys and settles a foundation for experiments.

  14. Accurate evaluation of magnetic coupling between atoms with numerous open shells: An ab initio method

    Gellé, A.; Varignon, J.; Lepetit, M.-B.

    2009-11-01

    We propose a new ab initio method designed for the accurate calculation of effective exchange integrals between atoms with numerous open shells. This method applies to ferromagnetic as well as antiferromagnetic exchange, direct or ligand-mediated exchange. Test calculations on high spin transition metal oxides such as KNiF3, Ba2CoS3 or YMnO3 exhibit a very good accuracy compared either to the best ab initio calculations —when those are feasible— and with experimental evaluations.

  15. The Religious And Political Attitude Of Abû Hanîfa

    DOĞAN, İsa

    2006-01-01

    The relapsing of the tribal manners after the Prophet’s death prevented that political system supported with scientific criterions. This situation caused of the chaos to be lived in Islamic society. Abû Hanîfa even was one of the men suffering annoyances of wrong politics. Racist Umayyad didn’t act with fairness towards Mavali new rightly guided in social, economic, and religious subjects. This situation caused Abû Hanîfa to be directed towards defensing the political and the legal rights of...

  16. A novel variant in CMAH is associated with blood type AB in Ragdoll cats

    Barbara Gandolfi; Grahn, Robert A.; Gustafson, Nicholas A.; Daniela Proverbio; Eva Spada; Badri Adhikari; Janling Cheng; Gordon Andrews; Lyons, Leslie A.; Helps, Chris R.

    2016-01-01

    The enzyme cytidine monophospho-N-acetylneuraminic acid hydroxylase is associated with the production of sialic acids on cat red blood cells. The cat has one major blood group with three serotypes; the most common blood type A being dominant to type B. A third rare blood type is known as AB and has an unclear mode of inheritance. Cat blood type antigens are defined, with N-glycolylneuraminic acid being associated with type A and N-acetylneuraminic acid with type B. Blood type AB is serologica...

  17. Die Begrenzung von qualifizierten Beteiligungen nach § 12 Abs. 1 KWG

    Senger, Michael

    2003-01-01

    Die Begrenzung der Beteiligungen von Einlagenkreditinstituten an Unternehmen außerhalb des Finanzsektors nach § 12 Abs. 1 KWG ist mit der Einführung des Begriffs der qualifizierten Beteiligung (§ 1 Abs. 15 KWG) durch das Vierte Finanzmarktförderungsgesetz1 neu geregelt worden, nachdem § 12 KWG bereits zuvor im Rahmen der 6. KWG-Novelle2 gänzlich umgestaltet wurde3. Bislang knüpfte die bankaufsichtsrechtliche Reglementierung von Unternehmensbeteiligungen an den Begriff der bedeutenden Beteilig...

  18. Post-exilic conflict as “possible” historical background to Psalm 69:10ab

    Alphonso Groenewald

    2005-01-01

    As is the case with Psalm 8a, Psalm 69:10a, also commences with the emphatic particle kî. 10a and 10b are syndetically bound together by means of the conjunction “and”. What has already been stated in cola 8ab, is repeated and even expressed in clearer terms in these cola (10ab). The supplicant does not believe that he deserves his present distress. Actually, the distress and insult he is enduring come as a direct result of his devotion to God and God’s service. Even his fasting and mourning ...

  19. Attenuation coefficient determination of printed ABS and PLA samples in diagnostic radiology standard beams

    Veneziani, G. R.; Corrêa, E. L.; Potiens, M. P. A.; Campos, L. L.

    2016-07-01

    IAEA code of practice TRS-457 states that standard phantoms should offer the same primary attenuation and scatter production as relevant body section of a representative patient. Material cost, availability and dimensional stability must also be considered. The goal of this study is to determine the attenuation coefficient of printed ABS and PLA samples in standard X-ray beams, verifying if phantoms printed with these materials could be an easier-handle substitute for PMMA, enabling the creation of different designs in an easier and cheaper way. Results show that PMMA presents higher attenuation coefficient, followed by PLA and ABS, which means that thinner PMMA layer creates higher radiation attenuation.

  20. Hydrogen adsorption in ZIF-7: A DFT and ab-initio molecular dynamics study

    Dixit, Mudit; Major, Dan Thomas; Pal, Sourav

    2016-05-01

    Primary H2 adsorption sites in a zeolitic imidazolate framework, ZIF-7, are identified using ab-initio density functional theory (DFT) based molecular dynamics annealing simulations. The simulations suggest several low energy adsorption sites. The effect of light transition metal decoration on hydrogen storage properties was studied. Our ab-intio DFT calculations illustrate that decorating the ZIF with Sc increases both the number of H2 molecules, as well as the H2 binding energy. The binding energy (∼25 kJ/mol per H2) at 8H2 loading in the pore, suggests that Sc-ZIFs can be potential candidates for hydrogen storage.

  1. AB Nordea Bank Finland Plc Lietuvos skyriaus darbdavio vidinio įvaizdžio stiprinimas

    Stundytė, Inga

    2009-01-01

    Ši tema pasirinkta siekiant išanalizuoti Nordea banko esamą darbdavio įvaizdį, bei išaiškinti darbuotojų pasitenkinimo juo lygį. Nagrinėti darbdavio įvaizdį svarbu dėl to, kad egzistuoja ryšis tarp pasitenkinimo darbdaviu bei įsipareigojimo organizacijai. Darbo tikslas: Parengti rekomendacijas AB Nordea Bank Finland Plc Lietuvos skyriaus vidinio darbdavio įvaizdžio stiprinimui. Darbo uždaviniai: Nustatyti veiksnius, neigiamai įtakojančius AB Nordea Bank Finland Plc Lietuvos skyriaus ...

  2. Ab initio calculations versus polarized neutron diffraction for the spin density of free radicals

    The determination of the magnetization distribution using polarized neutron diffraction has played a key role during the last twenty years in the field of molecular magnetism. This distribution can also be obtained by first principle ab initio calculations. Such calculations always rely on approximations and the question that arises is to know whether the obtained results are reliable enough to represent accurately the properties of these molecules. The comparison between polarized neutron experimental results and ab initio calculations has turned to provide stringent tests for these methods. In the resent article a comparison between experimental and theoretical results is made and is illustrated by examples based on magnetic free radicals. (author)

  3. Regulation of expression of the Lactobacillus pentosus XylAB operon

    Lokman, B. C.; Heerikhuisen, M.; Leer, R J; Broek, van den, W.; Borsboom, Y.; Chaillou, S; Postma, P W; Pouwels, P H

    1997-01-01

    The xylose cluster of Lactobacillus pentosus consists of five genes, two of which, xylAB, form an operon and code for the enzymes involved in the catabolism of xylose, while a third encodes a regulatory protein, XylR. By introduction of a multicopy plasmid carrying the xyl operator and by disruption of the chromosomal xylR gene, it was shown that L. pentosus xylR encodes a repressor. Constitutive expression of xylAB in the xylR mutant is repressed by glucose, indicating that glucose repressio...

  4. Study on Rheological Behavior of PET/ABS/SMA Blends%PET/ABS/SMA共混物流变性能的研究

    张少峰; 李迎春; 郭晓晨; 郑佳星; 王超

    2011-01-01

    Polyester terephthalate ( PET)/acrylonitrile butadiene styrene(ABS) blends were compatibi-lized with styrene-maleic anhydride copolymer (SMA) as a compatibilizer, the rheological behavior was measured by means of melt flow rate testing machine and XLY- II capillary rheometer. The cures of lgyw~ lgrw, lgya ~ lgyw, lgηa ~ 1/T were obtained. The results of the experiments showed that PET/ABS/SMA blends were pseudo plastic fluids in the range of 260 ~266 ℃. And the shear stress of 2. 45 × 10 4 ~7. 35 × 10 4 Pa. Adding SMA in blends caused the non-Newtonian decreasing and the flow activation energy of PET increased remarkably, but too much SMA would make the flow activation energy decreased. With the increases of SMA content, the viscosity of the melts first increased and then decreased, and it reached the maximum value when the SMA content was 5% (wt).%以苯乙烯接枝马来酸酐共聚物(SMA)为增容剂对聚对苯二甲酸乙二醇酯(PET)/丙烯腈-丁二烯-苯乙烯(ABS)共混物进行研究;采用熔体质量流动速率试验机和毛细管流变仪研究了PET/ABS/SMA共混物的流变行为,并对其lgγw~lgτw、lgηa~lgγw、lgηa~ 1/T曲线进行了分析.结果表明:在260 ~ 266℃及剪切应力为24.5~73.5 MPa时,PET/ABS/SMA共混物均为假塑性流体;增容剂SMA的加入明显地降低了共混物的非牛顿指数(n),并且使PET的黏流活化能(△E)较大幅度的升高,但过量的SMA会使AE下降.随着SMA的增加,共混物的黏度先增加后减小,SMA用量达到5%时,达到最大值.

  5. Ab-initio modeling of an anion $C_{60}^-$ pseudopotential for fullerene-based compounds

    Vrubel, I I; Ivanov, V K

    2015-01-01

    A pseudopotential of $C_{60}^-$ has been constructed from ab-initio quantum-mechanical calculations. Since the obtained pseudopotential can be easily fitted by rather simple analytical approximation it can be effectively used both in classical and quantum molecular dynamics of fullerene-based compounds.

  6. Ab initio Calculations of Charge Symmetry Breaking in the A=4 Hypernuclei

    Gazda, Daniel; Gal, A.

    2016-01-01

    Roč. 116, č. 12 (2016), s. 122501. ISSN 0031-9007 R&D Projects: GA ČR(CZ) GA15-04301S Institutional support: RVO:61389005 Keywords : ab initio * shell model * four-body calculations Subject RIV: BE - Theoretical Physics Impact factor: 7.512, year: 2014

  7. THE AB INITIO CALCULATION FOR THE BONDING STATE OF THE Hn CTUSTERS

    Liang-moMei; GuanPeng; 等

    1990-01-01

    The equilibrium geometries of several Hn(n=4,5,6,7,9,13) clsters with certain symmetry have been optimized by the ab inito Murtaug-Sargent(MS) method.We find that the stability of a centered cluster depends on the structure,the spin symmetry and the coordinate number,and the latter plays a more important role.

  8. All-electron ab initio investigations of the electronic states of the NiC molecule

    Shim, Irene; Gingerich, Karl. A.

    The low-lying electronic states of NiC are investigated by all-electron ab initio multi-configuration self-consistent-field (CASSCF) calculations including relativistic corrections. The electronic structure of NiC is interpreted as perturbed antiferromagnetic couplings of the localized angular...

  9. Ab initio charge-carrier mobility model for amorphous molecular semiconductors

    Massé, Andrea; Friederich, Pascal; Symalla, Franz; Liu, Feilong; Nitsche, Robert; Coehoorn, Reinder; Wenzel, Wolfgang; Bobbert, Peter A.

    2016-05-01

    Accurate charge-carrier mobility models of amorphous organic molecular semiconductors are essential to describe the electrical properties of devices based on these materials. The disordered nature of these semiconductors leads to percolative charge transport with a large characteristic length scale, posing a challenge to the development of such models from ab initio simulations. Here, we develop an ab initio mobility model using a four-step procedure. First, the amorphous morphology together with its energy disorder and intermolecular charge-transfer integrals are obtained from ab initio simulations in a small box. Next, the ab initio information is used to set up a stochastic model for the morphology and transfer integrals. This stochastic model is then employed to generate a large simulation box with modeled morphology and transfer integrals, which can fully capture the percolative charge transport. Finally, the charge-carrier mobility in this simulation box is calculated by solving a master equation, yielding a mobility function depending on temperature, carrier concentration, and electric field. We demonstrate the procedure for hole transport in two important molecular semiconductors, α -NPD and TCTA. In contrast to a previous study, we conclude that spatial correlations in the energy disorder are unimportant for α -NPD. We apply our mobility model to two types of hole-only α -NPD devices and find that the experimental temperature-dependent current density-voltage characteristics of all devices can be well described by only slightly decreasing the simulated energy disorder strength.

  10. Improvements to a five-phase ABS algorithm for experimental validation

    Gerard, Mathieu; Pasillas-Lépine, William; de Vries, Edwin; Verhaegen, Michel

    2012-10-01

    The anti-lock braking system (ABS) is the most important active safety system for passenger cars. Unfortunately, the literature is not really precise about its description, stability and performance. This research improves a five-phase hybrid ABS control algorithm based on wheel deceleration [W. Pasillas-Lépine, Hybrid modeling and limit cycle analysis for a class of five-phase anti-lock brake algorithms, Veh. Syst. Dyn. 44 (2006), pp. 173-188] and validates it on a tyre-in-the-loop laboratory facility. Five relevant effects are modelled so that the simulation matches the reality: oscillations in measurements, wheel acceleration reconstruction, brake pressure dynamics, brake efficiency changes and tyre relaxation. The time delays in measurement and actuation have been identified as the main difficulty for the initial algorithm to work in practice. Three methods are proposed in order to deal with these delays. It is verified that the ABS limit cycles encircle the optimal braking point, without assuming any tyre parameter being a priori known. The ABS algorithm is compared with the commercial algorithm developed by Bosch.

  11. Optical Spectroscopy of the Bulk and Interfacial Hydrated Electron from Ab Initio Calculations

    Uhlig, Frank; Herbert, J. M.; Coons, M. P.; Jungwirth, Pavel

    2014-01-01

    Roč. 118, č. 35 (2014), s. 7507-7515. ISSN 1089-5639 R&D Projects: GA ČR GBP208/12/G016 Institutional support: RVO:61388963 Keywords : hydrated electron * optical spectrum * ab initio molecular dynamics Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.693, year: 2014

  12. Labelling of MoAb with 153SmH1ETA: Preliminary results

    A method to label MoAb with Sm-153 using 1,5,9,13-tetraazacyclohexadecane N,N',N'',N''' tetraacetic acid (H4ETA) as a bifunctional chelator was developed. H4ETA and SmH1ETA were synthesized in our laboratory and characterized by IR spectroscopy, TGA (thermogravimetric analysis), SEM (Scattering Electronic Microscopy), EDAX (Elemental Dispersion Analysis by X-rays) and EPR (Electron Paramagnetic Resonance) at 6 K. The 153SmH1ETAMoAb was prepared by a simple incubation of the MoAb ior cea1, and the 153SmH1ETA complex at neutral pH and at room temperature for 24 h. The specific activity of the labelled antibody was 111 MBq/mg (3 mCi/mg). Sm-153(III) is commercially available with specific activities up to 318.2 GBq/mg. Therefore, under the conditions described above 153SmH1ETA labelled MoAb could be obtained with specific activity up to 1.14 GBq/mg (30.7 mCi/mg). (author)

  13. Accurate radio and optical positions for the radio star HD 36705 (AB Doradus)

    White, Graeme L.; Jauncey, David L.; Batty, Michael J.; Peters, W. L.; Gulkis, S.

    1988-01-01

    Arc-second position measurements of the active star HD 36705 (AB Dor) and of the variable radio source found nearby are presented. These measurements show that the radio source is clearly identified with HD 36705 and not with the nearby red-dwarf star Rst 137B.

  14. Mechanical properties of carbynes investigated by ab initio total-energy calculations

    Castelli, Ivano E.; Salvestrini, Paolo; Manini, Nicola

    2012-01-01

    As sp carbon chains (carbynes) are relatively rigid molecular objects, can we exploit them as construction elements in nanomechanics? To answer this question, we investigate their remarkable mechanical properties by ab initio total-energy simulations. In particular, we evaluate their linear...

  15. Variability in the cadherin gene in an Ostrinia nubilalis strain selected for Cry1Ab resistance.

    Bel, Yolanda; Siqueira, Herbert A A; Siegfried, Blair D; Ferré, Juan; Escriche, Baltasar

    2009-03-01

    Transgenic corn expressing Cry1Ab (a Bacillus thuringiensis toxin) is highly effective in the control of Ostrinia nubilalis. For its toxic action, Cry1Ab has to bind to specific insect midgut proteins. To date, in three Lepidoptera species resistance to a Cry1A toxin has been conferred by mutations in cadherin, a protein of the Lepidoptera midgut membrane. The implication of cadherin in the resistance of an Ostrinia nubilalis colony (Europe-R) selected with Bacillus thuringiensis Cry1Ab protoxin was investigated. Several major mutations in the cadherin (cdh) gene were found, which introduced premature termination codons and/or large deletions (ranging from 1383 to 1701bp). The contribution of these major mutations to the resistance was analyzed in resistant individuals that survived exposure to a high concentration of Cry1Ab protoxin. The results indicated that the presence of major mutations was drastically reduced in individuals that survived exposure. Previous inheritance experiments with the Europe-R strain indicated the involvement of more than one genetic locus and reduced amounts of the cadherin receptor. The results of the present work support a polygenic inheritance of resistance in the Europe-R strain, in which mutations in the cdh gene would contribute to resistance by means of an additive effect. PMID:19114103

  16. Possible Future Monoclonal Antibody (mAb-Based Therapy against Arbovirus Infections

    Giuseppe Sautto

    2013-01-01

    Full Text Available More than 150 arboviruses belonging to different families are known to infect humans, causing endemic infections as well as epidemic outbreaks. Effective vaccines to limit the occurrence of some of these infections have been licensed, while for the others several new immunogens are under development mostly for their improvements concerning safety and effectiveness profiles. On the other hand, specific and effective antiviral drugs are not yet available, posing an urgent medical need in particular for emergency cases. Neutralizing monoclonal antibodies (mAbs have been demonstrated to be effective in the treatment of several infectious diseases as well as in preliminary in vitro and in vivo models of arbovirus-related infections. Given their specific antiviral activity as well-tolerated molecules with limited side effects, mAbs could represent a new therapeutic approach for the development of an effective treatment, as well as useful tools in the study of the host-virus interplay and in the development of more effective immunogens. However, before their use as candidate therapeutics, possible hurdles (e.g., Ab-dependent enhancement of infection, occurrence of viral escape variants must be carefully evaluated. In this review are described the main arboviruses infecting humans and candidate mAbs to be possibly used in a future passive immunotherapy.

  17. Method for the separation of high impact polystyrene (HIPS) and acrylonitrile butadiene styrene (ABS) plastics

    Jody, Bassam J.; Arman, Bayram; Karvelas, Dimitrios E.; Pomykala, Jr., Joseph A.; Daniels, Edward J.

    1997-01-01

    An improved method is provided for separating acrylonitrile butadiene styrene (ABS) and high impact polystyrene (HIPS) plastics from each other. The ABS and HIPS plastics are shredded to provide a selected particle size. The shredded particles of the ABS and HIPS plastics are applied to a solution having a solution density in a predefined range between 1.055 gm/cm.sup.3 and 1.07 gm/cm.sup.3, a predefined surface tension in a range between 22 dynes/cm to 40 dynes/cm and a pH in the range of 1.77 and 2.05. In accordance with a feature of the invention, the novel method is provided for separating ABS and HIPS, two solid thermoplastics which have similar densities by selectively modifying the effective density of the HIPS using a binary solution with the appropriate properties, such as pH, density and surface tension, such as a solution of acetic acid and water or a quaternary solution having the appropriate density, surface tension, and pH.

  18. Ab initio calculation of the lifetimes of 4p and 3d levels of Ca+

    We have done an ab initio calculation based on the Brueckner approximation for the lifetimes of 4p2P and 3d2D levels of Ca+. The results of the Brueckner approximation differ from experiment by 2.5%. With leading third-order corrections included, our results agree with the latest accurate experiment within a 1% difference

  19. Atomic carbon chains as spin-transmitters: An ab initio transport study

    Fürst, Joachim Alexander; Brandbyge, Mads; Jauho, Antti-Pekka

    2010-01-01

    An atomic carbon chain joining two graphene flakes was recently realized in a ground-breaking experiment by Jin et al. (Phys. Rev. Lett., 102 (2009) 205501). We present ab initio results for the electron transport properties of such chains and demonstrate complete spin-polarization of the transmi...

  20. Electronic transport properties of fullerene functionalized carbon nanotubes: Ab initio and tight-binding calculations

    Fürst, Joachim Alexander; Hashemi, J.; Markussen, Troels;

    2009-01-01

    Fullerene functionalized carbon nanotubes-NanoBuds-form a novel class of hybrid carbon materials, which possesses many advantageous properties as compared to the pristine components. Here, we report a theoretical study of the electronic transport properties of these compounds. We use both ab init...

  1. Ab initio and work function and surface energy anisotropy of LaB6

    Uijttewaal, M. A.; de Wijs, G. A.; de Groot, R. A.

    2006-01-01

    Lanthanum hexaboride is one of the cathode materials most used in high-power electronics technology, but the many experimental results do not provide a consistent picture of the surface properties. Therefore, we report the first ab initio calculations of the work functions and surface energies of th

  2. Ab initio study of long-period superstructures in close-packed A3B compounds

    Rosengaard, N. M.; Skriver, Hans Lomholt

    1994-01-01

    We have performed ab initio calculations of the stability of one-dimensional long-period superstructures in Cu3Pd, Cu3Al, and Ag3Mg by means of an interface Green's function technique based on the linear-muffin-tin-orbitals method within the tight-binding and atomic-sphere approximations. The...

  3. Mechanisms for catalytic carbon nanofiber growth studied by ab initio density functional theory calculations

    Abild-Pedersen, Frank; Nørskov, Jens Kehlet; Rostrup-Nielsen, Jens;

    2006-01-01

    Mechanisms and energetics of graphene growth catalyzed by nickel nanoclusters were studied using ab initio density functional theory calculations. It is demonstrated that nickel step-edge sites act as the preferential growth centers for graphene layers on the nickel surface. Carbon is transported...

  4. Investigation of the Hydroxylation Mechanism of Noncoupled Copper Oxygenases by Ab Initio Molecular Dynamics Simulations

    Meliá, C.; Ferrer, S.; Řezáč, Jan; Parisel, O.; Reinaud, O.; Moliner, V.; de la Lande, A.

    2013-01-01

    Roč. 19, č. 51 (2013), s. 17328-17337. ISSN 0947-6539 Institutional support: RVO:61388963 Keywords : ab initio calculations * copper * electron transfer * enzymes * molecular dynamics * reaction mechanisms Subject RIV: CC - Organic Chemistry Impact factor: 5.696, year: 2013

  5. Ab initio molecular dynamics approach to a quantitative description of ion pairing in water

    Pluhařová, Eva; Maršálek, Ondřej; Schmidt, B.; Jungwirth, Pavel

    2013-01-01

    Roč. 4, č. 23 (2013), s. 4177-4181. ISSN 1948-7185 R&D Projects: GA ČR GBP208/12/G016 Institutional support: RVO:61388963 Keywords : ion pairing * charge transfer * water * ab initio molecular dynamics Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.687, year: 2013

  6. Stabilization of Ab Initio Molecular Dynamics Simulations at Large Time Steps

    Tsuchida, Eiji

    2014-01-01

    The Verlet method is still widely used to integrate the equations of motion in ab initio molecular dynamics simulations. We show that the stability limit of the Verlet method may be significantly increased by setting an upper limit on the kinetic energy of each atom with only a small loss in accuracy. The validity of this approach is demonstrated for molten lithium fluoride.

  7. Ab initio Defect Energetics in LaBO3 Perovskite Solid Oxide Fuel Cell Materials

    Lee, Yueh-Lin; Morgan, Dane; Kleis, Jesper;

    2009-01-01

    Perovskite materials of the form ABO3 are a promising family of compounds for use in solid oxide fuel cell (SOFC) cathodes. Study of the physics of these compounds under SOFC conditions with ab initio methods is particularly challenging due to high temperatures, exchange of oxygen with O2 gas, and...

  8. Ductility improvement of Mg alloys by solid solution: Ab initio modeling, synthesis and mechanical properties

    Sandlöbes, S.; Pei, Z.; Friák, Martin; Zhu, L.-F.; Wang, F.; Zaefferer, S.; Raabe, D.; Neugebauer, J.

    2014-01-01

    Roč. 70, MAY (2014), s. 92-104. ISSN 1359-6454 Grant ostatní: GA MŠk(CZ) LM2010005 Institutional support: RVO:68081723 Keywords : Magnesium * Rare-earth elements * Ductility * Modeling * Ab initio Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 4.465, year: 2014

  9. Ab initio I-V characteristics of short C-20 chains

    Roland, C.; Larade, B.; Taylor, Jeremy Philip;

    2002-01-01

    We have calculated the I-V characteristics of short chains of C-20 molecular cages between Al and Au leads with an ab initio formalism. The results indicate that a linear chain of such molecules acts primarily as metallic nanowires. The transmission, however, depends sensitively both on the...

  10. Ab initio electronic properties of dual phosphorus monolayers in silicon

    Drumm, Daniel W.; Per, Manolo C.; Budi, Akin;

    2014-01-01

    In the midst of the epitaxial circuitry revolution in silicon technology, we look ahead to the next paradigm shift: effective use of the third dimension - in particular, its combination with epitaxial technology. We perform ab initio calculations of atomically thin epitaxial bilayers in silicon, ...

  11. Raman and ab initio studies of simple and binary 1-alkyl-3-methylimidazolium ionic liquids

    Berg, R.W.; Deetlefs, M.; Seddon, K.R.;

    2005-01-01

    Raman spectra of the ionic liquids, 1-butyl-3-methylimidazolium hexafluorophosphate ([C(4)mim][PF6]), 1-hexyl-3-methylimidazolium chloride ([C(6)mim]Cl), and 1-hexyl-3-methylimidazolium hexafluorophosphate ([C(6)mim][PF6]), and binary mixtures thereof, have been assigned using ab initio MP2...

  12. Computationally efficient and quantitatively accurate multiscale simulation of solid-solution strengthening by ab initio calculation

    Ma, D.; Friák, Martin; von Pezold, J.; Raabe, D.; Neugebauer, J.

    2015-01-01

    Roč. 85, FEB (2015), s. 53-66. ISSN 1359-6454 Institutional support: RVO:68081723 Keywords : Solid-solution strengthening * DFT * Peierls–Nabarro model * Ab initio * Al alloy s Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 4.465, year: 2014

  13. Ab initio Nuclear structure Theory with chiral two- plus three-nucleon interactions

    Low-energy nuclear theory has entered an era of ab initio nuclear structure and reaction calculations based on input from QCD. One of the most promising paths from QCD to nuclear observables employs Hamiltonians constructed within chiral effective field theory as consistent starting point for precise ab initio nuclear structure and reaction studies. However, the full inclusion of chiral two- plus three-nucleon (NN+3N) interactions in exact and approximate many-body calculations still poses a formidable challenge. We discuss recent developments towards this goal, ranging from consistent Similarity Renormalization Group evolutions of NN+3N Hamiltonians to large-scale ab initio calculations for ground states and spectra in the Importance-Truncated No-Core Shell Model with full 3N interactions. We highlight recent achievements and discuss open issues and future perspectives for nuclear structure theory with QCD-based interactions. Moreover, we discuss successful steps towards merging ab initio structure and reaction theory and show applications to low-energy reactions in the p-shell relevant for astrophysics.

  14. Ultra Low Voltage Class AB Switched Current Memory Cells Based on Floating Gate Transistors

    Mucha, Igor

    1999-01-01

    A proposal for a class AB switched current memory cell, suitable for ultra-low-voltage applications is presented. The proposal employs transistors with floating gates, allowing to build analog building blocks for ultralow supply voltage operation also in CMOS processes with high threshold voltages...

  15. Conformational Sampling by Ab Initio Molecular Dynamics Simulations Improves NMR Chemical Shift Predictions

    Dračínský, Martin; Möller, H. M.; Exner, T. E.

    2013-01-01

    Roč. 9, č. 8 (2013), s. 3806-3815. ISSN 1549-9618 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : ab initio molecular dynamics * NMR spectroscopy * DFT calculations * hydration Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 5.310, year: 2013

  16. Ab Initio Calculations of Deuterium Isotope Effects on Chemical Shifts of Salt-Bridged Lysines

    Ullah, Saif; Ishimoto, Takayoshi; Williamson, Mike P.;

    2011-01-01

    Deuterium isotope effects measure the change in chemical shift on substitution of a proton by deuterium. They have been calculated by direct treatment of the H/D nuclear quantum effect using a multicomponent ab initio molecular orbital method based on a non-Born−Oppenheimer approximation. This me...

  17. Isotopic composition of trace elements in presolar silicon carbide A+B grains

    Savina, M.; Tripa, C.; Pellin, M.; Davis, A.; Clayton, R.; Lewis, R.; Amari, S.

    2003-04-01

    Presolar SiC are classified into several types based on C, N, and Si isotopic compositions. Most are mainstream, which are generally believed to derive from low-mass asymptotic giant branch (AGB) stars. Among the less common grains, A+B grains, which comprise ˜3-4% of presolar SiC, are perhaps the least well understood. Recent measurements of trace element concentration patterns in individual grains suggest that A+B grains can be divided into at least 4 groups, and thus have multiple astrophysical sites of origin^1. We report here our Resonant Ionization Mass Spectrometry (RIMS) measurements of Zr, Mo, Ba, and Fe isotopic compositions in individual mainstream and type A+B presolar SiC. While the mainstream grains show isotopic compositions compatible with condensation around low-mass AGB stars, most A+B grains have near-solar isotopic compositions, though some show Zr, Mo, and Fe isotope patterns that have not been observed in other types of presolar SiC grains. We discuss these results in terms of possible astrophysical sites for the production of these unusual grains. This work was supported in part by the Department of Energy, BES-Materials Sciences through Contract No. W-31-109-ENG-38. ^1 Amari S., Nittler L. R., Zinner E., Lodders K., and Lewis R. S. (2001) Astrophys. J. 559, 463-483.

  18. Study on the surface hydroxyl group on solid breeding materials by ab-initio calculations

    Tanaka, Satoru; Taniguchi, Masaki [Tokyo Univ. (Japan). Faculty of Engineering

    1996-10-01

    The nature of -OH on the surface of Li{sub 2}O was analyzed with the ab-initio quantum chemical calculation technique. Calculation results showed that the stretching vibration of O-H is affected by the chemical species around the -OH. (author)

  19. Ab Initio Studies of Chlorine Oxide and Nitrogen Oxide Species of Interest in Stratospheric Chemistry

    Lee, Timothy J.; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    The ability of modern state-of-the art ab initio quantum chemical techniques to characterize reliably the gas-phase molecular structure, vibrational spectrum, electronic spectrum, and thermal stability of chlorine oxide and nitrogen oxide species will be demonstrated by presentation of some example studies. In particular the geometrical structures, vibrational spectra, and heats of formation Of ClNO2, CisClONO, and trans-ClONO are shown to be in excellent agreement with the available experimental data, and where the experimental data are either not known or are inconclusive, the ab initio results are shown to fill in the gaps and to resolve the experimental controversy. In addition, ab initio studies in which the electronic spectra and the characterization of excited electronic states of ClONO2, HONO2, ClOOC17 ClOOH, and HOOH will also be presented. Again where available, the ab initio results are compared to experimental observations, and are used to aid in the interpretation of the experimental studies.

  20. Environment-friendly Pd free surface activation technics for ABS surface

    Shu, Zengnian; Wang, Xu

    2012-05-01

    An environment-friendly surface etching and activation technics for acrylonitrile-butadiene-styrene (ABS) surface metallization were investigated as a replacement for conventional chromic acid etching bath and palladium catalyst. After etching by H2SO4-MnO2 colloid, the ABS surfaces became roughness; meanwhile the carboxyl and hydroxyl groups were formed on the surface. With absorption and a reduction by a dimethylamineborane solution, copper particles were deposited on the ABS surface, which serves as a catalyst replacement for SnCl2/PdCl2 colloid. The effects of CuSO4 concentration, (CH3)2NHBH3 concentration, reduction temperature and reduction time on the adhesion strength between the ABS surface and the electroless copper film were investigated. And the average adhesion strengths reached 1.31 kN m-1, which is near the values (1.19 kN m-1) obtained by SnCl2/PdCl2 colloid.

  1. Living with an imperfect cell wall : compensation of femAB inactivation in Staphylococcus aureus

    Hübscher, Judith; Jansen, Andrea; Kotte, Oliver; Schäfer, Juliane; Majcherczyk, Paul A.; Harris, Llinos G.; Bierbaum, Gabriele; Heinemann, Matthias; Berger-Bächi, Brigitte

    2007-01-01

    Background: Synthesis of the Staphylococcus aureus peptidoglycan pentaglycine interpeptide bridge is catalyzed by the nonribosomal peptidyl transferases FemX, FemA and FemB. Inactivation of the femAB operon reduces the interpeptide to a monoglycine, leading to a poorly crosslinked peptidoglycan. fem

  2. Ab initio ground state phenylacetylene-argon intermolecular potential energy surface and rovibrational spectrum

    Cybulski, Hubert; Fernandez, Berta; Henriksen, Christian; Felker, Peter M.

    2012-01-01

    We evaluate the phenylacetylene-argon intermolecular potential energy surface by fitting a representative number of ab initio interaction energies to an analytic function. These energies are calculated at a grid of intermolecular geometries, using the CCSD(T) method and the aug-cc-pVDZ basis set...

  3. Preparative Purification and Bioassay of Bt Toxin from Cry1Ab Transgenic Rice

    WU Jian-min; YE Qin-fu

    2004-01-01

    A method of extracting and purifying Cry1Ab protein(Bt toxin) from Cry1Ab transgenic rice was established. Most of the Bt toxin present in the tissue of Cry1Ab transgenic rice was extracted effectively with a solution of 50 mmol/LNa2CO3 and NaHCO3. The crude protein containing Bt toxin was obtained after the pretreatment of Cry1Ab transgenic rice with ultra-filtration, ammonium sulfate precipitation and centrifugation. The dialysed crude protein was futher separated on DEAE Sephadex A-50 columns and Sephadex G-150 columns. The protein bound on DEAE Sephadex A-50 gel was eluted with buffer solution B(10 mmol/L trisHCl buffer+1. 0 mmol/L EDTA, pH=8.0) mixed with 0. 1, 0. 3, 0. 5 and 0. 8 mol/L NaCl in a discontinuous gradient elution mode. The peak of the Bt toxin eluted from the columns was identified by ELISA and bioassayed with larvae of tobacco hornworms and silkworms. The purity and the bioactivity of the Bt toxin were determined by means of SDS-PAGE and larvicidal assay, respectively. The purity of the Bt toxin obtained by this method is high, and its insecticidal activity is retained after the toxin is purified.

  4. USA püüab vältida halba mainet araabia riikides / Neeme Raud

    Raud, Neeme, 1969-

    2001-01-01

    Samal ajal kui G. W. Bushi administratsioon püüab Washingtonis sõlmida uusi sidemeid araabia riikidega, otsustas New Yorgi linnapea Rudolf Giuliani mitte vastu võtta Saudi Araabia printsi Alwaleed bin Talali abitshekki 10 milj. dollarile

  5. Prevalence and Regional Distribution of Autoantibodies Against GAD65Ab in a European Population Without Diabetes

    Rolandsson, Olov; Hampe, Christiane S; Wennberg, Patrik; Radtke, Jared; Langenberg, Claudia; Wareham, Nicholas

    2015-01-01

    Geographical differences in type 1 diabetes (T1D) prevalence in Europe have been well documented, but little is known about the geographical distribution of autoantibodies specific to GAD65 (GAD65Ab) in the general population without diabetes, which is reported to range between 0.4 and 3%. However......, these studies used different methods to define GAD65Ab positivity with cutoff values based on the 97–99th centile or at +3 SD above the mean among healthy individuals without T1D or type 2 diabetes (T2D). In doing so, the prevalence of GAD65Ab among the study cohorts was, by definition, 1–3%. The...... European countries and 2) compare characteristics of age, sex, and BMI in relation to GAD65Ab positivity. A center-stratified random subcohort of 16,835 (4.9%) individuals was selected from the original European Prospective Investigation into Cancer and Nutrition (EPIC)-InterAct study (1). After exclusion...

  6. Hexamethylcyclopentadiene: time-resolved photoelectron spectroscopy and ab initio multiple spawning simulations

    Wolf, T. J. A.; Kuhlman, Thomas Scheby; Schalk, O.;

    2014-01-01

    comparing time-resolved photoelectron spectroscopy (TRPES) with ab initio multiple spawning (AIMS) simulations on the MS-MR-CASPT2 level of theory. We disentangle the relationship between two phenomena that dominate the immediate molecular response upon light absorption: a spectrally dependent delay of the...

  7. Predicting materials for solar energy conversion: ab-initio spectroscopy of heterogeneous interfaces

    Galli, Giulia

    We will discuss some progress in predicting materials for solar energy conversion using ab initio calculations, in particular we will focus on heterogeneous interfaces between photo-electrodes and water and between nanocomposites. We will also address the problem of building much needed tighter connections between computational and laboratory experiments.

  8. Ab Initio Investigations of the C2F4S Isomers and of Their Interconversions

    Shim, Irene; Vallano-Lorenzo, Sandra; Lisbona-Martin, Pilar;

    2003-01-01

    The transition states and the activation energies for the unobserved isomerization reactions between the three possible C2F4S isomers with divalent sulfur, trifluorothioacetyl fluoride 1, tetrafluorothiirane 2, and trifluoroethenesulfenyl fluoride 3, have been determined by ab initio Hartree-Fock...

  9. Ab Initio Studies of Shock-Induced Chemical Reactions of Inter-Metallics

    Zaharieva, Roussislava; Hanagud, Sathya

    2009-06-01

    Shock-induced and shock assisted chemical reactions of intermetallic mixtures are studied by many researchers, using both experimental and theoretical techniques. The theoretical studies are primarily at continuum scales. The model frameworks include mixture theories and meso-scale models of grains of porous mixtures. The reaction models vary from equilibrium thermodynamic model to several non-equilibrium thermodynamic models. The shock-effects are primarily studied using appropriate conservation equations and numerical techniques to integrate the equations. All these models require material constants from experiments and estimates of transition states. Thus, the objective of this paper is to present studies based on ab initio techniques. The ab inito studies, to date, use ab inito molecular dynamics. This paper presents a study that uses shock pressures, and associated temperatures as starting variables. Then intermetallic mixtures are modeled as slabs. The required shock stresses are created by straining the lattice. Then, ab initio binding energy calculations are used to examine the stability of the reactions. Binding energies are obtained for different strain components super imposed on uniform compression and finite temperatures. Then, vibrational frequencies and nudge elastic band techniques are used to study reactivity and transition states. Examples include Ni and Al.

  10. Transgenic Cry1Ab rice does not impact ecological fitness and predation of a generalist spider.

    Jun-Ce Tian

    Full Text Available BACKGROUND: The commercial release of rice genetically engineered to express a Cry1Ab protein from Bacillus thuringiensis (Bt for control of Lepidoptera in China is a subject of debate. One major point of the debate has focused on the ecological safety of Bt rice on nontarget organisms, especially predators and parasitoids that help control populations of insect pests. METHODOLOGY/PRINCIPAL FINDINGS: A tritrophic bioassay was conducted to evaluate the potential impact of Cry1Ab-expressing rice on fitness parameters of a predaceous ground spider (Pardosa pseudoannulata (Bösenberg et Strand that had fed on Bt rice-fed brown planthopper (Nilaparvata lugens (Stål nymphs. Survival, development time and fecundity of this spider were not different when they were fed with Bt rice-fed or non-Bt rice-fed prey. Furthermore, ELISA and PCR gut assays, as well as a functional response trial, indicated that predation by P. pseudoannulata was not significantly different in Bt rice or non-Bt rice fields. CONCLUSIONS/SIGNIFICANCE: The transgenic Cry1Ab rice lines tested in this study had no adverse effects on the survival, developmental time and fecundity of P. pseudoannulata in the laboratory or on predation under field conditions. This suggests that this important predator would not be harmed if transgenic Cry1Ab rice were commercialized.

  11. Matrix product operators, matrix product states, and ab initio density matrix renormalization group algorithms.

    Chan, Garnet Kin-Lic; Keselman, Anna; Nakatani, Naoki; Li, Zhendong; White, Steven R

    2016-07-01

    Current descriptions of the ab initio density matrix renormalization group (DMRG) algorithm use two superficially different languages: an older language of the renormalization group and renormalized operators, and a more recent language of matrix product states and matrix product operators. The same algorithm can appear dramatically different when written in the two different vocabularies. In this work, we carefully describe the translation between the two languages in several contexts. First, we describe how to efficiently implement the ab initio DMRG sweep using a matrix product operator based code, and the equivalence to the original renormalized operator implementation. Next we describe how to implement the general matrix product operator/matrix product state algebra within a pure renormalized operator-based DMRG code. Finally, we discuss two improvements of the ab initio DMRG sweep algorithm motivated by matrix product operator language: Hamiltonian compression, and a sum over operators representation that allows for perfect computational parallelism. The connections and correspondences described here serve to link the future developments with the past and are important in the efficient implementation of continuing advances in ab initio DMRG and related algorithms. PMID:27394094

  12. Matrix product operators, matrix product states, and ab initio density matrix renormalization group algorithms

    Chan, Garnet Kin-Lic; Keselman, Anna; Nakatani, Naoki; Li, Zhendong; White, Steven R.

    2016-07-01

    Current descriptions of the ab initio density matrix renormalization group (DMRG) algorithm use two superficially different languages: an older language of the renormalization group and renormalized operators, and a more recent language of matrix product states and matrix product operators. The same algorithm can appear dramatically different when written in the two different vocabularies. In this work, we carefully describe the translation between the two languages in several contexts. First, we describe how to efficiently implement the ab initio DMRG sweep using a matrix product operator based code, and the equivalence to the original renormalized operator implementation. Next we describe how to implement the general matrix product operator/matrix product state algebra within a pure renormalized operator-based DMRG code. Finally, we discuss two improvements of the ab initio DMRG sweep algorithm motivated by matrix product operator language: Hamiltonian compression, and a sum over operators representation that allows for perfect computational parallelism. The connections and correspondences described here serve to link the future developments with the past and are important in the efficient implementation of continuing advances in ab initio DMRG and related algorithms.

  13. Detection and analysis of tupaia hepatocytes via mAbs against tupaia serum albumin.

    Liu, Xuan; Yuan, Lunzhi; Yuan, Quan; Zhang, Yali; Wu, Kun; Zhang, Tianying; Wu, Yong; Hou, Wangheng; Wang, Tengyun; Liu, Pingguo; Shih, James Wai Kuo; Cheng, Tong; Xia, Ningshao

    2016-05-20

    On the basis of its close phylogenetic relationship with primates, the development of Tupaia belangeri as an infection animal model and drug metabolism model could provide a new option for preclinical studies, especially in hepatitis virus research. As a replacement for primary human hepatocytes (PHHs), primary tupaia hepatocytes (PTHs) have been widely used. Similar to human serum albumin, tupaia serum albumin (TSA) is the most common liver synthesis protein and is an important biomarker for PTHs and liver function. However, no detection or quantitative method for TSA has been reported. In this study, mouse monoclonal antibodies (mAbs) 4G5 and 9H3 against TSA were developed to recognize PTHs, and they did not show cross-reactivity with serum albumin from common experimental animals, such as the mouse, rat, cow, rabbit, goat, monkey, and chicken. The two mAbs also exhibited good performance in fluorescence activated cell sorting (FACS) analysis and immunofluorescence (IF) detection of PTHs. A chemiluminescent enzyme immune assay method using the two mAbs, with a linear range from 96.89 pg/ml to 49,609.38 pg/ml, was developed for the quantitative detection of TSA. The mAbs and the CLEIA method provide useful tools for research on TSA and PTHs. PMID:26597317

  14. Ab initio molecular dynamics simulation of hydrogen fluoride at several thermodynamic states

    Kreitmeir, M.; Bertagnolli, H.; Mortensen, Jens Jørgen;

    2003-01-01

    Liquid hydrogen fluoride is a simple but interesting system for studies of the influence of hydrogen bonds on physical properties. We have performed ab initio molecular dynamics simulations of HF at several thermodynamic states, where we examine the microscopic structure of the liquid as well as...

  15. Biocontrol of the oriental armyworm, Mythimna separata, by the tachinid fly Exorista civilis is synergized by Cry1Ab protoxin.

    Jiang, Xingfu; Zhang, Lei; Yang, Haixia; Sappington, Thomas W; Cheng, Yunxia; Luo, Li Zhi

    2016-01-01

    Tritrophic interactions between Mythimna separata, its tachinid parasite Exorista civilis and the Cry1Ab were examined. Although 6th instar M. separata mortality increased with increasing Cry1Ab concentration, some tolerance was evident. Likewise, parasitization by E. civilis resulted in only 18% host mortality. However, combination of Cry1Ab and E. civilis parasitization resulted in a significant Cry1Ab dose-dependent increase in mortality over that of either alone, including a 50-56% synergistic increase in efficacy at the two concentrations tested. Pupal weight, adult emergence and lifetime fecundity of M. separata derived from larvae surviving both agents were negatively affected. The ability of E. civilis to parasitize and subsequently develop on the host was not adversely influenced by Cry1Ab. Instead, pupation rate increased significantly among host larvae fed 3.125 μg/g Cry1Ab diet. Overall, our results demonstrate that use of Cry1Ab to control M. separata not only is compatible with the use of the tachinid parasitoid, but that the two methods can act synergistically to manage this destructive pest, provide support for the safety of transgenic Cry1Ab Bt plants in China. This example of two independent pest management strategies acting synergistically against a difficult pest offers a new perspective of broad significance in striving for agricultural sustainability. PMID:27324469

  16. Overexpression of MexAB-OprM efflux pump in carbapenem-resistant Pseudomonas aeruginosa.

    Pan, Ya-Ping; Xu, Yuan-Hong; Wang, Zhong-Xin; Fang, Ya-Ping; Shen, Ji-Lu

    2016-08-01

    Efflux pump systems are one of the most important mechanisms conferring multidrug resistance in Pseudomonas aeruginosa. MexAB-OprM efflux pump is one of the largest multi-drug resistant efflux pumps with high-level expression, which is controlled by regulatory genes mexR, nalC, and nalD. This study investigated the role of efflux pump MexAB-OprM in 75 strains of carbapenem-resistant P. aeruginosa and evaluated the influence of point mutation of the regulatory genes. The minimum inhibitory concentrations of imipenem and meropenem, with or without MC207110, an efflux pump inhibitor, were determined by agar dilution method to select the positive strains for an overexpressed active efflux pump. Carba NP test and EDTA-disk synergy test were used for the detection of carbapenemase and metallo-β-lactamases, respectively. The gene mexA, responsible for the fusion protein structure, and the reference gene rpoD of the MexAB-OprM pump were amplified by real-time PCR. The quantity of relative mRNA expression was determined simultaneously. By PCR method, the efflux regulatory genes mexR, nalC, and nalD and outer membrane protein OprD2 were amplified for the strains showing overexpression of MexAB-OprM and subsequently analyzed by BLAST. Among the 75 P. aeruginosa strains, the prevalence of efflux pump-positive phenotype was 17.3 % (13/75). Carba NP test and EDTA-disk synergy test were all negative in the 13 strains. PCR assay results showed that ten strains overexpressed the MexAB-OprM efflux pump and were all positive for the regulatory genes mexR, nalC, and nalD. Sequence analysis indicated that of the ten isolates, nine had a mutation (Gly → Glu) at 71st amino acid position in NalC, and eight also had a mutation (Ser → Arg) at 209th position in NalC. Only one strain had a mutation (Thr → Ile) at the 158th amino acid position in NalD, whereas eight isolates had mutations in MexR. In conclusion, overexpression of efflux pump MexAB-OprM plays an important role in

  17. Preparation of a pure [sup 99m]Tc-F(ab')[sub 2] radioimmunoconjugate by direct labeling methods

    Griffiths, G.L.; Jones, A.L.; Hansen, H.J. (Immunomedics Inc., Morris Plains, NJ (United States)); Goldenberg, D.M. (Center for Molecular Medicine and Immunology, Newark, NJ (United States))

    1994-05-01

    Intact IgG and Fab' can be labeled directly with [sup 99m]Tc to give quantitative incorporation of radioactivity into the protein. With F(ab')[sub 2] the reductive conditions yield a mixture of [sup 99m]Tc-F(ab')[sub 2] and [sup 99m]Tc-Fab'. We now report a direct labeling method to produce only [sup 99m]Tc-F(ab')[sub 2] in quantitative yield and contaminated with [sup 99m]Tc-Fab'. The properties, stability and biodistribution of the [sup 99m]Tc-F(ab')[sub 2] have been compared to [sup 99m]Tc-Fab'. This new technology will allow us to compare technetium direct-labeled IgG, F(ab')[sub 2] and Fab' derivatives of the same antibody for radioimmunodetection. (author).

  18. EVIDENCE FOR RADIOGENIC SULFUR-32 IN TYPE AB PRESOLAR SILICON CARBIDE GRAINS?

    Fujiya, Wataru; Hoppe, Peter [Max Planck Institute for Chemistry, Hahn-Meitner-Weg 1, D-55128 Mainz (Germany); Zinner, Ernst [Laboratory for Space Sciences and Physics Department, Campus Box 1105, Washington University, St. Louis, MO 63130 (United States); Pignatari, Marco [Department of Physics, University of Basel, Klingelbergstrasse 82, CH-4056 Basel (Switzerland); Herwig, Falk, E-mail: wataru.fujiya@mpic.de, E-mail: peter.hoppe@mpic.de, E-mail: ekz@wustl.edu, E-mail: mpignatari@gmail.com, E-mail: fherwig@uvic.ca [Department of Physics and Astronomy, University of Victoria, Canada, P.O. Box 3055, Victoria, BC V8W 3P6 (Canada)

    2013-10-20

    We report C, Si, and S isotope measurements on 34 presolar silicon carbide grains of Type AB, characterized by {sup 12}C/{sup 13}C < 10. Nitrogen, Mg-Al-, and Ca-Ti-isotopic compositions were measured on a subset of these grains. Three grains show large {sup 32}S excesses, a signature that has been previously observed for grains from supernovae (SNe). Enrichments in {sup 32}S may be due to contributions from the Si/S zone and the result of S molecule chemistry in still unmixed SN ejecta or due to incorporation of radioactive {sup 32}Si from C-rich explosive He shell ejecta. However, a SN origin remains unlikely for the three AB grains considered here, because of missing evidence for {sup 44}Ti, relatively low {sup 26}Al/{sup 27}Al ratios (a few times 10{sup –3}), and radiogenic {sup 32}S along with low {sup 12}C/{sup 13}C ratios. Instead, we show that born-again asymptotic giant branch (AGB) stars that have undergone a very-late thermal pulse (VLTP), known to have low {sup 12}C/{sup 13}C ratios and enhanced abundances of the light s-process elements, can produce {sup 32}Si, which makes such stars attractive sources for AB grains with {sup 32}S excesses. This lends support to the proposal that at least some AB grains originate from born-again AGB stars, although uncertainties in the born-again AGB star models and possible variations of initial S-isotopic compositions in the parent stars of AB grains make it difficult to draw a definitive conclusion.

  19. Data characteristics and preliminary results from the atacama b-mode search (ABS)

    Visnjic, Catherine

    The Atacama B-Mode Search (ABS) is a 145 GHz polarimeter located at a high altitude site on Cerro Toco, in the Andes of northern Chile. Having deployed in early 2012, it is currently in its second year of operation, observing the polarization of the Cosmic Microwave Background (CMB). It seeks to probe the as yet undetected odd-parity B-modes of the polarization, which would have been created by the primordial gravitational wave background (GWB) predicted by theories of inflation. The magnitude of the B-mode signal is characterized by the tensor-to-scalar ratio, r. ABS features 60 cm cryogenic reflectors in the crossed-Dragone configuration, and a warm, continuously rotating sapphire half-wave plate to modulate the polarization of incoming radiation. The focal plane consists of 480 antenna-coupled transition edge sensor bolometers, arranged in orthogonal pairs for polarization sensitivity, and coupled to feedhorns in a hexagonal array. In this thesis we describe the ABS instrument in the state in which it is now operating, outline the first season of observations, and characterize the data obtained. Focusing on observations of the primary CMB field during a one month reference period, we detail the algorithms currently used to select the data suitable for making maps. This is the first pass at data cuts and provides a conservative estimate for the sensitivity of ABS to the polarization modes in the sky. We project that with one year total observation time of the primary CMB field, ABS should be able to detect the B-mode signal at roughly the level of r = 0.03.

  20. Investigation of polarization effects in the gramicidin A channel from ab initio molecular dynamics simulations

    Timko, Jeff; Kuyucak, Serdar

    2012-11-01

    Polarization is an important component of molecular interactions and is expected to play a particularly significant role in inhomogeneous environments such as pores and interfaces. Here we investigate the effects of polarization in the gramicidin A ion channel by performing quantum mechanics/molecular mechanics molecular dynamics (MD) simulations and comparing the results with those obtained from classical MD simulations with non-polarizable force fields. We consider the dipole moments of backbone carbonyl groups and channel water molecules as well as a number of structural quantities of interest. The ab initio results show that the dipole moments of the carbonyl groups and water molecules are highly sensitive to the hydrogen bonds (H-bonds) they participate in. In the absence of a K+ ion, water molecules in the channel are quite mobile, making the H-bond network highly dynamic. A central K+ ion acts as an anchor for the channel waters, stabilizing the H-bond network and thereby increasing their average dipole moments. In contrast, the K+ ion has little effect on the dipole moments of the neighboring carbonyl groups. The weakness of the ion-peptide interactions helps to explain the near diffusion-rate conductance of K+ ions through the channel. We also address the sampling issue in relatively short ab initio MD simulations. Results obtained from a continuous 20 ps ab initio MD simulation are compared with those generated by sampling ten windows from a much longer classical MD simulation and running each window for 2 ps with ab initio MD. Both methods yield similar results for a number of quantities of interest, indicating that fluctuations are fast enough to justify the short ab initio MD simulations.

  1. Ionizing radiation effect study by electron beam on acrylonitrile butadiene styrene - ABS terpolymer

    The great advantage in the researches involving development has as objective to increase significantly the quality of the products. The ABS (acrylonitrile, butadiene, styrene) resins are terpolymers formed by an elastomer and two thermoplastics amorphous components. The three different monomeric units from the terpolymer ABS contribute separately to the material characteristics exhibited. The molecular stiffness originating from polystyrene and the benzene ring hanging on the chain is responsible for the flexion module ABS. The acrylonitrile and the styrene incorporated butadiene exercises strong influence in the resistance to the impact because it reduces the bonding among them. The engineering use of this terpolymer became important due their mechanical properties and mainly, for the responses of this to tensions or deformations applied. The polymeric materials, when submitted to the ionizing radiation are modified by the transference of energy to these materials, introducing excitation and ionization of the molecules, generating chemical reactions that can produce permanent modifications in the polymeric physicochemical structure. The induced modifications can result in the polymeric material degradation or crosslinking, which can result in the improvement of some properties. This work has, as objective, to study the electron beam ionizing radiation effect, at different doses, in the properties of the polymer ABS. The studied properties were: tensile strength at break, elongation at break, Izod impact strength, flexural strength, melt flow index, Vicat softening temperature and the thermic distortion temperature. Also researches on Differential Scanning Calorimetry (DSC) and Thermogravimetric Analyses (TGA) were accomplished. From the experimental results, it was showed that for doses until 500 kGy, at 22.6 kGy/s dose rate, in the presence of air, the crosslinking process of ABS prevails. (author)

  2. The Use of Solitaire AB Stents in Coil Embolization of Wide-Necked Cerebral Aneurysms.

    Teng-Fei Li

    Full Text Available The Solitaire AB stent is one of many assistant stents used for treating wide-necked cerebral aneurysm, and has been used since 2003. However, large sample studies on its safety and effectiveness are lacking. The objective of this study was to evaluate the effectiveness and safety of the Solitaire AB stent in the coil embolization of wide-necked cerebral aneurysms.Retrospective review of the clinical and image data of 116 patients with wide-necked cerebral aneurysms who had been enrolled at six interventional neuroradiology centers from February 2010 to February 2014 and had been treated by coil embolization; in total, 120 Solitaire AB stents were used. The degree of aneurysm occlusion was examined using digital subtraction angiography (DSA immediately after the procedure and during follow-up, and was graded using the modified Raymond classification. We also observed complications to evaluate the safety and effectiveness of this therapy.The 120 Solitaire AB stents (4 mm × 15 mm, four stents; 4 mm × 20 mm, 16 stents; 6 mm × 20 mm, 36 stents; 6 mm × 30 mm, 64 stents were inserted to treat 120 wide-necked cerebral aneurysms. All stents were inserted successfully. DSA immediately post-surgery revealed 55 cases of complete occlusion, 59 cases of neck remnant, and six cases of aneurysm remnant. Perioperatively, there were four cases of hemorrhage and four cases of stent thrombosis. The follow-up spanned 3-37 months; of 92 patients examined by DSA at the 6-month follow up, 12 had disease recurrence.The Solitaire AB stent is effective with a good technical success rate and short-term effect for assisting coil embolization of wide-necked cerebral aneurysms.

  3. ESR Studies and Dating of Egyptian Gypsum at Ras Mala'ab, Sinai, Egypt

    A gypsum sample from the famous gypsum-anhydrite evaporitic deposit composing the Ras Mala'ab Formation, Upper Miocene, occurring at Ras Mala'ab, on the east coast of the Gulf of Suez, was subjected to (ESR) dosimetric studies. Also, (ESR) was used to date the formation or most recent recrystallization of that gypsum. The gypsum derivative (ESR) spectrum is characterized by the large broad Fe2+ signal (g=2.50) and HF-sixtet Mn2+ signals. Only the characteristic gypsum signal (G l, g=2.0040) was detected between the third and fourth lines of the HF-Mn2+ which is attributed to the electron-center SO3-. This signal was sensitive to artificial γ-irradiation and showed significant enhancement using a γ-dose of 550 Gy. Also, the signal was very stable up to 400 oC. The gypsum sample with a total dose (TD) of 1500 Gy, determined graphically by extrapolating the linear relationship between defect concentration and the artificial γ-doses for (G l, g=2.0040) and an annual dose (D) due to cosmic rays (0.3 mGy), yielded an age of 5.00 Ma. This could mean the age of formation or latest recrystallization of this gypsum deposit. The geologic age assignment of the Ras Mala'ab Group including the evaporitic gypsum unit, is Middle to Late Miocene. It is directly overlain by the Pliocene elastics at the locality of Ras Mala'ab. This might suggest that these evaporitic gypsum facies represent the top of the Miocene in the Gulf of Suez area, since the Miocene-Pliocene boundary is now put at 5.00-5.50 Ma ago. Therefore, the ESR age of the Ras Mala'ab gypsum is consistent with the geologic age assignment

  4. Some aspects of the recombinantly expressed humanised superagonist anti-CD28 mAb, TGN1412 trial catastrophe lessons to safeguard mAbs and vaccine trials.

    Mehrishi, Jitendra N; Szabó, Miklós; Bakács, Tibor

    2007-05-01

    We consider essential, still ignored, basic research aspects of the failed clinical trial (13 March 2006) of a recombinantly expressed humanised superagonist anti-CD28 mAb, TGN14122. Without hindsight, if for approval of the first ever recombinantly expressed anti-CD28 mAb use in humans attention had been paid to the physico-chemical factors and receptor saturation, the possible catastrophe will have been predictable and preventable. To understand what went wrong and, crucially, to prevent any future disasters to safeguard human health, safety and welfare, the information provided is likely to be of wide interest. We present calculations to show CD28 receptors on T cells of the six healthy volunteers by the anti-CD28 mAb superagonist, TGN1412. This led to the over activation of T cells and the violent cytokine storm precipitating the cascade and the release of endogenous molecules affecting other cells. Monocytes and plasma cells are likely to have been affected. We discuss briefly the role of neutrophils and activation releasing the surface-located sialidase affecting cell coats, such as, of T lymphocytes exposing galactose receptors that could have been involved in antigen presenting cell interactions. The role of the cell surface thiols of lymphocytes in forming mixed disulphides with endogenous ligands and in the REDOX system are briefly mentioned. Consideration of these various factors and a critical evaluation of the receptor occupancy data before injecting 0.1 mg/kg TGN1412 will have rung alarm bells about possible serious side effects and the catastrophe will have been averted. PMID:17397974

  5. Tobacco plants expressing the Cry1AbMod toxin suppress tolerance to Cry1Ab toxin of Manduca sexta cadherin-silenced larvae.

    Porta, Helena; Jiménez, Gladys; Cordoba, Elizabeth; León, Patricia; Soberón, Mario; Bravo, Alejandra

    2011-07-01

    Cry toxins produced by Bacillus thuringiensis bacteria are insecticidal proteins used worldwide in the control of different insect pests. Alterations in toxin-receptor interaction represent the most common mechanism to induce resistance to Cry toxins in lepidopteran insects. Cry toxins bind with high affinity to the cadherin protein present in the midgut cells and this interaction facilitates the proteolytic removal of helix α-1 and pre-pore oligomer formation. Resistance to Cry toxins has been linked with mutations in the cadherin gene. One strategy effective to overcome larval resistance to Cry1A toxins is the production of Cry1AMod toxins that lack helix α-1. Cry1AMod are able to form oligomeric structures without binding to cadherin receptor and were shown to be toxic to cadherin-silenced Manduca sexta larvae and Pectinophora gossypiella strain with resistance linked to mutations in a cadherin gene. We developed Cry1AbMod tobacco transgenic plants to analyze if Cry1AMod toxins can be expressed in transgenic crops, do not affect plant development and are able to control insect pests. Our results show that production of the Cry1AbMod toxin in transgenic plants does not affect plant development, since these plants exhibited healthy growth, produced abundant seeds, and were virtually undistinguishable from control plants. Most importantly, Cry1AbMod protein produced in tobacco plants retains its functional toxic activity against susceptible and tolerant M. sexta larvae due to the silencing of cadherin receptor by RNAi. These results suggest that CryMod toxins could potentially be expressed in other transgenic crops to protect them against both toxin-susceptible and resistant lepidopteran larvae affected in cadherin gene. PMID:21621616

  6. Budding yeast cDNA sequencing project: Y102_P06_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y102_P06_F.ab1 - - - Show Y102_P06_F.ab1 Seqid Y102_P06_F.ab1 Link to SGD - Link to dbEST - Link ... TTGACTGNNGCGTGTGTT GAGGTGGGGGGGAGGGAAATTATAAAAGAGGATCC GGGGAGAGGGGGGTT TCTCC ANTTNTTNGGNGNNNNNNNNNNNNNNNCNT ... NANNNNNNNTGTTTTAGGGGGGGGGG AGACTTTTTTTTGGGGGGGTTTTTTCC CCCCAAAAAAAAAAATTTTTGTG TGTGGGCCCCCCCCCCACCGGGGGAAA ... AAAAAATTTTTTTTAAAAAAGGG GGGGGTTTTTTTTTTTTCC CCCCGCGGGGAAAAAAAAAAAAAAAAAGCCC TCTTTTTTTTTTTTGGAGG ... TTAAATAAACCCCCCGCCAACCCCCCCCGGGAGGTTTTTGGGCGCCCCTT TCC ... Quality >Y102_P06_F.ab1 653 0 653 ABI 12 12 12 12 ...

  7. Serious Gaming for Test & Evaluation of Clean-Slate (Ab Initio) National Airspace System (NAS) Designs

    Allen, B. Danette; Alexandrov, Natalia

    2016-01-01

    Incremental approaches to air transportation system development inherit current architectural constraints, which, in turn, place hard bounds on system capacity, efficiency of performance, and complexity. To enable airspace operations of the future, a clean-slate (ab initio) airspace design(s) must be considered. This ab initio National Airspace System (NAS) must be capable of accommodating increased traffic density, a broader diversity of aircraft, and on-demand mobility. System and subsystem designs should scale to accommodate the inevitable demand for airspace services that include large numbers of autonomous Unmanned Aerial Vehicles and a paradigm shift in general aviation (e.g., personal air vehicles) in addition to more traditional aerial vehicles such as commercial jetliners and weather balloons. The complex and adaptive nature of ab initio designs for the future NAS requires new approaches to validation, adding a significant physical experimentation component to analytical and simulation tools. In addition to software modeling and simulation, the ability to exercise system solutions in a flight environment will be an essential aspect of validation. The NASA Langley Research Center (LaRC) Autonomy Incubator seeks to develop a flight simulation infrastructure for ab initio modeling and simulation that assumes no specific NAS architecture and models vehicle-to-vehicle behavior to examine interactions and emergent behaviors among hundreds of intelligent aerial agents exhibiting collaborative, cooperative, coordinative, selfish, and malicious behaviors. The air transportation system of the future will be a complex adaptive system (CAS) characterized by complex and sometimes unpredictable (or unpredicted) behaviors that result from temporal and spatial interactions among large numbers of participants. A CAS not only evolves with a changing environment and adapts to it, it is closely coupled to all systems that constitute the environment. Thus, the ecosystem that

  8. Experimental study of biotin-avidin pretargeting technique for anti-CEA McAb radioimmunoimaging

    Biotin-avidin pretargeting technique was used in promoting the diagnostic efficacy of anti-CEA McAb radioimmunoimaging. CEA McAb was conjugated with biotin McAb (B-McAb), streptavidin (SA) was labeled with 131I (131I-SA) and DTPA-biotin with 111In(111In-DTPA-B). Experimental human colonic tumor bearing nude mice were used. Two step method: B-McAb was preinjected, followed by 131I SA 48h later, 24, 48, 96 and 120 h postinjection, γ-imaging and biodistribution were studied. Three step method: B-McAb was preinjected, followed by cold SA 24h later and 111In-DTPA-B another 24h later. 2,6,24 and 48h postinjection, γ-imaging and biodistribution were also studied. Two step method: T/NT of all organs in experimental group was significantly increased compared with controls. The blood T/NT in experimental group and control group at 24 and 120h was 1.11:0.42 and 8.58:3.51, respectively. Tumor % ID/g in all organs slightly decreased compared with direct group. In γ-imaging radioactivity has been accumulated in tumor site as early as 24h, while only slightly visualized or non-visualized in controls. Three step method: in experimental group the blood T/NT reached 4.19 at 2 h, whereas all was < 1.37 at each phase of controls, the T/NT of all organs was also higher in experimental grouped than in controls. The tumor % ID/g in experimental group was 9.72% at 2h and 3.65% at 48h whereas % ID/g in controls in all phases was <3.07. The tumor clearly visualized at 2h and clearer at 48h in γ-imaging. In controls, the tumor was slightly visualized also to early stage, but faded away later on. Biotin-avidin pretargeting technique can elevate the T/NT ratio and decrease the blood background. Early imaging was obtained with better imaging quality

  9. Expression of cry1Ab gene from a novel Bacillus thuringiensis strain SY49-1 active on pest insects.

    Azizoglu, Ugur; Ayvaz, Abdurrahman; Yılmaz, Semih; Karabörklü, Salih; Temizgul, Rıdvan

    2016-01-01

    In this study, the cry1Ab gene of previously characterized and Lepidoptera-, Diptera-, and Coleoptera-active Bacillus thuringiensis SY49-1 strain was cloned, expressed and individually tested on Ephestia kuehniella (Lepidoptera: Pyralidae) and Plodia interpunctella (Lepidoptera: Pyralidae) larvae. pET-cry1Ab plasmids were constructed by ligating the cry1Ab into pET28a (+) expression vector. Constructed plasmids were transferred to an Escherichia coli BL21 (DE3) strain rendered competent with CaCl2. Isopropyl β-d-1-thiogalactopyranoside was used to induce the expression of cry1Ab in E. coli BL21(DE3), and consequently, ∼130kDa of Cry1Ab was obtained. Bioassay results indicated that recombinant Cry1Ab at a dose of 1000μgg(-1) caused 40% and 64% mortality on P. interpunctella and E. kuehniella larvae, respectively. However, the mortality rates of Bt SY49-1 strains' spore-crystal mixture at the same dose were observed to be 70% on P. interpunctella and 90% on E. kuehniella larvae. The results indicated that cry1Ab may be considered as a good candidate in transgenic crop production and as an alternative biocontrol agent in controlling stored product moths. PMID:27143037

  10. Marker-assisted selection on E. coli F4ab/ac resistance and the effect on neonatal survival in piglets

    Jørgensen, Claus Bøttcher; Anderson, Susan I.; Cirera, Susanna; Archibald, Alan; Raudsepp, Terje; Chowdhary, Bhanu; Edfors-Lilja, Inger; Andersson, Leif; Nielsen, Bjarne; Johannsen, Maria N.; Fredholm, Merete

    Enterotoxigenic Escherichia coli (ETEC) that express the F4ab or F4ac fimbriae (formerly known as K88ab/ac) are major causes of diarrhea and death in neonatal and young pigs. A locus controlling susceptibility towards ETEC F4ab/ac has previously been mapped to pig chromosome 13q41. A number of st...

  11. Budding yeast cDNA sequencing project: Y031_N21_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y031_N21_F.ab1 - - - Show Y031_N21_F.ab1 Seqid Y031_N21_F.ab1 Link to SGD - Link to dbEST - Link ... TGGTACCGCGGCCGCG GATCTCCCTTTAGTGAGGGTTAATTGGATCCAGACAT GATAAGATACAT T GATGAGTTTGGACAAACCACAACTAGAATGCAGTGAA ... AAAAATGCTTTAT TTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCAT TATAAGCTGCA ATAAACAAGTTAACAACAACAATTGCAT TCAT TTTATGT ...

  12. Budding yeast cDNA sequencing project: Y073_K23_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y073_K23_F.ab1 - - - Show Y073_K23_F.ab1 Seqid Y073_K23_F.ab1 Link to SGD - Link to dbEST - Link ... TGGTACCGCGGCCGCGG ATCTCCCTTTAGTGAGGGTTAATTGGATCCAGACAT GATAAGATACAT TG ATGAGTTTGGACAAACCACAACTAGAATGCAGTGAA ... AAAAATGCTTTATT TGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCAT TATAAGCTGCAA TAAACAAGTTAACAACAACAATTGCAT TCAT TTTATGT ...

  13. Budding yeast cDNA sequencing project: Y091_K02_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y091_K02_F.ab1 - - - Show Y091_K02_F.ab1 Seqid Y091_K02_F.ab1 Link to SGD - Link to dbEST - Link ... GNNATATACAGATATAAAAGAAGATAAATAAAATTTTTGT TTATAACCAATCC ACGAGATAAATTATTATTCATAACTTGGTTAAACTTT AAAGTGGGGGTGT ... TGACTAAGAATATATCTTACTATA ATTTATTAAAAAAAAAATAACTACCTTCC AGTATTAATATATTATTTTGT AATATCTAAAACAATATTTTTACGAAATG ... T TTTCTAAGATAAAACAAAAACTAATAATAAAATTTTTTTTTTCTTTTAAT CC AAAATTGGGAGGGGGGTGGATTTAATATCTCTATAAAAGATTTTCTTC C ... ACATACCGCATAACATAATGATTTAAA AGAGTGAGAGTATTTATAAACAATCC ATATTCC TTATATCATAATATATT TACTATACTTACACCTTAAGCTTATT ...

  14. 77 FR 47287 - Bacillus thuringiensis eCry3.1Ab Protein in Corn; Exemption From the Requirement of a Tolerance

    2012-08-08

    ... AGENCY 40 CFR Part 174 Bacillus thuringiensis eCry3.1Ab Protein in Corn; Exemption From the Requirement...-incorporated protectant (PIP), Bacillus thuringiensis eCry3.1Ab protein in corn, in or on the food and feed... permissible level for residues of Bacillus thuringiensis eCry3.1Ab protein in corn. DATES: This regulation...

  15. Impact of enrofloxacin and florfenicol therapy on the spread of OqxAB gene and intestinal microbiota in chickens.

    Chen, Yi; Sun, Jian; Liao, Xiao-Ping; Shao, Yang; Li, Liang; Fang, Liang-Xing; Liu, Ya-Hong

    2016-08-30

    Horizontal transfer of plasmid-encoded multidrug-resistant determinants is a major health problem and has attracted much public attention. We studied the dissemination of the efflux pump gene oqxAB located on transferable plasmid pHXY0908 between Salmonella Typhimurium and Escherichia coli in the gut of chickens. After an inoculation with Salmonella Typhimurium harboring oqxAB-bearing plasmid pHXY0908, chickens were treated with enrofloxacin and florfenicol. Inoculated, but non-treated chickens were included as a control group. Our results revealed that commensal E. coli isolates from the gut of chickens acquired the oqxAB-bearing plasmid in both treated and non-treated groups. Additionally, in the florfenicol treatment group, the average isolation rate of oqxAB-positive E. coli was significantly higher than that in the non-treated group. PFGE analysis showed that oqxAB-positive E. coli strains belonged to different patterns with one predominating. Moreover, multilocus sequence typing analysis revealed that E. coli ST533 was closely associated with the spread of oqxAB gene. qPCR analysis indicated that antibiotic administration provided selective advantages for sustaining a significantly high level of oqxAB gene from the DNA extracted from the feces. There was also a fluctuation in the intestinal microbiota with antibiotic therapy. In conclusion, the present study indicates that the oqxAB gene could be readily spread within the intestinal microflora. This could be enhanced by administrated with clinical doses of florfenicol and enrofloxacin, resulting in the enlargement of resistance gene reservoirs. In addition, ST533 E. coli isolates were found to contribute to transfer of the oqxAB gene. PMID:27527758

  16. Specific interactions between DNA and regulatory protein controlled by ligand-binding: Ab initio molecular simulation

    Matsushita, Y., E-mail: kurita@cs.tut.ac.jp; Murakawa, T., E-mail: kurita@cs.tut.ac.jp; Shimamura, K., E-mail: kurita@cs.tut.ac.jp; Oishi, M., E-mail: kurita@cs.tut.ac.jp; Ohyama, T., E-mail: kurita@cs.tut.ac.jp; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Tempaku-cho, Toyohashi, Aichi, 441-8580 (Japan)

    2015-02-27

    The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA.

  17. Specific interactions between DNA and regulatory protein controlled by ligand-binding: Ab initio molecular simulation

    The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA

  18. Bridging a gap between continuum-QCD and ab initio predictions of hadron observables

    Binosi, Daniele; Papavassiliou, Joannis; Roberts, Craig D

    2014-01-01

    Within contemporary hadron physics there are two common methods for determining the momentum-dependence of the interaction between quarks: the top-down approach, which works toward an ab initio computation of the interaction via direct analysis of the gauge-sector gap equations; and the bottom-up scheme, which aims to infer the interaction by fitting data within a well-defined truncation of those equations in the matter sector that are relevant to bound-state properties. We unite these two approaches by demonstrating that the renormalisation-group-invariant running-interaction predicted by contemporary analyses of QCD's gauge sector coincides with that required in order to describe ground-state hadron observables using a nonperturbative truncation of QCD's Dyson-Schwinger equations in the matter sector. This bridges a gap that had lain between nonperturbative continuum-QCD and the ab initio prediction of bound-state properties.

  19. Ab initio molecular dynamics simulation of liquid water by quantum Monte Carlo

    Although liquid water is ubiquitous in chemical reactions at roots of life and climate on the earth, the prediction of its properties by high-level ab initio molecular dynamics simulations still represents a formidable task for quantum chemistry. In this article, we present a room temperature simulation of liquid water based on the potential energy surface obtained by a many-body wave function through quantum Monte Carlo (QMC) methods. The simulated properties are in good agreement with recent neutron scattering and X-ray experiments, particularly concerning the position of the oxygen-oxygen peak in the radial distribution function, at variance of previous density functional theory attempts. Given the excellent performances of QMC on large scale supercomputers, this work opens new perspectives for predictive and reliable ab initio simulations of complex chemical systems

  20. Liquid Be, Ca and Ba. An orbital-free ab-initio molecular dynamics study

    Several static and dynamic properties of liquid beryllium (l-Be), liquid calcium (l-Ca) and liquid barium (l-Ba) near their triple point have been evaluated by the orbital-free ab initio molecular dynamics method (OF-AIMD), where the interaction between valence electrons and ions is described by means of local pseudopotentials. These local pseudopotentials used were constructed through a force-matching process with those obtained from a Kohn-Sham ab initio molecular dynamics study (KS-AIMD) of a reduced system with non-local pseudopotentials. The calculated static structures show good agreement with the available experimental data, including an asymmetric second peak in the structure factor which has been linked to the existence of a marked icosahedral short-range order in the liquid. As for the dynamic properties, we obtain collective density excitations whose associated dispersion relations exhibit a positive dispersion

  1. The second Studsvik AB - JAEA meeting for cooperation in nuclear energy research and development

    The second annual meeting was held at Studsvik AB in Sweden to exchange information on radioactive waste treatment technology including recycling of materials and technical developments for the neutron irradiation experiments in materials testing reactors. The information exchange meeting was held on the basis of the implemental agreement between the Studsvik AB and the Japan Atomic Energy Agency (JAEA) for cooperation in nuclear energy research and development. The major items of the information exchange were the present status of waste treatment in both organizations including acceptance criteria of wastes in Studsvik facilities, experience and current status of RI production technology in both organizations as well as the sensor development. The future plan in cooperative program was also discussed. This report describes contents of the information exchange and discussions in two cooperation areas. (author)

  2. Ultracold mixtures of metastable He and Rb: Scattering lengths from ab initio calculations and thermalization measurements

    Knoop, S.; Żuchowski, P. S.; KÈ©dziera, D.; Mentel, Ł.; Puchalski, M.; Mishra, H. P.; Flores, A. S.; Vassen, W.

    2014-08-01

    We have investigated the ultracold interspecies scattering properties of metastable triplet He and Rb. We performed state-of-the-art ab initio calculations of the relevant interaction potential, and measured the interspecies elastic cross section for an ultracold mixture of metastable triplet He4 and Rb87 in a quadrupole magnetic trap at a temperature of 0.5 mK. Our combined theoretical and experimental study gives an interspecies scattering length a4+87=+17-4+1a0, which prior to this work was unknown. More general, our work shows the possibility of obtaining accurate scattering lengths using ab initio calculations for a system containing a heavy, many-electron atom, such as Rb.

  3. An Ionized Outflow from AB Aur, a Herbig Ae Star with a Transitional Disk

    Rodriguez, Luis F; Dzib, Sergio A; Ortiz-Leon, Gisela; Loinard, Laurent; Macias, Enrique; Anglada, Guillem

    2014-01-01

    AB Aur is a Herbig Ae star with a transitional disk. Transitional disks present substantial dust clearing in their inner regions, most probably because of the formation of one or more planets, although other explanations are still viable. In transitional objects, accretion is found to be about an order of magnitude smaller than in classical full disks. Since accretion is believed to be correlated with outflow activity, centimeter free-free jets are expected to be present in association with these systems, at weaker levels than in classical protoplanetary (full) systems. We present new observations of the centimeter radio emission associated with the inner regions of AB Aur and conclude that the morphology, orientation, spectral index and lack of temporal variability of the centimeter source imply the presence of a collimated, ionized outflow. The radio luminosity of this radio jet is, however, about 20 times smaller than that expected for a classical system of similar bolometric luminosity. We conclude that c...

  4. Ab initio studies of equations of state and chemical reactions of reactive structural materials

    Zaharieva, Roussislava

    subject of studies of the shock or thermally induced chemical reactions of the two solids comprising these reactive materials, from first principles, is a relatively new field of study. The published literature on ab initio techniques or quantum mechanics based approaches consists of the ab initio or ab initio-molecular dynamics studies in related fields that contain a solid and a gas. One such study in the literature involves a gas and a solid. This is an investigation of the adsorption of gasses such as carbon monoxide (CO) on Tungsten. The motivation for these studies is to synthesize alternate or synthetic fuel technology by Fischer-Tropsch process. In this thesis these studies are first to establish the procedure for solid-solid reaction and then to extend that to consider the effects of mechanical strain and temperature on the binding energy and chemisorptions of CO on tungsten. Then in this thesis, similar studies are also conducted on the effect of mechanical strain and temperature on the binding energies of Titanium and hydrogen. The motivations are again to understand the method and extend the method to such solid-solid reactions. A second motivation is to seek strained conditions that favor hydrogen storage and strain conditions that release hydrogen easily when needed. Following the establishment of ab initio and ab initio studies of chemical reactions between a solid and a gas, the next step of research is to study thermally induced chemical reaction between two solids (Ni+Al). Thus, specific new studies of the thesis are as follows: (1) Ab initio Studies of Binding energies associated with chemisorption of (a) CO on W surfaces (111, and 100) at elevated temperatures and strains and (b) adsorption of hydrogen in titanium base. (2) Equations of state of mixtures of reactive material structures from ab initio methods. (3) Ab initio studies of the reaction initiation, transition states and reaction products of intermetallic mixtures of (Ni+Al) at elevated

  5. Conformational space of clindamycin studied by ab initio and full-atom molecular dynamics.

    Kulczycka-Mierzejewska, Katarzyna; Trylska, Joanna; Sadlej, Joanna

    2016-01-01

    Molecular dynamics (MD) simulations allow determining internal flexibility of molecules at atomic level. Using ab initio Born-Oppenheimer molecular dynamics (BOMD), one can simulate in a reasonable time frame small systems with hundreds of atoms, usually in vacuum. With quantum mechanics/molecular mechanics (QM/MM) or full-atom molecular dynamics (FAMD), the influence of the environment can also be simulated. Here, we compare three types of MD calculations: ab initio BOMD, hybrid QM/MM, and classical FAMD. As a model system, we use a small antibiotic molecule, clindamycin, which is one of the lincosamide antibiotics. Clindamycin acquires two energetically stable forms and we investigated the transition between these two experimentally known conformers. We performed 60-ps BOMD simulations in vacuum, 50-ps QM/MM, and 100-ns FAMD in explicit water. The transition between two antibiotic conformers was observed using both BOMD and FAMD methods but was not noted in the QM/MM simulations. PMID:26733483

  6. Ab initio calculations on the magnetic properties of transition metal complexes

    We present a protocol for the ab initio determination of the magnetic properties of mono- and polynuclear transition metal compounds. First, we obtain the low lying electronic states by multireference methods. Then, we include spin-orbit coupling and an external magnetic field for the determination of zero-field splitting and g-tensors. For the polynuclear complexes the magnetic exchange coupling constants are determined by a modified complete active space self consistent field method. Based on the results of the ab initio calculations, magnetic data such as magnetic susceptibility or magnetization are simulated and compared to experimental data. The results obtained for the polynuclear complexes are further analysed by calculations on model complexes where part of the magnetic centers are substituted by diamagnetic ions. The methods are applied to different Co and Ni containing transition metal complexes

  7. Combined SLD Measurement of $A_{b}$ at the $Z^{0}$ Resonance using Various Techniques

    Abe, K; Akagi, T; Akimoto, H; Allen, N J; Ash, William W; Aston, D; Baird, K G; Baltay, C; Band, H R; Barakat, M B; Bardon, O; Barklow, Timothy L; Bashindzhagian, G L; Bauer, J M; Bellodi, G; Benvenuti, Alberto C; Bilei, G M; Bisello, D; Blaylock, G; Bogart, J R; Bower, G R; Brau, J E; Breidenbach, M; Bugg, W M; Burke, D; Burnett, T H; Burrows, P N; Byrne, R M; Calcaterra, A; Calloway, D H; Camanzi, B; Carpinelli, M; Cassell, R; Castaldi, R; Castro, A; Cavalli-Sforza, M; Chou, A; Church, E; Cohn, H O; Coller, J A; Convery, M R; Cook, V; Cowan, R F; Coyne, D G; Crawford, G; Damerell, C J S; Danielson, M N; Daoudi, M; De Groot, N; Dell'Orso, R; Dervan, P J; De Sangro, R; Dima, M; Dong, D N; Doser, Michael; Dubois, R; Eisenstein, B I; Erofeeva, I; Eschenburg, V; Etzion, E; Fahey, S; Falciai, D; Fan, C; Fernández, J P; Fero, M J; Flood, K; Frey, R; Gifford, J A; Gillman, T; Gladding, G E; González, S; Goodman, E R; Hart, E L; Harton, J L; Hasuko, K; Hedges, S J; Hertzbach, S S; Hildreth, M D; Huber, J; Huffer, M E; Hughes, E W; Huynh, X; Hwang, H; Iwasaki, M; Jackson, D J; Jacques, P; Jaros, J A; Jiang, Z Y; Johnson, A S; Johnson, J R; Johnson, R A; Junk, T R; Kajikawa, R; Kalelkar, M S; Kamyshkov, Yu A; Kang, H J; Karliner, I; Kawahara, H; Kim, Y D; King, M E; King, R; Kofler, R R; Krishna, N M; Kroeger, R S; Langston, M; Lath, A; Leith, D W G S; Lia, V; Lin, C; Liu, M X; Liu, X; Loreti, M; Lu, A; Lynch, H L; Ma, J; Mahjouri, M; Mancinelli, G; Manly, S L; Mantovani, G C; Markiewicz, T W; Maruyama, T; Masuda, H; Mazzucato, E; McKemey, A K; Meadows, B T; Menegatti, G; Messner, R; Mockett, P M; Moffeit, K C; Moore, T B; Morii, M; Müller, D; Murzin, V S; Nagamine, T; Narita, S; Nauenberg, U; Neal, H A; Nussbaum, M; Oishi, N; Onoprienko, D V; Osborne, L S; Panvini, R S; Park, C H; Pavel, T J; Peruzzi, I; Piccolo, M; Piemontese, L; Pitts, K T; Plano, R J; Prepost, R; Prescott, C Y; Punkar, G D; Quigley, J; Ratcliff, B N; Reeves, T W; Reidy, J; Reinertsen, P L; Rensing, P E; Rochester, L S; Rowson, P C; Russell, J J; Saxton, O H; Schalk, T L; Schindler, R H; Schumm, B A; Schwiening, J; Sen, S; Serbo, V V; Shaevitz, M H; Shank, J T; Shapiro, G; Sherden, D J; Shmakov, K D; Simopoulos, C; Sinev, N B; Smith, S R; Smy, M B; Snyder, J A; Stängle, H; Stahl, A; Stamer, P E; Steiner, H; Steiner, R; Strauss, M G; Su, D; Suekane, F; Sugiyama, A; Suzuki, S; Swartz, M; Szumilo, A; Takahashi, T; Taylor, F E; Thom, J; Torrence, E; Toumbas, N K; Usher, T; Vannini, C; Vavra, J; Vella, E N; Venuti, J P; Verdier, R; Verdini, P G; Wagner, D L; Wagner, S R; Waite, A P; Walston, S; Watts, S J; Weidemann, A W; Weiss, E R; Whitaker, J S; White, S L; Wickens, F J; Williams, B; Williams, D C; Williams, S H; Willocq, S; Wilson, R J; Wisniewski, W J; Wittlin, J L; Woods, M; Word, G B; Wright, T R; Wyss, J; Yamamoto, R K; Yamartino, J M; Yang, X; Yashima, J; Yellin, S J; Young, C C; Yuta, H; Zapalac, G H; Zdarko, R W; Zhou, J

    1999-01-01

    We present a new preliminary combination of measurements of the parity-violation parameter Ab made by the SLD collaboration using various experimental techniques. The techniques differ in detail, but in general a sample of bb events is selected or enhanced by using the topologically reconstructed mass of the separated vertices formed by decaying B hadrons. The direction of the b(bbar) quark is signed by one of four final state tags: jet charge, vertex charge, leptons, or identified K+- from the b vertex. We account for statistical and systematic correlations between the four analyses to arrive at our combined result: Ab=0.905 +/- 0.017 {stat} +/- 0.020 (syst).

  8. Direct Measurement of $A_{b}$ using Charged Kaons at the SLD Detector

    Abe, K; Akagi, T; Akimoto, H; Allen, N J; Ash, William W; Aston, D; Baird, K G; Baltay, C; Band, H R; Barakat, M B; Bardon, O; Barklow, Timothy L; Bashindzhagian, G L; Bauer, J M; Bellodi, G; Benvenuti, Alberto C; Bilei, G M; Bisello, D; Blaylock, G; Bogart, J R; Bower, G R; Brau, J E; Breidenbach, M; Bugg, W M; Burke, D; Burnett, T H; Burrows, P N; Byrne, R M; Calcaterra, A; Calloway, D H; Camanzi, B; Carpinelli, M; Cassell, R; Castaldi, R; Castro, A; Cavalli-Sforza, M; Chou, A; Church, E; Cohn, H O; Coller, J A; Convery, M R; Cook, V; Cowan, R F; Coyne, D G; Crawford, G; Damerell, C J S; Danielson, M N; Daoudi, M; De Groot, N; Dell'Orso, R; Dervan, P J; De Sangro, R; Dima, M; Dong, D N; Doser, Michael; Dubois, R; Eisenstein, B I; Erofeeva, I; Eschenburg, V; Etzion, E; Fahey, S; Falciai, D; Fan, C; Fernández, J P; Fero, M J; Flood, K; Frey, R; Gifford, J A; Gillman, T; Gladding, G E; González, S; Goodman, E R; Hart, E L; Harton, J L; Hasuko, K; Hedges, S J; Hertzbach, S S; Hildreth, M D; Huber, J; Huffer, M E; Hughes, E W; Huynh, X; Hwang, H; Iwasaki, M; Jackson, D J; Jacques, P; Jaros, J A; Jiang, Z Y; Johnson, A S; Johnson, J R; Johnson, R A; Junk, T R; Kajikawa, R; Kalelkar, M S; Kamyshkov, Yu A; Kang, H J; Karliner, I; Kawahara, H; Kim, Y D; King, M E; King, R; Kofler, R R; Krishna, N M; Kroeger, R S; Langston, M; Lath, A; Leith, D W G S; Lia, V; Lin, C; Liu, M X; Liu, X; Loreti, M; Lu, A; Lynch, H L; Ma, J; Mahjouri, M; Mancinelli, G; Manly, S L; Mantovani, G C; Markiewicz, T W; Maruyama, T; Masuda, H; Mazzucato, E; McKemey, A K; Meadows, B T; Menegatti, G; Messner, R; Mockett, P M; Moffeit, K C; Moore, T B; Morii, M; Müller, D; Murzin, V S; Nagamine, T; Narita, S; Nauenberg, U; Neal, H A; Nussbaum, M; Oishi, N; Onoprienko, D V; Osborne, L S; Panvini, R S; Park, C H; Pavel, T J; Peruzzi, I; Piccolo, M; Piemontese, L; Pitts, K T; Plano, R J; Prepost, R; Prescott, C Y; Punkar, G D; Quigley, J; Ratcliff, B N; Reeves, T W; Reidy, J; Reinertsen, P L; Rensing, P E; Rochester, L S; Rowson, P C; Russell, J J; Saxton, O H; Schalk, T L; Schindler, R H; Schumm, B A; Schwiening, J; Sen, S; Serbo, V V; Shaevitz, M H; Shank, J T; Shapiro, G; Sherden, D J; Shmakov, K D; Simopoulos, C; Sinev, N B; Smith, S R; Smy, M B; Snyder, J A; Stängle, H; Stahl, A; Stamer, P E; Steiner, H; Steiner, R; Strauss, M G; Su, D; Suekane, F; Sugiyama, A; Suzuki, S; Swartz, M; Szumilo, A; Takahashi, T; Taylor, F E; Thom, J; Torrence, E; Toumbas, N K; Usher, T; Vannini, C; Vavra, J; Vella, E N; Venuti, J P; Verdier, R; Verdini, P G; Wagner, D L; Wagner, S R; Waite, A P; Walston, S; Watts, S J; Weidemann, A W; Weiss, E R; Whitaker, J S; White, S L; Wickens, F J; Williams, B; Williams, D C; Williams, S H; Willocq, S; Wilson, R J; Wisniewski, W J; Wittlin, J L; Woods, M; Word, G B; Wright, T R; Wyss, J; Yamamoto, R K; Yamartino, J M; Yang, X; Yashima, J; Yellin, S J; Young, C C; Yuta, H; Zapalac, G H; Zdarko, R W; Zhou, J

    1999-01-01

    We report a new measurement of A_b using data obtained by SLD in 1997-98. This measurement uses a vertex tag technique, where the selection of a b hemisphere is based on the reconstructed mass of the bottom hadron decay vertex. The method uses the 3D vertexing capabilities of SLD's CCD vertex detector and the small and stable SLC beams to obtain a high b-event tagging efficiency and purity of 78% and 97%, respectively. Charged kaons identified by the CRID detector provide an efficient quark-antiquark tag, with the analyzing power calibrated from the data. We obtain a preliminary result of A_b = 0.997

  9. Study of atomic structure of liquid Hg-In alloys using ab-initio molecular dynamics

    Sharma, Nalini; Ahluwalia, P. K. [Department of Physics, Himachal Pradesh University, Shimla(HP)-171005 (India); Thakur, Anil [Department of Physics, Govt. P. G. College Solan (HP)-173212 (India)

    2015-05-15

    Ab-initio molecular dynamics simulations are performed to study the structural properties of liquid Hg-In alloys. The interatomic interactions are described by ab-initio pseudopotentials given by Troullier and Martins. Five liquid Hg-In mixtures (Hg{sub 10}In{sub 90}, Hg{sub 30}In{sub 70}, Hg{sub 50}In{sub 50}, Hg{sub 70}In{sub 30} and Hg{sub 90}In{sub 10}) at 299K are considered. The radial distribution function g(r) and structure factor S(q) of considered alloys are compared with respective experimental results for liquid Hg (l-Hg) and (l-In). The radial distribution function g(r) shows the presence of short range order in the systems considered. Smooth curves of Bhatia-Thornton partial structure factors factor shows the presence of liquid state in the considered alloys.

  10. Study of atomic structure of liquid Hg-In alloys using ab-initio molecular dynamics

    Ab-initio molecular dynamics simulations are performed to study the structural properties of liquid Hg-In alloys. The interatomic interactions are described by ab-initio pseudopotentials given by Troullier and Martins. Five liquid Hg-In mixtures (Hg10In90, Hg30In70, Hg50In50, Hg70In30 and Hg90In10) at 299K are considered. The radial distribution function g(r) and structure factor S(q) of considered alloys are compared with respective experimental results for liquid Hg (l-Hg) and (l-In). The radial distribution function g(r) shows the presence of short range order in the systems considered. Smooth curves of Bhatia-Thornton partial structure factors factor shows the presence of liquid state in the considered alloys

  11. Ab initio calculation of valley splitting in monolayer δ-doped phosphorus in silicon.

    Drumm, Daniel W; Budi, Akin; Per, Manolo C; Russo, Salvy P; L Hollenberg, Lloyd C

    2013-01-01

    : The differences in energy between electronic bands due to valley splitting are of paramount importance in interpreting transport spectroscopy experiments on state-of-the-art quantum devices defined by scanning tunnelling microscope lithography. Using vasp, we develop a plane-wave density functional theory description of systems which is size limited due to computational tractability. Nonetheless, we provide valuable data for the benchmarking of empirical modelling techniques more capable of extending this discussion to confined disordered systems or actual devices. We then develop a less resource-intensive alternative via localised basis functions in siesta, retaining the physics of the plane-wave description, and extend this model beyond the capability of plane-wave methods to determine the ab initio valley splitting of well-isolated δ-layers. In obtaining an agreement between plane-wave and localised methods, we show that valley splitting has been overestimated in previous ab initio calculations by more than 50%. PMID:23445785

  12. Emergent properties of nuclei from ab initio coupled-cluster calculations

    Hagen, G; Hjorth-Jensen, M; Papenbrock, T

    2016-01-01

    Emergent properties such as nuclear saturation and deformation, and the effects on shell structure due to the proximity of the scattering continuum and particle decay channels are fascinating phenomena in atomic nuclei. In recent years, ab initio approaches to nuclei have taken the first steps towards tackling the computational challenge of describing these phenomena from Hamiltonians with microscopic degrees of freedom. This endeavor is now possible due to ideas from effective field theories, novel optimization strategies for nuclear interactions, ab initio methods exhibiting a soft scaling with mass number, and ever-increasing computational power. This paper reviews some of the recent accomplishments. We also present new results. The recently optimized chiral interaction NNLO$_{\\rm sat}$ is shown to provide an accurate description of both charge radii and binding energies in selected light- and medium-mass nuclei up to $^{56}$Ni. We derive an efficient scheme for including continuum effects in coupled-clust...

  13. Ab initio calculations on twisted graphene/hBN: Electronic structure and STM image simulation

    Correa, J. D.; Cisternas, E.

    2016-09-01

    By performing ab initio calculations we obtained theoretical scanning tunneling microscopy (STM) images and studied the electronic properties of graphene on a hexagonal boron-nitrite (hBN) layer. Three different stack configurations and four twisted angles were considered. All calculations were performed using density functional theory, including van der Waals interactions as implemented in the SIESTA ab initio package. Our results show that the electronic structure of graphene is preserved, although some small changes are induced by the interaction with the hBN layer, particularly in the total density of states at 1.5 eV under the Fermi level. When layers present a twisted angle, the density of states shows several van Hove singularities under the Fermi level, which are associated to moiré patterns observed in theoretical STM images.

  14. Predicting the activation energy of catalytic dissociation of the heteroatomic AB bond

    Two analytical formalisms, adiabatic and diabatic ones, were developed for the description of catalytic dissociation of heteroatomic bond AB interacting with a metal surface in the adsorption processes. In the adiabatic formalism, the transition state was localized on a four-dimensional potential energy surface in classical approximation. This approach generalizes the previous three-dimensional model for dissociative adsorption of homonuclear molecules X2 on metals surfaces, and it was used for studying the effect of non-parallel orientation to a surface of O2 molecules in the adsorption precursor state. The second formalism takes into account a possible quantum character of vibrations along the chemical bond AB. The calculation of the activation energy in this approach is performed by the density matrix method. This approach is applied for studying catalytic dissociation of CO molecule on a Ni(1 1 1) surface. The calculated apparent activation energy for this reaction is compared with published data for this system

  15. The coronal FeXXI 1354.094 line in AB Doradus

    Vilhu, O R; Mewe, R; Hakala, P

    2001-01-01

    The active late-type star AB Doradus was observed in February 1996 with the Goddard High Resolution Spectrograph of the Hubble Space Telescope using the low resolution G140L grating. The observations covered one half of the star's rotation cycle (P = 0.514 d) with 11.5 min time resolution. The strong coronal Fe XXI 1354.094 line formed at 10^7 K was analysed and its emission measure (EM) derived. This EM is much higher than that derived from recent XMM-Newton observations (Guedel et al. 2001), and earlier EXOSAT (Collier Cameron et al. 1988) and ASCA/EUVE (Mewe et al. 1996) data, as well, requiring a variability by a factor of 5. The physical reason for the variability remains unknown, since (outside flares) the observed broad band variability of AB Dor is much smaller.

  16. Ab Initio Calculations and Raman and SERS Spectral Analyses of Amphetamine Species

    Berg, Rolf W.; Nørbygaard, Thomas; White, Peter C.;

    2011-01-01

    For the first time, the differences between the spectra of amphetamine and amphetamine-H+ and between different conformers are thoroughly studied by ab initio model calculations, and Raman and surface-enhanced Raman spectroscopy (SERS) spectra are measured for different species of amphetamine....... The spectra of amphetamine and amphetamine-H+ sampleswere obtained and assigned according to a comparison of the experimental spectra and the ab initio MO calculations, performed using the Gaussian 03W program (Gaussian, Inc., Pittsburgh, PA). The analyses were based on complete geometry minimization...... with internal bonds (sulfates, hydrogen phosphates, etc.) need to be taken into account when employing these spectra for identification purposes. These results also show how Raman spectroscopy can assist the forensic community in drug profiling studies. Furthermore, because their spectra are different...

  17. Direct calculation of equilibrium constants for isotopic exchange reactions by ab initio molecular orbital theory

    The ability of simple levels of ab initio molecular orbital theory to describe with reasonable accuracy the energetics of isotopic exchange processes is demonstrated. Three levels of ab initio molecular orbital theory have been surveyed. The first two levels are single-determinant Hartree-Foch methods utilizing the 3-21G split-valence and 6-31G* polarization basis sets. The third level, which is computationally the most complex, uses the 6-31G* basis set but allows for partial account of electron correlation by way of Moller-Plesset perturbation theory terminated at second order. Theoretical and spectroscopic equilibrium constants for reactions XH + XD reversible XD + H2 where XD is a hydride of the first row of the periodic table are tabulated

  18. Properties of metals during the heating by intense laser irradiation using ab initio simulations

    Holst, Bastian; Recoules, Vanina; Torrent, Marc; Mazevet, Stephane

    2011-10-01

    Ultrashort laser pulses irradiating a target heat the electrons to very high temperatures. In contrast, the ionic lattice is unaffected on the time scale of the laser pulse since the heat capacity of electrons is much smaller than that of the lattice. This non-equilibrium system can be described as a composition of two subsystems: one consisting of hot electrons and the other of an ionic lattice at low temperature. We studied the effect of this intense electronic excitations on the optical properties of gold using ab initio simulations. We additionally use ab initio linear response to compute the phonon spectrum and the electron-phonon coupling constant within Density Functional Theory for several electronic temperatures of few eV. LULI, Ecole Polytechnique, CNRS, CEA, UPMC, 91128 Palaiseau, France.

  19. Ab-initio molecular dynamics simulation of liquid water by Quantum Monte Carlo

    Zen, Andrea; Mazzola, Guglielmo; Guidoni, Leonardo; Sorella, Sandro

    2014-01-01

    Despite liquid water is ubiquitous in chemical reactions at roots of life and climate on earth, the prediction of its properties by high-level ab initio molecular dynamics simulations still represents a formidable task for quantum chemistry. In this article we present a room temperature simulation of liquid water based on the potential energy surface obtained by a many-body wave function through quantum Monte Carlo (QMC) methods. The simulated properties are in excellent agreement with recent neutron scattering and X-ray experiments, particularly concerning the position of the oxygen-oxygen peak in the radial distribution function, at variance of previous Density Functional Theory attempts. Given the excellent performances of QMC on large scale supercomputers, this work opens new perspectives for predictive and reliable ab-initio simulations of complex chemical systems.

  20. Ab initio molecular dynamics simulation of liquid water by quantum Monte Carlo

    Zen, Andrea, E-mail: a.zen@ucl.ac.uk [Dipartimento di Fisica, “La Sapienza” - Università di Roma, piazzale Aldo Moro 5, 00185 Rome (Italy); London Centre for Nanotechnology, University College London, London WC1E 6BT (United Kingdom); Luo, Ye, E-mail: xw111luoye@gmail.com; Mazzola, Guglielmo, E-mail: gmazzola@phys.ethz.ch; Sorella, Sandro, E-mail: sorella@sissa.it [SISSA–International School for Advanced Studies, Via Bonomea 26, 34136 Trieste (Italy); Democritos Simulation Center CNR–IOM Istituto Officina dei Materiali, 34151 Trieste (Italy); Guidoni, Leonardo, E-mail: leonardo.guidoni@univaq.it [Dipartimento di Fisica, “La Sapienza” - Università di Roma, piazzale Aldo Moro 5, 00185 Rome (Italy); Dipartimento di Scienze Fisiche e Chimiche, Università degli Studi dell’ Aquila, via Vetoio, 67100 L’ Aquila (Italy)

    2015-04-14

    Although liquid water is ubiquitous in chemical reactions at roots of life and climate on the earth, the prediction of its properties by high-level ab initio molecular dynamics simulations still represents a formidable task for quantum chemistry. In this article, we present a room temperature simulation of liquid water based on the potential energy surface obtained by a many-body wave function through quantum Monte Carlo (QMC) methods. The simulated properties are in good agreement with recent neutron scattering and X-ray experiments, particularly concerning the position of the oxygen-oxygen peak in the radial distribution function, at variance of previous density functional theory attempts. Given the excellent performances of QMC on large scale supercomputers, this work opens new perspectives for predictive and reliable ab initio simulations of complex chemical systems.

  1. Adaptive Noise Cancellation Method Used for Wheel Speed Signal of Integrate ABS/ASR System

    MA Yue-feng; LIU Zhao-du; QI Zhi-quan; CUI Hai-feng

    2006-01-01

    A novel adaptive noise cancellation method for wheel speed signal of the anti-lock braking system/anti-slip regulation(ABS/ASR) control system is proposed. Based on the spectrum distribution of vehicle's wheel speed signal got from fast Fourier transform under various conditions, the high-pass filter is used to deal with original wheel speed signals sampled to get reference noise signal and the original wheel speed signals are used as adaptive filter's desired outputs. The difference between original signals and reference noise signals is used as the error signal for the adaptive FIR filter and also used as the whole adaptive noise cancellation system's final output. This method can obtain the noise signal on-line and is easy to use for real control system,which is useful to improve the performance of integrate system ABS/ASR.

  2. A fully ab initio potential energy surface for ClH2 reactive system

    2000-01-01

    An ab initio analytical potential energy surface called BW3 for the ClH2 reactive system is presented. The fit of this surface is based on about 1 200 ab initio energy points, computed with multi-reference configuration interaction(MRCI) and scaling external correlation (SEC) method and a very large basis set. The precision in the fit is very high. The BW3 surface could reproduce correctly the dissociation energy of H2 and HCl, and the endothermicity of the Cl + H2 abstraction reaction. For the Cl + H2 abstraction reaction, the saddle point of BW3 lies in collinear geometries, and the barrier height is 32.84 kJ/mol; for the H + ClH exchange reaction, the barrier of BW3 is also linear, with a height of 77.40 kJ/mol.

  3. A fully ab initio potential energy surface for C1H2 reactive system

    边文生; 刘成卜; H.J.Werner

    2000-01-01

    An ab initio analytical potential energy surface called BW3 for the CIH2 reactive system is presented. The fit of this surface is based on about 1 200 ab initio energy points, computed with multi-reference configuration interaction(MRCI) and scaling external correlation (SEC) method and a very large basis set. The precision in the fit is very high. The BW3 surface could reproduce correctly the dissociation energy of H2 and HCI, and the endothermicity of the Cl + H2 abstraction reaction. For the Cl + H2 abstraction reaction, the saddle point of BW3 lies in collinear geometries, and the barrier height is 32.84 kJ/mol; for the H + CIH exchange reaction, the barrier of BW3 is also linear, with a height of 77.40 kJ/mol.

  4. Ab Initio No-Core Shell Model Calculations Using Realistic Two- and Three-Body Interactions

    Navratil, P; Ormand, W E; Forssen, C; Caurier, E

    2004-11-30

    There has been significant progress in the ab initio approaches to the structure of light nuclei. One such method is the ab initio no-core shell model (NCSM). Starting from realistic two- and three-nucleon interactions this method can predict low-lying levels in p-shell nuclei. In this contribution, we present a brief overview of the NCSM with examples of recent applications. We highlight our study of the parity inversion in {sup 11}Be, for which calculations were performed in basis spaces up to 9{Dirac_h}{Omega} (dimensions reaching 7 x 10{sup 8}). We also present our latest results for the p-shell nuclei using the Tucson-Melbourne TM three-nucleon interaction with several proposed parameter sets.

  5. Electronic properties of liquid Hg-In alloys : Ab-initio molecular dynamics study

    Sharma, Nalini; Thakur, Anil; Ahluwalia, P. K.

    2016-05-01

    Ab-initio molecular dynamics simulations are performed to study the structural properties of liquid Hg-In alloys. The interatomic interactions are described by ab-initio pseudopotentials given by Troullier and Martins. Three liquid Hg-In alloys (Hg10In90, Hg30In70,. Hg50In50, Hg70In30, and Hg90Pb10) at 299 K are considered. The calculated results for liquid Hg (l-Hg) and lead (l-In) are also drawn. Along with the calculated results of considered five liquid alloys of Hg-In alloy. The results obtained from electronic properties namely total density of state and partial density of states help to find the local arrangement of Hg and In atoms and the presence of liquid state in the considered five alloys.

  6. Melting of sodium under high pressure. An ab-initio study

    González, D. J.; González, L. E. [Departamento de Física Teórica, Atómica y Optica, Universidad de Valladolid, 47011 Valladolid (Spain)

    2015-08-17

    We report ab-initio molecular dynamics simulations of dense liquid/solid sodium for a pressure range from 0 to 100 GPa. The simulations have been performed with the orbital free ab-initio molecular dynamics method which, by using the electron density as the basic variable, allows to perform simulations with large samples and for long runs. The calculated melting curve shows a maximum at a pressure ≈ 30 GPa and it is followed by a long, steep decrease. These features are in good agreement with the experimental data. For various pressures along the melting curve, we have calculated several liquid static properties (pair distribution functions, static structure factors and short-range order parameters) in order to analyze the structural effects of pressure.

  7. Ab Initio Calculations for the BaTiO3 (001) Surface Structure

    XUE Xu-Yan; WANG Chun-Lei; ZHONG Wei-Lie

    2004-01-01

    @@ The ab initio method within the local density approximation is applied to calculate cubic BaTiO3 (001) surface relaxation and rumpling for two different terminations (BaO and TiO2). Our calculations demonstrate that cubic perovskite BaTiO3 crystals possess surface polarization, accompanied by the presence of the relevant electric field.We analyse their electronic structures (band structure, density of states and the electronic density redistribution with emphasis on the covalency effects). The results are also compared with that of the previous ab initio calculations. Considerable increases of Ti-O chemical bond covalency nearby the surface have been observed.The band gap reduces especially for the TiO2 termination.

  8. Raman spectroscopy, ab-initio model calculations, and conformational, equilibria in ionic liquids

    Berg, Rolf W.

    hoped that the structural resolving power of Raman spectroscopy will be appreciated by the reader, when used on crystals of known conformation and on the corresponding liquids, especially in combination with modern quantum mechanics calculations. It is hoped that these inetrdisciplinary methods will be...... spectroscopy and ab-initio molecular orbital calculations. A discussion is given, based mainly on some recent FT- Raman spectroscopic results on the model ionic liquid system of 1-butyl-3-methyl-imidazolium ([C4C1Im]+X-) salts. The rotational isomerism of the [C4C1Im]+ cation is described: the presence of anti...... instrumentation ...... 311 12.3 Brief introduction to ab-initio model calculations .... 312 12.4 Case study on Raman spectroscopy and structure of imidazolium-based ionic liquids ..... 312 12.5 Raman spectra and structure of [C4C1Im]+ liquids ..... 315 12.6 Normal mode analysis and rotational isomerism of the [C4...

  9. Implementation of a vector potential method in an ab initio Hartree-Fock code

    Tevekeliyska, Violina; Springborg, Michael; Champagne, Benoît; Kirtman, Bernard

    2012-12-01

    For extended systems exposed to an external, electrostatic field, the presence of the field leads to an extra term (E⃗. P⃗) to the Hamiltonian, where E⃗ is the field vector and P⃗ is the polarization of the system of interest. In order to find out how a polymer chain responds to an external electric perturbation, a field with a charge and a current term for the polarization is added to an ab initio Hartree-Fock Hamiltonian. The polarization expression is taken from an efficient vector potential approach (VPA) [1] for calculating electronic and nuclear responses of infinite periodic systems to finite electric fields and is implemented in the ab initio LCAO-SCF algorithm [3], which computes band structure of regular or helical polymers, taking into account the one-dimensional translational symmetry. A smoothing procedure for numerical differentiation of the orbital coefficients is used in order to calculate self-consistently the charge flow contribution to the polarization.

  10. Large-scale ab initio configuration interaction calculations for light nuclei

    In ab-initio Configuration Interaction calculations, the nuclear wavefunction is expanded in Slater determinants of single-nucleon wavefunctions and the many-body Schrodinger equation becomes a large sparse matrix problem. The challenge is to reach numerical convergence to within quantified numerical uncertainties for physical observables using finite truncations of the infinite-dimensional basis space. We discuss strategies for constructing and solving the resulting large sparse matrix eigenvalue problems on current multicore computer architectures. Several of these strategies have been implemented in the code MFDn, a hybrid MPI/OpenMP Fortran code for ab-initio nuclear structure calculations that can scale to 100,000 cores and more. Finally, we will conclude with some recent results for 12C including emerging collective phenomena such as rotational band structures using SRG evolved chiral N3LO interactions.

  11. Ab-initio approach to study hydrogen diffusion in 9Cr steels

    We calculate the equilibrium energies and migration barriers of Fe, Cr and H interstitial defects in α-FeX(X=Cr). We use the ab-initio electronic structure code, SIESTA, coupled to the monomer method to find activated states (or migration barriers), in order to study atomic defects diffusion. Ab-initio calculations reveal that in the presence of Cr the H migration barriers are higher than in pure α-Fe. On the other hand, our permeation tests on 9%Cr-91%Fe alloys reveal a permeation coefficient 10 times lower and a diffusion coefficient 200 times lower than in pure, annealed iron. Focusing on our experimental results, we explore very simple model of new H trapping sites and possible migration paths that can explain the experimental observations.

  12. {\\it Ab initio} nuclear structure - the large sparse matrix eigenvalue problem

    Vary, James P; Ng, Esmond; Yang, Chao; Sosonkina, Masha

    2009-01-01

    The structure and reactions of light nuclei represent fundamental and formidable challenges for microscopic theory based on realistic strong interaction potentials. Several {\\it ab initio} methods have now emerged that provide nearly exact solutions for some nuclear properties. The {\\it ab initio} no core shell model (NCSM) and the no core full configuration (NCFC) method, frame this quantum many-particle problem as a large sparse matrix eigenvalue problem where one evaluates the Hamiltonian matrix in a basis space consisting of many-fermion Slater determinants and then solves for a set of the lowest eigenvalues and their associated eigenvectors. The resulting eigenvectors are employed to evaluate a set of experimental quantities to test the underlying potential. For fundamental problems of interest, the matrix dimension often exceeds $10^{10}$ and the number of nonzero matrix elements may saturate available storage on present-day leadership class facilities. We survey recent results and advances in solving t...

  13. Experimental studies and ab initio calculations on characteristics of the C state of SF2 radical

    SF2 radicals were generated by a pulsed dc discharge in the mixture gas beam of SF2 and Ar. The (2+1) resonance-enhanced multiphoton ionization (REMPI) excitation spectroscopy of SF2 radical was obtained between 325 and 365 nm. The SF+ ion signals were also observed in the same wavelength range. The analysis shows that the spectrum can be assigned as the two-photon resonant excitation of SF2 radical (B-tilde1 B1 and (C-tilde1 A1 states). And also, ab initio calculations suggest that the C-tilde state is a bonding state with Rydberg characteristic. The potential energy surfaces (PESs) of SF2 and SF2+ by ab initio calculations suggest that SF+ ions originate from dissociation processes of excited SF2+ ions. (author)

  14. An efficient time-stepping scheme for ab initio molecular dynamics simulations

    Tsuchida, Eiji

    2015-01-01

    In ab initio molecular dynamics simulations of real-world problems, the simple Verlet method is still widely used for integrating the equations of motion, while more efficient algorithms are routinely used in classical molecular dynamics. We show that if the Verlet method is used in conjunction with pre- and postprocessing, the accuracy of the time integration is significantly improved with only a small computational overhead. The validity of the processed Verlet method is demonstrated in several examples including ab initio molecular dynamics simulations of liquid water. The structural properties obtained from the processed Verlet method are found to be sufficiently accurate even for large time steps close to the stability limit. This approach results in a 2x performance gain over the standard Verlet method for a given accuracy.

  15. Ab initio modelling of the behaviour of point defects and fission products in nuclear fuel

    The aim of this work is to determine precisely the mechanisms of formation and migration of defects and fission products as well as the associated energies. Examples on uranium dioxide UO2 (standard nuclear fuel) and on uranium carbide UC (potential fuel for new generation reactors) are given. The obtained results are discussed and compared with the experimental results carried out. The ab initio method used is the Projector Augmented-Wave (PAW) method based on the density functional theory. The particular electronic properties of actinides are especially studied because, on account of their 5f orbitals more or less localized around the nucleus, it is difficult to model the actinide compounds by the DFT method. In particular, the modelling of the exchange-correlation interaction of the 5f electrons of UO2 requires approximations (as GGA+U) beyond those more currently used in ab initio calculations (LDA or GGA). (O.M.)

  16. Characterization of the Mycobacterial AdnAB DNA Motor Provides Insights into the Evolution of Bacterial Motor-Nuclease Machines*

    Unciuleac, Mihaela-Carmen; Shuman, Stewart

    2009-01-01

    Mycobacterial AdnAB exemplifies a family of heterodimeric motor-nucleases involved in processing DNA double strand breaks (DSBs). The AdnA and AdnB subunits are each composed of an N-terminal UvrD-like motor domain and a C-terminal RecB-like nuclease module. Here we conducted a biochemical characterization of the AdnAB motor, using a nuclease-inactivated heterodimer. AdnAB is a vigorous single strand DNA (ssDNA)-dependent ATPase (kcat 415 s−1), and the affinity of the motor for the ssDNA cofa...

  17. La relació entre abús a la infantesa i comportaments parasuïcides

    Coll Corominas, Xavier

    2001-01-01

    Les persones amb una historia d'abús i maltractaments presenten una prevalència alta de comportaments parasuïcides. Malauradament però, hi ha una manca d'informació en voltant de la prevalència de les experiències d'abús en aquelles que han presentat comportaments parasuïcides.En aquest treball hem utilitzat versions modificades de qüestionaris estandarditzats d'autocomplexió d'abús sexual, físic i psicològic. També mides de psicopatologia general, i de l'estil parental. Aquests, varen ser ad...

  18. Immunological and metabolomic impacts of administration of Cry1Ab protein and MON 810 maize in mouse

    Adel-Patient, Karine; Guimaraes, Odette; Paris, Alain; Drumare, Marie-Francoise; Ah-Leung-Poullias, Sandrine; Lamourette, Patricia; Nevers, Marie-Claire; Canlet, Cecile; Molina, Jerome; Bernard, Herve; Créminon, Christophe; Wal, Jean-Michel

    2011-01-01

    We have investigated the immunological and metabolomic impacts of Cry1Ab administration to mice, either as a purified protein or as the Cry1Ab-expressing genetically modified (GM) MON810 maize. Humoral and cellular specific immune responses induced in BALB/cJ mice after intra-gastric (i.g.) or intra-peritoneal (i.p.) administration of purified Cry1Ab were analyzed and compared with those induced by proteins of various immunogenic and allergic potencies. Possible unintended effects of the gene...

  19. Characterisation of five candidate genes within the ETEC F4ab/ac candidate region in pigs

    Jacobsen, Mette Juul; Cirera Salicio, Susanna; Joller, David;

    2011-01-01

    dominant Mendelian trait. Indentifying the genetics behind this trait will greatly benefit pig welfare as well as the pig breeding industry by providing an opportunity to select against genetically susceptible animals, thereby reducing the number of diarrhoea outbreaks. The trait has recently been mapped...... between ETEC F4ab/ac resistant and ETEC F4ab/ac susceptible animals in any of the tested tissues. CONCLUSIONS: None of the identified polymorphisms are obvious causative mutations for ETEC F4ab/ac susceptibility, as they have no impact on the level of the overall mRNA expression nor predicted to influence...

  20. LOFT CIS analysis S-5B penetration 3'' IA-296-AB

    The 3'' IA-296-AB line from the containment penetration S-5B was analyzed to ASME Code, Subsection NC (Class 2) criteria. This section of piping is part of the Containment Isolation System; the model considered the line from penetration S-5B outward through a series of elbows and through the third isolation valve. Results of this analysis show that the section of line described will meet Class 2 requirements if additional supports are installed at three locations