WorldWideScience

Sample records for abs

  1. Fotfavoriten AB

    Søilen, Klaus Solberg; HUBER, Stefan

    2004-01-01

    Fotfavoriten AB, a foot care company located in Sollefttå in Northern Sweden, is an example of how local government fires staff only to reengage them as entrepreneurs delivering similar service. The case is typical for the social sector and may mark a trend. The result is often felt to be positive both by the entrepreneur, who is now more directly in charge of her or his earnings, and the end consumer. The CEO of Fotfavoriten AB, Eva Wörmann, waited a long time before she dared to take the ne...

  2. Verdivurdering av SAS AB

    Gangås, Silje Garberg

    2013-01-01

    Formålet med denne mastergradsavhandlingen har vært å beregne den teoretiske verdien på det børsnoterte selskapet SAS AB og på bakgrunn av denne gi en handlingsanbefaling på selskapets aksje. Forskningsspørsmålet for oppgaven er utledet som følger: ”Hva er verdien av SAS AB?” SAS AB er inne i en fundamental omstillingsprosses hvor den nye strategien, 4XNG, ble presentert og påbegynt november 2012. Omstillingsprosessen innebærer blant annet en omfattende omstrukturering i organisasjonen ...

  3. ABS 415 Course Tutorial / tutorialrank

    welcome1257

    2015-01-01

                     For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 4 Times, Rating: A+   ASHFORD ABS 415 Week 1 DQ 1Discovering Strengths in Leadership ASHFORD ABS 415 Week 1 DQ 2 Ethical Leadership ASHFORD ABS 415 Week 2 DQ 1 Developing Emotional Intelligence in Leadership ASHFORD ABS 415 Week 2 DQ 2 Elements of Emotional Intelligence in Leadership ASHFORD ABS 415 Week 3 DQ 1 Motivational...

  4. The AB Staff Plan

    Boillot, J; Delahaye, J P; Myers, S; CERN. Geneva. AB Department

    2003-01-01

    The present report summarises the staff plan of the newly created Accelerators and Beams (AB) Division following the restructuring of the Accelerator Sector and covering the period 2003 to 2010. It underlines the refocusing of the staff on priority work, especially the LHC Project and is coherent with the recently adopted CERN Long Term Plan (LTP). It compares the requested and available manpower (both staff and industrial support) for each Project, Programme and Activity (PPA) split in work packages and highlights the missing manpower for each category of personnel.

  5. AB Manpower Plan 2007

    Myers, Stephen

    2007-01-01

    The present exercise is not as such a "manpower plan" but a purely budgetary comparison of known plus requested resources with the known commitments over the period 2007-2012. From a purely budgetary point of view, AB will have the capacity to maintain all those recently hired staff who fulfill the criteria for long term employment at CERN. Following this budgetary exercise, AB proposes to perform a CERN-wide staff work plan so as to compare the manpower available to the quantity of work to be done in the totality of the work-packages. If there is a significant mismatch between these two quantities then we propose the following measures which would create personnel economies and allow us to redress the mismatch by increased recruitment: a new job severance scheme; CERN restructuring; use of the new CERN-ITER agreement; more flexibility in transfers from Materials to Personnel budgets. Failing this a re-examination of possible closure of lower priority facilities may be needed.

  6. ABS 415 ASH Course Tutorial / Tutorialrank

    charles

    2015-01-01

    For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 4 Times, Rating: A+   ASHFORD ABS 415 Week 1 DQ 1Discovering Strengths in Leadership ASHFORD ABS 415 Week 1 DQ 2 Ethical Leadership ASHFORD ABS 415 Week 2 DQ 1 Developing Emotional Intelligence in Leadership ASHFORD ABS 415 Week 2 DQ 2 Elements of Emotional Intelligence in Leadership ASHFORD ABS 415 Week 3 DQ 1 Motivational Techniques ASHFORD ABS 415 Week 3 DQ 2 Leadership in a Cr...

  7. Clinical significance of combined detection of multiple serum antibodies (AsAb, EmAb, AcAb, AoAb, ToxAb) in infertile women

    Objective: To determine the clinical significance of combined detection of multiple serum antibodies in infertile women. Methods; Serum multiple antibodies were examined in 120 infertile women, including 88 failed to get pregnancy and 32 with repeated spontaneous abortion. The antibodies tested were: (1) anti-sperm antibody (AsAb) (2) endometrial antibody (EmAb) (3) anti-cardiophospholipid antibody (AcAb) (4) Anti-ovarian antibody (AoAb) and Toxoplasmosis antibody (ToxAb). Results: In 48 of the infertile women, none of the five antibodies were positive (40% of 120). The rest were: one antibody positive--38/120 or 31.6%; two antibodies positive--31/120 or 25.83%, three and four antibodies positive--4/120 or 3.33%. None of the women were positive with all five antibodies. Conclusion: Immune factor was the chief cause of infertility in women. (authors)

  8. Equity valuation : Atlas Copco AB

    Santos, Ricardo Manuel Castro Lopes Alba

    2016-01-01

    This Dissertation presents a literature review of some of the most appraised theories on equity valuation models. A thoughtful analysis is made, presenting the main advantages and restrictions of each model and setting the path for a discussion about improvements to be made on this field of study. A practical implementation follows, proposing a fair value estimation of Atlas Copco AB shares. Atlas Copco is a Swedish-based capital goods company, operating across four differen...

  9. AB Levitator and Electricity Storage

    Bolonkin, Alexander

    2007-01-01

    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative...

  10. AB Levitator and Electricity Storage

    Bolonkin, A

    2007-01-01

    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative weight ratio of this engine is 0.01 - 0.1 (from thrust). For some types of AB engine (toroidal form) the thrust easily may be changed in any direction without turning of engine. The author computed many projects using different versions of offered AB engine: small device for levitation-flight of a human (including flight from Earth to Outer Space), fly VTOL car (track), big VTOL aircrat, suspended low altitude stationary satellite, powerful Space Shuttle-like booster for travel to the Moon and Mars without spending energ...

  11. Thermonuclear Reflect AB-Reactor

    Bolonkin, Alexander

    2008-01-01

    The author offers a new kind of thermonuclear reflect reactor. The remarkable feature of this new reactor is a three net AB reflector, which confines the high temperature plasma. The plasma loses part of its energy when it contacts with the net but this loss can be compensated by an additional permanent plasma heating. When the plasma is rarefied (has a small density), the heat flow to the AB reflector is not large and the temperature in the triple reflector net is lower than 2000 - 3000 K. This offered AB-reactor has significantly less power then the currently contemplated power reactors with magnetic or inertial confinement (hundreds-thousands of kW, not millions of kW). But it is enough for many vehicles and ships and particularly valuable for tunnelers, subs and space apparatus, where air to burn chemical fuel is at a premium or simply not available. The author has made a number of innovations in this reactor, researched its theory, developed methods of computation, made a sample computation of typical pr...

  12. ABS: Sequence alignment by scanning

    Bonny, Mohamed Talal

    2011-08-01

    Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  13. AP calculus AB/BC

    Schwartz, Stu

    2013-01-01

    All Access for the AP® Calculus AB & BC Exams Book + Web + Mobile Everything you need to prepare for the Advanced Placement® exam, in a study system built around you! There are many different ways to prepare for an Advanced Placement® exam. What's best for you depends on how much time you have to study and how comfortable you are with the subject matter. To score your highest, you need a system that can be customized to fit you: your schedule, your learning style, and your current level of knowledge. This book, and the free online tools that come with it, will help you personalize your AP® Cal

  14. Ab-Initio Molecular Dynamics

    Kühne, Thomas D

    2012-01-01

    Computer simulations and molecular dynamics in particular, is a very powerful method to provide detailed and essentially exact informations of classical many-body problems. With the advent of \\textit{ab-initio} molecular dynamics, where the forces are computed on-the-fly by accurate electronic structure calculations, the scope of either method has been greatly extended. This new approach, which unifies Newton's and Schr\\"odinger's equations, allows for complex simulations without relying on any adjustable parameter. This review is intended to outline the basic principles as well as a survey of the field. Beginning with the derivation of Born-Oppenheimer molecular dynamics, the Car-Parrinello method as well as novel hybrid scheme that unifies best of either approach are discussed. The predictive power is demonstrated by a series of applications ranging from insulators to semiconductors and even metals in condensed phases.

  15. GINGA Observations of AB Doradus

    Vilhu, O.; Tsuru, T.; Collier Cameron, A.

    We report GINGA observations of the pre main sequence star AB Doradus (HD 36705), performed during 8 - 12 January, 1990. Some rotational modulation might be present. four X-ray flares were detected. Three of these events were similar to the EINSTEIN HRI-flare (Vilhu and Linsky, 1987), with decay times around 25 min. The last flare had long rise and decay times (100 min), resembling the EXOSAT flares observed by Collier Cameron et.al. (1988). The mean flare spectrum can be fitted by a thermal bremstrahlung with temperature 5.0 keV, or by a power-law model with photon index 2.2. The 3 upper limit of the Iron line equivalent width in the flare spectrum is 1 keV, weaker than predicted by thermal models. This Iron line anomaly was first discussed in the case of UX Ari by Tsuru et. al. (1989). However, normal equivalent widths can be derived from several EXOSAT spectra of active cool stars (Pallavicini and Tagliaferri, 1990). We discuss the possibility that the continuum from non-thermal electrons (producing also the microwave emission) could occasionally lower the apparent equivalent width. The mechanism works for reasonably low magnetic field strengths and electon power-law indexes. However, a large population of non-thermal electrons is needed (comparable to the thermal one). Stronger magnetic fields could explain the radio emission with less electrons, but then the non-thermal X-ray continuum remains small.

  16. AP calculus AB & BC crash course

    Rosebush, J

    2012-01-01

    AP Calculus AB & BC Crash Course - Gets You a Higher Advanced Placement Score in Less Time Crash Course is perfect for the time-crunched student, the last-minute studier, or anyone who wants a refresher on the subject. AP Calculus AB & BC Crash Course gives you: Targeted, Focused Review - Study Only What You Need to Know Crash Course is based on an in-depth analysis of the AP Calculus AB & BC course description outline and actual AP test questions. It covers only the information tested on the exams, so you can make the most of your valuable study time. Written by experienced math teachers, our

  17. Main: DREDR1ATRD29AB [PLACE

    Full Text Available DREDR1ATRD29AB S000152 23-June-2006 (last modified) kehi Related to responsiveness ...dependent in the ABA-responsive expression of the rd29A in Arabidopsis; DRE; drought; water stress; oxidativ

  18. Ab initio valence calculations in chemistry

    Cook, D B

    1974-01-01

    Ab Initio Valence Calculations in Chemistry describes the theory and practice of ab initio valence calculations in chemistry and applies the ideas to a specific example, linear BeH2. Topics covered include the Schrödinger equation and the orbital approximation to atomic orbitals; molecular orbital and valence bond methods; practical molecular wave functions; and molecular integrals. Open shell systems, molecular symmetry, and localized descriptions of electronic structure are also discussed. This book is comprised of 13 chapters and begins by introducing the reader to the use of the Schrödinge

  19. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    Souto, F.J.; Haskin, F.E. [Univ. of New Mexico, Albuquerque, NM (United States). Dept. of Chemical and Nuclear Engineering; Kmetyk, L.N. [Sandia National Labs., Albuquerque, NM (United States)

    1994-10-01

    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS.

  20. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS

  1. Improved age constraints for the AB Dor quadruple system - The binary nature of AB Dor B

    Janson, M; Lenzen, R; Close, L; Nielsen, E; Hartung, M; Henning, T; Bouy, H; Janson, Markus; Brandner, Wolfgang; Lenzen, Rainer; Close, Laird; Nielsen, Eric; Hartung, Markus; Henning, Thomas; Bouy, Herve

    2006-01-01

    We present resolved NACO photometry of the close binary AB Dor B in H- and Ks-band. AB Dor B is itself known to be a wide binary companion to AB Dor A, which in turn has a very low-mass close companion named AB Dor C. These four known components make up the young and dynamically interesting system AB Dor, which will likely become a benchmark system for calibrating theoretical pre-main sequence evolutionary mass tracks for low-mass stars. However, for this purpose the actual age has to be known, and this subject has been a matter of discussion in the recent scientific literature. We compare our resolved photometry of AB Dor Ba and Bb with theoretical and empirical isochrones in order to constrain the age of the system. This leads to an age estimate of about 50 to 100 Myr. We discuss the implications of such an age range for the case of AB Dor C, and compare with other results in the literature.

  2. Ab interno trabeculectomy: A comprehensive review

    Ting Ting Liu

    2013-07-01

    Full Text Available PURPOSE To summarize the original literature on ab interno trabeculectomy with the Trabectome system and to review its efficacy and safety in the treatment of glaucoma. METHOD A literature search in PubMed was performed on ab interno trabeculectomy with the Trabectome system, and clinical relevant information was reviewed and summarized. RESULTS Ab interno trabeculectomy with the Trabectome system on average lowered intraocular pressure (IOP to the mid-teens, and decreased the number of required glaucoma medications. Greater preoperative IOP correlated to a greater percent reduction in IOP. The success rates varied among studies, and the definition of success differed by authors. Intraoperative blood reflux was found in nearly all cases. Incidences of early hypotony and IOP spikes were low. No cases of endophthalmitis, wound leak, aqueous misdirection, choroidal hemorrhage or effusions, and irreversible visual acuity decrease (≥2 Snellen lines have been reported. Available studies had a significant amount of data overlap. Only limited data on long-term results was available. There was no randomized controlled trial to date. CONCLUSIONS Ab interno trabeculectomy with the Trabectome system is an effective and safe surgical approach for patients with various types of open angle glaucoma. On average, the procedure at least in the short term lowers IOP to the mid teens regardless of preoperative IOP with or without the aid of topical medications.

  3. Reference: DREDR1ATRD29AB [PLACE

    Full Text Available DREDR1ATRD29AB Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, N... ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant J. 34: 137-148 (2003) PubMed: 12694590; ...

  4. Preparation of national standard product of Anti-TgAb and Anti-TpoAb in our laboratory

    Objective: To standardize the China-made quantitative immunoassay kits of Anti-TgAb and Anti-TpoAb with a national standdized product of Anti-TgAb and And-TpoAb developed in our laboratory. Methods and Results: Higher titer Anti - TgAb and Anti-TpoAb serum specimens were pooled and treated with centrifuging and filtering, then freeze-dried and packaged into 2ml anpoules for preparing the national standard candidate. The results of the collaborative study showed that, the immuno-activity of the Anti-TgAb was 3916 IU/Amp in term of the 65/093, and the immuno-activity of the Anti-TpoAb was 434 IU/Amp in term of the 66/387. Conclusion: On the basis of the present study, it is proposed that the candidate standard be established as the National Standard for Anti-TgAb and Anti-TpoAb for immunoassay, the immunoactivity of the Anti-TgAb 4000IU/Amp, and that of Anti - TpoAb is 430IU/Amp. A comparative study on the quality of immunoassay kits of Anti-TgAb and Anti-TpoAb by Axsym System, Immulite 1000, Modular Analytics El70, ADVIA Centaur Assay (the most commonly used types in China) is also presented. (authors)

  5. On the Strain Rate Sensitivity of Abs and Abs Plus Fused Deposition Modeling Parts

    Vairis, A.; Petousis, M.; Vidakis, N.; Savvakis, K.

    2016-06-01

    In this work the effect of strain rate on the tensile strength of fused deposition modeling parts built with Acrylonitrile-butadiene-styrene (ABS) and ABS plus material is presented. ASTM D638-02a specimens were built with ABS and ABS plus and they were tested on a Schenck Trebel Co. tensile test machine at three different test speeds, equal, lower, and higher to the test speed required by the ASTM D638-02a standard. The experimental tensile strength results were compared and evaluated. The fracture surfaces of selected specimens were examined with a scanning electron microscope, to determine failure mode of the filament strands. It was found that, as the test speed increases, specimens develop higher tensile strength and have higher elastic modulus. Specimens tested in the highest speed of the experiment had on average about 10% higher elastic modulus and developed on average about 11% higher tensile strength.

  6. KINETIC ANALYSIS OF CO-CONDENSATION POLYMERIZATION OF AB2 AND AB MONOMERS

    Min-qiang Yu; Zhi-ping Zhou; De-yue Yan

    2004-01-01

    This work deals with the kinetics of co-condensation polymerization of AB2 and AB monomers, giving expressions of the two-dimensional molecular weight distribution function and the number/weight average molecular weights of the resulting copolymers. The two-dimensional molecular weight distribution depends on two indices, n and l, which are the respective numbers of AB2 and AB units in a copolymer species. The evolution of the two-dimensional weight and z distributions during the co-condensation polymerization has been evaluated systematically. Finally, the two-dimensional distribution was transformed into a one-dimensional molecular weight distribution with only one variable (the molecular weight of the products instead of the degree of polymerization). The calculated results show that the highly branched copolymer has a very broad molecular weight distribution when the co-condensation polymerization approaches completion.

  7. Leaching behaviour of the Swedish KBS-glasses ABS 39 and ABS 41

    The planned Swedish KBS glass corrosion investigation program comprises experiments with inactive glasses containing simulated waste, prolonged in-situ tests, the characterization of corrosion products, immiscibility studies, and corrosion experiments with hot glass. This presentation gives a short description of the entire program. It focuses thereafter on some recent leaching results with the inactive KBS glass qualities ABS 39 and ABS 41, which were leached in a manner similar to the PNL MCC-1 test procedure. 5 figures, 9 tables

  8. Thermomechanical properties of ABS/PA AND ABS/PC blends

    GUINAULT, Alain; Sollogoub, Cyrille

    2009-01-01

    International audience The significant increase of Waste Electric and Electronic Equipment (WEEE) has led to an important research in upgrading recycled engineering plastics by means of a blending technique. Classical twin-screw extrusion is compared to a new blending technique, where two polymers are combined together and then flow in several static mixers. This technique allows to obtain different morphologies of compatibilized ABS/PA or ABS/PC blends and the aim of this work is to evalu...

  9. AB077. Relationship of TPO-Ab and TSH with in vitro fertilization and embryo transfer

    Wang, Liyun

    2015-01-01

    Objective Study of thyroid peroxidase antibodies and thyroid stimulating effect on in vitro fertilization embryo transfer ending. Methods From March 2011 to October 2013 in the reproductive center in Qinghai Province People’s Hospital in vitro fertilization embryo transfer a total of 378 cycles were analyzed. (I) Basis for TPO-Ab grouping: research group is thyroid peroxidase antibody positive and thyroid function in patients with normal 69 cycles (TPO-Ab+ group), control group is thyroid per...

  10. Genetics Home Reference: GM2-gangliosidosis, AB variant

    ... of GM2-gangliosidosis, AB variant: Genetic Testing Registry: Tay-Sachs disease, variant AB These resources from MedlinePlus offer ... AB variant Activator Deficiency/GM2 Gangliosidosis Activator-deficient Tay-Sachs disease GM2 Activator Deficiency Disease GM2 gangliosidosis, type ...

  11. Investigation of high level of AsAb, EmAb in fertility female serum infected by chlamydia trachomatis

    Objective: To investigate the mechanism of chlamydia trachomatis. AsAb, EmAb in female fertility. Methods: LPS antigen of chlamydia in reproduction tract of fertility female was detected by monoclonal antibody and immunology chromatography; the content of AsAb, EmAb in serum of fertility female was detected by ELISA. Results: Infections rate of chlamydia trachomatis in fertility female was higher than that in the control AsAb, EmAb in serum of the fertility patients who were infected with chlamydia trachomatis showed a significant difference from that in the control group. Conclusion: The level of AsAb, EmAb increases in patients who have been infected with chlamydia trachomatis and these cytokines is involved in the course of female fertility

  12. Ab initio mass tensor molecular dynamics

    Tsuchida, Eiji

    2010-01-01

    Mass tensor molecular dynamics was first introduced by Bennett [J. Comput. Phys. 19, 267 (1975)] for efficient sampling of phase space through the use of generalized atomic masses. Here, we show how to apply this method to ab initio molecular dynamics simulations with minimal computational overhead. Test calculations on liquid water show a threefold reduction in computational effort without making the fixed geometry approximation. We also present a simple recipe for estimating the optimal ato...

  13. Discovering chemistry with an ab initio nanoreactor

    Wang, Lee-Ping; Titov, Alexey; McGibbon, Robert; Liu, Fang; Pande, Vijay S.; Martínez, Todd J.

    2014-01-01

    Chemical understanding is driven by the experimental discovery of new compounds and reactivity, and is supported by theory and computation that provides detailed physical insight. While theoretical and computational studies have generally focused on specific processes or mechanistic hypotheses, recent methodological and computational advances harken the advent of their principal role in discovery. Here we report the development and application of the ab initio nanoreactor – a highly accelerat...

  14. Ab initio vel ex eventu. II

    Thiessen, P. A.; Treder, H.-J.

    Jedes initium wird durch experimenta crucis zum eventus. Jedes theoretisch interpretierbare ex-eventu-Resultat führt auf ein neues Initium. Gerade dies ist die gemeinsame Aussage von Atomistik, Quantenmechanik und Relativitätstheorie.Translated AbstractAb initio vel ex eventu. IIEvery initium becomes an eventus by experimenta crucis. Every theoretically interpretable ex-eventu result leads to a new initium. Right this is the joint assertion of atomism, quantum mechanics, and relativity.

  15. Highly scalable Ab initio genomic motif identification

    Marchand, Benoît

    2011-01-01

    We present results of scaling an ab initio motif family identification system, Dragon Motif Finder (DMF), to 65,536 processor cores of IBM Blue Gene/P. DMF seeks groups of mutually similar polynucleotide patterns within a set of genomic sequences and builds various motif families from them. Such information is of relevance to many problems in life sciences. Prior attempts to scale such ab initio motif-finding algorithms achieved limited success. We solve the scalability issues using a combination of mixed-mode MPI-OpenMP parallel programming, master-slave work assignment, multi-level workload distribution, multi-level MPI collectives, and serial optimizations. While the scalability of our algorithm was excellent (94% parallel efficiency on 65,536 cores relative to 256 cores on a modest-size problem), the final speedup with respect to the original serial code exceeded 250,000 when serial optimizations are included. This enabled us to carry out many large-scale ab initio motiffinding simulations in a few hours while the original serial code would have needed decades of execution time. Copyright 2011 ACM.

  16. Undoing Gender Through Legislation and Schooling: the Case of AB 537 and AB 394 IN California, USA

    Knotts, Greg

    2009-11-01

    This article investigates California laws AB 537: The Student Safety and Violence Prevention Act of 2000, and the recently enacted AB 394: Safe Place to Learn Act. Both demand that gender identity and sexual orientation be added to the lexicon of anti-harassment protection in public education. However, despite these progressive measures, schools have an unconscious acceptance of heteronormativity and gendered norms, which undermines both the spirit and language of these laws. This paper examines how California schools can both change standard practices and realise the transformative social change that laws like AB 537 and AB 394 can instigate. I assert that the systemic implementation of these laws, through the adoption, enforcement and evaluation of existing AB 537 Task Force Recommendations, is necessary for their success. My second assertion is that AB 537 and AB 394 have the potential to change and reconstitute gender-based and heteronormative standards at school sites.

  17. 汽车ABS/ASR/ACC集成化系统%Integrated ABS/ASR/ACC System for the Car

    刘昭度; 卢江; 时开斌; 安巍

    2001-01-01

    叙述了ACC系统和ABS/ASR系统在改善汽车高速行驶主动安全性方面的功用,阐述了ACC系统是ABS/ASR系统功能的延伸、逻辑的发展及它们之间的内在联系,指出了在ABS/ASR的基础上只需增加测距装置和添加巡航控制子程序,就可方便地实现ABS/ASR/ACC集成化系统,并给出了集成化系统的控制框图和控制方法,论述了ABS/ASR/ACC集成化系统比孤立的ABS/ASR和ACC系统的优越性.%The individual functions of ACC and ABS/ASR are described in the improvements of active safety while the road vehicles travel at a high speed. Being a logic extension of and many inherent connections with ABS/BSR, ACC is easily integrated with ABS/ASR to form an integrated system by adding the headway distance*$-detecting device to the existing ABS/ASR system and expanding the ABS/ASR software. The algorithm flowcharts and control methods of the ABS/ASR/ACC are given. The advantages of the ABS/ASR/ACC system compared with those using the stand alone systems ABS, ASR and ACC are mentioned in details.

  18. Testing Distributed ABS System with Fault Injection

    Trawczyński, Dawid; Sosnowski, Janusz; Gawkowski, Piotr

    The paper deals with the problem of adapting software implemented fault injection technique (SWIFI) to evaluate dependability of reactive microcontroller systems. We present an original methodology of disturbing controller operation and analyzing fault effects taking into account reactions of the controlled object and the impact of the system environment. Faults can be injected randomly (in space and time) or targeted at the most sensitive elements of the controller to check it at high stresses. This approach allows identifying rarely encountered problems, usually missed in classical approaches. The developed methodology has been used successfully to verify dependability of ABS system. Experimental results are commented in the paper.

  19. Ab initio calculations of material strength

    Šob, Mojmír; Friák, Martin; Vitek, V.

    Tokyo : The Japan Society of Mechanical Engineers, 2003, s. 467-475. [International Symposium on Micro-Mechanical Engineering - Heat Transfer, Fluid Dynamics, Reliability and Mechanotronics.. Tsuchiura and Tsukuba (JP), 01.12.2003-03.12.2003] R&D Projects: GA AV ČR IAA1041302; GA ČR GA202/03/1351; GA MŠk OC 523.90 Institutional research plan: CEZ:AV0Z2041904 Keywords : ab initio calculations * electronic structure * theoretical tensile strength Subject RIV: BM - Solid Matter Physics ; Magnetism

  20. Ab Initio Molecular Dynamics: A Virtual Laboratory

    Hobbi Mobarhan, Milad

    2014-01-01

    In this thesis, we perform ab initio molecular dynamics (MD) simulations at the Hartree-Fock level, where the forces are computed on-the-fly using the Born-Oppenheimer approximation. The theory behind the Hartree-Fock method is discussed in detail and an implementation of this method based on Gaussian basis functions is explained. We also demonstrate how to calculate the analytic energy derivatives needed for obtaining the forces acting on the nuclei. Hartree-Fock calculations on the ground s...

  1. Germacrene D Cyclization: An Ab Initio Investigation

    William N. Setzer

    2008-01-01

    Full Text Available Essential oils that contain large concentrations of germacrene D are typically accompanied by cadinane sesquiterpenoids. The acid-catalyzed cyclization of germacrene D to give cadinane and selinane sesquiterpenes has been computationally investigated using both density functional (B3LYP/6-31G* and post Hartree-Fock (MP2/6-31G** ab initio methods. The calculated energies are in general agreement with experimentally observed product distributions, both from acid-catalyzed cyclizations as well as distribution of the compounds in essential oils.

  2. Asiakassuhdehallinnan kehityssuunnitelma : Case: Oy Combi Cool Ab

    Puikkonen, Touko

    2011-01-01

    Tässä insinöörityössä tutustuttiin Oy Combi Cool Ab:n asiakassuhdehallintaan ja siinä havaittuihin puutteisiin ja kehitystarpeisiin. Työn tarkoituksena oli luoda yritykselle ajan tasalla oleva asiakasrekisteri ja sen pohjalta kehittää asiakassuhdehallintaa etenkin myynnin, oston ja johdon henkilöstön tarpeita ajatellen muovaamalla siitä henkilöstön myynti- ja asiakaspalvelutyöskentelyä tehostava toimiva kokonaisuus. Combi Cool on vuonna 1985 perustettu kylmäalan tukkuliike, joka on vajaan 30 ...

  3. Elastic properties of intermetallic AB2 and AB5 hydrogen-absorbing compounds

    The elastic properties of AB2 and AB5 hydrogen-absorbing intermetallic compounds are reviewed. The relevance of these properties to hydrogen absorption is discussed briefly. In many cases the temperature dependence of the elastic constants of the AB2 compounds is anomalous in that the moduli do not decrease monotonically with increasing temperature. This unusual behavior appears to be associated with electronic structure effects in a number of cases. The absorption of hydrogen by polycrystalline TaV2 has a profound effect on the aggregate shear modulus, changing both the magnitude and temperature dependence significantly. This effect of hydrogen on the mechanical properties appears to occur via effects on the electronic structure. Few measurements of elastic properties have been reported for hydrogen-absorbing AB5 intermetallic compounds. The LaAlxNi5-x system has been investigated by means of measurements on polycrystals prepared by hot isostatic pressing. The moduli decrease about 8% as x increases from 0 to 1

  4. Biosorption of Acid Blue 290 (AB 290) and Acid Blue 324 (AB 324) dyes on Spirogyra rhizopus

    In this study, the biosorption of Acid Blue 290 and Acid Blue 324 on Spirogyra rhizopus, a green algae growing on fresh water, was studied with respect to initial pH, temperature, initial dye concentration and biosorbent concentration. The optimum initial pH and temperature values for AB 290 and AB 324 biosorption were found to be 2.0, 30 deg. C and 3.0, 25 deg. C, respectively. It was observed that the adsorbed AB 290 and AB 324 amounts increased with increasing the initial dye concentration up to 1500 and 750 mg/L, respectively. The Langmuir, Freundlich, Redlich-Peterson and Koble-Corrigan isotherm models were applied to the experimental equilibrium data and the isotherm constants were determined by using Polymath 4.1 software. The monolayer coverage capacities of S. rhizopus for AB 290 and AB 324 dyes were found as 1356.6 mg/g and 367.0 mg/g, respectively. The intraparticle diffusion model and the pseudo-second order kinetic model were applied to the experimental data in order to describe the removal mechanism of these acidic dyes by S. rhizopus. The pseudo-second order kinetic model described very well the biosorption kinetics of AB 290 and AB 324 dyes. Thermodynamic studies showed that the biosorption of AB 290 and AB 324 on S. rhizopus was exothermic in nature

  5. Ab initio non-relativistic spin dynamics

    Ding, Feizhi; Goings, Joshua J.; Li, Xiaosong, E-mail: xsli@uw.edu [Department of Chemistry, University of Washington, Seattle, Washington 98195 (United States); Frisch, Michael J. [Gaussian, Inc., 340 Quinnipiac St, Bldg 40, Wallingford, Connecticut 06492 (United States)

    2014-12-07

    Many magnetic materials do not conform to the (anti-)ferromagnetic paradigm where all electronic spins are aligned to a global magnetization axis. Unfortunately, most electronic structure methods cannot describe such materials with noncollinear electron spin on account of formally requiring spin alignment. To overcome this limitation, it is necessary to generalize electronic structure methods and allow each electron spin to rotate freely. Here, we report the development of an ab initio time-dependent non-relativistic two-component spinor (TDN2C), which is a generalization of the time-dependent Hartree-Fock equations. Propagating the TDN2C equations in the time domain allows for the first-principles description of spin dynamics. A numerical tool based on the Hirshfeld partitioning scheme is developed to analyze the time-dependent spin magnetization. In this work, we also introduce the coupling between electron spin and a homogenous magnetic field into the TDN2C framework to simulate the response of the electronic spin degrees of freedom to an external magnetic field. This is illustrated for several model systems, including the spin-frustrated Li{sub 3} molecule. Exact agreement is found between numerical and analytic results for Larmor precession of hydrogen and lithium atoms. The TDN2C method paves the way for the ab initio description of molecular spin transport and spintronics in the time domain.

  6. Ab initio no core full configuration approach for light nuclei

    Kim, Youngman; Shin, Ik Jae; Maris, Pieter; Vary, James P.; Forssén, Christian; Rotureau, Jimmy

    2015-10-01

    Comprehensive understanding of the structure and reactions of light nuclei poses theoretical and computational challenges. Still, a number of ab initio approaches have been developed to calculate the properties of atomic nuclei using fundamental interactions among nucleons. Among them, we work with the ab initio no core full configuration (NCFC) method and ab initio no core Gamow Shell Model (GSM). We first review these approaches and present some recent results.

  7. Workshop on automated beam steering and shaping (ABS). Proceedings

    A workshop on Automated Beam Steering and Shaping (ABS) was held at CERN in December 1998. This was the first workshop dedicated to this subject. The workshop had two major goals: to review the present status of ABS algorithms and systems around the world and to create a worldwide ABS community. These proceedings contain summary reports from all sessions, contributions from several presentations held at the workshop, and a complete set of abstracts for all presentations. (orig.)

  8. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 interactions with western corn rootworm midgut membrane binding sites.

    Huarong Li

    Full Text Available BACKGROUND: Bacillus thuringiensis (Bt Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interactions are one line of evidence that Bt protein mechanisms of action differ and that the probability of receptor-mediated cross-resistance is low. METHODOLOGY/PRINCIPAL FINDINGS: Binding site interactions were investigated between Cry34Ab1/Cry35Ab1 and coleopteran active insecticidal proteins Cry3Aa, Cry6Aa, and Cry8Ba on western corn rootworm midgut brush border membrane vesicles (BBMV. Competitive binding of radio-labeled proteins to western corn rootworm BBMV was used as a measure of shared binding sites. Our work shows that (125I-Cry35Ab1 binds to rootworm BBMV, Cry34Ab1 enhances (125I-Cry35Ab1 specific binding, and that (125I-Cry35Ab1 with or without unlabeled Cry34Ab1 does not share binding sites with Cry3Aa, Cry6Aa, or Cry8Ba. Two primary lines of evidence presented here support the lack of shared binding sites between Cry34Ab1/Cry35Ab1 and the aforementioned proteins: 1 No competitive binding to rootworm BBMV was observed for competitor proteins when used in excess with (125I-Cry35Ab1 alone or combined with unlabeled Cry34Ab1, and 2 No competitive binding to rootworm BBMV was observed for unlabeled Cry34Ab1 and Cry35Ab1, or a combination of the two, when used in excess with (125I-Cry3Aa, or (125I-Cry8Ba. CONCLUSIONS/SIGNIFICANCE: Combining two or more insecticidal proteins active against the same target pest is one tactic to delay the onset of resistance to either protein. We conclude that Cry34Ab1/Cry35Ab1 are compatible with Cry3Aa, Cry6Aa, or Cry8Ba

  9. Ising and Heisenberg models on ferrimagnetic AB sub 2 chains

    Vitoriano, C; Raposo, E P

    2002-01-01

    We study the Ising and Heisenberg models on one-dimensional ferrimagnetic bipartite chains with the special AB sub 2 unit-cell topology and experimental motivation in inorganic and organic magnetic polymers. The spin-1/2 AB sub 2 Ising case is exactly solved in the presence of an external magnetic field. We also derive asymptotical low- and high-temperature limits of several thermodynamical quantities of the zero-field classical AB sub 2 Heisenberg model. Further, the quantum spin-1/2 AB sub 2 Heisenberg model in a field is studied using a mean-field approach.

  10. Ab Initio Path to Heavy Nuclei

    Binder, Sven; Calci, Angelo; Roth, Robert

    2014-01-01

    We present the first ab initio calculations of nuclear ground states up into the domain of heavy nuclei, spanning the range from 16-O to 132-Sn based on two- plus three-nucleon interactions derived within chiral effective field theory. We employ the similarity renormalization group for preparing the Hamiltonian and use coupled-cluster theory to solve the many-body problem for nuclei with closed sub-shells. Through an analysis of theoretical uncertainties resulting from various truncations in this framework, we identify and eliminate the technical hurdles that previously inhibited the step beyond medium-mass nuclei, allowing for reliable validations of nuclear Hamiltonians in the heavy regime. Following this path we show that chiral Hamiltonians qualitatively reproduce the systematics of nuclear ground-state energies up to the neutron-rich Sn isotopes.

  11. Guiding ab initio calculations by alchemical derivatives

    to Baben, M.; Achenbach, J. O.; von Lilienfeld, O. A.

    2016-03-01

    We assess the concept of alchemical transformations for predicting how a further and not-tested change in composition would change materials properties. This might help to guide ab initio calculations through multidimensional property-composition spaces. Equilibrium volumes, bulk moduli, and relative lattice stability of fcc and bcc 4d transition metals Zr, Nb, Mo, Tc, Ru, Rh, Pd, and Ag are calculated using density functional theory. Alchemical derivatives predict qualitative trends in lattice stability while equilibrium volumes and bulk moduli are predicted with less than 9% and 28% deviation, respectively. Predicted changes in equilibrium volume and bulk moduli for binary and ternary mixtures of Rh-Pd-Ag are in qualitative agreement even for predicted bulk modulus changes as large as +100% or -50%. Based on these results, it is suggested that alchemical transformations could be meaningful for enhanced sampling in the context of virtual high-throughput materials screening projects.

  12. Ab initio molar volumes and Gaussian radii.

    Parsons, Drew F; Ninham, Barry W

    2009-02-12

    Ab initio molar volumes are calculated and used to derive radii for ions and neutral molecules using a spatially diffuse model of the electron distribution with Gaussian spread. The Gaussian radii obtained can be used for computation of nonelectrostatic ion-ion dispersion forces that underlie Hofmeister specific ion effects. Equivalent hard-sphere radii are also derived, and these are in reasonable agreement with crystalline ionic radii. The Born electrostatic self-energy is derived for a Gaussian model of the electronic charge distribution. It is shown that the ionic volumes used in electrostatic calculations of strongly hydrated cosmotropic ions ought best to include the first hydration shell. Ionic volumes for weakly hydrated chaotropic metal cations should exclude electron overlap (in electrostatic calculations). Spherical radii are calculated as well as nonisotropic ellipsoidal radii for nonspherical ions, via their nonisotropic static polarizability tensors. PMID:19140766

  13. Discovering chemistry with an ab initio nanoreactor

    Martinez, Todd

    Traditional approaches for modeling chemical reaction networks such as those involved in combustion have focused on identifying individual reactions and using theoretical approaches to explore the underlying mechanisms. Recent advances involving graphical processing units (GPUs), commodity products developed for the videogaming industry, have made it possible to consider a distinct approach wherein one attempts to discover chemical reactions and mechanisms. We provide a brief summary of these developments and then discuss the concept behind the ``ab initio nanoreactor'' which explores the space of possible chemical reactions and molecular species for a given stoichiometry. The nanoreactor concept is exemplified with an example to the Urey-Miller reaction network which has been previously advanced as a potential model for prebiotic chemistry. We briefly discuss some of the future directions envisioned for the development of this nanoreactor concept.

  14. Operator evolution for ab initio nuclear theory

    Schuster, Micah D; Johnson, Calvin W; Jurgenson, Eric D; Navratil, Petr

    2014-01-01

    The past two decades have seen a revolution in ab initio calculations of nuclear properties. One key element has been the development of a rigorous effective interaction theory, applying unitary transformations to soften the nuclear Hamiltonian and hence accelerate the convergence as a function of the model space size. For consistency, however, one ought to apply the same transformation to other operators when calculating transitions and mean values from the eigenstates of the renormalized Hamiltonian. Working in a translationally-invariant harmonic oscillator basis for the two- and three-nucleon systems, we evolve the Hamiltonian, square-radius and total dipole strength operators by the similarity renormalization group (SRG). The inclusion of up to three-body matrix elements in the 4He nucleus all but completely restores the invariance of the expectation values under the transformation. We also consider a Gaussian operator with adjustable range and find at short ranges an increased contribution from such ind...

  15. Ab initio alpha-alpha scattering

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Luu, Thomas; Meißner, Ulf-G.

    2015-12-01

    Processes such as the scattering of alpha particles (4He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei—nuclei with even and equal numbers of protons and neutrons—is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the ‘adiabatic projection method’ to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  16. Ab initio alpha-alpha scattering.

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  17. Ablation dynamics in laser sclerotomy ab externo

    Brinkmann, Ralf; Droege, Gerit; Mohrenstecher, Dirk; Scheu, M.; Birngruber, Reginald

    1996-01-01

    Laser sclerostomy ab externo with flashlamp excited mid-IR laser systems emitting in the 2-3 micrometer spectral range is in phase II clinical trials. Although acutely high success rates were achieved, the restenosis rate after several months is about 40%. Laser pulses of several hundreds of microseconds, known to induce thermo-mechanical explosive evaporation were used for this procedure. We investigated the ablation dynamics in tissue and the cavitation bubble dynamics in water by means of an Er:YAG laser system to estimate the extent of mechanical damage zones in the sclera and in the anterior chamber, which may contribute to the clinical failure. We found substantial mechanical tissue deformation during the ablation process caused by the cavitation effects. Stress waves up to several bar generated by explosive evaporization were measured. The fast mechanical stretching and collapsing of the scleral tissue induced by cavitation resulted in tissue dissection as could be proved by flash photography and histology. The observed high restenosis might be a result of a subsequent enhanced wound healing process. Early fistula occlusions due to iris adherences, observed in about 20% of the clinical cases may be attributed to intraocular trauma induced by vapor bubble expansion through the anterior chamber after scleral perforation. An automatic feedback system minimizing adverse effects by steering and terminating the laser process during scleral fistulization is demonstrated. Moreover, a new approach in laser sclerostomy ab externo is presented using a cw-IR laser diode system emitting at the 1.94 micrometer mid-IR water absorption peak. This system was used in vitro and showed smaller damage zones compared to the pulsed laser radiation.

  18. Dicty_cDB: FCL-AB06 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AB06 (Link to dictyBase) - - - Contig-U15603-1 FCL-AB06P ...(Link to Original site) FCL-AB06F 694 FCL-AB06Z 573 FCL-AB06P 1267 - - Show FCL-AB06 Library FCL (Link to library) Clone ID FCL-...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AB/FCL-AB06Q....Seq.d/ Representative seq. ID FCL-AB06P (Link to Original site) Representative DNA sequence >FCL-AB06 (FCL-AB06Q) /CSM/FCL/FCL-...AB/FCL-AB06Q.Seq.d/ CAATTTTATCGGAACCATCAATTCATGCAGGTTCTGTATTTAGTATTAATTTAACCAAAT CTAGACA

  19. A Case of Laptop Computer-Induced Erythema Ab Igne

    Nurettin Özgür Doğan

    2014-12-01

    Full Text Available Erythema ab igne, also known as toasted skin syndrome, is a skin reaction characterized by reticulate erythema, brown pigmentation, and telangiectasia. In some cases, epidermal atrophy and scaling are also identified. The condition is usually caused by prolonged exposure to a source of heat or infrared radiation. Here, we report a case of erythema ab igne associated with laptop computer use.

  20. Kopplung von Dichtefunktional- und ab-initio-Methoden

    Goll, Erich

    2008-01-01

    Im Rahmen der Doktorarbeit wurde untersucht, inwieweit die Kopplung von Dichtefunktionalmethoden und ab-initio-Korrelationsmethoden der Quantenchemie eine Verbesserung bezüglich beider Grenzmethoden erbringt. Die Kopplung erfolgt durch eine Aufspaltung des interelektronischen Hamiltonoperators (abstoßende Coulombwechselwirkung). Die kurzreichweitige Wechselwirkung wird mit Dichtefunktionaltheorie behandelt, die langreichweitige mit Hilfe von ab-initio-Methoden. Diese Aufteilung soll dazu dien...

  1. Effects of Cry1F and Cry34Ab1/35Ab1 on storage pests

    Two crystalline protoxins from Bacillus thuringiensis (Bt), Cry1Fa1 and Cry34Ab1/Cry35Ab1 (Cry1F, Cry34/35), were evaluated for efficacy against lepidopteran and coleopteran storage pests. Cry1F was tested against the lepidopterans Sitotroga cerealella (Angoumois grain moth) and colonies of the lep...

  2. Preparation of grafted ABS and compatibilization of r-PET/ABS blends by the grafted ABS%ABS接枝物的制备及其对r-PET/ABS的增容作用

    陈智军; 王益龙; 郑辰

    2012-01-01

    Two kinds of grafted acrylonitrile-butadiene-styrene copolymer(ABS), i.e. maleic anhydride (MAH) grafted ABS(ABS-g-MAH) and glycidyl methacrylate (GMA) grafted ABS (ABS-g-GMA), were prepared via reactive extrusion and were used as compatibilizer for recycled polyethylene glycol terephthalate (r-PET)/ABS blends. The results show that ABS-g-MAH and ABS-g-GMA can greatly improve the impact strength of the blends. ABS-g-MAH is superior to ABS-g-GMA in compatibilization effect. The optimal compatibilization effect is acquired when the grafting ratio of ABS-g-MAH is 1.35% and the mass content of the copolymer is 5%. Under such conditions, the notched and unnotched *Charpy impact strength of the r-PET/ABS/ABS-g--MAH blends rise by 42% and 23%, respectively, in comparison with those of r-PET/ ABS. The observation by scanning electron microscope(SEM) shows that adding grafted ABS can make ABS be dispersed more homogeneously in the r-PET continuous phase and make particle size more even.%通过反应挤出法制备马来酸酐(MAH)接枝丙烯腈-丁二烯-苯乙烯三元共聚物(ABS)(ABS-g-MAH)和甲基丙烯酸缩水甘油酯(GMA)接枝ABS(ABS-g-GMA),将其用于增容回收聚对苯二甲酸乙二酯(PET)瓶片(r-PET)/ABS共混物,发现能显著提高其混物的冲击强度.ABS-g-MAH的增容效果优于ABS-g-GMA;ABS-g-MAH的接枝率为1.35%,w(ABS-g-MAH)为5%时对r-PET/ABS的增容作用最佳,此时r-PET/ABS/ABS-g-MAH的简支梁缺口冲击强度和无缺口冲击强度比r-PET/ABS分别提高了42%和23%.扫描电子显微镜观察表明,加入ABS接枝物能使ABS在r-PET连续相中的分散更均匀,粒径尺寸更均一.

  3. Structural and biophysical characterization of Bacillus thuringiensis insecticidal proteins Cry34Ab1 and Cry35Ab1.

    Matthew S Kelker

    Full Text Available Bacillus thuringiensis strains are well known for the production of insecticidal proteins upon sporulation and these proteins are deposited in parasporal crystalline inclusions. The majority of these insect-specific toxins exhibit three domains in the mature toxin sequence. However, other Cry toxins are structurally and evolutionarily unrelated to this three-domain family and little is known of their three dimensional structures, limiting our understanding of their mechanisms of action and our ability to engineer the proteins to enhance their function. Among the non-three domain Cry toxins, the Cry34Ab1 and Cry35Ab1 proteins from B. thuringiensis strain PS149B1 are required to act together to produce toxicity to the western corn rootworm (WCR Diabrotica virgifera virgifera Le Conte via a pore forming mechanism of action. Cry34Ab1 is a protein of ∼14 kDa with features of the aegerolysin family (Pfam06355 of proteins that have known membrane disrupting activity, while Cry35Ab1 is a ∼44 kDa member of the toxin_10 family (Pfam05431 that includes other insecticidal proteins such as the binary toxin BinA/BinB. The Cry34Ab1/Cry35Ab1 proteins represent an important seed trait technology having been developed as insect resistance traits in commercialized corn hybrids for control of WCR. The structures of Cry34Ab1 and Cry35Ab1 have been elucidated to 2.15 Å and 1.80 Å resolution, respectively. The solution structures of the toxins were further studied by small angle X-ray scattering and native electrospray ion mobility mass spectrometry. We present here the first published structure from the aegerolysin protein domain family and the structural comparisons of Cry34Ab1 and Cry35Ab1 with other pore forming toxins.

  4. Ab initio two-component Ehrenfest dynamics

    We present an ab initio two-component Ehrenfest-based mixed quantum/classical molecular dynamics method to describe the effect of nuclear motion on the electron spin dynamics (and vice versa) in molecular systems. The two-component time-dependent non-collinear density functional theory is used for the propagation of spin-polarized electrons while the nuclei are treated classically. We use a three-time-step algorithm for the numerical integration of the coupled equations of motion, namely, the velocity Verlet for nuclear motion, the nuclear-position-dependent midpoint Fock update, and the modified midpoint and unitary transformation method for electronic propagation. As a test case, the method is applied to the dissociation of H2 and O2. In contrast to conventional Ehrenfest dynamics, this two-component approach provides a first principles description of the dynamics of non-collinear (e.g., spin-frustrated) magnetic materials, as well as the proper description of spin-state crossover, spin-rotation, and spin-flip dynamics by relaxing the constraint on spin configuration. This method also holds potential for applications to spin transport in molecular or even nanoscale magnetic devices

  5. Ab initio gene identification in metagenomic sequences.

    Zhu, Wenhan; Lomsadze, Alexandre; Borodovsky, Mark

    2010-07-01

    We describe an algorithm for gene identification in DNA sequences derived from shotgun sequencing of microbial communities. Accurate ab initio gene prediction in a short nucleotide sequence of anonymous origin is hampered by uncertainty in model parameters. While several machine learning approaches could be proposed to bypass this difficulty, one effective method is to estimate parameters from dependencies, formed in evolution, between frequencies of oligonucleotides in protein-coding regions and genome nucleotide composition. Original version of the method was proposed in 1999 and has been used since for (i) reconstructing codon frequency vector needed for gene finding in viral genomes and (ii) initializing parameters of self-training gene finding algorithms. With advent of new prokaryotic genomes en masse it became possible to enhance the original approach by using direct polynomial and logistic approximations of oligonucleotide frequencies, as well as by separating models for bacteria and archaea. These advances have increased the accuracy of model reconstruction and, subsequently, gene prediction. We describe the refined method and assess its accuracy on known prokaryotic genomes split into short sequences. Also, we show that as a result of application of the new method, several thousands of new genes could be added to existing annotations of several human and mouse gut metagenomes. PMID:20403810

  6. On the hierarchical parallelization of ab initio simulations

    Ruiz-Barragan, Sergi; Shiga, Motoyuki

    2016-01-01

    A hierarchical parallelization has been implemented in a new unified code PIMD-SMASH for ab initio simulation where the replicas and the Born-Oppenheimer forces are parallelized. It is demonstrated that ab initio path integral molecular dynamics simulations can be carried out very efficiently for systems up to a few tens of water molecules. The code was then used to study a Diels-Alder reaction of cyclopentadiene and butenone by ab initio string method. A reduction in the reaction energy barrier is found in the presence of hydrogen-bonded water, in accordance with experiment.

  7. Tensile deformation mechanisms of ABS/PMMA/EMA blends

    Wang, S. H.; Gao, J.; Lin, S. X.; Zhang, P.; Huang, J.; Xu, L. L.

    2014-08-01

    The tensile deformation mechanisms of acrylonitrile - butadiene - styrene (ABS) / polymethyl methacrylate (PMMA) blends toughened by ethylene methacrylate (EMA) copolymer was investigated by analysing the fracture morphology. ABS/PMMA was blended with EMA copolymer by melt mixing technique using co-rotating twin extruder. Tensile tests show that the elongation at break of ABS/PMMA blends can be efficiently improved with the increase in EMA content. Fracture morphology of ABS/PMMA/EMA blends reveals that the material yield induced by hollowing-out of EMA particles and its propagation into yield zone is the main toughening mechanism. Moreover, the appearance that EMA particles in the central area are given priority to hollowing-out may be related to the skin-core structure of the injection moulded parts caused by the different cooling rate between surface and inside in the process of injection moulding.

  8. Toward ab initio density functional theory for nuclei

    Drut, J. E.; Furnstahl, R. J.; Platter, L.

    2009-01-01

    We survey approaches to nonrelativistic density functional theory (DFT) for nuclei using progress toward ab initio DFT for Coulomb systems as a guide. Ab initio DFT starts with a microscopic Hamiltonian and is naturally formulated using orbital-based functionals, which generalize the conventional local-density-plus-gradients form. The orbitals satisfy single-particle equations with multiplicative (local) potentials. The DFT functionals can be developed starting from internucleon forces using ...

  9. Ab-initio study of thermoelectricity of layered tellurium compounds

    Ibarra Hernández, Wilfredo

    2015-01-01

    In this thesis, we explore the electronic, dynamic and thermoelectric properties of different tellurium-based compounds. We perform ab-initio calculations within the Vienna Ab-initio Simulation Package (VASP) that works in the framework of Density Functional Theory (DFT). For the thermoelectric properties, we use the Boltztrap code that solves the Boltzmann Transport Equations (BTE) for electrons within the Constant Relaxation Time Approximation (CRTA). This computational pa...

  10. Evaluation of the Urotest AB antibacterial substance detection test.

    Blondeau, J. M.; Yaschuk, Y; Galenzoski, D; Hrabok, D; Isaacson, M; Lee, L.(Department of Physics, Yale University, New Haven, CT, USA); Link, H; Walshaw, L

    1994-01-01

    The Urotest AB was used to detect antimicrobial substances in urine samples. Of 1022 urine specimens evaluated, Urotest AB detected inhibitors in 38.9%. Of 159 urine specimens from patients thought to be taking an antibiotic, inhibitors were detected in 80.5%. This test may help to explain culture negative urine samples from symptomatic patients, and could help elucidate treatment failures and the epidemiology of antibiotic resistance.

  11. Deriving conservation laws for ABS lattice equations from Lax pairs

    In this paper we derive infinitely many conservation laws for ABS lattice equations from their Lax pairs. These conservation laws can be algebraically expressed by means of some known polynomials. For each equation, the infinitely many conservation laws are not equivalent and are nontrivial. We also show that the (H1), (H2), (H3), (Q1), (Q2), (Q3) and (A1) equations in the ABS list share a generic discrete Riccati equation. (paper)

  12. 基于ABS的ABS/ASR集成液压系统设计%ABS/ASR Integrated Hydraulic System Based on ABS

    马岳峰; 刘昭度; 吴利军; 王国业

    2004-01-01

    介绍一种基于JETTA GTX轿车ABS液压系统的ABS/ASR集成液压系统改造方案,该ABS/ASR集成液压系统在原有ABS液压系统的基础上增加较少的液压元件实现全部ABS功能和ASR制动干预控制功能,改造后的集成系统工作可靠,不影响原有的常规制动和ABS制动过程.

  13. Ab Initio No-Core Shell Model

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory (χEFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The resulting NN

  14. Ab Initio No-Core Shell Model

    Barrett, B R; Navratil, P; Vary, J P

    2011-04-11

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory ({chi}EFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The

  15. Study on Exothermic Oxidation of Acrylonitrile-butadiene-styrene (ABS Resin Powder with Application to ABS Processing Safety

    Jenq-Renn Chen

    2010-08-01

    Full Text Available Oxidative degradation of commercial grade ABS (Acrylonitrile-butadiene-styrene resin powders was studied by thermal analysis. The instabilities of ABS containing different polybutadiene (PB contents with respect to temperature were studied by Differential Scanning Calorimeter (DSC. Thermograms of isothermal test and dynamic scanning were performed. Three exothermic peaks were observed and related to auto-oxidation, degradation and oxidative decomposition, respectively. Onset temperature of the auto-oxidation was determined to be around 193 °C. However, threshold temperature of oxidation was found to be as low as 140 °C by DSC isothermal testing. Another scan of the powder after degeneration in air showed an onset temperature of 127 °C. Reactive hazards of ABS powders were verified to be the exothermic oxidation of unsaturated PB domains, not the SAN (poly(styrene-acrylonitrile matrix. Heat of oxidation was first determined to be 2,800 ± 40 J per gram of ABS or 4,720 ± 20 J per gram of PB. Thermal hazards of processing ABS powder are assessed by adiabatic temperature rise at process conditions. IR spectroscopy associated with heat of oxidation verified the oxidative mechanism, and these evidences excluded the heat source from the degradation of SAN. A specially prepared powder of ABS without adding anti-oxidant was analyzed by DSC for comparing the exothermic behaviors. Exothermic onset temperatures were determined to be 120 °C and 80 °C by dynamic scanning and isothermal test, respectively. The assessment successfully explained fires and explosions in an ABS powder dryer and an ABS extruder.

  16. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 Interactions with Western Corn Rootworm Midgut Membrane Binding Sites

    Huarong Li; Monica Olson; Gaofeng Lin; Timothy Hey; Sek Yee Tan; Narva, Kenneth E.

    2013-01-01

    BACKGROUND: Bacillus thuringiensis (Bt) Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry) proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interact...

  17. Comparisons of metallic clusters imbedded in the surface oxide of AB2, AB5, and A2B7 alloys

    Research highlights: Different growth mechanisms have been found on the metallic inclusions imbedded in the surface oxides of AB2, AN5, and A2B7. The high power performance has been correlated to the size and distribution of these inclusions. - Abstract: In order to clarify the relationship between the saturation magnetization of the activated metal hydride material and electrode performance, the specific power measured at both low temperature (-30 oC) and operating temperature (35 oC) of a nickel metal hydride battery were compared with magnetization measurements. It is found specific powers measured at both temperatures correlate well with the saturated magnetic susceptibility, which is proportional to the total amount of metallic nickel clusters distributed within the surface oxide layer after activation. Both the gas phase storage and electrochemical properties of the activated AB2, AB5, and A2B7 alloys were investigated. While the AB2 alloy has the highest storage capacity, it also has the lowest high-rate dischargeability among the three alloys. This suggests a competition between storage capacity and rate capability in these materials. In an alkaline etching experiment, it is established the saturation magnetization increases with etching time in these AB2, AB5, and A2B7 alloys. The saturation magnetization after a 4 h etches track the changes in the high-rate dischargeability. The increase is attributed to the growth in size of the metallic inclusions for the AB2 and Nd-A2B7 samples, and from an increase in the number of metallic inclusion in the case of AB5 and La-A2B7. Transmission electron microscope studies calibrate the size inferred from magnetic susceptibility studies and also the Ni-dominated FCC structure of the metallic clusters.

  18. Dicty_cDB: FC-AB09 [Dicty_cDB

    Full Text Available /dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AB/FC-AB09Q.Seq.d/ Representative seq. ID ...FC-AB09F (Link to Original site) Representative DNA sequence >FC-AB09 (FC-AB09Q) /CSM/FC/FC-AB/FC-AB09Q.Seq....QNQKKKKKKKKKKKKKKKKKK Translated Amino Acid sequence (All Frames) Frame A: desashkqlckiynkihyliifinfvlvvdlyp...0.00 m_ : 1.00 72.0 %: nuclear 16.0 %: cytoplasmic 8.0 %: mitochondrial 4.0 %: cytoskeletal >> prediction fo...kkkrkktkpkekkkkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits)

  19. Dicty_cDB: FCL-AB19 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AB19 (Link to dictyBase) - - - Contig-U15232-1 FCL-AB19Z ...(Link to Original site) - - FCL-AB19Z 697 - - - - Show FCL-AB19 Library FCL (Link to library) Clone ID FCL-A... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AB/FCL-AB19Q.Seq.d/ Representative seq. ID FCL-...AB19Z (Link to Original site) Representative DNA sequence >FCL-AB19 (FCL-AB19Q) /CSM/FCL/FCL-AB/FCL-...KLINFSIFQ* Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value FCL-

  20. Hydrogenation of AB5 and AB2 metal hydride alloys studied by in situ X-ray diffraction

    Highlights: • Hydrogenation process of an AB5 alloy and two AB2 alloys were studied by quasi in-situ XRD. • In both AB5 and AB2 metal alloy, hydrogen occupation sites on the half-plane were taken first. • In the C14/C15 mixed alloy, C14 phase is the main hydrogen storage phase with a lower equilibrium pressure. • In the C14/C15 mixed alloy, C15 phase is the catalyst hydrogen storage phase with a higher equilibrium pressure. • Small amount of C15 was hydrided first but not completed until C14 phase was fully hydrided. - Abstract: The evolution of lattice constants and abundances of metal (α) and metal hydride (β) phases during the hydrogenation process of an AB5 alloy with a CaCu5 crystal structure, an AB2 alloy with a predominating C14 structure, and a C14/C15-mixed AB2 alloy were reported. The preferred hydrogen insertion sites at different states of charge in both the α and β phases were studied based on the lattice parameter changes during hydrogenation. During the hydrogenation of the AB5 alloy, the ratio between lattice parameters a and c (a/c ratio) in the α phase decreases, stabilizes, and then decreases again while that in the β phase decreases and then stabilizes. The trends in unit cell volume changes are increasing, plateauing, and increasing again in the α phase and increasing followed by plateauing in the β phase as the hydrogenation level increases. In the C14-predominant AB2 alloy, the a/c ratio in the α phase increases at the beginning and then stabilizes while that in the β phase remains about the same and then increases during the addition of hydrogen. Moreover, the unit cell volume in the α phase increases slightly during hydrogenation, comparing to the increasing, decreasing, and then increasing trend in the β phase. In the C14/C15 mixed AB2 alloy, hydrogenation of the C15 phase starts at the beginning and promotes the hydrogenation of the C14 phase. The C14 phase, as the main hydrogen storage phase, completes hydrogenation

  1. Study of the mechanical properties of recycled abs and recovery throught mixing with SEBS

    Peydro, M. A.; Juárez Varón, David; Samuel SANCHEZ-CABALLERO; Pla-Ferrando, R

    2014-01-01

    Recovery of recycled acrylonitrile butadiene styrene (ABS) through mixing with styrene-ethylene/butylene- styrene (SEBS) has been studied in this paper. To simulate recycled ABS, virgin ABS was processed through 5 cycles, at extreme processing temperatures, 220 oC and 260 oC. The virgin ABS, the virgin SEBS, the recycled ABS and the mixtures were mechanically characterized after the various cycles of reprocessing in order to evaluate their corresponding properties and correlate them with the...

  2. Ab Initio Studies of Stratospheric Ozone Depletion Chemistry

    Lee, Timothy J.; Head-Gordon, Martin; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    An overview of the current understanding of ozone depletion chemistry, particularly with regards the formation of the so-called Antarctic ozone hole, will be presented together with an outline as to how ab initio quantum chemistry can be used to further our understanding of stratospheric chemistry. The ability of modern state-of-the art ab initio quantum chemical techniques to characterize reliably the gas-phase molecular structure, vibrational spectrum, electronic spectrum, and thermal stability of fluorine, chlorine, bromine and nitrogen oxide species will be demonstrated by presentation of some example studies. The ab initio results will be shown to be in excellent agreement with the available experimental data, and where the experimental data are either not known or are inconclusive, the theoretical results are shown to fill in the gaps and to resolve experimental controversies. In addition, ab initio studies in which the electronic spectra and the characterization of excited electronic states of halogen oxide species will also be presented. Again where available, the ab initio results are compared to experimental observations, and are used to aid in the interpretation of experimental studies.

  3. The over-expression of two transcription factors, ABS5/bHLH30 and ABS7/MYB101, leads to upwardly curly leaves.

    Rui An

    Full Text Available Proper leaf development is essential for plant growth and development, and leaf morphogenesis is under the control of intricate networks of genetic and environmental cues. We are interested in dissecting these regulatory circuits genetically and report here the isolation of two Arabidopsis dominant mutants, abnormal shoot5-1D (abs5-1D and abs7-1D identified through activation tagging screens. Both abs5-1D and abs7-1D display an intriguing upwardly curly leaf phenotype. Molecular cloning showed that the elevated expression of a bHLH transcription factor ABS5/T5L1/bHLH30 or a MYB transcription factor ABS7/MYB101 is the cause for the abnormal leaf phenotypes found in abs5-1D or abs7-1D, respectively. Protoplast transient expression assays confirmed that both ABS5/T5L1 and ABS7/MYB101 are targeted to the nucleus. Interestingly, the expression domains of auxin response reporter DR5::GUS were abnormal in leaves of abs5-1D and ABS5/T5L1 over-expression lines. Moreover, cotyledon venation analysis showed that more areoles and free-ending veins are formed in abs5-1D. We found that the epidermis-specific expressions of ABS5/T5L1 or ABS7/MYB101 driven by the Arabidopsis Meristem Layer 1 promoter (PAtML1 were sufficient to recapitulate the curly leaf phenotype of abs5-1D or abs7-1D. In addition, PAtML1::ABS5 lines exhibited similar changes in DR5::GUS expression patterns as those found in 35S-driven ABS5/T5L1 over-expression lines. Our work demonstrated that enhanced expressions of two transcription factors, ABS5/T5L1 and ABS7/MYB101, are able to alter leaf lamina development and reinforce the notion that leaf epidermis plays critical roles in regulating plant organ morphogenesis.

  4. Ab initio simulation of transport phenomena in rarefied gases.

    Sharipov, Felix; Strapasson, José L

    2012-09-01

    Ab initio potentials are implemented into the direct simulation Monte Carlo (DSMC) method. Such an implementation allows us to model transport phenomena in rarefied gases without any fitting parameter of intermolecular collisions usually extracted from experimental data. Applying the method proposed by Sharipov and Strapasson [Phys. Fluids 24, 011703 (2012)], the use of ab initio potentials in the DSMC requires the same computational efforts as the widely used potentials such as hard spheres, variable hard sphere, variable soft spheres, etc. At the same time, the ab initio potentials provide more reliable results than any other one. As an example, the transport coefficients of a binary mixture He-Ar, viz., viscosity, thermal conductivity, and thermal diffusion factor, have been calculated for several values of the mole fraction. PMID:23030889

  5. Surface Modification of AB2. and AB5 Hydrogen Storage Alloy Electrodes by the Hot-Charging Treatment

    2001-01-01

    The effect of the hot-charging treatment on the performance ofAB2 and AB5 hydrogen storage alloy electrodes was investigated. The result showed that the treatment can markedly improve the voltage plateau ratio (VPR), the high rate discharge ability (HRDA), the diffusion coefficient of hydrogen DH and the discharge capacity of the AB2 hydrogen storage alloy electrode. The SEM analysis showed that the hot-charging treatment brings about a Ni-rich surface due to the dissolution of Zr oxides. It is also very helpful for the improvement of the kinetic properties of AB2 hydrogen storage alloy electrode because the microcracking o.f the surface results in fresh surface. This can be the basic modification treatment for NiMH battery used in electric vehicles (EVs) in the future. But for AB5 type alloys, the treatment has the disadvantage of impairing the comprehensive electrochemical properties, because the surface of the alloy may be corroded during the treatment. The mechanism of the surface modification of the electrode is also proposed.

  6. Stimulation of UvrD helicase by UvrAB.

    Atkinson, John; Guy, Colin P; Cadman, Chris J; Moolenaar, Geri F; Goosen, Nora; McGlynn, Peter

    2009-04-01

    Helicases play critical roles in all aspects of nucleic acid metabolism by catalyzing the remodeling of DNA and RNA structures. UvrD is an abundant helicase in Escherichia coli with well characterized functions in mismatch and nucleotide excision repair and a possible role in displacement of proteins such as RecA from single-stranded DNA. The mismatch repair protein MutL is known to stimulate UvrD. Here we show that the nucleotide excision repair proteins UvrA and UvrB can together stimulate UvrD-catalyzed unwinding of a range of DNA substrates containing strand discontinuities, including forked DNA substrates. The stimulation is specific for UvrD, as UvrAB failed to stimulate Rep helicase, a UvrD homologue. Moreover, although UvrAB can promote limited strand displacement, stimulation of UvrD did not require the strand displacement function of UvrAB. We conclude that UvrAB, like MutL, modulate UvrD helicase activity. This stimulation likely plays a role in DNA strand and protein displacement by UvrD in nucleotide excision repair. Promotion of UvrD-catalyzed unwinding of nicked duplexes by UvrAB may also explain the need for UvrAB and UvrD in Okazaki fragment processing in cells lacking DNA polymerase I. More generally, these data support the idea that helicase activity is regulated in vivo, with helicases acting as part of multisubunit complexes rather than in isolation. PMID:19208629

  7. Bruksmakt och maktbruk : Robertsfors AB 1897-1968

    Holmström, Per

    1988-01-01

    This thesis studies seven strategic decisions made in the family-owned forestry company Robertsfors AB, in Northern Sweden. During the present century Ro­bertsfors AB has developed from a patriarchally concern controlled into a capi­talistic industrial company. This also meant a radical change in the decision­making process. Two factors were decisive in this process: the managing direc­tor's values, and altered power relationships both within the company and exter­nally in relation to e g sta...

  8. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1962. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses (≥ 100 mrem/quarter) is for the whole of AB Atomenergi during this year 74. 2 manrem corresponding to about 50 mrem/year and person or 1 % of the maximum permissible dose. 32500 gamma films and 6200 neutron films have been evaluated. The total number of urine analyses is 2700 and of whole body measurements 10

  9. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1963. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses during the year is for AB Atomenergi 64.2 manrem which, distributed over the whole company personnel, corresponds to about 40 mrem per year and person or about 1 % of the maximum permissible dose. 37800 gamma films and 6700 neutron films have been evaluated. The total number of urine analyses is 3603 and of whole body measurements 211

  10. Intern kontroll : - En studie om Schroff Scandinavia ABs interna kontroll

    Huldt, Martin; Björksved, Patrick

    2014-01-01

    Sammanfattning: ”Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll” Datum:  2014-06-11 Nivå: Kandidatuppsats i företagsekonomi, 15 ECTS Institution: Akademin för Ekonomi, Samhälle och Teknik, EST,                 Mälardalen Högskola Författare: Patrick Björksved, Martin Huldt Titel: Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll Handledare : Magnus Linderström Nyckelord: Intern kontroll, intern revision, intern styrning, COSO-modellen, Lean product...

  11. Simplest AB-Thermonuclear Space Propulsion and Electric Generator

    Bolonkin, Alexander

    2007-01-01

    The author applies, develops and researches mini-sized Micro- AB Thermonuclear Reactors for space propulsion and space power systems. These small engines directly convert the high speed charged particles produced in the thermonuclear reactor into vehicle thrust or vehicle electricity with maximum efficiency. The simplest AB-thermonuclear propulsion offered allows spaceships to reach speeds of 20,000 50,000 km/s (1/6 of light speed) for fuel ratio 0.1 and produces a huge amount of useful elect...

  12. Utveckling av ergoterapitjänster vid Helsingfors ergoterapi Ab

    Sandells, Linn

    2015-01-01

    Syftet med examensarbetet är att ta fram kvalitativa rekommendationer på ergoterapitjänster för barn i behov av särskilt stöd. Det har gjorts genom en processinriktad metod, rekommendationerna på ergoterapitjänster har tagits fram för Helsingfors ergoterapi Ab. Aktivitetsrättvisa är den teoretiska referensramen i arbetet. Den frågeställning som besvarats är vilka ergoterapitjänster kan rekommenderas till Helsingfors ergoterapi Ab. För att uppnå resultatet har materialinsamling och intervjuer ...

  13. Towards new horizons in ab initio nuclear structure theory

    We review recent advances in ab initio nuclear structure theory, which have changed the horizons of this field. Starting from chiral effective field theory to construct the nuclear Hamiltonian and the similarity renormalization group to further soften it, we address several many-body approaches that have seen major developments over the past few years. We show that the domain of ab initio nuclear structure theory has been pushed well beyond the p-shell and that quantitative QCD-based predictions are becoming possible all the way from the proton to the neutron drip line up into the medium-mass regime. (authors)

  14. Use of ab initio quantum chemical methods in battery technology

    Deiss, E. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1997-06-01

    Ab initio quantum chemistry can nowadays predict physical and chemical properties of molecules and solids. An attempt should be made to use this tool more widely for predicting technologically favourable materials. To demonstrate the use of ab initio quantum chemistry in battery technology, the theoretical energy density (energy per volume of active electrode material) and specific energy (energy per mass of active electrode material) of a rechargeable lithium-ion battery consisting of a graphite electrode and a nickel oxide electrode has been calculated with this method. (author) 1 fig., 1 tab., 7 refs.

  15. P-V Relation for Mercuric Calcogenides: Ab Initio Method

    G. Misra

    2011-01-01

    Full Text Available Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P, volume (V and temperature (T that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This ab initio method is extended to derive the equation of state for Mercuric Calcogenides. The present equation of state has also been tested for the prediction of End Point. The computed results compare well with Quantum statistical data.

  16. The optimal placement of up and ab – a comparison

    Dehé, Nicole

    2005-01-01

    The particle verb construction (PVC), also referred to in the literature as phrasal verb or separable complex verb, occurs in most if not all of the Germanic languages. The work presented here deals with a comparison of the transitive PVC in English and German. In English, the construction occurs in two alternating word orders (They called off the concert vs. They called the concert off ). In German, on the other hand, only one order is possible (Sie sagten das Konzert ab vs. *Sie sagten ab das...

  17. Recent achievements in ab initio modelling of liquid water

    Khaliullin, Rustam Z

    2013-01-01

    The application of newly developed first-principle modeling techniques to liquid water deepens our understanding of the microscopic origins of its unusual macroscopic properties and behaviour. Here, we review two novel ab initio computational methods: second-generation Car-Parrinello molecular dynamics and decomposition analysis based on absolutely localized molecular orbitals. We show that these two methods in combination not only enable ab initio molecular dynamics simulations on previously inaccessible time and length scales, but also provide unprecedented insights into the nature of hydrogen bonding between water molecules. We discuss recent applications of these methods to water clusters and bulk water.

  18. Comparative study of intact A7 MoAb and F(ab')2 fragments for radioimmunoimaging of human colon cancer in nude mice

    Differences of pharmacokinetics and tumor imaging ability between intact monoclonal antibody A7 (A7 MoAb) and F(ab')2 fragments were studied in human colon cancer (LS-174T)-bearing nude mouse. First of all, we examined the yield and the immunoreactivity of F(ab')2 fragments after treatment with ficin as a function of time. The yield of F(ab')2 fragments reached about 50% after ficin treatment for 8 h, and the F(ab')2 retained about 80% of the immunoreactivity of the corresponding MoAb. Longer digestion with ficin produced smaller fragments (less than 92 kDa) with a lower yield and most of the immunoreactivity was lost. In pharmacokinetics studies, the F(ab')2 was preferentially taken up by the tumor, was cleared more rapidly from the blood circulation and seemed to have less non-specific tissue binding than intact A7 MoAb. In addition, the tumor image obtained at an early time using 131I-F(ab')2 was much superior in quality to that with intact 131I-A7 MoAb. The use of F(ab')2 fragments may be effective for tumor diagnosis and therapy. (author)

  19. GJ 282 AB (WDS 07400-0336 AB = BGH 3 AB) and GICLAS 112-29: A Very Wide System in Process of Dissociation

    Rica, F. M.; Benavides, R.

    2016-04-01

    Very wide binaries are interesting objects that shed light on the binary formation process and their dynamical evolution. Poveda et al. (2009) studied the possible physical relation of the near (14.2 pc) and wide (~58") binary star GJ 282 AB and the extremely wide (1.09º; ~55,000 AU) companion, NLTT 18149, and they concluded that this very wide system is in the process of dynamical disintegration. In this work, we confirm the same conclusion but using a different method. We first study dynamically GJ 282 AB, confirmed that it is a bound system and then we determine possible orbital solutions. Later, we calculate the relative velocity of NLTT 18149 with respect to the GJ 282 AB's center mass using their (U, V, W) galactocentric velocity. The relative velocity, Vrel = 1.98 ± 0.16 km s-1, is much larger than the escape velocity (0.25 ± 0.01 km s-1). Therefore, with a significance level of 11s, we also conclude that this very wide system is in a process of dynamical disintegration.

  20. Ab initio study of phase equilibria in TiCx

    Korzhavyi, P.A.; Pourovskii, L.V.; Hugosson, H.W.;

    2002-01-01

    The phase diagram for the vacancy-ordered structures in the substoichiometric TiCx (x = 0.5-1.0) has been established from Monte Carlo simulations with the long-range pair and multisite effective interactions obtained from ab initio calculations. Three ordered superstructures of vacancies (Ti2C, ...

  1. Ab initio calculations of mechanical properties: Methods and applications

    Pokluda, J.; Černý, Miroslav; Šob, Mojmír; Umeno, Y.

    2015-01-01

    Roč. 73, AUG (2015), s. 127-158. ISSN 0079-6425 R&D Projects: GA ČR(CZ) GAP108/12/0311 Institutional support: RVO:68081723 Keywords : Ab initio methods * Elastic moduli * Intrinsic hardness * Stability analysis * Theoretical strength * Intrinsic brittleness/ductility Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 27.417, year: 2014

  2. Discovery of New Substrates for LuxAB Bacterial Bioluminescence.

    Jiang, Tianyu; Wang, Weishan; Wu, Xingkang; Wu, Wenxiao; Bai, Haixiu; Ma, Zhao; Shen, Yuemao; Yang, Keqian; Li, Minyong

    2016-08-01

    In this article, four novel substrates with long halftime have been designed and synthesized successfully for luxAB bacterial bioluminescence. After in vitro and in vivo biological evaluation, these molecules can emit obvious bioluminescence emission with known bacterial luciferase, thus indicating a new promising approach to developing the bacterial bioluminescent system. PMID:26896339

  3. Cyanogen Azide. Ionization Potentials and Ab Initio SCF MO Calculation

    Bak, Börge; Jansen, Peter; Stafast, Herbert

    1975-01-01

    The Ne(I) and He(I) photoelectron(PE) spectra of cyanogen azide, NCN3, have been recorded at high resolution. Their interpretation is achieved by comparison with the PE spectrum of HN3 and an ab initio LCGO SCF MO calculation. Deviations from Koopmans' theorem of quite different magnitudes are fo...

  4. Relaxation of Small Molecules: an ab initio Study

    CAO Yi-Gang; JIAO Zheng-Kuan; A. Antons; K. Schroeder; S. Blügel2

    2002-01-01

    Using an ab initio total energy and force method, we have relaxed several group IV and group V elementalclusters, in detail the arsenic and antimony dimers, silicon, phosphorus, arsenic and antimony tetramers. The obtainedbond lengths and cohesive energies are more accurate than other calculating methods, and in excellent agreement withthe experimental results.

  5. Relaxation of Small Molecules:an ab initio Study

    CAOYi-Gang; A.Antons; 等

    2002-01-01

    Using an ab inito total energy and force method,we have relaxed several group IV and group V elemental clusters,in detail the arsenic and antimony dimers,silicon,phosphorus,arsenic and antimony tetraners,The obtained bond lengths and cohesive energies are more accurate than other calculating methods,and in excellent agreement with the experimental results.

  6. Ultra-Low Voltage Class AB Switched Current Memory Cell

    Igor, Mucha

    1996-01-01

    This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process with...

  7. Environmentally friendly process for nickel electroplating of ABS

    Bazzaoui, M.; Martins, J. I.; Bazzaoui, E. A.; Albourine, A.

    2012-08-01

    Nickel electroplating of acrylonitrile butadiene styrene (ABS) plastic has been achieved successfully without any chromium or palladium pretreatment. Once the ABS is coated with polypyrrole (PPy), the sample may be electroplated. The process is fast, economic and involves three stages. Firstly, chemical deposition of PPy on ABS, secondly, copper deposition and finally nickel electroplating. A homogenous and adherent PPy has been synthesized chemically on ABS plate by using pyrrole as monomer and iron (III) chloride as oxidant. Copper and nickel were deposited galvanostatically from industrial plating baths. The metallic coatings were homogeneous and the adherence was estimated at 100%. The thickness of copper and nickel depend on the electrolysis time. As the current density increases, the Cu and Ni thickness raises. This result was confirmed from SEM characterization and RX map. The Ni coating is characterized by a globular structure with globules of different sizes. Energy dispersive X-ray spectroscopy (EDS) analysis shows the presence of Ni with some amount of carbon and oxygen due to the nickel oxides and contaminant from the bath solution.

  8. A-B Distinction in a Sample of Prominent Psychotherapists

    Geller, Jesse D.; Berzins, Juris I.

    1976-01-01

    A sample of prominent psychotherapists were asked to fill out the A-B therapist "type" scale and comment on their possible differential effectiveness in treating schizoid/schizophrenic versus neurotic patients. The data suggest that B therapists desire and seek more complex and exciting sensory-cognitive inputs during therapy hours than A…

  9. AB 1725 Model Accountability System. California Community Colleges. Revised.

    California Community Colleges, Sacramento. Board of Governors.

    This report proposes a model accountability system for the California community colleges to comply with the directives of Assembly Bill 1725 (AB 1725). The purpose of the accountability system is to provide colleges and districts, the board of governors, and the California legislature with information that will allow for the continued improvement…

  10. Protective mAbs and Cross-Reactive mAbs Raised by Immunization with Engineered Marburg Virus GPs.

    Marnie L Fusco

    2015-06-01

    Full Text Available The filoviruses, which include the marburg- and ebolaviruses, have caused multiple outbreaks among humans this decade. Antibodies against the filovirus surface glycoprotein (GP have been shown to provide life-saving therapy in nonhuman primates, but such antibodies are generally virus-specific. Many monoclonal antibodies (mAbs have been described against Ebola virus. In contrast, relatively few have been described against Marburg virus. Here we present ten mAbs elicited by immunization of mice using recombinant mucin-deleted GPs from different Marburg virus (MARV strains. Surprisingly, two of the mAbs raised against MARV GP also cross-react with the mucin-deleted GP cores of all tested ebolaviruses (Ebola, Sudan, Bundibugyo, Reston, but these epitopes are masked differently by the mucin-like domains themselves. The most efficacious mAbs in this panel were found to recognize a novel "wing" feature on the GP2 subunit that is unique to Marburg and does not exist in Ebola. Two of these anti-wing antibodies confer 90 and 100% protection, respectively, one hour post-exposure in mice challenged with MARV.

  11. Preparation, biodistribution, and dosimetry of 188Re-Labeled MoAb ior cea1 and its f(ab')2 fragments by avidin-biotin strategy

    The biotinylated monoclonal antibody (MoAb) ior cea1 and its F(ab')2 fragments were labeled with Re-188 by combination of avidin-biotin strategy. 188Re-MoAb, 188Re-MoAb-biotin, 188Re-F(ab')2, and 188Re-F(ab')2-biotin preparations were produced for these studies with specific activities of 1.30±0.18 GBq/mg and from instant freeze-dried kit formulations using ethane-1-hydroxy-1,1-diphosphonic acid (EHDP) as a weak competing ligand. There were no significant differences (p>0.05) between the biodistribution in mice of biotinylated and unbiotinylated 188Re-labeled immunoconjugates. When avidin was injected as a chase after injection of 188Re-MoAb-biotin or 188Re-F(ab')2-biotin, the blood radioactivity level decreased approximately 75% (cumulated activity) and the effective dose decreased almost 25% with respect to that of the radioimmunoconjugates in which the chase effect was not used. Our results suggest that 188Re-labeled biotinylated MoAb ior cea1 and its F(ab')2 fragments prepared by this method are stable complexes in vivo

  12. Solar Powered Vapor Absorption System Using Propane And Alkylated Benzene Ab300 Oil

    Al-Dadah, R.K.; Jackson, G.; Rezk, Ahmed

    2011-01-01

    Abstract This paper describes experimental work on a solar assisted vapour absorption air conditioning system using Propane (refrigerant) and Alkylated Benzene (AB300?refrigeration lubrication oil, absorbent). Preliminary experiments to assess the miscibility of propane in various lubricating oils namely Shell Clavus oils 32 and 64 and Alkylated Benzene oils AB150 and AB300 indicated that Propane is most miscible in Alkylated Benzene AB300. The vapour absorption system is a single ...

  13. Kostnadseffektivering av logistikkostnader : Rolls-Royce Oy Ab

    Nordlund, Lucas

    2013-01-01

    Rolls-Royce Oy Ab som fungerar som uppdragsgivare i detta examensarbete, är ett företag med internationell verksamhet. Företaget hör till det globala Rolls-Royce plc som verkar inom många olika delområden i länder runt om i hela världen. Enheten i Karleby verkar inom Rolls-Royce Marine koncernen och tillverkar vattenjetaggregat. I och med att Rolls-Royce Oy Ab hör till Marine koncernen, medför det att man följer bestämmelser och standarder som följs i hela Marine koncernen. Till dessa gem...

  14. Ab-initio calculations on melting of thorium

    Mukherjee, D.; Sahoo, B. D.; Joshi, K. D.; Kaushik, T. C.; Gupta, Satish C.

    2016-05-01

    Ab-initio molecular dynamics study has been performed on face centered cubic structured thorium to determine its melting temperature at room pressure. The ion-electron interaction potential energy calculated as a function of temperature for three volumes (a0)3 and (1.02a0)3 and (1.04a0)3 increases gradually with temperature and undergoes a sharp jump at ~2200 K, ~2100 K and ~1800 K, respectively. Here, a0 = 5.043 Å is the equilibrium lattice parameter at 0 K obtained from ab-initio calculations. These jumps in interaction energy are treated as due to the onset of melting and corresponding temperatures as melting point. The melting point of 2100 K is close to the experimental value of 2023K. Further, the same has been verified by plotting the atomic arrangement evolved at various temperatures and corresponding pair correlation functions.

  15. Chemical and Electrochemical Metallic Covering of ABS polymers

    Florentina Cziple

    2009-10-01

    Full Text Available The aim of this paper is the deposition of metallic layers on the surface of ABS plastic material, by means of two consecutive procedures, namely: the first is represented by the conductibility through chemical or electro-chemical metallic covering of the polymeric support and the second procedure is the electrodeposition of the metal through galvanization. The chemical mehtod consists in the submission of ABS polymers to some conductibility operations of the plastic material surface through chemical copper plating (chemical roughing, degreasing with ultra-sounds, chemical sensitivation, activation and proper conductibility of the material surface. The electrochemical deposition of nickel was made on the plastic material activated in the mixture solution of graphite with potassium carbonate.

  16. Ab Initio Nuclear Structure Theory: From Few to Many

    We summarize recent advances in ab initio nuclear structure theory, aiming to connect few- and many-body systems in a coherent theoretical framework. Starting from chiral effective field theory to construct the nuclear Hamiltonian and the similarity renormalization group to soften it, we address several many-body approaches that have seen major developments over the past few years. We show that the domain of ab initio nuclear structure theory has been pushed well beyond the p-shell and that quantitative predictions connected to QCD via chiral effective field theory are becoming possible all the way from the proton to the neutron drip line up into the medium-mass regime. (author)

  17. Serine Proteases an Ab Initio Molecular Dynamics Study

    De Santis, L

    1999-01-01

    In serine proteases (SP's), the H-bond between His-57 and Asp-102, and that between Gly-193 and the transition state intermediate play a crucial role for enzymatic function. To shed light on the nature of these interactions, we have carried out ab initio molecular dynamics simulations on complexes representing adducts between the reaction intermediate and elastase (one protein belonging to the SP family). Our calculations indicate the presence of a low--barrier H-bond between His-57 and Asp-102, in complete agreement with NMR experiments on enzyme--transition state analog complexes. Comparison with an ab initio molecular dynamics simulation on a model of the substrate--enzyme adduct indicates that the Gly-193--induced strong stabilization of the intermediate is accomplished by charge/dipole interactions and not by H-bonding as previously suggested. Inclusion of the protein electric field in the calculations does not affect significantly the charge distribution.

  18. Understanding phonon transport in thermoelectric materials using ab initio approaches

    Broido, David

    Good thermoelectric materials have low phonon thermal conductivity, kph. Accurate theories to describe kph are important components in developing predictive models of thermoelectric efficiency that can help guide synthesis and measurement efforts. We have developed ab initio approaches to calculate kph, in which phonon modes and phonon scattering rates are computed using interatomic force constants determined from density functional theory, and a full solution of the Boltzmann transport equation for phonons is implemented. A recent approach to calculate interatomic force constants using ab initio molecular dynamics has yielded a good description of the thermal properties of Bi2Te3. But, the complexity of new promising candidate thermoelectric materials introduces computational challenges in assessing their thermal properties. An example is germanane, a germanium based hydrogen-terminated layered semiconductor, which we will discuss in this talk.

  19. The density matrix renormalization group for ab initio quantum chemistry

    Wouters, Sebastian

    2014-01-01

    During the past 15 years, the density matrix renormalization group (DMRG) has become increasingly important for ab initio quantum chemistry. Its underlying wavefunction ansatz, the matrix product state (MPS), is a low-rank decomposition of the full configuration interaction tensor. The virtual dimension of the MPS, the rank of the decomposition, controls the size of the corner of the many-body Hilbert space that can be reached with the ansatz. This parameter can be systematically increased until numerical convergence is reached. The MPS ansatz naturally captures exponentially decaying correlation functions. Therefore DMRG works extremely well for noncritical one-dimensional systems. The active orbital spaces in quantum chemistry are however often far from one-dimensional, and relatively large virtual dimensions are required to use DMRG for ab initio quantum chemistry (QC-DMRG). The QC-DMRG algorithm, its computational cost, and its properties are discussed. Two important aspects to reduce the computational co...

  20. Augmented wave ab initio EFG calculations: some methodological warnings

    Errico, Leonardo A. [Departamento de Fisica-IFLP (CONICET), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CC67 (1900) La Plata (Argentina); Renteria, Mario [Departamento de Fisica-IFLP (CONICET), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CC67 (1900) La Plata (Argentina); Petrilli, Helena M. [Instituto de Fisica-DFMT, Universidade de Sao Paulo, C.P. 66318, 05315-970 Sao Paulo, SP (Brazil)]. E-mail: hmpetril@macbeth.if.usp.br

    2007-02-01

    We discuss some accuracy aspects inherent to ab initio electronic structure calculations in the understanding of nuclear quadrupole interactions. We use the projector augmented wave method to study the electric-field gradient (EFG) at both Sn and O sites in the prototype cases SnO and SnO{sub 2}. The term ab initio is used in the standard context of the also called first principles methods in the framework of the Density Functional Theory. As the main contributions of EFG calculations to problems in condensed matter physics are related to structural characterizations on the atomic scale, we discuss the 'state of the art' on theoretical EFG calculations and make a brief critical review on the subject, calling attention to some fundamental theoretical aspects.

  1. Augmented wave ab initio EFG calculations: some methodological warnings

    We discuss some accuracy aspects inherent to ab initio electronic structure calculations in the understanding of nuclear quadrupole interactions. We use the projector augmented wave method to study the electric-field gradient (EFG) at both Sn and O sites in the prototype cases SnO and SnO2. The term ab initio is used in the standard context of the also called first principles methods in the framework of the Density Functional Theory. As the main contributions of EFG calculations to problems in condensed matter physics are related to structural characterizations on the atomic scale, we discuss the 'state of the art' on theoretical EFG calculations and make a brief critical review on the subject, calling attention to some fundamental theoretical aspects

  2. Der halbunendliche Kristall - Elektronische und optische Eigenschaften ab-initio

    Brodersen, Sven

    2002-01-01

    Es werden die elektronischen und optischen Eigenschaften eines kristallinen Festkörpers unter Berücksichtigung der Oberfläche mit ab-initio Methoden berechnet. Die Behandlung der Oberflächeneffekte in einer Halbraum-Geometrie erzwingt die Darstellung der Wellenfunktionen und der Dielektrischen Funktion (DK) in einer lokalen Basis. Anhand von Volumenkristallen wird die Effizienz von LCAO- Basisfunktionen demonstriert. Die Erweiterung der atomaren Orbitale mit unbesetzten Orbitalen und 'off-sit...

  3. Ab initio simulation of helium inside carbon nanotubes

    In present work we consider the complex behaviour of quantum liquids like liquid He-4 inside carbon nanotubes. Interactions between helium atoms and carbon atoms of the short-length atomistic model and model with periodical boundary conditions of carbon nanotube were studied via ab initio quantum simulations. Effects of geometrical confinement of the tube on the He behaviour inside CNT (13,0) have been explored. Nanotubes with typical average diameter of 10 angstroms are under consideration.

  4. The density matrix renormalization group for ab initio quantum chemistry

    Wouters, Sebastian

    2015-01-01

    During the past 15 years, the density matrix renormalization group (DMRG) has become increasingly important for ab initio quantum chemistry. It is used as a numerically exact solver for highly correlated regions in molecules. While the method works extremely well for one-dimensional systems, the correlated regions of interest are often far from one-dimensional. In this introductory talk, I will discuss the DMRG algorithm from a quantum information perspective, how quantum information theory h...

  5. Ab Initio Modeling of Ecosystems with Artificial Life

    Adami, C.

    2002-01-01

    Artificial Life provides the opportunity to study the emergence and evolution of simple ecosystems in real time. We give an overview of the advantages and limitations of such an approach, as well as its relation to individual-based modeling techniques. The Digital Life system Avida is introduced and prospects for experiments with ab initio evolution (evolution "from scratch"), maintenance, as well as stability of ecosystems are discussed.

  6. P-V Relation for Mercuric Calcogenides: Ab Initio Method

    G. Misra; S. Tenguria; Gautam, M.

    2011-01-01

    Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P), volume (V) and temperature (T) that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This a...

  7. Erythema Ab Igne in Three Girls with Anorexia Nervosa.

    Dessinioti, Clio; Katsambas, Andreas; Tzavela, Eleni; Karountzos, Vasileios; Tsitsika, Artemis K

    2016-03-01

    We present three girls with the eating disorder anorexia nervosa (AN) presenting with erythema ab igne (EAI), a benign, reticular, erythematous dermatosis caused by repeated prolonged skin exposure to mild heat. AN has been associated with abnormal peripheral vascular response to cold, vasoconstriction of the limbs, low hand blood flow, exaggerated response to cold stimuli, subnormal core temperature, and a general feeling of cold that may encourage prolonged heat exposure and induce EAI. PMID:26822102

  8. Structure models: from shell model to ab initio methods

    Bacca, Sonia

    2016-01-01

    A brief review of models to describe nuclear structure and reactions properties is presented, starting from the historical shell model picture and encompassing modern ab initio approaches. A selection of recent theoretical results on observables for exotic light and medium-mass nuclei is shown. Emphasis is given to the comparison with experiment and to what can be learned about three-body forces and continuum properties.

  9. Ab-initio calculations for dilute magnetic semiconductors

    Belhadji, Brahim

    2008-01-01

    This thesis focusses on ab-initio calculations for the electronic structure and the magnetic properties of dilute magnetic semiconductors (DMS). In particular we aim at the understanding of the complex exchange interactions in these systems. Our calculations are based on density functional theory, being ideally suited for a description of the material specific properties of the considered DMS. Moreover we use the KKR Green function method in connection with the coherent potential approximatio...

  10. Integrated Design of Antibodies for Systems Biology Using Ab Designer

    Pisitkun, Trairak; Dummer, Patrick; Somparn, Poorichaya; Hirankarn, Nattiya; Kopp, Jeffrey B.; Knepper, Mark A.

    2014-01-01

    In the current era of large-scale biology, systems biology has evolved as a powerful approach to identify complex interactions within biological systems. In addition to high throughput identification and quantification techniques, methods based on high-quality mono-specific antibodies remain an essential element of the approach. To assist the large-scale design and production of peptide-directed antibodies for systems biology studies, we developed a fully integrated online application, AbDesi...

  11. Innovativeness and innovations utilizations : Oy LM Ericsson Ab

    Saarinen, Vesa

    2010-01-01

    The aim of this action research was to improve the innovativeness amongst the R&D personnel at LM Ericsson Ab in Finland. The main purpose of this study was to understand the background of innovativeness and to practically compare the research results with the actual company situation. Innovativeness is predominantly a personal, internal matter and it is based on the intrinsic motivation of an individual. Creativity, courage and persistent effort are the key elements of innovativeness...

  12. Molexpl: a tool for ab initio data exploration and visualization

    Wang, Xueying; Onofrio, Nicolas,; Strachan, Alejandro

    2015-01-01

    Density functional theory (DFT) based on ab initio theory, is a powerful method to resolve the electronic structure of atoms, molecules and solids. However, in practical, DFT is limited to few hundreds of atoms. To overcome this limitation, researchers have developed empirical interatomic potentials implemented in molecular dynamics (MD) simulations. MD ignores the movements of electrons and describes bonding and non-bonding interaction as a function of the distance between atoms called force...

  13. Ab initio molecular dynamics simulation of laser melting of silicon

    Silvestrelli, P.-L.; Alavi, A; Parrinello, M.; Frenkel, D

    1996-01-01

    The method of ab initio molecular dynamics, based on finite temperature density functional theory, is used to simulate laser heating of crystal silicon. We have found that a high concentration of excited electrons dramatically weakens the covalent bond. As a result, the system undergoes a melting transition to a metallic state. In contrast to ordinary liquid silicon, the new liquid is characterized by a high coordination number and a strong reduction of covalent bonding effects.

  14. Towards an ab initio description of magnetism in ionic solids

    Illas, F.; Casanovas, J.; García-Bach, M. A.; Caballol, R.; Castell, O.

    1993-11-01

    The physical contributions to the KNiF3 magnetic exchange coupling integral have been obtained from specially designed ab initio cluster model calculations. Three important mechanisms have been identified. These are the delocalization of the magnetic orbitals into the anion ``p'' band, the variational contribution of the second-order interactions, and the many-body terms ``hidden'' in the two-body operator and the Heisenberg Hamiltonian.

  15. Social Media Marketing : CASE: OY SUOMEN LYYRA AB

    Eriksson, Irene

    2012-01-01

    This bachelor thesis was commissioned by Oy Suomen Lyyra Ab, the largest student online media and student card producer for higher education students in Finland. The the-sis objective was to understanding the current social media situation and activity among the students of higher education in Finland, the social media networks that the case company currently uses as well as understanding how to use these networks for successful marketing activities. The quantitative research was conducted in...

  16. GAUSSIAN 76: an ab initio molecular orbital program

    Binkley, J. S.; Whiteside, R.; Hariharan, P. C.; Seeger, R.; Hehre, W. J.; Lathan, W. A.; Newton, M. D.; Ditchfield, R.; Pople, J. A.

    1978-06-01

    Gaussian 76 is a general-purpose computer program for ab initio Hartree-Fock molecular orbital calculations. It can handle basis sets involving s, p and d-type gaussian functions. Certain standard sets (STO-3G, 4-31G, 6-31G*, etc.) are stored internally for easy use. Closed shell (RHF) or unrestricted open shell (UHF) wave functions can be obtained. Facilities are provided for geometry optimization to potential minima and for limited potential surface scans.

  17. GAUSSIAN 76: An ab initio Molecular Orbital Program

    Binkley, J. S.; Whiteside, R.; Hariharan, P. C.; Seeger, R.; Hehre, W. J.; Lathan, W. A.; Newton, M. D.; Ditchfield, R.; Pople, J. A.

    1978-01-01

    Gaussian 76 is a general-purpose computer program for ab initio Hartree-Fock molecular orbital calculations. It can handle basis sets involving s, p and d-type Gaussian functions. Certain standard sets (STO-3G, 4-31G, 6-31G*, etc.) are stored internally for easy use. Closed shell (RHF) or unrestricted open shell (UHF) wave functions can be obtained. Facilities are provided for geometry optimization to potential minima and for limited potential surface scans.

  18. Ab initio nuclear structure - the large sparse matrix eigenvalue problem

    The structure and reactions of light nuclei represent fundamental and formidable challenges for microscopic theory based on realistic strong interaction potentials. Several ab initio methods have now emerged that provide nearly exact solutions for some nuclear properties. The ab initio no core shell model (NCSM) and the no core full configuration (NCFC) method, frame this quantum many-particle problem as a large sparse matrix eigenvalue problem where one evaluates the Hamiltonian matrix in a basis space consisting of many-fermion Slater determinants and then solves for a set of the lowest eigenvalues and their associated eigenvectors. The resulting eigenvectors are employed to evaluate a set of experimental quantities to test the underlying potential. For fundamental problems of interest, the matrix dimension often exceeds 1010 and the number of nonzero matrix elements may saturate available storage on present-day leadership class facilities. We survey recent results and advances in solving this large sparse matrix eigenvalue problem. We also outline the challenges that lie ahead for achieving further breakthroughs in fundamental nuclear theory using these ab initio approaches.

  19. Ab Initio Nuclear Structure and Reaction Calculations for Rare Isotopes

    Draayer, Jerry P. [Louisiana State Univ., Baton Rouge, LA (United States)

    2014-09-28

    We have developed a novel ab initio symmetry-adapted no-core shell model (SA-NCSM), which has opened the intermediate-mass region for ab initio investigations, thereby providing an opportunity for first-principle symmetry-guided applications to nuclear structure and reactions for nuclear isotopes from the lightest p-shell systems to intermediate-mass nuclei. This includes short-lived proton-rich nuclei on the path of X-ray burst nucleosynthesis and rare neutron-rich isotopes to be produced by the Facility for Rare Isotope Beams (FRIB). We have provided ab initio descriptions of high accuracy for low-lying (including collectivity-driven) states of isotopes of Li, He, Be, C, O, Ne, Mg, Al, and Si, and studied related strong- and weak-interaction driven reactions that are important, in astrophysics, for further understanding stellar evolution, X-ray bursts and triggering of s, p, and rp processes, and in applied physics, for electron and neutrino-nucleus scattering experiments as well as for fusion ignition at the National Ignition Facility (NIF).

  20. Studies on the runaway reaction of ABS polymerization process

    Hu, K.-H. [Department of Occupational Safety and Health, Jen-Teh Junior College of Medicine, Nursing and Management, Miaoli, Taiwan (China); Kao, C.-S. [Department of Safety, Health and Environmental Engineering, National United University, Taiwan (China); Duh, Y.-S. [Department of Occupational Safety and Health, Jen-Teh Junior College of Medicine, Nursing and Management, Miaoli, Taiwan (China)], E-mail: yihshingduh@yahoo.com.tw

    2008-11-15

    Taiwan has the largest acrylonitrile-butadiene-styrene (ABS) copolymer production in the world. Preventing on unexpected exothermic reactions and related emergency relief hazard is essential in the safety control of ABS emulsion polymerization. A VSP2 (Vent Sizing Package 2) apparatus is capable of studying both normal and abnormal conditions (e.g., cooling failure, mischarge, etc.) of industrial process. In this study, the scenarios were verified from the following abnormal conditions: loss of cooling, double charge of initiator, overcharge of monomer, without charge of solvent, and external fire. An external fire with constant heating will promote higher self-heat rate and this is recommended as the worst case scenario of emulsion polymerization on butadiene. Cooling failure coupled with bulk system of reactant was determined to be the credible worst case in ABS emulsion polymerization. Finally, the emergency vent sizing based on thermokinetics from VSP associated with DIERS methodology were used for evaluating the vent sizing and compared to that of the industrial plants.

  1. Ab initio calculations for industrial materials engineering: successes and challenges

    Wimmer, Erich; Freeman, Clive; Christensen, Mikael; Wolf, Walter; Saxe, Paul [Materials Design, Inc., PO Box 2000, Angel Fire, NM 87710 (United States); Najafabadi, Reza; Young Jr, George A; Ballard, Jake D; Angeliu, Thomas M; Vollmer, James [Knolls Atomic Power Laboratory, PO Box 1072, Schenectady, NY 12301-1072 (United States); Chambers, James J; Niimi, Hiroaki; Shaw, Judy B, E-mail: ewimmer@materialsdesign.co [Advanced CMOS, Texas Instruments Incorporated, Dallas, TX 75243 (United States)

    2010-09-29

    Computational materials science based on ab initio calculations has become an important partner to experiment. This is demonstrated here for the effect of impurities and alloying elements on the strength of a Zr twist grain boundary, the dissociative adsorption and diffusion of iodine on a zirconium surface, the diffusion of oxygen atoms in a Ni twist grain boundary and in bulk Ni, and the dependence of the work function of a TiN-HfO{sub 2} junction on the replacement of N by O atoms. In all of these cases, computations provide atomic-scale understanding as well as quantitative materials property data of value to industrial research and development. There are two key challenges in applying ab initio calculations, namely a higher accuracy in the electronic energy and the efficient exploration of large parts of the configurational space. While progress in these areas is fueled by advances in computer hardware, innovative theoretical concepts combined with systematic large-scale computations will be needed to realize the full potential of ab initio calculations for industrial applications.

  2. Ab initio calculations for industrial materials engineering: successes and challenges

    Computational materials science based on ab initio calculations has become an important partner to experiment. This is demonstrated here for the effect of impurities and alloying elements on the strength of a Zr twist grain boundary, the dissociative adsorption and diffusion of iodine on a zirconium surface, the diffusion of oxygen atoms in a Ni twist grain boundary and in bulk Ni, and the dependence of the work function of a TiN-HfO2 junction on the replacement of N by O atoms. In all of these cases, computations provide atomic-scale understanding as well as quantitative materials property data of value to industrial research and development. There are two key challenges in applying ab initio calculations, namely a higher accuracy in the electronic energy and the efficient exploration of large parts of the configurational space. While progress in these areas is fueled by advances in computer hardware, innovative theoretical concepts combined with systematic large-scale computations will be needed to realize the full potential of ab initio calculations for industrial applications.

  3. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as “cloning,” in analogy to the “spawning” procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, “trains,” as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions

  4. Converting of Matter to Nuclear Energy by AB-Generator

    Alexander Bolonkin

    2009-01-01

    Full Text Available Problem statement: Researcher offered a new nuclear generator which allowed to convert any matter to nuclear energy in accordance with Einstein equation E = mc2. The method was based upon tapping the energy potential of a Micro Black Hole (MBH and Hawking radiation created by this MBH. Researcher did not meet the idea and its research in literature to develop the method for getting a cheap energy. Approach: As is well-known, vacuum continuously produced virtual pairs of particles and antiparticles, in particular, photons and anti-photons. MBH event horizon allowed separating them. Anti-photons can be moved to MBH and be annihilated, decreasing mass of MBH, resulting photons leave the MBH neighborhood as Hawking radiation. The offered nuclear generator (named by Researcher as AB-generator utilized Hawking radiation and injected the matter into MBH and kept MBH in a stable state with near-constant mass. Results: AB-generator can be produced gigantic energy outputs and should be cheaper than a conventional electric station by a factor of hundreds of times. One also may be used in aerospace as a photon rocket or as a power source for many vehicles. Conclusion: Many scientists expect Large Hadron Collider at CERN may be produced one MBH every second. A technology to capture them may be developed; than they may be used for the AB-generator.

  5. Pressure tracking control of vehicle ABS using piezo valve modulator

    Jeon, Juncheol; Choi, Seung-Bok

    2011-03-01

    This paper presents a wheel slip control for the ABS(anti-lock brake system) of a passenger vehicle using a controllable piezo valve modulator. The ABS is designed to optimize for braking effectiveness and good steerability. As a first step, the principal design parameters of the piezo valve and pressure modulator are appropriately determined by considering the braking pressure variation during the ABS operation. The proposed piezo valve consists of a flapper, pneumatic circuit and a piezostack actuator. In order to get wide control range of the pressure, the pressure modulator is desired. The modulator consists of a dual-type cylinder filled with different substances (fluid and gas) and a piston rod moving vertical axis to transmit the force. Subsequently, a quarter car wheel slip model is formulated and integrated with the governing equation of the piezo valve modulator. A sliding mode controller to achieve the desired slip rate is then designed and implemented. Braking control performances such as brake pressure and slip rate are evaluated via computer simulations.

  6. Monte Carlo simulation of AB-copolymers with saturating bonds

    Chertovich, A V; Khokhlov, A R; Bohr, J

    2003-01-01

    Structural transitions in a single AB-copolymer chain where saturating bonds can be formed between A-and B-units are studied by means of Monte Carlo computer simulations using the bond fluctuation model. Three transitions are found, coil-globule, coil-hairpin and globule-hairpin, depending on the nature of a particular AB-sequence: statistical random sequence, diblock sequence and 'random-complementary' sequence (one-half of such an AB-sequence is random with Bernoulli statistics while the other half is complementary to the first one). The properties of random-complementary sequences are closer to those of diblock sequences than to the properties of random sequences. The model (although quite rough) is expected to represent some basic features of real RNA molecules, i.e. the formation of secondary structure of RNA due to hydrogen bonding of corresponding bases and stacking interactions of the base pairs in helixes. We introduce the notation of RNA-like copolymers and discuss in what sense the sequences studie...

  7. Ab Initio Nuclear Structure and Reaction Calculations for Rare Isotopes

    We have developed a novel ab initio symmetry-adapted no-core shell model (SA-NCSM), which has opened the intermediate-mass region for ab initio investigations, thereby providing an opportunity for first-principle symmetry-guided applications to nuclear structure and reactions for nuclear isotopes from the lightest p-shell systems to intermediate-mass nuclei. This includes short-lived proton-rich nuclei on the path of X-ray burst nucleosynthesis and rare neutron-rich isotopes to be produced by the Facility for Rare Isotope Beams (FRIB). We have provided ab initio descriptions of high accuracy for low-lying (including collectivity-driven) states of isotopes of Li, He, Be, C, O, Ne, Mg, Al, and Si, and studied related strong- and weak-interaction driven reactions that are important, in astrophysics, for further understanding stellar evolution, X-ray bursts and triggering of s, p, and rp processes, and in applied physics, for electron and neutrino-nucleus scattering experiments as well as for fusion ignition at the National Ignition Facility (NIF).

  8. A Complete and Accurate Ab Initio Repeat Finding Algorithm.

    Lian, Shuaibin; Chen, Xinwu; Wang, Peng; Zhang, Xiaoli; Dai, Xianhua

    2016-03-01

    It has become clear that repetitive sequences have played multiple roles in eukaryotic genome evolution including increasing genetic diversity through mutation, changes in gene expression and facilitating generation of novel genes. However, identification of repetitive elements can be difficult in the ab initio manner. Currently, some classical ab initio tools of finding repeats have already presented and compared. The completeness and accuracy of detecting repeats of them are little pool. To this end, we proposed a new ab initio repeat finding tool, named HashRepeatFinder, which is based on hash index and word counting. Furthermore, we assessed the performances of HashRepeatFinder with other two famous tools, such as RepeatScout and Repeatfinder, in human genome data hg19. The results indicated the following three conclusions: (1) The completeness of HashRepeatFinder is the best one among these three compared tools in almost all chromosomes, especially in chr9 (8 times of RepeatScout, 10 times of Repeatfinder); (2) in terms of detecting large repeats, HashRepeatFinder also performed best in all chromosomes, especially in chr3 (24 times of RepeatScout and 250 times of Repeatfinder) and chr19 (12 times of RepeatScout and 60 times of Repeatfinder); (3) in terms of accuracy, HashRepeatFinder can merge the abundant repeats with high accuracy. PMID:26272474

  9. Ab initio calculations of reactions with light nuclei

    Quaglioni, Sofia; Hupin, Guillaume; Calci, Angelo; Navrátil, Petr; Roth, Robert

    2016-03-01

    An ab initio (i.e., from first principles) theoretical framework capable of providing a unified description of the structure and low-energy reaction properties of light nuclei is desirable to further our understanding of the fundamental interactions among nucleons, and provide accurate predictions of crucial reaction rates for nuclear astrophysics, fusion-energy research, and other applications. In this contribution we review ab initio calculations for nucleon and deuterium scattering on light nuclei starting from chiral two- and three-body Hamiltonians, obtained within the framework of the ab initio no-core shell model with continuum. This is a unified approach to nuclear bound and scattering states, in which square-integrable energy eigenstates of the A-nucleon system are coupled to (A-a)+a target-plus-projectile wave functions in the spirit of the resonating group method to obtain an efficient description of the many-body nuclear dynamics both at short and medium distances and at long ranges.

  10. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    Makhov, Dmitry V.; Glover, William J.; Martinez, Todd J.; Shalashilin, Dmitrii V.

    2014-08-01

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as "cloning," in analogy to the "spawning" procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, "trains," as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions.

  11. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    Makhov, Dmitry V.; Shalashilin, Dmitrii V. [Department of Chemistry, University of Leeds, Leeds LS2 9JT (United Kingdom); Glover, William J.; Martinez, Todd J. [Department of Chemistry and The PULSE Institute, Stanford University, Stanford, California 94305, USA and SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States)

    2014-08-07

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as “cloning,” in analogy to the “spawning” procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, “trains,” as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions.

  12. A ProActive Backend for ABS: from Modelling to Deployment

    Rochas, Justine; Henrio, Ludovic

    2014-01-01

    ABS is an object-oriented modeling language that is based on a concurrent object group model, derived itself from the active object model. Its goal is to describe distributed and concurrent applications in order to verify their properties and make them safer. Thanks to the ABS Tool Suite, ABS programs can be translated into the Java programming language (among others), and executed in the JVM. This paper presents a new ABS backend that translates ABS programs into ProActive programs. ProActiv...

  13. Towards hydrogen metallization: an Ab initio approach; Vers la metallisation de l`hydrogene: approche AB initio

    Bernard, St

    1998-12-31

    The quest for metallic hydrogen is a major goal for both theoretical and experimental condensed matter physics. Hydrogen and deuterium have been compressed up to 200 GPa in diamond anvil cells, without any clear evidence for a metallic behaviour. Loubeyere has recently suggested that hydrogen could metallize, at pressures within experimental range, in a new Van der Waals compound: Ar(H{sub 2}){sub 2} which is characterized at ambient pressure by an open and anisotropic sublattice of hydrogen molecules, stabilized by an argon skeleton. This thesis deals with a detailed ab initio investigation, by Car-Parrinello molecular dynamics methods, of the evolution under pressure of this compound. In a last chapter, we go to much higher pressures and temperatures, in order to compare orbital and orbital free ab initio methods for the dense hydrogen plasma. (author) 109 refs.

  14. 40 CFR 174.506 - Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of...

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. 174.506 Section 174.506 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED...

  15. GQ Lup Ab Visible & Near-Infrared Photometric Analysis

    Marois, C; Macintosh, B; Barman, T

    2006-08-07

    We have re-analyzed archival HST R and I band images and Subaru CH{sub 4}, H, Ks and L{prime} data of the recently discovered planetary mass companion (PMC) GQ Lup Ab. With these we produce the first R and I band photometry of the companion and fit a radius and effective temperature using detailed model atmospheres. We find an effective temperature of 2338 {+-} 100K, and a radius of 0.37 {+-} 0.05R{sub {circle_dot}} and luminosity of log(L/L{sub {circle_dot}}) = -2.43 {+-} 0.07 (at 140pc). Since we fit wavelengths that span most of the emitted radiation from GQ Lup this luminosity estimate is robust, with uncertainty dominated by the distance uncertainty. The radius obtained for 140pc (0.37R{sub {circle_dot}}) is significantly larger than the one originally derived. The mass of the object is much more model-dependent than the radiative properties, but for the GAIA dusty models we find a mass between 9-20 M{sub Jup}, in the range of the brown dwarf and PMC deuterium burning boundary. Assuming a distance of 140pc, observations fit to 1{sigma} the Baraffe evolution model for a {approx} 15 M{sub Jup} brown dwarf. Additionally, the F606W photometric band is significantly overluminous compared to model predictions. Such overluminosity could be explained by a bright H{alpha} emission from chromospheric activity, interaction with another undetected companion, or accretion. Assuming that GQ Lup Ab has a bright H{alpha} emission line, its H{alpha} emission strength is 10{sup -1.71 {+-} 0.10} L{sub bol}, significantly larger than field late-type dwarfs. GQ Lup Ab might be strongly accreting and still be in its formation phase.

  16. Accelerating Ab Initio Nuclear Physics Calculations with GPUs

    Potter, Hugh; Maris, Pieter; Sosonkina, Masha; Vary, James; Binder, Sven; Calci, Angelo; Langhammer, Joachim; Roth, Robert; Çatalyürek, Ümit; Saule, Erik

    2014-01-01

    This paper describes some applications of GPU acceleration in ab initio nuclear structure calculations. Specifically, we discuss GPU acceleration of the software package MFDn, a parallel nuclear structure eigensolver. We modify the matrix construction stage to run partly on the GPU. On the Titan supercomputer at the Oak Ridge Leadership Computing Facility, this produces a speedup of approximately 2.2x - 2.7x for the matrix construction stage and 1.2x - 1.4x for the entire run.

  17. Ab initio study of neutron drops with chiral Hamiltonians

    We report ab initio calculations for neutron drops in a 10 MeV external harmonic-oscillator trap using chiral nucleon–nucleon plus three-nucleon interactions. We present total binding energies, internal energies, radii and odd–even energy differences for neutron numbers N=2–18 using the no-core shell model with and without importance truncation. Furthermore, we present total binding energies for N=8,16,20,28,40,50 obtained in a coupled-cluster approach. Comparisons with quantum Monte Carlo results, where available, using Argonne v8′ with three-nucleon interactions reveal important dependences on the chosen Hamiltonian

  18. Tailoring magnetoresistance at the atomic level: An ab initio study

    Tao, Kun

    2012-01-05

    The possibility of manipulating the tunneling magnetoresistance (TMR) of antiferromagnetic nanostructures is predicted in the framework of ab initio calculations. By the example of a junction composed of an antiferromagnetic dimer and a spin-polarized scanning tunneling microscopy tip we show that the TMR can be tuned and even reversed in sign by lateral and vertical movements of the tip. Moreover, our finite-bias calculations demonstrate that the magnitude and the sign of the TMR can also be tuned by an external voltage. © 2012 American Physical Society.

  19. Ab initio calculation of tensile strength in iron

    Friák, Martin; Šob, Mojmír; Vitek, V.

    2003-01-01

    Roč. 83, 31-34 (2003), s. 3529-3537. ISSN 1478-6435. [Multiscale Materials Modelling: Working Theory for Industry /1./. London, 17.06.2002-20.06.2002] R&D Projects: GA AV ČR IAA1041302; GA ČR GA202/03/1351; GA MŠk OC 523.90 Institutional research plan: CEZ:AV0Z2041904 Keywords : ab initio calculations * electronic structure * theoretical tensile strength Subject RIV: BM - Solid Matter Physics ; Magnetism

  20. Ab initio structure determination via powder X-ray diffraction

    Digamber G Porob; T N Guru Row

    2001-10-01

    Structure determination by powder X-ray diffraction data has gone through a recent surge since it has become important to get to the structural information of materials which do not yield good quality single crystals. Although the method of structure completion when once the starting model is provided is facile through the Rietveld refinement technique, the structure solution ab initio os still not push-button technology. In this article a survey of the recent development in this area is provided with an illustration of the structure determination of -NaBi3V2O10.

  1. Ab-initio study of napthelene based conducting polymer

    Ruhela, Ankur [Advanced Materials Research Group, Computational Nanoscience and Technology Lab (CNTL), ABV-Indian Institute of Information Technology and Management, Gwalior -474010, India and Amity Institute of Nanotechnology, Amity University, Noida-201303 (India); Kanchan, Reena, E-mail: reena.kanchan1977@gmail.com [Department of Chemistry, Jiwaji University, Gwalior-474001 (India); Srivastava, Anurag [Advanced Materials Research Group, Computational Nanoscience and Technology Lab (CNTL), ABV-Indian Institute of Information Technology and Management, Gwalior -474010 (India); Sinha, O. P. [Amity Institute of Nanotechnology, Amity University, Noida-201303 (India)

    2014-04-24

    In this paper, we have identified structural and electronic properties of conducting polymers by using DFT based ATK-VNL ab-initio tool. Naphthalene derivative structures were stabilized by varying the bond length between two atoms of the molecule C-N and C-C. We have also studied the molecular energy spectrum of naphthalene derivatives and found the HOMOLUMO for the same. A comparison of structural and electronic properties of naphthalene derivatives by attaching the functional group of amine, have been performed and found that they show good semi conducting properties.

  2. Ab-initio study of napthelene based conducting polymer

    In this paper, we have identified structural and electronic properties of conducting polymers by using DFT based ATK-VNL ab-initio tool. Naphthalene derivative structures were stabilized by varying the bond length between two atoms of the molecule C-N and C-C. We have also studied the molecular energy spectrum of naphthalene derivatives and found the HOMOLUMO for the same. A comparison of structural and electronic properties of naphthalene derivatives by attaching the functional group of amine, have been performed and found that they show good semi conducting properties

  3. Equations of state of heavy metals: ab initio approaches

    The determination of equations of states of heavy metals through ab initio calculation, i.e. without any adjustable parameter, allows to access to pressure and temperature thermodynamic conditions sometimes inaccessible to experiment. To perform such calculations, density functional theory (DFT) is a good starting point: when electronic densities are homogeneous enough, the local density approximation (LDA) remarkably accounts for thermodynamic properties of heavy metals, such as tantalum, or the light actinides, as well for static properties - equilibrium volume, elastic constants - as for dynamical quantities like phonon spectra. For heavier elements, like neptunium or plutonium, relativistic effects and strong electronic interactions must be taken into account, which requires more sophisticated theoretical approaches. (authors)

  4. Ab initio study of neutron drops with chiral Hamiltonians

    H.D. Potter

    2014-12-01

    Full Text Available We report ab initio calculations for neutron drops in a 10 MeV external harmonic-oscillator trap using chiral nucleon–nucleon plus three-nucleon interactions. We present total binding energies, internal energies, radii and odd–even energy differences for neutron numbers N=2–18 using the no-core shell model with and without importance truncation. Furthermore, we present total binding energies for N=8,16,20,28,40,50 obtained in a coupled-cluster approach. Comparisons with quantum Monte Carlo results, where available, using Argonne v8′ with three-nucleon interactions reveal important dependences on the chosen Hamiltonian.

  5. Ab initio and kinetic modeling studies of formic acid oxidation

    Marshall, Paul; Glarborg, Peter

    2015-01-01

    A detailed chemical kinetic model for oxidation of formic acid (HOCHO) in flames has been developed, based on theoretical work and data from literature. Ab initio calculations were used to obtain rate coefficients for reactions of HOCHO with H, O, and HO2. Modeling predictions with the mechanism...... on calculations with the kinetic model. Formic acid is consumed mainly by reaction with OH, yielding OCHO, which dissociates rapidly to CO2 + H, and HOCO, which may dissociate to CO + OH or CO2 + H, or react with H, OH, or O2 to form more stable products. The branching fraction of the HOCHO + OH...

  6. Ab initio vibrational and dielectric properties of Y V O

    Vali, R.

    2009-10-01

    For the yttrium orthovanadate Y V O with a tetragonal zircon-type structure, the first complete set of Raman-active and IR-active phonon modes has been calculated using ab initio density functional perturbation theory. The calculated IR reflectivity spectra are in good agreement with available experimental data. We report the calculated frequencies of three Raman-active modes that could not be detected experimentally and a new assignment of the experimental Raman data. The contributions of each IR-active phonon modes to static dielectric tensor have been determined.

  7. Escolha de formas de barragens abóbada

    Meliço, José Alberto Garcia

    2010-01-01

    Sendo Portugal um dos países europeus com maior potencial hidroeléctrico por explorar, e atendendo à sua dependência energética do exterior, o governo lançou, em 2007, um programa visando o aproveitamento racional dos recursos hídricos disponíveis. Está-se, em 2010, na fase de projecto de um conjunto de barragens abóbada integradas nesses aproveitamentos. Existindo uma vasta experiência da engenharia portuguesa neste tipo de estruturas, de que são exemplo o projecto e a construção de ob...

  8. Arbetsprocess för materialanskaffning vid Forsmarks Kraftgrupp AB

    Westbom, Johan

    2013-01-01

    This thesis has been made on behalf of Forsmarks Kraftgrupp AB and is the final part of the education of Bachelor of Engineering in – Innovation, production and logistics atMälardalens Högskola.Forsmark nuclear power plant is located in Östhammars municipality at the coast of Uppland. The three nuclear reactors in Forsmark together produces approximately one-sixth of Sweden’s electricity consumption each year.The background of this study is that a large number of requests come to the purchasi...

  9. Pharmacokinetics of radioimmunotherapeutic agent of direct labeling mAb 188Re-HAb18

    Chao Lou; Zhi-Nan Chen; Hui-Jie Bian; Jie Li; Shou-Bo Zhou

    2002-01-01

    AIM: To labed Anti-hepatoma monoclonal antibody (mAb)fragment HAb18 F (ab')2 was labeled with 188 Re for thepharmacokinetic model of 188 Re-HAb18 F (ab')2 and toevaluate its pharmacokinetic parameters in hepatoma-bearing nude mice.METHODS: HAb18 F(ab')2 was directly labeled with 188Reusing 2-mercaptoethanol (2-ME) as reducing agents.Labeling efficiency and immunoreactivity of 188 Re-HAb18 F( ab')2 were evaluated by Whatman 3MM paperchromatography and live cell assay, respectively.Biodiatribution analysis was also conducted in nude micebearing human hepatoma in which animals were sacrificed atdifferent time points(1, 4, 18, 24 and 24h) after 188Re-HAb18F(ab' )2 was injected through tail-vein into hepatoma-bearingnude mice. The blood and radioactivity of organs and masswere measured. The concentrations of 188 Re-HAb18 F(ab')2were evaluated with a pharmacokinetic 3P97 software.RESULTS: The optimum labeling efficiency andimmunoreactive fraction were 91.7% and 0.78%,respectively. The parameters of 188Re-HAb18 F(ab')2 were:T1/2, 2.29h; Vd, 1.49 × 10-9L@ Bq- 1; AUC, 20.49 × 109Bq@ h@L-1 ;CL, 0.45 × 10-3L@ h- 1. 188Re- HAb18 F(ab')2 could locatespecially in hepatoma with high selective reactivity of HAb18F(ab')2. 188 Re-HAb18 F(ab')2 was mainly eliminated bykidney. The maximal tumor to blood ratio was at 48h, andmaximal tumor to liver ratio was at 18h.CONCLUTION: The pharmacokinetics of 188Re-HAb18 F(ab')2fit a I-compartment model. 188 Re-HAb18 F(ab')2 can beuptaken selectively at the hepatoma site.

  10. TITRATION METHOD OF AB0 ANTIBODIES WITH THE USE OF MODERN GEL TECHNOLOGY IN AB0-INCOMPATIBLE TRANSPLANTATION

    A. K. Porunova; Morozova, V.V.; I. E. Tsiroulnikova; O. M. Tsiroulnikova; S. V. Gautier

    2014-01-01

    It is shown that developed method of titrating AB0 antibodies allows defi ning the titer of the investigational antibodies more precisely on 1–3 dilution of serum compared to the prototype method (titration method of antibodiesin saline medium on the plane). It is more obvious as it excludes hardly interpretable results due to the possibility of conducting visual assessment of agglutination reaction in the gel card thick column and requires less time foranalysis. The results can be saved for ...

  11. AB INITIO SIMULATIONS FOR MATERIAL PROPERTIES ALONG THE JUPITER ADIABAT

    We determine basic thermodynamic and transport properties of hydrogen-helium-water mixtures for the extreme conditions along Jupiter's adiabat via ab initio simulations, which are compiled in an accurate and consistent data set. In particular, we calculate the electrical and thermal conductivity, the shear and longitudinal viscosity, and diffusion coefficients of the nuclei. We present results for associated quantities like the magnetic and thermal diffusivity and the kinematic shear viscosity along an adiabat that is taken from a state-of-the-art interior structure model. Furthermore, the heat capacities, the thermal expansion coefficient, the isothermal compressibility, the Grüneisen parameter, and the speed of sound are calculated. We find that the onset of dissociation and ionization of hydrogen at about 0.9 Jupiter radii marks a region where the material properties change drastically. In the deep interior, where the electrons are degenerate, many of the material properties remain relatively constant. Our ab initio data will serve as a robust foundation for applications that require accurate knowledge of the material properties in Jupiter's interior, e.g., models for the dynamo generation.

  12. Ab Initio Thermodynamic Model for Magnesium Carbonates and Hydrates

    Chaka, Anne M.; Felmy, Andrew R.

    2014-03-28

    An ab initio thermodynamic framework for predicting properties of hydrated magnesium carbonate minerals has been developed using density-functional theory linked to macroscopic thermodynamics through the experimental chemical potentials for MgO, water, and CO2. Including semiempirical dispersion via the Grimme method and small corrections to the generalized gradient approximation of Perdew, Burke, and Ernzerhof for the heat of formation yields a model with quantitative agreement for the benchmark minerals brucite, magnesite, nesquehonite, and hydromagnesite. The model shows how small differences in experimental conditions determine whether nesquehonite, hydromagnesite, or magnesite is the result of laboratory synthesis from carbonation of brucite, and what transformations are expected to occur on geological time scales. Because of the reliance on parameter-free first principles methods, the model is reliably extensible to experimental conditions not readily accessible to experiment and to any mineral composition for which the structure is known or can be hypothesized, including structures containing defects, substitutions, or transitional structures during solid state transformations induced by temperature changes or processes such as water, CO2, or O2 diffusion. Demonstrated applications of the ab initio thermodynamic framework include an independent means to evaluate differences in thermodynamic data for lansfordite, predicting the properties of Mg analogs of Ca-based hydrated carbonates monohydrocalcite and ikaite which have not been observed in nature, and an estimation of the thermodynamics of barringtonite from the stoichiometry and a single experimental observation.

  13. Electrocatalytic reduction of nitrate and selenate by NapAB.

    Gates, Andrew J; Butler, Clive S; Richardson, David J; Butt, Julea N

    2011-01-01

    Bacterial cellular metabolism is renowned for its metabolic diversity and adaptability. However, certain environments present particular challenges. Aerobic metabolism of highly reduced carbon substrates by soil bacteria such as Paracoccus pantotrophus presents one such challenge since it may result in excessive electron delivery to the respiratory redox chain when compared with the availability of terminal oxidant, O2. The level of a periplasmic ubiquinol-dependent nitrate reductase, NAP, is up-regulated in the presence of highly reduced carbon substrates. NAP oxidizes ubiquinol at the periplasmic face of the cytoplasmic membrane and reduces nitrate in the periplasm. Thus its activity counteracts the accumulation of excess reducing equivalents in ubiquinol, thereby maintaining the redox poise of the ubiquinone/ubiquinol pool without contributing to the protonmotive force across the cytoplasmic membrane. Although P. pantotrophus NapAB shows a high level of substrate specificity towards nitrate, the enzyme has also been reported to reduce selenate in spectrophotometric solution assays. This transaction draws on our current knowledge concerning the bacterial respiratory nitrate reductases and extends the application of PFE (protein film electrochemistry) to resolve and quantify the selenate reductase activity of NapAB. PMID:21265780

  14. Unified ab initio approaches to nuclear structure and reactions

    Navrátil, Petr; Quaglioni, Sofia; Hupin, Guillaume; Romero-Redondo, Carolina; Calci, Angelo

    2016-05-01

    The description of nuclei starting from the constituent nucleons and the realistic interactions among them has been a long-standing goal in nuclear physics. In addition to the complex nature of the nuclear forces, with two-, three- and possibly higher many-nucleon components, one faces the quantum-mechanical many-nucleon problem governed by an interplay between bound and continuum states. In recent years, significant progress has been made in ab initio nuclear structure and reaction calculations based on input from QCD-employing Hamiltonians constructed within chiral effective field theory. After a brief overview of the field, we focus on ab initio many-body approaches—built upon the no-core shell model—that are capable of simultaneously describing both bound and scattering nuclear states, and present results for resonances in light nuclei, reactions important for astrophysics and fusion research. In particular, we review recent calculations of resonances in the 6He halo nucleus, of five- and six-nucleon scattering, and an investigation of the role of chiral three-nucleon interactions in the structure of 9Be. Further, we discuss applications to the 7Be {({{p}},γ )}8{{B}} radiative capture. Finally, we highlight our efforts to describe transfer reactions including the 3H{({{d}},{{n}})}4He fusion.

  15. Unified ab initio approaches to nuclear structure and reactions

    Navratil, Petr; Hupin, Guillaume; Romero-Redondo, Carolina; Calci, Angelo

    2016-01-01

    The description of nuclei starting from the constituent nucleons and the realistic interactions among them has been a long-standing goal in nuclear physics. In addition to the complex nature of the nuclear forces, with two-, three- and possibly higher many-nucleon components, one faces the quantum-mechanical many-nucleon problem governed by an interplay between bound and continuum states. In recent years, significant progress has been made in {\\em ab initio} nuclear structure and reaction calculations based on input from QCD-employing Hamiltonians constructed within chiral effective field theory. After a brief overview of the field, we focus on ab initio many-body approaches - built upon the No-Core Shell Model - that are capable of simultaneously describing both bound and scattering nuclear states, and present results for resonances in light nuclei, reactions important for astrophysics and fusion research. In particular, we review recent calculations of resonances in the $^6$He halo nucleus, of five- and six...

  16. Ab initio dynamics of the cytochrome P450 hydroxylation reaction

    Elenewski, Justin E.; Hackett, John C, E-mail: jchackett@vcu.edu [Department of Physiology and Biophysics and The Massey Cancer Center, School of Medicine, Virginia Commonwealth University, 401 College Street, Richmond, Virginia 23219-1540 (United States)

    2015-02-14

    The iron(IV)-oxo porphyrin π-cation radical known as Compound I is the primary oxidant within the cytochromes P450, allowing these enzymes to affect the substrate hydroxylation. In the course of this reaction, a hydrogen atom is abstracted from the substrate to generate hydroxyiron(IV) porphyrin and a substrate-centered radical. The hydroxy radical then rebounds from the iron to the substrate, yielding the hydroxylated product. While Compound I has succumbed to theoretical and spectroscopic characterization, the associated hydroxyiron species is elusive as a consequence of its very short lifetime, for which there are no quantitative estimates. To ascertain the physical mechanism underlying substrate hydroxylation and probe this timescale, ab initio molecular dynamics simulations and free energy calculations are performed for a model of Compound I catalysis. Semiclassical estimates based on these calculations reveal the hydrogen atom abstraction step to be extremely fast, kinetically comparable to enzymes such as carbonic anhydrase. Using an ensemble of ab initio simulations, the resultant hydroxyiron species is found to have a similarly short lifetime, ranging between 300 fs and 3600 fs, putatively depending on the enzyme active site architecture. The addition of tunneling corrections to these rates suggests a strong contribution from nuclear quantum effects, which should accelerate every step of substrate hydroxylation by an order of magnitude. These observations have strong implications for the detection of individual hydroxylation intermediates during P450 catalysis.

  17. Three-cluster dynamics within an ab initio framework

    Quaglioni, S; Navrátil, P

    2013-01-01

    We introduce a fully antisymmetrized treatment of three-cluster dynamics within the ab initio framework of the no-core shell model/resonating-group method (NCSM/RGM). Energy-independent non-local interactions among the three nuclear fragments are obtained from realistic nucleon-nucleon interactions and consistent ab initio many-body wave functions of the clusters. The three-cluster Schr\\"odinger equation is solved with bound-state boundary conditions by means of the hyperspherical-harmonic method on a Lagrange mesh. We discuss the formalism in detail and give algebraic expressions for systems of two single nucleons plus a nucleus. Using a soft similarity-renormalization-group evolved chiral nucleon-nucleon potential, we apply the method to an $^4$He+$n+n$ description of $^6$He and compare the results to experiment and to a six-body diagonalization of the Hamiltonian performed within the harmonic-oscillator expansions of the NCSM. Differences between the two calculations provide a measure of core ($^4$He) pola...

  18. Ab Initio Protein Structure Prediction Using Pathway Models

    Christopher Bystroff

    2006-04-01

    Full Text Available Ab initio prediction is the challenging attempt to predict protein structures based only on sequence information and without using templates. It is often divided into two distinct sub-problems: (a the scoring function that can distinguish native, or native-like structures, from non-native ones; and (b the method of searching the conformational space. Currently, there is no reliable scoring function that can always drive a search to the native fold, and there is no general search method that can guarantee a significant sampling of near-natives. Pathway models combine the scoring function and the search. In this short review, we explore some of the ways pathway models are used in folding, in published works since 2001, and present a new pathway model, HMMSTR-CM, that uses a fragment library and a set of nucleation/propagation-based rules. The new method was used for ab initio predictions as part of CASP5. This work was presented at the Winter School in Bioinformatics, Bologna, Italy, 10–14 February 2003.

  19. ABS polymer electroless plating through a one-step poly(acrylic acid) covalent grafting.

    Garcia, Alexandre; Berthelot, Thomas; Viel, Pascal; Mesnage, Alice; Jégou, Pascale; Nekelson, Fabien; Roussel, Sébastien; Palacin, Serge

    2010-04-01

    A new, efficient, palladium- and chromium-free process for the electroless plating of acrylonitrile-butadiene-styrene (ABS) polymers has been developed. The process is based on the ion-exchange properties of poly(acrylic acid) (PAA) chemically grafted onto ABS via a simple and one-step method that prevents using classical surface conditioning. Hence, ABS electroless plating can be obtained in three steps, namely: (i) the grafting of PAA onto ABS, (ii) the copper Cu(0) seeding of the ABS surface, and (iii) the nickel or copper metallization using commercial-like electroless plating bath. IR, XPS, and SEM were used to characterize each step of the process, and the Cu loading was quantified by atomic absorption spectroscopy. This process successfully compares with the commercial one based on chromic acid etching and palladium-based seed layer, because the final metallic layer showed excellent adhesion with the ABS substrate. PMID:20361751

  20. Cry1Ab protein from Bacillus thuringiensis and MON810 cry1Ab-transgenic maize exerts no adjuvant effect after airway exposure.

    Andreassen, M; Bøhn, T; Wikmark, O-G; Van den Berg, J; Løvik, M; Traavik, T; Nygaard, U C

    2015-03-01

    The genetically modified (GM) maize event MON810 has been inserted with a processed version of the transgene, cry1Ab, derived from the soil bacterium Bacillus thuringiensis (Bt) to express proteins with insecticidal properties. Such proteins may introduce new allergens and also act as adjuvants that promote allergic responses. While focus has been on safe consumption and hence the oral exposure to GM food and feed, little is known regarding inhalation of pollen and desiccated airborne plant material from GM crops. The aim of this study was to investigate whether plant material from the Cry1Ab-expressing maize variety MON810, or trypsin-activated Cry1Ab (trypCry1Ab) protein produced in recombinant bacteria, may act as adjuvants against the allergen ovalbumin (OVA) in a mouse model of airway allergy. A clear proallergic adjuvant effect of the mucosal adjuvant cholera toxin (CT) was demonstrated, determined as increased specific IgE, eosinophils and Th2 cytokines in MLN cell supernates, while no elevation in OVA-specific antibodies or cytokine release from MLN cells after stimulation with OVA were observed in mice receiving Cry1Ab-containing plant materials or the trypCry1Ab protein. Our data suggest that Cry1Ab proteins had no detectable systemic adjuvant effect in mice after airway exposure. Further experiments with purified plant proteins, as well as long-term exposures needs be conducted to further evaluate exposures experienced in real-life situations. PMID:25564738

  1. Living with an imperfect cell wall: compensation of femAB inactivation in Staphylococcus aureus.

    Bierbaum Gabriele; Harris Llinos G; Majcherczyk Paul A; Schäfer Juliane; Kotte Oliver; Jansen Andrea; Hübscher Judith; Heinemann Matthias; Berger-Bächi Brigitte

    2007-01-01

    Abstract Background Synthesis of the Staphylococcus aureus peptidoglycan pentaglycine interpeptide bridge is catalyzed by the nonribosomal peptidyl transferases FemX, FemA and FemB. Inactivation of the femAB operon reduces the interpeptide to a monoglycine, leading to a poorly crosslinked peptidoglycan. femAB mutants show a reduced growth rate and are hypersusceptible to virtually all antibiotics, including methicillin, making FemAB a potential target to restore β-lactam susceptibility in met...

  2. Phosphoric acid doped AB-PBI membranes and its applications in high temperature PEMFC

    He, Ronghuan; Qingfeng, Li; Bjerrum, Niels

    2005-01-01

    Poly(2,5-benzimidazole) (ab-PBI) was prepared from 3,4-diaminobenzoic acid via a polymerisation reaction. The obtained polymer exhibits excellent thermal stability in a temperature range ….. The membrane of ab-PBI when doped with phosphoric acid at room temperaturepresents high proton conductivity......C with phosphoric acid doped ab-PBI as the electrolyte under atmospheric pressure at 200°C without humidification....

  3. Performance of the Molecular Alere i Influenza A&B Test Compared to That of the Xpert Flu A/B Assay

    Chapin, Kimberle C.; Flores-Cortez, Estefany J.

    2014-01-01

    Data on the performance of rapid molecular point-of-care use platforms for diagnosis of influenza are lacking. We validated nasopharyngeal (NP) flocked specimens in universal transport medium (UTM) and evaluated the clinical sensitivity and specificity of the Alere i influenza A&B test compared to those of the Xpert flu A/B assay. The Alere i influenza A&B test had an overall sensitivity and specificity of 93.8% and 62.5% for influenza A, respectively, and of 91.8% and 53.6% for influenza B, ...

  4. Adsorption of insecticidal Cry1Ab protein to humic substances. 1. Experimental approach and mechanistic aspects.

    Sander, Michael; Tomaszewski, Jeanne E; Madliger, Michael; Schwarzenbach, René P

    2012-09-18

    Adsorption is a key process affecting the fate of insecticidal Cry proteins (Bt toxins), produced by genetically modified Bt crops, in soils. However, the mechanisms of adsorption to soil organic matter (SOM) remain poorly understood. This work assesses the forces driving the adsorption of Cry1Ab to Leonardite humic acid (LHA), used as a model for SOM. We studied the effects of solution pH and ionic strength (I) on adsorption using a quartz crystal microbalance with dissipation monitoring and optical waveguide lightmode spectroscopy. Initial Cry1Ab adsorption rates were close to diffusion-limited and resulted in extensive adsorption, even at pH >6, at which LHA and Cry1Ab carry negative net charges. Adsorption increased with decreasing I at pH >6, indicating Cry1Ab-LHA patch-controlled electrostatic attraction via positively charged domains of Cry1Ab. Upon rinsing, only a fraction of Cry1Ab desorbed, suggesting a range of interaction energies of Cry1Ab with LHA. Different interaction energies likely resulted from nonuniformity in the LHA surface polarity, with higher Cry1Ab affinities to more apolar LHA regions due to the hydrophobic effect. Contributions from the hydrophobic effect were substantiated by comparison of the adsorption of Cry1Ab and the reference proteins albumin and lysozyme to LHA and to apolar and polar model surfaces. PMID:22862304

  5. Comparative Study of Electroless Copper Film on Different Self-Assembled Monolayers Modified ABS Substrate

    Jiushuai Xu

    2014-04-01

    Full Text Available Copper films were grown on (3-Mercaptopropyltrimethoxysilane (MPTMS, (3-Aminopropyltriethoxysilane (APTES and 6-(3-(triethoxysilylpropylamino-1,3,5- triazine-2,4-dithiol monosodium (TES self-assembled monolayers (SAMs modified acrylonitrile-butadiene-styrene (ABS substrate via electroless copper plating. The copper films were examined using scanning electron microscopy (SEM and X-ray diffraction (XRD. Their individual deposition rate and contact angle were also investigated to compare the properties of SAMs and electroless copper films. The results indicated that the formation of copper nuclei on the TES-SAMs modified ABS substrate was faster than those on the MPTMS-SAMs and APTES-SAMs modified ABS substrate. SEM images revealed that the copper film on TES-SAM modified ABS substrate was smooth and uniform, and the density of copper nuclei was much higher. Compared with that of TES-SAMs modified resin, the coverage of copper nuclei on MPTMS and APTES modified ABS substrate was very limited and the copper particle size was too big. The adhesion property test demonstrated that all the SAMs enhanced the interfacial interaction between copper plating and ABS substrate. XRD analysis showed that the copper film deposited on SAM-modified ABS substrate had a structure with Cu(111 preferred orientation, and the copper film deposited on TES-SAMs modified ABS substrate is better than that deposited on MPTMS-SAMs or APTES-SAMs modified ABS resins in electromigrtion resistance.

  6. Heat Shock Protein 90AB1 and Hyperthermia Rescue Infectivity of HIV with Defective Cores

    Joshi, Pheroze; Sloan, Barbara; Torbett, Bruce E.; Stoddart, Cheryl A.

    2012-01-01

    We previously showed that reduced infectivity of HIV with incompletely processed capsid-spacer protein 1 (CA-SP1) is rescued by cellular activation or increased expression of HSP90AB1, a member of the cytosolic heat shock protein 90 family. Here we show that HSP90AB1 is present in HIV virions and that HSP90AB1, but not nonfunctional mutated HSP90AB1E42A+D88A, restores infectivity to HIV with mutations in CA that alter core stability. Further, the CA mutants were hypersensitive to pharmacologi...

  7. Effect of Rapid Quenching on Electrochemical Properties of AB5 and AB3.5-Type Hydrogen Storage Alloys

    Li Ping; Zheng Xueping; An Fuqiang; Islam S. Humail; Qu Xuanhui

    2007-01-01

    Effect of rapid quenching on the electrochemical properties of AB5 and AB3.5-type hydrogen storage alloys was studied. The results indicated that the discharge capacities of the rapid quenching MmNi3.55 Co0.75 Mn0.4Al0.3 alloys decrease under 25 and -35℃ with the increase of the quenching rate. Comparatively, the decrease extent of the quenching alloys at -35℃ is lower than that at 25℃. The result on the study of the cycle life indicated that the quenching process was favorable to improve the cycle stabilities of the MmNi3.55Co0.75-Mn0.4Al0.3alloys under 25 and -35℃. Whereas, the effect of the quenching process on the La0.7Mg0.3(Ni0.85Co0.15)3.5 alloy was different at 25℃ from at -35℃. Under 25℃, the cycle life of the alloy was obviously improved by the quenching process, however, the quenching process did not improve but decreased slightly the cycle life at -35℃.

  8. Ab initio Potential Energy Surface for H-H2

    Partridge, Harry; Bauschlicher, Charles W., Jr.; Stallcop, James R.; Levin, Eugene

    1993-01-01

    Ab initio calculations employing large basis sets are performed to determine an accurate potential energy surface for H-H2 interactions for a broad range of separation distances. At large distances, the spherically averaged potential determined from the calculated energies agrees well with the corresponding results determined from dispersion coefficients; the van der Waals well depth is predicted to be 75 +/- (mu)E(sub h). Large basis sets have also been applied to reexamine the accuracy of theoretical repulsive potential energy surfaces. Multipolar expansions of the computed H-H2 potential energy surface are reported for four internuclear separation distances (1.2, 1.401, 1.449, and 1.7a(sub 0) of the hydrogen molecule. The differential elastic scattering cross section calculated from the present results is compared with the measurements from a crossed beam experiment.

  9. Ab initio H2O in realistic hydrophilic confinement.

    Allolio, Christoph; Klameth, Felix; Vogel, Michael; Sebastiani, Daniel

    2014-12-15

    A protocol for the ab initio construction of a realistic cylindrical pore in amorphous silica, serving as a geometric nanoscale confinement for liquids and solutions, is presented. Upon filling the pore with liquid water at different densities, the structure and dynamics of the liquid inside the confinement can be characterized. At high density, the pore introduces long-range oscillations into the water density profile, which makes the water structure unlike that of the bulk across the entire pore. The tetrahedral structure of water is also affected up to the second solvation shell of the pore wall. Furthermore, the effects of the confinement on hydrogen bonding and diffusion, resulting in a weakening and distortion of the water structure at the pore walls and a slowdown in diffusion, are characterized. PMID:25208765

  10. Ab initio design of laser pulse for controlling photochemical reactions

    With high level ab initio description of molecule-field interaction, we have developed an optimal control algorithm for manipulating molecular transformation and quantum populations. High order molecule-field interactions are fully taken into account through the use of electric-nuclear Born-Oppenheimer (ENBO) approximation. The present algorithm is demonstrated on the control of molecular post-pulse (transient)alignment and orientation. High degrees of alignment and orientation are achieved in a vibrationally selective manner by optimized infrared laser pulses of duration on the order one rotational period of molecule. To reveal the control mechanism behind the complicated optimal pulses, an analytical pulse design method is developed within the ENBO approximation, which is based on a two-state treatment of the dynamics in a Floquet picture. This analytical method is also illustrated on the control of the alignment of homonuclear diatomics. (author)

  11. Highly anisotropic thermal conductivity of arsenene: An ab initio study

    Zeraati, Majid; Vaez Allaei, S. Mehdi; Abdolhosseini Sarsari, I.; Pourfath, Mahdi; Donadio, Davide

    2016-02-01

    Elemental two-dimensional (2D) materials exhibit intriguing heat transport and phononic properties. Here we have investigated the lattice thermal conductivity of newly proposed arsenene, the 2D honeycomb structure of arsenic, using ab initio calculations. Solving the Boltzmann transport equation for phonons, we predict a highly anisotropic thermal conductivity of 30.4 and 7.8 W/mK along the zigzag and armchair directions, respectively, at room temperature. Our calculations reveal that phonons with mean free paths between 20 nm and 1 μ m provide the main contribution to the large thermal conductivity in the zigzag direction; mean free paths of phonons contributing to heat transport in the armchair directions range between 20 and 100 nm. The obtained anisotropic thermal conductivity and feasibility of synthesis, in addition to high electron mobility reported elsewhere, make arsenene a promising material for nanoelectronic applications and thermal management.

  12. Efficient Ab initio Modeling of Random Multicomponent Alloys

    Jiang, Chao; Uberuaga, Blas P.

    2016-03-01

    We present in this Letter a novel small set of ordered structures (SSOS) method that allows extremely efficient ab initio modeling of random multicomponent alloys. Using inverse II-III spinel oxides and equiatomic quinary bcc (so-called high entropy) alloys as examples, we demonstrate that a SSOS can achieve the same accuracy as a large supercell or a well-converged cluster expansion, but with significantly reduced computational cost. In particular, because of this efficiency, a large number of quinary alloy compositions can be quickly screened, leading to the identification of several new possible high-entropy alloy chemistries. The SSOS method developed here can be broadly useful for the rapid computational design of multicomponent materials, especially those with a large number of alloying elements, a challenging problem for other approaches.

  13. Molecular ion LiHe+: ab initio study

    Highlights: ► Excited electronic states of LiHe+ are studied. ► Potential energy curves of thirteen states are calculated. ► Dipole moment and transition dipole moment functions are determined. ► Basic spectroscopic properties of the electronic states are derived. - Abstract: High level ab initio calculations are performed on the molecular ion LiHe+. Potential energy curves for the low-lying singlet and triplet electronic states are calculated using the multi-reference configuration interaction and single-reference coupled cluster methods with large basis sets. The corresponding dipole moments and transition dipole moments functions are also determined. The basic spectroscopic properties and excitation energies of the electronic states are derived from rovibrational bound state calculations.

  14. OPTIMIZATION STUDY IN MANUFACTURING PROCESS FOR PC/ABS BLENDS

    Huang Chenghung; Fung Chinping; Chang Shihhsing; Hwang Jiunren; Doong Jiliang

    2003-01-01

    The optimization of injection molding process for polycarbonate/acrylonitrile-butadiene-styrene (PC/ABS) blends is studied using Taguchi method and principal component analysis (PCA). Four controllable process factors are studied at three levels each in the manufacturing process. The L9 orthogonal array is conducted to determine the optimum process factor/level combination for single quality of mechanical properties. In addition, the principal component analysis is employed to transform the correlated mechanical properties to a set of uncorrelated components and to evaluate a comprehensive index for multi-response cases. Then the optimum process factor/level combination for multiple qualities can be determined. Finally, the analysis of variance is used to find out the most influential injection molding parameter for single and multiple qualities problems.

  15. AB "DNB" banko įvaizdžio valdymas

    Vaškelytė, Virginija

    2012-01-01

    Šio darbo tikslas - išnagrinėji AB „DNB“ banko įvaizdžio formavimą ir valdymą teoriniu bei praktiniu aspektu ir konstatavus įvaizdžio formavimo bei valdymo problemas sukurti banko įvaizdžio tobulinimo modelį. Teorinėje darbo dalyje analizuojama organizacijos įvaizdžio samprata, kūrimo lygiai, pagrindiniai veiksniai, formuojantys organizacijos įvaizdį. Taip pat teorinėje dalyje analizuojami, lyginami organizacijos įvaizdžio kūrimo modeliai bei banko įvaizdžio valdymas. Analitinėje baigiamojo d...

  16. Ab initio study of II-(VI){sub 2} dichalcogenides

    Olsson, P; Vidal, J; Lincot, D, E-mail: polsson@kth.se [Institut de R and D sur l' energie photovoltaique (IRDEP), UMR 7174-EDF-CNRS-ENSCP, 6 quai Watier, 78401 Chatou Cedex (France)

    2011-10-12

    The structural stabilities of the (Zn,Cd)(S,Se,Te){sub 2} dichalcogenides have been determined ab initio. These compounds are shown to be stable in the pyrite phase, in agreement with available experiments. Structural parameters for the ZnTe{sub 2} pyrite semiconductor compound proposed here are presented. The opto-electronic properties of these dichalcogenide compounds have been calculated using quasiparticle GW theory. Bandgaps, band structures and effective masses are proposed as well as absorption coefficients and refraction indices. The compounds are all indirect semiconductors with very flat conduction band dispersion and high absorption coefficients. The work functions and surface properties are predicted. The Te and Se based compounds could be of interest as absorber materials in photovoltaic applications. (paper)

  17. Ab initio calculations of grain boundaries in bcc metals

    Scheiber, Daniel; Pippan, Reinhard; Puschnig, Peter; Romaner, Lorenz

    2016-03-01

    In this study, we compute grain boundary (GB) properties for a large set of GBs in bcc transition metals with a special focus on W, Mo and Fe using ab initio density functional theory (DFT) and semi-empirical second nearest neighbour modified embedded atom method (2NN-MEAM) potentials. The GB properties include GB energies, surface energies, GB excess volume and work of separation, which we analyse and then compare to experimental data. We find that the used 2NN-MEAM potentials can predict general trends of GB properties, but do not always reproduce the GB ground state structure and energy found with DFT. In particular, our results explain the experimental finding that W and Mo prefer intergranular fracture, while other bcc metals prefer transgranular cleavage.

  18. Ab initio quantum dynamics using coupled-cluster

    Kvaal, Simen

    2012-01-01

    The curse of dimensionality (COD) limits the current state-of-the-art {\\it ab initio} propagation methods for non-relativistic quantum mechanics to relatively few particles. For stationary structure calculations, the coupled-cluster (CC) method overcomes the COD in the sense that the method scales polynomially with the number of particles while still being size-consistent and extensive. We generalize the CC method to the time domain while allowing the single-particle functions to vary in an adaptive fashion as well, thereby creating a highly flexible, polynomially scaling approximation to the time-dependent Schr\\"odinger equation. The method inherits size-consistency and extensivity from the CC method. The method is dubbed orbital-adaptive time-dependent coupled-cluster (OATDCC), and is a hierarchy of approximations to the now standard multi-configurational time-dependent Hartree method for fermions. A numerical experiment is also given.

  19. Ab initio study of the transition-metal carbene cations

    李吉海; 冯大诚; 冯圣玉

    1999-01-01

    The geometries and bonding characteristics of the first-row transition-metal carbene cations MCH2+ were investigated by ab initio molecular orbital theory (HF/LANL2DZ). All of MCH2+ are coplanar. In the closed shell structures the C bonds to M with double bonds; while in the open shell structures the partial double bonds are formed, because one of the σ and π orbitals is singly occupied. It is mainly the π-type overlap between the 2px orbital of C and 4px, 3dxz, orbitals of M+ that forms the π orbitals. The dissociation energies of C—M bond appear in periodic trend from Sc to Cu. Most of the calculated bond dissociation energies are close to the experimental ones.

  20. Ab initio electronic stopping power of protons in bulk materials

    Shukri, Abdullah Atef; Bruneval, Fabien; Reining, Lucia

    2016-01-01

    The electronic stopping power is a crucial quantity for ion irradiation: it governs the deposited heat, the damage profile, and the implantation depth. Whereas experimental data are readily available for elemental solids, the data are much more scarce for compounds. Here we develop a fully ab initio computational scheme based on linear response time-dependent density-functional theory to predict the random electronic stopping power (RESP) of materials without any empirical fitting. We show that the calculated RESP compares well with experimental data, when at full convergence, with the inclusion of the core states and of the exchange correlation. We evaluate the unexpectedly limited magnitude of the nonlinear terms in the RESP by comparing with other approaches based on the time propagation of time-dependent density-functional theory. Finally, we check the validity of a few empirical rules of thumbs that are commonly used to estimate the electronic stopping power.

  1. High-throughput ab-initio dilute solute diffusion database.

    Wu, Henry; Mayeshiba, Tam; Morgan, Dane

    2016-01-01

    We demonstrate automated generation of diffusion databases from high-throughput density functional theory (DFT) calculations. A total of more than 230 dilute solute diffusion systems in Mg, Al, Cu, Ni, Pd, and Pt host lattices have been determined using multi-frequency diffusion models. We apply a correction method for solute diffusion in alloys using experimental and simulated values of host self-diffusivity. We find good agreement with experimental solute diffusion data, obtaining a weighted activation barrier RMS error of 0.176 eV when excluding magnetic solutes in non-magnetic alloys. The compiled database is the largest collection of consistently calculated ab-initio solute diffusion data in the world. PMID:27434308

  2. Transport coefficients in diamond from ab-initio calculations

    Löfâs, Henrik; Grigoriev, Anton; Isberg, Jan; Ahuja, Rajeev

    2013-03-01

    By combining the Boltzmann transport equation with ab-initio electronic structure calculations, we obtain transport coefficients for boron-doped diamond. We find the temperature dependence of the resistivity and the hall coefficients in good agreement with experimental measurements. Doping in the samples is treated via the rigid band approximation and scattering is treated in the relaxation time approximation. In contrast to previous results, the acoustic phonon scattering is the dominating scattering mechanism for the considered doping range. At room temperature, we find the thermopower, S, in the range 1-1.6 mV/K and the power factor, S2σ, in the range 0.004-0.16 μW /cm K2.

  3. Ab-initio melting curve and principal Hugoniot of tantalum

    We report first principles calculations of the melting curve and principal Hugoniot (P - V curve) of body centered cubic (bcc) tantalum in the pressure range 0-300 GPa. A description of lattice dynamics and thermal properties of bcc Ta using finite temperature density functional theory (DFT) is presented. The approach works within the projector augmented wave (PAW) implementation of DFT and explicitly treats in valence the 5p, 6s and 5d electrons. The principal Hugoniot (P - V curve), obtained using the Rankine-Hugoniot equation, is investigated using the generalized gradient approximations (GGA). Very good agreement with the shock experiments is obtained with GGA in all the range of pressure. We also report the temperature-pressure relation on the shock Hugoniot and the full ab-initio melting curve of Ta

  4. Diode laser welding of ABS: Experiments and process modeling

    Ilie, Mariana; Mattei, Simone; Cicala, Eugen; Stoica, Virgil; 10.1016/j.optlastec.2008.10.005

    2010-01-01

    The laser beam weldability of acrylonitrile/butadiene/styrene (ABS) plates is determined by combining both experimental and theoretical aspects. In modeling the process, an optical model is used to determine how the laser beam is attenuated by the first material and to obtain the laser beam profile at the interface. Using this information as the input data to a thermal model, the evolution of the temperature field within the two components can be estimated. The thermal model is based on the first principles of heat transfer and utilizes the temperature variation laws of material properties. Corroborating the numerical results with the experimental results, some important insights concerning the fundamental phenomena that govern the process could be extracted. This approach proved to be an efficient tool in determining the weldability of polimeric materials and assures a significant reduction of time and costs with the experimental exploration.

  5. Socialiai atsakingo verslo koncepcijos įgyvendinimas AB "Lietuvos draudimas"

    Žukauskienė, Justina

    2010-01-01

    Bakalauro baigiamajame darbe nagrinėjama socialiai atsakingo verslo koncepcija, pateikiami socialinės atsakomybės modeliai, kuriais remiantis įmonės gali įgyvendinti socialinę atsakomybę. Apžvelgiama Lietuvos patirtis socialinės atsakomybės srityje. Pateikiama ne tik socialinės atsakomybės nauda įmonei ir visuomenei, bet ir kritiškas požiūris į socialinę atsakomybę. Darbe analizuojamas AB „Lietuvos draudimas“ įgyvendinamas socialinės atsakomybės modelis. Nustatyta, kad įmonė socialinę atsakom...

  6. Ab initio methods for electron-molecule collisions

    This review concentrates on the recent advances in treating the electronic aspect of the electron-molecule interaction and leaves to other articles the description of the rotational and vibrational motions. Those methods which give the most complete treatment of the direct, exchange, and correlation effects are focused on. Such full treatments are generally necessary at energies below a few Rydbergs (≅ 60 eV). This choice unfortunately necessitates omission of those active and vital areas devoted to the development of model potentials and approximate scattering formulations. The ab initio and model approaches complement each other and are both extremely important to the full explication of the electron-scattering process. Due to the rapid developments of recent years, the approaches that provide the fullest treatment are concentrated on. 81 refs

  7. Ab initio electronic structure and optical conductivity of bismuth tellurohalides

    Schwalbe, Sebastian; Starke, Ronald; Schober, Giulio A H; Kortus, Jens

    2016-01-01

    We investigate the electronic structure, dielectric and optical properties of bismuth tellurohalides BiTeX (X = I, Cl, Br) by means of all-electron density functional theory. In particular, we present the ab initio conductivities and dielectric tensors calculated over a wide frequency range, and compare our results with the recent measurements by Akrap et al. , Makhnev et al. , and Rusinov et al. . We show how the low-frequency branch of the optical conductivity can be used to identify characteristic intra- and interband transitions between the Rashba spin-split bands in all three bismuth tellurohalides. We further calculate the refractive indices and dielectric constants, which in turn are systematically compared to previous predictions and measurements. We expect that our quantitative analysis will contribute to the general assessment of bulk Rashba materials for their potential use in spintronics devices.

  8. Relativistic ab initio calculations for ion-atom collisions

    Within the independent particle model we solve the time---dependent single-particle equation using ab initio SCF-DIRAC-FOCK-SLATER wavefunctions as a basis. To reinstate the many-particle aspect of the collision system we use the inclusive probability formalism to answer experimental questions. As an example we show an application to the case of S15+ on Ar where experimental data on the K-K charge transfer are available for a wide range of impact energies from 4.7 to 90 MeV. Our molecular adiabatic calculations and the evaluation using the inclusive probability formalism show good results in the low energy range from 4.7 to 16 MeV impact energy

  9. Ab Initio Calculations of Co Shielding in Model Complexes

    Elaine A. Moore

    2002-08-01

    Full Text Available Abstract: Recent ab initio calculations of cobalt NMR shielding show that DFT-GIAO calculations using hybrid functionals are found to reproduce experimental values well. This method is used to calculate the variation of the cobalt NMR shielding tensor of sqaure pyramidal nitrosyl complexes with respect to the CoNO geometry and to differing basal ligands. The isotropic shielding is shown to have a large negative derivative with respect to CoX distance where X is a ligating atom.; the derivative with respect to NO distance is smaller but still significant. The zz component where z is along the CoN(NO bond is more sensitive to the basal ligands but the other two principal components are sensitive to the CoNO geometry.

  10. Interatomic Coulombic decay widths of helium trimer: Ab initio calculations

    Kolorenč, Přemysl, E-mail: kolorenc@mbox.troja.mff.cuni.cz [Charles University in Prague, Faculty of Mathematics and Physics, Institute of Theoretical Physics, V Holešovičkách 2, 180 00 Prague (Czech Republic); Sisourat, Nicolas [Sorbonne Universités, UPMC Univ Paris 06, UMR 7614, Laboratoire de Chimie Physique Matière et Rayonnement, F-75005 Paris (France); CNRS, UMR 7614, Laboratoire de Chimie Physique Matière et Rayonnement, F-75005 Paris (France)

    2015-12-14

    We report on an extensive study of interatomic Coulombic decay (ICD) widths in helium trimer computed using a fully ab initio method based on the Fano theory of resonances. Algebraic diagrammatic construction for one-particle Green’s function is utilized for the solution of the many-electron problem. An advanced and universal approach to partitioning of the configuration space into discrete states and continuum subspaces is described and employed. Total decay widths are presented for all ICD-active states of the trimer characterized by one-site ionization and additional excitation of an electron into the second shell. Selected partial decay widths are analyzed in detail, showing how three-body effects can qualitatively change the character of certain relaxation transitions. Previously unreported type of three-electron decay processes is identified in one class of the metastable states.

  11. An Efficient Approach to Ab Initio Monte Carlo Simulation

    Leiding, Jeff

    2013-01-01

    We present a Nested Markov Chain Monte Carlo (NMC) scheme for building equilibrium averages based on accurate potentials such as density functional theory. Metropolis sampling of a reference system, defined by an inexpensive but approximate potential, is used to substantially decorrelate configurations at which the potential of interest is evaluated, thereby dramatically reducing the number needed to build ensemble averages at a given level of precision. The efficiency of this procedure is maximized on-the-fly through variation of the reference system thermodynamic state (characterized here by its inverse temperature \\beta^0), which is otherwise unconstrained. Local density approximation (LDA) results are presented for shocked states in argon at pressures from 4 to 60 GPa. Depending on the quality of the reference potential, the acceptance probability is enhanced by factors of 1.2-28 relative to unoptimized NMC sampling, and the procedure's efficiency is found to be competitive with that of standard ab initio...

  12. Internetmarknadsföring inom turismen : Case Esbo Turism Ab

    Gothoni, Jenny

    2010-01-01

    I detta arbetet behandlas kundförnöjsamheten med Esbo Turism Abs hemsidor, och ifall dessa kan förbättras ytterligare. Teorin baserar sig mycket på marknadsföring samt kundens beteende och behov, internetsidor samt kvalitet och segmentering. Undersökningen har genomförts med hjälp av webbenkäter och litet djupare e-post intervjuer under våren 2010. I undersökningen deltog 30 personer i enkäterna och tre stycken i intervjuerna. Störst svarskvot bildades av 15-25 åringar från Helsingfors. ...

  13. Ab initio potential energy surface and rovibrational states of HBO

    Ha, Tae-Kyu; Makarewicz, Jan

    1999-01-01

    The potential energy surface describing the large-amplitude motion of H around the BO core in the HBO molecule has been determined from ab initio calculations. This surface has been sampled by a set of 170 grid points from a two-dimensional space defined by the stretching and the bending coordinates of the H nucleus. At each grid point, the BO bond length has been optimized using the second-order Møller-Plesset perturbation theory with the basis set aug-cc-pVTZ. The surface has a local minimum for the linear as well as the bent configuration of HBO. A low energy barrier to the linear configuration BOH causes a large-amplitude motion and a strong rovibrational interaction in the molecule. Its rovibrational dynamics is different from the dynamics in bent or quasilinear triatomic molecules.

  14. Ab initio quantum dynamics using coupled-cluster.

    Kvaal, Simen

    2012-05-21

    The curse of dimensionality (COD) limits the current state-of-the-art ab initio propagation methods for non-relativistic quantum mechanics to relatively few particles. For stationary structure calculations, the coupled-cluster (CC) method overcomes the COD in the sense that the method scales polynomially with the number of particles while still being size-consistent and extensive. We generalize the CC method to the time domain while allowing the single-particle functions to vary in an adaptive fashion as well, thereby creating a highly flexible, polynomially scaling approximation to the time-dependent Schrödinger equation. The method inherits size-consistency and extensivity from the CC method. The method is dubbed orbital-adaptive time-dependent coupled-cluster, and is a hierarchy of approximations to the now standard multi-configurational time-dependent Hartree method for fermions. A numerical experiment is also given. PMID:22612082

  15. A Review on Ab Initio Approaches for Multielectron Dynamics

    Ishikawa, Kenichi L

    2015-01-01

    In parallel with the evolution of femtosecond and attosecond laser as well as free-electron laser technology, a variety of theoretical methods have been developed to describe the behavior of atoms, molecules, clusters, and solids under the action of those laser pulses. Here we review major ab initio wave-function-based numerical approaches to simulate multielectron dynamics in atoms and molecules driven by intense long-wavelength and/or ultrashort short-wavelength laser pulses. Direct solution of the time-dependent Schr\\"odinger equation (TDSE), though its applicability is limited to He, ${\\rm H}_2$, and Li, can provide an exact description and has been greatly contributing to the understanding of dynamical electron-electron correlation. Multiconfiguration self-consistent-field (MCSCF) approach offers a flexible framework from which a variety of methods can be derived to treat both atoms and molecules, with possibility to systematically control the accuracy. The equations of motion of configuration interactio...

  16. Energiutredning på Chips AB, Åland

    Renström, Thom; Sundbäck, Henrik

    2013-01-01

    En energikartläggning har gjorts hos Chips AB för att undersöka hur energin fördelas över de olika produktionslinjerna. Energianvändningen från processer som är gemensamma för alla produktionslinjer har också undersökts. Energianvändningen för dessa har fördelats över pro- duktionslinjerna eftersom produkterna även ska bära upp dessa energikostnader. Där det vi- sade sig att chipslinjen använder överlägset mest energi under ett år, 13 200 MWh, men den linjen körs mest o...

  17. Ab initio engineering of materials with stacked hexagonal tin frameworks

    Shao, Junping; Beaufils, Clément; Kolmogorov, Aleksey N.

    2016-01-01

    The group-IV tin has been hypothesized to possess intriguing electronic properties in an atom-thick hexagonal form. An attractive pathway of producing sizable 2D crystallites of tin is based on deintercalation of bulk compounds with suitable tin frameworks. Here, we have identified a new synthesizable metal distannide, NaSn2, with a 3D stacking of flat hexagonal layers and examined a known compound, BaSn2, with buckled hexagonal layers. Our ab initio results illustrate that despite being an exception to the 8-electron rule, NaSn2 should form under pressures easily achievable in multi-anvil cells and remain (meta)stable under ambient conditions. Based on calculated Z2 invariants, the predicted NaSn2 may display topologically non-trivial behavior and the known BaSn2 could be a strong topological insulator. PMID:27387140

  18. Effect of gamma irradiation on nutritional components and Cry1Ab protein in the transgenic rice with a synthetic cry1Ab gene from Bacillus thuringiensis

    Wu, Dianxing; Ye, Qingfu; Wang, Zhonghua; Xia, Yingwu

    2004-01-01

    The effects of gamma irradiation on the transgenic rice containing a synthetic cry1Ab gene from Bacillus thuringiensis were investigated. There was almost no difference in the content of the major nutritional components, i.e. crude protein, crude lipid, eight essential amino acids and total ash between the irradiated grains and the non-irradiated transgenic rice. However, the amounts of Cry1Ab protein and apparent amylose in the irradiated transgenic rice were reduced significantly by the doses higher than 200 Gy. In vivo observation showed that Cry1Ab protein contents also decreased in the fresh leaf tissues of survival seedlings after irradiation with 200 Gy or higher doses and showed inhibition of seedling growth. The results indicate that gamma irradiation might improve the quality of transgenic rice due to removal of the toxic Cry1Ab protein.

  19. Effect of gamma irradiation on nutritional components and Cry1Ab protein in the transgenic rice with a synthetic cry1Ab gene from Bacillus thuringiensis

    The effects of gamma irradiation on the transgenic rice containing a synthetic cry1Ab gene from Bacillus thuringiensis were investigated. There was almost no difference in the content of the major nutritional components, i.e. crude protein, crude lipid, eight essential amino acids and total ash between the irradiated grains and the non-irradiated transgenic rice. However, the amounts of Cry1Ab protein and apparent amylose in the irradiated transgenic rice were reduced significantly by the doses higher than 200 Gy. In vivo observation showed that Cry1Ab protein contents also decreased in the fresh leaf tissues of survival seedlings after irradiation with 200 Gy or higher doses and showed inhibition of seedling growth. The results indicate that gamma irradiation might improve the quality of transgenic rice due to removal of the toxic Cry1Ab protein

  20. 一种AB PLC与Profibus DP网络通信的方法%A Solution for Communication between AB PLC and Profibus DP Network

    李学治

    2015-01-01

    Industrial automation communication network is variousness. This paper presents a solution for communication be-tween AB PLC and Profibus DP network, introduces an example that an AB PLC system communicates with Siemens S120 drives through Profibus DP network by using MVI56-PDPMV1 module.%工业自动化通信网络具有多样性的特点, wenz对AB PLC与Profibus DP网络通信的方法进行探究,用设计实例探讨AB PLC系统通过MVI56-PDPMV1通信模块与西门子S120驱动系统构建Profibus-DP通信网络的设计与编程设置。

  1. Expression of Cry1Ab and Cry2Ab by a polycistronic transgene with a self-cleavage peptide in rice.

    Qichao Zhao

    Full Text Available Insect resistance to Bacillus thuringiensis (Bt crystal protein is a major threat to the long-term use of transgenic Bt crops. Gene stacking is a readily deployable strategy to delay the development of insect resistance while it may also broaden insecticidal spectrum. Here, we report the creation of transgenic rice expressing discrete Cry1Ab and Cry2Ab simultaneously from a single expression cassette using 2A self-cleaving peptides, which are autonomous elements from virus guiding the polycistronic viral gene expression in eukaryotes. The synthetic coding sequences of Cry1Ab and Cry2Ab, linked by the coding sequence of a 2A peptide from either foot and mouth disease virus or porcine teschovirus-1, regardless of order, were all expressed as discrete Cry1Ab and Cry2Ab at high levels in the transgenic rice. Insect bioassays demonstrated that the transgenic plants were highly resistant to lepidopteran pests. This study suggested that 2A peptide can be utilized to express multiple Bt genes at high levels in transgenic crops.

  2. InterProScan Result: AB474577 [KAIKOcDNA[Archive

    Full Text Available AB474577 AB474577_2_ORF1 55017EA0D2FBC672 SMART SM00051 DSL 4.0999959904578364E-24 T IPR001774 D ... rrate/lag-2 (DSL) protein Biological Process: cell communication ... (GO:0007154)|Cellular Component: membrane (GO:0016 ...

  3. InterProScan Result: AB474577 [KAIKOcDNA[Archive

    Full Text Available AB474577 AB474577_2_ORF1 55017EA0D2FBC672 PFAM PF01414 DSL 2.7000000000000042E-20 T IPR001774 De ... rrate/lag-2 (DSL) protein Biological Process: cell communication ... (GO:0007154)|Cellular Component: membrane (GO:0016 ...

  4. InterProScan Result: AB474577 [KAIKOcDNA[Archive

    Full Text Available AB474577 AB474577_2_ORF1 55017EA0D2FBC672 PROFILE PS51051 DSL 0.0 T IPR001774 Delta/Serrate/lag- ... 2 (DSL) protein Biological Process: cell communication ... (GO:0007154)|Cellular Component: membrane (GO:0016 ...

  5. Leonid Apananski müüs AB Grupi maa oma firmale / Silva Männik

    Männik, Silva, 1974-

    1999-01-01

    Ilmunud ka: Den za Dnjom Nov/26 lk. 8. Apananski müüs AB Kindlustuse Grupile kuulunud Maakri tänava kinnistu. Skeem: AB Grupist on välja viidud ligikaudu 70 milj. krooni. Ilmunud ka: Den za Dnjom 23. nov. lk. 3

  6. InterProScan Result: AB047925 [KAIKOcDNA[Archive

    Full Text Available AB047925 AB047925_1_ORF1 537628749FFCB8C5 SUPERFAMILY SSF81321 SSF81321 4.1E-6 T IPR000856 unint ... ng pathway (GO:0007186)|Biological Process: visual perception ... (GO:0007601)|Biological Process: phototransduction ...

  7. InterProScan Result: AB047925 [KAIKOcDNA[Archive

    Full Text Available AB047925 AB047925_1_ORF1 537628749FFCB8C5 PANTHER PTHR19264:SF17 Opsin_RH3/RH4 3.099999458993759 ... ng pathway (GO:0007186)|Biological Process: visual perception ... (GO:0007601)|Biological Process: phototransduction ...

  8. InterProScan Result: AB047925 [KAIKOcDNA[Archive

    Full Text Available AB047925 AB047925_1_ORF1 537628749FFCB8C5 PANTHER PTHR19264 PTHR19264 3.0999994589937598E-30 T I ... ng pathway (GO:0007186)|Biological Process: visual perception ... (GO:0007601)|Biological Process: phototransduction ...

  9. Dicty_cDB: FCL-AB15 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AB15 (Link to dictyBase) - - - Contig-U15231-1 FCL-AB15E (Link to Orig ... ifliicqk*eidleatllnlkkllkrin*idyhslvklnfsmqchy*kle vtl *iisilnqlmpkqsvnlkny*iislnk*sk**iiiiiskykicnpsncwss ...

  10. Dicty_cDB: FC-AB36 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AB36 (Link to dictyBase) - - - Contig-U15455-1 FC-AB36Z (Link to Origina ... yk*nnkknkkklkkkkktk*n*ikkqkqnkkkk Frame C: ---*icp*risk *kefineiikkikkn*krkkkqnkik*knknktkkk Homology vs CS ...

  11. Prediction on Antigenic Epitope Characteristics of Bt Cry2Ab Protein in Transgenic Crops

    Jierong GAO; Ying HE; Zehong ZOU; Ailin TAO; Yuncan AI

    2012-01-01

    Abstract [Objective] This study aimed to predict the structural characteristics of Bt Cry2Ab protein in transgenic crops with bioinformatic analysis to provide the theoreti- cal clues for design of antibody Cry2Ab. [Method] The amino acid sequence of Cry2Ab protein was searched from NCBI database. The B cell epitopes were pre- dicted with DNAStar. The binding affinity between Cry2Ab protein and MHC-II molecules was analyzed with NetMHCII 2.2 Server to predict the T cell epitopes. [Result] Prediction result suggested the potential B cell epitope of Cry2Ab locating in the region of 208-215. Analysis of the binding affinity between Cry2Ab and MHC-II molecules suggested the regions of 177-185, 299-307 and 255-263 were the po- tential T cell epitopes. Human with HLA-DRB10101 alleles and HLA-DRB10701 al- leles were more sensitive to Cry2Ab protein. [Conclusion] This study facilitates to un- derstand the structural characteristics of Cry2Ab protein and provides a new clue to improve the assessment method for potential allergenicity of genetically modified food.

  12. Towards a fair and equitable abs regime: is Nagoya leading us in the right direction?

    Jonge, de B.

    2013-01-01

    A historical overview of the concept of Access and Benefit Sharing (ABS) suggests that ABS is all about compensation, i.e. a benefit sharing mechanism that provides one with compensation for allowing access to one’s resources. The principles of entitlement (based on sovereign rights) and desert (bas

  13. ABS/PET合金的相容化研究%Study on the Compatibility of ABS/PET Alloy

    刘辉辉; 杜一凡; 谷志杰; 许海燕

    2014-01-01

    以苯乙烯-丙烯腈-甲基丙烯酸缩水甘油酯(SAG)和苯乙烯-丙烯腈-马来酸酐(SMA)为相容剂对丙烯腈-丁二烯-苯乙烯(ABS)/聚对苯二甲酸乙二醇酯(PET)合金进行增容.并从拉伸性能、弯曲性能、冲击性能、熔体质量流动速率(MFR)等方面对SAG和SMA的增容效果进行了比较.结果表明,含有GMA基团的SAG比含有MAH基团的SAM的增容效果更好.

  14. Influence of Cellulose on the Mechanical and Thermal Stability of ABS Plastic Composites

    K. Crews

    2016-01-01

    Full Text Available Microcrystalline cellulose was explored as possible biodegradable fillers in the fabrication of ABS plastic composites. TGA indicates that upon inclusion of cellulose microcrystals the thermal stability of the ABS plastics was improved significantly when compared to the neat ABS plastic counterparts. Furthermore, inclusion of extracted cellulose from plant biomass showed a higher thermal stability with maximum decomposition temperatures around 131.95°C and 124.19°C for cellulose from cotton and Hibiscus sabdariffa, respectively, when compared to that of the purchased cellulose. In addition, TMA revealed that the average CTE value for the neat ABS and 1 : 1 ratio of cellulose to ABS fabricated in this study was significantly lower than the reported CTE (ca. 73.8 μm/m°C.

  15. Hydrogenation of AB{sub 5} and AB{sub 2} metal hydride alloys studied by in situ X-ray diffraction

    Wang, L. [Department of Chemical Engineering and Materials Science, Wayne State University, Detroit, MI 48202 (United States); BASF – Battery Materials Ovonic, 2983 Waterview Drive, Rochester Hills, MI 48309 (United States); Young, K., E-mail: kwo.young@basf.com [BASF – Battery Materials Ovonic, 2983 Waterview Drive, Rochester Hills, MI 48309 (United States); Nei, J.; Pawlik, D. [BASF – Battery Materials Ovonic, 2983 Waterview Drive, Rochester Hills, MI 48309 (United States); Ng, K.Y.S. [Department of Chemical Engineering and Materials Science, Wayne State University, Detroit, MI 48202 (United States)

    2014-12-15

    Highlights: • Hydrogenation process of an AB{sub 5} alloy and two AB{sub 2} alloys were studied by quasi in-situ XRD. • In both AB{sub 5} and AB{sub 2} metal alloy, hydrogen occupation sites on the half-plane were taken first. • In the C14/C15 mixed alloy, C14 phase is the main hydrogen storage phase with a lower equilibrium pressure. • In the C14/C15 mixed alloy, C15 phase is the catalyst hydrogen storage phase with a higher equilibrium pressure. • Small amount of C15 was hydrided first but not completed until C14 phase was fully hydrided. - Abstract: The evolution of lattice constants and abundances of metal (α) and metal hydride (β) phases during the hydrogenation process of an AB{sub 5} alloy with a CaCu{sub 5} crystal structure, an AB{sub 2} alloy with a predominating C14 structure, and a C14/C15-mixed AB{sub 2} alloy were reported. The preferred hydrogen insertion sites at different states of charge in both the α and β phases were studied based on the lattice parameter changes during hydrogenation. During the hydrogenation of the AB{sub 5} alloy, the ratio between lattice parameters a and c (a/c ratio) in the α phase decreases, stabilizes, and then decreases again while that in the β phase decreases and then stabilizes. The trends in unit cell volume changes are increasing, plateauing, and increasing again in the α phase and increasing followed by plateauing in the β phase as the hydrogenation level increases. In the C14-predominant AB{sub 2} alloy, the a/c ratio in the α phase increases at the beginning and then stabilizes while that in the β phase remains about the same and then increases during the addition of hydrogen. Moreover, the unit cell volume in the α phase increases slightly during hydrogenation, comparing to the increasing, decreasing, and then increasing trend in the β phase. In the C14/C15 mixed AB{sub 2} alloy, hydrogenation of the C15 phase starts at the beginning and promotes the hydrogenation of the C14 phase. The C14

  16. Performance Study of ABS/Graphite/NBR Thermal Conductive Composites%ABS/石墨/NBR导热复合材料性能的研究

    傅伟宁; 张云灿; 韦亚兵; 成敏

    2013-01-01

    采用熔融共混法制备丙烯腈-丁二烯-苯乙烯共聚物(ABS)/石墨/丁腈橡胶(NBR)导热复合材料,通过热常数分析仪、同步热分析仪、扫描电子显微镜、力学性能测试等手段研究了NBR、ABS高胶粉及石墨(G)的添加量对ABS复合材料导热性能及力学性能的影响.结果表明,ABS高胶粉和NBR均能明显提高ABS的热导率和缺口冲击强度,但是丁腈胶粉的改性效果优于高胶粉.以NBR作为ABS复合材料的增韧剂,随着石墨含量的增大,增韧效果下降,ABS复合材料的热导率提高到纯ABS的5倍,热分解温度提高40℃左右,热膨胀系数下降.当ABS/G/NBR复合材料的质量比为60/15/25时,其热导率为纯ABS的2倍,缺口冲击强度达21.8 kJ/m2,明显高于纯ABS(2.6 kJ/m2).%Thermally conductive ABS/graphite/nitrile butadiene rubber (NBR) composites were prepared by melt bleding method.The effects of NBR,ABS and graphite content on the thermal conductivity and mechanical property of the ABS composites were studied respectively by the thermal constant analyzer,synchronous thermal analysis,scanning electron microscopy and mechanical properties testing means.The results showed that ABS high glue powder and NBR could increase the thermal conductivity and Notched impact strength of ABS,but NBR was more suitable as a toughening agent for ABS composite.The toughening effect decreased as the graphite content increased.Meanwhile the thermal conductivity of the ABS composite was up to five times than that of the pure ABS.The thermal decomposition temperature of the composite increased by about 40 ℃ and the thermal expansion coefficient failed.When the mass ratio of ABS/G/NBR was 60/15/25,the thermal conductivity was two times than that of pure ABS and the impact strength was up to 21.8 kJ/m2 which was larger than that of pure ABS (2.6 kJ/m2).

  17. Ab initio molecular crystal structures, spectra, and phase diagrams.

    Hirata, So; Gilliard, Kandis; He, Xiao; Li, Jinjin; Sode, Olaseni

    2014-09-16

    Conspectus Molecular crystals are chemists' solids in the sense that their structures and properties can be understood in terms of those of the constituent molecules merely perturbed by a crystalline environment. They form a large and important class of solids including ices of atmospheric species, drugs, explosives, and even some organic optoelectronic materials and supramolecular assemblies. Recently, surprisingly simple yet extremely efficient, versatile, easily implemented, and systematically accurate electronic structure methods for molecular crystals have been developed. The methods, collectively referred to as the embedded-fragment scheme, divide a crystal into monomers and overlapping dimers and apply modern molecular electronic structure methods and software to these fragments of the crystal that are embedded in a self-consistently determined crystalline electrostatic field. They enable facile applications of accurate but otherwise prohibitively expensive ab initio molecular orbital theories such as Møller-Plesset perturbation and coupled-cluster theories to a broad range of properties of solids such as internal energies, enthalpies, structures, equation of state, phonon dispersion curves and density of states, infrared and Raman spectra (including band intensities and sometimes anharmonic effects), inelastic neutron scattering spectra, heat capacities, Gibbs energies, and phase diagrams, while accounting for many-body electrostatic (namely, induction or polarization) effects as well as two-body exchange and dispersion interactions from first principles. They can fundamentally alter the role of computing in the studies of molecular crystals in the same way ab initio molecular orbital theories have transformed research practices in gas-phase physical chemistry and synthetic chemistry in the last half century. In this Account, after a brief summary of formalisms and algorithms, we discuss applications of these methods performed in our group as compelling

  18. AB-8大孔树脂对蓝莓花色苷的纯化研究%The purification study of blueberry anthocyanin on resin AB-8

    黄月鹏; 黄翠贤

    2012-01-01

    花色苷是一种水溶性的安全的天然色素。本论文以蓝莓花色苷提取液为原料。使用AB-8树脂对蓝莓花色苷精制工艺进行了研究。结果表明:AB-8树脂吸附流速为10mL/min,用40%乙醇洗脱,解吸流速为5mL/min。AB-8树脂饱和吸附量1.25mg/mL,树脂量是蓝莓花色苷量的3BV。蓝莓花色苷的纯度为38.1%。%Anthocyanin was a water-soluble, safe and natural pigment. Extraction of blueberry anthocyanin was used as raw material in this paper.lt was studied that technology of purifing resin AB-8 to blueberry anthocyanin. The results showed that the absorption speed of resin AB-8 was 10ml/min,the anthocyanin from blueberry was eluted with 40% ethanol at the flow rate of 5mL/min.The absorption capacity of the resin AB-8 was determined to be 1.25mg/mL. It revealed that ratio of resinAB-8 to blueberry anthocyanin solvent were 3BV. The purification of blueberry anthocyanin was 38.1%.

  19. Ab initio simulations on rutile-based titania nanowires

    Zhukovskii, Yu F.; Evarestov, R. A.

    2012-08-01

    The rod symmetry groups for monoperiodic (1D) nanostructures have been applied for construction of models for bulk-like TiO2 nanowires (NWs) cut from a rutile-based 3D crystal along the chosen [001] and [110] directions of crystallographic axes. In this study, we have considered nanowires described by both the Ti-atom centered rotation axes as well as the hollow site centered axes passing through the interstitial positions between the Ti and O atoms closest to the axes. The most stable [001]-oriented TiO2 NWs with rhombic cross sections are found to display the energetically preferable {110} facets only while the nanowires with quasi-square sections across the [110] axis are formed by the alternating { 1bar 10 } and {001} facets. For simulations on rutile-based nanowires possessing different diameters for each NW type, we have performed large-scale ab initio Density Functional Theory (DFT) and hybrid DFT-Hartree Fock (DFT-HF) calculations with total geometry optimization within the Generalized Gradient Approximation (GGA) in the form of the Perdew-Becke-Ernzenhof (PBE) exchange-correlation functionals (PBE and PBE0, respectively), using the formalism of linear combination of localized atomic functions (LCAO). We have simulated both structural and electronic properties of TiO2 NWs depending both on orientation and position of symmetry axes as well as on diameter and morphology of nanowires.

  20. Ab initio transport across bismuth selenide surface barriers

    Narayan, Awadhesh

    2014-11-24

    © 2014 American Physical Society. We investigate the effect of potential barriers in the form of step edges on the scattering properties of Bi2Se3(111) topological surface states by means of large-scale ab initio transport simulations. Our results demonstrate the suppression of perfect backscattering, while all other scattering processes, which do not entail a complete spin and momentum reversal, are allowed. Furthermore, we find that the spin of the surface state develops an out-of-plane component as it traverses the barrier. Our calculations reveal the existence of quasibound states in the vicinity of the surface barriers, which appear in the form of an enhanced density of states in the energy window corresponding to the topological state. For double barriers we demonstrate the formation of quantum well states. To complement our first-principles results we construct a two-dimensional low-energy effective model and illustrate its shortcomings. Our findings are discussed in the context of a number of recent experimental works.

  1. Accurate ab initio vibrational energies of methyl chloride

    Two new nine-dimensional potential energy surfaces (PESs) have been generated using high-level ab initio theory for the two main isotopologues of methyl chloride, CH335Cl and CH337Cl. The respective PESs, CBS-35 HL, and CBS-37 HL, are based on explicitly correlated coupled cluster calculations with extrapolation to the complete basis set (CBS) limit, and incorporate a range of higher-level (HL) additive energy corrections to account for core-valence electron correlation, higher-order coupled cluster terms, scalar relativistic effects, and diagonal Born-Oppenheimer corrections. Variational calculations of the vibrational energy levels were performed using the computer program TROVE, whose functionality has been extended to handle molecules of the form XY 3Z. Fully converged energies were obtained by means of a complete vibrational basis set extrapolation. The CBS-35 HL and CBS-37 HL PESs reproduce the fundamental term values with root-mean-square errors of 0.75 and 1.00 cm−1, respectively. An analysis of the combined effect of the HL corrections and CBS extrapolation on the vibrational wavenumbers indicates that both are needed to compute accurate theoretical results for methyl chloride. We believe that it would be extremely challenging to go beyond the accuracy currently achieved for CH3Cl without empirical refinement of the respective PESs

  2. Accurate ab initio vibrational energies of methyl chloride

    Owens, Alec, E-mail: owens@mpi-muelheim.mpg.de [Max-Planck-Institut für Kohlenforschung, Kaiser-Wilhelm-Platz 1, 45470 Mülheim an der Ruhr (Germany); Department of Physics and Astronomy, University College London, Gower Street, WC1E 6BT London (United Kingdom); Yurchenko, Sergei N.; Yachmenev, Andrey; Tennyson, Jonathan [Department of Physics and Astronomy, University College London, Gower Street, WC1E 6BT London (United Kingdom); Thiel, Walter [Max-Planck-Institut für Kohlenforschung, Kaiser-Wilhelm-Platz 1, 45470 Mülheim an der Ruhr (Germany)

    2015-06-28

    Two new nine-dimensional potential energy surfaces (PESs) have been generated using high-level ab initio theory for the two main isotopologues of methyl chloride, CH{sub 3}{sup 35}Cl and CH{sub 3}{sup 37}Cl. The respective PESs, CBS-35{sup  HL}, and CBS-37{sup  HL}, are based on explicitly correlated coupled cluster calculations with extrapolation to the complete basis set (CBS) limit, and incorporate a range of higher-level (HL) additive energy corrections to account for core-valence electron correlation, higher-order coupled cluster terms, scalar relativistic effects, and diagonal Born-Oppenheimer corrections. Variational calculations of the vibrational energy levels were performed using the computer program TROVE, whose functionality has been extended to handle molecules of the form XY {sub 3}Z. Fully converged energies were obtained by means of a complete vibrational basis set extrapolation. The CBS-35{sup  HL} and CBS-37{sup  HL} PESs reproduce the fundamental term values with root-mean-square errors of 0.75 and 1.00 cm{sup −1}, respectively. An analysis of the combined effect of the HL corrections and CBS extrapolation on the vibrational wavenumbers indicates that both are needed to compute accurate theoretical results for methyl chloride. We believe that it would be extremely challenging to go beyond the accuracy currently achieved for CH{sub 3}Cl without empirical refinement of the respective PESs.

  3. Ab-initio calculations for dilute magnetic semiconductors

    Belhadji, Brahim

    2008-03-03

    This thesis focusses on ab-initio calculations for the electronic structure and the magnetic properties of dilute magnetic semiconductors (DMS). In particular we aim at the understanding of the complex exchange interactions in these systems. Our calculations are based on density functional theory, being ideally suited for a description of the material specific properties of the considered DMS. Moreover we use the KKR Green function method in connection with the coherent potential approximation (CPA), which allows to include the random substitutional disorder in a mean field-like approximation for the electronic structure. Finally we calculate the exchange coupling constants J{sub ij} between two impurities in a CPA medium by using the Lichtenstein formula and from this calculate the Curie temperature by a numerically exact Monte Carlo method. Based on this analysis we found and investigated four different exchange mechanisms being of importance in DMS systems: Double exchange, p-d exchange, antiferromagnetic superexchanges, and ferromagnetic superexchange. A second topic we have investigated in this thesis is the pressure dependence of the exchange interactions and the Curie temperatures in (Ga,Mn)As and (In,Mn)As, using the LDA and the LDA+U approximations. Exact calculations of T{sub C} by Monte Carlo simulations show a somehow different behavior. (orig.)

  4. Ab initio no-core solutions for $^6$Li

    Shin, Ik Jae; Maris, Pieter; Vary, James P; Forssén, Christian; Rotureau, Jimmy; Michel, Nicolas

    2016-01-01

    We solve for properties of $^6$Li in the ab initio No-Core Full Configuration approach and we separately solve for its ground state and $J^{\\pi}=2_{2}^{+}$ resonance with the Gamow Shell Model in the Berggren basis. We employ both the JISP16 and chiral NNLO$_{opt}$ realistic nucleon-nucleon interactions and investigate the ground state energy, excitation energies, point proton root-mean-square radius and a suite of electroweak observables. We also extend and test methods to extrapolate the ground state energy, point proton root-mean-square radius, and electric quadrupole moment. We attain improved estimates of these observables in the No-Core Full Configuration approach by using basis spaces up through N$_{max}$=18 that enable more definitive comparisons with experiment. Using the Density Matrix Renormalization Group approach with the JISP16 interaction, we find that we can significantly improve the convergence of the Gamow Shell Model treatment of the $^6$Li ground state and $J^{\\pi}=2_{2}^{+}$ resonance by ...

  5. Ab initio studies of phoshorene island single electron transistor.

    Ray, S J; Venkata Kamalakar, M; Chowdhury, R

    2016-05-18

    Phosphorene is a newly unveiled two-dimensional crystal with immense potential for nanoelectronic and optoelectronic applications. Its unique electronic structure and two dimensionality also present opportunities for single electron devices. Here we report the behaviour of a single electron transistor (SET) made of a phosphorene island, explored for the first time using ab initio calculations. We find that the band gap and the charging energy decrease monotonically with increasing layer numbers due to weak quantum confinement. When compared to two other novel 2D crystals such as graphene and MoS2, our investigation reveals larger adsorption energies of gas molecules on phosphorene, which indicates better a sensing ability. The calculated charge stability diagrams show distinct changes in the presence of an individual molecule which can be applied to detect the presence of different molecules with sensitivity at a single molecular level. The higher charging energies of the molecules within the SET display operational viability at room temperature, which is promising for possible ultra sensitive detection applications. PMID:27093536

  6. Ab initio studies of phosphorene island single electron transistor

    Ray, S. J.; Venkata Kamalakar, M.; Chowdhury, R.

    2016-05-01

    Phosphorene is a newly unveiled two-dimensional crystal with immense potential for nanoelectronic and optoelectronic applications. Its unique electronic structure and two dimensionality also present opportunities for single electron devices. Here we report the behaviour of a single electron transistor (SET) made of a phosphorene island, explored for the first time using ab initio calculations. We find that the band gap and the charging energy decrease monotonically with increasing layer numbers due to weak quantum confinement. When compared to two other novel 2D crystals such as graphene and MoS2, our investigation reveals larger adsorption energies of gas molecules on phosphorene, which indicates better a sensing ability. The calculated charge stability diagrams show distinct changes in the presence of an individual molecule which can be applied to detect the presence of different molecules with sensitivity at a single molecular level. The higher charging energies of the molecules within the SET display operational viability at room temperature, which is promising for possible ultra sensitive detection applications.

  7. Ab initio study of MoS2 nanotube bundles

    Verstraete, Matthieu; Charlier, Jean-Christophe

    2003-07-01

    Recently, the synthesis of a new phase of MoS2I1/3 stoichiometry was reported [M. Remskar, A. Mrzel, Z. Skraba, A. Jesih, M. Ceh, J. Demšar, P. Stadelmann, F. Lévy, and D. Mihailovic, Science 292, 479 (2001)]. Electron microscope images and diffraction data were interpreted to indicate bundles of sub-nanometer-diameter single-wall MoS2 nanotubes. After experimental characterization, the structure was attributed to an assembly of “armchair” nanotubes with interstitial iodine. Using first-principles total-energy calculations, bundles of MoS2 nanotubes with different topologies and stoichiometries are investigated. All of the systems are strongly metallic. Configurations with “zigzag” structures are found to be more stable energetically than the “armchair” ones, though all of the structures have similar stabilities. After relaxation, there remain several candidates which give a lattice parameter in relative agreement with experiment. Further, spin-polarized calculations indicate that a structure with armchair tubes iodine atoms in their center acquires a very large spontaneous magnetic moment of 12μB, while the other structures are nonmagnetic. Our ab initio calculations show that in most of the other structures, the tubes are very strongly bound together, and that the compounds should be considered as a crystal, rather than as a bundle of tubes in the habitual sense.

  8. Atmospheric Characterization of the Hot Jupiter Kepler-13Ab

    Shporer, Avi; Knutson, Heather A; Szabo, Gyula M; Zhao, Ming; Burrows, Adam; Fortney, Jonathan; Agol, Eric; Cowan, Nicolas B; Desert, Jean-Michel; Howard, Andrew W; Isaacson, Howard; Lewis, Nikole A; Showman, Adam P; Todorov, Kamen O

    2014-01-01

    (abridged) Kepler-13Ab (= KOI-13.01) is one of very few known short-period (1.76 day) transiting planets orbiting a bright A-type star. The availability of Kepler data allows a measurement of the planet's occultation (secondary eclipse) and orbital phase curve, which we combine with occultations observed by Spitzer at 3.6 micron and 4.5 micron and a ground-based occultation observation in the $Ks$ band (2.1 micron). For the day-side hemisphere we derive a temperate of 2,750 $\\pm$ 160 K as the effective temperature of a black body that will show the same occultation depths, and a high geometric albedo $A_g$ = 0.33$^{+0.04}_{-0.06}$. Comparing the occultation depths with one-dimensional planetary atmosphere models suggests the presence of an atmospheric temperature inversion. The Kepler mid-occultation time measured here is 34.0 $\\pm$ 6.9 s earlier than expected based on the mid-transit time reported in the literature and the expected time delay due to light travel time. This could be due to a small orbital ecc...

  9. Ab initio evaluations of the He solubility in liquid Li

    Sedano, Luis A. [EURATOM-CIEMAT Assoc., Materials for Fusion Program, Bd. 43 P0.04, Avda. Complutense 22, 28040 Madrid (Spain)]. E-mail: luis.sedano@ciemat.es; Hassanein, Ahmed [Argonne Nat. Lab, 9700 South Class Av., Argonne, IL (United States)]. E-mail: hassanein@anl.gov; Sanz, Javier [ETSII-UNED, c/Juan del Rosal, 12, 28040 Madrid (E) (Spain)]. E-mail: jsanz@ind.UNED.es

    2005-11-15

    Modified embedding atom methods (MEAM) are developed to have predictions of the partial molar heat of solution (-H{sub s}) by direct simulation of metal cohesion, He-metal and He-He interaction. Transitions from crystalline Li to configurations, having the liquid Li structure's factors (h-bar (q)), are simulated ab initio. Once h-bar (q) reproduced, He atoms are added, one by one, to the Li system. Parallel lines for each case, with slopes clearly independent on the number of He atoms in the system, are obtained for energy versus pressure at given temperatures. Average differences between two adjacent parallels at zero pressure, once kinetic energy of the system discounted, represents the energy gained by an He atom when added to the Li system, related to the solution energy -H{sub s}. The molar excess entropy of gas in solution (S-bar {sub l}{sup ex}) is previously evaluated following diverse fundamental approaches: a 'thermodynamic liquid-hole' (TL-H) model for alkali liquids and a statistical-mechanics (Neff and McQuarrie's) model (SMM). Between 600 and 900 deg. C, a typical range of interest for the use of Li in fusion technology, the computed values for the (He) Henry's constant in Li range from 8x10{sup -14} to 10{sup -13} at. fr. Pa{sup -1}.

  10. Volumic omit maps in ab initio dual-space phasing.

    Oszlányi, Gábor; Sütő, András

    2016-07-01

    Alternating-projection-type dual-space algorithms have a clear construction, but are susceptible to stagnation and, thus, inefficient for solving the phase problem ab initio. To improve this behaviour new omit maps are introduced, which are real-space perturbations applied periodically during the iteration process. The omit maps are called volumic, because they delete some predetermined subvolume of the unit cell without searching for atomic regions or analysing the electron density in any other way. The basic algorithms of positivity, histogram matching and low-density elimination are tested by their solution statistics. It is concluded that, while all these algorithms based on weak constraints are practically useless in their pure forms, appropriate volumic omit maps can transform them to practically useful methods. In addition, the efficiency of the already useful reflector-type charge-flipping algorithm can be further improved. It is important that these results are obtained by using non-sharpened structure factors and without any weighting scheme or reciprocal-space perturbation. The mathematical background of volumic omit maps and their expected applications are also discussed. PMID:27357850