WorldWideScience

Sample records for abs terpolymer estudo

  1. Ionizing radiation effect study by electron beam on acrylonitrile butadiene styrene - ABS terpolymer

    The great advantage in the researches involving development has as objective to increase significantly the quality of the products. The ABS (acrylonitrile, butadiene, styrene) resins are terpolymers formed by an elastomer and two thermoplastics amorphous components. The three different monomeric units from the terpolymer ABS contribute separately to the material characteristics exhibited. The molecular stiffness originating from polystyrene and the benzene ring hanging on the chain is responsible for the flexion module ABS. The acrylonitrile and the styrene incorporated butadiene exercises strong influence in the resistance to the impact because it reduces the bonding among them. The engineering use of this terpolymer became important due their mechanical properties and mainly, for the responses of this to tensions or deformations applied. The polymeric materials, when submitted to the ionizing radiation are modified by the transference of energy to these materials, introducing excitation and ionization of the molecules, generating chemical reactions that can produce permanent modifications in the polymeric physicochemical structure. The induced modifications can result in the polymeric material degradation or crosslinking, which can result in the improvement of some properties. This work has, as objective, to study the electron beam ionizing radiation effect, at different doses, in the properties of the polymer ABS. The studied properties were: tensile strength at break, elongation at break, Izod impact strength, flexural strength, melt flow index, Vicat softening temperature and the thermic distortion temperature. Also researches on Differential Scanning Calorimetry (DSC) and Thermogravimetric Analyses (TGA) were accomplished. From the experimental results, it was showed that for doses until 500 kGy, at 22.6 kGy/s dose rate, in the presence of air, the crosslinking process of ABS prevails. (author)

  2. Thermal oxidation of epdm terpolymer and vulcanizate

    Thermal ageing tests were made in the range 110-160 deg. C., on an ethylene-propylene-hexadiene terpolymer and with a filled, stabilised and vulcanized industrial rubber based on it. Carbonyl build-up, weight loss, density, chemiluminescence and removable fraction kinetic curves reveal an induction period whose duration is almost independent of the measurement method. These results suggest that the hypothesis of spatially heterogeneous (at small scale) oxidation is to be rejected in this case. They reveal the interest of density measurement for the detection of the end of the induction period, and the fact that variations of the soluble fraction are due to changes of the solubility parameter rather than to changes of the molecular weight/crosslink density. (authors)

  3. Rational design of ABC triblock terpolymer solution nanostructures with controlled patch morphology

    Löbling, Tina I.; Borisov, Oleg; Haataja, Johannes S.; Ikkala, Olli; Gröschel, André H.; Müller, Axel H. E.

    2016-06-01

    Block copolymers self-assemble into a variety of nanostructures that are relevant for science and technology. While the assembly of diblock copolymers is largely understood, predicting the solution assembly of triblock terpolymers remains challenging due to complex interplay of block/block and block/solvent interactions. Here we provide guidelines for the self-assembly of linear ABC triblock terpolymers into a large variety of multicompartment nanostructures with C corona and A/B cores. The ratio of block lengths NC/NA thereby controls micelle geometry to spheres, cylinders, bilayer sheets and vesicles. The insoluble blocks then microphase separate to core A and surface patch B, where NB controls the patch morphology to spherical, cylindrical, bicontinuous and lamellar. The independent control over both parameters allows constructing combinatorial libraries of unprecedented solution nanostructures, including spheres-on-cylinders/sheets/vesicles, cylinders-on-sheets/vesicles, and sheets/vesicles with bicontinuous or lamellar membrane morphology (patchy polymersomes). The derived parameters provide a logical toolbox towards complex self-assemblies for soft matter nanotechnologies.

  4. Rational design of ABC triblock terpolymer solution nanostructures with controlled patch morphology

    Löbling, Tina I.; Borisov, Oleg; Haataja, Johannes S.; Ikkala, Olli; Gröschel, André H.; Müller, Axel H. E.

    2016-01-01

    Block copolymers self-assemble into a variety of nanostructures that are relevant for science and technology. While the assembly of diblock copolymers is largely understood, predicting the solution assembly of triblock terpolymers remains challenging due to complex interplay of block/block and block/solvent interactions. Here we provide guidelines for the self-assembly of linear ABC triblock terpolymers into a large variety of multicompartment nanostructures with C corona and A/B cores. The ratio of block lengths NC/NA thereby controls micelle geometry to spheres, cylinders, bilayer sheets and vesicles. The insoluble blocks then microphase separate to core A and surface patch B, where NB controls the patch morphology to spherical, cylindrical, bicontinuous and lamellar. The independent control over both parameters allows constructing combinatorial libraries of unprecedented solution nanostructures, including spheres-on-cylinders/sheets/vesicles, cylinders-on-sheets/vesicles, and sheets/vesicles with bicontinuous or lamellar membrane morphology (patchy polymersomes). The derived parameters provide a logical toolbox towards complex self-assemblies for soft matter nanotechnologies. PMID:27352897

  5. Superhydrophobic terpolymer nanofibers containing perfluoroethyl alkyl methacrylate by electrospinning

    A new statistical terpolymer containing perfluoroethyl alkyl methacrylate (Zonyl-TM), methyl methacrylate and butyl acrylate, poly(Zonyl-TM-ran-MMA-ran-BA) was synthesized in supercritical carbon dioxide at 200 bar and 80 °C using AIBN as an initiator by heterogeneous free radical copolymerization. Nanofibers of this terpolymer were produced by electrospinning from its DMF solution. The structural and thermal properties of terpolymers and electrospun poly(Zonyl-TM-MMA-BA) nanofibers were analyzed using Fourier transform infrared spectroscopy, nuclear magnetic resonance spectroscopy and differential scanning calorimetry. Nanofiber morphology was investigated by scanning electron microscopy. Electrospun nanofiber layer was found to be superhydrophobic with a water contact angle of 172 ± 1° and highly oleophobic with hexadecane, glycerol and ethylene glycol contact angles of 70 ± 1°, 167 ± 1° and 163 ± 1° respectively. The change of the contact angle results on the electrospun fiber layer and flat terpolymer surfaces by varying feed monomer composition were compared and discussed in the text.

  6. Superhydrophobic terpolymer nanofibers containing perfluoroethyl alkyl methacrylate by electrospinning

    Cengiz, Ugur, E-mail: ucengiz@gyte.edu.tr [Department of Chemical Engineering, Gebze Institute of Technology, Cayirova, 41400 Kocaeli (Turkey); Avci, Merih Z. [Polymer Science and Technology, Deparment of Chemistry, Istanbul Technical University, Maslak 34469, Istanbul (Turkey); Erbil, H. Yildirim [Department of Chemical Engineering, Gebze Institute of Technology, Cayirova, 41400 Kocaeli (Turkey); Sarac, A. Sezai [Polymer Science and Technology, Deparment of Chemistry, Istanbul Technical University, Maslak 34469, Istanbul (Turkey)

    2012-05-15

    A new statistical terpolymer containing perfluoroethyl alkyl methacrylate (Zonyl-TM), methyl methacrylate and butyl acrylate, poly(Zonyl-TM-ran-MMA-ran-BA) was synthesized in supercritical carbon dioxide at 200 bar and 80 Degree-Sign C using AIBN as an initiator by heterogeneous free radical copolymerization. Nanofibers of this terpolymer were produced by electrospinning from its DMF solution. The structural and thermal properties of terpolymers and electrospun poly(Zonyl-TM-MMA-BA) nanofibers were analyzed using Fourier transform infrared spectroscopy, nuclear magnetic resonance spectroscopy and differential scanning calorimetry. Nanofiber morphology was investigated by scanning electron microscopy. Electrospun nanofiber layer was found to be superhydrophobic with a water contact angle of 172 {+-} 1 Degree-Sign and highly oleophobic with hexadecane, glycerol and ethylene glycol contact angles of 70 {+-} 1 Degree-Sign , 167 {+-} 1 Degree-Sign and 163 {+-} 1 Degree-Sign respectively. The change of the contact angle results on the electrospun fiber layer and flat terpolymer surfaces by varying feed monomer composition were compared and discussed in the text.

  7. Thermoanalytical Study and Kinetics of New 8-Hydroxyquinoline 5-sulphonic Acid-Oxamide-Formaldehyde Terpolymer Resins

    Singru, Rajesh N.; Anil B. Zade; Gurnule, Wasudeo B.

    2009-01-01

    The terpolymer resins (8-HQ5-SAOF) have been synthesized by the condensation of 8-hydroxyquinoline 5-sulphonic acid (8-HQ5-SA) and oxamide (O) with formaldehyde (F) in the presence of acid catalyst and using varied molar proportion of the reacting monomers. The synthesized terpolymer resins have been characterized by different physico-chemical techniques. Thermogravimetric analysis of all terpolymer resins in present study have been carried out by non-isothermal thermogravimetric analysis tec...

  8. Non-isothermal Kinetic Study of p-Cresol-Dithiooxamide-Formaldehyde Terpolymer

    Gurnule, W. B.; S. S. Katkamwar

    2010-01-01

    Terpolymer (p-CDF) has been prepared by using the monomer p-cresol, dithiooxanude and formaldehyde in 1:1:2 molar proportions. The structure of p-CDF terpolymer has been elucidated on the basis of elemental analysis and various physicochemical technique like UV-visible, FTIR, 1H NMR and TG analysis. Detailed thermal degradation curve is discussed which shows four steps decomposition. The activation energy (Ea) and thermal stability calculated by using the Sharp Wentworth, Frceman-Carroll meth...

  9. Synthesis and Demulsibility of the Terpolymer Demulsifier of Acryl Resin

    KANG,Wan-Li; MENG,Ling-Wei; ZHANG,Hong-Yan; LIU,Shu-Ren

    2008-01-01

    Terpolymer demulsifier of acryl resin has been synthesized through solution polymerization with water as a dissolvent,potassium persulfate as an initiator and the monomers of methyl methacrylate,butyl acrylate and acrylic acid as starting materials.The effects of the reaction temperature,dripping time,the amount of monomers and initiator on the dehydration rate of the demulsifier were investigated by an orthogonal experiment.It shows that the stronger influence on the dehydration rate among six factors is reaction temperature,dripping time,and amount of catalyst,while monomer has weak influence.The performance of the demulsifier was evaluated under different demulsification time,temperatures and concentrations of the screened demulsifiers.The result shows that the dehydration rate of the demulsifier can reach over 67%,which is better than that by the emulsion polymerization way.

  10. Network morphologies in monodisperse and polydisperse multiblock terpolymers

    Meuler, Adam James

    Multiply continuous network morphologies were previously identified in "monodisperse" (polydispersity index (PDI) blocks) poly(isoprene-bstyrene-b-ethylene oxide) (ISO) triblock terpolymers. This work extends the investigation of multiply continuous network structures to two other classes of multiblock terpolymers: (i) "monodisperse" OSISO pentablocks and (ii) polydisperse ISO triblocks. The OSISO pentablocks are synthesized using a protected initiation strategy that required the development of the functional organolithium 3-triisopropylsilyloxy-1-propyllithium (TIPSOPrLi). TIPSOPrLi may be used to prepare alpha-hydroxypolystyrene with narrower molecular weight distributions (PDI ˜ 1.1) than are attainable using the commercially available 3-tert-butyldimethylsilyloxy-1-propyllithium. A telechelic triblock terpolymer (HO-SIS-OH) with narrow molecular weight distributions in all blocks is prepared using TIPSOPrLi. A series of OSISO pentablocks is synthesized from this parent triblock, and a stable region of O70 (the orthorhombic Fddd network) is identified between two-domain lamellae (LAM2) and three-domain lamellae (LAM3) in OSISO materials. This sequence of morphologies was previously reported in ISO triblocks with comparable compositions. Mechanical tensile testing reveals that an OSISO sample with a lamellar mesostructure fractures in a brittle fashion at a strain of 0.06. An OSISO containing the O70 network, in contrast, has a strain at failure of 1.3, even though the crystallinity of the terminal blocks is above the brittle threshold established in other multiblock materials. This improved toughness is attributed to the combined effects of a triply continuous morphology and an intrinsically tough SIS core. The ISO triblock studies probe the stability of network morphologies with respect to polydispersity in the polystyrene and poly(ethylene oxide) chains. Three series of ISO triblocks with polydisperse (PS PDI = 1.16, 1.31, 1.44) polystyrene blocks are

  11. Estudo da geometria da uréia por métodos ab initio e simulação computacional de líquidos

    Cirino José Jair Vianna

    2002-01-01

    Full Text Available A study was carried out on the urea geometries using ab initio calculation and Monte Carlo computational simulation of liquids. The ab initio calculated results showed that urea has a non-planar conformation in the gas phase in which the hydrogen atoms are out of the plane formed by the heavy atoms. Free energies associated to the rotation of the amino groups of urea in water were obtained using the Monte Carlo method in which the thermodynamic perturbation theory is implemented. The magnitude of the free energy obtained from this simulation did not permit us to conclude that urea is non-planar in water.

  12. Development of new multifunctional terpolymer sorbent for proteomics applications.

    Najam-ul-Haq, Muhammad; Saeed, Adeela; Jabeen, Fahmida; Hussain, Dilshad; Khan, Naseem; Shabir, Maryam; Raza, Nadeem; Ashiq, Muhammad Naeem; Malana, Muhammad Aslam; Zafar, Zafar Iqbal

    2015-07-01

    Determination of the availability of phases for specific separations is an important task achieved by a separation chemist. This becomes vital when the complex samples like biofluids are dealt with in proteome science. The work presented here involves the synthesis and application of terpolymeric sorbent with different functionalizations adopted for the selective enrichment of biomolecules of interest from biological fluids. Synthesis of terpolymer was carried out by the radical polymerization of monomers: methyl acrylate, acrylic acid and vinyl acetate with diethylene glycol dimethacrylate as cross-linking agent, benzoyl peroxide as initiator and chloroform as a porogenic solvent. Characterization was done through Fourier transform infrared spectroscopy, scanning electron microscopy and nitrogen adsorption porosimetry. The polymer was further modified to immobilized metal ion affinity chromatographic material, with immobilized Fe(3+)/La(3+) ions that allowed phosphopeptide enrichment from tryptic digests of standard proteins as well as milk, egg yolk and human serum. Sensitivity of enrichment down to 50 fmol was achieved in the presence of complex protein background as bovine serum albumin. Hydrophobicity was introduced through octadecyl amine, which provides comparable results to ZipTip C18/C4 for desalting of complex mixtures of all caseins. Analysis of the enriched content was performed by Matrix Assisted Laser Desorption Ionization Mass Spectrometry (MALDI-MS). PMID:25402016

  13. Multicompartment Core Micelles of Triblock Terpolymers in Organic Media

    Schacher, Felix [University of Bayreuth; Walther, Andreas [Helsinki University of Technology, Helsinki, Finland; Ruppel, Markus A [ORNL; Drechsler, Markus [Universitat Bayreuth; Muller, Axel [Universitat Bayreuth

    2009-01-01

    The formation of multicompartment micelles featuring a spheres on sphere core morphology in acetone as a selective solvent is presented. The polymers investigated are ABC triblock terpolymers, polybutadieneb-poly(2-vinyl pyridine)-b-poly(tert-butyl methacrylate) (BVT), which were synthesized via living sequential anionic polymerization in THF. Two polymers with different block lengths of the methacrylate moiety were studied with respect to the formation of multicompartmental aggregates. The micelles were analyzed by static and dynamic light scattering as well as by transmission electron microscopy. Cross-linking of the polybutadiene compartment could be accomplished via two different methods, cold vulcanization and with photopolymerization after the addition of a multifunctional acrylate. In both cases, the multicompartmental character of the micellar core is fully preserved, and the micelles could be transformed into core-stabilized nanoparticles. The successful cross-linking of the polybutadiene core is indicated by 1H NMR and by the transfer of the aggregates into nonselective solvents such as THF or dioxane.

  14. Sequential crystallization and morphology of triple crystalline biodegradable PEO-b-PCL-b-PLLA triblock terpolymers

    Palacios, Jordana

    2016-01-05

    The sequential crystallization of poly(ethylene oxide)-b-poly(e-caprolactone)-b-poly(L-lactide) (PEO-b-PCL-b-PLLA) triblock terpolymers, in which the three blocks are able to crystallize separately and sequentially from the melt, is presented. Two terpolymers with identical PEO and PCL block lengths and two different PLLA block lengths were prepared, thus the effect of increasing PLLA content on the crystallization behavior and morphology was evaluated. Wide angle X-Ray scattering (WAXS) experiments performed on cooling from the melt confirmed the triple crystalline nature of these terpolymers and revealed that they crystallize in sequence: the PLLA block crystallizes first, then the PCL block, and finally the PEO block. Differential scanning calorimetry (DSC) analysis further demonstrated that the three blocks can crystallize from the melt when a low cooling rate is employed. The crystallization process takes place from a homogenous melt as indicated by small angle X-Ray scattering (SAXS) experiments. The crystallization and melting enthalpies and temperatures of both PEO and PCL blocks decrease as PLLA content in the terpolymer increases. Polarized light optical microscopy (PLOM) demonstrated that the PLLA block templates the morphology of the terpolymer, as it forms spherulites upon cooling from the melt. The subsequent crystallization of PCL and PEO blocks occurs inside the interlamellar regions of the previously formed PLLA block spherulites. In this way, unique triple crystalline mixed spherulitic superstructures have been observed for the first time. As the PLLA content in the terpolymer is reduced the superstructural morphology changes from spherulites to a more axialitic-like structure.

  15. Synthesis and application of terpolymer bearing cyclic carbonate and cinnamoyl groups

    Park, S. Y.; Park, H. Y.; Lee, H. S.; Park, S. W.; Park, D. W.

    2003-01-01

    We propose the syntheses of photopolymer with pendant cinnamic ester and cyclic carbonate groups by the addition reaction of poly(glycidyl methacrylate- co-styrene) with CO 2 and then with cinnamoyl chloride. Quaternary ammonium salts showed good catalytic activity for this synthesis. Photochemical reaction experiments revealed that terpolymer having cinnamate and cyclic carbonate groups has good photosensitivity, even in the absence of sensitizer. In order to expand the application of the obtained terpolymer, polymer blends with poly(methyl methacrylate) were prepared. Differential scanning calorimetry and optical clarity tests showed that the blends were miscible over the whole composition ranges.

  16. Morphologies of ABC triblock terpolymer melts containing poly(Cyclohexadiene): Effects of conformational asymmetry

    Kumar, Rajeev Senthil

    2013-02-12

    We have synthesized linear ABC triblock terpolymers containing poly(1,3-cyclohexadiene), PCHD, as an end block and characterized their morphologies in the melt. Specifically, we have studied terpolymers containing polystyrene (PS), polybutadiene (PB), and polyisoprene (PI) as the other blocks. Systematically varying the ratio of 1,2- /1,4-microstructures of poly(1,3-cyclohexadiene), we have studied the effects of conformational asymmetry among the three blocks on the morphologies using transmission electron microscopy (TEM), small-angle X-ray scattering (SAXS), and self-consistent field theory (SCFT) performed with PolySwift++. Our work reveals that the triblock terpolymer melts containing a high percentage of 1,2-microstructures in the PCHD block are disordered at 110 C for all the samples, independent of sequence and volume fraction of the blocks. In contrast, the triblock terpolymer melts containing a high percentage of 1,4-microstructure form regular morphologies known from the literature. The accuracy of the SCFT calculations depends on calculating the χ parameters that quantify the repulsive interactions between different monomers. Simulations using χ values obtained from solubility parameters and group contribution methods are unable to reproduce the morphologies as seen in the experiments. However, SCFT calculations accounting for the enhancement of the χ parameter with an increase in the conformational asymmetry lead to an excellent agreement between theory and experiments. These results highlight the importance of conformational asymmetry in tuning the χ parameter and, in turn, morphologies in block copolymers. © 2012 American Chemical Society.

  17. Kinetics of nanocrystallization in regular alternating terpolymers of ethene and propene with carbon monoxide

    Privalko, V. P.; Dolgoshey, V. B.; Privalko, E. G.; Sikora, Antonín

    2003-01-01

    Roč. 42, č. 5 (2003), s. 953-962. ISSN 0022-2348 R&D Projects: GA AV ČR IAA4050007 Institutional research plan: CEZ:AV0Z4050913 Keywords : alternating terpolymers of ethene and propene with carbon monoxide * nanocrystallinity * kinetics of nanocrystallization Subject RIV: CD - Macromolecular Chemistry Impact factor: 0.679, year: 2003

  18. Removal of cations using ion-binding terpolymer involving 2-amino-6-nitro-benzothiazole and thiosemicarbazide with formaldehyde by batch equilibrium technique

    Ahamed, Mohamed A. Riswan [Department of Chemistry, Oxford Engineering College, Tiruchirappalli 620 009, Tamil Nadu (India); Jeyakumar, Duraisamy [Functional Materials Division, Central Electrochemical Research Institute, Karaikudi 630 006, Tamil Nadu (India); Burkanudeen, Abdul R., E-mail: a_deen@rediffmail.com [PG and Research Department of Chemistry, Jamal Mohamed College, Tiruchirappalli 620 020, Tamil Nadu (India)

    2013-03-15

    Graphical abstract: Effect of (a) NaCl, (b) NaNO{sub 3}, (c) NaClO{sub 4} and (d) Na{sub 2}SO{sub 4} electrolytes on metal ion uptake. Display Omitted Highlights: ► A novel [(2-amino-6-nitro-benzothiazole)–thiosemicarbazide–formaldehyde] terpolymer has been synthesized. ► SEM images show high porosity in the surface of the resin evidences the effective adsorption of various metal ions. ► BTF terpolymer is a well recyclable cation-exchange resin for industrial waste water treatment. -- Abstract: 2-Amino-6-nitro-benzothiazole and thiosemicarbazide with formaldehyde (BTF) terpolymer was synthesized by the condensation polymerization technique. The elemental analysis and physico-chemical parameters of the terpolymer were measured. This chelation terpolymer was characterized by infrared, electronic and nuclear magnetic resonance ({sup 1}H and {sup 13}C NMR) spectral studies. The molecular weight of the terpolymer was determined by gel permeation chromatography (GPC). Surface analysis of the terpolymer was analyzed by scanning electron microscopy (SEM) and X-ray diffraction (XRD) method. The thermal stability of the terpolymer was analyzed by thermogravimetric analysis (TGA). The cation-exchange property of the terpolymer was determined by batch equilibrium method with the effect of pH, contact time and electrolytes. The reusability of the resin was also studied to estimate the effectiveness of the terpolymer resin.

  19. Synthesis and characterization of CdS nanocrystals in Maleic anhydride-Octene-1-Vinylbutyl Ether terpolymer matrix

    Akperov, Oktay H.; Muradov, Mustafa B.; Malikov, Elvin Y.; Akperov, Elchin O.; Mammadova, Rasmiyya E.; Eyvazova, Goncha M.; Kukovecz, Ákos; Kónya, Zoltán

    2016-07-01

    A Maleic anhydride-Octene-1-Vinylbutyl Ether terpolymer was synthesized via the radical terpolymerization method in order to prepare a new matrix for CdS nanocrystal synthesis. CdS nanocrystals were synthesized through the reaction of thiourea with cadmium chloride. The synthesized terpolymer/CdS nanocrystal composites were characterized by several methods. Energy Dispersive X-ray analysis, Raman spectroscopy and powder X-ray diffraction methods. The room temperature UV-visible absorption spectra show a shift of the absorption edge towards higher energies. The band gap of the CdS nanocomposite is bigger than that of bulk CdS. Raman spectrum exhibits characteristic peaks of CdS. Images of the nanocomposite obtained with Atomic Force Microscopy and Transmission Electron Microscopy are the evidences of CdS nanocrystal formation in the terpolymer. Thermal investigation shows that the nanocomposite is more thermostable than the terpolymer which could be useful for application in thermo aggressive medium.

  20. Tuning Structure and Properties of Graded Triblock Terpolymer-Based Mesoporous and Hybrid Films

    Phillip, William A.

    2011-07-13

    Despite considerable efforts toward fabricating ordered, water-permeable, mesoporous films from block copolymers, fine control over pore dimensions, structural characteristics, and mechanical behavior of graded structures remains a major challenge. To this end, we describe the fabrication and performance characteristics of graded mesoporous and hybrid films derived from the newly synthesized triblock terpolymer, poly(isoprene-b-styrene-b-4-vinylpyridine). A unique morphology, unachievable in diblock copolymer systems, with enhanced mechanical integrity is evidenced. The film structure comprises a thin selective layer containing vertically aligned and nearly monodisperse mesopores at a density of more than 1014 per m2 above a graded macroporous layer. Hybridization via homopolymer blending enables tuning of pore size within the range of 16 to 30 nm. Solvent flow and solute separation experiments demonstrate that the terpolymer films have permeabilities comparable to commercial membranes, are stimuli-responsive, and contain pores with a nearly monodisperse diameter. These results suggest that moving to multiblock polymers and their hybrids may open new paths to produce high-performance graded membranes for filtration, separations, nanofluidics, catalysis, and drug delivery. © 2011 American Chemical Society.

  1. Biodegradable PTLGA Terpolymers versus Collagen Implants Used as an Adjuvant in Trabeculectomy in Rabbit Eye.

    Niu, Weiran; Shen, Guanglin; Yuan, Yuanzhi; Ma, Xiaoping; Li, Suming; Wang, Jingzhao; Fan, Zhongyong; Liao, Lan

    2015-01-01

    Purpose. To evaluate the effectiveness and safety of three biodegradable terpolymers prepared from L-lactide, trimethylene carbonate, and glycolide (PTLGA) as an aid for trabeculectomy compared with the Ologen (OLO). Methods. Trabeculectomy was carried out on rabbits with implantation made from OLO or three PTLGA terpolymers. Intraocular pressure (IOP) was recorded 1, 2, 3, and 6 months postoperatively and bleb evaluations were performed using ultrasound biomicroscopy (UBM) 3 months after surgery, optical coherence tomography (OCT) every month, and transmission electron microscopy (TEM) six months after surgery followed by histological examination 1, 2, 3, and 6 months postoperatively. Result. IOP was significantly reduced in all groups after surgery. There were no significant differences in the IOL between groups at any time after implantation. There was no significant difference between the groups examined by OCT, UBM, and TEM. Exposure of the implant was observed in one eye from the OLO group and one eye in the P1. Subconjunctiva hyperblastosis was observed in one eye from group P3 and two eyes from the OLO group. Conclusions. Subconjunctival implantation of filtering devices made from PTLGA may present a safe and effective additional surgical tool for the treatment of filtering surgery. Fewer complications were observed in the group with P2 implants compared to other groups. PMID:26697212

  2. Morphology and properties of polypropylene/-low density polyethylene blends compatibilized by ethylene-propylene-diene terpolymer

    Vranješ, N.; Rek, V.; Šlouf, Miroslav; Jelčic, Ž.

    Dresden: Leibniz Institut für Polymerforschung e. V, 2010. s. 62. [European Symposium on Polymer Blends /10./. 07.03.2010-10.03.2010, Dresden] Institutional research plan: CEZ:AV0Z40500505 Keywords : polypropylene * polyethylene * terpolymer Subject RIV: CD - Macromolecular Chemistry

  3. Triblock and pentablock terpolymers by sequential base-assisted living cationic copolymerization of functionalized vinyl ethers

    Bouchekif, Hassen

    2015-01-01

    A series of novel, well-defined triblock (PnBVE-b-PCEVE-b-PSiDEGVE) and pentablock (PSiDEGVE-b-PCEVE-b-PnBVE-b-PCEVE-b-PSiDEGVE) terpolymers of n-butyl vinyl ether (nBVE), 2-chloroethyl vinyl ether (CEVE) and tert-butyldimethylsilyl ethylene glycol vinyl ether (SiEGVE) were synthesized by sequential base-assisted living cationic polymerization. The living character of the homopolymerization of the three VE monomers and the crossover reaction resulting in the formation of well-defined block copolymers were investigated in various solvents (toluene, dichloromethane and n-hexane) using either a monofunctional [nBVE-acetic acid adduct (nBEA), CEVE-acetic acid adduct (CEEA) and SiDEGVE-acetic acid adduct (SiDEGEA)] or a difunctional [1,4-cyclohexane-1,4-diyl bis(2-methoxyethyl acetate) (cHDMEA)] initiator. All initiators are structurally equivalent to the dormant species of the corresponding monomers in order to achieve fast initiation. The optimal conditions of polymerization were achieved in n-hexane at -20 °C, in the presence of 1 M AcOEt (base). Good control over the number average molecular weight (Mn) and the polydispersity index (PDI) was obtained only at [Et3Al2Cl3]0 = [Chain-end]0 ≤ 10 mM. 2,6-Di-tert-butylpyridine (DtBP) was used as a non-nucleophilic proton trap to suppress any protonic initiation from moisture (i.e., Et3Al2Cl3·H2O). Well-defined PnBVEn-b-PCEVEp-b-PSiDEGVEq and PSiDEGVEq-b-PCEVEp-b-PnBVEn-b-PCEVEp-b-PSiDEGVEq terpolymers with a high crossover efficiency, no PCEVE-induced physical gelation, and predictable Mn and PDI < 1.15 were synthesized successfully provided that the targeted DPCEVE/DPnBVE ratio (i.e., p/n) did not exceed 2 and 0.2, respectively. The quantitative desilylation of the PSiEGVE by n-Bu4N+F- in THF at 0 °C led to triblock and pentablock terpolymers in which the PCEVE is the central block and the polyalcohol is the outer block. The thermal properties of the synthesized materials were examined by differential scanning

  4. Fotfavoriten AB

    Søilen, Klaus Solberg; HUBER, Stefan

    2004-01-01

    Fotfavoriten AB, a foot care company located in Sollefttå in Northern Sweden, is an example of how local government fires staff only to reengage them as entrepreneurs delivering similar service. The case is typical for the social sector and may mark a trend. The result is often felt to be positive both by the entrepreneur, who is now more directly in charge of her or his earnings, and the end consumer. The CEO of Fotfavoriten AB, Eva Wörmann, waited a long time before she dared to take the ne...

  5. Elastocaloric effect in poly(vinylidene fluoride-trifluoroethylene-chlorotrifluoroethylene) terpolymer

    Yoshida, Yukihiro; Yuse, Kaori; Guyomar, Daniel; Capsal, Jean-Fabien; Sebald, Gael

    2016-06-01

    The elastocaloric properties of poly (vinylidene fluoride-trifluoroethylene-chlorotrifluoroethylene) [P(VDF-TrFE-CTFE)] terpolymer were directly characterized using an infrared imaging camera. At a strain of 12%, a reversible adiabatic temperature variation of 2.15 °C was measured, corresponding to an isothermal entropy variation of 21.5 kJ m-3 K-1 or 11 J kg-1 K-1. In comparison with other elastocaloric materials, P(VDF-TrFE-CTFE) appears to represent a trade-off between the large required stresses in shape memory alloys and the large required strains in natural rubber. The internal energy of the P(VDF-TrFE-CTFE) polymer was found to be independent of the strain, resulting in complete conversion of the mechanical work into heat, as for pure elastomeric materials. The elastocaloric effect therefore originates from a pure entropic elasticity, which is likely to be related to the amorphous phase of the polymer only.

  6. Electric field manipulated nanopatterns in thin films of metalorganic 3-miktoarm star terpolymers.

    Kathrein, Christine C; Bai, Wubin; Nunns, Adam; Gwyther, Jessica; Manners, Ian; Böker, Alexander; Tsarkova, Larisa; Ross, Caroline A

    2016-05-25

    We report the effect of electric field on the morphological transitions and ordering behavior of polyferrocenylethylmethylsilane block (PFEMS)-containing copolymers. By analyzing structures in solvent-annealed films of metalorganic sphere- and cylinder-forming diblock copolymers, as well as of 3-miktoarm polyisoprene-arm-polystyrene-arm-PFEMS (3μ-ISF) terpolymers, we decouple two types of responses to the electric field: morphological transformations as a result of an increase in the volume fraction of the PFEMS block by oxidation of the ferrocenyl groups, and the orientation of the dielectric interfaces of microdomains parallel to the electric field vector. In the case of 3μ-ISF, the former effect dominates at high electric field strengths which results in an unexpected cylinder-to-sphere transition, leading to a well-ordered hexagonal dot pattern. Our results demonstrate multiple tunability of ordered microdomain morphologies, suggesting future applications in nanofabrication and surface patterning. PMID:27136891

  7. Linking experiment and theory for three-dimensional networked binary metal nanoparticle–triblock terpolymer superstructures

    Li, Zihui

    2014-02-21

    © 2014 Macmillan Publishers Limited. Controlling superstructure of binary nanoparticle mixtures in three dimensions from self-assembly opens enormous opportunities for the design of materials with unique properties. Here we report on how the intimate coupling of synthesis, in-depth electron tomographic characterization and theory enables exquisite control of superstructure in highly ordered porous three-dimensional continuous networks from single and binary mixtures of metal nanoparticles with a triblock terpolymer. Poly(isoprene-block-styrene-block-(N,N-dimethylamino)ethyl methacrylate) is synthesized and used as structure-directing agent for ligand-stabilized platinum and gold nanoparticles. Quantitative analysis provides insights into short-and long-range nanoparticle-nanoparticle correlations, and local and global contributions to structural chirality in the networks. Results provide synthesis criteria for next-generation mesoporous network superstructures from binary nanoparticle mixtures for potential applications in areas including catalysis.

  8. A solution blending route to ethylene propylene diene terpolymer/layered double hydroxide nanocomposites

    Bhowmick Anil

    2006-01-01

    Full Text Available AbstractEthylene propylene diene terpolymer (EPDM/MgAl layered double hydroxide (LDH nanocomposites have been synthesized by solution intercalation using organically modified LDH (DS-LDH. The molecular level dispersion of LDH nanolayers has been verified by the disappearance of basal XRD peak of DS-LDH in the composites. The internal structures, of the nanocomposite with the dispersion nature of LDH particles in EPDM matrix have been studied by TEM and AFM. Thermogravimetric analysis (TGA shows thermal stability of nanocomposites improved by ≈40 °C when 10% weight loss was selected as point of comparison. The degradation for pure EPDM is faster above 380 °C while in case of its nanocomposites, it is much slower.

  9. Corrosion Inhibitive Evaluation of an Environmentally Friendly Water-Base Acrylic Terpolymer on Mild Steel in Hydrochloric Acid Media

    Azghandi, Mojtaba Vakili; Davoodi, Ali; Farzi, Gholam Ali; Kosari, Ali

    2013-12-01

    The corrosion inhibitive performance of an environmentally friendly water-base acrylic terpolymer [methyl methacrylate/Butyl Acrylate/Acrylic acid (ATP)] on mild steel in 1 M HCl was investigated by alternating current and direct current electrochemical techniques and the quantum chemical method. An efficiency of more than 97 pct was obtained with 0.8 mmol/L ATP. The increase in inhibitor concentration and immersion time has a positive effect, while the temperature influence is negligible on the inhibitor efficiency. The present terpolymer obeys the Langmuir isotherm, and thermodynamic calculation reveals a chemisorption type on the surface. Density functional calculations showed that the lone pairs of electrons of oxygen in the structure of three monomers are suitable sites to adsorb onto the metal surface. Finally, in the presence of ATP, a decrease in surface roughness and corrosion attacks was demonstrated by atomic force microscopy and optical microscopy examinations, respectively.

  10. Filled Ethylene-propylene Diene Terpolymer Elastomer as ThermalInsulator for Case-bonded Solid Rocket Motors

    C. M. Bhuvaneswari; S. D. Kakade; V. D. Deuskar; A. B. Dange; Manoj Gupta

    2008-01-01

    Ethylene-propylene diene terpolymer (EPDM)-based insulation system is being globallyused for case-bonded solid rocket motors. A study was undertaken using EPDM as base polymer,blended with hypalon and liquid EPDM and filled with fibrous and non-fibrous fillers. Theseformulations were evaluated as rocket motor insulation system. The basic objective of the studywas to develop an insulation system based on EPDM for case-bonded applications. A series ofrocket motor insulator compositions based on...

  11. Synthesis and uranyl ion adsorption study of cross-linked allyl propionate-maleic anhydride-styrene terpolymer

    AKPEROV, Elchin; MAHARRAMOV, Abel; AKPEROV, Oktay

    2010-01-01

    Allyl propionate-maleic anhydride-styren terpolymer has been modified with glycerin in order to prepare a new cross-linked functional polymer sorbent. The synthesized cross-linked polymer sorbent has a network structure and contains carboxylic acid, carbonyl, hydroxy, and ester groups, all of which are capable ofinteracting with metal ions. The sorption behavior of UO22+ ions under optimum sorption conditions was determined. The sorption properties of the sorbent were determined unde...

  12. Well-defined Polymethylene-Based Co/Terpolymers by Combining Anthracene/Maleimide Diels-Alder Reaction with Polyhomologation

    Hadjichristidis, Nikolaos

    2015-05-26

    A novel strategy towards well-defined polymethylene-based co/terpolymers, by combining anthracene/maleimide Diels-Alder reaction with polyhomologation, is presented. For the synthesis of diblock copolymers the following approach was applied: a) synthesis of α-anthracene-ω-hydroxy- polymethylene by polyhomologation using tri (9-anthracene-methyl propyl ether) borane as initiator, b) synthesis of furan-protected-maleimide-terminated poly (ε-caprolactone) or polyethylene glycol and c). Diels-Alder reaction between the anthracene and maleimide-terminated polymers. In the case of triblock terpolymers the α-anthracene-ω-hydroxy-polymethylene was used as macroinitiator for the ring-opening polymerization of D, L-lactide to afford an anthracene-terminated PM-b-PLA copolymer, followed by Diels-Alder reaction with furan-protected maleimide-terminated poly (ε-caprolactone) or polyethylene glycol to give the triblock terpolymers. All intermediate and final products were characterized by SEC, 1H NMR, UV-VIS spectroscopy and DSC.

  13. Impact of structural changes on dielectric and thermal properties of vinylidene fluoride–trifluoroethylene-based terpolymer/copolymer blends

    Casar, G. [Jožef Stefan Institute and Jožef Stefan International Postgraduate School, Jamova 39, SI-1000 Ljubljana (Slovenia); Li, X. [Department of Electrical Engineering and Materials Research Institute, The Pennsylvania State University, University Park, PA 16802 (United States); Malič, B. [Jožef Stefan Institute and Jožef Stefan International Postgraduate School, Jamova 39, SI-1000 Ljubljana (Slovenia); Zhang, Q.M. [Department of Electrical Engineering and Materials Research Institute, The Pennsylvania State University, University Park, PA 16802 (United States); Bobnar, V., E-mail: vid.bobnar@ijs.si [Jožef Stefan Institute and Jožef Stefan International Postgraduate School, Jamova 39, SI-1000 Ljubljana (Slovenia)

    2015-03-15

    We report dielectric and thermal properties of the poly(vinylidene fluoride–trifluoroethylene–chlorofluoroethylene) terpolymer [P(VDF–TrFE–CFE), a member of the relaxor polymer family that exhibits fast response speeds, giant electrostriction, high electric energy density, and large electrocaloric effect] blended with the ferroelectric poly(vinylidene fluoride–trifluoroethylene) copolymer, P(VDF–TrFE). Although the differential scanning calorimetry (DSC) clearly reveals that both components form separate crystalline phases, at low copolymer content blends entirely exhibit a relaxorlike linear dielectric response, since the interfacial couplings to the bulky defects in the terpolymer convert the normal ferroelectric copolymer into a relaxor. On the other hand, dielectric experiments evidence that in blends with 20–50 wt% of P(VDF–TrFE) the ferroelectric and relaxor states coexist. This coexistence is confirmed by DSC results, which further reveal the influence of blending on the terpolymer crystallinity and melting point. At last, the crystallinity data appropriately explain the variation of the dielectric constant in P(VDF–TrFE–CFE)/P(VDF–TrFE) blends.

  14. Enhanced permittivity and energy density in neat poly(vinylidene fluoride-trifluoroethylene-chlorotrifluoroethylene) terpolymer films through control of morphology.

    Smith, O'Neil L; Kim, Yunsang; Kathaperumal, Mohanalingam; Gadinski, Matthew R; Pan, Ming-Jen; Wang, Qing; Perry, Joseph W

    2014-06-25

    Polymer materials with large dielectric constants are desirable for the development of high energy density capacitors. We show that the dielectric properties of poly(vinylidene fluoride-trifluoroethylene-chlorotrifluoroethylene) [P(VDF-TrFE-CTFE)] can be improved by the use of processing conditions that favor formation of a highly crystalline morphology of the nonpolar α-phase. Through the use of spin coating, thermal treatment above the melting temperature, and quenching, we were able to attain a highly crystalline, α-phase rich morphology that has a quite large dielectric constant of 77 ± 10 at 1 kHz. The final morphology and phase composition of the terpolymer films depend strongly on the postprocessing thermal treatment and the quality of the solvent. Evaluation of the polarization behavior of the terpolymer films as a function of electric field reveal that the polymer exhibits a relaxor-ferroelectric behavior and has a substantial energy density of 9.7 J/cm(3) at fields of up to approximately 470 V/μm. Under millisecond pulsed charge-discharge measurements a 3-fold increase in energy density (27 J/cm(3)) is obtained at high fields (∼600 V/μm). Our study demonstrates that the processing conditions and morphology of fluorinated terpolymer films are controlling factors for achievement of high dielectric permittivity and energy density that are critical for high performance capacitors. PMID:24873348

  15. Preparation and Characterization of Amphiphilic Triblock Terpolymer-Based Nanofibers as Antifouling Biomaterials

    Cho, Youngjin

    2012-05-14

    Antifouling surfaces are critical for the good performance of functional materials in various applications including water filtration, medical implants, and biosensors. In this study, we synthesized amphiphilic triblock terpolymers (tri-BCPs, coded as KB) and fabricated amphiphilic nanofibers by electrospinning of solutions prepared by mixing the KB with poly(lactic acid) (PLA) polymer. The resulting fibers with amphiphilic polymer groups exhibited superior antifouling performance to the fibers without such groups. The adsorption of bovine serum albumin (BSA) on the amphiphilic fibers was about 10-fold less than that on the control surfaces from PLA and PET fibers. With the increase of the KB content in the amphiphilic fibers, the resistance to adsorption of BSA was increased. BSA was released more easily from the surface of the amphiphilic fibers than from the surface of hydrophobic PLA or PET fibers. We have also investigated the structural conformation of KB in fibers before and after annealing by contact angle measurements, transmission electron microscopy (TEM), energy-dispersive X-ray spectroscopy (EDX), and coarse-grained molecular dynamics (CGMD) simulation to probe the effect of amphiphilic chain conformation on antifouling. The results reveal that the amphiphilic KB was evenly distributed within as-spun hybrid fibers, while migrated toward the core from the fiber surface during thermal treatment, leading to the reduction in antifouling. This suggests that the antifouling effect of the amphiphilic fibers is greatly influenced by the arrangement of amphiphilic groups in the fibers. © 2012 American Chemical Society.

  16. Research on the synthesis and scale inhibition performance of a new terpolymer scale inhibitor.

    Bao, Yufei; Li, Meng; Zhang, Yanqing

    2016-01-01

    A new terpolymer named β-CD-MA-SSS was produced using free-radical polymerization of β-cyclodextrin (β-CD), maleic-anhydride (MA) and sodium-styrene-sulfonate (SSS) as monomers, with potassium persulfate (KPS) as initiator. Its performance as a scale inhibitor to prevent deposition of calcium carbonate (CaCO3) has been investigated. Experimental results demonstrated that β-CD-MA-SSS performed excellent scale inhibition and exhibited a high conversion rate under the following conditions: initiator consisting of 6%, molar ratio of reaction monomers SSS:MA = 0.8:1, MA:β-CD = 6:1, reaction temperature of 80 °C, reaction time of 6 h, and dropping time of 40 min when MA was dosed as a substrate, and SSS and KPS were dosed as dropping reactants simultaneously. Use of a Fourier transform infrared spectrometer for this inhibitor showed that the polymerization reaction had taken place with the reaction monomers under the above specified conditions. Scanning electron microscopy indicated that the β-CD-MA-SSS had a strong chelating ability for calcium (Ca(2+)) and a good dispersion ability for calcium carbonate (CaCO3). PMID:27054733

  17. Understanding the structure and performance of self-assembled triblock terpolymer membranes

    Pendergast, MaryTheresa M.

    2013-10-01

    Nanoporous membranes represent a possible route towards more precise particle and macromolecular separations, which are of interest across many industries. Here, we explored membranes with vertically-aligned nanopores formed from a poly(isoprene-. b-styrene-. b-4 vinyl pyridine) (ISV) triblock terpolymer via a hybrid self-assembly/nonsolvent induced phase separation process (S-NIPS). ISV concentration, solvent composition, and evaporation time in the S-NIPS process were varied to tailor ordering of the selective layer and produce enhanced water permeability. Here, water permeability was doubled over previous versions of ISV membranes. This was achieved by increasing volatile solvent concentration, thereby decreasing the evaporation period required for self-assembly. Fine-tuning was required, however, since overly-rapid evaporation did not yield the desired pore structure. Transport models, used to relate the in-. situ structure to the performance of these materials, revealed narrowing of pores and blocking by the dense region below. It was shown that these vertically aligned nanoporous membranes compare favorably with commercial ultrafiltration membranes formed by NIPS and track-etching processes, which suggests that there is practical value in further developing and optimizing these materials for specific industrial separations. © 2013 Elsevier B.V.

  18. Poly (ethylene oxide)-block-poly (n-butyl acrylate)-blockpoly (acrylic acid) triblock terpolymers with highly asymmetric hydrophilic blocks: synthesis and aqueous solution properties

    Petrov, P; Yoncheva, K. (Krassimira); Mokreva, P. (Pavlina); Konstantinov, S.; J M Irache; Müller, A.H.E. (Axel H.E.)

    2013-01-01

    The synthesis and aggregation behaviour in aqueous media of novel amphiphilic poly(ethylene oxide)- block-poly(n-butyl acrylate)-block-poly(acrylic acid) (PEO–PnBA–PAA) triblock terpolymers were studied. Terpolymers composed of two highly asymmetric hydrophilic PEO (113 monomer units) and PAA (10–17 units) blocks, and a longer soft hydrophobic PnBA block (163 or 223 units) were synthesized by atom transfer radical polymerisation (ATRP) of n-butyl acrylate and tert-butyl acrylate ...

  19. Radiation grafting of acrylonitrile on ethylene-propylene diene terpolymer rubber. Optimization of grafting parameters and oil resistance properties

    Radiation induced grafting of acrylonitrile (ACN) on ethylene-propene diene terpolymer (EPDM) rubber film was investigated by mutual radiation grafting technique. Effect of experimental variables viz. radiation dose, dose rate, type of solvent and monomer content on extent of grafting was studied. From the kinetic studies a mathematical relation Rgα[M]0.7D0.68 showing non-linear relationship for rate of grafting with monomer concentration and dose was deduced. The grafted samples showed increased hardness and oil resistance. (author)

  20. Injectable hydrogel as stem cell scaffolds from the thermosensitive terpolymer of NIPAAm/AAc/HEMAPCL

    Lian S

    2012-09-01

    Full Text Available Sheng Lian,1Yan Xiao,1 Qingqing Bian,1Yu Xia,2 Changfa Guo,2 Shenguo Wang,2 Meidong Lang11Shanghai Key Laboratory of Advanced Polymeric Materials, Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology, Shanghai, People's Republic of China; 2Department of Cardiac Surgery, Zhongshan Hospital, Fudan University and Shanghai Institute of Cardiovascular Diseases, Shanghai, People's Republic of ChinaAbstract: A series of biodegradable thermosensitive copolymers was synthesized by free radical polymerization with N-isopropylacrylamide (NIPAAm, acrylic acid (AAc and macromer 2-hydroxylethyl methacrylate-poly(ε-caprolactone (HEMAPCL. The structure and composition of the obtained terpolymers were confirmed by proton nuclear magnetic resonance spectroscopy, while their molecular weight was measured using gel permeation chromatography. The copolymers were dissolved in phosphate-buffered saline (PBS solution (pH = 7.4 with different concentrations to prepare hydrogels. The lower critical solution temperature (LCST, cloud point, and rheological property of the hydrogels were determined by differential scanning calorimetry, ultraviolet-visible spectrometry, and rotational rheometry, respectively. It was found that LCST of the hydrogel increased significantly with the increasing NIPAAm content, and hydrogel with higher AAc/HEMAPCL ratio exhibited better storage modulus, water content, and injectability. The hydrogels were formed by maintaining the copolymer solution at 37°C. The degradation experiment on the formed hydrogels was conducted in PBS solution for 2 weeks and demonstrated a less than 20% weight loss. Scanning electron microscopy was also used to study the morphology of the hydrogel. The copolymer with NIPAAm/AAc/HEMAPCL ratio of 88:9.6:2.4 was bioconjugated with type I collagen for the purpose of biocompatibility enhancement. In-vitro cytotoxicity

  1. Cornucopia of Nanoscale Ordered Phases in Sphere-Forming Tetrablock Terpolymers.

    Chanpuriya, Siddharth; Kim, Kyungtae; Zhang, Jingwen; Lee, Sangwoo; Arora, Akash; Dorfman, Kevin D; Delaney, Kris T; Fredrickson, Glenn H; Bates, Frank S

    2016-05-24

    We report the phase behavior of a series of poly(styrene)-b-poly(isoprene)-b-poly(styrene)'-b-poly(ethylene oxide) (SIS'O) tetrablock terpolymers. This study was motivated by self-consistent field theory (SCFT) calculations that anticipate a rich array of sphere-forming morphologies with variations in the molecular symmetry parameter τ = NS/(NS + NS'), where N is the block degree of polymerization and the volume fraction of O is less than about 0.22. Eight SIS'O samples, with τ ranging from 0.21 to 0.73, were synthesized and investigated using small-angle X-ray scattering and transmission electron microscopy, yielding evidence of nine different spherical phases: hexagonal, FCC, HCP, BCC, rhombohedral (tentative), liquid-like packing, dodecagonal quasicrystal, and Frank-Kasper σ and A15 phases. At temperatures close to the order-disorder transition, these tetrablocks behave as pseudo-[SIS']-O diblocks and form equilibrium morphologies mediated by facile chain exchange between micelles. Transition from equilibrium to nonequilibrium behavior occurs at a temperature (Terg) several tens of degrees below the order-disorder transition temperature, speculated to be coincident with the loss of ergodicity, as chain exchange is arrested due to increased segregation strength between the core (O) and corona (SIS') blocks. Nonequilibrium ordered structures form when T ordering in the S and I block matrix. These experiments demonstrate a profound dependence on phase stability with variations in τ and temperature, providing insights into the formation of ordered phase symmetry in this class of asymmetric multiblock polymers. PMID:27055118

  2. Optimization of tyrosine-derived polycarbonate terpolymers for bone regeneration scaffolds

    Resurreccion-Magno, Maria Hanshella C.

    Tyrosine-derived polycarbonates (TyrPC) are a versatile class of polymers highly suitable for bone tissue engineering. Among the tyrosine-derived polycarbonates, poly(DTE carbonate) has an FDA masterfile that documents its biocompatibility and non-toxicity and has shown potential utility in orthopedics due to its osteoconductive properties and strength. DTE stands for desaminotyrosyl-tyrosine ethyl ester and is the most commonly used tyrosine-derived monomer. However, in vitro degradation studies showed that poly(DTE carbonate) did not completely resorb even after four years of incubation in phosphate buffered saline. Thus for bone regeneration, which only requires a temporary implant until the bone heals, poly(DTE carbonate) would not be the best choice. The goal of the present research was to optimize a scaffold composition for bone regeneration that is based on desaminotyrosyl-tyrosine alkyl ester (DTR), desaminotyrosyl-tyrosine (DT) and poly(ethylene glycol) (PEG). Five areas of research were presented: (1) synthesis and characterization of a focused library of TyrPC terpolymers; (2) evaluation of the effects of how small changes on the composition affected the mechanism and kinetics of polymer degradation and erosion; (3) fabrication of bioactive three-dimensional porous scaffold constructs for bone regeneration; (4) assessment of osteogenic properties in vitro using pre-osteoblasts; and (5) evaluation of bone regeneration potential, with or without recombinant human bone morphogenetic protein-2 (rhBMP-2), in vivo using a critical sized defect (CSD) rabbit calvaria (cranium) model. Small changes in the composition, such as changing the R group of DTR from ethyl to methyl, varying the mole percentages of DT and PEG, and using a different PEG block length, affected the overall properties of these polymers. Porous scaffolds were prepared by a combination of solvent casting, porogen leaching and phase separation techniques. Calcium phosphate was coated on the

  3. Synthesis and Thermal Properties of Acrylonitrile/Butyl Acrylate/Fumaronitrile and Acrylonitrile/Ethyl Hexyl Acrylate/Fumaronitrile Terpolymers as a Potential Precursor for Carbon Fiber

    Siti Nurul Ain Md Jamil

    2014-09-01

    Full Text Available A synthesis of acrylonitrile (AN/butyl acrylate (BA/fumaronitrile (FN and AN/EHA (ethyl hexyl acrylate/FN terpolymers was carried out by redox polymerization using sodium bisulfite (SBS and potassium persulphate (KPS as initiator at 40 °C. The effect of comonomers, BA and EHA and termonomer, FN on the glass transition temperature (Tg and stabilization temperature was studied using Differential Scanning Calorimetry (DSC. The degradation behavior and char yield were obtained by Thermogravimetric Analysis. The conversions of AN, comonomers (BA and EHA and FN were 55%–71%, 85%–91% and 76%–79%, respectively. It was found that with the same comonomer feed (10%, the Tg of AN/EHA copolymer was lower at 63 °C compared to AN/BA copolymer (70 °C. AN/EHA/FN terpolymer also exhibited a lower Tg at 63 °C when compared to that of the AN/BA/FN terpolymer (67 °C. By incorporating BA and EHA into a PAN system, the char yield was reduced to ~38.0% compared to that of AN (~47.7%. It was found that FN reduced the initial cyclization temperature of AN/BA/FN and AN/EHA/FN terpolymers to 228 and 221 °C, respectively, in comparison to that of AN/BA and AN/EHA copolymers (~260 °C. In addition, FN reduced the heat liberation per unit time during the stabilization process that consequently reduced the emission of volatile group during this process. As a result, the char yields of AN/BA/FN and AN/EHA/FN terpolymers are higher at ~45.1% and ~43.9%, respectively, as compared to those of AN/BA copolymer (37.1% and AN/EHA copolymer (38.0%.

  4. Enhanced Performance of Polymer Solar Cells Comprising Diketopyrrolopyrrole-Based Regular Terpolymer Bearing Two Different π-Extended Donor Units.

    Ko, Eun Yi; Park, Gi Eun; Lee, Dae Hee; Um, Hyun Ah; Shin, Jicheol; Cho, Min Ju; Choi, Dong Hoon

    2015-12-30

    New regular and random diketopyrrolopyrrole (DPP)-based terpolymers (i.e., Reg-PBDPPT and Ran-PBDPPT, respectively) bearing DPP as an electron deficient unit and 2,2'-bithiophene and (E)-1,2-di(thiophen-2-yl)ethene as electron donating units were designed and synthesized, and their performance in photovoltaic cells was investigated precisely. The absorption properties and highest occupied molecular orbital (HOMO) of Reg-PBDPPT were found to be different from those of Ran-PBDPPT. The results of grazing incidence X-ray diffraction experiments revealed that Ran-PBDPPT typically had a predominantly edge-on chain orientation on the substrate, whereas Reg-PBDPPT showed mixed chain orientation both in pristine and thermally annealed films. Although Reg-PBDPPT exhibited a lower degree of edge-on chain orientation on the substrate, the corresponding TFTs showed a high hole mobility of 0.42-0.96 cm(2) V(-1) s(-1) and maintained a high current on/off ratio (>10(6)). A polymer solar cell (PSC) composed of Reg-PBDPPT and PC71BM exhibited power conversion efficiencies (PCE) of 5.24-5.45%, which were higher than those of the Ran-PBDPPT-based PSCs. The enhanced efficiency was supported by an increase in the short circuit current, which is strongly related to the unique internal crystalline morphology and pronounced nanophase segregation behavior in the blend films. These results obviously manifested that this synthetic strategy for regular conjugated terpolymers could be employed to control morphological properties to obtain high-performance PSCs. PMID:26645584

  5. Amphiphilic Diblock Terpolymer PMAgala-b-P(MAA-co-MAChol)s with Attached Galactose and Cholesterol Grafts and Their Intracellular pH-Responsive Doxorubicin Delivery.

    Wang, Zhao; Luo, Ting; Sheng, Ruilong; Li, Hui; Sun, Jingjing; Cao, Amin

    2016-01-11

    In this work, a series of diblock terpolymer poly(6-O-methacryloyl-D-galactopyranose)-b-poly(methacrylic acid-co-6-cholesteryloxy hexyl methacrylate) amphiphiles bearing attached galactose and cholesterol grafts denoted as the PMAgala-b-P(MAA-co-MAChol)s were designed and prepared, and these terpolymer amphiphiles were further exploited as a platform for intracellular doxorubicin (DOX) delivery. First, employing a sequential RAFT strategy with preliminarily synthesized poly(6-O-methacryloyl-1,2:3,4-di-O-isopropylidene-d-galactopyranose) (PMAIpGP) macro-RAFT initiator and a successive trifluoroacetic acid (TFA)-mediated deprotection, a series of amphiphilic diblock terpolymer PMAgala-b-P(MAA-co-MAChol)s were prepared, and were further characterized by NMR, Fourier transform infrared spectrometer (FTIR), gel permeation chromatography (GPC), differential scanning calorimetry (DSC), and a dynamic contact angle testing instrument (DCAT). In aqueous media, spontaneous micellization of the synthesized diblock terpolymer amphiphiles were continuously examined by critical micellization concentration assay, dynamic light scattering (DLS), and transmission electron microscopy (TEM), and the efficacies of DOX loading by these copolymer micelles were investigated along with the complexed nanoparticle stability. Furthermore, in vitro DOX release of the drug-loaded terpolymer micelles were studied at 37 °C in buffer under various pH conditions, and cell toxicities of as-synthesized diblock amphiphiles were examined by MTT assay. Finally, with H1299 cells, intracellular DOX delivery and localization by the block amphiphile vectors were investigated by invert fluorescence microscopy. As a result, it was revealed that the random copolymerization of MAA and MAChol comonomers in the second block limited the formation of cholesterol liquid-crystal phase and enhanced DOX loading efficiency and complex nanoparticle stability, that ionic interactions between the DOX and MAA comonomer

  6. Sequential polymerization of ethylene oxide, ε-caprolactone and l-lactide: A one-pot metal-free route to tri- and pentablock terpolymers

    Zhao, Junpeng

    2014-01-01

    Metal-free polymerization of ethylene oxide (EO) catalyzed by a relatively mild phosphazene base (t-BuP2) was proven feasible, which enabled the one-pot sequential polymerization of EO, ε-caprolactone, and l-lactide. Using either 3-phenyl-1-propanol or water as an initiator, the corresponding triblock or pentablock terpolymers were easily prepared. © 2014 the Partner Organisations.

  7. Novel thermo-responsive double-hydrophilic and hydrophobic MPEO-b-PEtOx-b-PCL triblock terpolymers: synthesis, characterization and self-assembly studies

    Petrova, Svetlana; Venturini, Cristina Garcia; Jäger, Alessandro; Jäger, Eliezer; Černoch, Peter; Kereiche, S.; Kováčik, L.; Raška, I.; Štěpánek, Petr

    2015-01-01

    Roč. 59, 24 February (2015), s. 215-225. ISSN 0032-3861 R&D Projects: GA ČR GAP208/10/1600; GA MŠk(CZ) 7F14009 Institutional support: RVO:61389013 Keywords : MPEO-b-PEtOx-b-PCL triblock terpolymers * light-scattering * thermo-responsive nanoparticles Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.562, year: 2014

  8. Supramolecular self-assembly of novel thermo-responsive double-hydrophilic and hydrophobic Y-shaped [MPEO-b-PEtOx-b-(PCL)2] terpolymers

    Petrova, Svetlana; Venturini, Cristina Garcia; Jäger, Alessandro; Jäger, Eliezer; Hrubý, Martin; Pavlova, Ewa; Štěpánek, Petr

    2015-01-01

    Roč. 5, č. 77 (2015), s. 62844-62854. ISSN 2046-2069 R&D Projects: GA MŠk(CZ) LH14079; GA MŠk(CZ) 7F14009 Institutional support: RVO:61389013 Keywords : Y-shaped [PEO-b-PEtOx-b-(PCL)2] terpolymers * light scattering * nanoparticles Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.840, year: 2014

  9. Redução e substituição do ácido crômico na etapa de condicionamento de ABS para metalização Reduction and replacement of chromic acid in step-conditioning of ABS for metallization

    Ana Paula Kurek

    2009-01-01

    Full Text Available Na etapa de condicionamento de peças em acrilonitrila-butadieno-estireno (ABS, geralmente, são empregadas soluções sulfocrômicas, resultando na geração de efluentes altamente tóxicos e ambientalmente poluentes. Este trabalho apresenta resultados do estudo do emprego de soluções condicionantes visando à redução e substituição do ácido crômico. O condicionamento das amostras foi realizado em banhos contendo soluções de ácido crômico e ácido sulfúrico, permanganato de potássio e ácido fosfórico, e ácido sulfúrico, ácido fosfórico e dicromato de potássio, variando-se concentração, tempo de imersão e temperatura. A morfologia e estrutura da superfície das amostras foram analisadas por microscopia eletrônica de varredura (MEV, rugosidade e espectroscopia no infravermelho (FITR/ATR e a qualidade da adesão metálica após cromagem foi avaliada por inspeção visual, testes de adesão e de corrosão por exposição à névoa salina. Os resultados mostraram que o condicionamento químico ocasionou remoção dos componentes do ABS na superfície das amostras, provocando modificações como rugosidade e formação de poros, cavidades e reentrâncias, que influenciaram na adesão e foram dependentes da solução e das condições empregadas. O ácido crômico pode ser empregado em concentrações menores que a solução padrão (400 g.L-1 e soluções isentas deste foram eficientes na modificação da superfície e adesão metálica.In step-conditioning (etching of acrylonitrile-butadiene-styrene (ABS terpolymer, use is generally made of sulfuric/chromic acid solutions resulting in the generation of highly toxic, environmentally polluting waste. The present work reports the results of a study of reduction and replacement of chromic acid from the etching solution. The samples conditioning was carried out in baths containing solutions of chromic and sulfuric acids, potassium permanganate and phosphoric acid, and sulfuric

  10. Filled Ethylene-propylene Diene Terpolymer Elastomer as ThermalInsulator for Case-bonded Solid Rocket Motors

    C. M. Bhuvaneswari

    2008-01-01

    Full Text Available Ethylene-propylene diene terpolymer (EPDM-based insulation system is being globallyused for case-bonded solid rocket motors. A study was undertaken using EPDM as base polymer,blended with hypalon and liquid EPDM and filled with fibrous and non-fibrous fillers. Theseformulations were evaluated as rocket motor insulation system. The basic objective of the studywas to develop an insulation system based on EPDM for case-bonded applications. A series ofrocket motor insulator compositions based on EPDM, filled with particulate and fibrous fillerslike precipitated silica, fumed silica, aramid, and carbon fibres have been studied for mechanical,rheological, thermal, and interface properties. Compositions based on particulate fillers wereoptimised for the filler content. Comparatively, fumed silica was found to be superior as fillerin terms of mechanical and interface properties. Addition of fibrous filler (5 parts improved thepeel strength, and reduced the thermal conductivity and erosion rate. All the compositions wereevaluated for sulphur and peroxide curing. Superior mechanical properties were achieved forsulphur-cured products, whereas peroxide-cured products exhibited an excellent ageing resistance.Rocket motors were insulated with optimised composition and propellant cast, and the motorswere evaluated by conducting static test in end-burning mode.Defence Science Journal, 2008, 58(1, pp.94-102, DOI : http://dx.doi.org/10.14429/dsj.58.1628

  11. Verdivurdering av SAS AB

    Gangås, Silje Garberg

    2013-01-01

    Formålet med denne mastergradsavhandlingen har vært å beregne den teoretiske verdien på det børsnoterte selskapet SAS AB og på bakgrunn av denne gi en handlingsanbefaling på selskapets aksje. Forskningsspørsmålet for oppgaven er utledet som følger: ”Hva er verdien av SAS AB?” SAS AB er inne i en fundamental omstillingsprosses hvor den nye strategien, 4XNG, ble presentert og påbegynt november 2012. Omstillingsprosessen innebærer blant annet en omfattende omstrukturering i organisasjonen ...

  12. ABS 415 Course Tutorial / tutorialrank

    welcome1257

    2015-01-01

                     For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 4 Times, Rating: A+   ASHFORD ABS 415 Week 1 DQ 1Discovering Strengths in Leadership ASHFORD ABS 415 Week 1 DQ 2 Ethical Leadership ASHFORD ABS 415 Week 2 DQ 1 Developing Emotional Intelligence in Leadership ASHFORD ABS 415 Week 2 DQ 2 Elements of Emotional Intelligence in Leadership ASHFORD ABS 415 Week 3 DQ 1 Motivational...

  13. Well-defined polyethylene-based graft terpolymers by combining nitroxide-mediated radical polymerization, polyhomologation and azide/alkyne “click” chemistry†

    Alkayal, Nazeeha

    2016-03-30

    Novel well–defined polyethylene–based graft terpolymers were synthesized via the “grafting onto” strategy by combining nitroxide-mediated radical polymerization (NMP), polyhomologation and copper (I)-catalyzed azide-alkyne cycloaddition (CuAAC) “click” chemistry. Three steps were involved in this approach: (i) synthesis of alkyne-terminated polyethylene-b-poly(ε-caprolactone) (PE-b-PCL-alkyne) block copolymers (branches) by esterification of PE-b-PCL-OH with 4-pentynoic acid; the PE-b-PCL-OH was obtained by polyhomologation of dimethylsulfoxonium methylide to afford PE-OH, followed by ring opening polymerization of ε-caprolactone using the PE-OH as macroinitiator, (ii) synthesis of random copolymers of styrene (St) and 4-chloromethylstyrene (4-CMS) with various CMS contents, by nitroxide-mediated radical copolymerization (NMP), and conversion of chloride to azide groups by reaction with sodium azide (NaN3) (backbone) and (iii) “click” linking reaction to afford the PE-based graft terpolymers. All intermediates and final products were characterized by high-temperature size exclusion chromatography (HT-SEC), Fourier transform infrared spectroscopy (FTIR), proton nuclear magnetic resonance spectroscopy (1H NMR) and differential scanning calorimetry (DSC).

  14. Triblock-Terpolymer-Directed Self-Assembly of Mesoporous TiO2: High-Performance Photoanodes for Solid-State Dye-Sensitized Solar Cells

    Docampo, Pablo

    2012-04-30

    A new self-assembly platform for the fast and straightforward synthesis of bicontinuous, mesoporous TiO 2 films is presented, based on the triblock terpolymer poly(isoprene - b - styrene - b - ethylene oxide). This new materials route allows the co-assembly of the metal oxide as a fully interconnected minority phase, which results in a highly porous photoanode with strong advantages over the state-of-the-art nanoparticle-based photoanodes employed in solidstate dye-sensitized solar cells. Devices fabricated through this triblock terpolymer route exhibit a high availability of sub-bandgap states distributed in a narrow and low enough energy band, which maximizes photoinduced charge generation from a state-of-the-art organic dye, C220. As a consequence, the co-assembled mesoporous metal oxide system outperformed the conventional nanoparticle-based electrodes fabricated and tested under the same conditions, exhibiting solar power-conversion efficiencies of over 5%. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Estudo da adsorção de hidrogênio e sulfeto na superfície de paládio: aspectos experimentais (eletroquímica) e teóricos (ab initio e Teoria do Funcional da Densidade)

    Ângelo Antônio Carlos D.; Souza Aguinaldo R. de; Morgon Nelson H.; Sambrano Júlio R.

    2001-01-01

    The adsorption of H and S2- species on Pd (100) has been studied with ab initio, density-functional calculations and electrochemical methods. A cluster of five Pd atoms with a frozen geometry described the surface. The computational calculations were performed through the GAUSSIAN94 program, and the basis functions adapted to a pseudo-potential obtained by using the Generator Coordinate Method adapted to the this program. Using the cyclic voltammetry technique through a Model 283 Potentiostat...

  16. um estudo de caso

    Costa, Cátia Filipa Pereira da

    2011-01-01

    Dissertação apresentada à Universidade Fernando Pessoa como parte dos requisitos para obtenção do grau de Mestre em Psicologia Jurídica As situações de abuso sexual de crianças nas quais o perpetrador pertence ao sexo feminino obtiveram ao longo dos últimos anos um acrescido reconhecimento por parte da comunidade científica, evidenciado pelo significativo incremento das investigações no âmbito desta temática consistindo na sua maioria estudos de caso. Um conjunto de particularidades encont...

  17. The AB Staff Plan

    Boillot, J; Delahaye, J P; Myers, S; CERN. Geneva. AB Department

    2003-01-01

    The present report summarises the staff plan of the newly created Accelerators and Beams (AB) Division following the restructuring of the Accelerator Sector and covering the period 2003 to 2010. It underlines the refocusing of the staff on priority work, especially the LHC Project and is coherent with the recently adopted CERN Long Term Plan (LTP). It compares the requested and available manpower (both staff and industrial support) for each Project, Programme and Activity (PPA) split in work packages and highlights the missing manpower for each category of personnel.

  18. AB Manpower Plan 2007

    Myers, Stephen

    2007-01-01

    The present exercise is not as such a "manpower plan" but a purely budgetary comparison of known plus requested resources with the known commitments over the period 2007-2012. From a purely budgetary point of view, AB will have the capacity to maintain all those recently hired staff who fulfill the criteria for long term employment at CERN. Following this budgetary exercise, AB proposes to perform a CERN-wide staff work plan so as to compare the manpower available to the quantity of work to be done in the totality of the work-packages. If there is a significant mismatch between these two quantities then we propose the following measures which would create personnel economies and allow us to redress the mismatch by increased recruitment: a new job severance scheme; CERN restructuring; use of the new CERN-ITER agreement; more flexibility in transfers from Materials to Personnel budgets. Failing this a re-examination of possible closure of lower priority facilities may be needed.

  19. Macromolecular Engineering: New Routes Towards the Synthesis of Well-??Defined Polyethers/Polyesters Co/Terpolymers with Different Architectures

    Alamri, Haleema

    2016-05-18

    The primary objective of this research was to develop a new and efficient pathway for well-defined multicomponent homo/co/terpolymers of cyclic esters/ethers using an organocatalytic approach with an emphasis on the macromolecular engineering aspects of the overall synthesis. Macromolecular engineering (as discussed in the first chapter) of homo/copolymers refers to the specific tailoring of these materials for achieving an easy and reproducible synthesis that results in precise molecular characteristics, i.e. molecular weight and polydispersity, as well as specific structure and end?group choices. Precise control of these molecular characteristics will provide access to new materials that can be used for pre-targeted purposes such as biomedical applications. Among the most commonly used engineering materials are polyesters (biocompatible and biodegradable) and polyethers (biocompatible), either as homopolymers or when or copolymers with linear structures. The ability to create non-linear structures, for example stars, will open new horizons in the applications of these important polymeric materials. The second part of this thesis describes the synthesis of aliphatic polyesters, particularly polycaprolactone and polylactide, using a metal-free initiator/catalyst system. A phosphazene base (t?BuP2) was used as the catalyst for the ring-opening copolymerization of ?-aprolactone (??CL) and L,Lactide (LLA) at room temperature with a variety of protic initiators in different solvents. These studies provided important information for the design of a metal-free route toward the synthesis of polyester?based (bio) materials. The third part of the thesis describes a novel route for the one?pot synthesis of polyether-b polyester block copolymers with either a linear or a specific macromolecular architecture. Poly (styrene oxide)?b?poly(caprolactone)?b?poly(L,lactide) was prepared using this method with the goal of synthesizing poly(styrene oxide)-based materials since this

  20. Estudo da adsorção de hidrogênio e sulfeto na superfície de paládio: aspectos experimentais (eletroquímica e teóricos (ab initio e Teoria do Funcional da Densidade

    Ângelo Antônio Carlos D.

    2001-01-01

    Full Text Available The adsorption of H and S2- species on Pd (100 has been studied with ab initio, density-functional calculations and electrochemical methods. A cluster of five Pd atoms with a frozen geometry described the surface. The computational calculations were performed through the GAUSSIAN94 program, and the basis functions adapted to a pseudo-potential obtained by using the Generator Coordinate Method adapted to the this program. Using the cyclic voltammetry technique through a Model 283 Potentiostat/Galvanostat E.G.&G-PAR obtained the electrochemical results. The calculated chemisorption geometry has a Pd-H distance of 1.55Å, and the potential energy surface was calculated using the Becke3P86//(GCM/DFT/SBK methodology. The adsorption of S2- ions on Pd surface obtained both through comparison between the experimental and theoretical results, at MP2 level, suggest a S2- absorption into the metallic cluster. The produced Pd-(S2- system was show to be very stable under the employed experimental conditions. The paper has shows the powerful aid of computational methods to interpret adsorption experimental data.

  1. ABS 415 ASH Course Tutorial / Tutorialrank

    charles

    2015-01-01

    For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 4 Times, Rating: A+   ASHFORD ABS 415 Week 1 DQ 1Discovering Strengths in Leadership ASHFORD ABS 415 Week 1 DQ 2 Ethical Leadership ASHFORD ABS 415 Week 2 DQ 1 Developing Emotional Intelligence in Leadership ASHFORD ABS 415 Week 2 DQ 2 Elements of Emotional Intelligence in Leadership ASHFORD ABS 415 Week 3 DQ 1 Motivational Techniques ASHFORD ABS 415 Week 3 DQ 2 Leadership in a Cr...

  2. Controlling Solution Self-assembly and Non-Solvent Induced Microphase Separation of Triblock Terpolymers to Generate Nanofiltration Membranes with Chemically-Tailored Pore Walls

    Boudouris, Bryan; Mulvenna, Ryan; Weidman, Jacob; Phillip, William

    2014-03-01

    Block polymer-based templates have been utilized in a number of membrane applications; however, there has yet to be a demonstration of a nanoporous block polymer thin film that can achieve high flux and high selectivity simultaneously while also allowing for the facile tuning of the pore wall chemistry. Here, we demonstrate that by synthesizing and controlling the solution self-assembly of a triblock terpolymer, polyisoprene- b-polystyrene- b-poly(N, N-dimethylacrylamide) (PI-PS-PDMA), and precisely inducing non-solvent induced phase separation during the self-assembly process allows for the creation of an asymmetric nanoporous membrane with PDMA-lined pore walls. This PDMA functionality is then converted to any number of side chain functionalities through simple chemistry in the solid state. In this way, we are able to show a highly selectivity membrane that can separate analytes of interest based both on size and chemical composition at a high solution flux. In fact, this high fidelity structure has a very narrow distribution of pore sizes (500 cm2) . This has allowed for the separation of particles with hydrodynamic radii as low as 0.8 nm, which is the smallest separation achieved using a block polymer-based membrane to date.

  3. Water-base acrylic terpolymer as a corrosion inhibitor for SAE1018 in simulated sour petroleum solution in stagnant and hydrodynamic conditions

    Highlights: ► Corrosion inhibition of a water-base copolymer, ATP, was studied. ► Efficiency more than 90% was obtained with 0.8 mmol/L ATP in 2000 rpm. ► ATP obeys Langmuir isotherm in static and hydrodynamic conditions. ► With the presence of ATP, OM images showed a decrease in surface attack. - Abstract: The effect of static and hydrodynamic conditions (0–2000 rpm) on corrosion inhibition of a water-base acrylic terpolymer (ATP), methyl methacrylate/butyl acrylate/acrylic acid, for SAE1018 steel in simulated sour petroleum corrosive solution (NACE 1D196) were investigated by AC/DC electrochemical tests. Increase in rotation speed accelerates the corrosion rate; however the corrosion inhibitor efficiency increases. This was attributed to the enhanced mass transport of inhibitor molecules to the metal surface. OM examinations also demonstrate that in presence of ATP, a decrease in corrosion attacks is observed. Thermodynamic calculations also showed that ATP obeys Langmuir adsorption isotherm and adsorbs chemically into the surface.

  4. Increasing the Mechanical Strength of Block Polymer Ion Gels Through the Stepwise Self-Assembly of a Thermoresponsive ABC Triblock Terpolymer

    Hall, Cecilia; Zhou, Can; Danielsen, Scott; Lodge, Timothy

    Blends of network-forming block polymers and ionic liquids have remarkable potential for solid electrolytes, as they allow the combination of desirable mechanical and electrical properties. While ABA triblock copolymers have successfully been implemented as the network component of ion gels, these networks contain looped defects, where the endblocks of the polymer loop back into the same spherical core instead of forming a bridge between two cores. We demonstrate that the ABC triblock terpolymer poly(ethylene-alt-propylene)-block-poly(ethylene oxide)-block-poly(N-isopropylacrylamide) (PEP-b-PEO-b-PNIPAm) in the ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide forms a thermoreversible gel network with negligible looping defects. PEP-core micelles exist at all temperatures, while cooling causes association of the PNIPAm micelle corona to form a bridging network. Small-angle x-ray scattering and dynamic light scattering were used to characterize the high-temperature micelles. These gels show enhanced mechanical properties and the ability to form gels at lower concentrations than the corresponding thermoresponsive ABA triblock copolymers.

  5. Teologia e estudo das escrituras

    Rabuske, Irineu J.

    2007-01-01

    Full Text Available A revalorização da sagrada escritura, no âmbito da Igreja Católica, enseja uma reflexão sobre a relação entre a teologia e o estudo das sagradas escrituras. Ponto de partida para esta reflexão é o nº 24 do documento Dei Verbum, no Concílio Ecumênico Vaticano II: ". . . o estudo das Sagradas Escrituras seja como que a alma da Sagrada Teologia".

  6. Clinical significance of combined detection of multiple serum antibodies (AsAb, EmAb, AcAb, AoAb, ToxAb) in infertile women

    Objective: To determine the clinical significance of combined detection of multiple serum antibodies in infertile women. Methods; Serum multiple antibodies were examined in 120 infertile women, including 88 failed to get pregnancy and 32 with repeated spontaneous abortion. The antibodies tested were: (1) anti-sperm antibody (AsAb) (2) endometrial antibody (EmAb) (3) anti-cardiophospholipid antibody (AcAb) (4) Anti-ovarian antibody (AoAb) and Toxoplasmosis antibody (ToxAb). Results: In 48 of the infertile women, none of the five antibodies were positive (40% of 120). The rest were: one antibody positive--38/120 or 31.6%; two antibodies positive--31/120 or 25.83%, three and four antibodies positive--4/120 or 3.33%. None of the women were positive with all five antibodies. Conclusion: Immune factor was the chief cause of infertility in women. (authors)

  7. Equity valuation : Atlas Copco AB

    Santos, Ricardo Manuel Castro Lopes Alba

    2016-01-01

    This Dissertation presents a literature review of some of the most appraised theories on equity valuation models. A thoughtful analysis is made, presenting the main advantages and restrictions of each model and setting the path for a discussion about improvements to be made on this field of study. A practical implementation follows, proposing a fair value estimation of Atlas Copco AB shares. Atlas Copco is a Swedish-based capital goods company, operating across four differen...

  8. AB Levitator and Electricity Storage

    Bolonkin, Alexander

    2007-01-01

    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative...

  9. AB Levitator and Electricity Storage

    Bolonkin, A

    2007-01-01

    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative weight ratio of this engine is 0.01 - 0.1 (from thrust). For some types of AB engine (toroidal form) the thrust easily may be changed in any direction without turning of engine. The author computed many projects using different versions of offered AB engine: small device for levitation-flight of a human (including flight from Earth to Outer Space), fly VTOL car (track), big VTOL aircrat, suspended low altitude stationary satellite, powerful Space Shuttle-like booster for travel to the Moon and Mars without spending energ...

  10. Thermonuclear Reflect AB-Reactor

    Bolonkin, Alexander

    2008-01-01

    The author offers a new kind of thermonuclear reflect reactor. The remarkable feature of this new reactor is a three net AB reflector, which confines the high temperature plasma. The plasma loses part of its energy when it contacts with the net but this loss can be compensated by an additional permanent plasma heating. When the plasma is rarefied (has a small density), the heat flow to the AB reflector is not large and the temperature in the triple reflector net is lower than 2000 - 3000 K. This offered AB-reactor has significantly less power then the currently contemplated power reactors with magnetic or inertial confinement (hundreds-thousands of kW, not millions of kW). But it is enough for many vehicles and ships and particularly valuable for tunnelers, subs and space apparatus, where air to burn chemical fuel is at a premium or simply not available. The author has made a number of innovations in this reactor, researched its theory, developed methods of computation, made a sample computation of typical pr...

  11. Estudo multicasos sobre atividades inovativas

    Sonia Regina Hierro Parolin

    2013-09-01

    Full Text Available Em estudos sobre competitividade argumenta-se que as empresas necessitam de estratégias baseadas em inovações e de capacidades internas em constantes e intensas transformações, não somente nos padrões tecnológicos, mas também no encadeamento do processo de gestão das atividades inovativas, como processos dinâmicos, não lineares e diversificados, em função de múltiplos fatores dos ambientes interno e externo. Para contribuir com essas discussões, neste artigo apresenta-se um estudo multicasos em quatro indústrias de médio e grande portes, de segmentos, densidades tecnológicas e históricos com inovações diferentes entre si. Como principais resultados, salientam-se o encadeamento das atividades inovativas como parte de uma estratégia organizacional para obter resultados com inovação e a afluência de todas as pessoas, e não somente as alocadas em pesquisa e desenvolvimento, para o cumprimento dessa estratégia.

  12. ABS: Sequence alignment by scanning

    Bonny, Mohamed Talal

    2011-08-01

    Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  13. AP calculus AB/BC

    Schwartz, Stu

    2013-01-01

    All Access for the AP® Calculus AB & BC Exams Book + Web + Mobile Everything you need to prepare for the Advanced Placement® exam, in a study system built around you! There are many different ways to prepare for an Advanced Placement® exam. What's best for you depends on how much time you have to study and how comfortable you are with the subject matter. To score your highest, you need a system that can be customized to fit you: your schedule, your learning style, and your current level of knowledge. This book, and the free online tools that come with it, will help you personalize your AP® Cal

  14. Biosynthesis of P(3HB-co-3HV-co-3HHp terpolymer by Cupriavidus necator PHB-4 transformant harboring the highly active PHA synthase gene of Chromobacterium sp. USM2

    Rathi, D-N.

    2013-01-01

    Full Text Available Aims: This study evaluates potentials of Cupriavidus necator PHB4 transformant harboring the highly activepolyhydroxyalkanoate synthase gene (phaC of a locally isolated Chromobacterium sp. USM2 for its ability toincorporate 3-hydroxyheptanoate (3HHp monomer.Methodology and results: A mixture of fructose and sodium heptanoate fed to the culture gave rise to poly(3-hydroxybutyrate-co-3-hydroxyvalerate-co-3-hydroxyheptanoate, [P(3HB-co-3HV-co-3HHp] terpolymer synthesis, withtraces of 3HHp monomers confirmed through gas chromatography (GC, proton (1H and carbon (13C NMR spectra.Conclusion, significance and impact of study: This study has revealed that the PHA synthase of Chromobacteriumsp. USM2 has a broad range of substrate specificity. The synthase is able to polymerize 3-hydroxyalkanoate monomershaving 4–7 carbon atoms.

  15. Genetic control of immune responses in vitro. VI. Experimental conditions for the development of helper T-cell activity specific for the terpolymer L-glutamic acid60-L-alanine30-L-tyrosine10 (GAT) in nonresponder mice

    Mice which are genetic nonresponders to the random terpolymer of L-glutamic acid60-L-alanine30-L-tyrosine10 (GAT) not only fail to develop GAT-specific antibody responses when stimulated with soluble GAT either in vivo or in vitro, but develop GAT-specific T cells which suppress the GAT-specific plaque-forming cell response of normal nonresponder mice stimulated with GAT complexed to methylated bovine serum albumin (MBSA). Thus, both responder and nonresponder mice have T cells which recognize GAT. However, nonresponder mice can develop GAT-specific helper T cells if immunized with GAT bound to MBSA or to macrophages. The relevance of Ir gene-controlled responses is discussed

  16. 腈纶皂化制备电流变液悬浮粒子的研究%Studies on Saponification of Acrylonitrile Terpolymer for Suspending Particles of Electrorheological Fluids

    吴孟强; 陈艾

    2001-01-01

    In order to prepare suspending particles for electrorheological fluids, hetergeneous hydrolysis of acrylonitrile terpolymer is conducted in presence of saponifying agent(sodium hydroxide) in this paper. The effects of the saponification conditions such as the amount of added sodium hydroxide, time duration and temperature on the degree of saponification are studied in detail. Meanwhile, the conversion of nitrile groups is discussed with the result that the saponification of nitrile groups of the terpolymer initially yields amide groups, then slows down to carboxylic groups. The research sets a way for the preparation of dispersing particles of water-free electrorheological fluids tentatively used for controlling light transmittance.%为了制备无水电流变液用悬浮粒子,研究了腈纶在碱性条件下的多相水解。详细考察了皂化试剂氢氧化钾的用量,皂化时间和温度等皂化条件对皂化程度的影响; 讨论了氰基转化过程。研究结果表明,在皂化初期,腈纶分子链上的氰基转化为酰胺基,然后缓慢转化为羧基。给出了一条制备无水电流变液用悬浮粒子的方法,并初步考察了该类电流变液的控光特性。

  17. Ab-Initio Molecular Dynamics

    Kühne, Thomas D

    2012-01-01

    Computer simulations and molecular dynamics in particular, is a very powerful method to provide detailed and essentially exact informations of classical many-body problems. With the advent of \\textit{ab-initio} molecular dynamics, where the forces are computed on-the-fly by accurate electronic structure calculations, the scope of either method has been greatly extended. This new approach, which unifies Newton's and Schr\\"odinger's equations, allows for complex simulations without relying on any adjustable parameter. This review is intended to outline the basic principles as well as a survey of the field. Beginning with the derivation of Born-Oppenheimer molecular dynamics, the Car-Parrinello method as well as novel hybrid scheme that unifies best of either approach are discussed. The predictive power is demonstrated by a series of applications ranging from insulators to semiconductors and even metals in condensed phases.

  18. Avaliação da degradação térmica e fotooxidativa do ABS para fins de reciclagem Evaluation of thermal and photo-oxidative ABS degradation with recycling purposes

    Elisabete Maria Saraiva Sanchez

    2003-07-01

    Full Text Available Este trabalho tem como objetivo avaliar a degradação térmica e fotooxidativa do terpolímero poli (acrilonitrila-butadieno-estireno, ABS, utilizado em componentes internos de automóveis. Corpos de prova de ABS moldados por injeção foram submetidos ao envelhecimento térmico, segundo a norma ASTM D794, e ao envelhecimento fotooxidativo segundo as normas ASTM G24 e G53. As amostras envelhecidas foram submetidas às análises dinâmico-mecânica, e microscópicas por microscopia de força atômica no modo não contato. Os resultados mostraram que as transições, tanto da fase vítrea quanto da fase elastomérica na superfície do ABS, são afetadas pela degradação. As áreas dos picos das curvas de módulo de perda em função da temperatura relativos às transições vítreas do ABS foram correlacionadas ao alongamento na ruptura, em função do tempo e tipo de envelhecimento. As propriedades mecânicas são influenciadas de forma mais acentuada pela extensão da degradação da matriz. O método de envelhecimento ASTM G24 mostrou-se mais agressivo que o G53, seja para a fase BR ou para a fase SAN. As imagens microscópicas mostraram que os diferentes envelhecimentos provocaram diferentes variações na rugosidade das superfícies. Amostras fotooxidadas, com perda de alongamento maior que 50%, foram reprocessadas e mostraram uma recuperação superior a 90% nessa propriedade.The aim of this work is the evaluation of thermal and photo-oxidative degradation of the terpolymer acrylonitrile-butadiene-styrene, ABS, used in internal automotive components. Injection molded specimens were aged by ASTM D794, ASTM G24 and ASTM G53 standards. The aged test specimens were studied by means of dynamic mechanical analysis and non-contact atomic force microscopy. The results revealed that the transitions of the glass and rubber phases were affected by the degradation. The area under linear loss modulus-temperature curves was related to tensile properties

  19. GINGA Observations of AB Doradus

    Vilhu, O.; Tsuru, T.; Collier Cameron, A.

    We report GINGA observations of the pre main sequence star AB Doradus (HD 36705), performed during 8 - 12 January, 1990. Some rotational modulation might be present. four X-ray flares were detected. Three of these events were similar to the EINSTEIN HRI-flare (Vilhu and Linsky, 1987), with decay times around 25 min. The last flare had long rise and decay times (100 min), resembling the EXOSAT flares observed by Collier Cameron et.al. (1988). The mean flare spectrum can be fitted by a thermal bremstrahlung with temperature 5.0 keV, or by a power-law model with photon index 2.2. The 3 upper limit of the Iron line equivalent width in the flare spectrum is 1 keV, weaker than predicted by thermal models. This Iron line anomaly was first discussed in the case of UX Ari by Tsuru et. al. (1989). However, normal equivalent widths can be derived from several EXOSAT spectra of active cool stars (Pallavicini and Tagliaferri, 1990). We discuss the possibility that the continuum from non-thermal electrons (producing also the microwave emission) could occasionally lower the apparent equivalent width. The mechanism works for reasonably low magnetic field strengths and electon power-law indexes. However, a large population of non-thermal electrons is needed (comparable to the thermal one). Stronger magnetic fields could explain the radio emission with less electrons, but then the non-thermal X-ray continuum remains small.

  20. AP calculus AB & BC crash course

    Rosebush, J

    2012-01-01

    AP Calculus AB & BC Crash Course - Gets You a Higher Advanced Placement Score in Less Time Crash Course is perfect for the time-crunched student, the last-minute studier, or anyone who wants a refresher on the subject. AP Calculus AB & BC Crash Course gives you: Targeted, Focused Review - Study Only What You Need to Know Crash Course is based on an in-depth analysis of the AP Calculus AB & BC course description outline and actual AP test questions. It covers only the information tested on the exams, so you can make the most of your valuable study time. Written by experienced math teachers, our

  1. Main: DREDR1ATRD29AB [PLACE

    Full Text Available DREDR1ATRD29AB S000152 23-June-2006 (last modified) kehi Related to responsiveness ...dependent in the ABA-responsive expression of the rd29A in Arabidopsis; DRE; drought; water stress; oxidativ

  2. Tumor estromal gastrointestinal: estudo de oito casos

    Amico Enio Campos; Coimbra Cesar Wilson Bastos; Bugalho Luiz Antônio; Nai Gisele Alborghetti; Matos Ricardo Marcondes; Machado Cibele Chuery; Silva Fabrício Colacino

    2006-01-01

    OBJETIVO: O diagnóstico e tratamento dos tumores estromais gastrointestinais (TEGI) têm evoluído a partir de estudos recentes de genética e biologia molecular. Tais avanços têm refletido em melhor sobrevivência dos doentes. MÉTODOS: Foi realizado estudo retrospectivo no período de novembro/1998 a julho/2004, em instituição universitária e em clínica privada dos autores, que identificou portadores de TEGI a partir de positividade para c-kit (CD 117), ao exame imunoistoquímico. RESULTADOS: Dos ...

  3. Do buzz ao marketing viral : um estudo

    Viveiros, Nuno Filipe Carvalho

    2015-01-01

    Dissertação de Mestrado em Gestão de Empresas/MBA. Com o crescente ênfase do marketing viral e das redes sociais na divulgação de produtos, serviços e marcas, o seu estudo torna-se pertinente para o desenvolvimento de campanhas mais eficazes e eficientes. Esta tese apresenta um estudo centralizado sobre o impacto que um país tem na criação de buzz de modo a tornar as campanhas de marketing, virais. Estudando e analisando três países (dois desenvolvidos e um em desenvolvimento), com o objet...

  4. Ab initio valence calculations in chemistry

    Cook, D B

    1974-01-01

    Ab Initio Valence Calculations in Chemistry describes the theory and practice of ab initio valence calculations in chemistry and applies the ideas to a specific example, linear BeH2. Topics covered include the Schrödinger equation and the orbital approximation to atomic orbitals; molecular orbital and valence bond methods; practical molecular wave functions; and molecular integrals. Open shell systems, molecular symmetry, and localized descriptions of electronic structure are also discussed. This book is comprised of 13 chapters and begins by introducing the reader to the use of the Schrödinge

  5. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    Souto, F.J.; Haskin, F.E. [Univ. of New Mexico, Albuquerque, NM (United States). Dept. of Chemical and Nuclear Engineering; Kmetyk, L.N. [Sandia National Labs., Albuquerque, NM (United States)

    1994-10-01

    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS.

  6. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS

  7. Study of processing conditions on properties of ABS and clay organically modified nanocomposites; Estudo das condicoes de processamento nas propriedades de nanocompositos de ABS e argilas organofilicas

    Galvan, Danieli; Massucato, Felipe; Bartoli, Julio R., E-mail: bartoli@feq.unicamp.br [Fac. de Engenharia Quimica/Universidade Estadual de Campinas - DTP/FEQ/UNICAMP, Campinas, SP (Brazil); D' Avila, Marcos A. [Fac. de Engenharia Mecanica/Universidade Estadual de Campinas - DEMA/FEM/UNICAMP, Campinas, SP (Brazil); Fernandes, Elizabeth G. [Tezca P and D Celulas Solares, Campinas, SP (Brazil)

    2011-07-01

    Nanocomposites of poly(acrylonitrile-butadiene-styrene) and organically modified montmorillonite clay were prepared by melt intercalation on a co-rotating twin-screw extruder. The independent variables studied were the kind of organoclay (Cloisite 20A and Cloisite 30B) and the screw torque at levels of 45 and 70%. The effect of these variables on the intercalation/exfoliation were accessed by means of the morphological characteristics using X-ray diffraction and the mechanical properties of uniaxial tensile test. The experimental results showed that the incorporation of clay in the polymeric matrix improved the mechanical properties of elastic modulus, yield stress and tensile strength of nanocomposites, being more significant for that containing Cloisite 30B. Torque was also a significant variable for the responses studied. (author)

  8. Improved age constraints for the AB Dor quadruple system - The binary nature of AB Dor B

    Janson, M; Lenzen, R; Close, L; Nielsen, E; Hartung, M; Henning, T; Bouy, H; Janson, Markus; Brandner, Wolfgang; Lenzen, Rainer; Close, Laird; Nielsen, Eric; Hartung, Markus; Henning, Thomas; Bouy, Herve

    2006-01-01

    We present resolved NACO photometry of the close binary AB Dor B in H- and Ks-band. AB Dor B is itself known to be a wide binary companion to AB Dor A, which in turn has a very low-mass close companion named AB Dor C. These four known components make up the young and dynamically interesting system AB Dor, which will likely become a benchmark system for calibrating theoretical pre-main sequence evolutionary mass tracks for low-mass stars. However, for this purpose the actual age has to be known, and this subject has been a matter of discussion in the recent scientific literature. We compare our resolved photometry of AB Dor Ba and Bb with theoretical and empirical isochrones in order to constrain the age of the system. This leads to an age estimate of about 50 to 100 Myr. We discuss the implications of such an age range for the case of AB Dor C, and compare with other results in the literature.

  9. Ab interno trabeculectomy: A comprehensive review

    Ting Ting Liu

    2013-07-01

    Full Text Available PURPOSE To summarize the original literature on ab interno trabeculectomy with the Trabectome system and to review its efficacy and safety in the treatment of glaucoma. METHOD A literature search in PubMed was performed on ab interno trabeculectomy with the Trabectome system, and clinical relevant information was reviewed and summarized. RESULTS Ab interno trabeculectomy with the Trabectome system on average lowered intraocular pressure (IOP to the mid-teens, and decreased the number of required glaucoma medications. Greater preoperative IOP correlated to a greater percent reduction in IOP. The success rates varied among studies, and the definition of success differed by authors. Intraoperative blood reflux was found in nearly all cases. Incidences of early hypotony and IOP spikes were low. No cases of endophthalmitis, wound leak, aqueous misdirection, choroidal hemorrhage or effusions, and irreversible visual acuity decrease (≥2 Snellen lines have been reported. Available studies had a significant amount of data overlap. Only limited data on long-term results was available. There was no randomized controlled trial to date. CONCLUSIONS Ab interno trabeculectomy with the Trabectome system is an effective and safe surgical approach for patients with various types of open angle glaucoma. On average, the procedure at least in the short term lowers IOP to the mid teens regardless of preoperative IOP with or without the aid of topical medications.

  10. Reference: DREDR1ATRD29AB [PLACE

    Full Text Available DREDR1ATRD29AB Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, N... ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant J. 34: 137-148 (2003) PubMed: 12694590; ...

  11. Preparation of national standard product of Anti-TgAb and Anti-TpoAb in our laboratory

    Objective: To standardize the China-made quantitative immunoassay kits of Anti-TgAb and Anti-TpoAb with a national standdized product of Anti-TgAb and And-TpoAb developed in our laboratory. Methods and Results: Higher titer Anti - TgAb and Anti-TpoAb serum specimens were pooled and treated with centrifuging and filtering, then freeze-dried and packaged into 2ml anpoules for preparing the national standard candidate. The results of the collaborative study showed that, the immuno-activity of the Anti-TgAb was 3916 IU/Amp in term of the 65/093, and the immuno-activity of the Anti-TpoAb was 434 IU/Amp in term of the 66/387. Conclusion: On the basis of the present study, it is proposed that the candidate standard be established as the National Standard for Anti-TgAb and Anti-TpoAb for immunoassay, the immunoactivity of the Anti-TgAb 4000IU/Amp, and that of Anti - TpoAb is 430IU/Amp. A comparative study on the quality of immunoassay kits of Anti-TgAb and Anti-TpoAb by Axsym System, Immulite 1000, Modular Analytics El70, ADVIA Centaur Assay (the most commonly used types in China) is also presented. (authors)

  12. On the Strain Rate Sensitivity of Abs and Abs Plus Fused Deposition Modeling Parts

    Vairis, A.; Petousis, M.; Vidakis, N.; Savvakis, K.

    2016-06-01

    In this work the effect of strain rate on the tensile strength of fused deposition modeling parts built with Acrylonitrile-butadiene-styrene (ABS) and ABS plus material is presented. ASTM D638-02a specimens were built with ABS and ABS plus and they were tested on a Schenck Trebel Co. tensile test machine at three different test speeds, equal, lower, and higher to the test speed required by the ASTM D638-02a standard. The experimental tensile strength results were compared and evaluated. The fracture surfaces of selected specimens were examined with a scanning electron microscope, to determine failure mode of the filament strands. It was found that, as the test speed increases, specimens develop higher tensile strength and have higher elastic modulus. Specimens tested in the highest speed of the experiment had on average about 10% higher elastic modulus and developed on average about 11% higher tensile strength.

  13. KINETIC ANALYSIS OF CO-CONDENSATION POLYMERIZATION OF AB2 AND AB MONOMERS

    Min-qiang Yu; Zhi-ping Zhou; De-yue Yan

    2004-01-01

    This work deals with the kinetics of co-condensation polymerization of AB2 and AB monomers, giving expressions of the two-dimensional molecular weight distribution function and the number/weight average molecular weights of the resulting copolymers. The two-dimensional molecular weight distribution depends on two indices, n and l, which are the respective numbers of AB2 and AB units in a copolymer species. The evolution of the two-dimensional weight and z distributions during the co-condensation polymerization has been evaluated systematically. Finally, the two-dimensional distribution was transformed into a one-dimensional molecular weight distribution with only one variable (the molecular weight of the products instead of the degree of polymerization). The calculated results show that the highly branched copolymer has a very broad molecular weight distribution when the co-condensation polymerization approaches completion.

  14. Leaching behaviour of the Swedish KBS-glasses ABS 39 and ABS 41

    The planned Swedish KBS glass corrosion investigation program comprises experiments with inactive glasses containing simulated waste, prolonged in-situ tests, the characterization of corrosion products, immiscibility studies, and corrosion experiments with hot glass. This presentation gives a short description of the entire program. It focuses thereafter on some recent leaching results with the inactive KBS glass qualities ABS 39 and ABS 41, which were leached in a manner similar to the PNL MCC-1 test procedure. 5 figures, 9 tables

  15. Thermomechanical properties of ABS/PA AND ABS/PC blends

    GUINAULT, Alain; Sollogoub, Cyrille

    2009-01-01

    International audience The significant increase of Waste Electric and Electronic Equipment (WEEE) has led to an important research in upgrading recycled engineering plastics by means of a blending technique. Classical twin-screw extrusion is compared to a new blending technique, where two polymers are combined together and then flow in several static mixers. This technique allows to obtain different morphologies of compatibilized ABS/PA or ABS/PC blends and the aim of this work is to evalu...

  16. AB077. Relationship of TPO-Ab and TSH with in vitro fertilization and embryo transfer

    Wang, Liyun

    2015-01-01

    Objective Study of thyroid peroxidase antibodies and thyroid stimulating effect on in vitro fertilization embryo transfer ending. Methods From March 2011 to October 2013 in the reproductive center in Qinghai Province People’s Hospital in vitro fertilization embryo transfer a total of 378 cycles were analyzed. (I) Basis for TPO-Ab grouping: research group is thyroid peroxidase antibody positive and thyroid function in patients with normal 69 cycles (TPO-Ab+ group), control group is thyroid per...

  17. Genetics Home Reference: GM2-gangliosidosis, AB variant

    ... of GM2-gangliosidosis, AB variant: Genetic Testing Registry: Tay-Sachs disease, variant AB These resources from MedlinePlus offer ... AB variant Activator Deficiency/GM2 Gangliosidosis Activator-deficient Tay-Sachs disease GM2 Activator Deficiency Disease GM2 gangliosidosis, type ...

  18. Investigation of high level of AsAb, EmAb in fertility female serum infected by chlamydia trachomatis

    Objective: To investigate the mechanism of chlamydia trachomatis. AsAb, EmAb in female fertility. Methods: LPS antigen of chlamydia in reproduction tract of fertility female was detected by monoclonal antibody and immunology chromatography; the content of AsAb, EmAb in serum of fertility female was detected by ELISA. Results: Infections rate of chlamydia trachomatis in fertility female was higher than that in the control AsAb, EmAb in serum of the fertility patients who were infected with chlamydia trachomatis showed a significant difference from that in the control group. Conclusion: The level of AsAb, EmAb increases in patients who have been infected with chlamydia trachomatis and these cytokines is involved in the course of female fertility

  19. Ab initio mass tensor molecular dynamics

    Tsuchida, Eiji

    2010-01-01

    Mass tensor molecular dynamics was first introduced by Bennett [J. Comput. Phys. 19, 267 (1975)] for efficient sampling of phase space through the use of generalized atomic masses. Here, we show how to apply this method to ab initio molecular dynamics simulations with minimal computational overhead. Test calculations on liquid water show a threefold reduction in computational effort without making the fixed geometry approximation. We also present a simple recipe for estimating the optimal ato...

  20. Discovering chemistry with an ab initio nanoreactor

    Wang, Lee-Ping; Titov, Alexey; McGibbon, Robert; Liu, Fang; Pande, Vijay S.; Martínez, Todd J.

    2014-01-01

    Chemical understanding is driven by the experimental discovery of new compounds and reactivity, and is supported by theory and computation that provides detailed physical insight. While theoretical and computational studies have generally focused on specific processes or mechanistic hypotheses, recent methodological and computational advances harken the advent of their principal role in discovery. Here we report the development and application of the ab initio nanoreactor – a highly accelerat...

  1. Ab initio vel ex eventu. II

    Thiessen, P. A.; Treder, H.-J.

    Jedes initium wird durch experimenta crucis zum eventus. Jedes theoretisch interpretierbare ex-eventu-Resultat führt auf ein neues Initium. Gerade dies ist die gemeinsame Aussage von Atomistik, Quantenmechanik und Relativitätstheorie.Translated AbstractAb initio vel ex eventu. IIEvery initium becomes an eventus by experimenta crucis. Every theoretically interpretable ex-eventu result leads to a new initium. Right this is the joint assertion of atomism, quantum mechanics, and relativity.

  2. Highly scalable Ab initio genomic motif identification

    Marchand, Benoît

    2011-01-01

    We present results of scaling an ab initio motif family identification system, Dragon Motif Finder (DMF), to 65,536 processor cores of IBM Blue Gene/P. DMF seeks groups of mutually similar polynucleotide patterns within a set of genomic sequences and builds various motif families from them. Such information is of relevance to many problems in life sciences. Prior attempts to scale such ab initio motif-finding algorithms achieved limited success. We solve the scalability issues using a combination of mixed-mode MPI-OpenMP parallel programming, master-slave work assignment, multi-level workload distribution, multi-level MPI collectives, and serial optimizations. While the scalability of our algorithm was excellent (94% parallel efficiency on 65,536 cores relative to 256 cores on a modest-size problem), the final speedup with respect to the original serial code exceeded 250,000 when serial optimizations are included. This enabled us to carry out many large-scale ab initio motiffinding simulations in a few hours while the original serial code would have needed decades of execution time. Copyright 2011 ACM.

  3. Emergência de plântulas de abóbora a partir da avaliação da qualidade das sementes Squash seedlings emergency from seed quality evaluation

    Alexandra Augusti Boligon; Alessandro Dal' Col Lúcio; Danton Camacho Garcia

    2010-01-01

    O objetivo do estudo foi identificar as variáveis da análise de sementes de abóbora que melhor predizem a emergência de plântulas dessa cultura. O trabalho foi realizado no Departamento de Fitotecnia da Universidade Federal de Santa Maria. Três lotes de sementes de abóbora de cada um dos cultivares 'Caserta', 'De Tronco', 'Caravela' e 'Menina Brasileira' foram utilizados. Foi determinada a percentagem de plântulas normais nos testes de germinação, primeira contagem de germinação, teste de env...

  4. Estudo comparativo de sistemas em aquecimento

    Castro, Inês Marques Costa Borges de

    2013-01-01

    O presente estudo pretende avaliar o desempenho energético e rentabilidade do uso de equipamento de climatização para o aquecimento ambiente de uma casa sénior, através de sistemas tradicionais de produção de água aquecida, como a caldeira e a tradicional bomba de calor, e um sistema apoiado num equipamento de produção solar térmico. Perante uma determinada arquitectura, foram calculados os caudais de ar novo, de forma a garantir a qualidade do ar interior, cumprindo os requisitos da actua...

  5. Estudo retrospectivo de latrodectismo na Bahia, Brasil

    Rejâne Maria Lira-da-Silva; Graciela Brige Matos; Roney Orismar Sampaio; Tania Brazil Nunes

    1995-01-01

    O trabalho apresenta um estudo retrospectivo de setenta e sete casos de latrodectismo no Estado da Bahia, Brasil, de agosto de 1980 a julho de 1990. Os dados foram levantados nos livros de registro e arquivo de fichas do CIAVE. O agente etiológico em 28% dos acidentes aracnídeos foi a espécie L. curacaviensis e a maior incidência foi registrada no meio urbano (57%), em indivíduos do sexo masculino (70%) e faixa etária de 10 a 29 anos (58%). Os principais sinais locais foram dor (56%), pápula ...

  6. Undoing Gender Through Legislation and Schooling: the Case of AB 537 and AB 394 IN California, USA

    Knotts, Greg

    2009-11-01

    This article investigates California laws AB 537: The Student Safety and Violence Prevention Act of 2000, and the recently enacted AB 394: Safe Place to Learn Act. Both demand that gender identity and sexual orientation be added to the lexicon of anti-harassment protection in public education. However, despite these progressive measures, schools have an unconscious acceptance of heteronormativity and gendered norms, which undermines both the spirit and language of these laws. This paper examines how California schools can both change standard practices and realise the transformative social change that laws like AB 537 and AB 394 can instigate. I assert that the systemic implementation of these laws, through the adoption, enforcement and evaluation of existing AB 537 Task Force Recommendations, is necessary for their success. My second assertion is that AB 537 and AB 394 have the potential to change and reconstitute gender-based and heteronormative standards at school sites.

  7. 汽车ABS/ASR/ACC集成化系统%Integrated ABS/ASR/ACC System for the Car

    刘昭度; 卢江; 时开斌; 安巍

    2001-01-01

    叙述了ACC系统和ABS/ASR系统在改善汽车高速行驶主动安全性方面的功用,阐述了ACC系统是ABS/ASR系统功能的延伸、逻辑的发展及它们之间的内在联系,指出了在ABS/ASR的基础上只需增加测距装置和添加巡航控制子程序,就可方便地实现ABS/ASR/ACC集成化系统,并给出了集成化系统的控制框图和控制方法,论述了ABS/ASR/ACC集成化系统比孤立的ABS/ASR和ACC系统的优越性.%The individual functions of ACC and ABS/ASR are described in the improvements of active safety while the road vehicles travel at a high speed. Being a logic extension of and many inherent connections with ABS/BSR, ACC is easily integrated with ABS/ASR to form an integrated system by adding the headway distance*$-detecting device to the existing ABS/ASR system and expanding the ABS/ASR software. The algorithm flowcharts and control methods of the ABS/ASR/ACC are given. The advantages of the ABS/ASR/ACC system compared with those using the stand alone systems ABS, ASR and ACC are mentioned in details.

  8. Testing Distributed ABS System with Fault Injection

    Trawczyński, Dawid; Sosnowski, Janusz; Gawkowski, Piotr

    The paper deals with the problem of adapting software implemented fault injection technique (SWIFI) to evaluate dependability of reactive microcontroller systems. We present an original methodology of disturbing controller operation and analyzing fault effects taking into account reactions of the controlled object and the impact of the system environment. Faults can be injected randomly (in space and time) or targeted at the most sensitive elements of the controller to check it at high stresses. This approach allows identifying rarely encountered problems, usually missed in classical approaches. The developed methodology has been used successfully to verify dependability of ABS system. Experimental results are commented in the paper.

  9. Ab initio calculations of material strength

    Šob, Mojmír; Friák, Martin; Vitek, V.

    Tokyo : The Japan Society of Mechanical Engineers, 2003, s. 467-475. [International Symposium on Micro-Mechanical Engineering - Heat Transfer, Fluid Dynamics, Reliability and Mechanotronics.. Tsuchiura and Tsukuba (JP), 01.12.2003-03.12.2003] R&D Projects: GA AV ČR IAA1041302; GA ČR GA202/03/1351; GA MŠk OC 523.90 Institutional research plan: CEZ:AV0Z2041904 Keywords : ab initio calculations * electronic structure * theoretical tensile strength Subject RIV: BM - Solid Matter Physics ; Magnetism

  10. Ab Initio Molecular Dynamics: A Virtual Laboratory

    Hobbi Mobarhan, Milad

    2014-01-01

    In this thesis, we perform ab initio molecular dynamics (MD) simulations at the Hartree-Fock level, where the forces are computed on-the-fly using the Born-Oppenheimer approximation. The theory behind the Hartree-Fock method is discussed in detail and an implementation of this method based on Gaussian basis functions is explained. We also demonstrate how to calculate the analytic energy derivatives needed for obtaining the forces acting on the nuclei. Hartree-Fock calculations on the ground s...

  11. Germacrene D Cyclization: An Ab Initio Investigation

    William N. Setzer

    2008-01-01

    Full Text Available Essential oils that contain large concentrations of germacrene D are typically accompanied by cadinane sesquiterpenoids. The acid-catalyzed cyclization of germacrene D to give cadinane and selinane sesquiterpenes has been computationally investigated using both density functional (B3LYP/6-31G* and post Hartree-Fock (MP2/6-31G** ab initio methods. The calculated energies are in general agreement with experimentally observed product distributions, both from acid-catalyzed cyclizations as well as distribution of the compounds in essential oils.

  12. Asiakassuhdehallinnan kehityssuunnitelma : Case: Oy Combi Cool Ab

    Puikkonen, Touko

    2011-01-01

    Tässä insinöörityössä tutustuttiin Oy Combi Cool Ab:n asiakassuhdehallintaan ja siinä havaittuihin puutteisiin ja kehitystarpeisiin. Työn tarkoituksena oli luoda yritykselle ajan tasalla oleva asiakasrekisteri ja sen pohjalta kehittää asiakassuhdehallintaa etenkin myynnin, oston ja johdon henkilöstön tarpeita ajatellen muovaamalla siitä henkilöstön myynti- ja asiakaspalvelutyöskentelyä tehostava toimiva kokonaisuus. Combi Cool on vuonna 1985 perustettu kylmäalan tukkuliike, joka on vajaan 30 ...

  13. Estudo do teor de alicina em alho

    Mendes, Patrícia Alexandra Pinto

    2008-01-01

    A alicina (dialil-tiosulfinato) é o componente biológico mais activo no alho com inúmeras aplicações a nível da saúde, já conhecida desde décadas. Existem actualmente diversos métodos publicados para a determinação do teor de alicina no alho por HPLC e espectrofotometria. No entanto, os resultados mostram discordância no teor de alicina medido pelos vários métodos. Este estudo tem por objectivo a determinação do teor de alicina por métodos de HPLC e espectrofotometria; e com...

  14. Elastic properties of intermetallic AB2 and AB5 hydrogen-absorbing compounds

    The elastic properties of AB2 and AB5 hydrogen-absorbing intermetallic compounds are reviewed. The relevance of these properties to hydrogen absorption is discussed briefly. In many cases the temperature dependence of the elastic constants of the AB2 compounds is anomalous in that the moduli do not decrease monotonically with increasing temperature. This unusual behavior appears to be associated with electronic structure effects in a number of cases. The absorption of hydrogen by polycrystalline TaV2 has a profound effect on the aggregate shear modulus, changing both the magnitude and temperature dependence significantly. This effect of hydrogen on the mechanical properties appears to occur via effects on the electronic structure. Few measurements of elastic properties have been reported for hydrogen-absorbing AB5 intermetallic compounds. The LaAlxNi5-x system has been investigated by means of measurements on polycrystals prepared by hot isostatic pressing. The moduli decrease about 8% as x increases from 0 to 1

  15. Biosorption of Acid Blue 290 (AB 290) and Acid Blue 324 (AB 324) dyes on Spirogyra rhizopus

    In this study, the biosorption of Acid Blue 290 and Acid Blue 324 on Spirogyra rhizopus, a green algae growing on fresh water, was studied with respect to initial pH, temperature, initial dye concentration and biosorbent concentration. The optimum initial pH and temperature values for AB 290 and AB 324 biosorption were found to be 2.0, 30 deg. C and 3.0, 25 deg. C, respectively. It was observed that the adsorbed AB 290 and AB 324 amounts increased with increasing the initial dye concentration up to 1500 and 750 mg/L, respectively. The Langmuir, Freundlich, Redlich-Peterson and Koble-Corrigan isotherm models were applied to the experimental equilibrium data and the isotherm constants were determined by using Polymath 4.1 software. The monolayer coverage capacities of S. rhizopus for AB 290 and AB 324 dyes were found as 1356.6 mg/g and 367.0 mg/g, respectively. The intraparticle diffusion model and the pseudo-second order kinetic model were applied to the experimental data in order to describe the removal mechanism of these acidic dyes by S. rhizopus. The pseudo-second order kinetic model described very well the biosorption kinetics of AB 290 and AB 324 dyes. Thermodynamic studies showed that the biosorption of AB 290 and AB 324 on S. rhizopus was exothermic in nature

  16. Ab initio non-relativistic spin dynamics

    Ding, Feizhi; Goings, Joshua J.; Li, Xiaosong, E-mail: xsli@uw.edu [Department of Chemistry, University of Washington, Seattle, Washington 98195 (United States); Frisch, Michael J. [Gaussian, Inc., 340 Quinnipiac St, Bldg 40, Wallingford, Connecticut 06492 (United States)

    2014-12-07

    Many magnetic materials do not conform to the (anti-)ferromagnetic paradigm where all electronic spins are aligned to a global magnetization axis. Unfortunately, most electronic structure methods cannot describe such materials with noncollinear electron spin on account of formally requiring spin alignment. To overcome this limitation, it is necessary to generalize electronic structure methods and allow each electron spin to rotate freely. Here, we report the development of an ab initio time-dependent non-relativistic two-component spinor (TDN2C), which is a generalization of the time-dependent Hartree-Fock equations. Propagating the TDN2C equations in the time domain allows for the first-principles description of spin dynamics. A numerical tool based on the Hirshfeld partitioning scheme is developed to analyze the time-dependent spin magnetization. In this work, we also introduce the coupling between electron spin and a homogenous magnetic field into the TDN2C framework to simulate the response of the electronic spin degrees of freedom to an external magnetic field. This is illustrated for several model systems, including the spin-frustrated Li{sub 3} molecule. Exact agreement is found between numerical and analytic results for Larmor precession of hydrogen and lithium atoms. The TDN2C method paves the way for the ab initio description of molecular spin transport and spintronics in the time domain.

  17. Ab initio no core full configuration approach for light nuclei

    Kim, Youngman; Shin, Ik Jae; Maris, Pieter; Vary, James P.; Forssén, Christian; Rotureau, Jimmy

    2015-10-01

    Comprehensive understanding of the structure and reactions of light nuclei poses theoretical and computational challenges. Still, a number of ab initio approaches have been developed to calculate the properties of atomic nuclei using fundamental interactions among nucleons. Among them, we work with the ab initio no core full configuration (NCFC) method and ab initio no core Gamow Shell Model (GSM). We first review these approaches and present some recent results.

  18. Workshop on automated beam steering and shaping (ABS). Proceedings

    A workshop on Automated Beam Steering and Shaping (ABS) was held at CERN in December 1998. This was the first workshop dedicated to this subject. The workshop had two major goals: to review the present status of ABS algorithms and systems around the world and to create a worldwide ABS community. These proceedings contain summary reports from all sessions, contributions from several presentations held at the workshop, and a complete set of abstracts for all presentations. (orig.)

  19. A Influência da Responsabilidade Social Corporativa na Imagem de Marca: Um Estudo em Empresas Brasileiras do Setor de Cosméticos

    Márcio Ribeiro da Fonseca; Thelma Valéria Rocha; Eduardo Eugênio Spers

    2014-01-01

    Este estudo tem como tema a influência da Responsabilidade Social Corporativa (RSC) na imagem de marca (IM) e na reputação corporativa (RC) de empresas brasileiras do setor de cosméticos. O foco da pesquisa foi investigar a percepção dos consumidores universitários pertencentes às classes A/B sobre as ações de RSC de duas grandes empresas brasileiras de cosméticos. O objetivo foi comparar as percepções d...

  20. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 interactions with western corn rootworm midgut membrane binding sites.

    Huarong Li

    Full Text Available BACKGROUND: Bacillus thuringiensis (Bt Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interactions are one line of evidence that Bt protein mechanisms of action differ and that the probability of receptor-mediated cross-resistance is low. METHODOLOGY/PRINCIPAL FINDINGS: Binding site interactions were investigated between Cry34Ab1/Cry35Ab1 and coleopteran active insecticidal proteins Cry3Aa, Cry6Aa, and Cry8Ba on western corn rootworm midgut brush border membrane vesicles (BBMV. Competitive binding of radio-labeled proteins to western corn rootworm BBMV was used as a measure of shared binding sites. Our work shows that (125I-Cry35Ab1 binds to rootworm BBMV, Cry34Ab1 enhances (125I-Cry35Ab1 specific binding, and that (125I-Cry35Ab1 with or without unlabeled Cry34Ab1 does not share binding sites with Cry3Aa, Cry6Aa, or Cry8Ba. Two primary lines of evidence presented here support the lack of shared binding sites between Cry34Ab1/Cry35Ab1 and the aforementioned proteins: 1 No competitive binding to rootworm BBMV was observed for competitor proteins when used in excess with (125I-Cry35Ab1 alone or combined with unlabeled Cry34Ab1, and 2 No competitive binding to rootworm BBMV was observed for unlabeled Cry34Ab1 and Cry35Ab1, or a combination of the two, when used in excess with (125I-Cry3Aa, or (125I-Cry8Ba. CONCLUSIONS/SIGNIFICANCE: Combining two or more insecticidal proteins active against the same target pest is one tactic to delay the onset of resistance to either protein. We conclude that Cry34Ab1/Cry35Ab1 are compatible with Cry3Aa, Cry6Aa, or Cry8Ba

  1. Ising and Heisenberg models on ferrimagnetic AB sub 2 chains

    Vitoriano, C; Raposo, E P

    2002-01-01

    We study the Ising and Heisenberg models on one-dimensional ferrimagnetic bipartite chains with the special AB sub 2 unit-cell topology and experimental motivation in inorganic and organic magnetic polymers. The spin-1/2 AB sub 2 Ising case is exactly solved in the presence of an external magnetic field. We also derive asymptotical low- and high-temperature limits of several thermodynamical quantities of the zero-field classical AB sub 2 Heisenberg model. Further, the quantum spin-1/2 AB sub 2 Heisenberg model in a field is studied using a mean-field approach.

  2. Estudos sobre o comportamento do consumidor na SciELO

    Santana, Dhione Oliveira; Reis, Ana Alinny Cruz dos; Oliveira, Rafaela Santana

    2016-01-01

    Os estudos sobre o comportamento do consumidor têm chamado à atenção de pesquisadores de diversos países e de diversas áreas do conhecimento com objetivos dos mais variados possíveis. O presente artigo faz um estudo bibliométrico interdisciplinar sobre o comportamento do consumidor no contexto internacional (países Ibero-americanos e da África do Sul) da plataforma SciELO (Scientific Electronic Library Online). O presente estudo analisou 153 artigos científicos, como conclusão, observou-se qu...

  3. Ab Initio Path to Heavy Nuclei

    Binder, Sven; Calci, Angelo; Roth, Robert

    2014-01-01

    We present the first ab initio calculations of nuclear ground states up into the domain of heavy nuclei, spanning the range from 16-O to 132-Sn based on two- plus three-nucleon interactions derived within chiral effective field theory. We employ the similarity renormalization group for preparing the Hamiltonian and use coupled-cluster theory to solve the many-body problem for nuclei with closed sub-shells. Through an analysis of theoretical uncertainties resulting from various truncations in this framework, we identify and eliminate the technical hurdles that previously inhibited the step beyond medium-mass nuclei, allowing for reliable validations of nuclear Hamiltonians in the heavy regime. Following this path we show that chiral Hamiltonians qualitatively reproduce the systematics of nuclear ground-state energies up to the neutron-rich Sn isotopes.

  4. Guiding ab initio calculations by alchemical derivatives

    to Baben, M.; Achenbach, J. O.; von Lilienfeld, O. A.

    2016-03-01

    We assess the concept of alchemical transformations for predicting how a further and not-tested change in composition would change materials properties. This might help to guide ab initio calculations through multidimensional property-composition spaces. Equilibrium volumes, bulk moduli, and relative lattice stability of fcc and bcc 4d transition metals Zr, Nb, Mo, Tc, Ru, Rh, Pd, and Ag are calculated using density functional theory. Alchemical derivatives predict qualitative trends in lattice stability while equilibrium volumes and bulk moduli are predicted with less than 9% and 28% deviation, respectively. Predicted changes in equilibrium volume and bulk moduli for binary and ternary mixtures of Rh-Pd-Ag are in qualitative agreement even for predicted bulk modulus changes as large as +100% or -50%. Based on these results, it is suggested that alchemical transformations could be meaningful for enhanced sampling in the context of virtual high-throughput materials screening projects.

  5. Ab initio molar volumes and Gaussian radii.

    Parsons, Drew F; Ninham, Barry W

    2009-02-12

    Ab initio molar volumes are calculated and used to derive radii for ions and neutral molecules using a spatially diffuse model of the electron distribution with Gaussian spread. The Gaussian radii obtained can be used for computation of nonelectrostatic ion-ion dispersion forces that underlie Hofmeister specific ion effects. Equivalent hard-sphere radii are also derived, and these are in reasonable agreement with crystalline ionic radii. The Born electrostatic self-energy is derived for a Gaussian model of the electronic charge distribution. It is shown that the ionic volumes used in electrostatic calculations of strongly hydrated cosmotropic ions ought best to include the first hydration shell. Ionic volumes for weakly hydrated chaotropic metal cations should exclude electron overlap (in electrostatic calculations). Spherical radii are calculated as well as nonisotropic ellipsoidal radii for nonspherical ions, via their nonisotropic static polarizability tensors. PMID:19140766

  6. Discovering chemistry with an ab initio nanoreactor

    Martinez, Todd

    Traditional approaches for modeling chemical reaction networks such as those involved in combustion have focused on identifying individual reactions and using theoretical approaches to explore the underlying mechanisms. Recent advances involving graphical processing units (GPUs), commodity products developed for the videogaming industry, have made it possible to consider a distinct approach wherein one attempts to discover chemical reactions and mechanisms. We provide a brief summary of these developments and then discuss the concept behind the ``ab initio nanoreactor'' which explores the space of possible chemical reactions and molecular species for a given stoichiometry. The nanoreactor concept is exemplified with an example to the Urey-Miller reaction network which has been previously advanced as a potential model for prebiotic chemistry. We briefly discuss some of the future directions envisioned for the development of this nanoreactor concept.

  7. Operator evolution for ab initio nuclear theory

    Schuster, Micah D; Johnson, Calvin W; Jurgenson, Eric D; Navratil, Petr

    2014-01-01

    The past two decades have seen a revolution in ab initio calculations of nuclear properties. One key element has been the development of a rigorous effective interaction theory, applying unitary transformations to soften the nuclear Hamiltonian and hence accelerate the convergence as a function of the model space size. For consistency, however, one ought to apply the same transformation to other operators when calculating transitions and mean values from the eigenstates of the renormalized Hamiltonian. Working in a translationally-invariant harmonic oscillator basis for the two- and three-nucleon systems, we evolve the Hamiltonian, square-radius and total dipole strength operators by the similarity renormalization group (SRG). The inclusion of up to three-body matrix elements in the 4He nucleus all but completely restores the invariance of the expectation values under the transformation. We also consider a Gaussian operator with adjustable range and find at short ranges an increased contribution from such ind...

  8. Dois estudos sobre o trabalho dos petroleiros

    Leda Leal Ferreira

    1996-06-01

    Full Text Available O presente artigo traz um resumo de dois estudos realizados na área do petróleo, o primeiro feito em uma unidade de refino e o segundo abarcando o trabalho de operadores exercendo várias funções dentro de uma refinaria e de terminais marítimos de petróleo. Nos dois casos, o ponto central foi a análise da atividade dos trabalhadores, isto é, o que eles faziam e como o faziam para dai conta das exigências de produção que lhes eram atribuídas. No entanto, os métodos utilizados foram diferentes: no primeiro caso utilizou-se a Análise Ergonômica do Trabalho (AET e no segundo, a Análise Coletiva do Trabalho (ACT. Além de apresentar os principais resultados destes estudos, a autora faz considerações sobre as diferenças entre os dois métodos e um apelo à comunidade científica para que se preocupe mais em estudar a atividade real dos trabalhadores e assim contribuir para um melhor conhecimento do que se passa no interior das unidades produtivas, evitando que sofrimentos humanos inúteis e até catástrofes industriais continuem a ocorrer.This paper describes two studies about petroleum industry. The first was developed in a refinery and the second focuses on the work of operators in various jobs within a refinery and maritime petroleum units. In both cases, the focal point was the analyses of activities, that is, what the workers do and how they do it in order to meet production demandai put on them. However, two different methods were applied in the studies. Ergonomics Work Analyses (EWA was used on the first case and Collective Work Analyses (CWA, on the second. Besides showing the main results, the author compares the two methods. She also draws the scientific community attention to the importance of studding the workers actual activity in order to contribute to a better understanding of what is going on inside production units, avoiding useless human suffering, and the still ocurring undustrial disasters.

  9. Ab initio alpha-alpha scattering

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Luu, Thomas; Meißner, Ulf-G.

    2015-12-01

    Processes such as the scattering of alpha particles (4He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei—nuclei with even and equal numbers of protons and neutrons—is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the ‘adiabatic projection method’ to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  10. Ab initio alpha-alpha scattering.

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  11. Ablation dynamics in laser sclerotomy ab externo

    Brinkmann, Ralf; Droege, Gerit; Mohrenstecher, Dirk; Scheu, M.; Birngruber, Reginald

    1996-01-01

    Laser sclerostomy ab externo with flashlamp excited mid-IR laser systems emitting in the 2-3 micrometer spectral range is in phase II clinical trials. Although acutely high success rates were achieved, the restenosis rate after several months is about 40%. Laser pulses of several hundreds of microseconds, known to induce thermo-mechanical explosive evaporation were used for this procedure. We investigated the ablation dynamics in tissue and the cavitation bubble dynamics in water by means of an Er:YAG laser system to estimate the extent of mechanical damage zones in the sclera and in the anterior chamber, which may contribute to the clinical failure. We found substantial mechanical tissue deformation during the ablation process caused by the cavitation effects. Stress waves up to several bar generated by explosive evaporization were measured. The fast mechanical stretching and collapsing of the scleral tissue induced by cavitation resulted in tissue dissection as could be proved by flash photography and histology. The observed high restenosis might be a result of a subsequent enhanced wound healing process. Early fistula occlusions due to iris adherences, observed in about 20% of the clinical cases may be attributed to intraocular trauma induced by vapor bubble expansion through the anterior chamber after scleral perforation. An automatic feedback system minimizing adverse effects by steering and terminating the laser process during scleral fistulization is demonstrated. Moreover, a new approach in laser sclerostomy ab externo is presented using a cw-IR laser diode system emitting at the 1.94 micrometer mid-IR water absorption peak. This system was used in vitro and showed smaller damage zones compared to the pulsed laser radiation.

  12. Dicty_cDB: FCL-AB06 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AB06 (Link to dictyBase) - - - Contig-U15603-1 FCL-AB06P ...(Link to Original site) FCL-AB06F 694 FCL-AB06Z 573 FCL-AB06P 1267 - - Show FCL-AB06 Library FCL (Link to library) Clone ID FCL-...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AB/FCL-AB06Q....Seq.d/ Representative seq. ID FCL-AB06P (Link to Original site) Representative DNA sequence >FCL-AB06 (FCL-AB06Q) /CSM/FCL/FCL-...AB/FCL-AB06Q.Seq.d/ CAATTTTATCGGAACCATCAATTCATGCAGGTTCTGTATTTAGTATTAATTTAACCAAAT CTAGACA

  13. A Case of Laptop Computer-Induced Erythema Ab Igne

    Nurettin Özgür Doğan

    2014-12-01

    Full Text Available Erythema ab igne, also known as toasted skin syndrome, is a skin reaction characterized by reticulate erythema, brown pigmentation, and telangiectasia. In some cases, epidermal atrophy and scaling are also identified. The condition is usually caused by prolonged exposure to a source of heat or infrared radiation. Here, we report a case of erythema ab igne associated with laptop computer use.

  14. Kopplung von Dichtefunktional- und ab-initio-Methoden

    Goll, Erich

    2008-01-01

    Im Rahmen der Doktorarbeit wurde untersucht, inwieweit die Kopplung von Dichtefunktionalmethoden und ab-initio-Korrelationsmethoden der Quantenchemie eine Verbesserung bezüglich beider Grenzmethoden erbringt. Die Kopplung erfolgt durch eine Aufspaltung des interelektronischen Hamiltonoperators (abstoßende Coulombwechselwirkung). Die kurzreichweitige Wechselwirkung wird mit Dichtefunktionaltheorie behandelt, die langreichweitige mit Hilfe von ab-initio-Methoden. Diese Aufteilung soll dazu dien...

  15. Effects of Cry1F and Cry34Ab1/35Ab1 on storage pests

    Two crystalline protoxins from Bacillus thuringiensis (Bt), Cry1Fa1 and Cry34Ab1/Cry35Ab1 (Cry1F, Cry34/35), were evaluated for efficacy against lepidopteran and coleopteran storage pests. Cry1F was tested against the lepidopterans Sitotroga cerealella (Angoumois grain moth) and colonies of the lep...

  16. Preparation of grafted ABS and compatibilization of r-PET/ABS blends by the grafted ABS%ABS接枝物的制备及其对r-PET/ABS的增容作用

    陈智军; 王益龙; 郑辰

    2012-01-01

    Two kinds of grafted acrylonitrile-butadiene-styrene copolymer(ABS), i.e. maleic anhydride (MAH) grafted ABS(ABS-g-MAH) and glycidyl methacrylate (GMA) grafted ABS (ABS-g-GMA), were prepared via reactive extrusion and were used as compatibilizer for recycled polyethylene glycol terephthalate (r-PET)/ABS blends. The results show that ABS-g-MAH and ABS-g-GMA can greatly improve the impact strength of the blends. ABS-g-MAH is superior to ABS-g-GMA in compatibilization effect. The optimal compatibilization effect is acquired when the grafting ratio of ABS-g-MAH is 1.35% and the mass content of the copolymer is 5%. Under such conditions, the notched and unnotched *Charpy impact strength of the r-PET/ABS/ABS-g--MAH blends rise by 42% and 23%, respectively, in comparison with those of r-PET/ ABS. The observation by scanning electron microscope(SEM) shows that adding grafted ABS can make ABS be dispersed more homogeneously in the r-PET continuous phase and make particle size more even.%通过反应挤出法制备马来酸酐(MAH)接枝丙烯腈-丁二烯-苯乙烯三元共聚物(ABS)(ABS-g-MAH)和甲基丙烯酸缩水甘油酯(GMA)接枝ABS(ABS-g-GMA),将其用于增容回收聚对苯二甲酸乙二酯(PET)瓶片(r-PET)/ABS共混物,发现能显著提高其混物的冲击强度.ABS-g-MAH的增容效果优于ABS-g-GMA;ABS-g-MAH的接枝率为1.35%,w(ABS-g-MAH)为5%时对r-PET/ABS的增容作用最佳,此时r-PET/ABS/ABS-g-MAH的简支梁缺口冲击强度和无缺口冲击强度比r-PET/ABS分别提高了42%和23%.扫描电子显微镜观察表明,加入ABS接枝物能使ABS在r-PET连续相中的分散更均匀,粒径尺寸更均一.

  17. Estudo retrospectivo de latrodectismo na Bahia, Brasil

    Rejâne Maria Lira-da-Silva

    1995-09-01

    Full Text Available O trabalho apresenta um estudo retrospectivo de setenta e sete casos de latrodectismo no Estado da Bahia, Brasil, de agosto de 1980 a julho de 1990. Os dados foram levantados nos livros de registro e arquivo de fichas do CIAVE. O agente etiológico em 28% dos acidentes aracnídeos foi a espécie L. curacaviensis e a maior incidência foi registrada no meio urbano (57%, em indivíduos do sexo masculino (70% e faixa etária de 10 a 29 anos (58%. Os principais sinais locais foram dor (56%, pápula eritematosa (21% e edema discreto (17%, e os sistêmicos foram dor em membros inferiores (29%, tremores e contraturas (29%, sudorese (28% parestesia em membros (21% e dor abdominal (17%. O tratamento foi sintomático em 67% dos casos e específico em 21%. O tempo de permanência hospitalar após o uso do soro antilatrodectus foi menor que 24 horas em 64% dos casos.This work is a retrospective study of latrodectism in the State of Bahia, Brazil, from August 1980 to July 1990. The data concerning the accidents were obtained from file cards at the Antivenom Information Center of Bahia (AVICB. Latrodectus curacavienis was the ethiologic agent identified in 28% of the arachnid accidents. The major incidence was registered in urban area (57% affecting men (70% more than women, with 10 to 29year-old age group (58%. Local pain (56%, erythematous papula (29% and light oedema (17% were the principal local symptoms. Pain in the limbs (29%, tremor and rigidities (29%, sweating (28%, limbs and arms paresthesia (21% and abdominal pain (17% were systemic ones. The treatment was mainly symptomatic (67% and antivenin serum was used in 21% of the cases. After serotherapy, 64% of the patients left the hospital within less than 24 hours.

  18. Reticulossarcomas epidurais intraespinais: estudo de 34 casos

    Lígia M. B. Coutinho

    1974-12-01

    Full Text Available Foi realizado um estudo de 34 casos de reticulossarcomas localizados no tecido epidural intraespinal. Assinala-se sua maior freqüência entre homens com mais de 50 anos, embora pacientes mais jovens possam ser acometidos, principalmente entre 15 e 29 anos. A distribuição segmentar dos tumores permite um diagnóstico diferencial, sendo a região torácica a sede mais freqüentes de sarcomas. O principal sintoma encontrado nos pacientes com reticulossarcoma foi a dor, do tipo radicular, que serve para diferenciar os tumores intra e extra-medulares, tendo sido de aparecimento precoce em 15 dos pacientes estudados, precedendo em muitos meses e até anos os demais sintomas. Classificou-se os tumores reticulohistiocitários epidurais do canal vertebral em três grupos, de acordo com seu aspecto tecidual e celular e, principalmente, com a presença e distribuição da reticulina. Relacionou-se o tempo de evolução desses tumores com seu aspecto histopatológico, chegando-se à conclusão que os tumores classificados no grupo III apresentam um período evolutivo maior que os demais, o que nos levou a pensar que crescem mais lentamente, apresentando, portanto, melhor prognóstico que os demais tipos, muito embora todos os tipos de reticulossarcomas possam apresentar um prognóstico mais favorável quando precocemente diagnosticados e tratados adequadamente.

  19. Estudos sobre a Esquistosomose em Pernambuco, Brasil

    Aggeu Magalhães

    1940-01-01

    Full Text Available Os autores referem os resultados dos estudos sobre esquistosomose realisados, em Pernambuco, de Novembro de 1938 a Dezembro de 1939. Não se extendem em discussão, nem comentarios, tampouco, relacionam suas verificações com o que já foi relatado sobre o assunto em trabalhos nacionais e estrangeiros, pelo fato de que, não se trata de um resultado definitivo e sim de atividades que irão proseguir. Os estudos sistematicos em torno da endemia esquistosomica foram executados em duas localidades diversas pela população e pela situação geografica e ecologica. Pontezinha é uma povoação de 1200 habitantes localizada proximo a um conjunto de charcos e lagõas de agua dôce onde pululam caramujos do tipo olivaceus de Spix, e apresenta uma taxa de infestação de 21,4% para individuos do sexo masculino, e de 14,7% para os do sexo feminino. A distribuição por grupos de idade mostra que a incidencia cresce até o grupo de 16 a 20 anos de idade, quando atinge a percentagem de 37,8%, para decrescer em seguida. Em Vitoria a incidencia foi maior nos indivíduos do sexo feminino, atingindo a taxa de 41,4%, dando o sexo masculino a taxa de 36,9%. Por idade a percentagem maxima é atingida pelo grupo de 11 a 15 anos. Vitoria é uma cidade de 1500 habitantes, construida á margem do rio Tapacurá, onde se encontram numerosos caramujos do tipo centimetralis Lutz. A divergencia de incidencia corre por conta dos habitos da população e pela utilização que ela faz do rio, sendo maior em Vitoria porque a proximidade do rio facilita o uso de suas aguas para banho e serviços domesticos, condicionando este ultimo fato, a maior infestação das mulheres. O estudo da frequencia da infestação dos caramujos por cercarias de diversos trematodios, permite suspeitar uma relação inversa entre a taxa de infestação e o diametro maximo atingido pelos caramujos, parecendo este fato confirmar os trabalhos de Vianna Martins sobre a identidade dos hospedeiros

  20. Structural and biophysical characterization of Bacillus thuringiensis insecticidal proteins Cry34Ab1 and Cry35Ab1.

    Matthew S Kelker

    Full Text Available Bacillus thuringiensis strains are well known for the production of insecticidal proteins upon sporulation and these proteins are deposited in parasporal crystalline inclusions. The majority of these insect-specific toxins exhibit three domains in the mature toxin sequence. However, other Cry toxins are structurally and evolutionarily unrelated to this three-domain family and little is known of their three dimensional structures, limiting our understanding of their mechanisms of action and our ability to engineer the proteins to enhance their function. Among the non-three domain Cry toxins, the Cry34Ab1 and Cry35Ab1 proteins from B. thuringiensis strain PS149B1 are required to act together to produce toxicity to the western corn rootworm (WCR Diabrotica virgifera virgifera Le Conte via a pore forming mechanism of action. Cry34Ab1 is a protein of ∼14 kDa with features of the aegerolysin family (Pfam06355 of proteins that have known membrane disrupting activity, while Cry35Ab1 is a ∼44 kDa member of the toxin_10 family (Pfam05431 that includes other insecticidal proteins such as the binary toxin BinA/BinB. The Cry34Ab1/Cry35Ab1 proteins represent an important seed trait technology having been developed as insect resistance traits in commercialized corn hybrids for control of WCR. The structures of Cry34Ab1 and Cry35Ab1 have been elucidated to 2.15 Å and 1.80 Å resolution, respectively. The solution structures of the toxins were further studied by small angle X-ray scattering and native electrospray ion mobility mass spectrometry. We present here the first published structure from the aegerolysin protein domain family and the structural comparisons of Cry34Ab1 and Cry35Ab1 with other pore forming toxins.

  1. Ab initio two-component Ehrenfest dynamics

    We present an ab initio two-component Ehrenfest-based mixed quantum/classical molecular dynamics method to describe the effect of nuclear motion on the electron spin dynamics (and vice versa) in molecular systems. The two-component time-dependent non-collinear density functional theory is used for the propagation of spin-polarized electrons while the nuclei are treated classically. We use a three-time-step algorithm for the numerical integration of the coupled equations of motion, namely, the velocity Verlet for nuclear motion, the nuclear-position-dependent midpoint Fock update, and the modified midpoint and unitary transformation method for electronic propagation. As a test case, the method is applied to the dissociation of H2 and O2. In contrast to conventional Ehrenfest dynamics, this two-component approach provides a first principles description of the dynamics of non-collinear (e.g., spin-frustrated) magnetic materials, as well as the proper description of spin-state crossover, spin-rotation, and spin-flip dynamics by relaxing the constraint on spin configuration. This method also holds potential for applications to spin transport in molecular or even nanoscale magnetic devices

  2. Ab initio gene identification in metagenomic sequences.

    Zhu, Wenhan; Lomsadze, Alexandre; Borodovsky, Mark

    2010-07-01

    We describe an algorithm for gene identification in DNA sequences derived from shotgun sequencing of microbial communities. Accurate ab initio gene prediction in a short nucleotide sequence of anonymous origin is hampered by uncertainty in model parameters. While several machine learning approaches could be proposed to bypass this difficulty, one effective method is to estimate parameters from dependencies, formed in evolution, between frequencies of oligonucleotides in protein-coding regions and genome nucleotide composition. Original version of the method was proposed in 1999 and has been used since for (i) reconstructing codon frequency vector needed for gene finding in viral genomes and (ii) initializing parameters of self-training gene finding algorithms. With advent of new prokaryotic genomes en masse it became possible to enhance the original approach by using direct polynomial and logistic approximations of oligonucleotide frequencies, as well as by separating models for bacteria and archaea. These advances have increased the accuracy of model reconstruction and, subsequently, gene prediction. We describe the refined method and assess its accuracy on known prokaryotic genomes split into short sequences. Also, we show that as a result of application of the new method, several thousands of new genes could be added to existing annotations of several human and mouse gut metagenomes. PMID:20403810

  3. On the hierarchical parallelization of ab initio simulations

    Ruiz-Barragan, Sergi; Shiga, Motoyuki

    2016-01-01

    A hierarchical parallelization has been implemented in a new unified code PIMD-SMASH for ab initio simulation where the replicas and the Born-Oppenheimer forces are parallelized. It is demonstrated that ab initio path integral molecular dynamics simulations can be carried out very efficiently for systems up to a few tens of water molecules. The code was then used to study a Diels-Alder reaction of cyclopentadiene and butenone by ab initio string method. A reduction in the reaction energy barrier is found in the presence of hydrogen-bonded water, in accordance with experiment.

  4. ESTUDOS NUTRICIONAIS COM ARROZ (Oryza sativa, L.

    Alfredo LAM-SÁNCHEZ

    2009-07-01

    Full Text Available

    RESUMO: Estudos com arroz (Oryza sativa, L. foram realizados a fim de determinar a variabilidade do teor de proteína em coleções de cultivares e a possibilidade de utilizar as camadas periféricas do grão na alimentação humana. Foram analisadas 626 linhagens e cultivares de arroz que mostraram uma variação quanto ao teor de proteína de 4.00 a 14.31 g/100 g de amostra. Para se extrair as camadas periféricas do grão, foi desenvolvida uma máquina experimental, que removia as camadas superficiais dos grãos de arroz integral (inteiros somente com a casca removida. Verificou-se que a quantidade de proteína do grão diminui de fora para dentro. O resíduo, que era constituído de grande parte de restos de endosperma com um teor protéico menor mas incluía o embrião, que é a primeira estrutura a se deslocar de grão no beneficiamento e contém proteínas, vitaminas, sais minerais e lípides, tinha um bom valor nutritivo. Desenvolveu-se também uma fórmula para alimentação infantil a partir da mistura de leite de vaca com arroz, com composição semelhante à do leite materno, a ser utilizada sob a forma de bebida ou mingau. Formulações com 40%-20% arroz + 60%-80% leite de vaca proporcionaram valores de Coeficiente de Eficiência Protéica (2,39 e 2,38, respectivamente que não diferiam estatisticamente do valor de 2,43 obtido na fórmula com 100% de leite de vaca. Seus preços foram 59% e 65% do obtido para o leite de vaca integral. PALAVRAS-CHAVE: Arroz; qualidade do grão; proteína; camadas periféricas; misturas arroz-leite; nutrição humana.

  5. Tensile deformation mechanisms of ABS/PMMA/EMA blends

    Wang, S. H.; Gao, J.; Lin, S. X.; Zhang, P.; Huang, J.; Xu, L. L.

    2014-08-01

    The tensile deformation mechanisms of acrylonitrile - butadiene - styrene (ABS) / polymethyl methacrylate (PMMA) blends toughened by ethylene methacrylate (EMA) copolymer was investigated by analysing the fracture morphology. ABS/PMMA was blended with EMA copolymer by melt mixing technique using co-rotating twin extruder. Tensile tests show that the elongation at break of ABS/PMMA blends can be efficiently improved with the increase in EMA content. Fracture morphology of ABS/PMMA/EMA blends reveals that the material yield induced by hollowing-out of EMA particles and its propagation into yield zone is the main toughening mechanism. Moreover, the appearance that EMA particles in the central area are given priority to hollowing-out may be related to the skin-core structure of the injection moulded parts caused by the different cooling rate between surface and inside in the process of injection moulding.

  6. Toward ab initio density functional theory for nuclei

    Drut, J. E.; Furnstahl, R. J.; Platter, L.

    2009-01-01

    We survey approaches to nonrelativistic density functional theory (DFT) for nuclei using progress toward ab initio DFT for Coulomb systems as a guide. Ab initio DFT starts with a microscopic Hamiltonian and is naturally formulated using orbital-based functionals, which generalize the conventional local-density-plus-gradients form. The orbitals satisfy single-particle equations with multiplicative (local) potentials. The DFT functionals can be developed starting from internucleon forces using ...

  7. Ab-initio study of thermoelectricity of layered tellurium compounds

    Ibarra Hernández, Wilfredo

    2015-01-01

    In this thesis, we explore the electronic, dynamic and thermoelectric properties of different tellurium-based compounds. We perform ab-initio calculations within the Vienna Ab-initio Simulation Package (VASP) that works in the framework of Density Functional Theory (DFT). For the thermoelectric properties, we use the Boltztrap code that solves the Boltzmann Transport Equations (BTE) for electrons within the Constant Relaxation Time Approximation (CRTA). This computational pa...

  8. Evaluation of the Urotest AB antibacterial substance detection test.

    Blondeau, J. M.; Yaschuk, Y; Galenzoski, D; Hrabok, D; Isaacson, M; Lee, L.(Department of Physics, Yale University, New Haven, CT, USA); Link, H; Walshaw, L

    1994-01-01

    The Urotest AB was used to detect antimicrobial substances in urine samples. Of 1022 urine specimens evaluated, Urotest AB detected inhibitors in 38.9%. Of 159 urine specimens from patients thought to be taking an antibiotic, inhibitors were detected in 80.5%. This test may help to explain culture negative urine samples from symptomatic patients, and could help elucidate treatment failures and the epidemiology of antibiotic resistance.

  9. Deriving conservation laws for ABS lattice equations from Lax pairs

    In this paper we derive infinitely many conservation laws for ABS lattice equations from their Lax pairs. These conservation laws can be algebraically expressed by means of some known polynomials. For each equation, the infinitely many conservation laws are not equivalent and are nontrivial. We also show that the (H1), (H2), (H3), (Q1), (Q2), (Q3) and (A1) equations in the ABS list share a generic discrete Riccati equation. (paper)

  10. 基于ABS的ABS/ASR集成液压系统设计%ABS/ASR Integrated Hydraulic System Based on ABS

    马岳峰; 刘昭度; 吴利军; 王国业

    2004-01-01

    介绍一种基于JETTA GTX轿车ABS液压系统的ABS/ASR集成液压系统改造方案,该ABS/ASR集成液压系统在原有ABS液压系统的基础上增加较少的液压元件实现全部ABS功能和ASR制动干预控制功能,改造后的集成系统工作可靠,不影响原有的常规制动和ABS制动过程.

  11. Desenvolvimento da Tanatologia: estudos sobre a morte e o morrer

    Maria Julia Kovács

    2008-12-01

    Full Text Available Este artigo discute os principais temas e pesquisas na área da Tanatologia, estudos sobre a morte e o morrer. São apresentados os autores pioneiros que escreveram as primeiras obras de sistematização da Tanatologia entre os quais: Herman Feifel, Robert Kastenbaum e Elizabeth Kübler-Ross, e os principais temas de estudo: luto, violência e guerra, a morte e a TV, cuidados a pacientes gravemente enfermos, além da formação de profissionais da área de saúde e educação para lidar com pessoas vivendo situações de perdas e morte. São feitas propostas de estudos para o futuro desenvolvimento da Tanatologia em nosso país.

  12. Ab Initio No-Core Shell Model

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory (χEFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The resulting NN

  13. Ab Initio No-Core Shell Model

    Barrett, B R; Navratil, P; Vary, J P

    2011-04-11

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory ({chi}EFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The

  14. Voluntariado empresarial e a empresa : estudo do caso Unicer

    Pavia, Bernardo Nuno Andrade Barreiros

    2014-01-01

    O voluntariado empresarial é hoje uma componente da responsabilidade social das empresas cada vez mais importante e determinante na estratégia de comunicação com os seus diferentes stakeholders. Este estudo procurou perceber de que forma o voluntariado empresarial é visto e entendido pelas empresas, pelos seus colaboradores e, que tipo de intervenções são prática na relação com a comunidade. O estudo procurou também analisar as motivações e os benefícios das ações de voluntariado empresari...

  15. Estudos cronotópicos em narrativas audiovisuais

    Egle Müller Spinelli

    2008-01-01

    O presente trabalho pretende aplicar o conceito de cronotopia de Bakhtin à análise de narrativas audiovisuais. Para tanto, será discutido o conceito de cronotopo bakhtiniano e sua relação com os estudos de Saussure, com o intuito de mostrar como os elementos cronotópicos podem estar ligados a contextos que vão além do enunciado, remetendo a mecanismos da enunciação. No estudo são analisados filmes que apresentam determinadas características semelhantes às dos principais tipos de cronotopia es...

  16. Estudo químico da Lavanda luisieri

    Araújo, João Paulo Miranda Ribeiro

    2012-01-01

    O estudo de plantas medicinais tem ganho particular importância nos últimos anos devido ás propriedades atribuídas ás mesmas. Esta dissertação consistiu no estudo químico de uma planta já com algumas propriedades benéficas comprovadas, a Lavandula luisieri. Para além dos compostos principais presentes no óleo da mesma, existem uma série de compostos com estrutura 1,2,2,3,4-pentametilciclopentano (necrodano) que têm especial interesse. Este trabalho teve uma abordagem diferente das tomadas até...

  17. Study on Exothermic Oxidation of Acrylonitrile-butadiene-styrene (ABS Resin Powder with Application to ABS Processing Safety

    Jenq-Renn Chen

    2010-08-01

    Full Text Available Oxidative degradation of commercial grade ABS (Acrylonitrile-butadiene-styrene resin powders was studied by thermal analysis. The instabilities of ABS containing different polybutadiene (PB contents with respect to temperature were studied by Differential Scanning Calorimeter (DSC. Thermograms of isothermal test and dynamic scanning were performed. Three exothermic peaks were observed and related to auto-oxidation, degradation and oxidative decomposition, respectively. Onset temperature of the auto-oxidation was determined to be around 193 °C. However, threshold temperature of oxidation was found to be as low as 140 °C by DSC isothermal testing. Another scan of the powder after degeneration in air showed an onset temperature of 127 °C. Reactive hazards of ABS powders were verified to be the exothermic oxidation of unsaturated PB domains, not the SAN (poly(styrene-acrylonitrile matrix. Heat of oxidation was first determined to be 2,800 ± 40 J per gram of ABS or 4,720 ± 20 J per gram of PB. Thermal hazards of processing ABS powder are assessed by adiabatic temperature rise at process conditions. IR spectroscopy associated with heat of oxidation verified the oxidative mechanism, and these evidences excluded the heat source from the degradation of SAN. A specially prepared powder of ABS without adding anti-oxidant was analyzed by DSC for comparing the exothermic behaviors. Exothermic onset temperatures were determined to be 120 °C and 80 °C by dynamic scanning and isothermal test, respectively. The assessment successfully explained fires and explosions in an ABS powder dryer and an ABS extruder.

  18. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 Interactions with Western Corn Rootworm Midgut Membrane Binding Sites

    Huarong Li; Monica Olson; Gaofeng Lin; Timothy Hey; Sek Yee Tan; Narva, Kenneth E.

    2013-01-01

    BACKGROUND: Bacillus thuringiensis (Bt) Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry) proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interact...

  19. Comparisons of metallic clusters imbedded in the surface oxide of AB2, AB5, and A2B7 alloys

    Research highlights: Different growth mechanisms have been found on the metallic inclusions imbedded in the surface oxides of AB2, AN5, and A2B7. The high power performance has been correlated to the size and distribution of these inclusions. - Abstract: In order to clarify the relationship between the saturation magnetization of the activated metal hydride material and electrode performance, the specific power measured at both low temperature (-30 oC) and operating temperature (35 oC) of a nickel metal hydride battery were compared with magnetization measurements. It is found specific powers measured at both temperatures correlate well with the saturated magnetic susceptibility, which is proportional to the total amount of metallic nickel clusters distributed within the surface oxide layer after activation. Both the gas phase storage and electrochemical properties of the activated AB2, AB5, and A2B7 alloys were investigated. While the AB2 alloy has the highest storage capacity, it also has the lowest high-rate dischargeability among the three alloys. This suggests a competition between storage capacity and rate capability in these materials. In an alkaline etching experiment, it is established the saturation magnetization increases with etching time in these AB2, AB5, and A2B7 alloys. The saturation magnetization after a 4 h etches track the changes in the high-rate dischargeability. The increase is attributed to the growth in size of the metallic inclusions for the AB2 and Nd-A2B7 samples, and from an increase in the number of metallic inclusion in the case of AB5 and La-A2B7. Transmission electron microscope studies calibrate the size inferred from magnetic susceptibility studies and also the Ni-dominated FCC structure of the metallic clusters.

  20. Dicty_cDB: FC-AB09 [Dicty_cDB

    Full Text Available /dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AB/FC-AB09Q.Seq.d/ Representative seq. ID ...FC-AB09F (Link to Original site) Representative DNA sequence >FC-AB09 (FC-AB09Q) /CSM/FC/FC-AB/FC-AB09Q.Seq....QNQKKKKKKKKKKKKKKKKKK Translated Amino Acid sequence (All Frames) Frame A: desashkqlckiynkihyliifinfvlvvdlyp...0.00 m_ : 1.00 72.0 %: nuclear 16.0 %: cytoplasmic 8.0 %: mitochondrial 4.0 %: cytoskeletal >> prediction fo...kkkrkktkpkekkkkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits)

  1. Dicty_cDB: FCL-AB19 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AB19 (Link to dictyBase) - - - Contig-U15232-1 FCL-AB19Z ...(Link to Original site) - - FCL-AB19Z 697 - - - - Show FCL-AB19 Library FCL (Link to library) Clone ID FCL-A... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AB/FCL-AB19Q.Seq.d/ Representative seq. ID FCL-...AB19Z (Link to Original site) Representative DNA sequence >FCL-AB19 (FCL-AB19Q) /CSM/FCL/FCL-AB/FCL-...KLINFSIFQ* Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value FCL-

  2. Hydrogenation of AB5 and AB2 metal hydride alloys studied by in situ X-ray diffraction

    Highlights: • Hydrogenation process of an AB5 alloy and two AB2 alloys were studied by quasi in-situ XRD. • In both AB5 and AB2 metal alloy, hydrogen occupation sites on the half-plane were taken first. • In the C14/C15 mixed alloy, C14 phase is the main hydrogen storage phase with a lower equilibrium pressure. • In the C14/C15 mixed alloy, C15 phase is the catalyst hydrogen storage phase with a higher equilibrium pressure. • Small amount of C15 was hydrided first but not completed until C14 phase was fully hydrided. - Abstract: The evolution of lattice constants and abundances of metal (α) and metal hydride (β) phases during the hydrogenation process of an AB5 alloy with a CaCu5 crystal structure, an AB2 alloy with a predominating C14 structure, and a C14/C15-mixed AB2 alloy were reported. The preferred hydrogen insertion sites at different states of charge in both the α and β phases were studied based on the lattice parameter changes during hydrogenation. During the hydrogenation of the AB5 alloy, the ratio between lattice parameters a and c (a/c ratio) in the α phase decreases, stabilizes, and then decreases again while that in the β phase decreases and then stabilizes. The trends in unit cell volume changes are increasing, plateauing, and increasing again in the α phase and increasing followed by plateauing in the β phase as the hydrogenation level increases. In the C14-predominant AB2 alloy, the a/c ratio in the α phase increases at the beginning and then stabilizes while that in the β phase remains about the same and then increases during the addition of hydrogen. Moreover, the unit cell volume in the α phase increases slightly during hydrogenation, comparing to the increasing, decreasing, and then increasing trend in the β phase. In the C14/C15 mixed AB2 alloy, hydrogenation of the C15 phase starts at the beginning and promotes the hydrogenation of the C14 phase. The C14 phase, as the main hydrogen storage phase, completes hydrogenation

  3. Study of the mechanical properties of recycled abs and recovery throught mixing with SEBS

    Peydro, M. A.; Juárez Varón, David; Samuel SANCHEZ-CABALLERO; Pla-Ferrando, R

    2014-01-01

    Recovery of recycled acrylonitrile butadiene styrene (ABS) through mixing with styrene-ethylene/butylene- styrene (SEBS) has been studied in this paper. To simulate recycled ABS, virgin ABS was processed through 5 cycles, at extreme processing temperatures, 220 oC and 260 oC. The virgin ABS, the virgin SEBS, the recycled ABS and the mixtures were mechanically characterized after the various cycles of reprocessing in order to evaluate their corresponding properties and correlate them with the...

  4. Ab Initio Studies of Stratospheric Ozone Depletion Chemistry

    Lee, Timothy J.; Head-Gordon, Martin; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    An overview of the current understanding of ozone depletion chemistry, particularly with regards the formation of the so-called Antarctic ozone hole, will be presented together with an outline as to how ab initio quantum chemistry can be used to further our understanding of stratospheric chemistry. The ability of modern state-of-the art ab initio quantum chemical techniques to characterize reliably the gas-phase molecular structure, vibrational spectrum, electronic spectrum, and thermal stability of fluorine, chlorine, bromine and nitrogen oxide species will be demonstrated by presentation of some example studies. The ab initio results will be shown to be in excellent agreement with the available experimental data, and where the experimental data are either not known or are inconclusive, the theoretical results are shown to fill in the gaps and to resolve experimental controversies. In addition, ab initio studies in which the electronic spectra and the characterization of excited electronic states of halogen oxide species will also be presented. Again where available, the ab initio results are compared to experimental observations, and are used to aid in the interpretation of experimental studies.

  5. ESTUDOS CULTURAIS E ESTUDOS DE GÊNERO: PROPOSIÇÕES E ENTRELACES ÀS PESQUISAS EDUCACIONAIS

    Dinah Quesada Beck

    2013-09-01

    Full Text Available Este artigo tem o interesse de proporcionar ao/a leitor/a uma análise acerca da relação estabelecida entre dois distintos campos de estudos, os Estudos de Gênero e os Estudos Culturais, os quais têm fundamentado as pesquisas desenvolvidas no âmbito das temáticas que têm mobilizado nossos estudos e investigações, sejam elas infância, cultura, consumo, gênero, sexualidade, embelezamento, produção e política dos corpos. Para tanto, nos ocuparemos, nessa argumentação, com alguns movimentos discursivos: após situar a importância atribuída a esses campos nas pesquisas educacionais vinculadas a perspectiva pós-estruturalista de análise, bem como o modo como operamos com eles, interessa-nos discutir e problematizar algumas de suas características, demarcando sua profícua relação. Finalizamos essa narrativa ressaltando suas contribuições em nossas investigações que discutem a produção de identidades de gênero e culturais à infância contemporânea.

  6. The over-expression of two transcription factors, ABS5/bHLH30 and ABS7/MYB101, leads to upwardly curly leaves.

    Rui An

    Full Text Available Proper leaf development is essential for plant growth and development, and leaf morphogenesis is under the control of intricate networks of genetic and environmental cues. We are interested in dissecting these regulatory circuits genetically and report here the isolation of two Arabidopsis dominant mutants, abnormal shoot5-1D (abs5-1D and abs7-1D identified through activation tagging screens. Both abs5-1D and abs7-1D display an intriguing upwardly curly leaf phenotype. Molecular cloning showed that the elevated expression of a bHLH transcription factor ABS5/T5L1/bHLH30 or a MYB transcription factor ABS7/MYB101 is the cause for the abnormal leaf phenotypes found in abs5-1D or abs7-1D, respectively. Protoplast transient expression assays confirmed that both ABS5/T5L1 and ABS7/MYB101 are targeted to the nucleus. Interestingly, the expression domains of auxin response reporter DR5::GUS were abnormal in leaves of abs5-1D and ABS5/T5L1 over-expression lines. Moreover, cotyledon venation analysis showed that more areoles and free-ending veins are formed in abs5-1D. We found that the epidermis-specific expressions of ABS5/T5L1 or ABS7/MYB101 driven by the Arabidopsis Meristem Layer 1 promoter (PAtML1 were sufficient to recapitulate the curly leaf phenotype of abs5-1D or abs7-1D. In addition, PAtML1::ABS5 lines exhibited similar changes in DR5::GUS expression patterns as those found in 35S-driven ABS5/T5L1 over-expression lines. Our work demonstrated that enhanced expressions of two transcription factors, ABS5/T5L1 and ABS7/MYB101, are able to alter leaf lamina development and reinforce the notion that leaf epidermis plays critical roles in regulating plant organ morphogenesis.

  7. Ab initio simulation of transport phenomena in rarefied gases.

    Sharipov, Felix; Strapasson, José L

    2012-09-01

    Ab initio potentials are implemented into the direct simulation Monte Carlo (DSMC) method. Such an implementation allows us to model transport phenomena in rarefied gases without any fitting parameter of intermolecular collisions usually extracted from experimental data. Applying the method proposed by Sharipov and Strapasson [Phys. Fluids 24, 011703 (2012)], the use of ab initio potentials in the DSMC requires the same computational efforts as the widely used potentials such as hard spheres, variable hard sphere, variable soft spheres, etc. At the same time, the ab initio potentials provide more reliable results than any other one. As an example, the transport coefficients of a binary mixture He-Ar, viz., viscosity, thermal conductivity, and thermal diffusion factor, have been calculated for several values of the mole fraction. PMID:23030889

  8. Study on the Mechanical and Friction Properties of Ethylene Propylene Diene Terpolymer/Vinyl Silicon Rubber Foam Materials%三元乙丙橡胶/乙烯基硅橡胶泡沫材料的力学性能与摩擦性能研究

    雷卫华; 罗世凯; 花成; 王晓英

    2013-01-01

    The mechanical and friction properties of the foam materials of ethylene propylene diene terpolymer/ vinyl silicone rubber blend were studied. The results show that, while the vinyl silicone rubber content increasing, the hardness, tensile strength and compressive modulus at break of the rubber foams were decreased, the coefficient of friction (COF) was initially reduced, and then increased. While the testing temperature and pressure increasing, the COF of the foam materials reduced. The COF of the foam materials increased while the dosage of processing oil increasing and curative reducing.%研究了三元乙丙橡胶/乙烯基硅橡胶泡沫材料的力学性能,并表征了泡沫的摩擦性能.实验结果表明,随着乙烯基硅橡胶的含量增加,泡沫材料的硬度、拉伸强度和压缩模量呈下降的趋势,而静摩擦系数先下降后轻微上升;随着正压力和温度的升高,橡胶泡沫材料的静摩擦系数逐渐减小;随着硫化剂用量的减小和操作油用量的增加,橡胶泡沫的静摩擦系数上升.

  9. Surface Modification of AB2. and AB5 Hydrogen Storage Alloy Electrodes by the Hot-Charging Treatment

    2001-01-01

    The effect of the hot-charging treatment on the performance ofAB2 and AB5 hydrogen storage alloy electrodes was investigated. The result showed that the treatment can markedly improve the voltage plateau ratio (VPR), the high rate discharge ability (HRDA), the diffusion coefficient of hydrogen DH and the discharge capacity of the AB2 hydrogen storage alloy electrode. The SEM analysis showed that the hot-charging treatment brings about a Ni-rich surface due to the dissolution of Zr oxides. It is also very helpful for the improvement of the kinetic properties of AB2 hydrogen storage alloy electrode because the microcracking o.f the surface results in fresh surface. This can be the basic modification treatment for NiMH battery used in electric vehicles (EVs) in the future. But for AB5 type alloys, the treatment has the disadvantage of impairing the comprehensive electrochemical properties, because the surface of the alloy may be corroded during the treatment. The mechanism of the surface modification of the electrode is also proposed.

  10. Stimulation of UvrD helicase by UvrAB.

    Atkinson, John; Guy, Colin P; Cadman, Chris J; Moolenaar, Geri F; Goosen, Nora; McGlynn, Peter

    2009-04-01

    Helicases play critical roles in all aspects of nucleic acid metabolism by catalyzing the remodeling of DNA and RNA structures. UvrD is an abundant helicase in Escherichia coli with well characterized functions in mismatch and nucleotide excision repair and a possible role in displacement of proteins such as RecA from single-stranded DNA. The mismatch repair protein MutL is known to stimulate UvrD. Here we show that the nucleotide excision repair proteins UvrA and UvrB can together stimulate UvrD-catalyzed unwinding of a range of DNA substrates containing strand discontinuities, including forked DNA substrates. The stimulation is specific for UvrD, as UvrAB failed to stimulate Rep helicase, a UvrD homologue. Moreover, although UvrAB can promote limited strand displacement, stimulation of UvrD did not require the strand displacement function of UvrAB. We conclude that UvrAB, like MutL, modulate UvrD helicase activity. This stimulation likely plays a role in DNA strand and protein displacement by UvrD in nucleotide excision repair. Promotion of UvrD-catalyzed unwinding of nicked duplexes by UvrAB may also explain the need for UvrAB and UvrD in Okazaki fragment processing in cells lacking DNA polymerase I. More generally, these data support the idea that helicase activity is regulated in vivo, with helicases acting as part of multisubunit complexes rather than in isolation. PMID:19208629

  11. Bruksmakt och maktbruk : Robertsfors AB 1897-1968

    Holmström, Per

    1988-01-01

    This thesis studies seven strategic decisions made in the family-owned forestry company Robertsfors AB, in Northern Sweden. During the present century Ro­bertsfors AB has developed from a patriarchally concern controlled into a capi­talistic industrial company. This also meant a radical change in the decision­making process. Two factors were decisive in this process: the managing direc­tor's values, and altered power relationships both within the company and exter­nally in relation to e g sta...

  12. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1962. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses (≥ 100 mrem/quarter) is for the whole of AB Atomenergi during this year 74. 2 manrem corresponding to about 50 mrem/year and person or 1 % of the maximum permissible dose. 32500 gamma films and 6200 neutron films have been evaluated. The total number of urine analyses is 2700 and of whole body measurements 10

  13. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1963. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses during the year is for AB Atomenergi 64.2 manrem which, distributed over the whole company personnel, corresponds to about 40 mrem per year and person or about 1 % of the maximum permissible dose. 37800 gamma films and 6700 neutron films have been evaluated. The total number of urine analyses is 3603 and of whole body measurements 211

  14. Intern kontroll : - En studie om Schroff Scandinavia ABs interna kontroll

    Huldt, Martin; Björksved, Patrick

    2014-01-01

    Sammanfattning: ”Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll” Datum:  2014-06-11 Nivå: Kandidatuppsats i företagsekonomi, 15 ECTS Institution: Akademin för Ekonomi, Samhälle och Teknik, EST,                 Mälardalen Högskola Författare: Patrick Björksved, Martin Huldt Titel: Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll Handledare : Magnus Linderström Nyckelord: Intern kontroll, intern revision, intern styrning, COSO-modellen, Lean product...

  15. Simplest AB-Thermonuclear Space Propulsion and Electric Generator

    Bolonkin, Alexander

    2007-01-01

    The author applies, develops and researches mini-sized Micro- AB Thermonuclear Reactors for space propulsion and space power systems. These small engines directly convert the high speed charged particles produced in the thermonuclear reactor into vehicle thrust or vehicle electricity with maximum efficiency. The simplest AB-thermonuclear propulsion offered allows spaceships to reach speeds of 20,000 50,000 km/s (1/6 of light speed) for fuel ratio 0.1 and produces a huge amount of useful elect...

  16. Utveckling av ergoterapitjänster vid Helsingfors ergoterapi Ab

    Sandells, Linn

    2015-01-01

    Syftet med examensarbetet är att ta fram kvalitativa rekommendationer på ergoterapitjänster för barn i behov av särskilt stöd. Det har gjorts genom en processinriktad metod, rekommendationerna på ergoterapitjänster har tagits fram för Helsingfors ergoterapi Ab. Aktivitetsrättvisa är den teoretiska referensramen i arbetet. Den frågeställning som besvarats är vilka ergoterapitjänster kan rekommenderas till Helsingfors ergoterapi Ab. För att uppnå resultatet har materialinsamling och intervjuer ...

  17. Towards new horizons in ab initio nuclear structure theory

    We review recent advances in ab initio nuclear structure theory, which have changed the horizons of this field. Starting from chiral effective field theory to construct the nuclear Hamiltonian and the similarity renormalization group to further soften it, we address several many-body approaches that have seen major developments over the past few years. We show that the domain of ab initio nuclear structure theory has been pushed well beyond the p-shell and that quantitative QCD-based predictions are becoming possible all the way from the proton to the neutron drip line up into the medium-mass regime. (authors)

  18. Use of ab initio quantum chemical methods in battery technology

    Deiss, E. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1997-06-01

    Ab initio quantum chemistry can nowadays predict physical and chemical properties of molecules and solids. An attempt should be made to use this tool more widely for predicting technologically favourable materials. To demonstrate the use of ab initio quantum chemistry in battery technology, the theoretical energy density (energy per volume of active electrode material) and specific energy (energy per mass of active electrode material) of a rechargeable lithium-ion battery consisting of a graphite electrode and a nickel oxide electrode has been calculated with this method. (author) 1 fig., 1 tab., 7 refs.

  19. P-V Relation for Mercuric Calcogenides: Ab Initio Method

    G. Misra

    2011-01-01

    Full Text Available Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P, volume (V and temperature (T that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This ab initio method is extended to derive the equation of state for Mercuric Calcogenides. The present equation of state has also been tested for the prediction of End Point. The computed results compare well with Quantum statistical data.

  20. The optimal placement of up and ab – a comparison

    Dehé, Nicole

    2005-01-01

    The particle verb construction (PVC), also referred to in the literature as phrasal verb or separable complex verb, occurs in most if not all of the Germanic languages. The work presented here deals with a comparison of the transitive PVC in English and German. In English, the construction occurs in two alternating word orders (They called off the concert vs. They called the concert off ). In German, on the other hand, only one order is possible (Sie sagten das Konzert ab vs. *Sie sagten ab das...

  1. Recent achievements in ab initio modelling of liquid water

    Khaliullin, Rustam Z

    2013-01-01

    The application of newly developed first-principle modeling techniques to liquid water deepens our understanding of the microscopic origins of its unusual macroscopic properties and behaviour. Here, we review two novel ab initio computational methods: second-generation Car-Parrinello molecular dynamics and decomposition analysis based on absolutely localized molecular orbitals. We show that these two methods in combination not only enable ab initio molecular dynamics simulations on previously inaccessible time and length scales, but also provide unprecedented insights into the nature of hydrogen bonding between water molecules. We discuss recent applications of these methods to water clusters and bulk water.

  2. Aceitabilidade de flocos desidratados de abóbora Dehydrated pumpkin flakes acceptability

    Carmem Lygia Burgos Ambrósio

    2006-02-01

    Full Text Available OBJETIVO: Avaliar a aceitabilidade de flocos desidratados de abóbora, uma vez que tal produto pode constituir uma alternativa no combate à hipovitaminose A. MÉTODOS: Os flocos foram avaliados quanto às características microbiológicas, por meio das análises de coliformes a 45ºC, Escherichia coli, Staphylococcus aureus, Salmonela sp, contagem de bolores e leveduras, e características físico-químicas, por meio da análise de umidade, proteínas, lipídios, cinzas, fibra alimentar, carboidratos, carotenóides, estabilidade ao longo do tempo de armazenamento e aceitabilidade dos flocos adicionados ao feijão e ao pirão de 188 adultos e 67 crianças, respectivamente. RESULTADOS: Os flocos estavam adequados quanto às características microbiológicas e físico-químicas e os percentuais de aceitação de 95,21% para os adultos e 95,52% para as crianças. CONCLUSÃO: Os flocos desidratados de abóbora podem ser utilizados em larga escala para o estudo do efeito deste produto no combate à hipovitaminose A.OBJECTIVE: The objective of this study was to evaluate the acceptability of flakes since this product can be an alternative in the fight against hypovitaminosis A. METHODS: The flakes were evaluated through analyses of coliforms at 45ºC, Escherichia coli, Staphylococcus aureus, Salmonela sp; counting of yeasts and molds; analysis of moisture, proteins, lipids, ash, dietary fibers, carbohydrates and carotenoids; storage stability; and acceptability of flakes added to beans and "pirão" (a widely consumed Brazilian dish consisting of meat and vegetable broth and cassava flour by 188 adults and 67 children. RESULTS: The microbiological and physical-chemical characteristics of the flakes were adequate and the acceptability percentages were 95.21% for adults and 95.52% for children. CONCLUSION: Dehydrated pumpkin flakes can be used in large scale to determine its effectiveness in the fight against hypovitaminosis A.

  3. Flocos desidratados de abóbora na prevenção da carência de vitamina A em pré-escolares de uma creche

    Carmem Lygia Burgos Ambrósio

    2012-02-01

    Full Text Available OBJETIVO: Esta pesquisa teve como objetivo avaliar a eficácia de flocos desidratados de abóbora na elevação dos níveis séricos de retinol e a resposta relativa à dose em pré-escolares. MÉTODOS: A ingestão de vitamina A foi avaliada por meio de inquérito dietético. Os flocos foram analisados quanto às características microbiológicas e ao conteúdo de carotenoides. As crianças estudadas receberam diariamente 6g do produto no almoço, durante 90 dias. Elas foram submetidas ao teste de resposta relativa à dose no início e no final do estudo. Amostras de sangue foram colhidas em jejum, para análise do retinol sérico por espectro-fotometria, no início do estudo, aos 30 dias de consumo e aos 90 dias. RESULTADOS: Quanto às análises microbiológicas, os flocos encontravam-se adequados para consumo. O nível médio de retinol sérico nas crianças aumentou de M=1,438, DP=0,45µmol/L (tempo 0 para M=1,659, DP=0,51µmol/L (30 dias e M=1,928, DP=0,70µmol/L (90 dias. No início do estudo, 18,5% das crianças apresentavam níveis de retinol sérico abaixo do ponto de corte de 1,05µmol/L, proporção que caiu para 7,6% depois de 30 dias e para 0% após 90 dias. No final do período de estudo (90 dias nenhuma criança apresentou resposta relativa à dose positiva. CONCLUSÃO: Os flocos de abóbora são eficazes na elevação do retinol sérico e na reserva hepática da vitamina em pré-escolares.

  4. Comparative study of intact A7 MoAb and F(ab')2 fragments for radioimmunoimaging of human colon cancer in nude mice

    Differences of pharmacokinetics and tumor imaging ability between intact monoclonal antibody A7 (A7 MoAb) and F(ab')2 fragments were studied in human colon cancer (LS-174T)-bearing nude mouse. First of all, we examined the yield and the immunoreactivity of F(ab')2 fragments after treatment with ficin as a function of time. The yield of F(ab')2 fragments reached about 50% after ficin treatment for 8 h, and the F(ab')2 retained about 80% of the immunoreactivity of the corresponding MoAb. Longer digestion with ficin produced smaller fragments (less than 92 kDa) with a lower yield and most of the immunoreactivity was lost. In pharmacokinetics studies, the F(ab')2 was preferentially taken up by the tumor, was cleared more rapidly from the blood circulation and seemed to have less non-specific tissue binding than intact A7 MoAb. In addition, the tumor image obtained at an early time using 131I-F(ab')2 was much superior in quality to that with intact 131I-A7 MoAb. The use of F(ab')2 fragments may be effective for tumor diagnosis and therapy. (author)

  5. GJ 282 AB (WDS 07400-0336 AB = BGH 3 AB) and GICLAS 112-29: A Very Wide System in Process of Dissociation

    Rica, F. M.; Benavides, R.

    2016-04-01

    Very wide binaries are interesting objects that shed light on the binary formation process and their dynamical evolution. Poveda et al. (2009) studied the possible physical relation of the near (14.2 pc) and wide (~58") binary star GJ 282 AB and the extremely wide (1.09º; ~55,000 AU) companion, NLTT 18149, and they concluded that this very wide system is in the process of dynamical disintegration. In this work, we confirm the same conclusion but using a different method. We first study dynamically GJ 282 AB, confirmed that it is a bound system and then we determine possible orbital solutions. Later, we calculate the relative velocity of NLTT 18149 with respect to the GJ 282 AB's center mass using their (U, V, W) galactocentric velocity. The relative velocity, Vrel = 1.98 ± 0.16 km s-1, is much larger than the escape velocity (0.25 ± 0.01 km s-1). Therefore, with a significance level of 11s, we also conclude that this very wide system is in a process of dynamical disintegration.

  6. Estudo sobre reciclagem de lâmpadas fluorescentes

    Danniele Miranda Bacila; Klaus Fischer; Mônica Beatriz Kolicheski

    2014-01-01

    Lâmpadas fluorescentes (LF) contêm mercúrio em sua composição, um metal pesado que pode causar danos à saúde e ao meio ambiente. As LF são amplamente consumidas no Brasil, porém o descarte correto de LF usadas não é amplamente divulgado e os índices de reciclagem são baixos. O objetivo deste estudo foi demonstrar a relevância do descarte adequado, avaliar as tecnologias de reciclagem e a destinação dos materiais, por meio de estudo comparativo entre Brasil e Alemanha. Através de visitas a rec...

  7. Ab initio study of phase equilibria in TiCx

    Korzhavyi, P.A.; Pourovskii, L.V.; Hugosson, H.W.;

    2002-01-01

    The phase diagram for the vacancy-ordered structures in the substoichiometric TiCx (x = 0.5-1.0) has been established from Monte Carlo simulations with the long-range pair and multisite effective interactions obtained from ab initio calculations. Three ordered superstructures of vacancies (Ti2C, ...

  8. Ab initio calculations of mechanical properties: Methods and applications

    Pokluda, J.; Černý, Miroslav; Šob, Mojmír; Umeno, Y.

    2015-01-01

    Roč. 73, AUG (2015), s. 127-158. ISSN 0079-6425 R&D Projects: GA ČR(CZ) GAP108/12/0311 Institutional support: RVO:68081723 Keywords : Ab initio methods * Elastic moduli * Intrinsic hardness * Stability analysis * Theoretical strength * Intrinsic brittleness/ductility Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 27.417, year: 2014

  9. Discovery of New Substrates for LuxAB Bacterial Bioluminescence.

    Jiang, Tianyu; Wang, Weishan; Wu, Xingkang; Wu, Wenxiao; Bai, Haixiu; Ma, Zhao; Shen, Yuemao; Yang, Keqian; Li, Minyong

    2016-08-01

    In this article, four novel substrates with long halftime have been designed and synthesized successfully for luxAB bacterial bioluminescence. After in vitro and in vivo biological evaluation, these molecules can emit obvious bioluminescence emission with known bacterial luciferase, thus indicating a new promising approach to developing the bacterial bioluminescent system. PMID:26896339

  10. Cyanogen Azide. Ionization Potentials and Ab Initio SCF MO Calculation

    Bak, Börge; Jansen, Peter; Stafast, Herbert

    1975-01-01

    The Ne(I) and He(I) photoelectron(PE) spectra of cyanogen azide, NCN3, have been recorded at high resolution. Their interpretation is achieved by comparison with the PE spectrum of HN3 and an ab initio LCGO SCF MO calculation. Deviations from Koopmans' theorem of quite different magnitudes are fo...

  11. Relaxation of Small Molecules: an ab initio Study

    CAO Yi-Gang; JIAO Zheng-Kuan; A. Antons; K. Schroeder; S. Blügel2

    2002-01-01

    Using an ab initio total energy and force method, we have relaxed several group IV and group V elementalclusters, in detail the arsenic and antimony dimers, silicon, phosphorus, arsenic and antimony tetramers. The obtainedbond lengths and cohesive energies are more accurate than other calculating methods, and in excellent agreement withthe experimental results.

  12. Relaxation of Small Molecules:an ab initio Study

    CAOYi-Gang; A.Antons; 等

    2002-01-01

    Using an ab inito total energy and force method,we have relaxed several group IV and group V elemental clusters,in detail the arsenic and antimony dimers,silicon,phosphorus,arsenic and antimony tetraners,The obtained bond lengths and cohesive energies are more accurate than other calculating methods,and in excellent agreement with the experimental results.

  13. Ultra-Low Voltage Class AB Switched Current Memory Cell

    Igor, Mucha

    1996-01-01

    This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process with...

  14. Environmentally friendly process for nickel electroplating of ABS

    Bazzaoui, M.; Martins, J. I.; Bazzaoui, E. A.; Albourine, A.

    2012-08-01

    Nickel electroplating of acrylonitrile butadiene styrene (ABS) plastic has been achieved successfully without any chromium or palladium pretreatment. Once the ABS is coated with polypyrrole (PPy), the sample may be electroplated. The process is fast, economic and involves three stages. Firstly, chemical deposition of PPy on ABS, secondly, copper deposition and finally nickel electroplating. A homogenous and adherent PPy has been synthesized chemically on ABS plate by using pyrrole as monomer and iron (III) chloride as oxidant. Copper and nickel were deposited galvanostatically from industrial plating baths. The metallic coatings were homogeneous and the adherence was estimated at 100%. The thickness of copper and nickel depend on the electrolysis time. As the current density increases, the Cu and Ni thickness raises. This result was confirmed from SEM characterization and RX map. The Ni coating is characterized by a globular structure with globules of different sizes. Energy dispersive X-ray spectroscopy (EDS) analysis shows the presence of Ni with some amount of carbon and oxygen due to the nickel oxides and contaminant from the bath solution.

  15. A-B Distinction in a Sample of Prominent Psychotherapists

    Geller, Jesse D.; Berzins, Juris I.

    1976-01-01

    A sample of prominent psychotherapists were asked to fill out the A-B therapist "type" scale and comment on their possible differential effectiveness in treating schizoid/schizophrenic versus neurotic patients. The data suggest that B therapists desire and seek more complex and exciting sensory-cognitive inputs during therapy hours than A…

  16. AB 1725 Model Accountability System. California Community Colleges. Revised.

    California Community Colleges, Sacramento. Board of Governors.

    This report proposes a model accountability system for the California community colleges to comply with the directives of Assembly Bill 1725 (AB 1725). The purpose of the accountability system is to provide colleges and districts, the board of governors, and the California legislature with information that will allow for the continued improvement…

  17. Frequência dos antígenos eritrocitários do sistema AB em felinos domésticos no estado da Paraíba

    2013-01-01

    Objetivou-se com este estudo determinar a frequência de antígenos eritrocitários do sistema AB em felinos domésticos da Paraíba, Brasil. Foram selecionados aleatoriamente 178 gatos, clinicamente saudáveis, sem pré-requisitos quanto a sexo ou raça, com peso corporal acima de 1,5 kg e faixa etária acima de um ano de idade, abordados no ato da consulta ambulatorial em clínicas médicas de pequenos animais distribuídas entre três cidades da Paraíba (João Pessoa, Campina Grande e Patos). A determin...

  18. Protective mAbs and Cross-Reactive mAbs Raised by Immunization with Engineered Marburg Virus GPs.

    Marnie L Fusco

    2015-06-01

    Full Text Available The filoviruses, which include the marburg- and ebolaviruses, have caused multiple outbreaks among humans this decade. Antibodies against the filovirus surface glycoprotein (GP have been shown to provide life-saving therapy in nonhuman primates, but such antibodies are generally virus-specific. Many monoclonal antibodies (mAbs have been described against Ebola virus. In contrast, relatively few have been described against Marburg virus. Here we present ten mAbs elicited by immunization of mice using recombinant mucin-deleted GPs from different Marburg virus (MARV strains. Surprisingly, two of the mAbs raised against MARV GP also cross-react with the mucin-deleted GP cores of all tested ebolaviruses (Ebola, Sudan, Bundibugyo, Reston, but these epitopes are masked differently by the mucin-like domains themselves. The most efficacious mAbs in this panel were found to recognize a novel "wing" feature on the GP2 subunit that is unique to Marburg and does not exist in Ebola. Two of these anti-wing antibodies confer 90 and 100% protection, respectively, one hour post-exposure in mice challenged with MARV.

  19. Preparation, biodistribution, and dosimetry of 188Re-Labeled MoAb ior cea1 and its f(ab')2 fragments by avidin-biotin strategy

    The biotinylated monoclonal antibody (MoAb) ior cea1 and its F(ab')2 fragments were labeled with Re-188 by combination of avidin-biotin strategy. 188Re-MoAb, 188Re-MoAb-biotin, 188Re-F(ab')2, and 188Re-F(ab')2-biotin preparations were produced for these studies with specific activities of 1.30±0.18 GBq/mg and from instant freeze-dried kit formulations using ethane-1-hydroxy-1,1-diphosphonic acid (EHDP) as a weak competing ligand. There were no significant differences (p>0.05) between the biodistribution in mice of biotinylated and unbiotinylated 188Re-labeled immunoconjugates. When avidin was injected as a chase after injection of 188Re-MoAb-biotin or 188Re-F(ab')2-biotin, the blood radioactivity level decreased approximately 75% (cumulated activity) and the effective dose decreased almost 25% with respect to that of the radioimmunoconjugates in which the chase effect was not used. Our results suggest that 188Re-labeled biotinylated MoAb ior cea1 and its F(ab')2 fragments prepared by this method are stable complexes in vivo

  20. Solar Powered Vapor Absorption System Using Propane And Alkylated Benzene Ab300 Oil

    Al-Dadah, R.K.; Jackson, G.; Rezk, Ahmed

    2011-01-01

    Abstract This paper describes experimental work on a solar assisted vapour absorption air conditioning system using Propane (refrigerant) and Alkylated Benzene (AB300?refrigeration lubrication oil, absorbent). Preliminary experiments to assess the miscibility of propane in various lubricating oils namely Shell Clavus oils 32 and 64 and Alkylated Benzene oils AB150 and AB300 indicated that Propane is most miscible in Alkylated Benzene AB300. The vapour absorption system is a single ...

  1. A Influência da Responsabilidade Social Corporativa na Imagem de Marca: Um Estudo em Empresas Brasileiras do Setor de Cosméticos

    Márcio Ribeiro da Fonseca

    2014-12-01

    Full Text Available 800x600 Este estudo tem como tema a influência da Responsabilidade Social Corporativa (RSC na imagem de marca (IM e na reputação corporativa (RC de empresas brasileiras do setor de cosméticos. O foco da pesquisa foi investigar a percepção dos consumidores universitários pertencentes às classes A/B sobre as ações de RSC de duas grandes empresas brasileiras de cosméticos. O objetivo foi comparar as percepções dos consumidores e apontar as diferenças entre as duas empresas. O desenvolvimento deste estudo ocorreu em duas etapas: a primeira etapa envolveu revisão bibliográfica, verificando as teorias e pesquisas publicadas sobre responsabilidade social corporativa, IM e RC. A segunda etapa envolveu a coleta de dados por meio de uma survey com consumidores de duas grandes empresas brasileiras de cosméticos que publicam relatórios sociais com metodologia GRI. Os resultados demonstraram que a RSC tem influência positiva na IM, porém tal influência demonstrou-se significativa apenas para uma das marcas estudadas, sendo moderada para a segunda. Entre as contribuições deste trabalho estão a revisão de literatura sobre o tema, os apontamentos da influência dos subconstrutos e variáveis da RSC na IM e RC e as diferenças da percepção do consumidor para cada uma das marcas estudadas, bem como as recomendações para estudos futuros. Normal 0 21 false false false PT-BR X-NONE X-NONE MicrosoftInternetExplorer4 Tenacificação do poli(ácido lático pela adição do terpolímero (etileno/acrilato de metila/metacrilato de glicidila Toughening of polylactide by melt blending with an (ethylene/methyl acrylate/glycidyl methacrylate terpolymer

    Gustavo F. Brito

    2012-01-01

    Full Text Available O poli(ácido lático é um polímero biodegradável proveniente de fontes renováveis com grande potencial para substituir polímeros não biodegradáveis provenientes do petróleo. Entretanto, seu uso em determinadas aplicações é restringido devido a sua elevada fragilidade e rigidez. Com o intuito de tornar o PLA mais tenaz, o terpolímero (etileno/acrilato de metila/metacrilato de glicidila -EMA-GMA foi adicionado ao PLA em diferentes concentrações. A adição do EMA-GMA tornou o PLA mais estável durante o processamento. Por FTIR comprovou-se a existência de reação química entre os grupos terminais do PLA e grupos do EMA-GMA. A partir dos ensaios mecânicos observou-se uma resistência ao impacto três vezes superior à do PLA puro.The Poly(lactic acid is a biodegradable polymer from renewable sources with potential to replace non-biodegradable polymers derived from petroleum. However its use is restricted in certain applications due to its high brittleness and rigidity. In order to make the PLA more tenacious, the terpolymer (ethylene/methyl acrylate/glycidyl methacrylate - EMA-GMA was added to PLA in different concentrations. The addition of EMA-GMA to PLA turned the blends more stable during processing. The FTIR data confirmed the chemical reaction between groups in PLA and the EMA-GMA. A three fold increase was observed in the impact strength compared to pure PLA.

  2. Kostnadseffektivering av logistikkostnader : Rolls-Royce Oy Ab

    Nordlund, Lucas

    2013-01-01

    Rolls-Royce Oy Ab som fungerar som uppdragsgivare i detta examensarbete, är ett företag med internationell verksamhet. Företaget hör till det globala Rolls-Royce plc som verkar inom många olika delområden i länder runt om i hela världen. Enheten i Karleby verkar inom Rolls-Royce Marine koncernen och tillverkar vattenjetaggregat. I och med att Rolls-Royce Oy Ab hör till Marine koncernen, medför det att man följer bestämmelser och standarder som följs i hela Marine koncernen. Till dessa gem...

  3. Ab-initio calculations on melting of thorium

    Mukherjee, D.; Sahoo, B. D.; Joshi, K. D.; Kaushik, T. C.; Gupta, Satish C.

    2016-05-01

    Ab-initio molecular dynamics study has been performed on face centered cubic structured thorium to determine its melting temperature at room pressure. The ion-electron interaction potential energy calculated as a function of temperature for three volumes (a0)3 and (1.02a0)3 and (1.04a0)3 increases gradually with temperature and undergoes a sharp jump at ~2200 K, ~2100 K and ~1800 K, respectively. Here, a0 = 5.043 Å is the equilibrium lattice parameter at 0 K obtained from ab-initio calculations. These jumps in interaction energy are treated as due to the onset of melting and corresponding temperatures as melting point. The melting point of 2100 K is close to the experimental value of 2023K. Further, the same has been verified by plotting the atomic arrangement evolved at various temperatures and corresponding pair correlation functions.

  4. Chemical and Electrochemical Metallic Covering of ABS polymers

    Florentina Cziple

    2009-10-01

    Full Text Available The aim of this paper is the deposition of metallic layers on the surface of ABS plastic material, by means of two consecutive procedures, namely: the first is represented by the conductibility through chemical or electro-chemical metallic covering of the polymeric support and the second procedure is the electrodeposition of the metal through galvanization. The chemical mehtod consists in the submission of ABS polymers to some conductibility operations of the plastic material surface through chemical copper plating (chemical roughing, degreasing with ultra-sounds, chemical sensitivation, activation and proper conductibility of the material surface. The electrochemical deposition of nickel was made on the plastic material activated in the mixture solution of graphite with potassium carbonate.

  5. Ab Initio Nuclear Structure Theory: From Few to Many

    We summarize recent advances in ab initio nuclear structure theory, aiming to connect few- and many-body systems in a coherent theoretical framework. Starting from chiral effective field theory to construct the nuclear Hamiltonian and the similarity renormalization group to soften it, we address several many-body approaches that have seen major developments over the past few years. We show that the domain of ab initio nuclear structure theory has been pushed well beyond the p-shell and that quantitative predictions connected to QCD via chiral effective field theory are becoming possible all the way from the proton to the neutron drip line up into the medium-mass regime. (author)

  6. Serine Proteases an Ab Initio Molecular Dynamics Study

    De Santis, L

    1999-01-01

    In serine proteases (SP's), the H-bond between His-57 and Asp-102, and that between Gly-193 and the transition state intermediate play a crucial role for enzymatic function. To shed light on the nature of these interactions, we have carried out ab initio molecular dynamics simulations on complexes representing adducts between the reaction intermediate and elastase (one protein belonging to the SP family). Our calculations indicate the presence of a low--barrier H-bond between His-57 and Asp-102, in complete agreement with NMR experiments on enzyme--transition state analog complexes. Comparison with an ab initio molecular dynamics simulation on a model of the substrate--enzyme adduct indicates that the Gly-193--induced strong stabilization of the intermediate is accomplished by charge/dipole interactions and not by H-bonding as previously suggested. Inclusion of the protein electric field in the calculations does not affect significantly the charge distribution.

  7. Understanding phonon transport in thermoelectric materials using ab initio approaches

    Broido, David

    Good thermoelectric materials have low phonon thermal conductivity, kph. Accurate theories to describe kph are important components in developing predictive models of thermoelectric efficiency that can help guide synthesis and measurement efforts. We have developed ab initio approaches to calculate kph, in which phonon modes and phonon scattering rates are computed using interatomic force constants determined from density functional theory, and a full solution of the Boltzmann transport equation for phonons is implemented. A recent approach to calculate interatomic force constants using ab initio molecular dynamics has yielded a good description of the thermal properties of Bi2Te3. But, the complexity of new promising candidate thermoelectric materials introduces computational challenges in assessing their thermal properties. An example is germanane, a germanium based hydrogen-terminated layered semiconductor, which we will discuss in this talk.

  8. The density matrix renormalization group for ab initio quantum chemistry

    Wouters, Sebastian

    2014-01-01

    During the past 15 years, the density matrix renormalization group (DMRG) has become increasingly important for ab initio quantum chemistry. Its underlying wavefunction ansatz, the matrix product state (MPS), is a low-rank decomposition of the full configuration interaction tensor. The virtual dimension of the MPS, the rank of the decomposition, controls the size of the corner of the many-body Hilbert space that can be reached with the ansatz. This parameter can be systematically increased until numerical convergence is reached. The MPS ansatz naturally captures exponentially decaying correlation functions. Therefore DMRG works extremely well for noncritical one-dimensional systems. The active orbital spaces in quantum chemistry are however often far from one-dimensional, and relatively large virtual dimensions are required to use DMRG for ab initio quantum chemistry (QC-DMRG). The QC-DMRG algorithm, its computational cost, and its properties are discussed. Two important aspects to reduce the computational co...

  9. Augmented wave ab initio EFG calculations: some methodological warnings

    Errico, Leonardo A. [Departamento de Fisica-IFLP (CONICET), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CC67 (1900) La Plata (Argentina); Renteria, Mario [Departamento de Fisica-IFLP (CONICET), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CC67 (1900) La Plata (Argentina); Petrilli, Helena M. [Instituto de Fisica-DFMT, Universidade de Sao Paulo, C.P. 66318, 05315-970 Sao Paulo, SP (Brazil)]. E-mail: hmpetril@macbeth.if.usp.br

    2007-02-01

    We discuss some accuracy aspects inherent to ab initio electronic structure calculations in the understanding of nuclear quadrupole interactions. We use the projector augmented wave method to study the electric-field gradient (EFG) at both Sn and O sites in the prototype cases SnO and SnO{sub 2}. The term ab initio is used in the standard context of the also called first principles methods in the framework of the Density Functional Theory. As the main contributions of EFG calculations to problems in condensed matter physics are related to structural characterizations on the atomic scale, we discuss the 'state of the art' on theoretical EFG calculations and make a brief critical review on the subject, calling attention to some fundamental theoretical aspects.

  10. Augmented wave ab initio EFG calculations: some methodological warnings

    We discuss some accuracy aspects inherent to ab initio electronic structure calculations in the understanding of nuclear quadrupole interactions. We use the projector augmented wave method to study the electric-field gradient (EFG) at both Sn and O sites in the prototype cases SnO and SnO2. The term ab initio is used in the standard context of the also called first principles methods in the framework of the Density Functional Theory. As the main contributions of EFG calculations to problems in condensed matter physics are related to structural characterizations on the atomic scale, we discuss the 'state of the art' on theoretical EFG calculations and make a brief critical review on the subject, calling attention to some fundamental theoretical aspects

  11. Der halbunendliche Kristall - Elektronische und optische Eigenschaften ab-initio

    Brodersen, Sven

    2002-01-01

    Es werden die elektronischen und optischen Eigenschaften eines kristallinen Festkörpers unter Berücksichtigung der Oberfläche mit ab-initio Methoden berechnet. Die Behandlung der Oberflächeneffekte in einer Halbraum-Geometrie erzwingt die Darstellung der Wellenfunktionen und der Dielektrischen Funktion (DK) in einer lokalen Basis. Anhand von Volumenkristallen wird die Effizienz von LCAO- Basisfunktionen demonstriert. Die Erweiterung der atomaren Orbitale mit unbesetzten Orbitalen und 'off-sit...

  12. Ab initio simulation of helium inside carbon nanotubes

    In present work we consider the complex behaviour of quantum liquids like liquid He-4 inside carbon nanotubes. Interactions between helium atoms and carbon atoms of the short-length atomistic model and model with periodical boundary conditions of carbon nanotube were studied via ab initio quantum simulations. Effects of geometrical confinement of the tube on the He behaviour inside CNT (13,0) have been explored. Nanotubes with typical average diameter of 10 angstroms are under consideration.

  13. The density matrix renormalization group for ab initio quantum chemistry

    Wouters, Sebastian

    2015-01-01

    During the past 15 years, the density matrix renormalization group (DMRG) has become increasingly important for ab initio quantum chemistry. It is used as a numerically exact solver for highly correlated regions in molecules. While the method works extremely well for one-dimensional systems, the correlated regions of interest are often far from one-dimensional. In this introductory talk, I will discuss the DMRG algorithm from a quantum information perspective, how quantum information theory h...

  14. Ab Initio Modeling of Ecosystems with Artificial Life

    Adami, C.

    2002-01-01

    Artificial Life provides the opportunity to study the emergence and evolution of simple ecosystems in real time. We give an overview of the advantages and limitations of such an approach, as well as its relation to individual-based modeling techniques. The Digital Life system Avida is introduced and prospects for experiments with ab initio evolution (evolution "from scratch"), maintenance, as well as stability of ecosystems are discussed.

  15. P-V Relation for Mercuric Calcogenides: Ab Initio Method

    G. Misra; S. Tenguria; Gautam, M.

    2011-01-01

    Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P), volume (V) and temperature (T) that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This a...

  16. Erythema Ab Igne in Three Girls with Anorexia Nervosa.

    Dessinioti, Clio; Katsambas, Andreas; Tzavela, Eleni; Karountzos, Vasileios; Tsitsika, Artemis K

    2016-03-01

    We present three girls with the eating disorder anorexia nervosa (AN) presenting with erythema ab igne (EAI), a benign, reticular, erythematous dermatosis caused by repeated prolonged skin exposure to mild heat. AN has been associated with abnormal peripheral vascular response to cold, vasoconstriction of the limbs, low hand blood flow, exaggerated response to cold stimuli, subnormal core temperature, and a general feeling of cold that may encourage prolonged heat exposure and induce EAI. PMID:26822102

  17. Structure models: from shell model to ab initio methods

    Bacca, Sonia

    2016-01-01

    A brief review of models to describe nuclear structure and reactions properties is presented, starting from the historical shell model picture and encompassing modern ab initio approaches. A selection of recent theoretical results on observables for exotic light and medium-mass nuclei is shown. Emphasis is given to the comparison with experiment and to what can be learned about three-body forces and continuum properties.

  18. Ab-initio calculations for dilute magnetic semiconductors

    Belhadji, Brahim

    2008-01-01

    This thesis focusses on ab-initio calculations for the electronic structure and the magnetic properties of dilute magnetic semiconductors (DMS). In particular we aim at the understanding of the complex exchange interactions in these systems. Our calculations are based on density functional theory, being ideally suited for a description of the material specific properties of the considered DMS. Moreover we use the KKR Green function method in connection with the coherent potential approximatio...

  19. Integrated Design of Antibodies for Systems Biology Using Ab Designer

    Pisitkun, Trairak; Dummer, Patrick; Somparn, Poorichaya; Hirankarn, Nattiya; Kopp, Jeffrey B.; Knepper, Mark A.

    2014-01-01

    In the current era of large-scale biology, systems biology has evolved as a powerful approach to identify complex interactions within biological systems. In addition to high throughput identification and quantification techniques, methods based on high-quality mono-specific antibodies remain an essential element of the approach. To assist the large-scale design and production of peptide-directed antibodies for systems biology studies, we developed a fully integrated online application, AbDesi...

  1. Innovativeness and innovations utilizations : Oy LM Ericsson Ab

    Saarinen, Vesa

    2010-01-01

    The aim of this action research was to improve the innovativeness amongst the R&D personnel at LM Ericsson Ab in Finland. The main purpose of this study was to understand the background of innovativeness and to practically compare the research results with the actual company situation. Innovativeness is predominantly a personal, internal matter and it is based on the intrinsic motivation of an individual. Creativity, courage and persistent effort are the key elements of innovativeness...

  2. Molexpl: a tool for ab initio data exploration and visualization

    Wang, Xueying; Onofrio, Nicolas,; Strachan, Alejandro

    2015-01-01

    Density functional theory (DFT) based on ab initio theory, is a powerful method to resolve the electronic structure of atoms, molecules and solids. However, in practical, DFT is limited to few hundreds of atoms. To overcome this limitation, researchers have developed empirical interatomic potentials implemented in molecular dynamics (MD) simulations. MD ignores the movements of electrons and describes bonding and non-bonding interaction as a function of the distance between atoms called force...

  3. Ab initio molecular dynamics simulation of laser melting of silicon

    Silvestrelli, P.-L.; Alavi, A; Parrinello, M.; Frenkel, D

    1996-01-01

    The method of ab initio molecular dynamics, based on finite temperature density functional theory, is used to simulate laser heating of crystal silicon. We have found that a high concentration of excited electrons dramatically weakens the covalent bond. As a result, the system undergoes a melting transition to a metallic state. In contrast to ordinary liquid silicon, the new liquid is characterized by a high coordination number and a strong reduction of covalent bonding effects.

  4. Towards an ab initio description of magnetism in ionic solids

    Illas, F.; Casanovas, J.; García-Bach, M. A.; Caballol, R.; Castell, O.

    1993-11-01

    The physical contributions to the KNiF3 magnetic exchange coupling integral have been obtained from specially designed ab initio cluster model calculations. Three important mechanisms have been identified. These are the delocalization of the magnetic orbitals into the anion ``p'' band, the variational contribution of the second-order interactions, and the many-body terms ``hidden'' in the two-body operator and the Heisenberg Hamiltonian.

  5. Social Media Marketing : CASE: OY SUOMEN LYYRA AB

    Eriksson, Irene

    2012-01-01

    This bachelor thesis was commissioned by Oy Suomen Lyyra Ab, the largest student online media and student card producer for higher education students in Finland. The the-sis objective was to understanding the current social media situation and activity among the students of higher education in Finland, the social media networks that the case company currently uses as well as understanding how to use these networks for successful marketing activities. The quantitative research was conducted in...

  6. GAUSSIAN 76: an ab initio molecular orbital program

    Binkley, J. S.; Whiteside, R.; Hariharan, P. C.; Seeger, R.; Hehre, W. J.; Lathan, W. A.; Newton, M. D.; Ditchfield, R.; Pople, J. A.

    1978-06-01

    Gaussian 76 is a general-purpose computer program for ab initio Hartree-Fock molecular orbital calculations. It can handle basis sets involving s, p and d-type gaussian functions. Certain standard sets (STO-3G, 4-31G, 6-31G*, etc.) are stored internally for easy use. Closed shell (RHF) or unrestricted open shell (UHF) wave functions can be obtained. Facilities are provided for geometry optimization to potential minima and for limited potential surface scans.

  7. GAUSSIAN 76: An ab initio Molecular Orbital Program

    Binkley, J. S.; Whiteside, R.; Hariharan, P. C.; Seeger, R.; Hehre, W. J.; Lathan, W. A.; Newton, M. D.; Ditchfield, R.; Pople, J. A.

    1978-01-01

    Gaussian 76 is a general-purpose computer program for ab initio Hartree-Fock molecular orbital calculations. It can handle basis sets involving s, p and d-type Gaussian functions. Certain standard sets (STO-3G, 4-31G, 6-31G*, etc.) are stored internally for easy use. Closed shell (RHF) or unrestricted open shell (UHF) wave functions can be obtained. Facilities are provided for geometry optimization to potential minima and for limited potential surface scans.

  8. TENDÊNCIAS DOS ESTUDOS COM PLANTAS MEDICINAIS NO BRASIL

    Fernanda Melo Carneiro

    2014-12-01

    Full Text Available As plantas medicinais são utilizadas pelo homem desde o início da história e atualmente empregadas como recursos na medicina alternativa por grande parte da população mundial. Esse uso deve-se à facilidade de acesso às plantas em relação aos medicamentos alopáticos. O objetivo deste trabalho foi, primariamente, desenvolver uma análise cienciométrica sobre as tendências dos estudos com plantas medicinais no Brasil, investigando se o número de trabalhos cresceu ao longo dos anos. Além disso, foi identificamos as principais plantas que são estudadas pelo seu principio medicinal no Brasil. Para a pesquisa foi empregada a base de dados Scielo, com artigos de 1995 a 2011, utilizando a palavra “Planta Medicinal” como palavra-chave. Foram avaliados 329 artigos, mas somente 265 foram compatíveis à pesquisa. Artigos que não foram desenvolvidos no Brasil; que não utilizaram o termo planta medicinal; ou não citaram plantas foram excluídos das análises. Em cada artigo selecionado foram coletadas as seguintes informações: título do artigo, quantidade de autores, instituições responsáveis pelo estudo, local das instituições, ano de publicação, tipo de estudo (ex.: farmacológico, agropecuário e ecológico e as plantas que foram estudadas. Por meio de análises desses dados foi possível verificar as tendências dos estudos com plantas medicinais no Brasil. Conforme esperado, a maior parte dos artigos avaliados estão voltados para a Farmacologia, com aplicação em diversas áreas da saúde e em segundo lugar a Agropecuária, devido ao interesse em desenvolver produtos a partir de plantas para o controle de pragas. Entretanto, verificou-se o emprego em outras áreas, como a Bioquímica, Botânica, Ecologia, Genética/Molecular e Educação que apesar de serem menos frequentes, são essenciais, pois os estudos com plantas medicinais requerem profissionais de múltiplas áreas. Além da investigação da medicina popular

  9. Ab initio nuclear structure - the large sparse matrix eigenvalue problem

    The structure and reactions of light nuclei represent fundamental and formidable challenges for microscopic theory based on realistic strong interaction potentials. Several ab initio methods have now emerged that provide nearly exact solutions for some nuclear properties. The ab initio no core shell model (NCSM) and the no core full configuration (NCFC) method, frame this quantum many-particle problem as a large sparse matrix eigenvalue problem where one evaluates the Hamiltonian matrix in a basis space consisting of many-fermion Slater determinants and then solves for a set of the lowest eigenvalues and their associated eigenvectors. The resulting eigenvectors are employed to evaluate a set of experimental quantities to test the underlying potential. For fundamental problems of interest, the matrix dimension often exceeds 1010 and the number of nonzero matrix elements may saturate available storage on present-day leadership class facilities. We survey recent results and advances in solving this large sparse matrix eigenvalue problem. We also outline the challenges that lie ahead for achieving further breakthroughs in fundamental nuclear theory using these ab initio approaches.

  10. Ab Initio Nuclear Structure and Reaction Calculations for Rare Isotopes

    Draayer, Jerry P. [Louisiana State Univ., Baton Rouge, LA (United States)

    2014-09-28

    We have developed a novel ab initio symmetry-adapted no-core shell model (SA-NCSM), which has opened the intermediate-mass region for ab initio investigations, thereby providing an opportunity for first-principle symmetry-guided applications to nuclear structure and reactions for nuclear isotopes from the lightest p-shell systems to intermediate-mass nuclei. This includes short-lived proton-rich nuclei on the path of X-ray burst nucleosynthesis and rare neutron-rich isotopes to be produced by the Facility for Rare Isotope Beams (FRIB). We have provided ab initio descriptions of high accuracy for low-lying (including collectivity-driven) states of isotopes of Li, He, Be, C, O, Ne, Mg, Al, and Si, and studied related strong- and weak-interaction driven reactions that are important, in astrophysics, for further understanding stellar evolution, X-ray bursts and triggering of s, p, and rp processes, and in applied physics, for electron and neutrino-nucleus scattering experiments as well as for fusion ignition at the National Ignition Facility (NIF).

  11. Studies on the runaway reaction of ABS polymerization process

    Hu, K.-H. [Department of Occupational Safety and Health, Jen-Teh Junior College of Medicine, Nursing and Management, Miaoli, Taiwan (China); Kao, C.-S. [Department of Safety, Health and Environmental Engineering, National United University, Taiwan (China); Duh, Y.-S. [Department of Occupational Safety and Health, Jen-Teh Junior College of Medicine, Nursing and Management, Miaoli, Taiwan (China)], E-mail: yihshingduh@yahoo.com.tw

    2008-11-15

    Taiwan has the largest acrylonitrile-butadiene-styrene (ABS) copolymer production in the world. Preventing on unexpected exothermic reactions and related emergency relief hazard is essential in the safety control of ABS emulsion polymerization. A VSP2 (Vent Sizing Package 2) apparatus is capable of studying both normal and abnormal conditions (e.g., cooling failure, mischarge, etc.) of industrial process. In this study, the scenarios were verified from the following abnormal conditions: loss of cooling, double charge of initiator, overcharge of monomer, without charge of solvent, and external fire. An external fire with constant heating will promote higher self-heat rate and this is recommended as the worst case scenario of emulsion polymerization on butadiene. Cooling failure coupled with bulk system of reactant was determined to be the credible worst case in ABS emulsion polymerization. Finally, the emergency vent sizing based on thermokinetics from VSP associated with DIERS methodology were used for evaluating the vent sizing and compared to that of the industrial plants.

  12. Ab initio calculations for industrial materials engineering: successes and challenges

    Wimmer, Erich; Freeman, Clive; Christensen, Mikael; Wolf, Walter; Saxe, Paul [Materials Design, Inc., PO Box 2000, Angel Fire, NM 87710 (United States); Najafabadi, Reza; Young Jr, George A; Ballard, Jake D; Angeliu, Thomas M; Vollmer, James [Knolls Atomic Power Laboratory, PO Box 1072, Schenectady, NY 12301-1072 (United States); Chambers, James J; Niimi, Hiroaki; Shaw, Judy B, E-mail: ewimmer@materialsdesign.co [Advanced CMOS, Texas Instruments Incorporated, Dallas, TX 75243 (United States)

    2010-09-29

    Computational materials science based on ab initio calculations has become an important partner to experiment. This is demonstrated here for the effect of impurities and alloying elements on the strength of a Zr twist grain boundary, the dissociative adsorption and diffusion of iodine on a zirconium surface, the diffusion of oxygen atoms in a Ni twist grain boundary and in bulk Ni, and the dependence of the work function of a TiN-HfO{sub 2} junction on the replacement of N by O atoms. In all of these cases, computations provide atomic-scale understanding as well as quantitative materials property data of value to industrial research and development. There are two key challenges in applying ab initio calculations, namely a higher accuracy in the electronic energy and the efficient exploration of large parts of the configurational space. While progress in these areas is fueled by advances in computer hardware, innovative theoretical concepts combined with systematic large-scale computations will be needed to realize the full potential of ab initio calculations for industrial applications.

  13. Ab initio calculations for industrial materials engineering: successes and challenges

    Computational materials science based on ab initio calculations has become an important partner to experiment. This is demonstrated here for the effect of impurities and alloying elements on the strength of a Zr twist grain boundary, the dissociative adsorption and diffusion of iodine on a zirconium surface, the diffusion of oxygen atoms in a Ni twist grain boundary and in bulk Ni, and the dependence of the work function of a TiN-HfO2 junction on the replacement of N by O atoms. In all of these cases, computations provide atomic-scale understanding as well as quantitative materials property data of value to industrial research and development. There are two key challenges in applying ab initio calculations, namely a higher accuracy in the electronic energy and the efficient exploration of large parts of the configurational space. While progress in these areas is fueled by advances in computer hardware, innovative theoretical concepts combined with systematic large-scale computations will be needed to realize the full potential of ab initio calculations for industrial applications.

  14. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as “cloning,” in analogy to the “spawning” procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, “trains,” as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions

  15. Converting of Matter to Nuclear Energy by AB-Generator

    Alexander Bolonkin

    2009-01-01

    Full Text Available Problem statement: Researcher offered a new nuclear generator which allowed to convert any matter to nuclear energy in accordance with Einstein equation E = mc2. The method was based upon tapping the energy potential of a Micro Black Hole (MBH and Hawking radiation created by this MBH. Researcher did not meet the idea and its research in literature to develop the method for getting a cheap energy. Approach: As is well-known, vacuum continuously produced virtual pairs of particles and antiparticles, in particular, photons and anti-photons. MBH event horizon allowed separating them. Anti-photons can be moved to MBH and be annihilated, decreasing mass of MBH, resulting photons leave the MBH neighborhood as Hawking radiation. The offered nuclear generator (named by Researcher as AB-generator utilized Hawking radiation and injected the matter into MBH and kept MBH in a stable state with near-constant mass. Results: AB-generator can be produced gigantic energy outputs and should be cheaper than a conventional electric station by a factor of hundreds of times. One also may be used in aerospace as a photon rocket or as a power source for many vehicles. Conclusion: Many scientists expect Large Hadron Collider at CERN may be produced one MBH every second. A technology to capture them may be developed; than they may be used for the AB-generator.

  16. Pressure tracking control of vehicle ABS using piezo valve modulator

    Jeon, Juncheol; Choi, Seung-Bok

    2011-03-01

    This paper presents a wheel slip control for the ABS(anti-lock brake system) of a passenger vehicle using a controllable piezo valve modulator. The ABS is designed to optimize for braking effectiveness and good steerability. As a first step, the principal design parameters of the piezo valve and pressure modulator are appropriately determined by considering the braking pressure variation during the ABS operation. The proposed piezo valve consists of a flapper, pneumatic circuit and a piezostack actuator. In order to get wide control range of the pressure, the pressure modulator is desired. The modulator consists of a dual-type cylinder filled with different substances (fluid and gas) and a piston rod moving vertical axis to transmit the force. Subsequently, a quarter car wheel slip model is formulated and integrated with the governing equation of the piezo valve modulator. A sliding mode controller to achieve the desired slip rate is then designed and implemented. Braking control performances such as brake pressure and slip rate are evaluated via computer simulations.

  17. Monte Carlo simulation of AB-copolymers with saturating bonds

    Chertovich, A V; Khokhlov, A R; Bohr, J

    2003-01-01

    Structural transitions in a single AB-copolymer chain where saturating bonds can be formed between A-and B-units are studied by means of Monte Carlo computer simulations using the bond fluctuation model. Three transitions are found, coil-globule, coil-hairpin and globule-hairpin, depending on the nature of a particular AB-sequence: statistical random sequence, diblock sequence and 'random-complementary' sequence (one-half of such an AB-sequence is random with Bernoulli statistics while the other half is complementary to the first one). The properties of random-complementary sequences are closer to those of diblock sequences than to the properties of random sequences. The model (although quite rough) is expected to represent some basic features of real RNA molecules, i.e. the formation of secondary structure of RNA due to hydrogen bonding of corresponding bases and stacking interactions of the base pairs in helixes. We introduce the notation of RNA-like copolymers and discuss in what sense the sequences studie...

  18. Ab Initio Nuclear Structure and Reaction Calculations for Rare Isotopes

    We have developed a novel ab initio symmetry-adapted no-core shell model (SA-NCSM), which has opened the intermediate-mass region for ab initio investigations, thereby providing an opportunity for first-principle symmetry-guided applications to nuclear structure and reactions for nuclear isotopes from the lightest p-shell systems to intermediate-mass nuclei. This includes short-lived proton-rich nuclei on the path of X-ray burst nucleosynthesis and rare neutron-rich isotopes to be produced by the Facility for Rare Isotope Beams (FRIB). We have provided ab initio descriptions of high accuracy for low-lying (including collectivity-driven) states of isotopes of Li, He, Be, C, O, Ne, Mg, Al, and Si, and studied related strong- and weak-interaction driven reactions that are important, in astrophysics, for further understanding stellar evolution, X-ray bursts and triggering of s, p, and rp processes, and in applied physics, for electron and neutrino-nucleus scattering experiments as well as for fusion ignition at the National Ignition Facility (NIF).

  19. A Complete and Accurate Ab Initio Repeat Finding Algorithm.

    Lian, Shuaibin; Chen, Xinwu; Wang, Peng; Zhang, Xiaoli; Dai, Xianhua

    2016-03-01

    It has become clear that repetitive sequences have played multiple roles in eukaryotic genome evolution including increasing genetic diversity through mutation, changes in gene expression and facilitating generation of novel genes. However, identification of repetitive elements can be difficult in the ab initio manner. Currently, some classical ab initio tools of finding repeats have already presented and compared. The completeness and accuracy of detecting repeats of them are little pool. To this end, we proposed a new ab initio repeat finding tool, named HashRepeatFinder, which is based on hash index and word counting. Furthermore, we assessed the performances of HashRepeatFinder with other two famous tools, such as RepeatScout and Repeatfinder, in human genome data hg19. The results indicated the following three conclusions: (1) The completeness of HashRepeatFinder is the best one among these three compared tools in almost all chromosomes, especially in chr9 (8 times of RepeatScout, 10 times of Repeatfinder); (2) in terms of detecting large repeats, HashRepeatFinder also performed best in all chromosomes, especially in chr3 (24 times of RepeatScout and 250 times of Repeatfinder) and chr19 (12 times of RepeatScout and 60 times of Repeatfinder); (3) in terms of accuracy, HashRepeatFinder can merge the abundant repeats with high accuracy. PMID:26272474

  20. Ab initio calculations of reactions with light nuclei

    Quaglioni, Sofia; Hupin, Guillaume; Calci, Angelo; Navrátil, Petr; Roth, Robert

    2016-03-01

    An ab initio (i.e., from first principles) theoretical framework capable of providing a unified description of the structure and low-energy reaction properties of light nuclei is desirable to further our understanding of the fundamental interactions among nucleons, and provide accurate predictions of crucial reaction rates for nuclear astrophysics, fusion-energy research, and other applications. In this contribution we review ab initio calculations for nucleon and deuterium scattering on light nuclei starting from chiral two- and three-body Hamiltonians, obtained within the framework of the ab initio no-core shell model with continuum. This is a unified approach to nuclear bound and scattering states, in which square-integrable energy eigenstates of the A-nucleon system are coupled to (A-a)+a target-plus-projectile wave functions in the spirit of the resonating group method to obtain an efficient description of the many-body nuclear dynamics both at short and medium distances and at long ranges.

  1. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    Makhov, Dmitry V.; Glover, William J.; Martinez, Todd J.; Shalashilin, Dmitrii V.

    2014-08-01

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as "cloning," in analogy to the "spawning" procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, "trains," as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions.

  2. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    Makhov, Dmitry V.; Shalashilin, Dmitrii V. [Department of Chemistry, University of Leeds, Leeds LS2 9JT (United Kingdom); Glover, William J.; Martinez, Todd J. [Department of Chemistry and The PULSE Institute, Stanford University, Stanford, California 94305, USA and SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States)

    2014-08-07

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as “cloning,” in analogy to the “spawning” procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, “trains,” as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions.

  3. Criatividade e gastronomia: Um estudo exploratório

    Ferreira, Ana Catarina

    2012-01-01

    O presente trabalho é um estudo exploratório que aborda o tema da criatividade na gastronomia, sendo um tema pioneiro e pouco trabalhado. Na teoria, a gastronomia tem um grande significado afectivo e identitário (seja a nível cultural ou a nível individual) e é uma área que acompanha o desenvolvimento das sociedades. Por outro lado, a criatividade demonstra-se como sendo uma prática complexa de processos e dinâmicas mentais, também implicando muito da identidade e da personalidade do sujeito ...

  4. Eletrocardiografia computadorizada em cães: estudo comparativo

    Lídia S. Oliveira; Roberto R.B. Santos; Melo, Marcos B; Daniela F. Larangeira; Stella Maria Barrouin-Melo

    2013-01-01

    O método de eletrocardiografia computadorizada (ECG-C) vem sendo crescentemente difundido na medicina veterinária, havendo atualmente diversas marcas e modelos de eletrocardiógrafos disponíveis no mercado. Diante da possibilidade de diferenças na sensibilidade e na reprodutibilidade das medidas obtidas nos traçados, o presente estudo teve como objetivo comparar os parâmetros eletrocardiográficos de cães, obtidos por dois sistemas. Foram avaliados dois diferentes softwares computadorizados, o ...

  5. "Buzz marketing" : estudo de caso da marca Red Bull

    Conceição, Miguel David

    2012-01-01

    Este relatório é baseado no estágio efetuado na agência de publicidade Ogilvy & Mather e é dedicado à temática do Buzz Marketing. De modo a poder explorar a fundo as dinâmicas deste tema foi feita uma análise à estratégia de marketing da marca Red Bull, considerada como um dos principais estudos de caso no âmbito do Buzz Marketing. Este tema pode ser definido como uma estratégia de marketing inovadora cujo objetivo principal é a criação de conversas entre os consumidores, colocando-os a falar...

  6. Inteligência emocional: estudo exploratório

    Seabra, Diana Catarina Lopes

    2013-01-01

    A presente dissertação tem como objetivo esclarecer e refletir sobre a inteligência emocional e explorar se existe uma influência entre a atividade que o grupo exerce, o tempo de pertença e o tempo de vida do mesmo, ao nível da inteligência emocional grupal e das suas dimensões. Para tal, foi desenvolvido um estudo exploratório. A recolha dos dados realizou-se através do Questionário de Inteligência Emocional Grupal traduzido e adaptado por Correia (2010) do Group Emotional Intelligence Quest...

  7. Marketing digital : um estudo das empresas em Angola

    Guerra, Dalva Marina Teixeira

    2013-01-01

    Dissertação de mestrado em Estudos de Gestão Com a introdução das novas tecnologias e da Internet, os mercados têm evoluído cada vez mais. Os consumidores tornam-se cada vez mais exigentes, por sentirem que mais facilmente podem comparar, comprar e reclamar através desta ferramenta. Por este motivo, as empresas procuram cada vez mais superar-se e oferecer produtos e serviços diferenciados ao cliente, de forma a ganhar vantagem competitiva num mercado cada vez mais competitiv...

  8. Responsabilidade Social Corporativa: estudo comparativo das normas socioambientais

    Francisco Roberto Pinto; Dorelland Ponte Lima; Marcelle Colares Oliveira; Leonel Gois Lima Oliveira

    2007-01-01

    A utilização de normas socioambientais visa dar maior credibilidade às práticas de Responsabilidade Social Corporativa (RSC). Neste estudo, levantaram-se os seguintes questionamentos: Quais as características das normas socioambientais existentes quanto à avaliação do processo produtivo, das relações com a comunidade, das relações com os empregados e dependentes? Quais os aspectos convergentes e divergentes dessas características no tocante à integração dos sistemas de gestão da RSC propugnad...

  9. Estudo para uma mobilidade flutuante na Ria de Aveiro

    Gaspar, Licínia

    2012-01-01

    O presente estudo desenvolve uma estratégia orientada à criação de um novo sistema de mobilidade fluvial que promove a Ria de Aveiro, no sentido de ampliar a mobilidade na Ria, bem como reafirmar a natureza desse território, proporcionando o conhecimento de uma vasta área lagunar. Numa análise à mobilidade fluvial em Aveiro, que foi suporte para o crescimento e desenvolvimento da cidade, constatou-se a ausência de uma mobilidade diversificada assente na oferta de um serviço ...

  10. TENDÊNCIAS DOS ESTUDOS COM PLANTAS MEDICINAIS NO BRASIL

    Fernanda Melo Carneiro; Maria José Pereira da Silva; Leonardo Luiz Borges; Lorena Carneiro Albernaz,; Joana Darc Pereira Costa

    2014-01-01

    As plantas medicinais são utilizadas pelo homem desde o início da história e atualmente empregadas como recursos na medicina alternativa por grande parte da população mundial. Esse uso deve-se à facilidade de acesso às plantas em relação aos medicamentos alopáticos. O objetivo deste trabalho foi, primariamente, desenvolver uma análise cienciométrica sobre as tendências dos estudos com plantas medicinais no Brasil, investigando se o número de trabalhos cresceu ao longo dos anos. Além disso, f...