WorldWideScience

Sample records for abs terpolymer estudo

  1. Ionizing radiation effect study by electron beam on acrylonitrile butadiene styrene - ABS terpolymer

    The great advantage in the researches involving development has as objective to increase significantly the quality of the products. The ABS (acrylonitrile, butadiene, styrene) resins are terpolymers formed by an elastomer and two thermoplastics amorphous components. The three different monomeric units from the terpolymer ABS contribute separately to the material characteristics exhibited. The molecular stiffness originating from polystyrene and the benzene ring hanging on the chain is responsible for the flexion module ABS. The acrylonitrile and the styrene incorporated butadiene exercises strong influence in the resistance to the impact because it reduces the bonding among them. The engineering use of this terpolymer became important due their mechanical properties and mainly, for the responses of this to tensions or deformations applied. The polymeric materials, when submitted to the ionizing radiation are modified by the transference of energy to these materials, introducing excitation and ionization of the molecules, generating chemical reactions that can produce permanent modifications in the polymeric physicochemical structure. The induced modifications can result in the polymeric material degradation or crosslinking, which can result in the improvement of some properties. This work has, as objective, to study the electron beam ionizing radiation effect, at different doses, in the properties of the polymer ABS. The studied properties were: tensile strength at break, elongation at break, Izod impact strength, flexural strength, melt flow index, Vicat softening temperature and the thermic distortion temperature. Also researches on Differential Scanning Calorimetry (DSC) and Thermogravimetric Analyses (TGA) were accomplished. From the experimental results, it was showed that for doses until 500 kGy, at 22.6 kGy/s dose rate, in the presence of air, the crosslinking process of ABS prevails. (author)

  2. Thermal oxidation of epdm terpolymer and vulcanizate

    Thermal ageing tests were made in the range 110-160 deg. C., on an ethylene-propylene-hexadiene terpolymer and with a filled, stabilised and vulcanized industrial rubber based on it. Carbonyl build-up, weight loss, density, chemiluminescence and removable fraction kinetic curves reveal an induction period whose duration is almost independent of the measurement method. These results suggest that the hypothesis of spatially heterogeneous (at small scale) oxidation is to be rejected in this case. They reveal the interest of density measurement for the detection of the end of the induction period, and the fact that variations of the soluble fraction are due to changes of the solubility parameter rather than to changes of the molecular weight/crosslink density. (authors)

  3. Rational design of ABC triblock terpolymer solution nanostructures with controlled patch morphology

    Löbling, Tina I.; Borisov, Oleg; Haataja, Johannes S.; Ikkala, Olli; Gröschel, André H.; Müller, Axel H. E.

    2016-06-01

    Block copolymers self-assemble into a variety of nanostructures that are relevant for science and technology. While the assembly of diblock copolymers is largely understood, predicting the solution assembly of triblock terpolymers remains challenging due to complex interplay of block/block and block/solvent interactions. Here we provide guidelines for the self-assembly of linear ABC triblock terpolymers into a large variety of multicompartment nanostructures with C corona and A/B cores. The ratio of block lengths NC/NA thereby controls micelle geometry to spheres, cylinders, bilayer sheets and vesicles. The insoluble blocks then microphase separate to core A and surface patch B, where NB controls the patch morphology to spherical, cylindrical, bicontinuous and lamellar. The independent control over both parameters allows constructing combinatorial libraries of unprecedented solution nanostructures, including spheres-on-cylinders/sheets/vesicles, cylinders-on-sheets/vesicles, and sheets/vesicles with bicontinuous or lamellar membrane morphology (patchy polymersomes). The derived parameters provide a logical toolbox towards complex self-assemblies for soft matter nanotechnologies.

  4. Rational design of ABC triblock terpolymer solution nanostructures with controlled patch morphology

    Löbling, Tina I.; Borisov, Oleg; Haataja, Johannes S.; Ikkala, Olli; Gröschel, André H.; Müller, Axel H. E.

    2016-01-01

    Block copolymers self-assemble into a variety of nanostructures that are relevant for science and technology. While the assembly of diblock copolymers is largely understood, predicting the solution assembly of triblock terpolymers remains challenging due to complex interplay of block/block and block/solvent interactions. Here we provide guidelines for the self-assembly of linear ABC triblock terpolymers into a large variety of multicompartment nanostructures with C corona and A/B cores. The ratio of block lengths NC/NA thereby controls micelle geometry to spheres, cylinders, bilayer sheets and vesicles. The insoluble blocks then microphase separate to core A and surface patch B, where NB controls the patch morphology to spherical, cylindrical, bicontinuous and lamellar. The independent control over both parameters allows constructing combinatorial libraries of unprecedented solution nanostructures, including spheres-on-cylinders/sheets/vesicles, cylinders-on-sheets/vesicles, and sheets/vesicles with bicontinuous or lamellar membrane morphology (patchy polymersomes). The derived parameters provide a logical toolbox towards complex self-assemblies for soft matter nanotechnologies. PMID:27352897

  5. Superhydrophobic terpolymer nanofibers containing perfluoroethyl alkyl methacrylate by electrospinning

    Cengiz, Ugur, E-mail: ucengiz@gyte.edu.tr [Department of Chemical Engineering, Gebze Institute of Technology, Cayirova, 41400 Kocaeli (Turkey); Avci, Merih Z. [Polymer Science and Technology, Deparment of Chemistry, Istanbul Technical University, Maslak 34469, Istanbul (Turkey); Erbil, H. Yildirim [Department of Chemical Engineering, Gebze Institute of Technology, Cayirova, 41400 Kocaeli (Turkey); Sarac, A. Sezai [Polymer Science and Technology, Deparment of Chemistry, Istanbul Technical University, Maslak 34469, Istanbul (Turkey)

    2012-05-15

    A new statistical terpolymer containing perfluoroethyl alkyl methacrylate (Zonyl-TM), methyl methacrylate and butyl acrylate, poly(Zonyl-TM-ran-MMA-ran-BA) was synthesized in supercritical carbon dioxide at 200 bar and 80 Degree-Sign C using AIBN as an initiator by heterogeneous free radical copolymerization. Nanofibers of this terpolymer were produced by electrospinning from its DMF solution. The structural and thermal properties of terpolymers and electrospun poly(Zonyl-TM-MMA-BA) nanofibers were analyzed using Fourier transform infrared spectroscopy, nuclear magnetic resonance spectroscopy and differential scanning calorimetry. Nanofiber morphology was investigated by scanning electron microscopy. Electrospun nanofiber layer was found to be superhydrophobic with a water contact angle of 172 {+-} 1 Degree-Sign and highly oleophobic with hexadecane, glycerol and ethylene glycol contact angles of 70 {+-} 1 Degree-Sign , 167 {+-} 1 Degree-Sign and 163 {+-} 1 Degree-Sign respectively. The change of the contact angle results on the electrospun fiber layer and flat terpolymer surfaces by varying feed monomer composition were compared and discussed in the text.

  6. Superhydrophobic terpolymer nanofibers containing perfluoroethyl alkyl methacrylate by electrospinning

    A new statistical terpolymer containing perfluoroethyl alkyl methacrylate (Zonyl-TM), methyl methacrylate and butyl acrylate, poly(Zonyl-TM-ran-MMA-ran-BA) was synthesized in supercritical carbon dioxide at 200 bar and 80 °C using AIBN as an initiator by heterogeneous free radical copolymerization. Nanofibers of this terpolymer were produced by electrospinning from its DMF solution. The structural and thermal properties of terpolymers and electrospun poly(Zonyl-TM-MMA-BA) nanofibers were analyzed using Fourier transform infrared spectroscopy, nuclear magnetic resonance spectroscopy and differential scanning calorimetry. Nanofiber morphology was investigated by scanning electron microscopy. Electrospun nanofiber layer was found to be superhydrophobic with a water contact angle of 172 ± 1° and highly oleophobic with hexadecane, glycerol and ethylene glycol contact angles of 70 ± 1°, 167 ± 1° and 163 ± 1° respectively. The change of the contact angle results on the electrospun fiber layer and flat terpolymer surfaces by varying feed monomer composition were compared and discussed in the text.

  7. Thermoanalytical Study and Kinetics of New 8-Hydroxyquinoline 5-sulphonic Acid-Oxamide-Formaldehyde Terpolymer Resins

    Singru, Rajesh N.; Anil B. Zade; Gurnule, Wasudeo B.

    2009-01-01

    The terpolymer resins (8-HQ5-SAOF) have been synthesized by the condensation of 8-hydroxyquinoline 5-sulphonic acid (8-HQ5-SA) and oxamide (O) with formaldehyde (F) in the presence of acid catalyst and using varied molar proportion of the reacting monomers. The synthesized terpolymer resins have been characterized by different physico-chemical techniques. Thermogravimetric analysis of all terpolymer resins in present study have been carried out by non-isothermal thermogravimetric analysis tec...

  8. Non-isothermal Kinetic Study of p-Cresol-Dithiooxamide-Formaldehyde Terpolymer

    Gurnule, W. B.; S. S. Katkamwar

    2010-01-01

    Terpolymer (p-CDF) has been prepared by using the monomer p-cresol, dithiooxanude and formaldehyde in 1:1:2 molar proportions. The structure of p-CDF terpolymer has been elucidated on the basis of elemental analysis and various physicochemical technique like UV-visible, FTIR, 1H NMR and TG analysis. Detailed thermal degradation curve is discussed which shows four steps decomposition. The activation energy (Ea) and thermal stability calculated by using the Sharp Wentworth, Frceman-Carroll meth...

  9. Synthesis and Demulsibility of the Terpolymer Demulsifier of Acryl Resin

    KANG,Wan-Li; MENG,Ling-Wei; ZHANG,Hong-Yan; LIU,Shu-Ren

    2008-01-01

    Terpolymer demulsifier of acryl resin has been synthesized through solution polymerization with water as a dissolvent,potassium persulfate as an initiator and the monomers of methyl methacrylate,butyl acrylate and acrylic acid as starting materials.The effects of the reaction temperature,dripping time,the amount of monomers and initiator on the dehydration rate of the demulsifier were investigated by an orthogonal experiment.It shows that the stronger influence on the dehydration rate among six factors is reaction temperature,dripping time,and amount of catalyst,while monomer has weak influence.The performance of the demulsifier was evaluated under different demulsification time,temperatures and concentrations of the screened demulsifiers.The result shows that the dehydration rate of the demulsifier can reach over 67%,which is better than that by the emulsion polymerization way.

  10. Network morphologies in monodisperse and polydisperse multiblock terpolymers

    Meuler, Adam James

    Multiply continuous network morphologies were previously identified in "monodisperse" (polydispersity index (PDI) blocks) poly(isoprene-bstyrene-b-ethylene oxide) (ISO) triblock terpolymers. This work extends the investigation of multiply continuous network structures to two other classes of multiblock terpolymers: (i) "monodisperse" OSISO pentablocks and (ii) polydisperse ISO triblocks. The OSISO pentablocks are synthesized using a protected initiation strategy that required the development of the functional organolithium 3-triisopropylsilyloxy-1-propyllithium (TIPSOPrLi). TIPSOPrLi may be used to prepare alpha-hydroxypolystyrene with narrower molecular weight distributions (PDI ˜ 1.1) than are attainable using the commercially available 3-tert-butyldimethylsilyloxy-1-propyllithium. A telechelic triblock terpolymer (HO-SIS-OH) with narrow molecular weight distributions in all blocks is prepared using TIPSOPrLi. A series of OSISO pentablocks is synthesized from this parent triblock, and a stable region of O70 (the orthorhombic Fddd network) is identified between two-domain lamellae (LAM2) and three-domain lamellae (LAM3) in OSISO materials. This sequence of morphologies was previously reported in ISO triblocks with comparable compositions. Mechanical tensile testing reveals that an OSISO sample with a lamellar mesostructure fractures in a brittle fashion at a strain of 0.06. An OSISO containing the O70 network, in contrast, has a strain at failure of 1.3, even though the crystallinity of the terminal blocks is above the brittle threshold established in other multiblock materials. This improved toughness is attributed to the combined effects of a triply continuous morphology and an intrinsically tough SIS core. The ISO triblock studies probe the stability of network morphologies with respect to polydispersity in the polystyrene and poly(ethylene oxide) chains. Three series of ISO triblocks with polydisperse (PS PDI = 1.16, 1.31, 1.44) polystyrene blocks are

  11. Estudo da geometria da uréia por métodos ab initio e simulação computacional de líquidos

    Cirino José Jair Vianna

    2002-01-01

    Full Text Available A study was carried out on the urea geometries using ab initio calculation and Monte Carlo computational simulation of liquids. The ab initio calculated results showed that urea has a non-planar conformation in the gas phase in which the hydrogen atoms are out of the plane formed by the heavy atoms. Free energies associated to the rotation of the amino groups of urea in water were obtained using the Monte Carlo method in which the thermodynamic perturbation theory is implemented. The magnitude of the free energy obtained from this simulation did not permit us to conclude that urea is non-planar in water.

  12. Development of new multifunctional terpolymer sorbent for proteomics applications.

    Najam-ul-Haq, Muhammad; Saeed, Adeela; Jabeen, Fahmida; Hussain, Dilshad; Khan, Naseem; Shabir, Maryam; Raza, Nadeem; Ashiq, Muhammad Naeem; Malana, Muhammad Aslam; Zafar, Zafar Iqbal

    2015-07-01

    Determination of the availability of phases for specific separations is an important task achieved by a separation chemist. This becomes vital when the complex samples like biofluids are dealt with in proteome science. The work presented here involves the synthesis and application of terpolymeric sorbent with different functionalizations adopted for the selective enrichment of biomolecules of interest from biological fluids. Synthesis of terpolymer was carried out by the radical polymerization of monomers: methyl acrylate, acrylic acid and vinyl acetate with diethylene glycol dimethacrylate as cross-linking agent, benzoyl peroxide as initiator and chloroform as a porogenic solvent. Characterization was done through Fourier transform infrared spectroscopy, scanning electron microscopy and nitrogen adsorption porosimetry. The polymer was further modified to immobilized metal ion affinity chromatographic material, with immobilized Fe(3+)/La(3+) ions that allowed phosphopeptide enrichment from tryptic digests of standard proteins as well as milk, egg yolk and human serum. Sensitivity of enrichment down to 50 fmol was achieved in the presence of complex protein background as bovine serum albumin. Hydrophobicity was introduced through octadecyl amine, which provides comparable results to ZipTip C18/C4 for desalting of complex mixtures of all caseins. Analysis of the enriched content was performed by Matrix Assisted Laser Desorption Ionization Mass Spectrometry (MALDI-MS). PMID:25402016

  13. Multicompartment Core Micelles of Triblock Terpolymers in Organic Media

    Schacher, Felix [University of Bayreuth; Walther, Andreas [Helsinki University of Technology, Helsinki, Finland; Ruppel, Markus A [ORNL; Drechsler, Markus [Universitat Bayreuth; Muller, Axel [Universitat Bayreuth

    2009-01-01

    The formation of multicompartment micelles featuring a spheres on sphere core morphology in acetone as a selective solvent is presented. The polymers investigated are ABC triblock terpolymers, polybutadieneb-poly(2-vinyl pyridine)-b-poly(tert-butyl methacrylate) (BVT), which were synthesized via living sequential anionic polymerization in THF. Two polymers with different block lengths of the methacrylate moiety were studied with respect to the formation of multicompartmental aggregates. The micelles were analyzed by static and dynamic light scattering as well as by transmission electron microscopy. Cross-linking of the polybutadiene compartment could be accomplished via two different methods, cold vulcanization and with photopolymerization after the addition of a multifunctional acrylate. In both cases, the multicompartmental character of the micellar core is fully preserved, and the micelles could be transformed into core-stabilized nanoparticles. The successful cross-linking of the polybutadiene core is indicated by 1H NMR and by the transfer of the aggregates into nonselective solvents such as THF or dioxane.

  14. Sequential crystallization and morphology of triple crystalline biodegradable PEO-b-PCL-b-PLLA triblock terpolymers

    Palacios, Jordana

    2016-01-05

    The sequential crystallization of poly(ethylene oxide)-b-poly(e-caprolactone)-b-poly(L-lactide) (PEO-b-PCL-b-PLLA) triblock terpolymers, in which the three blocks are able to crystallize separately and sequentially from the melt, is presented. Two terpolymers with identical PEO and PCL block lengths and two different PLLA block lengths were prepared, thus the effect of increasing PLLA content on the crystallization behavior and morphology was evaluated. Wide angle X-Ray scattering (WAXS) experiments performed on cooling from the melt confirmed the triple crystalline nature of these terpolymers and revealed that they crystallize in sequence: the PLLA block crystallizes first, then the PCL block, and finally the PEO block. Differential scanning calorimetry (DSC) analysis further demonstrated that the three blocks can crystallize from the melt when a low cooling rate is employed. The crystallization process takes place from a homogenous melt as indicated by small angle X-Ray scattering (SAXS) experiments. The crystallization and melting enthalpies and temperatures of both PEO and PCL blocks decrease as PLLA content in the terpolymer increases. Polarized light optical microscopy (PLOM) demonstrated that the PLLA block templates the morphology of the terpolymer, as it forms spherulites upon cooling from the melt. The subsequent crystallization of PCL and PEO blocks occurs inside the interlamellar regions of the previously formed PLLA block spherulites. In this way, unique triple crystalline mixed spherulitic superstructures have been observed for the first time. As the PLLA content in the terpolymer is reduced the superstructural morphology changes from spherulites to a more axialitic-like structure.

  15. Synthesis and application of terpolymer bearing cyclic carbonate and cinnamoyl groups

    Park, S. Y.; Park, H. Y.; Lee, H. S.; Park, S. W.; Park, D. W.

    2003-01-01

    We propose the syntheses of photopolymer with pendant cinnamic ester and cyclic carbonate groups by the addition reaction of poly(glycidyl methacrylate- co-styrene) with CO 2 and then with cinnamoyl chloride. Quaternary ammonium salts showed good catalytic activity for this synthesis. Photochemical reaction experiments revealed that terpolymer having cinnamate and cyclic carbonate groups has good photosensitivity, even in the absence of sensitizer. In order to expand the application of the obtained terpolymer, polymer blends with poly(methyl methacrylate) were prepared. Differential scanning calorimetry and optical clarity tests showed that the blends were miscible over the whole composition ranges.

  16. Kinetics of nanocrystallization in regular alternating terpolymers of ethene and propene with carbon monoxide

    Privalko, V. P.; Dolgoshey, V. B.; Privalko, E. G.; Sikora, Antonín

    2003-01-01

    Roč. 42, č. 5 (2003), s. 953-962. ISSN 0022-2348 R&D Projects: GA AV ČR IAA4050007 Institutional research plan: CEZ:AV0Z4050913 Keywords : alternating terpolymers of ethene and propene with carbon monoxide * nanocrystallinity * kinetics of nanocrystallization Subject RIV: CD - Macromolecular Chemistry Impact factor: 0.679, year: 2003

  17. Morphologies of ABC triblock terpolymer melts containing poly(Cyclohexadiene): Effects of conformational asymmetry

    Kumar, Rajeev Senthil

    2013-02-12

    We have synthesized linear ABC triblock terpolymers containing poly(1,3-cyclohexadiene), PCHD, as an end block and characterized their morphologies in the melt. Specifically, we have studied terpolymers containing polystyrene (PS), polybutadiene (PB), and polyisoprene (PI) as the other blocks. Systematically varying the ratio of 1,2- /1,4-microstructures of poly(1,3-cyclohexadiene), we have studied the effects of conformational asymmetry among the three blocks on the morphologies using transmission electron microscopy (TEM), small-angle X-ray scattering (SAXS), and self-consistent field theory (SCFT) performed with PolySwift++. Our work reveals that the triblock terpolymer melts containing a high percentage of 1,2-microstructures in the PCHD block are disordered at 110 C for all the samples, independent of sequence and volume fraction of the blocks. In contrast, the triblock terpolymer melts containing a high percentage of 1,4-microstructure form regular morphologies known from the literature. The accuracy of the SCFT calculations depends on calculating the χ parameters that quantify the repulsive interactions between different monomers. Simulations using χ values obtained from solubility parameters and group contribution methods are unable to reproduce the morphologies as seen in the experiments. However, SCFT calculations accounting for the enhancement of the χ parameter with an increase in the conformational asymmetry lead to an excellent agreement between theory and experiments. These results highlight the importance of conformational asymmetry in tuning the χ parameter and, in turn, morphologies in block copolymers. © 2012 American Chemical Society.

  18. Removal of cations using ion-binding terpolymer involving 2-amino-6-nitro-benzothiazole and thiosemicarbazide with formaldehyde by batch equilibrium technique

    Ahamed, Mohamed A. Riswan [Department of Chemistry, Oxford Engineering College, Tiruchirappalli 620 009, Tamil Nadu (India); Jeyakumar, Duraisamy [Functional Materials Division, Central Electrochemical Research Institute, Karaikudi 630 006, Tamil Nadu (India); Burkanudeen, Abdul R., E-mail: a_deen@rediffmail.com [PG and Research Department of Chemistry, Jamal Mohamed College, Tiruchirappalli 620 020, Tamil Nadu (India)

    2013-03-15

    Graphical abstract: Effect of (a) NaCl, (b) NaNO{sub 3}, (c) NaClO{sub 4} and (d) Na{sub 2}SO{sub 4} electrolytes on metal ion uptake. Display Omitted Highlights: ► A novel [(2-amino-6-nitro-benzothiazole)–thiosemicarbazide–formaldehyde] terpolymer has been synthesized. ► SEM images show high porosity in the surface of the resin evidences the effective adsorption of various metal ions. ► BTF terpolymer is a well recyclable cation-exchange resin for industrial waste water treatment. -- Abstract: 2-Amino-6-nitro-benzothiazole and thiosemicarbazide with formaldehyde (BTF) terpolymer was synthesized by the condensation polymerization technique. The elemental analysis and physico-chemical parameters of the terpolymer were measured. This chelation terpolymer was characterized by infrared, electronic and nuclear magnetic resonance ({sup 1}H and {sup 13}C NMR) spectral studies. The molecular weight of the terpolymer was determined by gel permeation chromatography (GPC). Surface analysis of the terpolymer was analyzed by scanning electron microscopy (SEM) and X-ray diffraction (XRD) method. The thermal stability of the terpolymer was analyzed by thermogravimetric analysis (TGA). The cation-exchange property of the terpolymer was determined by batch equilibrium method with the effect of pH, contact time and electrolytes. The reusability of the resin was also studied to estimate the effectiveness of the terpolymer resin.

  19. Synthesis and characterization of CdS nanocrystals in Maleic anhydride-Octene-1-Vinylbutyl Ether terpolymer matrix

    Akperov, Oktay H.; Muradov, Mustafa B.; Malikov, Elvin Y.; Akperov, Elchin O.; Mammadova, Rasmiyya E.; Eyvazova, Goncha M.; Kukovecz, Ákos; Kónya, Zoltán

    2016-07-01

    A Maleic anhydride-Octene-1-Vinylbutyl Ether terpolymer was synthesized via the radical terpolymerization method in order to prepare a new matrix for CdS nanocrystal synthesis. CdS nanocrystals were synthesized through the reaction of thiourea with cadmium chloride. The synthesized terpolymer/CdS nanocrystal composites were characterized by several methods. Energy Dispersive X-ray analysis, Raman spectroscopy and powder X-ray diffraction methods. The room temperature UV-visible absorption spectra show a shift of the absorption edge towards higher energies. The band gap of the CdS nanocomposite is bigger than that of bulk CdS. Raman spectrum exhibits characteristic peaks of CdS. Images of the nanocomposite obtained with Atomic Force Microscopy and Transmission Electron Microscopy are the evidences of CdS nanocrystal formation in the terpolymer. Thermal investigation shows that the nanocomposite is more thermostable than the terpolymer which could be useful for application in thermo aggressive medium.

  20. Biodegradable PTLGA Terpolymers versus Collagen Implants Used as an Adjuvant in Trabeculectomy in Rabbit Eye.

    Niu, Weiran; Shen, Guanglin; Yuan, Yuanzhi; Ma, Xiaoping; Li, Suming; Wang, Jingzhao; Fan, Zhongyong; Liao, Lan

    2015-01-01

    Purpose. To evaluate the effectiveness and safety of three biodegradable terpolymers prepared from L-lactide, trimethylene carbonate, and glycolide (PTLGA) as an aid for trabeculectomy compared with the Ologen (OLO). Methods. Trabeculectomy was carried out on rabbits with implantation made from OLO or three PTLGA terpolymers. Intraocular pressure (IOP) was recorded 1, 2, 3, and 6 months postoperatively and bleb evaluations were performed using ultrasound biomicroscopy (UBM) 3 months after surgery, optical coherence tomography (OCT) every month, and transmission electron microscopy (TEM) six months after surgery followed by histological examination 1, 2, 3, and 6 months postoperatively. Result. IOP was significantly reduced in all groups after surgery. There were no significant differences in the IOL between groups at any time after implantation. There was no significant difference between the groups examined by OCT, UBM, and TEM. Exposure of the implant was observed in one eye from the OLO group and one eye in the P1. Subconjunctiva hyperblastosis was observed in one eye from group P3 and two eyes from the OLO group. Conclusions. Subconjunctival implantation of filtering devices made from PTLGA may present a safe and effective additional surgical tool for the treatment of filtering surgery. Fewer complications were observed in the group with P2 implants compared to other groups. PMID:26697212

  1. Tuning Structure and Properties of Graded Triblock Terpolymer-Based Mesoporous and Hybrid Films

    Phillip, William A.

    2011-07-13

    Despite considerable efforts toward fabricating ordered, water-permeable, mesoporous films from block copolymers, fine control over pore dimensions, structural characteristics, and mechanical behavior of graded structures remains a major challenge. To this end, we describe the fabrication and performance characteristics of graded mesoporous and hybrid films derived from the newly synthesized triblock terpolymer, poly(isoprene-b-styrene-b-4-vinylpyridine). A unique morphology, unachievable in diblock copolymer systems, with enhanced mechanical integrity is evidenced. The film structure comprises a thin selective layer containing vertically aligned and nearly monodisperse mesopores at a density of more than 1014 per m2 above a graded macroporous layer. Hybridization via homopolymer blending enables tuning of pore size within the range of 16 to 30 nm. Solvent flow and solute separation experiments demonstrate that the terpolymer films have permeabilities comparable to commercial membranes, are stimuli-responsive, and contain pores with a nearly monodisperse diameter. These results suggest that moving to multiblock polymers and their hybrids may open new paths to produce high-performance graded membranes for filtration, separations, nanofluidics, catalysis, and drug delivery. © 2011 American Chemical Society.

  2. Morphology and properties of polypropylene/-low density polyethylene blends compatibilized by ethylene-propylene-diene terpolymer

    Vranješ, N.; Rek, V.; Šlouf, Miroslav; Jelčic, Ž.

    Dresden: Leibniz Institut für Polymerforschung e. V, 2010. s. 62. [European Symposium on Polymer Blends /10./. 07.03.2010-10.03.2010, Dresden] Institutional research plan: CEZ:AV0Z40500505 Keywords : polypropylene * polyethylene * terpolymer Subject RIV: CD - Macromolecular Chemistry

  3. Triblock and pentablock terpolymers by sequential base-assisted living cationic copolymerization of functionalized vinyl ethers

    Bouchekif, Hassen

    2015-01-01

    A series of novel, well-defined triblock (PnBVE-b-PCEVE-b-PSiDEGVE) and pentablock (PSiDEGVE-b-PCEVE-b-PnBVE-b-PCEVE-b-PSiDEGVE) terpolymers of n-butyl vinyl ether (nBVE), 2-chloroethyl vinyl ether (CEVE) and tert-butyldimethylsilyl ethylene glycol vinyl ether (SiEGVE) were synthesized by sequential base-assisted living cationic polymerization. The living character of the homopolymerization of the three VE monomers and the crossover reaction resulting in the formation of well-defined block copolymers were investigated in various solvents (toluene, dichloromethane and n-hexane) using either a monofunctional [nBVE-acetic acid adduct (nBEA), CEVE-acetic acid adduct (CEEA) and SiDEGVE-acetic acid adduct (SiDEGEA)] or a difunctional [1,4-cyclohexane-1,4-diyl bis(2-methoxyethyl acetate) (cHDMEA)] initiator. All initiators are structurally equivalent to the dormant species of the corresponding monomers in order to achieve fast initiation. The optimal conditions of polymerization were achieved in n-hexane at -20 °C, in the presence of 1 M AcOEt (base). Good control over the number average molecular weight (Mn) and the polydispersity index (PDI) was obtained only at [Et3Al2Cl3]0 = [Chain-end]0 ≤ 10 mM. 2,6-Di-tert-butylpyridine (DtBP) was used as a non-nucleophilic proton trap to suppress any protonic initiation from moisture (i.e., Et3Al2Cl3·H2O). Well-defined PnBVEn-b-PCEVEp-b-PSiDEGVEq and PSiDEGVEq-b-PCEVEp-b-PnBVEn-b-PCEVEp-b-PSiDEGVEq terpolymers with a high crossover efficiency, no PCEVE-induced physical gelation, and predictable Mn and PDI < 1.15 were synthesized successfully provided that the targeted DPCEVE/DPnBVE ratio (i.e., p/n) did not exceed 2 and 0.2, respectively. The quantitative desilylation of the PSiEGVE by n-Bu4N+F- in THF at 0 °C led to triblock and pentablock terpolymers in which the PCEVE is the central block and the polyalcohol is the outer block. The thermal properties of the synthesized materials were examined by differential scanning

  4. Fotfavoriten AB

    Søilen, Klaus Solberg; HUBER, Stefan

    2004-01-01

    Fotfavoriten AB, a foot care company located in Sollefttå in Northern Sweden, is an example of how local government fires staff only to reengage them as entrepreneurs delivering similar service. The case is typical for the social sector and may mark a trend. The result is often felt to be positive both by the entrepreneur, who is now more directly in charge of her or his earnings, and the end consumer. The CEO of Fotfavoriten AB, Eva Wörmann, waited a long time before she dared to take the ne...

  5. Electric field manipulated nanopatterns in thin films of metalorganic 3-miktoarm star terpolymers.

    Kathrein, Christine C; Bai, Wubin; Nunns, Adam; Gwyther, Jessica; Manners, Ian; Böker, Alexander; Tsarkova, Larisa; Ross, Caroline A

    2016-05-25

    We report the effect of electric field on the morphological transitions and ordering behavior of polyferrocenylethylmethylsilane block (PFEMS)-containing copolymers. By analyzing structures in solvent-annealed films of metalorganic sphere- and cylinder-forming diblock copolymers, as well as of 3-miktoarm polyisoprene-arm-polystyrene-arm-PFEMS (3μ-ISF) terpolymers, we decouple two types of responses to the electric field: morphological transformations as a result of an increase in the volume fraction of the PFEMS block by oxidation of the ferrocenyl groups, and the orientation of the dielectric interfaces of microdomains parallel to the electric field vector. In the case of 3μ-ISF, the former effect dominates at high electric field strengths which results in an unexpected cylinder-to-sphere transition, leading to a well-ordered hexagonal dot pattern. Our results demonstrate multiple tunability of ordered microdomain morphologies, suggesting future applications in nanofabrication and surface patterning. PMID:27136891

  6. Elastocaloric effect in poly(vinylidene fluoride-trifluoroethylene-chlorotrifluoroethylene) terpolymer

    Yoshida, Yukihiro; Yuse, Kaori; Guyomar, Daniel; Capsal, Jean-Fabien; Sebald, Gael

    2016-06-01

    The elastocaloric properties of poly (vinylidene fluoride-trifluoroethylene-chlorotrifluoroethylene) [P(VDF-TrFE-CTFE)] terpolymer were directly characterized using an infrared imaging camera. At a strain of 12%, a reversible adiabatic temperature variation of 2.15 °C was measured, corresponding to an isothermal entropy variation of 21.5 kJ m-3 K-1 or 11 J kg-1 K-1. In comparison with other elastocaloric materials, P(VDF-TrFE-CTFE) appears to represent a trade-off between the large required stresses in shape memory alloys and the large required strains in natural rubber. The internal energy of the P(VDF-TrFE-CTFE) polymer was found to be independent of the strain, resulting in complete conversion of the mechanical work into heat, as for pure elastomeric materials. The elastocaloric effect therefore originates from a pure entropic elasticity, which is likely to be related to the amorphous phase of the polymer only.

  7. A solution blending route to ethylene propylene diene terpolymer/layered double hydroxide nanocomposites

    Bhowmick Anil

    2006-01-01

    Full Text Available AbstractEthylene propylene diene terpolymer (EPDM/MgAl layered double hydroxide (LDH nanocomposites have been synthesized by solution intercalation using organically modified LDH (DS-LDH. The molecular level dispersion of LDH nanolayers has been verified by the disappearance of basal XRD peak of DS-LDH in the composites. The internal structures, of the nanocomposite with the dispersion nature of LDH particles in EPDM matrix have been studied by TEM and AFM. Thermogravimetric analysis (TGA shows thermal stability of nanocomposites improved by ≈40 °C when 10% weight loss was selected as point of comparison. The degradation for pure EPDM is faster above 380 °C while in case of its nanocomposites, it is much slower.

  8. Linking experiment and theory for three-dimensional networked binary metal nanoparticle–triblock terpolymer superstructures

    Li, Zihui

    2014-02-21

    © 2014 Macmillan Publishers Limited. Controlling superstructure of binary nanoparticle mixtures in three dimensions from self-assembly opens enormous opportunities for the design of materials with unique properties. Here we report on how the intimate coupling of synthesis, in-depth electron tomographic characterization and theory enables exquisite control of superstructure in highly ordered porous three-dimensional continuous networks from single and binary mixtures of metal nanoparticles with a triblock terpolymer. Poly(isoprene-block-styrene-block-(N,N-dimethylamino)ethyl methacrylate) is synthesized and used as structure-directing agent for ligand-stabilized platinum and gold nanoparticles. Quantitative analysis provides insights into short-and long-range nanoparticle-nanoparticle correlations, and local and global contributions to structural chirality in the networks. Results provide synthesis criteria for next-generation mesoporous network superstructures from binary nanoparticle mixtures for potential applications in areas including catalysis.

  9. Corrosion Inhibitive Evaluation of an Environmentally Friendly Water-Base Acrylic Terpolymer on Mild Steel in Hydrochloric Acid Media

    Azghandi, Mojtaba Vakili; Davoodi, Ali; Farzi, Gholam Ali; Kosari, Ali

    2013-12-01

    The corrosion inhibitive performance of an environmentally friendly water-base acrylic terpolymer [methyl methacrylate/Butyl Acrylate/Acrylic acid (ATP)] on mild steel in 1 M HCl was investigated by alternating current and direct current electrochemical techniques and the quantum chemical method. An efficiency of more than 97 pct was obtained with 0.8 mmol/L ATP. The increase in inhibitor concentration and immersion time has a positive effect, while the temperature influence is negligible on the inhibitor efficiency. The present terpolymer obeys the Langmuir isotherm, and thermodynamic calculation reveals a chemisorption type on the surface. Density functional calculations showed that the lone pairs of electrons of oxygen in the structure of three monomers are suitable sites to adsorb onto the metal surface. Finally, in the presence of ATP, a decrease in surface roughness and corrosion attacks was demonstrated by atomic force microscopy and optical microscopy examinations, respectively.

  10. Synthesis and uranyl ion adsorption study of cross-linked allyl propionate-maleic anhydride-styrene terpolymer

    AKPEROV, Elchin; MAHARRAMOV, Abel; AKPEROV, Oktay

    2010-01-01

    Allyl propionate-maleic anhydride-styren terpolymer has been modified with glycerin in order to prepare a new cross-linked functional polymer sorbent. The synthesized cross-linked polymer sorbent has a network structure and contains carboxylic acid, carbonyl, hydroxy, and ester groups, all of which are capable ofinteracting with metal ions. The sorption behavior of UO22+ ions under optimum sorption conditions was determined. The sorption properties of the sorbent were determined unde...

  11. Filled Ethylene-propylene Diene Terpolymer Elastomer as ThermalInsulator for Case-bonded Solid Rocket Motors

    C. M. Bhuvaneswari; S. D. Kakade; V. D. Deuskar; A. B. Dange; Manoj Gupta

    2008-01-01

    Ethylene-propylene diene terpolymer (EPDM)-based insulation system is being globallyused for case-bonded solid rocket motors. A study was undertaken using EPDM as base polymer,blended with hypalon and liquid EPDM and filled with fibrous and non-fibrous fillers. Theseformulations were evaluated as rocket motor insulation system. The basic objective of the studywas to develop an insulation system based on EPDM for case-bonded applications. A series ofrocket motor insulator compositions based on...

  12. Enhanced permittivity and energy density in neat poly(vinylidene fluoride-trifluoroethylene-chlorotrifluoroethylene) terpolymer films through control of morphology.

    Smith, O'Neil L; Kim, Yunsang; Kathaperumal, Mohanalingam; Gadinski, Matthew R; Pan, Ming-Jen; Wang, Qing; Perry, Joseph W

    2014-06-25

    Polymer materials with large dielectric constants are desirable for the development of high energy density capacitors. We show that the dielectric properties of poly(vinylidene fluoride-trifluoroethylene-chlorotrifluoroethylene) [P(VDF-TrFE-CTFE)] can be improved by the use of processing conditions that favor formation of a highly crystalline morphology of the nonpolar α-phase. Through the use of spin coating, thermal treatment above the melting temperature, and quenching, we were able to attain a highly crystalline, α-phase rich morphology that has a quite large dielectric constant of 77 ± 10 at 1 kHz. The final morphology and phase composition of the terpolymer films depend strongly on the postprocessing thermal treatment and the quality of the solvent. Evaluation of the polarization behavior of the terpolymer films as a function of electric field reveal that the polymer exhibits a relaxor-ferroelectric behavior and has a substantial energy density of 9.7 J/cm(3) at fields of up to approximately 470 V/μm. Under millisecond pulsed charge-discharge measurements a 3-fold increase in energy density (27 J/cm(3)) is obtained at high fields (∼600 V/μm). Our study demonstrates that the processing conditions and morphology of fluorinated terpolymer films are controlling factors for achievement of high dielectric permittivity and energy density that are critical for high performance capacitors. PMID:24873348

  13. Well-defined Polymethylene-Based Co/Terpolymers by Combining Anthracene/Maleimide Diels-Alder Reaction with Polyhomologation

    Hadjichristidis, Nikolaos

    2015-05-26

    A novel strategy towards well-defined polymethylene-based co/terpolymers, by combining anthracene/maleimide Diels-Alder reaction with polyhomologation, is presented. For the synthesis of diblock copolymers the following approach was applied: a) synthesis of α-anthracene-ω-hydroxy- polymethylene by polyhomologation using tri (9-anthracene-methyl propyl ether) borane as initiator, b) synthesis of furan-protected-maleimide-terminated poly (ε-caprolactone) or polyethylene glycol and c). Diels-Alder reaction between the anthracene and maleimide-terminated polymers. In the case of triblock terpolymers the α-anthracene-ω-hydroxy-polymethylene was used as macroinitiator for the ring-opening polymerization of D, L-lactide to afford an anthracene-terminated PM-b-PLA copolymer, followed by Diels-Alder reaction with furan-protected maleimide-terminated poly (ε-caprolactone) or polyethylene glycol to give the triblock terpolymers. All intermediate and final products were characterized by SEC, 1H NMR, UV-VIS spectroscopy and DSC.

  14. Impact of structural changes on dielectric and thermal properties of vinylidene fluoride–trifluoroethylene-based terpolymer/copolymer blends

    Casar, G. [Jožef Stefan Institute and Jožef Stefan International Postgraduate School, Jamova 39, SI-1000 Ljubljana (Slovenia); Li, X. [Department of Electrical Engineering and Materials Research Institute, The Pennsylvania State University, University Park, PA 16802 (United States); Malič, B. [Jožef Stefan Institute and Jožef Stefan International Postgraduate School, Jamova 39, SI-1000 Ljubljana (Slovenia); Zhang, Q.M. [Department of Electrical Engineering and Materials Research Institute, The Pennsylvania State University, University Park, PA 16802 (United States); Bobnar, V., E-mail: vid.bobnar@ijs.si [Jožef Stefan Institute and Jožef Stefan International Postgraduate School, Jamova 39, SI-1000 Ljubljana (Slovenia)

    2015-03-15

    We report dielectric and thermal properties of the poly(vinylidene fluoride–trifluoroethylene–chlorofluoroethylene) terpolymer [P(VDF–TrFE–CFE), a member of the relaxor polymer family that exhibits fast response speeds, giant electrostriction, high electric energy density, and large electrocaloric effect] blended with the ferroelectric poly(vinylidene fluoride–trifluoroethylene) copolymer, P(VDF–TrFE). Although the differential scanning calorimetry (DSC) clearly reveals that both components form separate crystalline phases, at low copolymer content blends entirely exhibit a relaxorlike linear dielectric response, since the interfacial couplings to the bulky defects in the terpolymer convert the normal ferroelectric copolymer into a relaxor. On the other hand, dielectric experiments evidence that in blends with 20–50 wt% of P(VDF–TrFE) the ferroelectric and relaxor states coexist. This coexistence is confirmed by DSC results, which further reveal the influence of blending on the terpolymer crystallinity and melting point. At last, the crystallinity data appropriately explain the variation of the dielectric constant in P(VDF–TrFE–CFE)/P(VDF–TrFE) blends.

  15. Preparation and Characterization of Amphiphilic Triblock Terpolymer-Based Nanofibers as Antifouling Biomaterials

    Cho, Youngjin

    2012-05-14

    Antifouling surfaces are critical for the good performance of functional materials in various applications including water filtration, medical implants, and biosensors. In this study, we synthesized amphiphilic triblock terpolymers (tri-BCPs, coded as KB) and fabricated amphiphilic nanofibers by electrospinning of solutions prepared by mixing the KB with poly(lactic acid) (PLA) polymer. The resulting fibers with amphiphilic polymer groups exhibited superior antifouling performance to the fibers without such groups. The adsorption of bovine serum albumin (BSA) on the amphiphilic fibers was about 10-fold less than that on the control surfaces from PLA and PET fibers. With the increase of the KB content in the amphiphilic fibers, the resistance to adsorption of BSA was increased. BSA was released more easily from the surface of the amphiphilic fibers than from the surface of hydrophobic PLA or PET fibers. We have also investigated the structural conformation of KB in fibers before and after annealing by contact angle measurements, transmission electron microscopy (TEM), energy-dispersive X-ray spectroscopy (EDX), and coarse-grained molecular dynamics (CGMD) simulation to probe the effect of amphiphilic chain conformation on antifouling. The results reveal that the amphiphilic KB was evenly distributed within as-spun hybrid fibers, while migrated toward the core from the fiber surface during thermal treatment, leading to the reduction in antifouling. This suggests that the antifouling effect of the amphiphilic fibers is greatly influenced by the arrangement of amphiphilic groups in the fibers. © 2012 American Chemical Society.

  16. Research on the synthesis and scale inhibition performance of a new terpolymer scale inhibitor.

    Bao, Yufei; Li, Meng; Zhang, Yanqing

    2016-01-01

    A new terpolymer named β-CD-MA-SSS was produced using free-radical polymerization of β-cyclodextrin (β-CD), maleic-anhydride (MA) and sodium-styrene-sulfonate (SSS) as monomers, with potassium persulfate (KPS) as initiator. Its performance as a scale inhibitor to prevent deposition of calcium carbonate (CaCO3) has been investigated. Experimental results demonstrated that β-CD-MA-SSS performed excellent scale inhibition and exhibited a high conversion rate under the following conditions: initiator consisting of 6%, molar ratio of reaction monomers SSS:MA = 0.8:1, MA:β-CD = 6:1, reaction temperature of 80 °C, reaction time of 6 h, and dropping time of 40 min when MA was dosed as a substrate, and SSS and KPS were dosed as dropping reactants simultaneously. Use of a Fourier transform infrared spectrometer for this inhibitor showed that the polymerization reaction had taken place with the reaction monomers under the above specified conditions. Scanning electron microscopy indicated that the β-CD-MA-SSS had a strong chelating ability for calcium (Ca(2+)) and a good dispersion ability for calcium carbonate (CaCO3). PMID:27054733

  17. Understanding the structure and performance of self-assembled triblock terpolymer membranes

    Pendergast, MaryTheresa M.

    2013-10-01

    Nanoporous membranes represent a possible route towards more precise particle and macromolecular separations, which are of interest across many industries. Here, we explored membranes with vertically-aligned nanopores formed from a poly(isoprene-. b-styrene-. b-4 vinyl pyridine) (ISV) triblock terpolymer via a hybrid self-assembly/nonsolvent induced phase separation process (S-NIPS). ISV concentration, solvent composition, and evaporation time in the S-NIPS process were varied to tailor ordering of the selective layer and produce enhanced water permeability. Here, water permeability was doubled over previous versions of ISV membranes. This was achieved by increasing volatile solvent concentration, thereby decreasing the evaporation period required for self-assembly. Fine-tuning was required, however, since overly-rapid evaporation did not yield the desired pore structure. Transport models, used to relate the in-. situ structure to the performance of these materials, revealed narrowing of pores and blocking by the dense region below. It was shown that these vertically aligned nanoporous membranes compare favorably with commercial ultrafiltration membranes formed by NIPS and track-etching processes, which suggests that there is practical value in further developing and optimizing these materials for specific industrial separations. © 2013 Elsevier B.V.

  18. Poly (ethylene oxide)-block-poly (n-butyl acrylate)-blockpoly (acrylic acid) triblock terpolymers with highly asymmetric hydrophilic blocks: synthesis and aqueous solution properties

    Petrov, P; Yoncheva, K. (Krassimira); Mokreva, P. (Pavlina); Konstantinov, S.; J M Irache; Müller, A.H.E. (Axel H.E.)

    2013-01-01

    The synthesis and aggregation behaviour in aqueous media of novel amphiphilic poly(ethylene oxide)- block-poly(n-butyl acrylate)-block-poly(acrylic acid) (PEO–PnBA–PAA) triblock terpolymers were studied. Terpolymers composed of two highly asymmetric hydrophilic PEO (113 monomer units) and PAA (10–17 units) blocks, and a longer soft hydrophobic PnBA block (163 or 223 units) were synthesized by atom transfer radical polymerisation (ATRP) of n-butyl acrylate and tert-butyl acrylate ...

  19. Radiation grafting of acrylonitrile on ethylene-propylene diene terpolymer rubber. Optimization of grafting parameters and oil resistance properties

    Radiation induced grafting of acrylonitrile (ACN) on ethylene-propene diene terpolymer (EPDM) rubber film was investigated by mutual radiation grafting technique. Effect of experimental variables viz. radiation dose, dose rate, type of solvent and monomer content on extent of grafting was studied. From the kinetic studies a mathematical relation Rgα[M]0.7D0.68 showing non-linear relationship for rate of grafting with monomer concentration and dose was deduced. The grafted samples showed increased hardness and oil resistance. (author)

  20. Cornucopia of Nanoscale Ordered Phases in Sphere-Forming Tetrablock Terpolymers.

    Chanpuriya, Siddharth; Kim, Kyungtae; Zhang, Jingwen; Lee, Sangwoo; Arora, Akash; Dorfman, Kevin D; Delaney, Kris T; Fredrickson, Glenn H; Bates, Frank S

    2016-05-24

    We report the phase behavior of a series of poly(styrene)-b-poly(isoprene)-b-poly(styrene)'-b-poly(ethylene oxide) (SIS'O) tetrablock terpolymers. This study was motivated by self-consistent field theory (SCFT) calculations that anticipate a rich array of sphere-forming morphologies with variations in the molecular symmetry parameter τ = NS/(NS + NS'), where N is the block degree of polymerization and the volume fraction of O is less than about 0.22. Eight SIS'O samples, with τ ranging from 0.21 to 0.73, were synthesized and investigated using small-angle X-ray scattering and transmission electron microscopy, yielding evidence of nine different spherical phases: hexagonal, FCC, HCP, BCC, rhombohedral (tentative), liquid-like packing, dodecagonal quasicrystal, and Frank-Kasper σ and A15 phases. At temperatures close to the order-disorder transition, these tetrablocks behave as pseudo-[SIS']-O diblocks and form equilibrium morphologies mediated by facile chain exchange between micelles. Transition from equilibrium to nonequilibrium behavior occurs at a temperature (Terg) several tens of degrees below the order-disorder transition temperature, speculated to be coincident with the loss of ergodicity, as chain exchange is arrested due to increased segregation strength between the core (O) and corona (SIS') blocks. Nonequilibrium ordered structures form when T ordering in the S and I block matrix. These experiments demonstrate a profound dependence on phase stability with variations in τ and temperature, providing insights into the formation of ordered phase symmetry in this class of asymmetric multiblock polymers. PMID:27055118

  1. Injectable hydrogel as stem cell scaffolds from the thermosensitive terpolymer of NIPAAm/AAc/HEMAPCL

    Lian S

    2012-09-01

    Full Text Available Sheng Lian,1Yan Xiao,1 Qingqing Bian,1Yu Xia,2 Changfa Guo,2 Shenguo Wang,2 Meidong Lang11Shanghai Key Laboratory of Advanced Polymeric Materials, Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology, Shanghai, People's Republic of China; 2Department of Cardiac Surgery, Zhongshan Hospital, Fudan University and Shanghai Institute of Cardiovascular Diseases, Shanghai, People's Republic of ChinaAbstract: A series of biodegradable thermosensitive copolymers was synthesized by free radical polymerization with N-isopropylacrylamide (NIPAAm, acrylic acid (AAc and macromer 2-hydroxylethyl methacrylate-poly(ε-caprolactone (HEMAPCL. The structure and composition of the obtained terpolymers were confirmed by proton nuclear magnetic resonance spectroscopy, while their molecular weight was measured using gel permeation chromatography. The copolymers were dissolved in phosphate-buffered saline (PBS solution (pH = 7.4 with different concentrations to prepare hydrogels. The lower critical solution temperature (LCST, cloud point, and rheological property of the hydrogels were determined by differential scanning calorimetry, ultraviolet-visible spectrometry, and rotational rheometry, respectively. It was found that LCST of the hydrogel increased significantly with the increasing NIPAAm content, and hydrogel with higher AAc/HEMAPCL ratio exhibited better storage modulus, water content, and injectability. The hydrogels were formed by maintaining the copolymer solution at 37°C. The degradation experiment on the formed hydrogels was conducted in PBS solution for 2 weeks and demonstrated a less than 20% weight loss. Scanning electron microscopy was also used to study the morphology of the hydrogel. The copolymer with NIPAAm/AAc/HEMAPCL ratio of 88:9.6:2.4 was bioconjugated with type I collagen for the purpose of biocompatibility enhancement. In-vitro cytotoxicity

  2. Optimization of tyrosine-derived polycarbonate terpolymers for bone regeneration scaffolds

    Resurreccion-Magno, Maria Hanshella C.

    Tyrosine-derived polycarbonates (TyrPC) are a versatile class of polymers highly suitable for bone tissue engineering. Among the tyrosine-derived polycarbonates, poly(DTE carbonate) has an FDA masterfile that documents its biocompatibility and non-toxicity and has shown potential utility in orthopedics due to its osteoconductive properties and strength. DTE stands for desaminotyrosyl-tyrosine ethyl ester and is the most commonly used tyrosine-derived monomer. However, in vitro degradation studies showed that poly(DTE carbonate) did not completely resorb even after four years of incubation in phosphate buffered saline. Thus for bone regeneration, which only requires a temporary implant until the bone heals, poly(DTE carbonate) would not be the best choice. The goal of the present research was to optimize a scaffold composition for bone regeneration that is based on desaminotyrosyl-tyrosine alkyl ester (DTR), desaminotyrosyl-tyrosine (DT) and poly(ethylene glycol) (PEG). Five areas of research were presented: (1) synthesis and characterization of a focused library of TyrPC terpolymers; (2) evaluation of the effects of how small changes on the composition affected the mechanism and kinetics of polymer degradation and erosion; (3) fabrication of bioactive three-dimensional porous scaffold constructs for bone regeneration; (4) assessment of osteogenic properties in vitro using pre-osteoblasts; and (5) evaluation of bone regeneration potential, with or without recombinant human bone morphogenetic protein-2 (rhBMP-2), in vivo using a critical sized defect (CSD) rabbit calvaria (cranium) model. Small changes in the composition, such as changing the R group of DTR from ethyl to methyl, varying the mole percentages of DT and PEG, and using a different PEG block length, affected the overall properties of these polymers. Porous scaffolds were prepared by a combination of solvent casting, porogen leaching and phase separation techniques. Calcium phosphate was coated on the

  3. Synthesis and Thermal Properties of Acrylonitrile/Butyl Acrylate/Fumaronitrile and Acrylonitrile/Ethyl Hexyl Acrylate/Fumaronitrile Terpolymers as a Potential Precursor for Carbon Fiber

    Siti Nurul Ain Md Jamil

    2014-09-01

    Full Text Available A synthesis of acrylonitrile (AN/butyl acrylate (BA/fumaronitrile (FN and AN/EHA (ethyl hexyl acrylate/FN terpolymers was carried out by redox polymerization using sodium bisulfite (SBS and potassium persulphate (KPS as initiator at 40 °C. The effect of comonomers, BA and EHA and termonomer, FN on the glass transition temperature (Tg and stabilization temperature was studied using Differential Scanning Calorimetry (DSC. The degradation behavior and char yield were obtained by Thermogravimetric Analysis. The conversions of AN, comonomers (BA and EHA and FN were 55%–71%, 85%–91% and 76%–79%, respectively. It was found that with the same comonomer feed (10%, the Tg of AN/EHA copolymer was lower at 63 °C compared to AN/BA copolymer (70 °C. AN/EHA/FN terpolymer also exhibited a lower Tg at 63 °C when compared to that of the AN/BA/FN terpolymer (67 °C. By incorporating BA and EHA into a PAN system, the char yield was reduced to ~38.0% compared to that of AN (~47.7%. It was found that FN reduced the initial cyclization temperature of AN/BA/FN and AN/EHA/FN terpolymers to 228 and 221 °C, respectively, in comparison to that of AN/BA and AN/EHA copolymers (~260 °C. In addition, FN reduced the heat liberation per unit time during the stabilization process that consequently reduced the emission of volatile group during this process. As a result, the char yields of AN/BA/FN and AN/EHA/FN terpolymers are higher at ~45.1% and ~43.9%, respectively, as compared to those of AN/BA copolymer (37.1% and AN/EHA copolymer (38.0%.

  4. Enhanced Performance of Polymer Solar Cells Comprising Diketopyrrolopyrrole-Based Regular Terpolymer Bearing Two Different π-Extended Donor Units.

    Ko, Eun Yi; Park, Gi Eun; Lee, Dae Hee; Um, Hyun Ah; Shin, Jicheol; Cho, Min Ju; Choi, Dong Hoon

    2015-12-30

    New regular and random diketopyrrolopyrrole (DPP)-based terpolymers (i.e., Reg-PBDPPT and Ran-PBDPPT, respectively) bearing DPP as an electron deficient unit and 2,2'-bithiophene and (E)-1,2-di(thiophen-2-yl)ethene as electron donating units were designed and synthesized, and their performance in photovoltaic cells was investigated precisely. The absorption properties and highest occupied molecular orbital (HOMO) of Reg-PBDPPT were found to be different from those of Ran-PBDPPT. The results of grazing incidence X-ray diffraction experiments revealed that Ran-PBDPPT typically had a predominantly edge-on chain orientation on the substrate, whereas Reg-PBDPPT showed mixed chain orientation both in pristine and thermally annealed films. Although Reg-PBDPPT exhibited a lower degree of edge-on chain orientation on the substrate, the corresponding TFTs showed a high hole mobility of 0.42-0.96 cm(2) V(-1) s(-1) and maintained a high current on/off ratio (>10(6)). A polymer solar cell (PSC) composed of Reg-PBDPPT and PC71BM exhibited power conversion efficiencies (PCE) of 5.24-5.45%, which were higher than those of the Ran-PBDPPT-based PSCs. The enhanced efficiency was supported by an increase in the short circuit current, which is strongly related to the unique internal crystalline morphology and pronounced nanophase segregation behavior in the blend films. These results obviously manifested that this synthetic strategy for regular conjugated terpolymers could be employed to control morphological properties to obtain high-performance PSCs. PMID:26645584

  5. Amphiphilic Diblock Terpolymer PMAgala-b-P(MAA-co-MAChol)s with Attached Galactose and Cholesterol Grafts and Their Intracellular pH-Responsive Doxorubicin Delivery.

    Wang, Zhao; Luo, Ting; Sheng, Ruilong; Li, Hui; Sun, Jingjing; Cao, Amin

    2016-01-11

    In this work, a series of diblock terpolymer poly(6-O-methacryloyl-D-galactopyranose)-b-poly(methacrylic acid-co-6-cholesteryloxy hexyl methacrylate) amphiphiles bearing attached galactose and cholesterol grafts denoted as the PMAgala-b-P(MAA-co-MAChol)s were designed and prepared, and these terpolymer amphiphiles were further exploited as a platform for intracellular doxorubicin (DOX) delivery. First, employing a sequential RAFT strategy with preliminarily synthesized poly(6-O-methacryloyl-1,2:3,4-di-O-isopropylidene-d-galactopyranose) (PMAIpGP) macro-RAFT initiator and a successive trifluoroacetic acid (TFA)-mediated deprotection, a series of amphiphilic diblock terpolymer PMAgala-b-P(MAA-co-MAChol)s were prepared, and were further characterized by NMR, Fourier transform infrared spectrometer (FTIR), gel permeation chromatography (GPC), differential scanning calorimetry (DSC), and a dynamic contact angle testing instrument (DCAT). In aqueous media, spontaneous micellization of the synthesized diblock terpolymer amphiphiles were continuously examined by critical micellization concentration assay, dynamic light scattering (DLS), and transmission electron microscopy (TEM), and the efficacies of DOX loading by these copolymer micelles were investigated along with the complexed nanoparticle stability. Furthermore, in vitro DOX release of the drug-loaded terpolymer micelles were studied at 37 °C in buffer under various pH conditions, and cell toxicities of as-synthesized diblock amphiphiles were examined by MTT assay. Finally, with H1299 cells, intracellular DOX delivery and localization by the block amphiphile vectors were investigated by invert fluorescence microscopy. As a result, it was revealed that the random copolymerization of MAA and MAChol comonomers in the second block limited the formation of cholesterol liquid-crystal phase and enhanced DOX loading efficiency and complex nanoparticle stability, that ionic interactions between the DOX and MAA comonomer

  6. Sequential polymerization of ethylene oxide, ε-caprolactone and l-lactide: A one-pot metal-free route to tri- and pentablock terpolymers

    Zhao, Junpeng

    2014-01-01

    Metal-free polymerization of ethylene oxide (EO) catalyzed by a relatively mild phosphazene base (t-BuP2) was proven feasible, which enabled the one-pot sequential polymerization of EO, ε-caprolactone, and l-lactide. Using either 3-phenyl-1-propanol or water as an initiator, the corresponding triblock or pentablock terpolymers were easily prepared. © 2014 the Partner Organisations.

  7. Supramolecular self-assembly of novel thermo-responsive double-hydrophilic and hydrophobic Y-shaped [MPEO-b-PEtOx-b-(PCL)2] terpolymers

    Petrova, Svetlana; Venturini, Cristina Garcia; Jäger, Alessandro; Jäger, Eliezer; Hrubý, Martin; Pavlova, Ewa; Štěpánek, Petr

    2015-01-01

    Roč. 5, č. 77 (2015), s. 62844-62854. ISSN 2046-2069 R&D Projects: GA MŠk(CZ) LH14079; GA MŠk(CZ) 7F14009 Institutional support: RVO:61389013 Keywords : Y-shaped [PEO-b-PEtOx-b-(PCL)2] terpolymers * light scattering * nanoparticles Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.840, year: 2014

  8. Novel thermo-responsive double-hydrophilic and hydrophobic MPEO-b-PEtOx-b-PCL triblock terpolymers: synthesis, characterization and self-assembly studies

    Petrova, Svetlana; Venturini, Cristina Garcia; Jäger, Alessandro; Jäger, Eliezer; Černoch, Peter; Kereiche, S.; Kováčik, L.; Raška, I.; Štěpánek, Petr

    2015-01-01

    Roč. 59, 24 February (2015), s. 215-225. ISSN 0032-3861 R&D Projects: GA ČR GAP208/10/1600; GA MŠk(CZ) 7F14009 Institutional support: RVO:61389013 Keywords : MPEO-b-PEtOx-b-PCL triblock terpolymers * light-scattering * thermo-responsive nanoparticles Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.562, year: 2014

  9. Redução e substituição do ácido crômico na etapa de condicionamento de ABS para metalização Reduction and replacement of chromic acid in step-conditioning of ABS for metallization

    Ana Paula Kurek

    2009-01-01

    Full Text Available Na etapa de condicionamento de peças em acrilonitrila-butadieno-estireno (ABS, geralmente, são empregadas soluções sulfocrômicas, resultando na geração de efluentes altamente tóxicos e ambientalmente poluentes. Este trabalho apresenta resultados do estudo do emprego de soluções condicionantes visando à redução e substituição do ácido crômico. O condicionamento das amostras foi realizado em banhos contendo soluções de ácido crômico e ácido sulfúrico, permanganato de potássio e ácido fosfórico, e ácido sulfúrico, ácido fosfórico e dicromato de potássio, variando-se concentração, tempo de imersão e temperatura. A morfologia e estrutura da superfície das amostras foram analisadas por microscopia eletrônica de varredura (MEV, rugosidade e espectroscopia no infravermelho (FITR/ATR e a qualidade da adesão metálica após cromagem foi avaliada por inspeção visual, testes de adesão e de corrosão por exposição à névoa salina. Os resultados mostraram que o condicionamento químico ocasionou remoção dos componentes do ABS na superfície das amostras, provocando modificações como rugosidade e formação de poros, cavidades e reentrâncias, que influenciaram na adesão e foram dependentes da solução e das condições empregadas. O ácido crômico pode ser empregado em concentrações menores que a solução padrão (400 g.L-1 e soluções isentas deste foram eficientes na modificação da superfície e adesão metálica.In step-conditioning (etching of acrylonitrile-butadiene-styrene (ABS terpolymer, use is generally made of sulfuric/chromic acid solutions resulting in the generation of highly toxic, environmentally polluting waste. The present work reports the results of a study of reduction and replacement of chromic acid from the etching solution. The samples conditioning was carried out in baths containing solutions of chromic and sulfuric acids, potassium permanganate and phosphoric acid, and sulfuric

  10. Filled Ethylene-propylene Diene Terpolymer Elastomer as ThermalInsulator for Case-bonded Solid Rocket Motors

    C. M. Bhuvaneswari

    2008-01-01

    Full Text Available Ethylene-propylene diene terpolymer (EPDM-based insulation system is being globallyused for case-bonded solid rocket motors. A study was undertaken using EPDM as base polymer,blended with hypalon and liquid EPDM and filled with fibrous and non-fibrous fillers. Theseformulations were evaluated as rocket motor insulation system. The basic objective of the studywas to develop an insulation system based on EPDM for case-bonded applications. A series ofrocket motor insulator compositions based on EPDM, filled with particulate and fibrous fillerslike precipitated silica, fumed silica, aramid, and carbon fibres have been studied for mechanical,rheological, thermal, and interface properties. Compositions based on particulate fillers wereoptimised for the filler content. Comparatively, fumed silica was found to be superior as fillerin terms of mechanical and interface properties. Addition of fibrous filler (5 parts improved thepeel strength, and reduced the thermal conductivity and erosion rate. All the compositions wereevaluated for sulphur and peroxide curing. Superior mechanical properties were achieved forsulphur-cured products, whereas peroxide-cured products exhibited an excellent ageing resistance.Rocket motors were insulated with optimised composition and propellant cast, and the motorswere evaluated by conducting static test in end-burning mode.Defence Science Journal, 2008, 58(1, pp.94-102, DOI : http://dx.doi.org/10.14429/dsj.58.1628

  11. Verdivurdering av SAS AB

    Gangås, Silje Garberg

    2013-01-01

    Formålet med denne mastergradsavhandlingen har vært å beregne den teoretiske verdien på det børsnoterte selskapet SAS AB og på bakgrunn av denne gi en handlingsanbefaling på selskapets aksje. Forskningsspørsmålet for oppgaven er utledet som følger: ”Hva er verdien av SAS AB?” SAS AB er inne i en fundamental omstillingsprosses hvor den nye strategien, 4XNG, ble presentert og påbegynt november 2012. Omstillingsprosessen innebærer blant annet en omfattende omstrukturering i organisasjonen ...

  12. ABS 415 Course Tutorial / tutorialrank

    welcome1257

    2015-01-01

                     For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 4 Times, Rating: A+   ASHFORD ABS 415 Week 1 DQ 1Discovering Strengths in Leadership ASHFORD ABS 415 Week 1 DQ 2 Ethical Leadership ASHFORD ABS 415 Week 2 DQ 1 Developing Emotional Intelligence in Leadership ASHFORD ABS 415 Week 2 DQ 2 Elements of Emotional Intelligence in Leadership ASHFORD ABS 415 Week 3 DQ 1 Motivational...

  13. Triblock-Terpolymer-Directed Self-Assembly of Mesoporous TiO2: High-Performance Photoanodes for Solid-State Dye-Sensitized Solar Cells

    Docampo, Pablo

    2012-04-30

    A new self-assembly platform for the fast and straightforward synthesis of bicontinuous, mesoporous TiO 2 films is presented, based on the triblock terpolymer poly(isoprene - b - styrene - b - ethylene oxide). This new materials route allows the co-assembly of the metal oxide as a fully interconnected minority phase, which results in a highly porous photoanode with strong advantages over the state-of-the-art nanoparticle-based photoanodes employed in solidstate dye-sensitized solar cells. Devices fabricated through this triblock terpolymer route exhibit a high availability of sub-bandgap states distributed in a narrow and low enough energy band, which maximizes photoinduced charge generation from a state-of-the-art organic dye, C220. As a consequence, the co-assembled mesoporous metal oxide system outperformed the conventional nanoparticle-based electrodes fabricated and tested under the same conditions, exhibiting solar power-conversion efficiencies of over 5%. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Well-defined polyethylene-based graft terpolymers by combining nitroxide-mediated radical polymerization, polyhomologation and azide/alkyne “click” chemistry†

    Alkayal, Nazeeha

    2016-03-30

    Novel well–defined polyethylene–based graft terpolymers were synthesized via the “grafting onto” strategy by combining nitroxide-mediated radical polymerization (NMP), polyhomologation and copper (I)-catalyzed azide-alkyne cycloaddition (CuAAC) “click” chemistry. Three steps were involved in this approach: (i) synthesis of alkyne-terminated polyethylene-b-poly(ε-caprolactone) (PE-b-PCL-alkyne) block copolymers (branches) by esterification of PE-b-PCL-OH with 4-pentynoic acid; the PE-b-PCL-OH was obtained by polyhomologation of dimethylsulfoxonium methylide to afford PE-OH, followed by ring opening polymerization of ε-caprolactone using the PE-OH as macroinitiator, (ii) synthesis of random copolymers of styrene (St) and 4-chloromethylstyrene (4-CMS) with various CMS contents, by nitroxide-mediated radical copolymerization (NMP), and conversion of chloride to azide groups by reaction with sodium azide (NaN3) (backbone) and (iii) “click” linking reaction to afford the PE-based graft terpolymers. All intermediates and final products were characterized by high-temperature size exclusion chromatography (HT-SEC), Fourier transform infrared spectroscopy (FTIR), proton nuclear magnetic resonance spectroscopy (1H NMR) and differential scanning calorimetry (DSC).

  15. Estudo da adsorção de hidrogênio e sulfeto na superfície de paládio: aspectos experimentais (eletroquímica) e teóricos (ab initio e Teoria do Funcional da Densidade)

    Ângelo Antônio Carlos D.; Souza Aguinaldo R. de; Morgon Nelson H.; Sambrano Júlio R.

    2001-01-01

    The adsorption of H and S2- species on Pd (100) has been studied with ab initio, density-functional calculations and electrochemical methods. A cluster of five Pd atoms with a frozen geometry described the surface. The computational calculations were performed through the GAUSSIAN94 program, and the basis functions adapted to a pseudo-potential obtained by using the Generator Coordinate Method adapted to the this program. Using the cyclic voltammetry technique through a Model 283 Potentiostat...

  16. um estudo de caso

    Costa, Cátia Filipa Pereira da

    2011-01-01

    Dissertação apresentada à Universidade Fernando Pessoa como parte dos requisitos para obtenção do grau de Mestre em Psicologia Jurídica As situações de abuso sexual de crianças nas quais o perpetrador pertence ao sexo feminino obtiveram ao longo dos últimos anos um acrescido reconhecimento por parte da comunidade científica, evidenciado pelo significativo incremento das investigações no âmbito desta temática consistindo na sua maioria estudos de caso. Um conjunto de particularidades encont...

  17. The AB Staff Plan

    Boillot, J; Delahaye, J P; Myers, S; CERN. Geneva. AB Department

    2003-01-01

    The present report summarises the staff plan of the newly created Accelerators and Beams (AB) Division following the restructuring of the Accelerator Sector and covering the period 2003 to 2010. It underlines the refocusing of the staff on priority work, especially the LHC Project and is coherent with the recently adopted CERN Long Term Plan (LTP). It compares the requested and available manpower (both staff and industrial support) for each Project, Programme and Activity (PPA) split in work packages and highlights the missing manpower for each category of personnel.

  18. AB Manpower Plan 2007

    Myers, Stephen

    2007-01-01

    The present exercise is not as such a "manpower plan" but a purely budgetary comparison of known plus requested resources with the known commitments over the period 2007-2012. From a purely budgetary point of view, AB will have the capacity to maintain all those recently hired staff who fulfill the criteria for long term employment at CERN. Following this budgetary exercise, AB proposes to perform a CERN-wide staff work plan so as to compare the manpower available to the quantity of work to be done in the totality of the work-packages. If there is a significant mismatch between these two quantities then we propose the following measures which would create personnel economies and allow us to redress the mismatch by increased recruitment: a new job severance scheme; CERN restructuring; use of the new CERN-ITER agreement; more flexibility in transfers from Materials to Personnel budgets. Failing this a re-examination of possible closure of lower priority facilities may be needed.

  19. Macromolecular Engineering: New Routes Towards the Synthesis of Well-??Defined Polyethers/Polyesters Co/Terpolymers with Different Architectures

    Alamri, Haleema

    2016-05-18

    The primary objective of this research was to develop a new and efficient pathway for well-defined multicomponent homo/co/terpolymers of cyclic esters/ethers using an organocatalytic approach with an emphasis on the macromolecular engineering aspects of the overall synthesis. Macromolecular engineering (as discussed in the first chapter) of homo/copolymers refers to the specific tailoring of these materials for achieving an easy and reproducible synthesis that results in precise molecular characteristics, i.e. molecular weight and polydispersity, as well as specific structure and end?group choices. Precise control of these molecular characteristics will provide access to new materials that can be used for pre-targeted purposes such as biomedical applications. Among the most commonly used engineering materials are polyesters (biocompatible and biodegradable) and polyethers (biocompatible), either as homopolymers or when or copolymers with linear structures. The ability to create non-linear structures, for example stars, will open new horizons in the applications of these important polymeric materials. The second part of this thesis describes the synthesis of aliphatic polyesters, particularly polycaprolactone and polylactide, using a metal-free initiator/catalyst system. A phosphazene base (t?BuP2) was used as the catalyst for the ring-opening copolymerization of ?-aprolactone (??CL) and L,Lactide (LLA) at room temperature with a variety of protic initiators in different solvents. These studies provided important information for the design of a metal-free route toward the synthesis of polyester?based (bio) materials. The third part of the thesis describes a novel route for the one?pot synthesis of polyether-b polyester block copolymers with either a linear or a specific macromolecular architecture. Poly (styrene oxide)?b?poly(caprolactone)?b?poly(L,lactide) was prepared using this method with the goal of synthesizing poly(styrene oxide)-based materials since this

  20. Estudo da adsorção de hidrogênio e sulfeto na superfície de paládio: aspectos experimentais (eletroquímica e teóricos (ab initio e Teoria do Funcional da Densidade

    Ângelo Antônio Carlos D.

    2001-01-01

    Full Text Available The adsorption of H and S2- species on Pd (100 has been studied with ab initio, density-functional calculations and electrochemical methods. A cluster of five Pd atoms with a frozen geometry described the surface. The computational calculations were performed through the GAUSSIAN94 program, and the basis functions adapted to a pseudo-potential obtained by using the Generator Coordinate Method adapted to the this program. Using the cyclic voltammetry technique through a Model 283 Potentiostat/Galvanostat E.G.&G-PAR obtained the electrochemical results. The calculated chemisorption geometry has a Pd-H distance of 1.55Å, and the potential energy surface was calculated using the Becke3P86//(GCM/DFT/SBK methodology. The adsorption of S2- ions on Pd surface obtained both through comparison between the experimental and theoretical results, at MP2 level, suggest a S2- absorption into the metallic cluster. The produced Pd-(S2- system was show to be very stable under the employed experimental conditions. The paper has shows the powerful aid of computational methods to interpret adsorption experimental data.

  1. ABS 415 ASH Course Tutorial / Tutorialrank

    charles

    2015-01-01

    For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 4 Times, Rating: A+   ASHFORD ABS 415 Week 1 DQ 1Discovering Strengths in Leadership ASHFORD ABS 415 Week 1 DQ 2 Ethical Leadership ASHFORD ABS 415 Week 2 DQ 1 Developing Emotional Intelligence in Leadership ASHFORD ABS 415 Week 2 DQ 2 Elements of Emotional Intelligence in Leadership ASHFORD ABS 415 Week 3 DQ 1 Motivational Techniques ASHFORD ABS 415 Week 3 DQ 2 Leadership in a Cr...

  2. Water-base acrylic terpolymer as a corrosion inhibitor for SAE1018 in simulated sour petroleum solution in stagnant and hydrodynamic conditions

    Highlights: ► Corrosion inhibition of a water-base copolymer, ATP, was studied. ► Efficiency more than 90% was obtained with 0.8 mmol/L ATP in 2000 rpm. ► ATP obeys Langmuir isotherm in static and hydrodynamic conditions. ► With the presence of ATP, OM images showed a decrease in surface attack. - Abstract: The effect of static and hydrodynamic conditions (0–2000 rpm) on corrosion inhibition of a water-base acrylic terpolymer (ATP), methyl methacrylate/butyl acrylate/acrylic acid, for SAE1018 steel in simulated sour petroleum corrosive solution (NACE 1D196) were investigated by AC/DC electrochemical tests. Increase in rotation speed accelerates the corrosion rate; however the corrosion inhibitor efficiency increases. This was attributed to the enhanced mass transport of inhibitor molecules to the metal surface. OM examinations also demonstrate that in presence of ATP, a decrease in corrosion attacks is observed. Thermodynamic calculations also showed that ATP obeys Langmuir adsorption isotherm and adsorbs chemically into the surface.

  3. Increasing the Mechanical Strength of Block Polymer Ion Gels Through the Stepwise Self-Assembly of a Thermoresponsive ABC Triblock Terpolymer

    Hall, Cecilia; Zhou, Can; Danielsen, Scott; Lodge, Timothy

    Blends of network-forming block polymers and ionic liquids have remarkable potential for solid electrolytes, as they allow the combination of desirable mechanical and electrical properties. While ABA triblock copolymers have successfully been implemented as the network component of ion gels, these networks contain looped defects, where the endblocks of the polymer loop back into the same spherical core instead of forming a bridge between two cores. We demonstrate that the ABC triblock terpolymer poly(ethylene-alt-propylene)-block-poly(ethylene oxide)-block-poly(N-isopropylacrylamide) (PEP-b-PEO-b-PNIPAm) in the ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide forms a thermoreversible gel network with negligible looping defects. PEP-core micelles exist at all temperatures, while cooling causes association of the PNIPAm micelle corona to form a bridging network. Small-angle x-ray scattering and dynamic light scattering were used to characterize the high-temperature micelles. These gels show enhanced mechanical properties and the ability to form gels at lower concentrations than the corresponding thermoresponsive ABA triblock copolymers.

  4. Controlling Solution Self-assembly and Non-Solvent Induced Microphase Separation of Triblock Terpolymers to Generate Nanofiltration Membranes with Chemically-Tailored Pore Walls

    Boudouris, Bryan; Mulvenna, Ryan; Weidman, Jacob; Phillip, William

    2014-03-01

    Block polymer-based templates have been utilized in a number of membrane applications; however, there has yet to be a demonstration of a nanoporous block polymer thin film that can achieve high flux and high selectivity simultaneously while also allowing for the facile tuning of the pore wall chemistry. Here, we demonstrate that by synthesizing and controlling the solution self-assembly of a triblock terpolymer, polyisoprene- b-polystyrene- b-poly(N, N-dimethylacrylamide) (PI-PS-PDMA), and precisely inducing non-solvent induced phase separation during the self-assembly process allows for the creation of an asymmetric nanoporous membrane with PDMA-lined pore walls. This PDMA functionality is then converted to any number of side chain functionalities through simple chemistry in the solid state. In this way, we are able to show a highly selectivity membrane that can separate analytes of interest based both on size and chemical composition at a high solution flux. In fact, this high fidelity structure has a very narrow distribution of pore sizes (500 cm2) . This has allowed for the separation of particles with hydrodynamic radii as low as 0.8 nm, which is the smallest separation achieved using a block polymer-based membrane to date.

  5. Teologia e estudo das escrituras

    Rabuske, Irineu J.

    2007-01-01

    Full Text Available A revalorização da sagrada escritura, no âmbito da Igreja Católica, enseja uma reflexão sobre a relação entre a teologia e o estudo das sagradas escrituras. Ponto de partida para esta reflexão é o nº 24 do documento Dei Verbum, no Concílio Ecumênico Vaticano II: ". . . o estudo das Sagradas Escrituras seja como que a alma da Sagrada Teologia".

  6. Clinical significance of combined detection of multiple serum antibodies (AsAb, EmAb, AcAb, AoAb, ToxAb) in infertile women

    Objective: To determine the clinical significance of combined detection of multiple serum antibodies in infertile women. Methods; Serum multiple antibodies were examined in 120 infertile women, including 88 failed to get pregnancy and 32 with repeated spontaneous abortion. The antibodies tested were: (1) anti-sperm antibody (AsAb) (2) endometrial antibody (EmAb) (3) anti-cardiophospholipid antibody (AcAb) (4) Anti-ovarian antibody (AoAb) and Toxoplasmosis antibody (ToxAb). Results: In 48 of the infertile women, none of the five antibodies were positive (40% of 120). The rest were: one antibody positive--38/120 or 31.6%; two antibodies positive--31/120 or 25.83%, three and four antibodies positive--4/120 or 3.33%. None of the women were positive with all five antibodies. Conclusion: Immune factor was the chief cause of infertility in women. (authors)

  7. Equity valuation : Atlas Copco AB

    Santos, Ricardo Manuel Castro Lopes Alba

    2016-01-01

    This Dissertation presents a literature review of some of the most appraised theories on equity valuation models. A thoughtful analysis is made, presenting the main advantages and restrictions of each model and setting the path for a discussion about improvements to be made on this field of study. A practical implementation follows, proposing a fair value estimation of Atlas Copco AB shares. Atlas Copco is a Swedish-based capital goods company, operating across four differen...

  8. AB Levitator and Electricity Storage

    Bolonkin, Alexander

    2007-01-01

    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative...

  9. Thermonuclear Reflect AB-Reactor

    Bolonkin, Alexander

    2008-01-01

    The author offers a new kind of thermonuclear reflect reactor. The remarkable feature of this new reactor is a three net AB reflector, which confines the high temperature plasma. The plasma loses part of its energy when it contacts with the net but this loss can be compensated by an additional permanent plasma heating. When the plasma is rarefied (has a small density), the heat flow to the AB reflector is not large and the temperature in the triple reflector net is lower than 2000 - 3000 K. This offered AB-reactor has significantly less power then the currently contemplated power reactors with magnetic or inertial confinement (hundreds-thousands of kW, not millions of kW). But it is enough for many vehicles and ships and particularly valuable for tunnelers, subs and space apparatus, where air to burn chemical fuel is at a premium or simply not available. The author has made a number of innovations in this reactor, researched its theory, developed methods of computation, made a sample computation of typical pr...

  10. AB Levitator and Electricity Storage

    Bolonkin, A

    2007-01-01

    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative weight ratio of this engine is 0.01 - 0.1 (from thrust). For some types of AB engine (toroidal form) the thrust easily may be changed in any direction without turning of engine. The author computed many projects using different versions of offered AB engine: small device for levitation-flight of a human (including flight from Earth to Outer Space), fly VTOL car (track), big VTOL aircrat, suspended low altitude stationary satellite, powerful Space Shuttle-like booster for travel to the Moon and Mars without spending energ...

  11. Estudo multicasos sobre atividades inovativas

    Sonia Regina Hierro Parolin

    2013-09-01

    Full Text Available Em estudos sobre competitividade argumenta-se que as empresas necessitam de estratégias baseadas em inovações e de capacidades internas em constantes e intensas transformações, não somente nos padrões tecnológicos, mas também no encadeamento do processo de gestão das atividades inovativas, como processos dinâmicos, não lineares e diversificados, em função de múltiplos fatores dos ambientes interno e externo. Para contribuir com essas discussões, neste artigo apresenta-se um estudo multicasos em quatro indústrias de médio e grande portes, de segmentos, densidades tecnológicas e históricos com inovações diferentes entre si. Como principais resultados, salientam-se o encadeamento das atividades inovativas como parte de uma estratégia organizacional para obter resultados com inovação e a afluência de todas as pessoas, e não somente as alocadas em pesquisa e desenvolvimento, para o cumprimento dessa estratégia.

  12. AP calculus AB/BC

    Schwartz, Stu

    2013-01-01

    All Access for the AP® Calculus AB & BC Exams Book + Web + Mobile Everything you need to prepare for the Advanced Placement® exam, in a study system built around you! There are many different ways to prepare for an Advanced Placement® exam. What's best for you depends on how much time you have to study and how comfortable you are with the subject matter. To score your highest, you need a system that can be customized to fit you: your schedule, your learning style, and your current level of knowledge. This book, and the free online tools that come with it, will help you personalize your AP® Cal

  13. ABS: Sequence alignment by scanning

    Bonny, Mohamed Talal

    2011-08-01

    Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  14. Biosynthesis of P(3HB-co-3HV-co-3HHp terpolymer by Cupriavidus necator PHB-4 transformant harboring the highly active PHA synthase gene of Chromobacterium sp. USM2

    Rathi, D-N.

    2013-01-01

    Full Text Available Aims: This study evaluates potentials of Cupriavidus necator PHB4 transformant harboring the highly activepolyhydroxyalkanoate synthase gene (phaC of a locally isolated Chromobacterium sp. USM2 for its ability toincorporate 3-hydroxyheptanoate (3HHp monomer.Methodology and results: A mixture of fructose and sodium heptanoate fed to the culture gave rise to poly(3-hydroxybutyrate-co-3-hydroxyvalerate-co-3-hydroxyheptanoate, [P(3HB-co-3HV-co-3HHp] terpolymer synthesis, withtraces of 3HHp monomers confirmed through gas chromatography (GC, proton (1H and carbon (13C NMR spectra.Conclusion, significance and impact of study: This study has revealed that the PHA synthase of Chromobacteriumsp. USM2 has a broad range of substrate specificity. The synthase is able to polymerize 3-hydroxyalkanoate monomershaving 4–7 carbon atoms.

  15. Genetic control of immune responses in vitro. VI. Experimental conditions for the development of helper T-cell activity specific for the terpolymer L-glutamic acid60-L-alanine30-L-tyrosine10 (GAT) in nonresponder mice

    Mice which are genetic nonresponders to the random terpolymer of L-glutamic acid60-L-alanine30-L-tyrosine10 (GAT) not only fail to develop GAT-specific antibody responses when stimulated with soluble GAT either in vivo or in vitro, but develop GAT-specific T cells which suppress the GAT-specific plaque-forming cell response of normal nonresponder mice stimulated with GAT complexed to methylated bovine serum albumin (MBSA). Thus, both responder and nonresponder mice have T cells which recognize GAT. However, nonresponder mice can develop GAT-specific helper T cells if immunized with GAT bound to MBSA or to macrophages. The relevance of Ir gene-controlled responses is discussed

  16. 腈纶皂化制备电流变液悬浮粒子的研究%Studies on Saponification of Acrylonitrile Terpolymer for Suspending Particles of Electrorheological Fluids

    吴孟强; 陈艾

    2001-01-01

    In order to prepare suspending particles for electrorheological fluids, hetergeneous hydrolysis of acrylonitrile terpolymer is conducted in presence of saponifying agent(sodium hydroxide) in this paper. The effects of the saponification conditions such as the amount of added sodium hydroxide, time duration and temperature on the degree of saponification are studied in detail. Meanwhile, the conversion of nitrile groups is discussed with the result that the saponification of nitrile groups of the terpolymer initially yields amide groups, then slows down to carboxylic groups. The research sets a way for the preparation of dispersing particles of water-free electrorheological fluids tentatively used for controlling light transmittance.%为了制备无水电流变液用悬浮粒子,研究了腈纶在碱性条件下的多相水解。详细考察了皂化试剂氢氧化钾的用量,皂化时间和温度等皂化条件对皂化程度的影响; 讨论了氰基转化过程。研究结果表明,在皂化初期,腈纶分子链上的氰基转化为酰胺基,然后缓慢转化为羧基。给出了一条制备无水电流变液用悬浮粒子的方法,并初步考察了该类电流变液的控光特性。

  17. Ab-Initio Molecular Dynamics

    Kühne, Thomas D

    2012-01-01

    Computer simulations and molecular dynamics in particular, is a very powerful method to provide detailed and essentially exact informations of classical many-body problems. With the advent of \\textit{ab-initio} molecular dynamics, where the forces are computed on-the-fly by accurate electronic structure calculations, the scope of either method has been greatly extended. This new approach, which unifies Newton's and Schr\\"odinger's equations, allows for complex simulations without relying on any adjustable parameter. This review is intended to outline the basic principles as well as a survey of the field. Beginning with the derivation of Born-Oppenheimer molecular dynamics, the Car-Parrinello method as well as novel hybrid scheme that unifies best of either approach are discussed. The predictive power is demonstrated by a series of applications ranging from insulators to semiconductors and even metals in condensed phases.

  18. Avaliação da degradação térmica e fotooxidativa do ABS para fins de reciclagem Evaluation of thermal and photo-oxidative ABS degradation with recycling purposes

    Elisabete Maria Saraiva Sanchez

    2003-07-01

    Full Text Available Este trabalho tem como objetivo avaliar a degradação térmica e fotooxidativa do terpolímero poli (acrilonitrila-butadieno-estireno, ABS, utilizado em componentes internos de automóveis. Corpos de prova de ABS moldados por injeção foram submetidos ao envelhecimento térmico, segundo a norma ASTM D794, e ao envelhecimento fotooxidativo segundo as normas ASTM G24 e G53. As amostras envelhecidas foram submetidas às análises dinâmico-mecânica, e microscópicas por microscopia de força atômica no modo não contato. Os resultados mostraram que as transições, tanto da fase vítrea quanto da fase elastomérica na superfície do ABS, são afetadas pela degradação. As áreas dos picos das curvas de módulo de perda em função da temperatura relativos às transições vítreas do ABS foram correlacionadas ao alongamento na ruptura, em função do tempo e tipo de envelhecimento. As propriedades mecânicas são influenciadas de forma mais acentuada pela extensão da degradação da matriz. O método de envelhecimento ASTM G24 mostrou-se mais agressivo que o G53, seja para a fase BR ou para a fase SAN. As imagens microscópicas mostraram que os diferentes envelhecimentos provocaram diferentes variações na rugosidade das superfícies. Amostras fotooxidadas, com perda de alongamento maior que 50%, foram reprocessadas e mostraram uma recuperação superior a 90% nessa propriedade.The aim of this work is the evaluation of thermal and photo-oxidative degradation of the terpolymer acrylonitrile-butadiene-styrene, ABS, used in internal automotive components. Injection molded specimens were aged by ASTM D794, ASTM G24 and ASTM G53 standards. The aged test specimens were studied by means of dynamic mechanical analysis and non-contact atomic force microscopy. The results revealed that the transitions of the glass and rubber phases were affected by the degradation. The area under linear loss modulus-temperature curves was related to tensile properties

  19. GINGA Observations of AB Doradus

    Vilhu, O.; Tsuru, T.; Collier Cameron, A.

    We report GINGA observations of the pre main sequence star AB Doradus (HD 36705), performed during 8 - 12 January, 1990. Some rotational modulation might be present. four X-ray flares were detected. Three of these events were similar to the EINSTEIN HRI-flare (Vilhu and Linsky, 1987), with decay times around 25 min. The last flare had long rise and decay times (100 min), resembling the EXOSAT flares observed by Collier Cameron et.al. (1988). The mean flare spectrum can be fitted by a thermal bremstrahlung with temperature 5.0 keV, or by a power-law model with photon index 2.2. The 3 upper limit of the Iron line equivalent width in the flare spectrum is 1 keV, weaker than predicted by thermal models. This Iron line anomaly was first discussed in the case of UX Ari by Tsuru et. al. (1989). However, normal equivalent widths can be derived from several EXOSAT spectra of active cool stars (Pallavicini and Tagliaferri, 1990). We discuss the possibility that the continuum from non-thermal electrons (producing also the microwave emission) could occasionally lower the apparent equivalent width. The mechanism works for reasonably low magnetic field strengths and electon power-law indexes. However, a large population of non-thermal electrons is needed (comparable to the thermal one). Stronger magnetic fields could explain the radio emission with less electrons, but then the non-thermal X-ray continuum remains small.

  20. AP calculus AB & BC crash course

    Rosebush, J

    2012-01-01

    AP Calculus AB & BC Crash Course - Gets You a Higher Advanced Placement Score in Less Time Crash Course is perfect for the time-crunched student, the last-minute studier, or anyone who wants a refresher on the subject. AP Calculus AB & BC Crash Course gives you: Targeted, Focused Review - Study Only What You Need to Know Crash Course is based on an in-depth analysis of the AP Calculus AB & BC course description outline and actual AP test questions. It covers only the information tested on the exams, so you can make the most of your valuable study time. Written by experienced math teachers, our

  1. Main: DREDR1ATRD29AB [PLACE

    Full Text Available DREDR1ATRD29AB S000152 23-June-2006 (last modified) kehi Related to responsiveness ...dependent in the ABA-responsive expression of the rd29A in Arabidopsis; DRE; drought; water stress; oxidativ

  2. Tumor estromal gastrointestinal: estudo de oito casos

    Amico Enio Campos; Coimbra Cesar Wilson Bastos; Bugalho Luiz Antônio; Nai Gisele Alborghetti; Matos Ricardo Marcondes; Machado Cibele Chuery; Silva Fabrício Colacino

    2006-01-01

    OBJETIVO: O diagnóstico e tratamento dos tumores estromais gastrointestinais (TEGI) têm evoluído a partir de estudos recentes de genética e biologia molecular. Tais avanços têm refletido em melhor sobrevivência dos doentes. MÉTODOS: Foi realizado estudo retrospectivo no período de novembro/1998 a julho/2004, em instituição universitária e em clínica privada dos autores, que identificou portadores de TEGI a partir de positividade para c-kit (CD 117), ao exame imunoistoquímico. RESULTADOS: Dos ...

  3. Do buzz ao marketing viral : um estudo

    Viveiros, Nuno Filipe Carvalho

    2015-01-01

    Dissertação de Mestrado em Gestão de Empresas/MBA. Com o crescente ênfase do marketing viral e das redes sociais na divulgação de produtos, serviços e marcas, o seu estudo torna-se pertinente para o desenvolvimento de campanhas mais eficazes e eficientes. Esta tese apresenta um estudo centralizado sobre o impacto que um país tem na criação de buzz de modo a tornar as campanhas de marketing, virais. Estudando e analisando três países (dois desenvolvidos e um em desenvolvimento), com o objet...

  4. Ab initio valence calculations in chemistry

    Cook, D B

    1974-01-01

    Ab Initio Valence Calculations in Chemistry describes the theory and practice of ab initio valence calculations in chemistry and applies the ideas to a specific example, linear BeH2. Topics covered include the Schrödinger equation and the orbital approximation to atomic orbitals; molecular orbital and valence bond methods; practical molecular wave functions; and molecular integrals. Open shell systems, molecular symmetry, and localized descriptions of electronic structure are also discussed. This book is comprised of 13 chapters and begins by introducing the reader to the use of the Schrödinge

  5. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    Souto, F.J.; Haskin, F.E. [Univ. of New Mexico, Albuquerque, NM (United States). Dept. of Chemical and Nuclear Engineering; Kmetyk, L.N. [Sandia National Labs., Albuquerque, NM (United States)

    1994-10-01

    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS.

  6. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS

  7. Study of processing conditions on properties of ABS and clay organically modified nanocomposites; Estudo das condicoes de processamento nas propriedades de nanocompositos de ABS e argilas organofilicas

    Galvan, Danieli; Massucato, Felipe; Bartoli, Julio R., E-mail: bartoli@feq.unicamp.br [Fac. de Engenharia Quimica/Universidade Estadual de Campinas - DTP/FEQ/UNICAMP, Campinas, SP (Brazil); D' Avila, Marcos A. [Fac. de Engenharia Mecanica/Universidade Estadual de Campinas - DEMA/FEM/UNICAMP, Campinas, SP (Brazil); Fernandes, Elizabeth G. [Tezca P and D Celulas Solares, Campinas, SP (Brazil)

    2011-07-01

    Nanocomposites of poly(acrylonitrile-butadiene-styrene) and organically modified montmorillonite clay were prepared by melt intercalation on a co-rotating twin-screw extruder. The independent variables studied were the kind of organoclay (Cloisite 20A and Cloisite 30B) and the screw torque at levels of 45 and 70%. The effect of these variables on the intercalation/exfoliation were accessed by means of the morphological characteristics using X-ray diffraction and the mechanical properties of uniaxial tensile test. The experimental results showed that the incorporation of clay in the polymeric matrix improved the mechanical properties of elastic modulus, yield stress and tensile strength of nanocomposites, being more significant for that containing Cloisite 30B. Torque was also a significant variable for the responses studied. (author)

  8. Improved age constraints for the AB Dor quadruple system - The binary nature of AB Dor B

    Janson, M; Lenzen, R; Close, L; Nielsen, E; Hartung, M; Henning, T; Bouy, H; Janson, Markus; Brandner, Wolfgang; Lenzen, Rainer; Close, Laird; Nielsen, Eric; Hartung, Markus; Henning, Thomas; Bouy, Herve

    2006-01-01

    We present resolved NACO photometry of the close binary AB Dor B in H- and Ks-band. AB Dor B is itself known to be a wide binary companion to AB Dor A, which in turn has a very low-mass close companion named AB Dor C. These four known components make up the young and dynamically interesting system AB Dor, which will likely become a benchmark system for calibrating theoretical pre-main sequence evolutionary mass tracks for low-mass stars. However, for this purpose the actual age has to be known, and this subject has been a matter of discussion in the recent scientific literature. We compare our resolved photometry of AB Dor Ba and Bb with theoretical and empirical isochrones in order to constrain the age of the system. This leads to an age estimate of about 50 to 100 Myr. We discuss the implications of such an age range for the case of AB Dor C, and compare with other results in the literature.

  9. Ab interno trabeculectomy: A comprehensive review

    Ting Ting Liu

    2013-07-01

    Full Text Available PURPOSE To summarize the original literature on ab interno trabeculectomy with the Trabectome system and to review its efficacy and safety in the treatment of glaucoma. METHOD A literature search in PubMed was performed on ab interno trabeculectomy with the Trabectome system, and clinical relevant information was reviewed and summarized. RESULTS Ab interno trabeculectomy with the Trabectome system on average lowered intraocular pressure (IOP to the mid-teens, and decreased the number of required glaucoma medications. Greater preoperative IOP correlated to a greater percent reduction in IOP. The success rates varied among studies, and the definition of success differed by authors. Intraoperative blood reflux was found in nearly all cases. Incidences of early hypotony and IOP spikes were low. No cases of endophthalmitis, wound leak, aqueous misdirection, choroidal hemorrhage or effusions, and irreversible visual acuity decrease (≥2 Snellen lines have been reported. Available studies had a significant amount of data overlap. Only limited data on long-term results was available. There was no randomized controlled trial to date. CONCLUSIONS Ab interno trabeculectomy with the Trabectome system is an effective and safe surgical approach for patients with various types of open angle glaucoma. On average, the procedure at least in the short term lowers IOP to the mid teens regardless of preoperative IOP with or without the aid of topical medications.

  10. Reference: DREDR1ATRD29AB [PLACE

    Full Text Available DREDR1ATRD29AB Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, N... ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant J. 34: 137-148 (2003) PubMed: 12694590; ...

  11. Preparation of national standard product of Anti-TgAb and Anti-TpoAb in our laboratory

    Objective: To standardize the China-made quantitative immunoassay kits of Anti-TgAb and Anti-TpoAb with a national standdized product of Anti-TgAb and And-TpoAb developed in our laboratory. Methods and Results: Higher titer Anti - TgAb and Anti-TpoAb serum specimens were pooled and treated with centrifuging and filtering, then freeze-dried and packaged into 2ml anpoules for preparing the national standard candidate. The results of the collaborative study showed that, the immuno-activity of the Anti-TgAb was 3916 IU/Amp in term of the 65/093, and the immuno-activity of the Anti-TpoAb was 434 IU/Amp in term of the 66/387. Conclusion: On the basis of the present study, it is proposed that the candidate standard be established as the National Standard for Anti-TgAb and Anti-TpoAb for immunoassay, the immunoactivity of the Anti-TgAb 4000IU/Amp, and that of Anti - TpoAb is 430IU/Amp. A comparative study on the quality of immunoassay kits of Anti-TgAb and Anti-TpoAb by Axsym System, Immulite 1000, Modular Analytics El70, ADVIA Centaur Assay (the most commonly used types in China) is also presented. (authors)

  12. On the Strain Rate Sensitivity of Abs and Abs Plus Fused Deposition Modeling Parts

    Vairis, A.; Petousis, M.; Vidakis, N.; Savvakis, K.

    2016-06-01

    In this work the effect of strain rate on the tensile strength of fused deposition modeling parts built with Acrylonitrile-butadiene-styrene (ABS) and ABS plus material is presented. ASTM D638-02a specimens were built with ABS and ABS plus and they were tested on a Schenck Trebel Co. tensile test machine at three different test speeds, equal, lower, and higher to the test speed required by the ASTM D638-02a standard. The experimental tensile strength results were compared and evaluated. The fracture surfaces of selected specimens were examined with a scanning electron microscope, to determine failure mode of the filament strands. It was found that, as the test speed increases, specimens develop higher tensile strength and have higher elastic modulus. Specimens tested in the highest speed of the experiment had on average about 10% higher elastic modulus and developed on average about 11% higher tensile strength.

  13. KINETIC ANALYSIS OF CO-CONDENSATION POLYMERIZATION OF AB2 AND AB MONOMERS

    Min-qiang Yu; Zhi-ping Zhou; De-yue Yan

    2004-01-01

    This work deals with the kinetics of co-condensation polymerization of AB2 and AB monomers, giving expressions of the two-dimensional molecular weight distribution function and the number/weight average molecular weights of the resulting copolymers. The two-dimensional molecular weight distribution depends on two indices, n and l, which are the respective numbers of AB2 and AB units in a copolymer species. The evolution of the two-dimensional weight and z distributions during the co-condensation polymerization has been evaluated systematically. Finally, the two-dimensional distribution was transformed into a one-dimensional molecular weight distribution with only one variable (the molecular weight of the products instead of the degree of polymerization). The calculated results show that the highly branched copolymer has a very broad molecular weight distribution when the co-condensation polymerization approaches completion.

  14. Leaching behaviour of the Swedish KBS-glasses ABS 39 and ABS 41

    The planned Swedish KBS glass corrosion investigation program comprises experiments with inactive glasses containing simulated waste, prolonged in-situ tests, the characterization of corrosion products, immiscibility studies, and corrosion experiments with hot glass. This presentation gives a short description of the entire program. It focuses thereafter on some recent leaching results with the inactive KBS glass qualities ABS 39 and ABS 41, which were leached in a manner similar to the PNL MCC-1 test procedure. 5 figures, 9 tables

  15. Thermomechanical properties of ABS/PA AND ABS/PC blends

    GUINAULT, Alain; Sollogoub, Cyrille

    2009-01-01

    International audience The significant increase of Waste Electric and Electronic Equipment (WEEE) has led to an important research in upgrading recycled engineering plastics by means of a blending technique. Classical twin-screw extrusion is compared to a new blending technique, where two polymers are combined together and then flow in several static mixers. This technique allows to obtain different morphologies of compatibilized ABS/PA or ABS/PC blends and the aim of this work is to evalu...

  16. AB077. Relationship of TPO-Ab and TSH with in vitro fertilization and embryo transfer

    Wang, Liyun

    2015-01-01

    Objective Study of thyroid peroxidase antibodies and thyroid stimulating effect on in vitro fertilization embryo transfer ending. Methods From March 2011 to October 2013 in the reproductive center in Qinghai Province People’s Hospital in vitro fertilization embryo transfer a total of 378 cycles were analyzed. (I) Basis for TPO-Ab grouping: research group is thyroid peroxidase antibody positive and thyroid function in patients with normal 69 cycles (TPO-Ab+ group), control group is thyroid per...

  17. Genetics Home Reference: GM2-gangliosidosis, AB variant

    ... of GM2-gangliosidosis, AB variant: Genetic Testing Registry: Tay-Sachs disease, variant AB These resources from MedlinePlus offer ... AB variant Activator Deficiency/GM2 Gangliosidosis Activator-deficient Tay-Sachs disease GM2 Activator Deficiency Disease GM2 gangliosidosis, type ...

  18. Investigation of high level of AsAb, EmAb in fertility female serum infected by chlamydia trachomatis

    Objective: To investigate the mechanism of chlamydia trachomatis. AsAb, EmAb in female fertility. Methods: LPS antigen of chlamydia in reproduction tract of fertility female was detected by monoclonal antibody and immunology chromatography; the content of AsAb, EmAb in serum of fertility female was detected by ELISA. Results: Infections rate of chlamydia trachomatis in fertility female was higher than that in the control AsAb, EmAb in serum of the fertility patients who were infected with chlamydia trachomatis showed a significant difference from that in the control group. Conclusion: The level of AsAb, EmAb increases in patients who have been infected with chlamydia trachomatis and these cytokines is involved in the course of female fertility

  19. Ab initio mass tensor molecular dynamics

    Tsuchida, Eiji

    2010-01-01

    Mass tensor molecular dynamics was first introduced by Bennett [J. Comput. Phys. 19, 267 (1975)] for efficient sampling of phase space through the use of generalized atomic masses. Here, we show how to apply this method to ab initio molecular dynamics simulations with minimal computational overhead. Test calculations on liquid water show a threefold reduction in computational effort without making the fixed geometry approximation. We also present a simple recipe for estimating the optimal ato...

  20. Discovering chemistry with an ab initio nanoreactor

    Wang, Lee-Ping; Titov, Alexey; McGibbon, Robert; Liu, Fang; Pande, Vijay S.; Martínez, Todd J.

    2014-01-01

    Chemical understanding is driven by the experimental discovery of new compounds and reactivity, and is supported by theory and computation that provides detailed physical insight. While theoretical and computational studies have generally focused on specific processes or mechanistic hypotheses, recent methodological and computational advances harken the advent of their principal role in discovery. Here we report the development and application of the ab initio nanoreactor – a highly accelerat...

  1. Ab initio vel ex eventu. II

    Thiessen, P. A.; Treder, H.-J.

    Jedes initium wird durch experimenta crucis zum eventus. Jedes theoretisch interpretierbare ex-eventu-Resultat führt auf ein neues Initium. Gerade dies ist die gemeinsame Aussage von Atomistik, Quantenmechanik und Relativitätstheorie.Translated AbstractAb initio vel ex eventu. IIEvery initium becomes an eventus by experimenta crucis. Every theoretically interpretable ex-eventu result leads to a new initium. Right this is the joint assertion of atomism, quantum mechanics, and relativity.

  2. Highly scalable Ab initio genomic motif identification

    Marchand, Benoît

    2011-01-01

    We present results of scaling an ab initio motif family identification system, Dragon Motif Finder (DMF), to 65,536 processor cores of IBM Blue Gene/P. DMF seeks groups of mutually similar polynucleotide patterns within a set of genomic sequences and builds various motif families from them. Such information is of relevance to many problems in life sciences. Prior attempts to scale such ab initio motif-finding algorithms achieved limited success. We solve the scalability issues using a combination of mixed-mode MPI-OpenMP parallel programming, master-slave work assignment, multi-level workload distribution, multi-level MPI collectives, and serial optimizations. While the scalability of our algorithm was excellent (94% parallel efficiency on 65,536 cores relative to 256 cores on a modest-size problem), the final speedup with respect to the original serial code exceeded 250,000 when serial optimizations are included. This enabled us to carry out many large-scale ab initio motiffinding simulations in a few hours while the original serial code would have needed decades of execution time. Copyright 2011 ACM.

  3. Emergência de plântulas de abóbora a partir da avaliação da qualidade das sementes Squash seedlings emergency from seed quality evaluation

    Alexandra Augusti Boligon; Alessandro Dal' Col Lúcio; Danton Camacho Garcia

    2010-01-01

    O objetivo do estudo foi identificar as variáveis da análise de sementes de abóbora que melhor predizem a emergência de plântulas dessa cultura. O trabalho foi realizado no Departamento de Fitotecnia da Universidade Federal de Santa Maria. Três lotes de sementes de abóbora de cada um dos cultivares 'Caserta', 'De Tronco', 'Caravela' e 'Menina Brasileira' foram utilizados. Foi determinada a percentagem de plântulas normais nos testes de germinação, primeira contagem de germinação, teste de env...

  4. Estudo retrospectivo de latrodectismo na Bahia, Brasil

    Rejâne Maria Lira-da-Silva; Graciela Brige Matos; Roney Orismar Sampaio; Tania Brazil Nunes

    1995-01-01

    O trabalho apresenta um estudo retrospectivo de setenta e sete casos de latrodectismo no Estado da Bahia, Brasil, de agosto de 1980 a julho de 1990. Os dados foram levantados nos livros de registro e arquivo de fichas do CIAVE. O agente etiológico em 28% dos acidentes aracnídeos foi a espécie L. curacaviensis e a maior incidência foi registrada no meio urbano (57%), em indivíduos do sexo masculino (70%) e faixa etária de 10 a 29 anos (58%). Os principais sinais locais foram dor (56%), pápula ...

  5. Estudo comparativo de sistemas em aquecimento

    Castro, Inês Marques Costa Borges de

    2013-01-01

    O presente estudo pretende avaliar o desempenho energético e rentabilidade do uso de equipamento de climatização para o aquecimento ambiente de uma casa sénior, através de sistemas tradicionais de produção de água aquecida, como a caldeira e a tradicional bomba de calor, e um sistema apoiado num equipamento de produção solar térmico. Perante uma determinada arquitectura, foram calculados os caudais de ar novo, de forma a garantir a qualidade do ar interior, cumprindo os requisitos da actua...

  6. Undoing Gender Through Legislation and Schooling: the Case of AB 537 and AB 394 IN California, USA

    Knotts, Greg

    2009-11-01

    This article investigates California laws AB 537: The Student Safety and Violence Prevention Act of 2000, and the recently enacted AB 394: Safe Place to Learn Act. Both demand that gender identity and sexual orientation be added to the lexicon of anti-harassment protection in public education. However, despite these progressive measures, schools have an unconscious acceptance of heteronormativity and gendered norms, which undermines both the spirit and language of these laws. This paper examines how California schools can both change standard practices and realise the transformative social change that laws like AB 537 and AB 394 can instigate. I assert that the systemic implementation of these laws, through the adoption, enforcement and evaluation of existing AB 537 Task Force Recommendations, is necessary for their success. My second assertion is that AB 537 and AB 394 have the potential to change and reconstitute gender-based and heteronormative standards at school sites.

  7. 汽车ABS/ASR/ACC集成化系统%Integrated ABS/ASR/ACC System for the Car

    刘昭度; 卢江; 时开斌; 安巍

    2001-01-01

    叙述了ACC系统和ABS/ASR系统在改善汽车高速行驶主动安全性方面的功用,阐述了ACC系统是ABS/ASR系统功能的延伸、逻辑的发展及它们之间的内在联系,指出了在ABS/ASR的基础上只需增加测距装置和添加巡航控制子程序,就可方便地实现ABS/ASR/ACC集成化系统,并给出了集成化系统的控制框图和控制方法,论述了ABS/ASR/ACC集成化系统比孤立的ABS/ASR和ACC系统的优越性.%The individual functions of ACC and ABS/ASR are described in the improvements of active safety while the road vehicles travel at a high speed. Being a logic extension of and many inherent connections with ABS/BSR, ACC is easily integrated with ABS/ASR to form an integrated system by adding the headway distance*$-detecting device to the existing ABS/ASR system and expanding the ABS/ASR software. The algorithm flowcharts and control methods of the ABS/ASR/ACC are given. The advantages of the ABS/ASR/ACC system compared with those using the stand alone systems ABS, ASR and ACC are mentioned in details.

  8. Germacrene D Cyclization: An Ab Initio Investigation

    William N. Setzer

    2008-01-01

    Full Text Available Essential oils that contain large concentrations of germacrene D are typically accompanied by cadinane sesquiterpenoids. The acid-catalyzed cyclization of germacrene D to give cadinane and selinane sesquiterpenes has been computationally investigated using both density functional (B3LYP/6-31G* and post Hartree-Fock (MP2/6-31G** ab initio methods. The calculated energies are in general agreement with experimentally observed product distributions, both from acid-catalyzed cyclizations as well as distribution of the compounds in essential oils.

  9. Ab initio calculations of material strength

    Šob, Mojmír; Friák, Martin; Vitek, V.

    Tokyo : The Japan Society of Mechanical Engineers, 2003, s. 467-475. [International Symposium on Micro-Mechanical Engineering - Heat Transfer, Fluid Dynamics, Reliability and Mechanotronics.. Tsuchiura and Tsukuba (JP), 01.12.2003-03.12.2003] R&D Projects: GA AV ČR IAA1041302; GA ČR GA202/03/1351; GA MŠk OC 523.90 Institutional research plan: CEZ:AV0Z2041904 Keywords : ab initio calculations * electronic structure * theoretical tensile strength Subject RIV: BM - Solid Matter Physics ; Magnetism

  10. Ab Initio Molecular Dynamics: A Virtual Laboratory

    Hobbi Mobarhan, Milad

    2014-01-01

    In this thesis, we perform ab initio molecular dynamics (MD) simulations at the Hartree-Fock level, where the forces are computed on-the-fly using the Born-Oppenheimer approximation. The theory behind the Hartree-Fock method is discussed in detail and an implementation of this method based on Gaussian basis functions is explained. We also demonstrate how to calculate the analytic energy derivatives needed for obtaining the forces acting on the nuclei. Hartree-Fock calculations on the ground s...

  11. Asiakassuhdehallinnan kehityssuunnitelma : Case: Oy Combi Cool Ab

    Puikkonen, Touko

    2011-01-01

    Tässä insinöörityössä tutustuttiin Oy Combi Cool Ab:n asiakassuhdehallintaan ja siinä havaittuihin puutteisiin ja kehitystarpeisiin. Työn tarkoituksena oli luoda yritykselle ajan tasalla oleva asiakasrekisteri ja sen pohjalta kehittää asiakassuhdehallintaa etenkin myynnin, oston ja johdon henkilöstön tarpeita ajatellen muovaamalla siitä henkilöstön myynti- ja asiakaspalvelutyöskentelyä tehostava toimiva kokonaisuus. Combi Cool on vuonna 1985 perustettu kylmäalan tukkuliike, joka on vajaan 30 ...

  12. Testing Distributed ABS System with Fault Injection

    Trawczyński, Dawid; Sosnowski, Janusz; Gawkowski, Piotr

    The paper deals with the problem of adapting software implemented fault injection technique (SWIFI) to evaluate dependability of reactive microcontroller systems. We present an original methodology of disturbing controller operation and analyzing fault effects taking into account reactions of the controlled object and the impact of the system environment. Faults can be injected randomly (in space and time) or targeted at the most sensitive elements of the controller to check it at high stresses. This approach allows identifying rarely encountered problems, usually missed in classical approaches. The developed methodology has been used successfully to verify dependability of ABS system. Experimental results are commented in the paper.

  13. Estudo do teor de alicina em alho

    Mendes, Patrícia Alexandra Pinto

    2008-01-01

    A alicina (dialil-tiosulfinato) é o componente biológico mais activo no alho com inúmeras aplicações a nível da saúde, já conhecida desde décadas. Existem actualmente diversos métodos publicados para a determinação do teor de alicina no alho por HPLC e espectrofotometria. No entanto, os resultados mostram discordância no teor de alicina medido pelos vários métodos. Este estudo tem por objectivo a determinação do teor de alicina por métodos de HPLC e espectrofotometria; e com...

  14. Elastic properties of intermetallic AB2 and AB5 hydrogen-absorbing compounds

    The elastic properties of AB2 and AB5 hydrogen-absorbing intermetallic compounds are reviewed. The relevance of these properties to hydrogen absorption is discussed briefly. In many cases the temperature dependence of the elastic constants of the AB2 compounds is anomalous in that the moduli do not decrease monotonically with increasing temperature. This unusual behavior appears to be associated with electronic structure effects in a number of cases. The absorption of hydrogen by polycrystalline TaV2 has a profound effect on the aggregate shear modulus, changing both the magnitude and temperature dependence significantly. This effect of hydrogen on the mechanical properties appears to occur via effects on the electronic structure. Few measurements of elastic properties have been reported for hydrogen-absorbing AB5 intermetallic compounds. The LaAlxNi5-x system has been investigated by means of measurements on polycrystals prepared by hot isostatic pressing. The moduli decrease about 8% as x increases from 0 to 1

  15. Biosorption of Acid Blue 290 (AB 290) and Acid Blue 324 (AB 324) dyes on Spirogyra rhizopus

    In this study, the biosorption of Acid Blue 290 and Acid Blue 324 on Spirogyra rhizopus, a green algae growing on fresh water, was studied with respect to initial pH, temperature, initial dye concentration and biosorbent concentration. The optimum initial pH and temperature values for AB 290 and AB 324 biosorption were found to be 2.0, 30 deg. C and 3.0, 25 deg. C, respectively. It was observed that the adsorbed AB 290 and AB 324 amounts increased with increasing the initial dye concentration up to 1500 and 750 mg/L, respectively. The Langmuir, Freundlich, Redlich-Peterson and Koble-Corrigan isotherm models were applied to the experimental equilibrium data and the isotherm constants were determined by using Polymath 4.1 software. The monolayer coverage capacities of S. rhizopus for AB 290 and AB 324 dyes were found as 1356.6 mg/g and 367.0 mg/g, respectively. The intraparticle diffusion model and the pseudo-second order kinetic model were applied to the experimental data in order to describe the removal mechanism of these acidic dyes by S. rhizopus. The pseudo-second order kinetic model described very well the biosorption kinetics of AB 290 and AB 324 dyes. Thermodynamic studies showed that the biosorption of AB 290 and AB 324 on S. rhizopus was exothermic in nature

  16. Ab initio non-relativistic spin dynamics

    Ding, Feizhi; Goings, Joshua J.; Li, Xiaosong, E-mail: xsli@uw.edu [Department of Chemistry, University of Washington, Seattle, Washington 98195 (United States); Frisch, Michael J. [Gaussian, Inc., 340 Quinnipiac St, Bldg 40, Wallingford, Connecticut 06492 (United States)

    2014-12-07

    Many magnetic materials do not conform to the (anti-)ferromagnetic paradigm where all electronic spins are aligned to a global magnetization axis. Unfortunately, most electronic structure methods cannot describe such materials with noncollinear electron spin on account of formally requiring spin alignment. To overcome this limitation, it is necessary to generalize electronic structure methods and allow each electron spin to rotate freely. Here, we report the development of an ab initio time-dependent non-relativistic two-component spinor (TDN2C), which is a generalization of the time-dependent Hartree-Fock equations. Propagating the TDN2C equations in the time domain allows for the first-principles description of spin dynamics. A numerical tool based on the Hirshfeld partitioning scheme is developed to analyze the time-dependent spin magnetization. In this work, we also introduce the coupling between electron spin and a homogenous magnetic field into the TDN2C framework to simulate the response of the electronic spin degrees of freedom to an external magnetic field. This is illustrated for several model systems, including the spin-frustrated Li{sub 3} molecule. Exact agreement is found between numerical and analytic results for Larmor precession of hydrogen and lithium atoms. The TDN2C method paves the way for the ab initio description of molecular spin transport and spintronics in the time domain.

  17. Ab initio no core full configuration approach for light nuclei

    Kim, Youngman; Shin, Ik Jae; Maris, Pieter; Vary, James P.; Forssén, Christian; Rotureau, Jimmy

    2015-10-01

    Comprehensive understanding of the structure and reactions of light nuclei poses theoretical and computational challenges. Still, a number of ab initio approaches have been developed to calculate the properties of atomic nuclei using fundamental interactions among nucleons. Among them, we work with the ab initio no core full configuration (NCFC) method and ab initio no core Gamow Shell Model (GSM). We first review these approaches and present some recent results.

  18. Workshop on automated beam steering and shaping (ABS). Proceedings

    A workshop on Automated Beam Steering and Shaping (ABS) was held at CERN in December 1998. This was the first workshop dedicated to this subject. The workshop had two major goals: to review the present status of ABS algorithms and systems around the world and to create a worldwide ABS community. These proceedings contain summary reports from all sessions, contributions from several presentations held at the workshop, and a complete set of abstracts for all presentations. (orig.)

  19. A Influência da Responsabilidade Social Corporativa na Imagem de Marca: Um Estudo em Empresas Brasileiras do Setor de Cosméticos

    Márcio Ribeiro da Fonseca; Thelma Valéria Rocha; Eduardo Eugênio Spers

    2014-01-01

    Este estudo tem como tema a influência da Responsabilidade Social Corporativa (RSC) na imagem de marca (IM) e na reputação corporativa (RC) de empresas brasileiras do setor de cosméticos. O foco da pesquisa foi investigar a percepção dos consumidores universitários pertencentes às classes A/B sobre as ações de RSC de duas grandes empresas brasileiras de cosméticos. O objetivo foi comparar as percepções d...

  20. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 interactions with western corn rootworm midgut membrane binding sites.

    Huarong Li

    Full Text Available BACKGROUND: Bacillus thuringiensis (Bt Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interactions are one line of evidence that Bt protein mechanisms of action differ and that the probability of receptor-mediated cross-resistance is low. METHODOLOGY/PRINCIPAL FINDINGS: Binding site interactions were investigated between Cry34Ab1/Cry35Ab1 and coleopteran active insecticidal proteins Cry3Aa, Cry6Aa, and Cry8Ba on western corn rootworm midgut brush border membrane vesicles (BBMV. Competitive binding of radio-labeled proteins to western corn rootworm BBMV was used as a measure of shared binding sites. Our work shows that (125I-Cry35Ab1 binds to rootworm BBMV, Cry34Ab1 enhances (125I-Cry35Ab1 specific binding, and that (125I-Cry35Ab1 with or without unlabeled Cry34Ab1 does not share binding sites with Cry3Aa, Cry6Aa, or Cry8Ba. Two primary lines of evidence presented here support the lack of shared binding sites between Cry34Ab1/Cry35Ab1 and the aforementioned proteins: 1 No competitive binding to rootworm BBMV was observed for competitor proteins when used in excess with (125I-Cry35Ab1 alone or combined with unlabeled Cry34Ab1, and 2 No competitive binding to rootworm BBMV was observed for unlabeled Cry34Ab1 and Cry35Ab1, or a combination of the two, when used in excess with (125I-Cry3Aa, or (125I-Cry8Ba. CONCLUSIONS/SIGNIFICANCE: Combining two or more insecticidal proteins active against the same target pest is one tactic to delay the onset of resistance to either protein. We conclude that Cry34Ab1/Cry35Ab1 are compatible with Cry3Aa, Cry6Aa, or Cry8Ba

  1. Ising and Heisenberg models on ferrimagnetic AB sub 2 chains

    Vitoriano, C; Raposo, E P

    2002-01-01

    We study the Ising and Heisenberg models on one-dimensional ferrimagnetic bipartite chains with the special AB sub 2 unit-cell topology and experimental motivation in inorganic and organic magnetic polymers. The spin-1/2 AB sub 2 Ising case is exactly solved in the presence of an external magnetic field. We also derive asymptotical low- and high-temperature limits of several thermodynamical quantities of the zero-field classical AB sub 2 Heisenberg model. Further, the quantum spin-1/2 AB sub 2 Heisenberg model in a field is studied using a mean-field approach.

  2. Estudos sobre o comportamento do consumidor na SciELO

    Santana, Dhione Oliveira; Reis, Ana Alinny Cruz dos; Oliveira, Rafaela Santana

    2016-01-01

    Os estudos sobre o comportamento do consumidor têm chamado à atenção de pesquisadores de diversos países e de diversas áreas do conhecimento com objetivos dos mais variados possíveis. O presente artigo faz um estudo bibliométrico interdisciplinar sobre o comportamento do consumidor no contexto internacional (países Ibero-americanos e da África do Sul) da plataforma SciELO (Scientific Electronic Library Online). O presente estudo analisou 153 artigos científicos, como conclusão, observou-se qu...

  3. Guiding ab initio calculations by alchemical derivatives

    to Baben, M.; Achenbach, J. O.; von Lilienfeld, O. A.

    2016-03-01

    We assess the concept of alchemical transformations for predicting how a further and not-tested change in composition would change materials properties. This might help to guide ab initio calculations through multidimensional property-composition spaces. Equilibrium volumes, bulk moduli, and relative lattice stability of fcc and bcc 4d transition metals Zr, Nb, Mo, Tc, Ru, Rh, Pd, and Ag are calculated using density functional theory. Alchemical derivatives predict qualitative trends in lattice stability while equilibrium volumes and bulk moduli are predicted with less than 9% and 28% deviation, respectively. Predicted changes in equilibrium volume and bulk moduli for binary and ternary mixtures of Rh-Pd-Ag are in qualitative agreement even for predicted bulk modulus changes as large as +100% or -50%. Based on these results, it is suggested that alchemical transformations could be meaningful for enhanced sampling in the context of virtual high-throughput materials screening projects.

  4. Ab Initio Path to Heavy Nuclei

    Binder, Sven; Calci, Angelo; Roth, Robert

    2014-01-01

    We present the first ab initio calculations of nuclear ground states up into the domain of heavy nuclei, spanning the range from 16-O to 132-Sn based on two- plus three-nucleon interactions derived within chiral effective field theory. We employ the similarity renormalization group for preparing the Hamiltonian and use coupled-cluster theory to solve the many-body problem for nuclei with closed sub-shells. Through an analysis of theoretical uncertainties resulting from various truncations in this framework, we identify and eliminate the technical hurdles that previously inhibited the step beyond medium-mass nuclei, allowing for reliable validations of nuclear Hamiltonians in the heavy regime. Following this path we show that chiral Hamiltonians qualitatively reproduce the systematics of nuclear ground-state energies up to the neutron-rich Sn isotopes.

  5. Operator evolution for ab initio nuclear theory

    Schuster, Micah D; Johnson, Calvin W; Jurgenson, Eric D; Navratil, Petr

    2014-01-01

    The past two decades have seen a revolution in ab initio calculations of nuclear properties. One key element has been the development of a rigorous effective interaction theory, applying unitary transformations to soften the nuclear Hamiltonian and hence accelerate the convergence as a function of the model space size. For consistency, however, one ought to apply the same transformation to other operators when calculating transitions and mean values from the eigenstates of the renormalized Hamiltonian. Working in a translationally-invariant harmonic oscillator basis for the two- and three-nucleon systems, we evolve the Hamiltonian, square-radius and total dipole strength operators by the similarity renormalization group (SRG). The inclusion of up to three-body matrix elements in the 4He nucleus all but completely restores the invariance of the expectation values under the transformation. We also consider a Gaussian operator with adjustable range and find at short ranges an increased contribution from such ind...

  6. Discovering chemistry with an ab initio nanoreactor

    Martinez, Todd

    Traditional approaches for modeling chemical reaction networks such as those involved in combustion have focused on identifying individual reactions and using theoretical approaches to explore the underlying mechanisms. Recent advances involving graphical processing units (GPUs), commodity products developed for the videogaming industry, have made it possible to consider a distinct approach wherein one attempts to discover chemical reactions and mechanisms. We provide a brief summary of these developments and then discuss the concept behind the ``ab initio nanoreactor'' which explores the space of possible chemical reactions and molecular species for a given stoichiometry. The nanoreactor concept is exemplified with an example to the Urey-Miller reaction network which has been previously advanced as a potential model for prebiotic chemistry. We briefly discuss some of the future directions envisioned for the development of this nanoreactor concept.

  7. Ab initio molar volumes and Gaussian radii.

    Parsons, Drew F; Ninham, Barry W

    2009-02-12

    Ab initio molar volumes are calculated and used to derive radii for ions and neutral molecules using a spatially diffuse model of the electron distribution with Gaussian spread. The Gaussian radii obtained can be used for computation of nonelectrostatic ion-ion dispersion forces that underlie Hofmeister specific ion effects. Equivalent hard-sphere radii are also derived, and these are in reasonable agreement with crystalline ionic radii. The Born electrostatic self-energy is derived for a Gaussian model of the electronic charge distribution. It is shown that the ionic volumes used in electrostatic calculations of strongly hydrated cosmotropic ions ought best to include the first hydration shell. Ionic volumes for weakly hydrated chaotropic metal cations should exclude electron overlap (in electrostatic calculations). Spherical radii are calculated as well as nonisotropic ellipsoidal radii for nonspherical ions, via their nonisotropic static polarizability tensors. PMID:19140766

  8. Dois estudos sobre o trabalho dos petroleiros

    Leda Leal Ferreira

    1996-06-01

    Full Text Available O presente artigo traz um resumo de dois estudos realizados na área do petróleo, o primeiro feito em uma unidade de refino e o segundo abarcando o trabalho de operadores exercendo várias funções dentro de uma refinaria e de terminais marítimos de petróleo. Nos dois casos, o ponto central foi a análise da atividade dos trabalhadores, isto é, o que eles faziam e como o faziam para dai conta das exigências de produção que lhes eram atribuídas. No entanto, os métodos utilizados foram diferentes: no primeiro caso utilizou-se a Análise Ergonômica do Trabalho (AET e no segundo, a Análise Coletiva do Trabalho (ACT. Além de apresentar os principais resultados destes estudos, a autora faz considerações sobre as diferenças entre os dois métodos e um apelo à comunidade científica para que se preocupe mais em estudar a atividade real dos trabalhadores e assim contribuir para um melhor conhecimento do que se passa no interior das unidades produtivas, evitando que sofrimentos humanos inúteis e até catástrofes industriais continuem a ocorrer.This paper describes two studies about petroleum industry. The first was developed in a refinery and the second focuses on the work of operators in various jobs within a refinery and maritime petroleum units. In both cases, the focal point was the analyses of activities, that is, what the workers do and how they do it in order to meet production demandai put on them. However, two different methods were applied in the studies. Ergonomics Work Analyses (EWA was used on the first case and Collective Work Analyses (CWA, on the second. Besides showing the main results, the author compares the two methods. She also draws the scientific community attention to the importance of studding the workers actual activity in order to contribute to a better understanding of what is going on inside production units, avoiding useless human suffering, and the still ocurring undustrial disasters.

  9. Ab initio alpha-alpha scattering.

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  10. Ab initio alpha-alpha scattering

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Luu, Thomas; Meißner, Ulf-G.

    2015-12-01

    Processes such as the scattering of alpha particles (4He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei—nuclei with even and equal numbers of protons and neutrons—is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the ‘adiabatic projection method’ to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  11. Ablation dynamics in laser sclerotomy ab externo

    Brinkmann, Ralf; Droege, Gerit; Mohrenstecher, Dirk; Scheu, M.; Birngruber, Reginald

    1996-01-01

    Laser sclerostomy ab externo with flashlamp excited mid-IR laser systems emitting in the 2-3 micrometer spectral range is in phase II clinical trials. Although acutely high success rates were achieved, the restenosis rate after several months is about 40%. Laser pulses of several hundreds of microseconds, known to induce thermo-mechanical explosive evaporation were used for this procedure. We investigated the ablation dynamics in tissue and the cavitation bubble dynamics in water by means of an Er:YAG laser system to estimate the extent of mechanical damage zones in the sclera and in the anterior chamber, which may contribute to the clinical failure. We found substantial mechanical tissue deformation during the ablation process caused by the cavitation effects. Stress waves up to several bar generated by explosive evaporization were measured. The fast mechanical stretching and collapsing of the scleral tissue induced by cavitation resulted in tissue dissection as could be proved by flash photography and histology. The observed high restenosis might be a result of a subsequent enhanced wound healing process. Early fistula occlusions due to iris adherences, observed in about 20% of the clinical cases may be attributed to intraocular trauma induced by vapor bubble expansion through the anterior chamber after scleral perforation. An automatic feedback system minimizing adverse effects by steering and terminating the laser process during scleral fistulization is demonstrated. Moreover, a new approach in laser sclerostomy ab externo is presented using a cw-IR laser diode system emitting at the 1.94 micrometer mid-IR water absorption peak. This system was used in vitro and showed smaller damage zones compared to the pulsed laser radiation.

  12. Dicty_cDB: FCL-AB06 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AB06 (Link to dictyBase) - - - Contig-U15603-1 FCL-AB06P ...(Link to Original site) FCL-AB06F 694 FCL-AB06Z 573 FCL-AB06P 1267 - - Show FCL-AB06 Library FCL (Link to library) Clone ID FCL-...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AB/FCL-AB06Q....Seq.d/ Representative seq. ID FCL-AB06P (Link to Original site) Representative DNA sequence >FCL-AB06 (FCL-AB06Q) /CSM/FCL/FCL-...AB/FCL-AB06Q.Seq.d/ CAATTTTATCGGAACCATCAATTCATGCAGGTTCTGTATTTAGTATTAATTTAACCAAAT CTAGACA

  13. A Case of Laptop Computer-Induced Erythema Ab Igne

    Nurettin Özgür Doğan

    2014-12-01

    Full Text Available Erythema ab igne, also known as toasted skin syndrome, is a skin reaction characterized by reticulate erythema, brown pigmentation, and telangiectasia. In some cases, epidermal atrophy and scaling are also identified. The condition is usually caused by prolonged exposure to a source of heat or infrared radiation. Here, we report a case of erythema ab igne associated with laptop computer use.

  14. Kopplung von Dichtefunktional- und ab-initio-Methoden

    Goll, Erich

    2008-01-01

    Im Rahmen der Doktorarbeit wurde untersucht, inwieweit die Kopplung von Dichtefunktionalmethoden und ab-initio-Korrelationsmethoden der Quantenchemie eine Verbesserung bezüglich beider Grenzmethoden erbringt. Die Kopplung erfolgt durch eine Aufspaltung des interelektronischen Hamiltonoperators (abstoßende Coulombwechselwirkung). Die kurzreichweitige Wechselwirkung wird mit Dichtefunktionaltheorie behandelt, die langreichweitige mit Hilfe von ab-initio-Methoden. Diese Aufteilung soll dazu dien...

  15. Effects of Cry1F and Cry34Ab1/35Ab1 on storage pests

    Two crystalline protoxins from Bacillus thuringiensis (Bt), Cry1Fa1 and Cry34Ab1/Cry35Ab1 (Cry1F, Cry34/35), were evaluated for efficacy against lepidopteran and coleopteran storage pests. Cry1F was tested against the lepidopterans Sitotroga cerealella (Angoumois grain moth) and colonies of the lep...

  16. Preparation of grafted ABS and compatibilization of r-PET/ABS blends by the grafted ABS%ABS接枝物的制备及其对r-PET/ABS的增容作用

    陈智军; 王益龙; 郑辰

    2012-01-01

    Two kinds of grafted acrylonitrile-butadiene-styrene copolymer(ABS), i.e. maleic anhydride (MAH) grafted ABS(ABS-g-MAH) and glycidyl methacrylate (GMA) grafted ABS (ABS-g-GMA), were prepared via reactive extrusion and were used as compatibilizer for recycled polyethylene glycol terephthalate (r-PET)/ABS blends. The results show that ABS-g-MAH and ABS-g-GMA can greatly improve the impact strength of the blends. ABS-g-MAH is superior to ABS-g-GMA in compatibilization effect. The optimal compatibilization effect is acquired when the grafting ratio of ABS-g-MAH is 1.35% and the mass content of the copolymer is 5%. Under such conditions, the notched and unnotched *Charpy impact strength of the r-PET/ABS/ABS-g--MAH blends rise by 42% and 23%, respectively, in comparison with those of r-PET/ ABS. The observation by scanning electron microscope(SEM) shows that adding grafted ABS can make ABS be dispersed more homogeneously in the r-PET continuous phase and make particle size more even.%通过反应挤出法制备马来酸酐(MAH)接枝丙烯腈-丁二烯-苯乙烯三元共聚物(ABS)(ABS-g-MAH)和甲基丙烯酸缩水甘油酯(GMA)接枝ABS(ABS-g-GMA),将其用于增容回收聚对苯二甲酸乙二酯(PET)瓶片(r-PET)/ABS共混物,发现能显著提高其混物的冲击强度.ABS-g-MAH的增容效果优于ABS-g-GMA;ABS-g-MAH的接枝率为1.35%,w(ABS-g-MAH)为5%时对r-PET/ABS的增容作用最佳,此时r-PET/ABS/ABS-g-MAH的简支梁缺口冲击强度和无缺口冲击强度比r-PET/ABS分别提高了42%和23%.扫描电子显微镜观察表明,加入ABS接枝物能使ABS在r-PET连续相中的分散更均匀,粒径尺寸更均一.

  17. Reticulossarcomas epidurais intraespinais: estudo de 34 casos

    Lígia M. B. Coutinho

    1974-12-01

    Full Text Available Foi realizado um estudo de 34 casos de reticulossarcomas localizados no tecido epidural intraespinal. Assinala-se sua maior freqüência entre homens com mais de 50 anos, embora pacientes mais jovens possam ser acometidos, principalmente entre 15 e 29 anos. A distribuição segmentar dos tumores permite um diagnóstico diferencial, sendo a região torácica a sede mais freqüentes de sarcomas. O principal sintoma encontrado nos pacientes com reticulossarcoma foi a dor, do tipo radicular, que serve para diferenciar os tumores intra e extra-medulares, tendo sido de aparecimento precoce em 15 dos pacientes estudados, precedendo em muitos meses e até anos os demais sintomas. Classificou-se os tumores reticulohistiocitários epidurais do canal vertebral em três grupos, de acordo com seu aspecto tecidual e celular e, principalmente, com a presença e distribuição da reticulina. Relacionou-se o tempo de evolução desses tumores com seu aspecto histopatológico, chegando-se à conclusão que os tumores classificados no grupo III apresentam um período evolutivo maior que os demais, o que nos levou a pensar que crescem mais lentamente, apresentando, portanto, melhor prognóstico que os demais tipos, muito embora todos os tipos de reticulossarcomas possam apresentar um prognóstico mais favorável quando precocemente diagnosticados e tratados adequadamente.

  18. Estudo retrospectivo de latrodectismo na Bahia, Brasil

    Rejâne Maria Lira-da-Silva

    1995-09-01

    Full Text Available O trabalho apresenta um estudo retrospectivo de setenta e sete casos de latrodectismo no Estado da Bahia, Brasil, de agosto de 1980 a julho de 1990. Os dados foram levantados nos livros de registro e arquivo de fichas do CIAVE. O agente etiológico em 28% dos acidentes aracnídeos foi a espécie L. curacaviensis e a maior incidência foi registrada no meio urbano (57%, em indivíduos do sexo masculino (70% e faixa etária de 10 a 29 anos (58%. Os principais sinais locais foram dor (56%, pápula eritematosa (21% e edema discreto (17%, e os sistêmicos foram dor em membros inferiores (29%, tremores e contraturas (29%, sudorese (28% parestesia em membros (21% e dor abdominal (17%. O tratamento foi sintomático em 67% dos casos e específico em 21%. O tempo de permanência hospitalar após o uso do soro antilatrodectus foi menor que 24 horas em 64% dos casos.This work is a retrospective study of latrodectism in the State of Bahia, Brazil, from August 1980 to July 1990. The data concerning the accidents were obtained from file cards at the Antivenom Information Center of Bahia (AVICB. Latrodectus curacavienis was the ethiologic agent identified in 28% of the arachnid accidents. The major incidence was registered in urban area (57% affecting men (70% more than women, with 10 to 29year-old age group (58%. Local pain (56%, erythematous papula (29% and light oedema (17% were the principal local symptoms. Pain in the limbs (29%, tremor and rigidities (29%, sweating (28%, limbs and arms paresthesia (21% and abdominal pain (17% were systemic ones. The treatment was mainly symptomatic (67% and antivenin serum was used in 21% of the cases. After serotherapy, 64% of the patients left the hospital within less than 24 hours.

  19. Estudos sobre a Esquistosomose em Pernambuco, Brasil

    Aggeu Magalhães

    1940-01-01

    Full Text Available Os autores referem os resultados dos estudos sobre esquistosomose realisados, em Pernambuco, de Novembro de 1938 a Dezembro de 1939. Não se extendem em discussão, nem comentarios, tampouco, relacionam suas verificações com o que já foi relatado sobre o assunto em trabalhos nacionais e estrangeiros, pelo fato de que, não se trata de um resultado definitivo e sim de atividades que irão proseguir. Os estudos sistematicos em torno da endemia esquistosomica foram executados em duas localidades diversas pela população e pela situação geografica e ecologica. Pontezinha é uma povoação de 1200 habitantes localizada proximo a um conjunto de charcos e lagõas de agua dôce onde pululam caramujos do tipo olivaceus de Spix, e apresenta uma taxa de infestação de 21,4% para individuos do sexo masculino, e de 14,7% para os do sexo feminino. A distribuição por grupos de idade mostra que a incidencia cresce até o grupo de 16 a 20 anos de idade, quando atinge a percentagem de 37,8%, para decrescer em seguida. Em Vitoria a incidencia foi maior nos indivíduos do sexo feminino, atingindo a taxa de 41,4%, dando o sexo masculino a taxa de 36,9%. Por idade a percentagem maxima é atingida pelo grupo de 11 a 15 anos. Vitoria é uma cidade de 1500 habitantes, construida á margem do rio Tapacurá, onde se encontram numerosos caramujos do tipo centimetralis Lutz. A divergencia de incidencia corre por conta dos habitos da população e pela utilização que ela faz do rio, sendo maior em Vitoria porque a proximidade do rio facilita o uso de suas aguas para banho e serviços domesticos, condicionando este ultimo fato, a maior infestação das mulheres. O estudo da frequencia da infestação dos caramujos por cercarias de diversos trematodios, permite suspeitar uma relação inversa entre a taxa de infestação e o diametro maximo atingido pelos caramujos, parecendo este fato confirmar os trabalhos de Vianna Martins sobre a identidade dos hospedeiros

  20. Structural and biophysical characterization of Bacillus thuringiensis insecticidal proteins Cry34Ab1 and Cry35Ab1.

    Matthew S Kelker

    Full Text Available Bacillus thuringiensis strains are well known for the production of insecticidal proteins upon sporulation and these proteins are deposited in parasporal crystalline inclusions. The majority of these insect-specific toxins exhibit three domains in the mature toxin sequence. However, other Cry toxins are structurally and evolutionarily unrelated to this three-domain family and little is known of their three dimensional structures, limiting our understanding of their mechanisms of action and our ability to engineer the proteins to enhance their function. Among the non-three domain Cry toxins, the Cry34Ab1 and Cry35Ab1 proteins from B. thuringiensis strain PS149B1 are required to act together to produce toxicity to the western corn rootworm (WCR Diabrotica virgifera virgifera Le Conte via a pore forming mechanism of action. Cry34Ab1 is a protein of ∼14 kDa with features of the aegerolysin family (Pfam06355 of proteins that have known membrane disrupting activity, while Cry35Ab1 is a ∼44 kDa member of the toxin_10 family (Pfam05431 that includes other insecticidal proteins such as the binary toxin BinA/BinB. The Cry34Ab1/Cry35Ab1 proteins represent an important seed trait technology having been developed as insect resistance traits in commercialized corn hybrids for control of WCR. The structures of Cry34Ab1 and Cry35Ab1 have been elucidated to 2.15 Å and 1.80 Å resolution, respectively. The solution structures of the toxins were further studied by small angle X-ray scattering and native electrospray ion mobility mass spectrometry. We present here the first published structure from the aegerolysin protein domain family and the structural comparisons of Cry34Ab1 and Cry35Ab1 with other pore forming toxins.

  1. Ab initio gene identification in metagenomic sequences.

    Zhu, Wenhan; Lomsadze, Alexandre; Borodovsky, Mark

    2010-07-01

    We describe an algorithm for gene identification in DNA sequences derived from shotgun sequencing of microbial communities. Accurate ab initio gene prediction in a short nucleotide sequence of anonymous origin is hampered by uncertainty in model parameters. While several machine learning approaches could be proposed to bypass this difficulty, one effective method is to estimate parameters from dependencies, formed in evolution, between frequencies of oligonucleotides in protein-coding regions and genome nucleotide composition. Original version of the method was proposed in 1999 and has been used since for (i) reconstructing codon frequency vector needed for gene finding in viral genomes and (ii) initializing parameters of self-training gene finding algorithms. With advent of new prokaryotic genomes en masse it became possible to enhance the original approach by using direct polynomial and logistic approximations of oligonucleotide frequencies, as well as by separating models for bacteria and archaea. These advances have increased the accuracy of model reconstruction and, subsequently, gene prediction. We describe the refined method and assess its accuracy on known prokaryotic genomes split into short sequences. Also, we show that as a result of application of the new method, several thousands of new genes could be added to existing annotations of several human and mouse gut metagenomes. PMID:20403810

  2. Ab initio two-component Ehrenfest dynamics

    We present an ab initio two-component Ehrenfest-based mixed quantum/classical molecular dynamics method to describe the effect of nuclear motion on the electron spin dynamics (and vice versa) in molecular systems. The two-component time-dependent non-collinear density functional theory is used for the propagation of spin-polarized electrons while the nuclei are treated classically. We use a three-time-step algorithm for the numerical integration of the coupled equations of motion, namely, the velocity Verlet for nuclear motion, the nuclear-position-dependent midpoint Fock update, and the modified midpoint and unitary transformation method for electronic propagation. As a test case, the method is applied to the dissociation of H2 and O2. In contrast to conventional Ehrenfest dynamics, this two-component approach provides a first principles description of the dynamics of non-collinear (e.g., spin-frustrated) magnetic materials, as well as the proper description of spin-state crossover, spin-rotation, and spin-flip dynamics by relaxing the constraint on spin configuration. This method also holds potential for applications to spin transport in molecular or even nanoscale magnetic devices

  3. On the hierarchical parallelization of ab initio simulations

    Ruiz-Barragan, Sergi; Shiga, Motoyuki

    2016-01-01

    A hierarchical parallelization has been implemented in a new unified code PIMD-SMASH for ab initio simulation where the replicas and the Born-Oppenheimer forces are parallelized. It is demonstrated that ab initio path integral molecular dynamics simulations can be carried out very efficiently for systems up to a few tens of water molecules. The code was then used to study a Diels-Alder reaction of cyclopentadiene and butenone by ab initio string method. A reduction in the reaction energy barrier is found in the presence of hydrogen-bonded water, in accordance with experiment.

  4. ESTUDOS NUTRICIONAIS COM ARROZ (Oryza sativa, L.

    Alfredo LAM-SÁNCHEZ

    2009-07-01

    Full Text Available

    RESUMO: Estudos com arroz (Oryza sativa, L. foram realizados a fim de determinar a variabilidade do teor de proteína em coleções de cultivares e a possibilidade de utilizar as camadas periféricas do grão na alimentação humana. Foram analisadas 626 linhagens e cultivares de arroz que mostraram uma variação quanto ao teor de proteína de 4.00 a 14.31 g/100 g de amostra. Para se extrair as camadas periféricas do grão, foi desenvolvida uma máquina experimental, que removia as camadas superficiais dos grãos de arroz integral (inteiros somente com a casca removida. Verificou-se que a quantidade de proteína do grão diminui de fora para dentro. O resíduo, que era constituído de grande parte de restos de endosperma com um teor protéico menor mas incluía o embrião, que é a primeira estrutura a se deslocar de grão no beneficiamento e contém proteínas, vitaminas, sais minerais e lípides, tinha um bom valor nutritivo. Desenvolveu-se também uma fórmula para alimentação infantil a partir da mistura de leite de vaca com arroz, com composição semelhante à do leite materno, a ser utilizada sob a forma de bebida ou mingau. Formulações com 40%-20% arroz + 60%-80% leite de vaca proporcionaram valores de Coeficiente de Eficiência Protéica (2,39 e 2,38, respectivamente que não diferiam estatisticamente do valor de 2,43 obtido na fórmula com 100% de leite de vaca. Seus preços foram 59% e 65% do obtido para o leite de vaca integral. PALAVRAS-CHAVE: Arroz; qualidade do grão; proteína; camadas periféricas; misturas arroz-leite; nutrição humana.

  5. Tensile deformation mechanisms of ABS/PMMA/EMA blends

    Wang, S. H.; Gao, J.; Lin, S. X.; Zhang, P.; Huang, J.; Xu, L. L.

    2014-08-01

    The tensile deformation mechanisms of acrylonitrile - butadiene - styrene (ABS) / polymethyl methacrylate (PMMA) blends toughened by ethylene methacrylate (EMA) copolymer was investigated by analysing the fracture morphology. ABS/PMMA was blended with EMA copolymer by melt mixing technique using co-rotating twin extruder. Tensile tests show that the elongation at break of ABS/PMMA blends can be efficiently improved with the increase in EMA content. Fracture morphology of ABS/PMMA/EMA blends reveals that the material yield induced by hollowing-out of EMA particles and its propagation into yield zone is the main toughening mechanism. Moreover, the appearance that EMA particles in the central area are given priority to hollowing-out may be related to the skin-core structure of the injection moulded parts caused by the different cooling rate between surface and inside in the process of injection moulding.

  6. Ab-initio study of thermoelectricity of layered tellurium compounds

    Ibarra Hernández, Wilfredo

    2015-01-01

    In this thesis, we explore the electronic, dynamic and thermoelectric properties of different tellurium-based compounds. We perform ab-initio calculations within the Vienna Ab-initio Simulation Package (VASP) that works in the framework of Density Functional Theory (DFT). For the thermoelectric properties, we use the Boltztrap code that solves the Boltzmann Transport Equations (BTE) for electrons within the Constant Relaxation Time Approximation (CRTA). This computational pa...

  7. Evaluation of the Urotest AB antibacterial substance detection test.

    Blondeau, J. M.; Yaschuk, Y; Galenzoski, D; Hrabok, D; Isaacson, M; Lee, L.(Department of Physics, Yale University, New Haven, CT, USA); Link, H; Walshaw, L

    1994-01-01

    The Urotest AB was used to detect antimicrobial substances in urine samples. Of 1022 urine specimens evaluated, Urotest AB detected inhibitors in 38.9%. Of 159 urine specimens from patients thought to be taking an antibiotic, inhibitors were detected in 80.5%. This test may help to explain culture negative urine samples from symptomatic patients, and could help elucidate treatment failures and the epidemiology of antibiotic resistance.

  8. Toward ab initio density functional theory for nuclei

    Drut, J. E.; Furnstahl, R. J.; Platter, L.

    2009-01-01

    We survey approaches to nonrelativistic density functional theory (DFT) for nuclei using progress toward ab initio DFT for Coulomb systems as a guide. Ab initio DFT starts with a microscopic Hamiltonian and is naturally formulated using orbital-based functionals, which generalize the conventional local-density-plus-gradients form. The orbitals satisfy single-particle equations with multiplicative (local) potentials. The DFT functionals can be developed starting from internucleon forces using ...

  9. Deriving conservation laws for ABS lattice equations from Lax pairs

    In this paper we derive infinitely many conservation laws for ABS lattice equations from their Lax pairs. These conservation laws can be algebraically expressed by means of some known polynomials. For each equation, the infinitely many conservation laws are not equivalent and are nontrivial. We also show that the (H1), (H2), (H3), (Q1), (Q2), (Q3) and (A1) equations in the ABS list share a generic discrete Riccati equation. (paper)

  10. 基于ABS的ABS/ASR集成液压系统设计%ABS/ASR Integrated Hydraulic System Based on ABS

    马岳峰; 刘昭度; 吴利军; 王国业

    2004-01-01

    介绍一种基于JETTA GTX轿车ABS液压系统的ABS/ASR集成液压系统改造方案,该ABS/ASR集成液压系统在原有ABS液压系统的基础上增加较少的液压元件实现全部ABS功能和ASR制动干预控制功能,改造后的集成系统工作可靠,不影响原有的常规制动和ABS制动过程.

  11. Desenvolvimento da Tanatologia: estudos sobre a morte e o morrer

    Maria Julia Kovács

    2008-12-01

    Full Text Available Este artigo discute os principais temas e pesquisas na área da Tanatologia, estudos sobre a morte e o morrer. São apresentados os autores pioneiros que escreveram as primeiras obras de sistematização da Tanatologia entre os quais: Herman Feifel, Robert Kastenbaum e Elizabeth Kübler-Ross, e os principais temas de estudo: luto, violência e guerra, a morte e a TV, cuidados a pacientes gravemente enfermos, além da formação de profissionais da área de saúde e educação para lidar com pessoas vivendo situações de perdas e morte. São feitas propostas de estudos para o futuro desenvolvimento da Tanatologia em nosso país.

  12. Ab Initio No-Core Shell Model

    Barrett, B R; Navratil, P; Vary, J P

    2011-04-11

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory ({chi}EFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The

  13. Ab Initio No-Core Shell Model

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory (χEFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The resulting NN

  14. Voluntariado empresarial e a empresa : estudo do caso Unicer

    Pavia, Bernardo Nuno Andrade Barreiros

    2014-01-01

    O voluntariado empresarial é hoje uma componente da responsabilidade social das empresas cada vez mais importante e determinante na estratégia de comunicação com os seus diferentes stakeholders. Este estudo procurou perceber de que forma o voluntariado empresarial é visto e entendido pelas empresas, pelos seus colaboradores e, que tipo de intervenções são prática na relação com a comunidade. O estudo procurou também analisar as motivações e os benefícios das ações de voluntariado empresari...

  15. Estudos cronotópicos em narrativas audiovisuais

    Egle Müller Spinelli

    2008-01-01

    O presente trabalho pretende aplicar o conceito de cronotopia de Bakhtin à análise de narrativas audiovisuais. Para tanto, será discutido o conceito de cronotopo bakhtiniano e sua relação com os estudos de Saussure, com o intuito de mostrar como os elementos cronotópicos podem estar ligados a contextos que vão além do enunciado, remetendo a mecanismos da enunciação. No estudo são analisados filmes que apresentam determinadas características semelhantes às dos principais tipos de cronotopia es...

  16. Estudo químico da Lavanda luisieri

    Araújo, João Paulo Miranda Ribeiro

    2012-01-01

    O estudo de plantas medicinais tem ganho particular importância nos últimos anos devido ás propriedades atribuídas ás mesmas. Esta dissertação consistiu no estudo químico de uma planta já com algumas propriedades benéficas comprovadas, a Lavandula luisieri. Para além dos compostos principais presentes no óleo da mesma, existem uma série de compostos com estrutura 1,2,2,3,4-pentametilciclopentano (necrodano) que têm especial interesse. Este trabalho teve uma abordagem diferente das tomadas até...

  17. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 Interactions with Western Corn Rootworm Midgut Membrane Binding Sites

    Huarong Li; Monica Olson; Gaofeng Lin; Timothy Hey; Sek Yee Tan; Narva, Kenneth E.

    2013-01-01

    BACKGROUND: Bacillus thuringiensis (Bt) Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry) proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interact...

  18. Comparisons of metallic clusters imbedded in the surface oxide of AB2, AB5, and A2B7 alloys

    Research highlights: Different growth mechanisms have been found on the metallic inclusions imbedded in the surface oxides of AB2, AN5, and A2B7. The high power performance has been correlated to the size and distribution of these inclusions. - Abstract: In order to clarify the relationship between the saturation magnetization of the activated metal hydride material and electrode performance, the specific power measured at both low temperature (-30 oC) and operating temperature (35 oC) of a nickel metal hydride battery were compared with magnetization measurements. It is found specific powers measured at both temperatures correlate well with the saturated magnetic susceptibility, which is proportional to the total amount of metallic nickel clusters distributed within the surface oxide layer after activation. Both the gas phase storage and electrochemical properties of the activated AB2, AB5, and A2B7 alloys were investigated. While the AB2 alloy has the highest storage capacity, it also has the lowest high-rate dischargeability among the three alloys. This suggests a competition between storage capacity and rate capability in these materials. In an alkaline etching experiment, it is established the saturation magnetization increases with etching time in these AB2, AB5, and A2B7 alloys. The saturation magnetization after a 4 h etches track the changes in the high-rate dischargeability. The increase is attributed to the growth in size of the metallic inclusions for the AB2 and Nd-A2B7 samples, and from an increase in the number of metallic inclusion in the case of AB5 and La-A2B7. Transmission electron microscope studies calibrate the size inferred from magnetic susceptibility studies and also the Ni-dominated FCC structure of the metallic clusters.

  19. Study on Exothermic Oxidation of Acrylonitrile-butadiene-styrene (ABS Resin Powder with Application to ABS Processing Safety

    Jenq-Renn Chen

    2010-08-01

    Full Text Available Oxidative degradation of commercial grade ABS (Acrylonitrile-butadiene-styrene resin powders was studied by thermal analysis. The instabilities of ABS containing different polybutadiene (PB contents with respect to temperature were studied by Differential Scanning Calorimeter (DSC. Thermograms of isothermal test and dynamic scanning were performed. Three exothermic peaks were observed and related to auto-oxidation, degradation and oxidative decomposition, respectively. Onset temperature of the auto-oxidation was determined to be around 193 °C. However, threshold temperature of oxidation was found to be as low as 140 °C by DSC isothermal testing. Another scan of the powder after degeneration in air showed an onset temperature of 127 °C. Reactive hazards of ABS powders were verified to be the exothermic oxidation of unsaturated PB domains, not the SAN (poly(styrene-acrylonitrile matrix. Heat of oxidation was first determined to be 2,800 ± 40 J per gram of ABS or 4,720 ± 20 J per gram of PB. Thermal hazards of processing ABS powder are assessed by adiabatic temperature rise at process conditions. IR spectroscopy associated with heat of oxidation verified the oxidative mechanism, and these evidences excluded the heat source from the degradation of SAN. A specially prepared powder of ABS without adding anti-oxidant was analyzed by DSC for comparing the exothermic behaviors. Exothermic onset temperatures were determined to be 120 °C and 80 °C by dynamic scanning and isothermal test, respectively. The assessment successfully explained fires and explosions in an ABS powder dryer and an ABS extruder.

  20. Dicty_cDB: FC-AB09 [Dicty_cDB

    Full Text Available /dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AB/FC-AB09Q.Seq.d/ Representative seq. ID ...FC-AB09F (Link to Original site) Representative DNA sequence >FC-AB09 (FC-AB09Q) /CSM/FC/FC-AB/FC-AB09Q.Seq....QNQKKKKKKKKKKKKKKKKKK Translated Amino Acid sequence (All Frames) Frame A: desashkqlckiynkihyliifinfvlvvdlyp...0.00 m_ : 1.00 72.0 %: nuclear 16.0 %: cytoplasmic 8.0 %: mitochondrial 4.0 %: cytoskeletal >> prediction fo...kkkrkktkpkekkkkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits)

  1. Dicty_cDB: FCL-AB19 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AB19 (Link to dictyBase) - - - Contig-U15232-1 FCL-AB19Z ...(Link to Original site) - - FCL-AB19Z 697 - - - - Show FCL-AB19 Library FCL (Link to library) Clone ID FCL-A... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AB/FCL-AB19Q.Seq.d/ Representative seq. ID FCL-...AB19Z (Link to Original site) Representative DNA sequence >FCL-AB19 (FCL-AB19Q) /CSM/FCL/FCL-AB/FCL-...KLINFSIFQ* Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value FCL-

  2. Hydrogenation of AB5 and AB2 metal hydride alloys studied by in situ X-ray diffraction

    Highlights: • Hydrogenation process of an AB5 alloy and two AB2 alloys were studied by quasi in-situ XRD. • In both AB5 and AB2 metal alloy, hydrogen occupation sites on the half-plane were taken first. • In the C14/C15 mixed alloy, C14 phase is the main hydrogen storage phase with a lower equilibrium pressure. • In the C14/C15 mixed alloy, C15 phase is the catalyst hydrogen storage phase with a higher equilibrium pressure. • Small amount of C15 was hydrided first but not completed until C14 phase was fully hydrided. - Abstract: The evolution of lattice constants and abundances of metal (α) and metal hydride (β) phases during the hydrogenation process of an AB5 alloy with a CaCu5 crystal structure, an AB2 alloy with a predominating C14 structure, and a C14/C15-mixed AB2 alloy were reported. The preferred hydrogen insertion sites at different states of charge in both the α and β phases were studied based on the lattice parameter changes during hydrogenation. During the hydrogenation of the AB5 alloy, the ratio between lattice parameters a and c (a/c ratio) in the α phase decreases, stabilizes, and then decreases again while that in the β phase decreases and then stabilizes. The trends in unit cell volume changes are increasing, plateauing, and increasing again in the α phase and increasing followed by plateauing in the β phase as the hydrogenation level increases. In the C14-predominant AB2 alloy, the a/c ratio in the α phase increases at the beginning and then stabilizes while that in the β phase remains about the same and then increases during the addition of hydrogen. Moreover, the unit cell volume in the α phase increases slightly during hydrogenation, comparing to the increasing, decreasing, and then increasing trend in the β phase. In the C14/C15 mixed AB2 alloy, hydrogenation of the C15 phase starts at the beginning and promotes the hydrogenation of the C14 phase. The C14 phase, as the main hydrogen storage phase, completes hydrogenation

  3. Study of the mechanical properties of recycled abs and recovery throught mixing with SEBS

    Peydro, M. A.; Juárez Varón, David; Samuel SANCHEZ-CABALLERO; Pla-Ferrando, R

    2014-01-01

    Recovery of recycled acrylonitrile butadiene styrene (ABS) through mixing with styrene-ethylene/butylene- styrene (SEBS) has been studied in this paper. To simulate recycled ABS, virgin ABS was processed through 5 cycles, at extreme processing temperatures, 220 oC and 260 oC. The virgin ABS, the virgin SEBS, the recycled ABS and the mixtures were mechanically characterized after the various cycles of reprocessing in order to evaluate their corresponding properties and correlate them with the...

  4. Ab Initio Studies of Stratospheric Ozone Depletion Chemistry

    Lee, Timothy J.; Head-Gordon, Martin; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    An overview of the current understanding of ozone depletion chemistry, particularly with regards the formation of the so-called Antarctic ozone hole, will be presented together with an outline as to how ab initio quantum chemistry can be used to further our understanding of stratospheric chemistry. The ability of modern state-of-the art ab initio quantum chemical techniques to characterize reliably the gas-phase molecular structure, vibrational spectrum, electronic spectrum, and thermal stability of fluorine, chlorine, bromine and nitrogen oxide species will be demonstrated by presentation of some example studies. The ab initio results will be shown to be in excellent agreement with the available experimental data, and where the experimental data are either not known or are inconclusive, the theoretical results are shown to fill in the gaps and to resolve experimental controversies. In addition, ab initio studies in which the electronic spectra and the characterization of excited electronic states of halogen oxide species will also be presented. Again where available, the ab initio results are compared to experimental observations, and are used to aid in the interpretation of experimental studies.

  5. The over-expression of two transcription factors, ABS5/bHLH30 and ABS7/MYB101, leads to upwardly curly leaves.

    Rui An

    Full Text Available Proper leaf development is essential for plant growth and development, and leaf morphogenesis is under the control of intricate networks of genetic and environmental cues. We are interested in dissecting these regulatory circuits genetically and report here the isolation of two Arabidopsis dominant mutants, abnormal shoot5-1D (abs5-1D and abs7-1D identified through activation tagging screens. Both abs5-1D and abs7-1D display an intriguing upwardly curly leaf phenotype. Molecular cloning showed that the elevated expression of a bHLH transcription factor ABS5/T5L1/bHLH30 or a MYB transcription factor ABS7/MYB101 is the cause for the abnormal leaf phenotypes found in abs5-1D or abs7-1D, respectively. Protoplast transient expression assays confirmed that both ABS5/T5L1 and ABS7/MYB101 are targeted to the nucleus. Interestingly, the expression domains of auxin response reporter DR5::GUS were abnormal in leaves of abs5-1D and ABS5/T5L1 over-expression lines. Moreover, cotyledon venation analysis showed that more areoles and free-ending veins are formed in abs5-1D. We found that the epidermis-specific expressions of ABS5/T5L1 or ABS7/MYB101 driven by the Arabidopsis Meristem Layer 1 promoter (PAtML1 were sufficient to recapitulate the curly leaf phenotype of abs5-1D or abs7-1D. In addition, PAtML1::ABS5 lines exhibited similar changes in DR5::GUS expression patterns as those found in 35S-driven ABS5/T5L1 over-expression lines. Our work demonstrated that enhanced expressions of two transcription factors, ABS5/T5L1 and ABS7/MYB101, are able to alter leaf lamina development and reinforce the notion that leaf epidermis plays critical roles in regulating plant organ morphogenesis.

  6. ESTUDOS CULTURAIS E ESTUDOS DE GÊNERO: PROPOSIÇÕES E ENTRELACES ÀS PESQUISAS EDUCACIONAIS

    Dinah Quesada Beck

    2013-09-01

    Full Text Available Este artigo tem o interesse de proporcionar ao/a leitor/a uma análise acerca da relação estabelecida entre dois distintos campos de estudos, os Estudos de Gênero e os Estudos Culturais, os quais têm fundamentado as pesquisas desenvolvidas no âmbito das temáticas que têm mobilizado nossos estudos e investigações, sejam elas infância, cultura, consumo, gênero, sexualidade, embelezamento, produção e política dos corpos. Para tanto, nos ocuparemos, nessa argumentação, com alguns movimentos discursivos: após situar a importância atribuída a esses campos nas pesquisas educacionais vinculadas a perspectiva pós-estruturalista de análise, bem como o modo como operamos com eles, interessa-nos discutir e problematizar algumas de suas características, demarcando sua profícua relação. Finalizamos essa narrativa ressaltando suas contribuições em nossas investigações que discutem a produção de identidades de gênero e culturais à infância contemporânea.

  7. Ab initio simulation of transport phenomena in rarefied gases.

    Sharipov, Felix; Strapasson, José L

    2012-09-01

    Ab initio potentials are implemented into the direct simulation Monte Carlo (DSMC) method. Such an implementation allows us to model transport phenomena in rarefied gases without any fitting parameter of intermolecular collisions usually extracted from experimental data. Applying the method proposed by Sharipov and Strapasson [Phys. Fluids 24, 011703 (2012)], the use of ab initio potentials in the DSMC requires the same computational efforts as the widely used potentials such as hard spheres, variable hard sphere, variable soft spheres, etc. At the same time, the ab initio potentials provide more reliable results than any other one. As an example, the transport coefficients of a binary mixture He-Ar, viz., viscosity, thermal conductivity, and thermal diffusion factor, have been calculated for several values of the mole fraction. PMID:23030889

  8. Study on the Mechanical and Friction Properties of Ethylene Propylene Diene Terpolymer/Vinyl Silicon Rubber Foam Materials%三元乙丙橡胶/乙烯基硅橡胶泡沫材料的力学性能与摩擦性能研究

    雷卫华; 罗世凯; 花成; 王晓英

    2013-01-01

    The mechanical and friction properties of the foam materials of ethylene propylene diene terpolymer/ vinyl silicone rubber blend were studied. The results show that, while the vinyl silicone rubber content increasing, the hardness, tensile strength and compressive modulus at break of the rubber foams were decreased, the coefficient of friction (COF) was initially reduced, and then increased. While the testing temperature and pressure increasing, the COF of the foam materials reduced. The COF of the foam materials increased while the dosage of processing oil increasing and curative reducing.%研究了三元乙丙橡胶/乙烯基硅橡胶泡沫材料的力学性能,并表征了泡沫的摩擦性能.实验结果表明,随着乙烯基硅橡胶的含量增加,泡沫材料的硬度、拉伸强度和压缩模量呈下降的趋势,而静摩擦系数先下降后轻微上升;随着正压力和温度的升高,橡胶泡沫材料的静摩擦系数逐渐减小;随着硫化剂用量的减小和操作油用量的增加,橡胶泡沫的静摩擦系数上升.

  9. Surface Modification of AB2. and AB5 Hydrogen Storage Alloy Electrodes by the Hot-Charging Treatment

    2001-01-01

    The effect of the hot-charging treatment on the performance ofAB2 and AB5 hydrogen storage alloy electrodes was investigated. The result showed that the treatment can markedly improve the voltage plateau ratio (VPR), the high rate discharge ability (HRDA), the diffusion coefficient of hydrogen DH and the discharge capacity of the AB2 hydrogen storage alloy electrode. The SEM analysis showed that the hot-charging treatment brings about a Ni-rich surface due to the dissolution of Zr oxides. It is also very helpful for the improvement of the kinetic properties of AB2 hydrogen storage alloy electrode because the microcracking o.f the surface results in fresh surface. This can be the basic modification treatment for NiMH battery used in electric vehicles (EVs) in the future. But for AB5 type alloys, the treatment has the disadvantage of impairing the comprehensive electrochemical properties, because the surface of the alloy may be corroded during the treatment. The mechanism of the surface modification of the electrode is also proposed.

  10. Stimulation of UvrD helicase by UvrAB.

    Atkinson, John; Guy, Colin P; Cadman, Chris J; Moolenaar, Geri F; Goosen, Nora; McGlynn, Peter

    2009-04-01

    Helicases play critical roles in all aspects of nucleic acid metabolism by catalyzing the remodeling of DNA and RNA structures. UvrD is an abundant helicase in Escherichia coli with well characterized functions in mismatch and nucleotide excision repair and a possible role in displacement of proteins such as RecA from single-stranded DNA. The mismatch repair protein MutL is known to stimulate UvrD. Here we show that the nucleotide excision repair proteins UvrA and UvrB can together stimulate UvrD-catalyzed unwinding of a range of DNA substrates containing strand discontinuities, including forked DNA substrates. The stimulation is specific for UvrD, as UvrAB failed to stimulate Rep helicase, a UvrD homologue. Moreover, although UvrAB can promote limited strand displacement, stimulation of UvrD did not require the strand displacement function of UvrAB. We conclude that UvrAB, like MutL, modulate UvrD helicase activity. This stimulation likely plays a role in DNA strand and protein displacement by UvrD in nucleotide excision repair. Promotion of UvrD-catalyzed unwinding of nicked duplexes by UvrAB may also explain the need for UvrAB and UvrD in Okazaki fragment processing in cells lacking DNA polymerase I. More generally, these data support the idea that helicase activity is regulated in vivo, with helicases acting as part of multisubunit complexes rather than in isolation. PMID:19208629

  11. Simplest AB-Thermonuclear Space Propulsion and Electric Generator

    Bolonkin, Alexander

    2007-01-01

    The author applies, develops and researches mini-sized Micro- AB Thermonuclear Reactors for space propulsion and space power systems. These small engines directly convert the high speed charged particles produced in the thermonuclear reactor into vehicle thrust or vehicle electricity with maximum efficiency. The simplest AB-thermonuclear propulsion offered allows spaceships to reach speeds of 20,000 50,000 km/s (1/6 of light speed) for fuel ratio 0.1 and produces a huge amount of useful elect...

  12. Utveckling av ergoterapitjänster vid Helsingfors ergoterapi Ab

    Sandells, Linn

    2015-01-01

    Syftet med examensarbetet är att ta fram kvalitativa rekommendationer på ergoterapitjänster för barn i behov av särskilt stöd. Det har gjorts genom en processinriktad metod, rekommendationerna på ergoterapitjänster har tagits fram för Helsingfors ergoterapi Ab. Aktivitetsrättvisa är den teoretiska referensramen i arbetet. Den frågeställning som besvarats är vilka ergoterapitjänster kan rekommenderas till Helsingfors ergoterapi Ab. För att uppnå resultatet har materialinsamling och intervjuer ...

  13. Towards new horizons in ab initio nuclear structure theory

    We review recent advances in ab initio nuclear structure theory, which have changed the horizons of this field. Starting from chiral effective field theory to construct the nuclear Hamiltonian and the similarity renormalization group to further soften it, we address several many-body approaches that have seen major developments over the past few years. We show that the domain of ab initio nuclear structure theory has been pushed well beyond the p-shell and that quantitative QCD-based predictions are becoming possible all the way from the proton to the neutron drip line up into the medium-mass regime. (authors)

  14. Use of ab initio quantum chemical methods in battery technology

    Deiss, E. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1997-06-01

    Ab initio quantum chemistry can nowadays predict physical and chemical properties of molecules and solids. An attempt should be made to use this tool more widely for predicting technologically favourable materials. To demonstrate the use of ab initio quantum chemistry in battery technology, the theoretical energy density (energy per volume of active electrode material) and specific energy (energy per mass of active electrode material) of a rechargeable lithium-ion battery consisting of a graphite electrode and a nickel oxide electrode has been calculated with this method. (author) 1 fig., 1 tab., 7 refs.

  15. P-V Relation for Mercuric Calcogenides: Ab Initio Method

    G. Misra

    2011-01-01

    Full Text Available Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P, volume (V and temperature (T that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This ab initio method is extended to derive the equation of state for Mercuric Calcogenides. The present equation of state has also been tested for the prediction of End Point. The computed results compare well with Quantum statistical data.

  16. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1962. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses (≥ 100 mrem/quarter) is for the whole of AB Atomenergi during this year 74. 2 manrem corresponding to about 50 mrem/year and person or 1 % of the maximum permissible dose. 32500 gamma films and 6200 neutron films have been evaluated. The total number of urine analyses is 2700 and of whole body measurements 10

  17. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1963. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses during the year is for AB Atomenergi 64.2 manrem which, distributed over the whole company personnel, corresponds to about 40 mrem per year and person or about 1 % of the maximum permissible dose. 37800 gamma films and 6700 neutron films have been evaluated. The total number of urine analyses is 3603 and of whole body measurements 211

  18. Intern kontroll : - En studie om Schroff Scandinavia ABs interna kontroll

    Huldt, Martin; Björksved, Patrick

    2014-01-01

    Sammanfattning: ”Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll” Datum:  2014-06-11 Nivå: Kandidatuppsats i företagsekonomi, 15 ECTS Institution: Akademin för Ekonomi, Samhälle och Teknik, EST,                 Mälardalen Högskola Författare: Patrick Björksved, Martin Huldt Titel: Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll Handledare : Magnus Linderström Nyckelord: Intern kontroll, intern revision, intern styrning, COSO-modellen, Lean product...

  19. Bruksmakt och maktbruk : Robertsfors AB 1897-1968

    Holmström, Per

    1988-01-01

    This thesis studies seven strategic decisions made in the family-owned forestry company Robertsfors AB, in Northern Sweden. During the present century Ro­bertsfors AB has developed from a patriarchally concern controlled into a capi­talistic industrial company. This also meant a radical change in the decision­making process. Two factors were decisive in this process: the managing direc­tor's values, and altered power relationships both within the company and exter­nally in relation to e g sta...

  20. The optimal placement of up and ab – a comparison

    Dehé, Nicole

    2005-01-01

    The particle verb construction (PVC), also referred to in the literature as phrasal verb or separable complex verb, occurs in most if not all of the Germanic languages. The work presented here deals with a comparison of the transitive PVC in English and German. In English, the construction occurs in two alternating word orders (They called off the concert vs. They called the concert off ). In German, on the other hand, only one order is possible (Sie sagten das Konzert ab vs. *Sie sagten ab das...

  1. Recent achievements in ab initio modelling of liquid water

    Khaliullin, Rustam Z

    2013-01-01

    The application of newly developed first-principle modeling techniques to liquid water deepens our understanding of the microscopic origins of its unusual macroscopic properties and behaviour. Here, we review two novel ab initio computational methods: second-generation Car-Parrinello molecular dynamics and decomposition analysis based on absolutely localized molecular orbitals. We show that these two methods in combination not only enable ab initio molecular dynamics simulations on previously inaccessible time and length scales, but also provide unprecedented insights into the nature of hydrogen bonding between water molecules. We discuss recent applications of these methods to water clusters and bulk water.

  2. Aceitabilidade de flocos desidratados de abóbora Dehydrated pumpkin flakes acceptability

    Carmem Lygia Burgos Ambrósio

    2006-02-01

    Full Text Available OBJETIVO: Avaliar a aceitabilidade de flocos desidratados de abóbora, uma vez que tal produto pode constituir uma alternativa no combate à hipovitaminose A. MÉTODOS: Os flocos foram avaliados quanto às características microbiológicas, por meio das análises de coliformes a 45ºC, Escherichia coli, Staphylococcus aureus, Salmonela sp, contagem de bolores e leveduras, e características físico-químicas, por meio da análise de umidade, proteínas, lipídios, cinzas, fibra alimentar, carboidratos, carotenóides, estabilidade ao longo do tempo de armazenamento e aceitabilidade dos flocos adicionados ao feijão e ao pirão de 188 adultos e 67 crianças, respectivamente. RESULTADOS: Os flocos estavam adequados quanto às características microbiológicas e físico-químicas e os percentuais de aceitação de 95,21% para os adultos e 95,52% para as crianças. CONCLUSÃO: Os flocos desidratados de abóbora podem ser utilizados em larga escala para o estudo do efeito deste produto no combate à hipovitaminose A.OBJECTIVE: The objective of this study was to evaluate the acceptability of flakes since this product can be an alternative in the fight against hypovitaminosis A. METHODS: The flakes were evaluated through analyses of coliforms at 45ºC, Escherichia coli, Staphylococcus aureus, Salmonela sp; counting of yeasts and molds; analysis of moisture, proteins, lipids, ash, dietary fibers, carbohydrates and carotenoids; storage stability; and acceptability of flakes added to beans and "pirão" (a widely consumed Brazilian dish consisting of meat and vegetable broth and cassava flour by 188 adults and 67 children. RESULTS: The microbiological and physical-chemical characteristics of the flakes were adequate and the acceptability percentages were 95.21% for adults and 95.52% for children. CONCLUSION: Dehydrated pumpkin flakes can be used in large scale to determine its effectiveness in the fight against hypovitaminosis A.

  3. Flocos desidratados de abóbora na prevenção da carência de vitamina A em pré-escolares de uma creche

    Carmem Lygia Burgos Ambrósio

    2012-02-01

    Full Text Available OBJETIVO: Esta pesquisa teve como objetivo avaliar a eficácia de flocos desidratados de abóbora na elevação dos níveis séricos de retinol e a resposta relativa à dose em pré-escolares. MÉTODOS: A ingestão de vitamina A foi avaliada por meio de inquérito dietético. Os flocos foram analisados quanto às características microbiológicas e ao conteúdo de carotenoides. As crianças estudadas receberam diariamente 6g do produto no almoço, durante 90 dias. Elas foram submetidas ao teste de resposta relativa à dose no início e no final do estudo. Amostras de sangue foram colhidas em jejum, para análise do retinol sérico por espectro-fotometria, no início do estudo, aos 30 dias de consumo e aos 90 dias. RESULTADOS: Quanto às análises microbiológicas, os flocos encontravam-se adequados para consumo. O nível médio de retinol sérico nas crianças aumentou de M=1,438, DP=0,45µmol/L (tempo 0 para M=1,659, DP=0,51µmol/L (30 dias e M=1,928, DP=0,70µmol/L (90 dias. No início do estudo, 18,5% das crianças apresentavam níveis de retinol sérico abaixo do ponto de corte de 1,05µmol/L, proporção que caiu para 7,6% depois de 30 dias e para 0% após 90 dias. No final do período de estudo (90 dias nenhuma criança apresentou resposta relativa à dose positiva. CONCLUSÃO: Os flocos de abóbora são eficazes na elevação do retinol sérico e na reserva hepática da vitamina em pré-escolares.

  4. Comparative study of intact A7 MoAb and F(ab')2 fragments for radioimmunoimaging of human colon cancer in nude mice

    Differences of pharmacokinetics and tumor imaging ability between intact monoclonal antibody A7 (A7 MoAb) and F(ab')2 fragments were studied in human colon cancer (LS-174T)-bearing nude mouse. First of all, we examined the yield and the immunoreactivity of F(ab')2 fragments after treatment with ficin as a function of time. The yield of F(ab')2 fragments reached about 50% after ficin treatment for 8 h, and the F(ab')2 retained about 80% of the immunoreactivity of the corresponding MoAb. Longer digestion with ficin produced smaller fragments (less than 92 kDa) with a lower yield and most of the immunoreactivity was lost. In pharmacokinetics studies, the F(ab')2 was preferentially taken up by the tumor, was cleared more rapidly from the blood circulation and seemed to have less non-specific tissue binding than intact A7 MoAb. In addition, the tumor image obtained at an early time using 131I-F(ab')2 was much superior in quality to that with intact 131I-A7 MoAb. The use of F(ab')2 fragments may be effective for tumor diagnosis and therapy. (author)

  5. GJ 282 AB (WDS 07400-0336 AB = BGH 3 AB) and GICLAS 112-29: A Very Wide System in Process of Dissociation

    Rica, F. M.; Benavides, R.

    2016-04-01

    Very wide binaries are interesting objects that shed light on the binary formation process and their dynamical evolution. Poveda et al. (2009) studied the possible physical relation of the near (14.2 pc) and wide (~58") binary star GJ 282 AB and the extremely wide (1.09º; ~55,000 AU) companion, NLTT 18149, and they concluded that this very wide system is in the process of dynamical disintegration. In this work, we confirm the same conclusion but using a different method. We first study dynamically GJ 282 AB, confirmed that it is a bound system and then we determine possible orbital solutions. Later, we calculate the relative velocity of NLTT 18149 with respect to the GJ 282 AB's center mass using their (U, V, W) galactocentric velocity. The relative velocity, Vrel = 1.98 ± 0.16 km s-1, is much larger than the escape velocity (0.25 ± 0.01 km s-1). Therefore, with a significance level of 11s, we also conclude that this very wide system is in a process of dynamical disintegration.

  6. Estudo sobre reciclagem de lâmpadas fluorescentes

    Danniele Miranda Bacila; Klaus Fischer; Mônica Beatriz Kolicheski

    2014-01-01

    Lâmpadas fluorescentes (LF) contêm mercúrio em sua composição, um metal pesado que pode causar danos à saúde e ao meio ambiente. As LF são amplamente consumidas no Brasil, porém o descarte correto de LF usadas não é amplamente divulgado e os índices de reciclagem são baixos. O objetivo deste estudo foi demonstrar a relevância do descarte adequado, avaliar as tecnologias de reciclagem e a destinação dos materiais, por meio de estudo comparativo entre Brasil e Alemanha. Através de visitas a rec...

  7. Ab initio calculations of mechanical properties: Methods and applications

    Pokluda, J.; Černý, Miroslav; Šob, Mojmír; Umeno, Y.

    2015-01-01

    Roč. 73, AUG (2015), s. 127-158. ISSN 0079-6425 R&D Projects: GA ČR(CZ) GAP108/12/0311 Institutional support: RVO:68081723 Keywords : Ab initio methods * Elastic moduli * Intrinsic hardness * Stability analysis * Theoretical strength * Intrinsic brittleness/ductility Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 27.417, year: 2014

  8. Discovery of New Substrates for LuxAB Bacterial Bioluminescence.

    Jiang, Tianyu; Wang, Weishan; Wu, Xingkang; Wu, Wenxiao; Bai, Haixiu; Ma, Zhao; Shen, Yuemao; Yang, Keqian; Li, Minyong

    2016-08-01

    In this article, four novel substrates with long halftime have been designed and synthesized successfully for luxAB bacterial bioluminescence. After in vitro and in vivo biological evaluation, these molecules can emit obvious bioluminescence emission with known bacterial luciferase, thus indicating a new promising approach to developing the bacterial bioluminescent system. PMID:26896339

  9. Cyanogen Azide. Ionization Potentials and Ab Initio SCF MO Calculation

    Bak, Börge; Jansen, Peter; Stafast, Herbert

    1975-01-01

    The Ne(I) and He(I) photoelectron(PE) spectra of cyanogen azide, NCN3, have been recorded at high resolution. Their interpretation is achieved by comparison with the PE spectrum of HN3 and an ab initio LCGO SCF MO calculation. Deviations from Koopmans' theorem of quite different magnitudes are fo...

  10. Relaxation of Small Molecules: an ab initio Study

    CAO Yi-Gang; JIAO Zheng-Kuan; A. Antons; K. Schroeder; S. Blügel2

    2002-01-01

    Using an ab initio total energy and force method, we have relaxed several group IV and group V elementalclusters, in detail the arsenic and antimony dimers, silicon, phosphorus, arsenic and antimony tetramers. The obtainedbond lengths and cohesive energies are more accurate than other calculating methods, and in excellent agreement withthe experimental results.

  11. Relaxation of Small Molecules:an ab initio Study

    CAOYi-Gang; A.Antons; 等

    2002-01-01

    Using an ab inito total energy and force method,we have relaxed several group IV and group V elemental clusters,in detail the arsenic and antimony dimers,silicon,phosphorus,arsenic and antimony tetraners,The obtained bond lengths and cohesive energies are more accurate than other calculating methods,and in excellent agreement with the experimental results.

  12. Ab initio study of phase equilibria in TiCx

    Korzhavyi, P.A.; Pourovskii, L.V.; Hugosson, H.W.;

    2002-01-01

    The phase diagram for the vacancy-ordered structures in the substoichiometric TiCx (x = 0.5-1.0) has been established from Monte Carlo simulations with the long-range pair and multisite effective interactions obtained from ab initio calculations. Three ordered superstructures of vacancies (Ti2C, ...

  13. Environmentally friendly process for nickel electroplating of ABS

    Bazzaoui, M.; Martins, J. I.; Bazzaoui, E. A.; Albourine, A.

    2012-08-01

    Nickel electroplating of acrylonitrile butadiene styrene (ABS) plastic has been achieved successfully without any chromium or palladium pretreatment. Once the ABS is coated with polypyrrole (PPy), the sample may be electroplated. The process is fast, economic and involves three stages. Firstly, chemical deposition of PPy on ABS, secondly, copper deposition and finally nickel electroplating. A homogenous and adherent PPy has been synthesized chemically on ABS plate by using pyrrole as monomer and iron (III) chloride as oxidant. Copper and nickel were deposited galvanostatically from industrial plating baths. The metallic coatings were homogeneous and the adherence was estimated at 100%. The thickness of copper and nickel depend on the electrolysis time. As the current density increases, the Cu and Ni thickness raises. This result was confirmed from SEM characterization and RX map. The Ni coating is characterized by a globular structure with globules of different sizes. Energy dispersive X-ray spectroscopy (EDS) analysis shows the presence of Ni with some amount of carbon and oxygen due to the nickel oxides and contaminant from the bath solution.

  14. A-B Distinction in a Sample of Prominent Psychotherapists

    Geller, Jesse D.; Berzins, Juris I.

    1976-01-01

    A sample of prominent psychotherapists were asked to fill out the A-B therapist "type" scale and comment on their possible differential effectiveness in treating schizoid/schizophrenic versus neurotic patients. The data suggest that B therapists desire and seek more complex and exciting sensory-cognitive inputs during therapy hours than A…

  15. AB 1725 Model Accountability System. California Community Colleges. Revised.

    California Community Colleges, Sacramento. Board of Governors.

    This report proposes a model accountability system for the California community colleges to comply with the directives of Assembly Bill 1725 (AB 1725). The purpose of the accountability system is to provide colleges and districts, the board of governors, and the California legislature with information that will allow for the continued improvement…

  16. Ultra-Low Voltage Class AB Switched Current Memory Cell

    Igor, Mucha

    1996-01-01

    This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process with...

  17. Frequência dos antígenos eritrocitários do sistema AB em felinos domésticos no estado da Paraíba

    2013-01-01

    Objetivou-se com este estudo determinar a frequência de antígenos eritrocitários do sistema AB em felinos domésticos da Paraíba, Brasil. Foram selecionados aleatoriamente 178 gatos, clinicamente saudáveis, sem pré-requisitos quanto a sexo ou raça, com peso corporal acima de 1,5 kg e faixa etária acima de um ano de idade, abordados no ato da consulta ambulatorial em clínicas médicas de pequenos animais distribuídas entre três cidades da Paraíba (João Pessoa, Campina Grande e Patos). A determin...

  18. Protective mAbs and Cross-Reactive mAbs Raised by Immunization with Engineered Marburg Virus GPs.

    Marnie L Fusco

    2015-06-01

    Full Text Available The filoviruses, which include the marburg- and ebolaviruses, have caused multiple outbreaks among humans this decade. Antibodies against the filovirus surface glycoprotein (GP have been shown to provide life-saving therapy in nonhuman primates, but such antibodies are generally virus-specific. Many monoclonal antibodies (mAbs have been described against Ebola virus. In contrast, relatively few have been described against Marburg virus. Here we present ten mAbs elicited by immunization of mice using recombinant mucin-deleted GPs from different Marburg virus (MARV strains. Surprisingly, two of the mAbs raised against MARV GP also cross-react with the mucin-deleted GP cores of all tested ebolaviruses (Ebola, Sudan, Bundibugyo, Reston, but these epitopes are masked differently by the mucin-like domains themselves. The most efficacious mAbs in this panel were found to recognize a novel "wing" feature on the GP2 subunit that is unique to Marburg and does not exist in Ebola. Two of these anti-wing antibodies confer 90 and 100% protection, respectively, one hour post-exposure in mice challenged with MARV.

  19. Preparation, biodistribution, and dosimetry of 188Re-Labeled MoAb ior cea1 and its f(ab')2 fragments by avidin-biotin strategy

    The biotinylated monoclonal antibody (MoAb) ior cea1 and its F(ab')2 fragments were labeled with Re-188 by combination of avidin-biotin strategy. 188Re-MoAb, 188Re-MoAb-biotin, 188Re-F(ab')2, and 188Re-F(ab')2-biotin preparations were produced for these studies with specific activities of 1.30±0.18 GBq/mg and from instant freeze-dried kit formulations using ethane-1-hydroxy-1,1-diphosphonic acid (EHDP) as a weak competing ligand. There were no significant differences (p>0.05) between the biodistribution in mice of biotinylated and unbiotinylated 188Re-labeled immunoconjugates. When avidin was injected as a chase after injection of 188Re-MoAb-biotin or 188Re-F(ab')2-biotin, the blood radioactivity level decreased approximately 75% (cumulated activity) and the effective dose decreased almost 25% with respect to that of the radioimmunoconjugates in which the chase effect was not used. Our results suggest that 188Re-labeled biotinylated MoAb ior cea1 and its F(ab')2 fragments prepared by this method are stable complexes in vivo

  20. Solar Powered Vapor Absorption System Using Propane And Alkylated Benzene Ab300 Oil

    Al-Dadah, R.K.; Jackson, G.; Rezk, Ahmed

    2011-01-01

    Abstract This paper describes experimental work on a solar assisted vapour absorption air conditioning system using Propane (refrigerant) and Alkylated Benzene (AB300?refrigeration lubrication oil, absorbent). Preliminary experiments to assess the miscibility of propane in various lubricating oils namely Shell Clavus oils 32 and 64 and Alkylated Benzene oils AB150 and AB300 indicated that Propane is most miscible in Alkylated Benzene AB300. The vapour absorption system is a single ...

  1. A Influência da Responsabilidade Social Corporativa na Imagem de Marca: Um Estudo em Empresas Brasileiras do Setor de Cosméticos

    Márcio Ribeiro da Fonseca

    2014-12-01

    Full Text Available 800x600 Este estudo tem como tema a influência da Responsabilidade Social Corporativa (RSC na imagem de marca (IM e na reputação corporativa (RC de empresas brasileiras do setor de cosméticos. O foco da pesquisa foi investigar a percepção dos consumidores universitários pertencentes às classes A/B sobre as ações de RSC de duas grandes empresas brasileiras de cosméticos. O objetivo foi comparar as percepções dos consumidores e apontar as diferenças entre as duas empresas. O desenvolvimento deste estudo ocorreu em duas etapas: a primeira etapa envolveu revisão bibliográfica, verificando as teorias e pesquisas publicadas sobre responsabilidade social corporativa, IM e RC. A segunda etapa envolveu a coleta de dados por meio de uma survey com consumidores de duas grandes empresas brasileiras de cosméticos que publicam relatórios sociais com metodologia GRI. Os resultados demonstraram que a RSC tem influência positiva na IM, porém tal influência demonstrou-se significativa apenas para uma das marcas estudadas, sendo moderada para a segunda. Entre as contribuições deste trabalho estão a revisão de literatura sobre o tema, os apontamentos da influência dos subconstrutos e variáveis da RSC na IM e RC e as diferenças da percepção do consumidor para cada uma das marcas estudadas, bem como as recomendações para estudos futuros. Normal 0 21 false false false PT-BR X-NONE X-NONE MicrosoftInternetExplorer4 Tenacificação do poli(ácido lático pela adição do terpolímero (etileno/acrilato de metila/metacrilato de glicidila Toughening of polylactide by melt blending with an (ethylene/methyl acrylate/glycidyl methacrylate terpolymer

    Gustavo F. Brito

    2012-01-01

    Full Text Available O poli(ácido lático é um polímero biodegradável proveniente de fontes renováveis com grande potencial para substituir polímeros não biodegradáveis provenientes do petróleo. Entretanto, seu uso em determinadas aplicações é restringido devido a sua elevada fragilidade e rigidez. Com o intuito de tornar o PLA mais tenaz, o terpolímero (etileno/acrilato de metila/metacrilato de glicidila -EMA-GMA foi adicionado ao PLA em diferentes concentrações. A adição do EMA-GMA tornou o PLA mais estável durante o processamento. Por FTIR comprovou-se a existência de reação química entre os grupos terminais do PLA e grupos do EMA-GMA. A partir dos ensaios mecânicos observou-se uma resistência ao impacto três vezes superior à do PLA puro.The Poly(lactic acid is a biodegradable polymer from renewable sources with potential to replace non-biodegradable polymers derived from petroleum. However its use is restricted in certain applications due to its high brittleness and rigidity. In order to make the PLA more tenacious, the terpolymer (ethylene/methyl acrylate/glycidyl methacrylate - EMA-GMA was added to PLA in different concentrations. The addition of EMA-GMA to PLA turned the blends more stable during processing. The FTIR data confirmed the chemical reaction between groups in PLA and the EMA-GMA. A three fold increase was observed in the impact strength compared to pure PLA.

  2. Augmented wave ab initio EFG calculations: some methodological warnings

    Errico, Leonardo A. [Departamento de Fisica-IFLP (CONICET), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CC67 (1900) La Plata (Argentina); Renteria, Mario [Departamento de Fisica-IFLP (CONICET), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CC67 (1900) La Plata (Argentina); Petrilli, Helena M. [Instituto de Fisica-DFMT, Universidade de Sao Paulo, C.P. 66318, 05315-970 Sao Paulo, SP (Brazil)]. E-mail: hmpetril@macbeth.if.usp.br

    2007-02-01

    We discuss some accuracy aspects inherent to ab initio electronic structure calculations in the understanding of nuclear quadrupole interactions. We use the projector augmented wave method to study the electric-field gradient (EFG) at both Sn and O sites in the prototype cases SnO and SnO{sub 2}. The term ab initio is used in the standard context of the also called first principles methods in the framework of the Density Functional Theory. As the main contributions of EFG calculations to problems in condensed matter physics are related to structural characterizations on the atomic scale, we discuss the 'state of the art' on theoretical EFG calculations and make a brief critical review on the subject, calling attention to some fundamental theoretical aspects.

  3. Augmented wave ab initio EFG calculations: some methodological warnings

    We discuss some accuracy aspects inherent to ab initio electronic structure calculations in the understanding of nuclear quadrupole interactions. We use the projector augmented wave method to study the electric-field gradient (EFG) at both Sn and O sites in the prototype cases SnO and SnO2. The term ab initio is used in the standard context of the also called first principles methods in the framework of the Density Functional Theory. As the main contributions of EFG calculations to problems in condensed matter physics are related to structural characterizations on the atomic scale, we discuss the 'state of the art' on theoretical EFG calculations and make a brief critical review on the subject, calling attention to some fundamental theoretical aspects

  4. Chemical and Electrochemical Metallic Covering of ABS polymers

    Florentina Cziple

    2009-10-01

    Full Text Available The aim of this paper is the deposition of metallic layers on the surface of ABS plastic material, by means of two consecutive procedures, namely: the first is represented by the conductibility through chemical or electro-chemical metallic covering of the polymeric support and the second procedure is the electrodeposition of the metal through galvanization. The chemical mehtod consists in the submission of ABS polymers to some conductibility operations of the plastic material surface through chemical copper plating (chemical roughing, degreasing with ultra-sounds, chemical sensitivation, activation and proper conductibility of the material surface. The electrochemical deposition of nickel was made on the plastic material activated in the mixture solution of graphite with potassium carbonate.

  5. Ab Initio Nuclear Structure Theory: From Few to Many

    We summarize recent advances in ab initio nuclear structure theory, aiming to connect few- and many-body systems in a coherent theoretical framework. Starting from chiral effective field theory to construct the nuclear Hamiltonian and the similarity renormalization group to soften it, we address several many-body approaches that have seen major developments over the past few years. We show that the domain of ab initio nuclear structure theory has been pushed well beyond the p-shell and that quantitative predictions connected to QCD via chiral effective field theory are becoming possible all the way from the proton to the neutron drip line up into the medium-mass regime. (author)

  6. Serine Proteases an Ab Initio Molecular Dynamics Study

    De Santis, L

    1999-01-01

    In serine proteases (SP's), the H-bond between His-57 and Asp-102, and that between Gly-193 and the transition state intermediate play a crucial role for enzymatic function. To shed light on the nature of these interactions, we have carried out ab initio molecular dynamics simulations on complexes representing adducts between the reaction intermediate and elastase (one protein belonging to the SP family). Our calculations indicate the presence of a low--barrier H-bond between His-57 and Asp-102, in complete agreement with NMR experiments on enzyme--transition state analog complexes. Comparison with an ab initio molecular dynamics simulation on a model of the substrate--enzyme adduct indicates that the Gly-193--induced strong stabilization of the intermediate is accomplished by charge/dipole interactions and not by H-bonding as previously suggested. Inclusion of the protein electric field in the calculations does not affect significantly the charge distribution.

  7. Understanding phonon transport in thermoelectric materials using ab initio approaches

    Broido, David

    Good thermoelectric materials have low phonon thermal conductivity, kph. Accurate theories to describe kph are important components in developing predictive models of thermoelectric efficiency that can help guide synthesis and measurement efforts. We have developed ab initio approaches to calculate kph, in which phonon modes and phonon scattering rates are computed using interatomic force constants determined from density functional theory, and a full solution of the Boltzmann transport equation for phonons is implemented. A recent approach to calculate interatomic force constants using ab initio molecular dynamics has yielded a good description of the thermal properties of Bi2Te3. But, the complexity of new promising candidate thermoelectric materials introduces computational challenges in assessing their thermal properties. An example is germanane, a germanium based hydrogen-terminated layered semiconductor, which we will discuss in this talk.

  8. The density matrix renormalization group for ab initio quantum chemistry

    Wouters, Sebastian

    2014-01-01

    During the past 15 years, the density matrix renormalization group (DMRG) has become increasingly important for ab initio quantum chemistry. Its underlying wavefunction ansatz, the matrix product state (MPS), is a low-rank decomposition of the full configuration interaction tensor. The virtual dimension of the MPS, the rank of the decomposition, controls the size of the corner of the many-body Hilbert space that can be reached with the ansatz. This parameter can be systematically increased until numerical convergence is reached. The MPS ansatz naturally captures exponentially decaying correlation functions. Therefore DMRG works extremely well for noncritical one-dimensional systems. The active orbital spaces in quantum chemistry are however often far from one-dimensional, and relatively large virtual dimensions are required to use DMRG for ab initio quantum chemistry (QC-DMRG). The QC-DMRG algorithm, its computational cost, and its properties are discussed. Two important aspects to reduce the computational co...

  9. Ab-initio calculations on melting of thorium

    Mukherjee, D.; Sahoo, B. D.; Joshi, K. D.; Kaushik, T. C.; Gupta, Satish C.

    2016-05-01

    Ab-initio molecular dynamics study has been performed on face centered cubic structured thorium to determine its melting temperature at room pressure. The ion-electron interaction potential energy calculated as a function of temperature for three volumes (a0)3 and (1.02a0)3 and (1.04a0)3 increases gradually with temperature and undergoes a sharp jump at ~2200 K, ~2100 K and ~1800 K, respectively. Here, a0 = 5.043 Å is the equilibrium lattice parameter at 0 K obtained from ab-initio calculations. These jumps in interaction energy are treated as due to the onset of melting and corresponding temperatures as melting point. The melting point of 2100 K is close to the experimental value of 2023K. Further, the same has been verified by plotting the atomic arrangement evolved at various temperatures and corresponding pair correlation functions.

  10. Kostnadseffektivering av logistikkostnader : Rolls-Royce Oy Ab

    Nordlund, Lucas

    2013-01-01

    Rolls-Royce Oy Ab som fungerar som uppdragsgivare i detta examensarbete, är ett företag med internationell verksamhet. Företaget hör till det globala Rolls-Royce plc som verkar inom många olika delområden i länder runt om i hela världen. Enheten i Karleby verkar inom Rolls-Royce Marine koncernen och tillverkar vattenjetaggregat. I och med att Rolls-Royce Oy Ab hör till Marine koncernen, medför det att man följer bestämmelser och standarder som följs i hela Marine koncernen. Till dessa gem...

  11. Molexpl: a tool for ab initio data exploration and visualization

    Wang, Xueying; Onofrio, Nicolas,; Strachan, Alejandro

    2015-01-01

    Density functional theory (DFT) based on ab initio theory, is a powerful method to resolve the electronic structure of atoms, molecules and solids. However, in practical, DFT is limited to few hundreds of atoms. To overcome this limitation, researchers have developed empirical interatomic potentials implemented in molecular dynamics (MD) simulations. MD ignores the movements of electrons and describes bonding and non-bonding interaction as a function of the distance between atoms called force...

  12. Ab initio molecular dynamics simulation of laser melting of silicon

    Silvestrelli, P.-L.; Alavi, A; Parrinello, M.; Frenkel, D

    1996-01-01

    The method of ab initio molecular dynamics, based on finite temperature density functional theory, is used to simulate laser heating of crystal silicon. We have found that a high concentration of excited electrons dramatically weakens the covalent bond. As a result, the system undergoes a melting transition to a metallic state. In contrast to ordinary liquid silicon, the new liquid is characterized by a high coordination number and a strong reduction of covalent bonding effects.

  13. Towards an ab initio description of magnetism in ionic solids

    Illas, F.; Casanovas, J.; García-Bach, M. A.; Caballol, R.; Castell, O.

    1993-11-01

    The physical contributions to the KNiF3 magnetic exchange coupling integral have been obtained from specially designed ab initio cluster model calculations. Three important mechanisms have been identified. These are the delocalization of the magnetic orbitals into the anion ``p'' band, the variational contribution of the second-order interactions, and the many-body terms ``hidden'' in the two-body operator and the Heisenberg Hamiltonian.

  14. Social Media Marketing : CASE: OY SUOMEN LYYRA AB

    Eriksson, Irene

    2012-01-01

    This bachelor thesis was commissioned by Oy Suomen Lyyra Ab, the largest student online media and student card producer for higher education students in Finland. The the-sis objective was to understanding the current social media situation and activity among the students of higher education in Finland, the social media networks that the case company currently uses as well as understanding how to use these networks for successful marketing activities. The quantitative research was conducted in...

  15. Ab initio simulation of helium inside carbon nanotubes

    In present work we consider the complex behaviour of quantum liquids like liquid He-4 inside carbon nanotubes. Interactions between helium atoms and carbon atoms of the short-length atomistic model and model with periodical boundary conditions of carbon nanotube were studied via ab initio quantum simulations. Effects of geometrical confinement of the tube on the He behaviour inside CNT (13,0) have been explored. Nanotubes with typical average diameter of 10 angstroms are under consideration.

  16. The density matrix renormalization group for ab initio quantum chemistry

    Wouters, Sebastian

    2015-01-01

    During the past 15 years, the density matrix renormalization group (DMRG) has become increasingly important for ab initio quantum chemistry. It is used as a numerically exact solver for highly correlated regions in molecules. While the method works extremely well for one-dimensional systems, the correlated regions of interest are often far from one-dimensional. In this introductory talk, I will discuss the DMRG algorithm from a quantum information perspective, how quantum information theory h...

  17. Ab Initio Modeling of Ecosystems with Artificial Life

    Adami, C.

    2002-01-01

    Artificial Life provides the opportunity to study the emergence and evolution of simple ecosystems in real time. We give an overview of the advantages and limitations of such an approach, as well as its relation to individual-based modeling techniques. The Digital Life system Avida is introduced and prospects for experiments with ab initio evolution (evolution "from scratch"), maintenance, as well as stability of ecosystems are discussed.

  18. P-V Relation for Mercuric Calcogenides: Ab Initio Method

    G. Misra; S. Tenguria; Gautam, M.

    2011-01-01

    Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P), volume (V) and temperature (T) that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This a...

  19. Erythema Ab Igne in Three Girls with Anorexia Nervosa.

    Dessinioti, Clio; Katsambas, Andreas; Tzavela, Eleni; Karountzos, Vasileios; Tsitsika, Artemis K

    2016-03-01

    We present three girls with the eating disorder anorexia nervosa (AN) presenting with erythema ab igne (EAI), a benign, reticular, erythematous dermatosis caused by repeated prolonged skin exposure to mild heat. AN has been associated with abnormal peripheral vascular response to cold, vasoconstriction of the limbs, low hand blood flow, exaggerated response to cold stimuli, subnormal core temperature, and a general feeling of cold that may encourage prolonged heat exposure and induce EAI. PMID:26822102

  1. Structure models: from shell model to ab initio methods

    Bacca, Sonia

    2016-01-01

    A brief review of models to describe nuclear structure and reactions properties is presented, starting from the historical shell model picture and encompassing modern ab initio approaches. A selection of recent theoretical results on observables for exotic light and medium-mass nuclei is shown. Emphasis is given to the comparison with experiment and to what can be learned about three-body forces and continuum properties.

  2. Ab-initio calculations for dilute magnetic semiconductors

    Belhadji, Brahim

    2008-01-01

    This thesis focusses on ab-initio calculations for the electronic structure and the magnetic properties of dilute magnetic semiconductors (DMS). In particular we aim at the understanding of the complex exchange interactions in these systems. Our calculations are based on density functional theory, being ideally suited for a description of the material specific properties of the considered DMS. Moreover we use the KKR Green function method in connection with the coherent potential approximatio...

  3. Integrated Design of Antibodies for Systems Biology Using Ab Designer

    Pisitkun, Trairak; Dummer, Patrick; Somparn, Poorichaya; Hirankarn, Nattiya; Kopp, Jeffrey B.; Knepper, Mark A.

    2014-01-01

    In the current era of large-scale biology, systems biology has evolved as a powerful approach to identify complex interactions within biological systems. In addition to high throughput identification and quantification techniques, methods based on high-quality mono-specific antibodies remain an essential element of the approach. To assist the large-scale design and production of peptide-directed antibodies for systems biology studies, we developed a fully integrated online application, AbDesi...

  4. Innovativeness and innovations utilizations : Oy LM Ericsson Ab

    Saarinen, Vesa

    2010-01-01

    The aim of this action research was to improve the innovativeness amongst the R&D personnel at LM Ericsson Ab in Finland. The main purpose of this study was to understand the background of innovativeness and to practically compare the research results with the actual company situation. Innovativeness is predominantly a personal, internal matter and it is based on the intrinsic motivation of an individual. Creativity, courage and persistent effort are the key elements of innovativeness...

  5. GAUSSIAN 76: An ab initio Molecular Orbital Program

    Binkley, J. S.; Whiteside, R.; Hariharan, P. C.; Seeger, R.; Hehre, W. J.; Lathan, W. A.; Newton, M. D.; Ditchfield, R.; Pople, J. A.

    1978-01-01

    Gaussian 76 is a general-purpose computer program for ab initio Hartree-Fock molecular orbital calculations. It can handle basis sets involving s, p and d-type Gaussian functions. Certain standard sets (STO-3G, 4-31G, 6-31G*, etc.) are stored internally for easy use. Closed shell (RHF) or unrestricted open shell (UHF) wave functions can be obtained. Facilities are provided for geometry optimization to potential minima and for limited potential surface scans.

  6. GAUSSIAN 76: an ab initio molecular orbital program

    Binkley, J. S.; Whiteside, R.; Hariharan, P. C.; Seeger, R.; Hehre, W. J.; Lathan, W. A.; Newton, M. D.; Ditchfield, R.; Pople, J. A.

    1978-06-01

    Gaussian 76 is a general-purpose computer program for ab initio Hartree-Fock molecular orbital calculations. It can handle basis sets involving s, p and d-type gaussian functions. Certain standard sets (STO-3G, 4-31G, 6-31G*, etc.) are stored internally for easy use. Closed shell (RHF) or unrestricted open shell (UHF) wave functions can be obtained. Facilities are provided for geometry optimization to potential minima and for limited potential surface scans.

  7. Der halbunendliche Kristall - Elektronische und optische Eigenschaften ab-initio

    Brodersen, Sven

    2002-01-01

    Es werden die elektronischen und optischen Eigenschaften eines kristallinen Festkörpers unter Berücksichtigung der Oberfläche mit ab-initio Methoden berechnet. Die Behandlung der Oberflächeneffekte in einer Halbraum-Geometrie erzwingt die Darstellung der Wellenfunktionen und der Dielektrischen Funktion (DK) in einer lokalen Basis. Anhand von Volumenkristallen wird die Effizienz von LCAO- Basisfunktionen demonstriert. Die Erweiterung der atomaren Orbitale mit unbesetzten Orbitalen und 'off-sit...

  8. TENDÊNCIAS DOS ESTUDOS COM PLANTAS MEDICINAIS NO BRASIL

    Fernanda Melo Carneiro

    2014-12-01

    Full Text Available As plantas medicinais são utilizadas pelo homem desde o início da história e atualmente empregadas como recursos na medicina alternativa por grande parte da população mundial. Esse uso deve-se à facilidade de acesso às plantas em relação aos medicamentos alopáticos. O objetivo deste trabalho foi, primariamente, desenvolver uma análise cienciométrica sobre as tendências dos estudos com plantas medicinais no Brasil, investigando se o número de trabalhos cresceu ao longo dos anos. Além disso, foi identificamos as principais plantas que são estudadas pelo seu principio medicinal no Brasil. Para a pesquisa foi empregada a base de dados Scielo, com artigos de 1995 a 2011, utilizando a palavra “Planta Medicinal” como palavra-chave. Foram avaliados 329 artigos, mas somente 265 foram compatíveis à pesquisa. Artigos que não foram desenvolvidos no Brasil; que não utilizaram o termo planta medicinal; ou não citaram plantas foram excluídos das análises. Em cada artigo selecionado foram coletadas as seguintes informações: título do artigo, quantidade de autores, instituições responsáveis pelo estudo, local das instituições, ano de publicação, tipo de estudo (ex.: farmacológico, agropecuário e ecológico e as plantas que foram estudadas. Por meio de análises desses dados foi possível verificar as tendências dos estudos com plantas medicinais no Brasil. Conforme esperado, a maior parte dos artigos avaliados estão voltados para a Farmacologia, com aplicação em diversas áreas da saúde e em segundo lugar a Agropecuária, devido ao interesse em desenvolver produtos a partir de plantas para o controle de pragas. Entretanto, verificou-se o emprego em outras áreas, como a Bioquímica, Botânica, Ecologia, Genética/Molecular e Educação que apesar de serem menos frequentes, são essenciais, pois os estudos com plantas medicinais requerem profissionais de múltiplas áreas. Além da investigação da medicina popular

  9. Pressure tracking control of vehicle ABS using piezo valve modulator

    Jeon, Juncheol; Choi, Seung-Bok

    2011-03-01

    This paper presents a wheel slip control for the ABS(anti-lock brake system) of a passenger vehicle using a controllable piezo valve modulator. The ABS is designed to optimize for braking effectiveness and good steerability. As a first step, the principal design parameters of the piezo valve and pressure modulator are appropriately determined by considering the braking pressure variation during the ABS operation. The proposed piezo valve consists of a flapper, pneumatic circuit and a piezostack actuator. In order to get wide control range of the pressure, the pressure modulator is desired. The modulator consists of a dual-type cylinder filled with different substances (fluid and gas) and a piston rod moving vertical axis to transmit the force. Subsequently, a quarter car wheel slip model is formulated and integrated with the governing equation of the piezo valve modulator. A sliding mode controller to achieve the desired slip rate is then designed and implemented. Braking control performances such as brake pressure and slip rate are evaluated via computer simulations.

  10. Monte Carlo simulation of AB-copolymers with saturating bonds

    Chertovich, A V; Khokhlov, A R; Bohr, J

    2003-01-01

    Structural transitions in a single AB-copolymer chain where saturating bonds can be formed between A-and B-units are studied by means of Monte Carlo computer simulations using the bond fluctuation model. Three transitions are found, coil-globule, coil-hairpin and globule-hairpin, depending on the nature of a particular AB-sequence: statistical random sequence, diblock sequence and 'random-complementary' sequence (one-half of such an AB-sequence is random with Bernoulli statistics while the other half is complementary to the first one). The properties of random-complementary sequences are closer to those of diblock sequences than to the properties of random sequences. The model (although quite rough) is expected to represent some basic features of real RNA molecules, i.e. the formation of secondary structure of RNA due to hydrogen bonding of corresponding bases and stacking interactions of the base pairs in helixes. We introduce the notation of RNA-like copolymers and discuss in what sense the sequences studie...

  11. Ab Initio Nuclear Structure and Reaction Calculations for Rare Isotopes

    We have developed a novel ab initio symmetry-adapted no-core shell model (SA-NCSM), which has opened the intermediate-mass region for ab initio investigations, thereby providing an opportunity for first-principle symmetry-guided applications to nuclear structure and reactions for nuclear isotopes from the lightest p-shell systems to intermediate-mass nuclei. This includes short-lived proton-rich nuclei on the path of X-ray burst nucleosynthesis and rare neutron-rich isotopes to be produced by the Facility for Rare Isotope Beams (FRIB). We have provided ab initio descriptions of high accuracy for low-lying (including collectivity-driven) states of isotopes of Li, He, Be, C, O, Ne, Mg, Al, and Si, and studied related strong- and weak-interaction driven reactions that are important, in astrophysics, for further understanding stellar evolution, X-ray bursts and triggering of s, p, and rp processes, and in applied physics, for electron and neutrino-nucleus scattering experiments as well as for fusion ignition at the National Ignition Facility (NIF).

  12. Ab Initio Nuclear Structure and Reaction Calculations for Rare Isotopes

    Draayer, Jerry P. [Louisiana State Univ., Baton Rouge, LA (United States)

    2014-09-28

    We have developed a novel ab initio symmetry-adapted no-core shell model (SA-NCSM), which has opened the intermediate-mass region for ab initio investigations, thereby providing an opportunity for first-principle symmetry-guided applications to nuclear structure and reactions for nuclear isotopes from the lightest p-shell systems to intermediate-mass nuclei. This includes short-lived proton-rich nuclei on the path of X-ray burst nucleosynthesis and rare neutron-rich isotopes to be produced by the Facility for Rare Isotope Beams (FRIB). We have provided ab initio descriptions of high accuracy for low-lying (including collectivity-driven) states of isotopes of Li, He, Be, C, O, Ne, Mg, Al, and Si, and studied related strong- and weak-interaction driven reactions that are important, in astrophysics, for further understanding stellar evolution, X-ray bursts and triggering of s, p, and rp processes, and in applied physics, for electron and neutrino-nucleus scattering experiments as well as for fusion ignition at the National Ignition Facility (NIF).

  13. Studies on the runaway reaction of ABS polymerization process

    Hu, K.-H. [Department of Occupational Safety and Health, Jen-Teh Junior College of Medicine, Nursing and Management, Miaoli, Taiwan (China); Kao, C.-S. [Department of Safety, Health and Environmental Engineering, National United University, Taiwan (China); Duh, Y.-S. [Department of Occupational Safety and Health, Jen-Teh Junior College of Medicine, Nursing and Management, Miaoli, Taiwan (China)], E-mail: yihshingduh@yahoo.com.tw

    2008-11-15

    Taiwan has the largest acrylonitrile-butadiene-styrene (ABS) copolymer production in the world. Preventing on unexpected exothermic reactions and related emergency relief hazard is essential in the safety control of ABS emulsion polymerization. A VSP2 (Vent Sizing Package 2) apparatus is capable of studying both normal and abnormal conditions (e.g., cooling failure, mischarge, etc.) of industrial process. In this study, the scenarios were verified from the following abnormal conditions: loss of cooling, double charge of initiator, overcharge of monomer, without charge of solvent, and external fire. An external fire with constant heating will promote higher self-heat rate and this is recommended as the worst case scenario of emulsion polymerization on butadiene. Cooling failure coupled with bulk system of reactant was determined to be the credible worst case in ABS emulsion polymerization. Finally, the emergency vent sizing based on thermokinetics from VSP associated with DIERS methodology were used for evaluating the vent sizing and compared to that of the industrial plants.

  14. Ab initio calculations for industrial materials engineering: successes and challenges

    Wimmer, Erich; Freeman, Clive; Christensen, Mikael; Wolf, Walter; Saxe, Paul [Materials Design, Inc., PO Box 2000, Angel Fire, NM 87710 (United States); Najafabadi, Reza; Young Jr, George A; Ballard, Jake D; Angeliu, Thomas M; Vollmer, James [Knolls Atomic Power Laboratory, PO Box 1072, Schenectady, NY 12301-1072 (United States); Chambers, James J; Niimi, Hiroaki; Shaw, Judy B, E-mail: ewimmer@materialsdesign.co [Advanced CMOS, Texas Instruments Incorporated, Dallas, TX 75243 (United States)

    2010-09-29

    Computational materials science based on ab initio calculations has become an important partner to experiment. This is demonstrated here for the effect of impurities and alloying elements on the strength of a Zr twist grain boundary, the dissociative adsorption and diffusion of iodine on a zirconium surface, the diffusion of oxygen atoms in a Ni twist grain boundary and in bulk Ni, and the dependence of the work function of a TiN-HfO{sub 2} junction on the replacement of N by O atoms. In all of these cases, computations provide atomic-scale understanding as well as quantitative materials property data of value to industrial research and development. There are two key challenges in applying ab initio calculations, namely a higher accuracy in the electronic energy and the efficient exploration of large parts of the configurational space. While progress in these areas is fueled by advances in computer hardware, innovative theoretical concepts combined with systematic large-scale computations will be needed to realize the full potential of ab initio calculations for industrial applications.

  15. Ab initio calculations for industrial materials engineering: successes and challenges

    Computational materials science based on ab initio calculations has become an important partner to experiment. This is demonstrated here for the effect of impurities and alloying elements on the strength of a Zr twist grain boundary, the dissociative adsorption and diffusion of iodine on a zirconium surface, the diffusion of oxygen atoms in a Ni twist grain boundary and in bulk Ni, and the dependence of the work function of a TiN-HfO2 junction on the replacement of N by O atoms. In all of these cases, computations provide atomic-scale understanding as well as quantitative materials property data of value to industrial research and development. There are two key challenges in applying ab initio calculations, namely a higher accuracy in the electronic energy and the efficient exploration of large parts of the configurational space. While progress in these areas is fueled by advances in computer hardware, innovative theoretical concepts combined with systematic large-scale computations will be needed to realize the full potential of ab initio calculations for industrial applications.

  16. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as “cloning,” in analogy to the “spawning” procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, “trains,” as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions

  17. Converting of Matter to Nuclear Energy by AB-Generator

    Alexander Bolonkin

    2009-01-01

    Full Text Available Problem statement: Researcher offered a new nuclear generator which allowed to convert any matter to nuclear energy in accordance with Einstein equation E = mc2. The method was based upon tapping the energy potential of a Micro Black Hole (MBH and Hawking radiation created by this MBH. Researcher did not meet the idea and its research in literature to develop the method for getting a cheap energy. Approach: As is well-known, vacuum continuously produced virtual pairs of particles and antiparticles, in particular, photons and anti-photons. MBH event horizon allowed separating them. Anti-photons can be moved to MBH and be annihilated, decreasing mass of MBH, resulting photons leave the MBH neighborhood as Hawking radiation. The offered nuclear generator (named by Researcher as AB-generator utilized Hawking radiation and injected the matter into MBH and kept MBH in a stable state with near-constant mass. Results: AB-generator can be produced gigantic energy outputs and should be cheaper than a conventional electric station by a factor of hundreds of times. One also may be used in aerospace as a photon rocket or as a power source for many vehicles. Conclusion: Many scientists expect Large Hadron Collider at CERN may be produced one MBH every second. A technology to capture them may be developed; than they may be used for the AB-generator.

  18. Ab initio calculations of reactions with light nuclei

    Quaglioni, Sofia; Hupin, Guillaume; Calci, Angelo; Navrátil, Petr; Roth, Robert

    2016-03-01

    An ab initio (i.e., from first principles) theoretical framework capable of providing a unified description of the structure and low-energy reaction properties of light nuclei is desirable to further our understanding of the fundamental interactions among nucleons, and provide accurate predictions of crucial reaction rates for nuclear astrophysics, fusion-energy research, and other applications. In this contribution we review ab initio calculations for nucleon and deuterium scattering on light nuclei starting from chiral two- and three-body Hamiltonians, obtained within the framework of the ab initio no-core shell model with continuum. This is a unified approach to nuclear bound and scattering states, in which square-integrable energy eigenstates of the A-nucleon system are coupled to (A-a)+a target-plus-projectile wave functions in the spirit of the resonating group method to obtain an efficient description of the many-body nuclear dynamics both at short and medium distances and at long ranges.

  19. A Complete and Accurate Ab Initio Repeat Finding Algorithm.

    Lian, Shuaibin; Chen, Xinwu; Wang, Peng; Zhang, Xiaoli; Dai, Xianhua

    2016-03-01

    It has become clear that repetitive sequences have played multiple roles in eukaryotic genome evolution including increasing genetic diversity through mutation, changes in gene expression and facilitating generation of novel genes. However, identification of repetitive elements can be difficult in the ab initio manner. Currently, some classical ab initio tools of finding repeats have already presented and compared. The completeness and accuracy of detecting repeats of them are little pool. To this end, we proposed a new ab initio repeat finding tool, named HashRepeatFinder, which is based on hash index and word counting. Furthermore, we assessed the performances of HashRepeatFinder with other two famous tools, such as RepeatScout and Repeatfinder, in human genome data hg19. The results indicated the following three conclusions: (1) The completeness of HashRepeatFinder is the best one among these three compared tools in almost all chromosomes, especially in chr9 (8 times of RepeatScout, 10 times of Repeatfinder); (2) in terms of detecting large repeats, HashRepeatFinder also performed best in all chromosomes, especially in chr3 (24 times of RepeatScout and 250 times of Repeatfinder) and chr19 (12 times of RepeatScout and 60 times of Repeatfinder); (3) in terms of accuracy, HashRepeatFinder can merge the abundant repeats with high accuracy. PMID:26272474

  20. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    Makhov, Dmitry V.; Glover, William J.; Martinez, Todd J.; Shalashilin, Dmitrii V.

    2014-08-01

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as "cloning," in analogy to the "spawning" procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, "trains," as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions.

  1. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    Makhov, Dmitry V.; Shalashilin, Dmitrii V. [Department of Chemistry, University of Leeds, Leeds LS2 9JT (United Kingdom); Glover, William J.; Martinez, Todd J. [Department of Chemistry and The PULSE Institute, Stanford University, Stanford, California 94305, USA and SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States)

    2014-08-07

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as “cloning,” in analogy to the “spawning” procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, “trains,” as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions.

  2. Ab initio nuclear structure - the large sparse matrix eigenvalue problem

    The structure and reactions of light nuclei represent fundamental and formidable challenges for microscopic theory based on realistic strong interaction potentials. Several ab initio methods have now emerged that provide nearly exact solutions for some nuclear properties. The ab initio no core shell model (NCSM) and the no core full configuration (NCFC) method, frame this quantum many-particle problem as a large sparse matrix eigenvalue problem where one evaluates the Hamiltonian matrix in a basis space consisting of many-fermion Slater determinants and then solves for a set of the lowest eigenvalues and their associated eigenvectors. The resulting eigenvectors are employed to evaluate a set of experimental quantities to test the underlying potential. For fundamental problems of interest, the matrix dimension often exceeds 1010 and the number of nonzero matrix elements may saturate available storage on present-day leadership class facilities. We survey recent results and advances in solving this large sparse matrix eigenvalue problem. We also outline the challenges that lie ahead for achieving further breakthroughs in fundamental nuclear theory using these ab initio approaches.

  3. Inteligência emocional: estudo exploratório

    Seabra, Diana Catarina Lopes

    2013-01-01

    A presente dissertação tem como objetivo esclarecer e refletir sobre a inteligência emocional e explorar se existe uma influência entre a atividade que o grupo exerce, o tempo de pertença e o tempo de vida do mesmo, ao nível da inteligência emocional grupal e das suas dimensões. Para tal, foi desenvolvido um estudo exploratório. A recolha dos dados realizou-se através do Questionário de Inteligência Emocional Grupal traduzido e adaptado por Correia (2010) do Group Emotional Intelligence Quest...

  4. Marketing digital : um estudo das empresas em Angola

    Guerra, Dalva Marina Teixeira

    2013-01-01

    Dissertação de mestrado em Estudos de Gestão Com a introdução das novas tecnologias e da Internet, os mercados têm evoluído cada vez mais. Os consumidores tornam-se cada vez mais exigentes, por sentirem que mais facilmente podem comparar, comprar e reclamar através desta ferramenta. Por este motivo, as empresas procuram cada vez mais superar-se e oferecer produtos e serviços diferenciados ao cliente, de forma a ganhar vantagem competitiva num mercado cada vez mais competitiv...

  5. Responsabilidade Social Corporativa: estudo comparativo das normas socioambientais

    Francisco Roberto Pinto; Dorelland Ponte Lima; Marcelle Colares Oliveira; Leonel Gois Lima Oliveira

    2007-01-01

    A utilização de normas socioambientais visa dar maior credibilidade às práticas de Responsabilidade Social Corporativa (RSC). Neste estudo, levantaram-se os seguintes questionamentos: Quais as características das normas socioambientais existentes quanto à avaliação do processo produtivo, das relações com a comunidade, das relações com os empregados e dependentes? Quais os aspectos convergentes e divergentes dessas características no tocante à integração dos sistemas de gestão da RSC propugnad...

  6. Criatividade e gastronomia: Um estudo exploratório

    Ferreira, Ana Catarina

    2012-01-01

    O presente trabalho é um estudo exploratório que aborda o tema da criatividade na gastronomia, sendo um tema pioneiro e pouco trabalhado. Na teoria, a gastronomia tem um grande significado afectivo e identitário (seja a nível cultural ou a nível individual) e é uma área que acompanha o desenvolvimento das sociedades. Por outro lado, a criatividade demonstra-se como sendo uma prática complexa de processos e dinâmicas mentais, também implicando muito da identidade e da personalidade do sujeito ...

  7. Eletrocardiografia computadorizada em cães: estudo comparativo

    Lídia S. Oliveira; Roberto R.B. Santos; Melo, Marcos B; Daniela F. Larangeira; Stella Maria Barrouin-Melo

    2013-01-01

    O método de eletrocardiografia computadorizada (ECG-C) vem sendo crescentemente difundido na medicina veterinária, havendo atualmente diversas marcas e modelos de eletrocardiógrafos disponíveis no mercado. Diante da possibilidade de diferenças na sensibilidade e na reprodutibilidade das medidas obtidas nos traçados, o presente estudo teve como objetivo comparar os parâmetros eletrocardiográficos de cães, obtidos por dois sistemas. Foram avaliados dois diferentes softwares computadorizados, o ...

  8. "Buzz marketing" : estudo de caso da marca Red Bull

    Conceição, Miguel David

    2012-01-01

    Este relatório é baseado no estágio efetuado na agência de publicidade Ogilvy & Mather e é dedicado à temática do Buzz Marketing. De modo a poder explorar a fundo as dinâmicas deste tema foi feita uma análise à estratégia de marketing da marca Red Bull, considerada como um dos principais estudos de caso no âmbito do Buzz Marketing. Este tema pode ser definido como uma estratégia de marketing inovadora cujo objetivo principal é a criação de conversas entre os consumidores, colocando-os a falar...

  9. Craniostenose em gêmeos: estudo genético

    Walter Carlos Pereira

    1968-09-01

    Full Text Available É relatada a ocorrência de formas clínicas diversas de craniostenose em gêmeos de sexo diferente. A menina apresentava obliteração completa da sutura coronaria e dos dois terços anteriores da sutura sagital; no menino a sutura sagital era a única afetada. O estudo genético mostrou que a craniostenose independe de aberrações cromossômicas, indicando ser transmitida por gens recessivos raros de natureza autossômica.

  10. Enfermeiros e clientela com bulimia e anorexia: estudo de caso

    Claudia Regina Carvalho Martins; Paulo Vaccari Caccavo

    2012-01-01

    Investigação que objetivou identificar a interação de enfermeiros e clientes portadores de bulimia e anorexia. Utilizamos o estudo de caso como recurso, para o qual coletamos dados de prontuários e fizemos entrevistas com oito de quatorze enfermeiros, que foram nossos sujeitos-objeto. De acordo com os enfermeiros, os clientes se isolavam do mundo, vivendo num mundo sem fome e de espelhos que refletiam um corpo sempre acima do "peso ideal"; eram pessoas solitárias, que perderam o brilho pessoa...

  11. Estudos em desenvolvimento motor da criança VIII

    Lopes, Vítor P.; Gonçalves, Celina

    2015-01-01

    O desenvolvimento motor infantil é sem dúvida alguma, uma das áreas de estudo que mais tem intrigado os investigadores em ciências do desenvolvimento humano. Os fatores genéticos associados a fatores ambientais têm vindo a criar desafios interessantes em compreender a complexidade do processo de evolução motora ao longo da vida e em particular nas primeiras idades. Temos vindo a assistir a grandes transformações sociais que provocaram grandes alterações dos estilos de vida das ...

  12. COMPORTAMENTO DE CONSUMO ECOLOGICAMENTE CONSCIENTE: ESTUDO COMPARATIVO BRASIL X CHINA

    Tatiana Azevedo Yeh; Jailer Aguiar Lage

    2015-01-01

    Esse estudo buscou identificar os fatores que afetam o comportamento de consumo ecologicamente consciente (CCEC). Foram utilizadas duas amostras, uma com chineses e outra com brasileiros. Para análise dos dados utilizou-se técnica estatística descritiva, Teste t e regressão linear multivariada. Demonstrou-se, nas duas amostras, dois construtos comumente significativos para o CCEC: o próprio comportamento verde em si para realização de outros CCEC e os moderadores externos. Identificou-se que ...

  13. TENDÊNCIAS DOS ESTUDOS COM PLANTAS MEDICINAIS NO BRASIL

    Fernanda Melo Carneiro; Maria José Pereira da Silva; Leonardo Luiz Borges; Lorena Carneiro Albernaz,; Joana Darc Pereira Costa

    2014-01-01

    As plantas medicinais são utilizadas pelo homem desde o início da história e atualmente empregadas como recursos na medicina alternativa por grande parte da população mundial. Esse uso deve-se à facilidade de acesso às plantas em relação aos medicamentos alopáticos. O objetivo deste trabalho foi, primariamente, desenvolver uma análise cienciométrica sobre as tendências dos estudos com plantas medicinais no Brasil, investigando se o número de trabalhos cresceu ao longo dos anos. Além disso, f...

  14. Estudo para uma mobilidade flutuante na Ria de Aveiro

    Gaspar, Licínia

    2012-01-01

    O presente estudo desenvolve uma estratégia orientada à criação de um novo sistema de mobilidade fluvial que promove a Ria de Aveiro, no sentido de ampliar a mobilidade na Ria, bem como reafirmar a natureza desse território, proporcionando o conhecimento de uma vasta área lagunar. Numa análise à mobilidade fluvial em Aveiro, que foi suporte para o crescimento e desenvolvimento da cidade, constatou-se a ausência de uma mobilidade diversificada assente na oferta de um serviço ...

  15. Compatibilização de blendas de poliamida 6/ABS usando os copolímeros acrílicos reativos MMA-GMA e MMA-MA. Parte 1: Comportamento reológico e propriedades mecânicas das blendas Compatibilization of polyamide 6/ABS blends using MMA-GMA and MMA-MA reactive acrylic copolymers. Part 1. Rheological and mechanical properties of blends

    Edcleide M. Araújo

    2003-07-01

    Full Text Available A poliamida 6 (PA6 é um polímero semicristalino de grande aplicação na engenharia e que apresenta instabilidade no processamento e baixa resistência ao impacto sob entalhe. A incorporação do ABS (acrilonitrila-butadieno-estireno como modificador de impacto da PA6, pode melhorar estas propriedades. Entretanto, como esta mistura é imiscível e incompatível, torna-se necessária a incorporação de um terceiro componente que promova a interação destas duas fases imiscíveis. Este estudo analisa a influência dos copolímeros MMA-GMA (metacrilato de metila-metacrilato de glicidila e MMA-MA (metacrilato de metila-anidrido maléico como compatibilizantes de blendas PA6/ABS. Estes copolímeros apresentam miscibilidade com a fase SAN do ABS, devido à presença do PMMA, e têm também os grupos funcionais éster e anidrido capazes de reagir com os grupos terminais, presentes na PA6. As blendas PA6/ABS/MMA-MA apresentaram excelente desempenho sob impacto, permanecendo dúcteis em temperaturas subambiente e super-tenazes na temperatura ambiente.Polyamide 6 (PA6 is a semicrystalline polymer suitable to be used in engineering applications with a number of advantages, but its processing instability and relatively low impact strength are limiting aspects. The addition of acrylonitrile-butadiene-styrene (ABS as an impact modifier to PA6 can improve these properties. However, this blend is immiscible and incompatible, hence the use of an adhesion promoter is necessary to improve the interfacial interaction between the phases. This study focuses on the influence of poly(methyl methacrylate-co-glycidyl methacrylate (MMA-GMA and poly(methyl methacrylate-co-maleic anhydride (MMA-MA copolymers as compatibilizers for PA6/ABS blends. These copolymers are miscible with SAN phase of ABS due to the presence of PMMA and they have also the esther and anhydride functional groups capable of reacting with polyamide end groups. PA6/ABS/MMA-MA blends showed an

  16. A ProActive Backend for ABS: from Modelling to Deployment

    Rochas, Justine; Henrio, Ludovic

    2014-01-01

    ABS is an object-oriented modeling language that is based on a concurrent object group model, derived itself from the active object model. Its goal is to describe distributed and concurrent applications in order to verify their properties and make them safer. Thanks to the ABS Tool Suite, ABS programs can be translated into the Java programming language (among others), and executed in the JVM. This paper presents a new ABS backend that translates ABS programs into ProActive programs. ProActiv...

  17. Towards hydrogen metallization: an Ab initio approach; Vers la metallisation de l`hydrogene: approche AB initio

    Bernard, St

    1998-12-31

    The quest for metallic hydrogen is a major goal for both theoretical and experimental condensed matter physics. Hydrogen and deuterium have been compressed up to 200 GPa in diamond anvil cells, without any clear evidence for a metallic behaviour. Loubeyere has recently suggested that hydrogen could metallize, at pressures within experimental range, in a new Van der Waals compound: Ar(H{sub 2}){sub 2} which is characterized at ambient pressure by an open and anisotropic sublattice of hydrogen molecules, stabilized by an argon skeleton. This thesis deals with a detailed ab initio investigation, by Car-Parrinello molecular dynamics methods, of the evolution under pressure of this compound. In a last chapter, we go to much higher pressures and temperatures, in order to compare orbital and orbital free ab initio methods for the dense hydrogen plasma. (author) 109 refs.

  18. Paleoparasitologia. Estudo de parásitos em material arqueologico

    Adauto de Araújo

    2005-12-01

    Full Text Available Os primeiros estudos sobre parasitos em material arqueológico datam do início do século XX, feitos por Sir. Marc Armand Ruffer, médico e microbiologista de origem francesa a serviço em um hospital do Cairo. Nas horas vagas, dedicou-se ao estudo de lesões patológicas em múmias egípcias, assim, pode descrever diversas doenças, entre elas a esquistossomíase hematóbica, pela evidência de ovos de Schistosoma haematobium em cortes histológicos de tecido renal de múmias datadas de até 5.200 anos. Coube a Ruffer a introdução da técnica de reidratação de tecidos mumificados, capaz de permitir o uso de exames histopatológicos, usada até a atualidade.

  19. Marketing, Propaganda e Publicidade - um estudo dos termos no Brasil

    Miguel Arantes Normanha Filho

    2007-12-01

    Full Text Available Este estudo contribui para a verificação empírica das diversas interpretações e aplicabilidades dadas aos pares de termos marketing e propaganda, propaganda e publicidade, em especial pela forma e uso como se fossem sinônimos, num contexto de negócios que pode acarretar prejuízos às empresas. O estudo parte da observação de que utilizar marketing e propaganda como sinônimos não é uma questão semântica, mas conceitual, em que a aplicação de uma ferramenta [propaganda] específica, em detrimento de uma filosofia do negócio [marketing], leva empresários [decisores] a equívocos estratégicos, que influenciam e comprometem o capital de giro e, conseqüentemente, a saúde econômico-financeira da empresa.

  20. Responsabilidade Social Corporativa: estudo comparativo das normas socioambientais

    Francisco Roberto Pinto

    2007-05-01

    Full Text Available A utilização de normas socioambientais visa dar maior credibilidade às práticas de Responsabilidade Social Corporativa (RSC. Neste estudo, levantaram-se os seguintes questionamentos: Quais as características das normas socioambientais existentes quanto à avaliação do processo produtivo, das relações com a comunidade, das relações com os empregados e dependentes? Quais os aspectos convergentes e divergentes dessas características no tocante à integração dos sistemas de gestão da RSC propugnados nas normas socioambientais? Trata-se de um estudo exploratório, com abordagem qualitativa, em que se realizou pesquisa bibliográfica e documental, e análise comparativa do conteúdo dos documentos pesquisados. As normas estudadas foram SA 8000, AA 1000, ISO 14001, NBR 16001 e ISO 26000, esta ainda em fase de elaboração. Concluiu-se que as normas apresentam semelhanças quanto ao processo produtivo, relação com a comunidade e integração dos sistemas de gestão, sendo recomendável a aplicação complementar das mesmas.

  1. Perspectivas psicossociais para o estudo do cotidiano de trabalho

    Fábio de Oliveira

    2014-04-01

    Full Text Available Este estudo teve por objetivo analisar o debate e o aprofundamento teórico e metodológico desenvolvido nos estudos sobre a vida cotidiana no trabalho. A investigação partiu do diálogo interdisciplinar entre a antropologia do trabalho, a ergologia e a psicologia social do trabalho e sistematizou as contribuições mútuas entre esses campos científicos, suas aproximações e seus afastamentos da tematização e da apropriação da atividade humana no trabalho sob a perspectiva do cotidiano. A análise comparativa destacou eixos que diferenciam as formas de aproximação ao objeto, que se referem às relações estabelecidas entre saberes práticos e técnico-científicos e aos modos de intervenção sobre as situações de trabalho. As abordagens comparativas compartilham o interesse em conhecer o trabalho real, o valor conferido aos conhecimentos dos trabalhadores e a sensibilidade às dimensões micropolíticas do cotidiano. Conclui-se que a localização em cada um desses eixos depende da maior ou menor filiação às tradições da antropologia ou da ergonomia.

  2. 40 CFR 174.506 - Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of...

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. 174.506 Section 174.506 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED...

  3. GQ Lup Ab Visible & Near-Infrared Photometric Analysis

    Marois, C; Macintosh, B; Barman, T

    2006-08-07

    We have re-analyzed archival HST R and I band images and Subaru CH{sub 4}, H, Ks and L{prime} data of the recently discovered planetary mass companion (PMC) GQ Lup Ab. With these we produce the first R and I band photometry of the companion and fit a radius and effective temperature using detailed model atmospheres. We find an effective temperature of 2338 {+-} 100K, and a radius of 0.37 {+-} 0.05R{sub {circle_dot}} and luminosity of log(L/L{sub {circle_dot}}) = -2.43 {+-} 0.07 (at 140pc). Since we fit wavelengths that span most of the emitted radiation from GQ Lup this luminosity estimate is robust, with uncertainty dominated by the distance uncertainty. The radius obtained for 140pc (0.37R{sub {circle_dot}}) is significantly larger than the one originally derived. The mass of the object is much more model-dependent than the radiative properties, but for the GAIA dusty models we find a mass between 9-20 M{sub Jup}, in the range of the brown dwarf and PMC deuterium burning boundary. Assuming a distance of 140pc, observations fit to 1{sigma} the Baraffe evolution model for a {approx} 15 M{sub Jup} brown dwarf. Additionally, the F606W photometric band is significantly overluminous compared to model predictions. Such overluminosity could be explained by a bright H{alpha} emission from chromospheric activity, interaction with another undetected companion, or accretion. Assuming that GQ Lup Ab has a bright H{alpha} emission line, its H{alpha} emission strength is 10{sup -1.71 {+-} 0.10} L{sub bol}, significantly larger than field late-type dwarfs. GQ Lup Ab might be strongly accreting and still be in its formation phase.

  4. Ab-initio study of napthelene based conducting polymer

    Ruhela, Ankur [Advanced Materials Research Group, Computational Nanoscience and Technology Lab (CNTL), ABV-Indian Institute of Information Technology and Management, Gwalior -474010, India and Amity Institute of Nanotechnology, Amity University, Noida-201303 (India); Kanchan, Reena, E-mail: reena.kanchan1977@gmail.com [Department of Chemistry, Jiwaji University, Gwalior-474001 (India); Srivastava, Anurag [Advanced Materials Research Group, Computational Nanoscience and Technology Lab (CNTL), ABV-Indian Institute of Information Technology and Management, Gwalior -474010 (India); Sinha, O. P. [Amity Institute of Nanotechnology, Amity University, Noida-201303 (India)

    2014-04-24

    In this paper, we have identified structural and electronic properties of conducting polymers by using DFT based ATK-VNL ab-initio tool. Naphthalene derivative structures were stabilized by varying the bond length between two atoms of the molecule C-N and C-C. We have also studied the molecular energy spectrum of naphthalene derivatives and found the HOMOLUMO for the same. A comparison of structural and electronic properties of naphthalene derivatives by attaching the functional group of amine, have been performed and found that they show good semi conducting properties.

  5. Ab-initio study of napthelene based conducting polymer

    In this paper, we have identified structural and electronic properties of conducting polymers by using DFT based ATK-VNL ab-initio tool. Naphthalene derivative structures were stabilized by varying the bond length between two atoms of the molecule C-N and C-C. We have also studied the molecular energy spectrum of naphthalene derivatives and found the HOMOLUMO for the same. A comparison of structural and electronic properties of naphthalene derivatives by attaching the functional group of amine, have been performed and found that they show good semi conducting properties

  6. Equations of state of heavy metals: ab initio approaches

    The determination of equations of states of heavy metals through ab initio calculation, i.e. without any adjustable parameter, allows to access to pressure and temperature thermodynamic conditions sometimes inaccessible to experiment. To perform such calculations, density functional theory (DFT) is a good starting point: when electronic densities are homogeneous enough, the local density approximation (LDA) remarkably accounts for thermodynamic properties of heavy metals, such as tantalum, or the light actinides, as well for static properties - equilibrium volume, elastic constants - as for dynamical quantities like phonon spectra. For heavier elements, like neptunium or plutonium, relativistic effects and strong electronic interactions must be taken into account, which requires more sophisticated theoretical approaches. (authors)

  7. Ab initio study of neutron drops with chiral Hamiltonians

    H.D. Potter

    2014-12-01

    Full Text Available We report ab initio calculations for neutron drops in a 10 MeV external harmonic-oscillator trap using chiral nucleon–nucleon plus three-nucleon interactions. We present total binding energies, internal energies, radii and odd–even energy differences for neutron numbers N=2–18 using the no-core shell model with and without importance truncation. Furthermore, we present total binding energies for N=8,16,20,28,40,50 obtained in a coupled-cluster approach. Comparisons with quantum Monte Carlo results, where available, using Argonne v8′ with three-nucleon interactions reveal important dependences on the chosen Hamiltonian.

  8. Tailoring magnetoresistance at the atomic level: An ab initio study

    Tao, Kun

    2012-01-05

    The possibility of manipulating the tunneling magnetoresistance (TMR) of antiferromagnetic nanostructures is predicted in the framework of ab initio calculations. By the example of a junction composed of an antiferromagnetic dimer and a spin-polarized scanning tunneling microscopy tip we show that the TMR can be tuned and even reversed in sign by lateral and vertical movements of the tip. Moreover, our finite-bias calculations demonstrate that the magnitude and the sign of the TMR can also be tuned by an external voltage. © 2012 American Physical Society.

  9. Ab initio calculation of tensile strength in iron

    Friák, Martin; Šob, Mojmír; Vitek, V.

    2003-01-01

    Roč. 83, 31-34 (2003), s. 3529-3537. ISSN 1478-6435. [Multiscale Materials Modelling: Working Theory for Industry /1./. London, 17.06.2002-20.06.2002] R&D Projects: GA AV ČR IAA1041302; GA ČR GA202/03/1351; GA MŠk OC 523.90 Institutional research plan: CEZ:AV0Z2041904 Keywords : ab initio calculations * electronic structure * theoretical tensile strength Subject RIV: BM - Solid Matter Physics ; Magnetism

  10. Arbetsprocess för materialanskaffning vid Forsmarks Kraftgrupp AB

    Westbom, Johan

    2013-01-01

    This thesis has been made on behalf of Forsmarks Kraftgrupp AB and is the final part of the education of Bachelor of Engineering in – Innovation, production and logistics atMälardalens Högskola.Forsmark nuclear power plant is located in Östhammars municipality at the coast of Uppland. The three nuclear reactors in Forsmark together produces approximately one-sixth of Sweden’s electricity consumption each year.The background of this study is that a large number of requests come to the purchasi...

  11. Escolha de formas de barragens abóbada

    Meliço, José Alberto Garcia

    2010-01-01

    Sendo Portugal um dos países europeus com maior potencial hidroeléctrico por explorar, e atendendo à sua dependência energética do exterior, o governo lançou, em 2007, um programa visando o aproveitamento racional dos recursos hídricos disponíveis. Está-se, em 2010, na fase de projecto de um conjunto de barragens abóbada integradas nesses aproveitamentos. Existindo uma vasta experiência da engenharia portuguesa neste tipo de estruturas, de que são exemplo o projecto e a construção de ob...

  12. Ab initio study of neutron drops with chiral Hamiltonians

    We report ab initio calculations for neutron drops in a 10 MeV external harmonic-oscillator trap using chiral nucleon–nucleon plus three-nucleon interactions. We present total binding energies, internal energies, radii and odd–even energy differences for neutron numbers N=2–18 using the no-core shell model with and without importance truncation. Furthermore, we present total binding energies for N=8,16,20,28,40,50 obtained in a coupled-cluster approach. Comparisons with quantum Monte Carlo results, where available, using Argonne v8′ with three-nucleon interactions reveal important dependences on the chosen Hamiltonian

  13. Ab initio vibrational and dielectric properties of Y V O

    Vali, R.

    2009-10-01

    For the yttrium orthovanadate Y V O with a tetragonal zircon-type structure, the first complete set of Raman-active and IR-active phonon modes has been calculated using ab initio density functional perturbation theory. The calculated IR reflectivity spectra are in good agreement with available experimental data. We report the calculated frequencies of three Raman-active modes that could not be detected experimentally and a new assignment of the experimental Raman data. The contributions of each IR-active phonon modes to static dielectric tensor have been determined.

  14. Ab initio and kinetic modeling studies of formic acid oxidation

    Marshall, Paul; Glarborg, Peter

    2015-01-01

    A detailed chemical kinetic model for oxidation of formic acid (HOCHO) in flames has been developed, based on theoretical work and data from literature. Ab initio calculations were used to obtain rate coefficients for reactions of HOCHO with H, O, and HO2. Modeling predictions with the mechanism...... on calculations with the kinetic model. Formic acid is consumed mainly by reaction with OH, yielding OCHO, which dissociates rapidly to CO2 + H, and HOCO, which may dissociate to CO + OH or CO2 + H, or react with H, OH, or O2 to form more stable products. The branching fraction of the HOCHO + OH...

  15. Accelerating Ab Initio Nuclear Physics Calculations with GPUs

    Potter, Hugh; Maris, Pieter; Sosonkina, Masha; Vary, James; Binder, Sven; Calci, Angelo; Langhammer, Joachim; Roth, Robert; Çatalyürek, Ümit; Saule, Erik

    2014-01-01

    This paper describes some applications of GPU acceleration in ab initio nuclear structure calculations. Specifically, we discuss GPU acceleration of the software package MFDn, a parallel nuclear structure eigensolver. We modify the matrix construction stage to run partly on the GPU. On the Titan supercomputer at the Oak Ridge Leadership Computing Facility, this produces a speedup of approximately 2.2x - 2.7x for the matrix construction stage and 1.2x - 1.4x for the entire run.

  16. Ab initio structure determination via powder X-ray diffraction

    Digamber G Porob; T N Guru Row

    2001-10-01

    Structure determination by powder X-ray diffraction data has gone through a recent surge since it has become important to get to the structural information of materials which do not yield good quality single crystals. Although the method of structure completion when once the starting model is provided is facile through the Rietveld refinement technique, the structure solution ab initio os still not push-button technology. In this article a survey of the recent development in this area is provided with an illustration of the structure determination of -NaBi3V2O10.

  17. Recensão de "Cadernos de estudos latino-americanos nº4"

    Cardoso, João Casqueira

    2010-01-01

    Recensão - TOSCANO, Ana María da Costa, org. - Cadernos de estudos latino-americanos : publicação do CELA, Centro de Estudos Latino-Americanos. Porto: Edições Universidade Fernando Pessoa, 2008. p. 134. ISSN 1646-5164

  18. Pharmacokinetics of radioimmunotherapeutic agent of direct labeling mAb 188Re-HAb18

    Chao Lou; Zhi-Nan Chen; Hui-Jie Bian; Jie Li; Shou-Bo Zhou

    2002-01-01

    AIM: To labed Anti-hepatoma monoclonal antibody (mAb)fragment HAb18 F (ab')2 was labeled with 188 Re for thepharmacokinetic model of 188 Re-HAb18 F (ab')2 and toevaluate its pharmacokinetic parameters in hepatoma-bearing nude mice.METHODS: HAb18 F(ab')2 was directly labeled with 188Reusing 2-mercaptoethanol (2-ME) as reducing agents.Labeling efficiency and immunoreactivity of 188 Re-HAb18 F( ab')2 were evaluated by Whatman 3MM paperchromatography and live cell assay, respectively.Biodiatribution analysis was also conducted in nude micebearing human hepatoma in which animals were sacrificed atdifferent time points(1, 4, 18, 24 and 24h) after 188Re-HAb18F(ab' )2 was injected through tail-vein into hepatoma-bearingnude mice. The blood and radioactivity of organs and masswere measured. The concentrations of 188 Re-HAb18 F(ab')2were evaluated with a pharmacokinetic 3P97 software.RESULTS: The optimum labeling efficiency andimmunoreactive fraction were 91.7% and 0.78%,respectively. The parameters of 188Re-HAb18 F(ab')2 were:T1/2, 2.29h; Vd, 1.49 × 10-9L@ Bq- 1; AUC, 20.49 × 109Bq@ h@L-1 ;CL, 0.45 × 10-3L@ h- 1. 188Re- HAb18 F(ab')2 could locatespecially in hepatoma with high selective reactivity of HAb18F(ab')2. 188 Re-HAb18 F(ab')2 was mainly eliminated bykidney. The maximal tumor to blood ratio was at 48h, andmaximal tumor to liver ratio was at 18h.CONCLUTION: The pharmacokinetics of 188Re-HAb18 F(ab')2fit a I-compartment model. 188 Re-HAb18 F(ab')2 can beuptaken selectively at the hepatoma site.

  19. Otomycosis: a retrospective study Otomicoses: um estudo retrospectivo

    Zélia Braz Vieira da Silva Pontes

    2009-06-01

    Full Text Available Otomycosis is a fungal infection of the external ear canal with only a few studies about its real frequence in Brazil. AIM: to evaluate otomycosis frequence and characteristics in patients with clinical suspicion of external otitis. STUDY DESIGN: Retrospective study with transversal cohort (2000-2006. MATERIALS AND METHODS:103 patients were assigned to mycological diagnosis (direct microscopic examination and culture. RESULTS: Otomycosis was diagnosed in 19.4% of the patients. Patient age varied from 2 to 66 years (an average of 23.5 years of age, and 60% of otomycosis cases were seen in women between 2 to 20 years of age. Chronic otitis, previous antibiotic therapy and the lack of cerumen were predisposing factors; itching, otalgia, otorrhea and hypoacusis were the symptoms reported by the patients. The most frequently isolated species were C. albicans (30%, C. parapsilosis (20%, A. niger (20%, A. flavus (10%, A. fumigatus (5%, C. tropicalis (5%, Trichosporon asahii (5% and Scedosporium apiospermum (5%. CONCLUSIONS: Otomycosis is endemic in João Pessoa-PB. Clinical exam and mycological studies are important for diagnostic purposes because otomycosis symptoms are not specific.Otomicose é uma infecção fúngica do conduto auditivo externo com poucos estudos sobre sua real frequência no Brasil. OBJETIVO: Avaliar a frequência e características das otomicoses em pacientes com suspeita clínica de otite externa. DESENHO DO ESTUDO: Estudo retrospectivo com corte transversal (2000-2006. MATERIAL E MÉTODOS: 103 pacientes foram atendidos para diagnóstico micológico (exame microscópico direto e cultivo. RESULTADOS: Otomicoses foram diagnosticadas em 19,4% dos pacientes. A idade desses pacientes variou de 2 a 66 anos (média de 23,5 anos e 60% das otomicoses foram observadas em mulheres entre 2 a 20 anos de idade. Otite crônica, antibioticoterapia prévia e ausência de cerume foram os fatores predisponentes e prurido otológico, otalgia

  20. Estudos sobre a toxicologia da ε-caprolactama

    Marcus Vinicius Justo Bomfim

    2009-03-01

    Full Text Available A ε-caprolactama (CAP é um monômero precursor de polímeros denominados nylon 6. Esses polímeros destinam-se à produção de tapetes, vestuário e materiais plásticos tais como equipamentos, sistemas e componentes automotivos, conectores, além de embalagens plásticas. Resíduos de CAP podem migrar de embalagens plásticas de nylon 6 para os alimentos. Diante disso, foi de interesse realizar uma revisão dos efeitos relativos à exposição à CAP e o seu impacto sobre a saúde humana. Estudos epidemiológicos indicam a possibilidade da CAP causar inflamações oculares e cutâneas, além de irritações no sistema respiratório. Pode ocorrer ainda hipotensão, taquicardia, palpitações, rinorréia, ressecamento nasal, efeitos geniturinários e sobre a reprodução como distúrbios nas funções menstrual e ovariana, e complicações no parto; além de problemas neurológicos e hematológicos. Estudos com animais são consistentes com tais relatos. Os estudos de genotoxicidade in vitro e in vivo por via oral e intraperitoneal mostram em sua grande maioria, resultados negativos, bem como ausência de efeitos carcinogênicos em ratos e camundongos e sobre o desenvolvimento e reprodução em ratos e coelhos.ε -Caprolactam (CAP is a precursor monomer of nylon 6 polymers. Nylon 6 is used in the manufacture of carpets, clothes and plastic materials, such as equipment, systems and automotive components, connectors and plastic packaging. CAP residues can migrate from nylon 6 plastic packaging to foods. Given this fact, this review was realized concerning the effects of CAP exposure and its impact on human health. Epidemiological studies indicate that CAP could cause ocular, cutaneous and respiratory irritations, as well as hypotension, tachycardia, palpitations, rhinorrhea, nose dryness, neurological and blood problems, and genitourinary and reproductive effects, such as alterations in ovarian-menstrual functions and pregnancy

  1. um estudo de caso no concelho de Ponta Delgada

    Dias, Débora Pacheco de Medeiros

    2014-01-01

    Dissertação apresentada à Universidade Fernando Pessoa como parte dos requisitos para obtenção do grau de Mestre em Ciências da Educação: Educação Especial, área de especialização em Domínio Cognitivo e Motor O estudo em presença centra-se na problemática das atitudes dos docentes do ensino pré-escolar e do 1º ciclo perante os comportamentos agressivos manifestados pelos seus alunos em contexto de sala de aula. Neste trabalho procede-se à descrição, avaliação e comparação das teor...

  2. Estudo das características antiincrustantes de materiais

    Estael Araújo de Faria; José Roberto Tavares Branco; Mônica de Cássia Souza Campos; Márcia Divina Oliveira; Maria Edith Rolla

    2006-01-01

    O mexilhão dourado ou Limnoperna fortunei é um organismo invasor que tem causado grandes prejuízos a sistemas de captação de água e usinas hidroelétricas, sendo que, mais recentemente, vem causando danos ao deslocamento de embarcações fluviais em águas do Pantanal Mato-Grossense. No presente trabalho, foi feito um estudo, em laboratório e em campo, de materiais antiincrustantes. A relação entre a força de desligamento do mexilhão dourado e a energia livre de superfície foi avaliada. Foram sel...

  3. Raiva humana: estudo neuropatológico de trinta casos

    R. V. C. Assis; S. Rosemberg

    1984-01-01

    O estudo epidemiológico e neuropatológico concernente a trinta autópsias de encefalite rábica foi realizado, tendo sido os dados obtidos comparados com aqueles da literatura. Não houve relação estatística entre a topografia lesional e o local da mordida, entre o período de incubação ou a duração da doença e a presença ou ausência de inclusões virais (IV) assim como entre a intensidade do processo inflamatorio (PI) e a presença de IV. A dispersão do PI e das IV através o SNC foi diretamente pr...

  4. Retorno à obra. Dois arquitectos, dois casos de estudo.

    Andreia Liliana Barbosa Teixeira

    2013-01-01

    A presente dissertação pretende abordar a problemática da revisitação do autor à sua obra, propondo para tal, a análise, reflexão e estudo de conceitos de temas-chave como Tempo e Autoria como pontos estruturais do discurso.Propõe-se compreender, tendo como base o episódio que envolve Le Corbusier e recuperação da Villa Savoye e através de uma análise do percurso de dois autores - Álvaro Siza Vieira e Eduardo Souto de Moura - e de duas obras específicas Conjunto Habitacional da Bouça, Porto,...

  5. Pubalgia num atleta de futebol: estudo de caso

    Sousa, Pedro

    2010-01-01

    Introdução: No fu tebol os atletas são submetidos a um grande número de treinos e jogos, não havendo muitas vezes tempo necessário para o repouso ou alongamentos, estes factores predispõem o aparecimento de lesões incapacitantes como a pubalgia. O fisioterapeuta deverá realizar uma correcta avaliação e interpretação dos sintomas e das alterações posturais e biomecânicas do paciente com pubalgia. Objectivo: Através deste estudo de caso pretende-se descrever a avaliação e inte...

  6. Abordagens psicológicas no estudo do trabalho

    Marques, Carlos Alberto Alves

    1989-01-01

    O artigo apresenta duas categorias psicológicas do estudo do trabalho, técnica e metodologicamente distintas mas complementares na intervenção organizacional: a perspectiva ergonómica e a da representação das características das tarefas. Em relação a primeira, para além da sua apresentação, o autor discute níveis de intervenção ergonómica, destacando as áreas de acção da psicologia cognitiva e da Ergonomia dos Sistemas, borderline da psicologia das organizações. Em ...

  7. COMPORTAMENTO DE CONSUMO ECOLOGICAMENTE CONSCIENTE: ESTUDO COMPARATIVO BRASIL X CHINA

    Tatiana Azevedo Yeh

    2015-12-01

    Full Text Available Esse estudo buscou identificar os fatores que afetam o comportamento de consumo ecologicamente consciente (CCEC. Foram utilizadas duas amostras, uma com chineses e outra com brasileiros. Para análise dos dados utilizou-se técnica estatística descritiva, Teste t e regressão linear multivariada. Demonstrou-se, nas duas amostras, dois construtos comumente significativos para o CCEC: o próprio comportamento verde em si para realização de outros CCEC e os moderadores externos. Identificou-se que a baixa disponibilidade de produtos verdes entre os brasileiros é barreira à ser considerada para o fomento do CCEC no Brasil, que encontra-se na primeira fase de comportamento verde que é a compra. E que os chineses realizam todos os tipos de comportamento: compra, uso e reciclagem.

  8. estudo comparativo entre escolas públicas e privadas

    Vieira, Fernanda Maria Mesquita

    2012-01-01

    Este estudo tem como objetivo averiguar se existe satisfação profissional e sócio-organizacional entre membros de Direções de Escolas do Básico e do Secundário, do ensino público e privado, nomeadamente porque a investigação, nos domínios da gestão e da psicologia do trabalho e das organizações, preconiza que a satisfação profissional e a sócio-organizacional, direta ou indiretamente, se encontram ligadas à produtividade e à realização pessoal, aspetos estes que não são alheios às atuais polí...

  9. Coerência textual: um estudo com jovens e adultos

    Gonçalves Fabíola

    2003-01-01

    Full Text Available A coerência é um fenômeno lingüístico responsável pela construção de sentido que garante a interpretabilidade de um texto. As investigações conduzidas pela psicologia cognitiva têm investido esforços no exame da coerência a partir da perspectiva daqueles que recebem o texto. Este estudo examinou se o estabelecimento da coerência textual está relacionado à aquisição da leitura e da escrita com jovens e adultos, em processo de alfabetização, em uma situação de produção de texto. Alunos entre 15 a 45 anos, matriculados no 1º e 2º ciclos da Educação Básica de Jovens e Adultos de uma escola pública, foram individualmente solicitados a produzir oralmente uma história original. As histórias foram analisadas em função de indicadores específicos, agrupados em um sistema de análise, o qual expressa níveis distintos acerca do estabelecimento da coerência. Comparações entre os ciclos foram realizadas. Os resultados obtidos corroboram estudo realizado com crianças. Há indicadores mais fáceis de serem estabelecidos do que outros. Pode-se argumentar que a escolaridade contribui para o estabelecimento da coerência na produção de história.

  10. Estudo sobre reciclagem de lâmpadas fluorescentes

    Danniele Miranda Bacila

    2014-01-01

    Full Text Available Lâmpadas fluorescentes (LF contêm mercúrio em sua composição, um metal pesado que pode causar danos à saúde e ao meio ambiente. As LF são amplamente consumidas no Brasil, porém o descarte correto de LF usadas não é amplamente divulgado e os índices de reciclagem são baixos. O objetivo deste estudo foi demonstrar a relevância do descarte adequado, avaliar as tecnologias de reciclagem e a destinação dos materiais, por meio de estudo comparativo entre Brasil e Alemanha. Através de visitas a recicladoras e análise das tecnologias adotadas nos dois países, foi verificado que no Brasil o vidro é destinado à indústria de cerâmica, enquanto que na Alemanha é destinado à fabricação de tubos para LF. Além disso, foi observado que o mercúrio apresenta diversas possibilidades de uso. Um ponto a ser explorado nos dois países, e de grande potencial para reciclagem, é a recuperação de terras raras do pó fosfórico presente nas LF. Tanto Brasil como Alemanha possuem oportunidades de melhoria na logística reversa de LF, por meio da qual se torna possível elevar os índices de reciclagem e reduzir os impactos ambientais causados pelo descarte inadequado de LF usadas.

  11. Estudos cronotópicos em narrativas audiovisuais

    Egle Müller Spinelli

    2008-11-01

    Full Text Available O presente trabalho pretende aplicar o conceito de cronotopia de Bakhtin à análise de narrativas audiovisuais. Para tanto, será discutido o conceito de cronotopo bakhtiniano e sua relação com os estudos de Saussure, com o intuito de mostrar como os elementos cronotópicos podem estar ligados a contextos que vão além do enunciado, remetendo a mecanismos da enunciação. No estudo são analisados filmes que apresentam determinadas características semelhantes às dos principais tipos de cronotopia estabelecidos por Bakhtin: a da aventura, a do cotidiano e a autobiográfica, respectivamente correspondentes aos filmes Corra Lola, Corra (Tom Tykwer, 1998, Boca de Ouro (Nelson Pereira dos Santos, 1962 e Rashomon (Akira Kurosawa, 1950. Palavras-chave: cronotopia; enunciação; cinema; Bakhtin Abstract Chronotopic studies in audiovisual narratives - This paper proposes to apply Bakhtin's concept of chronotopia in an analysis of audiovisual discourse. To this end, it discusses the Bakhtin's postulation of the chronotope and its relation with the studies of Saussure in order to show how chronotopic elements may be connected to contexts that go beyond simple statements, suggesting mechanisms of enunciation. The films Run Lola, Run (Tom Tykwer, 1998, Boca de Ouro (Nelson Pereira dos Santos, 1962 and Rashomon (Akira Kurosawa, 1950 are used here to illustrate the principal chronotopic types established by Bakhtin, namely, adventure, everyday life and autobiography. Key words: chronotope; enunciation; cinema; Bakhtin

  12. TITRATION METHOD OF AB0 ANTIBODIES WITH THE USE OF MODERN GEL TECHNOLOGY IN AB0-INCOMPATIBLE TRANSPLANTATION

    A. K. Porunova; Morozova, V.V.; I. E. Tsiroulnikova; O. M. Tsiroulnikova; S. V. Gautier

    2014-01-01

    It is shown that developed method of titrating AB0 antibodies allows defi ning the titer of the investigational antibodies more precisely on 1–3 dilution of serum compared to the prototype method (titration method of antibodiesin saline medium on the plane). It is more obvious as it excludes hardly interpretable results due to the possibility of conducting visual assessment of agglutination reaction in the gel card thick column and requires less time foranalysis. The results can be saved for ...

  13. Electrocatalytic reduction of nitrate and selenate by NapAB.

    Gates, Andrew J; Butler, Clive S; Richardson, David J; Butt, Julea N

    2011-01-01

    Bacterial cellular metabolism is renowned for its metabolic diversity and adaptability. However, certain environments present particular challenges. Aerobic metabolism of highly reduced carbon substrates by soil bacteria such as Paracoccus pantotrophus presents one such challenge since it may result in excessive electron delivery to the respiratory redox chain when compared with the availability of terminal oxidant, O2. The level of a periplasmic ubiquinol-dependent nitrate reductase, NAP, is up-regulated in the presence of highly reduced carbon substrates. NAP oxidizes ubiquinol at the periplasmic face of the cytoplasmic membrane and reduces nitrate in the periplasm. Thus its activity counteracts the accumulation of excess reducing equivalents in ubiquinol, thereby maintaining the redox poise of the ubiquinone/ubiquinol pool without contributing to the protonmotive force across the cytoplasmic membrane. Although P. pantotrophus NapAB shows a high level of substrate specificity towards nitrate, the enzyme has also been reported to reduce selenate in spectrophotometric solution assays. This transaction draws on our current knowledge concerning the bacterial respiratory nitrate reductases and extends the application of PFE (protein film electrochemistry) to resolve and quantify the selenate reductase activity of NapAB. PMID:21265780

  14. AB INITIO SIMULATIONS FOR MATERIAL PROPERTIES ALONG THE JUPITER ADIABAT

    We determine basic thermodynamic and transport properties of hydrogen-helium-water mixtures for the extreme conditions along Jupiter's adiabat via ab initio simulations, which are compiled in an accurate and consistent data set. In particular, we calculate the electrical and thermal conductivity, the shear and longitudinal viscosity, and diffusion coefficients of the nuclei. We present results for associated quantities like the magnetic and thermal diffusivity and the kinematic shear viscosity along an adiabat that is taken from a state-of-the-art interior structure model. Furthermore, the heat capacities, the thermal expansion coefficient, the isothermal compressibility, the Grüneisen parameter, and the speed of sound are calculated. We find that the onset of dissociation and ionization of hydrogen at about 0.9 Jupiter radii marks a region where the material properties change drastically. In the deep interior, where the electrons are degenerate, many of the material properties remain relatively constant. Our ab initio data will serve as a robust foundation for applications that require accurate knowledge of the material properties in Jupiter's interior, e.g., models for the dynamo generation.

  15. Ab Initio Thermodynamic Model for Magnesium Carbonates and Hydrates

    Chaka, Anne M.; Felmy, Andrew R.

    2014-03-28

    An ab initio thermodynamic framework for predicting properties of hydrated magnesium carbonate minerals has been developed using density-functional theory linked to macroscopic thermodynamics through the experimental chemical potentials for MgO, water, and CO2. Including semiempirical dispersion via the Grimme method and small corrections to the generalized gradient approximation of Perdew, Burke, and Ernzerhof for the heat of formation yields a model with quantitative agreement for the benchmark minerals brucite, magnesite, nesquehonite, and hydromagnesite. The model shows how small differences in experimental conditions determine whether nesquehonite, hydromagnesite, or magnesite is the result of laboratory synthesis from carbonation of brucite, and what transformations are expected to occur on geological time scales. Because of the reliance on parameter-free first principles methods, the model is reliably extensible to experimental conditions not readily accessible to experiment and to any mineral composition for which the structure is known or can be hypothesized, including structures containing defects, substitutions, or transitional structures during solid state transformations induced by temperature changes or processes such as water, CO2, or O2 diffusion. Demonstrated applications of the ab initio thermodynamic framework include an independent means to evaluate differences in thermodynamic data for lansfordite, predicting the properties of Mg analogs of Ca-based hydrated carbonates monohydrocalcite and ikaite which have not been observed in nature, and an estimation of the thermodynamics of barringtonite from the stoichiometry and a single experimental observation.

  16. Three-cluster dynamics within an ab initio framework

    Quaglioni, S; Navrátil, P

    2013-01-01

    We introduce a fully antisymmetrized treatment of three-cluster dynamics within the ab initio framework of the no-core shell model/resonating-group method (NCSM/RGM). Energy-independent non-local interactions among the three nuclear fragments are obtained from realistic nucleon-nucleon interactions and consistent ab initio many-body wave functions of the clusters. The three-cluster Schr\\"odinger equation is solved with bound-state boundary conditions by means of the hyperspherical-harmonic method on a Lagrange mesh. We discuss the formalism in detail and give algebraic expressions for systems of two single nucleons plus a nucleus. Using a soft similarity-renormalization-group evolved chiral nucleon-nucleon potential, we apply the method to an $^4$He+$n+n$ description of $^6$He and compare the results to experiment and to a six-body diagonalization of the Hamiltonian performed within the harmonic-oscillator expansions of the NCSM. Differences between the two calculations provide a measure of core ($^4$He) pola...

  17. Ab Initio Protein Structure Prediction Using Pathway Models

    Christopher Bystroff

    2006-04-01

    Full Text Available Ab initio prediction is the challenging attempt to predict protein structures based only on sequence information and without using templates. It is often divided into two distinct sub-problems: (a the scoring function that can distinguish native, or native-like structures, from non-native ones; and (b the method of searching the conformational space. Currently, there is no reliable scoring function that can always drive a search to the native fold, and there is no general search method that can guarantee a significant sampling of near-natives. Pathway models combine the scoring function and the search. In this short review, we explore some of the ways pathway models are used in folding, in published works since 2001, and present a new pathway model, HMMSTR-CM, that uses a fragment library and a set of nucleation/propagation-based rules. The new method was used for ab initio predictions as part of CASP5. This work was presented at the Winter School in Bioinformatics, Bologna, Italy, 10–14 February 2003.

  18. Unified ab initio approaches to nuclear structure and reactions

    Navrátil, Petr; Quaglioni, Sofia; Hupin, Guillaume; Romero-Redondo, Carolina; Calci, Angelo

    2016-05-01

    The description of nuclei starting from the constituent nucleons and the realistic interactions among them has been a long-standing goal in nuclear physics. In addition to the complex nature of the nuclear forces, with two-, three- and possibly higher many-nucleon components, one faces the quantum-mechanical many-nucleon problem governed by an interplay between bound and continuum states. In recent years, significant progress has been made in ab initio nuclear structure and reaction calculations based on input from QCD-employing Hamiltonians constructed within chiral effective field theory. After a brief overview of the field, we focus on ab initio many-body approaches—built upon the no-core shell model—that are capable of simultaneously describing both bound and scattering nuclear states, and present results for resonances in light nuclei, reactions important for astrophysics and fusion research. In particular, we review recent calculations of resonances in the 6He halo nucleus, of five- and six-nucleon scattering, and an investigation of the role of chiral three-nucleon interactions in the structure of 9Be. Further, we discuss applications to the 7Be {({{p}},γ )}8{{B}} radiative capture. Finally, we highlight our efforts to describe transfer reactions including the 3H{({{d}},{{n}})}4He fusion.

  19. Unified ab initio approaches to nuclear structure and reactions

    Navratil, Petr; Hupin, Guillaume; Romero-Redondo, Carolina; Calci, Angelo

    2016-01-01

    The description of nuclei starting from the constituent nucleons and the realistic interactions among them has been a long-standing goal in nuclear physics. In addition to the complex nature of the nuclear forces, with two-, three- and possibly higher many-nucleon components, one faces the quantum-mechanical many-nucleon problem governed by an interplay between bound and continuum states. In recent years, significant progress has been made in {\\em ab initio} nuclear structure and reaction calculations based on input from QCD-employing Hamiltonians constructed within chiral effective field theory. After a brief overview of the field, we focus on ab initio many-body approaches - built upon the No-Core Shell Model - that are capable of simultaneously describing both bound and scattering nuclear states, and present results for resonances in light nuclei, reactions important for astrophysics and fusion research. In particular, we review recent calculations of resonances in the $^6$He halo nucleus, of five- and six...

  20. Ab initio dynamics of the cytochrome P450 hydroxylation reaction

    Elenewski, Justin E.; Hackett, John C, E-mail: jchackett@vcu.edu [Department of Physiology and Biophysics and The Massey Cancer Center, School of Medicine, Virginia Commonwealth University, 401 College Street, Richmond, Virginia 23219-1540 (United States)

    2015-02-14

    The iron(IV)-oxo porphyrin π-cation radical known as Compound I is the primary oxidant within the cytochromes P450, allowing these enzymes to affect the substrate hydroxylation. In the course of this reaction, a hydrogen atom is abstracted from the substrate to generate hydroxyiron(IV) porphyrin and a substrate-centered radical. The hydroxy radical then rebounds from the iron to the substrate, yielding the hydroxylated product. While Compound I has succumbed to theoretical and spectroscopic characterization, the associated hydroxyiron species is elusive as a consequence of its very short lifetime, for which there are no quantitative estimates. To ascertain the physical mechanism underlying substrate hydroxylation and probe this timescale, ab initio molecular dynamics simulations and free energy calculations are performed for a model of Compound I catalysis. Semiclassical estimates based on these calculations reveal the hydrogen atom abstraction step to be extremely fast, kinetically comparable to enzymes such as carbonic anhydrase. Using an ensemble of ab initio simulations, the resultant hydroxyiron species is found to have a similarly short lifetime, ranging between 300 fs and 3600 fs, putatively depending on the enzyme active site architecture. The addition of tunneling corrections to these rates suggests a strong contribution from nuclear quantum effects, which should accelerate every step of substrate hydroxylation by an order of magnitude. These observations have strong implications for the detection of individual hydroxylation intermediates during P450 catalysis.

  1. ABS polymer electroless plating through a one-step poly(acrylic acid) covalent grafting.

    Garcia, Alexandre; Berthelot, Thomas; Viel, Pascal; Mesnage, Alice; Jégou, Pascale; Nekelson, Fabien; Roussel, Sébastien; Palacin, Serge

    2010-04-01

    A new, efficient, palladium- and chromium-free process for the electroless plating of acrylonitrile-butadiene-styrene (ABS) polymers has been developed. The process is based on the ion-exchange properties of poly(acrylic acid) (PAA) chemically grafted onto ABS via a simple and one-step method that prevents using classical surface conditioning. Hence, ABS electroless plating can be obtained in three steps, namely: (i) the grafting of PAA onto ABS, (ii) the copper Cu(0) seeding of the ABS surface, and (iii) the nickel or copper metallization using commercial-like electroless plating bath. IR, XPS, and SEM were used to characterize each step of the process, and the Cu loading was quantified by atomic absorption spectroscopy. This process successfully compares with the commercial one based on chromic acid etching and palladium-based seed layer, because the final metallic layer showed excellent adhesion with the ABS substrate. PMID:20361751

  2. Effects of Ethylene/Vinyl Chloride/Vinyl Laurate Redispersible Terpolymer on Pore Structure and Properties of Cement Mortar%E/VC/VL三元共聚物对水泥砂浆孔结构和性能的影响

    张国防; 王培铭

    2013-01-01

    Effects of ethylene/vinyl chloride/vinyl laurate redispersible terpolymer(E/VC/VL) on the pore structure of cement mortar were studied through mercury intrusion porosimeter(MIP) and environmental scanning electron microscopy(ESEM). The relationships between the pore structure and the properties of cement mortar were also discussed. The results show that E/VC/VL remarkably affects the pore structure of cement mortar. E/VC/VL definitely increases the total pore volume, porosity and the average pore radius. E/VC/VL significantly increases the content of large capillary pores of cement mortar, which distribute in the C-S-H gel. With the increase of its use level, the effect of E/VC/VL on the pore structure of cement mortar is enhanced. As the porosity and the total pore volume of cement mortar modified with E/VC/VL increases, the bulk density and the compressive strength of cement mortar decrease, but the water permeation resistance is greatly enhanced.%利用压汞法和环境扫描电子显微镜分析方法,研究了乙烯/氯乙烯/月桂酸乙烯酯(E/VC/VL)三元共聚物对水泥砂浆孔结构的影响规律,并探讨了其与水泥砂浆的体积密度、抗压强度、抗水渗性、吸水量和吸水率等宏观性能的关系.研究表明:E/VC/VL三元共聚物能显著影响水泥砂浆的孔结构,增大水泥砂浆的孔隙率、总孔体积和平均孔半径;导致大毛细孔显著增多,且密布在C-S-H凝胶之间.E/VC/VL三元共聚物掺量越大,对水泥砂浆孔结构的影响越显著.E/VC/VL三元共聚物改性水泥砂浆的孔隙率和孔体积与宏观性能之间存在密切关系:孔隙率和孔体积越大,水泥砂浆的体积密度和抗压强度越小,但其抗水分渗透性能则越好.

  3. Cry1Ab protein from Bacillus thuringiensis and MON810 cry1Ab-transgenic maize exerts no adjuvant effect after airway exposure.

    Andreassen, M; Bøhn, T; Wikmark, O-G; Van den Berg, J; Løvik, M; Traavik, T; Nygaard, U C

    2015-03-01

    The genetically modified (GM) maize event MON810 has been inserted with a processed version of the transgene, cry1Ab, derived from the soil bacterium Bacillus thuringiensis (Bt) to express proteins with insecticidal properties. Such proteins may introduce new allergens and also act as adjuvants that promote allergic responses. While focus has been on safe consumption and hence the oral exposure to GM food and feed, little is known regarding inhalation of pollen and desiccated airborne plant material from GM crops. The aim of this study was to investigate whether plant material from the Cry1Ab-expressing maize variety MON810, or trypsin-activated Cry1Ab (trypCry1Ab) protein produced in recombinant bacteria, may act as adjuvants against the allergen ovalbumin (OVA) in a mouse model of airway allergy. A clear proallergic adjuvant effect of the mucosal adjuvant cholera toxin (CT) was demonstrated, determined as increased specific IgE, eosinophils and Th2 cytokines in MLN cell supernates, while no elevation in OVA-specific antibodies or cytokine release from MLN cells after stimulation with OVA were observed in mice receiving Cry1Ab-containing plant materials or the trypCry1Ab protein. Our data suggest that Cry1Ab proteins had no detectable systemic adjuvant effect in mice after airway exposure. Further experiments with purified plant proteins, as well as long-term exposures needs be conducted to further evaluate exposures experienced in real-life situations. PMID:25564738

  4. Phosphoric acid doped AB-PBI membranes and its applications in high temperature PEMFC

    He, Ronghuan; Qingfeng, Li; Bjerrum, Niels

    2005-01-01

    Poly(2,5-benzimidazole) (ab-PBI) was prepared from 3,4-diaminobenzoic acid via a polymerisation reaction. The obtained polymer exhibits excellent thermal stability in a temperature range ….. The membrane of ab-PBI when doped with phosphoric acid at room temperaturepresents high proton conductivity......C with phosphoric acid doped ab-PBI as the electrolyte under atmospheric pressure at 200°C without humidification....

  5. Living with an imperfect cell wall: compensation of femAB inactivation in Staphylococcus aureus.

    Bierbaum Gabriele; Harris Llinos G; Majcherczyk Paul A; Schäfer Juliane; Kotte Oliver; Jansen Andrea; Hübscher Judith; Heinemann Matthias; Berger-Bächi Brigitte

    2007-01-01

    Abstract Background Synthesis of the Staphylococcus aureus peptidoglycan pentaglycine interpeptide bridge is catalyzed by the nonribosomal peptidyl transferases FemX, FemA and FemB. Inactivation of the femAB operon reduces the interpeptide to a monoglycine, leading to a poorly crosslinked peptidoglycan. femAB mutants show a reduced growth rate and are hypersusceptible to virtually all antibiotics, including methicillin, making FemAB a potential target to restore β-lactam susceptibility in met...

  6. A paternidade na contemporaneidade: um estudo de mídia sob a perspectiva dos Estudos Culturais

    Hennigen Inês; Guareschi Neuza Maria de Fátima

    2002-01-01

    Neste artigo discutimos as possibilidades que a perspectiva dos Estudos Culturais abre para a pesquisa em Psicologia Social e, de forma mais específica, para a temática da paternidade. Questões relativas à construção das identidades e à importância da mídia neste processo são discutidas. A paternidade é aqui concebida como uma construção social que acompanha o caráter flexível das demais posições identitárias. A análise de um comercial de televisão é apresentada e mostra como diferentes aspec...

  7. Performance of the Molecular Alere i Influenza A&B Test Compared to That of the Xpert Flu A/B Assay

    Chapin, Kimberle C.; Flores-Cortez, Estefany J.

    2014-01-01

    Data on the performance of rapid molecular point-of-care use platforms for diagnosis of influenza are lacking. We validated nasopharyngeal (NP) flocked specimens in universal transport medium (UTM) and evaluated the clinical sensitivity and specificity of the Alere i influenza A&B test compared to those of the Xpert flu A/B assay. The Alere i influenza A&B test had an overall sensitivity and specificity of 93.8% and 62.5% for influenza A, respectively, and of 91.8% and 53.6% for influenza B, ...

  8. Comparative Study of Electroless Copper Film on Different Self-Assembled Monolayers Modified ABS Substrate

    Jiushuai Xu

    2014-04-01

    Full Text Available Copper films were grown on (3-Mercaptopropyltrimethoxysilane (MPTMS, (3-Aminopropyltriethoxysilane (APTES and 6-(3-(triethoxysilylpropylamino-1,3,5- triazine-2,4-dithiol monosodium (TES self-assembled monolayers (SAMs modified acrylonitrile-butadiene-styrene (ABS substrate via electroless copper plating. The copper films were examined using scanning electron microscopy (SEM and X-ray diffraction (XRD. Their individual deposition rate and contact angle were also investigated to compare the properties of SAMs and electroless copper films. The results indicated that the formation of copper nuclei on the TES-SAMs modified ABS substrate was faster than those on the MPTMS-SAMs and APTES-SAMs modified ABS substrate. SEM images revealed that the copper film on TES-SAM modified ABS substrate was smooth and uniform, and the density of copper nuclei was much higher. Compared with that of TES-SAMs modified resin, the coverage of copper nuclei on MPTMS and APTES modified ABS substrate was very limited and the copper particle size was too big. The adhesion property test demonstrated that all the SAMs enhanced the interfacial interaction between copper plating and ABS substrate. XRD analysis showed that the copper film deposited on SAM-modified ABS substrate had a structure with Cu(111 preferred orientation, and the copper film deposited on TES-SAMs modified ABS substrate is better than that deposited on MPTMS-SAMs or APTES-SAMs modified ABS resins in electromigrtion resistance.

  9. Heat Shock Protein 90AB1 and Hyperthermia Rescue Infectivity of HIV with Defective Cores

    Joshi, Pheroze; Sloan, Barbara; Torbett, Bruce E.; Stoddart, Cheryl A.

    2012-01-01

    We previously showed that reduced infectivity of HIV with incompletely processed capsid-spacer protein 1 (CA-SP1) is rescued by cellular activation or increased expression of HSP90AB1, a member of the cytosolic heat shock protein 90 family. Here we show that HSP90AB1 is present in HIV virions and that HSP90AB1, but not nonfunctional mutated HSP90AB1E42A+D88A, restores infectivity to HIV with mutations in CA that alter core stability. Further, the CA mutants were hypersensitive to pharmacologi...

  10. Adsorption of insecticidal Cry1Ab protein to humic substances. 1. Experimental approach and mechanistic aspects.

    Sander, Michael; Tomaszewski, Jeanne E; Madliger, Michael; Schwarzenbach, René P

    2012-09-18

    Adsorption is a key process affecting the fate of insecticidal Cry proteins (Bt toxins), produced by genetically modified Bt crops, in soils. However, the mechanisms of adsorption to soil organic matter (SOM) remain poorly understood. This work assesses the forces driving the adsorption of Cry1Ab to Leonardite humic acid (LHA), used as a model for SOM. We studied the effects of solution pH and ionic strength (I) on adsorption using a quartz crystal microbalance with dissipation monitoring and optical waveguide lightmode spectroscopy. Initial Cry1Ab adsorption rates were close to diffusion-limited and resulted in extensive adsorption, even at pH >6, at which LHA and Cry1Ab carry negative net charges. Adsorption increased with decreasing I at pH >6, indicating Cry1Ab-LHA patch-controlled electrostatic attraction via positively charged domains of Cry1Ab. Upon rinsing, only a fraction of Cry1Ab desorbed, suggesting a range of interaction energies of Cry1Ab with LHA. Different interaction energies likely resulted from nonuniformity in the LHA surface polarity, with higher Cry1Ab affinities to more apolar LHA regions due to the hydrophobic effect. Contributions from the hydrophobic effect were substantiated by comparison of the adsorption of Cry1Ab and the reference proteins albumin and lysozyme to LHA and to apolar and polar model surfaces. PMID:22862304

  11. SYSTHESIS AND PERFORMANCES OF ABS RESIN TOUGHENED BY SIBR VIA BULK POLYMERIZATION METHOD——STRUCTURE, PROPERTIES AND FRACTURE MECHNISM%SIBR增韧本体法ABS树脂的合成与性能——结构与性能及断裂机理

    于志省; 杜晓旭; 李杨

    2012-01-01

    以活性负离子聚合法合成的不同分子量和单体配比的苯乙烯-异戊二烯-丁二烯三元共聚物橡胶(SIBR)为增韧剂,以双官能团引发剂引发,采用本体聚合方法合成了系列ABS树脂,利用经典相分离技术、SEC、TEM和力学试验对聚合试样的结构、分子量、形态及性能进行了表征,并以SEM对冲击后的断面形貌进行观察以探究其断裂机理.结果发现,随着SIBR分子量的增大,橡胶相尺寸增大,接枝率下降,相界面明显,但冲击强度有所提高;SIBR中St组分含量增加,粒子均匀,但刚性增大,对抗冲击性能不利.高Mn、低St组分含量SIBR抵抗裂纹形成和扩展的能力强,ABS呈韧件断裂方式,以丰富的银纹化、明显的剪切屈服和大量系联带的撕裂为主要断裂机理;低Mn、高St组分含量SIBR抵抗裂纹形成和扩展的能力较低,ABS以半韧性方式断裂,断裂机理以基体甥化、剥离和界面的应力白化现象为主.%The styrene-isoprene-butadiene terpolymer rubbers ( SIBRs) with different molecular weights and monomer ratios were first synthesized by living anionic polymerization method. A series of ABS resins were prepared via bulk polymerization method under the initiation of difunctional initiator modified by the foresaid SIBR tougheners. The molecular structure, morphology and performances of ABS were characterized by typical phase-separating method, SEC, TEM and mechanical testing, respectively. And SEM technique was used for observing the fractured surfaces of specimens after impact in order to study the fracture mechanism. The results show that with increasing the molecular weight of SIBR,the rubber phase size increases and the grafting degree decreases besides gradually obvious phase interface and improved impact properties. Moreover, increasing thestyrene content in SIBR could lead to relatively uniform particles, but goes against the impact resistance due to its rigidity. The SIBR with higher

  12. Effect of Rapid Quenching on Electrochemical Properties of AB5 and AB3.5-Type Hydrogen Storage Alloys

    Li Ping; Zheng Xueping; An Fuqiang; Islam S. Humail; Qu Xuanhui

    2007-01-01

    Effect of rapid quenching on the electrochemical properties of AB5 and AB3.5-type hydrogen storage alloys was studied. The results indicated that the discharge capacities of the rapid quenching MmNi3.55 Co0.75 Mn0.4Al0.3 alloys decrease under 25 and -35℃ with the increase of the quenching rate. Comparatively, the decrease extent of the quenching alloys at -35℃ is lower than that at 25℃. The result on the study of the cycle life indicated that the quenching process was favorable to improve the cycle stabilities of the MmNi3.55Co0.75-Mn0.4Al0.3alloys under 25 and -35℃. Whereas, the effect of the quenching process on the La0.7Mg0.3(Ni0.85Co0.15)3.5 alloy was different at 25℃ from at -35℃. Under 25℃, the cycle life of the alloy was obviously improved by the quenching process, however, the quenching process did not improve but decreased slightly the cycle life at -35℃.

  13. Ab initio study of II-(VI){sub 2} dichalcogenides

    Olsson, P; Vidal, J; Lincot, D, E-mail: polsson@kth.se [Institut de R and D sur l' energie photovoltaique (IRDEP), UMR 7174-EDF-CNRS-ENSCP, 6 quai Watier, 78401 Chatou Cedex (France)

    2011-10-12

    The structural stabilities of the (Zn,Cd)(S,Se,Te){sub 2} dichalcogenides have been determined ab initio. These compounds are shown to be stable in the pyrite phase, in agreement with available experiments. Structural parameters for the ZnTe{sub 2} pyrite semiconductor compound proposed here are presented. The opto-electronic properties of these dichalcogenide compounds have been calculated using quasiparticle GW theory. Bandgaps, band structures and effective masses are proposed as well as absorption coefficients and refraction indices. The compounds are all indirect semiconductors with very flat conduction band dispersion and high absorption coefficients. The work functions and surface properties are predicted. The Te and Se based compounds could be of interest as absorber materials in photovoltaic applications. (paper)

  14. Ab initio calculations of grain boundaries in bcc metals

    Scheiber, Daniel; Pippan, Reinhard; Puschnig, Peter; Romaner, Lorenz

    2016-03-01

    In this study, we compute grain boundary (GB) properties for a large set of GBs in bcc transition metals with a special focus on W, Mo and Fe using ab initio density functional theory (DFT) and semi-empirical second nearest neighbour modified embedded atom method (2NN-MEAM) potentials. The GB properties include GB energies, surface energies, GB excess volume and work of separation, which we analyse and then compare to experimental data. We find that the used 2NN-MEAM potentials can predict general trends of GB properties, but do not always reproduce the GB ground state structure and energy found with DFT. In particular, our results explain the experimental finding that W and Mo prefer intergranular fracture, while other bcc metals prefer transgranular cleavage.

  15. Ab initio quantum dynamics using coupled-cluster

    Kvaal, Simen

    2012-01-01

    The curse of dimensionality (COD) limits the current state-of-the-art {\\it ab initio} propagation methods for non-relativistic quantum mechanics to relatively few particles. For stationary structure calculations, the coupled-cluster (CC) method overcomes the COD in the sense that the method scales polynomially with the number of particles while still being size-consistent and extensive. We generalize the CC method to the time domain while allowing the single-particle functions to vary in an adaptive fashion as well, thereby creating a highly flexible, polynomially scaling approximation to the time-dependent Schr\\"odinger equation. The method inherits size-consistency and extensivity from the CC method. The method is dubbed orbital-adaptive time-dependent coupled-cluster (OATDCC), and is a hierarchy of approximations to the now standard multi-configurational time-dependent Hartree method for fermions. A numerical experiment is also given.

  16. Ab initio study of the transition-metal carbene cations

    李吉海; 冯大诚; 冯圣玉

    1999-01-01

    The geometries and bonding characteristics of the first-row transition-metal carbene cations MCH2+ were investigated by ab initio molecular orbital theory (HF/LANL2DZ). All of MCH2+ are coplanar. In the closed shell structures the C bonds to M with double bonds; while in the open shell structures the partial double bonds are formed, because one of the σ and π orbitals is singly occupied. It is mainly the π-type overlap between the 2px orbital of C and 4px, 3dxz, orbitals of M+ that forms the π orbitals. The dissociation energies of C—M bond appear in periodic trend from Sc to Cu. Most of the calculated bond dissociation energies are close to the experimental ones.

  17. Ab initio electronic stopping power of protons in bulk materials

    Shukri, Abdullah Atef; Bruneval, Fabien; Reining, Lucia

    2016-01-01

    The electronic stopping power is a crucial quantity for ion irradiation: it governs the deposited heat, the damage profile, and the implantation depth. Whereas experimental data are readily available for elemental solids, the data are much more scarce for compounds. Here we develop a fully ab initio computational scheme based on linear response time-dependent density-functional theory to predict the random electronic stopping power (RESP) of materials without any empirical fitting. We show that the calculated RESP compares well with experimental data, when at full convergence, with the inclusion of the core states and of the exchange correlation. We evaluate the unexpectedly limited magnitude of the nonlinear terms in the RESP by comparing with other approaches based on the time propagation of time-dependent density-functional theory. Finally, we check the validity of a few empirical rules of thumbs that are commonly used to estimate the electronic stopping power.

  18. High-throughput ab-initio dilute solute diffusion database.

    Wu, Henry; Mayeshiba, Tam; Morgan, Dane

    2016-01-01

    We demonstrate automated generation of diffusion databases from high-throughput density functional theory (DFT) calculations. A total of more than 230 dilute solute diffusion systems in Mg, Al, Cu, Ni, Pd, and Pt host lattices have been determined using multi-frequency diffusion models. We apply a correction method for solute diffusion in alloys using experimental and simulated values of host self-diffusivity. We find good agreement with experimental solute diffusion data, obtaining a weighted activation barrier RMS error of 0.176 eV when excluding magnetic solutes in non-magnetic alloys. The compiled database is the largest collection of consistently calculated ab-initio solute diffusion data in the world. PMID:27434308

  19. Transport coefficients in diamond from ab-initio calculations

    Löfâs, Henrik; Grigoriev, Anton; Isberg, Jan; Ahuja, Rajeev

    2013-03-01

    By combining the Boltzmann transport equation with ab-initio electronic structure calculations, we obtain transport coefficients for boron-doped diamond. We find the temperature dependence of the resistivity and the hall coefficients in good agreement with experimental measurements. Doping in the samples is treated via the rigid band approximation and scattering is treated in the relaxation time approximation. In contrast to previous results, the acoustic phonon scattering is the dominating scattering mechanism for the considered doping range. At room temperature, we find the thermopower, S, in the range 1-1.6 mV/K and the power factor, S2σ, in the range 0.004-0.16 μW /cm K2.

  20. Ab-initio melting curve and principal Hugoniot of tantalum

    We report first principles calculations of the melting curve and principal Hugoniot (P - V curve) of body centered cubic (bcc) tantalum in the pressure range 0-300 GPa. A description of lattice dynamics and thermal properties of bcc Ta using finite temperature density functional theory (DFT) is presented. The approach works within the projector augmented wave (PAW) implementation of DFT and explicitly treats in valence the 5p, 6s and 5d electrons. The principal Hugoniot (P - V curve), obtained using the Rankine-Hugoniot equation, is investigated using the generalized gradient approximations (GGA). Very good agreement with the shock experiments is obtained with GGA in all the range of pressure. We also report the temperature-pressure relation on the shock Hugoniot and the full ab-initio melting curve of Ta

  1. Diode laser welding of ABS: Experiments and process modeling

    Ilie, Mariana; Mattei, Simone; Cicala, Eugen; Stoica, Virgil; 10.1016/j.optlastec.2008.10.005

    2010-01-01

    The laser beam weldability of acrylonitrile/butadiene/styrene (ABS) plates is determined by combining both experimental and theoretical aspects. In modeling the process, an optical model is used to determine how the laser beam is attenuated by the first material and to obtain the laser beam profile at the interface. Using this information as the input data to a thermal model, the evolution of the temperature field within the two components can be estimated. The thermal model is based on the first principles of heat transfer and utilizes the temperature variation laws of material properties. Corroborating the numerical results with the experimental results, some important insights concerning the fundamental phenomena that govern the process could be extracted. This approach proved to be an efficient tool in determining the weldability of polimeric materials and assures a significant reduction of time and costs with the experimental exploration.

  2. Socialiai atsakingo verslo koncepcijos įgyvendinimas AB "Lietuvos draudimas"

    Žukauskienė, Justina

    2010-01-01

    Bakalauro baigiamajame darbe nagrinėjama socialiai atsakingo verslo koncepcija, pateikiami socialinės atsakomybės modeliai, kuriais remiantis įmonės gali įgyvendinti socialinę atsakomybę. Apžvelgiama Lietuvos patirtis socialinės atsakomybės srityje. Pateikiama ne tik socialinės atsakomybės nauda įmonei ir visuomenei, bet ir kritiškas požiūris į socialinę atsakomybę. Darbe analizuojamas AB „Lietuvos draudimas“ įgyvendinamas socialinės atsakomybės modelis. Nustatyta, kad įmonė socialinę atsakom...

  3. Ab initio methods for electron-molecule collisions

    This review concentrates on the recent advances in treating the electronic aspect of the electron-molecule interaction and leaves to other articles the description of the rotational and vibrational motions. Those methods which give the most complete treatment of the direct, exchange, and correlation effects are focused on. Such full treatments are generally necessary at energies below a few Rydbergs (≅ 60 eV). This choice unfortunately necessitates omission of those active and vital areas devoted to the development of model potentials and approximate scattering formulations. The ab initio and model approaches complement each other and are both extremely important to the full explication of the electron-scattering process. Due to the rapid developments of recent years, the approaches that provide the fullest treatment are concentrated on. 81 refs

  4. Ab initio electronic structure and optical conductivity of bismuth tellurohalides

    Schwalbe, Sebastian; Starke, Ronald; Schober, Giulio A H; Kortus, Jens

    2016-01-01

    We investigate the electronic structure, dielectric and optical properties of bismuth tellurohalides BiTeX (X = I, Cl, Br) by means of all-electron density functional theory. In particular, we present the ab initio conductivities and dielectric tensors calculated over a wide frequency range, and compare our results with the recent measurements by Akrap et al. , Makhnev et al. , and Rusinov et al. . We show how the low-frequency branch of the optical conductivity can be used to identify characteristic intra- and interband transitions between the Rashba spin-split bands in all three bismuth tellurohalides. We further calculate the refractive indices and dielectric constants, which in turn are systematically compared to previous predictions and measurements. We expect that our quantitative analysis will contribute to the general assessment of bulk Rashba materials for their potential use in spintronics devices.

  5. Relativistic ab initio calculations for ion-atom collisions

    Within the independent particle model we solve the time---dependent single-particle equation using ab initio SCF-DIRAC-FOCK-SLATER wavefunctions as a basis. To reinstate the many-particle aspect of the collision system we use the inclusive probability formalism to answer experimental questions. As an example we show an application to the case of S15+ on Ar where experimental data on the K-K charge transfer are available for a wide range of impact energies from 4.7 to 90 MeV. Our molecular adiabatic calculations and the evaluation using the inclusive probability formalism show good results in the low energy range from 4.7 to 16 MeV impact energy

  6. Ab Initio Calculations of Co Shielding in Model Complexes

    Elaine A. Moore

    2002-08-01

    Full Text Available Abstract: Recent ab initio calculations of cobalt NMR shielding show that DFT-GIAO calculations using hybrid functionals are found to reproduce experimental values well. This method is used to calculate the variation of the cobalt NMR shielding tensor of sqaure pyramidal nitrosyl complexes with respect to the CoNO geometry and to differing basal ligands. The isotropic shielding is shown to have a large negative derivative with respect to CoX distance where X is a ligating atom.; the derivative with respect to NO distance is smaller but still significant. The zz component where z is along the CoN(NO bond is more sensitive to the basal ligands but the other two principal components are sensitive to the CoNO geometry.

  7. Ab initio H2O in realistic hydrophilic confinement.

    Allolio, Christoph; Klameth, Felix; Vogel, Michael; Sebastiani, Daniel

    2014-12-15

    A protocol for the ab initio construction of a realistic cylindrical pore in amorphous silica, serving as a geometric nanoscale confinement for liquids and solutions, is presented. Upon filling the pore with liquid water at different densities, the structure and dynamics of the liquid inside the confinement can be characterized. At high density, the pore introduces long-range oscillations into the water density profile, which makes the water structure unlike that of the bulk across the entire pore. The tetrahedral structure of water is also affected up to the second solvation shell of the pore wall. Furthermore, the effects of the confinement on hydrogen bonding and diffusion, resulting in a weakening and distortion of the water structure at the pore walls and a slowdown in diffusion, are characterized. PMID:25208765

  8. Ab initio design of laser pulse for controlling photochemical reactions

    With high level ab initio description of molecule-field interaction, we have developed an optimal control algorithm for manipulating molecular transformation and quantum populations. High order molecule-field interactions are fully taken into account through the use of electric-nuclear Born-Oppenheimer (ENBO) approximation. The present algorithm is demonstrated on the control of molecular post-pulse (transient)alignment and orientation. High degrees of alignment and orientation are achieved in a vibrationally selective manner by optimized infrared laser pulses of duration on the order one rotational period of molecule. To reveal the control mechanism behind the complicated optimal pulses, an analytical pulse design method is developed within the ENBO approximation, which is based on a two-state treatment of the dynamics in a Floquet picture. This analytical method is also illustrated on the control of the alignment of homonuclear diatomics. (author)

  9. Highly anisotropic thermal conductivity of arsenene: An ab initio study

    Zeraati, Majid; Vaez Allaei, S. Mehdi; Abdolhosseini Sarsari, I.; Pourfath, Mahdi; Donadio, Davide

    2016-02-01

    Elemental two-dimensional (2D) materials exhibit intriguing heat transport and phononic properties. Here we have investigated the lattice thermal conductivity of newly proposed arsenene, the 2D honeycomb structure of arsenic, using ab initio calculations. Solving the Boltzmann transport equation for phonons, we predict a highly anisotropic thermal conductivity of 30.4 and 7.8 W/mK along the zigzag and armchair directions, respectively, at room temperature. Our calculations reveal that phonons with mean free paths between 20 nm and 1 μ m provide the main contribution to the large thermal conductivity in the zigzag direction; mean free paths of phonons contributing to heat transport in the armchair directions range between 20 and 100 nm. The obtained anisotropic thermal conductivity and feasibility of synthesis, in addition to high electron mobility reported elsewhere, make arsenene a promising material for nanoelectronic applications and thermal management.

  10. Efficient Ab initio Modeling of Random Multicomponent Alloys

    Jiang, Chao; Uberuaga, Blas P.

    2016-03-01

    We present in this Letter a novel small set of ordered structures (SSOS) method that allows extremely efficient ab initio modeling of random multicomponent alloys. Using inverse II-III spinel oxides and equiatomic quinary bcc (so-called high entropy) alloys as examples, we demonstrate that a SSOS can achieve the same accuracy as a large supercell or a well-converged cluster expansion, but with significantly reduced computational cost. In particular, because of this efficiency, a large number of quinary alloy compositions can be quickly screened, leading to the identification of several new possible high-entropy alloy chemistries. The SSOS method developed here can be broadly useful for the rapid computational design of multicomponent materials, especially those with a large number of alloying elements, a challenging problem for other approaches.

  11. Molecular ion LiHe+: ab initio study

    Highlights: ► Excited electronic states of LiHe+ are studied. ► Potential energy curves of thirteen states are calculated. ► Dipole moment and transition dipole moment functions are determined. ► Basic spectroscopic properties of the electronic states are derived. - Abstract: High level ab initio calculations are performed on the molecular ion LiHe+. Potential energy curves for the low-lying singlet and triplet electronic states are calculated using the multi-reference configuration interaction and single-reference coupled cluster methods with large basis sets. The corresponding dipole moments and transition dipole moments functions are also determined. The basic spectroscopic properties and excitation energies of the electronic states are derived from rovibrational bound state calculations.

  12. OPTIMIZATION STUDY IN MANUFACTURING PROCESS FOR PC/ABS BLENDS

    Huang Chenghung; Fung Chinping; Chang Shihhsing; Hwang Jiunren; Doong Jiliang

    2003-01-01

    The optimization of injection molding process for polycarbonate/acrylonitrile-butadiene-styrene (PC/ABS) blends is studied using Taguchi method and principal component analysis (PCA). Four controllable process factors are studied at three levels each in the manufacturing process. The L9 orthogonal array is conducted to determine the optimum process factor/level combination for single quality of mechanical properties. In addition, the principal component analysis is employed to transform the correlated mechanical properties to a set of uncorrelated components and to evaluate a comprehensive index for multi-response cases. Then the optimum process factor/level combination for multiple qualities can be determined. Finally, the analysis of variance is used to find out the most influential injection molding parameter for single and multiple qualities problems.

  13. AB "DNB" banko įvaizdžio valdymas

    Vaškelytė, Virginija

    2012-01-01

    Šio darbo tikslas - išnagrinėji AB „DNB“ banko įvaizdžio formavimą ir valdymą teoriniu bei praktiniu aspektu ir konstatavus įvaizdžio formavimo bei valdymo problemas sukurti banko įvaizdžio tobulinimo modelį. Teorinėje darbo dalyje analizuojama organizacijos įvaizdžio samprata, kūrimo lygiai, pagrindiniai veiksniai, formuojantys organizacijos įvaizdį. Taip pat teorinėje dalyje analizuojami, lyginami organizacijos įvaizdžio kūrimo modeliai bei banko įvaizdžio valdymas. Analitinėje baigiamojo d...

  14. Ab initio potential energy surface and rovibrational states of HBO

    Ha, Tae-Kyu; Makarewicz, Jan

    1999-01-01

    The potential energy surface describing the large-amplitude motion of H around the BO core in the HBO molecule has been determined from ab initio calculations. This surface has been sampled by a set of 170 grid points from a two-dimensional space defined by the stretching and the bending coordinates of the H nucleus. At each grid point, the BO bond length has been optimized using the second-order Møller-Plesset perturbation theory with the basis set aug-cc-pVTZ. The surface has a local minimum for the linear as well as the bent configuration of HBO. A low energy barrier to the linear configuration BOH causes a large-amplitude motion and a strong rovibrational interaction in the molecule. Its rovibrational dynamics is different from the dynamics in bent or quasilinear triatomic molecules.

  15. Ab initio quantum dynamics using coupled-cluster.

    Kvaal, Simen

    2012-05-21

    The curse of dimensionality (COD) limits the current state-of-the-art ab initio propagation methods for non-relativistic quantum mechanics to relatively few particles. For stationary structure calculations, the coupled-cluster (CC) method overcomes the COD in the sense that the method scales polynomially with the number of particles while still being size-consistent and extensive. We generalize the CC method to the time domain while allowing the single-particle functions to vary in an adaptive fashion as well, thereby creating a highly flexible, polynomially scaling approximation to the time-dependent Schrödinger equation. The method inherits size-consistency and extensivity from the CC method. The method is dubbed orbital-adaptive time-dependent coupled-cluster, and is a hierarchy of approximations to the now standard multi-configurational time-dependent Hartree method for fermions. A numerical experiment is also given. PMID:22612082

  16. A Review on Ab Initio Approaches for Multielectron Dynamics

    Ishikawa, Kenichi L

    2015-01-01

    In parallel with the evolution of femtosecond and attosecond laser as well as free-electron laser technology, a variety of theoretical methods have been developed to describe the behavior of atoms, molecules, clusters, and solids under the action of those laser pulses. Here we review major ab initio wave-function-based numerical approaches to simulate multielectron dynamics in atoms and molecules driven by intense long-wavelength and/or ultrashort short-wavelength laser pulses. Direct solution of the time-dependent Schr\\"odinger equation (TDSE), though its applicability is limited to He, ${\\rm H}_2$, and Li, can provide an exact description and has been greatly contributing to the understanding of dynamical electron-electron correlation. Multiconfiguration self-consistent-field (MCSCF) approach offers a flexible framework from which a variety of methods can be derived to treat both atoms and molecules, with possibility to systematically control the accuracy. The equations of motion of configuration interactio...

  17. Energiutredning på Chips AB, Åland

    Renström, Thom; Sundbäck, Henrik

    2013-01-01

    En energikartläggning har gjorts hos Chips AB för att undersöka hur energin fördelas över de olika produktionslinjerna. Energianvändningen från processer som är gemensamma för alla produktionslinjer har också undersökts. Energianvändningen för dessa har fördelats över pro- duktionslinjerna eftersom produkterna även ska bära upp dessa energikostnader. Där det vi- sade sig att chipslinjen använder överlägset mest energi under ett år, 13 200 MWh, men den linjen körs mest o...

  18. Ab initio engineering of materials with stacked hexagonal tin frameworks

    Shao, Junping; Beaufils, Clément; Kolmogorov, Aleksey N.

    2016-01-01

    The group-IV tin has been hypothesized to possess intriguing electronic properties in an atom-thick hexagonal form. An attractive pathway of producing sizable 2D crystallites of tin is based on deintercalation of bulk compounds with suitable tin frameworks. Here, we have identified a new synthesizable metal distannide, NaSn2, with a 3D stacking of flat hexagonal layers and examined a known compound, BaSn2, with buckled hexagonal layers. Our ab initio results illustrate that despite being an exception to the 8-electron rule, NaSn2 should form under pressures easily achievable in multi-anvil cells and remain (meta)stable under ambient conditions. Based on calculated Z2 invariants, the predicted NaSn2 may display topologically non-trivial behavior and the known BaSn2 could be a strong topological insulator. PMID:27387140

  19. Ab initio Potential Energy Surface for H-H2

    Partridge, Harry; Bauschlicher, Charles W., Jr.; Stallcop, James R.; Levin, Eugene

    1993-01-01

    Ab initio calculations employing large basis sets are performed to determine an accurate potential energy surface for H-H2 interactions for a broad range of separation distances. At large distances, the spherically averaged potential determined from the calculated energies agrees well with the corresponding results determined from dispersion coefficients; the van der Waals well depth is predicted to be 75 +/- (mu)E(sub h). Large basis sets have also been applied to reexamine the accuracy of theoretical repulsive potential energy surfaces. Multipolar expansions of the computed H-H2 potential energy surface are reported for four internuclear separation distances (1.2, 1.401, 1.449, and 1.7a(sub 0) of the hydrogen molecule. The differential elastic scattering cross section calculated from the present results is compared with the measurements from a crossed beam experiment.

  20. An Efficient Approach to Ab Initio Monte Carlo Simulation

    Leiding, Jeff

    2013-01-01

    We present a Nested Markov Chain Monte Carlo (NMC) scheme for building equilibrium averages based on accurate potentials such as density functional theory. Metropolis sampling of a reference system, defined by an inexpensive but approximate potential, is used to substantially decorrelate configurations at which the potential of interest is evaluated, thereby dramatically reducing the number needed to build ensemble averages at a given level of precision. The efficiency of this procedure is maximized on-the-fly through variation of the reference system thermodynamic state (characterized here by its inverse temperature \\beta^0), which is otherwise unconstrained. Local density approximation (LDA) results are presented for shocked states in argon at pressures from 4 to 60 GPa. Depending on the quality of the reference potential, the acceptance probability is enhanced by factors of 1.2-28 relative to unoptimized NMC sampling, and the procedure's efficiency is found to be competitive with that of standard ab initio...

  1. Internetmarknadsföring inom turismen : Case Esbo Turism Ab

    Gothoni, Jenny

    2010-01-01

    I detta arbetet behandlas kundförnöjsamheten med Esbo Turism Abs hemsidor, och ifall dessa kan förbättras ytterligare. Teorin baserar sig mycket på marknadsföring samt kundens beteende och behov, internetsidor samt kvalitet och segmentering. Undersökningen har genomförts med hjälp av webbenkäter och litet djupare e-post intervjuer under våren 2010. I undersökningen deltog 30 personer i enkäterna och tre stycken i intervjuerna. Störst svarskvot bildades av 15-25 åringar från Helsingfors. ...

  2. Interatomic Coulombic decay widths of helium trimer: Ab initio calculations

    Kolorenč, Přemysl, E-mail: kolorenc@mbox.troja.mff.cuni.cz [Charles University in Prague, Faculty of Mathematics and Physics, Institute of Theoretical Physics, V Holešovičkách 2, 180 00 Prague (Czech Republic); Sisourat, Nicolas [Sorbonne Universités, UPMC Univ Paris 06, UMR 7614, Laboratoire de Chimie Physique Matière et Rayonnement, F-75005 Paris (France); CNRS, UMR 7614, Laboratoire de Chimie Physique Matière et Rayonnement, F-75005 Paris (France)

    2015-12-14

    We report on an extensive study of interatomic Coulombic decay (ICD) widths in helium trimer computed using a fully ab initio method based on the Fano theory of resonances. Algebraic diagrammatic construction for one-particle Green’s function is utilized for the solution of the many-electron problem. An advanced and universal approach to partitioning of the configuration space into discrete states and continuum subspaces is described and employed. Total decay widths are presented for all ICD-active states of the trimer characterized by one-site ionization and additional excitation of an electron into the second shell. Selected partial decay widths are analyzed in detail, showing how three-body effects can qualitatively change the character of certain relaxation transitions. Previously unreported type of three-electron decay processes is identified in one class of the metastable states.

  3. Estudo de caso controle para avaliar o impacto do abuso sexual infantil nos transtornos alimentares

    Felipe Paraventi; Angélica Medeiros Claudino; Christina Marcondes Morgan; Jair de Jesus Mari

    2011-01-01

    CONTEXTO: O objetivo deste estudo foi investigar se antecedente de abuso sexual na infância (ASI) está associado com transtornos alimentares na vida adulta. MÉTODOS: Realizou-se um estudo de caso controle (N = 120) comparando mulheres com transtornos alimentares tratadas em ambulatório universitário especializado com um grupo controle de pacientes de clínica não psiquiátrica (ambulatório de oftalmologia). RESULTADOS: Este estudo encontrou maior prevalência de ASI na anorexia nervosa (AN) comp...

  4. Lesões esportivas: um estudo com atletas do basquetebol bauruense

    Bruno Estevan Siqueira Dario; Gustavo Barquilha; Reinaldo Monteiro Marques

    2010-01-01

    Este estudo teve como objetivo identificar as principais lesões no basquetebol e suas incidências. Participaram do estudo vinte jogadores de basquetebol do sexo masculino com idade variando entre 13 e 15 anos. O instrumento utilizado foi o questionário e seus resultados mostraram que, dos atletas participantes do estudo, todos relataram algum tipo de lesão. Foram identificadas 26 lesões, sendo 13 nos membros inferiores (50%) e 13 nos membros superiores (50%). No joelho, as lesões mais frequen...

  5. O amor à marca e seus determinantes : um estudo comparativo entre marcas Apple e Samsung

    Clemente, Carolina

    2013-01-01

    O Amor à Marca é o objeto central de estudo da presente dissertação. Pretende-se compreender este fenómeno através de um estudo de cunho quantitativo, com o uso de inquéritos, e comparativo entre as marcas Apple e Samsung. Os dados foram recolhidos com a aplicação de um questionário a 405 pessoas, sendo este estruturado numa plataforma digital. O público alvo compreendia inquiridos com mais de 18 anos, de ambos os sexos, e de nacionalidades portuguesa e brasileira. O estudo ...

  6. Reflexões sobre fatos e fe(i)tiches no estudo das religiões

    Ricardo Vieiralves-Castro; Maria Clara Rebel Araújo

    2008-01-01

    Trata-se de um estudo teórico sobre o pensamento do cientista humano B. Latour e sua crítica à visão moderna sobre as religiões. Procuramos aqui discutir o conceito de simetria relacionado ao estudo das experiências religiosas, abordando especificamente a doutrina do Santo Daime, religião brasileira que utiliza um chá psicoativo em seus rituais. Relacionamos Latour às pesquisas sobre estados alterados de consciência do psiquiatra S. Grof. A busca de um olhar simétrico no estudo desta religião...

  7. Investimentos Socioambientais para Posicionamento de Marca: Um Estudo Sobre Imagem Organizacional

    Aline Eggres de Castro; Flavia Luciane Scherer

    2012-01-01

    O presente estudo tem como objetivo investigar se os Investimentos Socioambientais e demais ações de Responsabilidade Social Corporativa das empresas impactam positivamente na imagem organizacional delas perante seus consumidores. A Natura Cosméticos S.A. foi escolhida como objeto de estudo devido a sua forte atuação nas áreas social, ambiental e cultural no país. Para atingir os objetivos do estudo, foi realizada pesquisa survey com as consultoras (revendedoras de produtos) da empresa, que ...

  8. Desafios dos Estudos Gays, Lésbicos e Transgêneros

    Denilson Lopes

    2008-09-01

    Full Text Available Resumo: Este ensaio introduz algumas questões relativas aos estudos feministas, gays, lésbicos, transgênecos e teoria queer na busca de contribuições teórico-metodológicas na análise da cultura contemporânea. Palavras-chave: Estudos gays e lésbicos, estudos transgêneros, teoria queer, cultura. Abstrat: This essay introduces some issues related tofeminist studies, gay and lesbian studies, transgender studies and queer theory in the search of theoretical and methodological contributions in the analysis of contemporary culture. Key-words: Gay and Lesbian Studies, transgender studies, queer theory, culture

  9. Cultura nacional e orientação empreendedora: Um estudo comparativo entre Brasil e Portugal

    Silva, Marco Antonio Oliveira Monteiro da; Correia, Manuela Faia; Scholten, Marc; Gomes, Luiz Flavio Autran Monteiro

    2008-01-01

    Este artigo descreve um estudo realizado com o propósito de comparar empreendedoresproprietários de empresas em incubadoras no Brasil e em Portugal. A comparação entre estes dois países justificou-se pelo passado histórico comum, notadamente pela influência portuguesa na formaçã cultural brasileira, espelhada no estudo transcultural de Hofstede (1980). O objetivo deste estudo é comparar a orientação empreendedora desses empreendedores-proprietários de ambos os países. A orientação empreendedo...

  10. Effect of gamma irradiation on nutritional components and Cry1Ab protein in the transgenic rice with a synthetic cry1Ab gene from Bacillus thuringiensis

    The effects of gamma irradiation on the transgenic rice containing a synthetic cry1Ab gene from Bacillus thuringiensis were investigated. There was almost no difference in the content of the major nutritional components, i.e. crude protein, crude lipid, eight essential amino acids and total ash between the irradiated grains and the non-irradiated transgenic rice. However, the amounts of Cry1Ab protein and apparent amylose in the irradiated transgenic rice were reduced significantly by the doses higher than 200 Gy. In vivo observation showed that Cry1Ab protein contents also decreased in the fresh leaf tissues of survival seedlings after irradiation with 200 Gy or higher doses and showed inhibition of seedling growth. The results indicate that gamma irradiation might improve the quality of transgenic rice due to removal of the toxic Cry1Ab protein

  11. 一种AB PLC与Profibus DP网络通信的方法%A Solution for Communication between AB PLC and Profibus DP Network

    李学治

    2015-01-01

    Industrial automation communication network is variousness. This paper presents a solution for communication be-tween AB PLC and Profibus DP network, introduces an example that an AB PLC system communicates with Siemens S120 drives through Profibus DP network by using MVI56-PDPMV1 module.%工业自动化通信网络具有多样性的特点, wenz对AB PLC与Profibus DP网络通信的方法进行探究,用设计实例探讨AB PLC系统通过MVI56-PDPMV1通信模块与西门子S120驱动系统构建Profibus-DP通信网络的设计与编程设置。

  12. Effect of gamma irradiation on nutritional components and Cry1Ab protein in the transgenic rice with a synthetic cry1Ab gene from Bacillus thuringiensis

    Wu, Dianxing; Ye, Qingfu; Wang, Zhonghua; Xia, Yingwu

    2004-01-01

    The effects of gamma irradiation on the transgenic rice containing a synthetic cry1Ab gene from Bacillus thuringiensis were investigated. There was almost no difference in the content of the major nutritional components, i.e. crude protein, crude lipid, eight essential amino acids and total ash between the irradiated grains and the non-irradiated transgenic rice. However, the amounts of Cry1Ab protein and apparent amylose in the irradiated transgenic rice were reduced significantly by the doses higher than 200 Gy. In vivo observation showed that Cry1Ab protein contents also decreased in the fresh leaf tissues of survival seedlings after irradiation with 200 Gy or higher doses and showed inhibition of seedling growth. The results indicate that gamma irradiation might improve the quality of transgenic rice due to removal of the toxic Cry1Ab protein.

  13. Expression of Cry1Ab and Cry2Ab by a polycistronic transgene with a self-cleavage peptide in rice.

    Qichao Zhao

    Full Text Available Insect resistance to Bacillus thuringiensis (Bt crystal protein is a major threat to the long-term use of transgenic Bt crops. Gene stacking is a readily deployable strategy to delay the development of insect resistance while it may also broaden insecticidal spectrum. Here, we report the creation of transgenic rice expressing discrete Cry1Ab and Cry2Ab simultaneously from a single expression cassette using 2A self-cleaving peptides, which are autonomous elements from virus guiding the polycistronic viral gene expression in eukaryotes. The synthetic coding sequences of Cry1Ab and Cry2Ab, linked by the coding sequence of a 2A peptide from either foot and mouth disease virus or porcine teschovirus-1, regardless of order, were all expressed as discrete Cry1Ab and Cry2Ab at high levels in the transgenic rice. Insect bioassays demonstrated that the transgenic plants were highly resistant to lepidopteran pests. This study suggested that 2A peptide can be utilized to express multiple Bt genes at high levels in transgenic crops.

  14. Simulação de Escoamentos Atmosféricos para Estudo de Parques Eólicos: Estudo comparativo dos softwares OpenFOAM e Windie

    Faria, Ricardo Jorge Agrela

    2014-01-01

    A presente tese tem como principal objetivo a comparação entre dois software de CFD (Computer Fluid Dynamics) na simulação de escoamentos atmosféricos com vista à sua aplicação ao estudo e caracterização de parques eólicos. O software em causa são o OpenFOAM (Open Field Operation and Manipulation) - freeware open source genérico - e o Windie, ferramenta especializada no estudo de parques eólicos. Para este estudo foi usada a topografia circundante a um parque eólico situado na Grécia, do qual...

  15. Dicty_cDB: FC-AB36 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AB36 (Link to dictyBase) - - - Contig-U15455-1 FC-AB36Z (Link to Origina ... yk*nnkknkkklkkkkktk*n*ikkqkqnkkkk Frame C: ---*icp*risk *kefineiikkikkn*krkkkqnkik*knknktkkk Homology vs CS ...

  16. Prediction on Antigenic Epitope Characteristics of Bt Cry2Ab Protein in Transgenic Crops

    Jierong GAO; Ying HE; Zehong ZOU; Ailin TAO; Yuncan AI

    2012-01-01

    Abstract [Objective] This study aimed to predict the structural characteristics of Bt Cry2Ab protein in transgenic crops with bioinformatic analysis to provide the theoreti- cal clues for design of antibody Cry2Ab. [Method] The amino acid sequence of Cry2Ab protein was searched from NCBI database. The B cell epitopes were pre- dicted with DNAStar. The binding affinity between Cry2Ab protein and MHC-II molecules was analyzed with NetMHCII 2.2 Server to predict the T cell epitopes. [Result] Prediction result suggested the potential B cell epitope of Cry2Ab locating in the region of 208-215. Analysis of the binding affinity between Cry2Ab and MHC-II molecules suggested the regions of 177-185, 299-307 and 255-263 were the po- tential T cell epitopes. Human with HLA-DRB10101 alleles and HLA-DRB10701 al- leles were more sensitive to Cry2Ab protein. [Conclusion] This study facilitates to un- derstand the structural characteristics of Cry2Ab protein and provides a new clue to improve the assessment method for potential allergenicity of genetically modified food.

  17. Leonid Apananski müüs AB Grupi maa oma firmale / Silva Männik

    Männik, Silva, 1974-

    1999-01-01

    Ilmunud ka: Den za Dnjom Nov/26 lk. 8. Apananski müüs AB Kindlustuse Grupile kuulunud Maakri tänava kinnistu. Skeem: AB Grupist on välja viidud ligikaudu 70 milj. krooni. Ilmunud ka: Den za Dnjom 23. nov. lk. 3

  18. InterProScan Result: AB047925 [KAIKOcDNA[Archive

    Full Text Available AB047925 AB047925_1_ORF1 537628749FFCB8C5 SUPERFAMILY SSF81321 SSF81321 4.1E-6 T IPR000856 unint ... ng pathway (GO:0007186)|Biological Process: visual perception ... (GO:0007601)|Biological Process: phototransduction ...

  19. InterProScan Result: AB047925 [KAIKOcDNA[Archive

    Full Text Available AB047925 AB047925_1_ORF1 537628749FFCB8C5 PANTHER PTHR19264:SF17 Opsin_RH3/RH4 3.099999458993759 ... ng pathway (GO:0007186)|Biological Process: visual perception ... (GO:0007601)|Biological Process: phototransduction ...

  20. InterProScan Result: AB047925 [KAIKOcDNA[Archive

    Full Text Available AB047925 AB047925_1_ORF1 537628749FFCB8C5 PANTHER PTHR19264 PTHR19264 3.0999994589937598E-30 T I ... ng pathway (GO:0007186)|Biological Process: visual perception ... (GO:0007601)|Biological Process: phototransduction ...

  1. Dicty_cDB: FCL-AB15 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AB15 (Link to dictyBase) - - - Contig-U15231-1 FCL-AB15E (Link to Orig ... ifliicqk*eidleatllnlkkllkrin*idyhslvklnfsmqchy*kle vtl *iisilnqlmpkqsvnlkny*iislnk*sk**iiiiiskykicnpsncwss ...

  2. Towards a fair and equitable abs regime: is Nagoya leading us in the right direction?

    Jonge, de B.

    2013-01-01

    A historical overview of the concept of Access and Benefit Sharing (ABS) suggests that ABS is all about compensation, i.e. a benefit sharing mechanism that provides one with compensation for allowing access to one’s resources. The principles of entitlement (based on sovereign rights) and desert (bas

  3. InterProScan Result: AB474577 [KAIKOcDNA[Archive

    Full Text Available AB474577 AB474577_2_ORF1 55017EA0D2FBC672 SMART SM00051 DSL 4.0999959904578364E-24 T IPR001774 D ... rrate/lag-2 (DSL) protein Biological Process: cell communication ... (GO:0007154)|Cellular Component: membrane (GO:0016 ...

  4. InterProScan Result: AB474577 [KAIKOcDNA[Archive

    Full Text Available AB474577 AB474577_2_ORF1 55017EA0D2FBC672 PFAM PF01414 DSL 2.7000000000000042E-20 T IPR001774 De ... rrate/lag-2 (DSL) protein Biological Process: cell communication ... (GO:0007154)|Cellular Component: membrane (GO:0016 ...

  5. InterProScan Result: AB474577 [KAIKOcDNA[Archive

    Full Text Available AB474577 AB474577_2_ORF1 55017EA0D2FBC672 PROFILE PS51051 DSL 0.0 T IPR001774 Delta/Serrate/lag- ... 2 (DSL) protein Biological Process: cell communication ... (GO:0007154)|Cellular Component: membrane (GO:0016 ...

  6. ABS/PET合金的相容化研究%Study on the Compatibility of ABS/PET Alloy

    刘辉辉; 杜一凡; 谷志杰; 许海燕

    2014-01-01

    以苯乙烯-丙烯腈-甲基丙烯酸缩水甘油酯(SAG)和苯乙烯-丙烯腈-马来酸酐(SMA)为相容剂对丙烯腈-丁二烯-苯乙烯(ABS)/聚对苯二甲酸乙二醇酯(PET)合金进行增容.并从拉伸性能、弯曲性能、冲击性能、熔体质量流动速率(MFR)等方面对SAG和SMA的增容效果进行了比较.结果表明,含有GMA基团的SAG比含有MAH基团的SAM的增容效果更好.

  7. Raiva humana: estudo neuropatológico de trinta casos

    R. V. C. Assis

    1984-12-01

    Full Text Available O estudo epidemiológico e neuropatológico concernente a trinta autópsias de encefalite rábica foi realizado, tendo sido os dados obtidos comparados com aqueles da literatura. Não houve relação estatística entre a topografia lesional e o local da mordida, entre o período de incubação ou a duração da doença e a presença ou ausência de inclusões virais (IV assim como entre a intensidade do processo inflamatorio (PI e a presença de IV. A dispersão do PI e das IV através o SNC foi diretamente proporcional à sua intensidade. A estrutura mais freqüentemente comprometida pelo PI foi o mesencéfalo, seguido pelo bulbo, ponte e medula espinhal. A estrutura mais intensamente afetada foi o bulbo. As IV foram particularmente proeminentes no hipocampo e cerebelo.

  8. Lesões esportivas: um estudo com atletas do basquetebol bauruense

    Bruno Estevan Siqueira Dario

    2010-05-01

    Full Text Available Este estudo teve como objetivo identificar as principais lesões no basquetebol e suas incidências. Participaram do estudo vinte jogadores de basquetebol do sexo masculino com idade variando entre 13 e 15 anos. O instrumento utilizado foi o questionário e seus resultados mostraram que, dos atletas participantes do estudo, todos relataram algum tipo de lesão. Foram identificadas 26 lesões, sendo 13 nos membros inferiores (50% e 13 nos membros superiores (50%. No joelho, as lesões mais frequentes foram a tendinite patelar - sete casos (53,85%. Nos membros superiores, destacaram-se as entorses nos dedos das mãos - cinco casos (38,46%. Com este estudo, percebemos a necessidade de se desenvolver um trabalho preventivo no intuito de diminuir a incidência dessas lesões.

  9. Influence of Cellulose on the Mechanical and Thermal Stability of ABS Plastic Composites

    K. Crews

    2016-01-01

    Full Text Available Microcrystalline cellulose was explored as possible biodegradable fillers in the fabrication of ABS plastic composites. TGA indicates that upon inclusion of cellulose microcrystals the thermal stability of the ABS plastics was improved significantly when compared to the neat ABS plastic counterparts. Furthermore, inclusion of extracted cellulose from plant biomass showed a higher thermal stability with maximum decomposition temperatures around 131.95°C and 124.19°C for cellulose from cotton and Hibiscus sabdariffa, respectively, when compared to that of the purchased cellulose. In addition, TMA revealed that the average CTE value for the neat ABS and 1 : 1 ratio of cellulose to ABS fabricated in this study was significantly lower than the reported CTE (ca. 73.8 μm/m°C.

  10. Hydrogenation of AB{sub 5} and AB{sub 2} metal hydride alloys studied by in situ X-ray diffraction

    Wang, L. [Department of Chemical Engineering and Materials Science, Wayne State University, Detroit, MI 48202 (United States); BASF – Battery Materials Ovonic, 2983 Waterview Drive, Rochester Hills, MI 48309 (United States); Young, K., E-mail: kwo.young@basf.com [BASF – Battery Materials Ovonic, 2983 Waterview Drive, Rochester Hills, MI 48309 (United States); Nei, J.; Pawlik, D. [BASF – Battery Materials Ovonic, 2983 Waterview Drive, Rochester Hills, MI 48309 (United States); Ng, K.Y.S. [Department of Chemical Engineering and Materials Science, Wayne State University, Detroit, MI 48202 (United States)

    2014-12-15

    Highlights: • Hydrogenation process of an AB{sub 5} alloy and two AB{sub 2} alloys were studied by quasi in-situ XRD. • In both AB{sub 5} and AB{sub 2} metal alloy, hydrogen occupation sites on the half-plane were taken first. • In the C14/C15 mixed alloy, C14 phase is the main hydrogen storage phase with a lower equilibrium pressure. • In the C14/C15 mixed alloy, C15 phase is the catalyst hydrogen storage phase with a higher equilibrium pressure. • Small amount of C15 was hydrided first but not completed until C14 phase was fully hydrided. - Abstract: The evolution of lattice constants and abundances of metal (α) and metal hydride (β) phases during the hydrogenation process of an AB{sub 5} alloy with a CaCu{sub 5} crystal structure, an AB{sub 2} alloy with a predominating C14 structure, and a C14/C15-mixed AB{sub 2} alloy were reported. The preferred hydrogen insertion sites at different states of charge in both the α and β phases were studied based on the lattice parameter changes during hydrogenation. During the hydrogenation of the AB{sub 5} alloy, the ratio between lattice parameters a and c (a/c ratio) in the α phase decreases, stabilizes, and then decreases again while that in the β phase decreases and then stabilizes. The trends in unit cell volume changes are increasing, plateauing, and increasing again in the α phase and increasing followed by plateauing in the β phase as the hydrogenation level increases. In the C14-predominant AB{sub 2} alloy, the a/c ratio in the α phase increases at the beginning and then stabilizes while that in the β phase remains about the same and then increases during the addition of hydrogen. Moreover, the unit cell volume in the α phase increases slightly during hydrogenation, comparing to the increasing, decreasing, and then increasing trend in the β phase. In the C14/C15 mixed AB{sub 2} alloy, hydrogenation of the C15 phase starts at the beginning and promotes the hydrogenation of the C14 phase. The C14

  11. Estudos sobre Trabalho Global: A necessidade de uma perspetiva emancipatória

    Peter Waterman

    2013-04-01

    Full Text Available O presente artigo faz uma avaliação crítica dos chamados “Novos Estudos sobre Trabalho Global” com base nos seus parâmetros socioliberais, concentrando‑se em espaços, locais ou aspetos supranacionais ou globais. Advoga a necessidade de uma perspetiva emancipatória nos “Estudos sobre Trabalho Global”, apontando para algumas das fontes teóricas em que se pode basear.

  12. Performance Study of ABS/Graphite/NBR Thermal Conductive Composites%ABS/石墨/NBR导热复合材料性能的研究

    傅伟宁; 张云灿; 韦亚兵; 成敏

    2013-01-01

    采用熔融共混法制备丙烯腈-丁二烯-苯乙烯共聚物(ABS)/石墨/丁腈橡胶(NBR)导热复合材料,通过热常数分析仪、同步热分析仪、扫描电子显微镜、力学性能测试等手段研究了NBR、ABS高胶粉及石墨(G)的添加量对ABS复合材料导热性能及力学性能的影响.结果表明,ABS高胶粉和NBR均能明显提高ABS的热导率和缺口冲击强度,但是丁腈胶粉的改性效果优于高胶粉.以NBR作为ABS复合材料的增韧剂,随着石墨含量的增大,增韧效果下降,ABS复合材料的热导率提高到纯ABS的5倍,热分解温度提高40℃左右,热膨胀系数下降.当ABS/G/NBR复合材料的质量比为60/15/25时,其热导率为纯ABS的2倍,缺口冲击强度达21.8 kJ/m2,明显高于纯ABS(2.6 kJ/m2).%Thermally conductive ABS/graphite/nitrile butadiene rubber (NBR) composites were prepared by melt bleding method.The effects of NBR,ABS and graphite content on the thermal conductivity and mechanical property of the ABS composites were studied respectively by the thermal constant analyzer,synchronous thermal analysis,scanning electron microscopy and mechanical properties testing means.The results showed that ABS high glue powder and NBR could increase the thermal conductivity and Notched impact strength of ABS,but NBR was more suitable as a toughening agent for ABS composite.The toughening effect decreased as the graphite content increased.Meanwhile the thermal conductivity of the ABS composite was up to five times than that of the pure ABS.The thermal decomposition temperature of the composite increased by about 40 ℃ and the thermal expansion coefficient failed.When the mass ratio of ABS/G/NBR was 60/15/25,the thermal conductivity was two times than that of pure ABS and the impact strength was up to 21.8 kJ/m2 which was larger than that of pure ABS (2.6 kJ/m2).

  13. Ab initio molecular crystal structures, spectra, and phase diagrams.

    Hirata, So; Gilliard, Kandis; He, Xiao; Li, Jinjin; Sode, Olaseni

    2014-09-16

    Conspectus Molecular crystals are chemists' solids in the sense that their structures and properties can be understood in terms of those of the constituent molecules merely perturbed by a crystalline environment. They form a large and important class of solids including ices of atmospheric species, drugs, explosives, and even some organic optoelectronic materials and supramolecular assemblies. Recently, surprisingly simple yet extremely efficient, versatile, easily implemented, and systematically accurate electronic structure methods for molecular crystals have been developed. The methods, collectively referred to as the embedded-fragment scheme, divide a crystal into monomers and overlapping dimers and apply modern molecular electronic structure methods and software to these fragments of the crystal that are embedded in a self-consistently determined crystalline electrostatic field. They enable facile applications of accurate but otherwise prohibitively expensive ab initio molecular orbital theories such as Møller-Plesset perturbation and coupled-cluster theories to a broad range of properties of solids such as internal energies, enthalpies, structures, equation of state, phonon dispersion curves and density of states, infrared and Raman spectra (including band intensities and sometimes anharmonic effects), inelastic neutron scattering spectra, heat capacities, Gibbs energies, and phase diagrams, while accounting for many-body electrostatic (namely, induction or polarization) effects as well as two-body exchange and dispersion interactions from first principles. They can fundamentally alter the role of computing in the studies of molecular crystals in the same way ab initio molecular orbital theories have transformed research practices in gas-phase physical chemistry and synthetic chemistry in the last half century. In this Account, after a brief summary of formalisms and algorithms, we discuss applications of these methods performed in our group as compelling

  14. AB-8大孔树脂对蓝莓花色苷的纯化研究%The purification study of blueberry anthocyanin on resin AB-8

    黄月鹏; 黄翠贤

    2012-01-01

    花色苷是一种水溶性的安全的天然色素。本论文以蓝莓花色苷提取液为原料。使用AB-8树脂对蓝莓花色苷精制工艺进行了研究。结果表明:AB-8树脂吸附流速为10mL/min,用40%乙醇洗脱,解吸流速为5mL/min。AB-8树脂饱和吸附量1.25mg/mL,树脂量是蓝莓花色苷量的3BV。蓝莓花色苷的纯度为38.1%。%Anthocyanin was a water-soluble, safe and natural pigment. Extraction of blueberry anthocyanin was used as raw material in this paper.lt was studied that technology of purifing resin AB-8 to blueberry anthocyanin. The results showed that the absorption speed of resin AB-8 was 10ml/min,the anthocyanin from blueberry was eluted with 40% ethanol at the flow rate of 5mL/min.The absorption capacity of the resin AB-8 was determined to be 1.25mg/mL. It revealed that ratio of resinAB-8 to blueberry anthocyanin solvent were 3BV. The purification of blueberry anthocyanin was 38.1%.

  15. Estudo das pausas em idosos Study of pauses in elderly

    Vanessa de Oliveira Martins

    2011-09-01

    Full Text Available OBJETIVO: Verificar a ocorrência de pausas na fala de idosos e sua distribuição quanto à frequência e a duração. MÉTODOS: Participaram deste estudo 128 idosos de ambos os gêneros, divididos em dois grupos: GI (60-79 anos e GII (a partir de 80 anos. Foram obtidas amostras de fala de todos os participantes para análise das rupturas de fala. As pausas foram classificadas como: hesitação (pausas de um a dois segundos e pausa propriamente dita (acima de dois segundos. A análise computou 200 sílabas fluentes de cada amostra de fala. Os grupos foram comparados quanto às seguintes variáveis: presença de pausas e hesitações; duração média das pausas; porcentagem de tempo de pausas; frequência de pausas e hesitações; e frequência geral. RESULTADOS: Para GII houve maior número de pausas e hesitações. Na análise da duração e da porcentagem de tempo de pausas não foi observada diferença entre os grupos. Em relação à frequência de pausas, hesitações e pausamento geral, observa-se diferença apenas para a última variável, com maior média de ocorrência para GII. CONCLUSÃO: Idosos com mais de 80 anos apresentam mais rupturas de fala por pausas que os idosos abaixo dessa idade. O estudo contribui como um balizador sobre as mudanças na fala relacionadas à quantidade de pausas e como um parâmetro comparativo para sintomas de doenças que se manifestam pelas variações de fala.PURPOSE: To verify the occurrence of pauses in the speech of elderly and their distribution according to frequency and duration. METHODS: Participants were 128 elderly subjects of both genders, divided into two groups: GI (60-79 years and GII (80 years and older. Speech samples were gathered from all participants for the analysis of speech disruptions. Pauses were classified as: hesitation (one to two seconds and pause (over two seconds. The analysis considered 200 fluent syllables in each speech sample. The groups were compared regarding the

  16. Estudos de cestóides de peixes do Brasil

    A. Arandas Rego

    1974-01-01

    Full Text Available Os autores iniciam com este trabalho um estudo sistemático de determinação dos cestóides de peixes depositados na Coleção helmintológica do Instituto Oswaldo Cruz. São referidas ou descritas as seguintes espécies e seus hospedeiros: Schizochoerus liguloideus (Diesing, 1850 e Nesolecithus janicki Posche, 1922, ambas de Arapaima gigas (Cuvier, (piracuru; Gyrocotyle meandrica Herrera, 1946, de Callorhynchus callorhynchus (L., (quimera; Acanthobothrium dasybati Yamaguti, 1934 e Pterobothriidae não identificado, de uma arraia não determinada; três tipos larvares de trypanorrhyncha e um de Proteocephalidea, de Cynoscion striatus (Cuv. e C. leiarchus (pescadinha; Proteocephalus jandia Woodland, 1934, de um bagre não determinado. Monticellia siluri (Fuhrmann, 1916 e Amphoteromorphus praeputialis sp. n. de Cetopsis caecutiens e Nomimoscolex magna sp. n. de Pimelodus clarias (mandi.The authors start, with this note, a systematic study for determination of cestodes of fishes of the Helminthological Collection of the Instituto Oswaldo Cruz. The following species and hosts are refered and described: Schizochoerus liguloideus (Diesing, 1850 and Nesolecithus janicki poche, 1922 both of Arapaima gigas (Cuvier; Gyrocotyle meandrica Herrera, 1946 of Callorhynchus callorhynchus (L.,Acanthobothrium dasybati Yamaguti, 1934 and Pterobothriidae unidentified, of an indeterminate ray; three types of larvae of Trypanorrhyncha and type of Proteocephalidea, of Cynoscion striatus (Cuv. and C. leiarchus; Proteocephalus jandia Woodland, 1934 of an indeterminate catfish; Monticellia siluri (Furhrmann, 1916 and Amphoteromorphus praeputialis sp. n. of Cetopsis caecutiens and Nomimoscolex magna sp. n. of Pimelodus clarias.

  17. Toxoplasmose em primatas neotropicais: estudo retrospectivo de sete casos

    Renata A. Casagrande

    2013-01-01

    Full Text Available A toxoplasmose é considerada uma doença parasitária fatal em primatas neotropicais. O objetivo deste trabalho foi descrever, através de um estudo retrospectivo, os casos de toxoplasmose em primatas neotropicais. No período de 1999-2009 foram realizados 86 exames anatomopatológicos em primatas e a toxoplasmose foi a enfermidade mais comum (7/86, relatando-se um caso em sagui-do-tufo-preto (Callithrix penicillata e seis em bugio-ruivo (Alouatta guariba. Dois animais foram encontrados mortos e cinco morreram em poucos dias. Os sinais clínicos mais frequentes foram apatia e anorexia (5/7, distensão abdominal (4/7 e febre (3/7. Na necropsia observou-se esplenomegalia (4/7, hemorragia do trato digestório, linfonodos e bexiga (4/7, pulmões avermelhados (3/7 e hepatomegalia (2/7. No exame histopatológico evidenciou-se hepatite (7/7, esplenite (3/7, miocardite (2/7, enterite (2/7, linfadenite (1/7 e sialite (1/7 necróticas e, pneumonia intersticial (4/7. Em fígado, pulmões, baço, coração, linfonodos e glândula salivar havia taquizoítos de Toxoplasma gondii que foram também detectados pelo exame de imuno-histoquímica anti-T. gondii em fígado, baço e pulmões (5/7. A toxoplasmose pode causar alta mortalidade em colônias de primatas neotropicais e representar mais uma ameaça à conversação dessas espécies em cativeiro. Sendo assim, medidas preventivas devem ser tomadas para evitar a contaminação desses animais.

  18. UM ESTUDO SOBRE CLIMA ORGANIZACIONAL NO AMBIENTE HOSPITALAR

    VIGNERON, D. M. S.

    2015-09-01

    Full Text Available Toda organização é composta por recursos materiais e por capital humano, e ambos estão intimamente ligados. Para melhor aproveitamento dos colaboradores, torna-se imprescindível ter em mente os conceitos de gestão de pessoas, sabendo-se que colaboradores satisfeitos são mais produtivos e levam à empresa ao sucesso. Segundo Bispo (2006 a pesquisa de clima organizacional é a mais objetiva e segura dentre todas as diversas ferramentas que são criadas constantemente para avaliar o nível de relacionamento entre empresas e colaboradores, podendo identificar problemas reais na gestão de Recursos Humanos. Este estudo tem por objetivo geral avaliar o Clima Organizacional em um Hospital Público do município de Campos dos Goytacazes, RJ. De forma específica, além de realizar um diagnóstico do grau de motivação dos colaboradores dentro do hospital através de uma pesquisa de Clima Organizacional, busca-se também conhecer o comportamento dos entrevistados em relação às variáveis que interferem no clima. Portanto este estudo apresenta-se a seguinte problemática: Quais os fatores que influenciam no Clima Organizacional do Hospital Público X? Para desenvolver este trabalho foi realizada uma pesquisa do tipo exploratória por meio do levantamento bibliográfico e estudo de caso que proporcionou maior familiaridade com o problema e com o objetivo proposto. A pesquisa foi aplicada na emergência de um hospital público na cidade de Campos dos Goytacazes – RJ, referência em atendimentos de emergência. O questionário para avaliação do Clima Organizacional foi adaptado de Santos et al. (2012 e dividido em duas partes. A primeira parte com perguntas referentes ao perfil dos respondentes e a segunda com perguntas relacionadas ao trabalho. Foram avaliados 42 colaboradores da emergência, com idade entre 18 e 60 anos, de ambos os sexos. Quanto ao perfil dos colaboradores constatou que a maioria tem entre 06 e 18 anos de empresa, revelando

  19. Ab initio evaluations of the He solubility in liquid Li

    Sedano, Luis A. [EURATOM-CIEMAT Assoc., Materials for Fusion Program, Bd. 43 P0.04, Avda. Complutense 22, 28040 Madrid (Spain)]. E-mail: luis.sedano@ciemat.es; Hassanein, Ahmed [Argonne Nat. Lab, 9700 South Class Av., Argonne, IL (United States)]. E-mail: hassanein@anl.gov; Sanz, Javier [ETSII-UNED, c/Juan del Rosal, 12, 28040 Madrid (E) (Spain)]. E-mail: jsanz@ind.UNED.es

    2005-11-15

    Modified embedding atom methods (MEAM) are developed to have predictions of the partial molar heat of solution (-H{sub s}) by direct simulation of metal cohesion, He-metal and He-He interaction. Transitions from crystalline Li to configurations, having the liquid Li structure's factors (h-bar (q)), are simulated ab initio. Once h-bar (q) reproduced, He atoms are added, one by one, to the Li system. Parallel lines for each case, with slopes clearly independent on the number of He atoms in the system, are obtained for energy versus pressure at given temperatures. Average differences between two adjacent parallels at zero pressure, once kinetic energy of the system discounted, represents the energy gained by an He atom when added to the Li system, related to the solution energy -H{sub s}. The molar excess entropy of gas in solution (S-bar {sub l}{sup ex}) is previously evaluated following diverse fundamental approaches: a 'thermodynamic liquid-hole' (TL-H) model for alkali liquids and a statistical-mechanics (Neff and McQuarrie's) model (SMM). Between 600 and 900 deg. C, a typical range of interest for the use of Li in fusion technology, the computed values for the (He) Henry's constant in Li range from 8x10{sup -14} to 10{sup -13} at. fr. Pa{sup -1}.

  20. Volumic omit maps in ab initio dual-space phasing.

    Oszlányi, Gábor; Sütő, András

    2016-07-01

    Alternating-projection-type dual-space algorithms have a clear construction, but are susceptible to stagnation and, thus, inefficient for solving the phase problem ab initio. To improve this behaviour new omit maps are introduced, which are real-space perturbations applied periodically during the iteration process. The omit maps are called volumic, because they delete some predetermined subvolume of the unit cell without searching for atomic regions or analysing the electron density in any other way. The basic algorithms of positivity, histogram matching and low-density elimination are tested by their solution statistics. It is concluded that, while all these algorithms based on weak constraints are practically useless in their pure forms, appropriate volumic omit maps can transform them to practically useful methods. In addition, the efficiency of the already useful reflector-type charge-flipping algorithm can be further improved. It is important that these results are obtained by using non-sharpened structure factors and without any weighting scheme or reciprocal-space perturbation. The mathematical background of volumic omit maps and their expected applications are also discussed. PMID:27357850

  1. Engineering Room-temperature Superconductors Via ab-initio Calculations

    Gulian, Mamikon; Melkonyan, Gurgen; Gulian, Armen

    The BCS, or bosonic model of superconductivity, as Little and Ginzburg have first argued, can bring in superconductivity at room temperatures in the case of high-enough frequency of bosonic mode. It was further elucidated by Kirzhnitset al., that the condition for existence of high-temperature superconductivity is closely related to negative values of the real part of the dielectric function at finite values of the reciprocal lattice vectors. In view of these findings, the task is to calculate the dielectric function for real materials. Then the poles of this function will indicate the existence of bosonic excitations which can serve as a "glue" for Cooper pairing, and if the frequency is high enough, and the dielectric matrix is simultaneously negative, this material is a good candidate for very high-Tc superconductivity. Thus, our approach is to elaborate a methodology of ab-initio calculation of the dielectric function of various materials, and then point out appropriate candidates. We used the powerful codes (TDDF with the DP package in conjunction with ABINIT) for computing dielectric responses at finite values of the wave vectors in the reciprocal lattice space. Though our report is concerned with the particular problem of superconductivity, the application range of the data processing methodology is much wider. The ability to compute the dielectric function of existing and still non-existing (though being predicted!) materials will have many more repercussions not only in fundamental sciences but also in technology and industry.

  2. Ab initio simulations of peptide-mineral interactions

    Hug, Susanna; Hunter, Graeme K.; Goldberg, Harvey; Karttunen, Mikko

    We performed Car-Parrinello Molecular Dynamics (CPMD) simulations of two amino acids, aspartic acid (Asp) and phophoserine (pSer), on a calcium oxalate monohydrate (COM) surface as a model of the interactions of phosphoproteins with biominerals. In our earlier work using in vitro experiments and classical Molecular Dynamics (MD) simulations we have demonstrated the importance of phosphorylation of serine on the interactions of osteopontin (OPN) with COM. We used configurations from our previous classical MD simulations as a starting point for the ab initio simulations. In the case of Asp we found that the α-carboxyl and amine groups form temporary close contacts with the surface. For the dipeptide Asp-pSer the carboxyl groups form permanent close contacts with the surface and the distances of its other functional groups do not vary much. We show how the interaction of carboxyl groups with COM crystal is established and confirm the importance of phosphorylation in mediating the interactions between COM surfaces and OPN.

  3. Ab initio transport across bismuth selenide surface barriers

    Narayan, Awadhesh

    2014-11-24

    © 2014 American Physical Society. We investigate the effect of potential barriers in the form of step edges on the scattering properties of Bi2Se3(111) topological surface states by means of large-scale ab initio transport simulations. Our results demonstrate the suppression of perfect backscattering, while all other scattering processes, which do not entail a complete spin and momentum reversal, are allowed. Furthermore, we find that the spin of the surface state develops an out-of-plane component as it traverses the barrier. Our calculations reveal the existence of quasibound states in the vicinity of the surface barriers, which appear in the form of an enhanced density of states in the energy window corresponding to the topological state. For double barriers we demonstrate the formation of quantum well states. To complement our first-principles results we construct a two-dimensional low-energy effective model and illustrate its shortcomings. Our findings are discussed in the context of a number of recent experimental works.

  4. Accurate ab initio vibrational energies of methyl chloride

    Two new nine-dimensional potential energy surfaces (PESs) have been generated using high-level ab initio theory for the two main isotopologues of methyl chloride, CH335Cl and CH337Cl. The respective PESs, CBS-35 HL, and CBS-37 HL, are based on explicitly correlated coupled cluster calculations with extrapolation to the complete basis set (CBS) limit, and incorporate a range of higher-level (HL) additive energy corrections to account for core-valence electron correlation, higher-order coupled cluster terms, scalar relativistic effects, and diagonal Born-Oppenheimer corrections. Variational calculations of the vibrational energy levels were performed using the computer program TROVE, whose functionality has been extended to handle molecules of the form XY 3Z. Fully converged energies were obtained by means of a complete vibrational basis set extrapolation. The CBS-35 HL and CBS-37 HL PESs reproduce the fundamental term values with root-mean-square errors of 0.75 and 1.00 cm−1, respectively. An analysis of the combined effect of the HL corrections and CBS extrapolation on the vibrational wavenumbers indicates that both are needed to compute accurate theoretical results for methyl chloride. We believe that it would be extremely challenging to go beyond the accuracy currently achieved for CH3Cl without empirical refinement of the respective PESs

  5. Accurate ab initio vibrational energies of methyl chloride

    Owens, Alec, E-mail: owens@mpi-muelheim.mpg.de [Max-Planck-Institut für Kohlenforschung, Kaiser-Wilhelm-Platz 1, 45470 Mülheim an der Ruhr (Germany); Department of Physics and Astronomy, University College London, Gower Street, WC1E 6BT London (United Kingdom); Yurchenko, Sergei N.; Yachmenev, Andrey; Tennyson, Jonathan [Department of Physics and Astronomy, University College London, Gower Street, WC1E 6BT London (United Kingdom); Thiel, Walter [Max-Planck-Institut für Kohlenforschung, Kaiser-Wilhelm-Platz 1, 45470 Mülheim an der Ruhr (Germany)

    2015-06-28

    Two new nine-dimensional potential energy surfaces (PESs) have been generated using high-level ab initio theory for the two main isotopologues of methyl chloride, CH{sub 3}{sup 35}Cl and CH{sub 3}{sup 37}Cl. The respective PESs, CBS-35{sup  HL}, and CBS-37{sup  HL}, are based on explicitly correlated coupled cluster calculations with extrapolation to the complete basis set (CBS) limit, and incorporate a range of higher-level (HL) additive energy corrections to account for core-valence electron correlation, higher-order coupled cluster terms, scalar relativistic effects, and diagonal Born-Oppenheimer corrections. Variational calculations of the vibrational energy levels were performed using the computer program TROVE, whose functionality has been extended to handle molecules of the form XY {sub 3}Z. Fully converged energies were obtained by means of a complete vibrational basis set extrapolation. The CBS-35{sup  HL} and CBS-37{sup  HL} PESs reproduce the fundamental term values with root-mean-square errors of 0.75 and 1.00 cm{sup −1}, respectively. An analysis of the combined effect of the HL corrections and CBS extrapolation on the vibrational wavenumbers indicates that both are needed to compute accurate theoretical results for methyl chloride. We believe that it would be extremely challenging to go beyond the accuracy currently achieved for CH{sub 3}Cl without empirical refinement of the respective PESs.

  6. Ab-initio calculations for dilute magnetic semiconductors

    Belhadji, Brahim

    2008-03-03

    This thesis focusses on ab-initio calculations for the electronic structure and the magnetic properties of dilute magnetic semiconductors (DMS). In particular we aim at the understanding of the complex exchange interactions in these systems. Our calculations are based on density functional theory, being ideally suited for a description of the material specific properties of the considered DMS. Moreover we use the KKR Green function method in connection with the coherent potential approximation (CPA), which allows to include the random substitutional disorder in a mean field-like approximation for the electronic structure. Finally we calculate the exchange coupling constants J{sub ij} between two impurities in a CPA medium by using the Lichtenstein formula and from this calculate the Curie temperature by a numerically exact Monte Carlo method. Based on this analysis we found and investigated four different exchange mechanisms being of importance in DMS systems: Double exchange, p-d exchange, antiferromagnetic superexchanges, and ferromagnetic superexchange. A second topic we have investigated in this thesis is the pressure dependence of the exchange interactions and the Curie temperatures in (Ga,Mn)As and (In,Mn)As, using the LDA and the LDA+U approximations. Exact calculations of T{sub C} by Monte Carlo simulations show a somehow different behavior. (orig.)

  7. Ab initio no-core solutions for $^6$Li

    Shin, Ik Jae; Maris, Pieter; Vary, James P; Forssén, Christian; Rotureau, Jimmy; Michel, Nicolas

    2016-01-01

    We solve for properties of $^6$Li in the ab initio No-Core Full Configuration approach and we separately solve for its ground state and $J^{\\pi}=2_{2}^{+}$ resonance with the Gamow Shell Model in the Berggren basis. We employ both the JISP16 and chiral NNLO$_{opt}$ realistic nucleon-nucleon interactions and investigate the ground state energy, excitation energies, point proton root-mean-square radius and a suite of electroweak observables. We also extend and test methods to extrapolate the ground state energy, point proton root-mean-square radius, and electric quadrupole moment. We attain improved estimates of these observables in the No-Core Full Configuration approach by using basis spaces up through N$_{max}$=18 that enable more definitive comparisons with experiment. Using the Density Matrix Renormalization Group approach with the JISP16 interaction, we find that we can significantly improve the convergence of the Gamow Shell Model treatment of the $^6$Li ground state and $J^{\\pi}=2_{2}^{+}$ resonance by ...

  8. Ab initio studies of phoshorene island single electron transistor.

    Ray, S J; Venkata Kamalakar, M; Chowdhury, R

    2016-05-18

    Phosphorene is a newly unveiled two-dimensional crystal with immense potential for nanoelectronic and optoelectronic applications. Its unique electronic structure and two dimensionality also present opportunities for single electron devices. Here we report the behaviour of a single electron transistor (SET) made of a phosphorene island, explored for the first time using ab initio calculations. We find that the band gap and the charging energy decrease monotonically with increasing layer numbers due to weak quantum confinement. When compared to two other novel 2D crystals such as graphene and MoS2, our investigation reveals larger adsorption energies of gas molecules on phosphorene, which indicates better a sensing ability. The calculated charge stability diagrams show distinct changes in the presence of an individual molecule which can be applied to detect the presence of different molecules with sensitivity at a single molecular level. The higher charging energies of the molecules within the SET display operational viability at room temperature, which is promising for possible ultra sensitive detection applications. PMID:27093536

  9. Ab initio studies of phosphorene island single electron transistor

    Ray, S. J.; Venkata Kamalakar, M.; Chowdhury, R.

    2016-05-01

    Phosphorene is a newly unveiled two-dimensional crystal with immense potential for nanoelectronic and optoelectronic applications. Its unique electronic structure and two dimensionality also present opportunities for single electron devices. Here we report the behaviour of a single electron transistor (SET) made of a phosphorene island, explored for the first time using ab initio calculations. We find that the band gap and the charging energy decrease monotonically with increasing layer numbers due to weak quantum confinement. When compared to two other novel 2D crystals such as graphene and MoS2, our investigation reveals larger adsorption energies of gas molecules on phosphorene, which indicates better a sensing ability. The calculated charge stability diagrams show distinct changes in the presence of an individual molecule which can be applied to detect the presence of different molecules with sensitivity at a single molecular level. The higher charging energies of the molecules within the SET display operational viability at room temperature, which is promising for possible ultra sensitive detection applications.

  10. Ab initio study of MoS2 nanotube bundles

    Verstraete, Matthieu; Charlier, Jean-Christophe

    2003-07-01

    Recently, the synthesis of a new phase of MoS2I1/3 stoichiometry was reported [M. Remskar, A. Mrzel, Z. Skraba, A. Jesih, M. Ceh, J. Demšar, P. Stadelmann, F. Lévy, and D. Mihailovic, Science 292, 479 (2001)]. Electron microscope images and diffraction data were interpreted to indicate bundles of sub-nanometer-diameter single-wall MoS2 nanotubes. After experimental characterization, the structure was attributed to an assembly of “armchair” nanotubes with interstitial iodine. Using first-principles total-energy calculations, bundles of MoS2 nanotubes with different topologies and stoichiometries are investigated. All of the systems are strongly metallic. Configurations with “zigzag” structures are found to be more stable energetically than the “armchair” ones, though all of the structures have similar stabilities. After relaxation, there remain several candidates which give a lattice parameter in relative agreement with experiment. Further, spin-polarized calculations indicate that a structure with armchair tubes iodine atoms in their center acquires a very large spontaneous magnetic moment of 12μB, while the other structures are nonmagnetic. Our ab initio calculations show that in most of the other structures, the tubes are very strongly bound together, and that the compounds should be considered as a crystal, rather than as a bundle of tubes in the habitual sense.

  11. Atmospheric Characterization of the Hot Jupiter Kepler-13Ab

    Shporer, Avi; Knutson, Heather A; Szabo, Gyula M; Zhao, Ming; Burrows, Adam; Fortney, Jonathan; Agol, Eric; Cowan, Nicolas B; Desert, Jean-Michel; Howard, Andrew W; Isaacson, Howard; Lewis, Nikole A; Showman, Adam P; Todorov, Kamen O

    2014-01-01

    (abridged) Kepler-13Ab (= KOI-13.01) is one of very few known short-period (1.76 day) transiting planets orbiting a bright A-type star. The availability of Kepler data allows a measurement of the planet's occultation (secondary eclipse) and orbital phase curve, which we combine with occultations observed by Spitzer at 3.6 micron and 4.5 micron and a ground-based occultation observation in the $Ks$ band (2.1 micron). For the day-side hemisphere we derive a temperate of 2,750 $\\pm$ 160 K as the effective temperature of a black body that will show the same occultation depths, and a high geometric albedo $A_g$ = 0.33$^{+0.04}_{-0.06}$. Comparing the occultation depths with one-dimensional planetary atmosphere models suggests the presence of an atmospheric temperature inversion. The Kepler mid-occultation time measured here is 34.0 $\\pm$ 6.9 s earlier than expected based on the mid-transit time reported in the literature and the expected time delay due to light travel time. This could be due to a small orbital ecc...

  12. Ab initio molecular dynamics calculations of ion hydration free energies

    We apply ab initio molecular dynamics (AIMD) methods in conjunction with the thermodynamic integration or 'λ-path' technique to compute the intrinsic hydration free energies of Li+, Cl-, and Ag+ ions. Using the Perdew-Burke-Ernzerhof functional, adapting methods developed for classical force field applications, and with consistent assumptions about surface potential (φ) contributions, we obtain absolute AIMD hydration free energies (ΔGhyd) within a few kcal/mol, or better than 4%, of Tissandier et al.'s [J. Phys. Chem. A 102, 7787 (1998)] experimental values augmented with the SPC/E water model φ predictions. The sums of Li+/Cl- and Ag+/Cl- AIMD ΔGhyd, which are not affected by surface potentials, are within 2.6% and 1.2 % of experimental values, respectively. We also report the free energy changes associated with the transition metal ion redox reaction Ag++Ni+→Ag+Ni2+ in water. The predictions for this reaction suggest that existing estimates of ΔGhyd for unstable radiolysis intermediates such as Ni+ may need to be extensively revised.

  13. Exploring the free energy surface using ab initio molecular dynamics

    Samanta, Amit; Morales, Miguel A.; Schwegler, Eric

    2016-04-01

    Efficient exploration of configuration space and identification of metastable structures in condensed phase systems are challenging from both computational and algorithmic perspectives. In this regard, schemes that utilize a set of pre-defined order parameters to sample the relevant parts of the configuration space [L. Maragliano and E. Vanden-Eijnden, Chem. Phys. Lett. 426, 168 (2006); J. B. Abrams and M. E. Tuckerman, J. Phys. Chem. B 112, 15742 (2008)] have proved useful. Here, we demonstrate how these order-parameter aided temperature accelerated sampling schemes can be used within the Born-Oppenheimer and the Car-Parrinello frameworks of ab initio molecular dynamics to efficiently and systematically explore free energy surfaces, and search for metastable states and reaction pathways. We have used these methods to identify the metastable structures and reaction pathways in SiO2 and Ti. In addition, we have used the string method [W. E, W. Ren, and E. Vanden-Eijnden, Phys. Rev. B 66, 052301 (2002); L. Maragliano et al., J. Chem. Phys. 125, 024106 (2006)] within the density functional theory to study the melting pathways in the high pressure cotunnite phase of SiO2 and the hexagonal closed packed to face centered cubic phase transition in Ti.

  14. Exploring the free energy surface using ab initio molecular dynamics.

    Samanta, Amit; Morales, Miguel A; Schwegler, Eric

    2016-04-28

    Efficient exploration of configuration space and identification of metastable structures in condensed phase systems are challenging from both computational and algorithmic perspectives. In this regard, schemes that utilize a set of pre-defined order parameters to sample the relevant parts of the configuration space [L. Maragliano and E. Vanden-Eijnden, Chem. Phys. Lett. 426, 168 (2006); J. B. Abrams and M. E. Tuckerman, J. Phys. Chem. B 112, 15742 (2008)] have proved useful. Here, we demonstrate how these order-parameter aided temperature accelerated sampling schemes can be used within the Born-Oppenheimer and the Car-Parrinello frameworks of ab initio molecular dynamics to efficiently and systematically explore free energy surfaces, and search for metastable states and reaction pathways. We have used these methods to identify the metastable structures and reaction pathways in SiO2 and Ti. In addition, we have used the string method [W. E, W. Ren, and E. Vanden-Eijnden, Phys. Rev. B 66, 052301 (2002); L. Maragliano et al., J. Chem. Phys. 125, 024106 (2006)] within the density functional theory to study the melting pathways in the high pressure cotunnite phase of SiO2 and the hexagonal closed packed to face centered cubic phase transition in Ti. PMID:27131525

  15. Ab initio study of optical excitations in VO2

    Coulter, John; Gali, Adam; Manousakis, Efstratios

    2014-03-01

    Motivated by recent experimental efforts to fabricate p-n junctions from transition metal oxides (TMOs) and a recent theoretical study claiming TMOs to be good absorbers and promising materials for efficient carrier multiplication, we study the optical properties of a prototypical TMO, the insulator M1 phase of vanadium dioxide (VO2), by ab initio methods. We applied the Bethe-Salpeter equations (BSE) to calculate the optical properties, starting from self-consistent GW quasi-particle energy levels and states. In contrast to expectations, the exciton binding energy obtained by BSE is in good agreement with the experiment. We find that the electron-electron interaction is very strong which makes this material promising for efficient carrier multiplication that might lead to an enhanced efficiency in photo-voltaics applications. To illustrate this more quantitatively, we calculated the impact ionization rate within the independent quasiparticle approximation, and find that the rate is significantly higher than silicon in the region of highest solar intensity, due to the strong multiple carrier excitations.

  16. A coupled "AB" system: Rogue waves and modulation instabilities

    Wu, C. F.; Grimshaw, R. H. J.; Chow, K. W.; Chan, H. N.

    2015-10-01

    Rogue waves are unexpectedly large and localized displacements from an equilibrium position or an otherwise calm background. For the nonlinear Schrödinger (NLS) model widely used in fluid mechanics and optics, these waves can occur only when dispersion and nonlinearity are of the same sign, a regime of modulation instability. For coupled NLS equations, rogue waves will arise even if dispersion and nonlinearity are of opposite signs in each component as new regimes of modulation instability will appear in the coupled system. The same phenomenon will be demonstrated here for a coupled "AB" system, a wave-current interaction model describing baroclinic instability processes in geophysical flows. Indeed, the onset of modulation instability correlates precisely with the existence criterion for rogue waves for this system. Transitions from "elevation" rogue waves to "depression" rogue waves are elucidated analytically. The dispersion relation as a polynomial of the fourth order may possess double pairs of complex roots, leading to multiple configurations of rogue waves for a given set of input parameters. For special parameter regimes, the dispersion relation reduces to a cubic polynomial, allowing the existence criterion for rogue waves to be computed explicitly. Numerical tests correlating modulation instability and evolution of rogue waves were conducted.

  17. Ab initio simulations on rutile-based titania nanowires

    Zhukovskii, Yu F.; Evarestov, R. A.

    2012-08-01

    The rod symmetry groups for monoperiodic (1D) nanostructures have been applied for construction of models for bulk-like TiO2 nanowires (NWs) cut from a rutile-based 3D crystal along the chosen [001] and [110] directions of crystallographic axes. In this study, we have considered nanowires described by both the Ti-atom centered rotation axes as well as the hollow site centered axes passing through the interstitial positions between the Ti and O atoms closest to the axes. The most stable [001]-oriented TiO2 NWs with rhombic cross sections are found to display the energetically preferable {110} facets only while the nanowires with quasi-square sections across the [110] axis are formed by the alternating { 1bar 10 } and {001} facets. For simulations on rutile-based nanowires possessing different diameters for each NW type, we have performed large-scale ab initio Density Functional Theory (DFT) and hybrid DFT-Hartree Fock (DFT-HF) calculations with total geometry optimization within the Generalized Gradient Approximation (GGA) in the form of the Perdew-Becke-Ernzenhof (PBE) exchange-correlation functionals (PBE and PBE0, respectively), using the formalism of linear combination of localized atomic functions (LCAO). We have simulated both structural and electronic properties of TiO2 NWs depending both on orientation and position of symmetry axes as well as on diameter and morphology of nanowires.

  18. The wonderful complexity of the Mira AB system

    Ramstedt, S; Vlemmings, W H T; Maercker, M; Montez, R; Baudry, A; De Beck, E; Lindqvist, M; Olofsson, H; Humphreys, E M L; Jorissen, A; Kerschbaum, F; Mayer, A; Wittkowski, M; Cox, N L J; Lagadec, E; Leal-Ferreira, M L; Paladini, C; Pérez-Sánchez, A; Sacuto, S

    2014-01-01

    We have mapped the CO(3-2) line emission around the Mira AB system at 0.5 resolution using the Atacama Large Millimeter/submillimeter Array (ALMA). The CO map shows amazing complexity. The circumstellar gas has been shaped by different dynamical actors during the evolution of the system and several morphological components can be identified. The companion is marginally resolved in continuum emission and is currently at 0.487$\\pm$0.006 separation. In the main line component, centered on the stellar velocity, spiral arcs around Mira A are found. The spiral appears to be relatively flat and oriented in the orbital plane. An accretion wake behind the companion is clearly visible and the projected arc separation is of order 5''. In the blue wing of the line emission, offset from the main line, several large ($\\sim$5-10''), opposing arcs are found. We tentatively suggest that this structure is created by the wind of Mira B blowing a bubble in the expanding envelope of Mira A.

  19. Development of materials science by Ab initio powder diffraction analysis

    Crystal structure is most important information to understand properties and behavior of target materials. Technique to analyze unknown crystal structures from powder diffraction data (ab initio powder diffraction analysis) enables us to reveal crystal structures of target materials even we cannot obtain a single crystal. In the present article, three examples are introduced to show the power of this technique in the field of materials sciences. The first example is dehydration/hydration of the pharmaceutically relevant material erythrocycin A. In this example, crystal structures of two anhydrous phases were determined from synchrotron X-ray powder diffraction data and their different dehydration/hydration properties were understood from the crystal structures. In the second example, a crystal structure of a three dimensional metal-organic-framework prepared by a mechanochemical reaction was determined from laboratory X-ray powder diffraction data and the reaction scheme has been revealed. In the third example, a crystal structure of a novel oxide-ion conductor of a new structure family was determined from synchrotron X-ray and neutron powder diffraction data which gave an important information to understand the mechanism of the oxide-ion conduction. (author)

  20. Experimental, ab initio and density functional theory studies on sulfadiazine

    Ogruc-Ildiz, Gulce; Akyuz, Sevim; Ozel, Aysen E.

    2009-04-01

    In the present study, combined experimental and computational study on molecular vibrations of free sulfadiazine has been reported. The theoretically possible stable conformers of free sulfadiazine molecule in electronically ground state were searched by means of torsion potential energy surfaces scan studies through C1 sbnd C7 sbnd S8 sbnd N8, C7 sbnd S8 sbnd N9 sbnd C10 and S8 sbnd N9 sbnd C10 sbnd N11 dihedral angles, at both semi-empirical PM3 and B3LYP/3-21G levels of theory. The final geometrical parameters for the obtained stable conformers were determined by means of geometry optimization carried out at ab initio HF/6-31G++(d,p) and DFT/B3LYP/6-31G++(d,p) theory levels. The harmonic and anharmonic vibrational wavenumbers and IR intensities were calculated at the same theory levels used in geometry optimization. The modes of the fundamental vibrations were characterized depending on their the total energy distribution (TED%). In order to fit the calculated harmonic wavenumbers to experimental ones, dual scale factors were used. The experimental infrared and Raman spectra of sulfadiazine in solid phase have been measured and compared with the calculated vibrational spectra of each conformer.

  1. The Solar-System-Scale Disk Around AB Aurigae

    Oppenheimer, Ben R; Hinkley, Sasha; Zimmerman, Neil; Sivaramakrishnan, Anand; Soummer, Remi; Kuhn, Jeffrey; Graham, James R; Perrin, Marshall; Lloyd, James P; Roberts, Lewis C Jr; Harrington, David M

    2008-01-01

    The young star AB Aurigae is surrounded by a complex combination of gas-rich and dust dominated structures. The inner disk which has not been studied previously at sufficient resolution and imaging dynamic range seems to contain very little gas inside a radius of least 130 astronomical units (AU) from the star. Using adaptive-optics coronagraphy and polarimetry we have imaged the dust in an annulus between 43 and 302 AU from the star, a region never seen before. An azimuthal gap in an annulus of dust at a radius of 102 AU, along with a clearing at closer radii inside this annulus, suggests the formation of at least one small body at an orbital distance of about 100 AU. This structure seems consistent with crude models of mean motion resonances, or accumulation of material at two of the Lagrange points relative to the putative object and the star. We also report a low significance detection of a point source in this outer annulus of dust. This source may be an overdensity in the disk due to dust accreting onto...

  2. Heat shock protein 90AB1 and hyperthermia rescue infectivity of HIV with defective cores.

    Joshi, Pheroze; Sloan, Barbara; Torbett, Bruce E; Stoddart, Cheryl A

    2013-02-01

    We previously showed that reduced infectivity of HIV with incompletely processed capsid-spacer protein 1 (CA-SP1) is rescued by cellular activation or increased expression of HSP90AB1, a member of the cytosolic heat shock protein 90 family. Here we show that HSP90AB1 is present in HIV virions and that HSP90AB1, but not nonfunctional mutated HSP90AB1(E42A+D88A), restores infectivity to HIV with mutations in CA that alter core stability. Further, the CA mutants were hypersensitive to pharmacological inhibition of HSP90AB1. In agreement with Roesch et al. (2012), we found that culturing HIV at 39.5°C enhanced viral infectivity up to 30-fold in human peripheral blood mononuclear cells (p=0.002) and rescued CA-mutant infectivity in nonactivated cells, concurrent with elevated expression of HSP90AB1 during hyperthermia. In sum, the transdominant effect of HSP90AB1 on CA-mutant HIV infectivity suggests a potential role for this class of cellular chaperones in HIV core stability and uncoating. PMID:23200770

  3. Effect of Compatibilizers on the Morphological Properties of ABS and LCP Blends

    C. K. Das

    2007-12-01

    Full Text Available The blends of acrylonitrile butadiene styrene (ABS polymer and liquid crystalline polymer (LCP were prepared using a melt-blending technique in presence and absence of different types of nanosilica. The effect of Zn++ coated nanosilica on thermal, dynamic mechanical, and morphological properties of ABS/LCP blends was studied. The Zn++ coated nanosilica showed a significant effect on the above-mentioned properties of ABS/LCP blends by reacting at the interface between ABS and LCP. A substantial improvement in storage modulus of ABS/LCP blends was observed in presence of Zn++ coated nanosilica. Epoxy encapsulated nanosilica was also used as a compatibilizer in this blend system. It is known that the epoxy end group reacts with the LCP reacting groups. But in this case, we cannot find desirable results, may be due to the presence of ABS as the matrix. So Zn-ion-coated nanosilica proved to be better than that epoxy encapsulated nanosilica for the ABS/LCP containing blends. The SEM morphology also corroborates the above-mentioned argument.

  4. Stacking stability of MoS2 bilayer: An ab initio study

    Tao, Peng; Guo, Huai-Hong; Yang, Teng; Zhang, Zhi-Dong

    2014-10-01

    The study of the stacking stability of bilayer MoS2 is essential since a bilayer has exhibited advantages over single layer MoS2 in many aspects for nanoelectronic applications. We explored the relative stability, optimal sliding path between different stacking orders of bilayer MoS2, and (especially) the effect of inter-layer stress, by combining first-principles density functional total energy calculations and the climbing-image nudge-elastic-band (CI-NEB) method. Among five typical stacking orders, which can be categorized into two kinds (I: AA, AB and II: AA', AB', A'B), we found that stacking orders with Mo and S superposing from both layers, such as AA' and AB, is more stable than the others. With smaller computational efforts than potential energy profile searching, we can study the effect of inter-layer stress on the stacking stability. Under isobaric condition, the sliding barrier increases by a few eV/(ucGPa) from AA' to AB', compared to 0.1 eV/(ucGPa) from AB to [AB]. Moreover, we found that interlayer compressive stress can help enhance the transport properties of AA'. This study can help understand why inter-layer stress by dielectric gating materials can be an effective means to improving MoS2 on nanoelectronic applications.

  5. On Maintenance of Electronic Anti-lock Braking System (ABS)%电控防抱死制动系统(ABS)的检修

    吴继刚

    2015-01-01

    随着汽车制动系统技术的不断改进,电控防抱死ABS系统已逐渐成为汽车的标准配件,了解电控防抱死ABS系统的维修技术对汽车制动系统的维修和故障诊断工作十分重要.ABS主要部件的检修包括:ABS ECU的检修、轮速传感器的检修、液压控制装置的检修、制动压力调节器的检修.%With the continuous improvement of technology related to automobile braking system,electronic anti-lock ABS system has gradually become one of the standard fittings of automobile,to learn maintenance technology related to electronic anti-lock ABS system is of great importance to maintain and fault diagnosing of automobile braking system.The maintenance for main components of ABS includes the maintenance for ABS ECU,wheel speed sensor,hydraulic controlled devices,braking pressure regulator,etc.

  6. New terpolymers as hydrogels for oral protein delivery application.

    Mahkam, Mehrdad

    2009-01-01

    The purpose of this study is to develop novel intestinal-specific insulin delivery systems with pH-sensitive swelling and drug release properties. The glucose-6-acrylate-1,2,3,4-tetraacetate (GATA) monomer was prepared under mild conditions. Cubane-1,4-dicarboxylic acid linked to two 2-hydroxyethyl methacrylate groups was the crosslinking agent (CA). Methacrylic-type polymeric prodrugs were synthesized by free-radical copolymerization of methacrylic acid (MAA), poly(ethylene glycol)monomethyl ether methacrylate, and GATA in the presence of cubane as a crosslinking agent. The composition of the crosslinked three-dimensional polymers was determined by FTIR spectroscopy. Equilibrium swelling studies were carried out in enzyme-free simulated gastric and intestinal fluids (SGF and SIF, respectively). Insulin was entrapped in these gels and the in vitro release profiles were established separately in both SGF (pH 1) and SIF (pH 7.4). Drug release studies showed that the increasing content of MAA in the copolymer enhances hydrolysis in SIF. In these cases, the biological activity of insulin was retained. These results were used to design and improve protein release behavior from these carriers. PMID:19016070

  7. The adnAB Locus, Encoding a Putative Helicase-Nuclease Activity, Is Essential in Streptomyces

    Zhang, Lingli; Nguyen, Hoang Chuong; Chipot, Ludovic; Piotrowski, Emilie; Bertrand, Claire; Thibessard, Annabelle; Leblond, Pierre

    2014-01-01

    Homologous recombination is a crucial mechanism that repairs a wide range of DNA lesions, including the most deleterious ones, double-strand breaks (DSBs). This multistep process is initiated by the resection of the broken DNA ends by a multisubunit helicase-nuclease complex exemplified by Escherichia coli RecBCD, Bacillus subtilis AddAB, and newly discovered Mycobacterium tuberculosis AdnAB. Here we show that in Streptomyces, neither recBCD nor addAB homologues could be detected. The only pu...

  8. AdnAB: a new DSB-resecting motor–nuclease from mycobacteria

    Sinha, Krishna Murari; Unciuleac, Mihaela-Carmen; Glickman, Michael S.; Shuman, Stewart

    2009-01-01

    The resection of DNA double-strand breaks (DSBs) in bacteria is a motor-driven process performed by a multisubunit helicase–nuclease complex: either an Escherichia coli-type RecBCD enzyme or a Bacillus-type AddAB enzyme. Here we identify mycobacterial AdnAB as the founder of a new family of heterodimeric helicase–nucleases with distinctive properties. The AdnA and AdnB subunits are each composed of an N-terminal UvrD-like motor domain and a C-terminal nuclease module. The AdnAB ATPase is trig...

  9. Studies on Synthesis and Antitumor Activity of Phosphorylated Achyranthes bidentata Polysaccharide (P-AbPS)

    CHEN,Xiao-Ming(陈晓明); ZHANG,Jian(张健); TIAN,Geng-Yuan(田庚元)

    2002-01-01

    The synthesis of phosphorylated Achyranthes bidentata polysaccharide (P-AbPS) was reported based on different strategies.The P-AbPS with high degree of substitution (D.S. >0.5) was obtained when phosphorus oxychloride (POCl3) was used as a phosphorylating agent and trimethyl phosphate-pyridine or dimethyl formamide was used as solvent. The influences of different solvents and reaction conditins were discussed. Thepharmacology assay shows that P-AbPS possesses antitumor activity against sarcoma 180 and Lewis lung carner in mice.

  10. Emergence of rotational bands in ab initio no-core configuration interaction calculations

    Caprio, M A; Vary, J P; Smith, R

    2015-01-01

    Rotational bands have been observed to emerge in ab initio no-core configuration interaction (NCCI) calculations for p-shell nuclei, as evidenced by rotational patterns for excitation energies, electromagnetic moments, and electromagnetic transitions. We investigate the ab initio emergence of nuclear rotation in the Be isotopes, focusing on 9Be for illustration, and make use of basis extrapolation methods to obtain ab initio predictions of rotational band parameters for comparison with experiment. We find robust signatures for rotational motion, which reproduce both qualitative and quantitative features of the experimentally observed bands.

  11. STUDIES ON FLAME-RETARDANT PC/ABS MULTIPLE-ELEMENT ALLOY

    Ying Quan; Ming-shah Yang; Qing Yah

    2001-01-01

    The preparation technology of flame-retardant PC/ABS alloys was studied in this paper. Using a high-efficiency flame retardant system and by means of multiple-ingredient compatibilizing, PC/ABS alloys with excellent impact strength and flame retardant property were prepared. The experimental results showed that by using PS-g-MAH and SMA as synergistic compatibilizers, the notched Izod impact strength and flammability of PC/ABS alloy obtained in the present work can be up to 175 J/m and UL-94 V0, respectively.

  12. Immunogenicity of mAbs in non-human primates during nonclinical safety assessment

    2013-01-01

    The immunogenicity of biopharmaceuticals used in clinical practice remains an unsolved challenge in drug development. Non-human primates (NHPs) are often the only relevant animal model for the development of monoclonal antibodies (mAbs), but the immune response of NHPs to therapeutic mAbs is not considered to be predictive of the response in humans because of species differences. In this study, we accessed the drug registration files of all mAbs registered in the European Union to establish t...

  13. SatR Is a Repressor of Fluoroquinolone Efflux Pump SatAB

    Escudero, Jose Antonio; San Millan, Alvaro; Montero, Natalia; Gutierrez, Belen; Ovejero, Cristina Martinez; Carrilero, Laura; González-Zorn, Bruno

    2013-01-01

    Streptococcus suis is an emerging zoonotic agent responsible for high-mortality outbreaks among the human population in China. In this species, the ABC transporter SatAB mediates fluoroquinolone resistance when overexpressed. Here, we describe and characterize satR, an open reading frame (ORF) encoding a MarR superfamily regulator that acts as a repressor of satAB. satR is cotranscribed with satAB, and its interruption entails the overexpression of the pump, leading to a clinically relevant i...

  14. Preparación y caracterización de mezclas REX-PLA / ABS

    Constans Solé, Nil

    2015-01-01

    El presente proyecto se centra en la producción y caracterización de mezclas de poli(ácido láctico) modificado mediante un extensor de cadena (REX-PLA) con Acrilonitrilo-Butadieno- Estireno (ABS), usando ABS injertado con ácido anhídrido maleico (ABS-g-MAH) como compatibilizante. La primera etapa de la preparación de las mezclas consiste en la obtención de REX-PLA por extrusión reactiva en una extrusora de doble husillo. Se llevan a cabo acciones de mejora del proceso produc...

  15. Performance of the molecular Alere I influenza A&B test compared to that of the xpert flu A/B assay.

    Chapin, Kimberle C; Flores-Cortez, Estefany J

    2015-02-01

    Data on the performance of rapid molecular point-of-care use platforms for diagnosis of influenza are lacking. We validated nasopharyngeal (NP) flocked specimens in universal transport medium (UTM) and evaluated the clinical sensitivity and specificity of the Alere i influenza A&B test compared to those of the Xpert flu A/B assay. The Alere i influenza A&B test had an overall sensitivity and specificity of 93.8% and 62.5% for influenza A, respectively, and of 91.8% and 53.6% for influenza B, respectively. The poor specificity was due to influenza virus samples determined positive for both type A and B. PMID:25502527

  16. Performance of the Molecular Alere i Influenza A&B Test Compared to That of the Xpert Flu A/B Assay

    Flores-Cortez, Estefany J.

    2014-01-01

    Data on the performance of rapid molecular point-of-care use platforms for diagnosis of influenza are lacking. We validated nasopharyngeal (NP) flocked specimens in universal transport medium (UTM) and evaluated the clinical sensitivity and specificity of the Alere i influenza A&B test compared to those of the Xpert flu A/B assay. The Alere i influenza A&B test had an overall sensitivity and specificity of 93.8% and 62.5% for influenza A, respectively, and of 91.8% and 53.6% for influenza B, respectively. The poor specificity was due to influenza virus samples determined positive for both type A and B. PMID:25502527

  17. Eletrocardiografia computadorizada em cães: estudo comparativo

    Lídia S. Oliveira

    2013-07-01

    Full Text Available O método de eletrocardiografia computadorizada (ECG-C vem sendo crescentemente difundido na medicina veterinária, havendo atualmente diversas marcas e modelos de eletrocardiógrafos disponíveis no mercado. Diante da possibilidade de diferenças na sensibilidade e na reprodutibilidade das medidas obtidas nos traçados, o presente estudo teve como objetivo comparar os parâmetros eletrocardiográficos de cães, obtidos por dois sistemas. Foram avaliados dois diferentes softwares computadorizados, o Wincardio Micromed® (WIN e o modelo TEB ECGPC® (TEB. Quarenta e dois cães hígidos, de diferentes raças (Cocker Spaniel, Daschund, Labrador, Pinscher, Pit Bull Terrier Poodle, Schnauzer, Shit Tzu, Yorkshire e sem raça definida, machos e fêmeas e com idade entre 4 meses e 16 anos foram agrupados segundo o peso e examinados pelos dois sistemas. As medidas eletrocardiográficas dos diferentes traçados foram analisadas na derivação DII. Os resultados indicaram que o sistema TEB apresentou maior sensibilidade na obtenção das medidas de duração da onda P e do complexo QRS, enquanto o sistema WIN foi mais sensível para determinar as medidas de amplitude dos mesmos parâmetros. Os animais de maior porte (26-37kg apresentaram maior variância nas medidas de duração e amplitude de onda P e duração do complexo QRS em comparação aos cães de médio (14-25kg e pequeno (1-13kg porte. O achado de diferenças entre os sistemas testados deve ser levado em consideração ao se empregar os diversos equipamentos para diagnóstico por meio de ECG-C na rotina clínica, de modo a evitarem-se divergências na interpretação dos exames entre diferentes prestadores de serviços veterinários.

  18. Novel human anti-claudin 1 mAbs inhibit hepatitis C virus infection and may synergize with anti-SRB1 mAb.

    Paciello, Rolando; Urbanowicz, Richard A; Riccio, Gennaro; Sasso, Emanuele; McClure, C Patrick; Zambrano, Nicola; Ball, Jonathan K; Cortese, Riccardo; Nicosia, Alfredo; De Lorenzo, Claudia

    2016-01-01

    Hepatitis C virus (HCV) is a major cause of chronic hepatitis and liver carcinoma and new therapies based on novel targets are needed. The tight junction protein claudin 1 (CLDN-1) is essential for HCV cell entry and spread, and anti-CLDN-1 rat and mouse mAbs are safe and effective in preventing and treating HCV infection in a human liver chimeric mouse model. To accelerate translation of these observations into a novel approach to treat HCV infection and disease in humans, we screened a phage display library of human single-chain antibody fragments by using a panel of CLDN-1-positive and -negative cell lines and identified phage specifically binding to CLDN-1. The 12 clones showing the highest levels of binding were converted into human IgG4. Some of these mAbs displayed low-nanomolar affinity, and inhibited infection of human hepatoma Huh7.5 cells by different HCV isolates in a dose-dependent manner. Cross-competition experiments identified six inhibitory mAbs that recognized distinct epitopes. Combination of the human anti-SRB1 mAb C-1671 with these anti-CLDN-1 mAbs could either increase or reduce inhibition of cell culture-derived HCV infection in vitro. These novel human anti-CLDN-1 mAbs are potentially useful to develop a new strategy for anti-HCV therapy and lend support to the combined use of antibodies targeting the HCV receptors CLDN-1 and SRB1, but indicate that care must be taken in selecting the proper combination. PMID:26519290

  19. Ab initio no-core shell model with continuum

    Navratil, Petr

    2008-04-01

    The ab initio no-core shell model (NCSM) is a many-body approach to nuclear structure of light nuclei. The NCSM adopts an effective interaction theory to transform fundamental inter-nucleon interactions into effective interactions for a specified nucleus in a selected harmonic oscillator basis space [1]. The method is capable of predicting nuclear structure from inter-nucleon forces derived from quantum chromodynamics by means of chiral effective field theory [2]. NCSM extensions to the microscopic description of nuclear reactions are now under development. In my talk, I will first discuss our recent calculations of the ^4He total photo-absorption cross section using two- and three-nucleon interactions from chiral effective field theory [3]. I will then outline our effort to augment the NCSM by the resonating group method (RGM) technique to develop a new method capable of describing simultaneously both bound states and nuclear reactions on light nuclei [4]. This approach, which preserves translational symmetry and the Pauli principle, will allow us to calculate cross sections of reactions important for astrophysics and describe weakly-bound systems from first principles. I will present our first phase shift results for neutron scattering off ^3H, ^4He and ^7Li and proton scattering off ^3He, ^4He and ^7Be using realistic nucleon-nucleon potentials. 3mm [1] P. Navr'atil, J. P. Vary and B. R. Barrett, Phys. Rev. C 62, 054311 (2000). [2] P. Navr'atil and V. G. Gueorguiev and J. P. Vary, W. E. Ormand and A. Nogga, Phys. Rev. Lett. 99, 042501 (2007). [3] S. Quaglioni and P. Navr'atil, Phys. Lett. B 652, 370 (2007). [4] S. Quaglioni and P. Navr'atil, arXiv:0712.0855.

  20. Ab initio quantum transport calculations using plane waves

    Garcia-Lekue, A.; Vergniory, M. G.; Jiang, X. W.; Wang, L. W.

    2015-08-01

    We present an ab initio method to calculate elastic quantum transport at the nanoscale. The method is based on a combination of density functional theory using plane wave nonlocal pseudopotentials and the use of auxiliary periodic boundary conditions to obtain the scattering states. The method can be applied to any applied bias voltage and the charge density and potential profile can either be calculated self-consistently, or using an approximated self-consistent field (SCF) approach. Based on the scattering states one can straightforwardly calculate the transmission coefficients and the corresponding electronic current. The overall scheme allows us to obtain accurate and numerically stable solutions for the elastic transport, with a computational time similar to that of a ground state calculation. This method is particularly suitable for calculations of tunneling currents through vacuum, that some of the nonequilibrium Greens function (NEGF) approaches based on atomic basis sets might have difficulty to deal with. Several examples are provided using this method from electron tunneling, to molecular electronics, to electronic devices: (i) On a Au nanojunction, the tunneling current dependence on the electrode-electrode distance is investigated. (ii) The tunneling through field emission resonances (FERs) is studied via an accurate description of the surface vacuum states. (iii) Based on quantum transport calculations, we have designed a molecular conformational switch, which can turn on and off a molecular junction by applying a perpendicular electric field. (iv) Finally, we have used the method to simulate tunnel field-effect transistors (TFETs) based on two-dimensional transition-metal dichalcogenides (TMDCs), where we have studied the performance and scaling limits of such nanodevices and proposed atomic doping to enhance the transistor performance.

  1. An ab initio study of plutonium oxides surfaces

    By means of first-principles calculations, we have studied the atomic structure as well as the thermodynamic stability of various plutonium dioxide surfaces in function of their environment (in terms of oxygen partial pressure and temperature). All these simulations have been performed with the ABINIT code. It is well known that DFT fails to describe correctly plutonium-based materials since 5f electrons in such systems are strongly correlated. In order to go beyond DFT, we have treated PuO2 and β-Pu2O3 in a DFT+U framework. We show that the couple of parameters (U,J) that works well for pure Pu is also well designed for describing ground state (GS) properties of these two oxides. The major improvement with respect with DFT is that we are able to predict an insulating GS in agreement with experiments. The presence of a gap in the DOS (Density of States) of plutonium oxides should play a significant role in the predicted surface reactivity. However, performing DFT+U calculations on surfaces of plutonium oxide from scratch was too ambitious. That is why we decided, as a first step, to study the stability of the (100), (110) and (111) surfaces of PuO2 in a DFT-GGA framework. For each of these orientations, we considered various terminations. These ab initio results have been introduced in a thermodynamic model which allows us to predict the relative stability of the different terminations as a function of temperature and oxygen partial pressure (pO2). We conclude that at room temperature and for pO2∼10 atm., the polar O2-(100) termination is favoured. The stabilization of such a polar stoichiometric surface is surprising and should be confirmed by DFT+U calculations before any final conclusion. (authors)

  2. Atmospheric characterization of the hot Jupiter Kepler-13Ab

    Kepler-13Ab (= KOI-13.01) is a unique transiting hot Jupiter. It is one of very few known short-period planets orbiting a hot A-type star, making it one of the hottest planets currently known. The availability of Kepler data allows us to measure the planet's occultation (secondary eclipse) and phase curve in the optical, which we combine with occultations observed by warm Spitzer at 4.5 μm and 3.6 μm and a ground-based occultation observation in the Ks band (2.1 μm). We derive a day-side hemisphere temperature of 2750 ± 160 K as the effective temperature of a black body showing the same occultation depths. Comparing the occultation depths with one-dimensional planetary atmosphere models suggests the presence of an atmospheric temperature inversion. Our analysis shows evidence for a relatively high geometric albedo, A g = 0.33−0.06+0.04. While measured with a simplistic method, a high A g is supported also by the fact that the one-dimensional atmosphere models underestimate the occultation depth in the optical. We use stellar spectra to determine the dilution, in the four wide bands where occultation was measured, due to the visual stellar binary companion 1.''15 ± 0.''05 away. The revised stellar parameters measured using these spectra are combined with other measurements, leading to revised planetary mass and radius estimates of Mp = 4.94-8.09 M J and Rp = 1.406 ± 0.038 R J. Finally, we measure a Kepler midoccultation time that is 34.0 ± 6.9 s earlier than expected based on the midtransit time and the delay due to light-travel time and discuss possible scenarios.

  3. Atmospheric Characterization of the Hot Jupiter Kepler-13Ab

    Shporer, Avi; O'Rourke, Joseph G.; Knutson, Heather A.; Szabó, Gyula M.; Zhao, Ming; Burrows, Adam; Fortney, Jonathan; Agol, Eric; Cowan, Nicolas B.; Desert, Jean-Michel; Howard, Andrew W.; Isaacson, Howard; Lewis, Nikole K.; Showman, Adam P.; Todorov, Kamen O.

    2014-06-01

    Kepler-13Ab (= KOI-13.01) is a unique transiting hot Jupiter. It is one of very few known short-period planets orbiting a hot A-type star, making it one of the hottest planets currently known. The availability of Kepler data allows us to measure the planet's occultation (secondary eclipse) and phase curve in the optical, which we combine with occultations observed by warm Spitzer at 4.5 μm and 3.6 μm and a ground-based occultation observation in the Ks band (2.1 μm). We derive a day-side hemisphere temperature of 2750 ± 160 K as the effective temperature of a black body showing the same occultation depths. Comparing the occultation depths with one-dimensional planetary atmosphere models suggests the presence of an atmospheric temperature inversion. Our analysis shows evidence for a relatively high geometric albedo, A g = 0.33^{+0.04}_{-0.06}. While measured with a simplistic method, a high A g is supported also by the fact that the one-dimensional atmosphere models underestimate the occultation depth in the optical. We use stellar spectra to determine the dilution, in the four wide bands where occultation was measured, due to the visual stellar binary companion 1.''15 ± 0.''05 away. The revised stellar parameters measured using these spectra are combined with other measurements, leading to revised planetary mass and radius estimates of Mp = 4.94-8.09 M J and Rp = 1.406 ± 0.038 R J. Finally, we measure a Kepler midoccultation time that is 34.0 ± 6.9 s earlier than expected based on the midtransit time and the delay due to light-travel time and discuss possible scenarios.

  4. Lithium Insertion In Silicon Nanowires: An ab Initio Study

    Zhang, Qianfan

    2010-09-08

    The ultrahigh specific lithium ion storage capacity of Si nanowires (SiNWs) has been demonstrated recently and has opened up exciting opportunities for energy storage. However, a systematic theoretical study on lithium insertion in SiNWs remains a challenge, and as a result, understanding of the fundamental interaction and microscopic dynamics during lithium insertion is still lacking. This paper focuses on the study of single Li atom insertion into SiNWs with different sizes and axis orientations by using full ab initio calculations. We show that the binding energy of interstitial Li increases as the SiNW diameter grows. The binding energies at different insertion sites, which can be classified as surface, intermediate, and core sites, are quite different. We find that surface sites are energetically the most favorable insertion positions and that intermediate sites are the most unfavorable insertion positions. Compared with the other growth directions, the [110] SiNWs with different diameters always present the highest binding energies on various insertion locations, which indicates that [110] SiNWs are more favorable by Li doping. Furthermore, we study Li diffusion inside SiNWs. The results show that the Li surface diffusion has a much higher chance to occur than the surface to core diffusion, which is consistent with the experimental observation that the Li insertion in SiNWs is layer by layer from surface to inner region. After overcoming a large barrier crossing surface-to-intermediate region, the diffusion toward center has a higher possibility to occur than the inverse process. © 2010 American Chemical Society.

  5. Ab-initio molecular dynamics for metallic systems

    This thesis deals with the problem of performing first-principles electronic structure calculations in metallic systems, with the goal of bringing ab-initio quantum-mechanical molecular dynamics simulations for these systems to the same level of computational cost, efficiency and accuracy that are now obtained for semiconductors and insulators. The problem is first reviewed from the theoretical and methodological point of view, with a presentation of the current state of research. In particular, the formulation of the electronic structure problem as a Density-Functional-Theory constrained minimization is examined in detail, as well as the description of metallic systems via generalized electronic free energy functionals. A novel reformulation of the problem is here proposed, using the language of Ensemble Density Functional Theory, and a variational realization of it is developed and implemented. The dramatic improvement in the efficiency for the convergence to the electronic ground-state is discussed and explained. The role of the fictitious electronic temperature is examined, as well as its contribution to controlling the errors originating from inadequate sampling of the Brillouin Zone. The associated systematic errors are also examined, and non-selfconsistent and self-consistent estimates for these errors in the energies and the ionic forces are made explicit. The novel technique of cold smearing is introduced. The new method of Ensemble Density Functional Theory, in conjunction with the cold smearing, is shown to reach the proposed goal of greatly improving our current efficiency and accuracy for molecular dynamics simulations, making them affordable at the level of currently available computational power. The method is applied to the study of the finite temperature properties of bulk aluminium and aluminium surfaces, to identify the microscopical processes that give rise to the premelting of the (110) surface and to show evidence for the different phase

  6. Atmospheric characterization of the hot Jupiter Kepler-13Ab

    Shporer, Avi; O' Rourke, Joseph G.; Knutson, Heather A. [Division of Geological and Planetary Sciences, California Institute of Technology, Pasadena, CA 91125 (United States); Szabó, Gyula M. [ELTE Gothard Astrophysical Observatory, H-9704 Szombathely, Szent Imre herceg út 112 (Hungary); Zhao, Ming [Department of Astronomy and Astrophysics, 525 Davey Laboratory, The Pennsylvania State University, University Park, PA 16802 (United States); Burrows, Adam [Department of Astrophysical Sciences, Princeton University, Princeton, NJ 08544 (United States); Fortney, Jonathan [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Agol, Eric [Department of Astronomy, University of Washington, Seattle, WA 98195 (United States); Cowan, Nicolas B. [Center for Interdisciplinary Exploration and Research in Astrophysics and Department of Physics and Astronomy, Northwestern University, 2131 Tech Drive, Evanston, IL 60208 (United States); Desert, Jean-Michel [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado, 389-UCB, Boulder, CO 80309 (United States); Howard, Andrew W. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); Isaacson, Howard [University of California, Berkeley, CA 94720 (United States); Lewis, Nikole K.; Showman, Adam P. [Department of Planetary Sciences and Lunar and Planetary Laboratory, The University of Arizona, Tucson, AZ 85721 (United States); Todorov, Kamen O. [Institute for Astronomy, ETH Zürich, Wolfgang-Pauli-Strasse 27, 8093 Zürich (Switzerland)

    2014-06-10

    Kepler-13Ab (= KOI-13.01) is a unique transiting hot Jupiter. It is one of very few known short-period planets orbiting a hot A-type star, making it one of the hottest planets currently known. The availability of Kepler data allows us to measure the planet's occultation (secondary eclipse) and phase curve in the optical, which we combine with occultations observed by warm Spitzer at 4.5 μm and 3.6 μm and a ground-based occultation observation in the K{sub s} band (2.1 μm). We derive a day-side hemisphere temperature of 2750 ± 160 K as the effective temperature of a black body showing the same occultation depths. Comparing the occultation depths with one-dimensional planetary atmosphere models suggests the presence of an atmospheric temperature inversion. Our analysis shows evidence for a relatively high geometric albedo, A {sub g} = 0.33{sub −0.06}{sup +0.04}. While measured with a simplistic method, a high A {sub g} is supported also by the fact that the one-dimensional atmosphere models underestimate the occultation depth in the optical. We use stellar spectra to determine the dilution, in the four wide bands where occultation was measured, due to the visual stellar binary companion 1.''15 ± 0.''05 away. The revised stellar parameters measured using these spectra are combined with other measurements, leading to revised planetary mass and radius estimates of M{sub p} = 4.94-8.09 M {sub J} and R{sub p} = 1.406 ± 0.038 R {sub J}. Finally, we measure a Kepler midoccultation time that is 34.0 ± 6.9 s earlier than expected based on the midtransit time and the delay due to light-travel time and discuss possible scenarios.

  7. Cosmic-ray modulation: an ab initio approach

    A better understanding of cosmic-ray modulation in the heliosphere can only be gained through a proper understanding of the effects of turbulence on the diffusion and drift of cosmic rays. We present an ab initio model for cosmic-ray modulation, incorporating for the first time the results yielded by a two-component turbulence transport model. This model is solved for periods of minimum solar activity, utilizing boundary values chosen so that model results are in fair to good agreement with spacecraft observations of turbulence quantities, not only in the solar ecliptic plane but also along the out-of-ecliptic trajectory of the Ulysses spacecraft. These results are employed as inputs for modelled slab and 2D turbulence energy spectra. The latter spectrum is chosen based on physical considerations, with a drop-off at the very lowest wavenumbers commencing at the 2D outerscale. There currently exist no models or observations for this quantity, and it is the only free parameter in this study. The modelled turbulence spectra are used as inputs for parallel mean free path expressions based on those derived from quasi-linear theory and perpendicular mean free paths from extended nonlinear guiding center theory. Furthermore, the effects of turbulence on cosmic-ray drifts are modelled in a self-consistent way, employing a recently developed model for drift along the wavy current sheet. The resulting diffusion coefficients and drift expressions are applied to the study of galactic cosmic-ray protons and antiprotons using a three dimensional, steady-state cosmic-ray modulation code, and sample solutions in fair agreement with multiple spacecraft observations are presented. (author)

  8. Rapid Solidification of AB{sub 5} Hydrogen Storage Alloys

    Gulbrandsen-Dahl, Sverre

    2002-01-01

    This doctoral thesis is concerned with rapid solidification of AB{sub 5} materials suitable for electrochemical hydrogen storage. The primary objective of the work has been to characterise the microstructure and crystal structure of the produced AB{sub 5} materials as a function of the process parameters, e.g. the cooling rate during rapid solidification, the determination of which has been paid special attention to. The thesis is divided into 6 parts, of which Part I is a literature review, starting with a short presentation of energy storage alternatives. Then a general review of metal hydrides and their utilisation as energy carriers is presented. This part also includes more detailed descriptions of the crystal structure, the chemical composition and the hydrogen storage properties of AB{sub 5} materials. Furthermore, a description of the chill-block melt spinning process and the gas atomisation process is given. In Part II of the thesis a digital photo calorimetric technique has been developed and applied for obtaining in situ temperature measurements during chill-block melt spinning of a Mm(NiCoMnA1){sub 5} hydride forming alloy (Mm = Mischmetal of rare earths). Compared with conventional colour transmission temperature measurements, this technique offers a special advantage in terms of a high temperature resolutional and positional accuracy, which under the prevailing experimental conditions were found to be {+-}29 K and {+-} 0.1 mm, respectively. Moreover, it is shown that the cooling rate in solid state is approximately 2.5 times higher than that observed during solidification, indicating that the solid ribbon stayed in intimate contact with the wheel surface down to very low metal temperatures before the bond was broken. During this contact period the cooling regime shifted from near ideal in the melt puddle to near Newtonian towards the end, when the heat transfer from the solid ribbon to the wheel became the rate controlling step. In Part III of the

  9. Hydrogen adsorption on boron doped graphene: an {\\it ab initio} study

    Miwa, R. H.; Martins, T B; Fazzio, A.

    2007-01-01

    The electronic and structural properties of (i) boron doped graphene sheets, and (ii) the chemisorption processes of hydrogen adatoms on the boron doped graphene sheets have been examined by {\\it ab initio} total energy calculations.

  10. Inheritance of anthracnose resistance in common bean genotypes P.I. 207262 and AB 136

    Gonçalves-Vidigal M.C.

    1997-01-01

    Full Text Available Bean (Phaseolus vulgaris lines P.I. 207262 and AB 136, both resistant to delta and kappa races of Colletotrichum lindemuthianum, were crossed with Michelite, Dark Red Kidney, and Perry Marrow, susceptible to both races, and with Cornell 49-242, resistant to delta and susceptible to kappa. F1 and F2 reactions demonstrated that P.I. 207262 carries duplicate dominant genes for resistance to the delta race; AB 136 carries a dominant gene. These resistance genes are independent of the Are gene from Cornell 49-242. With respect to the kappa race, F1 and F2 data showed that the resistance controlled by P.I. 207262 and by AB 136 depends on a single dominant gene. Complementary factors were involved with AB 136 resistance to the delta race and with P.I. 207262 resistance to kappa.

  11. Time-resolved photoelectron spectroscopy and ab initio multiple spawning studies of hexamethylcyclopentadiene

    Wolf, T. J. A.; Kuhlman, Thomas Scheby; Schalk, O.;

    2014-01-01

    Time-resolved photoelectron spectroscopy and ab initio multiple spawning were applied to the ultrafast non-adiabatic dynamics of hexamethylcyclopentadiene. The high level of agreement between experiment and theory associates wavepacket motion with a distinct degree of freedom....

  12. Ab Initio Studies of Halogen and Nitrogen Oxide Species of Interest in Stratospheric Chemistry

    Lee, Timothy J.; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    The ability of modern state-of-the art ab initio quantum chemical techniques to characterize reliably the gas-phase molecular structure, vibrational spectrum, electronic spectrum, and thermal stability of fluorine, chlorine, bromine and nitrogen oxide species will be demonstrated by presentation of some example studies. The ab initio results are shown to be in excellent agreement with the available experimental data, and where the experimental data are either not known or are inconclusive, the theoretical results are shown to fill in the gaps and to resolve experimental controversies. In addition, ab initio studies in which the electronic spectra and the characterization of excited electronic states of halogen oxide species will also be presented. Again where available, the ab initio results are compared to experimental observations, and are used to aid in the interpretation of experimental studies.

  13. Effects of alloying side B on Ti-based AB2 hydrogen storage alloys

    王家淳; 于荣海; 刘庆

    2004-01-01

    Ti-based AB2-type hydrogen storage alloys are a group of promising materials, which will probably replace the prevalent rare earth-based AB5-type alloys and be adopted as the main cathode materials of nickelmetal hydride (Ni-MH) batteries in the near future. Alloying in side B is a major way to improve the performance of Ti-based AB2-type alloys. Based on recent studies, the effects of alloying elements in side B upon the performance of Ti-based AB2 -type hydrogen storage alloys are systematically reviewed here. These performances are divided into two categories, namely PCI characteristics, including hydrogen storage capacity (HSC), plateau pressure (PP), pressure hysteresis (PH) and pressure plateau sloping (PPS) , and electrochemical properties, including discharge capacity (DC), activation property (AP), cycling stability (CS) and high-rate dischargeability (HRD). Furthermore, the existing problems in these investigations and some suggestions for future research are proposed.

  14. Estudos sôbre índice de siclemia

    Ernani Martins da Silva

    1945-04-01

    Full Text Available O índice de sinclêmicos encontrado foi de 10%, examinando-se uma amostra heterógenea de 1130 indivíduos de grupo étnico negróide e mestiços desta etnia. Foi negativa a pesquisa em 120 indivíduos caucasóides e 30 mongolóides. O "índice familiar de siclêmicos" - a percentagem desses indivíduos em um grupo de famílias - fornece um resultado mais proximo do verdadeiro número de siclêmicos em uma amostra de população. O método clássico fornece um número inferior ao existente na amostra estudada. A aplicação do teste de siclemia em Jurisprudência, Antropologia e Etnografia, poderá contribuir, na qualidade de método auxiliar, no estudo de vários problemas. São indicados como métodos de escolha: o de Emmel e o de maceração de tecidos conservados em solução de formol ou alcool. Êste último permite estudos retrospectivos. A estase circulatória parece não ser fator suficiente para a passagem da condição de siclêmico para anemico. O parasitismo da hemátia pelo Plasmodium vivax não impede o fenômeno da siclisação. Infecção por plasmodídeos (P. falciparum e P. vivax não é fator suficiente para desencadear a doença. A importância da descoberta de Emmel (descoberta do fenômeno da siclisação reside no conhecimento em doença heredofamiliar de fato novo de máxima significação: a possibilidade de identificar os indivíduos ainda na fase de latência, ou seja, no período que medeia entre o nascimento e a instalação dos primeiros sintomas da doença. A relação entre casos de anemia falciforme ocorridos em gerações por vêzes muito afastadas (fenômeno denominado "skipping" - salto - pelos autores de lingua inglêsa é mantida através dos siclêmicos. Êsses indivíduos podem ser comparados aos portadores de germe no sentido empregado na profilaxia das doenças infectuosas. Exames periódicos dos siclêmicos poderiam contribuir para esclarecimento da patogenia e forneceriam dados úteis para a

  15. AdnAB: a new DSB-resecting motor-nuclease from mycobacteria.

    Sinha, Krishna Murari; Unciuleac, Mihaela-Carmen; Glickman, Michael S; Shuman, Stewart

    2009-06-15

    The resection of DNA double-strand breaks (DSBs) in bacteria is a motor-driven process performed by a multisubunit helicase-nuclease complex: either an Escherichia coli-type RecBCD enzyme or a Bacillus-type AddAB enzyme. Here we identify mycobacterial AdnAB as the founder of a new family of heterodimeric helicase-nucleases with distinctive properties. The AdnA and AdnB subunits are each composed of an N-terminal UvrD-like motor domain and a C-terminal nuclease module. The AdnAB ATPase is triggered by dsDNA with free ends and the energy of ATP hydrolysis is coupled to DSB end resection by the AdnAB nuclease. The mycobacterial nonhomologous end-joining (NHEJ) protein Ku protects DSBs from resection by AdnAB. We find that AdnAB incises ssDNA by measuring the distance from the free 5' end to dictate the sites of cleavage, which are predominantly 5 or 6 nucleotides (nt) from the 5' end. The "molecular ruler" of AdnAB is regulated by ATP, which elicits an increase in ssDNA cleavage rate and a distal displacement of the cleavage sites 16-17 nt from the 5' terminus. AdnAB is a dual nuclease with a clear division of labor between the subunits. Mutations in the nuclease active site of the AdnB subunit ablate the ATP-inducible cleavages; the corresponding changes in AdnA abolish ATP-independent cleavage. Complete suppression of DSB end resection requires simultaneous mutation of both subunit nucleases. The nuclease-null AdnAB is a helicase that unwinds linear plasmid DNA without degrading the displaced single strands. Mutations of the phosphohydrolase active site of the AdnB subunit ablate DNA-dependent ATPase activity, DSB end resection, and ATP-inducible ssDNA cleavage; the equivalent mutations of the AdnA subunit have comparatively little effect. AdnAB is a novel signature of the Actinomycetales taxon. Mycobacteria are exceptional in that they encode both AdnAB and RecBCD, suggesting the existence of alternative end-resecting motor-nuclease complexes. PMID:19470566

  16. Isolation and Characterization of a Virulent Bacteriophage AB1 of Acinetobacter baumannii

    Jia Shiru

    2010-04-01

    Full Text Available Abstract Background Acinetobacter baumannii is an emerging nosocomial pathogen worldwide with increasing prevalence of multi-drug and pan-drug resistance. A. baumannii exists widely in natural environment, especially in health care settings, and has been shown difficult to be eradicated. Bacteriophages are often considered alternative agent for controlling bacterial infection and contamination. In this study, we described the isolation and characterization of one virulent bacteriophage AB1 capable of specifically infecting A. baumannii. Results A virulent bacteriophage AB1, specific for infecting a clinical strain A. baumannii KD311, was first isolated from marine sediment sample. Restriction analysis indicated that phage AB1 was a dsDNA virus with an approximate genome size of 45.2 kb to 46.9 kb. Transmission electron microscopy showed that phage AB1 had an icosahedral head with a non-contractile tail and collar or whisker structures, and might be tentatively classified as a member of the Siphoviridae family. Proteomic pattern of phage AB1, generated by SDS-PAGE using purified phage particles, revealed five major bands and six minor bands with molecular weight ranging from 14 to 80 kilo-dalton. Also determined was the adsorption rate of phage AB1 to the host bacterium, which was significantly enhanced by addition of 10 mM CaCl2. In a single step growth test, phage AB1 was shown having a latent period of 18 minutes and a burst size of 409. Moreover, pH and thermal stability of phage AB1 were also investigated. At the optimal pH 6.0, 73.2% of phages survived after 60 min incubation at 50°C. When phage AB1 was used to infect four additional clinical isolates of A. baumannii, one clinical isolate of Stenotrophomonas maltophilia, and Pseudomonas aeruginosa lab strains PAK and PAO1, none of the tested strains was found susceptible, indicating a relatively narrow host range for phage AB1. Conclusion Phage AB1 was capable of eliciting efficient lysis

  17. Improving the control of work-in-process at VSM Group AB

    Karlsson, Per-Johan; Porto, Mariana

    2008-01-01

    Today many companies face problems with inventory management. The importance of adequate inventory management has become more evident, while organizations try to reduce their costs and increase their service level. This master thesis was conducted at VSM Group AB in Huskvarna, which is a manufacturer that produces and delivers sewing machines to a worldwide market. VSM Group AB has problems with the management and the refilling of the work-in-process (WIP) inventories and also with lack of in...

  18. Explicit Polarization (X-Pol) Potential Using ab Initio Molecular Orbital Theory and Density Functional Theory†

    Song, Lingchun; Han, Jaebeom; Lin, Yen-lin; Xie, Wangshen; Gao, Jiali

    2009-01-01

    The explicit polarization (X-Pol) method has been examined using ab initio molecular orbital theory and density functional theory. The X-Pol potential was designed to provide a novel theoretical framework for developing next-generation force fields for biomolecular simulations. Importantly, the X-Pol potential is a general method, which can be employed with any level of electronic structure theory. The present study illustrates the implementation of the X-Pol method using ab initio Hartree—Fo...

  19. Toward a Library Synthesis of the Natural Dipeptide Antibiotic TAN 1057 A,B

    Jochen Krüger; Nuria Aguilar

    2002-01-01

    The natural dipeptide antibiotic TAN 1057 A,B represents a promising new antibiotic entity. In this communication we report a novel approach for the synthesis of TAN 1057 A,B analogs bearing variations in the β-arginine side chain. This approach involves a combination of liquid and solid phase methods and allows for a library synthesis of analogs of the natural product.

  20. GORDITA, a young paralog of Arabidopsis thaliana Bsister MADS-box gene ABS, has undergone neofunctionalization

    Erdmann, Robert

    2010-01-01

    Bsister genes, a clade with close relationships to the class B floral homeotic genes, have been conserved for more than 300 million years. Bsister genes in Arabidopsis thaliana underwent gene duplication probably before the diversification of Brassicaceae leading to the paralogue genes ARABIDOPSIS BSISTER (ABS) and GORDITA (GOA). The phenotype of the abs mutant, however, is rather mild as it shows only reduced seed coloration and defects in endothelium development. This thesis focuses on the ...

  1. Effects of POSS nanoparticles on ABS-g-Ma thermo oxidation resistance

    Vilà Ramirez, N.; Sánchez Soto, Miguel

    2012-01-01

    Thermo oxidative degradation at and beyond process- ing temperatures has been carried out on ABS copoly- mer grafted with Maleic Anhydride (ABS- g -Ma) and three nanocomposites with the above material melt-blended with different types of POSS, being amino-propyl isobutyl (APOSS), glycidyl (GPOSS), and trisilanol (TPOSS). The incorporation adequacy of the nanofillers into the matrix has been assessed with scanning electron microscopy (SEM) and differential scan...

  2. MANAGING CUSTOMER LIFE-CYCLE : Case company: OY GOLDEN CROP AB

    He, Yao

    2016-01-01

    Oy Golden Crop Ab has been founded in 2012 February and is food trading company in Finland which supplies the Asian restaurants all over the Finland. For example, Chinese restaurants, Sushi restaurants, Thai restaurants, Indian restaurants and Vietnamese restaurants. Due to the high competition in the Helsinki region, the company needs to improve its system from customer perspective The aim of this thesis is to generate models to manage customer life-cycle for Oy Golden Crop Ab. Therefor...

  3. AbCD: arbitrary coverage design for sequencing-based genetic studies

    Kang, Jian; Huang, Kuan-Chieh; Xu, Zheng; Wang, Yunfei; Abecasis, Gonçalo R.; Li, Yun

    2013-01-01

    Summary: Recent advances in sequencing technologies have revolutionized genetic studies. Although high-coverage sequencing can uncover most variants present in the sequenced sample, low-coverage sequencing is appealing for its cost effectiveness. Here, we present AbCD (arbitrary coverage design) to aid the design of sequencing-based studies. AbCD is a user-friendly interface providing pre-estimated effective sample sizes, specific to each minor allele frequency category, for designs with arbi...

  4. URHEILUN SPONSOROINTI JA LUMILAUTAILU : FOREX Bank Ab:n mahdollisuudet lumilautailun sponsorointiin

    Autio, Suvi

    2011-01-01

    FOREX Bank Ab on Pohjoismaiden suurin valuutanvaihtoon erikoistunut yritys. FOREXin liikeideana on tarjota maasta lähteville ja maahan saapuville matkailijoille valuuttaa joustaviin kellonaikoihin, keskeisillä paikoilla, sekä kilpailukykyisillä kursseilla ja toimitusmaksuilla. Opinnäytetyön aiheena oli urheilun sponsorointi ja lumilautailu. Opinnäytetyön tarkoituksena oli selvittää FOREX Bank Ab:n sponsoroinnin nykytilaa ja lumilautailun sopivuutta FOREXin sponsorointikohteeksi. Teoriaosu...

  5. Hidroponik Tanaman Sayuran Sawi Beda Varietas Dengan Formulasi Nurtisi Ab Mix Dan Formulasi Racikan

    Siagian, Vyvian W.

    2016-01-01

    Vyvian W Siagian, research “Hydroponics of Mustard Vegetable Crops Different Varieties with AB Mix Nutrient and Self-made Nutrient Formulation”, supervised by Ir. Bintang, MP and Ir. Fauzi, MP. This research is aimed to find a differences production from hydroponics of mustard vegetable crops which is have a different varity within AB Mix nutrient and self-made nutrient formulation. It was located at Kompleks Citra Arkadia Jl. Bunga Wijaya Padang Bulan, Medan on June 2015 until September 2015...

  6. High Yield Chemical Vapor Deposition Growth of High Quality Large-Area AB Stacked Bilayer Graphene

    Liu, Lixin; Zhou, Hailong; Cheng, Rui; Yu, Woo Jong; Liu, Yuan; Chen, Yu; Shaw, Jonathan; Zhong, Xing; Huang, Yu; Duan, Xiangfeng

    2012-01-01

    Bernal stacked (AB stacked) bilayer graphene is of significant interest for functional electronic and photonic devices due to the feasibility to continuously tune its band gap with a vertical electrical field. Mechanical exfoliation can be used to produce AB stacked bilayer graphene flakes but typically with the sizes limited to a few micrometers. Chemical vapor deposition (CVD) has been recently explored for the synthesis of bilayer graphene but usually with limited coverage and a mixture of...

  7. Discrimination of Transgenic Rice containing the Cry1Ab Protein using Terahertz Spectroscopy and Chemometrics

    Wendao Xu; Lijuan Xie; Zunzhong Ye; Weilu Gao; Yang Yao; Min Chen; Jianyuan Qin; Yibin Ying

    2015-01-01

    Spectroscopic techniques combined with chemometrics methods have proven to be effective tools for the discrimination of objects with similar properties. In this work, terahertz time-domain spectroscopy (THz-TDS) combined with discriminate analysis (DA) and principal component analysis (PCA) with derivative pretreatments was performed to differentiate transgenic rice (Hua Hui 1, containing the Cry1Ab protein) from its parent (Ming Hui 63). Both rice samples and the Cry1Ab protein were ground a...

  8. Realistic modelling of water/solid interfaces from ab Initio molecular dynamics

    Tocci, G.

    2014-01-01

    Water/solid interfaces are of utmost importance to a number of technological processes. Theoretical studies, based on ab initio approaches are suitable to unveil processes occurring at water/solid interfaces and can therefore be instrumental to delineate guidelines to improve the efficiency of these processes. In this thesis we study several systems of current interest using ab initio methods based on density functional theory (DFT). By going often beyond the use of standard DFT methods and a...

  9. A Novel Variant in CMAH Is Associated with Blood Type AB in Ragdoll Cats

    Gandolfi, Barbara; Grahn, Robert A.; Gustafson, Nicholas A.; Proverbio, Daniela; Spada, Eva; Adhikari, Badri; Cheng, Janling; Andrews, Gordon; Lyons, Leslie A.; Helps, Chris R.

    2016-01-01

    The enzyme cytidine monophospho-N-acetylneuraminic acid hydroxylase is associated with the production of sialic acids on cat red blood cells. The cat has one major blood group with three serotypes; the most common blood type A being dominant to type B. A third rare blood type is known as AB and has an unclear mode of inheritance. Cat blood type antigens are defined, with N-glycolylneuraminic acid being associated with type A and N-acetylneuraminic acid with type B. Blood type AB is serologically characterized by agglutination using typing reagents directed against both A and B epitopes. While a genetic characterization of blood type B has been achieved, the rare type AB serotype remains genetically uncharacterized. A genome-wide association study in Ragdoll cats (22 cases and 15 controls) detected a significant association between blood type AB and SNPs on cat chromosome B2, with the most highly associated SNP being at position 4,487,432 near the candidate gene cytidine monophospho-N-acetylneuraminic acid hydroxylase. A novel variant, c.364C>T, was identified that is highly associated with blood type AB in Ragdoll cats and, to a lesser degree, with type AB in random bred cats. The newly identified variant is probably linked with blood type AB in Ragdoll cats, and is associated with the expression of both antigens (N-glycolylneuraminic acid and N-acetylneuraminic acid) on the red blood cell membrane. Other variants, not identified by this work, are likely to be associated with blood type AB in other breeds of cat. PMID:27171395

  10. An ab initio study of plutonium oxides surfaces; Etude ab initio des surfaces d'oxydes de Pu

    Jomard, G.; Bottin, F.; Amadon, B

    2007-07-01

    By means of first-principles calculations, we have studied the atomic structure as well as the thermodynamic stability of various plutonium dioxide surfaces in function of their environment (in terms of oxygen partial pressure and temperature). All these simulations have been performed with the ABINIT code. It is well known that DFT fails to describe correctly plutonium-based materials since 5f electrons in such systems are strongly correlated. In order to go beyond DFT, we have treated PuO{sub 2} and {beta}-Pu{sub 2}O{sub 3} in a DFT+U framework. We show that the couple of parameters (U,J) that works well for pure Pu is also well designed for describing ground state (GS) properties of these two oxides. The major improvement with respect with DFT is that we are able to predict an insulating GS in agreement with experiments. The presence of a gap in the DOS (Density of States) of plutonium oxides should play a significant role in the predicted surface reactivity. However, performing DFT+U calculations on surfaces of plutonium oxide from scratch was too ambitious. That is why we decided, as a first step, to study the stability of the (100), (110) and (111) surfaces of PuO{sub 2} in a DFT-GGA framework. For each of these orientations, we considered various terminations. These ab initio results have been introduced in a thermodynamic model which allows us to predict the relative stability of the different terminations as a function of temperature and oxygen partial pressure (p{sub O{sub 2}}). We conclude that at room temperature and for p{sub O{sub 2}}{approx}10 atm., the polar O{sub 2}-(100) termination is favoured. The stabilization of such a polar stoichiometric surface is surprising and should be confirmed by DFT+U calculations before any final conclusion. (authors)

  11. Treatment with Anti-EGF Ab Ameliorates Experimental Autoimmune Encephalomyelitis via Induction of Neurogenesis and Oligodendrogenesis

    Yifat Amir-Levy

    2014-01-01

    Full Text Available Background. The neural stem cells (NSCs migrate to the damaged sites in multiple sclerosis (MS and in experimental autoimmune encephalomyelitis (EAE. However, the differentiation into neurons or oligodendrocytes is blocked. Epidermal growth factor (EGF stimulates NSC proliferation and mobilization to demyelinated lesions but also induces astrogenesis and glial scar. Objective. To examine the clinical and histopathological effects of EGF neutralization on EAE. Methods. EAE-induced SJL mice were intravenously treated with either anti-EGF neutralizing antibody (Ab or isotype control or PBS. On day 9 after immunization, 3 mice of each group were daily treated for 9 days with BrdU and then sacrificed for immunohistochemical analysis. Results. Treatment with anti-EGF Ab significantly ameliorated EAE symptoms during the second relapse. Anti-EGF Ab induced a shift from BrdU+GFAP+ NSCs to BrdU+DCX+ neuroblasts in the subventricular zone (SVZ, increased BrdU+NeuN+ neurons in the granular cell layer of the dentate gyrus, and increased BrdU+O4+ oligodendrocytes in the SVZ. There was no change in the inflammatory infiltrates in response to anti-EGF Ab. Conclusions. Therapy with anti-EGF Ab ameliorates EAE via induction of neurogenesis and oligodendrogenesis. No immunosuppressive effect was found. Further investigation is needed to support these notions of beneficial effect of anti-EGF Ab in MS.

  12. Cry1Ab protein from Bt transgenic rice does not residue in rhizosphere soil

    Expression of Cry1Ab protein in Bt transgenic rice (KMD) and its residue in the rhizosphere soil during the whole growth in field, as well as degradation of the protein from KMD straw in five soils under laboratory incubation were studied. The residue of Cry1Ab protein in KMD rhizosphere soil was undetectable (below the limit of 0.5 ng/g air-dried soil). The Cry1Ab protein contents in the shoot and root of KMD were 3.23-8.22 and 0.68-0.89 μg/g (fresh weight), respectively. The half-lives of the Cry1Ab protein in the soils amended with KMD straw (4%, w/w) ranged from 11.5 to 34.3 d. The residence time of the protein varied significantly in a Fluvio-marine yellow loamy soil amended with KMD straw at the rate of 3, 4 and 7%, with half-lives of 9.9, 13.8 and 18 d, respectively. In addition, an extraction method for Cry1Ab protein in soil was developed, with extraction efficiencies of 46.4-82.3%. - Cry1Ab protein was not detected in the rhizosphere soil of field-grown Bt transgenic rice

  13. Formation of reflective and conductive silver film on ABS surface via covalent grafting and solution spray

    Chen, Dexin; Zhang, Yan [School of Mechanical and Automotive Engineering, South China University of Technology, 381 Wushan, Guangzhou 510640 (China); Bessho, Takeshi [Higashifuji Technical Center, Toyota Motor Corporation, 1200 Mishuku, Susono, Shizuoka 410-1193 (Japan); Kudo, Takahiro; Sang, Jing; Hirahara, Hidetoshi; Mori, Kunio [Faculty of Engineering, Iwate University, 4-3-5 Ueda, Morioka 020-8551 (Japan); Kang, Zhixin, E-mail: zxkang@scut.edu.cn [School of Mechanical and Automotive Engineering, South China University of Technology, 381 Wushan, Guangzhou 510640 (China)

    2015-09-15

    Highlights: • A pure and homogenous silver film was deposited by spray-style plating technique. • The mechanism of covalent bonding between coating and substrate was studied. • The silver coating is highly reflective and conductive. • UV light was used to activate the ABS surface with triazine azide derivative. - Abstract: Conductive and reflective silver layers on acrylonitrile butadiene styrene (ABS) plastics have been prepared by photo grafting of triazine azides upon ultraviolet activation, self-assembling of triazine dithiols and silver electroless plating by solution spray based on silver mirror reaction. The as-prepared silver film exhibited excellent adhesion with ABS owing to covalent bonds between coating and substrate, and the detailed bonding mechanism have been investigated by X-ray photoelectron spectroscopy (XPS). X-ray diffraction (XRD) result revealed that silver film on ABS was pure and with a nanocrystalline structure. Atomic force microscope (AFM) analysis demonstrated that massive silver particles with sizes varying from 80 to 120 nm were deposited on ABS and formed a homogenous and smooth coating, resulting in highly reflective surface. Furthermore, silver maintained its unique conductivity even as film on ABS surface in term of four-point probe method.

  14. Studies of the distribution of intrathecally injected 125I-tetanus antitoxin-F(ab')2

    Overall F(ab')2 and antitetanus-f(ab')2 - fragments were labelled with 125I and injected i.th. into normal juvenile cats and adult rats. One group of rats was normal; in the other, unilateral local tetanus had been induced by injection of tetanus toxin into a M. gastrocnemius. The animals were sacrificed 24 h after the i.th. injection, and tissue samples were taken for histoautoradiography. 125I-antitetanus-F(ab')2 permeated into the extracellular space of the spinal cord, roots, and ganglia but not into the neuronal intracellular space. 125I-overall-F(ab') showed identical permeation behaviour. 125I-antitetanus-F(ab')2 reacted with tetanus toxin issuing from the motoneurons after i.th. injection, forming an immunocomplex around the motorneurons. The immunocomplex was not formed around pseudo-unipolar ganglian cells in the spinal ganglia even though some of the ganglian cells contained tetanus toxin, and 125I-antitetanus-F(ab')2 was present in the extracellular space. As an explanation, it was suggested that tetanus toxin does not permeate into the extracellular space through the membrane of the pseudo-unipolar ganglian cells so that immune reactions will not occur. These findings help to explain the widely divergent results of tetanus therapy by means of i.th. injection of tetanus antitoxin. Recommendations for future therapy measures are derived from the findings. (orig./MG)

  15. Formation of reflective and conductive silver film on ABS surface via covalent grafting and solution spray

    Highlights: • A pure and homogenous silver film was deposited by spray-style plating technique. • The mechanism of covalent bonding between coating and substrate was studied. • The silver coating is highly reflective and conductive. • UV light was used to activate the ABS surface with triazine azide derivative. - Abstract: Conductive and reflective silver layers on acrylonitrile butadiene styrene (ABS) plastics have been prepared by photo grafting of triazine azides upon ultraviolet activation, self-assembling of triazine dithiols and silver electroless plating by solution spray based on silver mirror reaction. The as-prepared silver film exhibited excellent adhesion with ABS owing to covalent bonds between coating and substrate, and the detailed bonding mechanism have been investigated by X-ray photoelectron spectroscopy (XPS). X-ray diffraction (XRD) result revealed that silver film on ABS was pure and with a nanocrystalline structure. Atomic force microscope (AFM) analysis demonstrated that massive silver particles with sizes varying from 80 to 120 nm were deposited on ABS and formed a homogenous and smooth coating, resulting in highly reflective surface. Furthermore, silver maintained its unique conductivity even as film on ABS surface in term of four-point probe method

  16. Stacking stability of MoS2 bilayer: An ab initio study

    The study of the stacking stability of bilayer MoS2 is essential since a bilayer has exhibited advantages over single layer MoS2 in many aspects for nanoelectronic applications. We explored the relative stability, optimal sliding path between different stacking orders of bilayer MoS2, and (especially) the effect of inter-layer stress, by combining first-principles density functional total energy calculations and the climbing-image nudge-elastic-band (CI-NEB) method. Among five typical stacking orders, which can be categorized into two kinds (I: AA, AB and II: AA', AB', A'B), we found that stacking orders with Mo and S superposing from both layers, such as AA' and AB, is more stable than the others. With smaller computational efforts than potential energy profile searching, we can study the effect of inter-layer stress on the stacking stability. Under isobaric condition, the sliding barrier increases by a few eV/(ucGPa) from AA' to AB', compared to 0.1 eV/(ucGPa) from AB to [AB]. Moreover, we found that interlayer compressive stress can help enhance the transport properties of AA'. This study can help understand why inter-layer stress by dielectric gating materials can be an effective means to improving MoS2 on nanoelectronic applications. (condensed matter: structural, mechanical, and thermal properties)

  17. Yeast killer toxin-like candidacidal Ab6 antibodies elicited through the manipulation of the idiotypic cascade.

    Polonelli, Luciano; Beninati, Concetta; Teti, Giuseppe; Felici, Franco; Ciociola, Tecla; Giovati, Laura; Sperindè, Martina; Lo Passo, Carla; Pernice, Ida; Domina, Maria; Arigò, Milena; Papasergi, Salvatore; Mancuso, Giuseppe; Conti, Stefania; Magliani, Walter

    2014-01-01

    A mouse anti-anti-anti-idiotypic (Id) IgM monoclonal antibody (mAb K20, Ab4), functionally mimicking a Wyckerhamomyces anomalus (Pichia anomala) killer toxin (KT) characterized by fungicidal activity against yeasts presenting specific cell wall receptors (KTR) mainly constituted by β-1,3-glucan, was produced from animals presenting anti-KT Abs (Ab3) following immunization with a rat IgM anti-Id KT-like mAb (mAb K10, Ab2). MAb K10 was produced by immunization with a KT-neutralizing mAb (mAb KT4, Ab1) bearing the internal image of KTR. MAb K20, likewise mAb K10, proved to be fungicidal in vitro against KT-sensitive Candida albicans cells, an activity neutralized by mAb KT4, and was capable of binding to β-1,3-glucan. MAb K20 and mAb K10 competed with each other and with KT for binding to C. albicans KTR. MAb K20 was used to identify peptide mimics of KTR by the selection of phage clones from random peptide phage display libraries. Using this strategy, four peptides (TK 1-4) were selected and used as immunogen in mice in the form of either keyhole limpet hemocyanin (KLH) conjugates or peptide-encoding minigenes. Peptide and DNA immunization could induce serum Abs characterized by candidacidal activity, which was inhibited by laminarin, a soluble β-1,3-glucan, but not by pustulan, a β-1,6-glucan. These findings show that the idiotypic cascade can not only overcome the barrier of animal species but also the nature of immunogens and the type of technology adopted. PMID:25162681

  18. Yeast killer toxin-like candidacidal Ab6 antibodies elicited through the manipulation of the idiotypic cascade.

    Luciano Polonelli

    Full Text Available A mouse anti-anti-anti-idiotypic (Id IgM monoclonal antibody (mAb K20, Ab4, functionally mimicking a Wyckerhamomyces anomalus (Pichia anomala killer toxin (KT characterized by fungicidal activity against yeasts presenting specific cell wall receptors (KTR mainly constituted by β-1,3-glucan, was produced from animals presenting anti-KT Abs (Ab3 following immunization with a rat IgM anti-Id KT-like mAb (mAb K10, Ab2. MAb K10 was produced by immunization with a KT-neutralizing mAb (mAb KT4, Ab1 bearing the internal image of KTR. MAb K20, likewise mAb K10, proved to be fungicidal in vitro against KT-sensitive Candida albicans cells, an activity neutralized by mAb KT4, and was capable of binding to β-1,3-glucan. MAb K20 and mAb K10 competed with each other and with KT for binding to C. albicans KTR. MAb K20 was used to identify peptide mimics of KTR by the selection of phage clones from random peptide phage display libraries. Using this strategy, four peptides (TK 1-4 were selected and used as immunogen in mice in the form of either keyhole limpet hemocyanin (KLH conjugates or peptide-encoding minigenes. Peptide and DNA immunization could induce serum Abs characterized by candidacidal activity, which was inhibited by laminarin, a soluble β-1,3-glucan, but not by pustulan, a β-1,6-glucan. These findings show that the idiotypic cascade can not only overcome the barrier of animal species but also the nature of immunogens and the type of technology adopted.

  19. Uso do conceito de aprendizagem em estudos relacionados ao trabalho e organizações

    Francisco Antonio Coelho Junior

    2008-01-01

    Full Text Available A literatura em comportamento organizacional apresenta diversos estudos referenciando o conceito aprendizagem aplicado no âmbito das organizações. Porém, verifica-se o uso pouco crítico ou sistemático deste conceito. O objetivo do presente artigo consiste em realizar uma análise conceitual do termo aprendizagem, justificando sua transposição para estudos organizacionais. Aplicaram-se técnicas de análise conceitual propostas por Ryle. Como resultado, verificou-se que a natureza multifacetada do conceito de aprendizagem favorece o advento das diversas definições associadas a ele. Espera-se que haja maior sistematicidade acerca do uso do termo aprendizagem aplicado em estudos organizacionais, considerando seus níveis de análise e as dimensões presentemente discutidas.

  20. Impacto da plataforma Moodle nas escolas de Famalicão: um estudo de caso

    Pimentel, Paulo Carlos Fernandes

    2009-01-01

    Dissertação de mestrado em Educação (área de especialização em Tecnologia Educativa) Com a proliferação, por todas as escolas do país, da utilização da plataforma Moodle, urge estudar a forma como está a ser utilizada no apoio ao ensino presencial. No âmbito da presente dissertação de mestrado, desenvolveu-se um estudo com o objectivo de analisar o impacto da plataforma Moodle no Agrupamento de Escolas Júlio Brandão, em Vila Nova de Famalicão. O estudo realizado foi um estudo de caso...

  1. Caso de estudo: a entrada do azeite Gallo no mercado chinês

    Costa, Miguel Maria Portugal Martins

    2014-01-01

    Mestrado em Gestão 7 Classificação JEL: M16; F23 A elaboração desta dissertação consiste na criação de um caso de estudo pedagógico com o objectivo de tirar ilações sobre a entrada da marca “Azeite Gallo” no mercado Chinês. Optamos por desenvolver este caso de estudo através de um estudo qualitativo, suportado por um referencial teórico. O intuito do projecto é de documentar um exemplo paradigmático de um produto consumível de marca portuguesa que sucedeu em ultrapassar as barreiras ...

  2. Ab initio calculation of molecular energies including parity violating interactions

    A new approach, RHF-CIS, based on the perturbation of the ground state RHF wave function by the CIS excitations, has been implemented for evaluation of energy of parity violating interaction in molecules, Epv. The earlier approach, RHF-SDE, was based on the perturbation of the RHF ground states by the single-determinant ''excitations'' (SDE). The results obtained show the dramatic difference between Epv values in the RHF-CIS framework and those in the RHF-SDE framework: the Epv values of the RHF-CIS formalism are more than one order of magnitude greater compared to the RHF-SDE formalism as well as the corresponding tensor components. The maximal total value obtained for hydrogen peroxide in the RHF-CIS framework is 3.661 X 10-19 EH (DZ** basis set) while the maximal Epv value for the RHF-SDE formalism is just 3.635 X 10-20 EH (TZ basis set). It is remarkable that both in the RFH-CIS and in the RHF-SDE approaches the diagonal tensor components of Epv strictly follow the geometry of a molecule and are always different from zero at chiral conformations. The zeros of the total Epv at chiral geometries are now found to be the results of the interplay between the diagonal tensor components values. We have carried out exhaustive analysis of the RHF-SDE formalism and found that it is not sufficiently accurate for studies of Epv. To this end, we have completely reproduced the previous work, which has been done in the RHF-SDE frame-work, and developed it further, studying how the RHF-SDE results vary when changing size and quality of basis sets. This last resource does not save the RHF-SDE formalism for evaluations of Epv from the general failure. Packages of FORTRAN routines called ENWEAK/RHFSDE-93 and ENWEAK/RHFCIS-94 have been developed which run on top of an ab initio MO package. We used 6-31G and 6-31G**, DZ and DZ**, TZ and TZ**, and (10s, 6p,**) basis sets. We will discuss the importance of the present results for possible measurement of the parity violating energy

  3. Ab Initio Computation of Dynamical Properties: Pressure Broadening

    Wiesenfeld, Laurent; Drouin, Brian

    2014-06-01

    Rotational spectroscopy of polar molecules is the main observational tool in many areas of astrophysics, for gases of low densities (n ˜ 102 - 108 cm-3). Spectral line shapes in astrophysical media are largely dominated by turbulence-induced Doppler effects and natural line broadening are negligible. However line broadening remains an important tool for denser gases, like planetary high atmospheres. Understanding the excitation schemes of polar molecules requires the knowledge of excitation transfer rate due to collisional excitation, between the polar molecule and the ambient gas, usually H2. Transport properties in ionized media also require a precise knowledge of momentum transfer rates by elastic collisions. In order to assess the theoretically computed cross section and energy/momentum transfer rates, direct absolute experiments are scarce. The best way is to measure not individual scattering events but rather the global effect of the buffer gas, thanks to the pressure broadening cross sections, whose magnitude can be measured without any scaling parameters. At low temperatures, both elastic and inelastic scattering amplitudes are tested. At higher temperature, depending on the interaction strength, only inelastic scattering cross section are shown to play a significant role 1 ,2. Thanks to the advances of computer capabilities, it has become practical to compute spectral line parameters fromab initio quantum chemistry. In particular, the theory of rotational line broadening is readily incorporated into scattering quantum dynamical theory, like close-coupling schemes. The only approximations used in the computation are the isolated collision/isolated line approximations. We compute the non-binding interaction potential with high precision quantum chemistry and fit the resulting ab initio points onto a suitable functional. We have recently computed several such systems, for molecules in H2 buffer gas: H2O,3 H2CO,4 HCO+ .5 Detailed computations taking into

  4. Different evolutionary stages in S235A-B

    Felli, Marcello; Massi, Fabrizio; Cesaroni, Riccardo

    The star forming region S235A-B has been studied at high resolution with radio (IRAM Interferometer and VLA) and infrared (JCMT and Spitzer) observations. The region was mapped in HCO^+, C^34S, H[2]CS, SO[2] and CH[3]CN as well as in the 1.2 and 3.3 continuum, in the cm continuum at 6, 3.6, 1.3 and 0.7 cm and in the 22 GHz water maser line, in the far infrared at 450 and 850 micron and in the mid infrared from 3.6 to 8 micron. Use was made of the Medicina water maser patrol, from 1987 to 2005, to study the maser variability. S235A is a classical HII region, well resolved and with a very good match between radio and infrared images. To the south of it, molecular and continuum mm observations as well as infrared observations reveal the presence of newly formed YSOs placed in between S235A and S235B: a molecular core and an unresolved mm source centred on one maser component, with indication of mass infall onto the core. Two bipolar outflows and a jet originate from the same position. No cm radio continuum emission is detected either from the compact molecular core or from the jet-like structure, suggesting emission from dust in both cases. Evidence is found for a molecular rotating disk perpendicular to the main bipolar outflow. The derived parameters indicate that the YSO is an intermediate luminosity object in a very early evolutionary phase. Its main source of energy could come from gravitational infall thus making this YSO a rare link between the earliest evolutionary phases of massive stars and low mass protostars of class 0-I. Two compact radio continuum sources (VLA-1 and VLA-2) and three separate maser spots were found. VLA-1 coincides with one of the maser spots and with an IR source (M1). VLA-2 lies towards S235B and represents the first radio detection from this peculiar nebula. The two other maser spots coincide with the rotating disk perpendicular to the bipolar molecular outflow. The Spitzer images reveal a red object towards the molecular core which is

  5. Estudo de caso: neuropatia auditiva Auditory neuropathy: a study case

    Viviane M. Parra

    2003-03-01

    Full Text Available Atualmente, podemos complementar os resultados encontrados na audiometria convencional com os obtidos nos exames eletrofisiológicos, o que nos permite diagnosticar não apenas uma perda auditiva periférica, mas também diferenciar uma perda auditiva coclear da neural, ou central. Isto nos conduziu a um grupo novo de pacientes que apresentava alteração na sincronia neural com função normal das células ciliadas externas. Esta patologia é conhecida como Neuropatia Auditiva. O objetivo deste estudo é descrever as características audiológicas de um paciente com Neuropatia Auditiva atendido no Centro de Docência e Pesquisa em Fonoaudiologia da Faculdade de Medicina da Universidade de São Paulo (FMUSP, correlacionando os achados com os encontrados na literatura. O caso descrito é de um indivíduo de 24 anos de idade, com o diagnóstico de Neuropatia Auditiva, atendido no ano de 2001 no Centro de Docência e Pesquisa em Fonoaudiologia da FMUSP. Foram realizados anamnese, audiometria tonal e vocal, medidas de imitância acústica, Emissões Otoacústicas (EOAs e Audiometria de Tronco Encefálico (ABR. Observamos no caso estudado a incompatibilidade de resultados entre audiometria tonal e testes de inteligibilidade de fala, com os exames objetivos, EOAs e ABR, onde observou-se perda auditiva com importante alteração nos testes de inteligibilidade de fala, EOAs presentes e ABR anormal. Estes dados sugerem função coclear normal e alteração da sincronia neural.Nowadays, in our clinic, we can complement the conventional audiometry results with electrophysiologic exams. Not only does allow us to diagnose a peripheral hearing loss but also to differentiate cochlear, neural or central hearing loss. It led us to a new group of patients that presented changes in neural synchrony, with normal functions of the outer ear hair cells. This pathology is known as Auditory Neuropathy. Our study purpose is describe the audiologist characteristic of a

  6. Factores de competitividade do sector cerâmico : um estudo de caso

    Coelho, Liliana Carla Tavares

    2009-01-01

    O presente estudo pretende analisar os factores de competitividade do sector cerâmico. Para isso, é feita uma revisão da bibliografia existente nesta área, seguida pela caracterização do sector, sendo depois utilizada uma metodologia de estudo de caso aplicada a uma empresa do subsector de pavimentos e revestimentos cerâmicos de Portugal. São analisados diversos factores, entre os quais, a fusão, tecnologia e inovação, qualidade e ambiente, recursos humanos, marketing, marca...

  7. Estudo Aerodinâmico do Transporte de Pinhas (Pinus halepensis)

    Oliveira, Paulo Alexandre Malva

    2011-01-01

    Os incêndios florestais são uma das principais causas de devastação de grande área florestal que ocorre todos os anos. O estudo do comportamento do fogo e das suas formas de propagação, nomeadamente a ocorrência de focos secundários (spotfires), constitui-se como uma tarefa de auxílio nas estratégias de combate aos incêndios, que poderá amenizar os efeitos deste flagelo. O objectivo geral desta dissertação consiste no estudo das características aerodinâmicas das pinha...

  8. OS SISTEMAS AGROFLORESTAIS COMO ALTERNATIVA ECONÔMICA EM PEQUENAS PROPRIEDADES RURAIS: ESTUDO DE CASO

    Mário Jorge Campos dos Santos; Samantha Nazaré de Paiva

    2002-01-01

    Os Sistemas Agroflorestais (SAFs) constituem-se em uma alternativa de uso da terra para aliar a estabilidade do ecossistema visando à eficiência e otimização de recursos naturais na produção de forma integrada e sustentada. O objetivo deste estudo de caso foi avaliar a viabilidade econômica de um sistema agroflorestal localizado na região do Pontal do Paranapanema. O SAF em estudo é formada por espécies agrícolas: milho (Zea maiz), feijão guandu (Cajanus cajan), carioquinha, (Vigna unguiculat...

  9. A Periodização nos Estudos de Televisão

    Sérgio Capparelli

    2008-12-01

    Full Text Available Capparelli dá continuidade as suas análises sobre sistemas de televisão, com um exame dos critérios historiográficos utilizados para a periodização dos estudos sobre a televisão brasileira. Em seu artigo, o autor enfoca questões conceituais de historiografia e propõe a problematização dos cortes temporais produzidos ad hoc. Capparelli objetiva alertar para a necessidade de uma compreensão menos linear e mais crítica da periodização dos estudos da TV no Brasil.

  10. Vascularização do útero: estudo morfológico e experimental 

    Pires, Maria Alexandre Bettencourt

    2008-01-01

    RESUMO Os trabalhos de investigação, conducentes à elaboração do presente estudo morfofuncional, subordinado ao tema da "VASCULARIZAÇÃO ARTERIAL DO ÚTERO",fundamenta-se em conceitos da anatomia descritiva clássica, complementados por técnicas de estudo mais modernas, permitindo-nos observações originais. O principal objectivo é de definir um padrão descritivo da vascularização uterina e de estabelecer uma correlação anatomo-fisiológica e anatomo-clínica na descrição da angiomor...

  11. A CONTABILIDADE COMO BASE INFORMACIONAL AO DESENVOLVIMENTO DA ATIVIDADE AQÜICOLA: UM ESTUDO MULTICASO

    Cristiano do Nascimento; Alessandra Vasconcelos Gallon

    2008-01-01

    Esta pesquisa, efetuada junto aos pequenos produtores catarinenses de moluscos cultivados no mar (mexilhão e ostra), objetivou investigar sobre a utilização dos dados e informações contábeis na condução de seus negócios. Para isto, realizouse um estudo exploratório-descritivo, com abordagem dos dados predominantemente qualitativa, por meio de um estudo multicaso. Os dados coletados em 29 unidades produtoras de moluscos, via questionário aplicado entre agosto e outubro de 2007, abordam aspecto...

  12. Estudo do uso de midazolam em crianças com estado de mal epileptico

    Lohr Junior, Alfredo

    2013-01-01

    Resumo: O presente estudo teve o propósito de reavaliar o uso do midazolam em crianças com estado de mal epiléptico refratário. Foram avaliadas 50 crianças com estado de mal epiléptico, internadas na unidade de terapia intensiva do Hospital Infantil Pequeno Príncipe - Curitiba, Paraná, Brasil. O estudo foi caracterizado por dois grupos de pacientes, Grupo A - Midazolam (n=24) prospectivo, e o Grupo B - Thiopental (n=26) histórico. O Grupo Midazolam compôs-se por crianças com o diagnostico cli...

  13. Dificuldades de aprendizagem específicas: estudo de caso sobre dislexia

    Costa, Florismundo Augusto da Silva

    2013-01-01

    Neste estudo abordamos aspectos relacionados com as dificuldades de aprendizagem específicas designadamente a dislexia, debruçando-nos sobre a questão conceptual, sua tipificação, etiologia e processos de avaliação e intervenção. A dislexia é uma dificuldade da aprendizagem da leitura que não se pode explicar por um défice cognitivo nem sensorial, nem por um ambiente social ou familiar desfavorável, nem por métodos de ensino desajustados. O estudo empírico que desenvolvemos, consiste na...

  14. Viver com dislexia: Estudo de um modelo empírico e da sua aplicabilidade

    Pinto, Mónica Grasiela da Silva

    2013-01-01

    O presente trabalho incide na problemática da Dislexia, uma das Dificuldades de Aprendizagem Específicas e a mais prevalente no meio escolar. Tem com objeto de estudo um indivíduo adulto, escolarizado, cujo diagnóstico de Dislexia lhe foi conferido apenas em idade adulta, não tendo beneficiado de quaisquer adequações avaliativas ou estratégias diferenciadas de acordo com a sua problemática ao longo do seu percurso escolar. O propósito deste estudo é, pois, analisar a sua per...

  15. Cultura organizacional e satisfação profissional: estudo desenvolvido num hospital privado

    Santos, Joana Vieira; Sustelo, Margarida

    2009-01-01

    No presente estudo, procurou-se destacar a influência da cultura e do clima organizacionais sobre a satisfação no trabalho dos colaboradores. Esta tem bastante relevância para o desempenho organizacional, visto ter repercussões na realização pessoal dos activos humanos e na produtividade da empresa. O estudo foi realizado com 100 activos humanos de um Hospital Privado. Os dados foram recolhidos através de um instrumento constituído por duas escalas: o questionário FOCUS (First Organizational ...

  16. Estudo preliminar da actividade antimicrobiana das folhas de cydonia oblonga miller

    Filipe, Catarina; Silva, Ricardo; Miranda, Ana; Andreia P. Oliveira; Silva, Branca M.; Sousa, João Carlos; Cerqueira, Fátima

    2008-01-01

    O marmelo é reconhecido como uma importante fonte de compostos promotores da saúde sendo que a actividade antimicrobiana dos extractos da sua polpa, casca e sementes foi já avaliada. Não existem porém estudos da actividade antimicrobiana das folhas de marmeleiro. Este estudo preliminar teve como objectivo determinar a actividade dos seus extractos metanólicos. Concluiu-se que os extractos testados não apresentam actividade em E. coli, S. aureus, C. albicans, C. glabrata, A. niger,...

  17. Perfil psicomotor em crianças com e sem autismo: um estudo comparativo

    Coelho, Ana Paula Mendes Augusto

    2011-01-01

    O presente artigo “Perfil Psicomotor em Crianças com e sem Autismo - Um estudo comparativo” pretende diferenciar os perfis psicomotores de duas crianças: uma com autismo e outra com um desenvolvimento normativo e verificar a importância do conceito de psicomotricidade na avaliação da progressão das suas aprendizagens. A metodologia utilizada para a elaboração deste trabalho é o estudo de caso comparativo (Yin, 2001). Os instrumentos utilizados para a recolha de dados foram a BPM, (Fonseca, 20...

  18. “Gripe 2007”. Um estudo sobre comportamentos face à “gripe”

    Branco, Maria João; Nunes, Baltazar

    2007-01-01

    O Departamento de Epidemiologia realizou um estudo com o objectivo de caracterizar as práticas adoptadas perante a “gripe”/síndroma gripal, auto-referidas, pela população portuguesa do Continente. O estudo, descritivo transversal, constou de um inquérito realizado por entrevista telefónica, no segundo trimestre de 2007, a um dos elementos de 18 e mais anos, residente nas unidades de alojamento (UA) que integram a amostra de famílias ECOS. Esta amostra é aleatória e constituída por 1034 UA...

  19. GEOSSISTEMAS E CLIMATOLOGIA GEOGRÁFICA: ESTUDOS INTEGRADOS DO CLIMA EM BACIAS HIDROGRÁFICAS

    Wesley da Silva Belizário

    2014-01-01

    Os estudos do ambiente têm sido cada vez mais frequentes, sobretudo aqueles relacionados aos impactos negativos ao ambiente natural, seja no espaço rural ou urbano. Várias contribuições teóricas têm surgido para dar sentido e embasamento para tais análises, principalmente aquelas que tentam relacionar todas as possibilidades presentes no meio, a fim de que se efetive o chamado estudo integrado do ambiente, sendo uma dessas contribuições a teoria dos geossistemas. O presente trabalho tem como ...

  20. Comite de publicacoes em estudo multicentrico e sistema informatizado de apoio - publiELSA

    Marilia Sa Carvalho; Mauricio Lima Barreto; Claudia Medina Coeli; Rafael Monteiro Raposo; Eduardo Luiz Andrade Mota; Bruce Bartholow Duncan

    2013-01-01

    O comitê de publicações de um estudo multicêntrico visa organizar as propostas de artigos, garantindo: amplo acesso aos dados, qualidade e precedência. Foi desenvolvido um sistema online de informação e gerenciamento de propostas de estudos - o publiELSA - , composto por três módulos: (i) submissão e aprovação da proposta; (ii) acompanhamento da proposta aprovada; e (iii) relatórios consolidados. O primeiro permite a qualquer interessado buscar e conhecer artigos já publicados e em andamento,...

  1. Estudo de mercado: "A satisfação dos franchisados em Portugal"

    Fialho, Maria Cristina Grilo

    2013-01-01

    Este relatório de estágio foi realizado no âmbito do Mestrado em Matemática e Aplicações, com especialização em Estatística e Investigação Operacional, da Universidade de Aveiro, e o estágio foi realizado no GEMEO (Gabinete de Estudos de Mercado e Opinião do IPAM). Foram desenvolvidas várias atividades relacionadas com os Estudos de Mercado, e uma dessas atividades é sobre o Franchising, onde se pretende avaliar o perfil e satisfação do Franchisado em Portugal. Para isso, fo...

  2. Inatividade física em idosos não institucionalizados: estudo de base populacional

    Bruno Morbeck de Queiroz; Raildo da Silva Coqueiro; João Souza Leal Neto; Adriano Ferreti Borgatto; Aline Rodrigues Barbosa; Marcos Henrique Fernandes

    2014-01-01

    O objetivo deste estudo é descrever a prevalência de inatividade física e analisar os fatores sociodemográficos, de estilo de vida e condições de saúde associados em idosos do Nordeste brasileiro. Estudo descritivo e de associação, baseado em dados secundários originados de uma pesquisa epidemiológica de base populacional envolvendo 316 idosos. O nível de atividade física foi avaliado por meio do International Physical Activity Questionnaire. As variáveis explanatórias foram: sexo, grupo etár...

  3. Competência emocional em enfermeiros : um estudo em hospitais públicos

    Agostinho, Luís Miguel Coelho Ferreira

    2008-01-01

    O presente estudo foi desenhado no sentido de conhecer os comportamentos e atitudes que identificam as cinco capacidades da Competência Emocional dos enfermeiros de hospitais públicos, a partir do construto teórico da Inteligência Emocional proposto por Goleman (2003). Foi, para o autor, um estudo pioneiro por ser de âmbito distrital, englobando enfermeiros de todas as categorias de cinco hospitais públicos do Serviço Nacional de Saúde. Esta dissertação de candidatura ao gra...

  4. Monogamia e ajustamento conjugal: Estudo entre casais do mesmo sexo e casais de sexo diferente

    José Carlos da Silva Mendes; Henrique Marques Pereira

    2013-01-01

    Objetivo: O presente estudo pretende identificar diferenças de exclusividade sexual e ajustamento conjugal entre casais de sexo diferente e casais do mesmo sexo. Método: Participaram no estudo de caráter descritivo e exploratório, 909 indivíduos com idade igual ou superior a 16 anos e uma relação significativa com o mínimo de 6 meses. Recorrendo à internet, os participantes responderam a um questionário sociodemográfico, à versão portuguesa da DAS (Dyadic Adjustment Scale) e a um questionário...

  5. estudo exploratório com estudantes do 1º ciclo do ensino superior

    Rodrigues, Maria do Rosário Queirós

    2012-01-01

    Dissertação apresentada à Universidade Fernando Pessoa, como parte dos requisitos para a obtenção do grau de Mestre em Psicologia, especialização em Psicologia do Trabalho e das Organizações Este trabalho apresenta um estudo exploratório sobre as atividades de aprendizagem e as perceções de literacia no ensino superior, tendo sido concretizado com estudantes universitários do 1º ciclo de estudos (Licenciatura) em três instituições de ensino superior, públicas e privadas, do norte do país. ...

  6. Causas de (in) sucesso escolar: Estudo de Caso de uma Escola do Concelho de Vila Real

    Monteiro, Diana Raquel Bernardo

    2010-01-01

    Dissertação de Mestrado em Ensino da Educação Física nos Ensinos Básico e Secundário Nesta dissertação foi desenvolvido um estudo teórico baseado na problemática do (In) Sucesso Escolar, de forma a identificar os factores que influenciam o Rendimento escolar dos nossos alunos. Por este motivo procuramos clarificar o conceito de (In) sucesso Escolar baseado em estudos empíricos desenvolvidos por inúmeros autores onde pudemos constatar quais as manifestações e as causas do (In) Sucesso Esc...

  7. Imagem de destinos turísticos: um estudo sobre as publicações brasileiras

    Scalabrini, Elaine Cristina Borges; Remoaldo, Paula Cristina Almeida; Lourenço, Júlia

    2015-01-01

    Os estudos referentes ao turismo dedicam-se à compreensão de diferentes temas, sendo que um bastante analisado à escala internacional é a questão da imagem de um destino turístico. O interesse por este tema é percebido em diversas áreas do conhecimento, como a sociologia e o marketing. No Brasil, há diversos pesquisadores dedicando-se à imagem dos destinos turísticos. Assim, buscando compreender de que forma este tema tem sido trabalhado no Brasil, este estudo de caráter biblio...

  8. Marketing na imprensa : os jornais na era digital : estudo de caso do Jornal I

    Casanova, Steffany da Forte

    2014-01-01

    O presente relatório trata o estudo de caso do Jornal i, um jornal generalista, diário, português, relativamente ao marketing na imprensa e adaptação da mesma ao meio digital online. Este tema ganha importância no contexto atual da imprensa portuguesa, nomeadamente no que concerne à presença digital dos diferentes meios e ao impacto dessa mesma presença no seu sucesso. A relevância deste tema ganha maior destaque considerando o seu objeto de estudo: o Jornal i. Um jornal português, nascido si...

  9. Liderança transformacional na escola : estudo de caso sobre o Presidente de um agrupamento

    Barreto, Ângela Teresa Dias Vasconcelos

    2009-01-01

    O presente estudo focaliza-se no estudo da liderança no caso específico de um Agrupamento Vertical de Escolas. Pretende-se compreender a forma como os docentes do Agrupamento percepcionam a liderança protagonizada pelo Presidente do Conselho Executivo, bem como o modo como essa mesma liderança é percepcionada pelo próprio. Optámos por uma investigação de carácter quantitativo. O instrumento de recolha de dados seleccionado foi o Multifactor Leadership Questionnaire (MLQ), da autoria de Bru...

  10. Estudo da sintomatologia depressiva e ansiosa em crianças com e sem obesidade

    Morgado, Joana Alexandra da Silva

    2012-01-01

    A obesidade infantil constitui um problema de saúde pública, o que motivou a sua classificação pela WHO como “epidemia do seculo XXI”. Como se não bastasse, surge sempre associada ao aumento quer da mortalidade, quer da morbilidade. Este estudo procura perceber em que medida as crianças com obesidade infantil diferem das crianças sem obesidade em termos de sintomatologia depressiva e ansiosa. O desenho do estudo é de natureza transversal e comparativa. A amostra é composta por 85 crianças, co...

  11. Contribuição dos estudos fenomenológicos para o cuidado de enfermagem

    Lúcia de Fatima da Silva

    2001-09-01

    Full Text Available O ensaio reflete a contribuição que os estudos fenomenológicos trazem para o cuidado de enfermagem, exemplificando com o saber acerca da adesão do coronariopata ao modo de ser cotidiano do falatório. Considera que a compreensão das manifestações humanas permite interpretar atitudes e comportamentos, e que as contribuições dos estudos fenomenológicos podem facilitar o alcance da excelência dos cuidados de enfermagem.

  12. Fitoterápicos na odontologia: estudo etnobotânico na cidade de Manaus

    S. S. Evangelista; F.C. Sampaio; R. C. Parente; M. F. C. L. Bandeira

    2013-01-01

    O reconhecimento oficial da fitoterapia na odontologia no Brasil veio acompanhado de diversas lacunas na pesquisa científica e na utilização de plantas medicinais, especificamente para espécies vegetais com aplicação nas doenças da cavidade oral. O estado do Amazonas, especificamente a cidade de Manaus, não possui um diagnóstico da aplicabilidade de plantas medicinais nos serviços de atenção Odontológica. Esse estudo propôs realizar um estudo do tipo quali-quantitativo, descritivo e explorató...

  13. Uso do conceito de aprendizagem em estudos relacionados ao trabalho e organizações

    Francisco Antonio Coelho Junior; Jairo Eduardo Borges-Andrade

    2008-01-01

    A literatura em comportamento organizacional apresenta diversos estudos referenciando o conceito aprendizagem aplicado no âmbito das organizações. Porém, verifica-se o uso pouco crítico ou sistemático deste conceito. O objetivo do presente artigo consiste em realizar uma análise conceitual do termo aprendizagem, justificando sua transposição para estudos organizacionais. Aplicaram-se técnicas de análise conceitual propostas por Ryle. Como resultado, verificou-se que a natureza multifacetada d...

  14. Infecções dos espaços cervicais: estudo prospectivo de 57 casos

    Sennes Luiz Ubirajara; Imamura Rui; Angélico Júnior Fernando Veiga; Simoceli Lucinda; Frizzarini Ronaldo; Tsuji Domingos Hiroshi

    2002-01-01

    Objetivo: apesar da antibioticoterapia, as infecções dos espaços cervicais profundos continuam a ter grande importância, tanto por sua alta incidência, como pelo risco de complicações. Forma de estudo: clínico, prospectivo. Material e método: descrevem-se neste estudo 57 casos de pacientes com diagnóstico de infecção cervical (celulite, abscesso e fasceíte necrotizante) internados na Enfermaria de Otorrinolaringologia do Hospital das Clínicas da Faculdade de Medicina da USP entre janeiro de 1...

  15. DISTÂNCIA CULTURAL E MODOS DE ENTRADA: UM ESTUDO DAS MAIORES TRANSACIONAIS BRASILEIRAS

    Livia Lopes Barakat; Jase Ramsey; Patricia Vargas dos Santos Oliveira; Plinio Rafael Reis Monteiro

    2010-01-01

    O presente artigo analisa se o tamanho dos grupos transnacionais modera o grau de inter-relacionamento entre a distância cultural (DC) e a preferência por métodos de entrada de aquisição ou exportação. Visando a trazer um novo prisma sobre o tema da DC, este estudo analisa o fenômeno além das dimensões culturais de Hofstede, empregando como moldura teórica a perspectiva bimodal proposta pelo Globe Project. Para o estudo, foi pesquisada uma amostra de 31 grupos empresariais que estão entre os ...

  16. Debates críticos: os Estudos de Segurança e o futuro dos Estudos da Paz e dos Conflitos 10.5102/uri.v11i2.2526

    André Barrinha

    2013-11-01

    Full Text Available Irremediavelmente ligados pela proximidade dos respetivos objetos de estudo, Estudos de Segurança e Estudos da Paz e dos Conflitos constituíram-se e evoluíram ao longo da Guerra Fria como disciplinas antagónicas. Essa divisão operou-se sobretudo na Europa, onde Galtung e seus discípulos encaminharam o estudo das questões da guerra e da paz para uma agenda claramente normativa e crítica, enquanto o estudo das questões de segurança se centrava numa abordagem orientada para o policy-making. Como é defendido neste artigo, o final do conflito bipolar correspondeu, até certo ponto, a uma inversão de papéis, com os Estudos da Paz e dos Conflitos acomodados a um empirismo desprovido de normatividade e os Estudos de Segurança, pelo menos na Europa, a abrirem-se a novas abordagens de cariz mais crítico. É aqui sugerido que esta inversão contém, em si, importantes lições para os Estudos da Paz e da Segurança, nomeadamente sobre a centralidade da teoria na definição de uma nova agenda crítica que permita uma aproximação entre as duas disciplinas.

  17. Characterization of the mechanism of action of the genetically modified Cry1AbMod toxin that is active against Cry1Ab-resistant insects.

    Muñóz-Garay, Carlos; Portugal, Leivi; Pardo-López, Liliana; Jiménez-Juárez, Nuria; Arenas, Ivan; Gómez, Isabel; Sánchez-López, Rosana; Arroyo, Raquel; Holzenburg, Andreas; Savva, Christos G; Soberón, Mario; Bravo, Alejandra

    2009-10-01

    Bacillus thuringiensis Cry toxins are used in the control of insect pests. They are pore-forming toxins with a complex mechanism that involves the sequential interaction with receptors. They are produced as protoxins, which are activated by midgut proteases. Activated toxin binds to cadherin receptor, inducing an extra cleavage including helix alpha-1, facilitating the formation of a pre-pore oligomer. The toxin oligomer binds to secondary receptors such as aminopeptidase and inserts into lipid rafts forming pores and causing larval death. The primary threat to efficacy of Bt-toxins is the evolution of insect resistance. Engineered Cry1AMod toxins, devoid of helix alpha-1, could be used for the control of resistance in lepidopterans by bypassing the altered cadherin receptor, killing resistant insects affected in this receptor. Here we analyzed the mechanism of action of Cry1AbMod. We found that alkaline pH and the presence of membrane lipids facilitates the oligomerization of Cry1AbMod. In addition, tryptophan fluorescence emission spectra, ELISA binding to pure aminopeptidase receptor, calcein release assay and analysis of ionic-conductance in planar lipid bilayers, indicated that the secondary steps in mode of action that take place after interaction with cadherin receptor such as oligomerization, receptor binding and pore formation are similar in the Cry1AbMod and in the wild type Cry1Ab. Finally, the membrane-associated structure of Cry1AbMod oligomer was analyzed by electron crystallography showing that it forms a complex with a trimeric organization. PMID:19559004

  18. Budding yeast cDNA sequencing project: Y053_E12_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y053_E12_F.ab1 Y053_E12_F.ab1 - - Show Y053_E12_F.ab1 Seqid Y053_E12_F.ab1 Link to SGD Y053_E12_ ... 0 753 ABI TCTTCTGCTCTAAGCTGCTCGAGTGTAAACGACTTACACTACAT AGTTAA TACGACTCACTATTTGGCAT TCCTTAAGATTTGATCGAAATAGA ... TATTAA GAAAAACAAACTGTACAATCAATCAATCAATCAT CACAT AAAATGTTCAG CGAATTAATTAACTTCCAAAATGAAGGTCAT GAG ...

  19. Budding yeast cDNA sequencing project: Y004_M09_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y004_M09_F.ab1 Y004_M09_F.ab1 DB652777 DB652777 Show Y004_M09_F.ab1 Seqid Y004_M09_F.ab1 Link to ... TAGACGATGAGGTGTTTCCCTTATCTTTTGCCAATTA TCAATTTACCGAGCAT GTGTCACTTGGTGAGCAT TATTCACTCAATACTT CGGAAGATGCCAAATA ... ACTGT GTTCTCGTTAGATAACCCTCAAGAAAACAACTACAAACACCAAGCCAT GA ATAACGTCCAGGATTGTCGCAT GGCCGTCGCGGCCAAAACTACCCAGT ...

  20. Budding yeast cDNA sequencing project: Y045_B09_F.ab1 [Budding yeast cDNA sequencing project

    Full Text Available Y045_B09_F.ab1 Y045_B09_F.ab1 - - Show Y045_B09_F.ab1 Seqid Y045_B09_F.ab1 Link to SGD Y045_B09_ ... b1 753 0 753 ABI ATTCTGCTTAAGCTGCTCGAGTGTAAACGACGGCCAT TCCCCAT TAAAGA CGACTCACTATAGGGAATTCCTTAAGATTTGGAGCAC ... TCACAACAAATAGCCAAAAATGCCCGTAAAGCAGGGA ATATTTTGAAAACCAT CTCAAACGAGGGCAGATCAGATATTTTATACAAA ATTCACGATGCCCTGA ...