WorldWideScience

Sample records for abs alkyl benzenesulfonates

  1. Reaction of Lithium Diethylamide with an Alkyl Bromide and Alkyl Benzenesulfonate: Origins of Alkylation, Elimination, and Sulfonation

    Gupta, Lekha; Ramírez, Antonio; Collum, David B.

    2010-01-01

    A combination of NMR, kinetic, and computational methods are used to examine reactions of lithium diethylamide in tetrahydrofuran (THF) with n-dodecyl bromide and n-octyl benzenesulfonate. The alkyl bromide undergoes competitive SN2 substitution and E2 elimination in proportions independent of all concentrations except for a minor medium effect. Rate studies show that both reactions occur via trisolvated-monomer-based transition structures. The alkyl benzenesulfonate undergoes competitive SN2...

  2. 40 CFR 721.9220 - Reaction products of secondary alkyl amines with a substituted benzenesulfonic acid and sulfuric...

    2010-07-01

    ... amines with a substituted benzenesulfonic acid and sulfuric acid (generic name). 721.9220 Section 721... Reaction products of secondary alkyl amines with a substituted benzenesulfonic acid and sulfuric acid... benzenesulfonic acid and sulfuric acid (PMNs P-89-703, P-89-755, and P-89-756) are subject to reporting under...

  3. Correlation of Critical Micelle Concentration of Sodium Alkyl Benzenesulfonates with Molecular Descriptors

    2006-01-01

    The hydrophobic-hydrophilic segment geometries of 36 sodium alkyl benzenesulfonates were fully optimized and calculated by abini-tio RHF/6-31G(d), quantum chemical data such as the charge density, the energy of molecular orbital and the dipole moment were obtained. Based on two topological descriptors and one quantum chemical descriptor, a significant quantitative structure-property relationship (QSPR) model for the critical micelle concentration (cmc) of sodium alkyl benzenesulfonate surfactants was obtained by using the multiple linear regression technique. The good correlation coefficient of R2 (0.980) and cross-validation correlation coefficient R2cv (0.974) indicate the excellent capability and stability of the regression equation developed. In addition, linear relationships between logarithm of cmc and the dipole moment of surfactant hydrophobic hydrophilic segments for each homologous series have also been established with high correlation coefficient.

  4. Application of linear alkyl benzenesulfonic acid resin in chloroprene adhesives%烷基苯酸树脂在氯丁型胶粘剂中的应用

    凌辉; 钟锋; 李军; 陈亮; 刘根伸

    2015-01-01

    以烷基苯酸树脂部分取代酚醛树脂,探讨烷基苯酸树脂和酚醛树脂的混合比对氯丁型胶粘剂粘剂性能的影响。结果表明,当混合树脂中烷基苯酸树脂用量为20%~30%时,胶粘剂综合性能较优。%Using the alkyl benzenesulfonic acid resin partly instead of the phenolic resin, the effect of mixing proportion of benzenesulfonic acid resin and phenolic resin on the performance of chloroprene adhesives was discussed. The results showed that when the benzenesulfonic acid resin content was 20%~30%, the comprehensive performance of adhesives was optimal.

  5. Solar Powered Vapor Absorption System Using Propane And Alkylated Benzene Ab300 Oil

    Al-Dadah, R.K.; Jackson, G.; Rezk, Ahmed

    2011-01-01

    Abstract This paper describes experimental work on a solar assisted vapour absorption air conditioning system using Propane (refrigerant) and Alkylated Benzene (AB300?refrigeration lubrication oil, absorbent). Preliminary experiments to assess the miscibility of propane in various lubricating oils namely Shell Clavus oils 32 and 64 and Alkylated Benzene oils AB150 and AB300 indicated that Propane is most miscible in Alkylated Benzene AB300. The vapour absorption system is a single ...

  6. Economic Comparison of Standard Method with E.Jurdo Simplified Method to Measure Linear Alkyl Benzenesulfonates in Municipal Wastewater

    M Pirsaheb

    2011-06-01

    Full Text Available Background and Objectives: Linear alkyl benzene sulfonates are widely used as surfactants in formulated detergent products. Because of their use in household and industrial detergents, LAS is discharged into wastewater collection systems and subsequently entered to wastewater treatment plants. Therefore, it is important to determine the concentration of LAS with accuracy. They are usually determined by standard method which is time-consuming,tedious and requires great quantities of chloroform. IN 2006 E.Jurado et al proposed a simplified method for measurement of LAS. In the present work the standard method and E.Jurado simplified method was compared economically.Material and Methods: In this work NPV method was used for accounting the cost of initial investment, consumable material, non-consumable equipment and annual cost of staff and finally Net Present Value was calculated for them separately. The rate of interest was considered 15%.Results: calculation showed initial investment, annual cost of staff and materials for standard method 13351981, 499968 and 1710981 RLS, respectively. And these costs for simplified method were 12048202, 83328 and 58202 RLS, respectively. Finally NPV for standard method and simplified method were equal to 30360709 and 14681848 RLS.Conclusion: The method proposed by E.Jurdo et al is simple, time consuming and more economical than standard method .This technique can be suggested applying to the routine measurement of LAS in wastewater treatment plants.

  7. Raman and ab initio studies of simple and binary 1-alkyl-3-methylimidazolium ionic liquids

    Berg, R.W.; Deetlefs, M.; Seddon, K.R.; Shim, Irene; Thompson, J.M.

    2005-01-01

    calculations. The previously reported anti and gauche forms of the [C(4)mim](+) cation have been observed, and this study reveals this to be a general feature of the long-chain I-alkyl derivatives. Analysis of mixtures Of [C(6)mim]Cl and [C(6)mim][PF6] has provided information on the nature of the hydrogen...... bonding between the imidazolium headgroup and the anions, and the invariance of the essentially 50:50 mixture of the predominant conformers informs on the nature of glass formation in these systems....

  8. Raman and ab initio studies of simple and binary 1-alkyl-3-methylimidazolium ionic liquids

    Berg, R.W.; Deetlefs, M.; Seddon, K.R.;

    2005-01-01

    Raman spectra of the ionic liquids, 1-butyl-3-methylimidazolium hexafluorophosphate ([C(4)mim][PF6]), 1-hexyl-3-methylimidazolium chloride ([C(6)mim]Cl), and 1-hexyl-3-methylimidazolium hexafluorophosphate ([C(6)mim][PF6]), and binary mixtures thereof, have been assigned using ab initio MP2...

  9. Polypyrrole Doped with Alkyl Benzene Sulphonates

    Bay, Lasse; Mogensen, Naja; Skaarup, Steen;

    2002-01-01

    The properties of polypyrrole (PPy) are to a large extent determined by the condition of synthesis and especially by the counterion incorporated as dopant during synthesis. In this work, PPy doped with different alkyl benzenesulfonates are compared. The polymer films are prepared by constant curr...

  10. Ab initio MO study on the thermal stability of alkyl tetrazoles; Arukiru chikan tetorazoru rui no netsu anteisei yosoku

    Ono, Yoshio; Arai Mitsuru; Tamura [The University of Tokyo, Tokyo (Japan). Department of Chemical system Engineering; Matsunaga, Takehiro [National Institute of Materials and Chemical Research, Tsukuba (Japan)

    1999-10-31

    In order to estimate the thermal stability of tetrazoles, ab initio MO calculations of alkyl tetrazoles were carried out and the initial process of thermal decomposition were discussed. The relationships between the chemical structures and the thermal stabilities were investigated. The initial step of the thermal decomposition is the cleavage of the N3-N4 bond, then the C5-N1 bond is cleave. The relationship between the N3-N4 bond length and the thermal stability is recognized, that is, the shorter the bond length is, the more thermally stable the tetrazole is. In addition it turns out, the more positive the ring charge is, the more thermally stable the tetrazole is. The relationship between the {pi}-electron density and the thermal stability is not found. The indexes adopted as a measure of thermal stability indicate that the more equal the bond lengths of the ring are, the more thermally stable they are. From these results, three tetrazoles with both high thermal stability and high nitrogen content are proposed. (author)

  11. High-performance nanopapers based on benzenesulfonic functionalized graphenes.

    Huang, Wenyi; Ouyang, Xilian; Lee, L James

    2012-11-27

    High-performance graphene nanopapers are prepared from an aqueous solution of functional graphenes with benzenesulfonic acid groups via covalent bonds. The formed hydrophobic graphene nanopapers showed the highest tensile strength of 360 MPa and Young's modulus of 102 GPa for samples with 13.7 wt % functional group and annealed at 150 °C. These samples showed a high electrical conductivity of 4.45 × 10(4) S/m after being annealed at 250 °C. The aforementioned properties of graphene nanopapers are much higher than any previously reported data. The properties of nanopapers depend on the degree of functionality on graphenes and the annealing temperatures, which are further evidenced by X-ray photoelectron spectroscopy, FTIR, and X-ray diffraction patterns. Such unique nanopapers can be easily bounded and sandwiched onto any solid surface to give rise to great potentials in many applications such as gas diffusion barriers, EMI shielding, thermal management, and anticorrosion. PMID:23098084

  12. Alkyl glycosides

    Wimmer, Zdeněk; Zarevúcka, Marie; Šaman, David

    Venice, 2004. s. 20-21. [Sustainable Green Chemistry and Chemical Technology. Workshop /3./. 20.02.2004-21.02.2004, Venice] R&D Projects: GA ČR GA203/02/0166; GA MŠk OC D29.001 Keywords : alkyl glycosides Subject RIV: CC - Organic Chemistry

  13. Amlodipine Benzenesulfonate: A Mechanistic Investigation of Its Industrial Preparation via Detritylation of N-tritylamlodipine and Related NMR Studies

    Furlan, Borut; Grdadolnik, Simona Golič; Hočevar, Stanko; Kocjan, Darko; Levec, Janez; Maskill, Howard; Navrátilová, Hana; Pospíšil, Jiří; Potáček, Milan; Urleb, Uroš; Žmitek, Janko

    2009-01-01

    Kinetics and product analysis of detritylation of N-tritylamlodipine by benzenesulfonic acid in methanol, methanol-chloroform (volume ratio 9:1), ethanol, 2-propanol, and methanol/2-propanol (mole ratio 1:1) have been investigated by HPLC; amongst these reaction conditions are ones closely similar to those of one method of manufacturing amlodipine benzenesulfonate. Kinetics of detritylation of Ntritylamlodipine have also been investigated in methanol-d4 by 1H NMR spectroscopy and the agreemen...

  14. Some thermodynamic characteristics of uranyl benzenesulfonate and uranyl p-toluenesulfonate

    The enthalpy of dissolution of the anhydrous and hydrated salts in 4 M hydrochloric acid was determined. Based on experimental and published data, the enthalpy of water addition to the anhydrous salts and lowest hydrates of uranyl p-toluenesulfonate (UPTS) was evaluated. The enthalpy of addition of a water molecule to UPTS monohydrate was found to be approximately two times lower than in the case of UPTS trihydrate. This is in a good agreement with published data on formation of fairly stable coarse crystals of UPTS pentahydrate in slow crystallization in air. We did not find any published data on the standard enthalpy of formation of the sulfonate ions. However, according to the presented thermo-chemical cycles, from the experimental data we can evaluated the enthalpies of formation of sulfonates from the components, i.e. from amorphous uranium trioxide and aqueous solutions of benzenesulfonic and p-toluenesulfonic acids. It was shown that considering all approximations used in the evaluation, the enthalpy of formation of UPTS is by approximately 20 kJ.mole-1 more negative than in the case of uranyl benzenesulfonate. Along with thermochemical characteristics of hydrates, this allows us to conclude that electron-donor power of p-toluenesulfonate ion is noticeably greater than that of the benzenesulfonate ion, which is responsible for the differences in the characteristics of these salts

  15. Uranyl benzenesulfonate and anionic effects in processes of salt extraction and dissolution

    The results are reported of an investigation of the mutual solubility in the ternary uranylbenzenesulfonate-water-tributyl phosphate system at 25 degree C. The character of the phase diagram obtained is compared with known types of salt-water-TBP diagrams. Data on the extractability and solubility of UO2(C6H5SO3)2, and also for hydration-solvation processes in the system, together with IR data, permit the inference that the specific features of the behavior of uranyl benzenesulfonate are determined by the efficiency of the hydration of an oxygen atom of the sulfonate group not directly bonded to the cation

  16. Uranyl benzenesulfonate and anionic effects in processes of salt extraction and dissolution

    Baluev, A.V.; Suglobova, I.G.; Taranov, A.P.

    1989-01-01

    The results are reported of an investigation of the mutual solubility in the ternary uranylbenzenesulfonate-water-tributyl phosphate system at 25/degree/C. The character of the phase diagram obtained is compared with known types of salt-water-TBP diagrams. Data on the extractability and solubility of UO/sub 2/(C/sub 6/H/sub 5/SO/sub 3/)/sub 2/, and also for hydration-solvation processes in the system, together with IR data, permit the inference that the specific features of the behavior of uranyl benzenesulfonate are determined by the efficiency of the hydration of an oxygen atom of the sulfonate group not directly bonded to the cation.

  17. 2D-QSAR Studies on Triazolone Compounds Containing Benzenesulfonic Amide

    WEI Qing-Li; GAO Jun; SUN Dao-Xing; ZHANG Shu-Sheng

    2007-01-01

    The geometry structures of 6 triazolone compounds containing benzenesulfonic amide were fully optimized with DFT (Density Functional Theory) method at the B3LYP/6-31G level, and the structural and electronic parameters of the compounds were calculated. The hydrophobic and topological parameters of the title compounds were calculated by HyperChem software. The mono- and bi-parametric models between the parameters and biological activity of the compounds were analyzed by Multiple Linear Regression method based on Hansch-Fujita model. The results show that the activities of the title compounds were increased with higher hydrophobic property logP and molecular volume V, lower molecular energy ETOTAL and electronegative of benzene ring Qph.

  18. Biodegradation of phenol, salicylic acid, benzenesulfonic acid, and iomeprol by Pseudomonas fluorescens in the capillary fringe.

    Hack, Norman; Reinwand, Christian; Abbt-Braun, Gudrun; Horn, Harald; Frimmel, Fritz H

    2015-12-01

    Mass transfer and biological transformation phenomena in the capillary fringe were studied using phenol, salicylic acid, benzenesulfonic acid, and the iodinated X-ray contrast agent iomeprol as model organic compounds and the microorganism strain Pseudomonas fluorescens. Three experimental approaches were used: Batch experiments (uniform water saturation and transport by diffusion), in static columns (with a gradient of water saturation and advective transport in the capillaries) and in a flow-through cell (with a gradient of water saturation and transport by horizontal and vertical flow: 2-dimension flow-through microcosm). The reactors employed for the experiments were filled with quartz sand of defined particle size distribution (dp=200...600 μm, porosity ε=0.42). Batch experiments showed that phenol and salicylic acid have a high, whereas benzenesulfonic acid and iomeprol have a quite low potential for biodegradation under aerobic conditions and in a matrix nearly close to water saturation. Batch experiments under anoxic conditions with nitrate as electron acceptor revealed that the biodegradation of the model compounds was lower than under aerobic conditions. Nevertheless, the experiments showed that the moisture content was also responsible for an optimized transport in the liquid phase of a porous medium. Biodegradation in the capillary fringe was found to be influenced by both the moisture content and availability of the dissolved substrate, as seen in static column experiments. The gas-liquid mass transfer of oxygen also played an important role for the biological activity. In static column experiments under aerobic conditions, the highest biodegradation was found in the capillary fringe (e.g. βt/β0 (phenol)=0 after t=6 d) relative to the zone below the water table and unsaturated zone. The highest biodegradation occurred in the flow-through cell experiment where the height of the capillary fringe was largest. PMID:26529301

  19. Biodegradation of phenol, salicylic acid, benzenesulfonic acid, and iomeprol by Pseudomonas fluorescens in the capillary fringe

    Hack, Norman; Reinwand, Christian; Abbt-Braun, Gudrun; Horn, Harald; Frimmel, Fritz H.

    2015-12-01

    Mass transfer and biological transformation phenomena in the capillary fringe were studied using phenol, salicylic acid, benzenesulfonic acid, and the iodinated X-ray contrast agent iomeprol as model organic compounds and the microorganism strain Pseudomonas fluorescens. Three experimental approaches were used: Batch experiments (uniform water saturation and transport by diffusion), in static columns (with a gradient of water saturation and advective transport in the capillaries) and in a flow-through cell (with a gradient of water saturation and transport by horizontal and vertical flow: 2-dimension flow-through microcosm). The reactors employed for the experiments were filled with quartz sand of defined particle size distribution (dp = 200…600 μm, porosity ε = 0.42). Batch experiments showed that phenol and salicylic acid have a high, whereas benzenesulfonic acid and iomeprol have a quite low potential for biodegradation under aerobic conditions and in a matrix nearly close to water saturation. Batch experiments under anoxic conditions with nitrate as electron acceptor revealed that the biodegradation of the model compounds was lower than under aerobic conditions. Nevertheless, the experiments showed that the moisture content was also responsible for an optimized transport in the liquid phase of a porous medium. Biodegradation in the capillary fringe was found to be influenced by both the moisture content and availability of the dissolved substrate, as seen in static column experiments. The gas-liquid mass transfer of oxygen also played an important role for the biological activity. In static column experiments under aerobic conditions, the highest biodegradation was found in the capillary fringe (e.g. βt/β0 (phenol) = 0 after t = 6 d) relative to the zone below the water table and unsaturated zone. The highest biodegradation occurred in the flow-through cell experiment where the height of the capillary fringe was largest.

  20. Photoinduced intramolecular charge transfer of sodium 4-(N,N-dimethylamino)benzenesulfonate

    林丽榕; 江云宝

    2000-01-01

    A new dual fluorescent N,N-dimethylaniline derivative, sodium 4-(N,N-dimethylamino)-benzenesulfonate (SDMAS), is reported. In SDMAS, the electron acceptor is linked to the phenyl ring via a sulfur atom at the para-position of the electron donor. It was found that SDMAS emits dual fluorescence only in highly polar solvent water but not in organic solvents such as formamide, methanol and acetonitrile. In organic solvents only a single-band emission at ca.360 nm was observed in the short wavelength region. The dual fluorescence of SDMAS in water was found at 365 and 475 nm, respectively. Introduction of organic solvent such as ethanol, acetonitrile, and 1,4-dioxane into aqueous solution of SDMAS leads to blue-shift and quenching of the long-wavelength emission. Measurements of steady-state and picosecond time-resolved fluorescence indicate that the long wavelength fluorescence is emitted from a charge transfer (CT) state that is populated from the locally excited (LE) state, with the latter giving off the

  1. Tripodal (N-alkylated) CMP(O) and malonamide ligands: synthesis, extraction of metal ions, and potentiometric studies

    Janczewski, Dominik; Reinhoudt, David N.; Verboom, Willem; Malinowska, Elzbieta; Pietrzak, Mariusz; Hill, Clement; Allignol, Cecile

    2007-01-01

    Tripodal ligands build on the C-pivot ( 9b–e, 13b–d, and 17a–d) and trialkylbenzene platforms ( 10a,b, 11, 12, 14a,b, and 18a,b) bearing (N-alkylated) carbamoylmethylphosphine oxide (CMPO), carbamoylmethylphosphonate (CMP), and malonamide moieties were synthesized. Extraction studies with Am3+ and E

  2. Catalytic Reduction of Noble Metal Salts by Sodium Hypophosphite Promoted by the Film Poly-(p-Allyl Ether Benzenesulfonic Acid).

    Costa, M I C F; Steter, J R; Purgato, F L S; Romero, J R

    2011-01-01

    Glassy carbon electrodes were coated with the film poly-(p-allyl ether benzenesulfonic acid) by an anodic procedure. Nickel, platinum, and palladium ions were introduced into the film by ion exchange of H(+) with the corresponding salts. These ions were catalytically reduced to their corresponding metals using the known electroless reducing agent sodium hypophosphite. Scanning electron microcopy and energy dispersive X-ray spectroscopy were carried out to demonstrate the occurrence of the catalytic process. To compare this method with another one carried out in our laboratory, the electrocatalytic reduction of H(+) was studied using the same modified electrodes. A suggested mechanism for the catalysis is proposed. PMID:24052832

  3. Identify alkylation hazards

    This paper reports that extensive experience shows that alkylation plants regardless of acid catalyst choice, can be operated safely, and with minimum process risk to employees or neighbors. Both types of plants require a comprehensive and fully supported hazard management program that accounts for differing physical properties of the acids involved. Control and mitigation cost to refiners will vary considerably from plant to plant and location to location. In the author's experience, the order of magnitude costs will be about $1 to $2 million for a sulfuric acid (SA) alkylation plant, and about $10 to $15 million for a hydrofluoric acid (HF) plant. These costs include water supply systems and impoundment facilities for contaminated runoff water. The alkylation process, which chemically reacts isobutane and light olefins in the presence of a strong acid catalyst into a premium gasoline component is described

  4. Lithium Alkyl Exchange Equilibria

    Kinetic analyses of two types of exchange reactions of organo- lithium reagents, both alkyl and aryl types, RLi, have been made: (1) halogen-metal interchange with alkyl and aryl halides, R'X, and (2) hydrogen-metal interchange (commonly called metallation) with aromatic hydrocarbons, R'H. Rates of these RLi + R'X ⇄ RX + R'Li; (1) . RLi + R'H ⇄ RH+ R'Li (2) reactions have been determined, conditions under which the systems attain equilibrium have been established, and the positions of equilibrium measured, all as functions of the reactants, solvents and catalysts employed. Concerning halogen-lithium interchange between alkyl groups (1), the conclusion is reached that equilibration proceeds to yield the less sterically demanding alkyl group attached to lithium. The data show, for example, that isobutyllithium is much less stable than n-butyllithium, and again, that 2,6-dimethyl- phenyllithium is much less stable than phenyllithium. The exchange is general with iodides, occurs with some bromides and does not occur with chlorides. The exchange is quite slow in hydrocarbon media and is catalysed by relatively small amounts of ethers. In the presence of the optically active methyl ether of menthol, methyl iodide exchanges with racemic s-butyllithium to give optically active s-butyl iodide. In work with the second reaction, hydrogen-lithium interchange (2), nuclear magnetic resonance spectrometry has been used for rate studies. Catalysts (Lewis bases) have been evolved for establishing equilibria in rather unreactive systems, e.g. phenyllithium can be demonstrated to exchange with benzene by labelling the latter radioactivity. From the correlations of structure and reactivity found in this study, the conclusion is reached that the basic alkyllithium structure is dimeric, R2Li2 The arrangement of the groups within this dimer satisfactorily explain the special steric effects noted in organolithium reagent stability. (author)

  5. Method of making alkyl esters

    Elliott, Brian

    2010-09-14

    Methods of making alkyl esters are described herein. The methods are capable of using raw, unprocessed, low-cost feedstocks and waste grease. Generally, the method involves converting a glyceride source to a fatty acid composition and esterifying the fatty acid composition to make alkyl esters. In an embodiment, a method of making alkyl esters comprises providing a glyceride source. The method further comprises converting the glyceride source to a fatty acid composition comprising free fatty acids and less than about 1% glyceride by mass. Moreover, the method comprises esterifying the fatty acid composition in the presence of a solid acid catalyst at a temperature ranging firm about 70.degree. C. to about 120.degree. C. to produce alkyl esters, such that at least 85% of the free fatty acids are converted to alkyl esters. The method also incorporates the use of packed bed reactors for glyceride conversion and/or fatty acid esterification to make alkyl esters.

  6. Fotfavoriten AB

    Søilen, Klaus Solberg; HUBER, Stefan

    2004-01-01

    Fotfavoriten AB, a foot care company located in Sollefttå in Northern Sweden, is an example of how local government fires staff only to reengage them as entrepreneurs delivering similar service. The case is typical for the social sector and may mark a trend. The result is often felt to be positive both by the entrepreneur, who is now more directly in charge of her or his earnings, and the end consumer. The CEO of Fotfavoriten AB, Eva Wörmann, waited a long time before she dared to take the ne...

  7. 40 CFR 721.9595 - Alkyl benzene sulfonic acids and alkyl sulfates, amine salts (generic).

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Alkyl benzene sulfonic acids and alkyl... Significant New Uses for Specific Chemical Substances § 721.9595 Alkyl benzene sulfonic acids and alkyl...) The chemical substances identified generically as alkyl benzene sulfonic acids and alkyl...

  8. One-pot, three-component synthesis of a library of spirooxindole-pyrimidines catalyzed by magnetic nanoparticle supported dodecyl benzenesulfonic acid in aqueous media.

    Deng, Jia; Mo, Li-Ping; Zhao, Fei-Yang; Zhang, Zhan-Hui; Liu, Shou-Xin

    2012-05-14

    Dodecyl benzenesulfonic acid functionalized silica-coated magnetic nanoparticles (γ-Fe2O3@SiO2-DDBSA) were readily prepared and identified as an efficient catalyst for the synthesis of a library of spirooxindole-pyrimidine derivatives by three-component condensation reaction of barbituric acids, isatins and cyclohexane-1,3-diones. The aqueous reaction medium, easy recovery of the catalyst using an external magnet, and high yields make the protocol sustainable and economic. PMID:22533528

  9. Perfluorinated Alkyl Substances

    Grandjean, Philippe; Clapp, Richard

    2015-01-01

    Perfluorinated alkyl substances have been in use for over sixty years. These highly stable substances were at first thought to be virtually inert and of low toxicity. Toxicity information slowly emerged on perfluorooctanoic acid and perfluorooctane sulfonate. More than thirty years ago, early...... studies reported immunotoxicity and carcinogenicity effects. The substances were discovered in blood samples from exposed workers, then in the general population and in community water supplies near U.S. manufacturing plants. Only recently has research publication on perfluorooctanoic acid and...... perfluorooctane sulfonate intensified. While the toxicology database is still far from complete, carcinogenicity and immunotoxicity now appear to be relevant risks at prevalent exposure levels. Existing drinking water limits are based on less complete evidence that was available before 2008 and may be more than...

  10. Tripodal (N-alkylated) CMP(O) and malonamide ligands: synthesis, extraction of metal ions, and potentiometric studies

    Janczewski, D.; Reinhoudt, D.N.; Verboom, W. [Twente Univ., Lab. of Supramolecular Chemistry and Technology, Mesa Research Institute for Nanotechnology, Enschede (Netherlands); Malinowska, E.; Pietrzak, M. [Warsaw Univ. of Technology, Dept. of Analytical Chemistry, Faculty of Chemistry (Poland); Hill, C.; Allignol, C. [CEA Valrho, 30 - Marcoule (France)

    2007-01-15

    Tripodal ligands build on the C-pivot (9b-e, 13b-d, and 17a-d) and tri-alkyl-benzene platforms (10a,b, 11, 12, 14a,b, and 18a,b) bearing (N-alkylated) carbamoyl-methyl-phosphine oxide (CMPO), carbamoyl-methyl-phosphonate (CMP), and malonamide moieties were synthesized. Extraction studies with Am{sup 3+} and Eu{sup 3+} show that in general there is a positive influence of the N-alkyl substituents in C-pivot CMP(O) ligands on the D(distribution) coefficients. The tri-alkyl-benzene CMPO ligands 10a,b, 11, and 12 have considerably larger D coefficients than the corresponding C-pivot analogues 9a-e, although hardly having any selectivity, while N-alkylation gives rise to smaller D coefficients. Although less effective the extraction behavior of the C-pivot CMP analogues 13b-d shows more or less the same trend as the corresponding CMPO ligands 9b-e upon substitution of the carboxamide N-atom with different alkyl chains. The different malonamide ligands 17a-d and 18a,b are bad extractants, while N-alkylation makes them even worse. Potentiometric studies of CMP(O) and malonamide ligands in polymeric membranes on Pb{sup 2+}, Cu{sup 2+}, Ca{sup 2+}, Mg{sup 2+}, Na{sup +}, and K{sup +} salts revealed that N-alkyl substituents increase the stability constants of ion-ionophore complexes compared to unsubstituted ligands. In polymeric membrane electrodes the ligands induce a selectivity pattern that differs significantly from the so-called Hofmeister series, giving the highest selectivity coefficients for UO{sub 2}{sup 2+} among all examined cations (Pb{sup 2+}, Cu{sup 2+}, Ca{sup 2+}, Mg{sup 2+}, Na{sup +}, K{sup +}). (authors)

  11. Mild Catalytic methods for Alkyl-Alkyl Bond Formation

    Vicic, David A

    2009-08-10

    Overview of Research Goals and Accomplishments for the Period 07/01/06 – 06/30/07: Our overall research goal is to transform the rapidly emerging synthetic chemistry involving alkyl-alkyl cross-couplings into more of a mechanism-based field so that that new, rationally-designed catalysts can be performed under energy efficient conditions. Our specific objectives for the previous year were 1) to obtain a proper electronic description of an active catalyst for alkyl-alkyl cross-coupling reactions and 2) to determine the effect of ligand structure on the rate, scope, selectivity, and functional group compatibility of C(sp3)-C(sp3) cross-coupling catalysis. We have completed both of these initial objectives and established a firm base for further studies. The specific significant achievements of the current grant period include: 1) we have performed magnetic and computational studies on (terpyridine)NiMe, an active catalyst for alkyl-alkyl cross couplings, and have discovered that the unpaired electron resides heavily on the terpyridine ligand and that the proper electronic description of this nickel complex is a Ni(II)-methyl cation bound to a reduced terpyridine ligand; 2) we have for the first time shown that alkyl halide reduction by terpyridyl nickel catalysts is substantially ligand based; 3) we have shown by isotopic labeling studies that the active catalyst (terpyridine)NiMe is not produced via a mechanism that involves the formation of methyl radicals when (TMEDA)NiMe2 is used as the catalyst precursor; 4) we have performed an extensive ligand survey for the alkyl-alkyl cross-coupling reactions and have found that electronic factors only moderately influence reactivity in the terpyridine-based catalysis and that the most dramatic effects arise from steric and solubility factors; 5) we have found that the use of bis(dialkylphosphino)methanes as ligands for nickel does not produce active catalysts for cross-coupling but rather leads to bridging hydride

  12. Design, Synthesis, Biological Evaluation, and Structure–Activity Relationships of Substituted Phenyl 4-(2-Oxoimidazolidin-1-yl)benzenesulfonates as New Tubulin Inhibitors Mimicking Combretastatin A-4

    Fortin, Sébastien; Wei, Lianhu; Moreau, Emmanuel; Lacroix, Jacques; Côté, Marie-France; Petitclerc, Éric; Kotra, Lakshmi P.; C.-Gaudreault, René

    2011-01-01

    Sixty-one phenyl 4-(2-oxoimidazolidin-1-yl)benzenesulfonates (PIB-SOs) and 13 of their tetrahydro-2-oxopyrimidin-1(2H)-yl analogues (PPB-SOs) were prepared and biologically evaluated. The antiproliferative activities of PIB-SOs on 16 cancer cell lines are in the nanomolar range and unaffected in cancer cells resistant to colchicine, paclitaxel, and vinblastine or overexpressing the P-glycoprotein. None of the PPB-SOs exhibit significant antiproliferative activity. PIB-SOs block the cell cycle...

  13. The electrochemical behavior of N-n-undecyl-N'-(sodium-p- amino-benzenesulfonate) thiourea and its interaction with bovine serum albumin

    Hong Xia Luo; Yang Du; Zhi Xin Guo

    2008-01-01

    In pH 5.5 phosphate buffer solution, N-n-undecyl-N'-(sodium-p-amino-benzenesulfonate) thiourea (UPT) produced a pair ofredox peaks on the bare glassy carbon electrode. At the multi-walled carbon nanotube (MWNT) modified electrode, theelectrochemical behavior of UPT enhanced greatly. In the presence of bovine serum albumin (BSA), the peak currents ofUPT decreased linearly due to the formation of a super-molecular complex. This method was successfully applied to thedetermination of BSA in a bovine serum sample.2008 Hong Xia Luo. Published by Elsevier B.V. on behalf of Chinese Chemical Society. All rights reserved.

  14. A biological source of oceanic alkyl nitrates

    Dahl, E. E.; Lewis, C. B.; Velasco, F. L.; Escobar, C.; Kellogg, D.; Velcamp, M.

    2013-12-01

    Alkyl nitrates are an important component of reactive nitrogen in the troposphere. The oceans are a source of alkyl nitrates to the atmosphere, however the source of alkyl nitrates in the oceans is unknown. It has been demonstrated that the reaction of alkyl peroxy radicals (ROO) with nitric oxide (NO) produces alkyl nitrates in the aqueous phase. We hypothesize that alkyl nitrates may be formed by organisms through the same reaction and therefore biological production could be a source of alkyl nitrates to the troposphere. This work focuses on the production of alkyl nitrates by the diatoms Chaetoceros muelleri and Thalassiosira weisfloggi. Using chemostats, we measure alkyl nitrates formed under nitrate limited conditions. We also use triggers and inhibitors of nitric oxide formation to determine if alkyl nitrate formation is affected by changes in NO production. To date, the rates of production of alkyl nitrates in our cultures, lead us to estimate a production rate on the order of femtomolar/day for C1-C3 alkyl nitrates by diatom species in the equatorial Pacific Ocean. This suggests that diatoms may contribute to the overall ocean source of alkyl nitrates; however, it is possible that other types of phytoplankton, such as cyanobacteria, that are more abundant in the open ocean, may contribute to a greater extent.

  15. 40 CFR 721.9892 - Alkylated urea.

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Alkylated urea. 721.9892 Section 721... Alkylated urea. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as an alkylated urea (PMN P-93-1649) is subject to reporting under...

  16. Methods of making alkyl esters

    Elliott, Brian

    2010-08-03

    A method comprising contacting an alcohol, a feed comprising one or more glycerides and equal to or greater than 2 wt % of one or more free fatty acids, and a solid acid catalyst, a nanostructured polymer catalyst, or a sulfated zirconia catalyst in one or more reactors, and recovering from the one or more reactors an effluent comprising equal to or greater than about 75 wt % alkyl ester and equal to or less than about 5 wt % glyceride.

  17. Ni-catalyzed alkylative dimerization of vinyl grignard reagents using alkyl fluorides.

    Terao, Jun; Watabe, Hiroyasu; Kambe, Nobuaki

    2005-03-23

    Alkyl halides underwent unique cross-coupling reaction with vinylmagnesium chloride in the presence of Ni catalyst to give 2-alkyl-3-butenyl Grignard reagent (1) in high yields. This reaction proceeded efficiently at 25 degrees C in THF using primary and secondary alkyl fluorides. On the other hand, PhCH=CHMgBr gave double alkylative vinyl coupling product 4 in good yield as the sole coupling product. Alkyl fluorides react as the most suitable alkylating reagent in comparison to the corresponding chlorides, bromides, and iodides. PMID:15771474

  18. The Scarlet Letter of Alkylation: A Mini Review of Selective Alkylating Agents

    Oronsky, Bryan T.; Reid, Tony; Knox, Susan J.; Scicinski, Jan J.

    2012-01-01

    If there were a stigma scale for chemotherapy, alkylating agents would be ranked at the top of the list. The chemical term alkylation is associated with nonselective toxicity, an association that dates back to the use of nitrogen mustards during World War I as chemical warfare agents. That this stigma persists and extends to compounds that, through selectivity, attempt to “tame” the indiscriminate destructive potential of alkylation is the subject of this review. Selective alkylation, as it i...

  19. 40 CFR 721.8673 - [(Disubstituted phenyl)]azo dihydro hydroxy alkyl oxo alkyl-substituted-pyridines (generic name).

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false azo dihydro hydroxy alkyl oxo alkyl... Significant New Uses for Specific Chemical Substances § 721.8673 azo dihydro hydroxy alkyl oxo alkyl...) The chemical substances identified generically as azo dihydro hydroxy alkyl oxo...

  20. C-Alkylation by Hydrogen Autotransfer Reactions.

    Obora, Yasushi

    2016-04-01

    The development of practical, efficient, and atom-economical methods for the formation of carbon-carbon bonds remains a topic of considerable interest in current synthetic organic chemistry. In this review, we have summarized selected topics from the recent literature with particular emphasis on C-alkylation processes involving hydrogen transfer using alcohols as alkylation reagents. This review includes selected highlights concerning recent progress towards the modification of catalytic systems for the α-alkylation of ketones, nitriles, and esters. Furthermore, we have devoted a significant portion of this review to the methylation of ketones, alcohols, and indoles using methanol. Lastly, we have also documented recent advances in β-alkylation methods involving the dimerization of alcohols (Guerbet reaction), as well as new developments in C-alkylation methods based on sp (3) C-H activation. PMID:27573136

  1. PREPARATION OF ALKYL HALIDES VIA ORGANOTELLURIUMS

    チカマツ, キヨフミ; オオツボ, テツオ; オグラ, フミオ; ヤマグチ, ハチロウ; Kiyofumi, CHIKAMATSU; Tetsuo, OTSUBO; Fumio, OGURA; Hachiro, YAMAGUCHI

    1982-01-01

    The conversion of phenyltelluroalkanes to haloalkanes was studied in connection with the homologation of alkyl halides. Similar reactions of 1,1-bis(phenyltelluro)alkanes provided a new synthetic method of aldehydes.

  2. Thermally induced alkylation of diamond.

    Hoeb, Marco; Auernhammer, Marianne; Schoell, Sebastian J; Brandt, Martin S; Garrido, Jose A; Stutzmann, Martin; Sharp, Ian D

    2010-12-21

    We present an approach for the thermally activated formation of alkene-derived self-assembled monolayers on oxygen-terminated single and polycrystalline diamond surfaces. Chemical modification of the oxygen and hydrogen plasma-treated samples was achieved by heating in 1-octadecene. The resulting layers were characterized using X-ray photoelectron spectroscopy, thermal desorption spectroscopy, atomic force microscopy, Fourier transform infrared spectroscopy, and water contact angle measurements. This investigation reveals that alkenes selectively attach to the oxygen-terminated sites via covalent C-O-C bonds. The hydrophilic oxygen-terminated diamond is rendered strongly hydrophobic following this reaction. The nature of the process limits the organic layer growth to a single monolayer, and FTIR measurements reveal that such monolayers are dense and well ordered. In contrast, hydrogen-terminated diamond sites remain unaffected by this process. This method is thus complementary to the UV-initiated reaction of alkenes with diamond, which exhibits the opposite reactivity contrast. Thermal alkylation increases the range of available diamond functionalization strategies and provides a means of straightforwardly forming single organic layers in order to engineer the surface properties of diamond. PMID:21090790

  3. Sulfonate salts of the therapeutic agent dapsone: 4-[(4-aminophenyl)sulfonyl]anilinium benzenesulfonate monohydrate and 4-[(4-aminophenyl)sulfonyl]anilinium methanesulfonate monohydrate.

    Gaytán-Barrientos, Nancy Sarahy; Morales-Morales, David; Herrera-Ruiz, Dea; Reyes-Martínez, Reyna; Rivera-Islas, Jesús

    2016-04-01

    Dapsone, formerly used to treat leprosy, now has wider therapeutic applications. As is the case for many therapeutic agents, low aqueous solubility and high toxicity are the main problems associated with its use. Derivatization of its amino groups has been widely explored but shows no significant therapeutic improvements. Cocrystals have been prepared to understand not only its structural properties, but also its solubility and dissolution rate. Few salts of dapsone have been described. The title salts, C12H13N2O2S(+)·C6H5O3S(-)·H2O and C12H13N2O2S(+)·CH3SO3(-)·H2O, crystallize as hydrates and both compounds exhibit the same space group (monoclinic, P21/n). The asymmetric unit of each salt consists of a 4-[(4-aminophenyl)sulfonyl]anilinium monocation, the corresponding sulfonate anion and a water molecule. The cation, anion and water molecule form hydrogen-bonded networks through N-H...O=S, N-H...Owater and Owater-H...O=S hydrogen bonds. For both salts, the water molecules interact with one sulfonate anion and two anilinium cations. The benzenesulfonate salt forms a two-dimensional network, while the hydrogen bonding within the methanesulfonate salt results in a three-dimensional network. PMID:27045177

  4. Verdivurdering av SAS AB

    Gangås, Silje Garberg

    2013-01-01

    Formålet med denne mastergradsavhandlingen har vært å beregne den teoretiske verdien på det børsnoterte selskapet SAS AB og på bakgrunn av denne gi en handlingsanbefaling på selskapets aksje. Forskningsspørsmålet for oppgaven er utledet som følger: ”Hva er verdien av SAS AB?” SAS AB er inne i en fundamental omstillingsprosses hvor den nye strategien, 4XNG, ble presentert og påbegynt november 2012. Omstillingsprosessen innebærer blant annet en omfattende omstrukturering i organisasjonen ...

  5. R22(8 motifs in Aminopyrimidine sulfonate/carboxylate interactions: Crystal structures of pyrimethaminium benzenesulfonate monohydrate (2:2:1 and 2-amino-4,6-dimethylpyrimidinium sulfosalicylate dihydrate (4:2:2

    Muthiah Packianathan

    2007-11-01

    Full Text Available Abstract Background Pyrimethamine [2,4-diamino-5-(p-chlorophenyl-6-ethylpyrimidine] is an antifolate drug used in anti-malarial chemotherapy. Pyrimidine and aminopyrimidine derivatives are biologically important compounds owing to their natural occurrence as components of nucleic acids. Results In the crystal structures of two organic salts, namely pyrimethaminium benzenesulfonate monohydrate 1 and 2-amino-4, 6-dimethylpyrimidinium 3-carboxy-4-hydroxy benzenesulfonate dihydrate 2, pyrimethamine (PMN and 2-amino-4,6-dimethylpyrimidine (AMPY are protonated at one of the nitrogens in the pyrimidine rings. In both the PMN and AMPY sulfonate complexes, the protonated pyrimidine rings are hydrogen bonded to the sulfonate groups, forming a hydrogen-bonded bimolecular ring motif with graph-set notation R22(8. The sulfonate group mimics the carboxylate anion's mode of association, which is more commonly seen when binding with 2-aminopyrimidines. In compound 1, the PMN moieties are centrosymmetrically paired through a complementary DADA array of hydrogen bonds. In compound 2, two types of bimolecular cyclic hydrogen bonded R22(8 motifs (one involving the carboxylate group and the other involving sulfonate group coexist. Furthermore, this compound is stabilized by intra and intermolecular O-H...O hydrogen bonds. Conclusion The crystal structures of pyrimethaminium benzenesulfonate monohydrate and 2-amino-4,6-dimethylpyrimidinium sulfosalicylate dihydrate have been investigated in detail. In compound 1, the R22(8 motif involving the sulfonate group is present. The role the sulfonic acid group plays in mimicking the carboxylate anions is thus evident. In compound 2, two types of bimolecular cyclic hydrogen bonded R22(8 motifs (one involving the carboxylate group and the other involving sulfonate group coexist. In both the compounds base pairing also occurs. Thus homo and hetero synthons are present.

  6. Liquid-phase alkylation of Assam (Baragolai) coal

    Kalra, R.L.; Choudhury, R.; Sarkar, M.K.

    1982-12-01

    Liquid paraffin which consists of a large number of alkylated aliphatics and aromatics seems to be acting as an alkyl group transfer medium to receptive complexes like coal. The alkyl group receptive spots could be created in the coal complex by treatment with molten alkalis like sodium or potassium hydroxide. By repeating extractions of fresh coal with the same volume of liquid paraffin on a laboratory scale it was found that a stage was reached when liquid paraffin became rich enough in alkyl groups to become an alkyl group donor. This suggests a method for liquid phase alkylation of coal. (3 refs.)

  7. ABS 415 Course Tutorial / tutorialrank

    welcome1257

    2015-01-01

                     For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 4 Times, Rating: A+   ASHFORD ABS 415 Week 1 DQ 1Discovering Strengths in Leadership ASHFORD ABS 415 Week 1 DQ 2 Ethical Leadership ASHFORD ABS 415 Week 2 DQ 1 Developing Emotional Intelligence in Leadership ASHFORD ABS 415 Week 2 DQ 2 Elements of Emotional Intelligence in Leadership ASHFORD ABS 415 Week 3 DQ 1 Motivational...

  8. Silver-catalyzed coupling reactions of alkyl halides with indenyllithiums

    Someya, Hidenori; Yorimitsu, Hideki; Oshima, Koichiro

    2010-01-01

    Coupling reactions of tertiary and secondary alkyl halides with indenyllithiums proceeded effectively in the presence of a catalytic amount of silver bromide to provide tertiary- and secondary-alkyl-substituted indene derivatives in good yields.

  9. Outlook for the U.S. alkylation industry

    Alkylation has long been recognized in the refining industry as one of the best options to convert refinery olefins into valuable, clean, high octane blending components. In fact, refinery alkylation is a preferred source of blending stocks for reformulated gasoline. However, the hydrofluoric acid (HF) alkylation process and, to a lesser extent, the sulfuric acid (SA) process have come under increasing pressure in the US due to safety and environmental concerns. This paper examines the current outlook for the US alkylation industry including: key trends and driving forces in the industry, the impact of environmental issues on both HF and SA alkylation, US alkylation supply/demand forecast including the outlook for oxygenates, how US refines will respond to the increased demand and restricted supply for alkylates, and the outlook for new solid acid alkylation (SAC) technology

  10. N-Alkylated dinitrones from isosorbide as cross-linkers for unsaturated bio-based polyesters

    Oliver Goerz

    2014-04-01

    Full Text Available Isosorbide was esterified with acryloyl chloride and crotonic acid yielding isosorbide diacrylate (9a and isosorbide dicrotonate (9b, which were reacted with benzaldehyde oxime in the presence of zinc(II iodide and boron triflouride etherate as catalysts to obtain N-alkylated dinitrones 10a/b. Poly(isosorbide itaconite -co- succinate 13 as a bio-based unsaturated polyester was cross-linked by a 1,3-dipolar cycloaddition with the received dinitrones 10a/b. The 1,3-dipolar cycloaddition led to a strong change of the mechanical properties which were investigated by rheological measurements. Nitrones derived from methyl acrylate (3a and methyl crotonate (3b were used as model systems and reacted with dimethyl itaconate to further characterize the 1,3-dipolaric cycloaddition.

  11. N-Alkylated dinitrones from isosorbide as cross-linkers for unsaturated bio-based polyesters.

    Goerz, Oliver; Ritter, Helmut

    2014-01-01

    Isosorbide was esterified with acryloyl chloride and crotonic acid yielding isosorbide diacrylate (9a) and isosorbide dicrotonate (9b), which were reacted with benzaldehyde oxime in the presence of zinc(II) iodide and boron triflouride etherate as catalysts to obtain N-alkylated dinitrones 10a/b. Poly(isosorbide itaconite -co- succinate) 13 as a bio-based unsaturated polyester was cross-linked by a 1,3-dipolar cycloaddition with the received dinitrones 10a/b. The 1,3-dipolar cycloaddition led to a strong change of the mechanical properties which were investigated by rheological measurements. Nitrones derived from methyl acrylate (3a) and methyl crotonate (3b) were used as model systems and reacted with dimethyl itaconate to further characterize the 1,3-dipolaric cycloaddition. PMID:24991239

  12. 40 CFR 721.575 - Substituted alkyl halide.

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Substituted alkyl halide. 721.575... Substances § 721.575 Substituted alkyl halide. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as substituted alkyl halide (PMN P-83-1222)...

  13. 40 CFR 721.10053 - Alkyl silane methacrylate (generic).

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Alkyl silane methacrylate (generic... Specific Chemical Substances § 721.10053 Alkyl silane methacrylate (generic). (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as alkyl...

  14. The Synthesis of 6-Alkyl-5-Fluorouracil Derivatives

    2000-01-01

    6-alkyl-5-fluorouracil derivatives (5a~5f) were synthesized by facile alkylation of lithiation of 5-fluorouracil derivatives with mthyl iodide (MeI) or alkyl trifluoromethanesulfonate (ROTf) in yield of 42~58%. We found that the methylated product was ethyl-substituted derivatives, not methyl-substituted derivatives.

  15. IONIC LIQUID-CATALYZED ALKYLATION OF ISOBUTANE WITH 2-BUTENE

    A detailed study of the alkylation of isobutane with 2-butene in ionic liquid media has been conducted using 1-alkyl-3-methylimidazolium halides?aluminum chloride encompassing various alkyl groups (butyl-, hexyl-, and octyl-) and halides (Cl, Br, and I) on its cations and anions,...

  16. Synthesis and characterization of chitosan alkyl urea.

    Wang, Jing; Jiang, Ji-Zhou; Chen, Wei; Bai, Zheng-Wu

    2016-07-10

    Chitosan is a versatile material employed for various purposes in many fields including the development of chiral stationary phases for enantioseparation. Chitosan alkyl urea is a kind of intermediate used to prepare enantioseparation materials. In order to synthesize the intermediates, in the present work, a new way to prepare chitosan alkyl urea has been established: chitosan was first reacted with methyl chloroformate yielding N-methoxyformylated chitosan, which was then converted to chitosan alkyl urea through amine-ester exchange reaction. With a large excess of methyl chloroformate and primary amine of low stereohindrance, the amino group in chitosan could be almost completely converted to ureido group. The as-prepared chitosan alkyl urea derivatives were characterized by IR, (1)H NMR, (13)C NMR,(1)H-(1)H COSY and (1)H-(13)C HSQC NMR spectra. The chemical shifts of hydrogen and carbon atoms of glucose unit were assigned. It was found that the degree of substitution was obviously lower if cyclopropyl amine, aniline, tert-butyl amine and diethyl amine were used as reactants for the amine-ester exchange reaction. The reason was explained with the aid of theoretical calculations. PMID:27106154

  17. Ultra-bright alkylated graphene quantum dots

    Feng, Lan; Tang, Xing-Yan; Zhong, Yun-Xin; Liu, Yue-Wen; Song, Xue-Huan; Deng, Shun-Liu; Xie, Su-Yuan; Yan, Jia-Wei; Zheng, Lan-Sun

    2014-10-01

    Highly efficient and stable photoluminescence (PL) are urgently desired for graphene quantum dots (GQDs) to facilitate their prospective applications as optical materials. Here, we report the facile and straightforward synthesis of alkylated graphene quantum dots (AGQDs) via the solvothermal reaction of propagatively alkylated graphene sheets (PAGenes). In contrast to most GQDs reported so far, the synthesized AGQDs process pH-independent and ultra-bright PL with a relative quantum yield of up to 65%. Structural and chemical composition characterization demonstrated that the synthesized AGQDs are nearly oxygen-defect-free with alkyl groups decorated on edges and basal plane, which may contribute to their greatly improved pH tolerance and high quantum efficiency. The photocatalytic performance of AGQDs-P25 nanocomposites was evaluated by the degradation of Rhodamine B under visible light. The photocatalytic rate is ca. 5.9 times higher than that of pure P25, indicating that AGQDs could harness the visible spectrum of sunlight for energy conversion or environmental therapy.Highly efficient and stable photoluminescence (PL) are urgently desired for graphene quantum dots (GQDs) to facilitate their prospective applications as optical materials. Here, we report the facile and straightforward synthesis of alkylated graphene quantum dots (AGQDs) via the solvothermal reaction of propagatively alkylated graphene sheets (PAGenes). In contrast to most GQDs reported so far, the synthesized AGQDs process pH-independent and ultra-bright PL with a relative quantum yield of up to 65%. Structural and chemical composition characterization demonstrated that the synthesized AGQDs are nearly oxygen-defect-free with alkyl groups decorated on edges and basal plane, which may contribute to their greatly improved pH tolerance and high quantum efficiency. The photocatalytic performance of AGQDs-P25 nanocomposites was evaluated by the degradation of Rhodamine B under visible light. The

  18. Alkyl- and fluoroalkyltrialkoxysilanes for wettability modification

    Dopierala, Katarzyna, E-mail: katarzyna.dopierala@put.poznan.pl [Institute of Chemical Technology and Engineering, Poznan University of Technology, Pl. Marii Skłodowskiej-Curie 2, Poznań 60-965 (Poland); Maciejewski, Hieronim [Poznań Science and Technology Park, Rubież 46, Poznań 61-612 (Poland); Faculty of Chemistry, Adam Mickiewicz University, Grunwaldzka 6, Poznań 60-780 (Poland); Karasiewicz, Joanna [Poznań Science and Technology Park, Rubież 46, Poznań 61-612 (Poland); Prochaska, Krystyna [Institute of Chemical Technology and Engineering, Poznan University of Technology, Pl. Marii Skłodowskiej-Curie 2, Poznań 60-965 (Poland)

    2013-10-15

    Alkyl- and fluoroalkyltriethoxysilanes were investigated as potential surface modifiers. Many aspects concerning trialkoxysilanes were discussed, starting from hydrolysis of silanes in water solutions, the effect of this hydrolysis on the surface tension, wettability of the modified surface to the morphology of the modified surface. Surface tension and contact angle measurements as well as scanning electron microscopy were used to characterise alkyl- and fluoroalkyltriethoxysilanes and their ability to modify the wettability of glass. The effect of such modification was superhydrophobic surface with high values of contact angles. Superhydrophobic behaviour was observed as a result of two-step modification providing increased surface roughness thanks to the use of different size silica particles and surface chemical modification with fluorosilane molecules.

  19. Mechanism of prooxidant reaction of vitamin E. Kinetic, spectroscopic, and ab initio study of proton-transfer reaction

    Nagoaka, Shin-ichi; Sawada, Kouhei; Fukumoto, Youji [Ehime Univ., Matsuyama (Japan)] [and others

    1992-08-06

    This paper discusses using kinetic, spectroscopic, and ab initio studies of the prooxidant reaction of vitamin E derivatives to determine second-order rate constants for the reaction of six tocopheroxyl radicals with five alkyl hydroperoxides in benzene along with the first adiabatic ionization potentials of the alkyl hydroperoxides. These results suggest that charge transfer and proton tunneling play important roles in this prooxidant reaction, with proton tunneling taking place below the transition state and allowing the proton to cut a corner on the potential energy surface. 31 refs., 10 figs., 2 tabs.

  20. Enzymatic Synthesis of Palm Alkyl Ester Using Dialkyl Carbonate as an Alkyl Donors

    Roila Awang

    2010-01-01

    Full Text Available Problem statement: Though efficient in terms of reaction yield and time, the chemical approach to synthesizing alkyl ester has drawback such as difficulties in the recovery of glycerol and the need for removal of salt residue. On the other hand, biocatalyst allow for synthesis of specific alkyl esters and easy recovery of glycerol. However, the solvent-free alcoholysis, does not give high conversion. The same problem was also found when ethyl or methyl acetate was used as acyl acceptors. Approach: Lipase catalyzed transesterification of oil and dialkyl carbonate was predicted to give higher conversion in solvent free reaction system. Results: Alkyl esters were synthesized enzymatically to overcome the problems associated with chemical processes. In this study, dialkyl carbonates were used as an alkyl donor for the production of alkyl ester. Nine commercial lipases were tested for their suitability for the reaction system. Among the lipase tested, Novozym 435 was chosen for optimization study because of their higher activity. In a solvent-free reaction system, the ester formation using dialkyl carbonate was 6 times higher than using ethanol and methanol. The effect of various reaction parameters such as temperature, amount of enzyme, organic solvent and structure of substrates were studied to determine optimal condition. The optimal conditions of ester formation were reaction temperature at 60°C, reaction time at 8 h, enzyme amount of 10% (w/w of oil and 0.2% wt added water. Conclusion: Solvent-free lipase catalyzed transesterification of palm kernel oil and dialkyl carbonates gave higher conversion of ester compared to the reaction using short chain alcohol as an alkyl donors.

  1. The AB Staff Plan

    Boillot, J; Delahaye, J P; Myers, S; CERN. Geneva. AB Department

    2003-01-01

    The present report summarises the staff plan of the newly created Accelerators and Beams (AB) Division following the restructuring of the Accelerator Sector and covering the period 2003 to 2010. It underlines the refocusing of the staff on priority work, especially the LHC Project and is coherent with the recently adopted CERN Long Term Plan (LTP). It compares the requested and available manpower (both staff and industrial support) for each Project, Programme and Activity (PPA) split in work packages and highlights the missing manpower for each category of personnel.

  2. Oxidative Umpolung α‐Alkylation of Ketones

    Shneider, O. Svetlana; Pisarevsky, Evgeni; Fristrup, Peter; Szpilman, Alex M.

    2015-01-01

    We disclose a hypervalent iodine mediated α-alkylative umpolung reaction of carbonyl compounds with dialkylzinc as the alkyl source. The reaction is applicable to all common classes of ketones including 1,3-dicarbonyl compounds and regular ketones via their lithium enolates. The α-alkylated carbo......-alkylated carbonyl products are formed in up to 93% yield. An ionic mechanism is inferred based on meticulous analysis, NMR studies, trapping and crossover experiments, and computational studies.......We disclose a hypervalent iodine mediated α-alkylative umpolung reaction of carbonyl compounds with dialkylzinc as the alkyl source. The reaction is applicable to all common classes of ketones including 1,3-dicarbonyl compounds and regular ketones via their lithium enolates. The α...

  3. AB Manpower Plan 2007

    Myers, Stephen

    2007-01-01

    The present exercise is not as such a "manpower plan" but a purely budgetary comparison of known plus requested resources with the known commitments over the period 2007-2012. From a purely budgetary point of view, AB will have the capacity to maintain all those recently hired staff who fulfill the criteria for long term employment at CERN. Following this budgetary exercise, AB proposes to perform a CERN-wide staff work plan so as to compare the manpower available to the quantity of work to be done in the totality of the work-packages. If there is a significant mismatch between these two quantities then we propose the following measures which would create personnel economies and allow us to redress the mismatch by increased recruitment: a new job severance scheme; CERN restructuring; use of the new CERN-ITER agreement; more flexibility in transfers from Materials to Personnel budgets. Failing this a re-examination of possible closure of lower priority facilities may be needed.

  4. Determining cysteine oxidation status using differential alkylation

    Schilling, Birgit; Yoo, Chris B.; Collins, Christopher J.; Gibson, Bradford W.

    2004-08-01

    Oxidative damage to proteins plays a major role in aging and in the pathology of many degenerative diseases. Under conditions of oxidative stress, reactive oxygen and nitrogen species can modify key redox sensitive amino acid side chains leading to altered biological activities or structures of the targeted proteins. This in turn can affect signaling or regulatory control pathways as well as protein turnover and degradation efficiency in the proteasome. Cysteine residues are particularly susceptible to oxidation, primarily through reversible modifications (e.g., thiolation and nitrosylation), although irreversible oxidation can lead to products that cannot be repaired in vivo such as sulfonic acid. This report describes a strategy to determine the overall level of reversible cysteine oxidation using a stable isotope differential alkylation approach in combination with mass spectrometric analysis. This method employs 13C-labeled alkylating reagents, such as N-ethyl-[1,4-13C2]-maleimide, bromo-[1,2-13C2]-acetic acid and their non-labeled counterparts to quantitatively assess the level of cysteine oxidation at specific sites in oxidized proteins. The differential alkylation protocol was evaluated using standard peptides and proteins, and then applied to monitor and determine the level of oxidative damage induced by diamide, a mild oxidant. The formation and mass spectrometric analysis of irreversible cysteine acid modification will also be discussed as several such modifications have been identified in subunits of the mitochondrial electron transport chain complexes. This strategy will hopefully contribute to our understanding of the role that cysteine oxidation plays in such chronic diseases such as Parkinson's disease, where studies in animal and cell models have shown oxidative damage to mitochondrial Complex I to be a specific and early target.

  5. New Bioactive Alkyl Sulfates from Mediterranean Tunicates

    Marialuisa Menna

    2012-10-01

    Full Text Available Chemical investigation of two species of marine ascidians, Aplidium elegans and Ciona edwardsii, collected in Mediterranean area, led to isolation of a series of alkyl sulfates (compounds 1–5 including three new molecules 1–3. Structures of the new metabolites have been elucidated by spectroscopic analysis. Based on previously reported cytotoxic activity of these type of molecules, compounds 1–3 have been tested for their effects on the growth of two cell lines, J774A.1 (BALB/c murine macrophages and C6 (rat glioma in vitro. Compounds 1 and 2 induced selective concentration-dependent mortality on J774A.1 cells.

  6. Synthesis and structural characterisation of an yttrium-alkyl-alkylidene

    Arnold, Polly; Green, J. C.; McMaster, J; Liddle, S.T.

    2008-01-01

    The first structurally authenticated yttrium-alkyl-alkylidene is reported; structural, spectroscopic, and theoretical analyses show that whilst the yttrium-alkylidene bond is short, it possesses a bond order less than one and is comparable to the Y-C-alkyl single bond within the same molecule.

  7. Polyfluorinated alkyl phosphate ester surfactants - current knowledge and knowledge gaps

    Taxvig, Camilla; Rosenmai, Anna Kjerstine; Vinggaard, Anne Marie

    2014-01-01

    information on fluorochemicals. Polyfluorinated alkyl phosphate ester surfactants (PAPs) belong to the group of polyfluorinated alkyl surfactants. They have been detected in indoor dust and are widely used in food-contact materials, from which they have the ability to migrate into food. Toxicological data on...

  8. 40 CFR 721.840 - Alkyl substituted diaromatic hydrocarbons.

    2010-07-01

    ... hydrocarbons. 721.840 Section 721.840 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Specific Chemical Substances § 721.840 Alkyl substituted diaromatic hydrocarbons. (a) Chemical substance... alkyl substituted di-aro-matic hydrocarbons (PMN P-91-710) is subject to reporting under this...

  9. Clinical applications of quinone-containing alkylating agents.

    Begleiter, A

    2000-11-01

    Quinone-containing alkylating agents are a class of chemical agents that have received considerable interest as anticancer drugs. These agents contain a quinone moiety that can be reduced and an alkylating group that can form covalent bonds with a variety of cellular components. The oxidation state of the quinone element can modulate the activity of the alkylating element, and reduction of the quinone is required for activation of the alkylating activity of many of these agents. The quinone element may also contribute to the cytotoxic activity of quinone-containing alkylating agents through the formation of reactive oxygen species during redox cycling. The natural product, mitomycin C, has been the most widely used quinone-containing alkylating agent in the clinic, but other quinone-containing alkylating agents like porfiromycin, diaziquone, carbazilquinone, triaziquone and EO9 have also been used in the clinic for the treatment of cancer. In addition, many other quinone-containing alkylating agents have been tested in preclinical studies and the development of new agents is being actively pursued. This chapter describes the current and past clinical uses of these agents in the treatment of cancer and discusses new agents that are currently in clinical trials. PMID:11056078

  10. Degradable Polymer Composites Fabricated from Starch and Alkyl Cyanoacrylate Monomer

    Degradable polymer composites are fabricated from alkyl cyanoacrylate monomer and starch without special equipment. Alkyl cyanoacrylate, which is a major component of “super glue”, is a monomer that polymerizes at room temperature in the presence of initiators. During the fabrication of polymer com...

  11. Toward Efficient Palladium-Catalyzed Allylic C-H Alkylation

    Jensen, Thomas; Fristrup, Peter

    2009-01-01

    Recent breakthroughs have proved that direct palladium (II)-catalyzed allylic C-H alkylation can be achieved. This new procedure shows that the inherent requirement for a leaving group in the Tsuji-Trost palladium-catalyzed allylic alkylation can be lifted. These initial reports hold great promise...

  12. β-Alkyl Elimination: Fundamental Principles and Some Applications.

    O'Reilly, Matthew E; Dutta, Saikat; Veige, Adam S

    2016-07-27

    This review describes organometallic compounds and materials that are capable of mediating a rarely encountered but fundamentally important reaction: β-alkyl elimination at the metal-Cα-Cβ-R moiety, in which an alkyl group attached to the Cβ atom is transferred to the metal or to a coordinated substrate. The objectives of this review are to provide a cohesive fundamental understanding of β-alkyl-elimination reactions and to highlight its applications in olefin polymerization, alkane hydrogenolysis, depolymerization of branched polymers, ring-opening polymerization of cycloalkanes, and other useful organic reactions. To provide a coherent understanding of the β-alkyl elimination reaction, special attention is given to conditions and strategies used to facilitate β-alkyl-elimination/transfer events in metal-catalyzed olefin polymerization, which provide the well-studied examples. PMID:27366938

  13. ABS 415 ASH Course Tutorial / Tutorialrank

    charles

    2015-01-01

    For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 4 Times, Rating: A+   ASHFORD ABS 415 Week 1 DQ 1Discovering Strengths in Leadership ASHFORD ABS 415 Week 1 DQ 2 Ethical Leadership ASHFORD ABS 415 Week 2 DQ 1 Developing Emotional Intelligence in Leadership ASHFORD ABS 415 Week 2 DQ 2 Elements of Emotional Intelligence in Leadership ASHFORD ABS 415 Week 3 DQ 1 Motivational Techniques ASHFORD ABS 415 Week 3 DQ 2 Leadership in a Cr...

  14. Ab initio and DFT study of the geometric structures and static dipole (hyper)polarizabilities of aromatic anions.

    Castellano, O; Bermúdez, Y; Giffard, M; Mabon, G; Cubillan, N; Sylla, M; Nguyen-Phu, X; Hinchliffe, A; Soscún, H

    2005-11-17

    The geometries and the static dipole (hyper)polarizabilities (alpha, beta, gamma) of a series of aromatic anions were investigated at the ab initio (HF, MP2, and MP4) and density functional theory DFT (B3LYP) levels of theory. The anions chosen for the present study are the benzenethiolate (Ph-S-), benzenecarboxylate (Ph-CO2-), benzenesulfinate (Ph-SO2-), benzenesulfonate (Ph-SO3-), and 1,3-benzenedicarboxylate (1,3-Ph-(CO2)2(2-)). For benzenethiolate anion, additional alpha, beta, and gamma calculations were performed at the coupled cluster CCSD level with MP2 optimized geometries. The standard diffuse and polarized 6-31+G(d,p) basis set was employed in conjunction to the ab initio and DFT methods. Additional HF calculations were performed with the 6-311++G(3d,3p) basis set for all the anions. The correlated electric properties were evaluated numerically within the formalism of finite field. The optimized geometries were analyzed in terms of the few reports about the phenolate and sulfonate ions. The results show that electron correlation effects on the polarizabilities are very important in all the anion series. Was found that Ph-SO2- is highly polarizable in terms of alpha and beta, and the Ph-S- is the highest second hyperpolarizable in the series. The results of alpha were rationalized in terms of the analysis of the polarization of charge based in Mulliken atomic population and the structural features of the optimized geometries of anions, whereas the large differences in the beta and gamma values in the series were respectively interpreted in terms of the bond length alternation BLA and the separation of charge in the aromatic ring by effects of the substitution. These results allowed us to suggest the benzenesulfinate and benzenethiolate anions as promising candidates that should be incorporated in ionic materials for second and third-order nonlinear optical devices. PMID:16833334

  15. Organomontmorillonites Modified with 2-Methacryloyloxy Ethyl Alkyl Dimethyl Ammonium Bromide

    WANG Jian-quan; WU Wen-hui

    2007-01-01

    Organomontmorillonites (organo-MMT) were synthesized by means of montmorillonites (MMT) modified with a series of 2-methacryloyloxy ethyl alkyl dimethyl ammonium bromide (MAAB) having different alkyl chain lengths as cationic surfactants through a cationic exchanging reaction, and were characterized by FTIR, TG, elemental analysis, and XRD. The microenvironment of the organic interlayer such as the orientation and arrangement of the alkyl chains of MAAB, as well as the properties of nanocomposite hydrogels, were also investigated. The amount of organic components absorbed on interlayer and the basal spacing of organo-MMT both increase with the increasing of alkyl length of MAAB. When carbon number of alkyl chain is in the region of 8 to 14, the alkyl chains between layers would adopt a disordered gauche conformation; while the carbon number is 16, an ordered all-trans conformation with a vertical orientation would be found together with the disordered gauche conformation according to the results of XRD and FTIR. Due to the difference of microenvironment of organic interlayer, the Young's moduli of the nanocomposite hydrogels increased as the alkyl chains of MAAB became longer.

  16. Simple and Efficient Microwave Assisted N-Alkylation of Isatin

    María Mercedes Blanco

    2008-04-01

    Full Text Available We present herein the results of microwave promoted N-alkylations of isatin (1with different alkyl, benzyl and functionalized alkyl halides. Reactions were carried outunder different conditions, always employing methodologies compatible with MW assistedchemistry. Generation of isatin anion employing diverse bases and solvents or using thepreformed isatin sodium salt was tested. The best results were achieved using K2CO3 orCs2CO3 and a few drops of N,N-dimethylformamide or N-methyl-2-pyrrolidinone. Thesereactions present noteworthy advantages over those carried out employing conventionalheating.

  17. Involvement of apurinic sites in the synergistic action of alkylating and intercalating drugs in Escherichia coli.

    Malvy, C; Safraoui, H; Bloch, E; Bertrand, J R

    1988-03-01

    The toxicity of the intercalating compounds 9-aminoellipticine (9AE) and isopropyl-oxazolopyridocarbazole (Ipr-OPC) were studied. The inhibitory effect of non-toxic doses of 9AE, which incises DNA at apurinic (AP) sites, or Ipr-OPC, which does not cleave DNA at AP sites, with non-toxic doses of the alkylating agent dimethylsulphate (DMS) on the growth of Escherichia coli strain AB1157, is additive. The same result has been observed with an exonuclease III mutant which has only 10% of the AP endonuclease activity. However, 9AE or Ipr-OPC display a synergistic toxic effect with a DMS concentration which allows 20% of E. coli AB1157 survival. This synergy is increased for 9AE in the AP endonuclease mutant when compared to the wild-type strain. Under identical conditions 9AE and Ipr-OPC have no synergistic effect on a mutant deficient in the enzymes which generate AP sites. Therefore AP sites are involved in the synergistic toxicity of DMS and the studied intercalating agents. However, the precise role of the interaction of intercalating agents with AP sites, either without cleavage (type 1 compounds) or with cleavage (type 2 compounds), in the observed effect remains an open question. PMID:3284541

  18. Detection of Alkylating Agents using Electrical and Mechanical Means

    Gerchikov, Yulia; Borzin, Elena; Gannot, Yair; Shemesh, Ariel; Meltzman, Shai; Hertzog-Ronen, Carmit; Eichen, Yoav [Schulich Department of Chemistry, Technion-Israel Institute of Technology, Technion City, 32000, Haifa (Israel) (Israel); Tal, Shay [Present address: Systems Biology Department, Harvard Medical School, Boston, MA 02115 (United States); Stolyarova, Sara; Nemirovsky, Yael; Tessler, Nir, E-mail: chryoav@tx.technion.ac.il [Department of Electrical Engineering, Technion-Israel Institute of Technology, Technion City, 32000, Haifa (Israel)

    2011-08-17

    Alkylating agents are reactive molecules having at least one polar bond between a carbon atom and a good leaving group. These often simple molecules are frequently used in organic synthesis, as sterilizing agents in agriculture and even as anticancer agents in medicine. Unfortunately, for over a century, some of the highly reactive alkylating agents are also being used as blister chemical warfare agents. Being relatively simple to make, the risk is that these will be applied by terrorists as poor people warfare agents. The detection and identification of such alkylating agents is not a simple task because of their high reactivity and simple structure of the reactive site. Here we report on new approaches to the detection and identification of such alkylating agents using electrical (organic field effect transistors) and mechanical (microcantilevers) means.

  19. Detection of Alkylating Agents using Electrical and Mechanical Means

    Alkylating agents are reactive molecules having at least one polar bond between a carbon atom and a good leaving group. These often simple molecules are frequently used in organic synthesis, as sterilizing agents in agriculture and even as anticancer agents in medicine. Unfortunately, for over a century, some of the highly reactive alkylating agents are also being used as blister chemical warfare agents. Being relatively simple to make, the risk is that these will be applied by terrorists as poor people warfare agents. The detection and identification of such alkylating agents is not a simple task because of their high reactivity and simple structure of the reactive site. Here we report on new approaches to the detection and identification of such alkylating agents using electrical (organic field effect transistors) and mechanical (microcantilevers) means.

  20. Clinical significance of combined detection of multiple serum antibodies (AsAb, EmAb, AcAb, AoAb, ToxAb) in infertile women

    Objective: To determine the clinical significance of combined detection of multiple serum antibodies in infertile women. Methods; Serum multiple antibodies were examined in 120 infertile women, including 88 failed to get pregnancy and 32 with repeated spontaneous abortion. The antibodies tested were: (1) anti-sperm antibody (AsAb) (2) endometrial antibody (EmAb) (3) anti-cardiophospholipid antibody (AcAb) (4) Anti-ovarian antibody (AoAb) and Toxoplasmosis antibody (ToxAb). Results: In 48 of the infertile women, none of the five antibodies were positive (40% of 120). The rest were: one antibody positive--38/120 or 31.6%; two antibodies positive--31/120 or 25.83%, three and four antibodies positive--4/120 or 3.33%. None of the women were positive with all five antibodies. Conclusion: Immune factor was the chief cause of infertility in women. (authors)

  1. Copper-catalyzed arylation of alkyl halides with arylaluminum reagents

    Shrestha, Bijay

    2015-01-01

    Summary We report a Cu-catalyzed coupling between triarylaluminum reagents and alkyl halides to form arylalkanes. The reaction proceeds in the presence of N,N,N’,N’-tetramethyl-o-phenylenediamine (NN-1) as a ligand in combination with CuI as a catalyst. This catalyst system enables the coupling of primary alkyl iodides and bromides with electron-neutral and electron-rich triarylaluminum reagents and affords the cross-coupled products in good to excellent yields. PMID:26734088

  2. Copper-catalyzed arylation of alkyl halides with arylaluminum reagents

    Bijay Shrestha

    2015-12-01

    Full Text Available We report a Cu-catalyzed coupling between triarylaluminum reagents and alkyl halides to form arylalkanes. The reaction proceeds in the presence of N,N,N’,N’-tetramethyl-o-phenylenediamine (NN-1 as a ligand in combination with CuI as a catalyst. This catalyst system enables the coupling of primary alkyl iodides and bromides with electron-neutral and electron-rich triarylaluminum reagents and affords the cross-coupled products in good to excellent yields.

  3. Alkyl aryl ethers in lignite solubilization

    Mustral, A.M.; Cebolla, V.L.; Gavilan, J.M.

    1985-03-01

    The FT-I.R. and /sup 1/H N.M.R. spectroscopic analyses of oils or maltenes from a Spanish lignite (Utrillas, Teruel), are reported. These oils were obtained by depolymerization with alkyl aromatic ethers (anisole, 3-methyl anisole and 1,3-dimethoxybenzene) catalyzed by Lewis acids ZnCl/sub 2/, AlCl/sub 3/, SbCl/sub 3/ and BF/sub 3/ (as boron trifluoride etherate), at atmospheric pressure and temperatures <220/sup 0/C. Bands due to aromatic ethers in the I.R. and N.M.R. spectra of the oils obtained by depolymerization indicate solvent incorporation. Oils obtained by direct lignite extraction showed 25% aromatic H and some H /sub i/ (approx. = 3%) without OH groups. These appeared in some oils obtained by depolymerization with AlCl/sub 3/ and were due to secondary reactions with the aromatic extract. Oils derived from processes with good yields showed increases in aromaticity. The extent of substitution of aromatic rings in oils obtained by depolymerization was less than for oils directly extracted. All the oils studied show a low degree of condensation.

  4. Alkyl-halogenide promoted ionic liquid catalysis of isobutane/butene-alkylation

    Schilder, L.; Korth, W.; Jess, A. [Bayreuth Univ. (Germany). Dept. of Chemical Engineering

    2011-07-01

    The effect of two different types of promoters on the performance of Lewis-acidic chloroaluminate ionic liquid catalysts was studied for liquid liquid biphasic isobutane/2-butene alkylation. In particular, the activity and selectivity of such catalytic systems was investigated. Experimental results obtained from a batch reactor show, that tert-butyl halides increase the reaction rate significantly and shift the C8-selectivity towards the desired high-octane trimethylpentanes (TMPs). But, secondary reactions like oligomerization and cracking are not affected by the use of these promoters. (orig.)

  5. Alcohols as alkylating agents in heteroarene C-H functionalization

    Jin, Jian; MacMillan, David W. C.

    2015-09-01

    Redox processes and radical intermediates are found in many biochemical processes, including deoxyribonucleotide synthesis and oxidative DNA damage. One of the core principles underlying DNA biosynthesis is the radical-mediated elimination of H2O to deoxygenate ribonucleotides, an example of `spin-centre shift', during which an alcohol C-O bond is cleaved, resulting in a carbon-centred radical intermediate. Although spin-centre shift is a well-understood biochemical process, it is underused by the synthetic organic chemistry community. We wondered whether it would be possible to take advantage of this naturally occurring process to accomplish mild, non-traditional alkylation reactions using alcohols as radical precursors. Because conventional radical-based alkylation methods require the use of stoichiometric oxidants, increased temperatures or peroxides, a mild protocol using simple and abundant alkylating agents would have considerable use in the synthesis of diversely functionalized pharmacophores. Here we describe the development of a dual catalytic alkylation of heteroarenes, using alcohols as mild alkylating reagents. This method represents the first, to our knowledge, broadly applicable use of unactivated alcohols as latent alkylating reagents, achieved via the successful merger of photoredox and hydrogen atom transfer catalysis. The value of this multi-catalytic protocol has been demonstrated through the late-stage functionalization of the medicinal agents, fasudil and milrinone.

  6. Final Technical Report [Development of Catalytic Alkylation and Fluoroalkylation Methods

    Vicic, David A.

    2014-05-01

    In the early stages of this DOE-funded research project, we sought to prepare and study a well-defined nickel-alkyl complex containing tridentate nitrogen donor ligands. We found that reaction of (TMEDA)NiMe2 (1) with terpyridine ligand cleanly led to the formation of (terpyridyl)NiMe (2), which we also determined to be an active alkylation catalyst. The thermal stability of 2 was unlike that seen for any of the active pybox ligands, and enabled a number of key studies on alkyl transfer reactions to be performed, providing new insights into the mechanism of nickel-mediated alkyl-alkyl cross-coupling reactions. In addition to the mechanistic studies, we showed that the terpyridyl nickel compounds can catalytically cross-couple alkyl iodides in yields up to 98% and bromides in yields up to 46 %. The yields for the bromides can be increased up to 67 % when the new palladium catalyst [(tpy’)Pd-Ph]I is used. The best route to the targeted [(tpy)NiBr] (1) was found to involve the comproportionation reaction of [(dme)NiBr{sub 2}] and [Ni(COD){sub 2}] in the presence of two equivalents of terpyridine. This reaction was driven to high yields of product formation (72 % isolated) by the precipitation of 1 from THF solvent.

  7. Depolymerization of coal by oxidation and alkylation; Sanka bunkai to alkyl ka ni yoru sekitan kaijugo

    Tomita, H.; Isoda, T.; Kusakabe, K.; Morooka, S. [Kyushu University, Fukuoka (Japan). Faculty of Engineering; Hayashi, J. [Hokkaido University, Sapporo (Japan). Center for Advanced Research of Energy Technology

    1996-10-28

    Change in depolymerization degree and coal structure was studied for depolymerization treatment of coal in various alcohol containing aqueous hydrogen peroxide. In experiment, the mixture of Yallourn coal, alcohol and aqueous hydrogen peroxide was agitated in nitrogen atmosphere of normal pressure at 70{degree}C for 12 hours. As the experimental result, the methanol solubility of only 5% of raw coal increased up to 35.2% by hydrogen peroxide treatment, while the yield of insoluble matters also decreased from 94% to 62%. Most of the gas produced during treatment was composed of inorganic gases such as CO and CO2, and its carbon loss was extremely decreased by adding alcohol. From the analytical result of carbon loss in hydrogen peroxide treatment, it was clarified that alkylation advances with introduction of alkyl group derived from alcohol into coal by hydrogen peroxide treatment under a coexistence of alcohol, and depolymerization reaction of coal itself is thus promoted by alcohol. 4 refs., 7 figs., 1 tab.

  8. Solubility of gases in 1-alkyl-3methylimidazolium alkyl sulfate ionic liquids: Experimental determination and modeling

    Highlights: ► The solubility of CO2, CH4 and C2H6 in [emim][EtSO4] is measured with a magnetic suspension balance. ► New data and literature results have been modeled with a Group Contribution equation of state. ► A specific group definition is required to model data of ionic liquids with a [MeSO4] anion. ► Deviations between model and experiments are lower than 10% in most cases. ► Deviations of 34% are observed in the case of the solubility of ethane in the ionic liquid. -- Abstract: The solubility of different gases (carbon dioxide, methane, ethane, carbon monoxide and hydrogen) in ionic liquids with an alkyl sulfate anion has been modeled with the Group Contribution equation of state developed by Skjold-Jørgensen. New gas solubility measurements have been carried out with a high pressure magnetic suspension balance in order to cover pressure and temperature ranges not considered in previous studies and to obtain more experimental information for the correlation of parameters of the equation of state. New solubility measurements include the solubility of carbon dioxide in 1-ethyl 3-methyl imidazolium ethyl sulfate [emim][EtSO4] at temperatures of 298 K and 348 K and pressures ranging from 0.3 MPa to 6.5 MPa, the solubility of methane in [emim][EtSO4] at a temperature of 293 K and pressures ranging from 0.2 MPa to 10.2 MPa, and the solubility of ethane in [emim][EtSO4] at temperatures of 323 K and 350 K and pressures ranging from 0.2 MPa to 4 MPa. Results show that the Group Contribution equation of state can be used to describe the solubility of gases in alkyl sulfate ionic liquids as well as infinite dilution coefficients of alkanes in the ionic liquids, with average deviations between experiments and calculations ranging from 1% to 10% in the case of mixtures with CO2, CO, CH4 and H2 with the alkyl sulfate ionic liquids to up to 34% in the case of the solubility of ethane in [emim][EtSO4

  9. N-Alkyl-, 1-C-Alkyl-, and 5-C-Alkyl-1,5-dideoxy-1,5-imino-(L)-ribitols as Galactosidase Inhibitors.

    Front, Sophie; Gallienne, Estelle; Charollais-Thoenig, Julie; Demotz, Stéphane; Martin, Olivier R

    2016-01-01

    A series of 1,5-dideoxy-1,5-imino-(l)-ribitol (DIR) derivatives carrying alkyl or functionalized alkyl groups were prepared and investigated as glycosidase inhibitors. These compounds were designed as simplified 4-epi-isofagomine (4-epi-IFG) mimics and were expected to behave as selective inhibitors of β-galactosidases. All compounds were indeed found to be highly selective for β-galactosidases versus α-glycosidases, as they generally did not inhibit coffee bean α-galactosidase or other α-glycosidases. Some compounds were also found to be inhibitors of almond β-glucosidase. The N-alkyl DIR derivatives were only modest inhibitors of bovine β-galactosidase, with IC50 values in the 30-700 μM range. Likewise, imino-L-ribitol substituted at the C1 position was found to be a weak inhibitor of this enzyme. In contrast, alkyl substitution at C5 resulted in enhanced β-galactosidase inhibitory activity by a factor of up to 1000, with at least six carbon atoms in the alkyl substituent. Remarkably, the 'pseudo-anomeric' configuration in this series does not appear to play a role. Human lysosomal β-galactosidase from leukocyte lysate was, however, poorly inhibited by all iminoribitol derivatives tested (IC50 values in the 100 μM range), while 4-epi-IFG was a good inhibitor of this enzyme. Two compounds were evaluated as pharmacological chaperones for a GM1-gangliosidosis cell line (R301Q mutation) and were found to enhance the mutant enzyme activity by factors up to 2.7-fold. PMID:26644389

  10. Alkyl polycyclic aromatic hydrocarbons emissions in diesel/biodiesel exhaust

    Casal, Carina S.; Arbilla, Graciela; Corrêa, Sergio M.

    2014-10-01

    Polycyclic aromatic hydrocarbons (PAHs) are widely studied in environmental matrices, such as air, water, soil and sediment, because of their toxicity, mutagenicity and carcinogenicity. Because of these properties, the environmental agencies of developed countries have listed sixteen PAHs as priority pollutants. Few countries have limits for these compounds for ambient air, but they only limit emissions from stationary and mobile sources and occupational areas. There are several studies to specifically address the 16 priority PAHs and very little for the alkyl PAHs. These compounds are more abundant, more persistent and frequently more toxic than the non-alkylated PAHs, and the toxicity increases with the number of alkyl substitutions on the aromatic ring. In this study, a method was developed for the analysis of PAHs and alkyl PAHs by using a GC-MS and large injection volume injection coupled with program temperature vaporisation, which allows for limits of detection below 1.0 ng μL-1. Several variables were tested, such as the injection volume, injection velocity, injector initial temperature, duration of the solvent split and others. This method was evaluated in samples from particulate matter from the emissions of engines employing standard diesel, commercial diesel and biodiesel B20. Samples were collected on a dynamometer bench for a diesel engine cycle and the results ranged from 0.5 to 96.9 ng mL-1, indicating that diesel/biodiesel makes a significant contribution to the formation of PAHs and alkyl PAHs.

  11. Alkyl substituent effect on density, viscosity and chemical behavior of 1-alkyl-3-methylimidazolium chloride.

    Olmo, Lourdes del; Lage-Estebanez, Isabel; López, Rafael; García de la Vega, José M

    2014-09-01

    Molecular structure of the conformers of 1-C n -3-methylimidazolium chloride (n = 1 to 4) ionic liquids has been explored and the relationships with density and viscosity have been studied using COSMO related methodologies. Effects of the number of conformers, ionic character, anion-cation relative positions and the alkyl chain length of the cation on predictions of properties have been analyzed. The quality of the predictions has been tested by comparing with experimental results. Moreover, COSMO polarization charge densities, σ-profiles and σ-potentials of the conformers have been analyzed. Predictions on the chemical behavior based on the values of these properties in the conformers have been used to elucidate the affinity for electrophilic and nucleophilic reagents of ionic liquids. PMID:25149437

  12. Alkylation of imidazole under ultrasound irradiation over alkaline carbons

    N-Alkyl-imidazole has been synthesized by sonochemical irradiation of imidazole and 1-bromobutane using alkaline-promoted carbons (exchanged with the binary combinations of Na, K and Cs). The catalysts were characterized by X-ray photoelectron spectroscopy, thermal analysis and N2 adsorption isotherms. Under the experimental conditions, N-alkyl-imidazoles can be prepared with a high activity and selectivity. It is observed that imidazole conversion increases in parallel with increasing the basicity of the catalyst. The influence of the alkaline promoter, the reaction temperature, and the amount of catalyst on the catalytic activity has been studied. For comparison, the alkylation of imidazole has also been performed in a batch reactor system under thermal activation

  13. Alkyl Radicals as Hydrogen Bond Acceptors: Computational Evidence

    Hammerum, Steen

    2009-01-01

    Spectroscopic, energetic and structural information obtained by DFT and G3-type computational studies demonstrates that charged proton donors can form moderately strong hydrogen bonds to simple alkyl radicals. The presence of these bonds stabilizes the adducts and modifies their structure, and...... gives rise to pronounced shifts of IR stretching frequencies and to increased absorption intensities. The hydrogen bond acceptor properties of alkyl radicals equal those of many conventional acceptors, e.g., the bond length changes and IR red-shifts suggest that tert-butyl radicals are slightly better...... acceptors than formaldehyde molecules, while propyl radicals are as good as H2O. The hydrogen bond strength appears to depend on the proton affinity of the proton donor and on the ionization energy of the acceptor alkyl radical, not on the donor-acceptor proton affinity difference, reflecting that the...

  14. Alkylation of imidazole under ultrasound irradiation over alkaline carbons

    Costarrosa, L. [Dpto. de Quimica Inorganica y Quimica Tecnica, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia (UNED), C/Senda del Rey, 9, E-28040 Madrid (Spain); Calvino-Casilda, V. [Dpto. de Quimica Inorganica y Quimica Tecnica, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia (UNED), C/Senda del Rey, 9, E-28040 Madrid (Spain); Ferrera-Escudero, S. [Dpto. de Quimica Inorganica y Quimica Tecnica, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia (UNED), C/Senda del Rey, 9, E-28040 Madrid (Spain); Duran-Valle, C.J. [Dpto. de Quimica Inorganica, Facultad de Ciencias, Universidad de Extremadura, Avenida de Elvas s/n, 06071 Badajoz (Spain); Martin-Aranda, R.M. [Dpto. de Quimica Inorganica y Quimica Tecnica, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia (UNED), C/Senda del Rey, 9, E-28040 Madrid (Spain)]. E-mail: rmartin@ccia.uned.es

    2006-06-30

    N-Alkyl-imidazole has been synthesized by sonochemical irradiation of imidazole and 1-bromobutane using alkaline-promoted carbons (exchanged with the binary combinations of Na, K and Cs). The catalysts were characterized by X-ray photoelectron spectroscopy, thermal analysis and N{sub 2} adsorption isotherms. Under the experimental conditions, N-alkyl-imidazoles can be prepared with a high activity and selectivity. It is observed that imidazole conversion increases in parallel with increasing the basicity of the catalyst. The influence of the alkaline promoter, the reaction temperature, and the amount of catalyst on the catalytic activity has been studied. For comparison, the alkylation of imidazole has also been performed in a batch reactor system under thermal activation.

  15. Safety Assessment of Alkyl Ethylhexanoates as Used in Cosmetics.

    Fiume, Monice; Heldreth, Bart; Bergfeld, Wilma F; Belsito, Donald V; Hill, Ronald A; Klaassen, Curtis D; Liebler, Daniel C; Marks, James G; Shank, Ronald C; Slaga, Thomas J; Snyder, Paul W; Andersen, F Alan

    2015-01-01

    The Cosmetic Ingredient Review (CIR) Expert Panel (Panel) assessed the safety of 16 alkyl ethylhexanoates for use in cosmetics, concluding that these ingredients are safe in cosmetic formulations in the present practices of use and concentrations when formulated to be nonirritating. The alkyl ethylhexanoates primarily function as skin-conditioning agents in cosmetics. The highest concentration of use reported for any of the alkyl ethylhexanoates is 77.3% cetyl ethylhexanoate in rinse-off formulations used near the eye, and the highest leave-on use reported is 52% cetyl ethylhexanoate in lipstick formulations. The Panel reviewed available animal and clinical data related to these ingredients, and the similarities in structure, properties, functions, and uses of ingredients from previous CIR assessments on constituent alcohols that allowed for extrapolation of the available toxicological data to assess the safety of the entire group. PMID:26684798

  16. Structural features of a series of S-alkylated and non-S-alkylated aminothiolate nickel(II) complexes

    Chohan, B. S.

    2014-12-01

    The structural aspects of a family of S-alkylated complexes, generated by reacting iodoacetamide or iodoethanol with two mononuclear Ni(II) diaminodithiolate complexes are discussed. The S-alkylation reactions were investigated with particular attention paid to the size of the chelate ring that straps the N,N'-methylamine donors. In one complex the N-methyl groups are cis to each other and in the other they are trans. Both complexes undergo S-alkylation with two equivalents of either reagent, that coordinates through the pendant oxygen to the Ni(II), forming dications with an N2S2O2 ligand donor set. Crystal structures of [NiC12H26N4O2S2]I2 · MeOH, [NiC12H28N2O2S2]I2, and [NiC13H30N2O2S2]I2 · 1/2 MeOH, are determined by single crystal X-ray analysis. The N-methyl groups in each of the alkylated derivatives are trans to each other, suggesting that the cis configuration is highly unfavored for such complexes in octahedral conformation. Crystal packing data shows that each of the alkylated complexes interacts closely with the iodide counterions, and with solvent if present; some of these interactions include H-bonds. Only the iodoacetamide derivative shows any significant interaction with a neighboring molecule.

  17. SYNTHESIS OF 1-n-ALKYL-3-METHYL- AND 1-n-ALKYL-3- PHENYL-5-PYRAZOLONES AND FORMYL DERIVATIVES

    J. BELMAR

    2001-12-01

    Full Text Available 3-Methyl- and 3-phenyl-5-pyrazolones were alkylated and formylated. The phenyl derivative was less reactive towards alkylation. However in the formylation step 1-n-alkyl-3-methyl- and 1-n-alkyl-3-phenyl-5-pyrazolones showed no difference in reactivity. The alkylated products exist as 5-pyrazolones in chloroform solutions and in dimethylsulfoxide their structure is a 5-hydroxy-pyrazole. Chloroform and dimethyl sulfoxide solutions of 4-formyl derivatives have a structure that is better described as 4-hydroxymethylene-5-pyrazoloneSe alquiló y formiló 3-metil- y 3-fenil-5-pirazolona. El 3-fenil derivado es menos reactivo en la etapa de alquilación. En la etapa de formilación no hay diferencias entre 1-n-alquil-3-metil- o 1-n-alquil-3-fenil-5-pirazolona. Los productos de alquilación presentan una estructura de 5-pirazolona en cloformo, mientras que en dimetilsulfóxido la estructura es del tipo 5-hidroxipirazol. En estos mismos solventes, los derivados formilados solo presentan una estructura que es descrita como 4-hidroximetilén-5-pirazolona

  18. Alkylation of benzene with normal olefins from coker distillate

    Aboul-Gheit, A.K.; Moustafa, O.F.; Habbib, R.M.

    1985-10-01

    The normal olefins separated from a coker distillate were used to alkylate benzene on catalysts containing silicotungstic acid supported on silica, silica-alumina and activated natural clays. The alkylation activity was found to increase as the surface area and silica/alumina ratio of the catalysts increase, irrespective of the support texture. The activation energy of the reaction was very low (proportional3 k cal mol/sup -1/), assuming catalytic intraparticle diffusion limitation. Equilibrium shift towards dealkylation was observed beyond 300/sup 0/C. (orig.).

  19. Equity valuation : Atlas Copco AB

    Santos, Ricardo Manuel Castro Lopes Alba

    2016-01-01

    This Dissertation presents a literature review of some of the most appraised theories on equity valuation models. A thoughtful analysis is made, presenting the main advantages and restrictions of each model and setting the path for a discussion about improvements to be made on this field of study. A practical implementation follows, proposing a fair value estimation of Atlas Copco AB shares. Atlas Copco is a Swedish-based capital goods company, operating across four differen...

  20. AB Levitator and Electricity Storage

    Bolonkin, Alexander

    2007-01-01

    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative...

  1. Molecular pharmacology of hepsulfam, NSC 3296801: identification of alkylated nucleosides, alkylation site, and site of DNA cross-linking.

    Streeper, R T; Cotter, R J; Colvin, M E; Hilton, J; Colvin, O M

    1995-04-01

    We have determined that hepsulfam, in common with its structural homologue busulfan, alkylates both free guanosine and GMP in DNA at the 7 nitrogen. Mass spectral analysis of the products of the reaction of hepsulfam with guanosine has identified the mono- and bis-alkylated guanosine adducts. UV spectrophotometry and mass spectrometry were used to confirm that alkylation occurred at the 7 nitrogen by following the formation of the formamidopyrimidyl form of the hepsulfam-guanosine adduct at high pH. We have also isolated and identified 1-guanyl,7-hydroxyheptane, 1-guanyl,7-sulfamylheptane, and 1,7-bis(guanyl)heptane from in vitro reaction mixtures of hepsulfam and calf thymus DNA. We have isolated bis-(7-formamidopyrimidyldeoxyguanosinyl)-heptane from an enzymatic digest of DNA treated with hepsulfam. Finally, we have found that hepsulfam forms interstrand cross-links at 5'-GXC-3' sites in model oligonucleotides. PMID:7882358

  2. UV absorption spectra and kinetics for alkyl and alkyl peroxy radicals originating from di-tert-butyl ether

    Nielsen, O.J.; Sehested, J.; Langer, S.; Ljungström, E.; Wängberg, I.

    Alkyl, (CH3)(3)COC(CH3)(2)CH2, and alkyl peroxy, (CH3)(3)COC(CH3)(2)CH2O2, radicals from di-tert-butyl ether (DTBE), have been studied in the gas phase at 296 K. A pulse radiolysis UV absorption technique was used to measure the spectra and kinetics. Absorption cross sections were quantified over......) s(-1) was found. The rate constants for the reaction of the alkyl peroxy radicals with NO and NO2 were determined to be (1.8 +/- 0.2) X 10(-12) and (9.9 +/- 1.3) X 10(-12) cm(3) molecule(-1) s(-1), respectively. As a part of the work the rate constants k(F + DTBE) and k(OH + DTBE) were determined to...

  3. Thermonuclear Reflect AB-Reactor

    Bolonkin, Alexander

    2008-01-01

    The author offers a new kind of thermonuclear reflect reactor. The remarkable feature of this new reactor is a three net AB reflector, which confines the high temperature plasma. The plasma loses part of its energy when it contacts with the net but this loss can be compensated by an additional permanent plasma heating. When the plasma is rarefied (has a small density), the heat flow to the AB reflector is not large and the temperature in the triple reflector net is lower than 2000 - 3000 K. This offered AB-reactor has significantly less power then the currently contemplated power reactors with magnetic or inertial confinement (hundreds-thousands of kW, not millions of kW). But it is enough for many vehicles and ships and particularly valuable for tunnelers, subs and space apparatus, where air to burn chemical fuel is at a premium or simply not available. The author has made a number of innovations in this reactor, researched its theory, developed methods of computation, made a sample computation of typical pr...

  4. AB Levitator and Electricity Storage

    Bolonkin, A

    2007-01-01

    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative weight ratio of this engine is 0.01 - 0.1 (from thrust). For some types of AB engine (toroidal form) the thrust easily may be changed in any direction without turning of engine. The author computed many projects using different versions of offered AB engine: small device for levitation-flight of a human (including flight from Earth to Outer Space), fly VTOL car (track), big VTOL aircrat, suspended low altitude stationary satellite, powerful Space Shuttle-like booster for travel to the Moon and Mars without spending energ...

  5. Tetra-n-butylammonium Hydroxide: an Efficient Catalyst for N-Alkylation of Pyrimidines and Purines

    2006-01-01

    An efficient procedure for N-alkylation of pyrimidines and purines in the presence of tetra-n-butylammonium hydroxide(TBAH) is described. The method is very practical and the alkylation can occur at room temperature and the yields of the N-alkyl pyrimidines and purines were found to be excellent.

  6. 40 CFR 721.5380 - Mixed alkyl phenolic novolak resin (generic).

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Mixed alkyl phenolic novolak resin... Specific Chemical Substances § 721.5380 Mixed alkyl phenolic novolak resin (generic). (a) Chemical... as mixed alkyl phenolic novolak resin (PMN P-98-718) is subject to reporting under this section...

  7. 40 CFR 721.10143 - Amines, bis (C11-14-branched and linear alkyl).

    2010-07-01

    ... linear alkyl). 721.10143 Section 721.10143 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Specific Chemical Substances § 721.10143 Amines, bis (C11-14-branched and linear alkyl). (a) Chemical..., bis (C11-14-branched and linear alkyl) (PMN P-06-733; CAS No. 900169-60-0) is subject to...

  8. Ruthenium-Catalyzed Alkylation of Oxindole with Alcohols

    Jensen, Thomas; Madsen, Robert

    2009-01-01

    An atom-economical and solvent-free catalytic procedure for the mono-3-alkylation of oxindole with alcohols is described. The reaction is mediated by the in situ generated catalyst from RuCl3 center dot xH(2)O and PPh3 in the presence of sodium hydroxide, The reactions proceed in good to excellen...

  9. On the Boiling Points of the Alkyl Halides.

    Correia, John

    1988-01-01

    Discusses the variety of explanations in organic chemistry textbooks of a physical property of organic compounds. Focuses on those concepts explaining attractive forces between molecules. Concludes that induction interactions play a major role in alkyl halides and other polar organic molecules and should be given wider exposure in chemistry texts.…

  10. Synthesis of Hydroxytyrosyl Alkyl Ethers from Olive Oil Waste Waters

    Juan Fernández-Bolaños

    2009-05-01

    Full Text Available The preparation of a new type of derivatives of the naturally occurring antioxidant hydroxytyrosol is reported. Hydroxytyrosyl alkyl ethers were obtained in high yield by a three-step procedure starting from hydroxytyrosol isolated from olive oil waste waters. Preliminary results obtained by the Rancimat method have shown that these derivatives retain the high protective capacity of free hydroxytyrosol.

  11. Ionic liquid containing hydroxamate and N-alkyl sulfamate ions

    Friesen, Cody A.; Wolfe, Derek; Johnson, Paul Bryan

    2016-03-15

    Embodiments of the invention are related to ionic liquids and more specifically to ionic liquids used in electrochemical metal-air cells in which the ionic liquid includes a cation and an anion selected from hydroxamate and/or N-alkyl sulfamate anions.

  12. Synthesis of Hydroxytyrosyl Alkyl Ethers from Olive Oil Waste Waters

    2009-01-01

    The preparation of a new type of derivatives of the naturally occurring antioxidant hydroxytyrosol is reported. Hydroxytyrosyl alkyl ethers were obtained in high yield by a three-step procedure starting from hydroxytyrosol isolated from olive oil waste waters. Preliminary results obtained by the Rancimat method have shown that these derivatives retain the high protective capacity of free hydroxytyrosol.

  13. Alkyl Aryl Ether Bond Formation with PhenoFluor**

    Shen, Xiao; Neumann, Constanze N.; Kleinlein, Claudia; Claudia, Nathaniel W.; Ritter, Tobias

    2015-01-01

    An alkyl aryl ether bond formation reaction between phenols and primary and secondary alcohols with PhenoFluor has been developed. The reaction features a broad substrate scope and tolerates many functional groups, and substrates that are challenging for more conventional ether bond forming processes may be coupled. A preliminary mechanistic study indicates reactivity distinct from conventional ether bond formation.

  14. Students' Understanding of Alkyl Halide Reactions in Undergraduate Organic Chemistry

    Cruz-Ramirez de Arellano, Daniel

    2013-01-01

    Organic chemistry is an essential subject for many undergraduate students completing degrees in science, engineering, and pre-professional programs. However, students often struggle with the concepts and skills required to successfully solve organic chemistry exercises. Since alkyl halides are traditionally the first functional group that is…

  15. Alkylation of quinolines with trialkyl phosphates Pt. 3

    Intermolecular direct methyl transfer from the O-methyl group of N-methyl-4-methoxy-quinolinium quaternary salt to the ring nitrogen atom of 4-methoxyquinoline formed as intermediates in the alkylation reaction of 4-quinolone with trimethyl phosphate to N-methyl-4-quinolone was established by using tracer techniques. (author)

  16. Alkylation of quinolines with trialkyl phosphates Pt. 3. Isotopic studies

    Dutka, F.; Marton, A.F.; Koemives, T. (Magyar Tudomanyos Akademia Koezponti Kemiai Kutato Intezete, Budapest); Frank, J. (CHINOIN Gyogyszer es Vegyeszeti Termekek Gyara Rt., Budapest (Hungary))

    1981-10-03

    Intermolecular direct methyl transfer from the O-methyl group of N-methyl-4-methoxy-quinolinium quaternary salt to the ring nitrogen atom of 4-methoxyquinoline formed as intermediates in the alkylation reaction of 4-quinolone with trimethyl phosphate to N-methyl-4-quinolone was established by using tracer techniques.

  17. AP calculus AB/BC

    Schwartz, Stu

    2013-01-01

    All Access for the AP® Calculus AB & BC Exams Book + Web + Mobile Everything you need to prepare for the Advanced Placement® exam, in a study system built around you! There are many different ways to prepare for an Advanced Placement® exam. What's best for you depends on how much time you have to study and how comfortable you are with the subject matter. To score your highest, you need a system that can be customized to fit you: your schedule, your learning style, and your current level of knowledge. This book, and the free online tools that come with it, will help you personalize your AP® Cal

  18. ABS: Sequence alignment by scanning

    Bonny, Mohamed Talal

    2011-08-01

    Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  19. Impact of C4'-O-Alkyl Linker on in Vivo Pharmacokinetics of Near-Infrared Cyanine/Monoclonal Antibody Conjugates.

    Sato, Kazuhide; Nagaya, Tadanobu; Nakamura, Yuko; Harada, Toshiko; Nani, Roger R; Shaum, James B; Gorka, Alexander P; Kim, Insook; Paik, Chang H; Choyke, Peter L; Schnermann, Martin J; Kobayashi, Hisataka

    2015-09-01

    Near-infrared (NIR) fluorophores have several advantages over visible-light fluorophores, including superior tissue penetration and lower autofluorescence. We recently accessed a new class of readily synthesized NIR cyanines containing a novel C4'-O-alkyl linker, which provides both high chemical stability and excellent optical properties. In this study, we provide the first in vivo analysis of this new class of compounds, represented by the tetrasulfonate FNIR-774 (Frederick NIR 774). Monoclonal antibody (mAb) conjugates of FNIR-774 were compared to conjugates of the commercially available dye (IRDye800CW (IR800)), one of the most widely used NIR fluorophores for clinical translation. Both dyes were conjugated to panitumumab (pan) or cetuximab (cet) with ratios of 1:2 or 1:5. Conjugates of both dyes demonstrated similar quenching capacity, stability, and brightness in target cells in vitro. In contrast, in vivo imaging in mice showed different pharmacokinetics between pan-FNIR-774 (1:5) and pan-IR800 (1:5), or cet-FNIR-774 (1:5) and cet-IR800 (1:5). Particularly at the higher labeling density, mAb-FNIR-774 conjugates showed superior specific accumulation in tumors compared with mAb-IR800 conjugates. Thus, FNIR-774 conjugates showed superior in vivo pharmacokinetics compared with IR800 conjugates, independent of the mAb. These results suggest that FNIR-774 is a promising fluorescent probe for NIR optical imaging. PMID:26261913

  20. Inhibitory Activities of Alkyl Syringates and Related Compounds on Aflatoxin Production

    Tomohiro Furukawa

    2016-06-01

    Full Text Available Inhibitors of aflatoxin production of aflatoxigenic fungi are useful for preventing aflatoxin contamination in crops. As methyl syringate weakly inhibits aflatoxin production, aflatoxin production inhibitory activities of additional alkyl syringates with alkyl chains from ethyl to octyl were examined. Inhibitory activity toward aflatoxin production of Aspergillus flavus became stronger as the length of the alkyl chains on the esters became longer. Pentyl, hexyl, heptyl, and octyl syringates showed strong activity at 0.05 mM. Heptyl and octyl parabens, and octyl gallate also inhibited aflatoxin production as strongly as octyl syringate. Alkyl parabens and alkyl gallates inhibit the complex II activity of the mitochondrial respiration chain; thus, whether alkyl syringates inhibit complex II activity was examined. Inhibitory activities of alkyl syringates toward complex II also became stronger as the length of the alkyl chains increased. The complex II inhibitory activity of octyl syringate was comparable to that of octyl paraben and octyl gallate. These results suggest that alkyl syringates, alkyl parabens, and alkyl gallates, including commonly used food additives, are useful for aflatoxin control.

  1. Inhibitory Activities of Alkyl Syringates and Related Compounds on Aflatoxin Production.

    Furukawa, Tomohiro; Iimura, Kurin; Kimura, Taichi; Yamamoto, Toshiyoshi; Sakuda, Shohei

    2016-01-01

    Inhibitors of aflatoxin production of aflatoxigenic fungi are useful for preventing aflatoxin contamination in crops. As methyl syringate weakly inhibits aflatoxin production, aflatoxin production inhibitory activities of additional alkyl syringates with alkyl chains from ethyl to octyl were examined. Inhibitory activity toward aflatoxin production of Aspergillus flavus became stronger as the length of the alkyl chains on the esters became longer. Pentyl, hexyl, heptyl, and octyl syringates showed strong activity at 0.05 mM. Heptyl and octyl parabens, and octyl gallate also inhibited aflatoxin production as strongly as octyl syringate. Alkyl parabens and alkyl gallates inhibit the complex II activity of the mitochondrial respiration chain; thus, whether alkyl syringates inhibit complex II activity was examined. Inhibitory activities of alkyl syringates toward complex II also became stronger as the length of the alkyl chains increased. The complex II inhibitory activity of octyl syringate was comparable to that of octyl paraben and octyl gallate. These results suggest that alkyl syringates, alkyl parabens, and alkyl gallates, including commonly used food additives, are useful for aflatoxin control. PMID:27338472

  2. Synthesis and Antioxidant Activity of Alkyl Nitroderivatives of Hydroxytyrosol

    Elena Gallardo

    2016-05-01

    Full Text Available A series of alkyl nitrohydroxytyrosyl ether derivatives has been synthesized from free hydroxytyrosol (HT, the natural olive oil phenol, in order to increase the assortment of compounds with potential neuroprotective activity in Parkinson’s disease. In this work, the antioxidant activity of these novel compounds has been evaluated using Ferric Reducing Antioxidant Power (FRAP, 2,2′-azinobis(3-ethylbenzothiazoline-6-sulfonic acid diammonium salt (ABTS, and Oxygen Radical Scavenging Capacity (ORAC assays compared to that of nitrohydroxytyrosol (NO2HT and free HT. New compounds showed variable antioxidant activity depending on the alkyl side chain length; compounds with short chains (2–4 carbon atoms maintained or even improved the antioxidant activity compared to NO2HT and/or HT, whereas those with longer side chains (6–8 carbon atoms showed lower activity than NO2HT but higher than HT.

  3. Bacteria-driven production of alkyl nitrates in seawater

    Kim, Michelle J.; Michaud, Jennifer M.; Williams, Renee; Sherwood, Byron Pedler; Pomeroy, Robert; Azam, Farooq; Burkart, Michael; Bertram, Timothy H.

    2015-01-01

    and ship-borne measurements have shown that the ocean is a large, diffuse source for short chain (C1-C3) gas phase alkyl nitrates (RONO2). Photochemical production of RONO2 has been demonstrated previously as a viable mechanism in surface waters; however, it cannot account for the observed depth profile of RONO2, suggesting an additional, dark RONO2 production mechanism. We present measurements of gas phase C1-C5 alkyl nitrates emitted from seawater in a controlled mesocosm experiment conducted under low-light conditions in a glass-walled wave channel. Ethyl and butyl nitrate emission rates from seawater are strongly correlated with the abundance of heterotrophic bacteria (R2 ≥ 0.89) and show no correlation to chlorophyll a concentration. Controlled flask experiments conducted using ambient and sterile seawater, inoculated with a heterotrophic bacterium, confirm that bacterial driven production of select RONO2 can proceed efficiently in the absence of light.

  4. Branched Alkyl Alcohol Propoxylated Sulfate Surfactants for Improved Oil Recovery

    Wu, Y.; Iglauer, S.; Shuler, P.; Tang, Y.; Goddard, W. A., III

    2010-01-01

    This investigation considers branched alkyl alcohol propoxylated sulfate surfactants as candidates for chemcial enhanced oil recovery (EOR) applications. Results show that these anionic surfactants may be preferred candidates for EOR as they can be effective at creating low interfacial tension (1FT) at dilute concentrations, without requiring an alkaline agent or cosurfactant. In addition, some of the formulations exhibit a low 1FT at high salinity, and hence may be suita...

  5. Synthesis and Characterization of Responsive Poly(Alkyl Methacrylate) Topologies

    Kilian, Lars

    2004-01-01

    Dimethacrylate monomers containing two cleavable tert-butyl ester groups were synthesized and utilized in the synthesis of star-shaped polymers. Star polymer coupling was achieved by reacting the living poly(alkyl methacrylate) using 2,5-dimethyl-2,5-hexanediol dimethacrylate (DHDMA) or dicumyl dimethacrylate (DCDMA). These starshaped polymers were cleaved under hydrolytic conditions, leading to significant reductions in molecular weights. The cleavable star-shaped polymers also underwent unc...

  6. Ab-Initio Molecular Dynamics

    Kühne, Thomas D

    2012-01-01

    Computer simulations and molecular dynamics in particular, is a very powerful method to provide detailed and essentially exact informations of classical many-body problems. With the advent of \\textit{ab-initio} molecular dynamics, where the forces are computed on-the-fly by accurate electronic structure calculations, the scope of either method has been greatly extended. This new approach, which unifies Newton's and Schr\\"odinger's equations, allows for complex simulations without relying on any adjustable parameter. This review is intended to outline the basic principles as well as a survey of the field. Beginning with the derivation of Born-Oppenheimer molecular dynamics, the Car-Parrinello method as well as novel hybrid scheme that unifies best of either approach are discussed. The predictive power is demonstrated by a series of applications ranging from insulators to semiconductors and even metals in condensed phases.

  7. Synthesis and exfoliation of alkyl-pyridinium/Bi2212 nanohybrids

    Iwasaki, M; Enomoto, H [Division of Electronics and Applied Physics, Graduate School of Engineering, Osaka Electro-Communication University, Hatsu-cho 18-8, Neyagawa, Osaka 572-8530 (Japan); Ozaki, H [Department of Electrical Engineering and Bioscience, Waseda University, Ohkubo 3-4-1, Shinjuku-ku, Tokyo 169-8555 (Japan); Lerner, M M, E-mail: h-enomot@isc.osakac.ac.j [Department of Chemistry, Oregon State University, Corvallis, OR 97331-4003 (United States)

    2009-03-01

    Nanohybrids of superconducting Bi{sub 2}Sr{sub 2}CaCu2O{sub 8+d} (Bi2212) with alkyl-pyridinium salts were synthesized by a stepwise intercalation method. HgBr{sub 2} was intercalated into Bi2212 crystal to prepare a precursor before intercalation of alkyl-pyridinium ions. Alkyl-pyridinium (Py-C{sub n}H{sub 2n+1}, where Py = pyridine and n = 4, 12 and 16) was adopted as guest intercalants. Nanohybrids were characterized by X-ray powder diffraction. It is found that the gallery height of Bi2212 host is expanded from 3.07 nm to 8.69 nm (DELTAc = 5.61 nm) in Py-C{sub 16}H{sub 33}/Bi2212. We were successful in preparing transparent colloid of Py-C{sub 16}H{sub 33}/Bi2212 nanohybrid in organic solvent. This colloid is found to be stable for 6 days. Ultrathin films assembled by the layer-by-layer technique from Bi2212 colloids with a cationic polymer were fabricated.

  8. Chemotherapy-induced pulmonary hypertension: role of alkylating agents.

    Ranchoux, Benoît; Günther, Sven; Quarck, Rozenn; Chaumais, Marie-Camille; Dorfmüller, Peter; Antigny, Fabrice; Dumas, Sébastien J; Raymond, Nicolas; Lau, Edmund; Savale, Laurent; Jaïs, Xavier; Sitbon, Olivier; Simonneau, Gérald; Stenmark, Kurt; Cohen-Kaminsky, Sylvia; Humbert, Marc; Montani, David; Perros, Frédéric

    2015-02-01

    Pulmonary veno-occlusive disease (PVOD) is an uncommon form of pulmonary hypertension (PH) characterized by progressive obstruction of small pulmonary veins and a dismal prognosis. Limited case series have reported a possible association between different chemotherapeutic agents and PVOD. We evaluated the relationship between chemotherapeutic agents and PVOD. Cases of chemotherapy-induced PVOD from the French PH network and literature were reviewed. Consequences of chemotherapy exposure on the pulmonary vasculature and hemodynamics were investigated in three different animal models (mouse, rat, and rabbit). Thirty-seven cases of chemotherapy-associated PVOD were identified in the French PH network and systematic literature analysis. Exposure to alkylating agents was observed in 83.8% of cases, mostly represented by cyclophosphamide (43.2%). In three different animal models, cyclophosphamide was able to induce PH on the basis of hemodynamic, morphological, and biological parameters. In these models, histopathological assessment confirmed significant pulmonary venous involvement highly suggestive of PVOD. Together, clinical data and animal models demonstrated a plausible cause-effect relationship between alkylating agents and PVOD. Clinicians should be aware of this uncommon, but severe, pulmonary vascular complication of alkylating agents. PMID:25497573

  9. Alkylation of Benzene with Propylene Catalyzed by Ionic Liquids

    Sun Xuewen; Zhao Suoqi

    2006-01-01

    The alkylation of benzene with propylene catalyzed by ionic liquids to obtain cumene was investigated. Propylene conversion and cumene selectivity under mild reaction conditions were improved greatly after the ionic liquid was modified with HCl. Under the conditions of 20 oC, 0.1MPa, 5 min of reaction time, and a molar ratio of benzene to propylene of 10:1, propylene conversion increased from 83.6% to 100%, and cumene selectivity increased from 90.86% to 98.47%. In addition, it was found that the reaction could be carried out in two different stages so as to obtain a better result. At the first stage, the key reaction was alkylation and a higher propylene conversion was obtained at a lower temperature;At the second stage, the key reaction was transalkylation and a higher temperature was used to improve cumene selectivity. The reaction temperature, pressure and the amount of catalyst used in this work were lower than those used in traditional alkylation processes.

  10. Synthesis and exfoliation of alkyl-pyridinium/Bi2212 nanohybrids

    Nanohybrids of superconducting Bi2Sr2CaCu2O8+d (Bi2212) with alkyl-pyridinium salts were synthesized by a stepwise intercalation method. HgBr2 was intercalated into Bi2212 crystal to prepare a precursor before intercalation of alkyl-pyridinium ions. Alkyl-pyridinium (Py-CnH2n+1, where Py = pyridine and n = 4, 12 and 16) was adopted as guest intercalants. Nanohybrids were characterized by X-ray powder diffraction. It is found that the gallery height of Bi2212 host is expanded from 3.07 nm to 8.69 nm (Δc = 5.61 nm) in Py-C16H33/Bi2212. We were successful in preparing transparent colloid of Py-C16H33/Bi2212 nanohybrid in organic solvent. This colloid is found to be stable for 6 days. Ultrathin films assembled by the layer-by-layer technique from Bi2212 colloids with a cationic polymer were fabricated.

  11. Efficient synthesis of N-alkyl-2,7-dihalocarbazoles by simultaneous carbazole ring closure and N-alkylation

    Výprachtický, Drahomír; Kmínek, Ivan; Pokorná, Veronika; Cimrová, Věra

    2012-01-01

    Roč. 68, č. 25 (2012), s. 5075-5080. ISSN 0040-4020 R&D Projects: GA MŠk(CZ) 1M06031; GA ČR GAP106/12/0827 Institutional research plan: CEZ:AV0Z40500505 Institutional support: RVO:61389013 Keywords : carbazole ring closure * carbazole alkylation * heterocycles Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 2.803, year: 2012

  12. Quantitative structure–activity relationships for chronic toxicity of alkyl-chrysenes and alkyl-benz[a]anthracenes to Japanese medaka embryos (Oryzias latipes)

    Highlights: • Medaka embryos were exposed to alkyl chrysenes and benzo[a]anthracenes (BAA). • Concentrations were kept constant by partition controlled delivery. • Chrysene was not toxic within solubility limits, in contrast to BAA. • Alkylation increased the toxicity of chrysene and BAA. • Toxicity was related to hydrophobicity and to specific modes of action. - Abstract: Alkylated polycyclic aromatic hydrocarbons (alkyl-PAHs) are a class of compounds found at significant concentrations in crude oils, and likely the main constituents responsible for the chronic toxicity of oil to fish. Alkyl substituents at different locations on the aromatic rings change the size and shape of PAH molecules, which results in different interactions with tissue receptors and different severities of toxicity. The present study is the first to report the toxicity of several alkylated derivatives of chrysene and benz[a]anthracene to the embryos of Japanese medaka (Oryzias latipes) using the partition controlled delivery (PCD) method of exposure. The PCD method maintained the desired exposure concentrations by equilibrium partitioning of hydrophobic test compounds from polydimethylsiloxane (PDMS) films. Test concentrations declined by only 13% over a period of 17 days. Based on the prevalence of signs of blue sac disease (BSD), as expressed by median effective concentrations (EC50s), benz[a]anthracene (B[a]A) was more toxic than chrysene. Alkylation generally increased toxicity, except at position 2 of B[a]A. Alkyl-PAHs substituted in the middle region had a lower EC50 than those substituted at the distal region. Except for B[a]A and 7-methylbenz[a]anthracene (7-MB), estimated EC50 values were higher than their solubility limits, which resulted in limited toxicity within the range of test concentrations. The regression between log EC50s and log Kow values provided a rough estimation of structure–activity relationships for alkyl-PAHs, but Kow alone did not provide a complete

  13. Distance-Dependent Attractive and Repulsive Interactions of Bulky Alkyl Groups.

    Hwang, Jungwun; Li, Ping; Smith, Mark D; Shimizu, Ken D

    2016-07-01

    The stabilizing and destabilizing effects of alkyl groups on an aromatic stacking interaction were experimentally measured in solution. The size (Me, Et, iPr, and tBu) and position (meta and para) of the alkyl groups were varied in a molecular balance model system designed to measure the strength of an intramolecular aromatic interaction. Opposite stability trends were observed for alkyl substituents at different positions on the aromatic rings. At the closer meta-position, smaller groups were stabilizing and larger groups were destabilizing. Conversely, at the farther para-position, the larger alkyl groups were systematically more stabilizing with the bulky tBu group forming the strongest stabilizing interaction. X-ray crystal structures showed that the stabilizing interactions of the small meta-alkyl and large para-alkyl groups were due to their similar distances and van der Waals contact areas with the edge of opposing aromatic ring. PMID:27159670

  14. Safety Assessment of Alkyl PEG/PPG Ethers as Used in Cosmetics.

    Fiume, Monice M; Heldreth, Bart; Bergfeld, Wilma F; Belsito, Donald V; Hill, Ronald A; Klaassen, Curtis D; Liebler, Daniel C; Marks, James G; Shank, Ronald C; Slaga, Thomas J; Snyder, Paul W; Andersen, F Alan

    2016-07-01

    The Cosmetic Ingredient Review (CIR) Expert Panel assessed the safety of 131 alkyl polyethylene glycol (PEG)/polypropylene glycol ethers as used in cosmetics, concluding that these ingredients are safe in the present practices of use and concentration described in this safety assessment when formulated to be nonirritating. Most of the alkyl PEG/PPG ethers included in this review are reported to function in cosmetics as surfactants, skin-conditioning agents, and/or emulsifying agents. The alkyl PEG/PPG ethers share very similar physiochemical properties as the alkyl PEG ethers, which were reviewed previously by the CIR Expert Panel and found safe when formulated to be nonirritating. The alkyl PEG ethers differ by the inclusion of PPG repeat units, which are used to fine-tune the surfactant properties of this group. The Panel relied heavily on data on analogous ingredients, extracted from the alkyl PEG ethers and PPG reports, when making its determination of safety. PMID:27383199

  15. GINGA Observations of AB Doradus

    Vilhu, O.; Tsuru, T.; Collier Cameron, A.

    We report GINGA observations of the pre main sequence star AB Doradus (HD 36705), performed during 8 - 12 January, 1990. Some rotational modulation might be present. four X-ray flares were detected. Three of these events were similar to the EINSTEIN HRI-flare (Vilhu and Linsky, 1987), with decay times around 25 min. The last flare had long rise and decay times (100 min), resembling the EXOSAT flares observed by Collier Cameron et.al. (1988). The mean flare spectrum can be fitted by a thermal bremstrahlung with temperature 5.0 keV, or by a power-law model with photon index 2.2. The 3 upper limit of the Iron line equivalent width in the flare spectrum is 1 keV, weaker than predicted by thermal models. This Iron line anomaly was first discussed in the case of UX Ari by Tsuru et. al. (1989). However, normal equivalent widths can be derived from several EXOSAT spectra of active cool stars (Pallavicini and Tagliaferri, 1990). We discuss the possibility that the continuum from non-thermal electrons (producing also the microwave emission) could occasionally lower the apparent equivalent width. The mechanism works for reasonably low magnetic field strengths and electon power-law indexes. However, a large population of non-thermal electrons is needed (comparable to the thermal one). Stronger magnetic fields could explain the radio emission with less electrons, but then the non-thermal X-ray continuum remains small.

  16. Effect of the Ortho Alkylation of Perylene Bisimides on the Alignment and Self-Assembly Properties

    2014-01-01

    The effect of the ortho alkylation of perylene bisimides on the alignment and self-assembly properties has been studied. It was found that the dichroic properties of perylene bisimides in a liquid crystal host can be reversed with a single synthetic step by ortho alkylation. Furthermore, a solvent-induced growth of ultralong organic n-type semiconducting fibrils from non-ortho-alkylated perylene bisimide was observed. Ortho substitution of the perylene bisimide core alters the mode of fibrill...

  17. Coke precursor as an intermediate during the alkylation of isobutane/butene over a solid superacid

    XIE; Wenhua; FU; Qiang

    2004-01-01

    Alkylation of isobutane/butene was conducted on a Brφnsted-Lewis conjugated solid superacid. It is found that some hydrocarbons accumulated on the catalyst surface. These hydrocarbons, as called coke precursor, played an intermediate role at the initial stage of the alkylation before they lead the catalyst to lose its activity. The presence of the intermediate is beneficial to the alkylation between isobutane and butene, while increase the TMP content and TMP/DMH ratio in the products.

  18. Synthesis of Imidates: TFA-Mediated Regioselective Amide Alkylation Using Meerwein's Reagent.

    Popov, Kirill; Somfai, Peter

    2016-04-15

    Regioselective O-alkylation of an amide to form the corresponding imidate is a common synthetic problem, often resulting in varying amounts of N-alkylation. Screening existing methods for converting amides to imidates gave inconsistent or irreproducible results, sometimes affording N-alkylamide as the major product. A simple and reliable protocol for amide O-alkylation with complete regioselectivity has been designed, and its scope and efficiency demonstrated on a number of substrates. PMID:27019206

  19. Highly enantio- and diastereoselective allylic alkylation of Morita-Baylis-Hillman carbonates with allyl ketones

    Tong, Guanghu

    2013-05-17

    The asymmetric allylic alkylation of Morita-Baylis-Hillman (MBH) carbonates with allyl ketones has been developed. The α-regioselective alkylation adducts, containing a hexa-1,5-diene framework with important synthetic value, were achieved in up to 83% yield, >99% ee, and 50:1 dr by using a commercially available Cinchona alkaloid as the catalyst. From the allylic alkylation adduct, a cyclohexene bearing two adjacent chiral centers was readily prepared. © 2013 American Chemical Society.

  20. Effects of alkyl chain lengths of gallates upon enzymatic wool functionalisation

    Gaffar Hossain, Kh. M.; Díaz González, María; Dagá Monmany, José María; Tzanov, Tzanko

    2010-01-01

    The covalent grafting of alkyl gallates on wool through a laccase catalysed reaction in 80/20 (v/v, %)aqueous–ethanol mixture provided in a one-step process a multifunctional textile material with antioxidant, antibacterial and water repellent properties. Gallic acid and its alkyl esters ethyl, propyl, octyl and dodecyl gallate have been enzymatically grafted on wool fibres in order to study the effect of alkyl chain length on wool functional modification. The capacity of laccase to oxidis...

  1. Methods of producing alkylated hydrocarbons from an in situ heat treatment process liquid

    Roes, Augustinus Wilhelmus Maria; Mo, Weijian; Muylle, Michel Serge Marie; Mandema, Remco Hugo; Nair, Vijay

    2009-09-01

    A method for producing alkylated hydrocarbons is disclosed. Formation fluid is produced from a subsurface in situ heat treatment process. The formation fluid is separated to produce a liquid stream and a first gas stream. The first gas stream includes olefins. The liquid stream is fractionated to produce at least a second gas stream including hydrocarbons having a carbon number of at least 3. The first gas stream and the second gas stream are introduced into an alkylation unit to produce alkylated hydrocarbons. At least a portion of the olefins in the first gas stream enhance alkylation.

  2. AP calculus AB & BC crash course

    Rosebush, J

    2012-01-01

    AP Calculus AB & BC Crash Course - Gets You a Higher Advanced Placement Score in Less Time Crash Course is perfect for the time-crunched student, the last-minute studier, or anyone who wants a refresher on the subject. AP Calculus AB & BC Crash Course gives you: Targeted, Focused Review - Study Only What You Need to Know Crash Course is based on an in-depth analysis of the AP Calculus AB & BC course description outline and actual AP test questions. It covers only the information tested on the exams, so you can make the most of your valuable study time. Written by experienced math teachers, our

  3. Saturation properties of 1-alkyl-3-methylimidazolium based ionic liquids.

    Rane, Kaustubh S; Errington, Jeffrey R

    2014-07-24

    We study the liquid-vapor saturation properties of room temperature ionic liquids (RTILs) belonging to the homologous series 1-alkyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide ([Cnmim][NTf2]) using Monte Carlo simulation. We examine the effect of temperature and cation alkyl chain length n on the saturated densities, vapor pressures, and enthalpies of vaporization. These properties are explicitly calculated for temperatures spanning from 280 to 1000 K for RTILs with n = 2, 4, 6, 8, 10, and 12. We also explore how the identity of the anion influences saturation properties. Specifically, we compare results for [C(4)mim][NTf2] with those for 1-butyl-3-methylimidazolium tetrafluoroborate ([C(4)mim][BF4]) and 1-butyl-3-methylimidazolium hexafluorophosphate ([C(4)mim][PF6]). Simulations are completed with a recently developed realistic united-atom force field. A combination of direct grand canonical and isothermal-isobaric temperature expanded ensemble simulations are used to construct phase diagrams. Our results are compared with experimental data and Gibbs ensemble simulation data. Overall, we find good agreement between our results and those measured experimentally. We find that the vapor pressures and enthalpies of vaporization show a strong dependence on the size of the alkyl chain at low temperatures, whereas no particular trend is observed at high temperatures. Finally, we also discuss the effect of temperature on liquid phase nanodomains observed in RTILs with large hydrophobic groups. We do not observe a drastic change in liquid phase structure upon variation of the temperature, which suggests there is not a sharp phase transition between a nanostructured and homogeneous liquid, as has been suggested in earlier studies. PMID:24986360

  4. Monolayer structures of alkyl aldehydes: Odd-membered homologues

    Phillips, T. K.; Clarke, Stuart M.; Castro Arroyo, Miguel Ángel; Millán, Carmen; Medina, Santiago

    2011-01-01

    Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7, C 9 and C 11) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue...

  5. Monolayer structures of alkyl aldehydes: Odd-membered homologues

    Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C7, C9 and C11) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C7 homologue the p2 plane group is preferred.

  6. Synthesis and cytotoxic activity of some derivatives of alkyl piperidine.

    Jahan, Sarwat; Akhtar, Shamim; Saify, Zafar Saied; Mushtaq, Nousheen; Sial, Ali Akbar; Kamil, Arfa; Arif, Muhammed

    2013-05-01

    Synthesis of novel phenacyl derivatives of alkyl piperidine as cytotoxic agents via simple and single step reaction procedure is going to be reported here. Twelve new compounds were successfully synthesized in moderate yield and in solid form. Their synthesis was confirmed by TLC, melting point, CHN analysis and through different spectral studies such as UV, IR, Mass and proton NMR. The advantages of this synthetic route are simple operation, mild reaction conditions and good yields. These newly synthesized derivatives were extensively explored for their cytotoxicity by brine shrimp lethality assay. PMID:23625425

  7. Alkylating HIV-1 Nef - a potential way of HIV intervention

    Cai Catherine

    2010-07-01

    Full Text Available Abstract Background Nef is a 27 KDa HIV-1 accessory protein. It downregulates CD4 from infected cell surface, a mechanism critical for efficient viral replication and pathogenicity. Agents that antagonize the Nef-mediated CD4 downregulation may offer a new class of drug to combat HIV infection and disease. TPCK (N-α-p-tosyl-L-phenylalanine chloromethyl ketone and TLCK (N-α-p-tosyl-L-lysine chloromethyl ketone are alkylation reagents that chemically modify the side chain of His or Cys residues in a protein. In search of chemicals that inhibit Nef function, we discovered that TPCK and TLCK alkylated HIV Nef. Methods Nef modification by TPCK was demonstrated on reducing SDS-PAGE. The specific cysteine residues modified were determined by site-directed mutagenesis and mass spectrometry (MS. The effect of TPCK modification on Nef-CD4 interaction was studied using fluorescence titration of a synthetic CD4 tail peptide with recombinant Nef-His protein. The conformational change of Nef-His protein upon TPCK-modification was monitored using CD spectrometry Results Incubation of Nef-transfected T cells, or recombinant Nef-His protein, with TPCK resulted in mobility shift of Nef on SDS-PAGE. Mutagenesis analysis indicated that the modification occurred at Cys55 and Cys206 in Nef. Mass spectrometry demonstrated that the modification was a covalent attachment (alkylation of TPCK at Cys55 and Cys206. Cys55 is next to the CD4 binding motif (A56W57L58 in Nef required for Nef-mediated CD4 downregulation and for AIDS development. This implies that the addition of a bulky TPCK molecule to Nef at Cys55 would impair Nef function and reduce HIV pathogenicity. As expected, Cys55 modification reduced the strength of the interaction between Nef-His and CD4 tail peptide by 50%. Conclusions Our data suggest that this Cys55-specific alkylation mechanism may be exploited to develop a new class of anti HIV drugs.

  8. Suzuki-Miyaura Cross-Coupling Reactions of Unactivated Alkyl Halides Catalyzed by a Nickel Pincer Complex

    Di Franco, Thomas; Boutin, Nicolas; Hu, Xile

    2013-01-01

    A nickel(II) pincer complex, [((N2N)-N-Me)Ni-Cl], was used to catalyze alkyl-alkyl and alkyl-aryl Suzuki-Miyaura coupling reactions of unactivated alkyl halides. The coupling of 9-alkyl-9-borabicyclo[3.3.1]nonane and 9-phenyl-9-borabicyclo[3.3.1]nonane reagents with alkyl halides was achieved in modest to good yields. The reactions tolerated a variety of useful functional groups including ester, ether, furan, thioether, acetal, and Boc groups.

  9. Main: DREDR1ATRD29AB [PLACE

    Full Text Available DREDR1ATRD29AB S000152 23-June-2006 (last modified) kehi Related to responsiveness ...dependent in the ABA-responsive expression of the rd29A in Arabidopsis; DRE; drought; water stress; oxidativ

  10. A general alkyl-alkyl cross-coupling enabled by redox-active esters and alkylzinc reagents.

    Qin, Tian; Cornella, Josep; Li, Chao; Malins, Lara R; Edwards, Jacob T; Kawamura, Shuhei; Maxwell, Brad D; Eastgate, Martin D; Baran, Phil S

    2016-05-13

    Alkyl carboxylic acids are ubiquitous in all facets of chemical science, from natural products to polymers, and represent an ideal starting material with which to forge new connections. This study demonstrates how the same activating principles used for decades to make simple C-N (amide) bonds from carboxylic acids with loss of water can be used to make C-C bonds through coupling with dialkylzinc reagents and loss of carbon dioxide. This disconnection strategy benefits from the use of a simple, inexpensive nickel catalyst and exhibits a remarkably broad scope across a range of substrates (>70 examples). PMID:27103669

  11. UV absorption spectra and kinetics for alkyl and alkyl peroxy radicals originating from di-tert-butyl ether

    Nielsen, O.J.; Sehested, J.; Langer, S.;

    1995-01-01

    (CH3)(3)COC(CH3)(2)CH2O2 radicals were found to be (2.9 +/- 0.2) X 10(-11) cm(3) molecule(-1) s(-1) and (2.7 +/- 0.2) X 10(-12) cm(3) molecule(-1) s(-1), respectively. For the reaction of the alkyl radical with O-2 in 1 atm pressure of SF6 a rate constant of (7.2 +/- 1.1) X 10(-13) cm(3) molecule(-1...

  12. Molecular mechanisms of alkylation sensitivity in Indian muntjac cell lines.

    Musk, S R; Hatton, D H; Bouffler, S D; Margison, G P; Johnson, R T

    1989-07-01

    The responses of two Indian muntjac cell lines to two monofunctional alkylating agents were investigated. An SV40-transformed line (SVM) had an increased sensitivity to cell killing when compared to the other, euploid line (DM) after exposure both to methyl nitrosourea (MNU) and to dimethylsulphate (DMS) and also exhibited higher frequencies of sister chromatid exchanges (SCEs) following alkylation. The hypersensitivity of SVM to DMS correlates with the defective repair of single-strand breaks that results in the generation of long-lived breaks in the DNA following exposure, leading eventually to the formation of chromosome aberrations. In contrast no difference is seen in the formation of long-lived breaks in the DNA of SVM and DM after treatment with biologically relevant doses of MNU; in this case hypersensitivity may be due to the loss of O6-alkylguanine-DNA-alkyltransferase activity. The conclusion that the hypersensitivites of SVM to MNU and to DMS have different molecular bases is supported by transfection of SVM with plasmids containing the protein coding region of the Escherichia coli ada+ gene; subsequent expression within the cell corrects its hypersensitivity to the cytotoxic and SCE-inducing effects of MNU but has very little influence upon the lethality, SCE induction or the repair of long-lived DNA strand breaks after exposure to DMS. PMID:2544312

  13. Tyrosine-selective protein alkylation using pi-allylpalladium complexes.

    Tilley, S David; Francis, Matthew B

    2006-02-01

    A new protein modification reaction has been developed based on a palladium-catalyzed allylic alkylation of tyrosine residues. This technique employs electrophilic pi-allyl intermediates derived from allylic acetate and carbamate precursors and can be used to modify proteins in aqueous solution at room temperature. To facilitate the detection of modified proteins using SDS-PAGE analysis, a fluorescent allyl acetate was synthesized and coupled to chymotrypsinogen A and bacteriophage MS2. The tyrosine selectivity of the reaction was confirmed through trypsin digest analysis. The utility of the reaction was demonstrated by using taurine-derived carbamates as water solubilizing groups that are cleaved upon protein functionalization. This solubility switching technique was used to install hydrophobic farnesyl and C(17) chains on chymotrypsinogen A in water using little or no cosolvent. Following this, the C(17) alkylated proteins were found to associate with lipid vesicles. In addition to providing a new protein modification strategy targeting an under-utilized amino acid side chain, this method provides convenient access to synthetic lipoproteins. PMID:16433516

  14. Differential alkylation-based redox proteomics--Lessons learnt.

    Wojdyla, Katarzyna; Rogowska-Wrzesinska, Adelina

    2015-12-01

    Cysteine is one of the most reactive amino acids. This is due to the electronegativity of sulphur atom in the side chain of thiolate group. It results in cysteine being present in several distinct redox forms inside the cell. Amongst these, reversible oxidations, S-nitrosylation and S-sulfenylation are crucial mediators of intracellular redox signalling, with known associations to health and disease. Study of their functionalities has intensified thanks to the development of various analytical strategies, with particular contribution from differential alkylation-based proteomics methods. Presented here is a critical evaluation of differential alkylation-based strategies for the analysis of S-nitrosylation and S-sulfenylation. The aim is to assess the current status and to provide insights for future directions in the dynamically evolving field of redox proteomics. To achieve that we collected 35 original research articles published since 2010 and analysed them considering the following parameters, (i) resolution of modification site, (ii) quantitative information, including correction of modification levels by protein abundance changes and determination of modification site occupancy, (iii) throughput, including the amount of starting material required for analysis. The results of this meta-analysis are the core of this review, complemented by issues related to biological models and sample preparation in redox proteomics, including conditions for free thiol blocking and labelling of target cysteine oxoforms. PMID:26282677

  15. Differential alkylation-based redox proteomics - Lessons learnt

    Wojdyla, Katarzyna; Rogowska-Wrzesinska, Adelina

    2015-01-01

    Cysteine is one of the most reactive amino acids. This is due to the electronegativity of sulphur atom in the side chain of thiolate group. It results in cysteine being present in several distinct redox forms inside the cell. Amongst these, reversible oxidations, S-nitrosylation and S-sulfenylati......Cysteine is one of the most reactive amino acids. This is due to the electronegativity of sulphur atom in the side chain of thiolate group. It results in cysteine being present in several distinct redox forms inside the cell. Amongst these, reversible oxidations, S-nitrosylation and S......-sulfenylation are crucial mediators of intracellular redox signalling, with known associations to health and disease. Study of their functionalities has intensified thanks to the development of various analytical strategies, with particular contribution from differential alkylation-based proteomics methods....... Presented here is a critical evaluation of differential alkylation-based strategies for the analysis of S-nitrosylation and S-sulfenylation. The aim is to assess the current status and to provide insights for future directions in the dynamically evolving field of redox proteomics. To achieve that we...

  16. Synthesis of the alkylated active metabolite of tipidogrel.

    Zhi, Shuang; Xia, Guangping; Liu, Ying; Tao, Zunwei; Chen, Ligong; Liu, Dengke

    2015-04-15

    Tipidogrel (3), an effective anti-platelet drug candidate working by irreversibly inhibiting P2Y12 receptor, holds great promise in overcoming clopidogrel resistance and increasing bioavailability. As a prodrug like other thienopyridines, it metabolizes through thiophene ring opening to form active metabolites 3a and 3b, nevertheless they are easily to form disulfide bond. Derivatization of 3a and 3b via alkylation with MPBr can prevent disulfide conjugation and ensure reliable pharmacokinetic results. Thus, in order to support its pre-clinical studies on efficiencies in the formation of tipidogrel active metabolites, 13a and 13b were synthesized via seven steps of chemosynthesis and incubation with MPBr in rat plasma in vitro. The resulting crude productions were purified by semi-preparative HPLC to give Z configuration 13a and E configuration 13b. In LC-MS/MS spectra, they showed identical fragmentation pattern and retention time with M-13a and M-13b, the MPBr-derivatives of active metabolites of tipidogrel in rats. Thus, 13a and 13b were the anticipated alkylated active metabolite of tipidogrel. In addition, in the nucleophilic substitution of thioacetate with compound 11, besides the anticipated compounds 12a and 12b, their isomers compounds 12c and 12d were detected, whose structures were confirmed and the corresponding mechanism was presented. PMID:25801935

  17. Gas-phase reactions of cyclopropenylidene with protonated alkyl amines.

    Lin, Ziqing; Tan, Lei; Yang, Yang; Dai, Mingji; Tureček, František; Ouyang, Zheng; Xia, Yu

    2016-04-21

    Vinylidene carbenes (C3H2) are of high interest to interstellar, combustion, and organic chemistry. Due to their high instability, the direct experimental investigation of their chemical reactivity has rarely been achieved. Herein, we report a first study on the reactions of cyclopropenylidene (c-C3H2) with protonated alkyl amines in the gas phase using a home-built ion trap mass spectrometer. The high gas-phase basicity (GB) of ((1)A1) c-C3H2 (calculated as 920 kJ mol(-1)) facilitates the formation of a proton-bound dimer with protonated amines as the first step in the reaction. The dimer can stay as it is or rearrange to a covalent product. The formation of the covalent complex is highly exothermic and its yield is affected by the GB of alkyl amines. The highest yield (82%) was achieved when the GB of the amine was slightly lower but comparable to that of c-C3H2. Our results demonstrate a new reaction pathway of c-C3H2, which has long been considered as a "dead end" in interstellar carbon chemistry. PMID:26978226

  18. Synthesis of 2-substituted tryptophans via a C3- to C2-alkyl migration

    Michele Mari

    2014-08-01

    Full Text Available The reaction of 3-substituted indoles with dehydroalanine (Dha derivatives under Lewis acid-mediated conditions has been investigated. The formation of 2-substituted tryptophans is proposed to occur through a selective alkylative dearomatization–cyclization followed by C3- to C2-alkyl migration and rearomatization.

  19. Development of Degradable Polymer Composites from Starch and Poly(alkyl cyanoacrylate)

    This report describes the development of degradable polymer composites that can be made at room temperature without special equipment. The developed composites are made from poly(alkyl cyanoacrylate) and starch. Alkyl cyanoacrylate monomers are mixed with starch and the polymerization reaction of ...

  20. Versatile assembly of p-carboxylatocalix[4]arene-O-alkyl ethers

    Kennedy, Stuart; Teat, Simon J.; Dalgarno, Scott J.

    2009-07-08

    Crystallisation of lower-rim tetra-O-alkylated p-carboxylatocalix[4]arenes from pyridine results in the formation of both bi-layer and pillar type supramolecular motifs. Full alkylation at the calixarene lower rim has significant influence over the supramolecular self-assembly motif, including preclusion of pyridine guest molecules from the calixarene cavity in the solid state.

  1. Alkyl-π engineering in state control toward versatile optoelectronic soft materials

    Lu, Fengniu; Nakanishi, Takashi

    2015-02-01

    Organic π-conjugated molecules with extremely rich and tailorable electronic and optical properties are frequently utilized for the fabrication of optoelectronic devices. To achieve high solubility for facile solution processing and desirable softness for flexible device fabrication, the rigid π units were in most cases attached by alkyl chains through chemical modification. Considerable numbers of alkylated-π molecular systems with versatile applications have been reported. However, a profound understanding of the molecular state control through proper alkyl chain substitution is still highly demanded because effective applications of these molecules are closely related to their physical states. To explore the underlying rule, we review a large number of alkylated-π molecules with emphasis on the interplay of van der Waals interactions (vdW) of the alkyl chains and π-π interactions of the π moieties. Based on our comprehensive investigations of the two interactions’ impacts on the physical states of the molecules, a clear guidance for state control by alkyl-π engineering is proposed. Specifically, either with proper alkyl chain substitution or favorable additives, the vdW and π-π interactions can be adjusted, resulting in modulation of the physical states and optoelectronic properties of the molecules. We believe the strategy summarized here will significantly benefit the alkyl-π chemistry toward wide-spread applications in optoelectronic devices.

  2. Polycyclic Aromatic Acids Are Primary Metabolites of Alkyl-PAHs-A Case Study with Nereis diversicolor.

    Malmquist, Linus M V; Selck, Henriette; Jørgensen, Kåre B; Christensen, Jan H

    2015-05-01

    Although concentrations of alkylated polycyclic aromatic hydrocarbons (alkyl-PAHs) in oil-contaminated sediments are higher than those of unsubstituted PAHs, only little attention has been given to metabolism and ecotoxicity of alkyl-PAHs. In this study we demonstrated that metabolism of alkyl-PAHs primarily forms polycyclic aromatic acids (PAAs). We generalize this to other alkyl-PAHs, based on literature and the present study of the metabolism of 1-methylphenanthrene, 3,6-dimethylphenanthrene, and 1-, 2-, 3-, and 6-methylchrysene related to their unsubstituted parent PAHs. Also, we observed that body burdens and production of PAAs was related to the position of the methyl group, showing the same isomer specific preferences as for microbial degradation of alkyl-PAHs. We detected a high production of PAAs, and larger metabolism of alkyl-PAHs than their unsubstituted parent PAHs. We therefore propose that carboxylic acid metabolites of alkyl-PAHs have the potential of constituting a new class of contaminants in marine waters that needs attention in relation to ecological risk assessments. PMID:25827176

  3. Rhodium-catalyzed aerobic N-alkylation of sulfonamides with alcohols

    Sun Lin Feng; Chuan Zhi Liu; Qiang Li; Xiao Chun Yu; Qing Xu

    2011-01-01

    By using the famous Wilkinson's catalyst, N-alkylation of sulfonamides can be easily realized under mild aerobic conditions by using alcohols as the alkylating reagent, giving monoalkylated sulfonamides in high yields and selectivities with water produced as the only byproduct. This advantageous aerobic method is potentially general in substrate scope that it can also be applied to other amides, amines and alcohols.

  4. Catalytic Alkylation of 2-Methylfuran with Formalin Using Supported Acidic Ionic Liquids

    Li, Hu; Shunmugavel, Saravanamurugan; Yang, Song;

    2015-01-01

    Biphasic alkylation of 2-methylfuran (2-MF) with formalin was carried out with a series of SBA-15 supported acidic ionic liquid catalysts (acidic SILCs) under mild reaction conditions. Acidic SILC with sulfonic acid groups (SO3H) and long alkyl chains was observed to have higher catalytic activity...

  5. The Retention Behaviors of Benzene and Its Alkyl Homologues in Microemulsion Electrokinetic Chromatography

    2000-01-01

    The retention behaviors of benzene and its alkyl homologues in microemulsion electrokinetic chromatography were investigated in both anionic and cationic surfactant MEEKC systems. The effects of the composition of microemulsion on retention time and selectivity were studied. A good linear relationship was obtained between log k' and the carbon number of alkyl chain.

  6. Sulfated Alkyl Glucopyranans with Potent Antiviral Activity Synthesized by Ring-Opening Copolymerization of Anhydroglucose and Alkyl Anhydroglucose Monomers

    Shiming Bai

    2015-01-01

    Full Text Available Sulfated glucopyranans having long alkyl groups were prepared by the ring-opening copolymerization of benzylated 1,6-anhydroglucopyranose with 3-O-octadecyl 1,6-anhydro-β-d-glucopyranose monomers, and subsequent deprotection and sulfation. Water-soluble sulfated glucopyranans with 2.8 and 4.7 mol% of 3-O-octadecyl group and lower molecular weights of M-n = 2.5 × 103–5.1 × 103 have potent anti-HIV activity at 0.05–1.25 μg/mL, even though sulfated polysaccharides with molecular weights below M-n = 6 × 103 had low anti-HIV activity. The interaction with poly-l-lysine as a model compound of proteins was analyzed by SPR, DSL, and zeta potential, indicating that the sulfated 3-O-octadecyl glucopyranans had high association and low dissociation rate constants, and the particle size increased after addition of poly-l-lysine. The anti-HIV activity was induced by electrostatic interaction between sulfate groups and amino groups of poly-l-lysine and by the synergistic effect of the hydrophobic long alkyl chain and hydrophilic sulfated group.

  7. Structural modifications of petroleum asphaltenes by reductive alkylation investigated by TLC-FID

    Cagniant, D.; Nosyrev, I.; Cebolla, V.; Vela, J.; Membrado, L.; Gruber, R. [Universite de Metz, Metz (France). Laboratoire de Thermodynamique et d' Analyses Chimiques

    2001-01-01

    The reductive alkylation of a French petroleum asphaltene (Lagrave) was studied with potassium in THF, in absence of an electron transfer reagent. From the number of butyl and benzyl groups added to the starting asphaltene, the difference of reactivity of the alkyl reagents, butyl iodide and benzyl bromide, was pointed out. Special attention was focused on the cleavage of C-S and C-O linkages in relation to the structural modifications. From the number of hydrogen atoms added during the reduction step, it was concluded that the sulphide linkages are mainly of aryl-S-aryl, aryl-S-alkyl or alkyl-S-alkyl types. The TLC-FID (Iatroscan) analysis was found to be very suitable to follow the 'depolymerization' process of the asphaltene, qualitatively as well as quantitatively, by the application hydrocarbon group type analysis. 23 refs., 2 figs., 5 tabs.

  8. Building blocks for ionic liquids: Vapor pressures and vaporization enthalpies of 1-(n-alkyl)-imidazoles

    Highlights: → We measured vapor pressures of the 1-(n-alkyl)-imidazoles by transpiration method. → Variations on the alkyl chain length n were C3, C5-C7, and C9-C10. → Enthalpies of vaporization were derived from (p, T) dependencies. → Enthalpies of vaporization at 298.15 K were linear dependent on the chain length. - Abstract: Vapor pressures of the linear 1-(n-alkyl)-imidazoles with the alkyl chain C3, C5-C7, and C9-C10 have been measured by the transpiration method. The molar enthalpies of vaporization ΔlgHm of these compounds were derived from the temperature dependencies of vapor pressures. A linear correlation of enthalpies of vaporization ΔlgHm (298.15 K) of the 1-(n-alkyl)-imidazoles with the chain length has been found.

  9. Alkylating ability of carbohydrate oxetanes: Practical synthesis of bolaform skeleton derivative

    Hadžić Pavle A.

    2015-01-01

    Full Text Available Alkylating ability of oxetane ring in carbohydrate structure was investigated and flexible method for bolaform amphiplile skeleton construction with xylose as polar heads is proposed. The method is based on oxetane ring opening in easily accessible 3,5-anhydro-1,2-O-cyclohexylidenexylofuranose (1. One step nitrogen alkylation in terminal diamines with 1 gave basic cationic bolaform skeleton with xylose as potential polar heads and deliberately chosen length of non polar spacer. Under similar experimental conditions, but with appropriate molar ratio of alkylating agent, alkylation reaction provide for selective monoalkylation of diamines. Successful alkylation in xanthine series (theophylline was also achieved with 1, giving a new 5-deoxy-5-(7´-theophyllineamino-α-D-xylofuranose derivative.

  10. Alkyl chain length impacts the antioxidative effect of lipophilized ferulic acid in fish oil enriched milk

    Sørensen, Ann-Dorit Moltke; Lyneborg, Karina Sieron; Villeneuve, Pierre; Jacobsen, Charlotte

    2015-01-01

    Lipophilization of phenolics by esterification with fatty alcohols may alter their localization in an emulsion and thereby their antioxidant efficacy. In this study, synthesized unbranched alkyl ferulates were evaluated as antioxidants in fish oil enriched milk. Lipid oxidation was determined by...... peroxide values and concentration of volatile oxidation products. A cut-off effect in the antioxidant efficacy in relation to the alkyl chain length was observed. The most efficient alkyl ferulate was methyl ferulate followed by ferulic acid and butyl ferulate, whereas octyl ferulate was prooxidative and...... the prooxidative effect increased further with an increment in the alkyl chain length from C8 to C12. Further elongation of the alkyl chain length to C16 and C20 resulted in weak prooxidative effects to weak antioxidative effects depending on the different volatile oxidation compounds developed....

  11. Quality Control of 1-Alkyl-3-methylimidazolium Ionic Liquid Precursors with HPLC

    张延强; 张建敏; 陈玉涣; 张锁江

    2007-01-01

    A high performance liquid chromatography (HPLC) method was proposed to monitor the synthesis and purification of the 1-alkyl-3-methylimidazolium ionic liquid precursors from alkylation of 1-methylimidazole with alkyl halides and determine the purity of final products. The results showed that separation of 1-methylimidazole from the precursors could be obtained under the HPLC performance conditions such as cation exchange column, acetonitrile/KH2PO4 aqueous solution and 209 nm wavelength. The content of unreacted 1-methylimidazole in the precursors could be easily calculated from their corresponding HPLC peak areas with the calibration curve of 1-methylimidazole. The retention times of the 1-alkyl-3-methylimidazolium ionic liquid precursors decreased with their increasing alkyls, and the ionic liquids with the same cation and different anions had almost the same retention times.

  12. Reactivity patterns of transition metal hydrides and alkyls

    The complex PPN+ CpV(CO)3H- (Cp=eta5-C5H5 and PPN = (Ph3P)2) was prepared in 70% yield and its physical properties and chemical reactions investigated. PPN+ CpV(CO)3H- reacts with a wide range of organic halides. The organometallic products of these reactions are the vanadium halides PPN+[CpV(C)3X]- and in some cases the binuclear bridging hydride PPN+ [CpV(CO)3]2H-. The borohydride salt PPN+[CpV(CO)3BH4]- has also been prepared. The reaction between CpV(CO)3H- and organic halides was investigated and compared with halide reductions carried out using tri-n-butyltin hydride. Results demonstrate that in almost all cases, the reduction reaction proceeds via free radical intermediates which are generated in a chain process, and are trapped by hydrogen transfer from CpV(CO)3H-. Sodium amalgam reduction of CpRh(CO)2 or a mixture of CpRh(CO)2 and CpCo(CO)2 affords two new anions, PPN+ [Cp2Rh3(CO)4]- and PPN+[Cp2RhCo(CO)2]-. CpMo(CO)3H reacts with CpMo(CO)3R (R=CH3,C2H5, CH2C6H5) at 25 to 500C to produce aldehyde RCHO and the dimers [CpMo(CO)3]2 and [CpMo(CO)2]2. In general, CpV(CO)3H- appears to transfer a hydrogen atom to the metal radical anion formed in an electron transfer process, whereas CpMo(CO)3H transfers hydride in a 2-electron process to a vacant coordination site. The chemical consequences are that CpV(CO)3H- generally reacts with metal alkyls to give alkanes via intermediate alkyl hydride species whereas CpMo(CO)3H reacts with metal alkyls to produce aldehyde, via an intermediate acyl hydride species

  13. 40 CFR 721.10108 - Naphthalenedisulfonic acid, hydrozy-[[[(hydroxyl-disulfo-naphthaleneyl)azo]-alkyl(C=1-5...

    2010-07-01

    ...- -alkyl(C=1-5)-(sulfoalkoxy)cyclic]azo]-substituted azo-, metal salt (generic). 721.10108 Section 721... Naphthalenedisulfonic acid, hydrozy- -alkyl(C=1-5)-(sulfoalkoxy)cyclic]azo]-substituted azo-, metal salt (generic). (a... generically as naphthalenedisulfonic acid, hydrozy- -alkyl(C=1-5)-(sulfoalkoxy)cyclic]azo]-substituted...

  14. Quantitative structure–activity relationships for chronic toxicity of alkyl-chrysenes and alkyl-benz[a]anthracenes to Japanese medaka embryos (Oryzias latipes)

    Lin, Hongkang [Department of Biology, Queen' s University, Kingston, Ontario K7L3N6 (Canada); Morandi, Garrett D. [School of Environmental Studies, Queen' s University, Kingston, Ontario K7L3N6 (Canada); Brown, R. Stephen [School of Environmental Studies, Queen' s University, Kingston, Ontario K7L3N6 (Canada); Department of Chemistry, Queen' s University, Kingston, Ontario K7L3N6 (Canada); Snieckus, Victor; Rantanen, Toni [Department of Chemistry, Queen' s University, Kingston, Ontario K7L3N6 (Canada); Jørgensen, Kåre B. [Department of Mathematics and Natural Sciences, University of Stavanger, 4036 Stavanger (Norway); Hodson, Peter V., E-mail: peter.hodson@queensu.ca [Department of Biology, Queen' s University, Kingston, Ontario K7L3N6 (Canada); School of Environmental Studies, Queen' s University, Kingston, Ontario K7L3N6 (Canada)

    2015-02-15

    Highlights: • Medaka embryos were exposed to alkyl chrysenes and benzo[a]anthracenes (BAA). • Concentrations were kept constant by partition controlled delivery. • Chrysene was not toxic within solubility limits, in contrast to BAA. • Alkylation increased the toxicity of chrysene and BAA. • Toxicity was related to hydrophobicity and to specific modes of action. - Abstract: Alkylated polycyclic aromatic hydrocarbons (alkyl-PAHs) are a class of compounds found at significant concentrations in crude oils, and likely the main constituents responsible for the chronic toxicity of oil to fish. Alkyl substituents at different locations on the aromatic rings change the size and shape of PAH molecules, which results in different interactions with tissue receptors and different severities of toxicity. The present study is the first to report the toxicity of several alkylated derivatives of chrysene and benz[a]anthracene to the embryos of Japanese medaka (Oryzias latipes) using the partition controlled delivery (PCD) method of exposure. The PCD method maintained the desired exposure concentrations by equilibrium partitioning of hydrophobic test compounds from polydimethylsiloxane (PDMS) films. Test concentrations declined by only 13% over a period of 17 days. Based on the prevalence of signs of blue sac disease (BSD), as expressed by median effective concentrations (EC50s), benz[a]anthracene (B[a]A) was more toxic than chrysene. Alkylation generally increased toxicity, except at position 2 of B[a]A. Alkyl-PAHs substituted in the middle region had a lower EC50 than those substituted at the distal region. Except for B[a]A and 7-methylbenz[a]anthracene (7-MB), estimated EC50 values were higher than their solubility limits, which resulted in limited toxicity within the range of test concentrations. The regression between log EC50s and log K{sub ow} values provided a rough estimation of structure–activity relationships for alkyl-PAHs, but K{sub ow} alone did not provide

  15. Enhanced performance of alkylated graphene reinforced polybutylene succinate nanocomposite

    Abidin, A. S. Zainal; Yusoh, K.; Jamari, S. S.; Abdullah, A. H.; Ismail, Z.

    2016-07-01

    Polybutylene succinate (PBS) was being grafted with octadecylamine-functionalized graphene oxide (GO-ODA) to produce novel PBS/GO-ODA nanocomposites by solution blending technique. Alkylated graphene oxide has superhydrophobic surface thus improved the affinity of the filler with low polar polymer such as PBS. The structure and compatibility of the filler and nanocomposites were being characterized using Fourier transform infrared spectroscopy (FTIR), Universal tensile machine (UTM) and thermogravimetric analysis (TGA). Enhancement of tensile strength and Young's modulus by 30% and 165% respectively was achieved with cooperation of 0.5% GO-ODA loading. The functionalization of GO-ODA in PBS matrix leads to the improvement in the nanocomposites properties.

  16. Fluorescent RNA labeling using self-alkylating ribozymes.

    Sharma, Ashwani K; Plant, Joshua J; Rangel, Alexandra E; Meek, Kirsten N; Anamisis, April J; Hollien, Julie; Heemstra, Jennifer M

    2014-08-15

    The ability to fluorescently label specific RNA sequences is of significant utility for both in vitro and live cell applications. Currently, most RNA labeling methods utilize RNA-nucleic acid or RNA-protein molecular recognition. However, in the search for improved RNA labeling methods, harnessing the small-molecule recognition capabilities of RNA is rapidly emerging as a promising alternative. Along these lines, we propose a novel strategy in which a ribozyme acts to promote self-alkylation with a fluorophore, providing a robust, covalent linkage between the RNA and the fluorophore. Here we describe the selection and characterization of ribozymes that promote self-labeling with fluorescein iodoacetamide (FIA). Kinetic studies reveal a second-order rate constant that is on par with those of other reactions used for biomolecular labeling. Additionally, we demonstrate that labeling is specific to the ribozyme sequences, as FIA does not react nonspecifically with RNA. PMID:24896502

  17. Breastfeeding as an Exposure Pathway for Perfluorinated Alkylates

    Mogensen, Ulla B; Grandjean, Philippe; Nielsen, Flemming; Weihe, Pal; Budtz-Jørgensen, Esben

    2015-01-01

    Perfluorinated alkylate substances (PFASs) are widely used and have resulted in human exposures worldwide. PFASs occur in breast milk, and the duration of breastfeeding is associated with serum-PFAS concentrations in children. To determine the time-dependent impact of this exposure pathway, we...... examined the serum concentrations of five major PFASs in a Faroese birth cohort at birth, and at ages 11, 18, and 60 months. Information about the children's breastfeeding history was obtained from the mothers. The trajectory of serum-PFAS concentrations during months with and without breastfeeding was...... examined by linear mixed models that accounted for the correlations of the PFAS measurements for each child. The models were adjusted for confounders such as body size. The duration of exclusive breastfeeding was associated with increases of most PFAS concentrations by up to 30% per month, with lower...

  18. Novel alkyl substituted polyanilines/molybdenum disulfide nanocomposites

    Polyaniline (PANI), poly(N-methyl aniline) (PMA), poly(ethyl aniline) (PEA) and poly(propyl aniline) (PPA) were synthesized in their salt form, and then characterized by FT-IR spectroscopy and charge transport measurements. The solubility of the polymers was tested in a variety of solvents and N-methylformamide (NMF) was found to be the best solvent. While polyaniline gave a colloidal suspension in NMF, the solubility of the polymer increased with increasing length of the alkyl group, resulting in a concomitant decrease in electrical conductivity. The solubility of the polymers was exploited and their intercalation was performed in molybdenum disulfide by using the exfoliating/restacking property of LiMoS2. Powder X-ray diffraction showed that genuine intercalation compounds were formed. The resulting nanocomposites were also characterized by thermogravimetric analysis (TGA)

  19. Monolayer structures of alkyl aldehydes: Odd-membered homologues

    Phillips, T.K. [BP Institute, Department of Chemistry, University of Cambridge, Cambridge (United Kingdom); Clarke, S.M., E-mail: stuart@bpi.cam.ac.u [BP Institute, Department of Chemistry, University of Cambridge, Cambridge (United Kingdom); Bhinde, T. [BP Institute, Department of Chemistry, University of Cambridge, Cambridge (United Kingdom); Castro, M.A.; Millan, C. [Instituto Ciencia de los Materiales de Sevilla, Departamento de Quimica Inorganica (CSIC-Universidad de Sevilla) (Spain); Medina, S. [Centro de Investigacion, Tecnologia e Innovacion de la Universidad de Sevilla (CITIUS), Sevilla (Spain)

    2011-03-01

    Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C{sub 7}, C{sub 9} and C{sub 11}) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C{sub 11} homologue is determined to have a plane group of either p2, pgb or pgg, and for the C{sub 7} homologue the p2 plane group is preferred.

  20. Branched alkyl alcohol propoxylated sulfate surfactants for improved oil recovery

    Wu, Y.; Iglauer, S.; Shuler, P.; Tang, Y. [California Institute of Technology, Covina, CA (US). Power, Environmental and Energy Research (PEER) Center; Goddard, W.A. III [California Institute of Technology, Pasadena, CA (United States). Materials and Process Simulation Center

    2010-05-15

    This investigation considers branched alkyl alcohol propoxylated sulfate surfactants as candidates for chemical enhanced oil recovery (EOR) applications. Results show that these anionic surfactants may be preferred candidates for EOR as they can be effective at creating low interfacial tension (IFT) at dilute concentrations, without requiring an alkaline agent or cosurfactant. In addition, some of the formulations exhibit a low IFT at high salinity, and hence may be suitable for use in more saline reservoirs. Adsorption tests onto kaolinite clay indicate that the loss of these surfactants can be comparable to or greater than other types of anionic surfactants. Surfactant performance was evaluated in oil recovery core flood tests. Selected formulations recovered 35-50% waterflood residual oil even with dilute 0.2 wt% surfactant concentrations from Berea sandstone cores. (orig.)

  1. [Methaemoglobinaemia induced by ingestion of alkyl nitrite, "poppers"].

    Kragsfeldt, Celina Thelberg; Nissen, Christoffer B; Brandt, Frans

    2016-08-22

    We present a case report of an 18-year-old male who was referred to the emergency department with evidence of methaemoglobinaemia. He presented with classic symptoms with peripheral cyanosis and hypoxia. Arterial blood gas showed a methaemoglobin level of 36%. This was caused by ingestion of alkyl nitrate, a widespread party drug called "poppers". When inhaled it causes euphoria, reduced pain and relaxation of the anal sphincter, but oral use may induce life-threatening methaemoglobinaemia. The treatment of choice is the antidote methylene blue. After treatment the patient regained full recovery and was discharged on the following day. We discuss classic symptoms, diagnosis and treatment of intoxication with methylene blue. PMID:27549005

  2. Separation of Scintillation and Cherenkov Lights in Linear Alkyl Benzene

    Li, Mohan; Yeh, Minfang; Wang, Zhe; Chen, Shaomin

    2015-01-01

    To separate scintillation and Cherenkov lights in water-based liquid scintillator detectors is a desired feature for future neutrino and proton decay researches. Linear alkyl benzene (LAB) is one important ingredient of a water-based liquid scintillator being developed. In this paper we observed a good separation of scintillation and Cherenkov lights in an LAB sample. The rising and decay times of the scintillation light of the LAB were measured to be $(7.7\\pm3.0)\\ \\rm{ns}$ and $(36.6\\pm2.4)\\ \\rm{ns}$, respectively, while the full width [-3$\\sigma$, 3$\\sigma$] of the Cherenkov light was 12 ns dominated by the time resolution of our photomultiplier tubes. The light yield of the scintillation was measured to be $(1.01\\pm0.12)\\times10^3\\ \\rm{photons}/\\rm{MeV}$.

  3. Alkaline earth alkyl insertion chemistry of in situ generated aminoboranes.

    Bellham, Peter; Hill, Michael S; Kociok-Köhn, Gabriele; Liptrot, David J

    2013-01-21

    Reactions of equimolar quantities of secondary amine boranes, R(2)NH·BH(3), with the homoleptic group 2 alkyl compounds [M{CH(SiMe(3))(2)}(2)(THF)(2)] (M = Mg, Ca, Sr) provide the alkyl group 2 amido borane derivatives [M{CH(SiMe(3))(2)}{NR(2)BH(3)}(THF)](2). While the strontium derivatives of reactions with dimethylamine and pyrrolidine borane are stable and isolable compounds, the analogous magnesium and calcium compounds are found to be unstable at room temperature. Studies of the thermolysis of the alkylstrontium derivatives have allowed this instability to be rationalised as a result of β-hydride elimination, the facility of which varies with changing M(2+) charge density, to form the products of M-C insertion of H(2)B=NR(2). Subsequent to this process, alkylaminoboranes, [HB(NR(2)){CH(SiMe(3))(2)}], are observed to form through a further suggested β-hydride elimination reaction. This chemistry is also extended to the reaction of the primary amine borane (t)BuNH(2)·BH(3) with [Sr{CH(SiMe(3))(2)}(2)(THF)(2)]. In this case the crystal structure of a heteroleptic species, which may be considered as a tetrameric aggregate of two [Sr{CH(SiMe(3))(2)}{(NH(t)Bu)BH(3)}(2)] anions and two cationic [Sr{(NH(t)Bu)(BH(3))}(THF)(2)] components, has been determined. Kinetic studies of the reactions of [M{CH(SiMe(3))(2)}(2)(THF)(2)] (M = Mg, Ca, Sr) with dimethylamine borane have also been undertaken and describe a complex mechanism in which the barriers to formation of the various intermediate species are a consequence of M(2+) radius and resultant charge density as well as the steric demands of the coordinated amidoborane ligands. PMID:23070304

  4. Synthesis, characterization and chemoprotective activity of polyoxovanadates against DNA alkylation.

    Nunes, Giovana G; Bonatto, Ana C; de Albuquerque, Carla G; Barison, Andersson; Ribeiro, Ronny R; Back, Davi F; Andrade, André Vitor C; de Sá, Eduardo L; Pedrosa, Fábio de O; Soares, Jaísa F; de Souza, Emanuel M

    2012-03-01

    The alkylation of pUC19 plasmid DNA has been employed as a model reaction for the first studies on chemoprotective action by a mixed-valence (+IV/+V) polyoxovanadate. A new, non-hydrothermal route for the high yield preparation of the test compound is described. The deep green, microcrystalline solid A was isolated after a three-day reaction in water at 80°C and 1 atm, while the reaction at 100°C gave green crystals of B. Both solids were structurally characterized by X-ray diffractometry and FTIR, EPR, NMR and Raman spectroscopies. Product A was identified as (NH(4))(2)V(3)O(8), while B corresponds to the spherical polyoxoanion [V(15)O(36)(Cl)](6-), isolated as the NMe(4)(+) salt. The lack of solubility of A in water and buffers prevented its use in DNA interaction studies, which were then carried out with B. Complex B was also tested for its ability to react with DNA alkylating agents by incubation with diethylsulphate (DES) and dimethylsulphate (DMS) in both the absence and presence of pUC19. For DMS, the best results were obtained with 10 mM of B (48% protection); with DES, this percentage increased to 70%. The direct reaction of B with increasing amounts of DMS in both buffered (PIPES 50 mM) and non-buffered aqueous solutions revealed the sequential formation of several vanadium(IV), vanadium(V) and mixed-valence aggregates of different nuclearities, whose relevance to the DNA-protecting activity is discussed. PMID:22265837

  5. Microfungal alkylation and volatilization of selenium adsorbed by goethite.

    Peitzsch, Mirko; Kremer, Daniel; Kersten, Michael

    2010-01-01

    Selenium adsorbed in the oxyanionic form by Fe-oxides like goethite is considered of benefit for long-term stabilization of (79)Se under near field conditions of radionuclide waste disposal sites. However, microbe-mediated volatilization of the uranium fission product (79)Se has not yet been considered for risk assessment based on the use of the water-solid distribution coefficient K(D). We have performed incubation experiments in a ternary system selenium-microbe-goethite and show that mycobiota including the common black microfungi genera Alternaria alternata are capable of volatilizing the Se even if immobilized by goethite. The microfungi were incubated in a standardized nutrient broth suspension with 10 g L(-1) of the oxide target under defined conditions. Volatile organic selenium (VOSe) species formed in the head space of the culture flasks were sampled and measured directly by a cryotrapping cryofocusing gas chromatographic system coupled with ICP-MS detection (CT-CF-GC-ICP-MS). Alkylated VOSe species were found at the tens to hundreds ng m(-3) levels dominated by dimethyl selenide (DMSe) and dimethyl diselenide (DMDSe). The total amount of DMSe released into the 80-mL headspace volume within the 21 days of incubation was up to 1.12 +/- 0.17 nmol and 0.48 +/- 0.12 nmol for systems without and with goethite amendment, respectively. Alkylation rates of up to 0.1 mumol Se per day and g biomass cannot be neglected as a potential fission product mobilization pathway, unless the inherent radioactivity is proven to prevent any such microbial activity on the long-term. Otherwise it may lead to an onsite accumulation of (79)Se through evapoconcentration in the enclosed underground caverns. PMID:20039743

  6. Ab initio valence calculations in chemistry

    Cook, D B

    1974-01-01

    Ab Initio Valence Calculations in Chemistry describes the theory and practice of ab initio valence calculations in chemistry and applies the ideas to a specific example, linear BeH2. Topics covered include the Schrödinger equation and the orbital approximation to atomic orbitals; molecular orbital and valence bond methods; practical molecular wave functions; and molecular integrals. Open shell systems, molecular symmetry, and localized descriptions of electronic structure are also discussed. This book is comprised of 13 chapters and begins by introducing the reader to the use of the Schrödinge

  7. Natural and bioremediated selective degradation of polycyclic aromatic alkyl isomers in oil-contaminated soils

    In studies where 2- to 6-ring polycyclic aromatic hydrocarbons (PAHs) are determined as part of characterizing released oil constituents in environmental samples, the changes in composition of PAHs from weathering (e.g., evaporation, dissolution) and biodegradation are most often represented by PAH alkyl homologue distributions. Concentrations of PAH alkyl groups are the sum of individual PAH isomers of similar carbon number; such as for C2-naphthalenes, the C2 alkyl group consists of dimethyl and ethyl substitutions on the parent naphthalene. In weathering and degradation studies, the changes in relative concentration of the individual isomers within an alkyl group are rarely reported. In a field study of oiled soils, the authors looked at the selective losses, for a period of a year, of individual PAH alkyl isomers that occur both naturally by weathering processes and through the use of bioremediation technology. Results showed that decreases in alkyl group concentrations were not always represented by similar losses of each isomer in the alkyl group, but were often due to the preferential or selective loss of certain isomers in the group

  8. Aag DNA glycosylase promotes alkylation-induced tissue damage mediated by Parp1.

    Jennifer A Calvo

    2013-04-01

    Full Text Available Alkylating agents comprise a major class of front-line cancer chemotherapeutic compounds, and while these agents effectively kill tumor cells, they also damage healthy tissues. Although base excision repair (BER is essential in repairing DNA alkylation damage, under certain conditions, initiation of BER can be detrimental. Here we illustrate that the alkyladenine DNA glycosylase (AAG mediates alkylation-induced tissue damage and whole-animal lethality following exposure to alkylating agents. Aag-dependent tissue damage, as observed in cerebellar granule cells, splenocytes, thymocytes, bone marrow cells, pancreatic β-cells, and retinal photoreceptor cells, was detected in wild-type mice, exacerbated in Aag transgenic mice, and completely suppressed in Aag⁻/⁻ mice. Additional genetic experiments dissected the effects of modulating both BER and Parp1 on alkylation sensitivity in mice and determined that Aag acts upstream of Parp1 in alkylation-induced tissue damage; in fact, cytotoxicity in WT and Aag transgenic mice was abrogated in the absence of Parp1. These results provide in vivo evidence that Aag-initiated BER may play a critical role in determining the side-effects of alkylating agent chemotherapies and that Parp1 plays a crucial role in Aag-mediated tissue damage.

  9. Kinetic study of the anaerobic biodegradation of alkyl polyglucosides and the influence of their structural parameters.

    Ríos, Francisco; Fernández-Arteaga, Alejandro; Lechuga, Manuela; Jurado, Encarnación; Fernández-Serrano, Mercedes

    2016-05-01

    This paper reports a study of the anaerobic biodegradation of non-ionic surfactants alkyl polyglucosides applying the method by measurement of the biogas production in digested sludge. Three alkyl polyglucosides with different length alkyl chain and degree of polymerization of the glucose units were tested. The influence of their structural parameters was evaluated, and the characteristics parameters of the anaerobic biodegradation were determined. Results show that alkyl polyglucosides, at the standard initial concentration of 100 mgC L(-1), are not completely biodegradable in anaerobic conditions because they inhibit the biogas production. The alkyl polyglucoside having the shortest alkyl chain showed the fastest biodegradability and reached the higher percentage of final mineralization. The anaerobic process was well adjusted to a pseudo first-order equation using the carbon produced as gas during the test; also, kinetics parameters and a global rate constant for all the involved metabolic process were determined. This modeling is helpful to evaluate the biodegradation or the persistence of alkyl polyglucosides under anaerobic conditions in the environment and in the wastewater treatment. PMID:26820643

  10. mTOR target NDRG1 confers MGMT-dependent resistance to alkylating chemotherapy

    Weiler, Markus; Blaes, Jonas; Pusch, Stefan; Sahm, Felix; Czabanka, Marcus; Luger, Sebastian; Bunse, Lukas; Solecki, Gergely; Eichwald, Viktoria; Jugold, Manfred; Hodecker, Sibylle; Osswald, Matthias; Meisner, Christoph; Hielscher, Thomas; Rübmann, Petra; Pfenning, Philipp-Niklas; Ronellenfitsch, Michael; Kempf, Tore; Schnölzer, Martina; Abdollahi, Amir; Lang, Florian; Bendszus, Martin; von Deimling, Andreas; Winkler, Frank; Weller, Michael; Vajkoczy, Peter; Platten, Michael; Wick, Wolfgang

    2014-01-01

    A hypoxic microenvironment induces resistance to alkylating agents by activating targets in the mammalian target of rapamycin (mTOR) pathway. The molecular mechanisms involved in this mTOR-mediated hypoxia-induced chemoresistance, however, are unclear. Here we identify the mTOR target N-myc downstream regulated gene 1 (NDRG1) as a key determinant of resistance toward alkylating chemotherapy, driven by hypoxia but also by therapeutic measures such as irradiation, corticosteroids, and chronic exposure to alkylating agents via distinct molecular routes involving hypoxia-inducible factor (HIF)-1alpha, p53, and the mTOR complex 2 (mTORC2)/serum glucocorticoid-induced protein kinase 1 (SGK1) pathway. Resistance toward alkylating chemotherapy but not radiotherapy was dependent on NDRG1 expression and activity. In posttreatment tumor tissue of patients with malignant gliomas, NDRG1 was induced and predictive of poor response to alkylating chemotherapy. On a molecular level, NDRG1 bound and stabilized methyltransferases, chiefly O6-methylguanine-DNA methyltransferase (MGMT), a key enzyme for resistance to alkylating agents in glioblastoma patients. In patients with glioblastoma, MGMT promoter methylation in tumor tissue was not more predictive for response to alkylating chemotherapy in patients who received concomitant corticosteroids. PMID:24367102

  11. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    Souto, F.J.; Haskin, F.E. [Univ. of New Mexico, Albuquerque, NM (United States). Dept. of Chemical and Nuclear Engineering; Kmetyk, L.N. [Sandia National Labs., Albuquerque, NM (United States)

    1994-10-01

    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS.

  12. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS

  13. Mechanism of the extraction of nitric acid and water by organic solutions of tertiary alkyl-amines

    The micellar aggregation of tri-alkyl-ammonium nitrates in low polarity organic solvents has been verified by viscosity, conductivity and sedimentation velocity measurements. The aggregation depends upon the polarity of solvent, the length of the alkyl radicals and the organic concentration of the various constituents (tri-alkyl-ammonium nitrate, tri-alkyl-amine, nitric acid, water). The amine salification law has been established and the excess nitric acid and water solubilities in the organic solutions have been measured. Nitric acid and water are slightly more soluble in micellar organic solutions than in molecular organic solutions. A description of excess nitric acid containing tri-alkyl-ammonium nitrate solutions is proposed. (author)

  14. Polycyclic aromatic acids are primary metabolites of alkyl-PAHs - a case study with Nereis diversicolor

    Malmquist, Linus Mattias Valdemar; Selck, Henriette; Jørgensen, Kåre Bredeli; Christensen, Jan H.

    2015-01-01

    Although concentrations of alkylated polycyclic aromatic hydrocarbons (alkyl-PAHs) in oil-contaminated sediments are higher than those of unsubstituted PAHs, only little attention has been given to metabolism and ecotoxicity of alkyl-PAHs. In this study we demonstrated that metabolism of alkyl......-PAHs primarily forms polycyclic aromatic acids (PAAs). We generalize this to other alkyl-PAHs, based on literature and the present study of the metabolism of 1-methylphenanthrene, 3,6-dimethylphenanthrene, and 1-, 2-, 3-, and 6-methylchrysene related to their unsubstituted parent PAHs. Also, we observed that...

  15. Improved age constraints for the AB Dor quadruple system - The binary nature of AB Dor B

    Janson, M; Lenzen, R; Close, L; Nielsen, E; Hartung, M; Henning, T; Bouy, H; Janson, Markus; Brandner, Wolfgang; Lenzen, Rainer; Close, Laird; Nielsen, Eric; Hartung, Markus; Henning, Thomas; Bouy, Herve

    2006-01-01

    We present resolved NACO photometry of the close binary AB Dor B in H- and Ks-band. AB Dor B is itself known to be a wide binary companion to AB Dor A, which in turn has a very low-mass close companion named AB Dor C. These four known components make up the young and dynamically interesting system AB Dor, which will likely become a benchmark system for calibrating theoretical pre-main sequence evolutionary mass tracks for low-mass stars. However, for this purpose the actual age has to be known, and this subject has been a matter of discussion in the recent scientific literature. We compare our resolved photometry of AB Dor Ba and Bb with theoretical and empirical isochrones in order to constrain the age of the system. This leads to an age estimate of about 50 to 100 Myr. We discuss the implications of such an age range for the case of AB Dor C, and compare with other results in the literature.

  16. A mild and efficient procedure for the synthesis of ethers from various alkyl halides

    Mosstafa Kazemi

    2013-10-01

    Full Text Available A simple, mild and practical procedure has been developed for the synthesis of symmetrical and unsymmetrical ethers by using DMSO, TBAI in the presence of K2CO3. We extended the utility of Potassium carbonate as an efficient base for the preparation of ethers. A wide range of alkyl aryl and dialkyl ethers are synthezied from treatment of aliphatic alcohols and phenols with various alkyl halides in the prescence of efficient base Potassium carbonate. Secondary alkyl halides were easily converted to corresponding ethers in releatively good yields . This is a mild, simple and practical procedure for the preparation of ethers in high yields and suitable times under mild condition.

  17. Molecular modeling of the inhibition mechanism of 1-(2-aminoethyl)-2-alkyl-imidazoline

    Zhang Jun [College of Physics Science and Technology, China University of Petroleum Dongying, Shandong 257061 (China)], E-mail: zhjupc@yahoo.com; Liu Jinxiang [College of Physics Science and Technology, China University of Petroleum Dongying, Shandong 257061 (China); Yu Weizhao [College of Petroleum Engineering, China University of Petroleum Qingdao, Shandong 266555 (China); Yan Youguo; You Long; Liu Linfa [College of Physics Science and Technology, China University of Petroleum Dongying, Shandong 257061 (China)

    2010-06-15

    Inhibition mechanism of five 1-(2-aminoethyl)-2-alkyl-imidazoline derivatives for carbon steel against CO2 corrosion was studied by molecular modeling. Molecular reactivity derived from quantum chemical calculation is insensitive to alkyl length. Inhibitor molecules can be adsorbed preferentially on metal surface with imidazoline ring attached on the surface. And with increase of alkyl length, interaction between inhibitor molecule and metal surface is enhanced to enable more stable adsorption of inhibitor molecules, which will form more compact self-assembly membrane with higher inhibition efficiency. The efficiency order of the inhibitors obtained by theoretical analysis was verified by experimental results.

  18. Liposomes containing alkylated methotrexate analogues for phospholipase A(2) mediated tumor targeted drug delivery

    Kaasgaard, Thomas; Andresen, Thomas Lars; Jensen, Simon Skøde;

    2009-01-01

    alpha-carboxylic acid. The cytotoxicity of the gamma-alkylated compound towards KATO III (IC50 = 55 nM) and HT-29 (IC50 = 400 nM) cell lines, Was unaffected by the alkylation, whereas the additional benzyl group on the alpha-carboxyl group made the Compound nontoxic. The gamma-derivative with promising......Two lipophilic methotrexate analogues have been synthesized and evaluated for cytotoxicity against KATO III and HT-29 human colon cancer cells. Both analogues contained a C-16-alkyl chain attached to the gamma-carboxylic acid and one of the analogues had an additional benzyl group attached to the...

  19. Quantitative Structure-Activity Relationships in the Lithium and Sodium Affinities of n-Alkyl Fluorides

    2002-01-01

    B3LYP/6-31+g (d, p) method was used to calculate the lithium and sodium affinities of n-alkyl fluoride. These affinities were found to obey the Holmes relationship, i.e. they correlate linearly with the quotient n/(n+1), where n is the number of carbon atoms in the alkyl chain. From the correlation the limiting values of lithium and sodium affinities for very long alkyl chain were predicted to be -153.3 kJ/mol and -108.4 kJ/mol, respectively.

  20. Synthesis, antibacterial and antioxidant activities of new 1-alkyl-4-(1-alkyl-4-oxo-1,4-dihydroquinolin-2-yl)pyridinium bromides.

    Kahriman, Nuran; Yaylı, Büşra; Aktaş, Ayça; Iskefiyeli, Zeynep; Beriş, Fatih Şaban; Yaylı, Nurettin

    2013-11-01

    New 1-alkyl-4-(1-alkyl-4-oxo-1,4-dihydroquinolin-2-yl)pyridinium bromides (3a-k) were synthesized from 1,4'-diazaflavone [2-pyridin-4-ylquinolin-4(1H)-one] and evaluated for antibacterial and antioxidant activities. A rapid one-pot preparation of 1,4'-diazaflavone (2) was done from 2'-amino substituted chalcone (1) by intramolecular Michael addition using solvent-free microwave heating. New N,N'-dialkyl substituted (C₅-C₁₅) 1,4'-diazaflavonium bromides were synthesized from compound 2 with corresponding alkyl halides. Compounds 3a-k were active against six bacteria (MIC: 7.8-500.0 μg/mL). They also showed good antioxidant activities in DPPH scavenging (SC₅₀: 45-133 μg/mL) and ferric reducing/antioxidant power (14-141 μM TEAC) tests. The biological activities decreased as alkyl chain length increased. The reason behind the obvious negative effect of alkyl chain elongation is unclear and requires investigations about the intermolecular interactions of these pyridinium salts with bioassay components. PMID:24077525

  1. Ultrasonic Relaxation Study of 1-Alkyl-3-methylimidazolium-Based Room-Temperature Ionic Liquids: Probing the Role of Alkyl Chain Length in the Cation.

    Zorębski, Michał; Zorębski, Edward; Dzida, Marzena; Skowronek, Justyna; Jężak, Sylwia; Goodrich, Peter; Jacquemin, Johan

    2016-04-14

    Ultrasound absorption spectra of four 1-alkyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imides were determined as a function of the alkyl chain length on the cation from 1-propyl to 1-hexyl from 293.15 to 323.15 K at ambient pressure. Herein, the ultrasound absorption measurements were carried out using a standard pulse technique within a frequency range from 10 to 300 MHz. Additionally, the speed of sound, density, and viscosity have been measured. The presence of strong dissipative processes during the ultrasound wave propagation was found experimentally, i.e., relaxation processes in the megahertz range were observed for all compounds over the whole temperature range. The relaxation spectra (both relaxation amplitude and relaxation frequency) were shown to be dependent on the alkyl side chain length of the 1-alkyl-3-methylimidazolium ring. In most cases, a single-Debye model described the absorption spectra very well. However, a comparison of the determined spectra with the spectra of a few other imidazolium-based ionic liquids reported in the literature (in part recalculated in this work) shows that the complexity of the spectra increases rapidly with the elongation of the alkyl chain length on the cation. This complexity indicates that both the volume viscosity and the shear viscosity are involved in relaxation processes even in relatively low frequency ranges. As a consequence, the sound velocity dispersion is present at relatively low megahertz frequencies. PMID:26982480

  2. Current approaches to improve the anticancer chemotherapy with alkylating agents: state of the problem in world and Ukraine.

    Iatsyshyna A. P.

    2012-01-01

    Full Text Available Alkylating agents are frequently used in many established anticancer chemotherapies. They alkylate the genomic DNA at various sites. Alkylation of the guanine at the O6-position is cytotoxic, it has the strongest mutagenic potential, as well as can cause the tumor development. Alkyl groups at the O6-position of guanine are removed by the DNA repair enzyme O6-methylguanine-DNA methyltransferase (MGMT. The effectiveness of alkylating chemotherapy is limited by MGMT in cancer cells and adverse toxic side effects in normal cells. Different approaches consisting in the modulation of the MGMT expression and activity are under development now to improve the cancer chemotherapy. They include two main directions, in particular, the increase in chemosensitivity of cancer cells to alkylating drugs and the protection of normal cells from the toxic side effects of chemotherapy. This review is focused on current attempts to improve the alkylating chemotherapy of malignant tumours worldwide and state of the issue in Ukraine

  3. Ab interno trabeculectomy: A comprehensive review

    Ting Ting Liu

    2013-07-01

    Full Text Available PURPOSE To summarize the original literature on ab interno trabeculectomy with the Trabectome system and to review its efficacy and safety in the treatment of glaucoma. METHOD A literature search in PubMed was performed on ab interno trabeculectomy with the Trabectome system, and clinical relevant information was reviewed and summarized. RESULTS Ab interno trabeculectomy with the Trabectome system on average lowered intraocular pressure (IOP to the mid-teens, and decreased the number of required glaucoma medications. Greater preoperative IOP correlated to a greater percent reduction in IOP. The success rates varied among studies, and the definition of success differed by authors. Intraoperative blood reflux was found in nearly all cases. Incidences of early hypotony and IOP spikes were low. No cases of endophthalmitis, wound leak, aqueous misdirection, choroidal hemorrhage or effusions, and irreversible visual acuity decrease (≥2 Snellen lines have been reported. Available studies had a significant amount of data overlap. Only limited data on long-term results was available. There was no randomized controlled trial to date. CONCLUSIONS Ab interno trabeculectomy with the Trabectome system is an effective and safe surgical approach for patients with various types of open angle glaucoma. On average, the procedure at least in the short term lowers IOP to the mid teens regardless of preoperative IOP with or without the aid of topical medications.

  4. Reference: DREDR1ATRD29AB [PLACE

    Full Text Available DREDR1ATRD29AB Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, N... ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant J. 34: 137-148 (2003) PubMed: 12694590; ...

  5. Preparation of national standard product of Anti-TgAb and Anti-TpoAb in our laboratory

    Objective: To standardize the China-made quantitative immunoassay kits of Anti-TgAb and Anti-TpoAb with a national standdized product of Anti-TgAb and And-TpoAb developed in our laboratory. Methods and Results: Higher titer Anti - TgAb and Anti-TpoAb serum specimens were pooled and treated with centrifuging and filtering, then freeze-dried and packaged into 2ml anpoules for preparing the national standard candidate. The results of the collaborative study showed that, the immuno-activity of the Anti-TgAb was 3916 IU/Amp in term of the 65/093, and the immuno-activity of the Anti-TpoAb was 434 IU/Amp in term of the 66/387. Conclusion: On the basis of the present study, it is proposed that the candidate standard be established as the National Standard for Anti-TgAb and Anti-TpoAb for immunoassay, the immunoactivity of the Anti-TgAb 4000IU/Amp, and that of Anti - TpoAb is 430IU/Amp. A comparative study on the quality of immunoassay kits of Anti-TgAb and Anti-TpoAb by Axsym System, Immulite 1000, Modular Analytics El70, ADVIA Centaur Assay (the most commonly used types in China) is also presented. (authors)

  6. On the Strain Rate Sensitivity of Abs and Abs Plus Fused Deposition Modeling Parts

    Vairis, A.; Petousis, M.; Vidakis, N.; Savvakis, K.

    2016-06-01

    In this work the effect of strain rate on the tensile strength of fused deposition modeling parts built with Acrylonitrile-butadiene-styrene (ABS) and ABS plus material is presented. ASTM D638-02a specimens were built with ABS and ABS plus and they were tested on a Schenck Trebel Co. tensile test machine at three different test speeds, equal, lower, and higher to the test speed required by the ASTM D638-02a standard. The experimental tensile strength results were compared and evaluated. The fracture surfaces of selected specimens were examined with a scanning electron microscope, to determine failure mode of the filament strands. It was found that, as the test speed increases, specimens develop higher tensile strength and have higher elastic modulus. Specimens tested in the highest speed of the experiment had on average about 10% higher elastic modulus and developed on average about 11% higher tensile strength.

  7. KINETIC ANALYSIS OF CO-CONDENSATION POLYMERIZATION OF AB2 AND AB MONOMERS

    Min-qiang Yu; Zhi-ping Zhou; De-yue Yan

    2004-01-01

    This work deals with the kinetics of co-condensation polymerization of AB2 and AB monomers, giving expressions of the two-dimensional molecular weight distribution function and the number/weight average molecular weights of the resulting copolymers. The two-dimensional molecular weight distribution depends on two indices, n and l, which are the respective numbers of AB2 and AB units in a copolymer species. The evolution of the two-dimensional weight and z distributions during the co-condensation polymerization has been evaluated systematically. Finally, the two-dimensional distribution was transformed into a one-dimensional molecular weight distribution with only one variable (the molecular weight of the products instead of the degree of polymerization). The calculated results show that the highly branched copolymer has a very broad molecular weight distribution when the co-condensation polymerization approaches completion.

  8. Leaching behaviour of the Swedish KBS-glasses ABS 39 and ABS 41

    The planned Swedish KBS glass corrosion investigation program comprises experiments with inactive glasses containing simulated waste, prolonged in-situ tests, the characterization of corrosion products, immiscibility studies, and corrosion experiments with hot glass. This presentation gives a short description of the entire program. It focuses thereafter on some recent leaching results with the inactive KBS glass qualities ABS 39 and ABS 41, which were leached in a manner similar to the PNL MCC-1 test procedure. 5 figures, 9 tables

  9. Thermomechanical properties of ABS/PA AND ABS/PC blends

    GUINAULT, Alain; Sollogoub, Cyrille

    2009-01-01

    International audience The significant increase of Waste Electric and Electronic Equipment (WEEE) has led to an important research in upgrading recycled engineering plastics by means of a blending technique. Classical twin-screw extrusion is compared to a new blending technique, where two polymers are combined together and then flow in several static mixers. This technique allows to obtain different morphologies of compatibilized ABS/PA or ABS/PC blends and the aim of this work is to evalu...

  10. AB077. Relationship of TPO-Ab and TSH with in vitro fertilization and embryo transfer

    Wang, Liyun

    2015-01-01

    Objective Study of thyroid peroxidase antibodies and thyroid stimulating effect on in vitro fertilization embryo transfer ending. Methods From March 2011 to October 2013 in the reproductive center in Qinghai Province People’s Hospital in vitro fertilization embryo transfer a total of 378 cycles were analyzed. (I) Basis for TPO-Ab grouping: research group is thyroid peroxidase antibody positive and thyroid function in patients with normal 69 cycles (TPO-Ab+ group), control group is thyroid per...

  11. Photochemical alkylation of inorganic selenium in the presence of low molecular weight organic acids.

    Guo, Xuming; Sturgeon, Ralph E; Mester, Zoltán; Gardner, Graeme J

    2003-12-15

    Using a flow-through photochemical reactor and a low pressure mercury lamp as a UV source, alkyl selenium species are formed from inorganic selenium(IV) in the presence of low molecular weight organic acids (LMW acids). The volatile alkyl Se species were cryogenically trapped and identified by GC-MS and GC-ICP-MS. In the presence of formic, acetic, propionic and malonic acids, inorganic selenium(IV) is converted by UV irradiation to volatile selenium hydride and carbonyl, dimethylselenide and diethylselenide, respectively. Se(IV) was successfully removed from contaminated agricultural drainage waters (California, U.S.A.) using a batch photoreactor system Se. Photochemical alkylation may thus offer a promising means of converting toxic selenium salts, present in contaminated water, to less toxic dimethylselenide. The LMW acids and photochemical alkylation process may also be key to understanding the source of atmospheric selenium and are likely involved in its mobility in the natural anaerobic environment. PMID:14717175

  12. Vibrational Spectroscopic Study of Imidazolium Dicationic Ionic Liquids: Effect of Cation Alkyl Chain Length

    Moumene, T.; Belarbi, E. H.; Haddad, B.; Villemin, D.; Abbas, O.; Khelifa, B.; Bresson, S.

    2016-05-01

    Two new dicationic ionic liquids were synthesized: bis-methyl imidazolium methylidene hexafluorophosphate [M(CH2)IM2 +][2PF 6 - ] and bis-methyl imidazolium propylidene hexafluorophosphate [M(CH2)3IM2 +][2PF 6 - ]. Their structures were identified by H, C, P, F NMR, FTIR/ATR, and FT-Raman spectroscopies in order to study the effect of cation alkyl chain length on vibration behaviors. Several changes were recorded, which were related to alkyl chain length. A frequency shift was observed in some modes while others remained insensitive. A greater number of peaks was found in the FTIR/ATR spectra and the FT-Raman spectra with increasing alkyl chain length, which indicated that chain length influences the N-C connection twisting. More peaks with strong intensity appeared for longer alkyl chain lengths.

  13. Efficient, intermolecular, oxidative radical alkylation of heteroaromatic systems under "tin-free" conditions.

    Osornio, Yazmin M; Cruz-Almanza, Raymundo; Jiménez-Montaño, Vicente; Miranda, Luis D

    2003-09-21

    Novel and efficient radical alkylation of several heterocyclic systems including pyrroles, indoles, furan and thiophenes is described using xanthate based radical chemistry. The present methodology could be used to provide rapid access to various nonsteroidal antiinflammatory drugs. PMID:14518892

  14. 40 CFR 721.10126 - Alkyl amino substituted triazine amino substituted benezenesulfonic acid reaction product with...

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Alkyl amino substituted triazine amino... substituted triazine amino substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo... substituted triazine amino substituted benezenesulfonic acid reaction product with naphthalenesulfonato...

  15. Alkyl nitrate distributions and seasonal variation over the Pacific Ocean during HIPPO

    Atlas, E. L.; Smith, K.; Zhu, X.; Pope, L.; Lueb, R.; Hendershot, R.; Moore, F. L.; Miller, B. R.; Montzka, S. A.; Elkins, J. W.; Wofsy, S. C.

    2012-12-01

    Alkyl nitrates are produced in both the atmosphere and in the ocean by photochemical oxidation of organic precursors. Past studies have shown that low molecular weight alkyl nitrates, particularly methyl and ethyl nitrate, have high production rates and air-sea fluxes from equatorial ocean waters. In addition, high concentrations of these organic nitrates have been found in the atmosphere of the Southern Ocean. Measurements during the HIPPO campaign were able to characterize the tropospheric distribution of these alkyl nitrates over all seasons, and from virtually pole to pole over the Central Pacific Ocean. The measurements from HIPPO confirm the strong equatorial source and in addition show a strong asymmetry in methyl nitrate concentrations between hemispheres, with the Southern Hemisphere having consistently higher concentrations compared to the Northern Hemisphere. This presentation will discuss the alkyl nitrate distributions, sources, and variations observed during the HIPPO campaign and examine relationships to other trace gases of oceanic origin, such as DMS and methyl iodide.

  16. MULTISPECTRAL IDENTIFICATION OF ALKYL AND CHLOROALKYL PHOSPHATES FROM AN INDUSTRIAL EFFLUENT

    Multispectral techniques (gas chromatography combined with low and high resolution electron-impact mass spectrometry, low and high resolution chemical ionization mass spectrometry, and Fourier transform infrared mass spectroscopy) were used to identify 13 alkyl and chloralkyl pho...

  17. Characterization of two alkyl hydroperoxide reductase C homologs alkyl hydroperoxide reductase C_H1 and alkyl hydroperoxide reductase C_H2 in Bacillus subtilis

    Mee-Kyung; Cha; Yoo-Jeen; Bae; Kyu-Jeong; Kim; Byung-Joon; Park; Il-Han; Kim

    2015-01-01

    AIM: To identify alkyl hydroperoxide reductase subunit C(AhpC) homologs in Bacillus subtilis(B. subtilis) and to characterize their structural and biochemical properties. AhpC is responsible for the detoxification of reactive oxygen species in bacteria.METHODS: Two AhpC homologs(AhpC_H1 and AhpC_H2) were identified by searching the B. subtilis database; these were then cloned and expressed in Escherichia coli. AhpC mutants carrying substitutions of catalytically important Cys residues(C37S, C47 S, C166 S, C37/47 S, C37/166 S, C47/166 S, and C37/47/166 S for AhpC_H1; C52 S, C169 S, and C52/169 S for AhpC_H2) were obtained by site-directed mutagenesis and purified, and their structure-function relationship was analyzed. The B. subtilis ahp C genes were disrupted by the short flanking homology method, and the phenotypes of the resulting AhpC-deficient bacteria were examined.RESULTS: Comparative characterization of AhpC homologs indicates that AhpC_H1 contains an extra C37, which forms a disulfide bond with the peroxidatic C47, and behaves like an atypical 2-Cys AhpC, while AhpC_H2 functions like a typical 2-Cys AhpC. Tryptic digestion analysis demonstrated the presence of intramolecular Cys37-Cys47 linkage, which could be reduced by thioredoxin, resulting in the association of the dimer into higher-molecular-mass complexes. Peroxidase activity analysis of Cys→Ser mutants indicated that three Cys residues were involved in the catalysis. AhpC_H1 was resistant to inactivation by peroxide substrates, but had lower activity at physiological H2O2 concentrations compared to AhpC_H2, suggesting that in B. subtilis, the enzymes may be physiologically functional at different substrate concentrations. The exposure to organic peroxides induced AhpC_H1 expression, while AhpC_H1-deficient mutants exhibited growth retardation in the stationary phase, suggesting the role of AhpC_H1 as an antioxidant scavenger of lipid hydroperoxides and a stress-response factor in B. subtilis

  18. Synthesis of N-Alkyl-2-thiomethyl Benzimidazoles: A Green Approach

    S. Srinivas Rao; Ch. Venkata Ramana Reddy; Dubey, P.K.

    2014-01-01

    A green approach for the synthesis of N-alkyl-2-thiomethyl benzimidazoles 2 (R=CH3, C2H5, CH2Ph) under different conditions has been developed from N-alkyl-2-chloromethyl benzimidazole (i.e., CH3, C2H5, CH2Ph) 1 by reaction with thiourea by physical grinding, or by using green solvents like ethanol and PEG-600, or by using microwave irradiation technique.

  19. Risk factors for oral mucositis in paediatric oncology patients receiving alkylant chemotherapy

    Fadda, Giulia; Campus, Guglielmo; Lugliè, PierFranca

    2006-01-01

    Background We describe the risk indicators for oral mucositis (OM) in paediatric oncology patients hospitalised in the Institut Gustave Roussy (Villejuif-Paris) and treated with alkylant chemotherapy with autologous peripheral blood progenitor cells. Methods The sample was selected using PIGAS software. Three groups of subjects received different chemotherapy regimens: A. Melphalan, B. Busulfan and C. other alkylant protocols. The degree of mucositis was recorded by CTC version 2.0 (Common To...

  20. Risk factors for oral mucositis in paediatric oncology patients receiving alkylant chemotherapy

    Campus Guglielmo; Fadda Giulia; Lugliè PierFranca

    2006-01-01

    Abstract Background We describe the risk indicators for oral mucositis (OM) in paediatric oncology patients hospitalised in the Institut Gustave Roussy (Villejuif-Paris) and treated with alkylant chemotherapy with autologous peripheral blood progenitor cells. Methods The sample was selected using PIGAS software. Three groups of subjects received different chemotherapy regimens: A. Melphalan, B. Busulfan and C. other alkylant protocols. The degree of mucositis was recorded by CTC version 2.0 (...

  1. Risk factors for oral mucositis in paediatric oncology patients receiving alkylant chemotherapy

    Fadda, Giulia; Campus, Guglielmo Giuseppe; Lugliè, Pietrina Francesca

    2006-01-01

    Background: We describe the risk indicators for oral mucositis (OM) in paediatric oncology patients hospitalised in the Institut Gustave Roussy (Villejuif-Paris) and treated with alkylant chemotherapy with autologous peripheral blood progenitor cells. Methods: The sample was selected using PIGAS software. Three groups of subjects received different chemotherapy regimens: A. Melphalan, B. Busulfan and C. other alkylant protocols. The degree of mucositis was recorded by CTC versi...

  2. Alkylation and Carbamylation Effects of Lomustine and Its Major Metabolites and MGMT Expression in Canine Cells

    Thushara Chakkath; Sidonie Lavergne; Fan, Timothy M.; David Bunick; Levent Dirikolu

    2015-01-01

    DNA Alkylation is thought to be the reason for the efficacy of lomustine while carbamylation has been implicated as the cause for the side effects seen with lomustine treatment such as hepatotoxicity. In the alkylation study we show that lomustine and its metabolites form similar levels of the DNA adducts N7 hydroxyethylguanine and O6 hydroxyethyldeoxyguanosine. In terms of carbamylation, lomustine showed greater extent of carbamylation in the canine hepatocytes and lymphoma cell lines. The ...

  3. Alkyl Caffeates Improve the Antioxidant Activity, Antitumor Property and Oxidation Stability of Edible Oil

    Wang, Jun; Gu, Shuang-Shuang; Pang, Na; Wang, Fang-Qin; Pang, Fei; Cui, Hong-Sheng; Wu, Xiang-Yang; Wu, Fu-An

    2014-01-01

    Caffeic acid (CA) is distributed widely in nature and possesses strong antioxidant activity. However, CA has lower solubility in non-polar media, which limits its application in fat-soluble food. To increase the lipophilicity of natural antioxidant CA, a series of alkyl caffeates were synthesized and their antioxidant and antitumor activities were investigated. The antioxidant parameters, including the induction period, acid value and unsaturated fatty acid content, of the alkyl caffeates in ...

  4. Dependence of micelle size and shape on detergent alkyl chain length and head group.

    Ryan C Oliver

    Full Text Available Micelle-forming detergents provide an amphipathic environment that can mimic lipid bilayers and are important tools for solubilizing membrane proteins for functional and structural investigations in vitro. However, the formation of a soluble protein-detergent complex (PDC currently relies on empirical screening of detergents, and a stable and functional PDC is often not obtained. To provide a foundation for systematic comparisons between the properties of the detergent micelle and the resulting PDC, a comprehensive set of detergents commonly used for membrane protein studies are systematically investigated. Using small-angle X-ray scattering (SAXS, micelle shapes and sizes are determined for phosphocholines with 10, 12, and 14 alkyl carbons, glucosides with 8, 9, and 10 alkyl carbons, maltosides with 8, 10, and 12 alkyl carbons, and lysophosphatidyl glycerols with 14 and 16 alkyl carbons. The SAXS profiles are well described by two-component ellipsoid models, with an electron rich outer shell corresponding to the detergent head groups and a less electron dense hydrophobic core composed of the alkyl chains. The minor axis of the elliptical micelle core from these models is constrained by the length of the alkyl chain, and increases by 1.2-1.5 Å per carbon addition to the alkyl chain. The major elliptical axis also increases with chain length; however, the ellipticity remains approximately constant for each detergent series. In addition, the aggregation number of these detergents increases by ∼16 monomers per micelle for each alkyl carbon added. The data provide a comprehensive view of the determinants of micelle shape and size and provide a baseline for correlating micelle properties with protein-detergent interactions.

  5. Extraction of scandium ions by 1-alkyl-3-methyl-2-pyrazoline-5-ones from perchlorate solutions

    Extraction of acid and interphase distribution of 1-alkyl-3-methyl-2-pyrazoline-5-ones in the system water-chloroform-perchloric acid are studied. Reagents capable to extract scandium cations from subacid solutions in the presence of perchlorate ions. 1-Alkyl-3-methyl-2-pyrazoline-5-ones stratifies aqueous solutions of perchloric acid into two liquid phase. Scandium ions are concentrated in the lower phase having small volume

  6. A New Family of Ionic Liquids 1-amino-3-alkyl-1,2,3-Triazolium Nitrates

    Drake, Greg; Kaplan, Greg; Hall, Leslie; Hawkins, Tommy; Larue, Joann

    2004-01-01

    A new class of ionic liquids based upon 1-amino-3-alkyl-1,2,3-triazolium nitrates (alkyl = methyl, ethyl, n-propyl, 2-propeny1, and n-butyl) have been synthesized and characterized by vibrational spectra, multinuclear NMR, elemental analysis, and DSC studies. A single crystal x-ray study was carried out for 1-amino-3-methyl-1,2,3-triazolium nitrate and the details will be presented.

  7. 2-Alkyl-4-aryl-pyrimidine fused heterocycles as selective 5-HT2A antagonists.

    Shireman, Brock T; Dvorak, Curt A; Rudolph, Dale A; Bonaventure, Pascal; Nepomuceno, Diane; Dvorak, Lisa; Miller, Kirsten L; Lovenberg, Timothy W; Carruthers, Nicholas I

    2008-03-15

    The synthesis and SAR for a novel series of 2-alkyl-4-aryl-tetrahydro-pyrido-pyrimidines and 2-alkyl-4-aryl-tetrahydro-pyrimido-azepines is described. Representative compounds were shown to be subtype selective 5-HT(2A) antagonists. Optimal placement of a basic nitrogen relative to the pyrimidine and the presence of a 4-fluorophenyl group in the pyrimidine 4-position was found to have a profound effect on affinity and selectivity. PMID:18282705

  8. mTOR target NDRG1 confers MGMT-dependent resistance to alkylating chemotherapy

    Weiler, M.; Blaes, J; Pusch, S.; Sahm, F; Czabanka, M; Luger, S; Bunse, L; Solecki, G; Eichwald, V; Jugold, M; Hodecker, S; Osswald, M; Meisner, C; Hielscher, T; Rübmann, P

    2014-01-01

    A hypoxic microenvironment induces resistance to alkylating agents by activating targets in the mammalian target of rapamycin (mTOR) pathway. The molecular mechanisms involved in this mTOR-mediated hypoxia-induced chemoresistance, however, are unclear. Here we identify the mTOR target N-myc downstream regulated gene 1 (NDRG1) as a key determinant of resistance toward alkylating chemotherapy, driven by hypoxia but also by therapeutic measures such as irradiation, corticosteroids, and chronic e...

  9. Multifunctional poly(alkyl methacrylate) films for dental care

    Nielsen, Birthe V; Nevell, Thomas G; Barbu, Eugen; Smith, James R; Tsibouklis, John [School of Pharmacy and Biomedical Sciences, University of Portsmouth, Portsmouth, Hampshire, PO1 2DT (United Kingdom); Rees, Gareth D [GlaxoSmithKline R and D, St George' s Avenue, Weybridge, Surrey, KT13 0DE (United Kingdom)

    2011-02-15

    Towards the evaluation of non-permanent dental coatings for their capacity to impart dental-care benefits, thin films of a homologous series of comb-like poly(alkyl methacrylate)s (ethyl to octadecyl) have been deposited, from aqueous latex formulations, onto dentally relevant substrates. AFM studies have shown that the thickness (40-300 nm) and surface roughness (8-12 nm) of coherent polymer films are influenced by the degree of polymerization and by the length of the pendant chain. Of the polymers under consideration, poly(butyl methacrylate) formed a close-packed film that conferred to dental substrates a high degree of inhibition to acid-mediated erosion (about 27%), as evaluated by released-phosphate determinations. The potential utility of the coatings to act as anti-sensitivity barriers has been evaluated by determining the hydraulic conductance of coated bovine-dentine substrates; single treatments of dentine discs with poly(butyl methacrylate) or with poly(ethyl methacrylate) effected mean respective reductions in fluid flow of about 23% with respect to water-treated controls; repeated applications of the poly(butyl methacrylate) latex led to mean reductions in fluid flow of about 80%. Chromometric measurements have shown that pellicle-coated hydroxyapatite discs treated with poly(butyl methacrylate), poly(hexyl methacrylate) or poly(lauryl methacrylate) exhibit significant resistance to staining by food chromogens.

  10. Superhydrophobic terpolymer nanofibers containing perfluoroethyl alkyl methacrylate by electrospinning

    Cengiz, Ugur, E-mail: ucengiz@gyte.edu.tr [Department of Chemical Engineering, Gebze Institute of Technology, Cayirova, 41400 Kocaeli (Turkey); Avci, Merih Z. [Polymer Science and Technology, Deparment of Chemistry, Istanbul Technical University, Maslak 34469, Istanbul (Turkey); Erbil, H. Yildirim [Department of Chemical Engineering, Gebze Institute of Technology, Cayirova, 41400 Kocaeli (Turkey); Sarac, A. Sezai [Polymer Science and Technology, Deparment of Chemistry, Istanbul Technical University, Maslak 34469, Istanbul (Turkey)

    2012-05-15

    A new statistical terpolymer containing perfluoroethyl alkyl methacrylate (Zonyl-TM), methyl methacrylate and butyl acrylate, poly(Zonyl-TM-ran-MMA-ran-BA) was synthesized in supercritical carbon dioxide at 200 bar and 80 Degree-Sign C using AIBN as an initiator by heterogeneous free radical copolymerization. Nanofibers of this terpolymer were produced by electrospinning from its DMF solution. The structural and thermal properties of terpolymers and electrospun poly(Zonyl-TM-MMA-BA) nanofibers were analyzed using Fourier transform infrared spectroscopy, nuclear magnetic resonance spectroscopy and differential scanning calorimetry. Nanofiber morphology was investigated by scanning electron microscopy. Electrospun nanofiber layer was found to be superhydrophobic with a water contact angle of 172 {+-} 1 Degree-Sign and highly oleophobic with hexadecane, glycerol and ethylene glycol contact angles of 70 {+-} 1 Degree-Sign , 167 {+-} 1 Degree-Sign and 163 {+-} 1 Degree-Sign respectively. The change of the contact angle results on the electrospun fiber layer and flat terpolymer surfaces by varying feed monomer composition were compared and discussed in the text.

  11. Modeling of alkyl quaternary ammonium cations intercalated into montmorillonite lattice

    Highlights: ► The modification of montmorillonites by three surfactants increases the basal spacing. ► The model proposed show a bilayer conformation for the surfactant ODTMA. ► The DODMA and TOMA surfactants adopt a paraffin type arrangement. ► Behavior of surfactants in interlayer space was confirmed by TGA and ATR analysis. - Abstract: The objective of this work was to study the conformation of the quaternary ammonium cations viz., octadecyl trimethyl ammonium (ODTMA), dioctadecyl dimethyl ammonium (DMDOA) and trioctadecyl methyl ammonium (TOMA) intercalated within montmorillonite. The modified montmorillonite was characterized by X-ray diffraction in small angle (SAXS), thermal analysis (TGA) and infrared spectroscopy of attenuated total reflection (ATR). The modification of organophilic montmorillonites by the three surfactants ODTMA, DMDOA and TOMA increases the basal spacing from their respective intercalated distances of 1.9 nm, 2.6 nm and 3.4 nm respectively. The increase in the spacing due to the basic organic modification was confirmed by the results of thermal analysis (TGA) and infrared spectroscopy (ATR), and also supported by theoretical calculations of longitudinal and transversal chain sizes of these alkyl quaternary ammonium cations

  12. Superhydrophobic terpolymer nanofibers containing perfluoroethyl alkyl methacrylate by electrospinning

    A new statistical terpolymer containing perfluoroethyl alkyl methacrylate (Zonyl-TM), methyl methacrylate and butyl acrylate, poly(Zonyl-TM-ran-MMA-ran-BA) was synthesized in supercritical carbon dioxide at 200 bar and 80 °C using AIBN as an initiator by heterogeneous free radical copolymerization. Nanofibers of this terpolymer were produced by electrospinning from its DMF solution. The structural and thermal properties of terpolymers and electrospun poly(Zonyl-TM-MMA-BA) nanofibers were analyzed using Fourier transform infrared spectroscopy, nuclear magnetic resonance spectroscopy and differential scanning calorimetry. Nanofiber morphology was investigated by scanning electron microscopy. Electrospun nanofiber layer was found to be superhydrophobic with a water contact angle of 172 ± 1° and highly oleophobic with hexadecane, glycerol and ethylene glycol contact angles of 70 ± 1°, 167 ± 1° and 163 ± 1° respectively. The change of the contact angle results on the electrospun fiber layer and flat terpolymer surfaces by varying feed monomer composition were compared and discussed in the text.

  13. Alkyl hydroperoxide reductase: a candidate Helicobacter pylori vaccine.

    O'Riordan, Avril A; Morales, Veronica Athie; Mulligan, Linda; Faheem, Nazia; Windle, Henry J; Kelleher, Dermot P

    2012-06-01

    Helicobacter pylori (H. pylori) is the most important etiological agent of chronic active gastritis, peptic ulcer disease and gastric cancer. The aim of this study was to evaluate the efficacy of alkyl hydroperoxide reductase (AhpC) and mannosylated AhpC (mAhpC) as candidate vaccines in the C57BL/6J mouse model of H. pylori infection. Recombinant AhpC was cloned, over-expressed and purified in an unmodified form and was also engineered to incorporate N and C-terminal mannose residues when expressed in the yeast Pichia pastoris. Mice were immunized systemically and mucosally with AhpC and systemically with mAhpC prior to challenge with H. pylori. Serum IgG responses to AhpC were determined and quantitative culture was used to determine the efficacy of vaccination strategies. Systemic prophylactic immunization with AhpC/alum and mAhpC/alum conferred protection against infection in 55% and 77.3% of mice, respectively. Mucosal immunization with AhpC/cholera toxin did not protect against infection and elicited low levels of serum IgG in comparison with systemic immunization. These data support the use of AhpC as a potential vaccine candidate against H. pylori infection. PMID:22512976

  14. Effects of alkyl polyglycoside (APG) on composting of agricultural wastes

    Composting is the biological degradation and transformation of organic materials under controlled conditions to promote aerobic decomposition. To find effective ways to accelerate composting and improve compost quality, numerous methods including additive addition, inoculation of microorganisms, and the use of biosurfactants have been explored. Studies have shown that biosurfactant addition provides more favorable conditions for microorganism growth, thereby accelerating the composting process. However, biosurfactants have limited applications because they are expensive and their use in composting and microbial fertilizers is prohibited. Meanwhile, alkyl polyglycoside (APG) is considered a 'green' surfactant. This study aims to determine whether APG addition into a compost reaction vessel during 28-day composting can enhance the organic matter degradation and composting process of dairy manure. Samples were periodically taken from different reactor depths at 0, 3, 5, 7, 14, 21, and 28 days. pH levels, electrical conductivity (EC), ammonium and nitrate nitrogen, seed germination indices, and microbial population were determined. Organic matter and total nitrogen were also measured. Compared with the untreated control, the sample with APG exhibited slightly increased microbial populations, such as bacteria, fungi, and actinomycetes. APG addition increased temperatures without substantially affecting compost pH and EC throughout the process. After 28 days, APG addition increased nitrate nitrogen concentrations, promoted matter degradation, and increased seed germination indices. The results of this study suggest that the addition of APG provides more favorable conditions for microorganism growth, slightly enhancing organic matter decomposition and accelerating the composting process, improving the compost quality to a certain extent.

  15. Breastfeeding as an Exposure Pathway for Perfluorinated Alkylates.

    Mogensen, Ulla B; Grandjean, Philippe; Nielsen, Flemming; Weihe, Pal; Budtz-Jørgensen, Esben

    2015-09-01

    Perfluorinated alkylate substances (PFASs) are widely used and have resulted in human exposures worldwide. PFASs occur in breast milk, and the duration of breastfeeding is associated with serum-PFAS concentrations in children. To determine the time-dependent impact of this exposure pathway, we examined the serum concentrations of five major PFASs in a Faroese birth cohort at birth, and at ages 11, 18, and 60 months. Information about the children's breastfeeding history was obtained from the mothers. The trajectory of serum-PFAS concentrations during months with and without breastfeeding was examined by linear mixed models that accounted for the correlations of the PFAS measurements for each child. The models were adjusted for confounders such as body size. The duration of exclusive breastfeeding was associated with increases of most PFAS concentrations by up to 30% per month, with lower increases during partial breast-feeding. In contrast to this main pattern, perfluorohexanesulfonate was not affected by breast-feeding. After cessation of breastfeeding, all serum concentrations decreased. This finding supports the evidence of breastfeeding being an important exposure pathway to some PFASs in infants. PMID:26291735

  16. Role of clay as catalyst in Friedel–Craft alkylation

    Tanushree Choudhury; Nirendra M Misra

    2011-10-01

    Solid acids have become increasingly important for many liquid-phase industrial reactions these days. Montmorillonite clays (2:1 clay mineral) have been used as efficient solid acid catalysts for a number of organic and liquid phase reactions and offer several advantages over classic acids. Tailor made catalysts can be prepared from clays by suitably adjusting their acidity and surface area by acid activation. In the present work, preparation, characterization and performance of Pt (II) clays, Cu (II) clays, acid clay, and sol–gel hybrids of Cu (II) clays as solid catalysts in a test Friedel–Craft alkylation reaction of benzyl chloride with toluene using differential scanning calorimeter (DSC) are reported. Product formation has been analysed by FTIR spectroscopy. The main objective of this work is to show how clay as a solid catalyst affects reaction rates and activation energies. Acidity and dispersion of solid catalysts are twomain factors which govern a catalysis reaction. Kinetic parameter analysis and XRD studies confirm that acid Pt (II) clay and Pt (II) clay dispersed by natural dispersants aremore effective catalysts. In contrast to the reactions using AlCl3, the experimental conditions are non-polluting and the final work up does not require any aqueous treatment.

  17. Thiolate alkylation in tripod zinc complexes: a comparative kinetic study.

    Rombach, Michael; Seebacher, Jan; Ji, Mian; Zhang, Guofang; He, Guosen; Ibrahim, Mohamed M; Benkmil, Boumahdi; Vahrenkamp, Heinrich

    2006-05-29

    The biologically relevant alkylations of the thiolate ligands in tripod zinc thiolates by methyl iodide were studied kinetically. Five tripod ligands of the pyrazolyl/thioimidazolyl borate type were employed, offering N3, N2S, NS2, and S3 donor sets. For each of them, the ethyl-, benzyl-, phenyl-, and p-nitrophenylthiolate zinc complexes were investigated, yielding a total of 20 second-order rate constants. The comparison of these rate constants shows three effects: (1) the electronic effect among the thiolates, i.e., the ethanethiolates react about 3 orders of magnitude faster than the p-nitrophenylthiolates; (2) the steric effect among the pyrazolylborates, i.e., the phenyl-substituted ones react about 2 orders of magnitude faster than the tert-butyl-substituted ones; and (3) the strong acceleration by the sulfur donors in the tripods, reaching 4 orders of magnitude between the reaction times of the (N3)Zn-SR and (S3)Zn-SR complexes. PMID:16711708

  18. Electrophilic Metal Alkyl Chemistry in New Ligand Environments

    Jordan, Richard F. [University of Chicago

    2013-06-30

    The goals of this project were to design new electrophilic metal alkyl complexes and to exploit these systems in fundamental studies of olefin polymerization and other important and new catalytic reactions. A key target reaction is insertion copolymerization of olefins and polar CH2=CHX vinyl monomers such as vinyl halides and vinyl ethers. During the period covered by this report we (i) investigated the properties of ortho-alkoxy-arylphosphine ligands in Ni-based olefin polymerization catalysts, (ii) studied the synthesis of double-end-capped polyethylene using group 4 metal catalysts that contain tris-pyrazolylborate ligands, (iii) explored the ethylene insertion reactivity of group 4 metal tris-pyrazolyl-borate complexes, (iv) showed that (α-diimine)PdMe{sup +} species undergo multiple insertion of silyl vinyl ethers, (v) synthesized and explored the reactivity of base-free Ni benzyl complexes that contain ortho-phosphino-arene sulfonate ligands, (vi) established the mechanism of the reaction of vinyl chloride with (α-diimine)PdMe{sup +} catalysts, (vii) explored the role of cationic polymerization and insertion chemistry in the reactions of vinyl ethers with (α-diimine)PdMe{sup +} species, (viii) discovered a new class of self-assembled tetranuclear Pd catalysts that produce high molecular weight linear polyethylene and copolymerize ethylene and vinyl fluoride, and (ix) developed model systems that enabled investigation of cis-trans isomerization of {phosphine-sulfonate}Pd(II) complexes.

  19. Middle-phase microemulsions of green surfactant alkyl polyglucosides

    CHAI; Jinling; (柴金岭); LI; Ganzuo; (李干佐); ZHANG; Gaoyong; (张高勇); LOU; Anjing; ZHANG; Jian; (张剑); ZHANG; Yue; (张越)

    2003-01-01

    The microemulsion behavior in the quaternary system alkyl polyglucoside (C8G1.46 , C10G1.54)/1-butanol/cyclohexane/water has been studied at 40℃ with the alcohol concentration scanning and the fishlike phase diagram methods. Increasing δat a constant γ causes a phase inversion from an oil-in-water microemulsion in contact with excess oil (Winsor I or 2 ) to a water-in-oil microemulsion in contact with excess water (Winsor Ⅲ or ) via a middle-phase microemulsionin contact with excess oil and water (Winsor Ⅲ or 3). By using the simple mass balance equation and the HLB plane equation, the mass fraction of 1-butanol in the interfacial layer, S s2, the monomeric solubilities of APG and 1-butanol, S1 and S2, in the oil phase, and the mass fractions of APG and 1-butanol in the interfacial layer (C1 and C2 ) have been calculated, respectively. The effects of different alcohols, aqueous media and oils on the phase behavior and the composition of the interfacial layer are also investigated. It is found that the alcohols with longer hydrocarbon chain, oil molecules with smaller molecular volume and the addition of inorganic salt can increase the solubilization of the microemulsions .

  20. Physico-chemical properties and toxicity of alkylated polycyclic aromatic hydrocarbons.

    Kang, Hyun-Joong; Lee, So-Young; Kwon, Jung-Hwan

    2016-07-15

    Crude oil and refined petroleum products contain many polycyclic and heterocyclic aromatic hydrocarbons, in particular, alkylated PAHs. Although alkylated PAHs are found in significantly higher quantities than their corresponding unsubstituted PAHs, the most studies on the physico-chemical properties and toxicities of these compounds have been conducted on unsubstituted PAHs. In this study, we measured crucial physico-chemical properties (i.e., water solubility, partition coefficients between polydimethylsiloxane and water (KPDMSw), and partition coefficient between liposomes and water (Klipw)) of selected alkylated PAHs, and evaluated their toxicity using the luminescence inhibition of Aliivibrio fischeri and growth inhibition of Raphidocelis subcapitata. In general, the logarithms of these properties for alkylated PAHs showed good linear correlations with log Kow, as did those for unsubstituted PAHs. Changes in molecular symmetry on the introduction of alkyl groups on aromatic ring structure significantly altered water solubility. The inhibition of bacterial luminescence and algal growth by alkylated PAHs can be explained well by the baseline toxicity hypothesis, and good linear relationships between log Kow or log Klipw and log (1/EC50) were found. PMID:27037474

  1. Genetics Home Reference: GM2-gangliosidosis, AB variant

    ... of GM2-gangliosidosis, AB variant: Genetic Testing Registry: Tay-Sachs disease, variant AB These resources from MedlinePlus offer ... AB variant Activator Deficiency/GM2 Gangliosidosis Activator-deficient Tay-Sachs disease GM2 Activator Deficiency Disease GM2 gangliosidosis, type ...

  2. Investigation of high level of AsAb, EmAb in fertility female serum infected by chlamydia trachomatis

    Objective: To investigate the mechanism of chlamydia trachomatis. AsAb, EmAb in female fertility. Methods: LPS antigen of chlamydia in reproduction tract of fertility female was detected by monoclonal antibody and immunology chromatography; the content of AsAb, EmAb in serum of fertility female was detected by ELISA. Results: Infections rate of chlamydia trachomatis in fertility female was higher than that in the control AsAb, EmAb in serum of the fertility patients who were infected with chlamydia trachomatis showed a significant difference from that in the control group. Conclusion: The level of AsAb, EmAb increases in patients who have been infected with chlamydia trachomatis and these cytokines is involved in the course of female fertility

  3. Ab initio mass tensor molecular dynamics

    Tsuchida, Eiji

    2010-01-01

    Mass tensor molecular dynamics was first introduced by Bennett [J. Comput. Phys. 19, 267 (1975)] for efficient sampling of phase space through the use of generalized atomic masses. Here, we show how to apply this method to ab initio molecular dynamics simulations with minimal computational overhead. Test calculations on liquid water show a threefold reduction in computational effort without making the fixed geometry approximation. We also present a simple recipe for estimating the optimal ato...

  4. Discovering chemistry with an ab initio nanoreactor

    Wang, Lee-Ping; Titov, Alexey; McGibbon, Robert; Liu, Fang; Pande, Vijay S.; Martínez, Todd J.

    2014-01-01

    Chemical understanding is driven by the experimental discovery of new compounds and reactivity, and is supported by theory and computation that provides detailed physical insight. While theoretical and computational studies have generally focused on specific processes or mechanistic hypotheses, recent methodological and computational advances harken the advent of their principal role in discovery. Here we report the development and application of the ab initio nanoreactor – a highly accelerat...

  5. Ab initio vel ex eventu. II

    Thiessen, P. A.; Treder, H.-J.

    Jedes initium wird durch experimenta crucis zum eventus. Jedes theoretisch interpretierbare ex-eventu-Resultat führt auf ein neues Initium. Gerade dies ist die gemeinsame Aussage von Atomistik, Quantenmechanik und Relativitätstheorie.Translated AbstractAb initio vel ex eventu. IIEvery initium becomes an eventus by experimenta crucis. Every theoretically interpretable ex-eventu result leads to a new initium. Right this is the joint assertion of atomism, quantum mechanics, and relativity.

  6. UV absorption spectra, kinetics and mechanism for alkyl and alkyl peroxy radicals originating from t-butyl alcohol

    Langer, S.; Ljungström, E.; Sehested, J.;

    1994-01-01

    the self-reaction of HOC(CH3)2CH2. and HOC(CH3)2CH2O2. radicals were found to be (3.0 +/ -0.5) x 10(-11) and (7.8 +/- 1.5) X 10(-12) cm3 molecule-1 s-1, respectively. For the reaction of the alkyl radical with O2 in 1 atm SF6 a rate constant of (1.8 +/- 0.2) x 10(-12) cm3 molecule-1 s-1 was found. k......) to identify and quantify the reaction products. Absorption cross sections were quantified over the wavelength range 220-320 nm. At 240 nm, sigma(HOC(CH3)2CH2) = (2.4 +/- 0.3) x 10(-18) and sigma(HOC(CH3)2CH2O2) = (3.4 +/- 0.5) X 10(-18) cm2 molecule-1 have been obtained. Observed rate constants for......(HOC(CH3)2CH2O2. + NO) and k(HOC(CH3)2CH2O2. + NO2) were determined to be (4.9 +/- 0.9) X 10(-12) and (6.7 +/- 0.9) x 10(-12) cm3 molecule-1 s-1, respectively. In the FTIR experiments products were studied using chlorine-initiated oxidation in TBA/N2/Cl2 and TBA/N2/O2/Cl2 mixtures....

  7. Highly scalable Ab initio genomic motif identification

    Marchand, Benoît

    2011-01-01

    We present results of scaling an ab initio motif family identification system, Dragon Motif Finder (DMF), to 65,536 processor cores of IBM Blue Gene/P. DMF seeks groups of mutually similar polynucleotide patterns within a set of genomic sequences and builds various motif families from them. Such information is of relevance to many problems in life sciences. Prior attempts to scale such ab initio motif-finding algorithms achieved limited success. We solve the scalability issues using a combination of mixed-mode MPI-OpenMP parallel programming, master-slave work assignment, multi-level workload distribution, multi-level MPI collectives, and serial optimizations. While the scalability of our algorithm was excellent (94% parallel efficiency on 65,536 cores relative to 256 cores on a modest-size problem), the final speedup with respect to the original serial code exceeded 250,000 when serial optimizations are included. This enabled us to carry out many large-scale ab initio motiffinding simulations in a few hours while the original serial code would have needed decades of execution time. Copyright 2011 ACM.

  8. Divergent Reactivity of Alkyl Aryl Sulfones with Bases: Selective Functionalization of ortho-Aryl and alpha-Alkyl Units Enabled by a Unique Carbanion Transmetalation

    Řehová, Lucie; Císařová, I.; Jahn, Ullrich

    2014-01-01

    Roč. 2014, č. 7 (2014), s. 1461-1476. ISSN 1434-193X R&D Projects: GA ČR GAP207/11/1598 Institutional support: RVO:61388963 Keywords : sulfones * transmetalation * lithiation * deprotonation * alkylation * acidity Subject RIV: CC - Organic Chemistry Impact factor: 3.065, year: 2014

  9. Thiolated alkyl-modified carbomers: Novel excipients for mucoadhesive emulsions.

    Bonengel, Sonja; Hauptstein, Sabine; Leonaviciute, Gintare; Griessinger, Julia; Bernkop-Schnürch, Andreas

    2015-07-30

    The aim of this study was the design and evaluation of mucoadhesive emulsifying polymeric excipients. Three thiol bearing ligands with increasing pKa values of their sulfhydryl group, namely 4-aminothiophenol (pKa=6.86), l-cysteine (pKa=8.4) and d/l-homocysteine (pKa=10.0) were coupled to the polymeric backbone of alkyl-modified carbomer (PA1030). Resulting conjugates displayed 818.5μmol 4-aminothiophenol, 698.5μmol cysteine and 651.5μmol homocysteine per gram polymer and were evaluated regarding the reactivity of thiol groups, emulsifying and mucoadhesive properties. In general, the synthesized conjugates showed a pH dependent reactivity, whereby the fastest oxidation occurred in PA1030-cysteine, as almost no free thiol groups could be detected after 120min. Emulsification of medium chain triglycerides was feasible with all synthesized conjugates leading to oil-in-water-emulsions. Emulsions with PA1030-cysteine displayed the highest stability and the smallest droplet size among the tested formulations. Oxidation and consequently cross-linking of the thiomers prior to the emulsification process led to an overall decreased emulsion stability. Evaluating mucosal residence time of thiomer emulsions on porcine buccal mucosa, a 9.2-fold higher amount of formulation based on PA1030-cysteine remained on the mucosal tissue within 3h compared to the unmodified polymer. According to these results, the highest reactive ligand l-cysteine seems to be most promising in order to obtain thiolated polymers for the preparation of mucoadhesive o/w-emulsions. PMID:25857707

  10. Alkyl nitrate production and persistence in the Mexico City Plume

    G. Sachse

    2009-11-01

    Full Text Available Alkyl and multifunctional nitrates (ΣANs have been observed to be a significant fraction of NOy in a number of different chemical regimes. Their formation is an important free radical chain termination step ending production of ozone and possibly affecting formation of secondary organic aerosol. ΣANs also represent a potentially large, unmeasured contribution to OH reactivity and are a major pathway for the removal of nitrogen oxides from the atmosphere. Numerous studies have investigated the role of nitrate formation from biogenic compounds. Less attention has been paid to the role ΣANs may play in the complex mixtures of hydrocarbons typical of urban settings. Measurements of ΣANs, NO2, total peroxy nitrates (ΣPNs, HNO3 and a wide suite of hydrocarbons were obtained from the NASA DC-8 aircraft during spring of 2006 in and around Mexico City and the Gulf of Mexico. ΣANs were observed to be 10–20% of NOy in the Mexico City plume and to increase in importance with increased photochemical age. We describe three conclusions: 1 Correlations of ΣANs with odd-oxygen (Ox indicate a stronger role for ΣANs in the photochemistry of Mexico City than is expected based on currently accepted photochemical mechanisms, 2 ΣAN formation suppresses peak ozone production rates by as much as 30% in the near-field of Mexico City and 3 ΣANs play a comparable role to ΣPNs in the export of NOy to the Gulf Region.

  11. Isobutane/2-butene alkylation over potential heterogeneous catalysts in a slurry reactor

    Roervik, T.

    1996-12-31

    The trend towards more effective use of fossil fuels and reduced environmental pollution represents a major task of improvement within the refinery processes. The highly isomerized and high octane paraffins produced from isobutane and light olefins by alkylation fulfill all the requirements for reformulated gasoline. This doctoral thesis discusses new catalyst systems because of their potential in alkylation. A slurry reactor apparatus for solid-acid catalysed isobutane/butene alkylation was developed and used to investigate the performance of various heterogeneous catalysts. The selected materials were mainly zeolite types with faujasite structures. The samples were characterized by various methods before alkylation. In general, the order of decreasing catalyst activity after 3 h of reaction at 80{sup o}C was found to be: H-EMT >> H-FAU, dealuminated H-FAU >> NS.500, TA-Y, CeY-98 > Nafion-H. The order of decreasing alkylate selectivity of the catalysts was: H-EMT >> dealuminated H-FAU > H-FAU >> Nafion-H > CeY-98 > TA-Y > H-SAPO-37, NS.500. H-EMT was the most promising system for further development, also because of the very low formation of the undesirable isooctenes and a high selectivity towards isooctanes among the alkylates. A high density of accessible strong acid sites was found to be essential for a high alkylation activity and selectivity. Open structure, like hexagonal faujasite, was advantageous. The distribution of trimethylpentanes formed in zeolites was ascribed to pore restrictions as a major factor. The effect of operating conditions on catalyst performance was investigated statistically, and a high dilution of butene in the slurry reactor was found to be very important. 153 refs., 40 figs., 12 tabs.

  12. Mild and Phosphine-Free Iron-Catalyzed Cross-Coupling of Nonactivated Secondary Alkyl Halides with Alkynyl Grignard Reagents

    Cheung, Chi Wai; Ren, Peng; Hu, Xile

    2014-01-01

    A simple protocol for iron-catalyzed cross-coupling of nonactivated secondary alkyl bromides and iodides with alkynyl Grignard reagents at room temperature has been developed. A wide range of secondary alkyl halides and terminal alkynes are tolerated to afford the substituted alkynes in good yields. A slight modification of the reaction protocol also allows for cross-coupling with a variety of primary alkyl halides.

  13. The effect of ultrasound on the catalytic activity of alkaline carbons: preparation of N-alkyl imidazoles

    Duran-Valle, C.J.; Ferrera-Escudero, S.; Calvino-Casilda, V.; Diaz-Teran, J.; Martin-Aranda, R.M

    2004-11-15

    N-Alkyl imidazoles have been prepared by sonochemical irradiation of imidazole and 1-bromobutane using alkaline promoted carbons. Under the experimental conditions, N-alkyl imidazoles can be prepared with a high activity and selectivity. It is observed that imidazole conversion increases in parallel with increasing basicity of the catalyst. For comparison, the alkylation of imidazole has also been performed in a batch reactor system under thermal activation.

  14. Undoing Gender Through Legislation and Schooling: the Case of AB 537 and AB 394 IN California, USA

    Knotts, Greg

    2009-11-01

    This article investigates California laws AB 537: The Student Safety and Violence Prevention Act of 2000, and the recently enacted AB 394: Safe Place to Learn Act. Both demand that gender identity and sexual orientation be added to the lexicon of anti-harassment protection in public education. However, despite these progressive measures, schools have an unconscious acceptance of heteronormativity and gendered norms, which undermines both the spirit and language of these laws. This paper examines how California schools can both change standard practices and realise the transformative social change that laws like AB 537 and AB 394 can instigate. I assert that the systemic implementation of these laws, through the adoption, enforcement and evaluation of existing AB 537 Task Force Recommendations, is necessary for their success. My second assertion is that AB 537 and AB 394 have the potential to change and reconstitute gender-based and heteronormative standards at school sites.

  15. 汽车ABS/ASR/ACC集成化系统%Integrated ABS/ASR/ACC System for the Car

    刘昭度; 卢江; 时开斌; 安巍

    2001-01-01

    叙述了ACC系统和ABS/ASR系统在改善汽车高速行驶主动安全性方面的功用,阐述了ACC系统是ABS/ASR系统功能的延伸、逻辑的发展及它们之间的内在联系,指出了在ABS/ASR的基础上只需增加测距装置和添加巡航控制子程序,就可方便地实现ABS/ASR/ACC集成化系统,并给出了集成化系统的控制框图和控制方法,论述了ABS/ASR/ACC集成化系统比孤立的ABS/ASR和ACC系统的优越性.%The individual functions of ACC and ABS/ASR are described in the improvements of active safety while the road vehicles travel at a high speed. Being a logic extension of and many inherent connections with ABS/BSR, ACC is easily integrated with ABS/ASR to form an integrated system by adding the headway distance*$-detecting device to the existing ABS/ASR system and expanding the ABS/ASR software. The algorithm flowcharts and control methods of the ABS/ASR/ACC are given. The advantages of the ABS/ASR/ACC system compared with those using the stand alone systems ABS, ASR and ACC are mentioned in details.

  16. Alkyl caffeates improve the antioxidant activity, antitumor property and oxidation stability of edible oil.

    Jun Wang

    Full Text Available Caffeic acid (CA is distributed widely in nature and possesses strong antioxidant activity. However, CA has lower solubility in non-polar media, which limits its application in fat-soluble food. To increase the lipophilicity of natural antioxidant CA, a series of alkyl caffeates were synthesized and their antioxidant and antitumor activities were investigated. The antioxidant parameters, including the induction period, acid value and unsaturated fatty acid content, of the alkyl caffeates in edible oil were firstly investigated. The results indicated that alkyl caffeates had a lower DPPH IC₅₀ (14-23 µM compared to CA, dibutyl hydroxy toluene (BHT and Vitamin C (24-51 µM, and significantly inhibited four human cancer cells (SW620, SW480, SGC7901 and HepG2 with inhibition ratio of 71.4-78.0% by a MTT assay. With regard to the induction period and acid value assays, methyl and butyl caffeates had higher abilities than BHT to restrain the oxidation process and improve the stability of edible oil. The addition of ethyl caffeate to oil allowed maintenance of a higher unsaturated fatty acid methyl ester content (68.53% at high temperatures. Overall, the alkyl caffeats with short chain length (n<5 assessed better oxidative stability than those with long chain length. To date, this is the first report to the correlations among the antioxidant activity, anticancer activity and oxidative stability of alkyl caffeates.

  17. Kinetics of toluene alkylation with methanol catalyzed by pure and hybridized HZSM-5 catalysts

    Alabi, Wahab

    2012-07-01

    A kinetic study of toluene alkylation with methanol was performed over pure HZSM-5, mordenite/ZSM-5 (hybrid of mordenite and HZSM-5), and ZM13 (composite mixture of HZSM-5 and MCM-41 at pH 13). Experimental runs were conducted using a batch fluidized bed reactor at temperatures of 300, 350 and 400 °C and reaction times of 3, 5, 7, 10, 13, 15 and 20. s. The rate of toluene methylation and toluene disproportionation were studied on the three catalysts (toluene alkylation is usually accompanied by toluene disproportionation on acid catalyst). Based on the results obtained, a simplified power law kinetic model consisting of three reactions was developed to estimate the activation energies of toluene methylation and disproportionation simultaneously. Coke formation on catalysts was accounted for using both reaction time and reactant conversion decay functions. All parameters were estimated based on quasi-steady state approximation. Estimated kinetic parameters were in good agreement with experimental results. The order of alkylation ability of the catalysts was found to be ZM13 > HZSM-5 > mordenite/ZSM-5, while the reverse is for toluene disproportionation (mordenite/ZSM-5 > HZSM-5 > ZM13). Thus, alkylation of toluene is most favorable on ZM13 due to combined effect of mesoporosity induced through its synthetic route and acid content. Toluene/MeOH molar ratio of 1:1 was most suitable for toluene alkylation reaction. © 2012 Elsevier B.V.

  18. ORGANIC-INORGANIC HYBRIDS PREPARED FROM ALKYL PHOSPHONIUM SALTS INTERCALATED MONTMORILLONITES

    SAHELI GANGULY

    2012-12-01

    Full Text Available Present investigation is focused on systematic and detailed characterization of alkyl phosphonium intercalated montmorillonite (MMT. The objective of the work is to provide a better understanding of the specific changes in properties of the hybrid material with changes in structure of incoming organic cations. In the present work, Na-MMT was intercalated with phosphonium salts of two different cationic head compositions namely alkyl triphenyl and alkyl tributyl groups. Length of alkyl chain was also varied. Resultant organic-inorganic hybrids were characterized by X-ray diffraction (XRD, Transmission electron microscopy (TEM, Thermogravimetry (TG and Fourier transformed infrared spectroscopy (FTIR. Effective volume occupied by the cationic heads influenced interlayer arrangements. Intercalated MMT with two different cationic heads behaved differently in relation to thermal decomposition patterns. Possible explanation was given based on hybridization of bonds. Van der Waals attachment of alkyl chains influenced the interlayer stacking and organic loading. Attempts were made to correlate the changes in properties of intercalated MMT with the structural aspects of incoming organic cations.

  19. Germacrene D Cyclization: An Ab Initio Investigation

    William N. Setzer

    2008-01-01

    Full Text Available Essential oils that contain large concentrations of germacrene D are typically accompanied by cadinane sesquiterpenoids. The acid-catalyzed cyclization of germacrene D to give cadinane and selinane sesquiterpenes has been computationally investigated using both density functional (B3LYP/6-31G* and post Hartree-Fock (MP2/6-31G** ab initio methods. The calculated energies are in general agreement with experimentally observed product distributions, both from acid-catalyzed cyclizations as well as distribution of the compounds in essential oils.

  20. Ab initio calculations of material strength

    Šob, Mojmír; Friák, Martin; Vitek, V.

    Tokyo : The Japan Society of Mechanical Engineers, 2003, s. 467-475. [International Symposium on Micro-Mechanical Engineering - Heat Transfer, Fluid Dynamics, Reliability and Mechanotronics.. Tsuchiura and Tsukuba (JP), 01.12.2003-03.12.2003] R&D Projects: GA AV ČR IAA1041302; GA ČR GA202/03/1351; GA MŠk OC 523.90 Institutional research plan: CEZ:AV0Z2041904 Keywords : ab initio calculations * electronic structure * theoretical tensile strength Subject RIV: BM - Solid Matter Physics ; Magnetism

  1. Ab Initio Molecular Dynamics: A Virtual Laboratory

    Hobbi Mobarhan, Milad

    2014-01-01

    In this thesis, we perform ab initio molecular dynamics (MD) simulations at the Hartree-Fock level, where the forces are computed on-the-fly using the Born-Oppenheimer approximation. The theory behind the Hartree-Fock method is discussed in detail and an implementation of this method based on Gaussian basis functions is explained. We also demonstrate how to calculate the analytic energy derivatives needed for obtaining the forces acting on the nuclei. Hartree-Fock calculations on the ground s...

  2. Asiakassuhdehallinnan kehityssuunnitelma : Case: Oy Combi Cool Ab

    Puikkonen, Touko

    2011-01-01

    Tässä insinöörityössä tutustuttiin Oy Combi Cool Ab:n asiakassuhdehallintaan ja siinä havaittuihin puutteisiin ja kehitystarpeisiin. Työn tarkoituksena oli luoda yritykselle ajan tasalla oleva asiakasrekisteri ja sen pohjalta kehittää asiakassuhdehallintaa etenkin myynnin, oston ja johdon henkilöstön tarpeita ajatellen muovaamalla siitä henkilöstön myynti- ja asiakaspalvelutyöskentelyä tehostava toimiva kokonaisuus. Combi Cool on vuonna 1985 perustettu kylmäalan tukkuliike, joka on vajaan 30 ...

  3. Testing Distributed ABS System with Fault Injection

    Trawczyński, Dawid; Sosnowski, Janusz; Gawkowski, Piotr

    The paper deals with the problem of adapting software implemented fault injection technique (SWIFI) to evaluate dependability of reactive microcontroller systems. We present an original methodology of disturbing controller operation and analyzing fault effects taking into account reactions of the controlled object and the impact of the system environment. Faults can be injected randomly (in space and time) or targeted at the most sensitive elements of the controller to check it at high stresses. This approach allows identifying rarely encountered problems, usually missed in classical approaches. The developed methodology has been used successfully to verify dependability of ABS system. Experimental results are commented in the paper.

  4. Elastic properties of intermetallic AB2 and AB5 hydrogen-absorbing compounds

    The elastic properties of AB2 and AB5 hydrogen-absorbing intermetallic compounds are reviewed. The relevance of these properties to hydrogen absorption is discussed briefly. In many cases the temperature dependence of the elastic constants of the AB2 compounds is anomalous in that the moduli do not decrease monotonically with increasing temperature. This unusual behavior appears to be associated with electronic structure effects in a number of cases. The absorption of hydrogen by polycrystalline TaV2 has a profound effect on the aggregate shear modulus, changing both the magnitude and temperature dependence significantly. This effect of hydrogen on the mechanical properties appears to occur via effects on the electronic structure. Few measurements of elastic properties have been reported for hydrogen-absorbing AB5 intermetallic compounds. The LaAlxNi5-x system has been investigated by means of measurements on polycrystals prepared by hot isostatic pressing. The moduli decrease about 8% as x increases from 0 to 1

  5. Benzene alkylation with long chain olefins catalyzed by ionic liquids: a review

    Congzhen QIAO; Yonghong CAI; Quanhui GUO

    2008-01-01

    The introduction of ionic liquids to alkylation process gives a choice for "green production" in the pet-rochemical and detergent industry.A lot of papers and patents have been published using chloroaluminate ionic liquid as a novel catalyst for alkylation with high reactivity and easy separation from reactants.These included the acid-ity,characterization,determination and catalysis technolo-gies in batch and continuous operation mode for different scales.According to published data and several results of pilot alkylation,including the authors' experience,the pro-spect of chloroaluminate ionic liquids for commercials was also discussed.It has been pointed out that there still are many difficulties and challenges to be overcome for com-mercial application of the ionic liquid catalyst.

  6. Amine synthesis via iron-catalysed reductive coupling of nitroarenes with alkyl halides.

    Cheung, Chi Wai; Hu, Xile

    2016-01-01

    (Hetero)Aryl amines, an important class of organic molecules in medicinal chemistry, are most commonly synthesized from anilines, which are in turn synthesized by hydrogenation of nitroarenes. Amine synthesis directly from nitroarenes is attractive due to improved step economy and functional group compatibility. Despite these potential advantages, there is yet no general method for the synthesis of (hetero)aryl amines by carbon-nitrogen cross-coupling of nitroarenes. Here we report the reductive coupling of nitroarenes with alkyl halides to yield (hetero)aryl amines. A simple iron catalyst enables the coupling with numerous primary, secondary and tertiary alkyl halides. Broad scope and high functional group tolerance are demonstrated. Mechanistic study suggests that nitrosoarenes and alkyl radicals are involved as intermediates. This new C-N coupling method provides general and step-economical access to aryl amines. PMID:27515391

  7. Synthesis of a new conjugated polymer for DNA alkylation and gene regulation.

    Nie, Chenyao; Zhu, Chunlei; Feng, Liheng; Lv, Fengting; Liu, Libing; Wang, Shu

    2013-06-12

    A new polyfluorene derivative containing pendent alkylating chlorambucil (PFP-Cbl) was synthesized and characterized. Under direct incubation with DNA in vitro, PFP-Cbl could undergo an efficient DNA alkylating reaction and induce DNA cross-linking. In vitro transcription and translation experiment exhibited that the PFP-Cbl significantly down-regulated the gene expression of luciferase reporter plasmid. The down-regulation of gene expression was also verified through the transfection experiment of p-EGFP plasmid, which showed decreased green fluorescent protein (GFP) in cells. Meanwhile, the self-luminous property of PFP-Cbl could make it able to trace the internalized PFP-Cbl and plasmid complexes resulted from cross-linking in cells by fluorescent microscopy. Combining the features of alkylating function, multivalent binding sites, and fluorescent characteristics, PFP-Cbl provides a new insight in the area of gene regulation and extends the new applications of conjugated polymers (CPs). PMID:23548104

  8. AB008. Management of fertility post cancer

    Smith, James

    2016-01-01

    The successful treatment of males with cancer has led to increasing numbers of men and boys interested in life after cancer. One of the top priorities for many of these males is the opportunity to have a family. Most cancer treatments used for common malignancies in men and boys are associated with impaired fertility; for patients receiving alkylating agents or total body irradiation, severe fertility impairment occurs in most patients. While sperm banking for males, even those as young as 12, facing sterilizing cancer treatment can be effective, this approach requires subsequent use of reproductive procedures such as in vitro fertilization (IVF) or intrauterine insemination to achieve a pregnancy. Most males would prefer to restore their natural ability to father children and avoid these expensive and invasive approaches. No proven method for human male fertility restoration has yet been demonstrated; however, work in many mammalian species and recently in primates has demonstrated that autologous testicular cell transplant (TCT) can restore spermatogenesis after cancer treatment. Promising work in non-primate species has demonstrated the feasibility of in vitro development of mature sperm from neonatal testicular tissue. The safety and efficacy of either approach has not been established in humans. The objective of this lecture is to explore current and future fertility preservation and restoration techniques for males at risk of sterility from medical and surgical treatment.

  9. Biosorption of Acid Blue 290 (AB 290) and Acid Blue 324 (AB 324) dyes on Spirogyra rhizopus

    In this study, the biosorption of Acid Blue 290 and Acid Blue 324 on Spirogyra rhizopus, a green algae growing on fresh water, was studied with respect to initial pH, temperature, initial dye concentration and biosorbent concentration. The optimum initial pH and temperature values for AB 290 and AB 324 biosorption were found to be 2.0, 30 deg. C and 3.0, 25 deg. C, respectively. It was observed that the adsorbed AB 290 and AB 324 amounts increased with increasing the initial dye concentration up to 1500 and 750 mg/L, respectively. The Langmuir, Freundlich, Redlich-Peterson and Koble-Corrigan isotherm models were applied to the experimental equilibrium data and the isotherm constants were determined by using Polymath 4.1 software. The monolayer coverage capacities of S. rhizopus for AB 290 and AB 324 dyes were found as 1356.6 mg/g and 367.0 mg/g, respectively. The intraparticle diffusion model and the pseudo-second order kinetic model were applied to the experimental data in order to describe the removal mechanism of these acidic dyes by S. rhizopus. The pseudo-second order kinetic model described very well the biosorption kinetics of AB 290 and AB 324 dyes. Thermodynamic studies showed that the biosorption of AB 290 and AB 324 on S. rhizopus was exothermic in nature

  10. Ab initio non-relativistic spin dynamics

    Ding, Feizhi; Goings, Joshua J.; Li, Xiaosong, E-mail: xsli@uw.edu [Department of Chemistry, University of Washington, Seattle, Washington 98195 (United States); Frisch, Michael J. [Gaussian, Inc., 340 Quinnipiac St, Bldg 40, Wallingford, Connecticut 06492 (United States)

    2014-12-07

    Many magnetic materials do not conform to the (anti-)ferromagnetic paradigm where all electronic spins are aligned to a global magnetization axis. Unfortunately, most electronic structure methods cannot describe such materials with noncollinear electron spin on account of formally requiring spin alignment. To overcome this limitation, it is necessary to generalize electronic structure methods and allow each electron spin to rotate freely. Here, we report the development of an ab initio time-dependent non-relativistic two-component spinor (TDN2C), which is a generalization of the time-dependent Hartree-Fock equations. Propagating the TDN2C equations in the time domain allows for the first-principles description of spin dynamics. A numerical tool based on the Hirshfeld partitioning scheme is developed to analyze the time-dependent spin magnetization. In this work, we also introduce the coupling between electron spin and a homogenous magnetic field into the TDN2C framework to simulate the response of the electronic spin degrees of freedom to an external magnetic field. This is illustrated for several model systems, including the spin-frustrated Li{sub 3} molecule. Exact agreement is found between numerical and analytic results for Larmor precession of hydrogen and lithium atoms. The TDN2C method paves the way for the ab initio description of molecular spin transport and spintronics in the time domain.

  11. Global modeling of the C1-C3 alkyl nitrates using STOCHEM-CRI

    Khan, M. A. H.; Cooke, M. C.; Utembe, S. R.; Morris, W. C.; Archibald, A. T.; Derwent, R. G.; Jenkin, M. E.; Orr-Ewing, A. J.; Higgins, C. M.; Percival, C. J.; Leather, K. E.; Shallcross, D. E.

    2015-12-01

    The atmospheric global budget and distribution of C1-C3 alkyl nitrates have been investigated using a global three-dimensional chemistry transport model, STOCHEM-CRI. Alkyl nitrates (RONO2) are significant NOx reservoir species and the more detailed VOC oxidation mechanism (CRI v2-R5) leads to greater photochemical production. RONO2 are significant sources of NOx in regions remote from NOx sources. The study shows that the global burden and the atmospheric life-time of C1-C3 alkyl nitrates are 113 Gg and 9-10 days, respectively, which are in excellent agreement with estimates established by previous studies. The abundance of alkyl nitrates have been found to be higher in the continental atmosphere, with CH3ONO2 mixing ratios up to 20 ppt over the Amazon rainforest. Up to 15, 10, 2, and 5 ppt of modelled CH3ONO2, C2H5ONO2, n-C3H7ONO2 and i-C3H7ONO2 have been found in the northern hemisphere over regions with large anthropogenic emissions of NOx and VOCs. The combination of atmospheric production and long-range transport led to high alkyl nitrate levels at high latitudes. The model performance for C1-C3 alkyl nitrates was established using observations from nine flights and nine field campaigns. The comparison shows a tendency towards model under-prediction of the observations, particularly in the southern hemispheric marine boundary layer, possibly due to the absence of oceanic production mechanisms and air-sea exchange processes in the model. The discrepancies between model and observed seasonal cycles, especially of CH3ONO2, in both hemispheres are discussed.

  12. Temporal variability, sources, and sinks of C1-C5 alkyl nitrates in coastal New England

    B. C. Sive

    2010-02-01

    Full Text Available Seven C1-C5 alkyl nitrates were measured both on the mainland and off the coast of New Hampshire using gas chromatographic techniques. Five separate data sets are presented to characterize the seasonal and diurnal trends and the major sources and loss processes of these compounds. Based on in situ measurements conducted at the University of New Hampshire (UNH Atmospheric Observing Station at Thompson Farm (TF located in southeast NH during winter (January–February 2002, summer (June–August 2002, summer (July–August 2004, and on daily canister samples collected at midday from January 2004–February 2008, the median total alkyl nitrate mixing ratio (ΣRONO2 was 23–25 pptv in winter and 14–16 pptv in summer. During summers 2002 and 2004, MeONO2 decreased overnight and reached minimum hourly average mixing ratios in the early morning. Comparison with wind speed and trace gas trends suggested that dry deposition contributed to the early morning MeONO2 minimum which is a previously unaccounted for removal mechanism. The mean dry deposition rate and velocity of MeONO2 was estimated to be −0.5 nmol m−2 hr−1 and 0.13 cm s−1, respectively. Results from ambient air and surface seawater measurements made onboard the NOAA R/V Ronald H. Brown in the Gulf of Maine during the 2002 New England Air Quality Study and from ambient canister samples collected throughout the Great Bay estuary in August 2003 are also presented. Comparisons between the alkyl nitrate trends with anthropogenic and marine tracers suggest that a marine source of alkyl nitrates is not significant in coastal New England. Given the apparent prominence of a secondary source, comparisons between observed and predicted alkyl nitrate/parent hydrocarbon ratios were made which demonstrated that background mixing ratios have a continuous and prevalent influence on the alkyl nitrate distribution.

  13. Suppression of alkylating agent induced cell transformation and gastric ulceration by low-dose alkylating agent pretreatment

    Highlights: •Low-dose MNNG pretreatment suppresses high-dose MNNG induced in vitro transformation. •Gastric ulcers induced by high-dose MNNG decreased after low-dose MNNG pretreatment. •Efficacy of low-dose MNNG related to resistance of mutation and oxidative stress. -- Abstract: Exposure to mild stress by chemicals and radiation causes DNA damage and leads to acquired stress resistance. Although the linear no-threshold (LNT) model of safety assessment assumes risk from any dose, evidence from radiological research demonstrates a conflicting hormetic phenomenon known as the hormesis effect. However, the mechanisms underlying radiation hormesis have not yet been clarified, and little is known about the effects of low doses of chemical carcinogens. We analyzed the efficacy of pretreatment with low doses of the alkylating agent N-methyl-N′-nitro-N-nitrosoguanidine (MNNG) on the subsequent induction of cell transformation and gastric ulceration by high-dose MNNG. We used an in vitro Balb/3T3 A31-1-1 cell transformation test and monitored the formation of gastric ulcers in 5-week-old male ICR mice that were administered MNNG in drinking water. The treatment concentrations of MNNG were determined by the cell survival rate and past reports. For low-dose in vitro and in vivo experiments, MNNG was used at 0.028 μM, and 2.8 μg/mL, respectively. The frequency of cell transformation induced by 10 μm MNNG was decreased by low-dose MNNG pretreatment to levels similar to that of spontaneous transformation. In addition, reactive oxygen species (ROS) and mutation frequencies induced by 10 μm MNNG were decreased by low-dose MNNG pretreatment. Importantly, low-dose MNNG pretreatment had no effect on cell proliferation. In vivo studies showed that the number of gastric ulcers induced by 1 mg/mL MNNG decreased after low-dose MNNG pretreatment. These data indicate that low-dose pretreatment with carcinogens may play a beneficial role in the prevention of chemical toxicity

  14. Ab initio no core full configuration approach for light nuclei

    Kim, Youngman; Shin, Ik Jae; Maris, Pieter; Vary, James P.; Forssén, Christian; Rotureau, Jimmy

    2015-10-01

    Comprehensive understanding of the structure and reactions of light nuclei poses theoretical and computational challenges. Still, a number of ab initio approaches have been developed to calculate the properties of atomic nuclei using fundamental interactions among nucleons. Among them, we work with the ab initio no core full configuration (NCFC) method and ab initio no core Gamow Shell Model (GSM). We first review these approaches and present some recent results.

  15. Workshop on automated beam steering and shaping (ABS). Proceedings

    A workshop on Automated Beam Steering and Shaping (ABS) was held at CERN in December 1998. This was the first workshop dedicated to this subject. The workshop had two major goals: to review the present status of ABS algorithms and systems around the world and to create a worldwide ABS community. These proceedings contain summary reports from all sessions, contributions from several presentations held at the workshop, and a complete set of abstracts for all presentations. (orig.)

  16. Active-site alkylation destabilizes human O6-alkylguanine DNA alkyltransferase

    Rasimas, Joseph J.; Dalessio, Paula A.; Ropson, Ira J; Pegg, Anthony E.; Fried, Michael G.

    2004-01-01

    O6-alkylguanine-DNA alkyltransferase (AGT) repairs pro-mutagenic O6-alkylguanine and O4-alkylthymine lesions in DNA. The alkylated form of the protein is not reactivated; instead, it is rapidly ubiquitinated and degraded. Here, we show that alkylation destabilizes the native fold of the protein by 0.5–1.2 kcal/mole and the DNA-binding function by 0.8–1.4 kcal/mole. On this basis, we propose that destabilization of the native conformational ensemble acts as a signal for ubiquitination.

  17. Methyl phosphotriesters in alkylated DNA are repaired by the Ada regulatory protein of E. coli.

    McCarthy, T.V.; Lindahl, T

    1985-01-01

    The E. coli ada+ gene product that controls the adaptive response to alkylating agents has been purified to apparent homogeneity using an overproducing expression vector system. This 39 kDa protein repairs 0(6)-methylguanine and 0(4)-methylthymine residues in alkylated DNA by transfer of the methyl group from the base to a cysteine residue in the protein itself. The Ada protein also corrects one of the stereoisomers of methyl phosphotriesters in DNA by the same mechanism, while the other isom...

  18. Photoalignment efficiency enhancement of polyimide alignment layers by alkyl-amine vapor treatment

    Sakamoto, Kenji; Usami, Kiyoaki; Miki, Kazushi

    2014-08-01

    We have succeeded in enhancing the photoalignment efficiency of polyimide containing azobenzene in the backbone structure by exposing the corresponding precursor (polyamic acid: Azo-PAA) film to alkyl-amine vapor prior to photoalignment. The Azo-PAA film absorbed alky-amines and swelled by 300%. The photoinduced rotation of the Azo-PAA backbone structure occurred more easily in the swollen film. Most of the alkyl-amines in the swollen film desorbed during thermal imidization. As a result of the photoalignment efficiency enhancement, we also succeeded in expanding the controllable pretilt angle range of liquid crystals up to 38° without the appearance of threadlike disclination loops.

  19. Efficient SN2 fluorination of primary and secondary alkyl bromides by copper(I) fluoride complexes

    Liu, Yanpin

    2013-11-11

    Copper(I) fluoride complexes ligated by phenanthroline derivatives have been synthesized and structurally characterized by X-ray crystallography. These complexes adopt as either ionic or neutral forms in the solid state, depending on the steric bulkiness of the substituent groups on the phenanthroline ligands. These complexes react with primary and secondary alkyl bromides to produce the corresponding alkyl fluorides in modest to good yields. This new method is compatible with a variety of important functional groups such as ether, thioether, amide, nitrile, methoxyl, hydroxyl, ketone, ester, and heterocycle moieties. © 2013 American Chemical Society.

  20. Palladium catalysed asymmetric alkylation of benzophenone Schiff base glycine esters in ionic liquids

    Dae Hyun Kim; Jin Kyu Im; Dae Won Kim; Minserk Cheong; Hoon Sik Kim; Deb Kumar Mukherjee

    2011-07-01

    Asymmetric alkyl substitution of various benzophenone Schiff base substrates under biphasic conditions proceeded using optically active Palladium(II) complexes. The corresponding products were obtained in high yields but with moderate enantiomeric excess (ee). Addition of specific ionic liquids to the reaction medium enhanced reactivity and selectivity for phase transfer catalytic (PTC) glycine alkylation. It has been found that there is an anionic influence of the ionic liquids that modify the steric environment around the enolate ion. A computer-assisted molecular design of enantioselective phase-transfer catalysis with the palladium complex and the ionic liquid has been done.

  1. A study on synthesis and oxidation mechanism of mono-alkyl phosphate

    2009-01-01

    Oxidation of white phosphorus by peroxides to produce mono-alkyl phosphate in the alcoholic solution has been studied under non-and catalytic conditions. In this paper,the mechanism of the oxidation process was analyzed. The content of mono-alkyl phosphate in the product is affected by different types of alcoholic solution and peroxide solvent. The result shows the availability of the following order for the activity of the peroxide solvent and alcoholic solutions-tert-butyl hydroperoxide>(di) benzoyl perox...

  2. Synthesis, properties and self-organization of meso-arylporphyrins with higher alkyl substituents

    Bragina, N. A.; Zhdanova, K. A.; Mironov, A. F.

    2016-05-01

    The review summarizes published data on the methods for preparation of meso-arylporphyrins with higher alkyl substituents. The methods for creation of self-organized nanostructures based on these compounds and the data on their applications are presented. Approaches to the synthesis of functionalized lipophilic and amphiphilic meso-arylporphyrins are discussed. The ways and driving forces for the formation of supramolecular porphyrin arrays in solutions and on the substrate surface are considered. The prospects of using alkyl porphyrin derivatives for the design of nanomaterials are shown. The bibliography includes 204 references.

  3. Practical Ni-Catalyzed Aryl-Alkyl Cross-Coupling of Secondary Redox-Active Esters.

    Cornella, Josep; Edwards, Jacob T; Qin, Tian; Kawamura, Shuhei; Wang, Jie; Pan, Chung-Mao; Gianatassio, Ryan; Schmidt, Michael; Eastgate, Martin D; Baran, Phil S

    2016-02-24

    A new transformation is presented that enables chemists to couple simple alkyl carboxylic acids with aryl zinc reagents under Ni-catalysis. The success of this reaction hinges on the unique use of redox-active esters that allow one to employ such derivatives as alkyl halides surrogates. The chemistry exhibits broad substrate scope and features a high degree of practicality. The simple procedure and extremely inexpensive nature of both the substrates and pre-catalyst (NiCl2·6H2O, ca. $9.5/mol) bode well for the immediate widespread adoption of this method. PMID:26835704

  4. Neighbor-directed histidine N(τ) alkylation. A route to imidazolium-containing phosphopeptide macrocycles

    Qian, Wen-Jian [National Cancer Inst., Frederick, MD (United States); Park, Jung-Eun [National Cancer Inst., Bethesda, MD (United States); Grant, Robert [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States); Lai, Christopher C. [National Cancer Inst., Frederick, MD (United States); Kelley, James A. [National Cancer Inst., Frederick, MD (United States); Yaffe, Michael B. [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States); Lee, Kyung S. [National Cancer Inst., Bethesda, MD (United States); Burke, Terrence R. [National Cancer Inst., Frederick, MD (United States)

    2015-07-07

    Our recently discovered, selective, on-resin route to N(τ)-alkylated imidazolium-containing histidine residues affords new strategies for peptide mimetic design. In this, we demonstrate the use of this chemistry to prepare a series of macrocyclic phosphopeptides, in which imidazolium groups serve as ring-forming junctions. These cationic moieties subsequently serve to charge-mask the phosphoamino acid group that directed their formation. Furthermore, neighbor-directed histidine N(τ)-alkylation opens the door to new families of phosphopeptidomimetics for use in a range of chemical biology contexts.

  5. Alkylation mechanism of benzene with 1-dodecene catalyzed by Et3NHCl-AlCl3

    2010-01-01

    The isotope exchange method was employed to investigate the catalytic mechanism of ionic liquid in alkylation of benzenes with olefins.It is proposed that alkylation was induced by the Lewis acid AlCl3 which attracted π electrons of 1-dodecene to shift toward 1-carbon,thus forming a carbonium ion.The carbonium ion further reacted with benzenes to form a complex.Due to unstabilit of the complex,a deuterated ring proton was transferred into an electronegative 1-carbon of the side chain to substitute for the AlCl3,accordingly 2-phenyldodecane was generated.

  6. Effects of alkyl chain positioning on conjugated polymer microstructure and field-effect mobilities

    Schroeder, Bob C.

    2015-07-02

    Solubilizing alkyl chains play a crucial role in the design of semiconducting polymers because they define the materials solubility and processability as well as both the crystallinity and solid-state microstructure. In this paper, we present a scarcely explored design approach by attaching the alkyl side chains on one side (cis-) or on both sides (trans-) of the conjugated backbone. We further investigate the effects of this structural modification on the solid-state properties of the polymers and on the charge-carrier mobilities in organic thin-film transistors. Copyright © Materials Research Society 2015

  7. High-Throughput Screening of the Asymmetric Decarboxylative Alkylation Reaction of Enolate-Stabilized Enol Carbonates

    Stoltz, Brian

    2010-06-14

    The use of high-throughput screening allowed for the optimization of reaction conditions for the palladium-catalyzed asymmetric decarboxylative alkylation reaction of enolate-stabilized enol carbonates. Changing to a non-polar reaction solvent and to an electron-deficient PHOX derivative as ligand from our standard reaction conditions improved the enantioselectivity for the alkylation of a ketal-protected,1,3-diketone-derived enol carbonate from 28% ee to 84% ee. Similar improvements in enantioselectivity were seen for a β-keto-ester derived- and an α-phenyl cyclohexanone-derived enol carbonate.

  8. Studies on Phase Behavior of Alkyl Polyglucoside Based on Microemulsions with Modified Fishlike Phase Diagram

    Jin Ling CHAI; Gan Zuo LI; Zhao Yu DIAO; Gao Yong ZHANG

    2004-01-01

    The three-phase behavior in the quaternary system of an alkyl (C8/10- or C12/14-) polyglucoside / 1-butanol / n-octane / water has been studied at 40 ℃ with the modified fishlike phase diagram, which is presented by us for the first time. The mass fraction of 1-butanol in the hydrophile-lipophile balanced interfacial layer, AS, the coordinates of the start point B and the end point E of the phase diagram, and the solubilities of alkyl polyglucoside and 1-butanol in n-octane phase were calculated. The solubilization of the microemulsion was also discussed.

  9. Replacing Conventional Carbon Nucleophiles with Electrophiles: Nickel-Catalyzed Reductive Alkylation of Aryl Bromides and Chlorides

    Everson, Daniel A.; Jones, Brittany A.; Weix, Daniel J.

    2012-01-01

    A general method is presented for the synthesis of alkylated arenes by the chemoselective combination of two electrophilic carbons. Under the optimized conditions, a variety of aryl and vinyl bromides are reductively coupled with alkyl bromides in high yields. Under similar conditions, activated aryl chlorides can also be coupled with bromoalkanes. The protocols are highly functional-group tolerant (−OH, −NHTs, −OAc, −OTs, −OTf, −COMe, −NHBoc, −NHCbz, −CN, −SO2Me), and the reactions are assem...

  10. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 interactions with western corn rootworm midgut membrane binding sites.

    Huarong Li

    Full Text Available BACKGROUND: Bacillus thuringiensis (Bt Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interactions are one line of evidence that Bt protein mechanisms of action differ and that the probability of receptor-mediated cross-resistance is low. METHODOLOGY/PRINCIPAL FINDINGS: Binding site interactions were investigated between Cry34Ab1/Cry35Ab1 and coleopteran active insecticidal proteins Cry3Aa, Cry6Aa, and Cry8Ba on western corn rootworm midgut brush border membrane vesicles (BBMV. Competitive binding of radio-labeled proteins to western corn rootworm BBMV was used as a measure of shared binding sites. Our work shows that (125I-Cry35Ab1 binds to rootworm BBMV, Cry34Ab1 enhances (125I-Cry35Ab1 specific binding, and that (125I-Cry35Ab1 with or without unlabeled Cry34Ab1 does not share binding sites with Cry3Aa, Cry6Aa, or Cry8Ba. Two primary lines of evidence presented here support the lack of shared binding sites between Cry34Ab1/Cry35Ab1 and the aforementioned proteins: 1 No competitive binding to rootworm BBMV was observed for competitor proteins when used in excess with (125I-Cry35Ab1 alone or combined with unlabeled Cry34Ab1, and 2 No competitive binding to rootworm BBMV was observed for unlabeled Cry34Ab1 and Cry35Ab1, or a combination of the two, when used in excess with (125I-Cry3Aa, or (125I-Cry8Ba. CONCLUSIONS/SIGNIFICANCE: Combining two or more insecticidal proteins active against the same target pest is one tactic to delay the onset of resistance to either protein. We conclude that Cry34Ab1/Cry35Ab1 are compatible with Cry3Aa, Cry6Aa, or Cry8Ba

  11. Ising and Heisenberg models on ferrimagnetic AB sub 2 chains

    Vitoriano, C; Raposo, E P

    2002-01-01

    We study the Ising and Heisenberg models on one-dimensional ferrimagnetic bipartite chains with the special AB sub 2 unit-cell topology and experimental motivation in inorganic and organic magnetic polymers. The spin-1/2 AB sub 2 Ising case is exactly solved in the presence of an external magnetic field. We also derive asymptotical low- and high-temperature limits of several thermodynamical quantities of the zero-field classical AB sub 2 Heisenberg model. Further, the quantum spin-1/2 AB sub 2 Heisenberg model in a field is studied using a mean-field approach.

  12. Copper(I)-catalyzed carbon-halogen bond-selective boryl substitution of alkyl halides bearing terminal alkene moieties

    Iwamoto, Hiroaki; Kubota, Koji; Yamamoto, Eiji; Ito, Hajime

    2015-01-01

    The selective boryl substitution of alkyl halides bearing terminal C=C double bonds has been achieved using a copper(I)/tricyclohexylphosphine or copper(I)/o-diphenylphosphinophenol catalyst. This reaction represents a useful complementary approach to conventional procedures for the hydroboration of C=C double bonds or the borylative cyclization of alkyl halides bearing terminal alkenes.

  13. 40 CFR 721.3130 - Sulfuric acid, mono-C9-11-alkyl esters, sodium salts.

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Sulfuric acid, mono-C9-11-alkyl esters... Specific Chemical Substances § 721.3130 Sulfuric acid, mono-C9-11-alkyl esters, sodium salts. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as...

  14. Solid-state fluorescence property and crystal structure of biphenyl derivatives with carboxyl and n-alkyl groups

    Imai, Yoshitane, E-mail: y-imai@apch.kindai.ac.j [Department of Applied Chemistry, Faculty of Science and Engineering, Kinki University, 3-4-1 Kowakae, Higashi-Osaka, Osaka 577-8502 (Japan); Kamon, Kensaku [Department of Applied Chemistry, Faculty of Science and Engineering, Kinki University, 3-4-1 Kowakae, Higashi-Osaka, Osaka 577-8502 (Japan); Tajima, Nobuo [First-Principles Simulation Group, Computational Materials Science Center, NIMS, Sengen, Tsukuba, Ibaraki 305-0047 (Japan); Kinuta, Takafumi [Department of Applied Chemistry, Faculty of Science and Engineering, Kinki University, 3-4-1 Kowakae, Higashi-Osaka, Osaka 577-8502 (Japan); Sato, Tomohiro [JST ERATO-SORST Kuroda Chiromorphology Team, 4-7-6 Komaba, Meguro-ku, Tokyo 153-0041 (Japan); Kuroda, Reiko [JST ERATO-SORST Kuroda Chiromorphology Team, 4-7-6 Komaba, Meguro-ku, Tokyo 153-0041 (Japan); Department of Life Sciences, Graduate School of Arts and Sciences, University of Tokyo, 3-8-1 Komaba, Meguro-ku, Tokyo 153-8902 (Japan); Matsubara, Yoshio, E-mail: y-matsu@apch.kindai.ac.j [Department of Applied Chemistry, Faculty of Science and Engineering, Kinki University, 3-4-1 Kowakae, Higashi-Osaka, Osaka 577-8502 (Japan)

    2010-06-15

    By introducing carboxyl and n-alkyl groups into a biphenyl molecule, we can increase the photoluminescence quantum yields of biphenyl derivatives in the solid state. The solid-state fluorescence maxima (lambda{sub em}) of 4-biphenylcarboxylic acid derivatives change according to the n-alkyl group introduced.

  15. Oxidative stability of fatty acid alkyl esters: a review.

    Michal Angelovič

    2015-12-01

    Full Text Available The purpose of this study was to investigate and to process the current literary knowledge of the physico-chemical properties of vegetable oil raw used for biodiesel production in terms of its qualitative stability. An object of investigation was oxidative stability of biodiesel. In the study, we focused on the qualitative physico-chemical properties of vegetable oils used for biodiesel production, oxidative degradation and its mechanisms, oxidation of lipids, mechanisms of autooxidation, effectivennes of different synthetic antioxidants in relation to oxidative stability of biodiesel and methods of oxidative stability determination. Knowledge of the physical and chemical properties of vegetable oil as raw material and the factors affecting these properties is critical for the production of quality biodiesel and its sustainability. According to the source of oilseed, variations in the chemical composition of the vegetable oil are expressed by variations in the molar ratio among different fatty acids in the structure. The relative ratio of fatty acids present in the raw material is kept relatively constant after the transesterification reaction. The quality of biodiesel physico-chemical properties is influenced by the chain length and the level of unsaturation of the produced fatty acid alkyl esters. A biodiesel is thermodynamically stable. Its instability primarily occurs from contact of oxygen present in the ambient air that is referred to as oxidative instability. For biodiesel is oxidation stability a general term. It is necessary to distinguish ‘storage stability' and ‘thermal stability', in relation to oxidative degradation, which may occur during extended periods of storage, transportation and end use. Fuel instability problems can be of two related types, short-term oxidative instability and long-term storage instability. Storage instability is defined in terms of solid formation, which can plug nozzles, filters, and degrade engine

  16. Guiding ab initio calculations by alchemical derivatives

    to Baben, M.; Achenbach, J. O.; von Lilienfeld, O. A.

    2016-03-01

    We assess the concept of alchemical transformations for predicting how a further and not-tested change in composition would change materials properties. This might help to guide ab initio calculations through multidimensional property-composition spaces. Equilibrium volumes, bulk moduli, and relative lattice stability of fcc and bcc 4d transition metals Zr, Nb, Mo, Tc, Ru, Rh, Pd, and Ag are calculated using density functional theory. Alchemical derivatives predict qualitative trends in lattice stability while equilibrium volumes and bulk moduli are predicted with less than 9% and 28% deviation, respectively. Predicted changes in equilibrium volume and bulk moduli for binary and ternary mixtures of Rh-Pd-Ag are in qualitative agreement even for predicted bulk modulus changes as large as +100% or -50%. Based on these results, it is suggested that alchemical transformations could be meaningful for enhanced sampling in the context of virtual high-throughput materials screening projects.

  17. Ab Initio Path to Heavy Nuclei

    Binder, Sven; Calci, Angelo; Roth, Robert

    2014-01-01

    We present the first ab initio calculations of nuclear ground states up into the domain of heavy nuclei, spanning the range from 16-O to 132-Sn based on two- plus three-nucleon interactions derived within chiral effective field theory. We employ the similarity renormalization group for preparing the Hamiltonian and use coupled-cluster theory to solve the many-body problem for nuclei with closed sub-shells. Through an analysis of theoretical uncertainties resulting from various truncations in this framework, we identify and eliminate the technical hurdles that previously inhibited the step beyond medium-mass nuclei, allowing for reliable validations of nuclear Hamiltonians in the heavy regime. Following this path we show that chiral Hamiltonians qualitatively reproduce the systematics of nuclear ground-state energies up to the neutron-rich Sn isotopes.

  18. Operator evolution for ab initio nuclear theory

    Schuster, Micah D; Johnson, Calvin W; Jurgenson, Eric D; Navratil, Petr

    2014-01-01

    The past two decades have seen a revolution in ab initio calculations of nuclear properties. One key element has been the development of a rigorous effective interaction theory, applying unitary transformations to soften the nuclear Hamiltonian and hence accelerate the convergence as a function of the model space size. For consistency, however, one ought to apply the same transformation to other operators when calculating transitions and mean values from the eigenstates of the renormalized Hamiltonian. Working in a translationally-invariant harmonic oscillator basis for the two- and three-nucleon systems, we evolve the Hamiltonian, square-radius and total dipole strength operators by the similarity renormalization group (SRG). The inclusion of up to three-body matrix elements in the 4He nucleus all but completely restores the invariance of the expectation values under the transformation. We also consider a Gaussian operator with adjustable range and find at short ranges an increased contribution from such ind...

  19. Discovering chemistry with an ab initio nanoreactor

    Martinez, Todd

    Traditional approaches for modeling chemical reaction networks such as those involved in combustion have focused on identifying individual reactions and using theoretical approaches to explore the underlying mechanisms. Recent advances involving graphical processing units (GPUs), commodity products developed for the videogaming industry, have made it possible to consider a distinct approach wherein one attempts to discover chemical reactions and mechanisms. We provide a brief summary of these developments and then discuss the concept behind the ``ab initio nanoreactor'' which explores the space of possible chemical reactions and molecular species for a given stoichiometry. The nanoreactor concept is exemplified with an example to the Urey-Miller reaction network which has been previously advanced as a potential model for prebiotic chemistry. We briefly discuss some of the future directions envisioned for the development of this nanoreactor concept.

  20. Ab initio molar volumes and Gaussian radii.

    Parsons, Drew F; Ninham, Barry W

    2009-02-12

    Ab initio molar volumes are calculated and used to derive radii for ions and neutral molecules using a spatially diffuse model of the electron distribution with Gaussian spread. The Gaussian radii obtained can be used for computation of nonelectrostatic ion-ion dispersion forces that underlie Hofmeister specific ion effects. Equivalent hard-sphere radii are also derived, and these are in reasonable agreement with crystalline ionic radii. The Born electrostatic self-energy is derived for a Gaussian model of the electronic charge distribution. It is shown that the ionic volumes used in electrostatic calculations of strongly hydrated cosmotropic ions ought best to include the first hydration shell. Ionic volumes for weakly hydrated chaotropic metal cations should exclude electron overlap (in electrostatic calculations). Spherical radii are calculated as well as nonisotropic ellipsoidal radii for nonspherical ions, via their nonisotropic static polarizability tensors. PMID:19140766

  1. Binary functionalization of H:Si(111) surfaces by alkyl monolayers with different linker atoms enhances monolayer stability and packing.

    Arefi, Hadi H; Nolan, Michael; Fagas, Giorgos

    2016-05-14

    Alkyl monolayer modified Si forms a class of inorganic-organic hybrid materials with applications across many technologies such as thin-films, fuel/solar-cells and biosensors. Previous studies have shown that the linker atom, through which the monolayer binds to the Si substrate, and any tail group in the alkyl chain, can tune the monolayer stability and electronic properties. In this paper we study the H:Si(111) surface functionalized with binary SAMs: these are composed of alkyl chains that are linked to the surface by two different linker groups. Aiming to enhance SAM stability and increase coverage over singly functionalized Si, we examine with density functional theory simulations that incorporate vdW interactions, a range of linker groups which we denote as -X-(alkyl) with X = CH2, O(H), S(H) or NH(2) (alkyl = C6 and C12 chains). We show how the stability of the SAM can be enhanced by adsorbing alkyl chains with two different linkers, e.g. Si-[C, NH]-alkyl, through which the adsorption energy is increased compared to functionalization with the individual -X-alkyl chains. Our results show that it is possible to improve stability and optimum coverage of alkyl functionalized SAMs linked through a direct Si-C bond by incorporating alkyl chains linked to Si through a different linker group, while preserving the interface electronic structure that determines key electronic properties. This is important since any enhancement in stability and coverage to give more densely packed monolayers will result in fewer defects. We also show that the work function can be tuned within the interval of 3.65-4.94 eV (4.55 eV for bare H:Si(111)). PMID:27109872

  2. Ab initio alpha-alpha scattering.

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  3. Ab initio alpha-alpha scattering

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Luu, Thomas; Meißner, Ulf-G.

    2015-12-01

    Processes such as the scattering of alpha particles (4He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei—nuclei with even and equal numbers of protons and neutrons—is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the ‘adiabatic projection method’ to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  4. Ablation dynamics in laser sclerotomy ab externo

    Brinkmann, Ralf; Droege, Gerit; Mohrenstecher, Dirk; Scheu, M.; Birngruber, Reginald

    1996-01-01

    Laser sclerostomy ab externo with flashlamp excited mid-IR laser systems emitting in the 2-3 micrometer spectral range is in phase II clinical trials. Although acutely high success rates were achieved, the restenosis rate after several months is about 40%. Laser pulses of several hundreds of microseconds, known to induce thermo-mechanical explosive evaporation were used for this procedure. We investigated the ablation dynamics in tissue and the cavitation bubble dynamics in water by means of an Er:YAG laser system to estimate the extent of mechanical damage zones in the sclera and in the anterior chamber, which may contribute to the clinical failure. We found substantial mechanical tissue deformation during the ablation process caused by the cavitation effects. Stress waves up to several bar generated by explosive evaporization were measured. The fast mechanical stretching and collapsing of the scleral tissue induced by cavitation resulted in tissue dissection as could be proved by flash photography and histology. The observed high restenosis might be a result of a subsequent enhanced wound healing process. Early fistula occlusions due to iris adherences, observed in about 20% of the clinical cases may be attributed to intraocular trauma induced by vapor bubble expansion through the anterior chamber after scleral perforation. An automatic feedback system minimizing adverse effects by steering and terminating the laser process during scleral fistulization is demonstrated. Moreover, a new approach in laser sclerostomy ab externo is presented using a cw-IR laser diode system emitting at the 1.94 micrometer mid-IR water absorption peak. This system was used in vitro and showed smaller damage zones compared to the pulsed laser radiation.

  5. 40 CFR 721.642 - Amines, N-(C14-18 and C16-16 unsaturated alkyl)] dipropylene-tri-, tripropylenetetra-, and...

    2010-07-01

    ... unsaturated alkyl)] dipropylene-tri-, tripropylenetetra-, and tetrapropylenepenta-. 721.642 Section 721.642... Amines, N-(C14-18 and C16-16 unsaturated alkyl)] dipropylene-tri-, tripropylenetetra-, and... substances amines, N-(C14-18 and C16-18 unsaturated alkyl)] dipropylenetri-, (PMN...

  6. Enzymatic production of alkyl esters through alcoholysis: A critical evaluation of lipases and alcohols

    Li, Deng; Xu, Xuebing; Gudmundur G, Haraldsson; Wang, Fang

    2005-01-01

    This paper focuses on a detailed evaluation of commercially available immobilized lipases and simple monohydric alcohols for the production of alkyl esters from sunflower oil by enzymatic alcoholysis. Six lipases were tested with seven alcohols, including straight and branched-chain primary and...

  7. A study on synthesis and oxidation mechanism of mono-alkyl phosphate

    Sheng Wang; Shu-yun Yan; Qing-guo Ye

    2009-01-01

    Oxidation of white phosphor, us by peroxides to produce mono-alkyl phosphate in the alcoholic solution has been studied under non-and catalytic conditions. In this paper, the mechanism of the oxidation process was analyzed. The content of mono-alkyl phosphalte in the product is affected by different types of alcoholic solution and peroxide solvent. The result shows the availabulity of the following order for the activity of the peroxide solvent and alcoholic solutions-tert-butyl hydroperoxide>(di) benzoyl peroxide>hydroperoxide; methanol> n-butyl alcohol> phenol. Under optimized reaction conditions: n (a white phosphorus) : n( tert-butyl hydroperoxide) : n (methanol)= 1:10:12, reaction temperature 80 ℃, reaction time 2.5 h, products of 80.0% mono-alkyl phosphonates can be provided when white phosphorus undergoes oxidation by tert-butyl hydroperoxide in the methanol solutions. When Cu (I), and Cn(Ⅱ) complexes are used as catalysts, it is possible to significantly enhance the oxidation of white phosphorus with the increase in the reaction rate. Th'e order for activity of catalysts is Cu(acac)2>Cu (CH3COO)2>Cu (C3 H7COO)2:>CuI>CuCI2. Noticeably, with Cu(acac)2 as catalyst, the selectivity for mono-alkyl phusphonates can reach 95% under adequate reaction conditions.

  8. Radiation chemistry of hydrocarbon and alkyl halide systems. Progress report, August 1, 1980-July 31, 1981

    The results reported here include new measurements on the four systems proposed for study last year. These are pulse radiolysis of alkyl iodide and perfluoaroalkyl iodide systems; gamma radiolysis of H2-CO mixtures; photochemistry and mass spectrometry of propane. The work accomplished is described

  9. Effect of alkyl-N-phenylcarbamates on photochemical activity of spinach chloroplasts

    This study is aimed to investigate the effect of alkyl-N-phenylcarbamates on photosynthetic electron transport in spinach chloroplasts, to determine site of action in the photosynthetic apparatus of spinach chloroplasts and to find correlations between their structure and biological activity. (authors)

  10. Selective synthesis of linear alkylbenzene by alkylation of benzene with 1-dodecene over desilicated zeolites

    Aslam, W.; Siddiqui, M. A. B.; Jermy, B. R.; Aitani, A.; Čejka, Jiří; Al-Khattaf, S.

    2014-01-01

    Roč. 227, MAY 2014 (2014), s. 187-197. ISSN 0920-5861 R&D Projects: GA ČR GBP106/12/G015 Institutional support: RVO:61388955 Keywords : zeolites * benzene alkylation * long-chain olefin Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.893, year: 2014

  11. Effect O6-Guanine Alkylation on DNA Flexibility Studied by Comparative Molecular Dynamics Simulations

    Kara, M.; Dršata, Tomáš; Lankaš, Filip; Zacharias, M.

    2015-01-01

    Roč. 103, č. 1 (2015), s. 23-32. ISSN 0006-3525 R&D Projects: GA ČR(CZ) GA14-21893S Institutional support: RVO:61388963 Keywords : DNA damage * DNA alkylation * DNA repair * molecular simulation * molecular dynamics simulation Subject RIV: BO - Biophysics Impact factor: 2.385, year: 2014

  12. Production of poly(alkyl cyanoacrylate)nanoparticles as a coating material that changes wetting property

    Alkyl cyanoacrylates have long been used for the synthesis of colloidal nanoparticles. In the involved polymerization reaction, OH- ions derived from dissociation of water have been used as an initiator. In the current research, functional groups on the surface of proteins were utilized as an initia...

  13. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  14. Preparation of 6,6'-Bisperfluoroalkylated BINOLs and Their Application in Asymmetric Alkylation of Benzaldehyde

    YIN,Yue-Yan(尹月燕); ZHAO,Gang(赵刚); YANG,Gao-Sheng(杨高升); YIN,Wei-Xing(殷卫星)

    2002-01-01

    6,6'-Bis(1H,1H,2H,2H-perfluorooctyl)-BINOL and 6,6'-bis(1H ,1H , 2 H , 2 H- perfluorodecyl ) -BINOL were synthesized through Suzuki coupling reaction and used in fluorous biphase asymmetric alkylation of benzaldehyde. Good enantioselectivity was obtained and the catalysts could be recovered by liquid-liquid extraction.

  15. Alkylation of phenols and acylation 2-methoxynaphthalene over SSZ-33, SSZ-35 and SSZ-42 zeolites

    Vitvarová, Dana; Lupínková, Lenka; Kubů, Martin

    2015-01-01

    Roč. 210, JUL 2015 (2015), s. 133-141. ISSN 1387-1811 R&D Projects: GA ČR GAP106/11/0819 Institutional support: RVO:61388955 Keywords : phenol alkylation * 2-methoxynaphthalene acylation * SSZ-33 Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.453, year: 2014

  16. Presence and sources of anthropogenic perfluorinated alkyl acids in tap-water based beverages

    C. Eschauzier; M. Hoppe; M. Schlummer; P. de Voogt

    2012-01-01

    This study investigates the presence and sources of perfluorinated alkyl acids (PFAAs) in tap water and corresponding tap-water based beverages such as coffee and cola collected in the city of Amsterdam, The Netherlands. Exposure pathways studies have shown that low concentrations of PFAA in tap wat

  17. Controlling the reversible thermochromism of polydiacetylene/zinc oxide nanocomposites by varying alkyl chain length.

    Chanakul, Amornsak; Traiphol, Nisanart; Traiphol, Rakchart

    2013-01-01

    In this work, polydiacetylene (PDA)/ZnO nanocomposites are successfully fabricated by using three types of monomers with different alkyl chain length, 5,7-hexadecadiynoic acid, 10,12-tricosadiynoic acid, and 10,12-pentacosadiynoic acid. The monomers dispersed in aqueous medium spontaneously assemble onto the surface of ZnO nanoparticles, promoted by strong interfacial interactions. The PDA/ZnO nanocomposites obtained via photopolymerization process are characterized by scanning electron microscopy, laser light scattering, infrared spectroscopy, and uv/vis absorption spectroscopy. The strength of interfacial interactions and morphologies of the nanocomposites are found to vary with alkyl chain length of the monomers. The PDA/ZnO nanocomposites also exhibit rather different thermochromic behaviors compared to their pure PDA counterparts. All nanocomposites show reversible blue/purple color transition upon multiple heating/cooling cycles, while the irreversible blue/red color transition is observed in the systems of pure PDAs. The shortening of alkyl side chain in PDA/ZnO nanocomposites leads to a systematic decrease in their color-transition temperatures. Colors of the nanocomposites at elevated temperature also vary with the alkyl chain length. Our results provide a simple route for controlling the reversible thermochromism of PDA-based materials, allowing their utilization in a wider range of applications. PMID:23058980

  18. Suppression of superoxide anion generation catalyzed by xanthine oxidase with alkyl caffeates and the scavenging activity.

    Masuoka, Noriyoshi; Kubo, Isao

    2016-05-01

    Alkyl caffeates are strong antioxidants and inhibitors of xanthine oxidase. However, it is unclear about the effect of caffeic acid and alkyl caffeates on superoxide anion (O2(-)) generation catalyzed by xanthine oxidase. Effects of caffeic acid and alkyl caffeates on the uric acid formation and O2(-) generation catalyzed by xanthine oxidase were analyzed. The scavenging activities of 1,1-diphenyl-2-picryhydrazyl (DPPH) radical and O2(-) generated with phenazine methosulfate (PMS) and NADH were examined. Caffeic acid derivatives equally suppressed O2(-) generation, and the suppression is stronger than inhibition of xanthine oxidase. Scavenging activity of O2(-) is low compared to the suppression of O2(-) generation. Suppression of O2(-) generation catalyzed by xanthine oxidase with caffeic acid derivatives was not due to enzyme inhibition or O2(-) scavenging but due to the reduction of xanthine oxidase molecules. Alkyl caffeates are effective inhibitors of uric acid and O2(-) catalyzed by xanthine oxidase as well as antioxidants for edible oil. PMID:26940252

  19. Enzymes versus heavy metal promoters and lewis acid catalysts in the synthesis of alkyl glycosides

    Wimmer, Zdeněk; Zarevúcka, Marie; Reitmayerová, Pavla

    Poitiers, 2003. s. 12. [International Symposium Green Chemistry . Uses and Applications of Renewable Raw Materials. 19.05.2003-22.05.2003, Poitiers] R&D Projects: GA ČR GA203/02/0166 Institutional research plan: CEZ:AV0Z4055905 Keywords : alkyl glycosides Subject RIV: CC - Organic Chemistry

  20. Masked N-Heterocyclic Carbene-Catalyzed Alkylation of Phenols with Organic Carbonates.

    Lui, Matthew Y; Yuen, Alexander K L; Masters, Anthony F; Maschmeyer, Thomas

    2016-09-01

    An easily prepared masked N-heterocyclic carbene, 1,3-dimethylimidazolium-2-carboxylate (DMI-CO2 ), was investigated as a "green" and inexpensive organocatalyst for the alkylation of phenols. The process made use of various low-toxicity and renewable alkylating agents, such as dimethyl- and diethyl carbonate, in a focused microwave reactor. DMI-CO2 was found to be a very active catalyst and excellent yields of a range of aryl alkyl ethers were obtained under relatively benign conditions. The observed difference in the conversion behavior of phenol methylation, in the presence of either the carbene or 1,8-diazabicycloundec-7-ene (DBU) catalyst, was rationalized on the basis of mechanistic investigations. The primary mode of action for the N-heterocyclic carbene is nucleophilic catalysis. Activation of the dialkyl carbonate electrophile results in concomitant evolution of an organo-soluble alkoxide, which deprotonates the phenolic starting material. In contrast, DBU is initially protonated by the phenol and thus consumed. Subsequent regeneration and participation in nucleophilic catalysis only becomes significant after some phenolate alkylation occurs. PMID:27528488

  1. Catalyst-controlled switch of regioselectivity in the asymmetric allylic alkylation of oxazolones with MBHCs.

    Zhu, Gongming; Yang, Junxian; Bao, Guangjun; Zhang, Ming; Li, Jing; Li, Yiping; Sun, Wangsheng; Hong, Liang; Wang, Rui

    2016-06-14

    A catalyst-controlled switch of regioselectivity in asymmetric allylic alkylation of oxazolones with MBHCs was described. The SN2'-SN2' reaction catalysed by a quinine-derived base produced γ-selective secondary allylic oxazolone derivatives, whereas the addition-elimination reaction catalysed by an amino acid-derived bifunctional urea catalyst provided β-selective primary adducts. PMID:27250517

  2. IONIC LIQUIDS AS A CLEAN CATALYST FOR THE ALKYLATION OF ISOBUTANE WITH 2-BUTENE

    Ionic liquids as a clean catalyst for the alkylation of isobutane with 2-buteneKyesang Yoo, a Vasudevan V. Namboodiri,b Panagiotis G. Smirniotis,*a and Rajender S. Varma*b a Department of Chemical Engineering, University of Cincinnati, Cincinnati, OH 45221-0171, USA. ...

  3. New Condensation Reaction of β-keto-δ-valerolactones, Carbon Disulfide and Alkyl Halides

    You Ming WANG; Yu Xin LI; Su Hua WANG; Zheng Ming LI

    2004-01-01

    β-Keto-δ-valerolactones, which were obtained by reaction of acetoacetate with aldehydes or ketones, reacted with carbon disulfide, alkyl halides and a new condensation reaction was developed. The structures of the products 3 were confirmed by 1HNMR spectra and elemental analysis.

  4. Helsingør Statement on poly- and perfluorinated alkyl substances (PFASs)

    Scheringer, Martin; Trier, Xenia; Cousins, Ian T.; de Voogt, Pim; Fletcher, Tony; Wang, Zhanyun; Webster, Thomas F.

    2014-01-01

    In this discussion paper, the transition from long-chain poly- and perfluorinated alkyl substances (PFASs) to fluorinated alternatives is addressed. Long-chain PFASs include perfluoroalkyl carboxylic acids (PFCAs) with 7 or more perfluorinated carbons, perfluoroalkyl sulfonic acids (PFSAs) with 6...

  5. Kinematic viscosity of biodiesel components (fatty acid alkyl esters) and related compounds at low temperatures

    Biodiesel, defined as the mono-alkyl esters of vegetable oils and animal fats, has undergone rapid development and acceptance recently. Kinematic viscosity is one of the fuel properties specified in biodiesel standards, with 40 deg C being the temperature at which this property is to be determined ...

  6. Immunological detection and quantification of DNA components structurally modified by alkylating carcinogens, mutagens and chemotherapeutic agents

    The detection and quantification of defined reaction products of chemical mutagens and carcinogens (and of many cancer chemotherapeutic agents) with DNA require highly sensitive analytical techniques. The exceptional capability of immunoglobulins to recognize subtle alterations of molecular structure (especially when monoclonal antibodies are used to maximize specificity), outstanding sensitivity of immunoanalysis by high-affinity antibodies, and the fact that radioactively-labelled agents are not required suggest the utility of a radioimmunoassay to recognize and quantitate alkylated DNA products. We have recently developed a set of high-affinity monoclonal antibodies (secreted by mouse x mouse as well as by rat x rat hybridomas; antibody affinity constants, 109 to > 1010 lmol) specifically directed against several DNA alkylation products with possible relevance in relation to both mutagenesis and malignant transformation of mammalian cells. These alkylation products include 06-N-butyldeoxyguanosine, and 04-ethyldeoxythymidine. When used in a radioimmunassay, an antibody specific for 06-ethyldeoxyguanosine, for example, will detect this product at an 06-ethyldeoxyguanosine/deoxyguanosine molar ratio of approx. 3 x 10-7 in a hydrolysate of 100 ug of DNA. The limit of detection can be lowered further if the respective alkyldeoxynucleosides are separated by HPLC from the DNA hydrolysate prior to the RIA. The anti-alkyldeoxynucleoside monoclonal antibodies can also be used to visualize, by immunostaining and fluorescence microscopy combined with electronic image intensification, specific alkylation products in the nuclear DNA of individual cells, and to localize structurally modified bases in double-stranded DNA molecules by transmission electron microscopy

  7. Ionic liquids as solvent for efficient esterification of carboxylic acids with alkyl halides

    carboxylic, Ionic liquids as solvent for efficient e

    2010-01-01

    The selective esterification of carboxylic acid derivatives with a variety of alkyl halides was carried out using ionic liquid as solvent in the presence of triethylamine. The reaction was found to proceed under relatively mild conditions with excellent conversions (up to 99%) and selectivities. The ionic liquid was recycled and reused.

  8. Characterization of alkyl carbon in forest soils by CPMAS 13C NMR spectroscopy and dipolar dephasing

    Kogel-Knabner, I.; Hatcher, P.G.

    1989-01-01

    Samples obtained from forest soils at different stages of decomposition were treated sequentially with chloroform/methanol (extraction of lipids), sulfuric acid (hydrolysis), and sodium chlorite (delignification) to enrich them in refractory alkyl carbon. As revealed by NMR spectroscopy, this treatment yielded residues with high contents of alkyl carbon. In the NMR spectra of residues obtained from litter samples, resonances for carbohydrates are also present, indicating that these carbohydrates are tightly bound to the alkyl carbon structures. During decomposition in the soils this resistant carbohydrate fraction is lost almost completely. In the litter samples the alkyl carbon shows a dipolar dephasing behavior indicative of two structural components, a rigid and a more mobile component. As depth and decomposition increase, only the rigid component is observed. This fact could be due to selective degradation of the mobile component or to changes in molecular mobility during decomposition, e.g., because of an increase in cross linking or contact with the mineral matter of the soil.

  9. The Cyclization of Alkyl Side Chains of Naphthalenes: GC/Potential Energies/FTIR Approach

    Straka, Pavel; Novotná, M.; Buryan, P.; Bičáková, Olga

    2014-01-01

    Roč. 5, č. 14 (2014), s. 957-968. ISSN 2156-8251 Institutional support: RVO:67985891 Keywords : alkyl naphtalenes * retention times * molecular mechanics * Van der Waals forces Subject RIV: CC - Organic Chemistry http://www.scirp.org/journal/AJAC/

  10. Repair of Alkylation Damage in Eukaryotic Chromatin Depends on Searching Ability of Alkyladenine DNA Glycosylase.

    Zhang, Yaru; O'Brien, Patrick J

    2015-11-20

    Human alkyladenine DNA glycosylase (AAG) initiates the base excision repair pathway by excising alkylated and deaminated purine lesions. In vitro biochemical experiments demonstrate that AAG uses facilitated diffusion to efficiently search DNA to find rare sites of damage and suggest that electrostatic interactions are critical to the searching process. However, it remains an open question whether DNA searching limits the rate of DNA repair in vivo. We constructed AAG mutants with altered searching ability and measured their ability to protect yeast from alkylation damage in order to address this question. Each of the conserved arginine and lysine residues that are near the DNA binding interface were mutated, and the functional impacts were evaluated using kinetic and thermodynamic analysis. These mutations do not perturb catalysis of N-glycosidic bond cleavage, but they decrease the ability to capture rare lesion sites. Nonspecific and specific DNA binding properties are closely correlated, suggesting that the electrostatic interactions observed in the specific recognition complex are similarly important for DNA searching complexes. The ability of the mutant proteins to complement repair-deficient yeast cells is positively correlated with the ability of the proteins to search DNA in vitro, suggesting that cellular resistance to DNA alkylation is governed by the ability to find and efficiently capture cytotoxic lesions. It appears that chromosomal access is not restricted and toxic sites of alkylation damage are readily accessible to a searching protein. PMID:26317160

  11. Exploring a chemical encoding strategy for combinatorial synthesis using Friedel-Crafts alkylation

    Scott, Robin H.; Barnes, Colin; Gerhard, Ulrich; Balasubramanian, Shankar

    1999-01-01

    The use of scandium(III) triflate and ytterbium(III) triflate-catalysed Friedel-Crafts alkylation to insert a set of hydroxymethyl pyrrole amide tags (1b-i) on to polystyrene resins under mild conditions and the encoding of a split and mix peptide library is demonstrated.

  12. The effect of MFI zeolite lamellar and related mesostructures on toluene disproportionation and alkylation

    Jo, Ch.; Ryoo, R.; Žilková, Naděžda; Vitvarová, Dana; Čejka, Jiří

    2013-01-01

    Roč. 3, č. 8 (2013), s. 2119-2129. ISSN 2044-4753 R&D Projects: GA ČR(CZ) GAP106/12/0189 Institutional support: RVO:61388955 Keywords : Adsorption measurement * Alkylation of toluene * Isopropyl alcohol s Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.760, year: 2013

  13. Memory effects in palladium-catalyzed allylic Alkylations of 2-cyclohexen-1-yl acetate

    Svensen, Nina; Fristrup, Peter; Tanner, David Ackland;

    2007-01-01

    The objective of this work was to characterize the enantiospecificity of the allylic alkylation of enantioenriched 2-cyclohexen-1-yl acetate with the enolate ion of dimethyl malonate catalyzed by unsymmetrical palladium catalysts. The precatalysts employed were (eta(3)-allyl)PdLCl, where L is a...

  14. Direct C-H alkylation and indole formation of anilines with diazo compounds under rhodium catalysis.

    Mishra, Neeraj Kumar; Choi, Miji; Jo, Hyeim; Oh, Yongguk; Sharma, Satyasheel; Han, Sang Hoon; Jeong, Taejoo; Han, Sangil; Lee, Seok-Yong; Kim, In Su

    2015-12-18

    The rhodium(III)-catalyzed direct functionalization of aniline C-H bonds with α-diazo compounds is described. These transformations provide a facile construction of ortho-alkylated anilines with diazo malonates or highly substituted indoles with diazo acetoacetates. PMID:26458276

  15. Adsorption Kinetics of Alkyl Polyglucoside at the Air-Solution Interface

    2002-01-01

    The air-solution equilibrium tension ye and dynamic surface tension ye, of nonionic surfactant alkyl polyglucoside have been studied. ye was measured by the Wilhelmy method with tension vs. concentration curve. The ye decays were measured in the range 0.2~20 s using a maximum bubble pressure instrument and analyzed with the Ward and Tordai cquation.

  16. Influence of Backbone Fluorination in Regioregular Poly(3-alkyl-4-fluoro)thiophenes

    Fei, Zhuping

    2015-06-03

    © 2015 American Chemical Society. We report two strategies toward the synthesis of 3-alkyl-4-fluorothiophenes containing straight (hexyl and octyl) and branched (2-ethylhexyl) alkyl groups. We demonstrate that treatment of the dibrominated monomer with 1 equiv of alkyl Grignard reagent leads to the formation of a single regioisomer as a result of the pronounced directing effect of the fluorine group. Polymerization of the resulting species affords highly regioregular poly(3-alkyl-4-fluoro)thiophenes. Comparison of their properties to those of the analogous non-fluorinated polymers shows that backbone fluorination leads to an increase in the polymer ionization potential without a significant change in optical band gap. Fluorination also results in an enhanced tendency to aggregate in solution, which is ascribed to a more co-planar backbone on the basis of Raman and DFT calculations. Average charge carrier mobilities in field-effect transistors are found to increase by up to a factor of 5 for the fluorinated polymers.

  17. Root uptake and translocation of perfluorinated alkyl acids by three hydroponically grown crops

    S. Felizeter; M.S. McLachlan; P. de Voogt

    2014-01-01

    Tomato, cabbage, and zucchini plants were grown hydroponically in a greenhouse. They were exposed to 14 perfluorinated alkyl acids (PFAAs) at four different concentrations via the nutrient solution. At maturity the plants were harvested, and the roots, stems, leaves, twigs (where applicable), and ed

  18. Carbon Dioxide Induced Alkene Extrusion from Bis(pentamethylcyclopentadienyl)titanium(III) Alkyls

    Luinstra, Gerrit A.; Teuben, Jan H.

    1987-01-01

    Reaction of titanium(III) alkyls, (η5-C5Me5)2TiR (R = Et or Prn), in toluene solution with CO2 proceeds at room temperature with formation of the titanium formate (η5-C5Me5)2TiO2CH, and the corresponding alkene (ethene or propene).

  19. Polyvinylchloride/clay nanocomposites based on the alkyl-amine intercalates with different length of chain

    Kalendová, A.; Pospíšil, M.; Kovářová, L.; Měřínská, D.; Šimoník, J.; Čapková, P.; Valášková, M.; Vlková, Helena

    Akron : Polymer Processing Society , 2004. s. 248. [Polymer Processing Society Annual Meeting. 20.06.2004-24.06.2004, Akron] R&D Projects: GA AV ČR KSK4050111 Keywords : polyvinylchloride/clay * alkyl-amine intercalates * polymer nanotechnology Subject RIV: CD - Macromolecular Chemistry

  20. The use of polynuclear aromatic hydrocarbon (PAH) alkyl homologues in determining petroleum source identification and weathering

    Techniques utilizing double ratio plots of selected polynuclear aromatic hydrocarbon (PAH) alkyl homologues were used to identify and distinguish crude oils and refined petroleum products from each other and to distinguish petroleum sources in complex pollutant regimes. Petroleum samples were fractionated by high performance liquid chromatography (HPLC) into saturated and aromatic (PAH) hydrocarbon fractions. The saturated hydrocarbon fractions were then analyzed by gas chromatography/flame ionization detection (GC/FID) to obtain a resolved/unresolved alkane fingerprint of each oil. The aromatic fractions of the oils were analyzed by gas chromatography/mass spectrometry (GC/MS) for PAH and selected alkyl homologues. Comparisons of the saturated hydrocarbon fingerprints indicated that some oils were indistinguishable based on the alkane fingerprint alone. Another double ratio plot of the alkyl chrysenes and alkyl dibenzothiophenes was effective in establishing the weathering of oil in environmental samples which were processed using the same analytical techniques, since the dibenzothiophenes are degraded more rapidly than the chrysenes. The application of selected ratios in oil spill source identification in complex environmental samples from Suisin Bay California and Boston Harbor are discussed. The use of ratios to measure the extent of weathering in oil spill samples from Prince William Sound and the Gulf of Alaska is examined

  1. A cyclic (alkyl)(amido)carbene: synthesis, study and utility as a desulfurization reagent.

    McCarty, Zachary R; Lastovickova, Dominika N; Bielawski, Christopher W

    2016-04-01

    The synthesis and study of a cyclic (alkyl)(amido)carbene is described. The carbene was found to undergo C-H insertion at low temperatures, formed cyclopropenes upon exposure to alkynes, and facilitated desulfurization reactions. Spectroscopic studies revealed that the carbene is strongly π-accepting but retains a complimentary degree of σ-donating properties. PMID:27010415

  2. Enantioselective copper catalyzed allylic alkylation using Grignard reagents; Applications in synthesis

    Zijl, Anthoni Wouter van

    2009-01-01

    Enantioselective copper catalyzed allylic alkylation is a powerful carbon-carbon bond forming reaction. In this thesis the development of a new catalyst for the use of Grignard reagents in this reaction is described. This catalyst is based on copper and the ligand Taniaphos. The high regio- and enan

  3. Side reactions of N-terminal cysteine residue in peptides alkylated with various reagents

    Řehulková, Helena; Řehulka, Pavel

    Jena : ESF, 2008. s. 26. [Central and Eastern European Proteomic Conference /2./. 12.10.2008-15.10.2008, Jena] R&D Projects: GA MŠk 1M06030 Institutional research plan: CEZ:AV0Z40310501 Keywords : alkylation of proteins/peptides * MALDI-MS/MS Subject RIV: CB - Analytical Chemistry, Separation

  4. Formation of furan fatty alkyl esters from their bis-epoxide fatty esters

    Reactions of epoxidized alkyl soyate with four different alcohols: ethanol, isopropyl alcohol, 2-ethylhexanol, benzyl alcohol, in the presence of Bronsted acid catalyst, were investigated. Products that were not reported in prior studies of similar reactions were found. These were furan fatty acid a...

  5. Z-Selective copper-catalyzed asymmetric allylic alkylation with Grignard reagents.

    Giannerini, Massimo; Fañanás-Mastral, Martín; Feringa, Ben L

    2012-03-01

    Allylic gem-dichlorides undergo regio- and enanantioselective (er up to 99:1) copper-catalyzed allylic alkylation with Grignard reagents affording chiral Z-vinyl chlorides. This highly versatile class of synthons can be subjected to Suzuki cross coupling affording optically active Z-alkenes and 1,3-cis,trans dienes. PMID:22352853

  6. Stereospecific Ni-Catalyzed Cross-Coupling of Potassium Alkenyltrifluoroborates with Alkyl Halides

    Molander, Gary A.; Argintaru, O. Andreea

    2014-01-01

    A general method for the alkenylation of alkyl electrophiles using nearly stoichiometric amounts of the air- and moisture-stable potassium organotrifluoroborates has been developed. Various functional groups were tolerated on both the nucleophilic and electrophilic partner. Reactions of highly substituted E- and Z-alkenyltrifluoroborates, as well as vinyl- and propenyltrifluoroborates, were successful, and no loss of stereochemistry or regiochemistry was observed.

  7. Z-Selective Copper-Catalyzed Asymmetric Allylic Alkylation with Grignard Reagents

    Giannerini, Massimo; Fananas-Mastral, Martin; Feringa, Ben L.; Fañanás-Mastral, Martín

    2012-01-01

    Allylic gem-dichlorides undergo regio- and enanantioselective (er up to 99:1) copper-catalyzed allylic alkylation with Grignard reagents affording chiral Z-vinyl chlorides. This highly versatile class of synthons can be subjected to Suzuki cross coupling affording optically active Z-alkenes and 1,3-cis,trans dienes.

  8. Dicty_cDB: FCL-AB06 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AB06 (Link to dictyBase) - - - Contig-U15603-1 FCL-AB06P ...(Link to Original site) FCL-AB06F 694 FCL-AB06Z 573 FCL-AB06P 1267 - - Show FCL-AB06 Library FCL (Link to library) Clone ID FCL-...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AB/FCL-AB06Q....Seq.d/ Representative seq. ID FCL-AB06P (Link to Original site) Representative DNA sequence >FCL-AB06 (FCL-AB06Q) /CSM/FCL/FCL-...AB/FCL-AB06Q.Seq.d/ CAATTTTATCGGAACCATCAATTCATGCAGGTTCTGTATTTAGTATTAATTTAACCAAAT CTAGACA

  9. Temporal variability, sources, and sinks of C1-C5 alkyl nitrates in Coastal New England

    B. C. Sive

    2009-11-01

    Full Text Available Seven C1-C5 alkyl nitrates were measured both on the mainland and off the coast of New Hampshire using gas chromatographic techniques. Five separate data sets will be presented to characterize the seasonal and diurnal trends and the major sources and loss processes of these compounds. In situ measurements were conducted at the University of New Hampshire (UNH Atmospheric Observing Station at Thompson Farm (TF located in southeast NH during winter (January–February and summer (June–August 2002 and summer (July–August 2004. The median (±standard deviation total alkyl nitrate mixing ratio (ΣRONO2 was 25 (±7 in winter and 16 (±14 pptv in summer. Furthermore, daily canister samples collected at midday and later analyzed in the laboratory from January 2004–February 2008 gave median ΣRONO2 of 23 (±8 in winter and 14 (±10 pptv in summer. Alkyl nitrate mixing ratios increased throughout the morning and were highest in the afternoon reflecting mixing of remnant boundary layer air toward the surface and photochemical production during the day. During summers 2002 and 2004, MeONO2 decreased overnight and reached minimum hourly average mixing ratios in the early morning (05:00–07:00 LT. Comparison with wind speed and trace gas (i.e., hydrocarbons, ozone, carbon monoxide, total reactive nitrogen trends suggested that dry deposition contributed to the early morning MeONO2 minimum which is a previously unaccounted for removal mechanism. The mean dry deposition rate and velocity of MeONO2 was estimated to be −0.5 nmol m−2 hr−1 and 0.13 cm s−1, respectively. Results from ambient air and surface seawater measurements made onboard the NOAA R/V Ronald H. Brown in the Gulf of Maine during the 2002 New England Air Quality Study and from ambient canister samples collected throughout the Great Bay estuary in August 2003 are also presented. Comparisons between the alkyl nitrate trends with anthropogenic and marine source fingerprints and tracers

  10. A Case of Laptop Computer-Induced Erythema Ab Igne

    Nurettin Özgür Doğan

    2014-12-01

    Full Text Available Erythema ab igne, also known as toasted skin syndrome, is a skin reaction characterized by reticulate erythema, brown pigmentation, and telangiectasia. In some cases, epidermal atrophy and scaling are also identified. The condition is usually caused by prolonged exposure to a source of heat or infrared radiation. Here, we report a case of erythema ab igne associated with laptop computer use.

  11. Kopplung von Dichtefunktional- und ab-initio-Methoden

    Goll, Erich

    2008-01-01

    Im Rahmen der Doktorarbeit wurde untersucht, inwieweit die Kopplung von Dichtefunktionalmethoden und ab-initio-Korrelationsmethoden der Quantenchemie eine Verbesserung bezüglich beider Grenzmethoden erbringt. Die Kopplung erfolgt durch eine Aufspaltung des interelektronischen Hamiltonoperators (abstoßende Coulombwechselwirkung). Die kurzreichweitige Wechselwirkung wird mit Dichtefunktionaltheorie behandelt, die langreichweitige mit Hilfe von ab-initio-Methoden. Diese Aufteilung soll dazu dien...

  12. Thermodynamic Interactions between Polystyrene and Long-Chain Poly(n-Alkyl Acrylates) Derived from Plant Oils.

    Wang, Shu; Robertson, Megan L

    2015-06-10

    Vegetable oils and their fatty acids are promising sources for the derivation of polymers. Long-chain poly(n-alkyl acrylates) and poly(n-alkyl methacrylates) are readily derived from fatty acids through conversion of the carboxylic acid end-group to an acrylate or methacrylate group. The resulting polymers contain long alkyl side-chains with around 10-22 carbon atoms. Regardless of the monomer source, the presence of alkyl side-chains in poly(n-alkyl acrylates) and poly(n-alkyl methacrylates) provides a convenient mechanism for tuning their physical properties. The development of structured multicomponent materials, including block copolymers and blends, containing poly(n-alkyl acrylates) and poly(n-alkyl methacrylates) requires knowledge of the thermodynamic interactions governing their self-assembly, typically described by the Flory-Huggins interaction parameter χ. We have investigated the χ parameter between polystyrene and long-chain poly(n-alkyl acrylate) homopolymers and copolymers: specifically we have included poly(stearyl acrylate), poly(lauryl acrylate), and their random copolymers. Lauryl and stearyl acrylate were chosen as model alkyl acrylates derived from vegetable oils and have alkyl side-chain lengths of 12 and 18 carbon atoms, respectively. Polystyrene is included in this study as a model petroleum-sourced polymer, which has wide applicability in commercially relevant multicomponent polymeric materials. Two independent methods were employed to measure the χ parameter: cloud point measurements on binary blends and characterization of the order-disorder transition of triblock copolymers, which were in relatively good agreement with one another. The χ parameter was found to be independent of the alkyl side-chain length (n) for large values of n (i.e., n > 10). This behavior is in stark contrast to the n-dependence of the χ parameter predicted from solubility parameter theory. Our study complements prior work investigating the interactions between

  13. Response to alkylation damage of fibroblast cells from patients with therapy-related myeloid neoplasms

    Therapy-related myeloid neoplasms (t-MNs) are severe long-term consequences of chemo- and/or radiotherapy for a primary disease. It is generally accepted that genetic predisposition plays a major role in therapy-related leukemogenesis. The hypothesis that cellular response mechanisms to alkylation damage are deregulated in constitutional cells of patients with t-MNs due to predisposing genetic events was tested in this study. It was further examined whether genetic instability would also be a consequence of such a treatment. Therefore primary fibroblast cultures were established from skin biopsies from patients with t-MNs and matched healthy controls. These cultures were treated with the cyclophosphamide derivate phosphoramide mustard (PM), a bifunctional alkylating agent. The cellular response to alkylation damage was assessed with respect to cell viability, cell cycle regulation and chromosomal stability. Increased sensitivity to PM treatment could be demonstrated in 7/13 (54%) patient samples. IC50, IC75 and IC90 values as well as the percentage of viable cells at higher PM concentrations were significantly different when comparing patient and control groups. Both, fibroblast cells from patients and controls, properly induced cell cycle arrest following alkylating injury in the G2/M phase of the cell cycle. Gross genomic alterations like chromosome and chromatid breaks as well as structural and clonal numerical aberrations could be induced via PM treatment. The extent of induced changes per mitosis, however, was comparable in both, patient and control fibroblast cultures. These data demonstrate for the first time hypersensitivity of constitutional cells from patients with t-MNs to alkylation treatment indicating impaired DNA damage response and/or repair mechanisms. (author)

  14. Effects of Cry1F and Cry34Ab1/35Ab1 on storage pests

    Two crystalline protoxins from Bacillus thuringiensis (Bt), Cry1Fa1 and Cry34Ab1/Cry35Ab1 (Cry1F, Cry34/35), were evaluated for efficacy against lepidopteran and coleopteran storage pests. Cry1F was tested against the lepidopterans Sitotroga cerealella (Angoumois grain moth) and colonies of the lep...

  15. Synthesis of alkyl-ether glycerophospholipids in rat glomerular mesangial cells: evidence for alkyldihydroxyacetone phosphate synthase activity

    We studied the ability of rat glomerular mesangial cells and their microsomal fractions to incorporate 1-[14C]hexadecanol to glycerophospholipids via an O-alkyl ether linkage and assessed the presence and activity of the required enzyme: alkyl-dihydroxy acetone phosphate synthase. Suspensions of cultured mesangial cells incorporated 1-[14C]hexadecanol to the phosphatidyl ethanolamine and phosphatidyl choline lipid pools, via a bond resistant to acid and base hydrolysis. When cell homogenates or microsomal fractions were incubated with palmitoyl-DHAP and 1-[14C]hexadecanol, alkyl-DHAP and 1-O-alkyl glycerol were formed (alkyl:hexadecyl). The activity of the enzyme responsible for the O-alkyl product formation was calculated to be 2.5 +/- 0.3 and 544 +/- 50 pmoles/min/mg protein for mesangial cell homogenates and mesangial cell microsomes, respectively. These observations provide evidence that mesangial cells may elaborate either linked lipid precursors de novo for the biosynthesis of O-alkyl glycerophospholipids

  16. Preparation of grafted ABS and compatibilization of r-PET/ABS blends by the grafted ABS%ABS接枝物的制备及其对r-PET/ABS的增容作用

    陈智军; 王益龙; 郑辰

    2012-01-01

    Two kinds of grafted acrylonitrile-butadiene-styrene copolymer(ABS), i.e. maleic anhydride (MAH) grafted ABS(ABS-g-MAH) and glycidyl methacrylate (GMA) grafted ABS (ABS-g-GMA), were prepared via reactive extrusion and were used as compatibilizer for recycled polyethylene glycol terephthalate (r-PET)/ABS blends. The results show that ABS-g-MAH and ABS-g-GMA can greatly improve the impact strength of the blends. ABS-g-MAH is superior to ABS-g-GMA in compatibilization effect. The optimal compatibilization effect is acquired when the grafting ratio of ABS-g-MAH is 1.35% and the mass content of the copolymer is 5%. Under such conditions, the notched and unnotched *Charpy impact strength of the r-PET/ABS/ABS-g--MAH blends rise by 42% and 23%, respectively, in comparison with those of r-PET/ ABS. The observation by scanning electron microscope(SEM) shows that adding grafted ABS can make ABS be dispersed more homogeneously in the r-PET continuous phase and make particle size more even.%通过反应挤出法制备马来酸酐(MAH)接枝丙烯腈-丁二烯-苯乙烯三元共聚物(ABS)(ABS-g-MAH)和甲基丙烯酸缩水甘油酯(GMA)接枝ABS(ABS-g-GMA),将其用于增容回收聚对苯二甲酸乙二酯(PET)瓶片(r-PET)/ABS共混物,发现能显著提高其混物的冲击强度.ABS-g-MAH的增容效果优于ABS-g-GMA;ABS-g-MAH的接枝率为1.35%,w(ABS-g-MAH)为5%时对r-PET/ABS的增容作用最佳,此时r-PET/ABS/ABS-g-MAH的简支梁缺口冲击强度和无缺口冲击强度比r-PET/ABS分别提高了42%和23%.扫描电子显微镜观察表明,加入ABS接枝物能使ABS在r-PET连续相中的分散更均匀,粒径尺寸更均一.

  17. Structural and biophysical characterization of Bacillus thuringiensis insecticidal proteins Cry34Ab1 and Cry35Ab1.

    Matthew S Kelker

    Full Text Available Bacillus thuringiensis strains are well known for the production of insecticidal proteins upon sporulation and these proteins are deposited in parasporal crystalline inclusions. The majority of these insect-specific toxins exhibit three domains in the mature toxin sequence. However, other Cry toxins are structurally and evolutionarily unrelated to this three-domain family and little is known of their three dimensional structures, limiting our understanding of their mechanisms of action and our ability to engineer the proteins to enhance their function. Among the non-three domain Cry toxins, the Cry34Ab1 and Cry35Ab1 proteins from B. thuringiensis strain PS149B1 are required to act together to produce toxicity to the western corn rootworm (WCR Diabrotica virgifera virgifera Le Conte via a pore forming mechanism of action. Cry34Ab1 is a protein of ∼14 kDa with features of the aegerolysin family (Pfam06355 of proteins that have known membrane disrupting activity, while Cry35Ab1 is a ∼44 kDa member of the toxin_10 family (Pfam05431 that includes other insecticidal proteins such as the binary toxin BinA/BinB. The Cry34Ab1/Cry35Ab1 proteins represent an important seed trait technology having been developed as insect resistance traits in commercialized corn hybrids for control of WCR. The structures of Cry34Ab1 and Cry35Ab1 have been elucidated to 2.15 Å and 1.80 Å resolution, respectively. The solution structures of the toxins were further studied by small angle X-ray scattering and native electrospray ion mobility mass spectrometry. We present here the first published structure from the aegerolysin protein domain family and the structural comparisons of Cry34Ab1 and Cry35Ab1 with other pore forming toxins.

  18. Unresolved complex mixtures (UCMs) of aromatic hydrocarbons: branched alkyl indanes and branched alkyl tetralins are present in UCMs and accumulated by and toxic to, the mussel Mytilus edulis.

    Booth, Andrew M; Scarlett, Alan G; Lewis, C Anthony; Belt, Simon T; Rowland, Steven J

    2008-11-01

    Previously, comprehensive two-dimensional gas chromatography-time of flight-mass-spectrometry (GCxGC-ToF-MS) revealed that the unresolved complex mixtures (UCMs) of contaminant hydrocarbons accumulated by health-affected mussels Mytilus edulis (up to 125 microg g dry weight(-1)) collected from around U.K. coasts, included many isomeric branched alkyl benzenes (BABs). A commercial mixture of BABs (C12-C14) was toxic to mussels in laboratorytests (tissue effective concentration EC(20)10.5 microg g dry tissue(-1)). Branched alkyl indanes (BINs) and branched alkyl tetralins (BATs) were also tentatively identified in the wild mussels, but no commercial sources of BINs or BATs were available for compound confirmation or toxicity testing. In the present study, we synthesized 14 isomeric BINs and BATs, investigated their chromatographic and mass spectral properties and measured their toxicity to mussels (Mytilus edulis). Comparison of the results of GCxGC-ToF-MS analysis of the synthesized compounds with those of complex mixtures of BINs and BATs in wild mussels confirmed the previous tentative identifications. Toxicity assays showed that in 72 h exposures, each of the synthetic BINs and BATs and a mixture of all were toxic to mussels at concentrations comparable to the BABs investigated previously (EC(20)13 microg g dry tissue(-1)). A further 5 day recovery period in clean water resulted in incomplete depuration of the accumulated body burden of BINs and BATs by the mussels. We suggest that monitoring of hydrocarbon contaminants in mussels should include an assessment of the concentrations of aromatic UCMs and ideally identification and measurement of the concentrations of BABs, BINs, and BATs and other toxic UCM components in order that the effects of these toxicants are not overlooked. PMID:19031912

  19. Benchmark binding energies of ammonium and alkyl-ammonium ions interacting with water. Are ammonium-water hydrogen bonds strong?

    Vallet, Valérie; Masella, Michel

    2015-01-01

    Alkyl-ammonium ion/water interactions are investigated using high level quantum computations, yielding thermodynamics data in good agreement with gas-phase experiments. Alkylation and hydration lead to weaken the NHsbnd O hydrogen bonds. Upon complete hydration by four water molecules, their main features are close to those of the OHsbnd O bond in the isolated water dimer. Energy decomposition analyses indicate that hydration of alkyl-ammonium ions are mainly due to electrostatic/polarization effects, as for hard monoatomic cations, but with a larger effect of dispersion.

  20. Ab initio gene identification in metagenomic sequences.

    Zhu, Wenhan; Lomsadze, Alexandre; Borodovsky, Mark

    2010-07-01

    We describe an algorithm for gene identification in DNA sequences derived from shotgun sequencing of microbial communities. Accurate ab initio gene prediction in a short nucleotide sequence of anonymous origin is hampered by uncertainty in model parameters. While several machine learning approaches could be proposed to bypass this difficulty, one effective method is to estimate parameters from dependencies, formed in evolution, between frequencies of oligonucleotides in protein-coding regions and genome nucleotide composition. Original version of the method was proposed in 1999 and has been used since for (i) reconstructing codon frequency vector needed for gene finding in viral genomes and (ii) initializing parameters of self-training gene finding algorithms. With advent of new prokaryotic genomes en masse it became possible to enhance the original approach by using direct polynomial and logistic approximations of oligonucleotide frequencies, as well as by separating models for bacteria and archaea. These advances have increased the accuracy of model reconstruction and, subsequently, gene prediction. We describe the refined method and assess its accuracy on known prokaryotic genomes split into short sequences. Also, we show that as a result of application of the new method, several thousands of new genes could be added to existing annotations of several human and mouse gut metagenomes. PMID:20403810

  1. Ab initio two-component Ehrenfest dynamics

    We present an ab initio two-component Ehrenfest-based mixed quantum/classical molecular dynamics method to describe the effect of nuclear motion on the electron spin dynamics (and vice versa) in molecular systems. The two-component time-dependent non-collinear density functional theory is used for the propagation of spin-polarized electrons while the nuclei are treated classically. We use a three-time-step algorithm for the numerical integration of the coupled equations of motion, namely, the velocity Verlet for nuclear motion, the nuclear-position-dependent midpoint Fock update, and the modified midpoint and unitary transformation method for electronic propagation. As a test case, the method is applied to the dissociation of H2 and O2. In contrast to conventional Ehrenfest dynamics, this two-component approach provides a first principles description of the dynamics of non-collinear (e.g., spin-frustrated) magnetic materials, as well as the proper description of spin-state crossover, spin-rotation, and spin-flip dynamics by relaxing the constraint on spin configuration. This method also holds potential for applications to spin transport in molecular or even nanoscale magnetic devices

  2. Effect of pH on DNA alkylation by enzyme-activated mitomycin C and porfiromycin.

    Yu, F; Pan, S S

    1993-06-01

    DNA adduct formation by enzyme-activated antibiotics, mitomycin C (MMC) or porfiromycin (PFM), at pH 7.6 or pH 6.0 under anaerobic conditions was analyzed by a 32P-postlabeling method. Antibiotic activation by rat liver NADPH-cytochrome P-450 reductase (EC 1.6.2.4) and bovine milk xanthine oxidase (EC 1.2.3.2) produced similar results. Five 32P-labeled MMC adducts were separated by thin layer chromatography and high performance liquid chromatography from DNA alkylated at either pH. Four of the radioactive spots separated by thin layer chromatography were identified as two monofunctional monoadducts [1" alpha and 1" beta forms of N2-(2" beta,7"-diaminomitosen-1"-yl)-2'-deoxyguanylic acid], one bifunctional monoadduct [N2-(10"-decarbamoyl-2",7"-diaminomitosen-1" alpha-yl)-2'-deoxyguanylic acid], and one cross-linked adduct [N2-(2" beta,7"-diamino-10"-deoxyguanyl-N2-yl-mitosen- 1" alpha-yl)-2'-deoxyguanylic acid]. One minor radioactive spot was not identified. By comparing DNA alkylated at the two pH values, based on equal amounts of 32P radioactivity, similar amounts of cross-links were detected. However, the DNA showed different ratios of the alpha and beta isomers of the monofunctional monoadduct. Furthermore, the DNA alkylated at pH 6.0 showed more bifunctional monoadducts than did the DNA alkylated at pH 7.6. Analysis of alkylated DNA by enzyme-activated PFM showed a similar spectrum of DNA adduct formation. The effect of pH on the distribution of the five PFM-DNA adducts was similar to that observed for the five MMC-DNA adducts. The distribution of adducts in DNA alkylated at the same pH was similar irrespective of which enzyme activated MMC or PFM. The pH of the reaction during DNA and MMC interaction was the determining factor for the quantitative distribution of the adducts. This pH effect may be important for the cytotoxicity of MMC and PFM in tumor cells that have high levels of reductive enzymes with low optimal pH values. PMID:8391116

  3. On the hierarchical parallelization of ab initio simulations

    Ruiz-Barragan, Sergi; Shiga, Motoyuki

    2016-01-01

    A hierarchical parallelization has been implemented in a new unified code PIMD-SMASH for ab initio simulation where the replicas and the Born-Oppenheimer forces are parallelized. It is demonstrated that ab initio path integral molecular dynamics simulations can be carried out very efficiently for systems up to a few tens of water molecules. The code was then used to study a Diels-Alder reaction of cyclopentadiene and butenone by ab initio string method. A reduction in the reaction energy barrier is found in the presence of hydrogen-bonded water, in accordance with experiment.

  4. Influence of diluent alkyl substitution on the extraction of Am(III) and Eu(III) by a 6,6'-bis(1,2,4-triazin-3-yl)-2,2'-bipyridine ligand dissolved in alkylated cyclohexanone diluents

    Several alkylated cyclohexanones were investigated as potential diluents for the selective extraction of Am(III) from Eu(III) from nitric acid solutions by the CyMe4-BTBP ligand. No significant extraction of either of the metal ions was observed for these diluents themselves. In the extractions from 1 M HNO3, 3-methylcyclohexanone and 4-methylcyclohexanone gave comparable results to cyclohexanone whereas in the extractions from 4 M HNO3, 2-methylcyclohexanone, 3-methylcyclohexanone and 4-methylcyclohexanone all gave superior results. For the monomethylated diluents, DAm and SFAm/Eu decreased in the order of alkyl substitution 2 > 4 ∝ 3. However, alkyl substitution of cyclohexanone significantly slows down the extraction kinetics compared to cyclohexanone, and the position of alkyl substitution was found to play an important role in the solvents properties. 3-Methylcyclohexanone was identified as the most promising of the diluents. (orig.)

  5. Ab initio calculation of Ti NMR shieldings for titanium oxides and halides

    Tossell, J. A.

    Titanium NMR shielding constants have been calculated using ab initio coupled Hartree-Fock perturbation theory and polarized double-zeta basis sets for TiF 4, TiF 62-, TiCI 4, Ti(OH) 4, Ti(OH 2) 64+, Ti(OH) 4O, and Ti(OH) 3O -. In all cases the calculations were performed at Hartree-Fuck energy-optimized geometries. For Ti(OH) 4 a S4-symmetry geometry with nonlinear ∠ TiOH was employed. Relative shieldings are in reasonable agreement with experiment for TiF 62-, TiCI 4, and Ti(OR) 4, where R = H or alkyl. Ti(OH 2) 64+ is predicted to be more highly shielded than Ti(OH) 4 by about 340 ppm. The five-coordinate complex Ti(OH) 4O, whose calculated structure matches well that measured by extended X-ray absorption fine structure in K 2O · TiO 2 · SiO 2 glass, is actually deshielded compared to Ti(OH) 4 by about 40 ppm. X-ray absorption-near-edge spectral energies have also been calculated for TiF 4, TiCI 4, Ti(OH) 4, and Ti(OH) 4O using an equivalent ionic core virtual-orbital method and the observed reduction in term energy for the five-coordinate species compared to Ti(OH) 4 has been reproduced. Replacement of the H atoms in Ti(OH) 4 by point charges has only a slight effect upon σTi, suggesting a possible means of incorporating second-neighbor effects in NMR calculations for condensed phases.

  6. Steric Effect of Alkyl Substituted Piperidin-4-one Oximes for Corrosion Control of Mild Steel in H2SO4 Medium%Steric Effect of Alkyl Substituted Piperidin-4-one Oximes for Corrosion Control of Mild Steel in H2SO4Medium

    SENTHILKUMAR Annamalai; THARINI Kumaravel; SETHURAMAN Mathur Gopalakrishnan

    2012-01-01

    Three synthesized piperidin-4-one oximes,3-ethyl-2,6-diphenyl-piperidin-4-one oxime (A),1-methyl-3-isopropyl-2,6-diphenyl-piperidin-4-one oxime (B),and 3-isopropyl-2,6-diphenyl-piperidin-4-one oxime (C),were tested at different concentrations to determine their ability to inhibit corrosion of mild steel in 1 mol · L-1 H2SO4 and measured by a mass loss method (at various temperatures),polarization and impedance measurements,X-ray diffraction (XRD),scanning electron microscopy (SEM) with energydispersive X-ray spectroscopy (EDS),and a quantum chemical method.The synergistic influence of compounds A,B and C with iodides has also been evaluated.All three compounds show good inhibition efficiency in the following order:A>B>C.Compounds A,B and C were found to physically adsorb on the surface of mild steel while obeying the Temkin isotherm.Polarization measurements indicated that these compounds behave as a mixed mode inhibitor.XRD and SEM with EDS studies revealed the formation of a protective barrier on the mild steel surface by these oximes.The electron donating ability of the studied molecules was tested using semi empirical methods.The studies revealed that the oxime nitrogen,the piperidine moiety,and the phenyl ring assist largely in corrosion control.The studies also showed that the steric crowding by the alkyl group in the piperidine ring affects the inhibitor efficiency.Further,it is interesting to note that all of the studied compounds exhibit synergism with iodide ions.

  7. Associations of in Utero Exposure to Perfluorinated Alkyl Acids with Human Semen Quality and Reproductive Hormones in Adult Men

    Vested, Anne; Ramlau-Hansen, Cecilia Høst; Olsen, Sjurdur Frodi;

    2013-01-01

    Perfluorinated alkyl acids (PFAAs), persistent chemicals with unique water-, dirt-, and oil-repellent properties, are suspected of having endocrine-disrupting activity. The PFAA compounds perfluorooctanoic acid (PFOA) and perfluorooctane sulfonic acid (PFOS) are found globally in humans; because...

  8. Effect of hydrostatic pressure on phase behavior of deutrated polystyrene-block-poly(n-alkyl methacrylate) copolymer

    The effect of hydrostatic pressure on phase behavior of deutrated polystyrene-block-poly(n-alkyl methacrylate) [dPS-PnAMA] copolymers with various alkyl chains was investigated by small angle neutron scattering (SANS). Polystyrene-block-poly(n-alkyl methacrylate) copolymers are strongly dependant on both pressure and alkyl number (n) even though these block copolymers have just weak interaction. dPS-PnAMA with n = 2 ∼ 4 exhibited only Lower Disordered-to-Order Transit ion (LDOT), whereas the Ordered-to-Disorder (ODT) was found for n = 1 and n = 6. Additionally, a closed-loop phase behavior was found for n = 5. The order-to-disorder transition (ODT) is only weakly dependent on pressure, whereas, the Lower Disorder-to-Order Transition (LDOT) is strongly dependent on pressure. However, phase transition for a closed-loop phase behavior showed the largest pressure dependence

  9. The influence of alkyl polyglucosides (and highly ethoxylated alcohol boosters on the phase behavior of a water/toluene/technical alkyl polyethoxylate microemulsion system

    Ilić Marija

    2016-01-01

    Full Text Available The influence of additives (alkyl polyglucoside, Glucopon 600 CS UP and alcohol ethoxylate C18E100 on the behavior of the water/toluene/Lutensol ON 50 (technical oxoalcohol, i-C10E5 microemulsion system as a function of temperature and composition has been investigated. The phase behavior of the microemulsions was determined by vertical sections through the Gibbs phase prism (fish-like phase diagrams. Alkyl polyglucoside shifts the one phase region to lower temperatures compared with water/toluene/Lutensol ON 50 mixtures. This is contrary to the expectation, considering the extreme hydrophilic nature of the sugar headgroup. The addition of hydrophilic alcohol ethoxylate (C18E100 to the water/toluene/Lutensol ON 50 system increases the solubilization capacity of the surfactant, even if the co-surfactant is used in small quantities, and shifts the one-phase region to higher temperature by a few degrees Celsius. [Projekat Ministarstva nauke Republike Srbije, br. 172051

  10. Synthetic N-Alkyl/aralkyl-4-methyl-N-(naphthalen-1-ylbenzenesulfonamides as Potent Antibacterial Agents

    *M. A. Abbasi

    2015-03-01

    Full Text Available The current research effort involved the reaction of napthalen-1-amine (1 with 4-methylbenzenesulfonyl chloride (2 under dynamic pH control at 9-10, maintained with 10% aqueous Na2CO3 to obtain 4-methyl-N-(naphthalen-1-yl benzenesulfonamide (3. The parent molecule 3 was further substituted at N-atom with alkyl/aralkyl halides (4a-f in polar aprotic solvent; N,N-dimethylformamide, and lithium hydride which acts as a base, to achieve N-alkyl/aralkyl-4-methyl-N-(naphthalen-1-ylbenzenesulfonamides (5a-f. All the synthesized compounds were structurally elucidated by IR, 1H-NMR and EIMS spectral techniques. All the derivatives were further screened for antibacterial and anti-enzymatic potential against various bacterial strains and enzymes, respectively, and were found to be potent antibacterial agents and moderate to weak enzyme inhibitors.

  11. Reactions of 1,4-bis(tetrazole)benzenes: formation of long chain alkyl halides

    Kelleher, Fintan; Bond, Andrew; Fleming, Adrienne; McGinley, John; Prajapati, Vipa

    2006-01-01

    The reactions of 1,4-bis[2-(tributylstannyl)tetrazol-5-yl]benzene with α,ω-dibromoalkanes were carried out in order to synthesise pendant alkyl halide derivatives of the parent bis-tetrazole. This led to the formation of several alkyl halide derivatives, substituted variously at N1 or N2 on the tetrazole ring. The crystal structures of 1,4-bis[(2-(4-bromobutyl)tetrazol-5-yl)]benzene (2-N,2-N′), 1,4-bis[(2-(4-bromobutyl)tetrazol-5-yl)]benzene (1-N,2-N′) and 1,4-bis[(2-(8-bromooctyl)tetra...

  12. Interfacial assignment of branched-alkyl benzene sulfonates: A molecular simulation

    Liu, Zi-Yu; Wei, Ning; Wang, Ce; Zhou, He; Zhang, Lei; Liao, Qi; Zhang, Lu

    2015-11-01

    A molecular dynamics simulation was conducted to analyze orientations of sodium branched-alkyl benzene sulfonates molecules at nonane/water interface, which is helpful to design optimal surfactant structures to achieve ultralow interfacial tension (IFT). Through the two dimensional density profiles, monolayer collapses are found when surfactant concentration continues to increase. Thus the precise scope of monolayer is certain and orientation can be analyzed. Based on the simulated results, we verdict the interfacial assignment of branched-alkyl benzene sulfonates at the oil-water interface, and discuss the effect of hydrophobic tail structure on surfactant assignment. Bigger hydrophobic size can slow the change rate of surfactant occupied area as steric hindrance, and surfactant meta hydrophobic tails have a stronger tendency to stretch to the oil phase below the collapsed concentration. Furthermore, an interfacial model with reference to collapse, increasing steric hindrance and charge repulsive force between interfacial surfactant molecules, responsible for effecting of surfactant concentration and structure has been supposed.

  13. Enantioselective Decarboxylative Alkylation Reactions: Catalyst Development, Substrate Scope, and Mechanistic Studies

    Behenna, Douglas C.

    2011-11-14

    α-Quaternary ketones are accessed through novel enantioselective alkylations of allyl and propargyl electrophiles by unstabilized prochiral enolate nucleophiles in the presence of palladium complexes with various phosphinooxazoline (PHOX) ligands. Excellent yields and high enantiomeric excesses are obtained from three classes of enolate precursor: enol carbonates, enol silanes, and racemic β-ketoesters. Each of these substrate classes functions with nearly identical efficiency in terms of yield and enantioselectivity. Catalyst discovery and development, the optimization of reaction conditions, the exploration of reaction scope, and applications in target-directed synthesis are reported. Experimental observations suggest that these alkylation reactions occur through an unusual inner-sphere mechanism involving binding of the prochiral enolate nucleophile directly to the palladium center.

  14. Alkylation of Staurosporine to Derive a Kinase Probe for Fluorescence Applications.

    Disney, Alexander J M; Kellam, Barrie; Dekker, Lodewijk V

    2016-05-01

    The natural product staurosporine is a high-affinity inhibitor of nearly all mammalian protein kinases. The labelling of staurosporine has proven effective as a means of generating protein kinase research tools. Most tools have been generated by acylation of the 4'-methylamine of the sugar moiety of staurosporine. Herein we describe the alkylation of this group as a first step to generate a fluorescently labelled staurosporine. Following alkylation, a polyethylene glycol linker was installed, allowing subsequent attachment of fluorescein. We report that this fluorescein-staurosporine conjugate binds to cAMP-dependent protein kinase in the nanomolar range. Furthermore, its binding can be antagonised with unmodified staurosporine as well as ATP, indicating it targets the ATP binding site in a similar fashion to native staurosporine. This reagent has potential application as a screening tool for protein kinases of interest. PMID:27008372

  15. Synthesis of a Pseudodisaccharide α-C-Glycosidically Linked to an 8-Alkylated Guanine

    Jan Duchek

    2013-04-01

    Full Text Available The synthesis of stable guanofosfocin analogues has attracted considerable attention in the past 15 years. Several guanofosfocin analogues mimicking the three constitutional elements of mannose, ribose, and guanine were designed and synthesized. Interest in ether-linked pseudodisaccharides and 8-alkylated guanines is increasing, due to their potential applications in life science. In this article, a novel guanofosfocin analogue 6, an ether-linked pseudodisaccharide connected α-C-glycosidically to an 8-alkylated guanine, was synthesized in a 10-longest linear step sequence from known diol 13, resulting in an overall yield of 26%. The key steps involve the ring-opening of cyclic sulfate 8 by alkoxide generated from 7 and a reductive cyclization of 4-N-acyl-2,4-diamino-5-nitrosopyrimidine 19 to form compound 6.

  16. UV excimer laser photoproducts from absorbing and transparent surfaces covered by aluminum alkyl adsorbates

    Zhang, Y.; Stuke, M. (Max-Planck-Institut fuer Biophysikalische Chemie, Goettingen (Germany, F.R.))

    1989-06-01

    Neutral atomic and molecular species, generated upon the interaction of UV excimer laser light with Al-alkyl/substrate interfaces, are detected by single-shot dye laser mass spectroscopy. The molecules studied at 308, 248, and 193 nm are trimethylaluminum (TMA), triethylaluminum (TEA), and triisobutylaluminum (TIBA). The substrate is either n-type Si(100) or SiO{sub 2} (quartz). The major aluminum-containing species detected are Al atoms and AlH and AlCH{sub 3} molecules. Their relative abundance is shown to depend on the absorbate molecule and the wavelength chosen. Marked differences are observed between the case of the Al-alkyls photolyzed under collision-free conditions in the gas phase and when these molecules are adsorbed to a substrate.

  17. Alkyl- und Aryl-(2,2-dimethylpropionyl)trimethylsilylarsane (Acyl- und Alkylidenarsane ; 2,1)

    Becker, Gerd; Gutekunst, Gerhard

    1980-01-01

    Die Alkyl- oder Arylbis(trimethylsilyl)arsane la-1f [R=CH3a; C2H5b; (CH3)2CH c; (CH3)3C d; C6H5-CH2e und C6H5f] sowie Tris(trimethylsilyl)arsan 1h und 2,2-Di-methylpropionylchlorid 4 im Molverhältnis 1:1 reagieren im unpolaren Cyclopentan unter Substitution einer Trimethylsilylgruppe durch den Acylrest zu den Alkyl- oder Aryl-(2,2-dimethylpropionyl)tri-methylsilylarsanen 2a-2f und zum (2,2-Dimethylpropionyl)bis(trimethylsilyl)arsan 2h. Aus Bis-[bis(trimethylsilyl)arsano]methan lg (R=CH2) ist...

  18. Removal of phase transfer agent leads to restricted dynamics of alkyl chains in monolayer protected clusters

    V R Rajeev Kumar; R Mukhopadhyay; T Pradeep

    2008-11-01

    The effect of phase transfer agent in the dynamics of monolayer protected gold nanoparticles has been investigated by infrared (IR) and nuclear magnetic resonance (NMR) spectroscopies. The experiments were performed with octadecane thiol and dodecane thiol protected gold nanoparticles. The materials prepared were characterized by UV-Visible spectroscopy, transmission electron microscopy and IR spectroscopy. Repeated purification of the monolayer protected gold clusters made the alkyl chains defect-free. Such effects are reflected in the infrared spectra. Interdigitation of the monolayers that followed the purification leads to alkyl chains with limited mobility. This was reflected in 13C and 1H NMR linewidths. The NMR measurements indicate that the removal of phase transfer agent affects the dynamics of isolated clusters and those with interdigitated monolayers in different ways.

  19. Thermal phase behaviour of N-alkyl-N-methylpyrrolidinium and piperidinium bis(trifluoromethanesulfonyl)imide salts

    The phases, ion crystal packing and thermal properties of the N-alkyl-N-methylpyrrolidinium and piperidinium bis(trifluoromethanesulfonyl)imide (PYR1RTFSI and PIP1RTFSI (subscript R = 1 for methyl and 2 for ethyl), respectively) salts are compared using powder and single-crystal x-ray diffraction (XRD) and differential scanning calorimetry (DSC). The crystal structure of PIP12TFSI has been determined at 123 K. The salt crystallizes in the triclinic space group P1-bar with Z 8. Structural data are also reported for PYR11TFSI at 153 K and PIP12TFSI at 223 K. PIP11TFSI has identical ion crystal packing to the analogous pyrrolidinium salt PYR11TFSI. Since increasing the cation alkyl chain length to propyl or butyl (R = 3 or 4) reduces the melting point of the salts below room temperature, this study may provide valuable insight into why these pyrrolidinium and piperidinium salts form room-temperature ionic liquids

  20. Tensile deformation mechanisms of ABS/PMMA/EMA blends

    Wang, S. H.; Gao, J.; Lin, S. X.; Zhang, P.; Huang, J.; Xu, L. L.

    2014-08-01

    The tensile deformation mechanisms of acrylonitrile - butadiene - styrene (ABS) / polymethyl methacrylate (PMMA) blends toughened by ethylene methacrylate (EMA) copolymer was investigated by analysing the fracture morphology. ABS/PMMA was blended with EMA copolymer by melt mixing technique using co-rotating twin extruder. Tensile tests show that the elongation at break of ABS/PMMA blends can be efficiently improved with the increase in EMA content. Fracture morphology of ABS/PMMA/EMA blends reveals that the material yield induced by hollowing-out of EMA particles and its propagation into yield zone is the main toughening mechanism. Moreover, the appearance that EMA particles in the central area are given priority to hollowing-out may be related to the skin-core structure of the injection moulded parts caused by the different cooling rate between surface and inside in the process of injection moulding.

  1. Biotransformation von N-Alkyl- und N,N-Dialkylarylaminen durch Bacillus megaterium

    Taupp, Marcus

    2006-01-01

    In der vorliegenden Arbeit wurden Studien zur bakteriellen Biotransformation von N Alkyl- sowie N,N Dialkylarylaminen mit dem Ziel der arylischen Hydroxy-lierung und N-Dealkylierung durchgeführt. Bodenproben wurden einem Screening-Verfahren unterworfen, um selektiv nach Mikroorganismen zu suchen, die zu den genannten Biotransformationen fähig waren. In einem Screeningverfahren wurden unter Verwendung von N-Ethyl-N methyl-anilin als Standardsubstrat aus Boden-proben Mikroorganismen isoliert un...

  2. Methods and Mechanisms for Cross-Electrophile Coupling of Csp2 Halides with Alkyl Electrophiles

    Weix, Daniel J.

    2015-01-01

    Conspectus Cross-electrophile coupling, the cross-coupling of two different electrophiles, avoids the need for preformed carbon nucleophiles, but development of general methods has lagged behind cross-coupling and C–H functionalization. A central reason for this slow development is the challenge of selectively coupling two substrates that are alike in reactivity. This Account describes the discovery of generally cross-selective reactions of aryl halides and acyl halides with alkyl halides, th...

  3. Formal total syntheses of classic natural product target molecules via palladium-catalyzed enantioselective alkylation

    Yiyang Liu

    2014-10-01

    Full Text Available Pd-catalyzed enantioselective alkylation in conjunction with further synthetic elaboration enables the formal total syntheses of a number of “classic” natural product target molecules. This publication highlights recent methods for setting quaternary and tetrasubstituted tertiary carbon stereocenters to address the synthetic hurdles encountered over many decades across multiple compound classes spanning carbohydrate derivatives, terpenes, and alkaloids. These enantioselective methods will impact both academic and industrial settings, where the synthesis of stereogenic quaternary carbons is a continuing challenge.

  4. Radiation chemistry of hydrocarbon and alkyl halide systems. Progress report, August 1, 1981-July 31, 1982

    Considerable progress has been made on the four systems proposed for study in the previous Renewal Proposal, including gas phase pulse radiolysis of alkyl iodides; radiolysis of H2-CO mixtures on catalytic surfaces; photochemistry and mass spectrometry of CF3 I-CH3 I mixtures; and the effect of oxygen on gas phase propane radiolysis. Results obtained are described. 16 figures, 3 tables

  5. One-pot Synthesis of Lewis Acidic Ionic Liquids for Friedel-Crafts Alkylation

    2006-01-01

    Novel Lewis acidic ionic liquids containing thionyl cations and chloroaluminate anions were obtained by one-pot synthesis for the first time. Their acidities were determined by acetonitrile probe on IR spectrography. The ionic liquids were used as catalyst for Friedel-Crafts alkylation of benzene and 1-dodecene. The turnovers of 1-dodecene were higher than 99%. Monoalkylbenzene selectivity was 98%, while the 2-substituent product selectivity was 45%.

  6. Tribromoisocyanuric acid/triphenylphosphine: a new system for conversion of alcohols into alkyl bromides

    Andrade, Vitor S.C. de; Mattos, Marcio C.S. de, E-mail: mmattos@iq.ufrj.br [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Instituto de Quimica. Departamento de Quimica Organica

    2014-05-15

    An efficient and facile method has been developed for the conversion of alcohols into alkyl bromides under neutral conditions using tribromoisocyanuric acid and triphenylphosphine (molar ratio 1.0:0.7:2.0, alcohol/tribromoisocyanuric acid/triphenylphosphine) in dichloromethane at room temperature. This method can be applied for the conversion of primary, secondary, benzilic and allylic alcohols, and their corresponding bromides are obtained in 67-82 % yield. Tertiary alcohols do not react under these conditions. (author)

  7. Multiple Environmental Stressors: Biological Interactions Between Parameters of Climate Change and Perfluorinated Alkyl Substances in Fish

    Olufsen, Marianne Opsahl

    2016-01-01

    Aquatic organisms continuously acclimatize to fluctuations in environment parameters and contaminant insult. The aim of this thesis was to investigate effects of combined exposure to quantifiable measures of climate change (hypercapnia and hypoxia) and perfluorinated alkyl substances (PFASs) on oxidative stress, lipid homeostasis and endocrine disruption in fish. The thesis consists of four papers (Paper I-IV). In Paper I and II, Atlantic cod (Gadus morhua) juveniles was expose...

  8. Synergistic cytotoxicity of the DNA alkylating agent busulfan, nucleoside analogs and SAHA in lymphoma cell lines

    Valdez, Benigno C.; Murray, David; Nieto, Yago; Li, Yang; Wang, Guiyun; Champlin, Richard E.; Andersson, Borje S.

    2011-01-01

    Hematopoietic stem cell transplantation (HSCT) is a promising treatment for lymphomas. Its success depends on effective pre-transplant conditioning regimens. We previously reported on the efficacy of DNA alkylating agent-nucleoside analog (NA) combinations for conditioning in AML. We hypothesized that a similar combinatory approach can be used for lymphomas. A combination of busulfan (Bu) with two NAs – clofarabine (Clo), fludarabine (Flu) or gemcitabine (Gem) – resulted in synergistic cytoto...

  9. Effect of alkyl substituents on the adsorption of thienylenevinylene oligomers on the Si (100) surface

    Grandidier, Bruno; Stiévenard, Didier; Krzeminski, Christophe; Delerue, Christophe; Frere, Pierre; Blanchard, Phillippe; Roncali, Jean; 10.1016/S0039-6028(00)00946-8

    2012-01-01

    The adsorption of thienylenevinylene oligomers on the Si(100) surface has been investigated using scanning tunneling microscopy. The mode of substitution of the thiophene ring exerts a strong influence on the adsorption configurations and the images of the oligomer based on 3,4-dihexyl thiophene are highly voltage dependent. We discuss the influence of the alkyl chains on the adsorption process and on the appearance of the molecules in the STM images.

  10. DNA repair modulates the vulnerability of the developing brain to alkylating agents

    Kisby, G.E.; Olivas, A.; Park, T.; Churchwell, M.; Doerge, D; Samson, L. D.; Gerson, S L; Turker, M.S.

    2008-01-01

    Neurons of the developing brain are especially vulnerable to environmental agents that damage DNA (i.e., genotoxicants), but the mechanism is poorly understood. The focus of the present study is to demonstrate that DNA damage plays a key role in disrupting neurodevelopment. To examine this hypothesis, we compared the cytotoxic and DNA damaging properties of the methylating agents methylazoxymethanol (MAM) and dimethyl sulfate (DMS) and the mono- and bifunctional alkylating agents chloroethyla...

  11. Impact of Alkyl Polyglucosides Surfactant Lutensol GD 70 on Modification of Bacterial Cell Surface Properties

    Smułek, Wojciech; Kaczorek, Ewa; Zgoła-Grzeskowiak, Agnieszka; Cybulski, Zefiryn

    2015-01-01

    Alkyl polyglucosides, due to their low toxicity and environmental compatibility, could be used in biodegradation of hydrophobic compounds. In this study, the influence of Lutensol GD 70 on the cell hydrophobicity and zeta potential was measured. The particle size distribution and surfactant biodegradation were also investigated. Microbacterium sp. strain E19, Pseudomonas stutzeri strain 9, and the same strain cultivated in stress conditions were used in studies. Adding surfactant to the diese...

  12. Metallaphotoredox-catalysed sp(3)-sp(3) cross-coupling of carboxylic acids with alkyl halides.

    Johnston, Craig P; Smith, Russell T; Allmendinger, Simon; MacMillan, David W C

    2016-08-18

    In the past 50 years, cross-coupling reactions mediated by transition metals have changed the way in which complex organic molecules are synthesized. The predictable and chemoselective nature of these transformations has led to their widespread adoption across many areas of chemical research. However, the construction of a bond between two sp(3)-hybridized carbon atoms, a fundamental unit of organic chemistry, remains an important yet elusive objective for engineering cross-coupling reactions. In comparison to related procedures with sp(2)-hybridized species, the development of methods for sp(3)-sp(3) bond formation via transition metal catalysis has been hampered historically by deleterious side-reactions, such as β-hydride elimination with palladium catalysis or the reluctance of alkyl halides to undergo oxidative addition. To address this issue, nickel-catalysed cross-coupling processes can be used to form sp(3)-sp(3) bonds that utilize organometallic nucleophiles and alkyl electrophiles. In particular, the coupling of alkyl halides with pre-generated organozinc, Grignard and organoborane species has been used to furnish diverse molecular structures. However, the manipulations required to produce these activated structures is inefficient, leading to poor step- and atom-economies. Moreover, the operational difficulties associated with making and using these reactive coupling partners, and preserving them through a synthetic sequence, has hindered their widespread adoption. A generically useful sp(3)-sp(3) coupling technology that uses bench-stable, native organic functional groups, without the need for pre-functionalization or substrate derivatization, would therefore be valuable. Here we demonstrate that the synergistic merger of photoredox and nickel catalysis enables the direct formation of sp(3)-sp(3) bonds using only simple carboxylic acids and alkyl halides as the nucleophilic and electrophilic coupling partners, respectively. This metallaphotoredox

  13. Tools to discover anionic and nonionic polyfluorinated alkyl surfactants by liquid chromatography electrospray ionisation mass spectrometry

    Trier, Xenia; Granby, Kit; Christensen, Jan H.

    2011-01-01

    A tiered approach is proposed for the discovery of unknown anionic and nonionic polyfluorinated alkyl surfactants (PFASs) by reversed phase ultra high performance liquid chromatography (UHPLC) – negative electrospray ionisation – quadrupole time of flight mass spectrometry (UHPLC–ESI−–QTOF–MS). T.......g., structural PFAS isomers. The method has been used to discover PFASs in industrial blends and in extracts from food contact materials....

  14. Performance of HZSM-5 as Catalyst for Alkylation of Methyl naphthalene with Methanol in Supercritical Phase

    BAI Xue-feng; WU Wei; HU Hao-quan

    2005-01-01

    The alkylation of methylnaphthalene(MN) with methanol in the presence of HZSM-5 is a promising route for producing 2,6-dimetylnaphthalene(2,6-DMN) with a high selectivity. However, the conversion of MN is very low and the catalyst will be deactivated rapidly with increasing time on stream. In this study, the effects of the reaction pressure on the reactivity, selectivity and life of the catalyst of alkylation of MN over HZSM-5 modified by BaO were investigated. It was observed that with the enhancement of pressure, the conversion of MN increased, but the selectivity of 2,6-DMN kept unchanged, which was about 40%-42%. When the alkylation was carried out under a supercritical condition, the conversion of MN was 3-6 times higher and the life of catalyst was 25-30 times longer than those at an ambient pressure. The thermogravimetric analyses of the deactivated catalysts at different reaction pressures indicate that the amount of coke deposited on the catalysts was about 10% to 12 %, and the coke-burning reactions mainly took place in a temperature range from 720 to 860 K, and the apparent activation energies of the coke-burning catalysts at 0. 1 MPa( 10 h) and 7. 6 MPa( 108 h) were, respectively, 65.90 and 84. 72 kJ/mol. It is concluded from the results that the supercritical condition is advantageous to enhancing the conversion of alkylation and extraction in situ, and to transporting those high molecular-weight poly-aromatic compounds so as to extend the catalyst life successively.

  15. Minor groove DNA alkylation directed by major groove triplex forming oligodeoxyribonucleotides.

    Lukhtanov, E A; Mills, A G; Kutyavin, I V; Gorn, V V; Reed, M W; Meyer, R. B.

    1997-01-01

    We describe sequence-specific alkylation in the minor groove of double-stranded DNA by a hybridization-triggered reactive group conjugated to a triplex forming oligodeoxyribonucleotide (TFO) that binds in the major groove. The 24 nt TFOs (G/A motif) were designed to form triplexes with a homopurine tract within a 65 bp target duplex. They were conjugated to an N 5-methyl-cyclopropapyrroloindole (MCPI) residue, a structural analog of cyclopropapyrroloindole (CPI), the reactive subunit of the p...

  16. Alkyl polyglycoside surfactant-alcohol cosolvent formulations for improved oil recovery

    Iglauer, Stefan; Wu, Yongfu; Shuler, Patrick; Tang, Yongchun; Goddard, William A.

    2009-01-01

    We examine here the suitability of alkyl polyglycosides (APG) for improved oil recovery (IOR) applications. In recent years, these nonionic carbohydrate-based surfactants have become a significant commercial product (80,000 tons/year) with widespread use in household and agricultural products. Our laboratory study determined several characteristics of common APG surfactant formulations, in particular their capability to create low interfacial tensions (IFT) with n-alkane hydrocarbons. Our for...

  17. Workshop on the Increased Use of Ethanol and Alkylates in Automotive Fuels in California

    Rice, D W

    2001-05-04

    The goals of the Workshop are to: (1) Review the existing state of knowledge on (a) physicochemical properties, multi-media transport and fate, exposure mechanisms and (b) release scenarios associated with the production, distribution, and use of ethanol and alkylates in gasoline; (2) Identify key regulatory, environmental, and resource management issues and knowledge gaps associated with anticipated changes in gasoline formulation in California; and (3) Develop a roadmap for addressing issues/knowledge gaps.

  18. Starch-chitosan hydrogels prepared by reductive alkylation cross-linking

    Baran, E. T.; Mano, J. F.; Reis, R. L.

    2004-01-01

    Starch–chitosan hydrogels were produced by oxidation of soluble starch to produce polyaldehyde and subsequently cross-linked with chitosan via reductive alkylation. The swelling ratio of starch–chitosan membranes was increased gradually with increasing starch ratio, but it was always lower than the native chitosan. In dry state, starch–chitosan membranes with low starch ratio (0.16, 0.38) showed similar tensile strength values to those of native chitosan while these values decreased with incr...

  19. Tetranuclear Zn/4f coordination clusters as highly efficient catalysts for Friedel-Crafts alkylation.

    Griffiths, Kieran; Kumar, Prashant; Akien, Geoffrey R; Chilton, Nicholas F; Abdul-Sada, Alaa; Tizzard, Graham J; Coles, Simon J; Kostakis, George E

    2016-06-14

    A series of custom-designed, high yield, isoskeletal tetranuclear Zn/4f coordination clusters showing high efficiency as catalysts with low catalytic loadings in Friedel-Crafts alkylation are described for the first time. The possibility of altering the 4f centers in these catalysts without altering the core topology allows us to further confirm their stability via EPR and NMR, as well to gain insights into the plausible reaction mechanism, showcasing the usefulness of these bimetallic systems as catalysts. PMID:27248829

  20. Sensitive CE-MS analysis of potentially genotoxic alkylation compounds using derivatization and electrokinetic injection.

    van Wijk, A M; Niederländer, H A G; van Ogten, M D; de Jong, G J

    2015-05-18

    A CE-MS method has been developed to detect trace levels of potentially genotoxic alkyl halides. After derivatization of the target components with 4-dimethylaminopyridine (DMAP) or butyl 1-(pyridinyl-4yl) piperidine 4-carboxylate (BPPC), the natively positively charged derivatives are pre-concentrated by applying electrokinetic injection and separated by a highly efficient CZE method using a background electrolyte (BGE) consisting of 100mM of TRIS adjusted to pH 2.5 with phosphoric acid. Using a sheath liquid interface, subsequent MS detection allows highly specific and sensitive analysis of alkyl halides. Conditions for electrokinetic injection were optimized to allow selective and effective injection. Injection of samples with low water content at 10 kV for 150 s using a high concentration of buffer in the BGE resulted in optimum sample stacking during injection and a highly efficient CE separation. At the sample pH applied, neutral and negatively charged components are shown to be selectively discarded, resulting in injection of positively charged ions only. The sample matrix influences the efficiency of the injection, but when using an internal standard, reproducibilities better than 10% RSD are obtained. Relative recoveries of the derivatives spiked to different types of model API between 85 and 115% demonstrate that the method can be applied for quantitative analysis. Detection limits of lower than 1 mg kg(-1) for the tested alkyl halides obtained in CE-MS at least equal the sensitivity obtained in LC-MS. The CE-MS method is a valuable alternative for the LC-MS method used for analysis of alkylation compounds. PMID:25910449

  1. Imidazolinium salts as catalysts for the ring-opening alkylation of meso epoxides by alkylaluminum complexes.

    Zhou, H; Campbell, E J; Nguyen, S T

    2001-07-12

    [reaction: see text] Imidazolinium salts and their N-heterocyclic carbene (NHC) derivatives catalyze the alkylation of a variety of meso epoxides in the presence of triethylaluminum (yield = 70-90%), under mild conditions. Imidazolinium salts are better catalysts than their NHC derivatives but can lead to dimerization side reactions under extended reaction time. Preformed NHC.AlEt(3) complexes and Wanzlick-type olefins, which are dimers of free NHCs, are also catalysts for this reaction. PMID:11440586

  2. Lewis acid Mediated Aza-Diels-Alder Reactions and Asymmetric Alkylations of 2H-azirines

    Risberg, Erik

    2004-01-01

    This thesis describes the use of 2H-azirines, three-membered unsaturatednitrogen-containing heterocycles, as reactive intermediates ina number of Lewis acid promoted alkylations and Diels-Alderreactions providing synthetically useful aziridines. In order to carry out this investigation a new generalprocedure for the ring closure of vinyl azides, forming theresultant 3-substituted-2H-azirines, was developed applying low boiling solventsin closed reaction vessels at elevated temperatures. The a...

  3. Poly(2-alkyl-2-oxazolynes) as promising radionuclide carriers for nuclear medicine

    Hrubý, Martin; Filippov, Sergey K.; Pánek, Jiří; Kučka, Jan; Sedláček, Ondřej; Štěpánek, Petr

    San Francisco : ACS, 2014. POLY-214. [American Chemical Society National Meeting & Exposition /248./. 10.08.2014-14.08.2014, San Francisco] R&D Projects: GA MPO FR-TI4/625; GA ČR GAP304/12/0950 Grant ostatní: AV ČR(CZ) M200501201 Institutional support: RVO:61389013 Keywords : poly(2-alkyl-2-oxazolynes) * radionuclide * nuclear medicine Subject RIV: CD - Macromolecular Chemistry

  4. Release of 7-methylguanine residues from alkylated DNA by extracts of Micrococcus luteus and Escherichia coli.

    Laval, J; Pierre, J; Laval, F

    1981-01-01

    Cell extracts from Micrococcus luteus release both free 3-methyladenine and free 7-methylguanine from alkylated DNA. The glycosylase activity responsible for the liberation of 7-methylguanine is not 3-methyladenine-DNA glycosylase, which, when purified, does not liberate it. Furthermore, the heat inactivation rates of the two enzymatic activities are different. The release of 7-methylguanine by chemical depurination of ethanol-soluble oligonucleotides has been ruled out. A similar activity re...

  5. Electron beam induced electronic transport in alkyl amine-intercalated VOx nanotubes

    O'Dwyer, Colm; Lavayen, Vladimir; Clavijo-Cedeno, C.; Sotomayor Torres, Clivia M.

    2008-01-01

    The electron beam induced electronic transport in primary alkyl amine-intercalated V2O5 nanotubes is investigated where the organic amine molecules are employed as molecular conductive wires to an aminosilanized substrate surface and contacted to Au interdigitated electrode contacts. The results demonstrate that the high conductivity of the nanotubes is related to the non-resonant tunnelling through the amine molecules and a reduced polaron hopping conduction through the vanadium oxide itself...

  6. Stereospecific Ni-catalyzed cross-coupling of potassium alkenyltrifluoroborates with alkyl halides.

    Molander, Gary A; Argintaru, O Andreea

    2014-04-01

    A general method for the alkenylation of alkyl electrophiles using nearly stoichiometric amounts of the air- and moisture-stable potassium organotrifluoroborates has been developed. Various functional groups were tolerated on both the nucleophilic and electrophilic partner. Reactions of highly substituted E- and Z-alkenyltrifluoroborates, as well as vinyl- and propenyltrifluoroborates, were successful, and no loss of stereochemistry or regiochemistry was observed. PMID:24666316

  7. The effects of chain flexibility on the properties of vesicles formed from di-n-alkyl phosphates

    Smits, E.; Blandamer, M.J; Briggs, B; Cullis, P.M.; Engberts, J.B.F.N.

    1996-01-01

    This paper describes a study of the effects of chain flexibility and chain packing on the properties of vesicles formed from sodium di-n-alkyl phosphates. Three di-n-alkyl phosphates with a constant chain length but with different degrees of unsaturation have been synthesized: dioleyl phosphate (DOP) and dielaidyl phosphate (DEP) having, respectively, a cis and a trans double bond at C-9 and the saturated distearyl phosphate (DSP). These surfactants form vesicles, as confirmed by transmission...

  8. Heterogeneous platinum-catalyzed hydrogenation of dialkyl(diolefin)platinum(II) complexes: A new route to platinum surface alkyls

    McCarthy, Thomas J.; Shih, Yen-Shiang; Whitesides, George M.

    1981-01-01

    Platinum metal catalyzes the reduction of dialkyl(diolefin)platinum(II) complexes by dihydrogen to alkanes and platinum(0). The reaction involves adsorption of the platinum(II) complex on the platinum(0) catalyst surface with conversion of the alkyl moieties to platinum surface alkyls; these appear as alkane products. The platinum atom originally present in the soluble organoplatinum species becomes part of the platinum(0) surface.

  9. Distribution coefficients of purine alkaloids in water-ammonium sulfate-alkyl acetate-dialkyl phthalate systems

    Korenman, Ya. I.; Krivosheeva, O. A.; Mokshina, N. Ya.

    2012-12-01

    The distribution of purine alkaloids (caffeine, theobromine, theophylline) was studied in the systems: alkyl acetates-dialkyl phtalate-salting-out agent (ammonium sulfate). The quantitative characteristics of the extraction-distribution coefficients ( D) and the degree of extraction ( R, %) are calculated. The relationships between the distribution coefficients of alkaloids and the length of the hydrocarbon radical in the molecule of alkyl acetate (dialkyl phtalate) are determined. The possibility of predicting the distribution coefficients is demonstrated.

  10. Synthesis and Anti-Juvenile Hormone Activity of Alkyl 4-(2-Phenoxyalkyloxy) benzoates and Related Compounds

    Furuta, Kenjiro; Shirahashi, Hiromitsu; Ashibe, Kiyo; Yamashita, Haruma; Nishikawa,Masashi; Fujita, Norihiro; Yamada, Naotaka; Kuwano, Eiichi

    2006-01-01

    A number of alkyl 4-(2-phenoxyhexyloxy)benzoates and related compounds were synthesized and evaluated their activity to induce precocious metamorphosis in larvae of the silkworm, which was clearly recognized as a juvenile hormone-deficiency symptom. In the alkyl 4-(2-phenoxyhexyloxy)benzoate series, only the methyl and ethyl esters showed precocious metamorphosis-inducing activity. Replacement of the ester group with an ethylcarbamoyl, butanoyl, nitro or a phenoxy group dramatically decreased...

  11. Ab-initio study of thermoelectricity of layered tellurium compounds

    Ibarra Hernández, Wilfredo

    2015-01-01

    In this thesis, we explore the electronic, dynamic and thermoelectric properties of different tellurium-based compounds. We perform ab-initio calculations within the Vienna Ab-initio Simulation Package (VASP) that works in the framework of Density Functional Theory (DFT). For the thermoelectric properties, we use the Boltztrap code that solves the Boltzmann Transport Equations (BTE) for electrons within the Constant Relaxation Time Approximation (CRTA). This computational pa...

  12. Evaluation of the Urotest AB antibacterial substance detection test.

    Blondeau, J. M.; Yaschuk, Y; Galenzoski, D; Hrabok, D; Isaacson, M; Lee, L.(Department of Physics, Yale University, New Haven, CT, USA); Link, H; Walshaw, L

    1994-01-01

    The Urotest AB was used to detect antimicrobial substances in urine samples. Of 1022 urine specimens evaluated, Urotest AB detected inhibitors in 38.9%. Of 159 urine specimens from patients thought to be taking an antibiotic, inhibitors were detected in 80.5%. This test may help to explain culture negative urine samples from symptomatic patients, and could help elucidate treatment failures and the epidemiology of antibiotic resistance.

  13. Toward ab initio density functional theory for nuclei

    Drut, J. E.; Furnstahl, R. J.; Platter, L.

    2009-01-01

    We survey approaches to nonrelativistic density functional theory (DFT) for nuclei using progress toward ab initio DFT for Coulomb systems as a guide. Ab initio DFT starts with a microscopic Hamiltonian and is naturally formulated using orbital-based functionals, which generalize the conventional local-density-plus-gradients form. The orbitals satisfy single-particle equations with multiplicative (local) potentials. The DFT functionals can be developed starting from internucleon forces using ...

  14. Deriving conservation laws for ABS lattice equations from Lax pairs

    In this paper we derive infinitely many conservation laws for ABS lattice equations from their Lax pairs. These conservation laws can be algebraically expressed by means of some known polynomials. For each equation, the infinitely many conservation laws are not equivalent and are nontrivial. We also show that the (H1), (H2), (H3), (Q1), (Q2), (Q3) and (A1) equations in the ABS list share a generic discrete Riccati equation. (paper)

  15. Alkyl chain length-dependent surface reaction of dodecahydro-N-alkylcarbazoles on Pt model catalysts

    Gleichweit, Christoph; Amende, Max; Bauer, Udo; Schernich, Stefan; Höfert, Oliver; Lorenz, Michael P. A.; Zhao, Wei; Bachmann, Philipp; Papp, Christian, E-mail: christian.papp@fau.de [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Müller, Michael; Koch, Marcus [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Wasserscheid, Peter [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Libuda, Jörg; Steinrück, Hans-Peter [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany)

    2014-05-28

    The concept of liquid organic hydrogen carriers (LOHC) holds the potential for large scale chemical storage of hydrogen at ambient conditions. Herein, we compare the dehydrogenation and decomposition of three alkylated carbazole-based LOHCs, dodecahydro-N-ethylcarbazole (H{sub 12}-NEC), dodecahydro-N-propylcarbazole (H{sub 12}-NPC), and dodecahydro-N-butylcarbazole (H{sub 12}-NBC), on Pt(111) and on Al{sub 2}O{sub 3}-supported Pt nanoparticles. We follow the thermal evolution of these systems quantitatively by in situ high-resolution X-ray photoelectron spectroscopy. We show that on Pt(111) the relevant reaction steps are not affected by the different alkyl substituents: for all LOHCs, stepwise dehydrogenation to NEC, NPC, and NBC is followed by cleavage of the C–N bond of the alkyl chain starting at 380–390 K. On Pt/Al{sub 2}O{sub 3}, we discern dealkylation on defect sites already at 350 K, and on ordered, (111)-like facets at 390 K. The dealkylation process at the defects is most pronounced for NEC and least pronounced for NBC.

  16. Mycobacterium tuberculosis Rv3406 is a type II alkyl sulfatase capable of sulfate scavenging.

    Kimberly M Sogi

    Full Text Available The genome of Mycobacterium tuberculosis (Mtb encodes nine putative sulfatases, none of which have a known function or substrate. Here, we characterize Mtb's single putative type II sulfatase, Rv3406, as a non-heme iron (II and α-ketoglutarate-dependent dioxygenase that catalyzes the oxidation and subsequent cleavage of alkyl sulfate esters. Rv3406 was identified based on its homology to the alkyl sulfatase AtsK from Pseudomonas putida. Using an in vitro biochemical assay, we confirmed that Rv3406 is a sulfatase with a preference for alkyl sulfate substrates similar to those processed by AtsK. We determined the crystal structure of the apo Rv3406 sulfatase at 2.5 Å. The active site residues of Rv3406 and AtsK are essentially superimposable, suggesting that the two sulfatases share the same catalytic mechanism. Finally, we generated an Rv3406 mutant (Δrv3406 in Mtb to study the sulfatase's role in sulfate scavenging. The Δrv3406 strain did not replicate in minimal media with 2-ethyl hexyl sulfate as the sole sulfur source, in contrast to wild type Mtb or the complemented strain. We conclude that Rv3406 is an iron and α-ketoglutarate-dependent sulfate ester dioxygenase that has unique substrate specificity that is likely distinct from other Mtb sulfatases.

  17. Adsorption of sodium alkyl aryl sulfonates on sandstone. [Berea and Benton Tar Springs sandstones

    Lawson, J.B.; Dilgren, R.E.

    1976-01-01

    Equilibrium adsorption isotherms of commercial alkyl aryl sulfonates (petroleum sulfonates), and pure alkyl aryl sulfonates on disaggregated Berea and Benton Tar Springs sandstones were determined. Adsorption isotherms of commercial sulfonates were found to contain maxima, which did not necessarily correspond to the measured C.M.C. At adsorption maxima, surface coverage corresponded to about one half monomolecular layer of sulfonate, but, at high surfactant concentrations, coverage sometimes amounted to only about one-tenth of a monolayer. Pure alkyl aryl sulfonates were synthesized and adsorption on sandstone determined. These materials were found to yield conventional adsorption isotherms, with adsorption plateaus at about one half a monolayer of surface coverage. Apparently, adsorption maxima are unique to impure sulfonates. Selectivity of adsorption with respect to molecular weight and structural type was studied. Structure of petroleum sulfonate and accompanying mineral oil was determined as were structures of sulfonate and mineral oil that had been equilibrated with sandstone. Comparison showed no selectivity of adsorption based on carbon number distribution or structural type. However, aggregates relatively rich in mineral oil were found to be selectively adsorbed.

  18. Alkyl chain length-dependent surface reaction of dodecahydro-N-alkylcarbazoles on Pt model catalysts

    The concept of liquid organic hydrogen carriers (LOHC) holds the potential for large scale chemical storage of hydrogen at ambient conditions. Herein, we compare the dehydrogenation and decomposition of three alkylated carbazole-based LOHCs, dodecahydro-N-ethylcarbazole (H12-NEC), dodecahydro-N-propylcarbazole (H12-NPC), and dodecahydro-N-butylcarbazole (H12-NBC), on Pt(111) and on Al2O3-supported Pt nanoparticles. We follow the thermal evolution of these systems quantitatively by in situ high-resolution X-ray photoelectron spectroscopy. We show that on Pt(111) the relevant reaction steps are not affected by the different alkyl substituents: for all LOHCs, stepwise dehydrogenation to NEC, NPC, and NBC is followed by cleavage of the C–N bond of the alkyl chain starting at 380–390 K. On Pt/Al2O3, we discern dealkylation on defect sites already at 350 K, and on ordered, (111)-like facets at 390 K. The dealkylation process at the defects is most pronounced for NEC and least pronounced for NBC

  19. Discovery and SAR of 6-alkyl-2,4-diaminopyrimidines as histamine H₄ receptor antagonists.

    Savall, Brad M; Chavez, Frank; Tays, Kevin; Dunford, Paul J; Cowden, Jeffery M; Hack, Michael D; Wolin, Ronald L; Thurmond, Robin L; Edwards, James P

    2014-03-27

    This report discloses the discovery and SAR of a series of 6-alkyl-2-aminopyrimidine derived histamine H4 antagonists that led to the development of JNJ 39758979, which has been studied in phase II clinical trials in asthma and atopic dermatitis. Building on our SAR studies of saturated derivatives from the indole carboxamide series, typified by JNJ 7777120, and incorporating knowledge from the tricyclic pyrimidines led us to the 6-alkyl-2,4-diaminopyrimidine series. A focused medicinal chemistry effort delivered several 6-alkyl-2,4-diaminopyrimidines that behaved as antagonists at both the human and rodent H4 receptor. Further optimization led to a panel of antagonists that were profiled in animal models of inflammatory disease. On the basis of the preclinical profile and efficacy in several animal models, JNJ 39758979 was selected as a clinical candidate; however, further development was halted during phase II because of the observation of drug-induced agranulocytosis (DIAG) in two subjects. PMID:24495018

  20. Long Alkyl Chain Organophosphorus Coupling Agents for in Situ Surface Functionalization by Reactive Milling

    Annika Betke

    2014-08-01

    Full Text Available Innovative synthetic approaches should be simple and environmentally friendly. Here, we present the surface modification of inorganic submicrometer particles with long alkyl chain organophosphorus coupling agents without the need of a solvent, which makes the technique environmentally friendly. In addition, it is of great benefit to realize two goals in one step: size reduction and, simultaneously, surface functionalization. A top-down approach for the synthesis of metal oxide particles with in situ surface functionalization is used to modify titania with long alkyl chain organophosphorus coupling agents. A high energy planetary ball mill was used to perform reactive milling using titania as inorganic pigment and long alkyl chain organophosphorus coupling agents like dodecyl and octadecyl phosphonic acid. The final products were characterized by IR, NMR and X-ray fluorescence spectroscopy, thermal and elemental analysis as well as by X-ray powder diffraction and scanning electron microscopy. The process entailed a tribochemical phase transformation from the starting material anatase to a high-pressure modification of titania and the thermodynamically more stable rutile depending on the process parameters. Furthermore, the particles show sizes between 100 nm and 300 nm and a degree of surface coverage up to 0.8 mmol phosphonate per gram.

  1. Distributions of polycyclic aromatic hydrocarbons and alkylated polycyclic aromatic hydrocarbons in Osaka Bay, Japan

    Highlights: • Contamination of sediment by PAHs and alkylated PAHs was investigated in Osaka Bay. • The major sources appeared to be pyrogenic or both pyrogenic and petrogenic. • PAH concentrations were remarkably high at a site near Kobe. • PAHs in Kobe may have been derived from the fire associated with the earthquake. - Abstract: Contaminations in sediments by polycyclic aromatic hydrocarbons (PAHs) and alkylated PAHs were investigated at 44 sites in Osaka Bay, Japan. Concentrations of total PAHs and alkylated PAHs were in the range 6.40–7800 ng/g dry weights and 13.7–1700 ng/g dry weights, respectively. The PAH concentrations tended to be higher along the shoreline in the vicinities of big ports, industrialized areas, and densely populated regions such as the cities of Osaka and Kobe. The major sources appeared to be pyrogenic or both pyrogenic and petrogenic at most of the sites. PAH concentrations were remarkably high at a site near Kobe, where the concentrations of dibenzo(a,h)anthracene and benzo(g,h,i)perylene exceeded the effects-range-medium concentration and eight PAHs were above the corresponding effects-range-low concentrations. Those PAHs may have been derived from the great fire associated with the large earthquake in 1995

  2. On the structure and dynamics of secondary n-alkyl cations

    East, Allan L. L.; Bučko, Tomáš; Hafner, Jürgen

    2009-09-01

    A variety of computational studies was undertaken to examine and establish the relative importance of open versus closed structures for unbranched secondary n-alkyl cations. First, the PW91 level of density functional theory was used to optimize over 20 minimum-energy structures of sec-pentyl, sec-hexyl, and sec-heptyl ions, demonstrating that closed structures are more stable than open ones on the potential energy surface (PES). Second, PW91 was used with a theoretical Andersen thermostat to perform a molecular dynamics simulation (150 ps) of C9H19+ at a typical catalytic temperature of 800 K, demonstrating that the structure preference is inverted on the free-energy surface. Third, both quantum (rigid-rotor/harmonic oscillator) and classical partition functions were used to demonstrate that the simulated structure-opening at catalytic temperatures is due to the floppiness of the open forms, which improves its free energy by both lowering its zero-point vibrational energy and increasing its molecular entropy. The particular conformer of the preferred open form (at 800 K) is dependent on length of alkyl ion, with pentyl ions preferring syn/anti structures but longer ions preferring open-clinal ones. These results, plus an additional set of PES optimized structures from an alternative level of theory (MP2/6-31G(d,p)), are used to discuss the likely nature of secondary n-alkyl ions.

  3. Tris(thioimidazolyl)borate-zinc-thiolate complexes for the modeling of biological thiolate alkylations.

    Ibrahim, Mohamed M; Seebacher, Jan; Steinfeld, Gunther; Vahrenkamp, Heinrich

    2005-11-14

    The S3Zn-SR coordination of thiolate-alkylating enzymes such as the Ada DNA repair protein was reproduced in tris(thioimidazolyl)borate-zinc-thiolate complexes Tti(R)Zn-SR'. Four different Tti(R) ligands and nine different thiolates were employed, yielding a total of 12 new complexes. In addition, one Tti(R)Zn-SH complex and two thiolate-bridged [Tti(R)-SEt-Tti(R)]+ complexes were obtained. A selection of six thiolate complexes was converted with methyl iodide to the corresponding methyl thioethers and Tti(R)Zn-I. According to a kinetic analysis these reactions are second-order processes, which implies that the alkylations are likely to occur at the zinc-bound thiolates. They are much faster than the alkylations of zinc thiolates with N3 or N2S tripod ligands. The most reactive thiolate, Tti(Xyl)Zn-SEt, reacts slowly with trimethyl phosphate in a nonpolar medium at room temperature, yielding methyl-ethyl-thioether and Tti(Xyl)Zn-OPO(OMe)2 which can be converted back to the thiolate complex with NaSEt. This is the closest reproduction of the Ada repair process so far. PMID:16270993

  4. Reduction and alkylation of peanut allergen isoforms Ara h 2 and Ara h 6; characterization of intermediate- and end products.

    Apostolovic, Danijela; Luykx, Dion; Warmenhoven, Hans; Verbart, Dennis; Stanic-Vucinic, Dragana; de Jong, Govardus A H; Velickovic, Tanja Cirkovic; Koppelman, Stef J

    2013-12-01

    Conglutins, the major peanut allergens, Ara h 2 and Ara h 6, are highly structured proteins stabilized by multiple disulfide bridges and are stable towards heat-denaturation and digestion. We sought a way to reduce their potent allergenicity in view of the development of immunotherapy for peanut allergy. Isoforms of conglutin were purified, reduced with dithiothreitol and subsequently alkylated with iodoacetamide. The effect of this modification was assessed on protein folding and IgE-binding. We found that all disulfide bridges were reduced and alkylated. As a result, the secondary structure lost α-helix and gained some β-structure content, and the tertiary structure stability was reduced. On a functional level, the modification led to a strongly decreased IgE-binding. Using conditions for limited reduction and alkylation, partially reduced and alkylated proteins were found with rearranged disulfide bridges and, in some cases, intermolecular cross-links were found. Peptide mass finger printing was applied to control progress of the modification reaction and to map novel disulfide bonds. There was no preference for the order in which disulfides were reduced, and disulfide rearrangement occurred in a non-specific way. Only minor differences in kinetics of reduction and alkylation were found between the different conglutin isoforms. We conclude that the peanut conglutins Ara h 2 and Ara h 6 can be chemically modified by reduction and alkylation, such that they substantially unfold and that their allergenic potency decreases. PMID:24145103

  5. Identification and significance of 3β-alkyl steranes in the Eogene lacustrine sediments and petroleum of China

    WANG Guangli; ZHANG Linye; WANG Tieguan

    2006-01-01

    Several homologous series of steranes with alkyl side chains (C1 to C4) at the 3β position have been identified in the Jiyang Eogene lacustrine deposition. It is postulated that its precursors represent a new class of steroids, alkylated at the C-3 position with a polyhydroxy n-alkane. These precursors may have been formed by the bacterial addition of a ribose sugar to △2-sterenes, diagenetic alteration products of steroids synthesized by eukaryotes.3-alkyl steroids might substitute for hopanols in bacterial membranes. When they are present in a sample, the patterns of the isomer distributions of 3-alkyl steranes are similar to desmethyl steranes except for lower rearranged ones. It is shown that the configurational isomerization of 3-alkyl steranes is trending in line with that of desmethyl steranes with increasing of maturity. The abundance of 3-alkyl steranes may be controlled by the depositional environments; they are primary in saline or near shore lacustrine, moderate in shallow lacustrine, poor in sub-deep to deep lacustrine relative to the 4-methyl steranes.

  6. Chemical and Electrical Passivation of Single-Crystal Silicon(100) Surfaces Through a Two-Step Chlorination/Alkylation Process

    Single-crystal Si(100) surfaces have been functionalized by using a two-step radical chlorination-Grignard (R= MgCl, R = CH3, C2H5, C4H9, C6H5, or CH2C6H5) alkylation method. After alkylation, no chlorine was detectable on the surface by X-ray photoelectron spectroscopy (XPS), and the C 1s region showed a silicon-induced peak shift indicative of a Si-C bond. The relative intensity of this peak decreased, as expected, as the steric bulk of the alkyl increased. Despite the lack of full alkyl termination of the atop sites of the Si(100) surface, functionalization significantly reduced the rate of surface oxidation in air compared to that of the H-terminated Si(100) surface, with alkylated surfaces forming less than half a monolayer of oxide after over one month of exposure to air. Studies of the charge-carrier lifetime with rf photoconductivity decay methods indicated a surface recombination velocity of -1 for methylated surfaces, and 2, and SiH3 species, whereas Cl-Si(100) surfaces were predominantly terminated by monochloro (SiCl and SiHCl) and dichloro (SiCl2 and SiHCl2) Si species. Methylation produced signals consistent with termination by Si-alkyl bonding arising from SiH(CH3)-, SiH2(CH3)-, and Si(CH3)2-type species

  7. 基于ABS的ABS/ASR集成液压系统设计%ABS/ASR Integrated Hydraulic System Based on ABS

    马岳峰; 刘昭度; 吴利军; 王国业

    2004-01-01

    介绍一种基于JETTA GTX轿车ABS液压系统的ABS/ASR集成液压系统改造方案,该ABS/ASR集成液压系统在原有ABS液压系统的基础上增加较少的液压元件实现全部ABS功能和ASR制动干预控制功能,改造后的集成系统工作可靠,不影响原有的常规制动和ABS制动过程.

  8. Ab Initio No-Core Shell Model

    Barrett, B R; Navratil, P; Vary, J P

    2011-04-11

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory ({chi}EFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The

  9. Ab Initio No-Core Shell Model

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory (χEFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The resulting NN

  10. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 Interactions with Western Corn Rootworm Midgut Membrane Binding Sites

    Huarong Li; Monica Olson; Gaofeng Lin; Timothy Hey; Sek Yee Tan; Narva, Kenneth E.

    2013-01-01

    BACKGROUND: Bacillus thuringiensis (Bt) Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry) proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interact...

  11. Comparisons of metallic clusters imbedded in the surface oxide of AB2, AB5, and A2B7 alloys

    Research highlights: Different growth mechanisms have been found on the metallic inclusions imbedded in the surface oxides of AB2, AN5, and A2B7. The high power performance has been correlated to the size and distribution of these inclusions. - Abstract: In order to clarify the relationship between the saturation magnetization of the activated metal hydride material and electrode performance, the specific power measured at both low temperature (-30 oC) and operating temperature (35 oC) of a nickel metal hydride battery were compared with magnetization measurements. It is found specific powers measured at both temperatures correlate well with the saturated magnetic susceptibility, which is proportional to the total amount of metallic nickel clusters distributed within the surface oxide layer after activation. Both the gas phase storage and electrochemical properties of the activated AB2, AB5, and A2B7 alloys were investigated. While the AB2 alloy has the highest storage capacity, it also has the lowest high-rate dischargeability among the three alloys. This suggests a competition between storage capacity and rate capability in these materials. In an alkaline etching experiment, it is established the saturation magnetization increases with etching time in these AB2, AB5, and A2B7 alloys. The saturation magnetization after a 4 h etches track the changes in the high-rate dischargeability. The increase is attributed to the growth in size of the metallic inclusions for the AB2 and Nd-A2B7 samples, and from an increase in the number of metallic inclusion in the case of AB5 and La-A2B7. Transmission electron microscope studies calibrate the size inferred from magnetic susceptibility studies and also the Ni-dominated FCC structure of the metallic clusters.

  12. Study on Exothermic Oxidation of Acrylonitrile-butadiene-styrene (ABS Resin Powder with Application to ABS Processing Safety

    Jenq-Renn Chen

    2010-08-01

    Full Text Available Oxidative degradation of commercial grade ABS (Acrylonitrile-butadiene-styrene resin powders was studied by thermal analysis. The instabilities of ABS containing different polybutadiene (PB contents with respect to temperature were studied by Differential Scanning Calorimeter (DSC. Thermograms of isothermal test and dynamic scanning were performed. Three exothermic peaks were observed and related to auto-oxidation, degradation and oxidative decomposition, respectively. Onset temperature of the auto-oxidation was determined to be around 193 °C. However, threshold temperature of oxidation was found to be as low as 140 °C by DSC isothermal testing. Another scan of the powder after degeneration in air showed an onset temperature of 127 °C. Reactive hazards of ABS powders were verified to be the exothermic oxidation of unsaturated PB domains, not the SAN (poly(styrene-acrylonitrile matrix. Heat of oxidation was first determined to be 2,800 ± 40 J per gram of ABS or 4,720 ± 20 J per gram of PB. Thermal hazards of processing ABS powder are assessed by adiabatic temperature rise at process conditions. IR spectroscopy associated with heat of oxidation verified the oxidative mechanism, and these evidences excluded the heat source from the degradation of SAN. A specially prepared powder of ABS without adding anti-oxidant was analyzed by DSC for comparing the exothermic behaviors. Exothermic onset temperatures were determined to be 120 °C and 80 °C by dynamic scanning and isothermal test, respectively. The assessment successfully explained fires and explosions in an ABS powder dryer and an ABS extruder.

  13. Dicty_cDB: FC-AB09 [Dicty_cDB

    Full Text Available /dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AB/FC-AB09Q.Seq.d/ Representative seq. ID ...FC-AB09F (Link to Original site) Representative DNA sequence >FC-AB09 (FC-AB09Q) /CSM/FC/FC-AB/FC-AB09Q.Seq....QNQKKKKKKKKKKKKKKKKKK Translated Amino Acid sequence (All Frames) Frame A: desashkqlckiynkihyliifinfvlvvdlyp...0.00 m_ : 1.00 72.0 %: nuclear 16.0 %: cytoplasmic 8.0 %: mitochondrial 4.0 %: cytoskeletal >> prediction fo...kkkrkktkpkekkkkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits)

  14. Dicty_cDB: FCL-AB19 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AB19 (Link to dictyBase) - - - Contig-U15232-1 FCL-AB19Z ...(Link to Original site) - - FCL-AB19Z 697 - - - - Show FCL-AB19 Library FCL (Link to library) Clone ID FCL-A... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AB/FCL-AB19Q.Seq.d/ Representative seq. ID FCL-...AB19Z (Link to Original site) Representative DNA sequence >FCL-AB19 (FCL-AB19Q) /CSM/FCL/FCL-AB/FCL-...KLINFSIFQ* Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value FCL-

  15. Hydrogenation of AB5 and AB2 metal hydride alloys studied by in situ X-ray diffraction

    Highlights: • Hydrogenation process of an AB5 alloy and two AB2 alloys were studied by quasi in-situ XRD. • In both AB5 and AB2 metal alloy, hydrogen occupation sites on the half-plane were taken first. • In the C14/C15 mixed alloy, C14 phase is the main hydrogen storage phase with a lower equilibrium pressure. • In the C14/C15 mixed alloy, C15 phase is the catalyst hydrogen storage phase with a higher equilibrium pressure. • Small amount of C15 was hydrided first but not completed until C14 phase was fully hydrided. - Abstract: The evolution of lattice constants and abundances of metal (α) and metal hydride (β) phases during the hydrogenation process of an AB5 alloy with a CaCu5 crystal structure, an AB2 alloy with a predominating C14 structure, and a C14/C15-mixed AB2 alloy were reported. The preferred hydrogen insertion sites at different states of charge in both the α and β phases were studied based on the lattice parameter changes during hydrogenation. During the hydrogenation of the AB5 alloy, the ratio between lattice parameters a and c (a/c ratio) in the α phase decreases, stabilizes, and then decreases again while that in the β phase decreases and then stabilizes. The trends in unit cell volume changes are increasing, plateauing, and increasing again in the α phase and increasing followed by plateauing in the β phase as the hydrogenation level increases. In the C14-predominant AB2 alloy, the a/c ratio in the α phase increases at the beginning and then stabilizes while that in the β phase remains about the same and then increases during the addition of hydrogen. Moreover, the unit cell volume in the α phase increases slightly during hydrogenation, comparing to the increasing, decreasing, and then increasing trend in the β phase. In the C14/C15 mixed AB2 alloy, hydrogenation of the C15 phase starts at the beginning and promotes the hydrogenation of the C14 phase. The C14 phase, as the main hydrogen storage phase, completes hydrogenation

  16. Density functional theory with van der waals corrections study of the adsorption of alkyl, alkylthiol, alkoxyl, and amino-alkyl chains on the H:Si(111) surface.

    Arefi, Hadi H; Nolan, Michael; Fagas, Giorgos

    2014-11-11

    Surface modification of silicon with organic monolayers tethered to the surface by different linkers is an important process in realizing future miniaturized electronic and sensor devices. Understanding the roles played by the nature of the linking group and the chain length on the adsorption structures and stabilities of these assemblies is vital to advance this technology. This paper presents a density functional theory (DFT) study of the hydrogen passivated Si(111) surface modified with alkyl chains of the general formula H:Si-(CH2)n-CH2 and H:Si-X-(CH2)n-CH3, where X = NH, O, S and n = (0, 1, 3, 5, 7, 9, 11), at half coverage. For (X)-hexane and (X)-dodecane functionalization, we also examined various coverages up to full monolayer grafting in order to validate the result of half covered surface and the linker effect on the coverage. We find that it is necessary to take into account the van der Waals interaction between the alkyl chains. The strongest binding is for the oxygen linker, followed by S, N, and C, irrespective of chain length. The result revealed that the sequence of the stability is independent of coverage; however, linkers other than carbon can shift the optimum coverage considerably and allow further packing density. For all linkers apart from sulfur, structural properties, in particular, surface-linker-chain angles, saturate to a single value once n > 3. For sulfur, we identify three regimes, namely, n = 0-3, n = 5-7, and n = 9-11, each with its own characteristic adsorption structures. Where possible, our computational results are shown to be consistent with the available experimental data and show how the fundamental structural properties of modified Si surfaces can be controlled by the choice of linking group and chain length. PMID:25260071

  17. Vapor pressures of 1,3-dialkylimidazolium bis(trifluoromethylsulfonyl)imide ionic liquids with long alkyl chains

    This work presents the vapor pressure at several temperatures for the 1,3-dialkylimidazolium bis(trifluoromethylsulfonyl)imide series, [CN/2CN/2im][NTf2] (N = 14, 16, 18, and 20), measured by a Knudsen effusion method combined with a quartz crystal microbalance. The thermodynamic properties of vaporization of the ionic liquids under study are analysed together with the results obtained previously for the shorter alkyl chain length [CN/2CN/2im][NTf2] (N = 2, 4, 6, 8, 10, and 12), in order to evaluate the effect of the alkyl side chains of the cation and to get additional insights concerning the nanostructuration of ionic liquids. The symmetry effect is explored, based on the comparison with the asymmetric imidazolium based ionic liquids, [CN-1C1im][NTf2]. A trend shift on the thermodynamic properties of vaporization along the alkyl side chains of the extended symmetric ionic liquids, around [C6C6im][NTf2], was detected. An intensification of the odd-even effect was observed starting from [C6C6im][NTf2], with higher enthalpies and entropies of vaporization for the odd numbered ionic liquids, [C7C7im][NTf2] and [C9C9im][NTf2]. Similar, but less pronounced, odd-even effect was found for the symmetric ionic liquids with lower alkyl side chains length, [CN/2CN/2im][NTf2] (with N = 4, 6, 8, 10, and 12). This effect is related with the predominant orientation of the terminal methyl group of the alkyl chain to the imidazolium ring and their influence in the cation-anion interaction. The same Critical Alkyl length at the hexyl, (C6C1and C6C6) was found for both asymmetric and symmetric series indicating that the nanostructuration of the ionic liquids is related with alkyl chain length

  18. The effect of the cation alkyl chain length on density and diffusion in dialkylpyrrolidinium bis(mandelato)borate ionic liquids.

    Filippov, Andrei; Taher, Mamoun; Shah, Faiz Ullah; Glavatskih, Sergei; Antzutkin, Oleg N

    2014-12-28

    The physicochemical properties of ionic liquids are strongly affected by the selective combination of the cations and anions comprising the ionic liquid. In particular, the length of the alkyl chains of ions has a clear influence on the ionic liquid's performance. In this paper, we study the self-diffusion of ions in a series of halogen-free boron-based ionic liquids (hf-BILs) containing bis(mandelato)borate anions and dialkylpyrrolidinium cations with long alkyl chains CnH2n+1 with n from 4 to 14 within a temperature range of 293-373 K. It was found that the hf-BILs with n = 4-7 have very similar diffusion coefficients, while hf-BILs with n = 10-14 exhibit two liquid sub-phases in almost the entire temperature range studied (293-353 K). Both liquid sub-phases differ in their diffusion coefficients, while values of the slower diffusion coefficients are close to those of hf-BILs with shorter alkyl chains. To explain the particular dependence of diffusion on the alkyl chain length, we examined the densities of the hf-BILs studied here. It was shown that the dependence of the density on the number of CH2 groups in long alkyl chains of cations can be accurately described using a "mosaic type" model, where regions of long alkyl chains of cations (named 'aliphatic' regions) and the residual chemical moieties in both cations and anions (named 'ionic' regions) give additive contributions. Changes in density due to an increase in temperature and the number of CH2 groups in the long alkyl chains of cations are determined predominantly by changes in the free volume of the 'ionic' regions, while 'aliphatic' regions are already highly compressed by van der Waals forces, which results in only infinitesimal changes in their free volumes with temperature. PMID:25372279

  19. Determination of alkyl amines in atmospheric aerosol particles: a comparison of gas chromatography-mass spectrometry and ion chromatography approaches

    R.-J. Huang

    2014-03-01

    Full Text Available In recent years low molecular weight alkyl amines have been recognized to play an important role in particle formation and growth in the lower atmosphere. However, major uncertainties are associated with their atmospheric processes, sources and sinks, mostly due to the lack of ambient measurements and the difficulties in accurate quantification of alkyl amines at trace level. In this study, we present the evaluation and optimization of two analytical approaches, i.e., gas chromatography-mass spectrometry (GC-MS and ion chromatography (IC, for the determination of alkyl amines in aerosol particles. Alkyl amines were converted to carbamates through derivatization with isobutyl chloroformate for GC-MS determination. A set of parameters affecting the analytical performances of the GC-MS approach, including reagent amount, reaction time and pH value, was evaluated and optimized. The accuracy is 84.3–99.1%, and the limits of detection obtained are 1.8–3.9 pg. For the IC approach, a solid phase extraction (SPE column was used to separate alkyl amines from interfering cations before IC analysis. 1–2% (v/v of acetone (or 2–4% (v/v of acetonitrile was added to the eluent to improve the separation of alkyl amines on the IC column. The limits of detection obtained are 2.1–15.9 ng and the accuracy is 55.1–103.4%. The lower accuracy can be attributed to evaporation losses of amines during the sample concentration procedure. Measurements of ambient aerosol particle samples collected in Hong Kong show that the GC-MS approach is superior to the IC approach for the quantification of primary and secondary alkyl amines due to its lower detection limits and higher accuracy.

  20. Study of the mechanical properties of recycled abs and recovery throught mixing with SEBS

    Peydro, M. A.; Juárez Varón, David; Samuel SANCHEZ-CABALLERO; Pla-Ferrando, R

    2014-01-01

    Recovery of recycled acrylonitrile butadiene styrene (ABS) through mixing with styrene-ethylene/butylene- styrene (SEBS) has been studied in this paper. To simulate recycled ABS, virgin ABS was processed through 5 cycles, at extreme processing temperatures, 220 oC and 260 oC. The virgin ABS, the virgin SEBS, the recycled ABS and the mixtures were mechanically characterized after the various cycles of reprocessing in order to evaluate their corresponding properties and correlate them with the...

  1. Effect of alkyl glycerophosphate on the activation of peroxisome proliferator-activated receptor gamma and glucose uptake in C2C12 cells

    Highlights: •Alkyl-LPA specifically interacts with PPARγ. •Alkyl-LPA treatments induces lipid accumulation in C2C12 cells. •Alkyl-LPA enhanced glucose uptake in C2C12 cells. •Alkyl-LPA-treated C2C12 cells express increased amounts of GLUT4 mRNA. •Alkyl-LPA is a novel therapeutic agent that can be used for the treatment of obesity and diabetes. -- Abstract: Studies on the effects of lipids on skeletal muscle cells rarely examine the effects of lysophospholipids. Through our recent studies, we identified select forms of phospholipids, such as alkyl-LPA, as ligands for the intracellular receptor peroxisome proliferator-activated receptor gamma (PPARγ). PPARγ is a nuclear hormone receptor implicated in many human diseases, including diabetes and obesity. We previously showed that alkyl-LPA is a specific agonist of PPARγ. However, the mechanism by which the alkyl-LPA–PPARγ axis affects skeletal muscle cells is poorly defined. Our objective in the present study was to determine whether alkyl-LPA and PPARγ activation promotes glucose uptake in skeletal muscle cells. Our findings indicate that PPARγ1 mRNA is more abundant than PPARγ2 mRNA in C2C12 cells. We showed that alkyl-LPA (3 μM) significantly activated PPARγ and increased intracellular glucose levels in skeletal muscle cells. We also showed that incubation of C2C12 cells with alkyl-LPA led to lipid accumulation in the cells. These findings suggest that alkyl-LPA activates PPARγ and stimulates glucose uptake in the absence of insulin in C2C12 cells. This may contribute to the plasma glucose-lowering effect in the treatment of insulin resistance

  2. Quantum Chemical and Experimental Studies on the Mechanism of Alkylation of β-Dicarbonyl Compounds. The Synthesis of Five and Six Membered Heterocyclic Spiro Derivatives

    Ali Hüseyinli

    2004-11-01

    Full Text Available The alkylation of β-dicarbonyl compounds in a K2CO3/DMSO system wasfound to afford O- and C-alkylated derivatives, depending on the type of the β-dicarbonylcompound involved. The alkyl derivatives obtained were used in the synthesis of some newspiro barbituric acid derivatives. Quantum chemical calculations were carried out toelucidate the reaction mechanisms for some typical synthesis.

  3. Quantum chemical and experimental studies on the mechanism of alkylation of beta-dicarbonyl compounds. The synthesis of five and six membered heterocyclic spiro derivatives.

    Sadikov, Nurettin; Nasibov, Sahin; Oğretir, Cemil; Berber, Halil; Hüseyinli, Ali

    2004-01-01

    The alkylation of beta-dicarbonyl compounds in a K2CO3/DMSO system was found to afford O- and C-alkylated derivatives, depending on the type of the beta-dicarbonyl compound involved. The alkyl derivatives obtained were used in the synthesis of some new spiro barbituric acid derivatives. Quantum chemical calculations were carried out to elucidate the reaction mechanisms for some typical synthesis. PMID:18007493

  4. Quantum Chemical and Experimental Studies on the Mechanism of Alkylation of β-Dicarbonyl Compounds. The Synthesis of Five and Six Membered Heterocyclic Spiro Derivatives

    Ali Hüseyinli; Halil Berber; Cemil Ogretir; Sahin Nasibov; Nurettin Sadikov

    2004-01-01

    The alkylation of β-dicarbonyl compounds in a K2CO3/DMSO system wasfound to afford O- and C-alkylated derivatives, depending on the type of the β-dicarbonylcompound involved. The alkyl derivatives obtained were used in the synthesis of some newspiro barbituric acid derivatives. Quantum chemical calculations were carried out toelucidate the reaction mechanisms for some typical synthesis.

  5. An Efficient Protocol for the Palladium-Catalyzed Asymmetric Decarboxylative Allylic Alkylation Using Low Palladium Concentrations and a Palladium(II) Precatalyst

    Marziale, Alexander N.; Duquette, Douglas C.; Craig, Robert A.; Kim, Kelly E.; Liniger, Marc; Numajiri, Yoshitaka; Stoltz, Brian M.

    2015-01-01

    Enantioselective catalytic allylic alkylation for the synthesis of 2-alkyl-2-allylcycloalkanones and 3,3-disubstituted pyrrolidinones, piperidinones and piperazinones has been previously reported by our laboratory. The efficient construction of chiral all-carbon quaternary centers by allylic alkylation was previously achieved with a catalyst derived in situ from zero-valent palladium sources and chiral phosphinooxazoline (PHOX) ligands. We now report an improved reaction protocol with broad a...

  6. Palladium-Catalyzed 6-Endo Selective Alkyl-Heck Reactions: Access to 5-Phenyl-1,2,3,6-tetrahydropyridine Derivatives.

    Dong, Xu; Han, Ying; Yan, Fachao; Liu, Qing; Wang, Ping; Chen, Kexun; Li, Yueyun; Zhao, Zengdian; Dong, Yunhui; Liu, Hui

    2016-08-01

    A new type of palladium-catalyzed 6-endo-selective alkyl-Heck reaction of unactivated alkyl iodides has been described. This strategy provides efficient access to a variety of 5-phenyl-1,2,3,6-tetrahydropyridine derivatives, which are important structural motifs for bioactive molecules. This process displays a broad substrate scope with excellent 6-endo selectivity. Mechanistic investigations reveal that this alkyl-Heck reaction performs via a hybrid palladium-radical process. PMID:27409716

  7. An Efficient Protocol for the Palladium-catalyzed Asymmetric Decarboxylative Allylic Alkylation Using Low Palladium Concentrations and a Palladium(II) Precatalyst

    Marziale, Alexander N.; Duquette, Douglas C.; Craig, Robert A.; Kim, Kelly E.; Liniger, Marc; Numajiri, Yoshitaka; Stoltz, Brian M.

    2015-01-01

    Enantioselective catalytic allylic alkylation for the synthesis of 2-alkyl-2-allylcycloalkanones and 3,3-disubstituted pyrrolidinones, piperidinones and piperazinones has been previously reported by our laboratory. The efficient construction of chiral all-carbon quaternary centers by allylic alkylation was previously achieved with a catalyst derived in situ from zero valent palladium sources and chiral phosphinooxazoline (PHOX) ligands. We now report an improved reaction protocol with broad a...

  8. Effect of alkyl glycerophosphate on the activation of peroxisome proliferator-activated receptor gamma and glucose uptake in C2C12 cells

    Tsukahara, Tamotsu, E-mail: ttamotsu@shinshu-u.ac.jp [Department of Integrative Physiology and Bio-System Control, Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto, Nagano 390-8621 (Japan); Haniu, Hisao [Department of Orthopedic Surgery, Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto, Nagano 390-8621 (Japan); Matsuda, Yoshikazu [Clinical Pharmacology Educational Center, Nihon Pharmaceutical University, Ina-machi, Saitama 362-0806 (Japan)

    2013-04-12

    Highlights: •Alkyl-LPA specifically interacts with PPARγ. •Alkyl-LPA treatments induces lipid accumulation in C2C12 cells. •Alkyl-LPA enhanced glucose uptake in C2C12 cells. •Alkyl-LPA-treated C2C12 cells express increased amounts of GLUT4 mRNA. •Alkyl-LPA is a novel therapeutic agent that can be used for the treatment of obesity and diabetes. -- Abstract: Studies on the effects of lipids on skeletal muscle cells rarely examine the effects of lysophospholipids. Through our recent studies, we identified select forms of phospholipids, such as alkyl-LPA, as ligands for the intracellular receptor peroxisome proliferator-activated receptor gamma (PPARγ). PPARγ is a nuclear hormone receptor implicated in many human diseases, including diabetes and obesity. We previously showed that alkyl-LPA is a specific agonist of PPARγ. However, the mechanism by which the alkyl-LPA–PPARγ axis affects skeletal muscle cells is poorly defined. Our objective in the present study was to determine whether alkyl-LPA and PPARγ activation promotes glucose uptake in skeletal muscle cells. Our findings indicate that PPARγ1 mRNA is more abundant than PPARγ2 mRNA in C2C12 cells. We showed that alkyl-LPA (3 μM) significantly activated PPARγ and increased intracellular glucose levels in skeletal muscle cells. We also showed that incubation of C2C12 cells with alkyl-LPA led to lipid accumulation in the cells. These findings suggest that alkyl-LPA activates PPARγ and stimulates glucose uptake in the absence of insulin in C2C12 cells. This may contribute to the plasma glucose-lowering effect in the treatment of insulin resistance.

  9. Ab Initio Studies of Stratospheric Ozone Depletion Chemistry

    Lee, Timothy J.; Head-Gordon, Martin; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    An overview of the current understanding of ozone depletion chemistry, particularly with regards the formation of the so-called Antarctic ozone hole, will be presented together with an outline as to how ab initio quantum chemistry can be used to further our understanding of stratospheric chemistry. The ability of modern state-of-the art ab initio quantum chemical techniques to characterize reliably the gas-phase molecular structure, vibrational spectrum, electronic spectrum, and thermal stability of fluorine, chlorine, bromine and nitrogen oxide species will be demonstrated by presentation of some example studies. The ab initio results will be shown to be in excellent agreement with the available experimental data, and where the experimental data are either not known or are inconclusive, the theoretical results are shown to fill in the gaps and to resolve experimental controversies. In addition, ab initio studies in which the electronic spectra and the characterization of excited electronic states of halogen oxide species will also be presented. Again where available, the ab initio results are compared to experimental observations, and are used to aid in the interpretation of experimental studies.

  10. Base-promoted reactions of bridged ketones and 1,3- and 1,4-haloalkyl azides: competitive alkylation vs azidation reactions of ketone enolates.

    Yao, Lei; Smith, Brenton T; Aubé, Jeffrey

    2004-03-01

    The reactions of 1,3- and 1,4-haloalkyl azides with enolates of 2-norbornanone (and a ring-expanded analog) afford polycyclic 1,2,3-triazolines in good yields. The reaction occurs by the initial azidation of the ketone enolate, followed in order by triazoline formation and O-alkylation. An interesting element of this process is the preferential reaction of the alkyl azide with an enolate anion as opposed to the more familiar reaction of the alkyl halide (including Cl and I derivatives). Reactions of acyclic or monocyclic enolates generally lead to 1,2,3-triazoles but none of the alternative C-alkylation product. PMID:14987033

  11. The over-expression of two transcription factors, ABS5/bHLH30 and ABS7/MYB101, leads to upwardly curly leaves.

    Rui An

    Full Text Available Proper leaf development is essential for plant growth and development, and leaf morphogenesis is under the control of intricate networks of genetic and environmental cues. We are interested in dissecting these regulatory circuits genetically and report here the isolation of two Arabidopsis dominant mutants, abnormal shoot5-1D (abs5-1D and abs7-1D identified through activation tagging screens. Both abs5-1D and abs7-1D display an intriguing upwardly curly leaf phenotype. Molecular cloning showed that the elevated expression of a bHLH transcription factor ABS5/T5L1/bHLH30 or a MYB transcription factor ABS7/MYB101 is the cause for the abnormal leaf phenotypes found in abs5-1D or abs7-1D, respectively. Protoplast transient expression assays confirmed that both ABS5/T5L1 and ABS7/MYB101 are targeted to the nucleus. Interestingly, the expression domains of auxin response reporter DR5::GUS were abnormal in leaves of abs5-1D and ABS5/T5L1 over-expression lines. Moreover, cotyledon venation analysis showed that more areoles and free-ending veins are formed in abs5-1D. We found that the epidermis-specific expressions of ABS5/T5L1 or ABS7/MYB101 driven by the Arabidopsis Meristem Layer 1 promoter (PAtML1 were sufficient to recapitulate the curly leaf phenotype of abs5-1D or abs7-1D. In addition, PAtML1::ABS5 lines exhibited similar changes in DR5::GUS expression patterns as those found in 35S-driven ABS5/T5L1 over-expression lines. Our work demonstrated that enhanced expressions of two transcription factors, ABS5/T5L1 and ABS7/MYB101, are able to alter leaf lamina development and reinforce the notion that leaf epidermis plays critical roles in regulating plant organ morphogenesis.

  12. Ab initio simulation of transport phenomena in rarefied gases.

    Sharipov, Felix; Strapasson, José L

    2012-09-01

    Ab initio potentials are implemented into the direct simulation Monte Carlo (DSMC) method. Such an implementation allows us to model transport phenomena in rarefied gases without any fitting parameter of intermolecular collisions usually extracted from experimental data. Applying the method proposed by Sharipov and Strapasson [Phys. Fluids 24, 011703 (2012)], the use of ab initio potentials in the DSMC requires the same computational efforts as the widely used potentials such as hard spheres, variable hard sphere, variable soft spheres, etc. At the same time, the ab initio potentials provide more reliable results than any other one. As an example, the transport coefficients of a binary mixture He-Ar, viz., viscosity, thermal conductivity, and thermal diffusion factor, have been calculated for several values of the mole fraction. PMID:23030889

  13. Glutathione Depletion Induced by c-Myc Downregulation Triggers Apoptosis on Treatment with Alkylating Agents

    Annamaria Biroccio

    2004-05-01

    Full Text Available Here we investigate the mechanism(s involved in the c-Myc-dependent drug response of melanoma cells. By using three M14-derived c-Myc low-expressing clones, we demonstrate that alkylating agents, cisplatin and melphalan, trigger apoptosis in the c-Myc antisense transfectants, but not in the parental line. On the contrary, topoisomerase inhibitors, adriamycin and camptothecin, induce apoptosis to the same extent regardless of c-Myc expression. Because we previously demonstrated that c-Myc downregulation decreases glutathione (GSH content, we evaluated the role of GSH in the apoptosis induced by the different drugs. In control cells treated with one of the alkylating agents or the others, GSH depletion achieved by L-buthionine-sulfoximine preincubation opens the apoptotic pathway. The apoptosis proceeded through early Bax relocalization, cytochrome c release, concomitant caspase-9 activation, whereas reactive oxygen species production and alteration of mitochondria membrane potential were late events. That GSH was determining in the c-Myc-dependent druginduced apoptosis was demonstrated by altering the intracellular GSH content of the c-Myc low-expressing cells up to the level of controls. Indeed, GSH ethyl ester-mediated increase of GSH abrogated apoptosis induced by cisplatin and melphalan by inhibition of Baxicytochrome c redistribution. The relationship among c-Myc, GSH content, the response to alkylating agent has been also evaluated in the M14 Myc overexpressing clones as well as in the melanoma JR8 c-Myc antisense transfectants. All together, these results demonstrate that GSH plays a key role in governing c-Myc-dependent drug-induced apoptosis.

  14. DNA repair by MGMT, but not AAG, causes a threshold in alkylation-induced colorectal carcinogenesis.

    Fahrer, Jörg; Frisch, Janina; Nagel, Georg; Kraus, Alexander; Dörsam, Bastian; Thomas, Adam D; Reißig, Sonja; Waisman, Ari; Kaina, Bernd

    2015-10-01

    Epidemiological studies indicate that N-nitroso compounds (NOC) are causally linked to colorectal cancer (CRC). NOC induce DNA alkylations, including O (6)-methylguanine (O (6)-MeG) and N-methylated purines, which are repaired by O (6)-MeG-DNA methyltransferase (MGMT) and N-alkyladenine-DNA glycosylase (AAG)-initiated base excision repair, respectively. In view of recent evidence of nonlinear mutagenicity for NOC-like compounds, the question arises as to the existence of threshold doses in CRC formation. Here, we set out to determine the impact of DNA repair on the dose-response of alkylation-induced CRC. DNA repair proficient (WT) and deficient (Mgmt (-/-), Aag (-/-) and Mgmt (-/-)/Aag (-/-)) mice were treated with azoxymethane (AOM) and dextran sodium sulfate to trigger CRC. Tumors were quantified by non-invasive mini-endoscopy. A non-linear increase in CRC formation was observed in WT and Aag (-/-) mice. In contrast, a linear dose-dependent increase in tumor frequency was found in Mgmt (-/-) and Mgmt (-/-)/Aag (-/-) mice. The data were corroborated by hockey stick modeling, yielding similar carcinogenic thresholds for WT and Aag (-/-) and no threshold for MGMT lacking mice. O (6)-MeG levels and depletion of MGMT correlated well with the observed dose-response in CRC formation. AOM induced dose-dependently DNA double-strand breaks in colon crypts including Lgr5-positive colon stem cells, which coincided with ATR-Chk1-p53 signaling. Intriguingly, Mgmt (-/-) mice displayed significantly enhanced levels of γ-H2AX, suggesting the usefulness of γ-H2AX as an early genotoxicity marker in the colorectum. This study demonstrates for the first time a non-linear dose-response for alkylation-induced colorectal carcinogenesis and reveals DNA repair by MGMT, but not AAG, as a key node in determining a carcinogenic threshold. PMID:26243310

  15. Dynamic interfacial tension behavior of alkyl amino sulfonate in crude oil-brine system

    Ren, Zhao Hua; Luo, Yue [Yangtze Univ., Jingzhou, Hubei (China). College of Chemistry and Environmental Engineering

    2013-09-15

    The compatibility of surfactants, a series of alkyl amino sulfonate containing various the length of alkyl chain (dodecyl, tetradecyl, hexadecyl and octadecyl, developed in our laboratory), with formation water matching the Xinjiang Oil Field reservoir water and the dynamic interfacial tensions (DIT) behaviors between the crude oil and the formation water for a number of alkaline flooding systems were measured. These surfactants are found to be well compatible with formation water up to 0.10g L{sup -1} surfactant concentration, especially Dodec-AS and Tetradec-AS show a good compatibility with formation water over the full range of surfactant concentration investigated (0.01-0.20g L{sup -1}). All surfactants exhibit the dynamic interfacial tension behavior, and can reach and maintain low interfacial tension at very low concentration. The time for reaching the equilibrium DIT (DIT{sub eq}) is longer for surfactant with stronger lipophilicity, e.g. octadecyl-AS. It is interestingly found that the ratio value between DIT{sub eq} and the tension at crude oil/reservoir water interface in the absence of surfactant is in the range of 10{sup -4}-10{sup -3} mN m{sup -1}, accordingly based on which and the previous results, four surfactants individually or with other additives together may become potent candidates for enhanced oil recovery. Fortunately, the alkyl amino sulfonate combinational systems without alkali designed by our group can reduce the interfacial tension even to 10{sup -4} mN m{sup -1} at very low surfactant concentration. These surfactants or their systems have characteristic of 'Green', in addition to the excellent salt-tolerance and the less expensive cost for enhanced oil recovery, and therefore they are good oil-displacing reagents for enhanced oil recovery. (orig.)

  16. Anticancer activity of botanical alkyl hydroquinones attributed to topoisomerase II poisoning

    Cytotoxic alkyl hydroquinone compounds have been isolated from many plants. We previously isolated 3 structurally similar cytotoxic alkyl hydroquinone compounds from the sap of the lacquer tree Rhus succedanea L. belonging to the sumac family, which have a long history of medicinal use in Asia. Each has an unsaturated alkyl chain attached to the 2-position of a hydroquinone ring. One of these isolates, 10'(Z),13'(E),15'(E)-heptadecatrienylhydroquinone [HQ17(3)], being the most cytotoxic, was chosen for studying the anticancer mechanism of these compounds. We found that HQ17(3) was a topoisomerase (Topo) II poison. It irreversibly inhibited Topo IIα activity through the accumulation of Topo II-DNA cleavable complexes. A cell-based assay showed that HQ17(3) inhibited the growth of leukemia HL-60 cells with an EC50 of 0.9 μM, inhibited the topoisomerase-II-deficient cells HL-60/MX2 with an EC50 of 9.6 μM, and exerted no effect on peripheral blood mononuclear cells at concentrations up to 50 μM. These results suggest that Topo II is the cellular drug target. In HL-60 cells, HQ17(3) promptly inhibited DNA synthesis, induced chromosomal breakage, and led to cell death with an EC50 about one-tenth that of hydroquinone. Pretreatment of the cells with N-acetylcysteine could not attenuate the cytotoxicity and DNA damage induced by HQ17(3). However, N-acetylcysteine did significantly reduce the cytotoxicity of hydroquinone. In F344 rats, intraperitoneal injection of HQ17(3) for 28 days induced no clinical signs of toxicity. These results indicated that HQ17(3) is a potential anticancer agent, and its structural features could be a model for anticancer drug design

  17. Risk factors for oral mucositis in paediatric oncology patients receiving alkylant chemotherapy

    Campus Guglielmo

    2006-10-01

    Full Text Available Abstract Background We describe the risk indicators for oral mucositis (OM in paediatric oncology patients hospitalised in the Institut Gustave Roussy (Villejuif-Paris and treated with alkylant chemotherapy with autologous peripheral blood progenitor cells. Methods The sample was selected using PIGAS software. Three groups of subjects received different chemotherapy regimens: A. Melphalan, B. Busulfan and C. other alkylant protocols. The degree of mucositis was recorded by CTC version 2.0 (Common Toxicity Criteria. Descriptive statistics were performed. The association between mucositis and risk indicator variables was tested using a χ2 test. The association between case status and covariates was tested using unconditional logistic regression analysis. Results Of the 337 children enrolled, 241 showed mucositis (group 1 and 96 did not show mucositis (group 2 during alkylant chemotherapy. There was a higher prevalence of male patients in both groups. The three different chemotherapy regimen groups are correlated with the appearance of oral mucositis (χ2 = 22.42, p 2 = 6.31, p = 0.01. The duration of aplasia was lower in the Busulfan protocol (7.5 days than in the Melphalan group (9.3 days or the other regimens (8.6 days. The use of Bufulfan® was directly associated with case status (presence of oral mucositis: odds ratio [OR] = 2.1 and confidence interval [95%CI] = 1.3–3.0. Also, occurrences of germinal tumours and secondary bacterial infections were directly linked with case status: [OR] = 1.4 and 1.8, confidence interval [95%CI] = 1.2 – 1.7 and 1.1 – 2.5, respectively. Conclusion The presence of OM was associated with the three different chemotherapy regimens considered; in particularly patients treated with Busulfan had the highest prevalence.

  18. Cellular delivery of shRNA using aptamer-conjugated PLL-alkyl-PEI nanoparticles.

    Askarian, Saeedeh; Abnous, Khalil; Taghavi, Sahar; Oskuee, Reza Kazemi; Ramezani, Mohammad

    2015-12-01

    Introduction of an efficient gene delivery vector is still the main challenge of gene therapy. Both polyethylenimine (PEI) and poly(l-lysine) (PLL) comprise disadvantages which limited their application. To explore whether their deficiencies could be compensated by preparing copolymers consisting of both PLL and PEI, we generated several combinations of PLL-alkyl-PEI copolymers conjugated to aptamer and evaluated their both gene delivery efficiency and down-regulation of Bcl-XL, an anti-apoptotic gene, in lung cancer cell line. PLL was conjugated to either 10% or 50% of PEI by grafting different percentages of PEI to alkylated-PLL as core. The properties of modified polymers including size, surface charge density, DNA condensation ability, buffering capacity and cytotoxicity were evaluated. According to transfection results, aptamer conjugated PLL-alkyl-10%-PEI (PLPE8%) was selected for further gene silencing study by plasmid shRNA. Decrease in Bcl-XL gene expression was estimated by both RT-PCR and western-blot experiments. The obtained results revealed that the new copolymers had appropriate nano-scale size (117-128 nm) even after aptamer conjugation (168-183 nm). Moreover, they exhibited increased transfection efficiencies by up to 1.8-5 folds and acceptable cytotoxicity. The apoptosis was induced in transfected cells by shRNA-aptamer-copolymer due to the down-regulation of mRNA and protein levels. This study suggested a new vector for targeted non-viral gene delivery with high transfection efficiency in lung cancer or pulmonary systems. PMID:26433348

  19. Replacing conventional carbon nucleophiles with electrophiles: nickel-catalyzed reductive alkylation of aryl bromides and chlorides.

    Everson, Daniel A; Jones, Brittany A; Weix, Daniel J

    2012-04-11

    A general method is presented for the synthesis of alkylated arenes by the chemoselective combination of two electrophilic carbons. Under the optimized conditions, a variety of aryl and vinyl bromides are reductively coupled with alkyl bromides in high yields. Under similar conditions, activated aryl chlorides can also be coupled with bromoalkanes. The protocols are highly functional-group tolerant (-OH, -NHTs, -OAc, -OTs, -OTf, -COMe, -NHBoc, -NHCbz, -CN, -SO(2)Me), and the reactions are assembled on the benchtop with no special precautions to exclude air or moisture. The reaction displays different chemoselectivity than conventional cross-coupling reactions, such as the Suzuki-Miyaura, Stille, and Hiyama-Denmark reactions. Substrates bearing both an electrophilic and nucleophilic carbon result in selective coupling at the electrophilic carbon (R-X) and no reaction at the nucleophilic carbon (R-[M]) for organoboron (-Bpin), organotin (-SnMe(3)), and organosilicon (-SiMe(2)OH) containing organic halides (X-R-[M]). A Hammett study showed a linear correlation of σ and σ(-) parameters with the relative rate of reaction of substituted aryl bromides with bromoalkanes. The small ρ values for these correlations (1.2-1.7) indicate that oxidative addition of the bromoarene is not the turnover-frequency determining step. The rate of reaction has a positive dependence on the concentration of alkyl bromide and catalyst, no dependence upon the amount of zinc (reducing agent), and an inverse dependence upon aryl halide concentration. These results and studies with an organic reductant (TDAE) argue against the intermediacy of organozinc reagents. PMID:22463689

  20. Surface Modification of AB2. and AB5 Hydrogen Storage Alloy Electrodes by the Hot-Charging Treatment

    2001-01-01

    The effect of the hot-charging treatment on the performance ofAB2 and AB5 hydrogen storage alloy electrodes was investigated. The result showed that the treatment can markedly improve the voltage plateau ratio (VPR), the high rate discharge ability (HRDA), the diffusion coefficient of hydrogen DH and the discharge capacity of the AB2 hydrogen storage alloy electrode. The SEM analysis showed that the hot-charging treatment brings about a Ni-rich surface due to the dissolution of Zr oxides. It is also very helpful for the improvement of the kinetic properties of AB2 hydrogen storage alloy electrode because the microcracking o.f the surface results in fresh surface. This can be the basic modification treatment for NiMH battery used in electric vehicles (EVs) in the future. But for AB5 type alloys, the treatment has the disadvantage of impairing the comprehensive electrochemical properties, because the surface of the alloy may be corroded during the treatment. The mechanism of the surface modification of the electrode is also proposed.

  1. (E-4-[(5-Methyl-2-furylmethyleneamino]benzenesulfonic acid

    Jianlan Suo

    2008-09-01

    Full Text Available The title compound, C12H11NO4S, is a Schiff base derived from the condensation reaction of equimolar quantities of sulfamide and furfural. The molecule has a trans configuration with respect to the imine C=N double bond. The N atom is involved in an intermolecular O—H—N hydrogen bond.

  2. The Scope of Direct Alkylation of Gold Surface with Solutions of C1–C4n-Alkylstannanes

    2015-01-01

    Treatment of cleaned gold surfaces with dilute tetrahydrofuran or chloroform solutions of tetraalkylstannanes (alkyl = methyl, ethyl, n-propyl, n-butyl) or di-n-butylmethylstannyl tosylate under ambient conditions causes a self-limited growth of disordered monolayers consisting of alkyls and tin oxide. Extensive use of deuterium labeling showed that the alkyls originate from the stannane and not from ambient impurities, and that trialkylstannyl groups are absent in the monolayers, contrary to previous proposals. Methyl groups attached to the Sn atom are not transferred to the surface. Ethyl groups are transferred slowly, and propyl and butyl rapidly. In all cases, tin oxide is codeposited in submonolayer amounts. The monolayers were characterized by ellipsometry, contact angle goniometry, polarization modulated IR reflection absorption spectroscopy, X-ray photoelectron spectroscopy, and electrochemical impedance spectroscopy with ferrocyanide/ferricyanide, which revealed a very low charge-transfer resistance. The thermal stability of the monolayers and their resistance to solvents are comparable with those of an n-octadecanethiol monolayer. A preliminary examination of the kinetics of monolayer deposition from a THF solution of tetra-n-butylstannane revealed an approximately half-order dependence on the bulk solution concentration of the stannane, hinting that more than one alkyl can be transferred from a single stannane molecule. A detailed structure of the attachment of the alkyl groups is not known, and it is proposed that it involves direct single or multiple bonding of one or more C atoms to one or more Au atoms. PMID:26327466

  3. Stimulation of UvrD helicase by UvrAB.

    Atkinson, John; Guy, Colin P; Cadman, Chris J; Moolenaar, Geri F; Goosen, Nora; McGlynn, Peter

    2009-04-01

    Helicases play critical roles in all aspects of nucleic acid metabolism by catalyzing the remodeling of DNA and RNA structures. UvrD is an abundant helicase in Escherichia coli with well characterized functions in mismatch and nucleotide excision repair and a possible role in displacement of proteins such as RecA from single-stranded DNA. The mismatch repair protein MutL is known to stimulate UvrD. Here we show that the nucleotide excision repair proteins UvrA and UvrB can together stimulate UvrD-catalyzed unwinding of a range of DNA substrates containing strand discontinuities, including forked DNA substrates. The stimulation is specific for UvrD, as UvrAB failed to stimulate Rep helicase, a UvrD homologue. Moreover, although UvrAB can promote limited strand displacement, stimulation of UvrD did not require the strand displacement function of UvrAB. We conclude that UvrAB, like MutL, modulate UvrD helicase activity. This stimulation likely plays a role in DNA strand and protein displacement by UvrD in nucleotide excision repair. Promotion of UvrD-catalyzed unwinding of nicked duplexes by UvrAB may also explain the need for UvrAB and UvrD in Okazaki fragment processing in cells lacking DNA polymerase I. More generally, these data support the idea that helicase activity is regulated in vivo, with helicases acting as part of multisubunit complexes rather than in isolation. PMID:19208629

  4. Selective inhibition of human inducible nitric oxide synthase by S-alkyl-L-isothiocitrulline-containing dipeptides

    Park, Jung-Min; Higuchi, Tsunehiko; Kikuchi, Kazuya; Urano, Yasuteru; Hori, Hiroyuki; Nishino, Takeshi; Aoki, Junken; Inoue, Keizo; Nagano, Tetsuo

    2001-01-01

    The aim of this study was to investigate the structure-activity relationship of S-alkyl-L-isothiocitrulline-containing dipeptides towards three partially purified recombinant human nitric oxide synthase (NOS) isozymes, as well as the effects of these compounds on cytokine-induced NO production by human DLD-1 cells.In an in vitro assay, S-methyl-L-isothiocitrulline (L-MIT) was slightly selective for human neuronal NOS (nNOS) over the inducible (iNOS) or endothelial (eNOS) isozyme, but the comb...

  5. Alkyl aryl ethers in lignite solubilization 1. Study of the process

    Mastral, A.M.; Cebolla, V.L.; Gavilan, J.M.

    1984-10-01

    The chemistry of solubilization of a lignite has been investigated with anisole, 3-methyl anisole and 1,3dimethoxybenzene catalysed by SbCl/sub 3/, ZnCl/sub 2/, AlCl/sub 3/ and BF/sub 3/ as boron trifluoride etherate, at atmospheric pressure and temperatures <220/sup 0/C. 60% of lignite was solubilized in a toluene-ethanol azeotropic mixture. During the process, the solvent is incorporated as an alkylated substratum. The yield increased with activity of the aromatic ether ring and catalyst acidity.

  6. Alkyl aryl ethers in lignite solubilization. 1. Study of the process

    Mastral, A.M.; Cebolla, V.L.; Gavilan, J.M.

    1984-10-01

    The chemistry of solubilization of a lignite has been investigated with anisole, 3-methyl anisole and 13-dimethoxybenzene catalysed by SbCl/sub 3/, ZnCl/sub 2/, AlCl/sub 3/ and BF/sub 3/ as boron trifluoride etherate, at atmospheric pressure and temperatures <220 C. 60% of lignite was solubilized in a toluene-ethanol azeotropic mixture. During the process, the solvent is incorporated as an alkylated substratum. The yield increased with activity of the aromatic ether ring and catalyst acidity. 14 references.

  7. The enhanced alcohol sensing response of multiwalled carbon nanotube networks induced by alkyl diamine treatment

    Benlikaya, R.; Slobodian, P.; Říha, Pavel; Olejník, R.

    2014-01-01

    Roč. 201, October (2014), s. 122-130. ISSN 0925-4005 R&D Projects: GA MŠk(CZ) CZ.1.07/2.3.00/20.0104 Grant ostatní: UTB Zlín(CZ) IGA/FT/2013/018; GA MŠk(CZ) ED2.1.00/03.0111 Institutional research plan: CEZ:AV0Z20600510 Institutional support: RVO:67985874 Keywords : carbon nanotubes * multiwalled carbon nanotube networks * vapor sensing * linear alcohols * alkyl diamine treatment Subject RIV: BK - Fluid Dynamics Impact factor: 4.097, year: 2014

  8. Evaluation of the persistence in the induction of Sister Chromatid Exchanges (SCE) by alkylating agents

    The persistence in the induction of sister chromatid exchanges (SCE) by the alkylating agents methyl and ethyl-methanesulfonates (MMS and EMS) was evaluated. For it, to groups of mice its were administered a dose of these agents and later its were analyzed the induced SCE's in two periods: early and late. Both agents caused high increments of SCE in the early period and small in the late one; however, the caused lately by EMS was significantly bigger. This late induction of SCE by EMS possibly is associated with an epigenetic change or with the presence of etiladucts in the phosphodiester bonds of the DNA. (Author)

  9. Molecular structures of thimerosal (Merthiolate) and other arylthiolate mercury alkyl compounds.

    Melnick, Jonathan G; Yurkerwich, Kevin; Buccella, Daniela; Sattler, Wesley; Parkin, Gerard

    2008-07-21

    The molecular structure of sodium ethylmercury thiosalicylate (also known as thimerosal and Merthiolate) and related arylthiolate mercury alkyl compounds, namely PhSHgMe and PhSHgEt, have been determined by single crystal X-ray diffraction. (1)H NMR spectroscopic studies indicate that the appearance of the (199)Hg mercury satellites of the ethyl group of thimerosal is highly dependent on the magnetic field and the viscosity of the solvent as a consequence of relaxation due to chemical shift anisotropy. PMID:18533648

  10. In vitro susceptibilities in lymphocytes from mothers and cord blood to the monofunctional alkylating agent EMS

    Wyatt, N P; Falque-Gonzalez, C; Farrar, D;

    2007-01-01

    the Bradford Royal Infirmary collected venous blood samples from mothers at the time of birth and venous cord blood post-delivery. Lymphocytes were isolated from both blood types and examined in the alkaline comet assay using the monofunctional alkylating agent ethyl methanesulphonate (EMS). There.......05), but mean values in babies were always lower over the EMS dose range. Whole blood was used in the micronucleus (MN) assay, and there was a significantly (P<0.05) higher rate of MN in mothers (n=17), per 1000 binucleates, as compared with lymphocytes from their offspring (n=17) at the basal level. This...

  11. Customer exposure to MTBE, TAME, C6 alkyl methyl ethers, and benzene during gasoline refueling.

    Vainiotalo, S; Peltonen, Y; Ruonakangas, A; Pfäffli, P

    1999-01-01

    We studied customer exposure during refueling by collecting air samples from customers' breathing zone. The measurements were carried out during 4 days in summer 1996 at two Finnish self-service gasoline stations with "stage I" vapor recovery systems. The 95-RON (research octane number) gasoline contained approximately 2.7% methyl tert-butyl ether (MTBE), approximately 8.5% tert-amyl methyl ether (TAME), approximately 3.2% C6 alkyl methyl ethers (C6 AMEs), and 0.75% benzene. The individual ex...

  12. SYNTHESIS OF BIOLOGICALLY ACTIVE 2-CHLORO-N-ALKYL/ARYL ACETAMIDE DERIVATIVES

    S.A.Katke; S.V.Amrutkar; R.J.Bhor; M.V.Khairnar

    2011-01-01

    Medicinal chemistry plays an important role in development of drug for cure; maintain and improved health of human being. It is also equally important to design chemical entities for prevent the growth of micro-organism, which come in contact with human being in day-to-day life. We have synthesized 2-chloro-N-alkyl/aryl Acetamide derivatives with an aim as new bioactive agent, which can be used as anti microbial agents such as herbicides, antifungal, disinfectant. The present study involves t...

  13. Solvent isotope effects on the rates of alkylation of thiolamine models of papain

    As a test of whether it is chemically reasonable to attribute any or all of the observed kinetic solvent deuterium isotope effects reported on papain to the fundamental properties of the tautomerization equilibrium, the magnitudes of the solvent deuterium isotope effects on the rates of alkylation of the tautomeric forms of cysteine and β-mercaptoethylamine were determined for bromo- and chloroacetate, bromo- and chloroacetamide, as well as for methylbromoacetate. These thiolamines are viewed as elementary chemical models of the sulfhydryl group tautomerization equilibrium envisioned in the active site of papain. (Auth.)

  14. Synthesis of Single-stranded Polynorbornene with Pendant Group Bearing Benzenedicarboxaldehyde and Long Alkyl Chain

    ZHANG Ze; WU Hao-hao; WANG Chun-shan; FAN Kun-zeng

    2012-01-01

    An unprecedented single-stranded polynorbornene with the pendant group containing benzenedicarboxaldehyde and a long alkyl chain(12) was synthesized by ring-open metathesis polymerization(ROMP) of the corresponding monomer(11),which was obtained via the esterification of two crucial intermediates,namely,2-hexadecyloxy-5-hydroxymethy1-1,3-benzenedicarboxaldehyde(7,obtained via 6 steps) and 4-(4-aza-tricyclo[5.2.1.02.6]-dec-8en-4-yl)benzoic acid(10).The target compound and all the intermediates were characterized by infrared(IR),1H NMR and high resolution mass spectroscopy(HRMS) analysis.

  15. Imaging NO elimination in the infrared multiphoton dissociation of nitroalkanes and alkyl nitrites

    Fernando, Ravin; Ariyasingha, Nuwandi M.; Suits, Arthur G.

    2016-02-01

    We present a DC slice imaging study of the decomposition of C2, C3 and C4 nitroalkanes and alkyl nitrites, focusing on the NO elimination channel, possibly a minor pathway. Infrared multiphoton dissociation (IRMPD) is used to induce dissociation on the ground electronic state under collisionless conditions. The channels that produced NO as a product were studied and compared among the target molecules to gain a better understanding of the isomerization of the nitroalkanes prior to dissociation. Trends in the total translational energy and NO rotational temperatures obtained from the images are discussed.

  16. General Intermediates for the Synthesis of 6-C-Alkylated DMDP-Related Natural Products

    Chu-Yi Yu

    2013-06-01

    Full Text Available Protected L-homoDMDP en-8 and its C-6 epimer en-7 were prepared through two different pathways starting from the vinylpyrrolidine en-9. Based on the NMR and X-ray analysis, the stereochemistry of homoDMDP at C-6 was confirmed to be consistent with reported data. Compounds en-7 and en-8 are general intermediates for the synthesis of a series of 6-C-alkylated DMDP-related natural products, such as broussonetine G, homoDMDP-7-O-apioside, homoDMDP-7-O-b-D-xyloside and so on.

  17. Towards the Limits of Vibrational Circular Dichroism Spectroscopy: VCD Spectra of Some Alkyl Vinylethers.

    Zinna, Francesco; Pescitelli, Gennaro

    2016-02-01

    Three alkyl vinylethers from our collection of chiral samples were investigated through VCD spectroscopy, in combination with Density Functional Theory (DFT) calculations. Despite the simplicity of the compounds, reproducing all the spectral features is an involved task, since the many significantly populated conformers contribute to the total VCD spectrum with bands which often have opposite signatures. Nevertheless, we show that certain bands can be satisfactorily reproduced by calculation and therefore they may be employed for the determination of absolute configuration in these and similar compounds, for which no simple alternative method is available. Chirality 28:143-146, 2016. © 2015 Wiley Periodicals, Inc. PMID:26634887

  18. Synthesis, characterization and antibacterial studies of metal complexes of sulfadiazine with N-alkyl-N-phenyldithiocarbamate

    Okoh, A. I.; O. G. Idemudia; Ajibade, P. A.

    2013-01-01

    Co(II), Cu(II), Pd(II) and Pt(II) complexes of 4-amino-N-(2-pyrimidinyl)benzene sulfonamide (sulfadiazine) with some N-alkyl-N-phenyl dithiocarbamate have been synthesized and characterized by elemental analysis, conductivity measurements, UV-Vis and FTIR spectroscopy. The complexes are formulated as four coordinate MN2S2 species in which the metal ions are coordinated to one molecule of sulfadiazine through the pyrimidinyl and sulfulnamido nitrogen atoms and one molecule of dithiocarbamate t...

  19. Kinetics of the Esterification Reaction Catalyzed by Lipase in W/O Microemulsions of Alkyl Polyglucoside

    Jin Ling CHAI; Shou Qing WANG; Gan Zuo LI; Qing XU; Yan Hong GAO

    2004-01-01

    A novel kinetic mechanism of esterification reaction of 1-hexanoic acid with 1-butanol, catalyzed by lipase, was studied in water-in-oil microemulsions. The microemulsions were formed by alkyl polyglucoside C10G1.54 /1-butanol / cyclohexane/phosphate buffer solution. The result shows that when the ratio of mol concentration of 1-butanol to 1-hexanoic acid is about 3.0, the initial rate V0 get the maximum values. This phenomenon was explained by the modified fishlike phase diagrams.

  20. Simplest AB-Thermonuclear Space Propulsion and Electric Generator

    Bolonkin, Alexander

    2007-01-01

    The author applies, develops and researches mini-sized Micro- AB Thermonuclear Reactors for space propulsion and space power systems. These small engines directly convert the high speed charged particles produced in the thermonuclear reactor into vehicle thrust or vehicle electricity with maximum efficiency. The simplest AB-thermonuclear propulsion offered allows spaceships to reach speeds of 20,000 50,000 km/s (1/6 of light speed) for fuel ratio 0.1 and produces a huge amount of useful elect...

  1. Utveckling av ergoterapitjänster vid Helsingfors ergoterapi Ab

    Sandells, Linn

    2015-01-01

    Syftet med examensarbetet är att ta fram kvalitativa rekommendationer på ergoterapitjänster för barn i behov av särskilt stöd. Det har gjorts genom en processinriktad metod, rekommendationerna på ergoterapitjänster har tagits fram för Helsingfors ergoterapi Ab. Aktivitetsrättvisa är den teoretiska referensramen i arbetet. Den frågeställning som besvarats är vilka ergoterapitjänster kan rekommenderas till Helsingfors ergoterapi Ab. För att uppnå resultatet har materialinsamling och intervjuer ...

  2. Towards new horizons in ab initio nuclear structure theory

    We review recent advances in ab initio nuclear structure theory, which have changed the horizons of this field. Starting from chiral effective field theory to construct the nuclear Hamiltonian and the similarity renormalization group to further soften it, we address several many-body approaches that have seen major developments over the past few years. We show that the domain of ab initio nuclear structure theory has been pushed well beyond the p-shell and that quantitative QCD-based predictions are becoming possible all the way from the proton to the neutron drip line up into the medium-mass regime. (authors)

  3. Use of ab initio quantum chemical methods in battery technology

    Deiss, E. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1997-06-01

    Ab initio quantum chemistry can nowadays predict physical and chemical properties of molecules and solids. An attempt should be made to use this tool more widely for predicting technologically favourable materials. To demonstrate the use of ab initio quantum chemistry in battery technology, the theoretical energy density (energy per volume of active electrode material) and specific energy (energy per mass of active electrode material) of a rechargeable lithium-ion battery consisting of a graphite electrode and a nickel oxide electrode has been calculated with this method. (author) 1 fig., 1 tab., 7 refs.

  4. P-V Relation for Mercuric Calcogenides: Ab Initio Method

    G. Misra

    2011-01-01

    Full Text Available Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P, volume (V and temperature (T that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This ab initio method is extended to derive the equation of state for Mercuric Calcogenides. The present equation of state has also been tested for the prediction of End Point. The computed results compare well with Quantum statistical data.

  5. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1962. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses (≥ 100 mrem/quarter) is for the whole of AB Atomenergi during this year 74. 2 manrem corresponding to about 50 mrem/year and person or 1 % of the maximum permissible dose. 32500 gamma films and 6200 neutron films have been evaluated. The total number of urine analyses is 2700 and of whole body measurements 10

  6. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1963. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses during the year is for AB Atomenergi 64.2 manrem which, distributed over the whole company personnel, corresponds to about 40 mrem per year and person or about 1 % of the maximum permissible dose. 37800 gamma films and 6700 neutron films have been evaluated. The total number of urine analyses is 3603 and of whole body measurements 211

  7. Intern kontroll : - En studie om Schroff Scandinavia ABs interna kontroll

    Huldt, Martin; Björksved, Patrick

    2014-01-01

    Sammanfattning: ”Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll” Datum:  2014-06-11 Nivå: Kandidatuppsats i företagsekonomi, 15 ECTS Institution: Akademin för Ekonomi, Samhälle och Teknik, EST,                 Mälardalen Högskola Författare: Patrick Björksved, Martin Huldt Titel: Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll Handledare : Magnus Linderström Nyckelord: Intern kontroll, intern revision, intern styrning, COSO-modellen, Lean product...

  8. Bruksmakt och maktbruk : Robertsfors AB 1897-1968

    Holmström, Per

    1988-01-01

    This thesis studies seven strategic decisions made in the family-owned forestry company Robertsfors AB, in Northern Sweden. During the present century Ro­bertsfors AB has developed from a patriarchally concern controlled into a capi­talistic industrial company. This also meant a radical change in the decision­making process. Two factors were decisive in this process: the managing direc­tor's values, and altered power relationships both within the company and exter­nally in relation to e g sta...

  9. The optimal placement of up and ab – a comparison

    Dehé, Nicole

    2005-01-01

    The particle verb construction (PVC), also referred to in the literature as phrasal verb or separable complex verb, occurs in most if not all of the Germanic languages. The work presented here deals with a comparison of the transitive PVC in English and German. In English, the construction occurs in two alternating word orders (They called off the concert vs. They called the concert off ). In German, on the other hand, only one order is possible (Sie sagten das Konzert ab vs. *Sie sagten ab das...

  10. Recent achievements in ab initio modelling of liquid water

    Khaliullin, Rustam Z

    2013-01-01

    The application of newly developed first-principle modeling techniques to liquid water deepens our understanding of the microscopic origins of its unusual macroscopic properties and behaviour. Here, we review two novel ab initio computational methods: second-generation Car-Parrinello molecular dynamics and decomposition analysis based on absolutely localized molecular orbitals. We show that these two methods in combination not only enable ab initio molecular dynamics simulations on previously inaccessible time and length scales, but also provide unprecedented insights into the nature of hydrogen bonding between water molecules. We discuss recent applications of these methods to water clusters and bulk water.

  11. Comparative study of intact A7 MoAb and F(ab')2 fragments for radioimmunoimaging of human colon cancer in nude mice

    Differences of pharmacokinetics and tumor imaging ability between intact monoclonal antibody A7 (A7 MoAb) and F(ab')2 fragments were studied in human colon cancer (LS-174T)-bearing nude mouse. First of all, we examined the yield and the immunoreactivity of F(ab')2 fragments after treatment with ficin as a function of time. The yield of F(ab')2 fragments reached about 50% after ficin treatment for 8 h, and the F(ab')2 retained about 80% of the immunoreactivity of the corresponding MoAb. Longer digestion with ficin produced smaller fragments (less than 92 kDa) with a lower yield and most of the immunoreactivity was lost. In pharmacokinetics studies, the F(ab')2 was preferentially taken up by the tumor, was cleared more rapidly from the blood circulation and seemed to have less non-specific tissue binding than intact A7 MoAb. In addition, the tumor image obtained at an early time using 131I-F(ab')2 was much superior in quality to that with intact 131I-A7 MoAb. The use of F(ab')2 fragments may be effective for tumor diagnosis and therapy. (author)

  12. GJ 282 AB (WDS 07400-0336 AB = BGH 3 AB) and GICLAS 112-29: A Very Wide System in Process of Dissociation

    Rica, F. M.; Benavides, R.

    2016-04-01

    Very wide binaries are interesting objects that shed light on the binary formation process and their dynamical evolution. Poveda et al. (2009) studied the possible physical relation of the near (14.2 pc) and wide (~58") binary star GJ 282 AB and the extremely wide (1.09º; ~55,000 AU) companion, NLTT 18149, and they concluded that this very wide system is in the process of dynamical disintegration. In this work, we confirm the same conclusion but using a different method. We first study dynamically GJ 282 AB, confirmed that it is a bound system and then we determine possible orbital solutions. Later, we calculate the relative velocity of NLTT 18149 with respect to the GJ 282 AB's center mass using their (U, V, W) galactocentric velocity. The relative velocity, Vrel = 1.98 ± 0.16 km s-1, is much larger than the escape velocity (0.25 ± 0.01 km s-1). Therefore, with a significance level of 11s, we also conclude that this very wide system is in a process of dynamical disintegration.

  13. Synthetic Routes to N-9 Alkylated 8-Oxoguanines; Weak Inhibitors of the Human DNA Glycosylase OGG1

    Tushar R. Mahajan

    2015-09-01

    Full Text Available The human 8-oxoguanine DNA glycosylase OGG1 is involved in base excision repair (BER, one of several DNA repair mechanisms that may counteract the effects of chemo- and radiation therapy for the treatment of cancer. We envisage that potent inhibitors of OGG1 may be found among the 9-alkyl-8-oxoguanines. Thus we explored synthetic routes to 8-oxoguanines and examined these as OGG1 inhibitors. The best reaction sequence started from 6-chloroguanine and involved N-9 alkylation, C-8 bromination, and finally simultaneous hydrolysis of both halides. Bromination before N-alkylation should only be considered when the N-substituent is not compatible with bromination conditions. The 8-oxoguanines were found to be weak inhibitors of OGG1. 6-Chloro-8-oxopurines, byproducts in the hydrolysis of 2,6-halopurines, turned out to be slightly better inhibitors than the corresponding 8-oxoguanines.

  14. On the influence of toxicity of O-alkyl serotonin derivatives on the implantation of their protective potency

    In experiments with mongrel mice, a study was made of the pharmacological activity of serotonin and its O-alkyl derivatives. It was estimated by the two indices, that is, the radioprotective properties and the influence on a local blood cannel in the spleen, the modifying effect of the agents' toxicity being estimated as well. As an O-alkyl group of 5-alkoxytryptamines was elongated from one to three carbon atoms and the toxicity of the substances increased, their radiprotective effect decreased more readily than their effect on the local blood cannel. The shortening of the range of the therapeutic effect of the agents under study, with regard to the two pharmacological indices mentioned above, the alkyl group being lengthened, followed a logarithmic function which was more pronounced in relation to the radioprotective index (cosα1/cosα2=1.58)

  15. Surface reactivity and layer analysis of chemisorbed reaction films in the surface-chemical environment of alkyl octadecenoates

    R B Choudhary; O N Anand; O S Tyagi

    2009-05-01

    Studies on surface reactivity of substrate iron (Fe-particles) were made in the tribo-chemical environment of alkyl octadecenoates. Two alkyl octadecenoates namely ethyl octadecenoate and methyl 12-hydroxy octadecenoate, slightly different in their chemical nature, were taken for preparing the chemisorbed reaction films (CRF) at the temperature 100 ± 5°C. The reaction products collected in the composite (amorphous) phase were isolated into three different solvent-soluble fractions (sub-layer films) using polar solvents of increasing polar strength. The FTIR analysis of these films showed that these were primarily organic in nature and were composed of alkyl and/or aryl hydroxy ethers, unsaturated hydroxy ketones, and aromatic structures chemically linked with iron surface. These reaction films also contained large amount of iron (Fe). Further, these film fractions also showed varying thermal behaviour during thermal decomposition in the temperature range of 50-800°C when thermally evaluated in the nitrogen environment.

  16. Adsorption of quinolone antibiotics in spherical mesoporous silica: Effects of the retained template and its alkyl chain length.

    Liang, Zhijie; Zhaob, Zhiwei; Sun, Tianyi; Shi, Wenxin; Cui, Fuyi

    2016-03-15

    In this study, mesoporous silica (meso-silica) MCM-41 and those with the templates retained were synthesized and characterized. Adsorption capacities of the synthesized materials towards typical quinolone antibiotic pollutants, enrofloxacin and norfloxacin as representative, were investigated, and effects of the alkyl chain length of the templates on the adsorption capacity were evaluated. The results of this study indicated that the retained templates enhanced the adsorption capacities (Qmax) of the meso-silica MCM-41 toward hydrophobic enrofloxacin, but had an inhibitory effect on that towards hydrophilic norfloxacin, which were attributed to the hydrophobic inter-environment created by the long alkyl chains of the retained templates. Importantly, the adsorption capacity increased with the increase of the alkyl chain length of the retained templates. PMID:26642441

  17. Preparation and use of tetra-alkyl cobalt dicarbollide for extraction of cesium and strontium into hydrocarbon solvents

    Preparation and use of tetra-C-alkyl cobalt dicarbollide for extraction of cesium and strontium into hydrocarbon solvents. Tetra-C-alkyl derivatives of cobalt dicarbollide, Co(C2R2B9H9)2-(CoB2R4-; R=CH3 and C6H13) are demonstrated to be significant cesium and strontium extractants from acidic and alkaline solutions into non-toxic organic solvent systems. Extractions using mesitylene and diethylbenzene are compared to those with nitrobenzene as the organic phase. CoB2-hexyl4- in diethylbenzene shows improved selectivity (104) for Cs over Na in acidic solution. In dilute alkaline solution, CoB2-hexyl4- extracts Cs less efficiently, but more effectively removes Sr from higher base concentrations. A general synthesis of tetra-C-alkyl cobalt dicarbollides is described. 6 figs

  18. Ab initio O(N) elongation-counterpoise method for BSSE-corrected interaction energy analyses in biosystems

    Orimoto, Yuuichi; Xie, Peng; Liu, Kai [Department of Material Sciences, Faculty of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Yamamoto, Ryohei [Department of Molecular and Material Sciences, Interdisciplinary Graduate School of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Imamura, Akira [Hiroshima Kokusai Gakuin University, 6-20-1 Nakano, Aki-ku, Hiroshima 739-0321 (Japan); Aoki, Yuriko, E-mail: aoki.yuriko.397@m.kyushu-u.ac.jp [Department of Material Sciences, Faculty of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Japan Science and Technology Agency, CREST, 4-1-8 Hon-chou, Kawaguchi, Saitama 332-0012 (Japan)

    2015-03-14

    An Elongation-counterpoise (ELG-CP) method was developed for performing accurate and efficient interaction energy analysis and correcting the basis set superposition error (BSSE) in biosystems. The method was achieved by combining our developed ab initio O(N) elongation method with the conventional counterpoise method proposed for solving the BSSE problem. As a test, the ELG-CP method was applied to the analysis of the DNAs’ inter-strands interaction energies with respect to the alkylation-induced base pair mismatch phenomenon that causes a transition from G⋯C to A⋯T. It was found that the ELG-CP method showed high efficiency (nearly linear-scaling) and high accuracy with a negligibly small energy error in the total energy calculations (in the order of 10{sup −7}–10{sup −8} hartree/atom) as compared with the conventional method during the counterpoise treatment. Furthermore, the magnitude of the BSSE was found to be ca. −290 kcal/mol for the calculation of a DNA model with 21 base pairs. This emphasizes the importance of BSSE correction when a limited size basis set is used to study the DNA models and compare small energy differences between them. In this work, we quantitatively estimated the inter-strands interaction energy for each possible step in the transition process from G⋯C to A⋯T by the ELG-CP method. It was found that the base pair replacement in the process only affects the interaction energy for a limited area around the mismatch position with a few adjacent base pairs. From the interaction energy point of view, our results showed that a base pair sliding mechanism possibly occurs after the alkylation of guanine to gain the maximum possible number of hydrogen bonds between the bases. In addition, the steps leading to the A⋯T replacement accompanied with replications were found to be unfavorable processes corresponding to ca. 10 kcal/mol loss in stabilization energy. The present study indicated that the ELG-CP method is promising for

  19. Novel polymer electrolytes based on cationic polyurethane with different alkyl chain length

    Liu, Libin; Wu, Xiwen; Li, Tianduo

    2014-03-01

    A series of comb-like cationic polyurethanes (PUs) were synthesized by quaternizing different bromoalkane (C2H5Br, C8H17Br, and C14H29Br) with polyurethane. Solid polymer electrolytes were prepared by complexes cationic PUs with different content of LiClO4. All the solid polymer electrolytes had sufficient thermal stability as confirmed by TGA and exhibited a single-phase behavior evidenced by DSC results. For these electrolytes, FT-IR spectra indicated the formation of polymer-ion complexes. The ac impedance spectra show that the conductivity of the electrolytes follow the Arrhenius behavior, and ionic conductivity is associated with both the charge migration of ions between coordination sites and transmission between aggregates, as confirmed by FT-IR and SEM. Alkyl quaternary ammonium salts in the polymer backbone are recognized as inherent plasticizers, which make the electrolytes exhibit liquid-like behavior. The plasticizing effect of PU-C8 and PU-C14 electrolytes are more effective than that of PU-C2 electrolyte. Maximum ionic conductivity at room temperature for PU-C8 electrolytes containing 50 wt% LiClO4 reached 1.1 × 10-4 S cm-1. This work provides a new research clue that alkyl quaternary ammonium salts could be used as inherent plasticizers and hence make the system behave like a liquid with high ionic conductivity, while preserving the dimensional stability of the solids.

  20. N-Alkyl Carbazole Derivatives as New Tools for Alzheimer’s Disease: Preliminary Studies

    Carmela Saturnino

    2014-07-01

    Full Text Available Alzheimer’s disease (AD is a progressive and age-related neurodegenerative disorder affecting brain cells and is the most common form of “dementia”, because of the cognitive detriment which takes place. Neuronal disruption represents its major feature, due to the cytosolic accumulation of amyloid β-peptide (Aβ which leads to senile plaques formation and intracellular neurofibrillary tangles. Many studies have focused on the design and therapeutic use of new molecules able to inhibit Aβ aggregation. In this context, we evaluated the ability of two recently synthesized series of N-alkyl carbazole derivatives to increase the Aβ soluble forms, through molecular docking simulations and in vitro experiments. Our data evidenced that two carbazole derivatives, the most active, adopt distinct binding modes involving key residues for Aβ fibrillization. They exhibit a good interfering activity on Aβ aggregation in mouse (N2a cells, stably expressing wild-type human amyloid precursor protein (APP 695. These preliminary results are promising and we are confident that the N-alkyl carbazole derivatives may encourage next future studies needed for enlarging the knowledge about the AD disease approach.