WorldWideScience

Sample records for abs 1b bis

  1. Antidiabetic Bis-Maltolato-OxoVanadium(IV: Conversion of inactive trans- to bioactive cis-BMOV for possible binding to target PTP-1B

    Thomas Scior

    2008-11-01

    Full Text Available Thomas Scior1, Hans-Georg Mack2, José Antonio Guevara García3, Wolfhard Koch41Departamento de Farmacia. Facultad de Ciencias Químicas, Benemérita Universidad Autónoma de Puebla, Colonia San Manuel, Puebla, Mexico; 2Institut für Physikalische Chemie, Universität Tübingen, Tübingen, Germany; 3Laboratorio de Investigación en Bioinorgánica y Biorremediación (LIByB. Departamento de Ciencias Básicas, Ingeniería y Tecnología, Universidad Autónoma de Tlaxcala, Apizaco, Tlaxcala, Mexico; 4Facultad de Estudios Superiores Zaragoza (FESZ, Universidad Nacional Autónoma de México (UNAM, Colonia Ejército de Oriente, Delegación Iztapalapa, Mexico City, MexicoAbstract: The postulated transition of Bis-Maltolato-OxoVanadium(IV (BMOV from its inactive trans- into its cis-aquo-BMOV isomeric form in solution was simulated by means of computational molecular modeling. The rotational barrier was calculated with DFT – B3LYP under a stepwise optimization protocol with STO-3G, 3-21G, 3-21G*, and 6-31G ab initio basis sets. Our computed results are consistent with reports on the putative molecular mechanism of BMOV triggering the insulin-like cellular response (insulin mimetic as a potent inhibitor of the protein tyrosine phosphatase-1B (PTP-1B. Initially, trans-BMOV is present in its solid dosage form but in aqueous solution, and during oral administration, it is readily converted into a mixture of “open-type” and “closed-type” complexes of cis-aquo-BMOV under equilibrium conditions. However, in the same measure as the “closed-type” complex binds to the cytosolic PTP-1B, it disappears from solution, and the equilibrium shifts towards the “closed-type” species. In full accordance, the computed binding mode of cis-BMOV is energetically favored over sterically hindered trans-BMOV. In view of our earlier report on prodrug hypothesis of vanadium organic compounds the present results suggest that cis-BMOV is the bioactive species

  2. IMMUNOMODULATORY EFFECTS OF INTRAVENOUS BIS-1 F(AB')(2) ADMINISTRATION IN RENAL-CELL CANCER-PATIENTS

    JANSSEN, RAJ; KROESEN, BJ; MESANDER, G; SLEIJFER, DT; THE, TH; MULDER, NH; DELEIJ, L

    1995-01-01

    We report the immunomodulatory effects of an intravenous treatment with F(ab')(2) fragments of the bispecific monoclonal antibody BIS-1 during subcutaneous recombinant interleukin 2 (rIL-2) therapy of renal cell cancer (RCC) patients. BIS-1 is directed against both the CD3 antigen on T cells and the

  3. Legal problems of electricity quotas according to paragraph 7 Abs. 1b bis 1d AtGesetz

    On April 27, 2002, the 'Act of the Planned Termination of the Use of Nuclear Power for Industrial Electricity Generation - Atomic Energy Act' entered into force. It was preceded, among other things, by the 'Agreement between the Federal Government and the Power Utilities of June 14, 2000' in which the Red-Gree federal government and the operators of nuclear power plants had agreed on a timetable of termination and on the conditions of nuclear power plant operation for the residual plant operating life. One major part of that Agreement, which later was incorporated also in the Atomic Energy Act, are provisions about flexibiling the residual periods of operation of existing nuclear power plants. The arguments underlying the act on opting out of the use of nuclear power cite, as a key reason for the possibility to transfer electricity quotas, the constitutional principle of protection of bona fide acts. The transfer possibility opened up in the law is to 'allow the best possible residual periods of operation in the light of both plant operation and the national economy' to be agreed upon for each individual nuclear power plant. In principle, the Atomic Energy Act provides for any transfer of electricity quotas from one German nuclear power plant to another. An approval procedure is required for transfer from younger to older plants. Transfers from older to younger plants can be arranged without any approval. The report covers the basic legal principles and consequences, the details of the approval procedure, and the transfer of the electricity quotas attributed to the Muelheim-Kaerlich nuclear power plant. (orig./GL)

  4. New ab initio adiabatic potential energy surfaces and bound state calculations for the singlet ground X˜ 1A1 and excited C˜ 1B2(21A') states of SO2

    Kłos, Jacek; Alexander, Millard H.; Kumar, Praveen; Poirier, Bill; Jiang, Bin; Guo, Hua

    2016-05-01

    We report new and more accurate adiabatic potential energy surfaces (PESs) for the ground X˜ 1A1 and electronically excited C˜ 1B2(21A') states of the SO2 molecule. Ab initio points are calculated using the explicitly correlated internally contracted multi-reference configuration interaction (icMRCI-F12) method. A second less accurate PES for the ground X ˜ state is also calculated using an explicitly correlated single-reference coupled-cluster method with single, double, and non-iterative triple excitations [CCSD(T)-F12]. With these new three-dimensional PESs, we determine energies of the vibrational bound states and compare these values to existing literature data and experiment.

  5. Experimental and ab Initio Study of Catena(bis(μ2-iodo)-6-methylquinoline-copper(I)) under Pressure: Synthesis, Crystal Structure, Electronic, and Luminescence Properties.

    Aguirrechu-Comerón, Amagoia; Hernández-Molina, Rita; Rodríguez-Hernández, Plácida; Muñoz, Alfonso; Rodríguez-Mendoza, Ulises R; Lavín, Vı́ctor; Angel, Ross J; Gonzalez-Platas, Javier

    2016-08-01

    Copper(I) iodine compounds can exhibit interesting mechanochromic and thermochromic luminescent properties with important technological applications. We report the synthesis and structure determination by X-ray diffraction of a new polymeric staircase copper(I) iodine compound catena(bis(μ2-iodo)-6-methylquinoline-copper(I), [C10H9CuIN]. The structure is composed of isolated polymeric staircase chains of copper-iodine coordinated to organic ligands through Cu-N bonds. High pressure X-ray diffraction to 6.45 GPa shows that the material is soft, with a bulk modulus K0 = 10.2(2)GPa and a first derivative K'0 = 8.1(3), typical for organometallic compounds. The unit-cell compression is very anisotropic with the stiffest direction [302] arising from a combination of the stiff CuI ladders and the shear of the planar quinolone ligands over one another. Full structure refinements at elevated pressures show that pressures reduce the Cu···Cu distances in the compound. This effect is detected in luminescence spectra with the appearance of four sub-bands at 515, 600, 647, and 712 nm above 3.5 GPa. Red-shifts are observed, and they are tentatively associated with interactions between copper(I) ions due to the shortening of the Cu···Cu distances induced by pressure, below twice the van der Waals limit (2.8 Å). Additionally, ab initio simulations were performed, and they confirmed the structure and the results obtained experimentally for the equation of state. The simulation allowed the band structure and the electronic density of states of this copper(I) iodine complex to be determined. In particular, the band gap decreases slowly with pressure in a quadratic way with dEg/dP = -0.011 eV/GPa and d(2)Eg/dP(2) = 0.001 eV/GPa(2). PMID:27429246

  6. Crystal Structure, Vibrational Spectroscopy and ab Initio Density Functional Theory Calculations on the Ionic Liquid forming 1,1,3,3-Tetramethylguanidinium bis{(trifluoromethyl)sulfonyl}amide

    Berg, Rolf W.; Riisager, Anders; Nguyen van Buu, Olivier;

    2009-01-01

    The salt 1,1,3,3-tetramethylguanidinium bis{(trifluoromethyl)sulfonyl}amide, [((CH3)(2)N)(2)C=NH2](+)[N(SO2-CF3)(2)](-) or [tmgH][NTf2], easily forms an ionic liquid with high SO2 absorbing capacity. The crystal structure of the salt was determined at 120(2) K by X-ray diffraction. The structure...

  7. Interferon Beta-1b Injection

    Interferon beta-1b injection is used to reduce episodes of symptoms in patients with relapsing-remitting (course ... and problems with vision, speech, and bladder control). Interferon beta-1b is in a class of medications ...

  8. Interferon Gamma-1b Injection

    Interferon gamma-1b injection is used to reduce the frequency and severity of serious infections in people ... with severe, malignant osteopetrosis (an inherited bone disease). Interferon gamma-1b is in a class of medications ...

  9. BIS 245 Course Tutorial / tutorialrank

    welcome1351

    2015-01-01

    BIS 245 Week 1 Lab 1 Introduction to MS Visio and MS Access For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 2 Times, Rating: A   A. Lab # : BSBA BIS 245A-1 B. Lab 1 of 7 : Introduction to MS Visio and MS Access C. Lab Overview--Scenario/Summary TCOs: 1. Given a business situation in which managers require information from a database, determine, analyze and classify that information so that reports can be designed to meet the requ...

  10. Fotfavoriten AB

    Søilen, Klaus Solberg; HUBER, Stefan

    2004-01-01

    Fotfavoriten AB, a foot care company located in Sollefttå in Northern Sweden, is an example of how local government fires staff only to reengage them as entrepreneurs delivering similar service. The case is typical for the social sector and may mark a trend. The result is often felt to be positive both by the entrepreneur, who is now more directly in charge of her or his earnings, and the end consumer. The CEO of Fotfavoriten AB, Eva Wörmann, waited a long time before she dared to take the ne...

  11. Main: 1B37 [RPSD[Archive

    Full Text Available 1B37 トウモロコシ Corn Zea mays L. Polyamine Oxidase Precursor Name=Pao; Zea Mays Molecul...FSNWPVGVNRYEYDQLRAPVGRVYFTGEHTSEHYNGYVHGAYLSGIDSAEILINCAQKKMCKYHVQGKYD corn_1B37.jpg ...

  12. Introduction to BIS statistics

    Bank for International Settlements

    2015-01-01

    The BIS has expanded its statistics by publishing additional data, revamping their dissemination and strengthening their policy orientation. This special feature, prepared by members of the BIS Monetary and Economic Department, briefly describes each BIS data set and explains how the statistics can be used for analysis.

  13. 18 CFR 1b.19 - Submissions.

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Submissions. 1b.19 Section 1b.19 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT..., which may consist of a statement of fact, argument, and/or memorandum of law, with such...

  14. Gene profiling of growth factor independence 1B gene (Gfi-1B) in leukemic cells.

    Koldehoff, Michael; Zakrzewski, Johannes L; Klein-Hitpass, Ludger; Beelen, Dietrich W; Elmaagacli, Ahmet H

    2008-01-01

    To investigate the molecular effects of growth factor independence 1B (Gfi-1B), a transcription factor essential for the development of hematopoietic cells and differentiation of erythroid and megakaryocytic lineages, the naturally Gfi-1B overexpressing cell line K562 was cultured in the presence of Gfi-1B target-specific small interfering RNA (siRNA). SiRNA treatment significantly knocked down Gfi-1B expression with an efficiency of nearly 90%. Analysis of the siRNA silencing protocol by colony-forming units ensured that it was not cytotoxic. Samples from Gfi-1B overexpressing cells and cells with knocked-down Gfi-1B were analyzed by oligonucleotide microarray technology and based upon rigorous statistical analysis of the data; relevant genes were chosen for confirmation by reserve transcriptase-polymerase chain reaction, including MYC/MYCBP and CDKN1A. Interestingly, transcripts within components of the signalling cascade of immune cells (PLD1, LAMP1, HSP90, IL6ST), of the tyrosine kinase pathway (TPR, RAC3) and of the transcription factors (RAC3, CEP290, JEM-1, ATR, MYC, SMC3, RARA, RBBP6) were found to be differentially expressed in Gfi-1B overexpressing cells compared to controls. Individual genes such as ZDHHC17, DMXL1, ZNF292 were found to be upregulated in Gfi-1B overexpressing cells. In addition, down-regulated transcripts showed cell signaling transcripts for several chemokine gene members including GNAL, CXCL5, GNL3L, GPR65, TMEM30, BCL11B and transcription factors (GTF2H3, ATXN3). In conclusion, several essential cell signalling factors, as well as transcriptional and post-translational regulation genes were differentially expressed in cells that overexpressed Gfi-1B compared to control cells with knocked-down Gfi-1B. Our data indicate that Gfi-1B signalling is important for commitment and maturation of hematopoietic cell populations. PMID:18224412

  15. 2000 Johnston Site 1B-P

    US Fish and Wildlife Service, Department of the Interior — Underwater Site 1B-P was established at Johnston Atoll by Dr. James Maragos, U.S. Fish & Wildlife Service, on June 29, 2000. With a start point (meter 0) at...

  16. Oleanane triterpenes as protein tyrosine phosphatase 1B (PTP1B) inhibitors from Camellia japonica.

    Uddin, Mohammad Nasir; Sharma, Govinda; Yang, Jun-Li; Choi, Hong Seok; Lim, Seong-Il; Kang, Keon Wook; Oh, Won Keun

    2014-07-01

    Protein tyrosine phosphatase 1B (PTP1B) plays a key role in metabolic signaling, thereby making it an exciting drug target for type 2 diabetes and obesity. Besides, there is substantial evidence that shows its overexpression is involved in breast cancer, which suggests that selective PTP1B inhibition might be effective in breast cancer treatment. As part of our continuous research on PTP1B inhibitors from medicinal plants, four oleanane-type triterpenes were isolated from an EtOAc-soluble extract of fruit peels of Camellia japonica (Theaceae), together with 6 previously known compounds of this class. Their structures were determined on the basis of spectroscopic data analysis (UV, IR, (1)H and (13)CNMR, HMBC, HSQC, NOESY, and MS). All isolates were evaluated for their inhibitory effects on PTP1B, as well as their cytotoxic effects against human breast cancer cell lines MCF7, MCF7/ADR, and MDA-MB-231. Several compounds with OH-3 or/and COOH-28 functionalities showed strong PTP1B inhibitory activity (IC50 values ranging from 3.77±0.11 to 6.40±0.81 μM) as well as significant cytotoxicity (IC50 values ranging from 0.51±0.05 to 13.55±1.44 μM). PMID:24815008

  17. Substituierte Erdalkalimetall-bis(pentolide) und –bis(trialkylzinkate)

    Gückel, Christian

    2001-01-01

    Im Gegensatz zu den Alkalimetall-pentoliden erweckt das Gebiet der Erdalkalimetallbis( pentolide) erst seit einigen Jahren das Interesse einiger Arbeitsgruppen. Westerhausen et al. konnten vor einigen Jahren bei der Umsetzung von Diphenylbutadiin mit Calcium- und Strontium-bis[bis(trimethylsilyl)phosphanid] die Bildung von Erdalkalimetall-bis(phospholid) nachweisen. Ein alternativer Weg nutzt die Metallierung von 1-Chlor-substituierten Pentolen durch Erdalkalimetalle zu Nutze. ...

  18. Practical route to the left wing of CTX1B and total syntheses of CTX1B and 54-deoxyCTX1B.

    Yamashita, Shuji; Takeuchi, Katsutoshi; Koyama, Takuya; Inoue, Masayuki; Hayashi, Yujiro; Hirama, Masahiro

    2015-02-01

    Ciguatoxins, the principal causative agents of ciguatera seafood poisoning, are extremely large polycyclic ethers. We report herein a reliable route for constructing the left wing of CTX1B, which possesses the acid/base/oxidant-sensitive bisallylic ether moiety, by a 6-exo radical cyclization/ring-closing metathesis strategy. This new route enabled us to achieve the second-generation total synthesis of CTX1B and the first synthesis of 54-deoxyCTX1B. PMID:25529606

  19. Main: 1B5Q [RPSD[Archive

    Full Text Available 1B5Q トウモロコシ Corn Zea mays L. Polyamine Oxidase Precursor Name=Pao; Zea Mays Molecul...EESRRIEQQSDEQTKAEIMQVLRKMFPGKDVPDATDILVPRWWSDRFYKGTFSNWPVGVNRYEYDQLRAPVGRVYFTGEHTSEHYNGYVHGAYLSGIDSAEILINCAQKKMCKYHVQGKYD corn_1B5Q.jpg ...

  20. Mutation of Oryza sativa CORONATINE INSENSITIVE 1b (OsCOI1b) delays leaf senescence

    Sang-Hwa Lee; Yasuhito Sakuraba; Taeyoung Lee; Kyu-Won Kim; Gynheung An; Han Yong Lee; Nam-Chon Paek

    2015-01-01

    Jasmonic acid (JA) functions in plant development, including senescence and immunity. Arabidopsis thaliana CORONATINE INSENSITIVE 1 encodes a JA receptor and functions in the JA‐responsive signaling pathway. The Arabidopsis genome harbors a single COI gene, but the rice (Oryza sativa) genome harbors three COI homologs, OsCOI1a, OsCOI1b, and OsCOI2. Thus, it remains unclear whether each OsCOI has distinct, additive, synergistic, or redundant func-tions in development. Here, we use the oscoi1b‐1 knockout mutants to show that OsCOI1b mainly affects leaf senescence under senescence‐promoting conditions. oscoi1b‐1 mutants stayed green during dark‐induced and natural senescence, with substantial retention of chlorophylls and photosyn-thetic capacity. Furthermore, several senescence‐associated genes were downregulated in oscoi1b‐1 mutants, including homologs of Arabidopsis thaliana ETHYLENE INSENSITIVE 3 and ORESARA 1, important regulators of leaf senescence. These results suggest that crosstalk between JA signaling and ethylene signaling affects leaf senescence. The Arabidopsis coi1‐1 plants containing 35S:OsCOI1a or 35S:OsCOI1b rescued the delayed leaf senescence during dark incubation, sug-gesting that both OsCOI1a and OsCOI1b are required for promoting leaf senescence in rice. oscoi1b‐1 mutants showed significant decreases in spikelet fertility and grain weight, leading to severe reduction of grain yield, indicating that OsCOI1‐mediated JA signaling affects spikelet fertility and grain filling.

  1. Tandem Aldol-Michael Reactions in Aqueous Diethylamine Medium: A Greener and Efficient Approach to Bis-Pyrimidine Derivatives

    Al-Majid, Abdullah M.; Assem Barakat; Hany J. AL-Najjar; Mabkhot, Yahia N.; Ghabbour, Hazem A.; Hoong-Kun Fun

    2013-01-01

    A simple protocol, involving the green synthesis for the construction of novel bis-pyrimidine derivatives, 3a–i and 4a–e are accomplished by the aqueous diethylamine media promoted tandem Aldol-Michael reaction between two molecules of barbituric acid derivatives 1a,b with various aldehydes. This efficient synthetic protocol using an economic and environmentally friendly reaction media with versatility and shorter reaction time provides bis-pyrimidine derivatives with high yields (88%–99%)....

  2. Tandem aldol-Michael reactions in aqueous diethylamine medium: a greener and efficient approach to bis-pyrimidine derivatives.

    Al-Majid, Abdullah M; Barakat, Assem; Al-Najjar, Hany J; Mabkhot, Yahia N; Ghabbour, Hazem A; Fun, Hoong-Kun

    2013-01-01

    A simple protocol, involving the green synthesis for the construction of novel bis-pyrimidine derivatives, 3a-i and 4a-e are accomplished by the aqueous diethylamine media promoted tandem Aldol-Michael reaction between two molecules of barbituric acid derivatives 1a,b with various aldehydes. This efficient synthetic protocol using an economic and environmentally friendly reaction media with versatility and shorter reaction time provides bis-pyrimidine derivatives with high yields (88%-99%). PMID:24317435

  3. Purification, crystallization and preliminary crystallographic analysis of soybean mature glycinin A1bB2

    Soybean mature glycinin was purified and crystallized and its preliminary crystallographic analysis is also reported. Glycinin is one of the most abundant storage-protein molecules in soybean seeds and is composed of five subunits (A1aB1b, A1bB2, A2B1a, A3B4 and A5A4B3). A1bB2 was purified from a mutant soybean cultivar containing glycinin composed of only A5A4B3 and A1bB2. At 281 K the protein formed hexagonal, rectangular and rod-shaped crystals in the first [0.1 M imidazole pH 8.0, 0.2 M MgCl2, 35%(v/v) MPD], second [0.1 M sodium citrate pH 5.6, 0.2 M ammonium acetate, 30%(v/v) MPD] and third (0.1 M phosphate–citrate pH 4.2, 2.0 M ammonium sulfate) crystallization conditions, respectively. X-ray diffraction data were collected to resolutions of 1.85, 1.85 and 2.5 Å from crystals of the three different shapes. The crystals belonged to space groups P6322, P21 and P1, with unit-cell parameters a = b = 143.60, c = 84.54 Å, a = 114.54, b = 105.82, c = 116.67 Å, β = 94.99° and a = 94.45, b = 94.96, c = 100.66 Å, α = 107.02, β = 108.44, γ = 110.71°, respectively. One, six and six subunits of A1bB2 were estimated to be present in the respective asymmetric units. The three-dimensional structure of the A1bB2 hexamer is currently being determined

  4. Analysis list: ARID1B [Chip-atlas[Archive

    Full Text Available ARID1B Liver + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/ARID1B.1.tsv http://dbar...chive.biosciencedbc.jp/kyushu-u/hg19/target/ARID1B.5.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/AR...ID1B.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/ARID1B.Liver.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/Liver.gml ...

  5. Expression of the Aldo-Keto Reductases AKR1B1 and AKR1B10 in Human Cancers.

    BrianLaffin

    2012-06-01

    Full Text Available The American Cancer Society estimates that there will be more than 1.5 million new cases of cancer in 2011, underscoring the need for identification of new therapeutic targets and development of novel cancer therapies. Previous studies have implicated the human aldo-keto reductases AKR1B1 and AKR1B10 in cancer, and therefore we examined AKR1B1 and AKR1B10 expression across all major human cancer types using the Oncomine cancer gene expression database (Compendia Biosciences, www.oncomine.com. Using this database, we found that expression of of AKR1B1 and AKR1B10 varies greatly by cancer type and tissue of origin, including agreement with previous reports that AKR1B10 is significantly over-expressed in cancers of the lungs and liver. AKR1B1 is more broadly over-expressed in human cancers than AKR1B10, albeit at a generally lower magnitude. AKR1B1 over-expression was found to be associated with shortened patient survival in acute myelogenous leukemias and multiple myelomas. High AKR1B10 expression tends to predict less aggressive clinical course generally, notably within lung cancers, where it tends to be highly over-expressed compared to normal tissue. These findings suggest that AKR1B1 inhibitors in particular hold great potential as novel cancer therapeutics.

  6. Verdivurdering av SAS AB

    Gangås, Silje Garberg

    2013-01-01

    Formålet med denne mastergradsavhandlingen har vært å beregne den teoretiske verdien på det børsnoterte selskapet SAS AB og på bakgrunn av denne gi en handlingsanbefaling på selskapets aksje. Forskningsspørsmålet for oppgaven er utledet som følger: ”Hva er verdien av SAS AB?” SAS AB er inne i en fundamental omstillingsprosses hvor den nye strategien, 4XNG, ble presentert og påbegynt november 2012. Omstillingsprosessen innebærer blant annet en omfattende omstrukturering i organisasjonen ...

  7. Inhibition of bromophenols against PTP1B and anti-hyperglycemic effect of Rhodomela confervoides extract in diabetic rats

    SHI DaYong; XU Feng; HE Juan; LI Jing; FAN Xiao; HAN LiJun

    2008-01-01

    Protein tyrosine phosphatase 1B (PTP1B) plays an important role as s negative regulator in insulin signaling pathways.PTP1B is an effective target for the treatment of type 2 diabetes mellitus.Four bromophenol derivatives from red algae Rhodomela confervoides,2,2',3,3'-tetrabromo-4,4',5,5"-tetra-hydroxydiphenyl methane (1),3-bormo-4,5-bis(2,3-dibromo-4,5-dihydroxybenzyl) pyrocatechol (2),bis(2,3-dibromo-4,5-dihydroxybenzyl) ether (3) and 2,2",3-tribromo-3",4,4",5-tetrahydroxy-6"-ethyloxy-methyldiphenylmethane (4) showed significant inhibitory activity against PTP1B (IC50 were 2.4,1.7,1.5 and 0.84 μmol/L,respectively) as potential therapeutical agents for the treatment of type 2 diabetes mellitus.The anti-hyperglycemic effects of the ethanol extracts from R.confervoides on streptozoto-cin-induced diabetes (STZ-diabetes) in male Wistar rats fed with high fat diet were investigated.The STZ-diabetic rats treated with medium-dose and high-dose alga extracts showed remarkable reductions in fasting blood glucose (FBG) as compared with the STZ-diabetic control.The results indicate that the in vivo anti-hyperglycemic activity of the R.confervoides extracts can be partially attributed to the in-hibitory actions against PTP1B of the bromophenol derivatives and that may be of clinical importance in improving the management of type 2 diabetes mellitus.

  8. Characterization of hERG1a and hERG1b potassium channels-a possible role for hERG1b in the I (Kr) current

    Larsen, Anders Peter; Olesen, Søren-Peter; Grunnet, Morten;

    2008-01-01

    I (Kr) is the fast component of the delayed rectifier potassium currents responsible for the repolarization of the cardiac muscle. The molecular correlate underlying the I (Kr) current has been identified as the hERG1 channel. Recently, two splice variants of the hERG1 alpha-subunit, hERG1a and hERG......1b, have been shown to be co-expressed in human cardiomyocytes. In this paper, we present the electrophysiological characterization of hERG1a, hERG1b, and co-expressed hERG1a/b channels in a mammalian expression system using the whole-cell patch clamp technique. We also quantified the messenger RNA...... (mRNA) levels of hERG1a and hERG1b in human cardiac tissue, and based on the expressed ratios, we evaluated the resulting currents in Xenopus laevis oocytes. Compared to hERG1a channels, activation was faster for both hERG1b and hERG1a/b channels. The deactivation kinetics was greatly accelerated in...

  9. Genetic polymorphisms in CYP1A1, CYP1B1 and COMT genes in Greenlandic Inuit and Europeans

    Ghisari, Mandana; Long, Manhai; Bonefeld-Jørgensen, Eva Cecilie

    2013-01-01

    contaminants in Inuit and its relation to health risk. The Greenlandic Inuit are highly exposed to legacy persistent organic pollutants (POPs) such as polychlorinated biphenyls (PCBs) and organochlorine pesticides (OCPs), and an elucidation of gene–environment interactions in relation to health risks is needed....... We observed a significant difference in serum polychlorinated biphenyl (CB-153) and the pesticide 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene (p,p′-DDE) levels between Inuit and Europeans, and for Inuit also associations between the POP levels and genotypes for CYP1A1, CYP1B1 and COMT. Conclusion...

  10. IL1B induced Smad 7 negatively regulates gastrin expression.

    Dipanjana Datta De

    Full Text Available BACKGROUND: Helicobacter pylori elicited IL1B is one of the various modulators responsible for perturbation of acid secretion in gut. We have earlier reported that IL1B activated NFkB downregulates gastrin, a major modulator of acid secretion. However, we hypothesized that regulation of gastrin by IL1B would depend on the cell's ability to integrate inputs from multiple signaling pathways to generate appropriate biological response. PRINCIPAL FINDING: In this study, we report that IL1B induces Smad 7 expression by about 4.5 fold in gastric carcinoma cell line, AGS. Smad 7 resulted in transcriptional repression of gastrin promoter by about 6.5 fold when co-transfected with Smad 7 expression vector and gastrin-promoter luciferase in AGS cells. IL1B inhibited phosphorylation of Smad 3 and subsequently interfered with nuclear translocation of the positive Smad complex, thus occluding it off the gastrin promoter. IL1B promoter polymorphisms (-511T/-31C IL1B are known to be associated with H. pylori associated gastro-duodenal ulcer. We observed that IL1B expressed from -31T promoter driven IL1B cDNA elicited 3.5 fold more Smad 7 than that expressed from the IL1B-31C variant in AGS cells. This differential activation of Smad 7 by IL1B promoter variants translated into differential downregulation of gastrin expression. We further analyzed Smad 7, NFkB, IL1B and gastrin expression in antral gut biopsy samples of patients with H. pylori associated duodenal ulcer and normal individuals. We observed that individuals with duodenal ulcer had significantly lower levels of IL1B, Smad 7, NFkB and corresponding higher level of gastrin expression. CONCLUSION: Pro-inflammatory cytokine IL1B repress gastrin expression by activating Smad 7 and subsequent inhibition of nuclear localization of Smad 3/4 complex. Polymorphic promoter variants of IL1B gene can modulate the IL1B expression which resulted in differential activation Smad 7 and consequent repression of

  11. ABS 415 Course Tutorial / tutorialrank

    welcome1257

    2015-01-01

                     For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 4 Times, Rating: A+   ASHFORD ABS 415 Week 1 DQ 1Discovering Strengths in Leadership ASHFORD ABS 415 Week 1 DQ 2 Ethical Leadership ASHFORD ABS 415 Week 2 DQ 1 Developing Emotional Intelligence in Leadership ASHFORD ABS 415 Week 2 DQ 2 Elements of Emotional Intelligence in Leadership ASHFORD ABS 415 Week 3 DQ 1 Motivational...

  12. Clicked bis-PEG-peptide conjugates for studying calmodulin-Kv7.2 channel binding

    Bonache de Marcos, María Ángeles; Alaimo, Alessandro; Malo, Covadonga; Millet, Oscar; Villarroel, Alvaro; González-Muñiz, Rosario

    2014-01-01

    The recombinant Kv7.2 calmodulin (CaM) binding site (Q2AB CaMBD) shows a high tendency to aggregate, thus complicating biochemical and structural studies. To facilitate these studies we have conceived bis-PEG-peptide CaMBD-mimetics linking helices A and B in single, easy to handle molecules. Short PEG chains were selected as spacers between the two peptide molecules, and a Cu(i)-catalyzed cycloaddition (CuAAC) protocol was used to assemble the final bis-PEG-peptide conjugate, by the convenien...

  13. Aldo keto reductases 1B in endocrinology and metabolism

    AntoineMartinez

    2012-08-01

    Full Text Available The aldose reductase (human AKR1B1/mouse Akr1b3 has been the focus of many research because of its role in diabetic complications. The starting point of these alterations is the massive entry of glucose in polyol pathway where it is converted into sorbitol by this enzyme. However, the issue of aldose reductase function in non-diabetic condition remains unresolved. Aldose reductase-like enzymes (AKR1B10, Akr1b7 and Akr1b8 are highly related isoforms often co-expressed with bona fide aldose reductase, making functional analysis of one or the other isoform a challenging task. AKR1B/Akr1b members share at least 65% protein identity and the general ability to reduce many redundant substrates such as aldehydes provided from lipid peroxidation, steroids and their by-products and xenobiotics in vitro. Based on these properties, AKR1B/Akr1b are generally considered as detoxifying enzymes. Considering that divergences should be more informative than similarities to help understanding their physiological functions, we chose to review specific hallmarks of each human/mouse isoforms by focusing on tissue distribution and specific mechanisms of gene regulation. Indeed, although the aldose reductase shows ubiquitous expression, aldose reductase-like proteins exhibit tissue-specific patterns of expression. We focused on 3 organs where certain isoforms are enriched, the adrenal gland, enterohepatic and adipose tissues and tried to connect recent enzymatic and regulation data with endocrine and metabolic functions of these organs. We presented recent mouse models showing unsuspected physiological functions in the regulation of glucido-lipidic metabolism and adipose tissue homeostasis. Beyond the widely accepted idea that AKR1B/Akr1b are detoxification enzymes, these recent reports provide growing evidences that they are able to modify or generate signal molecules. This conceptually shifts this class of enzymes from unenviable status of scavenger to upper class of

  14. 18 CFR 1b.20 - Request for confidential treatment.

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Request for confidential treatment. 1b.20 Section 1b.20 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY....S.C. 1905, or is otherwise exempt by law from public disclosure. In such case, the person...

  15. The over-expression of two transcription factors, ABS5/bHLH30 and ABS7/MYB101, leads to upwardly curly leaves.

    Rui An

    Full Text Available Proper leaf development is essential for plant growth and development, and leaf morphogenesis is under the control of intricate networks of genetic and environmental cues. We are interested in dissecting these regulatory circuits genetically and report here the isolation of two Arabidopsis dominant mutants, abnormal shoot5-1D (abs5-1D and abs7-1D identified through activation tagging screens. Both abs5-1D and abs7-1D display an intriguing upwardly curly leaf phenotype. Molecular cloning showed that the elevated expression of a bHLH transcription factor ABS5/T5L1/bHLH30 or a MYB transcription factor ABS7/MYB101 is the cause for the abnormal leaf phenotypes found in abs5-1D or abs7-1D, respectively. Protoplast transient expression assays confirmed that both ABS5/T5L1 and ABS7/MYB101 are targeted to the nucleus. Interestingly, the expression domains of auxin response reporter DR5::GUS were abnormal in leaves of abs5-1D and ABS5/T5L1 over-expression lines. Moreover, cotyledon venation analysis showed that more areoles and free-ending veins are formed in abs5-1D. We found that the epidermis-specific expressions of ABS5/T5L1 or ABS7/MYB101 driven by the Arabidopsis Meristem Layer 1 promoter (PAtML1 were sufficient to recapitulate the curly leaf phenotype of abs5-1D or abs7-1D. In addition, PAtML1::ABS5 lines exhibited similar changes in DR5::GUS expression patterns as those found in 35S-driven ABS5/T5L1 over-expression lines. Our work demonstrated that enhanced expressions of two transcription factors, ABS5/T5L1 and ABS7/MYB101, are able to alter leaf lamina development and reinforce the notion that leaf epidermis plays critical roles in regulating plant organ morphogenesis.

  16. Synthesis and protein tyrosine phosphatase 1B inhibition activities of two new synthetic bromophenols and their methoxy derivatives

    Cui, Yongchao; Shi, Dayong; Hu, Zhiqiang

    2011-11-01

    3-bromo-4,5-bis(2,3-dibromo-4,5-dihydroxybenzyl)-1,2-benzenediol ( 1) is a natural bromophenol isolated from the red algae Rhodomela confervoides that exhibits significant inhibition against protein tyrosine phosphatase 1B (PTP1B). Based on its activity, we synthesized two new synthetic bromophenols and their methoxy derivatives from vanillin using the structure of natural bromophenol 1 as a scaffold. The structures of these bromophenols were elucidated from 1H NMR, 13C NMR, and high resolution electron ionization mass spectrometry as 2,3-dibromo-1-(2'-bromo-6'-(3″,4″-dimethoxybenzyl)-3',4'-dimethoxybenzyl)-4,5-dimethoxybenzene ( 2), 2,3-dibromo-1-(2'-bromo-6'-(2″-bromo-4″,5″-dimethoxybenzyl)-3',4'-dimethoxybenzyl)-4,5-dimethoxybenzene ( 3), 3,4-dibromo-5-(2'-bromo-6'-(2″-bromo-4″,5″-dihydroxybenzyl)-3',4'-dihydroxybenzyl)pyrocatechol ( 4) and 3,4-dibromo-5-(2'-bromo-6'-(3″,4″-dihydroxybenzyl)-3',4'-dihydroxybenzyl)pyrocatechol ( 5). PTP1B inhibition activities of these compounds were evaluated using a colorimetric assay, and compounds 3 and 4 demonstrated interesting activity against PTP1B.

  17. Protein tyrosine phosphatase 1B inhibitors isolated from Artemisia roxburghiana.

    Shah, Muhammad Raza; Ishtiaq; Hizbullah, Syed Muhammad; Habtemariam, Solomon; Zarrelli, Armando; Muhammad, Akhtar; Collina, Simona; Khan, Inamulllah

    2016-08-01

    Artemisia roxburghiana is used in traditional medicine for treating various diseases including diabetes. The present study was designed to evaluate the antidiabetic potential of active constituents by using protein tyrosine phosphatase 1B (PTP1B) as a validated target for management of diabetes. Various compounds were isolated as active principles from the crude methanolic extract of aerial parts of A. roxburghiana. All compounds were screened for PTP1B inhibitory activity. Molecular docking simulations were performed to investigate the mechanism behind PTP1B inhibition of the isolated compound and positive control, ursolic acid. Betulinic acid, betulin and taraxeryl acetate were the active PTP1B principles with IC50 values 3.49 ± 0.02, 4.17 ± 0.03 and 87.52 ± 0.03 µM, respectively. Molecular docking studies showed significant molecular interactions of the triterpene inhibitors with Gly220, Cys215, Gly218 and Asp48 inside the active site of PTP1B. The antidiabetic activity of A. roxburghiana could be attributed due to PTP1B inhibition by its triterpene constituents, betulin, betulinic acid and taraxeryl acetate. Computational insights of this study revealed that the C-3 and C-17 positions of the compounds needs extensive optimization for the development of new lead compounds. PMID:26118418

  18. A cytotoxic study of eugenol and its ortho dimer (bis-eugenol)

    Kashiwagi, Yasushi [Meikai Univ., Sakado, Saitama (Japan). School of Dentistry

    2000-07-01

    Eugenol is widely used not only as a dental material such as pulp capping material, provisional cement, root canal sealer, and impression paste, but also as a perfume ingredients. Eugenol has antioxidant, bactericidal, and sedative activities, inhibits and non-enzymatic peroxidation. It was previously reported that eugenol exhibited the cytotoxic activity toward pulp cells and gingial fibroblasts and also that the cytotoxic activity was predominantly performed by radicals derived from the oxidation of eugenol. This study was based on the hypothesis that the toxicity of eugenol may be greately reduced if the radicalization of eugenol was diminished by the dimerization of eugenol. Thus, bis-eugenol, the dimer of eugenol, was synthesized to characterize the effect of this eugenol-related compound. The cytotoxic activity of bis-eugenol against human gingival fibroblasts (HGF cell) or human submandibular gland cancer cells (HSG cell) was studied in the presence or absence of light irradiation (visible or ultraviolet light), and compared with that of eugenol. The cytotoxic activity of eugenol was significantly greater than that of bis-eugenol. The cytotoxic activity of irradiated eugenol, but not that of irradiated bis-eugenol, was significantly higher than that of the non-irradiated counterpart. Bis-eugenol at a relatively low concentration declined the phototoxic activity of irradiation on living cells. Also, the generation of reactive oxygen in HSG cells in the ab-sence or the presence of irradiated bis-eugenol or eugenol was evaluated by an ACAS laser cytometry, and the results indicated that eugenol, but not bis-eugenol, generated reactive oxygen in the cells. The DPPH-radical scavenging activity of bis-eugenol was larger than that of eugenol. Furthermore, eugenol had a positive apoptosis-inducing effect on HSG cells. The structure-activity relationships of eugenol-related compounds showed that the nature of the substituent at the ortho or para-position of eugenol

  19. TES/Aura L1B Spectra Nadir V004

    National Aeronautics and Space Administration — The L1B Nadir granule consists of radiometrically calibrated spectra & associated NESR, observed at 0.1 cm-1 resolution for an entire Global Survey &...

  20. TES/Aura L1B Spectra Limb V002

    National Aeronautics and Space Administration — The L1B Limb granule consists of radiometrically calibrated spectra & associated NESR, observed at 0.025 cm-1 resolution for an entire Global Survey &...

  1. Modeling the vibrational spectrum of 4,4'-diphenylmethane- bis(methyl)carbamate

    Shundalau, M. B.; Pitsevich, G. A.; Ksenofontov, M. A.; Umreiko, D. S.

    2010-07-01

    We present results of ab initio calculations of the structure and vibrational IR spectrum for 4,4'-diphenylmethane-bis(methyl)carbamate (DPMC). Calculations were carried out in the HF/6-311G approximation with subsequent force-field scaling. The calculated characteristics of the vibrational spectrum of DPMC show satisfactory agreement with experimental values, which permits them to be used in spectral and structural analysis

  2. Organic anion transporter 3- and organic anion transporting polypeptides 1B1- and 1B3-mediated transport of catalposide

    Jeong HU

    2015-01-01

    Full Text Available Hyeon-Uk Jeong,1 Mihwa Kwon,2 Yongnam Lee,3 Ji Seok Yoo,3 Dae Hee Shin,3 Im-Sook Song,2 Hye Suk Lee1 1College of Pharmacy, The Catholic University of Korea, Bucheon 420-743, Korea; 2College of Pharmacy and Research Institute of Pharmaceutical Sciences, Kyungpook National University, Daegu 702-701, Korea; 3Central R&D Institute, Yungjin Pharm Co., Ltd., Suwon 443-270, Korea Abstract: We investigated the in vitro transport characteristics of catalposide in HEK293 cells overexpressing organic anion transporter 1 (OAT1, OAT3, organic anion transporting polypeptide 1B1 (OATP1B1, OATP1B3, organic cation transporter 1 (OCT1, OCT2, P-glycoprotein (P-gp, and breast cancer resistance protein (BCRP. The transport mechanism of catalposide was investigated in HEK293 and LLC-PK1 cells overexpressing the relevant transporters. The uptake of catalposide was 319-, 13.6-, and 9.3-fold greater in HEK293 cells overexpressing OAT3, OATP1B1, and OATP1B3 transporters, respectively, than in HEK293 control cells. The increased uptake of catalposide via the OAT3, OATP1B1, and OATP1B3 transporters was decreased to basal levels in the presence of representative inhibitors such as probenecid, furosemide, and cimetidine (for OAT3 and cyclosporin A, gemfibrozil, and rifampin (for OATP1B1 and OATP1B3. The concentration-dependent OAT3-mediated uptake of catalposide revealed the following kinetic parameters: Michaelis constant (Km =41.5 µM, maximum uptake rate (Vmax =46.2 pmol/minute, and intrinsic clearance (CLint =1.11 µL/minute. OATP1B1- and OATP1B3-mediated catalposide uptake also showed concentration dependency, with low CLint values of 0.035 and 0.034 µL/minute, respectively. However, the OCT1, OCT2, OAT1, P-gp, and BCRP transporters were apparently not involved in the uptake of catalposide into cells. In addition, catalposide inhibited the transport activities of OAT3, OATP1B1, and OATP1B3 with half-maximal inhibitory concentration values of 83, 200, and 235 µ

  3. [1,2-Bis(diphenylphosphinoethane]{2-[bis(diphenylphosphinomethylamino]pyridinium}fluoridohydrazidatomolybdenum(IV bis(tetrafluoridoborate

    Felix Tuczek

    2008-05-01

    Full Text Available In the crystal structure of the title compound, [MoF(N2H2(C31H29N2P2(C26H24P2](BF42, each Mo atom is surrounded by four P atoms of one 1,2-bis(diphenylphosphinoethane and one 2-[bis(diphenylphosphinomethylamino]pyridinium ligand. The remaining binding sites of the distorted octahedron are occupied by a hydrazidate (NNH22− and a fluoride ligand. Two F atoms of an anion are disordered over two positions; the site occupancy factors are ca 0.7 and 0.3.

  4. Carnitine Palmitoyltransferase-1b (CPT1b) Deficiency Aggravates Pressure-Overload-Induced Cardiac Hypertrophy due to Lipotoxicity

    He, Lan; Kim, Teayoun; Long, Qinqiang; Liu, Jian; Wang, Peiyong; Zhou, Yiqun; Ding, Yishu; Prasain, Jeevan; Wood, Philip A.; Yang, Qinglin

    2012-01-01

    Background Carnitine palmitoyltransferase 1(CPT1) is a rate-limiting step of mitochondrial β-oxidation by controlling the mitochondrial uptake of long-chain acyl-CoAs. The muscle isoform, CPT1b, is the predominant isoform expressed in the heart. It has been suggested that inhibiting CPT-1 activity by specific CPT-1 inhibitors exerts protective effects against cardiac hypertrophy and heart failure. However, clinical and animal studies have shown mixed results, thereby posting concerns on the safety of this class of drugs. Preclinical studies using genetically modified animal models should provide a better understanding of targeting CPT1 in order to evaluate it as a safe and effective therapeutic approach. Methods and Results Heterozygous CPT1b knockout mice (CPT1b+/−) were subjected to transverse aorta constriction (TAC)-induced pressure-overload. These mice showed overtly normal cardiac structure/function under the basal condition. Under a severe pressure-overload condition induced by two weeks of transverse aorta constriction (TAC), CPT1b+/− mice were susceptible to premature death with congestive heart failure. Under a milder pressure-overload condition, CPT1b+/− mice exhibited exacerbated cardiac hypertrophy and remodeling compared with that in wild-type littermates. There were more pronounced impairments of cardiac contraction with greater eccentric cardiac hypertrophy in CPT1b+/− than in controlled mice. Moreover, the CPT1b+/− heart exhibited exacerbated mitochondrial abnormalities and myocardial lipid accumulation with elevated triglycerides and ceramide content, leading to greater cardiomyocytes apoptosis. Conclusions We conclude that CPT1b deficiency can cause lipotoxicity in the heart under pathological stress, leading to exacerbation of cardiac pathology. Therefore, caution should be applied in the clinical use of CPT-1 inhibitors. PMID:22932257

  5. Ferredoxin 1b (Fdx1b) Is the Essential Mitochondrial Redox Partner for Cortisol Biosynthesis in Zebrafish.

    Griffin, Aliesha; Parajes, Silvia; Weger, Meltem; Zaucker, Andreas; Taylor, Angela E; O'Neil, Donna M; Müller, Ferenc; Krone, Nils

    2016-03-01

    Mitochondrial cytochrome P450 (CYP) enzymes rely on electron transfer from the redox partner ferredoxin 1 (FDX1) for catalytic activity. Key steps in steroidogenesis require mitochondrial CYP enzymes and FDX1. Over 30 ferredoxin mutations have been explored in vitro; however, no spontaneously occurring mutations have been identified in humans leaving the impact of FDX1 on steroidogenesis in the whole organism largely unknown. Zebrafish are an important model to study human steroidogenesis, because they have similar steroid products and endocrine tissues. This study aimed to characterize the influence of ferredoxin on steroidogenic capacity in vivo by using zebrafish. Zebrafish have duplicate ferredoxin paralogs: fdx1 and fdx1b. Although fdx1 was observed throughout development and in most tissues, fdx1b was expressed after development of the zebrafish interrenal gland (counterpart to the mammalian adrenal gland). Additionally, fdx1b was restricted to adult steroidogenic tissues, such as the interrenal, gonads, and brain, suggesting that fdx1b was interacting with steroidogenic CYP enzymes. By using transcription activator-like effector nucleases, we generated fdx1b mutant zebrafish lines. Larvae with genetic disruption of fdx1b were morphologically inconspicuous. However, steroid hormone analysis by liquid chromatography tandem mass spectrometry revealed fdx1b mutants failed to synthesize glucocorticoids. Additionally, these mutants had an up-regulation of the hypothalamus-pituitary-interrenal axis and showed altered dark-light adaptation, suggesting impaired cortisol signaling. Antisense morpholino knockdown confirmed Fdx1b is required for de novo cortisol biosynthesis. In summary, by using zebrafish, we generated a ferredoxin knockout model system, which demonstrates for the first time the impact of mitochondrial redox regulation on glucocorticoid biosynthesis in vivo. PMID:26650568

  6. Synthesis, characterization, and reactivity of furan- and thiophene-functionalized bis(n-heterocyclic carbene) complexes of iron(II)

    Rieb, Julia

    2014-09-15

    The synthesis of iron(II) complexes bearing new heteroatom-functionalized methylene-bridged bis(N-heterocyclic carbene) ligands is reported. All complexes are characterized by single-crystal X-ray diffraction (SC-XRD), nuclear magnetic resonance (NMR) spectroscopy, and elemental analysis. Tetrakis(acetonitrile)-cis-[bis(o-imidazol-2-ylidenefuran)methane]iron(II) hexafluorophosphate (2a) and tetrakis(acetonitrile)-cis-[bis(o-imidazol-2-ylidenethiophene)methane]iron(II) hexafluorophosphate (2b) were obtained by aminolysis of [Fe{N(SiMe3)2}2(THF)] with furan- and thiophene-functionalized bis(imidazolium) salts 1a and 1b in acetonitrile. The SC-XRD structures of 2a and 2b show coordination of the bis(carbene) ligand in a bidentate fashion instead of a possible tetradentate coordination. The four other coordination sites of these distorted octahedral complexes are occupied by acetonitrile ligands. Crystallization of 2a in an acetone solution by the slow diffusion of Et2O led to the formation of cisdiacetonitriledi[ bis(o-imidazol-2-ylidenefuran)methane]iron(II) hexafluorophosphate (3a) with two bis(carbene) ligands coordinated in a bidentate manner and two cis-positioned acetonitrile molecules. Compounds 2a and 2b are the first reported iron(II) carbene complexes with four coordination sites occupied by solvent molecules, and it was demonstrated that those solvent ligands can undergo ligand-exchange reactions.

  7. Oncolytic Replication of E1b-Deleted Adenoviruses

    Pei-Hsin Cheng

    2015-11-01

    Full Text Available Various viruses have been studied and developed for oncolytic virotherapies. In virotherapy, a relatively small amount of viruses used in an intratumoral injection preferentially replicate in and lyse cancer cells, leading to the release of amplified viral particles that spread the infection to the surrounding tumor cells and reduce the tumor mass. Adenoviruses (Ads are most commonly used for oncolytic virotherapy due to their infection efficacy, high titer production, safety, easy genetic modification, and well-studied replication characteristics. Ads with deletion of E1b55K preferentially replicate in and destroy cancer cells and have been used in multiple clinical trials. H101, one of the E1b55K-deleted Ads, has been used for the treatment of late-stage cancers as the first approved virotherapy agent. However, the mechanism of selective replication of E1b-deleted Ads in cancer cells is still not well characterized. This review will focus on three potential molecular mechanisms of oncolytic replication of E1b55K-deleted Ads. These mechanisms are based upon the functions of the viral E1B55K protein that are associated with p53 inhibition, late viralmRNAexport, and cell cycle disruption.

  8. Contractile 5-HT1B receptors in human cerebral arteries

    Nilsson, T; Longmore, J; Shaw, D;

    1999-01-01

    immunocytochemistry with antibodies selective for human 5-HT1B and human 5-HT1D receptors and also studied the contractile effects of a range of 5-HT receptor agonists and antagonists in HCA. 2 Immunocytochemistry of cerebral arteries showed dense 5-HT1B receptor immunoreactivity (but no 5-HT1D receptor......1 The cerebrovascular receptor(s) that mediates 5-hydroxytryptamine (5-HT)-induced vasoconstriction in human cerebral arteries (HCA)has proven difficult to characterize, yet these are essential in migraine. We have examined 5-HT receptor subtype distribution in cerebral blood vessels by...... immunoreactivity) within the smooth muscle wall of the HCA. The endothelial cell layer was well preserved and weak 5-HT1B receptor immunoreactivity was present. 3 Pharmacological experiments on HCA with intact endothelium showed that 5-carboxamidotryptamine was significantly more potent than alpha-methyl-5-HT, 2...

  9. The AB Staff Plan

    Boillot, J; Delahaye, J P; Myers, S; CERN. Geneva. AB Department

    2003-01-01

    The present report summarises the staff plan of the newly created Accelerators and Beams (AB) Division following the restructuring of the Accelerator Sector and covering the period 2003 to 2010. It underlines the refocusing of the staff on priority work, especially the LHC Project and is coherent with the recently adopted CERN Long Term Plan (LTP). It compares the requested and available manpower (both staff and industrial support) for each Project, Programme and Activity (PPA) split in work packages and highlights the missing manpower for each category of personnel.

  10. The PD-L1:B7-1 pathway restrains diabetogenic effector T cells in vivo

    Paterson, Alison M.; Brown, Keturah E.; Keir, Mary E.; Vanguri, Vijay K.; Riella, Leonardo V.; Chandraker, Anil; Sayegh, Mohamed H.; Blazar, Bruce R; Freeman, Gordon J; Sharpe, Arlene H.

    2011-01-01

    PD-L1 is a co-inhibitory molecule that negatively regulates multiple tolerance checkpoints. In the NOD mouse model PD-L1 regulates the development of diabetes. PD-L1 has two binding partners, PD-1 and B7-1, but the significance of the PD-L1:B7-1 interaction in regulating self-reactive T cell responses is not yet clear. To investigate this issue in NOD mice, we have compared the effects of two anti-PD-L1 antibodies that have different blocking activities. Anti-PD-L1 mAb 10F.2H11 sterically and...

  11. AB Manpower Plan 2007

    Myers, Stephen

    2007-01-01

    The present exercise is not as such a "manpower plan" but a purely budgetary comparison of known plus requested resources with the known commitments over the period 2007-2012. From a purely budgetary point of view, AB will have the capacity to maintain all those recently hired staff who fulfill the criteria for long term employment at CERN. Following this budgetary exercise, AB proposes to perform a CERN-wide staff work plan so as to compare the manpower available to the quantity of work to be done in the totality of the work-packages. If there is a significant mismatch between these two quantities then we propose the following measures which would create personnel economies and allow us to redress the mismatch by increased recruitment: a new job severance scheme; CERN restructuring; use of the new CERN-ITER agreement; more flexibility in transfers from Materials to Personnel budgets. Failing this a re-examination of possible closure of lower priority facilities may be needed.

  12. Tandem Aldol-Michael Reactions in Aqueous Diethylamine Medium: A Greener and Efficient Approach to Bis-Pyrimidine Derivatives

    Abdullah M. Al-Majid

    2013-12-01

    Full Text Available A simple protocol, involving the green synthesis for the construction of novel bis-pyrimidine derivatives, 3a–i and 4a–e are accomplished by the aqueous diethylamine media promoted tandem Aldol-Michael reaction between two molecules of barbituric acid derivatives 1a,b with various aldehydes. This efficient synthetic protocol using an economic and environmentally friendly reaction media with versatility and shorter reaction time provides bis-pyrimidine derivatives with high yields (88%–99%.

  13. PTP1B targets the endosomal sorting machinery

    Stuible, Matthew; Abella, Jasmine V; Feldhammer, Matthew;

    2010-01-01

    STAM2 specifically suppressed Akt activation, and a phosphorylation-deficient STAM2 mutant displayed prolonged localization on endosomes following EGF stimulation. These results reveal a novel link between the dephosphorylation and endocytic machinery and suggest that PTP1B can affect RTK signaling...

  14. 18 CFR 1b.18 - Right to submit statements.

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Right to submit... COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.18 Right to submit statements. Any person may, at any time during the course of an investigation, submit documents,...

  15. PTP1B: a new therapeutic target for Rett syndrome.

    Tautz, Lutz

    2015-08-01

    Rett syndrome (RTT) is an X-linked neurodevelopmental disorder that is characterized by successive loss of acquired cognitive, social, and motor skills and development of autistic behavior. RTT affects approximately 1 in 10,000 live female births and is the second most common cause of severe mental retardation in females, after Down syndrome. Currently, there is no cure or effective therapy for RTT. Approved treatment regimens are presently limited to supportive management of specific physical and mental disabilities. In this issue, Krishnan and colleagues reveal that the protein tyrosine phosphatase PTP1B is upregulated in patients with RTT and in murine models and provide strong evidence that targeting PTP1B has potential as a viable therapeutic strategy for the treatment of RTT. PMID:26214520

  16. Performance and Applications of L1B2 Ultrasonic Motors

    Gal Peled; Roman Yasinov; Nir Karasikov

    2016-01-01

    Piezoelectric ultrasonic motors offer important advantages for motion applications where high speed is coupled with high precision. The advances made in the recent decades in the field of ultrasonic motor based motion solutions allow the construction of complete motion platforms in the fields of semiconductors, aerospace and electro-optics. Among the various motor designs, the L1B2 motor type has been successful in industrial applications, offering high precision, effective control and operat...

  17. NICMOS OBSERVATIONS OF THE TRANSITING HOT JUPITER XO-1b

    We refine the physical parameters of the transiting hot Jupiter planet XO-1b and its stellar host XO-1 using Hubble Space Telescope (HST) NICMOS observations. XO-1b has a radius Rp = 1.21 ± 0.03 RJ , and XO-1 has a radius R* = 0.94 ± 0.02 Rsun, where the uncertainty in the mass of XO-1 dominates the uncertainty of Rp and R*. There are no significant differences in the XO-1 system properties between these broadband NIR observations and previous determinations based upon ground-based optical observations. We measure two transit timings from these observations with 9 s and 15 s precision. As a residual to a linear ephemeris model, there is a 2.0σ timing difference between the two HST visits that are separated by three transit events (11.8 days). These two transit timings and additional timings from the literature are sufficient to rule out the presence of an Earth mass planet orbiting in 2:1 mean motion resonance coplanar with XO-1b. We identify and correct for poorly understood 'gain-like' variations present in NICMOS time series data. This correction reduces the effective noise in time series photometry by a factor of 2 for the case of XO-1.

  18. Trisodium scandium bis(orthoborate

    Kunpeng Wang

    2012-05-01

    Full Text Available Single crystals of trisodium scandium bis(orthoborate, Na3Sc(BO32, have been obtained by spontaneous crystallization from an Na2O–Sc2O3–B2O3 melt. The crystal structure features a three-dimensional framework composed of planar [BO3]3− groups and distorted ScO6 octahedra with Na atoms in the cavities. The Sc atom occupies a special position (Wyckoff position 2b, site symmetry -1 and of the two Na atoms, one occupies a special position (Wyckoff position 2c, site symmetry -1.

  19. Bis(1,3-dithiole) Compounds

    Andersen, Jan Rud; Engler, E. M.; Green, D. C.; Patel, V. V.

    1977-01-01

    There is described the preparation of bis-1,3-dithiole compounds (I) which are key synthetic precursors for the preparation of new polymeric metal bis(dithiolene) (i.e., II) and tetrathiafulvalene compounds (i.e., III): (Image Omitted)...

  20. ABS 415 ASH Course Tutorial / Tutorialrank

    charles

    2015-01-01

    For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 4 Times, Rating: A+   ASHFORD ABS 415 Week 1 DQ 1Discovering Strengths in Leadership ASHFORD ABS 415 Week 1 DQ 2 Ethical Leadership ASHFORD ABS 415 Week 2 DQ 1 Developing Emotional Intelligence in Leadership ASHFORD ABS 415 Week 2 DQ 2 Elements of Emotional Intelligence in Leadership ASHFORD ABS 415 Week 3 DQ 1 Motivational Techniques ASHFORD ABS 415 Week 3 DQ 2 Leadership in a Cr...

  1. (Acetonitrile[bis(2-pyridylmethylamine]bis(perchloratocopper(II

    Ray J. Butcher

    2008-01-01

    Full Text Available In the title compound, [Cu(ClO42(C12H13N3(C2H3N], the CuII atom is six-coordinate in a Jahn–Teller distorted octahedral geometry, with coordination by the tridentate chelating ligand, an acetonitrile molecule, and two axial perchlorate anions. The tridentate ligand bis(2-pyridylmethylamine chelates meridionally and equatorially while an acetonitrile molecule is coordinated at the fourth equatorial site. The two perchlorate anions are disordered with site occupancy factors of 0.72/0.28. The amine H is involved in intramolecular hydrogen bonding to the perchlorate O atoms and there are extensive but weak intermolecular C—H...O interactions.

  2. Plutonium disposition study phase 1b final report

    This report provides the results of the Westinghouse activities performed as part of the Plutonium Disposition Study Phase 1b. These activities, which took place from May 16, 1993 to September 15, 1993, build upon the work completed in Phase 1a, which concluded on May 15, 1993. In Phase 1a, three Plutonium Disposal Reactor (PDR) options were developed for the disposal of excess weapons grade plutonium from returned and dismantled nuclear weapons. This report documents the results of several tasks that were performed to further knowledge in specific areas leading up to Phase 2 of the PDR Study. The Westinghouse activities for Phase 1b are summarized as follows: (1) resolved technical issues concerning reactor physics including equilibrium cycle calculations, use of gadolinium, moderator temperature coefficient, and others as documented in Section 2.0; (2) analyzed large Westinghouse commercial plants for plutonium disposal; (3) reactor safety issues including the steam line break were resolved, and are included in Section 2.0; (4) several tasks related to the PDR Fuel Cycle were examined; (5) cost and deployment options were examined to determine optimal configuration for both plutonium disposal and tritium production; (6) response to questions from DOE and National Academy of Scientists (NAS) reviewers concerning the PDR Phase 1a report are included in Appendix A

  3. Down-regulated expression of the protein-tyrosine phosphatase 1B (PTP1B) is associated with aggressive clinicopathologic features and poor prognosis in hepatocellular carcinoma

    Highlights: ► PTP1B protein showed decreased expression in 67.79% of the HCC patients. ► Low PTP1B expression predicts poor prognosis of HCC. ► Low PTP1B expression is correlated with expansion of OV6+ tumor-initiating cells. ► Down-regulation of PTP1B is associated with activation of Wnt/β-Catenin signaling. -- Abstract: The protein-tyrosine phosphatase 1B (PTP1B) is a classical non-transmembrane protein tyrosine phosphatase that plays a key role in metabolic signaling and can exert both tumor suppressing and tumor promoting effects in different cancers depending on the substrate involved and the cellular context. However, the expression level and function of PTP1B in hepatocellular carcinoma (HCC) remain unclear. In this study, PTP1B expression was detected by immunohistochemistry in normal liver tissue (n = 16) and hepatocellular carcinoma (n = 169). The correlations between PTP1B expression level and clinicopathologic features and patient survival were also analyzed. One hundred and eleven of 169 HCC patients (65.7%) had negative or low PTP1B expression in tumorous tissues, whereas normal tissues always expressed strong PTP1B. Decreased PTP1B expression was significantly associated with aggressive clinicopathologic features and poor prognosis. Immunohistochemistry also showed that low PTP1B expression level was correlated with high percentage of OV6+ tumor-initiating cells (T-ICs) and high frequency of nuclear β-Catenin expression in HCC specimens. Our findings demonstrate for the first time that the loss of inhibitory effect of PTP1B may contribute to progression and invasion of HCC through activation of Wnt/β-Catenin signaling and expansion of liver T-ICs. PTP1B may serve as a valuable prognostic biomarker and potential therapeutic target in HCC.

  4. N-type calcium channel/syntaxin/SNAP-25 complex probed by antibodies to II-III intracellular loop of the α1B subunit

    Neuronal voltage-dependent calcium channels are integral components of cellular excitation and neurosecretion. In addition to mediating the entry of calcium across the plasma membrane, both N-type and P/Q-type voltage-dependent calcium channels have been shown to form stable complexes with synaptic vesicle and presynaptic membrane proteins, indicating a structural role for the voltage-dependent calcium channels in secretion. Recently, detailed structural analyses of N-type calcium channels have identified residues amino acids 718-963 as the site in the rat α1B subunit that mediates binding to syntaxin, synaptosome-associated protein of 25andpuncsp; omitted000 mol. wt and synaptotagmin [Sheng et al. (1996) Nature 379, 451-454]. The purpose of this study was to employ site-directed antibodies to target domains within and outside of the interaction site on the rat α1B to probe potential binding sites for syntaxin/SNAP-25/synaptotagmin.Our results demonstrate that both antibodies employed in this study have access to their epitopes on the α1B as evidenced by equivalent immunoprecipitation of native [125I]omega-conotoxin GVIA-labeled α1B protein from CHAPS-solubilized preparations. The N-type voltage-dependent calcium channel immunoprecipitated by Ab CW14, the antibody directed to a domain outside of the synprint site, is associated with syntaxin and SNAP-25 with the recovery of these proteins, increasing in parallel to the recovery of α1B. However, when we used the antibody raised to an epitope within the synprint site (Ab CW8) to immunoprecipitate N-type calcium channels, the α1B was depleted of more than 65% of syntaxin and 80% of SNAP-25 when compared to the recovery of these proteins using Ab CW14. This is the first report of a defined epitope on the α1B subunit II-III loop (amino acids 863-875) whose perturbation by a site-directed antibody influences the dissociation of SNAP-25 and syntaxin. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights

  5. A functional polymorphism in the IL1B gene promoter, IL1B -31C>T, is not associated with cerebral malaria in Thailand

    Tangpukdee Noppadon; Hananantachai Hathairad; Patarapotikul Jintana; Doi Akihiro; Naka Izumi; Ohashi Jun; Looareesuwan Sornchai; Tokunaga Katsushi

    2005-01-01

    Abstract Background IL-1β and IL-1RA levels are higher in the serum of cerebral malaria patients than in patients with mild malaria. Recently, the level of IL1B expression was reported to be influenced by a polymorphism in the promoter of IL1, IL1B -31C>T. Methods To examine whether polymorphisms in IL1B and IL1RA influence the susceptibility to cerebral malaria, IL1B -31C>T, IL1B 3953C>T, and IL1RA variable number of tandem repeat (VNTR) were analysed in 312 Thai patients with malaria (109 c...

  6. Interferon β-1b-neutralizing antibodies 5 years after clinically isolated syndrome

    Hartung, H-P; Freedman, M S; Polman, C H;

    2011-01-01

    To determine the frequency and consequences of neutralizing antibodies (NAbs) in patients with a first event suggestive of multiple sclerosis (MS) treated with interferon β-1b (IFNβ-1b).......To determine the frequency and consequences of neutralizing antibodies (NAbs) in patients with a first event suggestive of multiple sclerosis (MS) treated with interferon β-1b (IFNβ-1b)....

  7. Microtubule-associated protein 1B (MAP1B)-deficient neurons show structural presynaptic deficiencies in vitro and altered presynaptic physiology.

    Bodaleo, Felipe J; Montenegro-Venegas, Carolina; Henríquez, Daniel R; Court, Felipe A; Gonzalez-Billault, Christian

    2016-01-01

    Microtubule-associated protein 1B (MAP1B) is expressed predominantly during the early stages of development of the nervous system, where it regulates processes such as axonal guidance and elongation. Nevertheless, MAP1B expression in the brain persists in adult stages, where it participates in the regulation of the structure and physiology of dendritic spines in glutamatergic synapses. Moreover, MAP1B expression is also found in presynaptic synaptosomal preparations. In this work, we describe a presynaptic phenotype in mature neurons derived from MAP1B knockout (MAP1B KO) mice. Mature neurons express MAP1B, and its deficiency does not alter the expression levels of a subgroup of other synaptic proteins. MAP1B KO neurons display a decrease in the density of presynaptic and postsynaptic terminals, which involves a reduction in the density of synaptic contacts, and an increased proportion of orphan presynaptic terminals. Accordingly, MAP1B KO neurons present altered synaptic vesicle fusion events, as shown by FM4-64 release assay, and a decrease in the density of both synaptic vesicles and dense core vesicles at presynaptic terminals. Finally, an increased proportion of excitatory immature symmetrical synaptic contacts in MAP1B KO neurons was detected. Altogether these results suggest a novel role for MAP1B in presynaptic structure and physiology regulation in vitro. PMID:27425640

  8. Clinical significance of combined detection of multiple serum antibodies (AsAb, EmAb, AcAb, AoAb, ToxAb) in infertile women

    Objective: To determine the clinical significance of combined detection of multiple serum antibodies in infertile women. Methods; Serum multiple antibodies were examined in 120 infertile women, including 88 failed to get pregnancy and 32 with repeated spontaneous abortion. The antibodies tested were: (1) anti-sperm antibody (AsAb) (2) endometrial antibody (EmAb) (3) anti-cardiophospholipid antibody (AcAb) (4) Anti-ovarian antibody (AoAb) and Toxoplasmosis antibody (ToxAb). Results: In 48 of the infertile women, none of the five antibodies were positive (40% of 120). The rest were: one antibody positive--38/120 or 31.6%; two antibodies positive--31/120 or 25.83%, three and four antibodies positive--4/120 or 3.33%. None of the women were positive with all five antibodies. Conclusion: Immune factor was the chief cause of infertility in women. (authors)

  9. HIV protease inhibitors are substrates for OATP1A2, OATP1B1 and OATP1B3 and lopinavir plasma concentrations are influenced by SLCO1B1 polymorphisms

    Hartkoorn, Ruben C; San Kwan, Wai; Shallcross, Victoria; Chaikan, Ammara; Liptrott, Neill; Egan, Deirdre; Enrique Salcedo Sora, J; James, Chloe E; Gibbons, Sara; Bray, Pat G; Back, David J; Khoo, Saye H; Owen, Andrew

    2016-01-01

    OATP1B1 and OATP1B3 are major hepatic drug transporters whilst OATP1A2 is mainly located in the brain but is also located in liver and several other organs. These transporters affect the distribution and clearance of many endo- and xenobiotics and have been reported to have functional SNPs. We have assessed the substrate specificites of these transporters for a panel of antiretrovirals and investigated the effects of SNPs within these transporters on the pharmacokinetics of lopinavir. SLCO1A2, SLCO1B1 and SLCO1B3 were cloned, verified and used to generate cRNA for use in the Xenopus laevis oocyte transport system. Using the oocyte system, antiretrovirals were tested for their substrate specificities. Plasma samples (n=349) from the Liverpool therapeutic drug monitoring registry were genotyped for SNPs in SLCO1A2, SLCO1B1 and SLCO1B3 and associations between SNPs and lopinavir plasma concentrations were analysed. Antiretroviral protease inhibitors, but not non-nucleoside reverse transcriptase inhibitors are substrates for OATP1A2, OATP1B1 and OATP1B3. Furthermore, ritonavir was not an inhibitor of OATP1B1. The 521T>C polymorphism in SLCO1B1 was significantly associated with higher lopinavir plasma concentrations. No associations were observed with functional variants of SLCO1A2 and SLCO1B3. These data add to our understanding of the factors that contribute to variability in plasma concentrations of protease inhibitors. Further studies are now required to confirm the association of SLCO1B1 521T>C with lopinavir plasma concentrations and to assess the influence of other polymorphisms in the SLCO family. PMID:20051929

  10. Performance and Applications of L1B2 Ultrasonic Motors

    Gal Peled

    2016-06-01

    Full Text Available Piezoelectric ultrasonic motors offer important advantages for motion applications where high speed is coupled with high precision. The advances made in the recent decades in the field of ultrasonic motor based motion solutions allow the construction of complete motion platforms in the fields of semiconductors, aerospace and electro-optics. Among the various motor designs, the L1B2 motor type has been successful in industrial applications, offering high precision, effective control and operational robustness. This paper reviews the design of high precision motion solutions based on L1B2 ultrasonic motors—from the basic motor structure to the complete motion solution architecture, including motor drive and control, material considerations and performance envelope. The performance is demonstrated, via constructed motion stages, to exhibit fast move and settle, a repeatability window of tens of nanometers, lifetime into the tens of millions of operational cycles, and compatibility with clean room and aerospace environments. Example stages and modules for semiconductor, aerospace, electro-optical and biomedical applications are presented. The described semiconductor and aerospace solutions are powered by Nanomotion HR type motors, driven by a sine wave up to 80 V/mm rms, having a driving frequency of 39.6 kHz, providing a maximum force up to 4 N per driving element (at 5 W power consumption per element and a maximum linear velocity above 300 mm/s. The described electro-optical modules are powered by small Nanomotion Edge motors driven by voltages up to 11 V AC, providing stall forces up to 0.35 N (power consumption up to 0.75 W and maximum linear velocity above 200 mm/s.

  11. SYNTHESIS AND ANTIMICROBIAL EVALUATION OF 3-AMINO-11-CYANO-4-IMINO- PYRAZOLO [4, 5-E]-4H-PYRIMIDO [2, 1-B] QUINOLINE AND THEIR SUBSTUITED DERIVATIVES SYNTHESIS und antimikrobielle EVALUATION von 3-Amino-11-Cyano-4-IMINO-pyrazol [4, 5-D]-4H-pyrimido [2, 1-b] chinolin UND IHR SUBSTUITED DERIVATE

    Sambhaji P. Vartale, Nilesh K. Halikar and Yogesh D. Pawar

    2012-01-01

    Full Text Available 2-Amino-3-cyano quinoline (1 and bis (methylthio methylene malononitrile (2 were refluxed in N,N-dimethyl formamide (DMF in presence of catalytic amount of anhydrous potassium carbonate to afforded 3, 11-dicyano-4-imino-2-methylthio -4H-pyrimido [1, 2-a] quinoline (3. The latter were further reacted with different substituted hydrazino. Afforded to 3-amino-11- cyano-4-imino pyrazolo [4, 5-e]-4H-pyrimido [2, 1-b] quinoline and their 2-substuited derivatives (4a-j. All these newly synthesized compounds were characterized by elemental analysis and spectral data, and screened for their antimicrobial activities.

  12. Metal-Free Ammonia-Borane Dehydrogenation Catalyzed by a Bis(borane) Lewis Acid.

    Lu, Zhenpin; Schweighauser, Luca; Hausmann, Heike; Wegner, Hermann A

    2015-12-14

    The storage of energy in a safe and environmentally benign way is one of the main challenges of today's society. Ammonia-borane (AB=NH3 BH3 ) has been proposed as a possible candidate for the chemical storage of hydrogen. However, the efficient release of hydrogen is still an active field of research. Herein, we present a metal-free bis(borane) Lewis acid catalyst that promotes the evolution of up to 2.5 equivalents of H2 per AB molecule. The catalyst can be reused multiple times without loss of activity. The moderate temperature of 60 °C allows for controlling the supply of H2 on demand simply by heating and cooling. Mechanistic studies give preliminary insights into the kinetics and mechanism of the catalytic reaction. PMID:26537288

  13. Synthesis, characterization, ab initio calculations, thermal behaviour and thermodynamics of some oxovanadium(IV) complexes involving O,O- and ,-donor moieties

    Mozaffar Asadi; Mohammad Hadi Ghatee; Susan Torabi; Khosro Mohammadi; Fatemeh Moosavi

    2010-07-01

    Some oxovanadium(IV) complexes, namely bis(1,1,1-trifluro-2,4-pentanedionato-,') oxovanadium (IV), [VO(tfac)2(H2O)], bis(1-phenyl-2,4-pentanedionato-,')oxovanadium(IV), [VO(phac)2(H2O)], bis(1,3-diphenyl-2,4-pentanedionato-,')oxovanadium(IV), [VO(dphac)2 (H2O)], of the type [VO(O4)] and bis(pyrolidineaniline)oxovanadium(IV), [VO(pyran)2(H2O)], bis(-hydroxypyrolidineaniline) oxovanadium(IV), [VO(-hydroxypyran)2(H2O)], bis(-methoxypyrolidineaniline)oxovanadium(IV), [VO(-MeOpyran)2 (H2O)], bis(-chloropyrolidineaniline)oxovanadium(IV), [VO(-chloropyran)2(H2O)], bis(-bromopyrolidineaniline)oxovanadium(IV), [VO(-bromopyran)2(H2O)], bis(-cyano pyrolidineaniline)oxovanadium(IV), [VO(-cyanopyran)2(H2O)], and bis(pyrolidinebenzylamine)oxovanadium(IV), [VO(pyrbz)2(H2O)], of the type [VO(N4)] were synthesized and characterized by IR, UV-Vis, mass spectrometry, elemental analysis, magnetic moment and thermogravimetry in order to evaluate their thermal stability and thermal decomposition pathways. The number of steps and, in particular, the starting temperature of decomposition of these complexes depends on the equatorial ligand. Also, formation constants of the complexes have been determined by UV-Vis absorption spectroscopy through titration of the ligands with the metal ions at constant ionic strength (0.1 M NaClO4) and at 25°C. According to the thermodynamic studies, as the steric character of the ligand increases, the complexation tendency to VO(IV) center decreases. Also, the ab initio calculations were carried out to determine the structural and the geometrical properties of the complexes.

  14. Homozygous carnitine palmitoyltransferase 1b (muscle isoform) deficiency is lethal in the mouse

    Ji, Shaonin; You, Yun; Kerner, Janos; Hoppel, Charles L.; Schoeb, Trenton R.; Chick, Wallace S.H.; Hamm, Doug A.; Sharer, J. Daniel; Wood, Philip A.

    2008-01-01

    Carnitine palmitoyltransferase-1 (CPT-1) catalyzes the rate-limiting step of mitochondrial β-oxidation of long chain fatty acids (LCFA), the most abundant fatty acids in mammalian membranes and in energy metabolism. Human deficiency of the muscle isoform CPT-1b is poorly understood. In the current study, embryos with a homozygous knockout of Cpt-1b were lost before embryonic day 9.5 − 11.5. Also, while there were normal percentages of CPT-1b+/−pups born from both male and female CPT-1b+/− mice crossed with wild-type mates, the number of CPT-1b+/− pups from CPT-1b+/− breeding pairs was under-represented (63% of the expected number). Northern blot analysis demonstrated ∼50% Cpt-1b mRNA expression in brown adipose tissue (BAT), heart and skeletal muscles in the CPT-1b+/− male mice. Consistent with tissue-specific expression of Cpt-1b mRNA in muscle but not liver, CPT-1+/− mice had ∼60% CPT-1 activity in skeletal muscle and no change in total liver CPT-1 activity. CPT-1b+/− mice had normal fasting blood glucose concentration. Consistent with expression of CPT-1b in BAT and muscle, ∼7% CPT-1b+/− mice (n=30) developed fatal hypothermia following a 3 hr cold challenge, while none of the CPT-1b+/+ mice (n=30) did. With a prolonged cold challenge (6 hr), significantly more CPT-1b+/− mice developed fatal hypothermia (52% CPT-1b+/− mice vs. 21% CPT-1b+/+ mice), with increased frequency in females of both genotypes (67% female vs. 38% male CPT-1b+/− mice, and 33% female vs. 8% male CPT-1b+/+ mice). Therefore, lethality of homozygous CPT-1b deficiency in the mice is consistent with paucity of human cases. PMID:18023382

  15. Basel III, BIS and Global Financial Governance

    Khan, Haider

    2013-01-01

    This paper analyzes the following aspects of global financial governance: • Proposed BASEL III reforms for more stringent capital requirements and their implications for the developing world in particular. • BIS proposals for better regulation of financial derivatives, including commodities futures, by moving away from OTC transactions towards organized exchanges. The Basel reforms and the BIS proposals for regulating the derivatives markets have many positive features. However, ...

  16. Organic anion transporting polypeptides OATP1B1 and OATP1B3 and their genetic variants influence the pharmacokinetics and pharmacodynamics of raloxifene

    Trdan Lušin Tina

    2012-04-01

    Full Text Available Abstract Background Raloxifene, a selective estrogen receptor modulator, exhibits quite large and unexplained interindividual variability in pharmacokinetics and pharmacodynamics. The aim of this study was to determine the role of organic-anion transporting polypeptides OATP1B1 and OATP1B3 and their genetic variants in the pharmacokinetics and pharmacodynamics of raloxifene. Methods To test the role of OATP1B1 and OATP1B3 transporters on hepatic uptake of raloxifene and its metabolites an in vitro model of Chinese Hamster Ovary cells expressing OATP1B1 or OATP1B3 was employed. The influence of OATP1B1 and OATP1B3 genetic variants on in vivo pharmacokinetics and pharmacodynamics was evaluated in 53 osteoporotic postmenopausal women treated with raloxifene. Results Our in vitro results showed that raloxifene and two of the three metabolites, raloxifene-4'-β-glucuronide (M2 and raloxifene-6,4'-diglucuronide (M3, interact with OATP1B1 and OATP1B3. Higher M3 and total raloxifene serum concentrations in patients correlated with lower serum levels of bone resorption marker, serum C-terminal telopeptide fragments of type I collagen, indicating a higher antiresorptive effect of raloxifene. Higher concentrations of M2 correlated with higher increase of lumbar spine bone mineral density supporting the raloxifene vertebral fracture specific protection effect. Finally, raloxifene, M3 and total raloxifene serum concentrations were significantly higher in patients with SLCO1B1 c.388A > G polymorphism and *1b haplotype implicating a considerable genetic effect on pharmacokinetics and pharmacodynamics of raloxifene. Conclusions These findings indicate that SLCO1B1 c.388A > G polymorphism could play an important role in pharmacokinetics and pharmacodynamics of raloxifene.

  17. Protein tyrosine phosphatase 1B (PTP1B)-inhibiting constituents from the leaves of Syzygium polyanthum.

    Saifudin, Azis; Tanaka, Ken; Kadota, Shigetoshi; Tezuka, Yasuhiro

    2012-08-01

    A methanol extract of the leaves of Syzygium polyanthum (Wight) Walp. afforded four new acylbenzene derivatives (1-4) together with seven known compounds (5-11). The structures of 1-11 were elucidated by extensive spectroscopic methods and comparison with the literature data. The new compounds 1-3 and a known compound, campest-4-en-3-one (10), exhibited a significant protein tyrosine phosphatase 1B inhibitory activity with IC₅₀ values of 13.1 ± 0.1, 5.77 ± 0.15, 4.01 ± 0.26, and 10.4 ± 0.5 µM, respectively. The inhibitory potency of the new compounds 2 and 3 was comparable to that of a positive control RK-682 (IC₅₀, 5.51 ± 0.04 µM). PMID:22763740

  18. Mauserbestände von Kolbenenten Netta rufina aus Zentral- und Südwesteuropa am Ismaninger Speichersee: Entwicklung bis 2008 und saisonale Dynamik

    Köhler, Peter; Köhler, Ursula; von Krosigk, Eberhard; Hense, Burkhard

    2012-01-01

    Die Sommermaxima der Kolbenenten am „Ismaninger Speichersee mit Fischteichen“, Bayern, sind von 1967 bis 1997 langsam von etwa 750 auf über 2.500 gestiegen. Das entsprach etwa der Größenordnung und dem Trend der Brutbestände im südlichen Mitteleuropa und Teilen Frankreichs. Ab 1998 kletterten die Maxima rasch auf mehr als 13.500 im Jahr 2003. Dieses hohe Niveau blieb unter Schwankungen bis 2008 mit immer noch 11.500 Ind. erhalten (Allzeit-Maximum: 16.093 Ind. am 30.07....

  19. Growth factor independence 1b (gfi1b is important for the maturation of erythroid cells and the regulation of embryonic globin expression.

    Lothar Vassen

    Full Text Available Growth factor independence 1b (GFI1B is a DNA binding repressor of transcription with vital functions in hematopoiesis. Gfi1b-null embryos die at midgestation very likely due to defects in erythro- and megakaryopoiesis. To analyze the full functionality of Gfi1b, we used conditionally deficient mice that harbor floxed Gfi1b alleles and inducible (Mx-Cre, Cre-ERT or erythroid specific (EpoR-Cre Cre expressing transgenes. In contrast to the germline knockout, EpoR-Cre mediated erythroid specific ablation of Gfi1b allows full gestation, but causes perinatal lethality with very few mice surviving to adulthood. Both the embryonic deletion of Gfi1b by EpoR-Cre and the deletion in adult mice by Mx-Cre or Cre-ERT leads to reduced numbers of erythroid precursors, perturbed and delayed erythroid maturation, anemia and extramedullary erythropoiesis. Global expression analyses showed that the Hba-x, Hbb-bh1 and Hbb-y embryonic globin genes were upregulated in Gfi1b deficient TER119+ fetal liver cells over the gestation period from day 12.5-17.5 p.c. and an increased level of Hbb-bh1 and Hbb-y embryonic globin gene expression was even maintained in adult Gfi1b deficient mice. While the expression of Bcl11a, a regulator of embryonic globin expression was not affected by Gfi1b deficiency, the expression of Gata1 was reduced and the expression of Sox6, also involved in globin switch, was almost entirely lost when Gfi1b was absent. These findings establish Gfi1b as a regulator of embryonic globin expression and embryonic and adult erythroid maturation.

  20. Identification of the GTPase-activating protein DEP domain containing 1B (DEPDC1B) as a transcriptional target of Pitx2

    Wu, Di; Zhu, Xiaoxi; Jimenez-Cowell, Kevin; Mold, Alexander J.; Sollecito, Christopher C.; Lombana, Nicholas; Jiao, Meng; Wei, Qize

    2015-01-01

    Pitx2 is a bicoid-related homeobox transcription factor implicated in regulating left-right patterning and organogenesis. However, only a limited number of Pitx2 downstream target genes have been identified and characterized. Here we demonstrate that Pitx2 is a transcriptional repressor of DEP domain containing 1B (DEPDC1B). The first intron of the human and mouse DEP domain containing 1B genes contains multiple consensus DNA-binding sites for Pitx2. Chromatin immunoprecipitation assays revea...

  1. Paresev 1-B in flight with tow cable

    1964-01-01

    The Paresev 1-B tested the concept of a paraglider, designed to enable a Gemini capsule to fly to a controlled ground landing. This would remove the need to make an ocean splashdown at the end of a spaceflight. Once the paraglider was deployed, the Gemini crew could use it to steer toward a touchdown point and to land on three retractable skids. Because the paraglider represented an unproved technology, approval was given to build a simple test vehicle to try out the concept. The paraglider research vehicle, or Paresev, was built of steel tubing, with a fabric paraglider. The Paresev was unpowered, so it had to be towed aloft either by ground vehicles or aircraft, such as a biplane or a light aircraft. The Paresev was a demanding aircraft to fly. Milt Thompson said that he found it more difficult to handle than the later lifting bodies. Due to technical and cost problems, the Gemini spacecraft never used the paraglider, and all missions made ocean splashdowns.

  2. Mirk/dyrk1B Kinase in Ovarian Cancer

    Eileen Friedman

    2013-03-01

    Full Text Available Mirk/dyrk1B kinase is expressed in about 75% of resected human ovarian cancers and in most ovarian cancer cell lines with amplification in the OVCAR3 line. Mirk (minibrain-related kinase is a member of the Minibrain/dyrk family of related serine/threonine kinases. Mirk maintains cells in a quiescent state by stabilizing the CDK inhibitor p27 and by inducing the breakdown of cyclin D isoforms. Mirk also stabilizes the DREAM complex, which maintains G0 quiescence by sequestering transcription factors needed to enter cycle. By entering a quiescent state, tumor cells can resist the nutrient deficiencies, hypoxic and acidic conditions within the tumor mass. Mirk maintains the viability of quiescent ovarian cancer cells by reducing intracellular levels of reactive oxygen species. CDKN2A-negative ovarian cancer cells treated with a Mirk kinase inhibitor escaped G0/G1 quiescence, entered cycle with high ROS levels and underwent apoptosis. The ROS scavenger N-acetyl cysteine reduced the extent of cancer cell loss. In contrast, the Mirk kinase inhibitor slightly reduced the fraction of G0 quiescent diploid epithelial cells and fibroblasts, and the majority of the cells pushed into cycle accumulated in G2 + M. Apoptotic sub-G0/G1 cells were not detected. Thus, normal cells were spared because of their expression of CDK inhibitors that blocked unregulated cycling and Mirk kinase inhibitor-treated normal diploid cells were about as viable as untreated controls.

  3. Briefwechsel uber die Partikel "bis" (An Exchange of Letters about the Particle "bis").

    Ludwig, Horst; Holschuh, Albrecht

    1990-01-01

    A discussion, in the form of an animated letter exchange, argues that, contrary to most current grammatical descriptions, the German particle "bis" should not be viewed as a preposition governing the accusative case. Rather, it is demonstrated that "bis" most often occurs as a proclitic adverb. (16 references) (JTC)

  4. Crystalline Complexes of 2,2'-Bis(9-hydroxy-9-fluorenyl)biphenyl Host with Oligofunctional and Conjugate Functional Group Guests

    Weber, Edwin

    2007-01-01

    Abstract Four crystalline inclusion compounds of the 2,2'-bis(9-hydroxy-9-fluorenyl)biphenyl host 1, containing diethylene glycol (1:1) (1a), bis(2-aminoethyl)amine (1:1) (1b), methacrylic acid (1:1) (1c) and 2-cyclopenten-1-one (1:2) (1d), have been studied by X-ray diffraction analysis from single crystals. Departure from the expectation, the multifunctional and conjugate functional guest molecules, potentially being able to offer multiple H donor-/acceptorships or other modes of...

  5. Pregnancy and pregnancy outcome in hepatitis C type 1b.

    Jabeen, T

    2012-02-03

    A large cohort of rhesus-negative women in Ireland were inadvertently infected with hepatitis C virus following exposure to contaminated anti-D immunoglobulin in 1977-8. This major iatrogenic episode was discovered in 1994. We studied 36 women who had been infected after their first pregnancy, and compared them to an age- and parity-matched control group of rhesus-positive women. The presence of hepatitis C antibody was confirmed in all 36 by enzyme-linked immunosorbent assay and by recombinant immunoblot assay, while 26 (72%) of the cohort were HCV-RNA-positive (type 1b) on PCR testing. In the 20 years post-infection, all members of the study group had at least one pregnancy, and mean parity was 3.5. They had a total of 100 pregnancies and 85 of these went to term. There were four premature births, one being a twin pregnancy, and 11 spontaneous miscarriages. One miscarriage occurred in the pregnancy following HCV infection. There were two neonatal deaths due to severe congenital abnormalities in the PCR-positive women. Of the children born to HCV-RNA positive mothers, only one (2.3%) tested positive for the virus. Significant portal fibrosis on liver biopsy was confined to HCV-RNA-positive mothers apart from one single exception in the antibody-positive HCV-RNA-negative group. Comparison with the control group showed no increase in spontaneous miscarriage rate, and no significant difference in obstetric complications; birth weights were similar for the two groups.

  6. Protein tyrosine phosphatase 1B (PTP1B) inhibitors from Morinda citrifolia (Noni) and their insulin mimetic activity.

    Nguyen, Phi-Hung; Yang, Jun-Li; Uddin, Mohammad N; Park, So-Lim; Lim, Seong-Il; Jung, Da-Woon; Williams, Darren R; Oh, Won-Keun

    2013-11-22

    As part of our ongoing search for new antidiabetic agents from medicinal plants, we found that a methanol extract of Morinda citrifolia showed potential stimulatory effects on glucose uptake in 3T3-L1 adipocyte cells. Bioassay-guided fractionation of this active extract yielded two new lignans (1 and 2) and three new neolignans (9, 10, and 14), as well as 10 known compounds (3-8, 11-13, and 15). The absolute configurations of compounds 9, 10, and 14 were determined by ECD spectra analysis. Compounds 3, 6, 7, and 15 showed inhibitory effects on PTP1B enzyme with IC50 values of 21.86 ± 0.48, 15.01 ± 0.20, 16.82 ± 0.42, and 4.12 ± 0.09 μM, respectively. Furthermore, compounds 3, 6, 7, and 15 showed strong stimulatory effects on 2-NBDG uptake in 3T3-L1 adipocyte cells. This study indicated the potential of compounds 3, 6, 7, and 15 as lead molecules for antidiabetic agents. PMID:24224843

  7. An Lmx1b-miR135a2 regulatory circuit modulates Wnt1/Wnt signaling and determines the size of the midbrain dopaminergic progenitor pool.

    Angela Anderegg

    Full Text Available MicroRNAs regulate gene expression in diverse physiological scenarios. Their role in the control of morphogen related signaling pathways has been less studied, particularly in the context of embryonic Central Nervous System (CNS development. Here, we uncover a role for microRNAs in limiting the spatiotemporal range of morphogen expression and function. Wnt1 is a key morphogen in the embryonic midbrain, and directs proliferation, survival, patterning and neurogenesis. We reveal an autoregulatory negative feedback loop between the transcription factor Lmx1b and a newly characterized microRNA, miR135a2, which modulates the extent of Wnt1/Wnt signaling and the size of the dopamine progenitor domain. Conditional gain of function studies reveal that Lmx1b promotes Wnt1/Wnt signaling, and thereby increases midbrain size and dopamine progenitor allocation. Conditional removal of Lmx1b has the opposite effect, in that expansion of the dopamine progenitor domain is severely compromised. Next, we provide evidence that microRNAs are involved in restricting dopamine progenitor allocation. Conditional loss of Dicer1 in embryonic stem cells (ESCs results in expanded Lmx1a/b+ progenitors. In contrast, forced elevation of miR135a2 during an early window in vivo phenocopies the Lmx1b conditional knockout. When En1::Cre, but not Shh::Cre or Nes::Cre, is used for recombination, the expansion of Lmx1a/b+ progenitors is selectively reduced. Bioinformatics and luciferase assay data suggests that miR135a2 targets Lmx1b and many genes in the Wnt signaling pathway, including Ccnd1, Gsk3b, and Tcf7l2. Consistent with this, we demonstrate that this mutant displays reductions in the size of the Lmx1b/Wnt1 domain and range of canonical Wnt signaling. We posit that microRNA modulation of the Lmx1b/Wnt axis in the early midbrain/isthmus could determine midbrain size and allocation of dopamine progenitors. Since canonical Wnt activity has recently been recognized as a key

  8. Physiological and pharmacological functions of OATP1A/1B transporters

    Steeg, E.

    2010-01-01

    Organic Anion Transporting Polypeptide (OATP; mouse Oatp) transporters of the 1A/1B subfamilies are uptake transporters that mediate the cellular uptake of a wide range of endogenous and xenobiotic compounds. Since OATP1A/1B transporters are expressed in pharmacological important organs, like liver, kidney and small intestine, it has been hypothesized that OATP1A/1B transporters play an important role in drug disposition and elimination. By generating and utilizing novel Oatp1a/1b cluster kno...

  9. Genetic polymorphisms in CYP1A1, CYP1B1 and COMT genes in Greenlandic Inuit and Europeans

    Mandana Ghisari

    2013-06-01

    Full Text Available Background. The Indigenous Arctic population is of Asian descent, and their genetic background is different from the Caucasian populations. Relatively little is known about the specific genetic polymorphisms in genes involved in the activation and detoxification mechanisms of environmental contaminants in Inuit and its relation to health risk. The Greenlandic Inuit are highly exposed to legacy persistent organic pollutants (POPs such as polychlorinated biphenyls (PCBs and organochlorine pesticides (OCPs, and an elucidation of gene–environment interactions in relation to health risks is needed. Objectives. The aim of this study was to determine and compare the genotype and allele frequencies of the cytochrome P450 CYP1A1 Ile462Val (rs1048943, CYP1B1 Leu432Val (rs1056836 and catechol-O-methyltransferase COMT Val158Met (rs4680 in Greenlandic Inuit (n=254 and Europeans (n=262 and explore the possible relation between the genotypes and serum levels of POPs. Results. The genotype and allele frequency distributions of the three genetic polymorphisms differed significantly between the Inuit and Europeans. For Inuit, the genotype distribution was more similar to those reported for Asian populations. We observed a significant difference in serum polychlorinated biphenyl (CB-153 and the pesticide 1,1-dichloro-2,2-bis(p-chlorophenyl-ethylene (p,p′-DDE levels between Inuit and Europeans, and for Inuit also associations between the POP levels and genotypes for CYP1A1, CYP1B1 and COMT. Conclusion. Our data provide new information on gene polymorphisms in Greenlandic Inuit that might support evaluation of susceptibility to environmental contaminants and warrant further studies.

  10. Four and a Half LIM Domains 1b (Fhl1b) Is Essential for Regulating the Liver versus Pancreas Fate Decision and for β-Cell Regeneration.

    Xu, Jin; Cui, Jiaxi; Del Campo, Aranzazu; Shin, Chong Hyun

    2016-02-01

    The liver and pancreas originate from overlapping embryonic regions, and single-cell lineage tracing in zebrafish has shown that Bone morphogenetic protein 2b (Bmp2b) signaling is essential for determining the fate of bipotential hepatopancreatic progenitors towards the liver or pancreas. Despite its pivotal role, the gene regulatory networks functioning downstream of Bmp2b signaling in this process are poorly understood. We have identified four and a half LIM domains 1b (fhl1b), which is primarily expressed in the prospective liver anlage, as a novel target of Bmp2b signaling. fhl1b depletion compromised liver specification and enhanced induction of pancreatic cells from endodermal progenitors. Conversely, overexpression of fhl1b favored liver specification and inhibited induction of pancreatic cells. By single-cell lineage tracing, we showed that fhl1b depletion led lateral endodermal cells, destined to become liver cells, to become pancreatic cells. Reversely, when fhl1b was overexpressed, medially located endodermal cells, fated to differentiate into pancreatic and intestinal cells, contributed to the liver by directly or indirectly modulating the discrete levels of pdx1 expression in endodermal progenitors. Moreover, loss of fhl1b increased the regenerative capacity of β-cells by increasing pdx1 and neurod expression in the hepatopancreatic ductal system. Altogether, these data reveal novel and critical functions of Fhl1b in the hepatic versus pancreatic fate decision and in β-cell regeneration. PMID:26845333

  11. Four and a Half LIM Domains 1b (Fhl1b Is Essential for Regulating the Liver versus Pancreas Fate Decision and for β-Cell Regeneration.

    Jin Xu

    2016-02-01

    Full Text Available The liver and pancreas originate from overlapping embryonic regions, and single-cell lineage tracing in zebrafish has shown that Bone morphogenetic protein 2b (Bmp2b signaling is essential for determining the fate of bipotential hepatopancreatic progenitors towards the liver or pancreas. Despite its pivotal role, the gene regulatory networks functioning downstream of Bmp2b signaling in this process are poorly understood. We have identified four and a half LIM domains 1b (fhl1b, which is primarily expressed in the prospective liver anlage, as a novel target of Bmp2b signaling. fhl1b depletion compromised liver specification and enhanced induction of pancreatic cells from endodermal progenitors. Conversely, overexpression of fhl1b favored liver specification and inhibited induction of pancreatic cells. By single-cell lineage tracing, we showed that fhl1b depletion led lateral endodermal cells, destined to become liver cells, to become pancreatic cells. Reversely, when fhl1b was overexpressed, medially located endodermal cells, fated to differentiate into pancreatic and intestinal cells, contributed to the liver by directly or indirectly modulating the discrete levels of pdx1 expression in endodermal progenitors. Moreover, loss of fhl1b increased the regenerative capacity of β-cells by increasing pdx1 and neurod expression in the hepatopancreatic ductal system. Altogether, these data reveal novel and critical functions of Fhl1b in the hepatic versus pancreatic fate decision and in β-cell regeneration.

  12. 76 FR 62455 - Announcement of Updated Funding Availability for H-1B Technical Skills Training Grants

    2011-10-07

    ... Employment and Training Administration Announcement of Updated Funding Availability for H-1B Technical Skills... Federal Register announcing the availability of $240 million for the H-1B Technical Skills Training Grants... available and encouraging additional applicants to apply for the H-1B Technical Skills Training...

  13. Survival, but not maturation, is affected in neutrophil progenitors from GSD-1b patients

    Visser, Gepke; de Jager, Wilco; Verhagen, Liesbeth P.; Smit, G. Peter A.; Wijburg, Frits A.; Prakken, Berent J.; Coffer, Paul J.; Buitenhuis, Miranda

    2012-01-01

    Glycogen storage disease type 1b (GSD 1b) is caused by mutations in the Glucose-6-phosphate transporter and is characterized by impaired glucose homeostasis. In addition, GSD-1b is associated with chronic neutropenia resulting in recurrent infections and inflammatory bowel disease. It is unclear whe

  14. Long-term impact of interferon beta-1b in patients with CIS

    Edan, G; Kappos, L; Montalbán, X;

    2014-01-01

    OBJECTIVE: To examine the long-term impact of early treatment initiation of interferon beta-1b (IFNB1b, Betaferon/Betaseron) in patients with a first event suggestive of multiple sclerosis (MS). METHODS: In the original placebo-controlled phase of BENEFIT, patients were randomised to IFNB1b 250 μg...

  15. Deletion of Protein Tyrosine Phosphatase 1B (PTP1B Enhances Endothelial Cyclooxygenase 2 Expression and Protects Mice from Type 1 Diabetes-Induced Endothelial Dysfunction.

    David J Herren

    Full Text Available Protein tyrosine phosphatase 1B (PTP1B dephosphorylates receptors tyrosine kinase and acts as a molecular brake on insulin signaling pathway. Conditions of metabolic dysfunction increase PTP1B, when deletion of PTP1B protects against metabolic disorders by increasing insulin signaling. Although vascular insulin signaling contributes to the control of glucose disposal, little is known regarding the direct role of PTP1B in the control of endothelial function. We hypothesized that metabolic dysfunctions increase PTP1B expression in endothelial cells and that PTP1B deletion prevents endothelial dysfunction in situation of diminished insulin secretion. Type I diabetes (T1DM was induced in wild-type (WT and PTP1B-deficient mice (KO with streptozotocin (STZ injection. After 28 days of T1DM, KO mice exhibited a similar reduction in body weight and plasma insulin levels and a comparable increase in glycemia (WT: 384 ± 20 vs. Ko: 432 ± 29 mg/dL, cholesterol and triglycerides, as WT mice. T1DM increased PTP1B expression and impaired endothelial NO-dependent relaxation, in mouse aorta. PTP1B deletion did not affect baseline endothelial function, but preserved endothelium-dependent relaxation, in T1DM mice. NO synthase inhibition with L-NAME abolished endothelial relaxation in control and T1DM WT mice, whereas L-NAME and the cyclooxygenases inhibitor indomethacin were required to abolish endothelium relaxation in T1DM KO mice. PTP1B deletion increased COX-2 expression and PGI2 levels, in mouse aorta and plasma respectively, in T1DM mice. In parallel, simulation of diabetic conditions increased PTP1B expression and knockdown of PTP1B increased COX-2 but not COX-1 expression, in primary human aortic endothelial cells. Taken together these data indicate that deletion of PTP1B protected endothelial function by compensating the reduction in NO bioavailability by increasing COX-2-mediated release of the vasodilator prostanoid PGI2, in T1DM mice.

  16. A facile microwave assisted one-pot synthesis of novel 1-methylhexahydroquinazolin-5(6H-ones and bis-1-methylhexahydroquinazolin-5(6H-ones

    Madhusudhan Saha

    2011-03-01

    Full Text Available Novel hexahydroquinazolin-5(6H-ones 3a-j have been synthesized in good yields by the reaction of enaminones 2a-b with primary amines and formaldehyde under the influence microwaves. Enaminones 2a-b have also been reacted with diamines and formaldehyde under similar conditions resulting in hitherto unreported bis- hexahydroquinazolin-5(6H-ones 4a-d and 5a-d. The structures of the molecules have been established with the help of spectral and analytical data.

  17. Interference of kallikrein 1b26 (klk1b26 translation by microRNA specifically expressed in female mouse submandibular glands: an additional mechanism for sexual dimorphism of klk1b26 protein in the glands

    Kurihara Kinji

    2011-11-01

    Full Text Available Abstract Background Mouse kallikrein 1b26 (klk1b26 protein is more abundant in male submandibular glands (SMGs than in female ones. This sexual dimorphism has been thought to be due to increased mRNA synthesis stimulated by androgen. However, the klk1b26 protein level in female SMG is far less than that expected from the mRNA level, suggesting an additional mechanism for down-regulation of klk1b26 expression in female SMGs. Methods We examined the effects of small non-coding RNAs in mouse SMGs on in vitro translation of klk1b26 using a reticulocyte lysate system and reverse transcription (RT-PCR for klk1b26 mRNA. Statistical analyses were performed with a computer package (Microsoft Excel. Results The microRNA (miRNA preparation from female SMGs, but not male SMGs, interfered with the in vitro translation of the klk1b26 protein and inhibited the RT-PCR for klk1b26 mRNA with forward primers targeting its 5'-terminal region (between the 15th and 40th nucleotide from the 5'-terminal. The miRNA preparation from castrated mouse SMGs showed the inhibitory effect on the klk1b26 translation, but that from a 5α-dihydrotestosterone-treated female mouse SMGs did not. Synthetic miRNAs (miR-325 and miR-1497a, which have partial complementarity with klk1b26 mRNA at its 5'-terminal region (15th to 40th nucleotide position from the 5'-terminal, also interfered with the in vitro klk1b26 translation. When the female miRNA preparation was incubated with a 30-nucleotide-long single-strand oligoDNA (named [15th-44th]ssDNA, whose sequence corresponded to the 15th to 44th position from the 5'-terminal of klk1b26 mRNA prior to the addition into the in vitro translation system, the inhibitory effect of the miRNA preparation on klk1b26 translation disappeared, while [15th-44th]ssDNA itself had no effect on the translation. Preincubation of the miRNA preparation with another single-strand DNA ([169th-198th]ssDNA, whose sequence corresponded with 169th to 198th position

  18. Preparation, crystal structure and luminescent properties of the (6,3) type network supramolecular lanthanide picrate complexes with 2,2'-[(1,2-naphthalene)bis(oxy)]bis[N-(phenylmethyl)]acetamide

    Solid complexes of lanthanide picrates with a new podand-type ligand, 2,2'-[(1,2-naphthalene)bis(oxy)]bis[N-(phenylmethyl)]acetamide (L) have been prepared and characterized by elemental analysis, conductivity measurements, IR and electronic spectroscopies. The crystal and molecular structures of the coordination polymer {[Eu2L3(Pic)6].(CHCl3)3.(H2O)0.5}n have been determined by single-crystal X-ray diffraction, and the structure displays a two-dimensional honeycomb-like framework in the ab plane, which can be regarded as a (6,3) topological network with europium atoms acting as 'three-connected' centers. Furthermore, the coordination layers are linked by the intermolecular hydrogen bonds to form a three-dimensional (3-D) netlike supermolecule. Under excitation, Eu complex exhibited characteristic emissions. The lowest triplet state energy level of the ligand indicates that the triplet state energy level of the ligand matches better to the resonance level of Eu(III) than Tb(III) ion. - Graphical abstract: The (6,3) type network supramolecular luminescent lanthanide picrate complexes {Ln2L3(Pic)6}n (L=2,2'-[(1,2-naphthalene)bis(oxy)]bis[N-(phenylmethyl)]acetamide) displaying a two-dimensional honeycomb-like framework have been designed and prepared.

  19. CYP1B1 expression, a potential risk factor for breast cancer

    Goth-Goldstein, Regine; Erdmann, Christine A.; Russell, Marion

    2001-05-31

    CYP1B1 expression in non-tumor breast tissue from breast cancer patients and cancer-free individuals was determined to test the hypothesis that high CYP1B1 expression is a risk factor for breast cancer. Large interindividual variations in CYP1B1 expression were found with CYP1B1 levels notably higher in breast cancer patients than cancer-free individuals. The results indicate that CYP1B1 might play a role in breast cancer either through increased PAH activation or through metabolism of endogenous estrogen to a carcinogenic derivative.

  20. A novel role for protein tyrosine phosphatase 1B as a positive regulator of neuroinflammation

    Song, Gyun Jee; Jung, Myungsu; Kim, Jong-Heon; Park, Hana; Rahman, Md. Habibur; Zhang, Sheng; Zhang, Zhong-Yin; Park, Dong Ho; Kook, Hyun; Lee, In-Kyu; Suk, Kyoungho

    2016-01-01

    Background Protein tyrosine phosphatase 1B (PTP1B) is a member of the non-transmembrane phosphotyrosine phosphatase family. Recently, PTP1B has been proposed to be a novel target of anti-cancer and anti-diabetic drugs. However, the role of PTP1B in the central nervous system is not clearly understood. Therefore, in this study, we sought to define PTP1B’s role in brain inflammation. Methods PTP1B messenger RNA (mRNA) and protein expression levels were examined in mouse brain and microglial cel...

  1. Equity valuation : Atlas Copco AB

    Santos, Ricardo Manuel Castro Lopes Alba

    2016-01-01

    This Dissertation presents a literature review of some of the most appraised theories on equity valuation models. A thoughtful analysis is made, presenting the main advantages and restrictions of each model and setting the path for a discussion about improvements to be made on this field of study. A practical implementation follows, proposing a fair value estimation of Atlas Copco AB shares. Atlas Copco is a Swedish-based capital goods company, operating across four differen...

  2. AB Levitator and Electricity Storage

    Bolonkin, Alexander

    2007-01-01

    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative...

  3. Thermonuclear Reflect AB-Reactor

    Bolonkin, Alexander

    2008-01-01

    The author offers a new kind of thermonuclear reflect reactor. The remarkable feature of this new reactor is a three net AB reflector, which confines the high temperature plasma. The plasma loses part of its energy when it contacts with the net but this loss can be compensated by an additional permanent plasma heating. When the plasma is rarefied (has a small density), the heat flow to the AB reflector is not large and the temperature in the triple reflector net is lower than 2000 - 3000 K. This offered AB-reactor has significantly less power then the currently contemplated power reactors with magnetic or inertial confinement (hundreds-thousands of kW, not millions of kW). But it is enough for many vehicles and ships and particularly valuable for tunnelers, subs and space apparatus, where air to burn chemical fuel is at a premium or simply not available. The author has made a number of innovations in this reactor, researched its theory, developed methods of computation, made a sample computation of typical pr...

  4. AB Levitator and Electricity Storage

    Bolonkin, A

    2007-01-01

    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative weight ratio of this engine is 0.01 - 0.1 (from thrust). For some types of AB engine (toroidal form) the thrust easily may be changed in any direction without turning of engine. The author computed many projects using different versions of offered AB engine: small device for levitation-flight of a human (including flight from Earth to Outer Space), fly VTOL car (track), big VTOL aircrat, suspended low altitude stationary satellite, powerful Space Shuttle-like booster for travel to the Moon and Mars without spending energ...

  5. 40 CFR 721.1187 - Bis(imidoethylene) benzene.

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Bis(imidoethylene) benzene. 721.1187... Substances § 721.1187 Bis(imidoethylene) benzene. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance bis(imidoethylene)benzene (PMN P-93-1447) is subject to...

  6. Pancreatic Protein Tyrosine Phosphatase 1B Deficiency Exacerbates Acute Pancreatitis in Mice.

    Bettaieb, Ahmed; Koike, Shinichiro; Chahed, Samah; Bachaalany, Santana; Griffey, Stephen; Sastre, Juan; Haj, Fawaz G

    2016-08-01

    Acute pancreatitis (AP) is a common and devastating gastrointestinal disorder that causes significant morbidity. The disease starts as local inflammation in the pancreas that may progress to systemic inflammation and complications. Protein tyrosine phosphatase 1B (PTP1B) is implicated in inflammatory signaling, but its significance in AP remains unclear. To investigate whether PTP1B may have a role in AP, we used pancreas PTP1B knockout (panc-PTP1B KO) mice and determined the effects of pancreatic PTP1B deficiency on cerulein- and arginine-induced acute pancreatitis. We report that PTP1B protein expression was increased in the early phase of AP in mice and rats. In addition, histological analyses of pancreas samples revealed enhanced features of AP in cerulein-treated panc-PTP1B KO mice compared with controls. Moreover, cerulein- and arginine-induced serum amylase and lipase were significantly higher in panc-PTP1B KO mice compared with controls. Similarly, pancreatic mRNA and serum concentrations of the inflammatory cytokines IL-1B, IL-6, and tumor necrosis factor-α were increased in panc-PTP1B KO mice compared with controls. Furthermore, panc-PTP1B KO mice exhibited enhanced cerulein- and arginine-induced NF-κB inflammatory response accompanied with increased mitogen-activated protein kinases activation and elevated endoplasmic reticulum stress. Notably, these effects were recapitulated in acinar cells treated with a pharmacological inhibitor of PTP1B. These findings reveal a novel role for pancreatic PTP1B in cerulein- and arginine-induced acute pancreatitis. PMID:27461362

  7. Differential epigenetic and transcriptional response of the skeletal muscle carnitine palmitoyltransferase 1B (CPT1B) gene to lipid exposure with obesity.

    Maples, Jill M; Brault, Jeffrey J; Witczak, Carol A; Park, Sanghee; Hubal, Monica J; Weber, Todd M; Houmard, Joseph A; Shewchuk, Brian M

    2015-08-15

    The ability to increase fatty acid oxidation (FAO) in response to dietary lipid is impaired in the skeletal muscle of obese individuals, which is associated with a failure to coordinately upregulate genes involved with FAO. While the molecular mechanisms contributing to this metabolic inflexibility are not evident, a possible candidate is carnitine palmitoyltransferase-1B (CPT1B), which is a rate-limiting step in FAO. The present study was undertaken to determine if the differential response of skeletal muscle CPT1B gene transcription to lipid between lean and severely obese subjects is linked to epigenetic modifications (DNA methylation and histone acetylation) that impact transcriptional activation. In primary human skeletal muscle cultures the expression of CPT1B was blunted in severely obese women compared with their lean counterparts in response to lipid, which was accompanied by changes in CpG methylation, H3/H4 histone acetylation, and peroxisome proliferator-activated receptor-δ and hepatocyte nuclear factor 4α transcription factor occupancy at the CPT1B promoter. Methylation of specific CpG sites in the CPT1B promoter that correlated with CPT1B transcript level blocked the binding of the transcription factor upstream stimulatory factor, suggesting a potential causal mechanism. These findings indicate that epigenetic modifications may play important roles in the regulation of CPT1B in response to a physiologically relevant lipid mixture in human skeletal muscle, a major site of fatty acid catabolism, and that differential DNA methylation may underlie the depressed expression of CPT1B in response to lipid, contributing to the metabolic inflexibility associated with severe obesity. PMID:26058865

  8. The potential of transferrin-pendant-type polyethyleneglycol liposomes encapsulating decahydrodecaborate-1B (GB-10) as 1B-carriers for boron neutron capture therapy

    Purpose: To evaluate GB-10-encapsulating transferrin (TF)-pendant-type polyethyleneglycol (PEG) liposomes as tumor-targeting 1B-carriers for boron neutron capture therapy. Methods and Materials: A free mercaptoundecahydrododecaborate-1B (BSH) or decahydrodecaborate-1B (GB-10) solution, bare liposomes, PEG liposomes, or TF-PEG liposomes were injected into SCC VII tumor-bearing mice, and 1B concentrations in the tumors and normal tissues were measured by γ-ray spectrometry. Meanwhile, tumor-bearing mice were continuously given 5-bromo-2'-deoxyuridine (BrdU) to label all intratumor proliferating cells, then injected with these 1B-carriers containing BSH or GB-10 in the same manner. Right after thermal neutron irradiation, the response of quiescent (Q) cells was assessed in terms of the micronucleus frequency using immunofluorescence staining for BrdU. The frequency in the total tumor cells was determined from the BrdU nontreated tumors. Results: Transferrin-PEG liposomes showed a prolonged retention in blood circulation, low uptake by reticuloendothelial system, and the most enhanced accumulation of 1B in solid tumors. In general, the enhancing effects were significantly greater in total cells than Q cells. In both cells, the enhancing effects of GB-10-containing 1B-carriers were significantly greater than BSH-containing 1B-carriers, whether loaded in free solution or liposomes. In both cells, whether BSH or GB-10 was employed, the greatest enhancing effect was observed with TF-PEG liposomes followed in decreasing order by PEG liposomes, bare liposomes, and free BSH or GB-10 solution. In Q cells, the decrease was remarkable between PEG and bare liposomes. Conclusions: In terms of biodistribution characteristics and tumor cell-killing effect as a whole, including Q cells, GB-10 TF-PEG liposomes were regarded as promising 1B-carriers

  9. Theoretical Studies on the Ground State and Excited State of 2,4'- (Ethylene)-bis-8-hydroxyquinoline

    Hui-xue Li; Su-juan Pan; Xiao-feng Wang; Tai Xiao

    2008-01-01

    2,7'-(Ethylene)-bis-8-hydroxyquinoline was optimized with DFT/B3LYP and ab initio HF methods, so ion- ization potential and electron affinity could be determined. Absorption spectrum was calculated by ZINDO and TD-DFT. CIS method was used to calculate the S1 excited states of the compound and afterwards the emission spectrum was computed. When the solvent effect was taken into account, the computed results show encouraging agreement with known experimental data. The results of analyzing the relationship between the energies and absorption spectra indicate that the ability to transporting electrons is strengthened compared with 8-hydroxyquinoline and that absorption and emission spectra are red-shifted. The intramolecular reor- ganization energy of tris(2,7'-(ethylene)-bis-8-hydroxyquinoline)-aluminum implies its electron transporting property is worse than tris(8-hydroxyquinoline)-aluminurn. The predicted maximum emission wavelength is red-shifted compared with tris(8-hydroxyquinoline)-aluminum.

  10. Theoretical Studies on the Ground State and Excited State of 2,7'-(Ethylene)-bis-8-hydroxyquinoline

    Li, Hui-xue; Pan, Su-juan; Wang, Xiao-feng; Xiao, Tai

    2008-06-01

    2,7'-(Ethylene)-bis-8-hydroxyquinoline was optimized with DFT/B3LYP and ab initio HF methods, so ionization potential and electron affinity could be determined. Absorption spectrum was calculated by ZINDO and TD-DFT. CIS method was used to calculate the S1 excited states of the compound and afterwards the emission spectrum was computed. When the solvent effect was taken into account, the computed results show encouraging agreement with known experimental data. The results of analyzing the relationship between the energies and absorption spectra indicate that the ability to transporting electrons is strengthened compared with 8-hydroxyquinoline and that absorption and emission spectra are red-shifted. The intramolecular reorganization energy of tris(2,7'-(ethylene)-bis-8-hydroxyquinoline)-aluminum implies its electron transporting property is worse than tris(8-hydroxyquinoline)-aluminum. The predicted maximum emission wavelength is red-shifted compared with tris(8-hydroxyquinoline)-aluminum.

  11. Münchner Theatergeschichte 1600 bis 2000

    Hemler, Stefan; Zuber, Barbara

    2009-01-01

    Tagungsbericht: Münchner Theatergeschichte 1600 bis 2000 Veranstalter: Kulturreferat der Landeshauptstadt München; Institut für Theaterwissenschaft; Institut für Bayerische Geschichte an der Ludwig-Maximilians-Universität München Datum, Ort: 12.05.2000-14.05.2000, München

  12. Detection of genes regulated by Lmx1b during limb dorsalization.

    Feenstra, Jennifer M; Kanaya, Kohei; Pira, Charmaine U; Hoffman, Sarah E; Eppey, Richard J; Oberg, Kerby C

    2012-05-01

    Lmx1b is a homeodomain transcription factor that regulates dorsal identity during limb development. Lmx1b knockout (KO) mice develop distal ventral-ventral limbs. Although induction of Lmx1b is linked to Wnt7a expression in the dorsal limb ectoderm, the downstream targets of Lmx1b that accomplish limb dorsalization are unknown. To identify genes targeted by Lmx1b, we compared gene arrays from Lmx1b KO and wild type mouse limbs during limb dorsalization, i.e., 11.5, 12.5, and 13.5 days post coitum. We identified 54 target genes that were differentially expressed in all three stages. Several skeletal targets, including Emx2, Matrilin1 and Matrilin4, demonstrated a loss of scapular expression in the Lmx1b KO mice, supporting a role for Lmx1b in scapula development. Furthermore, the relative abundance of extracellular matrix-related soft tissue targets regulated by Lmx1b, such as collagens and proteoglycans, suggests a mechanism that includes changes in the extracellular matrix composition to accomplish limb dorsalization. Our study provides the most comprehensive characterization of genes regulated by Lmx1b during limb development to-date and provides targets for further investigation. PMID:22417325

  13. Ganglioside GQ1b induces dopamine release through the activation of Pyk2.

    Zhang, Zhao; Chu, Shi-Feng; Mou, Zheng; Gao, Yan; Wang, Zhen-Zhen; Wei, Gui-Ning; Chen, Nai-Hong

    2016-03-01

    Growing evidence indicates that GQ1b, one of the gangliosides members, contributes to synaptic transmission and synapse formation. Previous studies have shown that GQ1b could enhance depolarization induced neurotransmitter release, while the role of GQ1b in asynchronous release is still largely unknown. Here in our result, we found low concentration of GQ1b, but not GT1b or GD1b (which were generated from GQ1b by plasma membrane-associated sialidases), evoked asynchronous dopamine (DA) release from both clonal rat pheochromocytoma PC12 cells and rat striatal slices significantly. The release peaked at 2min after GQ1b exposure, and lasted for more than 6min. This effect was caused by the enhancement of intracellular Ca(2+) and the activation of Pyk2. Inhibition of Pyk2 by PF-431396 (a dual inhibitor of Pyk2 and FAK) or Pyk2 siRNA abolished DA release induced by GQ1b. Moreover, Pyk2 Y402, but not other tyrosine site, was phosphorylated at the peaking time. The mutant of Pyk2 Y402 (Pyk2-Y402F) was built to confirm the essential role of Y402 activation. Further studies revealed that activated Pyk2 stimulated ERK1/2 and p-38, while only the ERK1/2 activation was indispensable for GQ1b induced DA release, which interacted with Synapsin I directly and led to its phosphorylation, then depolymerization of F-actin, thus contributed to DA release. In conclusion, low concentration of GQ1b is able to enhance asynchronous DA release through Pyk2/ERK/Synapsin I/actin pathway. Our findings provide new insights into the role of GQ1b in neuronal communication, and implicate the potential application of GQ1b in neurological disorders. PMID:26704905

  14. Solvent-free Thia-Michael Addition Reactions Using 3-[Bis(alkylthio)methylene]pentane-2,4-diones as Efficient and Odorless Thiol Equivalents

    LIN Chun; ZHAO Xiao-Liang; OUYANG Yan; YU Hai-Feng; DONG De-Wen

    2008-01-01

    3-[Bis(alkylthio)methylene]pentane-2,4-diones (1a and 1b) have been investigated as nonthiolic and odorless thiol equivalents for thia-Michael addition reactions under solvent-free conditions. Promoted by HCl (aq.), the cleavage of compounds 1 took place, and the in-situ generated thiols underwent facile conjugate addition to α,β-unsaturated carbonyl compounds 2 affording the corresponding β-keto sulfides 3 in high yields.

  15. AP calculus AB/BC

    Schwartz, Stu

    2013-01-01

    All Access for the AP® Calculus AB & BC Exams Book + Web + Mobile Everything you need to prepare for the Advanced Placement® exam, in a study system built around you! There are many different ways to prepare for an Advanced Placement® exam. What's best for you depends on how much time you have to study and how comfortable you are with the subject matter. To score your highest, you need a system that can be customized to fit you: your schedule, your learning style, and your current level of knowledge. This book, and the free online tools that come with it, will help you personalize your AP® Cal

  16. ABS: Sequence alignment by scanning

    Bonny, Mohamed Talal

    2011-08-01

    Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  17. The histone demethylase Jarid1b is required for hematopoietic stem cell self-renewal

    Stewart, Morag H; Albert, Mareike; Sroczynska, Patrycja;

    2015-01-01

    Jarid1b/KDM5b is a histone demethylase that regulates self-renewal and differentiation in stem cells and cancer, however its function in hematopoiesis is unclear. Here, we find that Jarid1b is highly expressed in primitive hematopoietic compartments and is overexpressed in acute myeloid leukemias...... compromises hematopoietic stem cell (HSC) self-renewal capacity and suggest that Jarid1b is a positive regulator of HSC potential........ Constitutive genetic deletion of Jarid1b did not impact steady-state hematopoiesis. In contrast, acute deletion of Jarid1b from bone marrow increased peripheral blood T cells and, following secondary transplantation, resulted in loss of bone marrow reconstitution. Our results reveal that deletion of Jarid1b...

  18. Discovery of a novel competitive inhibitor of PTP1B by high-throughput screening

    Lei SHI; Hai-ping YU; Yue-yang ZHOU; Jun-qin DU; Qiang SHEN; Jing-ya LI; Jia LI

    2008-01-01

    Aim: The aim of the present study was to discover novel protein tyrosine phos-phatase 1B (PTP1B) inhibitors. We expressed and purified the human PTP1B catalytic domain and set up a molecular level high-throughput screening (HTS) assay to screen a set of 48 000 pure compounds. Results: HTS was finished with an averaged Z' factor of 0.63, and LGH00081, a competitive inhibitor of PTP1B with novel structure and relatively good selectivity for receptor-type protein ty-rosine phosphatases, was identified. Conclusion: We established a molecular level assay which is useful for the screening of PTP1B inhibitors with therapeutic potential. The novel competitive PTP1B inhibitor LGH00081 offers a good start for structure modification and cellular functional activity study.

  19. In vivo and in vitro CYP1B mRNA expression in channel catfish.

    Willett, Kristine L; Ganesan, Shobana; Patel, Monali; Metzger, Christine; Quiniou, Sylvie; Waldbieser, Geoff; Scheffler, Brian

    2006-07-01

    Our goal was to study the induction of CYP1B mRNA expression in channel catfish (Ictalurus punctatus). CYP1B belongs to the cytochrome P450 superfamily of genes, is involved in the oxidation of endogenous and exogenous compounds, and could potentially be a useful biomarker in fish for exposure to AhR ligands. The full-length catfish CYP1B cDNA is 2417 nt to the polyA tail and encodes a putative protein of 536 amino acids. It has 67% amino acid similarity to carp and zebrafish CYP1B and 68% similarity to carp CYP1B2. Male channel catfish were collected from three Mississippi Delta sites: Lake Roebuck, Itta Bena; Bee Lake, Thornton; and Sunflower River, Indianola. Total RNA was isolated from wild-caught catfish gill, blood, gonad and liver tissues. Quantitative real-time reverse transcriptase PCR was used to determine relative induction of CYP1B in wild catfish compared to laboratory control and BaP-exposed catfish (20mg/kg i.p. after 4 days). BaP exposure significantly induced CYP1B message in blood, gonad, and liver of laboratory catfish. In these same tissues of wild catfish from sites with relatively low sediment contaminants, CYP1B message was not statistically increased relative to laboratory control catfish. CYP1B transcript abundance was higher in gills compared to other tissues in both laboratory and wild catfish. When primary cultured gill cells were treated with increasing concentrations of BaP, TCDD, and PCBs 77, 126 and 169, CYP1B mRNA was induced more than 10-fold while PCB153 and 4,4'DDT did not cause significant CYP1B induction. Our results suggest that catfish CYP1B is induced by the classic AhR ligands. PMID:16697458

  20. Hnf1b controls pancreas morphogenesis and the generation of Ngn3+ endocrine progenitors

    De Vas, Matias G.; Kopp, Janel L; Heliot, Claire; Sander, Maike; Cereghini, Silvia; Haumaitre, Cécile

    2015-01-01

    Heterozygous mutations in the human HNF1B gene are associated with maturity-onset diabetes of the young type 5 (MODY5) and pancreas hypoplasia. In mouse, Hnf1b heterozygous mutants do not exhibit any phenotype, whereas the homozygous deletion in the entire epiblast leads to pancreas agenesis associated with abnormal gut regionalization. Here, we examine the specific role of Hnf1b during pancreas development, using constitutive and inducible conditional inactivation approaches at key developme...

  1. The Role of PTP1B O-GlcNAcylation in Hepatic Insulin Resistance

    Yun Zhao; Zhuqi Tang; Aiguo Shen; Tao Tao; Chunhua Wan; Xiaohui Zhu; Jieru Huang; Wanlu Zhang; Nana Xia; Suxin Wang; Shiwei Cui; Dongmei Zhang

    2015-01-01

    Protein tyrosine phosphatase 1B (PTP1B), which can directly dephosphorylate both the insulin receptor and insulin receptor substrate 1 (IRS-1), thereby terminating insulin signaling, reportedly plays an important role in insulin resistance. Accumulating evidence has demonstrated that O-GlcNAc modification regulates functions of several important components of insulin signal pathway. In this study, we identified that PTP1B is modified by O-GlcNAcylation at three O-GlcNAc sites (Ser104, Ser201...

  2. Water molecule network and active site flexibility of apo protein tyrosine phosphatase 1B

    Pedersen, A.K.; Peters, Günther H.J.; Møller, K.B.;

    2004-01-01

    Protein tyrosine phosphatase 1B (PTP1B) plays a key role as a negative regulator of insulin and leptin signalling and is therefore considered to be an important molecular target for the treatment of type 2 diabetes and obesity. Detailed structural information about the structure of PTP1B, including...... the conformation and flexibility of active-site residues as well as the water-molecule network, is a key issue in understanding ligand binding and enzyme kinetics and in structure-based drug design. A 1.95 Angstrom apo PTP1B structure has been obtained, showing four highly coordinated water molecules...

  3. Yersinia pestis Requires Host Rab1b for Survival in Macrophages.

    Michael G Connor

    2015-10-01

    Full Text Available Yersinia pestis is a facultative intracellular pathogen that causes the disease known as plague. During infection of macrophages Y. pestis actively evades the normal phagosomal maturation pathway to establish a replicative niche within the cell. However, the mechanisms used by Y. pestis to subvert killing by the macrophage are unknown. Host Rab GTPases are central mediators of vesicular trafficking and are commonly targeted by bacterial pathogens to alter phagosome maturation and killing by macrophages. Here we demonstrate for the first time that host Rab1b is required for Y. pestis to effectively evade killing by macrophages. We also show that Rab1b is specifically recruited to the Yersinia containing vacuole (YCV and that Y. pestis is unable to subvert YCV acidification when Rab1b expression is knocked down in macrophages. Furthermore, Rab1b knockdown also altered the frequency of association between the YCV with the lysosomal marker Lamp1, suggesting that Rab1b recruitment to the YCV directly inhibits phagosome maturation. Finally, we show that Rab1b knockdown also impacts the pH of the Legionella pneumophila containing vacuole, another pathogen that recruits Rab1b to its vacuole. Together these data identify a novel role for Rab1b in the subversion of phagosome maturation by intracellular pathogens and suggest that recruitment of Rab1b to the pathogen containing vacuole may be a conserved mechanism to control vacuole pH.

  4. Mutations in STX1B, encoding a presynaptic protein, cause fever-associated epilepsy syndromes

    Schubert, J.; Siekierska, A.; Langlois, M.;

    2014-01-01

    Febrile seizures affect 2-4% of all children(1) and have a strong genetic component(2). Recurrent mutations in three main genes (SCN1A, SCN1B and GABRG2)(3-5) have been identified that cause febrile seizures with or without epilepsy. Here we report the identification of mutations in STX1B, encodi....... Wild-type human syntaxin-1B but not a mutated protein rescued the effects of stx1b knockdown in zebrafish. Our results thus implicate STX1B and the presynaptic release machinery in fever-associated epilepsy syndromes.......Febrile seizures affect 2-4% of all children(1) and have a strong genetic component(2). Recurrent mutations in three main genes (SCN1A, SCN1B and GABRG2)(3-5) have been identified that cause febrile seizures with or without epilepsy. Here we report the identification of mutations in STX1B, encoding...... syntaxin-1B(6), that are associated with both febrile seizures and epilepsy. Whole-exome sequencing in independent large pedigrees(7,8) identified cosegregating STX1B mutations predicted to cause an early truncation or an in-frame insertion or deletion. Three additional nonsense or missense mutations and a...

  5. Homozygous carnitine palmitoyltransferase 1b (muscle isoform) deficiency is lethal in the mouse

    Ji, Shaonin; You, Yun; Kerner, Janos; Hoppel, Charles L.; Schoeb, Trenton R.; Chick, Wallace S H; Hamm, Doug A.; Sharer, J. Daniel; Wood, Philip A.

    2007-01-01

    Carnitine palmitoyltransferase-1 (CPT-1) catalyzes the rate-limiting step of mitochondrial β-oxidation of long chain fatty acids (LCFA), the most abundant fatty acids in mammalian membranes and in energy metabolism. Human deficiency of the muscle isoform CPT-1b is poorly understood. In the current study, embryos with a homozygous knockout of Cpt-1b were lost before embryonic day 9.5 − 11.5. Also, while there were normal percentages of CPT-1b+/−pups born from both male and female CPT-1b+/− mic...

  6. The ING1b tumor suppressor facilitates nucleotide excision repair by promoting chromatin accessibility to XPA

    ING1b is the most studied ING family protein and perhaps the most ubiquitously and abundantly expressed. This protein is involved in the regulation of various biological functions ranging from senescence, cell cycle arrest, apoptosis, to DNA repair. ING1b is upregulated by UV irradiation and enhances the removal of bulky nucleic acid photoproducts. In this study, we provide evidence that ING1b mediates nucleotide excision repair by facilitating the access to damaged nucleosomal DNA. We demonstrate that ING1b is not recruited to UV-induced DNA lesions but enhances nucleotide excision repair only in XPC-proficient cells, implying an essential role in early steps of the 'access, repair, restore' model. We also find that ING1b alters histone acetylation dynamics upon exposure to UV radiation and induces chromatin relaxation in microccocal nuclease digestion assay, revealing that ING1b may allow better access to nucleotide excision repair machinery. More importantly, ING1b associates with chromatin in a UV-inducible manner and facilitates DNA access to nucleotide excision repair factor XPA. Furthermore, depletion of the endogenous ING1b results to the sensitization of cells at S-phase to UV irradiation. Taken together, these observations establish a role of ING1b acting as a chromatin accessibility factor for DNA damage recognition proteins upon genotoxic injury

  7. Haploinsufficiency of the STX1B gene is associated with myoclonic astatic epilepsy.

    Vlaskamp, Danique R M; Rump, Patrick; Callenbach, Petra M C; Vos, Yvonne J; Sikkema-Raddatz, Birgit; van Ravenswaaij-Arts, Conny M A; Brouwer, Oebele F

    2016-05-01

    We describe an 18-year-old male patient with myoclonic astatic epilepsy (MAE), moderate to severe intellectual disability, behavioural problems, several dysmorphisms and a 1.2-Mb de novo deletion on chromosome 16p11.2. This deletion results in haploinsufficiency of STX1B and other genes. Recently, variants in the STX1B gene have been associated with a wide spectrum of fever-related epilepsies ranging from single febrile seizures to severe epileptic encephalopathies. Two previously reported patients with a STX1B missense variant or deletion were diagnosed with MAE. Our observation of a STX1B deletion in a third patient with MAE therefore supports that STX1B gene variants or deletions can be involved in the aetiology of MAE. Furthermore, STX1B encodes for syntaxin-1B, of which interaction with the protein encoded by the STXBP1 gene is essential for the regulation of the synaptic transmission of neurotransmitters. STXBP1 gene variants have been identified in patients with many different types of epilepsy, including Dravet syndrome and epileptic encephalopathies, suggesting STX1B plays a similar role. We recommend that analysis of STX1B should be considered in the diagnostic work-up of individuals with MAE. PMID:26818399

  8. Compressibility and structural stability of CeN from experiment and theory. The B1-B2 transition

    Olsen, J. Staun [Niels Bohr Institute, Oersted Laboratory, University of Copenhagen, Copenhagen (Denmark); Jorgensen, J.-E. [Department of Chemistry, Aarhus University, Aarhus (Denmark); Gerward, L., E-mail: gerward@fysik.dtu.dk [Department of Physics, Technical University of Denmark, Lyngby (Denmark); Vaitheeswaran, G. [Advanced Centre of Research in High Energy Materials, University of Hyderabad, Prof. C.R. Rao Road, Gachbowli, Hyderabad 500 046, Andhra Pradesh (India); Kanchana, V. [Department of Physics, Indian Institute of Technology Hyderabad, Ordnance Factory Estate, Yeddumailaram 502 205, Andhra Pradesh (India); Svane, A. [Department of Physics and Astronomy, Aarhus University, Aarhus (Denmark)

    2012-08-25

    Highlights: Black-Right-Pointing-Pointer First experimental determination of bulk modulus of CeN. Black-Right-Pointing-Pointer First observation of B1-B2 transformation in CeN. Black-Right-Pointing-Pointer Density functional calculations in remarkably good agreement with experiment. Black-Right-Pointing-Pointer Calculations extended to B2 phase, including B1-B2 transition. - Abstract: The high-pressure structural stability of CeN is investigated by experiment and theory. Experiments are carried out by energy-dispersive X-ray diffraction and synchrotron radiation, using a diamond anvil cell, to a maximum pressure of 77 GPa. The experimental results are in remarkably good agreement with ab initio calculations using the full-potential linear muffin-tin orbital method within the generalized gradient approximation (GGA). The experimental zero pressure bulk modulus is B{sub 0} = 156(3) GPa, the pressure derivative being constrained to B{sub 0} Prime = 4.00. The corresponding calculated data are B{sub 0} = 158.1 GPa and B{sub 0} Prime = 3.3. We report here the first experimental observation of the transformation of CeN from the ambient B1 type crystal structure to the B2 type. The onset of the transition is in the range 65-70 GPa, and the relative volume change at the transition is {Delta}V/V = -10.9(3)%. These data compare well with the calculated transition pressure P{sub tr} = 68 GPa and {Delta}V/V = -10.8%. Experimentally, the transition is found to be rather sluggish.

  9. 78 FR 5210 - Open Government Initiative: Implementation of the iCERT Labor Certification Registry for the H-1B...

    2013-01-24

    ... Certification Registry for the H-1B, H-1B1, E-3, H-2A, H-2B and Permanent Labor Certification Employment-Based... to the general public appropriately redacted copies of H-1B, H-1B1, E-3, H-2A, H-2B and permanent... a labor certification or, in the case of an H-1B, H-1B1, or E-3 visa, a labor condition...

  10. Characteristics of stably expressed human dopamine D1a and D1b receptors: atypical behavior of the dopamine D1b receptor

    Pedersen, U B; Norby, B; Jensen, Anders A.; Schiødt, M; Hansen, A; Suhr-Jessen, P; Scheideler, M; Thastrup, O; Andersen, P H

    1994-01-01

    Human dopamine D1a and D1b receptors were stably expressed in Baby Hamster Kidney (BHK) or Chinese Hamster Ovary (CHO) cells. [3H]SCH23390 saturation experiments indicated the presence of only a single binding site in the D1a expressing cell line with a Kd of 0.5 nM. In D1b expressing cell lines...... receptors. Besides SCH 23390, only NNC 112, fluphenazine and bulbocapnine were able to discriminate between the two states of the D1b receptor. In case of the D1a receptor, the Ki values obtained in binding experiments were very similar to Ki values obtained from inhibition of dopamine stimulated adenylyl...... cyclase. In the D1b expressing cell line, the Ki values obtained from inhibition of the dopamine stimulated adenylyl cyclase indicated a significantly better correlation with the state of the D1b receptor showing high affinity for antagonists. In agreement with observations from binding experiments...

  11. Bridged bis-BODIPYs: their synthesis, structures and properties.

    Kesavan, Praseetha E; Das, Sudipta; Lone, Mohsin Y; Jha, Prakash C; Mori, Shigeki; Gupta, Iti

    2015-10-21

    A series of bis-BODIPYs 1-6 bridged via thiophene, furan, N-alkylcarbazole, triphenyl-amine, para- and meta-phenylene groups have been synthesized and characterized by various spectroscopic techniques. The change in the spectroscopic properties of bis-BODIPYs upon varying the size of spacers was studied. X-ray crystal structures of three bis-BODIPYs containing triphenylamine, para- and meta-phenylene bridges were solved. Intermolecular C(H)π and ππ stacking interactions were observed in solid state structures of three bis-BODIPYs. The dihedral angles between the spacer unit and two boron-dipyrrin units were lower in all three compounds as compared to their corresponding monomers. This suggests increased interactions between the two boron-dipyrrin units in molecules which are in turn reflected in the anodic shifts in their reduction potentials. DFT studies indicated effective electronic interactions between spacers and two boron dipyrrin units in all the bis-BODIPYs. The calculated HOMO-LUMO gap was found to be lower for bis-BODIPY having bulky carbazole spacers and higher for bis-BODIPY having smaller furan spacers. Changing the spacer size clearly affected the spectroscopic properties of the bis-BODIPYs and red shifted absorption and emission maxima were observed for bis-BODIPYs with furan and thiophene spacers as compared to bis-BODIPYs with phenylene or bulky aromatic spacers. PMID:26373792

  12. SYNTHETIC APPROACHES FOR BIS (INDOLYL METHANES

    Partha Pratim Kaishap* and Chandrajit Dohutia

    2013-04-01

    Full Text Available ABSTRACT: Indole ring system is the most important heterocycle available in natural compounds. Owing to great structural diversity, the indole ring system has become an important structural requirement in many pharmaceutical agents. Indole has been widely identified as a privileged structure or pharmacophore, with its presence in over 3000 natural isolates which are known to possess broad spectrum of biological activities and pharmaceutical applications. The bis (indolyl methane derivatives are found to be very active compounds in pharmacy field. They are found in cruciferous plants and are known to promote beneficial oestrogen metabolism and induce apoptosis in human cancer cells. In recent years, a lots of bis (indolyl methane derivatives have been synthesized and found to possess promising biological activities including anticancer, antimicrobial, antifungal, analgesic, anti-inflammatory, anthelmintic, cardiovascular activities. In the present review several synthetic schemes of these compounds are discussed involving non-toxic catalyst and providing high yields.

  13. Bis-iridoid glucosides from Abelia chinensis.

    Tomassini, L; Foddai, S; Serafini, M; Cometa, M F

    2000-07-01

    Seven bis-iridoid glucosides have been isolated from Abelia chinensis and were characterized by having a secoiridoid residue as unit A esterifying a C(10)-iridoid or a delta-lactone iridoid as unit B. Among these, compounds 1-3 are new and correspond to 7-O-acetyllaciniatoside IV, 7-O-acetyllaciniatoside V, and 7-O-acetylabelioside B, respectively. The structures of 1-3 were elucidated by spectral methods. PMID:10924185

  14. [N,N-Bis(diphenylphosphinoisopropylamine]dibromidonickel(II

    2009-03-01

    Full Text Available The title compound, [NiBr2(C27H27NP2], was synthesized by the reaction of NiBr2(dme (dme is 1,2-dimethoxyethane with N,N-bis(diphenylphosphinoisopropylamine in methanol/tetrahydrofuran. The nickel(II center is coordinated by two P atoms of the chelating PNP ligand, Ph2PN(iPrPPh2, and two bromide ions in a distorted square-planar geometry.

  15. 76 FR 56637 - Airworthiness Directives; Lycoming Engines Model IO-720-A1B Reciprocating Engines

    2011-09-14

    ... Policies and Procedures (44 FR 11034, February 26, 1979), (3) Will not affect intrastate aviation in Alaska... Model IO-720-A1B Reciprocating Engines AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Final... model IO-720-A1B Lycoming Engines reciprocating engines. This AD requires a crankshaft inspection...

  16. Structural basis for inhibition of the protein tyrosine phosphatase 1B by phosphotyrosine peptide mimetics

    Groves, M R; Yao, Z J; Roller, P P; Burke, T R; Barford, D

    1998-01-01

    Protein tyrosine phosphatases regulate diverse cellular processes and represent important targets for therapeutic intervention in a number of diseases. The crystal structures of protein tyrosine phosphatase 1B (PTP1B) in complex with small molecule inhibitors based upon two classes of phosphotyrosin

  17. Selective binding modes and allosteric inhibitory effects of lupane triterpenes on protein tyrosine phosphatase 1B.

    Jin, Tiantian; Yu, Haibo; Huang, Xu-Feng

    2016-01-01

    Protein Tyrosine Phosphatase 1B (PTP1B) has been recognized as a promising therapeutic target for treating obesity, diabetes, and certain cancers for over a decade. Previous drug design has focused on inhibitors targeting the active site of PTP1B. However, this has not been successful because the active site is positively charged and conserved among the protein tyrosine phosphatases. Therefore, it is important to develop PTP1B inhibitors with alternative inhibitory strategies. Using computational studies including molecular docking, molecular dynamics simulations, and binding free energy calculations, we found that lupane triterpenes selectively inhibited PTP1B by targeting its more hydrophobic and less conserved allosteric site. These findings were verified using two enzymatic assays. Furthermore, the cell culture studies showed that lupeol and betulinic acid inhibited the PTP1B activity stimulated by TNFα in neurons. Our study indicates that lupane triterpenes are selective PTP1B allosteric inhibitors with significant potential for treating those diseases with elevated PTP1B activity. PMID:26865097

  18. Molecular dynamics simulations of interaction between protein-tyrosine phosphatase 1B and a bidentate inhibitor

    Gui-xia LIU; Jin-zhi TAN; Chun-ying NIU; Jian-hua SHEN; Xiao-min LUO; Xu SHEN; Kai-xian CHEN; Hua-liang JIANG

    2006-01-01

    Aim: To investigate the dynamic properties of protein-tyrosine phosphatase (PTP)1B and reveal the structural factors responsible for the high inhibitory potency and selectivity of the inhibitor SNA for PTP1B. Methods: We performed molecular dynamics (MD) simulations using a long time-scale for both PTP1B and PTP1B complexed with the inhibitor SNA, the most potent and selective PTP1B inhibitor reported to date. The trajectories were analyzed by using principal component analysis. Results: Trajectory analyses showed that upon binding the ligand, the flexibility of the entire PTP1B molecule decreases. The most notable change is the movement of the WPD-loop. Our simulation results also indicated that electrostatic interactions contribute more to PTP1B-SNA complex conformation than the van der Waals interactions, and that Lys41, Arg47, and Asp48 play important roles in determining the conformation of the inhibitor SNA and in the potency and selectivity of the inhibitor. Of these, Arg47 contributed most. These results were in agreement with previous experimental results. Conclusion: The information presented here suggests that potent and selective PTP1B inhibitors can be designed by targeting the surface residues, for example the region containing Lys41,Arg47, and Asp48, instead of the second phosphate binding site (besides the active phosphate binding site).

  19. PTP1B inhibition suggests a therapeutic strategy for Rett syndrome.

    Krishnan, Navasona; Krishnan, Keerthi; Connors, Christopher R; Choy, Meng S; Page, Rebecca; Peti, Wolfgang; Van Aelst, Linda; Shea, Stephen D; Tonks, Nicholas K

    2015-08-01

    The X-linked neurological disorder Rett syndrome (RTT) presents with autistic features and is caused primarily by mutations in a transcriptional regulator, methyl CpG-binding protein 2 (MECP2). Current treatment options for RTT are limited to alleviating some neurological symptoms; hence, more effective therapeutic strategies are needed. We identified the protein tyrosine phosphatase PTP1B as a therapeutic candidate for treatment of RTT. We demonstrated that the PTPN1 gene, which encodes PTP1B, was a target of MECP2 and that disruption of MECP2 function was associated with increased levels of PTP1B in RTT models. Pharmacological inhibition of PTP1B ameliorated the effects of MECP2 disruption in mouse models of RTT, including improved survival in young male (Mecp2-/y) mice and improved behavior in female heterozygous (Mecp2-/+) mice. We demonstrated that PTP1B was a negative regulator of tyrosine phosphorylation of the tyrosine kinase TRKB, the receptor for brain-derived neurotrophic factor (BDNF). Therefore, the elevated PTP1B that accompanies disruption of MECP2 function in RTT represents a barrier to BDNF signaling. Inhibition of PTP1B led to increased tyrosine phosphorylation of TRKB in the brain, which would augment BDNF signaling. This study presents PTP1B as a mechanism-based therapeutic target for RTT, validating a unique strategy for treating the disease by modifying signal transduction pathways with small-molecule drugs. PMID:26214522

  20. Temporal lobe epilepsy and GEFS+ phenotypes associated with SCN1B mutations.

    Scheffer, Ingrid E; Harkin, Louise A; Grinton, Bronwyn E; Dibbens, Leanne M; Turner, Samantha J; Zielinski, Marta A; Xu, Ruwei; Jackson, Graeme; Adams, Judith; Connellan, Mary; Petrou, Steven; Wellard, R Mark; Briellmann, Regula S; Wallace, Robyn H; Mulley, John C; Berkovic, Samuel F

    2007-01-01

    SCN1B, the gene encoding the sodium channel beta 1 subunit, was the first gene identified for generalized epilepsy with febrile seizures plus (GEFS+). Only three families have been published with SCN1B mutations. Here, we present four new families with SCN1B mutations and characterize the associated phenotypes. Analysis of SCN1B was performed on 402 individuals with various epilepsy syndromes. Four probands with missense mutations were identified. Detailed electroclinical phenotyping was performed on all available affected family members including quantitative MR imaging in those with temporal lobe epilepsy (TLE). Two new families with the original C121W SCN1B mutation were identified; novel mutations R85C and R85H were each found in one family. The following phenotypes occurred in the six families with SCN1B missense mutations: 22 febrile seizures, 20 febrile seizures plus, five TLE, three other GEFS+ phenotypes, two unclassified and ten unaffected individuals. All individuals with confirmed TLE had the C121W mutation; two underwent temporal lobectomy (one with hippocampal sclerosis and one without) and both are seizure free. We confirm the role of SCN1B in GEFS+ and show that the GEFS+ spectrum may include TLE alone. TLE with an SCN1B mutation is not a contraindication to epilepsy surgery. PMID:17020904

  1. Extending the Impact of RAC1b Overexpression to Follicular Thyroid Carcinomas

    Márcia Faria

    2016-01-01

    Full Text Available RAC1b is a hyperactive variant of the small GTPase RAC1 known to be a relevant molecular player in different cancers. Previous studies from our group lead to the evidence that its overexpression in papillary thyroid carcinoma (PTC is associated with an unfavorable prognosis. In the present study, we intended to extend the analysis of RAC1b expression to thyroid follicular neoplasms and to seek for clinical correlations. RAC1b expression levels were determined by RT-qPCR in thyroid follicular tumor samples comprising 23 follicular thyroid carcinomas (FTCs and 33 follicular thyroid adenomas (FTAs. RAC1b was found to be overexpressed in 33% of carcinomas while no RAC1b overexpression was documented among follicular adenomas. Patients with a diagnosis of FTC were divided into two groups based on longitudinal evolution and final outcome. RAC1b overexpression was significantly associated with both the presence of distant metastases (P = 0.01 and poorer clinical outcome (P = 0.01 suggesting that, similarly to that previously found in PTCs, RAC1b overexpression in FTCs is also associated with worse outcomes. Furthermore, the absence of RAC1b overexpression in follicular adenomas hints its potential as a molecular marker likely to contribute, in conjunction with other putative markers, to the preoperative differential diagnosis of thyroid follicular lesions.

  2. Extending the Impact of RAC1b Overexpression to Follicular Thyroid Carcinomas

    Faria, Márcia; Capinha, Liliana; Simões-Pereira, Joana; Bugalho, Maria João; Silva, Ana Luísa

    2016-01-01

    RAC1b is a hyperactive variant of the small GTPase RAC1 known to be a relevant molecular player in different cancers. Previous studies from our group lead to the evidence that its overexpression in papillary thyroid carcinoma (PTC) is associated with an unfavorable prognosis. In the present study, we intended to extend the analysis of RAC1b expression to thyroid follicular neoplasms and to seek for clinical correlations. RAC1b expression levels were determined by RT-qPCR in thyroid follicular tumor samples comprising 23 follicular thyroid carcinomas (FTCs) and 33 follicular thyroid adenomas (FTAs). RAC1b was found to be overexpressed in 33% of carcinomas while no RAC1b overexpression was documented among follicular adenomas. Patients with a diagnosis of FTC were divided into two groups based on longitudinal evolution and final outcome. RAC1b overexpression was significantly associated with both the presence of distant metastases (P = 0.01) and poorer clinical outcome (P = 0.01) suggesting that, similarly to that previously found in PTCs, RAC1b overexpression in FTCs is also associated with worse outcomes. Furthermore, the absence of RAC1b overexpression in follicular adenomas hints its potential as a molecular marker likely to contribute, in conjunction with other putative markers, to the preoperative differential diagnosis of thyroid follicular lesions. PMID:27127508

  3. Ab-Initio Molecular Dynamics

    Kühne, Thomas D

    2012-01-01

    Computer simulations and molecular dynamics in particular, is a very powerful method to provide detailed and essentially exact informations of classical many-body problems. With the advent of \\textit{ab-initio} molecular dynamics, where the forces are computed on-the-fly by accurate electronic structure calculations, the scope of either method has been greatly extended. This new approach, which unifies Newton's and Schr\\"odinger's equations, allows for complex simulations without relying on any adjustable parameter. This review is intended to outline the basic principles as well as a survey of the field. Beginning with the derivation of Born-Oppenheimer molecular dynamics, the Car-Parrinello method as well as novel hybrid scheme that unifies best of either approach are discussed. The predictive power is demonstrated by a series of applications ranging from insulators to semiconductors and even metals in condensed phases.

  4. Molecular characterization of a gilthead sea bream (Sparus aurata) muscle tissue cDNA for carnitine palmitoyltransferase 1B (CPT1B).

    Boukouvala, Evridiki; Leaver, Michael J; Favre-Krey, Laurence; Theodoridou, Maria; Krey, Grigorios

    2010-10-01

    Understanding the control of piscine fatty acid metabolism is important for determining the nutritional requirements of fish, and hence for the production of optimal aquaculture diets. The regulation and expression of carnitine palmitoyltransferase 1 (CPT1; EC No 2.3.1.21) are critical processes in the control of fatty acid metabolism, and here we report a cDNA from gilthead sea bream (Sparus aurata) which encodes a protein with high identity to vertebrate CPT1. This sea bream CPT1 mRNA is predominantly expressed in skeletal and cardiac muscle, with little expression in other tissues. Phylogenetic analysis of other vertebrate CPT1 sequences show that fish genomes contain a single gene related to mammalian CPT1B, and a further two multi-gene families related to mammalian CPT1A. Genes related to mammalian CPT1C are absent in fish. Therefore, based on both functional and evolutionary orthology to mammalian CPT1B, the sea bream CPT1 reported here is a CPT1B isoform. Sea bream CPT1B mRNA expression progressively decreases in heart and muscle up to 12h after last feeding, but returns to initial, non-fasted levels after 72h. In contrast, in liver non-fasted expression is low, but strongly increases at 24 and 72h after last feeding. In white muscle and liver, CPT1B mRNA expression is highly correlated with the expression of peroxisomal proliferator-activated receptor beta (PPARbeta). Thus fatty acid metabolism by CPT1B and its control by PPARs are similar in fish and mammals, but multiple genes for CPT1A-like proteins in fish also suggest different and more complex pathways of lipid utilisation than in mammals. PMID:20601065

  5. Cytochrome 450 1B1 (CYP1B1 polymorphisms associated with response to docetaxel in Castration-Resistant Prostate Cancer (CRPC patients

    Price Douglas K

    2010-09-01

    Full Text Available Abstract Background The selection of patients according to key genetic characteristics may help to tailor chemotherapy and optimize the treatment in Castration-Resistant Prostate Cancer (CRPC patients. Functional polymorphisms within the cytochrome P450 1B1 (CYP1B1 gene have been associated with alterations in enzymatic expression and activity and may change sensitivity to the widely used docetaxel regimen. Methods CYP1B1 genotyping was performed on blood samples of 60 CRPC patients treated with docetaxel, using TaqMan probes-based assays. Association between CYP1B1-142C>G (leading to the 48ArgGly transition, 4326C>G (432LeuVal, and 4390A>G (453AsnSer polymorphisms and treatment response, progression-free-survival (PFS and overall-survival (OS was estimated using Pearson χ2 test, Kaplan-Meier curves and Log-rank test. Results Patients carrying the CYP1B1-432ValVal genotype experienced a significantly lower response-rate (P = 0.014, shorter progression-free-survival (P = 0.032 and overall-survival (P Conclusions CYP1B1-4326C>G (432LeuVal polymorphism emerged as possible predictive marker of response and clinical outcome to docetaxel in CRPC patients and may represent a potential new tool for treatment optimization. Larger prospective trials are warranted to validate these findings, which might be applied to the future practice of CRPC treatment.

  6. Maternal BIS Sensitivity, Overprotective Parenting, and Children's Internalizing Behaviors.

    Kiel, Elizabeth J; Maack, Danielle J

    2012-08-01

    Although sensitivity to the Behavioral Inhibition System within Gray's (1970) reinforcement sensitivity theory relates to individuals' own depressive and anxious symptomatology, less is known about how parental BIS sensitivity relates to early indicators of internalizing problems in young children. Moreover, the extent to which this parental characteristic relates to parenting behavior, and children's internalizing problems above and beyond parenting, remains unknown. The current study assessed maternal BIS sensitivity, overprotective parenting, and toddlers' internalizing behaviors in a sample of 91 mothers while controlling for mothers' own internalizing symptomatology. Heightened BIS sensitivity related to both overprotective parenting and internalizing behaviors. Overprotective parenting partially mediated the relation between BIS sensitivity and children's internalizing behaviors, although BIS sensitivity maintained a marginal relation to internalizing behaviors. Maternal BIS sensitivity and toddler internalizing behaviors may represent a shared disposition towards inhibition that is somewhat accounted for by overprotective parenting. PMID:22904590

  7. Vibrational spectra, normal coordinate analysis, and conformation of bis(ɑ-cyanoacetylacetonato)Cu(II)

    Gandomi, Farzad; Vakili, Mohammad; Tayyari, Sayyed Faramarz

    2016-08-01

    Ab initio calculations, Natural Bond Orbital (NBO) and Atoms-in-Molecules (AIM) analyses, and Fourier transform Raman (3200-350 cm-1) and infrared (4000-200 cm-1) spectral measurements have been made for bis(α-cyanoacetylacetonato)Cu(II), Cu(CNacac)2. The molecular structure and vibrational spectra of Cu(CNacac)2 is compared with those of bis(acetylacetonato)Cu(II), Cu(acac)2. The molecular electronic energies and the equilibrium geometries for all theoretically possible conformations are calculated. A normal coordinate analysis of the vibrational modes has been computed for the most stable conformation of Cu(CNacac)2, D2h symmetry. A complete assignment of the observed band frequencies has been proposed. The metal-O bond strength was investigated by geometry calculations, NBO, AIM, and spectroscopic results to realize the effect of cyano substitution at α-position. All theoretical and vibrational spectroscopic studies confirm stronger metal-ligand bond in Cu(CNacac)2 than that in Cu(acac)2.

  8. A P387L variant in protein tyrosine phosphatase-1B (PTP-1B) is associated with type 2 diabetes and impaired serine phosphorylation of PTP-1B in vitro

    Echwald, Søren M; Riis, Helle Bach; Vestergaard, Henrik; Richelsen, Bjørn; Kristensen, Kurt; Drivsholm, Thomas; Borch-Johnsen, Knut; Hansen, Torben; Pedersen, Oluf

    2002-01-01

    frequency 0.5%, CI 0.1-1.1), showing a significant association to type 2 diabetes (P = 0.036). In vitro, p34 cell division cycle (p34(cdc2)) kinase-directed incorporation of [gamma-(32)P]ATP was reduced in a mutant peptide compared with native peptide (387P: 100% vs. 387L: 28.4 +/- 5.8%; P = 0.0012). In...... summary, a rare P387L variant of the PTP-1B gene is associated with a 3.7 (CI 1.26-10.93, P = 0.02) genotype relative risk of type 2 diabetes in the examined population of Danish Caucasian subjects and results in impaired in vitro serine phosphorylation of the PTP-1B peptide....

  9. 77 FR 3284 - Comment Request for Information Collection for the H-1B Technical Skills Training (H-1B) and the...

    2012-01-23

    ... programs and their partnerships with business-related nonprofit organizations, education and training... outcome measures will be used to measure success in the H-1B grants: Entered employment rate, employment... vocational training program. In addition to the three outcome measures, grantees will report on a number...

  10. Sulfone-stabilized carbanions for the reversible covalent capture of a posttranslationally-generated cysteine oxoform found in protein tyrosine phosphatase 1B (PTP1B).

    Parsons, Zachary D; Ruddraraju, Kasi Viswanatharaju; Santo, Nicholas; Gates, Kent S

    2016-06-15

    Redox regulation of protein tyrosine phosphatase 1B (PTP1B) involves oxidative conversion of the active site cysteine thiolate into an electrophilic sulfenyl amide residue. Reduction of the sulfenyl amide by biological thiols regenerates the native cysteine residue. Here we explored fundamental chemical reactions that may enable covalent capture of the sulfenyl amide residue in oxidized PTP1B. Various sulfone-containing carbon acids were found to react readily with a model peptide sulfenyl amide via attack of the sulfonyl carbanion on the electrophilic sulfur center in the sulfenyl amide. Both the products and the rates of these reactions were characterized. The results suggest that capture of a peptide sulfenyl amide residue by sulfone-stabilized carbanions can slow, but not completely prevent, thiol-mediated generation of the corresponding cysteine-containing peptide. Sulfone-containing carbon acids may be useful components in the construction of agents that knock down PTP1B activity in cells via transient covalent capture of the sulfenyl amide oxoform generated during insulin signaling processes. PMID:27132865

  11. The Role of PTP1B O-GlcNAcylation in Hepatic Insulin Resistance

    Yun Zhao

    2015-09-01

    Full Text Available Protein tyrosine phosphatase 1B (PTP1B, which can directly dephosphorylate both the insulin receptor and insulin receptor substrate 1 (IRS-1, thereby terminating insulin signaling, reportedly plays an important role in insulin resistance. Accumulating evidence has demonstrated that O-GlcNAc modification regulates functions of several important components of insulin signal pathway. In this study, we identified that PTP1B is modified by O-GlcNAcylation at three O-GlcNAc sites (Ser104, Ser201, and Ser386. Palmitate acid (PA impaired the insulin signaling, indicated by decreased phosphorylation of both serine/threonine-protein kinase B (Akt and glycogen synthase kinase 3 beta (GSK3β following insulin administration, and upregulated PTP1B O-GlcNAcylation in HepG2 cells. Compared with the wild-type, intervention PTP1B O-GlcNAcylation by site-directed gene mutation inhibited PTP1B phosphatase activity, resulted in a higher level of phosphorylated Akt and GSK3β, recovered insulin sensitivity, and improved lipid deposition in HepG2 cells. Taken together, our research showed that O-GlcNAcylation of PTP1B can influence insulin signal transduction by modulating its own phosphatase activity, which participates in the process of hepatic insulin resistance.

  12. Rrp1b, a new candidate susceptibility gene for breast cancer progression and metastasis.

    Nigel P S Crawford

    2007-11-01

    Full Text Available A novel candidate metastasis modifier, ribosomal RNA processing 1 homolog B (Rrp1b, was identified through two independent approaches. First, yeast two-hybrid, immunoprecipitation, and functional assays demonstrated a physical and functional interaction between Rrp1b and the previous identified metastasis modifier Sipa1. In parallel, using mouse and human metastasis gene expression data it was observed that extracellular matrix (ECM genes are common components of metastasis predictive signatures, suggesting that ECM genes are either important markers or causal factors in metastasis. To investigate the relationship between ECM genes and poor prognosis in breast cancer, expression quantitative trait locus analysis of polyoma middle-T transgene-induced mammary tumor was performed. ECM gene expression was found to be consistently associated with Rrp1b expression. In vitro expression of Rrp1b significantly altered ECM gene expression, tumor growth, and dissemination in metastasis assays. Furthermore, a gene signature induced by ectopic expression of Rrp1b in tumor cells predicted survival in a human breast cancer gene expression dataset. Finally, constitutional polymorphism within RRP1B was found to be significantly associated with tumor progression in two independent breast cancer cohorts. These data suggest that RRP1B may be a novel susceptibility gene for breast cancer progression and metastasis.

  13. DJ-1 can inhibit microtubule associated protein 1 B formed aggregates

    Ding Jianqing

    2011-06-01

    Full Text Available Abstract Background Abnormal accumulation and aggregation of microtubule associated proteins (MAPs plays an important role in the pathogenesis of neurodegenerative diseases. Loss-of-function mutation of DJ-1/Park7 can cause early onset of PD. DJ-1, a molecular chaperone, can inhibit α-synuclein aggregation. Currently, little is known whether or not loss of function of DJ-1 contributes to abnormal MAPs aggregation in neurodegenerative disorders such as PD. Results We presented evidence that DJ-1 could bind to microtubule associated protein1b Light Chain (MAP1b-LC. Overexpression of DJ-1 prevented MAP1b-LC aggregation in HEK293t and SH-SY5Y cells while DJ-1 knocking down (KD enhanced MAP1b-LC aggregation in SH-SY5Y cells. The increase in insoluble MAP1b-LC was also observed in the DJ-1 null mice brain. Moreover, in the DJ-1 KD SH-SY5Y cells, overexpression of MAP1B-LC led to endoplasmic reticulum (ER stress-induced apoptosis. Conclusion Our results suggest that DJ-1 acts as a molecular chaperone to inhibit MAP1B aggregation thus leading to neuronal apoptosis. Our study provides a novel insight into the mechanisms that underly the pathogenesis of Parkinson's disease (PD.

  14. Protein Tyrosine Phosphatase-1B Negatively Impacts Host Defense against Pseudomonas aeruginosa Infection.

    Yue, Lei; Xie, Zhongping; Li, Hua; Pang, Zheng; Junkins, Robert D; Tremblay, Michel L; Chen, Xiaochun; Lin, Tong-Jun

    2016-05-01

    Pseudomonas aeruginosa is a major opportunistic pathogen in immune-compromised individuals. Mechanisms governing immune responses to P. aeruginosa infection remain incompletely defined. Herein, we demonstrate that protein tyrosine phosphatase-1B (PTP1B) is a critical negative regulator in P. aeruginosa infection. PTP1B-deficient mice display greatly enhanced bacterial clearance and reduced disease scores, which are accompanied by increased neutrophil infiltration and cytokine production. Interestingly, PTP1B deficiency mainly up-regulates the production of interferon-stimulated response elements-regulated cytokines and chemokines, including chemokine ligand 5 (regulated on activation normal T cell expressed and secreted), CXCL10 (interferon γ-inducible protein 10), and interferon-β production. Further studies reveal that PTP1B deficiency leads to increased interferon regulatory factor 7 (IRF7) expression and activation. These findings demonstrate a novel regulatory mechanism of the immune response to P. aeruginosa infection through PTP1B-IRF7 interaction. This novel PTP1B-IRF7-interferon-stimulated response elements pathway may have broader implications in Toll-like receptor-mediated innate immunity. PMID:27105736

  15. The arginine vasopressin V1b receptor gene and prosociality: Mediation role of emotional empathy.

    Wu, Nan; Shang, Siyuan; Su, Yanjie

    2015-09-01

    The vasopressin V1b receptor (AVPR1B) gene has been shown to be closely associated with bipolar disorder and depression. However, whether it relates to positive social outcomes, such as empathy and prosocial behavior, remains unknown. This study explored the possible role of the AVPR1B gene rs28373064 in empathy and prosociality. A total of 256 men, who were genetically unrelated, non-clinical ethnic Han Chinese college students, participated in the study. Prosociality was tested by measuring the prosocial tendencies of cognitive and emotional empathy using the Interpersonal Reactivity Index (IRI). The single nucleotide polymorphism (SNP), rs28373064, was genotyped using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. The results suggest that the AVPR1B gene rs28373064 is linked to emotional empathy and prosociality. The mediation analysis indicated that the effect of the AVPR1B gene on prosociality might be mediated by emotional empathy. This study demonstrated the link between the AVPR1B gene and prosociality and provided evidence that emotional empathy might mediate the relation between the AVPR1B gene and prosociality. PMID:26354157

  16. Coumarins from Angelica decursiva inhibit α-glucosidase activity and protein tyrosine phosphatase 1B.

    Ali, Md Yousof; Jannat, Susoma; Jung, Hyun Ah; Jeong, Hyong Oh; Chung, Hae Young; Choi, Jae Sue

    2016-05-25

    In the present study, we investigated the anti-diabetic potential of six natural coumarins, 4-hydroxy Pd-C-III (1), 4'-methoxy Pd-C-I (2), decursinol (3), decursidin (4), umbelliferone 6-carboxylic acid (5), and 2'-isopropyl psoralene (6) isolated from Angelica decursiva and evaluated their inhibitory activities against protein tyrosine phosphatase 1B (PTP1B), α-glucosidase, and ONOO(-)-mediated protein tyrosine nitration. Coumarins 1-6 showed potent PTP1B and α-glucosidase inhibitory activities with ranges of IC50 values of 5.39-58.90 μM and 65.29-172.10 μM, respectively. In the kinetic study for PTP1B enzyme inhibition, compounds 1, 5, and 6 were competitive, whereas 2 and 4 showed mixed type, and 3 displayed noncompetitive type inhibition. For α-glucosidase enzyme inhibition, compounds 1 and 3 exhibited good mixed-type, while 2, 5, and 6 showed noncompetitive and 4 displayed competitive type inhibition. Furthermore, these coumarins also effectively suppressed ONOO(-)-mediated tyrosine nitration in a dose-dependent manner. To further investigate PTP1B inhibition, we generated a 3D structure of PTP1B using Autodock 4.2 and simulated the binding of compounds 1-6. Docking simulations showed that different residues of PTP1B interacted with different functional groups of compounds 1-6 through hydrogen and hydrophobic interactions. In addition, the binding energies of compounds 1-6 were negative, suggesting that hydrogen bonding may stabilize the open form of the enzyme and potentiate tight binding of the active site of PTP1B, thereby resulting in more effective PTP1B inhibition. These results demonstrate that the whole plant of A. decursiva and its coumarins are useful as potential functional food ingredients for the prevention and treatment of type 2 diabetes. PMID:27085377

  17. Regulation of brown fat adipogenesis by protein tyrosine phosphatase 1B.

    Kosuke Matsuo

    Full Text Available Protein-tyrosine phosphatase 1B (PTP1B is a physiological regulator of insulin signaling and energy balance, but its role in brown fat adipogenesis requires additional investigation.To precisely determine the role of PTP1B in adipogenesis, we established preadipocyte cell lines from wild type and PTP1B knockout (KO mice. In addition, we reconstituted KO cells with wild type, substrate-trapping (D/A and sumoylation-resistant (K/R PTP1B mutants, then characterized differentiation and signaling in these cells. KO, D/A- and WT-reconstituted cells fully differentiated into mature adipocytes with KO and D/A cells exhibiting a trend for enhanced differentiation. In contrast, K/R cells exhibited marked attenuation in differentiation and lipid accumulation compared with WT cells. Expression of adipogenic markers PPARγ, C/EBPα, C/EBPδ, and PGC1α mirrored the differentiation pattern. In addition, the differentiation deficit in K/R cells could be reversed completely by the PPARγ activator troglitazone. PTP1B deficiency enhanced insulin receptor (IR and insulin receptor substrate 1 (IRS1 tyrosyl phosphorylation, while K/R cells exhibited attenuated insulin-induced IR and IRS1 phosphorylation and glucose uptake compared with WT cells. In addition, substrate-trapping studies revealed that IRS1 is a substrate for PTP1B in brown adipocytes. Moreover, KO, D/A and K/R cells exhibited elevated AMPK and ACC phosphorylation compared with WT cells.These data indicate that PTP1B is a modulator of brown fat adipogenesis and suggest that adipocyte differentiation requires regulated expression of PTP1B.

  18. Synthesis and Structure of Bis-(o-vanillin)di-pyridine Nickel(Ⅱ)-pyridine Dihydrate

    孙命; 王瑾玲; 段月琴; 缪方明; 翁林红; 冷雪冰

    2001-01-01

    The structure of the complex bis-(o-vanillin)di-pyridine nickel(Ⅱ)([ Ni X-ray analysis.The crystal data are as follows: Monoclinic,P21/n,a=12.273(1),b=17.4700.674mm-1,F(000)=1328,final R=0.0428,Rw=0.1228 for 4528 observable reflections with I≥2σ(Ⅰ).The Nickel(Ⅱ)atom in the complex has a slightly distorted octahedral coordination geometr y and is six-coordinated by four O atoms from two O-Vanillin ligands and two N atoms from two pyridines.In the crystal,the Ni(Ⅱ)-complex and water molecules are linked through a network of hydrogen bonds.

  19. Current Perspectives on Interferon Beta-1b for the Treatment of Multiple Sclerosis

    Marziniak, Martin; Meuth, Sven

    2014-01-01

    Interferon (IFN) beta-1b was the first disease-modifying therapy to be approved for the treatment of multiple sclerosis (MS), and over 21 years of follow-up data demonstrate its efficacy and long-term safety profile. Following recent regulatory approvals in the USA and European Union, IFN beta-1b is now one of the seven disease-modifying therapies [intramuscular IFN beta-1a; subcutaneous (SC) IFN beta-1a; IFN beta-1b SC; glatiramer acetate SC; oral dimethyl fumarate; oral teriflunomide; and i...

  20. Telomere Protection by TPP1 Is Mediated by POT1a and POT1b

    Kibe, Tatsuya; Osawa, Gail A.; Keegan, Catherine E.; de Lange, Titia

    2009-01-01

    Mammalian telomeres are protected by the shelterin complex, which contains single-stranded telomeric DNA binding proteins (POT1a and POT1b in rodents, POT1 in other mammals). Mouse POT1a prevents the activation of the ATR kinase and contributes to the repression of the nonhomologous end-joining pathway (NHEJ) at newly replicated telomeres. POT1b represses unscheduled resection of the 5′-ended telomeric DNA strand, resulting in long 3′ overhangs in POT1b KO cells. Both POT1 proteins bind TPP1,...

  1. Fragile X mental retardation protein interactions with the microtubule associated protein 1B RNA

    Menon, Lakshmi; Mader, Samantha Ann; Mihailescu, Mihaela-Rita

    2008-01-01

    Fragile X mental retardation syndrome, the most common form of inherited mental retardation, is caused by the absence of the fragile X mental retardation protein (FMRP). FMRP has been shown to use its arginine–glycine–glycine (RGG) box to bind to a subset of RNA targets that form a G quadruplex structure. We performed a detailed analysis of the interactions between the FMRP RGG box and the microtubule associated protein 1B (MAP1B) mRNA, a relevant in vivo FMRP target. We show that MAP1B RNA f...

  2. GINGA Observations of AB Doradus

    Vilhu, O.; Tsuru, T.; Collier Cameron, A.

    We report GINGA observations of the pre main sequence star AB Doradus (HD 36705), performed during 8 - 12 January, 1990. Some rotational modulation might be present. four X-ray flares were detected. Three of these events were similar to the EINSTEIN HRI-flare (Vilhu and Linsky, 1987), with decay times around 25 min. The last flare had long rise and decay times (100 min), resembling the EXOSAT flares observed by Collier Cameron et.al. (1988). The mean flare spectrum can be fitted by a thermal bremstrahlung with temperature 5.0 keV, or by a power-law model with photon index 2.2. The 3 upper limit of the Iron line equivalent width in the flare spectrum is 1 keV, weaker than predicted by thermal models. This Iron line anomaly was first discussed in the case of UX Ari by Tsuru et. al. (1989). However, normal equivalent widths can be derived from several EXOSAT spectra of active cool stars (Pallavicini and Tagliaferri, 1990). We discuss the possibility that the continuum from non-thermal electrons (producing also the microwave emission) could occasionally lower the apparent equivalent width. The mechanism works for reasonably low magnetic field strengths and electon power-law indexes. However, a large population of non-thermal electrons is needed (comparable to the thermal one). Stronger magnetic fields could explain the radio emission with less electrons, but then the non-thermal X-ray continuum remains small.

  3. Poly[bis[μ-1,4-bis(imidazol-1-ylmethylbenzene]dichloridocadmium(II

    Xinliang Hu

    2008-07-01

    Full Text Available The title compound, [CdCl2(C14H14N42]n, has a slightly distorted octahedral coordination geometry, formed by four N atoms from 1,4-bis(imidazol-1-ylmethylbenzene ligands and two Cl atoms, giving a two-dimensional network. The Cd atom lies on a centre of inversion.

  4. Protein Tyrosine Phosphatase 1B Inhibitors from the Roots of Cudrania tricuspidata

    Tran Hong Quang

    2015-06-01

    Full Text Available A chemical investigation of the methanol extract from the roots of Cudrania tricuspidata resulted in the isolation of 16 compounds, including prenylated xanthones 1–9 and flavonoids 10–16. Their structures were identified by NMR spectroscopy and mass spectrometry and comparisons with published data. Compounds 1–9 and 13–16 significantly inhibited PTP1B activity in a dose dependent manner, with IC50 values ranging from 1.9–13.6 μM. Prenylated xanthones showed stronger PTP1B inhibitory effects than the flavonoids, suggesting that they may be promising targets for the future discovery of novel PTP1B inhibitors. Furthermore, kinetic analyses indicated that compounds 1 and 13 inhibited PTP1B in a noncompetitive manner; therefore, they may be potential lead compounds in the development of anti-obesity and -diabetic agents.

  5. SAGE III Meteor-3M L1B Solar Event Transmission Data (Native) V004

    National Aeronautics and Space Administration — Level 1B pixel group transmission profiles for a single solar event (Suggested Usage: Vertical transmission profiles for input into an inversion algorithm)

  6. SAGE III Meteor-3M L1B Solar Event Transmission Data (Native) V003

    National Aeronautics and Space Administration — Level 1B pixel group transmission profiles for a single solar event (Suggested Usage: Vertical transmission profiles for input into an inversion algorithm)

  7. GLAS/ICESat L1B Global Waveform-based Range Corrections Data V033

    National Aeronautics and Space Administration — The level 1B waveform parameterization data will contain waveform-based range corrections and surface characteristics at the full 40 per second resolution. Data...

  8. Dark Matter and Neutrino Masses from Global $U(1)_{B-L}$ Symmetry Breaking

    Lindner, Manfred; Schwetz, Thomas

    2011-01-01

    We present a scenario were neutrino masses and Dark Matter are related due to a global $U(1)_{B-L}$ symmetry. Specifically we consider neutrino mass generation via the Zee{Babu two-loop mecha- nism, augmented by a scalar singlet whose VEV breaks the global $U(1)_{B-L}$ symmetry. In order to obtain a Dark Matter candidate we introduce two Standard Model singlet fermions. They form a pseudo-Dirac particle and are stable because of a remnant $Z_2$ symmetry. Hence, in this model the stability of Dark Matter follows from the global $U(1)_{B-L}$ symmetry. We discuss the Dark Matter phenomenology of the model, and compare it to similar models based on gauged $U(1)_{B-L}$. We argue that in contrast to the gauged versions, the model based on the global symmetry does not suffer from sever constraints from Z' searches.

  9. Nature of Pi1B pulsations as inferred from ground and satellite observations

    Lessard, M. R.; Lund, E. J.; Jones, S. L.; Arnoldy, R. L.; Posch, J. L.; Engebretson, M. J.; Hayashi, K.

    2006-07-01

    The occurrence of Pi1B pulsations is well-documented, including the fact that these pulsations can be observed both on the ground and at geosynchronous orbit at substorm onset, although information about their propagation characteristics has been lacking. In this paper, data are presented from FAST, GOES 9 and various ground stations that show the simultaneous observations of Pi1B pulsations in association with an onset. While the data at GOES 9 show that the pulsations are compressional in nature, data from FAST show the presence of shear mode waves, implying that Pi1B mode conversion of some type must take place in the region between geosynchronous orbit and FAST altitudes. An additional point is that Pi1B pulsations apparently propagate through auroral phenomena routinely, begging the question of what role they may play.

  10. Trafficking of α1B-adrenergic receptor mediated by inverse agonist in living cells

    MingXU; Ying-huaGUAN; NingXU; Zhang-yiLIANG; Shu-yiWang; YaoSONG; Chi-deHAN; Xin-shengZHAO; You-yiZHANG

    2005-01-01

    AIM The project is aimed at understanding the action of inverse agonist at single molecule level and capturing the real time picture of molecular behavior of α1B-adrenergic receptor (AR) mediated by inverse agonist in living cells by single molecule detection (SMD). METHODS The location and distribution of α1B-AR was detected by laser confocal and whole cell 3H-prazosin binding assay. Dynamic imaging of BODIPY-FL-labeled prazosin (Praz), specific antagonist of (1-AR, was observed in α1B-AR stably expressed human embryonic kidney 293 (HEK293) living cells. The detection of real-time dynamic behaviors of AR was achieved by using fluorescence-labeled AR and its ligand combined with SMD techniques. RESULTS α1B-AR was predominantly distributed on the cell surface and 8.2% of the total receptors were located in cytosol.

  11. Interleukin 1B Variant -1473G/C (rs1143623) Influences Triglyceride and Interleukin 6 Metabolism

    Delgado-Lista, Javier; Garcia-Rios, Antonio; Perez-Martinez, Pablo; Solivera, Juan; Yubero-Serrano, Elena M; Fuentes, Francisco; Parnell, Laurence D.; Jian SHEN; Gomez, Purificacion; Jimenez-Gomez, Yolanda; Gomez-Luna, Maria J.; Marin, Carmen; Belisle, Sarah E; Rodriguez-Cantalejo, Fernando; Meydani, Simin N.

    2011-01-01

    Healthy young male carriers of the minor allele of IL1B -1473G/C have exaggerated lipid and inflammatory postprandial responses, which could help unravel these relationships during the postprandial state.

  12. TES/Aura L1B Spectra Special Observation Low Resolution V004

    National Aeronautics and Space Administration — The L1B Low Resolution granule consists of radiometrically calibrated spectra & associated NESR, observed at 0.1 cm-1 resolution for a Special Observation &...

  13. The new powder diffractometer D1B of the Institut Laue Langevin

    D1B is a medium resolution high flux powder diffractometer located at the Institut Laue Langevin, ILL. D1B a suitable instrument for studying a large variety of polycrystalline materials. D1B runs since 1998 as a CRG (collaborating research group) instrument, being exploited by the CNRS (Centre National de la Recherche Scientifique, France) and CSIC (Consejo Superior de Investigaciones Cientificas, Spain). In 2008 the Spanish CRG started an updating program which included a new detector and a radial oscillating collimator (ROC). The detector, which has a sensitive height of 100mm, covers an angular range of 128°. Its 1280 gold wires provide a neutron detection point every 0.1°. The ROC is made of 198 gadolinium- based absorbing collimation blades, regular placed every 0.67°. Here the present characteristics of D1B are reviewed and the different experimental performances will be presented

  14. MISR Level 1B1 Local Mode Radiance Data V002

    National Aeronautics and Space Administration — This is the Local Mode Level 1B1 Product containing the DNs radiometrically scaled to radiances with no geometric resampling (Suggested Usage: The MISR Instrument...

  15. Detection of the urban heat island in Beijing using HJ-1B satellite imagery

    2010-01-01

    Satellite images are used extensively in studying the urban heat island(UHI) phenomenon.We evaluated the suitability of thermal infrared(TIR) data from the HJ-1B satellite for detecting UHI using a case study in Beijing.Two modified algorithms for retrieving the land surface temperature(LST) from HJ-1B data were tested.The results were compared with LST images derived from a Landsat TM thermal band and the MODIS LST output.The spatial pattern of UHI generated using HJ-1B data matched well with that produced using TM and MODIS data.Of the two algorithms,the mono-window algorithm performed better but further tests are necessary.With more frequent coverage than TM and higher spatial resolution than MODIS,the HJ-1B TIR data present a unique opportunity to study thermal environments in cities in China and neighboring countries.

  16. The new powder diffractometer D1B of the Institut Laue Langevin

    Puente Orench, I.; Clergeau, J. F.; Martínez, S.; Olmos, M.; Fabelo, O.; Campo, J.

    2014-11-01

    D1B is a medium resolution high flux powder diffractometer located at the Institut Laue Langevin, ILL. D1B a suitable instrument for studying a large variety of polycrystalline materials. D1B runs since 1998 as a CRG (collaborating research group) instrument, being exploited by the CNRS (Centre National de la Recherche Scientifique, France) and CSIC (Consejo Superior de Investigaciones Cientificas, Spain). In 2008 the Spanish CRG started an updating program which included a new detector and a radial oscillating collimator (ROC). The detector, which has a sensitive height of 100mm, covers an angular range of 128°. Its 1280 gold wires provide a neutron detection point every 0.1°. The ROC is made of 198 gadolinium- based absorbing collimation blades, regular placed every 0.67°. Here the present characteristics of D1B are reviewed and the different experimental performances will be presented.

  17. Skin Necrosis Following a Recombinant Interferon-beta-1b Injection

    Chih-Hsun Yang

    2002-11-01

    Full Text Available Recombinant interferon beta-1b (INF-β-1b has been proven to be an effective means oftreating relapsing-remitting multiple sclerosis (MS. Adverse reactions to interferon therapyhave been well documented. The most common side effects are transient influenza-likesymptoms, including fever, fatigue, nausea, and myalgia. Cutaneous necrosis has occasionallybeen reported, mostly involving small and limited lesions. This article describes an MSpatient who developed multiple large, deep cutaneous ulcers on INF-β-1b injection sites,which subsequently required surgical treatment. Vessel thrombosis in the subcutaneous fattylayer and the clinical appearance of livedoid erythema beside the ulcers indicated that INF-β-1b may have caused skin necrosis through its vascular effects.

  18. Trisodium scandium bis­(orthoborate)

    Kunpeng Wang; Jinzhi Fang; Guochun Zhang; Xinyuan Zhang; Jiyong Yao

    2012-01-01

    Single crystals of trisodium scandium bis(orthoborate), Na3Sc(BO3)2, have been obtained by spontaneous crystallization from an Na2O–Sc2O3–B2O3 melt. The crystal structure features a three-dimensional framework composed of planar [BO3]3− groups and distorted ScO6 octahedra with Na atoms in the cavities. The Sc atom occupies a special position (Wyckoff position 2b, site symmetry -1) and of the two Na atoms, one occupies a special position (Wyckoff position 2c, site...

  19. Bis-spirolabdane Diterpenoids from Leonotis nepetaefolia

    Li, Jun; Fronczek, Frank R.; Ferreira, Daneel; Burandt, Charles L.; Setola, Vincent; Roth, Bryan L.; Zjawiony, Jordan K.

    2012-01-01

    Ten new bis-spirolabdane diterpenoids, leonepetaefolins A–E (1, 3, 5, 7, 9) and 15-epi-leonepetaefolins A-E (2, 4, 6, 8, 10), together with eight known labdane diterpenoids (11–18) as well as two known flavonoids apigenin and cirsiliol, were isolated from the leaves of Leonotis nepetaefolia. The structures of the new compounds were determined on the basis of 1D-and 2D-NMR experiments including 1H, 13C, DEPT, 1H-1H COSY, HSQC, HMBC, and NOESY. The absolute configuration of an epimeric mixture ...

  20. AP calculus AB & BC crash course

    Rosebush, J

    2012-01-01

    AP Calculus AB & BC Crash Course - Gets You a Higher Advanced Placement Score in Less Time Crash Course is perfect for the time-crunched student, the last-minute studier, or anyone who wants a refresher on the subject. AP Calculus AB & BC Crash Course gives you: Targeted, Focused Review - Study Only What You Need to Know Crash Course is based on an in-depth analysis of the AP Calculus AB & BC course description outline and actual AP test questions. It covers only the information tested on the exams, so you can make the most of your valuable study time. Written by experienced math teachers, our

  1. Experimental studies and ab initio calculations on characteristics of the C state of SF2 radical

    SF2 radicals were generated by a pulsed dc discharge in the mixture gas beam of SF2 and Ar. The (2+1) resonance-enhanced multiphoton ionization (REMPI) excitation spectroscopy of SF2 radical was obtained between 325 and 365 nm. The SF+ ion signals were also observed in the same wavelength range. The analysis shows that the spectrum can be assigned as the two-photon resonant excitation of SF2 radical (B-tilde1 B1 and (C-tilde1 A1 states). And also, ab initio calculations suggest that the C-tilde state is a bonding state with Rydberg characteristic. The potential energy surfaces (PESs) of SF2 and SF2+ by ab initio calculations suggest that SF+ ions originate from dissociation processes of excited SF2+ ions. (author)

  2. Injectable interferon beta-1b for the treatment of relapsing forms of multiple sclerosis

    Slobodan M Jankovic

    2010-03-01

    Full Text Available Slobodan M JankovicPharmacology Department, Medical Faculty, University of Kragujevac, Kragujevac, SerbiaAbstract: Multiple sclerosis (MS is chronic inflammatory and demyelinating disease with either a progressive (10%–15% or relapsing-remitting (85%–90% course. The pathological hallmarks of MS are lesions of both white and grey matter in the central nervous system. The onset of the disease is usually around 30 years of age. The patients experience an acute focal neurologic dysfunction which is not characteristic, followed by partial or complete recovery. Acute episodes of neurologic dysfunction with diverse signs and symptoms will then recur throughout the life of a patient, with periods of partial or complete remission and clinical stability in between. Currently, there are several therapeutic options for MS with disease-modifying properties. Immunomodulatory therapy with interferon beta-1b (IFN-β1b or -1a, glatiramer and natalizumab shows similar efficacy; in a resistant or intolerant patient, the most recently approved therapeutic option is mitoxantrone. IFN-β1b in patients with MS binds to specific receptors on surface of immune cells, changing the expression of several genes and leading to a decrease in quantity of cell-associated adhesion molecules, inhibition of major histocompatibility complex class II expression and reduction in inflammatory cells migration into the central nervous system. After 2 years of treatment, IFN-β1b reduces the risk of development of clinically defined MS from 45% (with placebo to 28% (with IFN-β1b. It also reduces relapses for 34% (1.31 exacerbations annually with placebo and 0.9 with higher dose of IFN-β1b and makes 31% more patients relapse-free. In secondary-progressive disease annual rate of progression is 3% lower with IFN-β1b. In recommended doses IFN-β1b causes the following frequent adverse effects: injection site reactions (redness, discoloration, inflammation, pain, necrosis and non

  3. Association Between 5HT1b Receptor Gene and Methamphetamine Dependence

    Ujike, H; Kishimoto, M; Okahisa, Y; Kodama, M; Takaki, M; Inada, T; Uchimura, N; Yamada, M; Iwata, N; Iyo, M; Sora, I; Ozaki, N

    2011-01-01

    Several lines of evidence implicate serotonergic dysfunction in diverse psychiatric disorders including anxiety, depression, and drug abuse. Mice with a knock-out of the 5HT1b receptor gene (HTR1B) displayed increased locomotor response to cocaine and elevated motivation to self-administer cocaine and alcohol. Previous genetic studies showed significant associations of HTR1B with alcohol dependence and substance abuse, but were followed by inconsistent results. We examined a case-control genetic association study of HTR1B with methamphetamine-dependence patients in a Japanese population. The subjects were 231 patients with methamphetamine dependence, 214 of whom had a co-morbidity of methamphetamine psychosis, and 248 age- and sex-matched healthy controls. The three single nucleotide polymorphisms (SNPs), rs130058 (A-165T), rs1228814 (A-700C) and rs1228814 (A+1180G) of HTR1B were genotyped. There was no significant difference in allelic and genotypic distributions of the SNPs between methamphetamine dependence and the control. Genetic associations of HTR1B were tested with several clinical phenotypes of methamphetamine dependence and/or psychosis, such as age at first abuse, duration of latency from the first abuse to onset of psychosis, prognosis of psychosis after therapy, and complication of spontaneous relapse of psychotic state. There was, however, no asscocation between any SNP and the clinical phenotypes. Haplotype analyses showed the three SNPs examined were within linkage disequilibrium, which implied that the three SNPs covered the whole HTR1B, and distribution of estimated haplotype frequency was not different between the groups. The present findings may indicate that HTR1B does not play a major role in individual susceptibility to methamphetamine dependence or development of methamphetamine-induced psychosis. PMID:21886584

  4. Plant compounds that induce polychlorinated biphenyl biodegradation by Arthrobacter sp. strain B1B.

    Gilbert, E S; Crowley, D. E.

    1997-01-01

    Plant compounds that induced Arthrobacter sp. strain B1B to cometabolize polychlorinated biphenyls (PCBs) were identified by a screening assay based on the formation of a 4,4'-dichlorobiphenyl ring fission product. A chemical component of spearmint (Mentha spicata), l-carvone, induced Arthrobacter sp. strain B1B to cometabolize Aroclor 1242, resulting in significant degradation of 26 peaks in the mixture, including selected tetra- and pentachlorobiphenyls. Evidence for PCB biodegradation incl...

  5. Role of CYP1B1 in PAH-DNA adduct formation and breast cancer risk

    Goth-Goldstein, Regine; Russell, Marion L.; Muller, A.P.; Caleffi, M.; Eschiletti, J.; Graudenz, M.; Sohn, Michael D.

    2010-04-01

    This study investigated the hypothesis that increased exposure to polycyclic aromatic hydrocarbons (PAHs) increases breast cancer risk. PAHs are products of incomplete burning of organic matter and are present in cigarette smoke, ambient air, drinking water, and diet. PAHs require metabolic transformation to bind to DNA, causing DNA adducts, which can lead to mutations and are thought to be an important pre-cancer marker. In breast tissue, PAHs appear to be metabolized to their cancer-causing form primarily by the cytochrome P450 enzyme CYP1B1. Because the genotoxic impact of PAH depends on their metabolism, we hypothesized that high CYP1B1 enzyme levels result in increased formation of PAH-DNA adducts in breast tissue, leading to increased development of breast cancer. We have investigated molecular mechanisms of the relationship between PAH exposure, CYP1B1 expression and breast cancer risk in a clinic-based case-control study. We collected histologically normal breast tissue from 56 women (43 cases and 13 controls) undergoing breast surgery and analyzed these specimens for CYP1B1 genotype, PAH-DNA adducts and CYP1B1 gene expression. We did not detect any difference in aromatic DNA adduct levels of cases and controls, only between smokers and non-smokers. CYP1B1 transcript levels were slightly lower in controls than cases, but the difference was not statistically significant. We found no correlation between the levels of CYP1B1 expression and DNA adducts. If CYP1B1 has any role in breast cancer etiology it might be through its metabolism of estrogen rather than its metabolism of PAHs. However, due to the lack of statistical power these results should be interpreted with caution.

  6. Functional properties of Claramine: a novel PTP1B inhibitor and insulin-mimetic compound.

    Qin, Zhaohong; Pandey, Nihar R; Zhou, Xun; Stewart, Chloe A; Hari, Aswin; Huang, Hua; Stewart, Alexandre F R; Brunel, Jean Michel; Chen, Hsiao-Huei

    2015-02-27

    Protein tyrosine phosphatase 1B (PTP1B) inhibits insulin signaling, interfering with its control of glucose homeostasis and metabolism. PTP1B activity is elevated in obesity and type 2 diabetes and is a major cause of insulin resistance. Trodusquemine (MSI-1436) is a "first-in-class" highly selective inhibitor of PTP1B that can cross the blood-brain barrier to suppress feeding and promote insulin sensitivity and glycemic control. Trodusquemine is a naturally occurring cholestane that can be purified from the liver of the dogfish shark, Squalus acanthias, but it can also be manufactured synthetically by a fairly laborious process that requires several weeks. Here, we tested a novel easily and rapidly (2 days) synthesized polyaminosteroid derivative (Claramine) containing a spermino group similar to Trodusquemine for its ability to inhibit PTP1B. Like Trodusquemine, Claramine displayed selective inhibition of PTP1B but not its closest related phosphatase TC-PTP. In cultured neuronal cells, Claramine and Trodusquemine both activated key components of insulin signaling, with increased phosphorylation of insulin receptor-β (IRβ), Akt and GSK3β. Intraperitoneal administration of Claramine or Trodusquemine effectively restored glycemic control in diabetic mice as determined by glucose and insulin tolerance tests. A single intraperitoneal dose of Claramine, like an equivalent dose of Trodusquemine, suppressed feeding and caused weight loss without increasing energy expenditure. In summary, Claramine is an alternative more easily manufactured compound for the treatment of type II diabetes. PMID:25623533

  7. A Contextual Fire Detection Algorithm for Simulated HJ-1B Imagery

    Xiangsheng Kong

    2009-02-01

    Full Text Available The HJ-1B satellite, which was launched on September 6, 2008, is one of the small ones placed in the constellation for disaster prediction and monitoring. HJ-1B imagery was simulated in this paper, which contains fires of various sizes and temperatures in a wide range of terrestrial biomes and climates, including RED, NIR, MIR and TIR channels. Based on the MODIS version 4 contextual algorithm and the characteristics of HJ-1B sensor, a contextual fire detection algorithm was proposed and tested using simulated HJ-1B data. It was evaluated by the probability of fire detection and false alarm as functions of fire temperature and fire area. Results indicate that when the simulated fire area is larger than 45 m2 and the simulated fire temperature is larger than 800 K, the algorithm has a higher probability of detection. But if the simulated fire area is smaller than 10 m2, only when the simulated fire temperature is larger than 900 K, may the fire be detected. For fire areas about 100 m2, the proposed algorithm has a higher detection probability than that of the MODIS product. Finally, the omission and commission error were evaluated which are important factors to affect the performance of this algorithm. It has been demonstrated that HJ-1B satellite data are much sensitive to smaller and cooler fires than MODIS or AVHRR data and the improved capabilities of HJ-1B data will offer a fine opportunity for the fire detection.

  8. Structural and functional analysis of the mouse mdr1b gene promoter.

    Cohen, D; Piekarz, R L; Hsu, S I; DePinho, R A; Carrasco, N; Horwitz, S B

    1991-02-01

    The overproduction of P-glycoprotein, an integral membrane protein thought to function as a drug efflux pump, is the hallmark of the multidrug resistance phenotype. In murine multidrug resistant J774.2 cell lines, distinct mdr genes, mdr1a and mdr1b, encode unique P-glycoprotein isoforms. To examine the transcriptional regulation of the mdr1b gene, its promoter was isolated and characterized. The transcription initiation site was mapped by primer extension, and the 5'-flanking region was sequenced. Several potential regulatory elements were identified in this region. A transient expression vector was constructed by fusion of 540 base pairs of 5'-flanking sequence and part of the first untranslated exon to the chloramphenicol acetyltransferase (CAT) gene. When transfected into monkey kidney COS-1, rat pituitary GH3 or T47D human breast cells, the mdr1b 5'-flanking sequences were capable of driving CAT expression. Transient transfection studies using deletion subclones of the mdr1b-CAT construct were done to locate potential cis-acting sequences. The studies indicate the presence of cis-acting elements in the 5'-flanking region of the mdr1b gene. The implications of these findings for expression and regulation of the mdr1b gene are discussed. PMID:1671222

  9. Uroplakin 1b is critical in urinary tract development and urothelial differentiation and homeostasis.

    Carpenter, Ashley R; Becknell, M Brian; Ching, Christina B; Cuaresma, Edward J; Chen, Xi; Hains, David S; McHugh, Kirk M

    2016-03-01

    Proper development and maintenance of urothelium is critical to its function. Uroplakins are expressed in developing and mature urothelium where they establish plaques associated with the permeability barrier. Their precise functional role in development and disease is unknown. Here, we disrupted Upk1b in vivo where its loss resulted in urothelial plaque disruption in the bladder and kidney. Upk1b(RFP/RFP) bladder urothelium appeared dysplastic with expansion of the progenitor cell markers, Krt14 and Krt5, increased Shh expression, and loss of terminal differentiation markers Krt20 and uroplakins. Upk1b(RFP/RFP) renal urothelium became stratified with altered cellular composition. Upk1b(RFP/RFP) mice developed age-dependent progressive hydronephrosis. Interestingly, 16% of Upk1b(RFP/RFP) mice possessed unilateral duplex kidneys. Our study expands the role of uroplakins, mechanistically links plaque formation to urinary tract development and function, and provides a tantalizing connection between congenital anomalies of the kidney and urinary tract along with functional deficits observed in a variety of urinary tract diseases. Thus, kidney and bladder urothelium are regionally distinct and remain highly plastic, capable of expansion through tissue-specific progenitor populations. Furthermore, Upk1b plays a previously unknown role in early kidney development representing a novel genetic target for congenital anomalies of the kidney and urinary tract. PMID:26880456

  10. A General Scheme for Formalizing Defaults Using the Predicate ab(I,S)

    SHEN Yidong

    1999-01-01

    In common sense reasoning two typical types of defaultsare encountered. One is of the form "All birds can fly except b1,b2,..., and bm (m1)", and the other "All birds can fly,but there exist exceptions". The first type of defaults is readilyformalized but the other, as some researchers have noticed, is difficultto deal with. This paper establishes a general scheme for formalizing defaults of the two types, the key to which is the introduction of atwo-argument predicate ab (I, S) to represent exceptional objects.

  11. BIS Handbook: An Organizational Manual & Directory. Revised Edition.

    Association of Coll. and Research Libraries, Chicago, IL. Bibliographic Instruction Section.

    This handbook was prepared for the officers and committee members of the ACRL (Association of College and Research Libraries) Bibliographic Instruction Section (BIS). Introductory material by Mimi Dudley and James W. Hart traces the history of bibliographic instruction (BI) and the development of BIS. Following a brief discussion of how to get…

  12. Synthesis, spectral and structural properties of bis-imidazoline selones

    Arruri Sathyanarayana; Katam Srinivas; Anindita Mandal; Saswati Gharami; Ganesan Prabusankar

    2014-09-01

    New biphenyl derivatives of bis-imidazoline selones were synthesized in good yield and characterized by multinuclear (1D and 2D) NMR and UV-vis studies. The solid state structures of bis-imidazoline selones were further confirmed by single crystal X ray diffraction technique.

  13. Accelerated optical holographic recording using bis-DNO

    Rasmussen, Palle H.; Ramanujam, P.S.; Hvilsted, Søren;

    1999-01-01

    The design, synthesis and optical holographic recording properties of bis-DNO are reported. Bis-DNO is composed of two identical azobenzene oligoornithine segments (DNO) connected via a dipeptide linker. The two segments were assembled in a parallel fashion at the two amino groups of the dipeptid...

  14. Bis-perfluoroalkylation of aromatic compounds with sodium perfluoroalkanesulfinates

    LIU, Jin-Tao(刘金涛); LU, He-Jun(吕贺军)

    2000-01-01

    Bis-perfluoroalkylation of aromatic compounds such as dimethoxybenzenes (2,4,6), anisole (8), pyridine (10) and quinoline (13) was accomplished by reaction with excess sodium perfluoroalkanesulfinates, RFSO2Na (1), in the presence of Mn(OAc)3·2H2O under mild conditions. The reaction provides a facile method for the synthesis of bis-perfluoroalkylated aromatic compounds.

  15. One pot synthesis of bis-silicon-bridged stilbene derivatives

    2007-01-01

    Bis-silicon-bridged stilbene derivatives were synthesized in a modified procedure that combined the preparation of bis[2-(silyl)phenyl]acetylene and its intrmolecular reductive cyclization in one pot. The results indicated that the one pot approach produced target products in a comparable yield to that of the two-step method reported previously.

  16. Main: DREDR1ATRD29AB [PLACE

    Full Text Available DREDR1ATRD29AB S000152 23-June-2006 (last modified) kehi Related to responsiveness ...dependent in the ABA-responsive expression of the rd29A in Arabidopsis; DRE; drought; water stress; oxidativ

  17. Pulsed EPR studies of bis imidazole heme a

    Electron spin echo studies have been performed on the model compound for cytochrome a, bis imidazole heme a, and the results compared with those obtained for bis imidazole protoheme and for cytochrome a. The 14N coupling with the iron in the heme a model compound, as obtained from a study of the nuclear modulation effect, is comparable with that seen for the bis imidazole complex of protoheme. The magnetic field dependence of the linear electric field effect is essentially the same in both bis imidazole complexes, but is markedly different from that observed for cytochrome a. Thus the odd field component of the crystal field in bis imid heme a is different from that in cytochrome a. (author)

  18. Upstream ORF affects MYCN translation depending on exon 1b alternative splicing

    The MYCN gene is transcribed into two major mRNAs: one full-length (MYCN) and one exon 1b-spliced (MYCNΔ1b) mRNA. But nothing is known about their respective ability to translate the MYCN protein. Plasmids were prepared to enable translation from the upstream (uORF) and major ORF of the two MYCN transcripts. Translation was studied after transfection in neuroblastoma SH-EP cell line. Impact of the upstream AUG on translation was evaluated after directed mutagenesis. Functional study with the two MYCN mRNAs was conducted by a cell viability assay. Existence of a new protein encoded by the MYCNΔ1b uORF was explored by designing a rabbit polyclonal antibody against a specific epitope of this protein. Both are translated, but higher levels of protein were seen with MYCNΔ1b mRNA. An upstream ORF was shown to have positive cis-regulatory activity on translation from MYCN but not from MYCNΔ1b mRNA. In transfected SH-EP neuroblastoma cells, high MYCN dosage obtained with MYCNΔ1b mRNA translation induces an antiapoptotic effect after serum deprivation that was not observed with low MYCN expression obtained with MYCN mRNA. Here, we showed that MYCNOT: MYCN Overlap Transcript, a new protein of unknown function is translated from the upstream AUG of MYCNΔ1b mRNA. Existence of upstream ORF in MYCN transcripts leads to a new level of MYCN regulation. The resulting MYCN dosage has a weak but significant anti-apoptotic activity after intrinsic apoptosis induction

  19. Haploinsufficiency of BAZ1B contributes to Williams syndrome through transcriptional dysregulation of neurodevelopmental pathways.

    Lalli, Matthew A; Jang, Jiwon; Park, Joo-Hye C; Wang, Yidi; Guzman, Elmer; Zhou, Hongjun; Audouard, Morgane; Bridges, Daniel; Tovar, Kenneth R; Papuc, Sorina M; Tutulan-Cunita, Andreea C; Huang, Yadong; Budisteanu, Magdalena; Arghir, Aurora; Kosik, Kenneth S

    2016-04-01

    Williams syndrome (WS) is a neurodevelopmental disorder caused by a genomic deletion of ∼28 genes that results in a cognitive and behavioral profile marked by overall intellectual impairment with relative strength in expressive language and hypersocial behavior. Advancements in protocols for neuron differentiation from induced pluripotent stem cells allowed us to elucidate the molecular circuitry underpinning the ontogeny of WS. In patient-derived stem cells and neurons, we determined the expression profile of the Williams-Beuren syndrome critical region-deleted genes and the genome-wide transcriptional consequences of the hemizygous genomic microdeletion at chromosome 7q11.23. Derived neurons displayed disease-relevant hallmarks and indicated novel aberrant pathways in WS neurons including over-activated Wnt signaling accompanying an incomplete neurogenic commitment. We show that haploinsufficiency of the ATP-dependent chromatin remodeler, BAZ1B, which is deleted in WS, significantly contributes to this differentiation defect. Chromatin-immunoprecipitation (ChIP-seq) revealed BAZ1B target gene functions are enriched for neurogenesis, neuron differentiation and disease-relevant phenotypes. BAZ1B haploinsufficiency caused widespread gene expression changes in neural progenitor cells, and together with BAZ1B ChIP-seq target genes, explained 42% of the transcriptional dysregulation in WS neurons. BAZ1B contributes to regulating the balance between neural precursor self-renewal and differentiation and the differentiation defect caused by BAZ1B haploinsufficiency can be rescued by mitigating over-active Wnt signaling in neural stem cells. Altogether, these results reveal a pivotal role for BAZ1B in neurodevelopment and implicate its haploinsufficiency as a likely contributor to the neurological phenotypes in WS. PMID:26755828

  20. Hypoglycemic effect of Astragalus polysaccharide and its effect on PTP1B

    Yong WU; Jing-ping OU-YANG; Ke WU; Ya WANG; Yun-feng ZHOU; Chong-yuan WEN

    2005-01-01

    Aim: To examine the effects ofAstragalus polysaccharide (APS), a component of an aqueous extract of Astragalus membranaceus roots, on protein tyrosine phosphatase 1B (PTP1B), a negative regulator of insulin-receptor (IR) signal transduction, and its potential role in the amelioration of insulin resistance.Methods: Ten-week-old fat-fed streptozotocin (STZ)-treated rats, an animal model of type Ⅱ diabetes mellitus (TIIDM), were treated with APS (400 mg/kg po) for 5 weeks. Insulin sensitivity was identified by the insulin-tolerance test. Further analyses on the possible changes in insulin signaling occurring in skeletal muscle and liver were performed by immunoprecipitation or Western blotting. PTP1B activity was measured by an assay kit. Results: The diabetic rats responded to APS with a significant decrease in body weight, plasma glucose, and improved insulin sensitivity. The activity and expression of PTP1B were elevated in the skeletal muscle and liver of TIIDM rats. Thus the insulin signaling in target tissues was diminished. APS reduced both PTP1B protein level and activity in the muscle,but not in the liver of TIIDM rats. Insulin-induced tyrosine phosphorylation of the IR β-subunit and insulin receptor substrate-1 (IRS-1) were increased in the muscle,but not in the liver of APS-treated TIIDM rats. There was no change in the activity or expression of PTP1B in APS-treated normal rats, and blood insulin levels did not change in TIIDM rats after treatment with APS. Conclusion: APS enables insulin-sensitizing and hypoglycemic activity at least in part by decreasing the elevated expression and activity of PTP1B in the skeletal muscles of TIIDM rats.

  1. Upstream ORF affects MYCN translation depending on exon 1b alternative splicing

    Tutrone Giovani

    2009-12-01

    Full Text Available Abstract Background The MYCN gene is transcribed into two major mRNAs: one full-length (MYCN and one exon 1b-spliced (MYCNΔ1b mRNA. But nothing is known about their respective ability to translate the MYCN protein. Methods Plasmids were prepared to enable translation from the upstream (uORF and major ORF of the two MYCN transcripts. Translation was studied after transfection in neuroblastoma SH-EP cell line. Impact of the upstream AUG on translation was evaluated after directed mutagenesis. Functional study with the two MYCN mRNAs was conducted by a cell viability assay. Existence of a new protein encoded by the MYCNΔ1b uORF was explored by designing a rabbit polyclonal antibody against a specific epitope of this protein. Results Both are translated, but higher levels of protein were seen with MYCNΔ1b mRNA. An upstream ORF was shown to have positive cis-regulatory activity on translation from MYCN but not from MYCNΔ1b mRNA. In transfected SH-EP neuroblastoma cells, high MYCN dosage obtained with MYCNΔ1b mRNA translation induces an antiapoptotic effect after serum deprivation that was not observed with low MYCN expression obtained with MYCN mRNA. Here, we showed that MYCNOT: MYCN Overlap Transcript, a new protein of unknown function is translated from the upstream AUG of MYCNΔ1b mRNA. Conclusions Existence of upstream ORF in MYCN transcripts leads to a new level of MYCN regulation. The resulting MYCN dosage has a weak but significant anti-apoptotic activity after intrinsic apoptosis induction.

  2. Flame retardancy mechanisms of bisphenol A bis(diphenyl phosphate) in combination with zinc borate in bisphenol A polycarbonate/acrylonitrile-butadiene-styrene blends

    Bisphenol A polycarbonate/acrylonitrile-butadiene-styrene (PC/ABS) with and without bisphenol A bis(diphenyl phosphate) (BDP) and 5 wt.% zinc borate (Znb) were investigated. The pyrolysis was studied by thermogravimetry (TG), TG-FTIR and NMR, the fire behaviour with a cone calorimeter applying different heat fluxes, LOI and UL 94. Fire residues were examined with NMR. BDP affects the decomposition of PC/ABS and acts as a flame retardant in the gas and condensed phases. The addition of Znb results in an additional hydrolysis of PC. The fire behaviour is similar to PC/ABS, aside from a slightly increased LOI and a reduced peak heat release rate, both caused by borates improving the barrier properties of the char. In PC/ABS + BDP + Znb, the addition of Znb yields a borate network and amorphous phosphates. Znb also reacts with BDP to form alpha-zinc phosphate and borophosphates that suppress the original flame retardancy mechanisms of BDP. The inorganic-organic residue formed provides more effective flame retardancy, in particular at low irradiation in the cone calorimeter, and a clear synergy in LOI, whereas for more developed fires BDP + Znb become less effective than BDP in PC/ABS with respect to the total heat evolved.

  3. TD-DFT Study on the Electronic Spectrum Properties of 2,7'-(Ethylene)-bis-8-hydroxyquinoline and Its Derivatives

    LI Zhi-Feng; ZHU Yuan-Cheng; YUAN Kun; KANG Jing-Wan

    2008-01-01

    The structures of 2,7'-(ethylene)-bis-8-hydroxyquinoline and its derivatives were optimized at the ground states using ab initio HF and B3LYP methods. At the same time, the molecular structures of the first singlet excited state for 2,7'-(ethylene)-bis-8-hydroxyquinoline and its derivatives were optimized by CIS/6-31G(d). The absorption and emission spectra based on the above structures were obtained by the time-dependent density functional theory (TD-DFT) by the B3LYP method with the 6-31G(d) basis set. The calculated results of luminescence originate from the electronic transition from the hydroxphenol ring of 8-hydroxyquinoline A to the pyridine ring of 8-hydroxyquinoline B. Their luminescence wave bands can be tuned by different substituents on the ligand of 8-hydroxyquinoline.

  4. Bis(μ-bis{[4-(2-pyridylpyrimidin-2-yl]sulfanyl}methanedisilver(I bis(perchlorate

    Hai-Bin Zhu

    2010-12-01

    Full Text Available In the macrocyclic centrosymmetric dinuclear complex, [Ag2(C19H14N6S22](ClO42, the AgI atom, bis{[4-(2-pyridylpyrimidin-2-yl]sulfanyl}methane (2-bppt ligand and perchlorate anion each lie on a twofold rotation axis. The 2-bppt ligand chelates two four-coordinated AgI atoms through its two bipyridine-like arms. The O atoms of the perchlorate anion are disordered each over two positions of equal occupancy. Adjacent complex molecules are linked by π–π interactions between the pyridine and pyrimidine rings [centroid–centroid distance = 3.663 (8 Å].

  5. Development of a monoclonal antibody against the left wing of ciguatoxin CTX1B: thiol strategy and detection using a sandwich ELISA.

    Tsumuraya, Takeshi; Takeuchi, Katsutoshi; Yamashita, Shuji; Fujii, Ikuo; Hirama, Masahiro

    2012-09-01

    Ciguatera fish poisoning (CFP) is a form of food poisoning caused by the ingestion of a variety of reef fish that have accumulated trace amounts of ciguatoxins produced by dinoflagellates of the genus Gambierdiscus through the food chain. CFP affects more than 50,000 people each year. The extremely low level of the causative neurotoxins, ciguatoxins, in fish has hampered the preparation of antibodies for detecting the toxins. In this paper, we describe a thiol strategy for synthesizing a keyhole limpet hemocyanin (KLH)-conjugate (20) of the ABCDE-ring fragment of the Pacific ciguatoxins, CTX1B (1) and 54-deoxyCTX1B (4). We succeeded in producing a monoclonal antibody (3G8) against the left wings of these ciguatoxins by immunizing mice with the hapten-KLH conjugate (20) as the synthetic antigen. The most promising mAb, 3G8, does not cross-react with other related marine toxins. Sandwich enzyme-linked immunosorbent assay (ELISA) utilizing 3G8 and the previously prepared monoclonal antibody (8H4) enabled us to detect 1 specifically at less than 0.28 ng/mL. PMID:22575284

  6. Adherence to interferon β-1b treatment in patients with multiple sclerosis in Spain.

    Oscar Fernández

    Full Text Available BACKGROUND: Adherence to interferon β-1b (INFβ-1b therapy is essential to maximize the beneficial effects of treatment in multiple sclerosis (MS. For that reason, the main objectives of this study are to assess adherence to INFβ-1b in patients suffering from MS in Spain, and to identify the factors responsible for adherence in routine clinical practice. METHODOLOGY/PRINCIPAL FINDINGS: This was an observational, retrospective, cross-sectional study including 120 Spanish patients with MS under INFβ-1b treatment. Therapeutic adherence was assessed with Morisky-Green test and with the percentage of doses received. The proportion of adherent patients assessed by Morisky-Green test was 68.3%, being indicative of poor adherence. Nevertheless, the percentage of doses received, which was based on the number of injected medication, was 94.3%. The main reason for missing INFβ-1b injections was forgetting some of the administrations (64%. Therefore, interventions that diminish forgetfulness might have a positive effect in the proportion of adherent patients and in the percentage of doses received. In addition, age and comorbidities had a significant effect in the number of doses injected per month, and should be considered in the management of adherence in MS patients. CONCLUSION/SIGNIFICANCE: Among all the available methods for assessing adherence, the overall consumption of the intended dose has to be considered when addressing adherence.

  7. E1B and E4 oncoproteins of adenovirus antagonize the effect of apoptosis inducing factor

    Adenovirus inundates the productively infected cell with linear, double-stranded DNA and an abundance of single-stranded DNA. The cellular response to this stimulus is antagonized by the adenoviral E1B and E4 early genes. A mutant group C adenovirus that fails to express the E1B-55K and E4ORF3 genes is unable to suppress the DNA-damage response. Cells infected with this double-mutant virus display significant morphological heterogeneity at late times of infection and frequently contain fragmented nuclei. Nuclear fragmentation was due to the translocation of apoptosis inducing factor (AIF) from the mitochondria into the nucleus. The release of AIF was dependent on active poly(ADP-ribose) polymerase-1 (PARP-1), which appeared to be activated by viral DNA replication. Nuclear fragmentation did not occur in AIF-deficient cells or in cells treated with a PARP-1 inhibitor. The E1B-55K or E4ORF3 proteins independently prevented nuclear fragmentation subsequent to PARP-1 activation, possibly by altering the intracellular distribution of PAR-modified proteins. - Highlights: • E1B-55K or E4orf3 prevents nuclear fragmentation. • Nuclear fragmentation requires AIF and PARP-1 activity. • Adenovirus DNA replication activates PARP-1. • E1B-55K or E4orf3 proteins alter the distribution of PAR

  8. Propagation of dysbindin-1B aggregates: exosome-mediated transmission of neurotoxic deposits.

    Zhu, C-Y; Shen, Y; Xu, Q

    2015-04-16

    Given the detection of aggregated deposits in chronic mental diseases (CMD), the disturbance of proteostasis in those diseases is receiving increasing attention. The study of aggregated proteins can contribute to our understanding of the chronic and progressive condition of such diseases. Dysbindin, encoded by the schizophrenia susceptibility gene DTNBP1, has been reported to co-aggregate with DISC1. However, there has been no evidence to date on the aggregation tendency of dysbindin. Therefore, we investigated the isoform-specific aggregation of dysbindin. We found that dysbindin-1B aggregated into cell-invasive deposits in mice. Because of the efficient propagation of dysbindin-1B, we further studied the mechanism of propagation and identified it as exosome-mediated transmission of the aggregates. In addition, aggregates of dysbindin-1B were toxic. Through exosome-mediated propagation, the deposits of dysbindin-1B exerted toxic effects on recipient neurons a long distance away from the initial aggregation site in mice brain. The rapid long distance propagation of neurotoxic deposits of dysbindin-1B in affected neuronal circuitry indicates a possible mechanism for the progressive deterioration of neurons and cognitive function in CMD. PMID:25704251

  9. E1B and E4 oncoproteins of adenovirus antagonize the effect of apoptosis inducing factor

    Turner, Roberta L. [Department of Microbiology and Immunology, Wake Forest School of Medicine, Winston-Salem, NC 27157 (United States); Wilkinson, John C., E-mail: john.wilkinson@ndsu.edu [Department of Biochemistry, Wake Forest School of Medicine, Winston-Salem, NC 27157 (United States); Ornelles, David A., E-mail: ornelles@wakehealth.edu [Department of Microbiology and Immunology, Wake Forest School of Medicine, Winston-Salem, NC 27157 (United States)

    2014-05-15

    Adenovirus inundates the productively infected cell with linear, double-stranded DNA and an abundance of single-stranded DNA. The cellular response to this stimulus is antagonized by the adenoviral E1B and E4 early genes. A mutant group C adenovirus that fails to express the E1B-55K and E4ORF3 genes is unable to suppress the DNA-damage response. Cells infected with this double-mutant virus display significant morphological heterogeneity at late times of infection and frequently contain fragmented nuclei. Nuclear fragmentation was due to the translocation of apoptosis inducing factor (AIF) from the mitochondria into the nucleus. The release of AIF was dependent on active poly(ADP-ribose) polymerase-1 (PARP-1), which appeared to be activated by viral DNA replication. Nuclear fragmentation did not occur in AIF-deficient cells or in cells treated with a PARP-1 inhibitor. The E1B-55K or E4ORF3 proteins independently prevented nuclear fragmentation subsequent to PARP-1 activation, possibly by altering the intracellular distribution of PAR-modified proteins. - Highlights: • E1B-55K or E4orf3 prevents nuclear fragmentation. • Nuclear fragmentation requires AIF and PARP-1 activity. • Adenovirus DNA replication activates PARP-1. • E1B-55K or E4orf3 proteins alter the distribution of PAR.

  10. Lmx1b controls peptide phenotypes in serotonergic and dopaminergic neurons

    Rui Yan; Tianwen Huang; Zhiqin Xie; Guannan Xia; Hui Qian; Xiaolin Zhao; Leping Cheng

    2013-01-01

    Serotonin (5-HT) neurons synthesize a variety of peptides.How these peptides are controlled during development remains unclear.It has been reported that the co-localization of peptides and 5-HT varies by species.In contrast to the situations in the rostral 5-HT neurons of human and rat brains,several peptides do not coexist with 5-HT in the rostral 5-HT neurons of mouse brain.In this study,we found that the peptide substance P and peptide genes,including those encoding peptides thyrotropin-releasing hormone,enkephalin,and calcitonin gene-related peptide,were expressed in the caudal 5-HT neurons of mouse brain; these findings are in line with observations in rat and monkey 5-HT neurons.We also revealed that these peptides/peptide genes partially overlapped with the transcription factor Lmx1b that specifies the 5-HT cell fate.Furthermore,we found that the peptide cholecystokinin was expressed in developing dopaminergic neurons and greatly overlapped with Lmx1b that specifies the dopaminergic cell fate.By examining the phenotype of Lmx1b deletion mice,we found that Lmx1b was required for the expression of above peptides expressed in 5-HT or dopaminergic neurons.Together,our results indicate that Lmx1b,a key transcription factor for the specification of 5-HT and dopaminergic transmitter phenotypes during embryogenesis,determines some peptide phenotypes in these neurons as well.

  11. Arabidopsis DREB1B in transgenic Salvia miltiorrhiza increased tolerance to drought stress without stunting growth.

    Wei, Tao; Deng, Kejun; Gao, Yonghong; Liu, Yu; Yang, Meiling; Zhang, Lipeng; Zheng, Xuelian; Wang, Chunguo; Song, Wenqin; Chen, Chengbin; Zhang, Yong

    2016-07-01

    Multiple stress response genes are controlled by transcription factors in a coordinated manner; therefore, these factors can be used for molecular plant breeding. CBF1/DREB1B, a known stress-inducible gene, was isolated from Arabidopsis thaliana and introduced into Salvia miltiorrhiza under the control of the CaMV35S or RD29A promoter. Under drought stress, relative water content, chlorophyll content, and the net photosynthetic rate were observed to be higher in the transgenic lines than in the wild type (WT). Moreover, O2(-) and H2O2 accumulation was observed to be lower in the transgenic lines. Additional analyses revealed that the AtDREB1B transgenic plants generally displayed lesser malondialdehyde (MDA) but higher superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) activities than the WT under drought stress. Quantitative real-time polymerase chain reaction of a subset of genes involved in photosynthesis, stress response, carbohydrate metabolism, and cell protection further verified that AtDREB1B could enhance tolerance to drought by activating different downstream DREB/CBF genes in the transgenic plants. Furthermore, no growth inhibition was detected in transgenic S. miltiorrhiza plants that expressed AtDREB1B driven by either the constitutive CaMV35S promoter or the stress-inducible RD29A promoter. Together, these results suggest that AtDREB1B is a good candidate gene for increasing drought tolerance in transgenic S. miltiorrhiza. PMID:27002402

  12. Organic anion transporting polypeptide-1B1 haplotypes in Chinese patients

    Lin-yong XU; Hong-hao ZHOU; Zhen-qiu SUN; Yi-jing HE; Wei ZHANG; Sheng Deng; Qing LI; Wei-xia ZHANG; Zhao-qian LIU; Dan WANG; Yuan-fei HUANG

    2007-01-01

    Aim: To detect 388G>A and 521T>C variant alleles in the organic anion transporting polypeptide- 1B 1 (OATP 1B 1, encoding gene SLCOIB1) gene. Methods:One hundred and eleven healthy volunteers were screened for OATPIB 1 alleles in our study. PCR-restriction fragment length polymorphism was used to identify the 388G>A polymorphism and a 1-step tetra-primer method was developed for the determination of 521T>C mutation. Results: The frequencies of the 388G>A and 521T>C variant alleles in the Chinese population were 73.4%and 14.0%,respectively. The frequencies of the SLCO1BI*lb and *15 haplotypes were 59.9% and 14.0%, respectively. Conclusion: The SLCO1B1*1b and SLCO1B1*15 variants are relatively common in the Chinese population. Their frequencies are similar to that in the Japanese, but significantly different from that in Caucasians and blacks.

  13. Atomic layer deposition of molybdenum oxide using bis(tert-butylimido)bis(dimethylamido) molybdenum

    Bertuch, Adam, E-mail: abertuch@ultratech.com; Sundaram, Ganesh [Ultratech/Cambridge NanoTech, 130 Turner Street, Waltham, Massachusetts 02453 (United States); Saly, Mark; Moser, Daniel; Kanjolia, Ravi [SAFC Hitech, 1429 Hilldale Avenue, Haverhill, Massachusetts 01832 (United States)

    2014-01-15

    Molybdenum trioxide films have been deposited using thermal atomic layer deposition techniques with bis(tert-butylimido)bis(dimethylamido)molybdenum. Films were deposited at temperatures from 100 to 300 °C using ozone as the oxidant for the process. The Mo precursor was evaluated for thermal stability and volatility using thermogravimetric analysis and static vapor pressure measurements. Film properties were evaluated with ellipsometry, x-ray photoelectron spectroscopy, secondary ion mass spectroscopy, and secondary electron microscopy. The growth rate per cycle was determined to extend from 0.3 to 2.4 Å/cycle with <4% nonuniformity (1-sigma) with-in-wafer across a 150 mm wafer for the investigated temperature range.

  14. trans-Bis[1,2-bis(dimethylphosphinoethane]bromidonitrosyltungsten(0

    Nataša Avramović

    2008-01-01

    Full Text Available The crystal structure of the title compound, [WBr(NO(C6H16P22], reveals a distorted octahedral geometry around the W centre. The W atom lies on a special position at an inversion centre (the Br and NO ligands are equally disordered. The bis(dimethylphosphinoethane ligand is also severely disordered (site occupancy factors 0.52 and 0.48. This is the first structure of a tungsten species with nitrosyl and bromide ligands.

  15. Molybdenum (VI) Bis(imidoaryl) Complexes Containing the Bis (amonimethyl)aryl 'Pincer' Ligand

    Koten, G. van; Brandts, J.A.M.; Gossage, R.A.; Boersma, J.; Spek, A.L.

    1999-01-01

    The synthesis and characterization of new, five-coordinate molybdenum bis(imido) chloride complexes [MoCl(NCN)(N-t-Bu)2] (2) and [MoCl(2-C,N-NCN)(NAr)2] (3) and the methylated derivative [Mo(2-C,N-NCN)(Me)(NAr)2] (5) (NCN = [C6H3(CH2NMe2)2-2,6]-, Ar = C6H3-i-Pr2-2,6) are reported. Compounds 3 and 5

  16. N-Terminal methionine processing by the zinc-activated Plasmodium falciparum methionine aminopeptidase 1b.

    Calcagno, Sarah; Klein, Christian D

    2016-08-01

    The methionine aminopeptidase 1b from Plasmodium falciparum (PfMetAP 1b) was cloned, expressed in Escherichia coli and characterized. Surprisingly, and in contrast to other methionine aminopeptidases (MetAPs) that require heavy-metal cofactors such as cobalt, the enzyme is reliably activated by zinc ions. Immobilization of the enzyme is possible by His-tag metal chelation to iminodiacetic acid-agarose and by covalent binding to chloroacetamido-hexyl-agarose. The covalently immobilized enzyme shows long-term stability, allowing a continuous, heterogenous processing of N-terminal methionines, for example, in recombinant proteins. Activation by zinc, instead of cobalt as for other MetAPs, avoids the introduction of heavy metals with toxicological liabilities and oxidative potential into biotechnological processes. The PfMetAP 1b therefore represents a useful tool for the enzymatic, posttranslational processing of recombinant proteins. PMID:27023914

  17. CLINICAL INFECTION OF TWO CAPTIVE ASIAN ELEPHANTS (ELEPHAS MAXIMUS) WITH ELEPHANT ENDOTHELIOTROPIC HERPESVIRUS 1B.

    Fuery, Angela; Tan, Jie; Peng, RongSheng; Flanagan, Joseph P; Tocidlowski, Maryanne E; Howard, Lauren L; Ling, Paul D

    2016-03-01

    The ability of prior infection from one elephant endotheliotropic herpesvirus (EEHV) type to protect against clinical or lethal infection from others remains an important question. This report describes viremia and subsequent shedding of EEHV1B in two juvenile 4-yr-old Asian elephants within 3 wk or 2 mo following significant infections caused by the rarely seen EEHV4. High levels of EEHV1B shedding were detected in the first elephant prior to emergence of infection and viremia in the second animal. The EEHV1B virus associated with both infections was identical to the strain causing infection in two herd mates previously. High EEHV viremia correlated with leukopenia and thrombocytopenia, which was followed by leukocytosis and thrombocytosis when clinical signs started to resolve. The observations from these cases should be beneficial for helping other institutions monitor and treat elephants infected with EEHV1, the most common virus associated with lethal hemorrhagic disease. PMID:27010294

  18. Caring from Afar: Asian H1B Migrant Workers and Aging Parents.

    Lee, Yeon-Shim; Chaudhuri, Anoshua; Yoo, Grace J

    2015-09-01

    With the growth in engineering/technology industries, the United States has seen an increase in the arrival of highly skilled temporary migrant workers on H1B visas from various Asian countries. Limited research exists on how these groups maintain family ties from afar including caring for aging parents. This study explores the experiences and challenges that Asian H1B workers face when providing care from a distance. A total of 21 Chinese/Taiwanese, Korean, and Indian H1B workers participated in in-depth qualitative interviews. Key findings indicate that despite distance, caring relationships still continue through regular communications, financial remittances, and return visits, at the same time creating emotional, psychological, and financial challenges for the workers. Findings highlight the need for further research in understanding how the decline of aging parent's health impacts the migrants' adjustment and health in the United States. PMID:26267591

  19. Characteristic Height Growth Pattern in Patients with Pseudohypoparathyroidism: Comparison between Type 1a and Type 1b

    Kinoshita, Kaori; Minagawa, Masanori; Anzai, Michiko; Sato, Yumiko; Kazukawa, Itsuro; Shimohashi, Kyoko; Ota, Setsuo; Kohno, Yoichi

    2007-01-01

    Pseudohypoparathyroidism (PHP) is a metabolic disorder characterized by organ resistance to the action of parathyroid hormone. PHP type 1 is subclassified into two apparent disorders, type 1a (PHP1a) and type 1b (PHP1b). Patients with PHP1a show Albright hereditary osteodystrophy including short stature. Patients with PHP1b have no such skeletal defects, however, literature regarding the growth of PHP1b is not currently available. We evaluated growth charts of PHP patients, including four PHP...

  20. Expanding the phenotypic spectrum of ARID1B-mediated disorders and identification of altered cell-cycle dynamics due to ARID1B haploinsufficiency

    Sim, J. C. H.; White, S. M.; Fitzpatrick, E.; Wilson, G. R.; Gillies, G.; Pope, K.; Mountford, H. S.; Tørring, Pernille M.; McKee, S.; Vulto-van Silfhout, A. T.; Jhangiani, S. N.; Muzny, D. M.; Leventer, R. J.; Delatycki, M. B.; Amor, D. J.; Lockhart, P. J.

    2014-01-01

    Background: Mutations in genes encoding components of the Brahma-associated factor (BAF) chromatin remodeling complex have recently been shown to contribute to multiple syndromes characterised by developmental delay and intellectual disability. ARID1B mutations have been identified as the...... predominant cause of Coffin-Siris syndrome and have also been shown to be a frequent cause of nonsyndromic intellectual disability. Here, we investigate the molecular basis of a patient with an overlapping but distinctive phenotype of intellectual disability, plantar fat pads and facial dysmorphism. Methods...

  1. Protein 4.1B contributes to the organization of peripheral myelinated axons.

    Carmen Cifuentes-Diaz

    Full Text Available Neurons are characterized by extremely long axons. This exceptional cell shape is likely to depend on multiple factors including interactions between the cytoskeleton and membrane proteins. In many cell types, members of the protein 4.1 family play an important role in tethering the cortical actin-spectrin cytoskeleton to the plasma membrane. Protein 4.1B is localized in myelinated axons, enriched in paranodal and juxtaparanodal regions, and also all along the internodes, but not at nodes of Ranvier where are localized the voltage-dependent sodium channels responsible for action potential propagation. To shed light on the role of protein 4.1B in the general organization of myelinated peripheral axons, we studied 4.1B knockout mice. These mice displayed a mildly impaired gait and motility. Whereas nodes were unaffected, the distribution of Caspr/paranodin, which anchors 4.1B to the membrane, was disorganized in paranodal regions and its levels were decreased. In juxtaparanodes, the enrichment of Caspr2, which also interacts with 4.1B, and of the associated TAG-1 and Kv1.1, was absent in mutant mice, whereas their levels were unaltered. Ultrastructural abnormalities were observed both at paranodes and juxtaparanodes. Axon calibers were slightly diminished in phrenic nerves and preterminal motor axons were dysmorphic in skeletal muscle. βII spectrin enrichment was decreased along the axolemma. Electrophysiological recordings at 3 post-natal weeks showed the occurrence of spontaneous and evoked repetitive activity indicating neuronal hyperexcitability, without change in conduction velocity. Thus, our results show that in myelinated axons 4.1B contributes to the stabilization of membrane proteins at paranodes, to the clustering of juxtaparanodal proteins, and to the regulation of the internodal axon caliber.

  2. Interferon-β1b Increases Th2 Response in Neuromyelitis Optica

    Toshiaki Hanafusa

    2012-09-01

    Full Text Available A Japanese randomized controlled study showed that Interferon â (IFN-â1b therapy is clinically effective in decreasing the frequency of attacks in multiple sclerosis (MS, even in optico-spinal MS (OSMS. However, recent studies have shown that IFN-â (IFN-â1a/IFN-â1b treatment was not effective in neuromyelitis optica (NMO patients and that the diminished benefit of IFN-â treatment in NMO may be due to different immune responses to IFN-â. We determined longitudinally the expression of CCR5, CXCR3 and CCR4 on CD4+ T and CD8+ T cells in the blood from patients with NMO and MS treated with IFN-â1b. During a 12-month period of IFN-â1b therapy, the annualized relapse rate decreased in MS patients but not in NMO patients. There was no significant difference in the expression of the chemokine receptors between NMO and MS at baseline. The percentages of CD4+CCR5+ and CD4+CXCR3+ T cells, representative of the Th1 response, were decreased in both NMO and MS after treatment. The percentage of CD4+CCR4+ T cells, representative of the Th2 response, was decreased in MS, but those for NMO was significantly increased compared with the pretreatment levels. Our results indicate that IFN-â1b-induced up-modulation of the Th2 response in NMO patients may be the source of differences in the therapeutic response to IFN-â1b therapy. In the present study, Th2 predominance is involved in the pathogenesis of NMO.

  3. Microstructure and magnetic properties of bulk magnets Nd_(14-x)Fe_(76+x)Co_3Zr_1B_6(x=0,0.5,1) prepared by spark plasma sintering

    马毅龙; 刘颖; 李军; 杜慧龙; 高静

    2009-01-01

    Melt-spun ribbons with nominal composition of Nd14-xFe76+xCo3Zr1B6(x=0,0.5,1) were consolidated into isotropic bulk magnets by spark plasma sintering method.It was found that the Nd content and sintering temperature had significant influence on the density and magnetic properties of the sintered magnets.Homogeneous microstructure and fine grain(50-100 nm) were obtained when sintering below 700 ℃,and the initial magnetization curve showed that the coercivity was controlled by the pinning mechanism.However,ab...

  4. CYP1B1 genotype and risk of cardiovascular disease, pulmonary disease, and cancer in 50,000 individuals

    Kaur-Knudsen, D.; Nordestgaard, B.G.; Tybjaerg-Hansen, A.;

    2009-01-01

    OBJECTIVE: Cytochrome P450 (CYP) 1B1 enzymes metabolize tobacco-smoke polycyclic aromatic hydrocarbons and 17beta-estradiol. CYP1B1*3 (rs1056836 = Leu432Val = 4326C>G) and CYP1B1*4 (rs1800440 = Asn453Ser = 4390A>G) influence this metabolism. We, therefore, hypothesized that these two polymorphism...

  5. Thermal conductivity of A1B3C26 ternary compounds and their solid solutions

    Thermal conductivity of ternary compounds A1B3C26 and solid solutions CuGaxIn1-xS2, CuGaxIn1-xSe2, CuInS2xSe2(1-x), was studied by the absolute and relative methods in the temperature range of 300-550 K. Interrelation between thermal conductivity and tetragonal distortion of the ternary compounds A1B3C26 was established. It is shown that concentrational dependence of thermal conductivity for the solid solutions has the minimum near equimolar compositions

  6. Protein Tyrosine Phosphatase 1B Inhibitors from the Roots of Cudrania tricuspidata

    Tran Hong Quang; Nguyen Thi Thanh Ngan; Chi-Su Yoon; Kwang-Ho Cho; Dae Gill Kang; Ho Sub Lee; Youn-Chul Kim; Hyuncheol Oh

    2015-01-01

    A chemical investigation of the methanol extract from the roots of Cudrania tricuspidata resulted in the isolation of 16 compounds, including prenylated xanthones 1–9 and flavonoids 10–16. Their structures were identified by NMR spectroscopy and mass spectrometry and comparisons with published data. Compounds 1–9 and 13–16 significantly inhibited PTP1B activity in a dose dependent manner, with IC50 values ranging from 1.9–13.6 μM. Prenylated xanthones showed stronger PTP1B inhibitory effects...

  7. Role of Rck-Pat1b binding in assembly of processing-bodies

    Ozgur, Sevim; Stoecklin, Georg

    2013-01-01

    The DEAD box RNA helicase Rck and the scaffold protein Pat1b participate in controlling gene expression at the post-transcriptional level by suppressing mRNA translation and promoting mRNA decapping. In addition, both proteins are required for the assembly of processing (P)-bodies, cytoplasmic foci that contain stalled mRNAs and numerous components of the mRNA decay machinery. The C-terminal RecA-like domain of Rck interacts with the N-terminal acidic domain of Pat1b. Here, we identified poin...

  8. A novel protein tyrosine phosphatase 1B inhibitor from Tinospora sinensis

    Prasoon Gupta; Upasana Sharma; Gupta, Praveen K.; Rakesh Maurya

    2012-01-01

    Bioassay-directed fractionation led to the identification of a new compound, 4-hydroxy-heptadec-6-enoic acid ethyl ester (1) together with three known compounds (2-4) from Tinospora sinensis. The structure of 1 was determined by analysis of spectroscopic data. The isolated compounds were evaluated for their protein tyrosine phosphatase 1B (PTP1B) inhibitory activity. Compounds 1 and 2 displayed significant inhibitory activity with IC 50 values 61.1 and 74.2 μM, respectively

  9. Distinct circuits underlie the effects of 5-HT1B receptors on aggression and impulsivity

    Nautiyal, Katherine M.; Tanaka, Kenji F.; Barr, Mary M.; Tritschler, Laurent; Le Dantec, Yannick; David, Denis J.; Gardier, Alain M.; Blanco, Carlos; Hen, René; Ahmari, Susanne E.

    2015-01-01

    Impulsive and aggressive behaviors are both modulated by serotonergic signaling, specifically through the serotonin 1B receptor (5-HT1BR). 5-HT1BR knockout mice show increased aggression and impulsivity, and 5-HT1BR polymorphisms are associated with aggression and drug addiction in humans. To dissect the mechanisms by which the 5-HT1BR affects these phenotypes, we developed a mouse model to spatially and temporally regulate 5-HT1BR expression. Our results demonstrate that forebrain 5-HT1B het...

  10. Transit observations at the observatory in Grossschwabhausen: XO-1b and TrES-1

    Vanko, M; Mugrauer, M; Schmidt, T O B; Roell, T; Eisenbeiss, T; Hohle, M; Seifahrt, A; Koeltzsch, A; Broeg, Ch; Koppenhoefer, J; Neuhäuser, R

    2009-01-01

    We report on observations of transit events of the transiting planets XO-1b and TrES-1 with the AIU Jena telescope in Grossschwabhausen. Based on our IR photometry (in March 2007) and available transit timings (SuperWASP, XO and TLC-project-data) we improved the orbital period of XO-1b (P = 3.941497$\\pm$0.000006) and TrES-1 (P = 3.0300737$\\pm$0.000006), respectively. The new ephemeris for the both systems are presented.

  11. Potent water extracts of Indonesian medicinal plants against PTP1B

    Azis Saifudin; Tepy Usia; Subehan AbLallo; Hiroyuki Morita; Ken Tanaka; Yasuhiro Tezuka

    2016-01-01

    Objective: To examine the potent of water as a solvent agent in the preparation of traditional herbal medicine. Methods: Water extracts of 18 plants were prepared through reflux and examined (25 μg/mL) to evaluate their possibility for inhibiting protein tyrosine phosphatase 1B (PTP1B). The determination of IC50 values was performed for the samples possessing more than 80% inhibition. Meanwhile, those exhibiting IC50 values more than 7.0 μg/mL were further profiled for their chemical const...

  12. Enzymes of the AKR1B and AKR1C subfamilies and uterine diseases

    Tea eLanisnik Rizner

    2012-03-01

    Full Text Available Endometrial and cervical cancers, uterine myoma, and endometriosis are very common uterine diseases. Worldwide, more than 800,000 women are affected annually by gynecological cancers, as a result of which, more than 360,000 die. During their reproductive age, about 70% of women develop uterine myomas, 10% to 15% suffer from endometriosis, and 35% to 50% from infertility associated with endometriosis. Uterine diseases are associated with aberrant inflammatory responses and concomitant increased production of prostaglandins (PG. They are also related to decreased differentiation, due to low levels of protective progesterone and retinoic acid, and to enhanced proliferation, due to high local concentrations of estrogens. The pathogenesis of these diseases can thus be attributed to disturbed PG, estrogen and retinoid metabolism and actions. Five human members of the aldo-keto reductase 1B (AKR1B and 1C (AKR1C superfamilies, i.e., AKR1B1, AKR1B10, AKR1C1, AKR1C2 and AKR1C3, have roles in these processes and can thus be implicated in uterine diseases. AKR1B1 and AKR1C3 catalyze the formation of PGF2alpha which stimulates cell proliferation. AKR1C3 converts PGD2 to 9alpha,11beta-PGF2, and thus counteracts the formation of 15deoxy-PGJ2, which can activate pro-apoptotic peroxisome-proliferator-activated receptor beta. AKR1B10 catalyzes the reduction of retinal to retinol, and in thus lessens the formation of retinoic acid, with potential pro-differentiating actions. The AKR1C1-AKR1C3 enzymes also act as 17-keto- and 20-ketosteroid reductases to varying extents, and are implicated in increased estradiol and decreased progesterone levels. This review comprises a short introduction to uterine diseases, followed by an overview of the current literature on the AKR1B and AKR1C expression in the uterus and in uterine diseases. The potential implications of the AKR1B and AKR1C enzymes and their pathophysiologies are then discussed, followed by conclusions and

  13. SIMULACIJA TEHNOLOGIJE NADZORA NAD GLOBINO ANESTEZIJE- BIS MONITOR

    Kaučič, Vlasta

    2010-01-01

    V diplomskem delu smo izdelali simulacijsko okolje za predstavitev tehnologije nadzora nad globino anestezije. Preverili smo ali so obstoječi simulatorji ustrezni za simulacijo BIS monitorja. Na svetovnem spletu smo poiskali vsebine v obliki računalniških simulatorjev, ki obravnavajo tehnologijo BIS monitoringa in se osredotočili na ključne učne točke. Diplomsko delo tako predstavlja učbenik za uporabo simulacije tehnologije nadzora nad globino anestezije. Monitor BIS je nev...

  14. High pressure synthesis of BiS2

    Søndergaard-Pedersen, Simone; Nielsen, Morten Bormann; Bremholm, Martin

    possibilities of using high pressure synthesis to discover new phases in the Bi-S binary system were investigated as early as the 1960’s.4 The research led to discovery of a compound with BiS2 stoichiometry, but no structure solution of BiS2 was reported. A reason behind making this new phase is to study the...... contains Bi atoms in distorted square-based pyramidal coordination to five surrounding sulfur atoms. The results will be displayed together with a comparison to other metal dichalcogenide compounds. Experimental details and physical properties will also be presented together with theoretical calculations...

  15. Mono- and bis-thiazolium salts have potent antimalarial activity.

    Hamzé, Abdallah; Rubi, Eric; Arnal, Pascal; Boisbrun, Michel; Carcel, Carole; Salom-Roig, Xavier; Maynadier, Marjorie; Wein, Sharon; Vial, Henri; Calas, Michèle

    2005-05-19

    Three new series comprising 24 novel cationic choline analogues and consisting of mono- or bis (N or C-5-duplicated) thiazolium salts have been synthesized. Bis-thiazolium salts showed potent antimalarial activity (much superior to monothiazoliums). Among them, bis-thiazolium salts 12 and 13 exhibited IC(50) values of 2.25 nM and 0.65 nM, respectively, against P. falciparum in vitro. These compounds also demonstrated good in vivo activity (ED(50)

  16. Bis-naphtho-γ-pyrones from Fungi and Their Bioactivities

    Shiqiong Lu

    2014-05-01

    Full Text Available Bis-naphtho-γ-pyrones are an important group of aromatic polyketides derived from fungi. They have a variety of biological activities including cytotoxic, antitumor, antimicrobial, tyrosine kinase and HIV-1 integrase inhibition properties, demonstrating their potential applications in medicine and agriculture. At least 59 bis-naphtho-γ-pyrones from fungi have been reported in the past few decades. This mini-review aims to briefly summarize their occurrence, biosynthesis, and structure, as well as their biological activities. Some considerations regarding to synthesis, production, and medicinal and agricultural applications of bis-naphtho-γ-pyrones are also discussed.

  17. Anthrax lethal toxin induced lysosomal membrane permeabilization and cytosolic cathepsin release is Nlrp1b/Nalp1b-dependent.

    Kathleen M Averette

    Full Text Available NOD-like receptors (NLRs are a group of cytoplasmic molecules that recognize microbial invasion or 'danger signals'. Activation of NLRs can induce rapid caspase-1 dependent cell death termed pyroptosis, or a caspase-1 independent cell death termed pyronecrosis. Bacillus anthracis lethal toxin (LT, is recognized by a subset of alleles of the NLR protein Nlrp1b, resulting in pyroptotic cell death of macrophages and dendritic cells. Here we show that LT induces lysosomal membrane permeabilization (LMP. The presentation of LMP requires expression of an LT-responsive allele of Nlrp1b, and is blocked by proteasome inhibitors and heat shock, both of which prevent LT-mediated pyroptosis. Further the lysosomal protease cathepsin B is released into the cell cytosol and cathepsin inhibitors block LT-mediated cell death. These data reveal a role for lysosomal membrane permeabilization in the cellular response to bacterial pathogens and demonstrate a shared requirement for cytosolic relocalization of cathepsins in pyroptosis and pyronecrosis.

  18. o-Nitroaryl-bis(5-methylfur-2-ylmethanes as Versatile Synthons for the Synthesis of Nitrogen-Containing Heterocycles

    Andrey V. Gutnov

    1997-04-01

    Full Text Available 2-Nitroaryldifurylmethanes 1a and 1b, readily available by condensation of 2-nitrobenzaldehyde and 6-nitroveratraldehyde with 2-methylfuran, were transformed into indole, cinnoline and benzothiazine-3,1 derivatives. The reduction of 2-nitroaryldifurylmethanes gave the corresponding anilines 2a,b or indole 3 depending on the reaction conditions. A plausible mechanism for the last reaction involving intramolecular heterocyclic addition between a nitroso-group and a furan ring is proposed. Diazotisation of the amine 2b gave a cinnoline derivative - a product of intramolecular oxidative furan ring opening. Treatment of isothiocyanates 7a,b with perchloric acid resulted in a new rearrangement with furan ring migration leading to the 4-Hbenzothiazine-3,1 derivatives.

  19. HF diets increase hypothalamic PTP1B and induce leptin resistance through both leptin-dependent and -independent mechanisms

    White, Christy L.; Whittington, Amy; Barnes, Maria J.; Wang, Zhong; Bray, George A; Morrison, Christopher D.

    2008-01-01

    Protein tyrosine phosphatase 1B (PTP1B) contributes to leptin resistance by inhibiting intracellular leptin receptor signaling. Mice with whole body or neuron-specific deletion of PTP1B are hypersensitive to leptin and resistant to diet-induced obesity. Here we report a significant increase in PTP1B protein levels in the mediobasal hypothalamus (P = 0.003) and a concomitant reduction in leptin sensitivity following 28 days of high-fat (HF) feeding in rats. A significant increase in PTP1B mRNA...

  20. Relationship between genetic polymorphisms of ALDH2 and ADH1B and esophageal cancer risk:A meta-analysis

    Akira; Yokoyama; Tetsuji; Yokoyama

    2010-01-01

    AIM:To evaluate the contribution of alcohol dehydrogenase-1B(ADH1B)and aldehyde dehydrogenase-2 (ALDH2)polymorphisms to the risk of esophageal cancer.METHODS:Nineteen articles were included by searching MEDLINE,EMBASE and the Chinese Biomedical Database,13 on ADH1B and 18 on ALDH2.We performed a meta-analysis of case-control studies including 13 studies on ADH1B(cases/controls:2390/7100)and 18 studies on ALDH2(2631/6030).RESULTS:The crude odds ratio[OR(95%confidence interval)]was 2.91(2.04-4.14)for ADH1B*1/...

  1. Study of structural transformations in Fe83W1B16 alloy resulting from natural aging

    Structural transformations taking place in amorphous Fe83W1B16 alloy as a result of its natural aging are investigated by Moessbauer spectroscopy and thermomagnetic analysis methods. Spatial inhomogeneity of changes in the atom closest vicinity and its effect on the alloy magnetization temperature dependence progress are ascertained. 9 refs.; 3 figs

  2. Insertional Mutagenesis Identifies a STAT3/Arid1b/β-catenin Pathway Driving Neurofibroma Initiation

    Jianqiang Wu

    2016-03-01

    Full Text Available To identify genes and signaling pathways that initiate Neurofibromatosis type 1 (NF1 neurofibromas, we used unbiased insertional mutagenesis screening, mouse models, and molecular analyses. We mapped an Nf1-Stat3-Arid1b/β-catenin pathway that becomes active in the context of Nf1 loss. Genetic deletion of Stat3 in Schwann cell progenitors (SCPs and Schwann cells (SCs prevents neurofibroma formation, decreasing SCP self-renewal and β-catenin activity. β-catenin expression rescues effects of Stat3 loss in SCPs. Importantly, P-STAT3 and β-catenin expression correlate in human neurofibromas. Mechanistically, P-Stat3 represses Gsk3β and the SWI/SNF gene Arid1b to increase β-catenin. Knockdown of Arid1b or Gsk3β in Stat3fl/fl;Nf1fl/fl;DhhCre SCPs rescues neurofibroma formation after in vivo transplantation. Stat3 represses Arid1b through histone modification in a Brg1-dependent manner, indicating that epigenetic modification plays a role in early tumorigenesis. Our data map a neural tumorigenesis pathway and support testing JAK/STAT and Wnt/β-catenin pathway inhibitors in neurofibroma therapeutic trials.

  3. Insertional Mutagenesis Identifies a STAT3/Arid1b/β-catenin Pathway Driving Neurofibroma Initiation.

    Wu, Jianqiang; Keng, Vincent W; Patmore, Deanna M; Kendall, Jed J; Patel, Ami V; Jousma, Edwin; Jessen, Walter J; Choi, Kwangmin; Tschida, Barbara R; Silverstein, Kevin A T; Fan, Danhua; Schwartz, Eric B; Fuchs, James R; Zou, Yuanshu; Kim, Mi-Ok; Dombi, Eva; Levy, David E; Huang, Gang; Cancelas, Jose A; Stemmer-Rachamimov, Anat O; Spinner, Robert J; Largaespada, David A; Ratner, Nancy

    2016-03-01

    To identify genes and signaling pathways that initiate Neurofibromatosis type 1 (NF1) neurofibromas, we used unbiased insertional mutagenesis screening, mouse models, and molecular analyses. We mapped an Nf1-Stat3-Arid1b/β-catenin pathway that becomes active in the context of Nf1 loss. Genetic deletion of Stat3 in Schwann cell progenitors (SCPs) and Schwann cells (SCs) prevents neurofibroma formation, decreasing SCP self-renewal and β-catenin activity. β-catenin expression rescues effects of Stat3 loss in SCPs. Importantly, P-STAT3 and β-catenin expression correlate in human neurofibromas. Mechanistically, P-Stat3 represses Gsk3β and the SWI/SNF gene Arid1b to increase β-catenin. Knockdown of Arid1b or Gsk3β in Stat3(fl/fl);Nf1(fl/fl);DhhCre SCPs rescues neurofibroma formation after in vivo transplantation. Stat3 represses Arid1b through histone modification in a Brg1-dependent manner, indicating that epigenetic modification plays a role in early tumorigenesis. Our data map a neural tumorigenesis pathway and support testing JAK/STAT and Wnt/β-catenin pathway inhibitors in neurofibroma therapeutic trials. PMID:26904939

  4. Haploinsufficiency of the STX1B gene is associated with myoclonic astatic epilepsy

    Vlaskamp, Danique R.M.; Rump, Patrick; Callenbach, Petra M.C.; Vos, Yvonne J.; Sikkema-Raddatz, Birgit; van Ravenswaaij-Arts, Conny M.A.; Brouwer, Oebele F.

    2016-01-01

    We describe an 18-year-old male patient with myoclonic astatic epilepsy (MAE), moderate to severe intellectual disability, behavioural problems, several dysmorphisms and a 1.2-Mb de novo deletion on chromosome 16p11.2. This deletion results in haploinsufficiency of STX1B and other genes. Recently, v

  5. Isolation of transformation-defective, replication-nondefective early region 1B mutants of adenovirus 12

    The authors isolated three adenovirus 12 early region 1B mutants (in205B, in205C, and dl205) by ligation of the cleaved DNA-protein complex and transfection of human embryo kidney cells with the ligation products. These mutants could replicate efficiently in human embryo kidney or KB cells but showed markedly reduced transforming capacities both in vitro and in vivo. In cells infected with the mutants, the early region 1B gene was transcribed efficiently. In cells infected with in205B, the products corresponding to the early region 1B-coded 19,000-molecular-weight polypeptide was detected by in vitro translation but not immunoprecipitated extract of labeled cells. In cells infected with in205C or dl205, the products corresponding to the same polypeptide were not detected by either in vitro translation or immunoprecipitation of labeled cell extracts. The results suggest that the 19,000-molecular-weight polypeptide encoded by early region 1B is required for cell transformation but not for viral propagation

  6. Human CRISP-3 binds serum alpha(1)B-glycoprotein across species

    Udby, Lene; Johnsen, Anders H; Borregaard, Niels

    2010-01-01

    CRISP-3 was previously shown to be bound to alpha(1)B-glycoprotein (A1BG) in human serum/plasma. All mammalian sera are supposed to contain A1BG, although its presence in rodent sera is not well-documented. Since animal sera are often used to supplement buffers in experiments, in particular such...

  7. Brevenal inhibits pacific ciguatoxin-1B-induced neurosecretion from bovine chromaffin cells.

    César Mattei

    Full Text Available Ciguatoxins and brevetoxins are neurotoxic cyclic polyether compounds produced by dinoflagellates, which are responsible for ciguatera and neurotoxic shellfish poisoning (NSP respectively. Recently, brevenal, a natural compound was found to specifically inhibit brevetoxin action and to have a beneficial effect in NSP. Considering that brevetoxin and ciguatoxin specifically activate voltage-sensitive Na+ channels through the same binding site, brevenal has therefore a good potential for the treatment of ciguatera. Pacific ciguatoxin-1B (P-CTX-1B activates voltage-sensitive Na+ channels and promotes an increase in neurotransmitter release believed to underpin the symptoms associated with ciguatera. However, the mechanism through which slow Na+ influx promotes neurosecretion is not fully understood. In the present study, we used chromaffin cells as a model to reconstitute the sequence of events culminating in ciguatoxin-evoked neurosecretion. We show that P-CTX-1B induces a tetrodotoxin-sensitive rise in intracellular Na+, closely followed by an increase in cytosolic Ca2+ responsible for promoting SNARE-dependent catecholamine secretion. Our results reveal that brevenal and beta-naphtoyl-brevetoxin prevent P-CTX-1B secretagogue activity without affecting nicotine or barium-induced catecholamine secretion. Brevenal is therefore a potent inhibitor of ciguatoxin-induced neurotoxic effect and a potential treatment for ciguatera.

  8. A complex selection signature at the human AVPR1B gene

    Cagliani Rachele

    2009-06-01

    Full Text Available Abstract Background The vasopressin receptor type 1b (AVPR1B is mainly expressed by pituitary corticotropes and it mediates the stimulatory effects of AVP on ACTH release; common AVPR1B haplotypes have been involved in mood and anxiety disorders in humans, while rodents lacking a functional receptor gene display behavioral defects and altered stress responses. Results Here we have analyzed the two exons of the gene and the data we present suggest that AVPR1B has been subjected to natural selection in humans. In particular, analysis of exon 2 strongly suggests the action of balancing selection in African populations and Europeans: the region displays high nucleotide diversity, an excess of intermediate-frequency alleles, a higher level of within-species diversity compared to interspecific divergence and a genealogy with common haplotypes separated by deep branches. This relatively unambiguous situation coexists with unusual features across exon 1, raising the possibility that a nonsynonymous variant (Gly191Arg in this region has been subjected to directional selection. Conclusion Although the underlying selective pressure(s remains to be identified, we consider this to be among the first documented examples of a gene involved in mood disorders and subjected to natural selection in humans; this observation might add support to the long-debated idea that depression/low mood might have played an adaptive role during human evolution.

  9. Evidence for protein 4.1B acting as a metastasis suppressor

    Cavanna, T.; Pokorná, Eva; Veselý, Pavel; Gray, C.; Zicha, D.

    2007-01-01

    Roč. 120, č. 4 (2007), s. 606-616. ISSN 0021-9533 Institutional research plan: CEZ:AV0Z50520514 Keywords : 4.1B protein * metastasis * migration Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.383, year: 2007

  10. Mirror Advanced Reactor Study (MARS). Final report. Volume 1-B. Commercial fusion electric plant

    Donohue, M.L.; Price, M.E. (eds.)

    1984-07-01

    Volume 1-B contains the following chapters: (1) blanket and reflector; (2) central cell shield; (3) central cell structure; (4) heat transport and energy conversion; (5) tritium systems; (6) cryogenics; (7) maintenance; (8) safety; (9) radioactivity, activation, and waste disposal; (10) instrumentation and control; (11) balance of plant; (12) plant startup and operation; (13) plant availability; (14) plant construction; and (15) economic analysis.

  11. Synthesis of three bromophenols from red algae as PTP1B inhibitors

    Guo, Shuju; Li, Jing; Li, Ting; Shi, Dayong; Han, Lijun

    2011-01-01

    Bromophenols are a set of natural products widely distributed in seaweed, most of which exhibit interesting and useful biological activities. To develop a reliable and efficient synthetic route to these natural bromophenols, three of them, 3,4-dibromo-5-(2'-bromo-3',4'-dihydroxy-6'-methoxymethyl-benzyl)-benzene-1,2-diol (compound 9), 3,4-dibromo-5-(2'-bromo-6'-ethoxy methyl-3',4'-dihydroxybenzyl)-benzene-1,2-diol (compound 10), and 3-bromo-4-(3'-bromo-4',5'-dihydroxy benzyl)-5-(ethoxymethyl)-benzene-1,2-diol (compound 14), isolated from red marine algae, have been synthesized in eight steps with an overall yield of 14.4%, 14.4%, and 18.2% respectively, via a practical approach employing bromination, Wolff-Kishner-Huang reduction and a Friedel-Crafts reaction as key steps. The protein tyrosine phosphatase 1B (PTP1B) inhibitory activities of the synthetic compounds were evaluated by the colorimetric assay. The results show that these compounds are moderate PTP1B inhibitors. The synthesis of these bromophenol derivatives makes in vivo studies of their structure-activity relationships and inhibition activity against PTP1B possible.

  12. Johnston Atoll Site 1B-P 6/29/2000 14-15M

    US Fish and Wildlife Service, Department of the Interior — One-meter-square (1 meter x 1 meter) benthic substrate at Johnston Atoll, site 1B-P (16 47.147N, 169 27.695W), between 14 and 15 meters along a permanent transect.

  13. Triptan-induced contractile (5-HT1B receptor) responses in human cerebral and coronary arteries

    Edvinsson, Lars; Uddman, Erik; Wackenfors, Angelica; Davenport, Anthony; Longmore, Jenny; Malmsjö, Malin

    2005-01-01

    Triptans are agonists at 5-HT1B and 5-HT1D (where 5-HT is 5-hydroxytryptamine; serotonin) receptors and cause vasoconstriction of isolated blood vessels. The aim of the present study was to determine vasoconstrictor potency (EC50) of triptans in human coronary and cerebral arteries and to examine...

  14. Johnston Atoll Site 1B-P 6/29/2000 16-17M

    US Fish and Wildlife Service, Department of the Interior — One-meter-square (1 meter x 1 meter) benthic substrate at Johnston Atoll, site 1B-P (16 47.147N, 169 27.695W), between 16 and 17 meters along a permanent transect.

  15. Johnston Atoll Site 1B-P 6/29/2000 5-6M

    US Fish and Wildlife Service, Department of the Interior — One-meter-square (1 meter x 1 meter) benthic substrate at Johnston Atoll, site 1B-P (16 47.147N, 169 27.695W), between 5 and 6 meters along a permanent transect.

  16. ISEcp1B-Mediated Transposition of blaCTX-M in Escherichia coli

    Poirel, Laurent; Lartigue, Marie-Frédérique; Decousser, Jean-Winoc; Nordmann, Patrice

    2005-01-01

    Several expanded-spectrum β-lactamase blaCTX-M genes are associated with ISEcp1-like elements in Enterobacteriaceae. We found that ISEcp1B was able to mobilize the adjacent blaCTX-M-19 gene by a transpositional mechanism in Escherichia coli by recognizing a variety of DNA sequences as right inverted repeats.

  17. Interaction of CPCCOEt with a chimeric mGlu1b and calcium sensing receptor

    Bräuner-Osborne, H; Jensen, Anders A.; Krogsgaard-Larsen, P

    1999-01-01

    7-Hydroxyiminocyclopropan[b]chromen-1a-carboxylic acid ethyl ester (CPCCOEt) has previously been shown to be a selective non-competitive antagonist at the metabotropic glutamate (mGlu) receptor subtype 1. In this study we have tested the effect of CPCCOEt on mGlu1b, the calcium sensing receptor (...

  18. Johnston Atoll Site 1B-P 6/29/2000 28-29M

    US Fish and Wildlife Service, Department of the Interior — One-meter-square (1 meter x 1 meter) benthic substrate at Johnston Atoll, site 1B-P (16 47.147N, 169 27.695W), between 28 and 29 meters along a permanent transect.

  19. ISEcp1B-Mediated Transposition of blaCTX-M in Escherichia coli

    Poirel, Laurent; Lartigue, Marie-Frédérique; Decousser, Jean-Winoc; Nordmann, Patrice

    2005-01-01

    Several expanded-spectrum β-lactamase blaCTX-M genes are associated with ISEcp1-like elements in Enterobacteriaceae. We found that ISEcp1B was able to mobilize the adjacent blaCTX-M-19 gene by a transpositional mechanism in Escherichia coli by recognizing a variety of DNA sequences as right inverted repeats. PMID:15616333

  20. Mirror Advanced Reactor Study (MARS). Final report. Volume 1-B. Commercial fusion electric plant

    Volume 1-B contains the following chapters: (1) blanket and reflector; (2) central cell shield; (3) central cell structure; (4) heat transport and energy conversion; (5) tritium systems; (6) cryogenics; (7) maintenance; (8) safety; (9) radioactivity, activation, and waste disposal; (10) instrumentation and control; (11) balance of plant; (12) plant startup and operation; (13) plant availability; (14) plant construction; and (15) economic analysis

  1. 2D numerical comparison of trailing edge flaps - UpWind WP1B3

    Buhl, Thomas; Andersen, Peter Bjørn; Barlas, T.K.

    This report covers the investigations and comparisons of trailing edge flaps carried out by Delft and Risø. The work is a part of the W1B3 work package of the UpWind EU-project. This report covers only 2D test cases with simple control of the trailing edge flap with the objective of keeping CL...

  2. Ab initio valence calculations in chemistry

    Cook, D B

    1974-01-01

    Ab Initio Valence Calculations in Chemistry describes the theory and practice of ab initio valence calculations in chemistry and applies the ideas to a specific example, linear BeH2. Topics covered include the Schrödinger equation and the orbital approximation to atomic orbitals; molecular orbital and valence bond methods; practical molecular wave functions; and molecular integrals. Open shell systems, molecular symmetry, and localized descriptions of electronic structure are also discussed. This book is comprised of 13 chapters and begins by introducing the reader to the use of the Schrödinge

  3. Patient satisfaction with the BETACONNECT™ autoinjector for interferon beta-1b

    Weller I

    2015-07-01

    Full Text Available Ivonne Weller,1 Anna Saake,1 Thomas Schreiner,1 Julika Vogelreuter,1 Nicolas Petroff2 1Bayer Vital GmbH, Leverkusen, Germany; 2Vitartis Medizin-Service GmbH, Göttingen, Germany Purpose: Multiple sclerosis (MS is a chronic demyelinating, degenerative disease requiring long-term treatment. Patient adherence to treatment may be challenging in such scenarios, especially since treatment often involves self-injection, for example, with interferon beta-1b during therapy. BETACONNECT™ is a novel electronic autoinjector for patient support in interferon beta-1b administration. The purpose of this survey was to assess patient satisfaction with the BETACONNECT™ device and its features.Patients and methods: A total of 2,299 MS patients using the BETACONNECT™ device were asked to participate in a survey in October 2014. All of these candidates participated in the BETAPLUS® program and had provided written informed consent. The participants were asked to answer 13 device-related questions.Results: Of these candidates, 1,365 replied to the questionnaire, with more than 60% of the participants being 40–59 years of age. Among them, 69% were women and 21% were men (10% not specified. Approximately half of the participants received treatment with interferon beta-1b for more than 5 years. Most participants (85% had used self-injection devices before, with 59% previously using BETACOMFORT®, 23% using BETAJECT® Comfort, and 3% using BETAJECT® Lite, while less than 4% manually injected interferon beta-1b. The majority of the participants had received the BETACONNECT™ device from a BETAPLUS® nurse (87% and 48% had already used the device for more than 2 months (49% for 2 months or less. Among the participants, more than 90% evaluated the BETACONNECT™ device as “very helpful” or “helpful” in supporting their interferon beta-1b therapy with only marginal sex differences. Features that were rated “very important” by more than half of the

  4. Estimation of evapotranspiration over heterogeneous surfaces based on HJ1B satellite data in China

    Xin, Xiaozhou; Jiao, Jingjun

    2014-05-01

    The HJ1B satellite of China is equipped with two CCD cameras with 30m resolution and one infrared multispectral camera with 300m resolution. And the revisit period of HJ1B satellite is 4 days. Compared to MODIS or TM, HJ1B data has the advantage of high spatial-temporal resolution. Methodology based on the one-source energy balance model was developed for net radiation (Rn), soil heat flux (G), sensible heat flux (H) and latent heat flux (LE) estimation from HI1B data. The core procedure is a scheme that was designed for correcting the spatial scale error over heterogeneous surfaces by taking advantage of the HJ1B data characteristics, i.e., high resolution CCD data (30m) along with thermal data (300m). First of all, a regression relationship between Ts and NDVI was built up at 300m resolution based on the data of Ts and NDVI of the selected "pure" pixels. And then the relationship function was applied at 30m resolution to derive Ts at high resolution, i.e., at the subpixel level. Furthermore, the 30m land class data was also used in the parameterization of surface energy balance and surface aerodynamic transfer, which is important since significant error may be resulted by using one land class type to represent the whole mixed pixel. By using high resolution NDVI and land class data, we are able to mitigate the spatial scale error of the mixed pixels at 300m resolution. At last, the 300m surface energy fluxes were obtained by aggregation of the 30m estimation. HJ1B data at Hai river basin in north China in 2010 were used to verify this method. The eddy-correlation system data were used as validation. The results of the method were compared with the results of a simple method that estimates the fluxes at 300m by aggregating all of the input parameters to 300m. It is shown that the method proposed in this study shows higher agreement with in-suit measurement, and the fluxes maps also show much more details of the spatial variation. By using this method, it can be

  5. Preclinical pharmacology and pharmacokinetics of AZD3783, a selective 5-hydroxytryptamine 1B receptor antagonist.

    Zhang, Minli; Zhou, Diansong; Wang, Yi; Maier, Donna L; Widzowski, Daniel V; Sobotka-Briner, Cynthia D; Brockel, Becky J; Potts, William M; Shenvi, Ashok B; Bernstein, Peter R; Pierson, M Edward

    2011-11-01

    The preclinical pharmacology and pharmacokinetic properties of (2R)-6-methoxy-8-(4-methylpiperazin-1-yl)-N-(4-morpholin-4-ylphenyl)chromane-2-carboxamide (AZD3783), a potent 5-hydroxytryptamine 1B (5-HT(1B)) receptor antagonist, were characterized as part of translational pharmacokinetic/pharmacodynamic hypothesis testing in human clinical trials. The affinity of AZD3783 to the 5-HT(1B) receptor was measured in vitro by using membrane preparations containing recombinant human or guinea pig 5-HT(1B) receptors and in native guinea pig brain tissue. In vivo antagonist potency of AZD3783 for the 5HT(1B) receptor was investigated by measuring the blockade of 5-HT(1B) agonist-induced guinea pig hypothermia. The anxiolytic-like potency was assessed using the suppression of separation-induced vocalization in guinea pig pups. The affinity of AZD3783 for human and guinea pig 5-HT(1B) receptor (K(i), 12.5 and 11.1 nM, respectively) was similar to unbound plasma EC(50) values for guinea pig receptor occupancy (11 nM) and reduction of agonist-induced hypothermia (18 nM) in guinea pig. Active doses of AZD3783 in the hypothermia assay were similar to doses that reduced separation-induced vocalization in guinea pig pups. AZD3783 demonstrated favorable pharmacokinetic properties. The predicted pharmacokinetic parameters (total plasma clearance, 6.5 ml/min/kg; steady-state volume of distribution, 6.4 l/kg) were within 2-fold of the values observed in healthy male volunteers after a single 20-mg oral dose. This investigation presents a direct link between AZD3783 in vitro affinity and in vivo receptor occupancy to preclinical disease model efficacy. Together with predicted human pharmacokinetic properties, we have provided a model for the quantitative translational pharmacology of AZD3783 that increases confidence in the optimal human receptor occupancy required for antidepressant and anxiolytic effects in patients. PMID:21825000

  6. Spatial-Temporal Study of Rab1b Dynamics and Function at the ER-Golgi Interface

    Martinez, Hernán; García, Iris A.; Sampieri, Luciana

    2016-01-01

    The GTPase Rab1b is involved in ER to Golgi transport, with multiple Rab1b effectors (located at ERES, VTCs and the Golgi complex) being required for its function. In this study, we performed live-cell dual-expression studies to analyze the dynamics of Rab1b and some effectors located at the ERES-Golgi interface. Rab1b occupied widely distributed mobile punctate and tubular structures, displaying a transient overlaps with its effectors and showing that these overlaps occurred at the same time in spatially distinct steps of ER to Golgi transport. In addition, we assessed Rab1b dynamics during cargo sorting by analyzing the concentration at ERES of a Golgi protein (SialT2-CFP) during Brefeldin A washout (BFA WO). Rab1b was associated to most of the ERES structures, but at different times during BFA WO, and recurrently SialT2-CFP was sorted in the ERES-Rab1b positive structures. Furthermore, we reveal for first time that Rab1b localization time at ERES depended on GBF1, a Rab1b effector that acts as the guanine nucleotide exchange factor of Arf1, and that Rab1b membrane association/dissociation dynamics at ERES was dependent on the GBF1 membrane association and activity, which strongly suggests that GBF1 activity modulates Rab1b membrane cycling dynamic. PMID:27500526

  7. The Polycomb protein and E3 ubiquitin ligase Ring1B harbors an IRES in its highly conserved 5' UTR.

    Erwin Boutsma

    Full Text Available Ring1B is an essential member of the highly conserved Polycomb group proteins, which orchestrate developmental processes, cell growth and stem cell fate by modifying local chromatin structure. Ring1B was found to be the E3 ligase that monoubiquitinates histone H2A, which adds a new level of chromatin modification to Polycomb group proteins. Here we report that Ring1B belongs to the exclusive group of proteins that for their translation depend on a stable 5' UTR sequence in their mRNA known as an Internal Ribosome Entry Site (IRES. In cell transfection assays the Ring1B IRES confers significantly higher expression levels of Ring1B than a Ring1B cDNA without the IRES. Also, dual luciferase assays show strong activity of the Ring1B IRES. Although our findings indicate Ring1B can be translated under conditions where cap-dependent translation is impaired, we found the Ring1B IRES to be cap-dependent. This raises the possibility that translational control of Ring1B is a multi-layered process and that translation of Ring1B needs to be maintained under varying conditions, which is in line with its essential role as an E3 ligase for monoubiquitination of histone H2A in the PRC1 Polycomb protein complex.

  8. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    Souto, F.J.; Haskin, F.E. [Univ. of New Mexico, Albuquerque, NM (United States). Dept. of Chemical and Nuclear Engineering; Kmetyk, L.N. [Sandia National Labs., Albuquerque, NM (United States)

    1994-10-01

    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS.

  9. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS

  10. Cryptochrome 1b: a possible inducer of visual lateralization in pigeons?

    Ströckens, Felix; Güntürkün, Onur

    2016-01-01

    The visual system of adult pigeons shows a lateralization of object discrimination with a left hemispheric dominance on the behavioural, physiological and anatomical levels. The crucial trigger for the establishment of this asymmetry is the position of the embryo inside the egg, which exposes the right eye to light falling through the egg shell. As a result, the right-sided retina is more strongly stimulated with light during embryonic development. However, it is unknown how this embryonic light stimulation is transduced to the brain as rods and cones are not yet functional. A possible solution could be the blue-light-sensitive molecule cryptochrome 1 (Cry1), which is expressed in retinal ganglion cells (RGCs) of several mammalian and avian species. RGCs have been shown to be functional during the time of induction of asymmetry and possess projections to primary visual areas. Therefore, Cry1-containing RGCs could be responsible for induction of asymmetry. The aim of this study was to identify the expression pattern of the Cry1 subtype Cry1b in the retina of embryonic, post-hatch and adult pigeons by immunohistochemical staining and to show whether Cry1b-containing RGCs project to the optic tectum. Cry1b-positive cells were indeed mainly found in the RGC layer and to lesser extent in the inner nuclear layer at all ages, including the embryonic stage. Tracing in adult animals revealed that at least a subset of Cry1b-containing RGCs project to the optic tectum. Thus, Cry1b-containing RGCs within the embryonic retina could be involved in the induction of asymmetries in the visual system of pigeons. PMID:26535920

  11. Interleukin 1B Variant -1473G/C (rs1143623) Influences Triglyceride and Interleukin 6 Metabolism

    Delgado-Lista, Javier; Garcia-Rios, Antonio; Perez-Martinez, Pablo; Solivera, Juan; Yubero-Serrano, Elena M.; Fuentes, Francisco; Parnell, Laurence D.; Shen, Jian; Gomez, Purificacion; Jimenez-Gomez, Yolanda; Gomez-Luna, Maria J.; Marin, Carmen; Belisle, Sarah E.; Rodriguez-Cantalejo, Fernando; Meydani, Simin N.; Ordovas, Jose M.; Perez-Jimenez, Francisco

    2011-01-01

    Context: IL1b (IL1B or IL1β), a key modulator of the immune response, exerts its functions mainly via IL6 regulation. Fatty meals cause transient hypertriglyceridemia and are considered to be proinflammatory, but the extent of these responses shows high interindividual susceptibility. Objective: We evaluated the influence of a genetic variant located in the promoter region of IL1B (-1473G/C) on fasting and postprandial lipids and IL6. Design, Setting, and Participants: A total of 477 people over age 65 yr were genotyped for IL1B -1473G/C, and we evaluated fasting lipids depending on genotype. Then, 88 healthy young men were also genotyped and were fed a saturated fatty acid-rich meal. Serial blood samples were drawn for 11 h after the meal, and lipid fractions and IL6 were assayed. Main Outcome and Interventions: Fasting lipids were studied in the aged persons. Fasting and postprandial measurements of lipids and IL6 were performed in the healthy young men. Results: In the aged persons, CC subjects (minor allele homozygotes) showed higher triglyceride (P = 0.002) and cholesterol (P = 0.011) levels. Healthy young male carriers of the minor C allele showed higher postprandial triglycerides (P = 0.037), and those carried into large triglyceride-rich lipoproteins (P = 0.004). In addition, they showed higher postprandial IL6 concentrations (P = 0.008). Conclusions: Our work shows that inflammatory genes may regulate fasting and postprandial lipids because the carriers of the minor allele of an IL gene variant have altered lipid metabolism. To reinforce these gene-phenotype findings, IL6 (the natural effector of IL1B) was increased in these persons. PMID:21307135

  12. Potent water extracts of Indonesian medicinal plants against PTP1B

    Azis Saifudin; Tepy Usia; Subehan AbLallo; Hiroyuki Morita; Ken Tanaka; Yasuhiro Tezuka

    2016-01-01

    Objective: To examine the potent of water as a solvent agent in the preparation of traditional herbal medicine. Methods: Water extracts of 18 plants were prepared through reflux and examined (25 mg/mL) to evaluate their possibility for inhibiting protein tyrosine phosphatase 1B (PTP1B). The determination of IC50 values was performed for the samples possessing more than 80% inhibition. Meanwhile, those exhibiting IC50 values more than 7.0 mg/mL were further profiled for their chemical constituents through nuclear magnetic resonance (NMR) measurement. Results: About 44% (8) of the examined samples showed more than 80% inhibition against PTP1B. The water extracts of Elephantopus scaber, Helicteres isora aerial parts, Elaeocarpus grandiflorus (E. grandiflorus) fruits, Melaleuca leucadendron leaves, and Quercus infectoria gum had IC50 values ranging from 2.05 to 6.90 mg/mL. Meanwhile, Andropogon nardus and Centella asiatica were at the area of d 3.0–4.0 ppm. Further, the 13C NMR observation of samples possessing the most intensive signals in their proton NMR Cinnamomum burmannii and E. grandiflorus showed the peaks at the area of d 60–90 ppm as the supportive evidence for sugar group signals. Intriguingly, a disaccharide from E. grandiflorus could be an active inhibitor towards PTB1B. Conclusions: In contrast to the mainstream solvents currently used in modern herbal manufactures especially Jamu medicine in Indonesia, pure-water-extracted materials should be reconsidered and could be reemerged for future studies and for the manufacture of herbal medicines. In addition, the activity of Jamu components should be confirmed that their antidiabetes and antiobesity activities could be through the inhibition of PTP1B.

  13. Improved age constraints for the AB Dor quadruple system - The binary nature of AB Dor B

    Janson, M; Lenzen, R; Close, L; Nielsen, E; Hartung, M; Henning, T; Bouy, H; Janson, Markus; Brandner, Wolfgang; Lenzen, Rainer; Close, Laird; Nielsen, Eric; Hartung, Markus; Henning, Thomas; Bouy, Herve

    2006-01-01

    We present resolved NACO photometry of the close binary AB Dor B in H- and Ks-band. AB Dor B is itself known to be a wide binary companion to AB Dor A, which in turn has a very low-mass close companion named AB Dor C. These four known components make up the young and dynamically interesting system AB Dor, which will likely become a benchmark system for calibrating theoretical pre-main sequence evolutionary mass tracks for low-mass stars. However, for this purpose the actual age has to be known, and this subject has been a matter of discussion in the recent scientific literature. We compare our resolved photometry of AB Dor Ba and Bb with theoretical and empirical isochrones in order to constrain the age of the system. This leads to an age estimate of about 50 to 100 Myr. We discuss the implications of such an age range for the case of AB Dor C, and compare with other results in the literature.

  14. 40 CFR 721.8100 - Potassium N,N-bis (hydroxy-ethyl) cocoamine oxide phosphate, and potassium N,N-bis (hy-droxy...

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Potassium N,N-bis (hydroxy-ethyl) cocoamine oxide phosphate, and potassium N,N-bis (hy-droxy-ethyl) tal-lo-wa-mine oxide phos-phate. 721.8100... Substances § 721.8100 Potassium N,N-bis (hydroxy-ethyl) cocoamine oxide phosphate, and potassium N,N-bis...

  15. The Flammability of ABS/PET/APP Mixtures with Different Synergic Agents%不同协效剂对APP膨胀阻燃ABS/PET合金的影响

    赵国栋; 潘治梁; 蔡绪福

    2011-01-01

    ABS/PET/APP mixtures with different synergic agents (SA) were prepared for investigating the effect of SA (2, 2' - bis ( 2 - oxazoline) (BOZ), thermoplastic phenolic resins (TPPF), manganese dioxide, montmorillonite (MMT), zinc borate, 4A Zeolite,zinc oxide (ZnO), and attapulgite on the flame retardancy of mixtures, and the thermal degradation and charring of ABS/PET/APP was analyzed. It was concluded that a novel intumescent flame retardant containing APP ( acid source and a blowing agent) and PET (carbon source) was obtained because APP mainly catalyzed PET to degrade into charring in ABS/PET/APP mixture on heating. The flammability of ABS/PET/APP mixtures with different SA was measured by the limited oxygen index (LOI) and UL-94 tests. Except for ABS/PET/APP/attapulgite mixture, ABS/PET/APP mixtures with other SA all passed the V-0 rating in UL-94 tests, the LOI of which was improved compare with ABS/PET/APP mixture. Thermo-oxidative degradation behaviors of mixtures were analyzed by thermal gravimetric analyzer (TGA), which showed an increasing char yield of ABS/PET/APP mixtures due to the addition of SA. And scanning electron microcopy (SEM) showed the denser carbon layer formation on the surface of ABS/PET/APP mixtures with SA ( except for attapulgite) after burning.%研究了8种协效剂(双噁唑啉、热塑性酚醛树脂、二氧化锰、蒙脱土、硼酸锌、4A分子筛、氧化锌和凹凸棒)对APP膨胀阻燃ABS/PET合金的影响,并探讨了ABS/PET/APP体系的降解成炭行为.研究表明,APP主要促进了PET分解成炭从而与其成为一种新型膨胀阻燃体系.通过氧指数(LOI)和UL-94标准测试燃烧性能,除凹凸棒外,其它7种协效剂均提高了ABS/PET/APP体系的氧指数,并使其通过V-0级测试;热失重分析(TGA)表明,ABS/PET/APP/协效剂体系具有更高的成炭率;通过扫描电子显微镜(SEM)对炭层表面进行观察,除凹凸棒体系外,其它7种协效剂体系的炭层表面均具有更好的致密性.

  16. catena-Poly[[bis(ethanol-κOmanganese(II]-μ-2,5-dichloro-3,6-dioxocyclohexa-1,4-diene-1,4-bis(olato-κ4O1,O6:O3,O4

    Seiya Tanaka

    2014-03-01

    Full Text Available In the title coordination polymer, [Mn(C6Cl2O4(C2H5OH2]n, the MnII atom and the chloranilate [systematic name: 2,5-dichloro-3,6-dioxocyclohexa-1,4-diene-1,4-bis(olate] ion lie on crystallographic inversion centers. The geometry around the MnII atom is a distorted octahedron involving four O atoms of two chloranilate ions and two O atoms from two ethanol molecules. The chloranilate ion serves as a bridging ligand between the MnII ions, leading to an infinite linear chain along the b-axis direction. The chains are linked by O—H...O hydrogen bonds between the apically coordinating ethanol molecule and the chloranilate ion, affording a two-dimensional layer expanding parallel to the ab plane.

  17. Ab interno trabeculectomy: A comprehensive review

    Ting Ting Liu

    2013-07-01

    Full Text Available PURPOSE To summarize the original literature on ab interno trabeculectomy with the Trabectome system and to review its efficacy and safety in the treatment of glaucoma. METHOD A literature search in PubMed was performed on ab interno trabeculectomy with the Trabectome system, and clinical relevant information was reviewed and summarized. RESULTS Ab interno trabeculectomy with the Trabectome system on average lowered intraocular pressure (IOP to the mid-teens, and decreased the number of required glaucoma medications. Greater preoperative IOP correlated to a greater percent reduction in IOP. The success rates varied among studies, and the definition of success differed by authors. Intraoperative blood reflux was found in nearly all cases. Incidences of early hypotony and IOP spikes were low. No cases of endophthalmitis, wound leak, aqueous misdirection, choroidal hemorrhage or effusions, and irreversible visual acuity decrease (≥2 Snellen lines have been reported. Available studies had a significant amount of data overlap. Only limited data on long-term results was available. There was no randomized controlled trial to date. CONCLUSIONS Ab interno trabeculectomy with the Trabectome system is an effective and safe surgical approach for patients with various types of open angle glaucoma. On average, the procedure at least in the short term lowers IOP to the mid teens regardless of preoperative IOP with or without the aid of topical medications.

  18. Reference: DREDR1ATRD29AB [PLACE

    Full Text Available DREDR1ATRD29AB Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, N... ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant J. 34: 137-148 (2003) PubMed: 12694590; ...

  19. Preparation of national standard product of Anti-TgAb and Anti-TpoAb in our laboratory

    Objective: To standardize the China-made quantitative immunoassay kits of Anti-TgAb and Anti-TpoAb with a national standdized product of Anti-TgAb and And-TpoAb developed in our laboratory. Methods and Results: Higher titer Anti - TgAb and Anti-TpoAb serum specimens were pooled and treated with centrifuging and filtering, then freeze-dried and packaged into 2ml anpoules for preparing the national standard candidate. The results of the collaborative study showed that, the immuno-activity of the Anti-TgAb was 3916 IU/Amp in term of the 65/093, and the immuno-activity of the Anti-TpoAb was 434 IU/Amp in term of the 66/387. Conclusion: On the basis of the present study, it is proposed that the candidate standard be established as the National Standard for Anti-TgAb and Anti-TpoAb for immunoassay, the immunoactivity of the Anti-TgAb 4000IU/Amp, and that of Anti - TpoAb is 430IU/Amp. A comparative study on the quality of immunoassay kits of Anti-TgAb and Anti-TpoAb by Axsym System, Immulite 1000, Modular Analytics El70, ADVIA Centaur Assay (the most commonly used types in China) is also presented. (authors)

  20. Safety assessment of bis-diglyceryl polyacyladipate-2 and bis-diglyceryl polyacyladipate-1 as used in cosmetics.

    Fiume, Monice M; Bergfeld, Wilma F; Belsito, Donald V; Hill, Ronald A; Klaassen, Curtis D; Liebler, Daniel C; Marks, James G; Shank, Ronald C; Slaga, Thomas J; Snyder, Paul W; Andersen, F Alan

    2013-01-01

    The Cosmetic Ingredient Review Expert Panel assessed the safety of bis-diglyceryl polyacyladipate-2 and bis-diglyceryl polyacyladipate-1 as used in cosmetics, finding that these ingredients are safe in cosmetic formulations in the present practices of use and concentration. Both ingredients are lanolin substitutes and are reported to function in cosmetics as skin-conditioning agents--emollients. The Panel reviewed available animal and clinical data in making its determination of safety. PMID:24174474

  1. Synergistic extraction of Eu(III) with N-phosphorylated bis-ureas and chlorinated cobalt bis(dicarbollide) ion

    Selucký, P.; Bubeníková, M.; Rais, J.; Grüner, Bohumír; Brusko, V.V.

    2013-01-01

    Roč. 101, č. 1 (2013), s. 27-31. ISSN 0033-8230 R&D Projects: GA ČR GA104/09/0668 Institutional support: RVO:61388980 Keywords : liquid-liquid extraction * lanthanides * actinides * N-phosphorylated bis-ureas * chlorinated cobalt bis(dicarbollide) ion * high level liquid waste Subject RIV: CA - Inorganic Chemistry Impact factor: 1.411, year: 2013

  2. Drug-drug interactions between rosuvastatin and oral antidiabetic drugs occurring at the level of OATP1B1.

    van de Steeg, E; Greupink, R; Schreurs, M; Nooijen, I H G; Verhoeckx, K C M; Hanemaaijer, R; Ripken, D; Monshouwer, M; Vlaming, M L H; DeGroot, J; Verwei, M; Russel, F G M; Huisman, M T; Wortelboer, H M

    2013-03-01

    Organic anion-transporting polypeptide 1B1 (OATP1B1) is an important hepatic uptake transporter, of which the polymorphic variant OATP1B1*15 (Asn130Asp and Val174Ala) has been associated with decreased transport activity. Rosuvastatin is an OATP1B1 substrate and often concomitantly prescribed with oral antidiabetics in the clinic. The aim of this study was to investigate possible drug-drug interactions between these drugs at the level of OATP1B1 and OATP1B1*15. We generated human embryonic kidney (HEK)293 cells stably overexpressing OATP1B1 or OATP1B1*15 that showed similar protein expression levels of OATP1B1 and OATP1B1*15 at the cell membrane as measured by liquid chromatography-tandem mass spectrometry. In HEK-OATP1B1*15 cells, the V(max) for OATP1B1-mediated transport of E(2)17β-G (estradiol 17β-d-glucuronide) was decreased >60%, whereas K(m) values (Michaelis constant) were comparable. Uptake of rosuvastatin in HEK-OATP1B1 cells (K(m) 13.1 ± 0.43 μM) was nearly absent in HEK-OATP1B1*15 cells. Interestingly, several oral antidiabetics (glyburide, glimepiride, troglitazone, pioglitazone, glipizide, gliclazide, and tolbutamide), but not metformin, were identified as significant inhibitors of the OATP1B1-mediated transport of rosuvastatin. The IC(50) values for inhibition of E(2)17β-G uptake were similar between OATP1B1 and OATP1B1*15. In conclusion, these studies indicate that several oral antidiabetic drugs affect the OATP1B1-mediated uptake of rosuvastatin in vitro. The next step will be to translate these data to the clinical situation, as it remains to be established whether the studied oral antidiabetics indeed affect the clinical pharmacokinetic profile of rosuvastatin in patients. PMID:23248200

  3. Preparation of 177Lu-DTPA-BIS-BIOTIN and biodistribution evaluation in normal mice

    The labeling method for 177Lu-DTPA-BIS-BIOTIN was established, and the biodistribution of 177Lu-DTPA-BIS-BIOTIN in normal mice was carried out as well. Under the optimal experimental condition (DTPA-BIS-BIOTIN 25 μg, pH=4.5 reacting at 80 degree C for 20 min), the labeling yield of 177Lu-DTPA-BIS-BIOTIN is more than 99.0%. 177Lu-DTPA-BIS-BIOTIN shows pretty good in vitro stability. The biodistribution of 177Lu-DTPA-BIS-BIOTIN in normal mice shows a rapid blood clearance. The uptake of 177Lu-DTPA-BIS-BIOTIN is mainly accumulated in liver, spleen and kidney. 177Lu-DTPA-BIS-BIOTIN is excreted by kidney. The results provide the basis for further study on 177Lu-DTPA-BIS-BIOTIN used in pretargeted radioimage and radiotherapy of cancer. (authors)

  4. On the Strain Rate Sensitivity of Abs and Abs Plus Fused Deposition Modeling Parts

    Vairis, A.; Petousis, M.; Vidakis, N.; Savvakis, K.

    2016-06-01

    In this work the effect of strain rate on the tensile strength of fused deposition modeling parts built with Acrylonitrile-butadiene-styrene (ABS) and ABS plus material is presented. ASTM D638-02a specimens were built with ABS and ABS plus and they were tested on a Schenck Trebel Co. tensile test machine at three different test speeds, equal, lower, and higher to the test speed required by the ASTM D638-02a standard. The experimental tensile strength results were compared and evaluated. The fracture surfaces of selected specimens were examined with a scanning electron microscope, to determine failure mode of the filament strands. It was found that, as the test speed increases, specimens develop higher tensile strength and have higher elastic modulus. Specimens tested in the highest speed of the experiment had on average about 10% higher elastic modulus and developed on average about 11% higher tensile strength.

  5. KINETIC ANALYSIS OF CO-CONDENSATION POLYMERIZATION OF AB2 AND AB MONOMERS

    Min-qiang Yu; Zhi-ping Zhou; De-yue Yan

    2004-01-01

    This work deals with the kinetics of co-condensation polymerization of AB2 and AB monomers, giving expressions of the two-dimensional molecular weight distribution function and the number/weight average molecular weights of the resulting copolymers. The two-dimensional molecular weight distribution depends on two indices, n and l, which are the respective numbers of AB2 and AB units in a copolymer species. The evolution of the two-dimensional weight and z distributions during the co-condensation polymerization has been evaluated systematically. Finally, the two-dimensional distribution was transformed into a one-dimensional molecular weight distribution with only one variable (the molecular weight of the products instead of the degree of polymerization). The calculated results show that the highly branched copolymer has a very broad molecular weight distribution when the co-condensation polymerization approaches completion.

  6. Leaching behaviour of the Swedish KBS-glasses ABS 39 and ABS 41

    The planned Swedish KBS glass corrosion investigation program comprises experiments with inactive glasses containing simulated waste, prolonged in-situ tests, the characterization of corrosion products, immiscibility studies, and corrosion experiments with hot glass. This presentation gives a short description of the entire program. It focuses thereafter on some recent leaching results with the inactive KBS glass qualities ABS 39 and ABS 41, which were leached in a manner similar to the PNL MCC-1 test procedure. 5 figures, 9 tables

  7. Thermomechanical properties of ABS/PA AND ABS/PC blends

    GUINAULT, Alain; Sollogoub, Cyrille

    2009-01-01

    International audience The significant increase of Waste Electric and Electronic Equipment (WEEE) has led to an important research in upgrading recycled engineering plastics by means of a blending technique. Classical twin-screw extrusion is compared to a new blending technique, where two polymers are combined together and then flow in several static mixers. This technique allows to obtain different morphologies of compatibilized ABS/PA or ABS/PC blends and the aim of this work is to evalu...

  8. AB077. Relationship of TPO-Ab and TSH with in vitro fertilization and embryo transfer

    Wang, Liyun

    2015-01-01

    Objective Study of thyroid peroxidase antibodies and thyroid stimulating effect on in vitro fertilization embryo transfer ending. Methods From March 2011 to October 2013 in the reproductive center in Qinghai Province People’s Hospital in vitro fertilization embryo transfer a total of 378 cycles were analyzed. (I) Basis for TPO-Ab grouping: research group is thyroid peroxidase antibody positive and thyroid function in patients with normal 69 cycles (TPO-Ab+ group), control group is thyroid per...

  9. Melatonin receptor 1B gene associated with hyperglycemia in bipolar disorder.

    Hukic, Dzana S; Lavebratt, Catharina; Frisén, Louise; Backlund, Lena; Hilding, Agneta; Gu, Harvest F; Östenson, Claes-Göran; Erlinge, David; Ehrenborg, Ewa; Schalling, Martin; Ösby, Urban

    2016-06-01

    Bipolar patients are at a higher risk of developing metabolic disorders. Cardiovascular morbidity and mortality is twice the rate reported in the population. Antipsychotic medication increases the risk of metabolic abnormalities. However, bipolar disorder and schizophrenia have a similarly increased mortality from cardiovascular causes of death, although bipolar patients medicate with antipsychotic drugs to a much smaller extent than schizophrenic patients. Bipolar disorder and schizophrenia share substantial genetic risk components; thus, increased metabolic abnormalities is hypothesized to be an effect of specific sets of metabolic risk genes, which might overlap with the metabolic risk genes in schizophrenia. This study reports that a functional genetic variant of MTNR1B, previously implicated in the impairment of glucose-stimulated insulin release also in schizophrenia, was associated with elevated fasting glucose levels in bipolar patients and controls. This finding suggests that the MTNR1B-dependent vulnerability for elevated fasting plasma glucose levels is shared between bipolar disorder and schizophrenia. PMID:26991397

  10. Synthesis and antiproliferative activity of imidazo[2,1-b][1,3,4]thiadiazole derivatives.

    Kumar, Sujeet; Gopalakrishnan, Vidya; Hegde, Mahesh; Rana, Vivek; Dhepe, Sharad S; Ramareddy, Sureshbabu A; Leoni, Alberto; Locatelli, Alessandra; Morigi, Rita; Rambaldi, Mirella; Srivastava, Mrinal; Raghavan, Sathees C; Karki, Subhas S

    2014-10-01

    A series of 2,5,6-substituted imidazo[2,1-b][1,3,4]thiadiazole derivatives have been prepared and were tested for antiproliferative activity on cancer cells at the National Cancer Institute. Results showed that molecules with a benzyl group at position 2, exhibited an increase in activity for the introduction of a formyl group at the 5 position. The compound 2-benzyl-5-formyl-6-(4-bromophenyl)imidazo[2,1-b][1,3,4]thiadiazole 22 has been chosen for understanding the mechanism of action by various molecular and cellular biology studies. Results obtained from cell cycle evaluation analysis, analysis of mitochondrial membrane potential and Annexin V-FITC by flow cytometric analysis, ROS production and expression of apoptotic and DNA-repair proteins suggested that compound 22 induced cytotoxicity by activating extrinsic pathway of apoptosis, however, without affecting cell cycle progression. PMID:25205189

  11. Intrinsic fluorescence spectra characteristics of vitamin B1, B2, and B6

    Yang, Hui; Xiao, Xue; Zhao, Xuesong; Hu, Lan; Lv, Caofang; Yin, Zhangkun

    2015-11-01

    This paper presents the intrinsic fluorescence characteristics of vitamin B1, B2 and B6 measured with 3D fluorescence Spectrophotometer. Three strong fluorescence areas of vitamin B2 locate at λex/λem=270/525nm, 370/525nm and 450/525nm, one fluorescence areas of vitamin B1 locates at λex/λem=370/460nm, two fluorescence areas of vitamin B6 locates at λex/λem=250/370nm and 325/370nm were found. The influence of pH of solution to the fluorescence profile was also discussed. Using the PARAFAC algorithm, 10 vitamin B1, B2 and B6 mixed solutions were successfully decomposed, and the emission profiles, excitation profiles, central wavelengths and the concentration of the three components were retrieved precisely through about 5 iteration times.

  12. Minimal gauged U(1) B-L model with spontaneous R parity violation.

    Barger, Vernon; Pérez, Pavel Fileviez; Spinner, Sogee

    2009-05-01

    We study the minimal gauged U(1) B-L supersymmetric model and show that it provides an attractive theory for spontaneous R-parity violation. Both U(1) B-L and R parity are broken by the vacuum expectation value of the right-handed sneutrino (proportional to the soft supersymmetry masses), thereby linking the B-L and soft SUSY scales. In this context we find a consistent mechanism for generating neutrino masses and a realistic mass spectrum, all without extending the Higgs sector of the minimal supersymmetry standard model. We discuss the most relevant collider signals and the connection between the Z' gauge boson and R-parity violation. PMID:19518859

  13. A Cadmium-transporting P1B-type ATPase in Yeast Saccharomyces cerevisiae*

    Adle, David J.; Sinani, Devis; Kim, Heejeong; Lee, Jaekwon

    2006-01-01

    Detoxification and homeostatic acquisition of metal ions are vital for all living organisms. We have identified PCA1 in yeast Saccharomyces cerevisiae as an overexpression suppressor of copper toxicity. PCA1 possesses signatures of a P1B-type heavy metal-transporting ATPase that is widely distributed from bacteria to humans. Copper resistance conferred by PCA1 is not dependent on catalytic activity, but it appears that a cysteine-rich region located in the N terminus sequesters copper. Unexpe...

  14. Condensation of rye chromatin in somatic interphase nuclei of Ph1 and ph1b wheat

    Kopecký, David; Allen, D.C.; Duchoslav, M.; Doležel, Jaroslav; Lukaszewski, A.J.

    2007-01-01

    Roč. 119, 3-4 (2007), s. 263-267. ISSN 1424-8581 R&D Projects: GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : hexaploid wheat * Ph1 and ph1b * rye chromatin Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.402, year: 2007

  15. Carnitine Palmitoyltransferase 1b Deficient Mice Develop Severe Insulin Resistance After Prolonged High Fat Diet Feeding

    Kim, Teayoun; Moore, John F.; Sharer, Jon D.; Yang, Kevin; Wood, Philip A.; Yang, Qinglin

    2014-01-01

    Background Carnitine palmitoyltransferase 1 (CPT1) is the rate-limiting enzyme governing the entry of long-chain acyl-CoAs into mitochondria. Treatments with CPT1 inhibitors protect against insulin resistance in short-term preclinical animal studies. We recently reported that mice with muscle isoform CPT1b deficiency demonstrated improved insulin sensitivity when fed a High Fat-Diet (HFD) for up to 5 months. In this follow up study, we further investigated whether the insulin sensitizing effe...

  16. Regulation of cytochrome P450 1B1 under proinflammatory conditions

    Umannová, Lenka; Machala, M.; Kozubík, Alois; Vondráček, Jan

    Trenčianske Teplice, 2008. s. 117. ISSN 1337-6853. [TOXCON 2008, Integration of Toxicological Research Within V4, 13th Interdisciplinary Toxicology Conference. 27.05.2008-30.05.2008, Trenčianske Teplice] R&D Projects: GA ČR(CZ) GA524/06/0517 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : CYP1B1 * TNF-alpha * inflammation Subject RIV: BO - Biophysics

  17. Regulation of cytochrome P450 1B1 in rat liver progenitor cells

    Umannová, Lenka; Machala, M.; Kozubík, Alois; Vondráček, Jan

    Rhodes : Elsevier, 2008. S43. ISSN 0378-4274. [45th Congress of the European Societies of Toxicology. 05.10.2008-08.10.2008, Rhodes] R&D Projects: GA ČR(CZ) GA524/06/0517 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : CYP1B1 * TNF-alpha * inflammation Subject RIV: BO - Biophysics

  18. Regulation of cytochrome P450 1B1 under inflammatory condition

    Umannová, Lenka; Machala, M.; Kozubík, Alois; Vondráček, Jan

    Mikulov, 2009. s. 13. [XXV. Xenobiochemické symposium. 22.09.2009-25.09.2009, Mikulov] R&D Projects: GA ČR(CZ) GA524/09/1337; GA ČR(CZ) GD204/09/H058 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : CYP1B1 * inflammation * environmental pollutants Subject RIV: BO - Biophysics

  19. Melatonin receptor 1 B polymorphisms associated with the risk of gestational diabetes mellitus

    Yang Jae-Hyug

    2011-06-01

    Full Text Available Abstract Backgrounds Two SNPs in melatonin receptor 1B gene, rs10830963 and rs1387153 showed significant associations with fasting plasma glucose levels and the risk of Type 2 Diabetes Mellitus (T2DM in previous studies. Since T2DM and gestational diabetes mellitus (GDM share similar characteristics, we suspected that the two genetic polymorphisms in MTNR1B may be associated with GDM, and conducted association studies between the polymorphisms and the disease. Furthermore, we also examined genetic effects of the two polymorphisms with various diabetes-related phenotypes. Methods A total of 1,918 subjects (928 GDM patients and 990 controls were used for the study. Two MTNR1B polymorphisms were genotyped using TaqMan assay. The allele distributions of SNPs were evaluated by x2 models calculating odds ratios (ORs, 95% confidence intervals (CIs, and corresponding P values. Multiple regressions were used for association analyses of GDM-related traits. Finally, conditional analyses were also performed. Results We found significant associations between the two genetic variants and GDM, rs10830963, with a corrected P value of 0.0001, and rs1387153, with the corrected P value of 0.0008. In addition, we also found that the two SNPs were associated with various phenotypes such as homeostasis model assessment of beta-cell function and fasting glucose levels. Further conditional analyses results suggested that rs10830963 might be more likely functional in case/control analysis, although not clear in GDM-related phenotype analyses. Conclusion There have been studies that found associations between genetic variants of other genes and GDM, this is the first study that found significant associations between SNPs of MTNR1B and GDM. The genetic effects of two SNPs identified in this study would be helpful in understanding the insight of GDM and other diabetes-related disorders.

  20. Criteria for HNF1B analysis in patients with congenital abnormalities of kidney and urinary tract

    Raaijmakers, Anke; Corveleyn, Anniek; Devriendt, Koenraad; van Tienoven, Theun Pieter; Allegaert, Karel; Van Dyck, Mieke; van den Heuvel, Bert; Kuypers, Dirk; Claes, Kathleen; Mekahli, Djalila; Levtchenko, Elena

    2015-01-01

    Congenital anomalies of kidneys and urinary tract (CAKUT) are the most predominant developmental disorders comprising ∼20-30% of all anomalies identified in the prenatal period. Mutations in hepatocyte nuclear factor 1-beta (HNF-1β) involved in the development of kidneys, liver, pancreas and urogenital tract are currently the most frequent monogenetic cause of CAKUT found in 10-30% of patients depending on screening policy and study design. We aimed to validate criteria for analysis of HNF1B ...

  1. Geochemical variations detected with continuous XRF measurements on ANDRILL AND-1B core - preliminary results

    Helling, D.; Kuhn, Gerhard

    2007-01-01

    Antarctica and especially its ice sheets play a major role in both the global ocean current system andclimate. The ANDRILL (Antarctic Geological Drilling) MIS deep drilling project (McMurdo Sound, NE Ross Ice Shelf, drilled core AND-1B during austral summer 2006/2007) is located in a flexural moat basin filled with glaciomarine, terrigenous, volcanic, and biogenic sediments (Horgan et al., 2005). This basin contains a well-preserved outstanding record of paleoclimate history. During the drill...

  2. 5-HT(1B) and 5-HT(1D) receptors in the human trigeminal ganglion

    Hou, M; Kanje, M; Longmore, J; Tajti, J; Uddman, R; Edvinsson, L

    5-Hydroxytryptamine (5-HT) is implicated in migraine and agonist directed against 5-HT(1B) and 5-HT(1D) receptors are commonly used as effective therapies. The antimigraine mechanisms involve the inhibition of intracranial sensory neuropeptide release. In order to determine which 5-HT(1) receptor...... expressed in the human trigeminal ganglion and they are mainly localized in medium-sized cells and they seem to colocalize with CGRP, SP and NOS....

  3. Der Einfluss der selektiven Serotonin 1 B/D-Agonisten auf die Thrombozyten- und Erythrozytenfunktion

    Heuel, T. (Thomas)

    2005-01-01

    Der Einfluss von selektiven und unselektiven Serotonin 1 B/D Agonisten auf die Thrombozyten und Erythrozytenfunktion wurde in einer einfachblinden, placebokontrollierten Studie an 20 Probanden untersucht. Getestet wurden 2,5 mg Zolmitriptan, 100 mg Sumatriptan, 2 mg Ergotamintartrat und 1000 mg Acetylsalicylsäure. Hierbei zeigte sich nach Einnahme von Placebo, Sumatriptan und Zolmitriptan keine signifikante Änderung der Plättchenreaktivität (PR) oder Erythrozytenaggregation (ER). Nach Einnahm...

  4. Free Fatty Acids Inhibit Protein Tyrosine Phosphatase 1B and Activate Akt

    Eisuke Shibata

    2013-09-01

    Full Text Available Background/Aims: Accumulating evidence has suggested that free fatty acids (FFAs interact with protein kinases and protein phosphatases. The present study examined the effect of FFAs on protein phosphatases and Akt. Methods: Activities of protein phosphatase 1 (PP1, protein phosphatase 2A (PP2A, and protein tyrosine phosphatase 1B (PTP1B were assayed under the cell-free conditions. Phosphorylation of Akt was monitored in MSTO-211H human malignant pleural mesothelioma cells without and with knocking-down phosphatidylinositol 3 kinase (PI3K or 3-phosphoinositide-dependent protein kinase-1 (PDK1. Results: In the cell-free assay, unsaturated FFAs (uFFAs such as oleic, linoleic and linolenic acid and saturated FFAs (sFFAs such as stearic, palmitic, myristic, and behenic acid markedly reduced PTP1B activity, with the potential for uFFAs greater than that for sFFAs. All the investigated sFFAs inhibited PP2A activity, but otherwise no inhibition was obtained with uFFAs. Both uFFAs and sFFAs had no effect on PP1 activity. Oleic acid phosphorylated Akt both on Thr308 and Ser473, while stearic acid phosphorylated Akt on Thr308 alone. The effects of oleic and stearic acid on Akt phosphorylation were abrogated by the PI3K inhibitor wortmannin or the PDK1 inhibitor BX912 and also by knocking-down PI3K or PDK1. Conclusion: The results of the present study indicate that uFFAs and sFFAs could activate Akt through a pathway along a PI3K/PDK1/Akt axis in association with PTP1B inhibition.

  5. Antimicrobial Resistance of Shigella flexneri Serotype 1b Isolates in China.

    Xianyan Cui

    Full Text Available Shigella flexneri serotype 1b is among the most prominent serotypes in developing countries, followed by serotype 2a. However, only limited data is available on the global phenotypic and genotypic characteristics of S. flexneri 1b. In the present study, 40 S. flexneri 1b isolates from different regions of China were confirmed by serotyping and biochemical characterization. Antimicrobial susceptibility testing showed that 85% of these isolates were multidrug-resistant strains and antibiotic susceptibility profiles varied between geographical locations. Strains from Yunnan were far more resistant than those from Xinjiang, while only one strain from Shanghai was resistant to ceftazidime and aztreonam. Fifteen cephalosporin resistant isolates were identified in this study. ESBL genes (blaSHV, blaTEM, blaOXA, and blaCTX-M and ampC genes (blaMOX, blaFOX, blaMIR(ACT-1, blaDHA, blaCIT and blaACC were subsequently detected among the 15 isolates. The results showed that these strains were positive only for blaTEM, blaOXA, blaCTX-M, intI1, and intI2. Furthermore, pulsed-field gel electrophoresis (PFGE analysis showed that the 40 isolates formed different profiles, and the PFGE patterns of Xinjiang isolates were distinct from Yunnan and Shanghai isolates by one obvious, large, missing band. In summary, similarities in resistance patterns were observed in strains with the same PFGE pattern. Overall, the results supported the need for more prudent selection and use of antibiotics in China. We suggest that antibiotic susceptibility testing should be performed at the start of an outbreak, and antibiotic use should be restricted to severe Shigella cases, based on resistance pattern variations observed in different regions. The data obtained in the current study might help to develop a strategy for the treatment of infections caused by S. flexneri 1b in China.

  6. Potent water extracts of Indonesian medicinal plants against PTP1B

    Azis Saifudin

    2016-01-01

    Conclusions: In contrast to the mainstream solvents currently used in modern herbal manufactures especially Jamu medicine in Indonesia, pure-water-extracted materials should be reconsidered and could be reemerged for future studies and for the manufacture of herbal medicines. In addition, the activity of Jamu components should be confirmed that their antidiabetes and antiobesity activities could be through the inhibition of PTP1B.

  7. Cardioembolic stroke related to limb-girdle muscular dystrophy 1B

    Chen, Chih-Hao; Tang, Sung-Chun; Su, Yi-Ning; Yang, Chih-Chao; Jeng, Jiann-Shing

    2013-01-01

    Background Cardioembolic stroke is an under-recognized complication in patients with limb-girdle muscular dystrophy 1B. Here we present a young stroke patient who had a novel lamin A/C gene (LMNA) mutation. Case presentation This is a 39-year-old man who had slowly progressive proximal muscle weakness and cardiac arrhythmia since adolescent and a family history of similar manifestation. He sustained acute ischemic stroke in the left middle cerebral artery territory. Intravenous recombinant ti...

  8. BOREAS RSS-2 Level-1B ASAS Image Data: At-Sensor Radiance in BSQ Format

    Russell, C.; Hall, Forrest G. (Editor); Nickeson, Jaime (Editor); Dabney, P. W.; Kovalick, W.; Graham, D.; Bur, Michael; Irons, James R.; Tierney, M.

    2000-01-01

    The BOREAS RSS-2 team used the ASAS instrument, mounted on the NASA C-130 aircraft, to create at-sensor radiance images of various sites as a function of spectral wavelength, view geometry (combinations of view zenith angle, view azimuth angle, solar zenith angle, and solar azimuth angle), and altitude. The level-1b ASAS images of the BOREAS study areas were collected from April to September 1994 and March to July 1996.

  9. Synthesis, properties and supramolecular structure of di(aqua)bis(ethylenediamine)nickel(II) bis(4-nitrobenzoate)

    Bikshandarkoil R Srinivasan; Gayatri K Rane

    2009-03-01

    The reaction of the sodium salt of 4-nitrobenzoic acid (4-nbaH) with [Ni(H2O)6]Cl2 or [Ni(en)3]Cl2.2H2O (en is ethylenediamine) results in the formation of the known octahedral compound [Ni(H2O)4(1-4-nba)2].2H2O (4-nba = 4-nitrobenzoate) 1 or the title compound di(aqua)bis(ethylenediamine) nickel(II) bis(4-nitrobenzoate) 2 respectively. Compounds 1 and 2 were characterized by elemental analysis, infrared spectra, DSC thermograms, weight loss studies and the structure of 2 was determined. Both 1 and 2 can be thermally decomposed to green NiO. The title compound [Ni(H2O)2(en)2](4-nba)2 2 crystallizes in the centrosymmetric monoclinic space group 21/ with the Ni(II) situated on an inversion center. The crystal structure of 2 consists of a hexacoordinated Ni(II) complex cation and an uncoordinated 4-nba anion. In the octahedral complex cation, the central metal is linked to two symmetry related bidentate en ligands and two water molecules. In the crystal structure, the cations and anions are linked by three varieties of hydrogen bonding interactions. A comparative study of seven nickel 4-nitrobenzoate compounds is described.

  10. Estructura molecular y cristalina del bis (bis(dietilamino glioximato níquel (II

    Luis Alejandro Nuvan

    2009-07-01

    Full Text Available Ni(CioH2lN4022- monoclínico, grupo espacial P2i/a, a = 15.760 (2, b = 11.793 (3, c = 7.297 (1 A°, j3 = 99.10 (1°, V = 1339.0 (7 A°3, Z = 2 , De = 1.28 Mg M " \\ M = 765 M " ' . La estructura fue resuelta por el método del átomo pesado y afinada por mínimos cuadrados, utilizando la matriz completa, hasta obtener una concordancia R = 0.068 para todas las reflexiones observadas. El átomo de níquel está localizado en un centro de inversión y presenta una coordinación cuadrado planar. El complejo Bis (Bis (Dietilamino Glioximato Níquel (II es casi planar y el desplazamiento de los grupos etil con respecto al plano es producido por efectos estéricos. Las moléculas planares se apilan a lo largo de c, las normales a los planos forman con este eje un ángulo de 41.53 . Existen interacciones axiales entre el níquel y los grupos amino de las moléculas adyacentes de la columna.

  11. Minimal Flavor Violation in the Minimal $U(1)_{B-L}$ Model and Resonant Leptogenesis

    Okada, Nobuchika; Yamada, Toshifumi

    2012-01-01

    We investigate the resonant leptogenesis scenario in the minimally $U(1)_{B-L}$ extended standard model with minimal flavor violation. In our model, the $U(1)_{B-L}$ gauge symmetry is broken at the TeV scale and standard model singlet neutrinos gain Majorana masses of order TeV. In addition, we introduce a flavor symmetry on the singlet neutrinos at a scale higher than TeV. The flavor symmetry is explicitly broken by the neutrino Dirac Yukawa coupling, which induces splittings in the singlet neutrino Majorana masses at lower scales through renormalization group evolutions. We call this setup "minimal flavor violation". The mass-splittings are proportional to the tiny Dirac Yukawa coupling, and hence they automatically enhance the CP asymmetry parameter necessary for the resonant leptogenesis mechanism. In this paper, we calculate the baryon number yield by solving the Boltzmann equations, including the effects of $U(1)_{B-L}$ gauge boson that also has TeV scale mass and causes washing-out of the singlet neutr...

  12. Significance of 1B and 2B domains in modulating elastic properties of lamin A

    Bera, Manindra; Ainavarapu, Sri Rama Koti; Sengupta, Kaushik

    2016-01-01

    Nuclear lamins are type V intermediate filament proteins which form an elastic meshwork underlying the inner nuclear membrane. Lamins directly contribute to maintain the nuclear shape and elasticity. More than 400 mutations have been reported in lamin A that are involved in diseases known as laminopathies. These mutations are scattered mainly in the lamin rod domain along with some in its C-terminal domain. The contribution of the rod domain towards the elasticity of lamin A molecule was hitherto unknown. Here, we have elucidated the significance of the 1B and 2B domains of the rod in modulating the elastic behavior of lamin A by single-molecule force spectroscopy. In addition, we have also studied the network forming capacity of these domains and their corresponding viscoelastic behavior. We have shown that the 1B domain has the ability to form a lamin-like network and resists larger deformation. However at the single-molecular level, both the domains have comparable mechanical properties. The self-assembly of the 1B domain contributes to the elasticity of the lamin A network. PMID:27301336

  13. Construction and in vitro Study of an E1B-Defective Adenovirus

    Xue Feng; Joshua Mallam Nock; Zhu Hua-bin; Dong Chang-yuan; Qi Yi-peng

    2004-01-01

    An E1B-defective adenovirus named r1/Ad was constructed by homologous recombination. The construction, selection and propagation of recombinant virus was done in the human embryonic kidney 293 cells (HEK293). The in vitro study demonstrated that the recombinant virus has the ability to replicate in and lyse some p53-deficient human tumor cells such as the human glioblastoma tumor cells (U251) and human bladder tumer cells (EJ) but not in the normal cells with functional p53 such as the human fibroblast cells (MRC-5). Also, based on the cytopathic effect (CPE), it was demonstrated that the U251 cells were more sensitive to the infection of r1/Ad than that of EJ cells under identical conditions. In this paper, it was found that r1/Ad could be very useful in studying the in vitro selective replication of E1B-defective adenovirus. This may help to determine the safety of using any E1B-defective adenoviruses in cancer gene therapy.

  14. A de novo microdeletion involving PAFAH1B (LIS1 related to lissencephaly phenotype

    Keiko Shimojima

    2015-09-01

    Full Text Available Lissencephaly is a type of the congenital malformation of the brain. Due to the impairments of neuronal migration, patients show absence of brain convolution manifesting smooth brain surfaces. One of the human genes responsible for lissencephaly is the platelet-activating factor acetylhydrolase 1b gene (PAFAH1B; also known as LIS1 located on 17p13.3. Patients with heterozygous deletion of this chromosomal region exhibit lissencephaly. Recently, we encountered a male patient who showed typical lissencephaly. Using a microarray analysis, we identified a 1.3 Mb submicroscopic deletion in 17p13.3. This deletion included PAFAH1B. Both of the parents showed no deletion in this region. Therefore, this was determined to be derived from de novo origin. After obtaining the written informed consent, skin fibroblasts were provided from this patient and disease-specific induced pluripotent stem (iPS cells were generated and used for medical research (Shimojima K, Okumura A, Hayashi M, Kondo T, Inoue H, and Yamamoto T. CHCHD2 is down-regulated in neuronal cells differentiated from iPS cells derived from patients with lissencephaly. Genomics, in press.

  15. Variant alleles of the CYP1B1 gene are associated with colorectal cancer susceptibility

    CYP1B1 is a P450 enzyme which is involved in the activation of pro-carcinogens to carcinogens as well as sex hormone metabolism. Because differences in the activity of the enzyme have been correlated with variant alleles of single nucleotide polymorphisms (SNPs), it represents an attractive candidate gene for studies into colorectal cancer susceptibility. We genotyped 597 cancer patients and 597controls for three CYP1B1 SNPs, which have previously been shown to be associated with altered enzymatic activity. Using the three SNPs, eight different haplotypes were constructed. The haplotype frequencies were estimated in cases and controls and then compared. The odds ratio for each tumour type, associated with each haplotype was estimated, with reference to the most common haplotype observed in the controls. The three SNPs rs10012, rs1056827 and rs1056836 alone did not provide any significant evidence of association with colorectal cancer risk. Haplotypes of rs1056827 and rs10012 or rs1056827 and rs1056836 revealed an association with colorectal cancer which was significantly stronger in the homozygous carriers. One haplotype was under represented in the colorectal cancer patient group compared to the control population suggesting a protective effect. Genetic variants within the CYP1B1 that are associated with altered function appear to influence susceptibility to a colorectal cancer in Poland. Three haplotypes were associated with altered cancer risk; one conferred protection and two were associated with an increased risk of disease. These observations should be confirmed in other populations

  16. Interstitial 6q25 microdeletion syndrome: ARID1B is the key gene.

    Ronzoni, Luisa; Tagliaferri, Francesco; Tucci, Arianna; Baccarin, Marco; Esposito, Susanna; Milani, Donatella

    2016-05-01

    Interstitial deletions of the long arm of chromosome 6 are rare. Clinically, these deletions are considered to be part of a unique microdeletion syndrome associated with intellectual disability and speech impairment, typical dysmorphic features, structural anomalies of the brain, microcephaly, and non-specific multiple organ anomalies. The critical region for the interstitial 6q microdeletion phenotype was mapped to 6q24-6q25, particularly the 6q25.3 region containing the genes ARID1B and ZDHHC14. It has been hypothesized that haploinsufficiency of these genes impairs normal development of the brain and is responsible for the phenotype. This case report describes a girl presenting with typical features of 6q microdeletion syndrome, including global developmental delay, speech impairment, distinct dysmorphic features, dysgenesis of the corpus callosum, common limb anomalies, and hearing loss. Chromosome analysis by array-CGH revealed a small interstitial 6q deletion spanning approximately 1.1 Mb of DNA and containing only one coding gene, ARID1B. We suggest that ARID1B is the key gene behind 6q microdeletion syndrome, and we discuss its possible role in the phenotypic manifestations. © 2016 Wiley Periodicals, Inc. PMID:26754677

  17. The PSACOIN level 1B exercise: A probabilistic code intercomparison involving a four compartment biosphere model

    The probabilistic Systems Assessment Code (PSAC) User Group of the OECD Nuclear Energy Agency has organised a series of code intercomparison studies of relevance to the performance assessment of underground repositories for radioactive wastes - known collectively by the name PSACOIN. The latest of these to be undertaken is designated PSACOIN Level 1b, and the case specification provides a complete assessment model of the behaviour of radionuclides following release into the biosphere. PSACOIN Level 1b differs from other biosphere oriented intercomparison exercises in that individual dose is the end point of the calculations as opposed to any other intermediate quantity. The PSACOIN Level 1b case specification describes a simple source term which is used to simulate the release of activity to the biosphere from certain types of near surface waste repository, the transport of radionuclides through the biosphere and their eventual uptake by humankind. The biosphere sub model comprises 4 compartments representing top and deep soil layers, river water and river sediment. The transport of radionuclides between the physical compartments is described by ten transfer coefficients and doses to humankind arise from the simultaneous consumption of water, fish, meat, milk, and grain as well as from dust inhalation and external γ-irradiation. The parameters of the exposure pathway sub model are chosen to be representative of an individual living in a small agrarian community. (13 refs., 3 figs., 2 tabs.)

  18. Forced expression of Hnf1b/Foxa3 promotes hepatic fate of embryonic stem cells.

    Yahoo, Neda; Pournasr, Behshad; Rostamzadeh, Jalal; Hakhamaneshi, Mohammad Saeed; Ebadifar, Asghar; Fathi, Fardin; Baharvand, Hossein

    2016-05-20

    Embryonic stem (ES) cell-derived hepatocytes have the potential to be used for basic research, regenerative medicine, and drug discovery. Recent reports demonstrated that in addition to conventional differentiation inducers such as chemical compounds and cytokines, overexpression of lineage-specific transcription factors could induce ES cells to differentiate to a hepatic fate. Here, we hypothesized that lentivirus-mediated inducible expression of hepatic lineage transcription factors could enhance mouse ES cells to hepatocyte-like cells. We screened the effects of candidate transcription factors Hnf1b, Hnf1a, Hnf4a, Foxa1, Foxa3 and Hex, and determined that the combination of Hnf1b/Foxa3 promoted expression of several hepatic lineage-specific markers and proteins, in addition to glycogen storage, ICG uptake, and secretion of albumin and urea. The differentiated cells were engraftable and expressed albumin when transplanted into a carbon tetrachloride-injured mouse model. These results demonstrated the crucial role of Hnf1b and Foxa3 in hepatogenesis in vitro and provided a valuable tool for the efficient differentiation of HLCs from ES cells. PMID:27107701

  19. HNF1B-associated clinical phenotypes: the kidney and beyond.

    Bockenhauer, Detlef; Jaureguiberry, Graciana

    2016-05-01

    Mutations in HNF1B, the gene encoding hepatocyte nuclear factor 1β are the most commonly identified genetic cause of renal malformations. HNF1B was first identified as a disease gene for diabetes (MODY5) in 1997, and its involvement in renal disease was subsequently noted through clinical observations in pedigrees affected by MODY5. Since then, a whole spectrum of associated phenotypes have been reported, including genital malformations, autism, epilepsy, gout, hypomagnesaemia, primary hyperparathyroidism, liver and intestinal abnormalities and a rare form of kidney cancer. The most commonly identified mutation, in approximately 50 % of patients, is an entire gene deletion occurring in the context of a 17q12 chromosomal microdeletion that also includes several other genes. Some of the associated phenotypes, especially the neurologic ones, appear to occur only in the context of this microdeletion and thus may not be directly linked to HNF1B. Here we review the spectrum of associated phenotypes and discuss potential implications for clinical management. PMID:26160100

  20. The thermal emission of the exoplanets WASP-1b and WASP-2b

    Wheatley, Peter J; Harrington, Joseph; Fortney, Jonathan J; Simpson, James M; Anderson, David R; Smith, Alexis M S; Aigrain, Suzanne; Clarkson, William I; Gillon, Michael; Haswell, Carole A; Hebb, Leslie; Hébrard, Guillaume; Hellier, Coel; Hodgkin, Simon T; Horne, Keith D; Kane, Stephen R; Maxted, Pierre F L; Norton, Andrew J; Pollacco, Don L; Pont, Frederic; Skillen, Ian; Smalley, Barry; Street, Rachel A; Udry, Stephane; West, Richard G; Wilson, David M

    2010-01-01

    We present a comparative study of the thermal emission of the transiting exoplanets WASP-1b and WASP-2b using the Spitzer Space Telescope. The two planets have very similar masses but suffer different levels of irradiation and are predicted to fall either side of a sharp transition between planets with and without hot stratospheres. WASP-1b is one of the most highly irradiated planets studied to date. We measure planet/star contrast ratios in all four of the IRAC bands for both planets (3.6-8.0um), and our results indicate the presence of a strong temperature inversion in the atmosphere of WASP-1b, particularly apparent at 8um, and no inversion in WASP-2b. In both cases the measured eclipse depths favor models in which incident energy is not redistributed efficiently from the day side to the night side of the planet. We fit the Spitzer light curves simultaneously with the best available radial velocity curves and transit photometry in order to provide updated measurements of system parameters. We do not find ...

  1. Evaluation of LLTR Series II tests A-1A and A-1B test results

    The standard methodology, with minor modifications provides conservative yet realistic predictions of leaksite and other sodium system pressures in the LLTR Series II vessel and piping. The good agreement between predicted and measured pressures indicates that the TRANSWRAP/RELAP modeling developed from the Series I tests is applicable to larger scale units prototypical of the Clinch River steam generator design. Calculated sodium system pressures are sensitive to several modeling parameters including rupture disc modeling, acoustic velocity in the test vessel, and flow rate from the rupture tube. The acoustic velocity which produced best agreement with leaksite pressures was calculated based on the shroud diameter and shroud wall thickness. The corresponding rupture tube discharge coefficient was that of the standard design methodology developed from Series I testing. As found in Series I testing, the Series II data suggests that the leading edge of the flow in the relief line is two phase for a single, doubled-ended guillotine tube rupture. The steam generator shroud acts as if it is relatively transparent to the transmission of radial pressures to the vessel wall. Slightly lower sodium system maximum pressures measured during Test A-1b compared to Test A-1a are attributed to premature failure (failure at a lower pressure) of the rupture disc in contact with the sodium for test A-1b. The delay in failure of the second disc in Test A-1b, which was successfully modeled with TRANSWRAP, is attributed to the limited energy in the nitrogen injection

  2. cis-Bis(butylamine-κNbis[sulfadiazine(1−-κ2N,N′]copper(II pentahydrate

    Orhan Büyükgüngör

    2008-09-01

    Full Text Available In the title compound {systematic name: cis-bis[4-amino-N-(pyrimidin-2-ylbenzenesulfonamidato-κ2N,N′]bis(butylamine-κNcopper(II pentahydrate}, [Cu(C10H9N4O2S2(C4H11N2]·5H2O or [Cu(sdz2(ba2]·5H2O [ba is butylamine and sdz = sulfadiazine(1−], the copper(II cation is six-coordinated by four N atoms of two sulfadiazine ligands and two N atoms of butylamine ligands. The copper(II ion and one of the water molecules lie on twofold rotation axes. One of the butyl groups is disordered over two sites, with occupancies of 0.395 (8 and 0.605 (8. The geometry around the S atom is distorted tetrahedral. The crystal structure involves intermolecular N—H...N and N—H...O hydrogen bonds. N—H...N hydrogen bonds between sdz ligands lead to a sheet structure parallel to the ab plane.

  3. Cystamine and cysteamine increase brain levels of BDNF in Huntington disease via HSJ1b and transglutaminase

    Borrell-Pagès, Maria; Canals, Josep M.; Cordelières, Fabrice P; Parker, J. Alex; Pineda, José R.; Grange, Ghislaine; Bryson, Elzbieta A.; Guillermier, Martine; Hirsch, Etienne; Hantraye, Philippe; Cheetham, Michael E.; Néri, Christian; Alberch, Jordi; Brouillet, Emmanuel; Saudou, Frédéric

    2006-01-01

    There is no treatment for the neurodegenerative disorder Huntington disease (HD). Cystamine is a candidate drug; however, the mechanisms by which it operates remain unclear. We show here that cystamine increases levels of the heat shock DnaJ-containing protein 1b (HSJ1b) that are low in HD patients. HSJ1b inhibits polyQ-huntingtin–induced death of striatal neurons and neuronal dysfunction in Caenorhabditis elegans. This neuroprotective effect involves stimulation of the secretory pathway thro...

  4. Protein tyrosine phosphatase 1B deficiency ameliorates murine experimental colitis via the expansion of myeloid-derived suppressor cells.

    Jing Zhang

    Full Text Available Protein tyrosine phosphatase 1B (PTP1B is a key molecule in modulating low-degree inflammatory conditions such as diabetes. The role of PTP1B in other chronic inflammations, however, remains unknown. Here, we report that PTP1B deficiency ameliorates Dextran Sulfate Sodium (DSS-induced murine experimental colitis via expanding CD11b(+Gr-1(+ myeloid-derived suppressor cells (MDSCs. Employing DSS-induced murine experimental colitis as inflammatory animal model, we found that, compared with wild-type littermates, PTP1B-null mice demonstrated greater resistance to DSS-induced colitis, as reflected by slower weight-loss, greater survival rates and decreased PMN and macrophage infiltration into the colon. The evidence collectively also demonstrated that the resistance of PTP1B-null mice to DSS-induced colitis is based on the expansion of MDSCs. First, PTP1B-null mice exhibited a greater frequency of MDSCs in the bone marrow (BM, peripheral blood and spleen when compared with wild-type littermates. Second, PTP1B levels in BM leukocytes were significantly decreased after cells were induced into MDSCs by IL-6 and GM-CSF, and the MDSC induction occurred more rapidly in PTP1B-null mice than in wild-type littermates, suggesting PTP1B as a negative regulator of MDSCs. Third, the adoptive transfer of MDSCs into mice with DSS-colitis significantly attenuated colitis, which accompanies with a decreased serum IL-17 level. Finally, PTP1B deficiency increased the frequency of MDSCs from BM cells likely through enhancing the activities of signal transducer and activator of transcription 3 (STAT3 and Janus kinase 2 (JAK2. In conclusion, our study provides the first evidences that PTP1B deficiency ameliorates murine experimental colitis via expanding MDSCs.

  5. Influence of ADH1B polymorphism on alcohol use and its subjective effects in a Jewish population.

    Carr, Lucinda G; Foroud, Tatiana; Stewart, Trent; Castelluccio, Peter; Edenberg, Howard J; Li, Ting-Kai

    2002-10-01

    Class I alcohol dehydrogenases (ADHs) are the principal enzymes responsible for ethanol metabolism in humans. Genetic polymorphism at the ADH1B locus (old nomenclature ADH2) results in isozymes with quite different catalytic properties. The frequency of the ADH1B*2 allele varies among ethnic groups. ADH1B*2 is most often observed in Asian populations, and has been shown to be protective against alcoholism. The Jewish population has a higher frequency of the ADH1B*2 allele and lower rates of alcohol-related problems as compared to other Caucasian populations. Thus, it would be of interest to determine whether the ADH1B*2 allele is associated with alcohol consumption and its subjective effects in this group. Four groups of Jewish subjects (male and female college-age samples, and male and female general samples) were recruited from the same region of the United States. All subjects completed a questionnaire to delineate alcohol consumption and its subjective consequences. Genotype at the ADH1B locus was determined for each participant. ADH1B*2 allele frequencies were similar for the Jewish college-age and general population samples. Men in both the college-age and general population in the ADH1B*2 group reported more unpleasant reactions following alcohol consumption than men in the ADH1B*1 group. Men in the general population in the ADH1B*2 group drank alcohol less frequently than men who were homozygous ADH1B*1; there was a similar trend among the women. The ADH1B polymorphism is associated with unpleasant reactions after alcohol consumption, and frequency of alcohol consumption in these Jewish samples. PMID:12244546

  6. A novel and facile synthesis of 3-(2-benzofuroyl- and 3,6-bis(2-benzofuroylcarbazole derivatives

    Wentao Gao

    2011-11-01

    Full Text Available A facile synthesis of hitherto unreported 3-(2-benzofuroylcarbazoles 3a–k, 3,6-bis(2-benzofuroylcarbazoles 5a–k, and naphtho[2,1-b]furoylcarbazoles 3l and 5l is described. The synthesis mainly relies on the ultrasound-assisted Rap–Stoermer reaction of 3-chloroacetyl- (1 or 3,6-dichloroacetyl-9-ethyl-9H-carbazole (4 with various salicylaldehydes 2a–k as well as 2-hydroxy-1-naphthaldehyde (2l in CH3CN with the presence of PEG-400 as catalyst. The procedure offers easy access to benzofuroylcarbazoles in short reaction times and the products are obtained in moderate to good yields.

  7. A common haplotype of carnitine palmitoyltransferase 1b is associated with the metabolic syndrome.

    Auinger, A; Rubin, D; Sabandal, M; Helwig, U; Rüther, A; Schreiber, S; Foelsch, U R; Döring, F; Schrezenmeir, J

    2013-03-14

    The carnitine palmitoyltransferase (CPT) enzyme system facilitates the transport of long-chain fatty acids into mitochondria to provide substrates for β-oxidation. We performed an analysis including three coding SNP in the muscle isoform of the CPT1b gene (rs3213445, rs2269383 and rs470117) and one coding SNP in the CPT2 gene (rs1799821) to find associations with traits of the metabolic syndrome (MetS). Male participants (n 755) from the Metabolic Intervention Cohort Kiel were genotyped and phenotyped for features of the MetS. Participants underwent a glucose tolerance test and a postprandial assessment of metabolic variables after a standardised mixed meal. Carriers of the rare CPT1b 66V (rs3213445) allele had significantly higher γ-glutamyl transpeptidase (GGT), glutamic oxaloacetic transaminase (GOT) and glutamic pyruvate transaminase (GPT) activities (P< 0·0001, P= 0·03 and P= 0·048, respectively) and a higher fatty liver index (FLI, P= 0·026). Fasting and postprandial TAG (P= 0·007 and P= 0·009, respectively) and fasting glucose (P= 0·012) were significantly higher in 66V-allele carriers. The insulin sensitivity index determined after a glucose load was lower in those subjects (P= 0·005). Total cholesterol (P= 0·051) and LDL-cholesterol (P= 0·062) tended to be higher in 66V-allele carriers when compared with I66I homozygotes. Homozygosity of the rare K531E allele presented with lower GGT and GOT activities (P= 0·011 and P= 0·027, respectively). E531E homozygotes tended to have lower GPT and FLI (P= 0·078 and P= 0·052, respectively). CPT2 V368I (rs1799821) genotypic groups did not differ in the investigated anthropometric and metabolic parameters. The present results confirm the association of CPT1b coding polymorphisms with the MetS, with a deleterious effect of the CPT1b I66V and a protective impact of the CPT1b K531E SNP, whereas haplotype analysis indicates a relevance of the E531K polymorphism only. PMID:22809552

  8. Polymorphisms in the ANKS1B gene are associated with cancer, obesity and type 2 diabetes

    Ke-Sheng Wang

    2015-08-01

    Full Text Available Obesity and type 2 diabetes (T2D are comorbidities with cancer which may be partially due to shared genetic variants. Genetic variants in the ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B gene may play a role in cancer, adiposity, body mass index (BMI, and body weight. However, few studies focused on the associations of ANKS1B with obesity and T2D. We examined genetic associations of 272 single nucleotide polymorphisms (SNPs within the ANKS1B with the cancer (any diagnosed cancer omitting minor skin cancer, obesity and T2D using the Marshfield sample (716 individuals with cancers, 1442 individuals with obesity, and 878 individuals with T2D. The Health Aging and Body Composition (Health ABC sample (305 obese and 1336 controls was used for replication. Multiple logistic regression analysis was performed using the PLINK software. Odds ratios (ORs and 95% confidence intervals (CIs were calculated. We identified 25 SNPs within the ANKS1B gene associated with cancer, 34 SNPs associated with obesity, and 12 SNPs associated with T2D (p < 0.05. The most significant SNPs associated with cancer, T2D, and obesity were rs2373013 (p = 2.21 × 10-4, rs10860548 (p = 1.92 × 10-3, and rs7139028 (p = 1.94 × 10-6, respectively. Interestingly, rs3759214 was identified for both cancer and T2D (p = 0.0161 and 0.044, respectively. Furthermore, seven SNPs were associated with both cancer and obesity (top SNP rs2372719 with p = 0.0161 and 0.0206, respectively; six SNPs were associated with both T2D and obesity (top SNP rs7139028 with p = 0.0231 and 1.94 × 10-6, respectively. In the Health ABC sample, 18 SNPs were associated with obesity, 5 of which were associated with cancer in the Marshfield sample. In addition, three SNPs (rs616804, rs7295102, and rs201421 were associated with obesity in meta-analysis using both samples. These findings provide evidence of common genetic variants in the ANKS1B gene influencing the risk of cancer, obesity, and

  9. Exogenous and Endogeneous Disialosyl Ganglioside GD1b Induces Apoptosis of MCF-7 Human Breast Cancer Cells.

    Ha, Sun-Hyung; Lee, Ji-Min; Kwon, Kyung-Min; Kwak, Choong-Hwan; Abekura, Fukushi; Park, Jun-Young; Cho, Seung-Hak; Lee, Kichoon; Chang, Young-Chae; Lee, Young-Choon; Choi, Hee-Jung; Chung, Tae-Wook; Ha, Ki-Tae; Chang, Hyeun-Wook; Kim, Cheorl-Ho

    2016-01-01

    Gangliosides have been known to play a role in the regulation of apoptosis in cancer cells. This study has employed disialyl-ganglioside GD1b to apoptosis in human breast cancer MCF-7 cells using exogenous treatment of the cells with GD1b and endogenous expression of GD1b in MCF-7 cells. First, apoptosis in MCF-7 cells was observed after treatment of GD1b. Treatment of MCF-7 cells with GD1b reduced cell growth rates in a dose and time dependent manner during GD1b treatment, as determined by XTT assay. Among the various gangliosides, GD1b specifically induced apoptosis of the MCF-7 cells. Flow cytometry and immunofluorescence assays showed that GD1b specifically induces apoptosis in the MCF-7 cells with Annexin V binding for apoptotic actions in early stage and propidium iodide (PI) staining the nucleus of the MCF-7 cells. Treatment of MCF-7 cells with GD1b activated apoptotic molecules such as processed forms of caspase-8, -7 and PARP (Poly(ADP-ribose) polymerase), without any change in the expression of mitochondria-mediated apoptosis molecules such as Bax and Bcl-2. Second, to investigate the effect of endogenously produced GD1b on the regulation of cell function, UDP-gal: β1,3-galactosyltransferase-2 (GD1b synthase, Gal-T2) gene has been transfected into the MCF-7 cells. Using the GD1b synthase-transfectants, apoptosis-related signal proteins linked to phenotype changes were examined. Similar to the exogenous GD1b treatment, the cell growth of the GD1b synthase gene-transfectants was significantly suppressed compared with the vector-transfectant cell lines and transfection activated the apoptotic molecules such as processed forms of caspase-8, -7 and PARP, but not the levels of expression of Bax and Bcl-2. GD1b-induced apoptosis was blocked by caspase inhibitor, Z-VAD. Therefore, taken together, it was concluded that GD1b could play an important role in the regulation of breast cancer apoptosis. PMID:27144558

  10. Analysen zur Funktion des E1B-55K-Proteins von Adenovirus Typ 5 im lytischen Replikationszyklus

    Kindsmüller, Kathrin

    2007-01-01

    Das E1B-55K-Protein von Adenovirus Typ 5 ist ein multifunktionelles Phosphoprotein, das eine zentrale Rolle im produktiven Replikationszyklus von Ad5 einnimmt. Die lytischen Aktivitäten des E1B-Proteins werden zumindest teilweise im Komplex mit dem viralen Protein E4orf6 vermittelt. Soweit bekannt fördert der E1B-55K/E4orf6-Komplex (E1B/E4-Komplex) den nukleozytoplasmatischen Transport viraler mRNAs und fördert somit die Synthese viraler Kapsidproteine bzw. die Produktion von Nachkommenviren....

  11. Association of Single Nucleotide Polymorphisms in CYP1B1 and COMT Genes with Breast Cancer Susceptibility in Indian Women

    Sharawan Yadav; Naveen Kumar Singhal; Virendra Singh; Neeraj Rastogi; Pramod Kumar Srivastava; Mahendra Pratap Singh

    2009-01-01

    Cytochrome P450 1B1 (CYP1B1) and catechol-$O$-methyltransferase (COMT) enzymes play critical roles in estrogen metabolism. Alterations in the catalytic activity of CYP1B1 and COMT enzymes have been found associated with altered breast cancer risk in postmenopausal women in many populations. The substitution of leucine (Leu) to valine (Val) at codon 432 increases the catalytic activity of CYP1B1, however, substitution of Val to methionine (Met) at codon 158 decreases the catalytic activity of ...

  12. Genetics Home Reference: GM2-gangliosidosis, AB variant

    ... of GM2-gangliosidosis, AB variant: Genetic Testing Registry: Tay-Sachs disease, variant AB These resources from MedlinePlus offer ... AB variant Activator Deficiency/GM2 Gangliosidosis Activator-deficient Tay-Sachs disease GM2 Activator Deficiency Disease GM2 gangliosidosis, type ...

  13. Sex Bias in Primary Congenital Glaucoma Patients with and without CYP1B1 Mutations

    Fatemeh Suri

    2009-04-01

    Full Text Available

    PURPOSE: To investigate variations in sex ratio among Iranian primary congenital glaucoma (PCG patients with and without mutations in the CYP1B1 gene and to evaluate possible clinical variations associated with sex in these two groups. METHODS: Phenotypical data on 104 unrelated Iranian PCG patients who had previously been screened for CYP1B1 mutations were analyzed. Emphasis was placed on analysis of sex ratios among patients with and without CYP1B1 mutations. In addition to sex, familial and sporadic incidence and clinical features including age at onset, bilateral/unilateral involvement, corneal diameter, intraocular pressure, and cup-disc ratios were compared between these two groups. Information on phenotypical parameters was available for most but not all patients. RESULTS: Among the 93 PCG patients whose sex was recorded, 57 were male (61.3% and 36 were female (38.7% (P=0.03. Patients with CYP1B1 mutations included 37 male (66.1% and 29 female (43.9% subjects (P=0.30, while patients without the mutation included 20 (74.1% male and 7 (25.9% female individuals (P=0.013. Our data did not provide conclusive evidence on difference in severity of the disease between those

  14. Investigation of high level of AsAb, EmAb in fertility female serum infected by chlamydia trachomatis

    Objective: To investigate the mechanism of chlamydia trachomatis. AsAb, EmAb in female fertility. Methods: LPS antigen of chlamydia in reproduction tract of fertility female was detected by monoclonal antibody and immunology chromatography; the content of AsAb, EmAb in serum of fertility female was detected by ELISA. Results: Infections rate of chlamydia trachomatis in fertility female was higher than that in the control AsAb, EmAb in serum of the fertility patients who were infected with chlamydia trachomatis showed a significant difference from that in the control group. Conclusion: The level of AsAb, EmAb increases in patients who have been infected with chlamydia trachomatis and these cytokines is involved in the course of female fertility

  15. Ab initio mass tensor molecular dynamics

    Tsuchida, Eiji

    2010-01-01

    Mass tensor molecular dynamics was first introduced by Bennett [J. Comput. Phys. 19, 267 (1975)] for efficient sampling of phase space through the use of generalized atomic masses. Here, we show how to apply this method to ab initio molecular dynamics simulations with minimal computational overhead. Test calculations on liquid water show a threefold reduction in computational effort without making the fixed geometry approximation. We also present a simple recipe for estimating the optimal ato...

  16. Discovering chemistry with an ab initio nanoreactor

    Wang, Lee-Ping; Titov, Alexey; McGibbon, Robert; Liu, Fang; Pande, Vijay S.; Martínez, Todd J.

    2014-01-01

    Chemical understanding is driven by the experimental discovery of new compounds and reactivity, and is supported by theory and computation that provides detailed physical insight. While theoretical and computational studies have generally focused on specific processes or mechanistic hypotheses, recent methodological and computational advances harken the advent of their principal role in discovery. Here we report the development and application of the ab initio nanoreactor – a highly accelerat...

  17. Ab initio vel ex eventu. II

    Thiessen, P. A.; Treder, H.-J.

    Jedes initium wird durch experimenta crucis zum eventus. Jedes theoretisch interpretierbare ex-eventu-Resultat führt auf ein neues Initium. Gerade dies ist die gemeinsame Aussage von Atomistik, Quantenmechanik und Relativitätstheorie.Translated AbstractAb initio vel ex eventu. IIEvery initium becomes an eventus by experimenta crucis. Every theoretically interpretable ex-eventu result leads to a new initium. Right this is the joint assertion of atomism, quantum mechanics, and relativity.

  18. Synthesis and Antimicrobial Evaluation of Some Novel Bis-α,β-Unsaturated Ketones, Nicotinonitrile, 1,2-Dihydropyridine-3-carbonitrile, Fused Thieno[2,3-b]pyridine and Pyrazolo[3,4-b]pyridine Derivatives

    Farag M. A. Altalbawy

    2013-01-01

    Full Text Available The title compounds were prepared by reaction of 1,1'-(5-methyl-1-phenyl-1H-pyrazole-3,4-diyldiethanone (1 with different aromatic aldehydes 2a–c, namely Furfural (2a, 4-chlorobenzaldehyde (2b and 4-methoxybenzaldhyde (2c to yield the corresponding α,β-unsaturated ketones 3a–c. Compound 3 was reacted with malononitrile, 2-cyanoacetamide or 2-cyanothioacetamide yielded the corresponding bis[2-amino-6-(arylnicotinonitrile] 4a–c, bis[6-(2-aryl-2-oxo-1,2-dihydropyridine-3-carbonitrile] 5a–c or bis[6-(2-aryl-2-thioxo-1,2-dihydropyridine-3-carbonitrile] 6a,b, respectively. The reaction of compound 6a with each of 2-chloro-N-(4-bromophenyl acetamide (7a, chloroacetamide (7b in ethanolic sodium ethoxide solution at room temperature to give the corresponding 4,4'-(5-methyl-1-phenyl-1H-pyrazole-3,4-diylbis-6-(2-furylthieno[2,3-b]pyridine-2-carboxamide] derivatives 9a,b. While compound 6a reacted with hydrazine hydrate yielded the 4,4'-(5-methyl-1-phenyl-1H-pyrazole-3,4-diylbis[6-(2-furyl-1H-pyrazolo[3,4-b]pyridin-3-amine] 11. The structures of the products were elucidated based on their spectral properties, elemental analyses and, wherever possible, by alternate synthesis. Antimicrobial evaluation of the products was carried out.

  19. Highly scalable Ab initio genomic motif identification

    Marchand, Benoît

    2011-01-01

    We present results of scaling an ab initio motif family identification system, Dragon Motif Finder (DMF), to 65,536 processor cores of IBM Blue Gene/P. DMF seeks groups of mutually similar polynucleotide patterns within a set of genomic sequences and builds various motif families from them. Such information is of relevance to many problems in life sciences. Prior attempts to scale such ab initio motif-finding algorithms achieved limited success. We solve the scalability issues using a combination of mixed-mode MPI-OpenMP parallel programming, master-slave work assignment, multi-level workload distribution, multi-level MPI collectives, and serial optimizations. While the scalability of our algorithm was excellent (94% parallel efficiency on 65,536 cores relative to 256 cores on a modest-size problem), the final speedup with respect to the original serial code exceeded 250,000 when serial optimizations are included. This enabled us to carry out many large-scale ab initio motiffinding simulations in a few hours while the original serial code would have needed decades of execution time. Copyright 2011 ACM.

  20. TNFα increases hypothalamic PTP1B activity via the NFκB pathway in rat hypothalamic organotypic cultures.

    Ito, Yoshihiro; Banno, Ryoichi; Hagimoto, Shigeru; Ozawa, Yoshiharu; Arima, Hiroshi; Oiso, Yutaka

    2012-02-10

    In obesity, levels of tumor necrosis-factor α (TNFα) are well known to be elevated in adipose tissues or serum, and a high-fat diet (HFD) reportedly increases TNFα expression in the hypothalamus. The expression levels of hypothalamic protein tyrosine phosphatase 1B (PTP1B), a negative regulator of leptin and insulin signaling, are also elevated by HFD, and several lines of evidence support a relationship between TNFα and PTP1B. It remains unclear however how TNFα acts locally in the hypothalamus to regulate hypothalamic PTP1B expression and activity. In this study, we examined whether TNFα can regulate PTP1B expression and activity using rat hypothalamic organotypic cultures. Incubation of cultures with TNFα resulted in increases in mRNA expression, protein levels and activity of PTP1B in a dose- and time-dependent manner, respectively compared with controls. TNFα-induced PTP1B protein levels were not influenced by co-incubation with the sodium channel blocker tetrodotoxin, indicating that the action of TNFα is independent of action potentials. TNFα also increased phosphorylation of p65, a subunit of nuclear factor-κB (NFκB), in a dose- and time-dependent manner. While incubation with inhibitors of NFκB did not affect basal levels of either p65 phosphorylation or PTP1B expression, it markedly suppressed both TNFα-induced p65 phosphorylation and PTP1B expression to almost basal levels. These data suggest that TNFα acts on the hypothalamus to increase hypothalamic PTP1B expression and activity via the NFκB pathway, and that TNFα-mediated induction of NFκB in the hypothalamus may cause leptin and insulin resistance in the hypothalamus by increasing hypothalamic PTP1B activity. PMID:22166493

  1. Structures of potassium, sodium and lithium bis(oxalato)borate salts from powder diffraction data

    The crystal structures of the alkali-metal bis(oxalato)borate salts A[B(C2O4)2] (A = K, Na, Li) have been determined ab initio using powder diffraction data obtained from a laboratory diffractometer. The K compound crystallizes in the orthorhombic space group Cmcm and its structure has been solved by direct methods applied to the integrated intensities from full pattern decomposition. The Na compound is isostructural with the K salt, while the crystal structure of the highly hydroscopic Li compound differs from the other two. It has an orthorhombic lattice, space group Pnma, and its structure was solved by the global optimization method using a parallel tempering approach. In the K and Na structures the metal ions and complex borate ions form chains with m2m symmetry. Metal-oxygen bonding between the chains links them into a layer and then a framework with square tunnels. The coordination number of both K and Na is eight. The Li compound also contains chains that have.m. symmetry and are bound together into a three-dimensional framework. The coordination polyhedron of the Li atom is a square pyramid with Li lying in its base. This square pyramidal coordination leads to its high reactivity with moisture to give Li[B(C2O4)2]H2O with lithium in six coordination. (orig.)

  2. Synthesis and biological study of novel methylene-bis-benzofuranyl-

    Sanjeeva R. Cherkupally

    2008-12-01

    Full Text Available A series of novel methylene-bis-[1,5]-benzothiazepines 4 and methylene-bis-benzofuranyl-[1,5]-benzothiazepines 5 were prepared by the reaction of methylene-bis-chalcones 3 with 2-aminothiophenolfollowed by the condensation with -bromoacetophenone. The structures of the synthesized compounds wereconfirmed by their IR, 1H, 13C NMR and Mass spectral analyses. All the synthesized compounds were tested fortheir antimicrobial activity against Gram-positive, Gram-negative bacteria and fungi. Among the synthesizedcompounds, the compounds 4f, 4g, 5f and 5g were found to be the most active against Bacillus subtilis, Bacillussphaericus, Staphylococcus aureus, Klebsiella aerogenes and Chromobacterium violaceum. Similarly thesecompounds showed potent antifungal effect against Candida albicans, Aspergillus fumigatus, Trichophytonrubrum, and Trichophyton mentagrophytes. It is interesting to note that the compounds with heterocyclic ringsubstituents at the 4th position of benzothiazepine system displayed notable antibacterial activity, almost equalto that of streptomycin and penicillin.

  3. Massive Expansion of Marine Archaea During The Early Albian Oceanic Anoxic Event 1B

    Kuypers, M. M.; Kuypers, M. M.; Blokker, P.; Erbacher, J.; Kinkel, H.; Pancost, R. D.; Pancost, R. D.; Schouten, S.; Sinninghe Damsté, J. S.

    2001-12-01

    Oceanic anoxic events (OAEs), periods of globally enhanced burial of organic matter (OM) in the marine realm, played an important role in the mid-Cretaceous `greenhouse climate' by effectively reducing atmospheric carbon dioxide concentrations. It is generally believed that these OAEs were caused either by decreased remineralisation or increased production of phytoplanktonic OM. Here we show that enhanced organic carbon (OC) burial during the early Albian OAE1b (~112 My) was caused by a different process. Combined biogeochemical and stable carbon isotopic analyses indicate that black shales from this period contain up to 80% of OC derived from archaea. Archaea-derived isoprenoidal tetraether membrane lipids and free and macromolecularly bound isoprenoid alkanes are abundantly present in these black shales. More specifically the presence of certain ether lipids (cyclic biphytane tetraethers) indicates representatives of the pelagic archaea. To the best of our knowledge this is the earliest fossil evidence for marine planktonic archaea, extending their geological record by more than 60 million years. The diversity of archaeal lipids recovered from the OAE1b black shales suggests that they derive from a multitude of archaeal species. However, the specific 13C enrichment of all such lipids indicates a common `heavy' (13C-rich) carbon source for the archaea and/or a common pathway of carbon-fixation with a reduced 13C fractionation effect compared to the Calvin cycle used by algae, cyanobacteria and higher plants. The large differences (up to 12%) in 13C/12C ratios between the algal biomarkers and the much more abundant archaeal molecular fossils suggest that the latter were not living heterotrophically on photoautotrophic biomass. It seems likely that the archaea present during OAE1b used a chemical energy source (possibly ammonium) for carbon fixation since photoautotrophy within the domain of the Archaea is restricted to only a few species from hypersaline

  4. In vitro study of vitamins B1, B2 and B6 adsorption on zeolite

    Basić Zorica

    2011-01-01

    Full Text Available Background/Aim. Zeolites are the hydratised alumosilicates of alcali and earthalcali cations, which have a long three-dimensional crystal structure. Preparations on the basis of zeolites are used for adsorption of organic and nonorganic toxic substances and they, also, find more and more use in veterinary and human medicine and pharmacy. The aim of this study was to evaluate the possibilities of zeolite to adsorb vitamins B1, B2 and B6 in acid and neutral solutions, as well as the characteristics of the process (saturability, reversibility and competitivness. Methods. The specific and sensitive HPLC method with fluorescent detector was used for determination of vitamins B1, B2 and B6. Analyte separation and detection were carried out by applying the reverse-phase method on column C18. An in vitro experiment was done by testing the influence of pH value (2 and 7, concentration of vitamin solution (1, 2 and 5 mg/L, the lenght of contact with zeolite (10-180 min and cation competitiveness on the exchange capacity, which is achieved by media and zeolite contact, as well as a possible vitamins desorption through changing pH value of the solution at 37°C. Jon competitiveness was examined by adding commercial feed mixture (grower with a defined content of the examined vitamines in zeolite solutions the pH = 2 and pH = 7. Results. Vitamins B1, B2 and B6 were stable in both pH=2 and pH = 7 solutions at 37°C, in the defined time intervals. In acid solution concentrations of vitamins significantly declined in the first 10 min, with no significant decline in further 30 min for all the three concentrations testch. In neutral solution, after the addition of 1% zeolite, decrease in vitamins concentrations was slightly lower than in acid solution, but also significant in the first 10 min of the contact with zeolite. It was found that zeolite, which adsorbed vitamins in acid solution, transferred in the neutral one released a significant quantity of adsorbed

  5. The light chain 1 subunit of the microtubule-associated protein 1B (MAP1B is responsible for Tiam1 binding and Rac1 activation in neuronal cells.

    Daniel R Henríquez

    Full Text Available Microtubule-associated protein 1B (MAP1B is a neuronal protein involved in the stabilization of microtubules both in the axon and somatodendritic compartments. Acute, genetic inactivation of MAP1B leads to delayed axonal outgrowth, most likely due to changes in the post-translational modification of tubulin subunits, which enhances microtubule polymerization. Furthermore, MAP1B deficiency is accompanied by abnormal actin microfilament polymerization and dramatic changes in the activity of small GTPases controlling the actin cytoskeleton. In this work, we showed that MAP1B interacts with a guanine exchange factor, termed Tiam1, which specifically activates Rac1. These proteins co-segregated in neurons, and interact in both heterologous expression systems and primary neurons. We dissected the molecular domains involved in the MAP1B-Tiam1 interaction, and demonstrated that pleckstrin homology (PH domains in Tiam1 are responsible for MAP1B binding. Interestingly, only the light chain 1 (LC1 of MAP1B was able to interact with Tiam1. Moreover, it was able to increase the activity of the small GTPase, Rac1. These results suggest that the interaction between Tiam1 and MAP1B, is produced by the binding of LC1 with PH domains in Tiam1. The formation of such a complex impacts on the activation levels of Rac1 confirming a novel function of MAP1B related with the control of small GTPases. These results also support the idea of cross-talk between cytoskeleton compartments inside neuronal cells.

  6. Bis(2-{[bis(dimethylaminomethylidene]amino-κN}benzenesulfonato-κNcopper(II

    Adam Neuba

    2012-12-01

    Full Text Available The molecular structure of the title compound, [Cu(C11H16N3O3S2], shows the CuII atom with a distorted square-planar coordination geometry from the N2O2 donor set of the two chelating 2-{[bis(dimethylaminomethylidene]amino}benzenesulfonate ligands. The CuII atom lies 0.065 (1 Å above the N2O2 plane and the Cu—O [2 × 1.945 (2 Å] and Cu—N bond lengths [1.968 (3 and 1.962 (3 Å] lie in expected ranges. The two aromatic ring planes make a dihedral angle of 85.48 (1°.

  7. trans-Tetraaquabis[bis(pyridin-3-ylmethanone-κN]manganese(II bis(perchlorate

    Bin Liu

    2012-01-01

    Full Text Available In the title complex, [Mn(C11H8N2O2(H2O4](ClO42, the Mn2+ ion is located on an inversion center with the slightly distorted N2O4 octahedral coordination sphere comprising N-atom donors from two monodentate trans-related bis(pyridin-3-ylmethanone ligands and four water ligands. The two perchlorate anions are linked to the mononuclear complex molecule through water O—H...O hydrogen bonds while inter-complex water O—H...N(pyridine interactions form an infinite chain structure extending along the b axis. The perchlorate anions also function as inter-unit links through water O—H...O hydrogen bonds which, together with water O—H...O(carbonyl interactions, give a three-dimensional framework structure.

  8. Synthesis of δ-Oxo-1,1-bis(triflyl)alkanes and Their Acidities

    Hikaru Yanai; Masaya Fujita; Arata Takahashi; Min Zhang; Masaaki Mishima; Akira Kotani; Takashi Matsumoto; Takeo Taguchi

    2013-01-01

    The reaction of 1,1-bis(triflyl)ethylene generated in situ with enolizable carbonyls yielded δ-oxo-1,1-bis(triflyl)alkane derivatives. Their acidities in both the gas and solution phases were determined.

  9. Short-Term Dynamic and Local Epidemiological Trends in the South American HIV-1B Epidemic

    Junqueira, Dennis Maletich; de Medeiros, Rubia Marília; Gräf, Tiago; Almeida, Sabrina Esteves de Matos

    2016-01-01

    The human displacement and sexual behavior are the main factors driving the HIV-1 pandemic to the current profile. The intrinsic structure of the HIV transmission among different individuals has valuable importance for the understanding of the epidemic and for the public health response. The aim of this study was to characterize the HIV-1 subtype B (HIV-1B) epidemic in South America through the identification of transmission links and infer trends about geographical patterns and median time of transmission between individuals. Sequences of the protease and reverse transcriptase coding regions from 4,810 individuals were selected from GenBank. Maximum likelihood phylogenies were inferred and submitted to ClusterPicker to identify transmission links. Bayesian analyses were applied only for clusters including ≥5 dated samples in order to estimate the median maximum inter-transmission interval. This study analyzed sequences sampled from 12 South American countries, from individuals of different exposure categories, under different antiretroviral profiles, and from a wide period of time (1989–2013). Continentally, Brazil, Argentina and Venezuela were revealed important sites for the spread of HIV-1B among countries inside South America. Of note, from all the clusters identified about 70% of the HIV-1B infections are primarily occurring among individuals living in the same geographic region. In addition, these transmissions seem to occur early after the infection of an individual, taking in average 2.39 years (95% CI 1.48–3.30) to succeed. Homosexual/Bisexual individuals transmit the virus as quickly as almost half time of that estimated for the general population sampled here. Public health services can be broadly benefitted from this kind of information whether to focus on specific programs of response to the epidemic whether as guiding of prevention campaigns to specific risk groups. PMID:27258369

  10. Identification of protein tyrosine phosphatase 1B and casein as substrates for 124-v-Mos

    Stabel Silvia

    2002-04-01

    Full Text Available Abstract Background The mos proto-oncogene encodes a cytoplasmic serine/threonine-specific protein kinase with crucial function during meiotic cell division in vertebrates. Based on oncogenic amino acid substitutions the viral derivative, 124-v-Mos, displays constitutive protein kinase activity and functions independent of unknown upstream effectors of mos protein kinase. We have utilized this property of 124-v-Mos and screened for novel mos substrates in immunocomplex kinase assays in vitro. Results We generated recombinant 124-v-Mos using the baculovirus expression system in Spodoptera frugiperda cells and demonstrated constitutive kinase activity by the ability of 124-v-Mos to auto-phosphorylate and to phosphorylate vimentin, a known substrate of c-Mos. Using this approach we analyzed a panel of acidic and basic substrates in immunocomplex protein kinase assays and identified novel in vitro substrates for 124-v-Mos, the protein tyrosine phosphatase 1B (PTP1B, alpha-casein and beta-casein. We controlled mos-specific phosphorylation of PTP1B and casein in comparative assays using a synthetic kinase-inactive 124-v-Mos mutant and further, tryptic digests of mos-phosphorylated beta-casein identified a phosphopeptide specifically targeted by wild-type 124-v-Mos. Two-dimensional phosphoamino acid analyses showed that 124-v-mos targets serine and threonine residues for phosphorylation in casein at a 1:1 ratio but auto-phosphorylation occurs predominantly on serine residues. Conclusion The mos substrates identified in this study represent a basis to approach the identification of the mos-consensus phosphorylation motif, important for the development of specific inhibitors of the Mos protein kinase.

  11. Short-Term Dynamic and Local Epidemiological Trends in the South American HIV-1B Epidemic.

    Junqueira, Dennis Maletich; de Medeiros, Rubia Marília; Gräf, Tiago; Almeida, Sabrina Esteves de Matos

    2016-01-01

    The human displacement and sexual behavior are the main factors driving the HIV-1 pandemic to the current profile. The intrinsic structure of the HIV transmission among different individuals has valuable importance for the understanding of the epidemic and for the public health response. The aim of this study was to characterize the HIV-1 subtype B (HIV-1B) epidemic in South America through the identification of transmission links and infer trends about geographical patterns and median time of transmission between individuals. Sequences of the protease and reverse transcriptase coding regions from 4,810 individuals were selected from GenBank. Maximum likelihood phylogenies were inferred and submitted to ClusterPicker to identify transmission links. Bayesian analyses were applied only for clusters including ≥5 dated samples in order to estimate the median maximum inter-transmission interval. This study analyzed sequences sampled from 12 South American countries, from individuals of different exposure categories, under different antiretroviral profiles, and from a wide period of time (1989-2013). Continentally, Brazil, Argentina and Venezuela were revealed important sites for the spread of HIV-1B among countries inside South America. Of note, from all the clusters identified about 70% of the HIV-1B infections are primarily occurring among individuals living in the same geographic region. In addition, these transmissions seem to occur early after the infection of an individual, taking in average 2.39 years (95% CI 1.48-3.30) to succeed. Homosexual/Bisexual individuals transmit the virus as quickly as almost half time of that estimated for the general population sampled here. Public health services can be broadly benefitted from this kind of information whether to focus on specific programs of response to the epidemic whether as guiding of prevention campaigns to specific risk groups. PMID:27258369

  12. Reduced inflammatory response in cigarette smoke exposed Mrp1/Mdr1a/1b deficient mice

    Postma Dirkje S

    2007-07-01

    Full Text Available Abstract Background Tobacco smoke is the principal risk factor for chronic obstructive pulmonary disease (COPD, though the mechanisms of its toxicity are still unclear. The ABC transporters multidrug resistance-associated protein 1 (MRP1 and P-glycoprotein (P-gp/MDR1 extrude a wide variety of toxic substances across cellular membranes and are highly expressed in bronchial epithelium. Their impaired function may contribute to COPD development by diminished detoxification of noxious compounds in cigarette smoke. Methods We examined whether triple knock-out (TKO mice lacking the genes for Mrp1 and Mdr1a/1b are more susceptible to develop COPD features than their wild-type (WT littermates. TKO and WT mice (six per group were exposed to 2 cigarettes twice daily by nose-only exposure or room air for 6 months. Inflammatory infiltrates were analyzed in lung sections, cytokines and chemokines in whole lung homogenates, emphysema by mean linear intercept. Multiple linear regression analysis with an interaction term was used to establish the statistical significances of differences. Results TKO mice had lower levels of interleukin (IL-7, KC (mouse IL-8, IL-12p70, IL-17, TNF-alpha, G-CSF, GM-CSF and MIP-1-alpha than WT mice independent of smoke exposure (P P P Conclusion Mrp1/Mdr1a/1b knock-out mice have a reduced inflammatory response to cigarette smoke. In addition, the expression levels of several cytokines and chemokines were also lower in lungs of Mrp1/Mdr1a/1b knock-out mice independent of smoke exposure. Further studies are required to determine whether dysfunction of MRP1 and/or P-gp contribute to the pathogenesis of COPD.

  13. TC-PTP and PTP1B: Regulating JAK-STAT signaling, controlling lymphoid malignancies.

    Pike, Kelly A; Tremblay, Michel L

    2016-06-01

    Lymphoid malignancies are characterized by an accumulation of genetic lesions that act co-operatively to perturb signaling pathways and alter gene expression programs. The Janus kinases (JAK)-signal transducers and activators of transcription (STATs) pathway is one such pathway that is frequently mutated in leukemia and lymphoma. In response to cytokines and growth factors, a cascade of reversible tyrosine phosphorylation events propagates the JAK-STAT pathway from the cell surface to the nucleus. Activated STAT family members then play a fundamental role in establishing the transcriptional landscape of the cell. In leukemia and lymphoma, somatic mutations have been identified in JAK and STAT family members, as well as, negative regulators of the pathway. Most recently, inactivating mutations in the protein tyrosine phosphatase (PTP) genes PTPN1 (PTP1B) and PTPN2 (TC-PTP) were sequenced in B cell lymphoma and T cell acute lymphoblastic leukemia (T-ALL) respectively. The loss of PTP1B and TC-PTP phosphatase activity is associated with an increase in cytokine sensitivity, elevated JAK-STAT signaling, and changes in gene expression. As inactivation mutations in PTPN1 and PTPN2 are restricted to distinct subsets of leukemia and lymphoma, a future challenge will be to identify in which cellular contexts do they contributing to the initiation or maintenance of leukemogenesis or lymphomagenesis. As well, the molecular mechanisms by which PTP1B and TC-PTP loss co-operates with other genetic aberrations will need to be elucidated to design more effective therapeutic strategies. PMID:26817397

  14. 2-Isobutyl-6-(4-methoxyphenylimidazo[2,1-b][1,3,4]thiadiazole

    Hoong-Kun Fun

    2011-02-01

    Full Text Available In the title compound, C15H17N3OS, the dihedral angle between the statistically planar imidazo[2,1-b][1,3,4]thiadiazole fused-ring system (r.m.s. deviation = 0.002 Å and the methyoxbenzene ring is 4.52 (6°. In the crystal, molecules are arranged into columns and stacked down the a axis. The crystal structure is stabilized by weak C—H...π and π–π interactions [centroid–centroid separations = 3.6053 (8 and 3.7088 (7 Å].

  15. Sterile neutrino portal to Dark Matter I: The $U(1)_{B-L}$ case

    Escudero, Miguel; Rius, Nuria; Sanz, Verónica

    2016-01-01

    In this paper we explore the possibility that the sterile neutrino and Dark Matter sectors in the Universe have a common origin. We study the consequences of this assumption in the simple case of coupling the dark sector to the Standard Model via a global $U(1)_{B-L}$, broken down spontaneously by a dark scalar. This dark scalar provides masses to the dark fermions and communicates with the Higgs via a Higgs portal coupling. We find an interesting interplay between Dark Matter annihilation to...

  16. Nail-patella syndrome—a novel mutation in the LMX1B gene

    Nair, Rajesh R.; Unni, Vavullipathy N.; Indu, Kadevalappil N.; Nampoothiri, Sheela; Mathew, Anil; Kurian, George; Vimala, Avadaiammal

    2013-01-01

    Nail-patella syndrome (NPS) is an autosomal-dominant pleiotropic disorder characterized by dyplasia of finger nails, skeletal anomalies and frequently renal disease. In the reported case, genetic analysis revealed a new missense mutation in the homeodomain of LMX1B, presumed to abolish DNA binding (c.725T>C, p.Val242Ala). A missense mutation at codon 725 was identified, where thymine was replaced by cytosine which led to the replacement of valine by alanine at position 242. It was not detecte...

  17. LEUPROLIDE INHIBITS MARBLE-BURYING BEHAVIOR VIA MODULATION OF 5-HT1B RECEPTOR

    Parle Milind; Gaikwad Uday

    2011-01-01

    Obsessive compulsive disorder (OCD) is characterized by intrusive thoughts followed by repetitive behaviors. Serotonin-related genes found in OCD include those required for coding of 5-HT transporter and 5-HT receptors (5-HT2A, 5-HT2B, 5-HT2C and 5-HT1B). Marble-burying behavior of mice is a well-accepted paradigm to screen anti-compulsive activity. The aim of this study was to evaluate the effect of leuprolide alone and it’s combination with sumatriptan or ondansetron on marble-burying behav...

  18. Four Years of Realtime GRB Followup by BOOTES-1B (2005-2008)

    Jelinek, Martin; Postigo, Antonio de Ugarte; Kubanek, Petr; Guziy, Sergei; Gorosabel, Javier; Cunniffe, Ronan; Vitek, Stanislav; Hudec, Rene; Reglero, Victor; Sabau-Graziati, Lola

    2010-01-01

    Four years of BOOTES-1B GRB follow-up history are summarised for the first time in the form of a table. The successfully followed events are described case by case. Further, the data are used to show the GRB trigger rate in Spain on a per-year basis, resulting in an estimate of 18 triggers and about 51 h of telescope time per year for real time triggers. These numbers grow to about 22 triggers and 77 h per year if we include also the GRBs observable within 2 hours after the trigger.

  19. Identification of Bmpr-1b and Bmp15 gene mutations in fat tail sheep

    Maskur .; Chairussyuhur Arman

    2012-01-01

    Fat tail sheep (FTS) is regarded as highly prolific local sheep and have been well adapted under tropical climate of Lombok island. BMPR-1B and BMP15 genes that controll reproductive traits such as ovulation rate and litter size in different type of sheep will be studied as candidate genes for prolific traits in FTS. These genes  have been reported by various investigators have different prolificacy mechanism between several breeds of sheep, and it is very likely will occur in FTS. This study...

  20. 弛豫铁电体Pb(B_1B_2)O_3和钛酸铅固溶体的相稳定性

    罗豪甦; 许桂生; 徐海清; 齐振一; 仲维卓; 殷之文

    2000-01-01

    弛豫铁电体Pb(B1B2 )O3 和PbTiO3 能够形成具有复合钙钛矿结构的二元固溶体Pb(B1B2 )O3 PbTiO3 。到目前为止 ,已经发现了多种这类二元固溶体单晶 (如PMN PT、PZN PT和PSN PT等 )不仅具有良好的介电性能 ,而且具有良好的压电性能。和普通压电陶瓷PZT相比较 ,弛豫铁电单晶的纵向机电耦合系数k3 3 要大得多 ,可以达到 90 %以上。由于缺少这类二元固溶体单晶的高温相图 ,这类单晶的生长比较困难。我们通过对几种具有复合钙钛矿结构的二元固溶体体系 ,进行差热分析 (DTA)和热重分析 (TG) ,分析了固溶体的相关系和相稳定性。并用粉末X射线衍射谱 (XRD)分析了固溶体的结构 ,以便确定相应的单晶生长方法。研究结果表明 ,A(B1B2 )O3 PbTiO3 二元固溶体体系的结果比较复杂 ,体系中除了具有钙钛结构的铁电相之外 ,还有多种焦绿石相 ,而且不同的弛豫铁电体形成的固溶体其相稳定性的差异较大。其中PMN PT固溶体的相稳定性较高。研究结果表明 ,PMN PT固溶体的液相线和固相线比较接近 ,晶体生长中的分凝现象较小 ,可以看作为同成分熔化的化合物 ,故可...

  1. Macrosomia, obesity, and macrocephaly as first clinical presentation of PHP1b caused by STX16 deletion.

    de Lange, Iris M; Verrijn Stuart, Annemarie A; van der Luijt, Rob B; Ploos van Amstel, Hans Kristian; van Haelst, Mieke M

    2016-09-01

    Pseudohypoparathyroidism (PHP) is a genetic disorder with resistance to parathyroid hormone (PTH) as most important feature. Main subtypes of the disease are pseudohypoparathyroidism 1b (PHP1b) and pseudohypoparathyroidism 1a (PHP1a). PHP1b is characterized by PTH resistance of the renal cortex due to reduced activity of the stimulatory G protein α subunit (Gsα) of the PTH receptor. In addition to resistance to PTH, PHP1a patients also lack sensitivity for other hormones that signal their actions through G protein-coupled receptors and display physical features of Albright hereditary osteodystrophy (AHO), which is not classically seen in PHP1b patients. PHP1a is caused by heterozygous loss-of-function mutations in maternally inherited GNAS exons 1-13, which encode Gsα. PHP1b is often caused by deletion of the STX16 gene, which is thought to have an important role in controlling the methylation and thus imprinting at part of the GNAS locus. Here we present a patient with PHP1b caused by the previously described recurrent 3-kb STX16 deletion. The patient's first symptoms were macrosomia, early onset obesity, and macrocephaly. Since this is an atypical but previously described rare presentation of PHP1b, we reemphasize STX16 deletions and PHP1b as a rare cause for early onset obesity and macrosomia. © 2016 Wiley Periodicals, Inc. PMID:27338644

  2. Implication of protein tyrosine phosphatase 1B in MCF-7 cell proliferation and resistance to 4-OH tamoxifen

    Blanquart, Christophe; Karouri, Salah-Eddine [Institut Cochin, Universite Paris Descartes, CNRS (UMR 8104), Paris (France); Inserm, U567, Paris (France); Issad, Tarik, E-mail: tarik.issad@inserm.fr [Institut Cochin, Universite Paris Descartes, CNRS (UMR 8104), Paris (France); Inserm, U567, Paris (France)

    2009-10-02

    The protein tyrosine phosphatase 1B (PTP1B) and the T-cell protein tyrosine phosphatase (TC-PTP) were initially thought to be mainly anti-oncogenic. However, overexpression of PTP1B and TC-PTP has been observed in human tumors, and recent studies have demonstrated that PTP1B contributes to the appearance of breast tumors by modulating ERK pathway. In the present work, we observed that decreasing the expression of TC-PTP or PTP1B in MCF-7 cells using siRNA reduced cell proliferation without affecting cell death. This reduction in proliferation was associated with decreased ERK phosphorylation. Moreover, selection of tamoxifen-resistant MCF-7 cells, by long-term culture in presence of 4-OH tamoxifen, resulted in cells that display overexpression of PTP1B and TC-PTP, and concomitant increase in ERK and STAT3 phosphorylation. siRNA experiments showed that PTP1B, but not TC-PTP, is necessary for resistance to 4-OH tamoxifen. Therefore, our work indicates that PTP1B could be a relevant therapeutic target for treatment of tamoxifen-resistant breast cancers.

  3. Antagonism of serotonin receptor 1B decreases viability and promotes apoptosis in the COS canine osteosarcoma cell line.

    Viall, A K; Goodall, C P; Stang, B; Marley, K; Chappell, P E; Bracha, S

    2016-06-01

    Serotonin receptor 1B (5HTR1B) traditionally exhibits anti-proliferative activity in osteoblasts. We examined the expression and function of 5HTR1B in the COS canine osteosarcoma cell line and normal canine osteoblasts. Equal levels of 5HTR1B gene and protein expression were found between normal and malignant osteoblasts. Treatment with serotonin enhanced viability of osteosarcoma cells but not normal osteoblasts. Challenge with the 5HTR1B agonist anpirtoline caused no change in cell viability. Rather incubation with the specific receptor antagonist SB224289 caused reduction in osteoblast viability, with this effect more substantial in osteosarcoma cells. Investigation of this inhibitory activity showed 5HTR1B antagonism induces apoptosis in malignant cells. Evaluation of phosphorylated levels of CREB and ERK, transcriptional regulators associated with serotonin receptor signalling in osteoblasts, revealed aberrant 5HTR1B signalling in COS. Our results confirm the presence of 5HTR1B in a canine osteosarcoma cell line and highlight this receptor as a possible novel therapeutic target. PMID:24916076

  4. 76 FR 11686 - Registration Requirement for Petitioners Seeking to File H-1B Petitions on Behalf of Aliens...

    2011-03-03

    ... random selection process on March 24, 2008. See 73 FR 15389. Although the current regulations at 8 CFR...-1B Petitions on Behalf of Aliens Subject to the Numerical Limitations AGENCY: U.S. Citizenship and... is proposing to amend its regulations governing petitions filed on behalf of H-1B alien...

  5. Complete Genome Sequence of Bovine Viral Diarrhea Virus-1 Strain Egy/Ismailia/2014, Subtype 1b

    Soltan, Mohamed A.; Wilkes, Rebecca P.; Elsheery, Mohamed N.; Elhaig, Mahmoud M.; Riley, Matthew C.; Melissa A. Kennedy

    2015-01-01

    Here, we report the complete genome sequence of bovine viral diarrhea virus-1b (BVDV-1b), strain Egy/Ismailia/2014. The virus genome is composed of 12,217 nucleotides organized as one open reading frame encoding 3,898 amino acids. This report will assist efforts in diagnostics, studying molecular epidemiology, and control of BVDV in Egypt.

  6. Complete Genome Sequence of Bovine Viral Diarrhea Virus-1 Strain Egy/Ismailia/2014, Subtype 1b.

    Soltan, Mohamed A; Wilkes, Rebecca P; Elsheery, Mohamed N; Elhaig, Mahmoud M; Riley, Matthew C; Kennedy, Melissa A

    2015-01-01

    Here, we report the complete genome sequence of bovine viral diarrhea virus-1b (BVDV-1b), strain Egy/Ismailia/2014. The virus genome is composed of 12,217 nucleotides organized as one open reading frame encoding 3,898 amino acids. This report will assist efforts in diagnostics, studying molecular epidemiology, and control of BVDV in Egypt. PMID:26701085

  7. 76 FR 39254 - Airworthiness Directives; Schweizer Aircraft Corporation (Schweizer) Model 269A, A-1, B, C, C-1...

    2011-07-06

    ... Regulatory Policies and Procedures (44 FR 11034, February 26, 1979), (3) Will not affect intrastate aviation... Corporation (Schweizer) Model 269A, A-1, B, C, C-1, and TH-55 Series Helicopters AGENCY: Federal Aviation... reviewed Schweizer Service Bulletins No. B-295 for Model 269A, A-1, B, and C helicopters, and No....

  8. Interaction of novel bis(platinum) complexes with DNA.

    Roberts, J. D.; Van Houten, B; Qu, Y.; Farrell, N P

    1989-01-01

    Bis(platinum) complexes [[cis-PtCl2(NH3)]2H2N(CH2)nNH2] are a novel series of potential anticancer agents in which two cis-diamine(platinum) groups are linked by an alkyldiamine of variable length. These complexes are potentially tetrafunctional, a unique feature in comparison with known anticancer agents. Studies of DNA interactions of bis(platinum) complexes in comparison with cisplatin demonstrate significant differences. Investigations of interstrand crosslink formation in which crosslink...

  9. Biodistribution of bis(short-chain-amino)-ortho-dicarbaborane hydrochloride

    Bis(aminomethyl)-ortho-dicarbaborane hydrochloride and their nido-derivates, which may potentially be used as boron neutron capture therapy agents, have been synthesized from corresponding bis(short-chain-phthalimido)acetylenes in 81% yield. The pharmacokinetics of the type compounds is studied in healthy mice. Blood, liver, lung and spleen samples are collected at 8, 16, 30 and 48 hours after intra-peritoneal administration of the compound in healthy mice. In the study, the compound has been well absorbed and peak much earlier. (author)

  10. Expression of organic anion-transporting polypeptides 1B3, 1B1, and 1A2 in human pancreatic cancer reveals a new class of potential therapeutic targets

    Kounnis V

    2011-04-01

    Full Text Available Valentinos Kounnis1, Elli Ioachim2, Martin Svoboda3, Andreas Tzakos4, Ioannis Sainis1, Theresia Thalhammer3, Georg Steiner5, Evangelos Briasoulis11Cancer Biobank Center of the University of Ioannina, Greece; 2Pathology Department of Hatzikosta General Hospital, Ioannina Greece; 3Department of Pathophysiology and Allergy Research, Medical University of Vienna, Austria; 4Department of Chemistry, University of Ioannina, Greece; 5TissueGnostics GmbH, Vienna, AustriaBackground: Organic anion-transporting polypeptides (OATPs are influx transporters that mediate intracellular uptake of selective endogenous and xenobiotic compounds. Identification of new molecular targets and discovery of novel targeted therapies is top priority for pancreatic cancer, which lacks any effective therapy.Materials and methods: We studied expression of OATP 1A2, 1B1, and 1B3 in pancreatic cancer tissue and in cell lines. Formalin-fixed paraffin-embedded biopsy material of 12 human pancreatic cancers was immunohistochemically assessed for protein expression of the three studied influx transporters. Immunohistochemistry was evaluated by experienced pathologists and quantified by use of an automated image analysis system. BxPC-3 and MIA PaCa-2 pancreatic cancer cell lines were used to quantify transcripts of OATP 1B1 and 1B3.Results: OATP 1A2, 1B1, and 1B3 proteins were found ubiquitously expressed in all studied cases. Quantification performed by HistoQuest system revealed that mean intensity was 53 for 1A2, 45 for 1B1, and 167 for OATP 1B1/1B3 on a range scale 0–250 units. At mRNA level, 1B1 and 1B3 were overexpressed in both studied cancer cell lines but not in normal pancreatic tissue.Conclusion: OATPs 1A2, 1B1, and 1B3 are highly expressed in pancreatic adenocarcinoma. We suggest that expression of these transporters in pancreatic cancer justify research efforts towards discovery of novel therapeutics targeting OATPs.Keywords: organic anion-transporting polypeptides

  11. Discovery of novel, high potent, ABC type PTP1B inhibitors with TCPTP selectivity and cellular activity.

    Liu, Peihong; Du, Yongli; Song, Lianhua; Shen, Jingkang; Li, Qunyi

    2016-08-01

    Protein tyrosine phosphatase 1B (PTP1B) as a key negative regulator of both insulin and leptin receptor pathways has been an attractive therapeutic target for the treatment of type 2 diabetes mellitus (T2DM) and obesity. With the goal of enhancing potency and selectivity of the PTP1B inhibitors, a series of methyl salicylate derivatives as ABC type PTP1B inhibitors (P1-P7) were discovered. More importantly, compound P6 exhibited high potent inhibitory activity (IC50 = 50 nM) for PTP1B with 15-fold selectivity over T-cell PTPase (TCPTP). Further studies on cellular activities revealed that compound P6 could enhance insulin-mediated insulin receptor β (IRβ) phosphorylation and insulin-stimulated glucose uptake. PMID:27123900

  12. Investigating the Impact of Asp181 Point Mutations on Interactions between PTP1B and Phosphotyrosine Substrate

    Liu, Mengyuan; Wang, Lushan; Sun, Xun; Zhao, Xian

    2014-05-01

    Protein tyrosine phosphatase 1B (PTP1B) is a key negative regulator of insulin and leptin signaling, which suggests that it is an attractive therapeutic target in type II diabetes and obesity. The aim of this research is to explore residues which interact with phosphotyrosine substrate can be affected by D181 point mutations and lead to increased substrate binding. To achieve this goal, molecular dynamics simulations were performed on wild type (WT) and two mutated PTP1B/substrate complexes. The cross-correlation and principal component analyses show that point mutations can affect the motions of some residues in the active site of PTP1B. Moreover, the hydrogen bond and energy decomposition analyses indicate that apart from residue 181, point mutations have influence on the interactions of substrate with several residues in the active site of PTP1B.

  13. MYELOMA CELL CKS1B EXPRESSION IN 171 NEWLY DIAGNOSED PATIENTS IS NOT ASSOCIATED WITH INFERIOR SURVIVAL

    Christensen, Jacob Haaber; Abildgaard, Niels; Meldgaard Knudsen, Lene;

    2007-01-01

    cells from 171 untreated, newly diagnosed MM-patients. 36% of the patients (stem cell support. 56% (>65 years) were treated with standard melphalan and prednisolone,  and 8% were untreated. Median follow-up was 53 months. The clonal...... the overall survival was similar in patients with or without up-reulated CKS1B expression. In patients treated with conventional chemotherapy expression of CKS1B showed a trend towards a survival benefit (p=0.05). So, our data do not confirm that myeloma celle over-expression of CKS1B is associated with af......Introduction. In recent years global gene expression profiling studies introduce several new potential prognostic markers in multiple myeloma (MM). Up-regulation and amplification of the gene CKS1B in myeloma cells has lately been associated with a poor prognosis in MM patients. The CKS1B gene...

  14. Synthesis and structure of bis(diethyldithiocarbamato)nitridotechnetium(v): a technetium-nitrogen triple bond

    The compound bis(diethyldithiocarbamato)nitridotechnetium(V), (dtc)2TcN, has been prepared by the reduction of ammonium pertechnetate with hydrazine followed by reaction with sodium diethyldithiocarbamate. The crystal structure of (dtc)2TcN has been determined by single-crystal X-ray diffraction methods at 17 deg. C. Crystals are monoclinic, space group P21/c, Z = 4, a = 14.823 (1), b = 9.159(1), c = 12.865(1) A, β = 107.98(1) deg. Diffractometry has provided significant Bragg intensities for 2152 independent reflections and the structure has been refined by full-matrix least-squares methods to R 0.042. The compound, which is isostructural with the rhenium analogue, consists of discrete (dtc) 2TcN molecules, each containing a terminal N3- group. The technetium atom has a distorted square-pyramidal environment with the nitrogen atom in the apical position and four sulphur atoms forming the base

  15. PPM1B and P-IKKβ expression levels correlated inversely with rat gastrocnemius atrophy after denervation

    Jian Wei

    2012-08-01

    Full Text Available Activated inhibitor of nuclear factor-κB kinase β (IKKβ is necessary and sufficient for denervated skeletal muscle atrophy. Although several studies have shown that Mg2+/Mn2+-dependent protein phosphatase 1B (PPM1B inactivated IKKβ, few studies have investigated the role of PPM1B in denervated skeletal muscle. In this study, we aim to explore the expression and significance of PPM1B and phosphorylated IKKβ (P-IKKβ during atrophy of the denervated gastrocnemius. Thirty young adult female Wistar rats were subjected to right sciatic nerve transection and were sacrificed at 0 (control, 2, 7, 14, and 28 days after denervation surgery. The gastrocnemius was removed from both the denervated and the contralateral limb. The muscle wet weight ratio was calculated as the ratio of the wet weight of the denervated gastrocnemius to that of the contralateral gastrocnemius. RT-PCR and Western blot analysis showed that mRNA and protein levels of PPM1B were significantly lower than those of the control group at different times after the initiation of denervation, while P-IKKβ showed the opposite trends. PPM1B protein expression persistently decreased while P-IKKβ expression persistently increased for 28 days after denervation. PPM1B expression correlated negatively with P-IKKβ expression by the Spearman test, whereas decreasing PPM1B expression correlated positively with the muscle wet weight ratio. The expression levels of PPM1B and P-IKKβ were closely associated with atrophy in skeletal denervated muscle. These results suggest that PPM1B and P-IKKβ could be markers in skeletal muscle atrophy.

  16. PPM1B and P-IKKβ expression levels correlated inversely with rat gastrocnemius atrophy after denervation

    Wei, Jian; Liang, Bing-Sheng [Department of Orthopedics, the Second Hospital, Shanxi Medical University, Taiyuan (China)

    2012-05-18

    Activated inhibitor of nuclear factor-κB kinase β (IKKβ) is necessary and sufficient for denervated skeletal muscle atrophy. Although several studies have shown that Mg{sup 2+}/Mn{sup 2+}-dependent protein phosphatase 1B (PPM1B) inactivated IKKβ, few studies have investigated the role of PPM1B in denervated skeletal muscle. In this study, we aim to explore the expression and significance of PPM1B and phosphorylated IKKβ (P-IKKβ) during atrophy of the denervated gastrocnemius. Thirty young adult female Wistar rats were subjected to right sciatic nerve transection and were sacrificed at 0 (control), 2, 7, 14, and 28 days after denervation surgery. The gastrocnemius was removed from both the denervated and the contralateral limb. The muscle wet weight ratio was calculated as the ratio of the wet weight of the denervated gastrocnemius to that of the contralateral gastrocnemius. RT-PCR and Western blot analysis showed that mRNA and protein levels of PPM1B were significantly lower than those of the control group at different times after the initiation of denervation, while P-IKKβ showed the opposite trends. PPM1B protein expression persistently decreased while P-IKKβ expression persistently increased for 28 days after denervation. PPM1B expression correlated negatively with P-IKKβ expression by the Spearman test, whereas decreasing PPM1B expression correlated positively with the muscle wet weight ratio. The expression levels of PPM1B and P-IKKβ were closely associated with atrophy in skeletal denervated muscle. These results suggest that PPM1B and P-IKKβ could be markers in skeletal muscle atrophy.

  17. Interaction between genetic polymorphism of cytochrome P450-1B1 and environmental pollutants in breast cancer risk.

    Saintot, M; Malaveille, C; Hautefeuille, A; Gerber, M

    2004-02-01

    Cytochrome P450 1B1 (CYP1B1) is implicated in the activation of potentially carcinogenic xenobiotics and oestrogens. The polymorphism of the CYP1B1 gene at codon 432 (Val-->Leu) is associated with change in catalytic function. In a case-series study of breast cancer patients, we investigated the interaction between this polymorphism and environmental exposure. The women carrying the Val CYP1B1 allele and who had lived near to a waste incinerator for more than 10 years had a higher risk of breast cancer than those never exposed with the Leu/Leu genotype (odds ratio of interactions (ORi)=3.26, 95% confidence interval (CI) 1.20-8.84). Also, the Val CYP1B1 allele increased the susceptibility to breast cancer for women exposed during their life to agricultural products used in farming (ORi = 2.18, 95% CI 1.10-4.32). These xenobiotics, mainly organochlorine hydrocarbons, are known to bind to the aromatic hydrocarbon receptor (AhR), and to induce the expression of CYP1B1 enzyme. The excess risk for exposed women with a Val CYP1B1 homo/heterozygous genotype could result from a higher exposure to activated metabolites of pesticides or dioxin-like substances. Also, a higher induction of CYP1B1 enzyme by xenobiotics could increase the formation of genotoxic catechol-oestrogens among exposed women carrying the Val CYP1B1 allele. Our results suggested that the Val CYP1B1 allele increases the susceptibility to breast cancer in women exposed to waste incinerator or agricultural pollutants. PMID:15075793

  18. Hydrazonoyl Chlorides as Precursors for Synthesis of Novel Bis-Pyrrole Derivatives

    Nabila Abdelshafy Kheder

    2016-01-01

    A convenient synthesis of some novel bis-pyrrole derivatives via hydrazonoyl halides is described. Antimicrobial evaluation of some selected examples of the synthesized products was carried out. The bis-pyrrole derivative having chloro substituents showed good activity against all of the used microbes. The molecular docking of the bis-pyrrole derivatives was performed by the Molecular Operating Environment (MOE) program.

  19. 40 CFR 721.10096 - Benzene, 1,4-bis (methoxymethyl)-.

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Benzene, 1,4-bis (methoxymethyl)-. 721... Substances § 721.10096 Benzene, 1,4-bis (methoxymethyl)-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzene, 1,4-bis (methoxymethyl)- (PMN...

  20. 40 CFR 721.3340 - Ethanol, 2,2′-(hexylamino)bis-.

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Ethanol, 2,2â²-(hexylamino)bis-. 721... Substances § 721.3340 Ethanol, 2,2′-(hexylamino)bis-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as ethanol, 2,2′-(hexylamino)bis- (PMN...

  1. Archaeal remains dominate marine organic matter from the early Albian oceanic anoxic event 1b

    Kuypers, M.M.M.; Blokker, P.; Hopmans, E.C.;

    2002-01-01

    The sources for both soluble and insoluble organic matter of the early Albian (∼112 Myr) oceanic anoxic event (OAE) 1b black shales of the Ocean Drilling Program (ODP) site 1049C (North Atlantic Ocean off the coast of Florida) and the Ravel section of the Southeast France Basin (SEFB) were...... C/C ratios was used to estimate that up to ∼40% of the organic matter of the SEFB and up to ∼80% of the organic matter of ODP site 1049C preserved in the black shales is derived from archaea. Furthermore, it is shown that, even though there are apparent similarities (high organic carbon (OC) content......, distinct lamination, C-enrichment of OC) between the black shales of OAE1b and the Cenomanian/Turonian (∼94 Myr) OAE, the origin of the organic matter (archaeal versus phytoplanktonic) and causes for C-enrichment of OC are completely different. © 2002 Elsevier Science B.V. All rights reserved....

  2. A detection of the secondary eclipse of Qatar-1b in the Ks-band

    Cruz, Patricia; Lillo-Box, Jorge; Diaz, Marcos; Birkby, Jayne; López-Morales, Mercedes; Fortney, Jonathan J

    2016-01-01

    Qatar-1b is a close-orbiting hot-Jupiter ($R_p\\simeq 1.18$ $R_J$, $M_p\\simeq 1.33$ $M_J$) around a metal-rich K-dwarf, with orbital separation and period of 0.023 AU and 1.42 days, respectively. We have observed the secondary eclipse of this exoplanet in the Ks-band with the objective of deriving a brightness temperature for the planet and providing further constraints to the orbital configuration of the system. We obtained near-infrared photometric data from the ground by using the OMEGA2000 instrument at the 3.5 m telescope at Calar Alto (Spain), in staring mode, with the telescope defocused. We have used Principal Component Analysis (PCA) to identify correlated systematic trends in the data. A Markov chain Monte Carlo analysis was performed in order to model the correlated systematics and fit for the secondary eclipse of Qatar-1b using the occultation model by Mandel & Agol (2002). We measured a secondary eclipse depth of $0.196\\%^{+0.071\\%}_{-0.051\\%}$, which indicates a brightness temperature in the ...

  3. Esophageal Stricture Secondary to Candidiasis in a Child with Glycogen Storage Disease 1b.

    Lee, Kyung Jae; Choi, Shin Jie; Kim, Woo Sun; Park, Sung-Sup; Moon, Jin Soo; Ko, Jae Sung

    2016-03-01

    Esophageal candidiasis is commonly seen in immunocompromised patients; however, candida esophagitis induced stricture is a very rare complication. We report the first case of esophageal stricture secondary to candidiasis in a glycogen storage disease (GSD) 1b child. The patient was diagnosed with GSD type 1b by liver biopsy. No mutation was found in the G6PC gene, but SLC37A4 gene sequencing revealed a compound heterozygous mutation (p.R28H and p.W107X, which was a novel mutation). The patient's absolute neutrophil count was continuously under 1,000/µL when he was over 6 years of age. He was admitted frequently for recurrent fever and infection, and frequently received intravenous antibiotics, antifungal agents. He complained of persistent dysphagia beginning at age 7 years. Esophageal stricture and multiple whitish patches were observed by endoscopy and endoscopic biopsy revealed numerous fungal hyphae consistent with candida esophagitis. He received esophageal balloon dilatation four times, and his symptoms improved. PMID:27066451

  4. LEUPROLIDE INHIBITS MARBLE-BURYING BEHAVIOR VIA MODULATION OF 5-HT1B RECEPTOR

    Parle Milind

    2011-04-01

    Full Text Available Obsessive compulsive disorder (OCD is characterized by intrusive thoughts followed by repetitive behaviors. Serotonin-related genes found in OCD include those required for coding of 5-HT transporter and 5-HT receptors (5-HT2A, 5-HT2B, 5-HT2C and 5-HT1B. Marble-burying behavior of mice is a well-accepted paradigm to screen anti-compulsive activity. The aim of this study was to evaluate the effect of leuprolide alone and it’s combination with sumatriptan or ondansetron on marble-burying behavior of mice. Leuprolide (100, 200 & 300 µg kg-1s.c. dose-dependently showed anti-compulsive effect, causing statistically significant inhibition of marble-burying behavior of mice. The prior treatment with 5HT1B/1D/1F agonist, sumatriptan (0.1 mg kg-1 s.c. potentiated the inhibitory effect of leuprolide (LHRH agonist on marble burying behavior of mice. Furthermore, prior treatment with 5HT3 antagonist, ondansetron (2 mg kg-1 s.c. did not affect the inhibitory effect of leuprolide (200 µg kg-1s.c. on marble burying behavior of mice.

  5. α1B-Adrenoceptors mediate adrenergically-induced renal vasoconstrictions in rats with renal impairment

    Md Abdul Hye KHAN; Munavvar Abdul SATTAR; Nor Azizan ABDULLAH; Edward James JOHNS

    2008-01-01

    Aim: This study examined whether α1B-adrenoceptors are involved in mediating adrenergically-induced renal vasoconstrictor responses in rats with pathophysi-ological and normal physiological states. Methods: Male Wistar Kyoto and spon-taneously hypertensive rats were induced with acute renal failure or experimental early diabetic nephropathy by cisplatin or streptozotocin, respectively. Cisplatin-induced renal failure was confirmed by impaired renal function and pronounced tubular damage. Experimental early diabetic nephropathy was confirmed by hyperglycemia, changes in physiological parameters, and renal function. The hemodynamic study was conducted on anesthetized rats after 7 d of cisplatin (renal failure) and 4 weeks of streptozotocin (experimental early diabetic nephropathy). Results: In the rats with renal failure and experimental early dia-betic nephropathy, there were marked reductions in their baseline renal blood flow (P0.05) in the renal failure and experimental early diabetic nephropathy rats, respectively, as compared to their non-renal failure and non-diabetic nephropathy controls. In the rats with renal impairment, chloroethylclonidine caused either accentuation or attenuation (all P0.05). Conclusion: This study demonstrated the presence of functional α1B-adrenoceptors that mediated the adrenergically-induced renal vaso-constrictions in rats with renal impairment, but not in rats with normal renal function.

  6. Spitzer and z' Secondary Eclipse Observations of the Highly Irradiated Transiting Brown Dwarf KELT-1b

    Beatty, Thomas G; Fortney, Jonathan; Knutson, Heather; Gaudi, B Scott; Bruns, Jacob M; Showman, Adam P; Eastman, Jason; Pepper, Joshua; Siverd, Robert; Stassun, Keivan G; Kielkopf, John F

    2013-01-01

    We present secondary eclipse observations of the highly irradiated transiting brown dwarf KELT-1b. Using the Spitzer Space Telescope, we measure secondary eclipse depths of 0.195+/-0.010% at 3.6um and 0.200+/-0.012% at 4.5um, corresponding to a fairly grey color of [3.6]-[4.5]=0.07+/-0.11. Using four separate ground-based light curves, we find tentative evidence for the secondary eclipse in the z' band with a depth of 0.049+/-0.023%. These observations suggest that the amount of heat redistribution in the atmosphere to the night side is very low, and prefer a model in which there is no TiO inversion and a strong substellar hotspot. However, models with no TiO and a more mild hotspot, or with TiO absorption and complete dayside redistribution, are only marginally disfavored. The eclipse timings and durations indicate that the orbital eccentricity of KELT-1b is consistent with circular to better than a percent. These observations represent the first constraints on the atmospheric dynamics of a highly irradiated...

  7. Metabolism and mechanism of action of 1-B-D-arabinosyl-5-azacytosine

    1-B-D-arabinofuranosyl-5-azacytosine (ara-5-aza-Cyd) is an analog of 1-B-D-arabinofuranosylcytozine (ara-C) which is currently being considered for clinical trial. Ara-5-aza-Cyd reduced clonogenic survival of human T-lymphoblastic cells (Molt-4) in culture by 50% and 98% at initial concentrations of 10-7 M and 10-6 M, respectively, compared to 3 x 10-8 M and 10-6 M, respectively, for the same effect with ara-C. The analog is chemically unstable, with a T l/1 = 12 hr for the nucleoside and 5 hr for the triphosphate in phosphate-buffered saline (PBS) at 370C. Ara-5-aza-Cyd was incorporated in a dose-dependent manner into DNA, but not RNA, primarily in internucleotide linkage as the parent nucleoside, rather than the chemical breakdown product. Incorporation into the DNA of Molt-4 cells was 3-5-fold higher at 5-8 hr than ara-C incorporation. With gapped duplex DNA as a substrate for purified human DNA polymerases alpha and beta, inhibition of [3H]-dCTP incorporation by ara-5-aza-CTP and ara-CTP was competitive, with Ki values for polymerase alpha of 11 and 1.5 μM, respectively. Ki values for polymerase beta were 39 and 7.6 uM, respectively

  8. Adenovirus E1A/E1B Transformed Amniotic Fluid Cells Support Human Cytomegalovirus Replication

    Natascha Krömmelbein

    2016-02-01

    Full Text Available The human cytomegalovirus (HCMV replicates to high titers in primary human fibroblast cell cultures. A variety of primary human cells and some tumor-derived cell lines do also support permissive HCMV replication, yet at low levels. Cell lines established by transfection of the transforming functions of adenoviruses have been notoriously resistant to HCMV replication and progeny production. Here, we provide first-time evidence that a permanent cell line immortalized by adenovirus type 5 E1A and E1B (CAP is supporting the full HCMV replication cycle and is releasing infectious progeny. The CAP cell line had previously been established from amniotic fluid cells which were likely derived from membranes of the developing fetus. These cells can be grown under serum-free conditions. HCMV efficiently penetrated CAP cells, expressed its immediate-early proteins and dispersed restrictive PML-bodies. Viral DNA replication was initiated and viral progeny became detectable by electron microscopy in CAP cells. Furthermore, infectious virus was released from CAP cells, yet to lower levels compared to fibroblasts. Subviral dense bodies were also secreted from CAP cells. The results show that E1A/E1B expression in transformed cells is not generally repressive to HCMV replication and that CAP cells may be a good substrate for dense body based vaccine production.

  9. Planetary transit observations at the University Observatory Jena: XO-1b and TrES-1

    Raetz, St; Schmidt, T O B; Roell, T; Eisenbeiss, T; Hohle, M M; Tetzlaff, N; Vanko, M; Seifahrt, A; Broeg, Ch; Koppenhoefer, J; Neuhäuser, R

    2009-01-01

    We report on observations of transit events of the transiting planets XO-1b and TrES-1 with a 25 cm telescope of the University Observatory Jena. With the transit timings for XO-1b from all 50 available XO, SuperWASP, Transit Light Curve (TLC)-Project- and Exoplanet Transit Database (ETD)-data, including our own I-band photometry obtained in March 2007, we find that the orbital period is P= (3.941501 +/- 0.000001) d, a slight change by ~3 s compared to the previously published period. We present new ephemeris for this transiting planet. Furthermore, we present new R-band photometry of two transits of TrES-1. With the help of all available transit times from literature this allows us to refine the estimate of the orbital period: P=(3.0300722 +/- 0.0000002) d. Our observations will be useful for future investigations of timing variations caused by additional perturbing planets and/or stellar spots and/or moons.

  10. Microwave assisted synthesis of bis and tris(ω -bromoacetophenones): versatile precursors for novel bis(imidazo[1,2- a]pyridines), bis(imidazo[1,2- a]pyrimidines) and their tris-analogs

    Shaaban, Mohamed R.

    2013-01-01

    Background α-Bromination of the side chain of aromatic ketones using NBS in the presence of p-toluenesulfonic acid (p-TsOH) in acetonitrile is very common. However, regioselective bromination of bis and tris(ω -bromoacetophenones) with NBS in the presence of p-TsOH in acetonitrile under microwave irradiation is quite novel. The bis- and tris(ω -bromoacetophenones) are used in synthesis of bis and tris(heterocycles). bis(heterocycles) have received a great deal of attention, because many biolo...

  11. Undoing Gender Through Legislation and Schooling: the Case of AB 537 and AB 394 IN California, USA

    Knotts, Greg

    2009-11-01

    This article investigates California laws AB 537: The Student Safety and Violence Prevention Act of 2000, and the recently enacted AB 394: Safe Place to Learn Act. Both demand that gender identity and sexual orientation be added to the lexicon of anti-harassment protection in public education. However, despite these progressive measures, schools have an unconscious acceptance of heteronormativity and gendered norms, which undermines both the spirit and language of these laws. This paper examines how California schools can both change standard practices and realise the transformative social change that laws like AB 537 and AB 394 can instigate. I assert that the systemic implementation of these laws, through the adoption, enforcement and evaluation of existing AB 537 Task Force Recommendations, is necessary for their success. My second assertion is that AB 537 and AB 394 have the potential to change and reconstitute gender-based and heteronormative standards at school sites.

  12. 汽车ABS/ASR/ACC集成化系统%Integrated ABS/ASR/ACC System for the Car

    刘昭度; 卢江; 时开斌; 安巍

    2001-01-01

    叙述了ACC系统和ABS/ASR系统在改善汽车高速行驶主动安全性方面的功用,阐述了ACC系统是ABS/ASR系统功能的延伸、逻辑的发展及它们之间的内在联系,指出了在ABS/ASR的基础上只需增加测距装置和添加巡航控制子程序,就可方便地实现ABS/ASR/ACC集成化系统,并给出了集成化系统的控制框图和控制方法,论述了ABS/ASR/ACC集成化系统比孤立的ABS/ASR和ACC系统的优越性.%The individual functions of ACC and ABS/ASR are described in the improvements of active safety while the road vehicles travel at a high speed. Being a logic extension of and many inherent connections with ABS/BSR, ACC is easily integrated with ABS/ASR to form an integrated system by adding the headway distance*$-detecting device to the existing ABS/ASR system and expanding the ABS/ASR software. The algorithm flowcharts and control methods of the ABS/ASR/ACC are given. The advantages of the ABS/ASR/ACC system compared with those using the stand alone systems ABS, ASR and ACC are mentioned in details.

  13. Germacrene D Cyclization: An Ab Initio Investigation

    William N. Setzer

    2008-01-01

    Full Text Available Essential oils that contain large concentrations of germacrene D are typically accompanied by cadinane sesquiterpenoids. The acid-catalyzed cyclization of germacrene D to give cadinane and selinane sesquiterpenes has been computationally investigated using both density functional (B3LYP/6-31G* and post Hartree-Fock (MP2/6-31G** ab initio methods. The calculated energies are in general agreement with experimentally observed product distributions, both from acid-catalyzed cyclizations as well as distribution of the compounds in essential oils.

  14. Ab initio calculations of material strength

    Šob, Mojmír; Friák, Martin; Vitek, V.

    Tokyo : The Japan Society of Mechanical Engineers, 2003, s. 467-475. [International Symposium on Micro-Mechanical Engineering - Heat Transfer, Fluid Dynamics, Reliability and Mechanotronics.. Tsuchiura and Tsukuba (JP), 01.12.2003-03.12.2003] R&D Projects: GA AV ČR IAA1041302; GA ČR GA202/03/1351; GA MŠk OC 523.90 Institutional research plan: CEZ:AV0Z2041904 Keywords : ab initio calculations * electronic structure * theoretical tensile strength Subject RIV: BM - Solid Matter Physics ; Magnetism

  15. Ab Initio Molecular Dynamics: A Virtual Laboratory

    Hobbi Mobarhan, Milad

    2014-01-01

    In this thesis, we perform ab initio molecular dynamics (MD) simulations at the Hartree-Fock level, where the forces are computed on-the-fly using the Born-Oppenheimer approximation. The theory behind the Hartree-Fock method is discussed in detail and an implementation of this method based on Gaussian basis functions is explained. We also demonstrate how to calculate the analytic energy derivatives needed for obtaining the forces acting on the nuclei. Hartree-Fock calculations on the ground s...

  16. Asiakassuhdehallinnan kehityssuunnitelma : Case: Oy Combi Cool Ab

    Puikkonen, Touko

    2011-01-01

    Tässä insinöörityössä tutustuttiin Oy Combi Cool Ab:n asiakassuhdehallintaan ja siinä havaittuihin puutteisiin ja kehitystarpeisiin. Työn tarkoituksena oli luoda yritykselle ajan tasalla oleva asiakasrekisteri ja sen pohjalta kehittää asiakassuhdehallintaa etenkin myynnin, oston ja johdon henkilöstön tarpeita ajatellen muovaamalla siitä henkilöstön myynti- ja asiakaspalvelutyöskentelyä tehostava toimiva kokonaisuus. Combi Cool on vuonna 1985 perustettu kylmäalan tukkuliike, joka on vajaan 30 ...

  17. Testing Distributed ABS System with Fault Injection

    Trawczyński, Dawid; Sosnowski, Janusz; Gawkowski, Piotr

    The paper deals with the problem of adapting software implemented fault injection technique (SWIFI) to evaluate dependability of reactive microcontroller systems. We present an original methodology of disturbing controller operation and analyzing fault effects taking into account reactions of the controlled object and the impact of the system environment. Faults can be injected randomly (in space and time) or targeted at the most sensitive elements of the controller to check it at high stresses. This approach allows identifying rarely encountered problems, usually missed in classical approaches. The developed methodology has been used successfully to verify dependability of ABS system. Experimental results are commented in the paper.

  18. Poly[bis[μ-1,3-bis(imidazol-1-ylmethylbenzene-κ2N3:N3′]bis(nitrato-κOcadmium

    Xi-Ying Hu

    2011-07-01

    Full Text Available A novel metal–organic framework based on 1,3-bis(imidazol-1-ylmethylbenzene (1,3-bimb, [Cd(NO32(C14H14N42]n, has been synthesized hydrothermally. The structure exhibits a two-dimensional metal–organic (4,4-net composed of CdII atoms and bimb ligands, and such layers are further joined through interlayer C—H...O hydrogen bonds to generate a three-dimensional supramolecular structure.

  19. The Effects of Dwarfing Genes (Rht-B1b,Rht-D1b,and Rht8) with Different Sensitivity to GA3 on the Coleoptile Length and Plant Height of Wheat

    TANG Na; JIANG Ying; HE Bei-ru; HU Yin-gang

    2009-01-01

    Understanding the effects of wheat dwarfing genes on the coleoptile length and plant height is crucial for the proper utilization of dwarfing genes in the improvement of wheat yield.Molecular marker analysis combined with pedigree information were used to classify wheat cultivars widely planted in major wheat growing regions in China into different categories based on the dwarfing genes they carried.The effects of the dwarfing genes with different sensitivity to gibberellins (GA3) on the coleoptile length and plant height were analyzed.Screening of 129 cultivars by molecular marker analysis revealed that 58 genotypes of wheat contained the dwarfing gene Rht-B1b,24 genotypes of wheat contained Rht-D1b gene and 73 genotypes of wheat possessed Rht8 gene.In addition,among these 129 cultivars,35 genotypes of wheat cultivars contained both Rht-B1b and Rht8 genes and 16 genotypes of wheat cultivars contained both Rht-D1b and Rht8 genes.Wheat cultivars with the dwarfing genes Rht-B1b or Rht-D1b were insensitive to GA3,while the cultivars with the dwarfing gene Rht8 were sensitive to GA3.Most of the wheat genotypes containing combination of Rht8 gene with either Rht-B1b or Rht-Dlb gene were insensitive to GA3.The plant height was reduced by 24.6,30.4,28.2,and 32.2%,respectively,for the wheat cultivars containing Rht-B1b,Rht-D1b,Rht-B1b+Rht8,and Rht-D1b+Rht8 genes.The plant height was reduced by 14.3% for the wheat cultivar containing GA3-sensitive gene Rht8.The coleoptile length was shortened by 25.4,31.3,28.4 and 31.3%,respectively,in the wheat cultivars containing Rht-B1b,Rht-D1b,Rht-B1b+Rht8 and Rht-D1b+Rht8 genes,while the coleoptile length was shortened only by 6.2% for the wheat cultivar containing Rht8 gene.We conclude that GA3-insensitive dwarfing genes (Rht-B1b and Rht-D1b)are not suitable for the wheat improvement in dryland because these two genes have eflfect on reducing both plant height and coleoptile length.In contrast,GA3-sensitive dwarfing gene (Rht8) is a

  20. A short Gfi-1B isoform controls erythroid differentiation by recruiting the LSD1-corest complex through the dimethylation of its SNAG domain

    B. Laurent (Benoît); V. Randrianarison-Huetz (Voahangy); E. Frisan (Emilie); C. Andrieu-Soler (Charlotte); E. Soler (Eric); M. Fontenay (Michaela); I. Dusanter-Fourt (Isabelle); D. Dumenil (Dominique)

    2012-01-01

    textabstractGfi-1B is a transcriptional repressor essential for the regulation of erythropoiesis and megakaryopoiesis. Here we identify Gfi-1B p32, a Gfi-1B isoform, as essential for erythroid differentiation. Gfi-1B p32 is generated by alternative splicing and lacks the two first zinc finger domain

  1. On the analysis of BIS stage epochs via fuzzy clustering.

    Nasibov, Efendi; Ozgören, Murat; Ulutagay, Gözde; Oniz, Adile; Kocaaslan, Sibel

    2010-06-01

    Among various types of clustering methods, partition-based methods such as k-means and FCM are widely used in the analysis of such data. However, when duration between stimuli is different, such methods are not able to provide satisfactory results because they find equal size clusters according to the fundamental running principle of these methods. In such cases, neighborhood-based clustering methods can give more satisfactory results because measurement series are separated from one another according to dramatic breaking points. In recent years, bispectral index (BIS) monitoring, which is used for monitoring the level of anesthesia, has been used in sleep studies. Sleep stages are classically scored according to the Rechtschaffen and Kales (R&K) scoring system. BIS has been shown to have a strong correlation with the R&K scoring system. In this study, fuzzy neighborhood/density-based spatial clustering of applications with noise (FN-DBSCAN) that combines speed of the DBSCAN algorithm and robustness of the NRFJP algorithm is applied to BIS measurement series. As a result of experiments, we can conclude that, by using BIS data, the FN-DBSCAN method estimates sleep stages better than the fuzzy c-means method. PMID:20156029

  2. 2,6-Bis(9-ethyl-9H-carbazolylmethylenecyclohexanone

    Abdullah M. Asiri

    2009-10-01

    Full Text Available The title compound, 2,6-bis(ethyl-9-ethyl-9H-carbazolylmethylenecyclohexanone has been synthesized by condensation of 9-ethylcarbazole-3-aldehyde and cyclohexanone in ethanol in the presence of pyridine. The structure of this new compound was confirmed by elemental analysis, IR, 1H NMR, 13C NMR and EI-MS spectral analysis.

  3. Multifunctional switches based on bis-imidazole derivative

    Abdullah M A Asiri; Gameel A Baghaffar; Khadija O Badahdah; Abdullah G M Al-Sehemi; Salman A Khan; Abeer A Bukhari

    2009-11-01

    multifunctional bis-imidazole derived from piperonal was prepared and found to have photo, thermo, solvato and peiezochromism with colour changes from pale green to deep blue. The multifunctionality colour changes and stability of the coloured species make the derivative candidates for various applications such as optical data storage. The photochromic properties and performance were found to be affected remarkably upon changing the solvent.

  4. 3,5-Bis(2-hydroxybenzylidenepiperidin-4-one

    Yum Eryanti

    2014-05-01

    Full Text Available The title compound, 3,5-bis(2-hydroxybenzylidenepiperidin-4-one (3, was prepared via reaction of 2-hydroxybenzaldehyde (1 and 4-piperidone (2 under microwave irradiation in the presence of 10% NaOH solution. The compound was fully characterized from its UV, IR, NMR and MS data.

  5. Preparation of ferrocenyl imidazolines using bis(triphenyl)oxodiphosphonium trifluoromethanesulfonate

    WANG XueQiang; XIA JiBao; DAI XiaoYang; YOU ShuLi

    2009-01-01

    An efficient synthesis of ferrocenyl imidazolines starting from ferrocenyl carboxylic acids has been developed.Bis(triphenyl)oxodiphosphonium trifluoromethanesulfonate was used to convert smoothly ferrocenyl carboxylic amides bearing an amine side chain,derived from ferrocenyl carboxylic acids and 1,2-diamines,to their corresponding ferrocenyl imidazolines.

  6. Preparation of ferrocenyl imidazolines using bis(triphenyl)oxodiphosphonium trifluoromethanesulfonate

    2009-01-01

    An efficient synthesis of ferrocenyl imidazolines starting from ferrocenyl carboxylic acids has been developed. Bis(triphenyl)oxodiphosphonium trifluoromethanesulfonate was used to convert smoothly ferrocenyl carboxylic amides bearing an amine side chain, derived from ferrocenyl carboxylic acids and 1,2-diamines, to their corresponding ferrocenyl imidazolines.

  7. A New Bis-iridoid Glucoside from Mussaenda incana

    Biswanath DINDA; Sudhan DEBNATH; Santanu MAJUMDER; Shiho ARIMA; Nariko SATO; Yoshihiro HARIGAYA

    2006-01-01

    A new bis-iridoid glucoside, incaside 1 was isolated along with known iridoid, 6-0veratroylcatalposide from the stem-bark of Mussaenda incana. The structure of the new iridoid was established mainly on the basis of the spectroscopic (including 2D NMR) and chemical studies of its octaacetate 1a.

  8. Microcystin-LR induces anoikis resistance to the hepatocyte uptake transporter OATP1B3-expressing cell lines

    Microcystin-LR is a cyclic peptide released by several bloom-forming cyanobacteria. Understanding the mechanism of microcystin-LR toxicity is important, because of the both potencies of its acute cytotoxicity and tumor-promoting activity in hepatocytes of animals and humans. Recently, we have reported that the expression of human hepatocyte uptake transporter OATP1B3 was critical for the selective uptake of microcystin-LR into hepatocytes and for induction of its fatal cytotoxicity. In this study, we demonstrated a novel function of microcystin-LR which induced bipotential changes including anoikis resistance and cytoskeleton reorganization to OATP1B3-transfected HEK293 cells (HEK293-OATP1B3). After exposure to microcystin-LR, HEK293-OATP1B3 cells were divided to the floating cells and remaining adherent cells. After collection and reseeding the floating cells into a fresh flask, cells were confluently proliferated (HEK293-OATP1B3-FL) under the microcystin-LR-free condition. Both the proliferated HEK293-OATP1B3-FL and remaining adherent HEK293-OATP1B3-AD cells changed the character with down- and up-regulation of E-cadherin, respectively. Additionally, these cells acquired resistance to microcystin-LR. These results suggest that microcystin-LR could be associated with not only tumor promotion, but also epithelial–mesenchymal transition-mediated cancer metastasis. Furthermore, microcystin-LR might induce the cytoskeleton reorganization be accompanied epithelial–mesenchymal transition

  9. Molecular evolution, characterization and expression profiling of uterine aldoketoreductase 1B5 gene in endometrium of goat (Capra hircus).

    Kumar, Rohit; Ramteke, P W; Sharma, Sanjeev Kumar; Mitra, Abhijit

    2015-01-01

    Aldoketoreductase 1B5 (AKR1B5), a member of the Aldoketoreductase family, is involved in the production of Prostaglandin F2α (PGF2α) as one of vital prostaglandin F synthase (PGFS). PGs (Prostaglandins) play a crucial role in female reproductive system. In the present study, we cloned and characterized the full-length open reading frame of AKR1B5 gene in Black Bengal (BB) goat. The complete coding sequence of AKR1B5 comprises an entire open reading frame of 951 bp, encoding 316 amino acid (AA) residues. BB AKR1B5 showed >82.9% identity with that of cattle, rabbit, human, and rat at nucleotide and amino acid levels, respectively. Further, a systematic study of AKR1B5 sequence evolution was also conducted using Phylogenetic Analysis by Maximum Likelihood (PAML), entropy plot, and Blossum 62 in a phylogenetic context. Analysis of nonsynonymous to synonymous nucleotide substitution rate ratios (Ka/Ks) revealed that negative selection may have been operating on this gene during evolution in goat, cattle, rabbit, human, and rat, which showed its conservation across species. Further, expression of AKR1B5 was determined by quantitative real-time PCR in goat endometrial tissues at different stages of the estrous cycle and early pregnancy. Our results indicated its high expression at luteolytic phase (stage III; day 16-21) during the estrous cycle. However, during early (day ∼30-40) pregnancy the expression was highest as compared to estrous cycle. PMID:25153450

  10. Review of Terra MODIS thermal emissive band L1B radiometric performance

    Moeller, Chris; Menzel, W. P.; Quinn, Greg

    2014-09-01

    The MODerate-resolution Imaging Spectroradiometer (MODIS) on NASA's Earth Observing System Terra satellite, launched into orbit on 18 December 1999, will have a "first light" 15th anniversary on 24 February 2015. For nearly 15 years the MODIS instrument has provided radiances in all spectral bands. Though some detectors have fallen below SNR thresholds, the vast majority of spectral bands continue to provide high quality L1B measurements for use in L2 science algorithms supporting global climate research. Radiometric accuracy of the Terra MODIS thermal emissive bands (TEBs) in the C6 L1B product has been assessed using various approaches over the nearly 15 year Terra MODIS data record, including comparisons with instruments on the ground, in aircraft under-flights, and on other satellites. All of these approaches contribute to the understanding of the Terra MODIS radiometric L1B performance. Early in the lifetime of Terra, ground-based measurements and NASA ER-2 aircraft under-flights revealed that TEBs in the infrared window ("window" bands) are well calibrated and performing within accuracy specifications. The ER-2 under-flights also suggested that many atmospheric bands may be performing outside of specification, especially LWIR CO2 sensitive bands that are subject to optical crosstalk, although analysis uncertainties are larger for atmospheric bands. Beginning in 2007, MetOp-A IASI observations were used to evaluate Terra MODIS TEB performance through Simultaneous Nadir Overpass (SNO) comparisons. These inter-satellite comparisons largely affirm the early aircraft and ground-based evaluations, showing that all Terra MODIS window bands have small biases, minimal trending, and minor detector and mirror side striping over the 2007-2013 timeframe. Most atmospheric bands are performing satisfactorily near to specification; however, biases, striping and trending are large and significantly out of specification in the water vapor sensitive band 27 and ozone sensitive

  11. Localisation of the Putative Magnetoreceptive Protein Cryptochrome 1b in the Retinae of Migratory Birds and Homing Pigeons.

    Petra Bolte

    Full Text Available Cryptochromes are ubiquitously expressed in various animal tissues including the retina. Some cryptochromes are involved in regulating circadian activity. Cryptochrome proteins have also been suggested to mediate the primary mechanism in light-dependent magnetic compass orientation in birds. Cryptochrome 1b (Cry1b exhibits a unique carboxy terminus exclusively found in birds so far, which might be indicative for a specialised function. Cryptochrome 1a (Cry1a is so far the only cryptochrome protein that has been localised to specific cell types within the retina of migratory birds. Here we show that Cry1b, an alternative splice variant of Cry1a, is also expressed in the retina of migratory birds, but it is primarily located in other cell types than Cry1a. This could suggest different functions for the two splice products. Using diagnostic bird-specific antibodies (that allow for a precise discrimination between both proteins, we show that Cry1b protein is found in the retinae of migratory European robins (Erithacus rubecula, migratory Northern Wheatears (Oenanthe oenanthe and pigeons (Columba livia. In all three species, retinal Cry1b is localised in cell types which have been discussed as potentially well suited locations for magnetoreception: Cry1b is observed in the cytosol of ganglion cells, displaced ganglion cells, and in photoreceptor inner segments. The cytosolic rather than nucleic location of Cry1b in the retina reported here speaks against a circadian clock regulatory function of Cry1b and it allows for the possible involvement of Cry1b in a radical-pair-based magnetoreception mechanism.

  12. Localisation of the Putative Magnetoreceptive Protein Cryptochrome 1b in the Retinae of Migratory Birds and Homing Pigeons.

    Bolte, Petra; Bleibaum, Florian; Einwich, Angelika; Günther, Anja; Liedvogel, Miriam; Heyers, Dominik; Depping, Anne; Wöhlbrand, Lars; Rabus, Ralf; Janssen-Bienhold, Ulrike; Mouritsen, Henrik

    2016-01-01

    Cryptochromes are ubiquitously expressed in various animal tissues including the retina. Some cryptochromes are involved in regulating circadian activity. Cryptochrome proteins have also been suggested to mediate the primary mechanism in light-dependent magnetic compass orientation in birds. Cryptochrome 1b (Cry1b) exhibits a unique carboxy terminus exclusively found in birds so far, which might be indicative for a specialised function. Cryptochrome 1a (Cry1a) is so far the only cryptochrome protein that has been localised to specific cell types within the retina of migratory birds. Here we show that Cry1b, an alternative splice variant of Cry1a, is also expressed in the retina of migratory birds, but it is primarily located in other cell types than Cry1a. This could suggest different functions for the two splice products. Using diagnostic bird-specific antibodies (that allow for a precise discrimination between both proteins), we show that Cry1b protein is found in the retinae of migratory European robins (Erithacus rubecula), migratory Northern Wheatears (Oenanthe oenanthe) and pigeons (Columba livia). In all three species, retinal Cry1b is localised in cell types which have been discussed as potentially well suited locations for magnetoreception: Cry1b is observed in the cytosol of ganglion cells, displaced ganglion cells, and in photoreceptor inner segments. The cytosolic rather than nucleic location of Cry1b in the retina reported here speaks against a circadian clock regulatory function of Cry1b and it allows for the possible involvement of Cry1b in a radical-pair-based magnetoreception mechanism. PMID:26953791

  13. Localisation of the Putative Magnetoreceptive Protein Cryptochrome 1b in the Retinae of Migratory Birds and Homing Pigeons

    Bolte, Petra; Bleibaum, Florian; Einwich, Angelika; Günther, Anja; Liedvogel, Miriam; Heyers, Dominik; Depping, Anne; Wöhlbrand, Lars; Rabus, Ralf; Janssen‐Bienhold, Ulrike; Mouritsen, Henrik

    2016-01-01

    Cryptochromes are ubiquitously expressed in various animal tissues including the retina. Some cryptochromes are involved in regulating circadian activity. Cryptochrome proteins have also been suggested to mediate the primary mechanism in light-dependent magnetic compass orientation in birds. Cryptochrome 1b (Cry1b) exhibits a unique carboxy terminus exclusively found in birds so far, which might be indicative for a specialised function. Cryptochrome 1a (Cry1a) is so far the only cryptochrome protein that has been localised to specific cell types within the retina of migratory birds. Here we show that Cry1b, an alternative splice variant of Cry1a, is also expressed in the retina of migratory birds, but it is primarily located in other cell types than Cry1a. This could suggest different functions for the two splice products. Using diagnostic bird-specific antibodies (that allow for a precise discrimination between both proteins), we show that Cry1b protein is found in the retinae of migratory European robins (Erithacus rubecula), migratory Northern Wheatears (Oenanthe oenanthe) and pigeons (Columba livia). In all three species, retinal Cry1b is localised in cell types which have been discussed as potentially well suited locations for magnetoreception: Cry1b is observed in the cytosol of ganglion cells, displaced ganglion cells, and in photoreceptor inner segments. The cytosolic rather than nucleic location of Cry1b in the retina reported here speaks against a circadian clock regulatory function of Cry1b and it allows for the possible involvement of Cry1b in a radical-pair-based magnetoreception mechanism. PMID:26953791

  14. Elastic properties of intermetallic AB2 and AB5 hydrogen-absorbing compounds

    The elastic properties of AB2 and AB5 hydrogen-absorbing intermetallic compounds are reviewed. The relevance of these properties to hydrogen absorption is discussed briefly. In many cases the temperature dependence of the elastic constants of the AB2 compounds is anomalous in that the moduli do not decrease monotonically with increasing temperature. This unusual behavior appears to be associated with electronic structure effects in a number of cases. The absorption of hydrogen by polycrystalline TaV2 has a profound effect on the aggregate shear modulus, changing both the magnitude and temperature dependence significantly. This effect of hydrogen on the mechanical properties appears to occur via effects on the electronic structure. Few measurements of elastic properties have been reported for hydrogen-absorbing AB5 intermetallic compounds. The LaAlxNi5-x system has been investigated by means of measurements on polycrystals prepared by hot isostatic pressing. The moduli decrease about 8% as x increases from 0 to 1

  15. Synthesis, Reactions and Biological Evaluation of Some New Naphtho[2,1-b]furan Derivatives Bearing a Pyrazole Nucleus

    El-Agrody, Ahemed M.; Fawzy M. Ali; Halawa, Ahmed H. A.; Ashraf H.F. Abd El-Wahab; Al-Fifi, Zarrag Isa A.; Bedair, Ahmed H

    2011-01-01

    Vilsmeier formylation of 2-(1-phenylhydrazonoethyl)naphtho[2,1-b]furan (2) gave 3-naphtho[2,1-b]furan-2-yl-1-phenyl-1H-pyrazole-4-carbaldehyde (3), which was reacted with C- and N-nucleophiles to afford naphthofuranpyrazol derivatives 4-8. Treatment of 2-[(3-(naphtho[2,1-b]furan-2-yl)-1-phenyl-1H-pyrazol-4-yl)methylene]-malononitrile (4a) with reactants having active hydrogen and Et3N gave the corresponding pyrazoline, pyran and chromene addition product derivatives 10, 12 and 13, consisting ...

  16. HNF-1B specifically regulates the transcription of the γa-subunit of the Na+/K+-ATPase

    Research highlights: → Defects in HNF-1B transcription factor affect Mg2+ handling in the distal kidney. → γa- and γb- subunits of the Na+/K+-ATPase colocalize in the distal convoluted tubule of the nephron. → HNF-1B specifically activates γa expression. → HNF-1B mutants have a dominant negative effect on wild type HNF-1B activity. → Defective transcription of γa may promote renal Mg2+ wasting. -- Abstract: Hepatocyte nuclear factor-1B (HNF-1B) is a transcription factor involved in embryonic development and tissue-specific gene expression in several organs, including the kidney. Recently heterozygous mutations in the HNF1B gene have been identified in patients with hypomagnesemia due to renal Mg2+ wasting. Interestingly, ChIP-chip data revealed HNF-1B binding sites in the FXYD2 gene, encoding the γ-subunit of the Na+/K+-ATPase. The γ-subunit has been described as one of the molecular players in the renal Mg2+ reabsorption in the distal convoluted tubule (DCT). Of note, the FXYD2 gene can be alternatively transcribed into two main variants, namely γa and γb. In the present study, we demonstrated via two different reporter gene assays that HNF-1B specifically acts as an activator of the γa-subunit, whereas the γb-subunit expression was not affected. Moreover, the HNF-1B mutations H69fsdelAC, H324S325fsdelCA, Y352finsA and K156E, previously identified in patients with hypomagnesemia, prevented transcription activation of γa-subunit via a dominant negative effect on wild type HNF1-B. By immunohistochemistry, it was shown that the γa- and γb-subunits colocalize at the basolateral membrane of the DCT segment of mouse kidney. On the basis of these data, we suggest that abnormalities involving the HNF-1B gene may impair the relative abundance of γa and γb, thus affecting the transcellular Mg2+ reabsorption in the DCT.

  17. The 4.1B cytoskeletal protein regulates the domain organization and sheath thickness of myelinated axons

    Einheber, Steven; Maurel, Patrice; Meng, Xiaosong; Rubin, Marina; Lam, Isabel; Mohandas, Narla; An, Xiuli; Shrager, Peter; Kissil, Joseph; Salzer, James L.

    2012-01-01

    Myelinated axons are organized into specialized domains critical to their function in saltatory conduction, i.e. nodes, paranodes, juxtaparanodes, and internodes. Here, we describe the distribution and role of the 4.1B protein in this organization. 4.1B is expressed by neurons, and at lower levels by Schwann cells, which also robustly express 4.1G. Immunofluorescence and immuno-EM demonstrates 4.1B is expressed subjacent to the axon membrane in all domains except the nodes. Mice deficient in ...

  18. Functional modulation of the glutamate transporter variant GLT1b by the PDZ domain protein PICK1

    Søgaard, Rikke; Borre, Lars; Braunstein, Thomas H;

    2013-01-01

    The dominant glutamate transporter isoform in the mammalian brain, GLT1, exists as at least three splice variants, GLT1a, GLT1b, and GLT1c. GLT1b interacts with the scaffold protein PICK1 (protein interacting with kinase C1), which is implicated in glutamatergic neurotransmission via its regulatory...... effect on trafficking of AMPA-type glutamate receptors. The 11 extreme C-terminal residues specific for the GLT1b variant are essential for its specific interaction with the PICK1 PDZ domain, but a functional consequence of this interaction has remained unresolved. To identify a functional effect of PICK...

  19. The AP-1A and AP-1B clathrin adaptor complexes define biochemically and functionally distinct membrane domains

    Fölsch, Heike; Pypaert, Marc; Maday, Sandra; Pelletier, Laurence; Mellman, Ira

    2003-01-01

    Most epithelial cells contain two AP-1 clathrin adaptor complexes. AP-1A is ubiquitously expressed and involved in transport between the TGN and endosomes. AP-1B is expressed only in epithelia and mediates the polarized targeting of membrane proteins to the basolateral surface. Both AP-1 complexes are heterotetramers and differ only in their 50-kD μ1A or μ1B subunits. Here, we show that AP-1A and AP-1B, together with their respective cargoes, define physically and functionally distinct membra...

  20. Role of miR-511 in the Regulation of OATP1B1 Expression by Free Fatty Acid

    Peng, Jin Fu; Liu, Li; Guo, Cheng Xian; Liu, Shi Kun; Chen, Xiao Ping; Huang, Li Hua; Xiang, Hong; Huang, Zhi Jun; Yuan, Hong; Yang, Guo Ping

    2015-01-01

    MicroRNAs (miRNAs) are a family of non-coding RNA that are able to adjust the expression of many proteins, including ATP-binding cassette transporter and organic cation transporter. We sought to evaluate the effect of miR-511 on the regulation of OATP1B1 expression by free fatty acids. When using free fatty acids to stimulate Chang liver cells, we found that the expression of miR-511 increased significantly while the expression of OATP1B1 decreased. We also proved that SLCO1B1 is the target g...

  1. Molecular dynamics simulations of protein-tyrosine phosphatase 1B: II. Substrate-enzyme interactions and dynamics

    Peters, Günther H.j.; Frimurer, T. M.; Andersen, J. N.; Olsen, O. H.

    2000-01-01

    Molecular dynamics simulations of protein tyrosine phosphatase 1B (PTP1B) complexed with the phosphorylated peptide substrate DADEpYL and the free substrate have been conducted to investigate 1) the physical forces involved in substrate-protein interactions, 2) the importance of enzyme and...... substrate binding. Based on essential dynamics analysis of the PTP1B/DADEpYL trajectory, it is shown that internal motions in the binding pocket occur in a subspace of only a few degrees of freedom. in particular, relatively large flexibilities are observed along several eigenvectors in the segments: Arg(24...

  2. Human immunodeficiency virus type 1 mutants that escape neutralization by human monoclonal antibody IgG1b12. off.

    Mo, H; Stamatatos, L; Ip, J E; Barbas, C F; Parren, P W; Burton, D R; Moore, J. P.; Ho, D D

    1997-01-01

    IgG1b12, a human monoclonal antibody (MAb) to an epitope overlapping the CD4-binding site on gp120, has broad and potent neutralizing activity against most primary human immunodeficiency virus type 1 (HIV-1) isolates. To assess whether and how escape mutants resistant to IgG1b12 can be generated, we cultured primary HIV-1 strain JRCSF in its presence. An escape mutant emerged which was approximately 100-fold more resistant to neutralization by IgG1b12. Both virion-associated and solubilized g...

  3. Biological activity and binding site characteristics of the PA1b Entomotoxin on insects from different orders

    Gressent, Frederic; Duport, Marie-Gabrielle; Rahioui, Isabelle; Pauchet, Yannick; Bolland, Patrice; Specty, Olivier; Rahbé, Yves

    2007-01-01

    The aim of this work was to investigate both the biological activity of an entomotoxin, the pea albumin 1b (PA1b), and the presence or absence of its binding site within an array of insect species. The data obtained showed that insect sensitivity was not related to its taxonomic position. Moreover, PA1b was not toxic to several tested microorganisms. However, the binding site was found to be conserved among very different insects, displaying similar thermodynamic constants regardless of the i...

  4. Biosorption of Acid Blue 290 (AB 290) and Acid Blue 324 (AB 324) dyes on Spirogyra rhizopus

    In this study, the biosorption of Acid Blue 290 and Acid Blue 324 on Spirogyra rhizopus, a green algae growing on fresh water, was studied with respect to initial pH, temperature, initial dye concentration and biosorbent concentration. The optimum initial pH and temperature values for AB 290 and AB 324 biosorption were found to be 2.0, 30 deg. C and 3.0, 25 deg. C, respectively. It was observed that the adsorbed AB 290 and AB 324 amounts increased with increasing the initial dye concentration up to 1500 and 750 mg/L, respectively. The Langmuir, Freundlich, Redlich-Peterson and Koble-Corrigan isotherm models were applied to the experimental equilibrium data and the isotherm constants were determined by using Polymath 4.1 software. The monolayer coverage capacities of S. rhizopus for AB 290 and AB 324 dyes were found as 1356.6 mg/g and 367.0 mg/g, respectively. The intraparticle diffusion model and the pseudo-second order kinetic model were applied to the experimental data in order to describe the removal mechanism of these acidic dyes by S. rhizopus. The pseudo-second order kinetic model described very well the biosorption kinetics of AB 290 and AB 324 dyes. Thermodynamic studies showed that the biosorption of AB 290 and AB 324 on S. rhizopus was exothermic in nature

  5. Ab initio non-relativistic spin dynamics

    Ding, Feizhi; Goings, Joshua J.; Li, Xiaosong, E-mail: xsli@uw.edu [Department of Chemistry, University of Washington, Seattle, Washington 98195 (United States); Frisch, Michael J. [Gaussian, Inc., 340 Quinnipiac St, Bldg 40, Wallingford, Connecticut 06492 (United States)

    2014-12-07

    Many magnetic materials do not conform to the (anti-)ferromagnetic paradigm where all electronic spins are aligned to a global magnetization axis. Unfortunately, most electronic structure methods cannot describe such materials with noncollinear electron spin on account of formally requiring spin alignment. To overcome this limitation, it is necessary to generalize electronic structure methods and allow each electron spin to rotate freely. Here, we report the development of an ab initio time-dependent non-relativistic two-component spinor (TDN2C), which is a generalization of the time-dependent Hartree-Fock equations. Propagating the TDN2C equations in the time domain allows for the first-principles description of spin dynamics. A numerical tool based on the Hirshfeld partitioning scheme is developed to analyze the time-dependent spin magnetization. In this work, we also introduce the coupling between electron spin and a homogenous magnetic field into the TDN2C framework to simulate the response of the electronic spin degrees of freedom to an external magnetic field. This is illustrated for several model systems, including the spin-frustrated Li{sub 3} molecule. Exact agreement is found between numerical and analytic results for Larmor precession of hydrogen and lithium atoms. The TDN2C method paves the way for the ab initio description of molecular spin transport and spintronics in the time domain.

  6. Studies on bioactive bis-1,3,5-triazinyl dithiocarbamates

    V. H. SHAH

    2007-07-01

    Full Text Available The compounds bis(4,6-dichloro/bis[(p-methoxyphenylamino]-1,3,5--triazin-2-yl1,2-hydrazine-1,2-dicarbodithioate/1,4-phenylenebis(carbamodithio­ate/(1,1’-biphenyl-4,4’-diylbis(carbamodithioate/(sulphonyldi-4,1-phenylene-bis(carbamodithioate/1,2-ethanediylbis(carbamothioate 4a–j were synthe­sized by two different methods. In the first method (A for the preparation of 4a–e, 2,4,6-tri­chloro-1,3,5-triazine 1 was condensed with diammonium 1,2-hy­drazine-1,2-di­carbo­dithioate/1,4-phenylenebis(carbamodithioate/(1,1’-biphenyl-4,4’diyl­bis(carba­mo­di­thioate/(sulphonyl-di-4,1-phenylene-bis(carbamodithioate/1,2-etha­nediylbis(car­bamodithioate 3a–e to afford 4a–e which undergo reaction with p-me­thoxyaniline to afford 4f–j. In the second method (B of preparation, 1 was condensed with p-me­thoxyaniline to yield 2 followed by the action of 3a–e to yield 4a–j. The structure of the newly synthesized compounds 4a–j was esta­blished on the basis of elemental analyses, as well as IR and 1H-NMR spec­tro­scopy. The antimicrobial activities of compounds 4a–j were determined by the cup‑plate method against gram-positive bacteria, gram-negative bacteria and fungi. All the synthesized compounds showed significant antimicrobial activity.

  7. Higgs portal dark matter in the minimal gauged $U(1)_{B-L}$ model

    Okada, Nobuchika

    2010-01-01

    We propose a scenario of the right-handed neutrino dark matter in the context of the minimal gauged $U(1)_{B-L}$ model by introducing an additional parity which ensures the stability of dark matter particle. The annihilation of this right-handed neutrino takes place dominantly through the s-channel Higgs boson exchange, so that this model can be called Higgs portal dark matter model. We show that the thermal relic abundance of the right-handed neutrino dark matter with help of Higgs resonance can match the observed dark matter abundance. In addition we estimate the cross section with nucleon and show that the next generation direct dark matter search experiments can explore this model.

  8. Neutrino Mass and Dark Matter from Gauged $U(1)_{B-L}$ Breaking

    Kanemura, Shinya; Sugiyama, Hiroaki

    2014-01-01

    We propose a new model where the Dirac mass term for neutrinos, the Majorana mass term for right-handed neutrinos, and the other new fermion masses arise via the spontaneous breakdown of the $U(1)_{B-L}$ gauge symmetry. The anomaly-free condition gives four sets of assignment of the B-L charge to new particles, and three of these sets have an associated global $U(1)_{DM}$ symmetry which stabilizes dark matter candidates. The dark matter candidates contribute to generating the Dirac mass term for neutrinos at the one-loop level. Consequently, tiny neutrino masses are generated at the two-loop level via a Type-I-Seesaw-like mechanism. We show that this model can satisfy current bounds from neutrino oscillation data, the lepton flavor violation, the relic abundance of the dark matter, and the direct search for the dark matter. This model would be tested at future collider experiments and dark matter experiments.

  9. ADH1B and ADH1C Genotype, Alcohol Consumption and Biomarkers of Liver Function

    Lawlor, Debbie A; Benn, Marianne; Zuccolo, Luisa; De Silva, N Maneka G; Tybjaerg-Hansen, Anne; Smith, George Davey; Nordestgaard, Børge G

    2014-01-01

    BACKGROUND: The effect of alcohol consumption on liver function is difficult to determine because of reporting bias and potential residual confounding. Our aim was to determine this effect using genetic variants to proxy for the unbiased effect of alcohol. METHODS: We used variants in ADH1B and ADH......1C genes as instrumental variables (IV) to estimate the causal effect of long-term alcohol consumption on alanine aminotransferase (ALT), γ-glutamyl-transferase (γ-GT), alkaline phosphatase (ALP), bilirubin and prothrombin action. Analyses were undertaken on 58,313 Danes (mean age 56). RESULTS: In...... inverse association of alcohol with ALP [-1.5% (-1 .7, -1.3)], which differed from the strong positive effect found in genetic-IV analyses [11.6% (6.8, 16.4)] (p diff<0.0001). In both multivariable and genetic-IV analyses associations with bilirubin and protrombin action were weak and close to the null...

  10. The Stability Of R-Parity In Supersymmetric Models Extended By U(1)_{B-L}

    Camargo-Molina, J E; Porod, W; Staub, F

    2013-01-01

    We perform a study of the stability of R-parity-conserving vacua of a constrained version of the minimal supersymmetric model with a gauged U(1)_{B-L} which can conserve R-parity, using homotopy continuation to find all the extrema of the tree-level potential, for which we also calculated the one-loop corrections. While we find that a majority of the points in the parameter space preserve R-parity, we find that a significant portion of points which naively have phenomenologically acceptable vacua which conserve R-parity actually have deeper vacua which break R-parity through sneutrino VEVs. We investigate under what conditions the deeper R-parity-violating vacua appear. We find that while previous exploratory work was broadly correct in some of its qualitative conclusions, we disagree in detail.

  11. PLEIADES-HR 1A&1B image quality commissioning: innovative geometric calibration methods and results

    Greslou, Daniel; de Lussy, Françoise; Amberg, Virginie; Dechoz, Cécile; Lenoir, Florie; Delvit, Jean-Marc; Lebègue, Laurent

    2013-09-01

    PLEIADES earth observing system consists of two satellites designed to provide optical 70cm resolution images to civilian and defense users. The first Pleiades satellite 1A was launched on December 2011 while the second satellite Pleiades 1B was placed on orbit, one year after, on December 2012. The calibration operations and the assessment of the image of the two satellites have been performed by CNES Image Quality team during the called commissioning phase which took place after each launch and lasted each time less than 6 months. The geometric commissioning activities consist in assessing and improving the geometric quality of the images in order to meet very demanding requirements. This paper deals with the means used and methods applied, mainly the innovative ones, in order to manage these activities. It describes both their accuracy and their operational interest. Finally it gives the main results for geometric image quality performances of the PHR system.

  12. Modification to the accelerator of the NBI-1B ion source for improving the injection efficiency

    Minimizing power loss of a neutral beam imposes modification of the accelerator of the ion source for further improvement of the beam optics. The beam optics can be improved by focusing beamlets. The injection efficiencies by the steering of ion beamlets are investigated numerically to find the optimum modification of the accelerator design of the NBI-1B ion source. The beam power loss was reduced by aperture displacement of three edge beamlets arrays considering power loadings on the beamline components. Successful testing and operation of the ion source at 60 keV/84% of injection efficiency led to the possibility of enhancing the system capability to a 2.4 MW power level at 100 keV/1.9 μP

  13. Efficient cell culture system for hepatitis C virus genotype 1a and 1b

    2013-01-01

    reference strain J4. Sequence analysis of recovered 1a/2a and 1b/2a recombinants from 2 serial passages and subsequent reverse genetic studies revealed adaptive mutations in e.g. p7, NS2 and/or NS3. In addition, the inventors demonstrate the possibility of using adaptive mutations identified for one HCV...... isolate in generating efficient cell culture systems for other isolates by transfer of mutations across isolates, subtypes or major genotypes. Furthermore neutralization studies showed that viruses of e.g. genotype 1 were efficiently neutralized by genotype Ia, 4a and 5a serum, an effect that could be...... utilized e.g. in vaccine development and immunological prophylaxis. The inventors in addition demonstrate the use of the developed systems for screening of antiviral substances in vitro and functional studies of the virus, e.g. identification of receptors required for HCV entry...

  14. Synthesis and Antibacterial Activities of Novel Imidazo[2,1-b]-1,3,4-thiadiazoles

    Kamal F. M. Atta

    2011-06-01

    Full Text Available 2-Amino-5-(2-aryl-2H-1,2,3-triazol-4-yl-1,3,4-thiadiazoles 2-4 have been synthesized by the reaction of 2-aryl-2H-1,2,3-triazole-4-carboxylic acids 1 with thiosemicarbazide. Their reaction with phenacyl (p-substituted phenacyl bromides led to formation of the respective 6-aryl-2-(2-aryl-2H-1,2,3-triazol-4-ylimidazo[2,1-b]-1,3,4-thiadiazoles 5. Reactivity of the latter fused ring towards reaction with different electrophilic reagents afforded the corresponding 5-substituted derivatives 6-8. The structure of the above compounds was confirmed from their spectral characteristics. Some of these compounds were found to possess slight to moderate activity against the microorganisms Staphylococcus aureus, Candida albicans, Pseudomonas aeruginosa, and Escherichia coli.

  15. Modification to the accelerator of the NBI-1B ion source for improving the injection efficiency

    Kim, T. S.; Jeong, S. H.; Chang, D. H.; In, S. R.; Park, M.; Jung, B. K.; Lee, K. W.; Wang, S. J.; Bae, Y. S.; Park, H. T.; Kim, J. S.; Cho, W.; Choi, D. J.

    2016-02-01

    Minimizing power loss of a neutral beam imposes modification of the accelerator of the ion source for further improvement of the beam optics. The beam optics can be improved by focusing beamlets. The injection efficiencies by the steering of ion beamlets are investigated numerically to find the optimum modification of the accelerator design of the NBI-1B ion source. The beam power loss was reduced by aperture displacement of three edge beamlets arrays considering power loadings on the beamline components. Successful testing and operation of the ion source at 60 keV/84% of injection efficiency led to the possibility of enhancing the system capability to a 2.4 MW power level at 100 keV/1.9 μP.

  16. The Mock LISA Data Challenges: from Challenge 1B to Challenge 3

    The Mock LISA Data Challenges are a programme to demonstrate and encourage the development of LISA data-analysis capabilities, tools and techniques. At the time of this workshop, three rounds of challenges had been completed, and the next was about to start. In this paper we provide a critical analysis of the entries to the latest completed round, Challenge 1B. The entries confirm the consolidation of a range of data-analysis techniques for galactic and massive-black-hole binaries, and they include the first convincing examples of detection and parameter estimation of extreme-mass-ratio inspiral sources. In this paper we also introduce the next round, Challenge 3. Its data sets feature more realistic waveform models (e.g., galactic binaries may now chirp, and massive-black-hole binaries may precess due to spin interactions), as well as new source classes (bursts from cosmic strings, isotropic stochastic backgrounds) and more complicated nonsymmetric instrument noise

  17. The Mock LISA Data Challenges: from Challenge 1B to Challenge 3

    Babak, Stanislav; Benacquista, Matthew J; Cornish, Neil J; Crowder, Jeff; Larson, Shane L; Plagnol, Eric; Porter, Edward K; Vallisneri, Michele; Vecchio, Alberto; Arnaud, Keith; Barack, Leor; Błaut, Arkadiusz; Cutler, Curt; Fairhurst, Stephen; Gair, Jonathan; Gong, Xuefei; Harry, Ian; Khurana, Deepak; Królak, Andrzej; Mandel, Ilya; Prix, Reinhard; Sathyaprakash, B S; Savov, Pavlin; Shang, Yu; Trias, Miquel; Veitch, John; Wang, Yan; Wen, Linqing; Whelan, John T

    2008-01-01

    The Mock LISA Data Challenges are a programme to demonstrate and encourage the development of LISA data-analysis capabilities, tools and techniques. At the time of this workshop, three rounds of challenges had been completed, and the next was about to start. In this article we provide a critical analysis of entries to the latest completed round, Challenge 1B. The entries confirm the consolidation of a range of data-analysis techniques for Galactic and massive--black-hole binaries, and they include the first convincing examples of detection and parameter estimation of extreme--mass-ratio inspiral sources. In this article we also introduce the next round, Challenge 3. Its data sets feature more realistic waveform models (e.g., Galactic binaries may now chirp, and massive--black-hole binaries may precess due to spin interactions), as well as new source classes (bursts from cosmic strings, isotropic stochastic backgrounds) and more complicated nonsymmetric instrument noise.

  18. VLT transit and occultation photometry for the bloated planet CoRoT-1b

    Gillon, M; Triaud, A H M J; Barman, T; Hebb, L; Montalban, J; Maxted, P F L; Queloz, D; Deleuil, M; Magain, P

    2009-01-01

    We present VLT eclipse photometry for the giant planet CoRoT-1b. We observed a transit in the R-band filter and an occultation in a narrow filter centered on 2.09 microns. Our analysis of this new photometry and published radial velocities, in combination with stellar-evolutionary modeling, leads to a planetary mass and radius of 1.07 (+0.13,-0.18) M_Jup and 1.45 (+0.07,-0.13) R_Jup, confirming the very low density previously deduced from CoRoT photometry. The large occultation depth that we measure at 2.09 microns (0.278 (+0.043,-0.066) %) is consistent with thermal emission and is better reproduced by an atmospheric model with no redistribution of the absorbed stellar flux to the night side of the planet.

  19. The stability of R-parity in supersymmetric models extended by U(1)B-L

    We perform a study of the stability of R-parity-conserving vacua of a constrained version of the minimal supersymmetric standard model with a gauged U(1)B-L which can conserve R-parity. Using the homotopy continuation method we find all the extrema of the tree-level potential, which are then used as starting point for the analysis of the loop-corrected potential. While we find that a majority of the points in the parameter space preserve R-parity, we also find that a significant portion of points which naively have phenomenologically acceptable vacua which conserve R-parity, actually have deeper vacua which break R-parity through sneutrino VEVs. We investigate under what conditions the deeper R-parity-violating vacua appear. We find that while previous exploratory work was broadly correct in some of its qualitative conclusions, we disagree in detail.

  20. Sterile neutrino portal to Dark Matter I: The $U(1)_{B-L}$ case

    Escudero, Miguel; Sanz, Verónica

    2016-01-01

    In this paper we explore the possibility that the sterile neutrino and Dark Matter sectors in the Universe have a common origin. We study the consequences of this assumption in the simple case of coupling the dark sector to the Standard Model via a global $U(1)_{B-L}$, broken down spontaneously by a dark scalar. This dark scalar provides masses to the dark fermions and communicates with the Higgs via a Higgs portal coupling. We find an interesting interplay between Dark Matter annihilation to dark scalars - the CP-even that mixes with the Higgs and the CP-odd which becomes a Goldstone boson, the Majoron - and heavy neutrinos, as well as collider probes via the coupling to the Higgs. Dark Matter annihilation into sterile neutrinos and its subsequent decay to gauge bosons and charged leptons or neutrinos produce unusual signatures for indirect searches.

  1. Application of MOS-1b/MESSR data to flood monitoring of Dongting Lake

    2006-01-01

    Taking Dongting Lake district as the studying area and utilizing multi-temporal MOS-1b/MESSR data as remote sensing info source, by the combination operation and ratio transform processing and the image, spectrum and histogram comparison of the MESSR image data of all bands for the flood season and dry season with the ERDAS IMAGINE system, a classification model was established, which can be used to acquire the spatial distributing information of water bodies. Meanwhile a water depth index model was derived and built, and then a model for detecting the depth of water body based on the non-linear recursive analysis was presented. By the overlay analysis of the classification thematic images based on the model for extracting flood information, the flooding area and distributing information were acquired.

  2. Cartilage Acidic Protein–1B (LOTUS), an Endogenous Nogo Receptor Antagonist for Axon Tract Formation

    Sato, Yasufumi; Iketani, Masumi; Kurihara, Yuji; Yamaguchi, Megumi; Yamashita, Naoya; Nakamura, Fumio; Arie, Yuko; Kawasaki, Takahiko; Hirata, Tatsumi; Abe, Takaya; Kiyonari, Hiroshi; Strittmatter, Stephen M.; Goshima, Yoshio; Takei, Kohtaro

    2011-01-01

    Neural circuitry formation depends on the molecular control of axonal projection during development. By screening with fluorophore-assisted light inactivation in the developing mouse brain, we identified cartilage acidic protein–1B as a key molecule for lateral olfactory tract (LOT) formation and named it LOT usher substance (LOTUS). We further identified Nogo receptor–1 (NgR1) as a LOTUS-binding protein. NgR1 is a receptor of myelin-derived axon growth inhibitors, such as Nogo, which prevent neural regeneration in the adult. LOTUS suppressed Nogo-NgR1 binding and Nogo-induced growth cone collapse. A defasciculated LOT was present in lotus-deficient mice but not in mice lacking both lotus- and ngr1. These findings suggest that endogenous antagonism of NgR1 by LOTUS is crucial for normal LOT formation. PMID:21817055

  3. Diphoton Resonances in U(1)_{B-L} Extension of MSSM

    Lazarides, G

    2016-01-01

    Inspired by the 750 GeV diphoton state recently reported by ATLAS and CMS, we propose a U(1)_{B-L} extension of the MSSM which predicts the existence of four spin zero resonance states that are degenerate in mass in the supersymmetric limit. Vector-like fields, a gauge singlet field, as well as the MSSM Higgsinos are prevented from acquiring arbitrary large masses by a U(1) R-symmetry. Indeed, these masses can be considerably lighter than the Z' gauge boson mass. Depending on kinematics the resonance states could decay into right handed neutrinos and sneutrinos, and/or MSSM Higgs fields and Higgsinos with total decay widths in the multi-GeV range.

  4. Diphoton resonances in a U (1 )B -L extension of the minimal supersymmetric standard model

    Lazarides, G.; Shafi, Q.

    2016-06-01

    Inspired by the 750 GeV diphoton state recently reported by ATLAS and CMS, we propose a U (1 )B-L extension of the MSSM which predicts the existence of four spin zero resonance states that are degenerate in mass in the supersymmetric limit. Vectorlike fields, a gauge singlet field, as well as the MSSM Higgsinos are prevented from acquiring arbitrary large masses by a U (1 ) R symmetry. Indeed, these masses can be considerably lighter than the Z' gauge boson mass. Depending on kinematics, the resonance states could decay into right-handed neutrinos and sneutrinos, and/or MSSM Higgs fields and Higgsinos with total decay widths in the multi-GeV range.

  5. BOREAS Level-1B MAS Imagery At-sensor Radiance, Relative X and Y Coordinates

    Strub, Richard; Strub, Richard; Newcomer, Jeffrey A.; Ungar, Stephen

    2000-01-01

    For BOReal Ecosystem-Atmosphere Study (BOREAS), the MODIS Airborne Simulator (MAS) images, along with the other remotely sensed data, were collected to provide spatially extensive information over the primary study areas. This information includes detailed land cover and biophysical parameter maps such as fraction of Photosynthetically Active Radiation (fPAR) and Leaf Area Index (LAI). Collection of the MAS images occurred over the study areas during the 1994 field campaigns. The level-1b MAS data cover the dates of 21-Jul-1994, 24-Jul-1994, 04-Aug-1994, and 08-Aug-1994. The data are not geographically/geometrically corrected; however, files of relative X and Y coordinates for each image pixel were derived by using the C-130 INS data in a MAS scan model. The data are provided in binary image format files.

  6. BOREAS Level-1B TIMS Imagery: At-sensor Radiance in BSQ Format

    Hall, Forrest G. (Editor); Nickeson, Jaime (Editor); Strub, Richard; Newcomer, Jeffrey A.; Chernobieff, Sonia

    2000-01-01

    The Boreal Ecosystem-Atmospheric Study (BOREAS) Staff Science Aircraft Data Acquisition Program focused on providing the research teams with the remotely sensed satellite data products they needed to compare and spatially extend point results. For BOREAS, the Thermal Infrared Multispectral Scanner (TIMS) imagery, along with other aircraft images, was collected to provide spatially extensive information over the primary study areas. The Level-1b TIMS images cover the time periods of 16 to 20 Apr 1994 and 06 to 17 Sep 1994. The system calibrated images are stored in binary image format files. The TIMS images are available from the Earth Observing System Data and Information System (EOSDIS) Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC).

  7. A NASTRAN investigation of simulated projectile damage effects on a UH-1B tail boom model

    Futterer, A. T.

    1980-01-01

    A NASTRAN model of a UH-1B tail boom that had been designed for another project was used to investigate the effect on structural integrity of simulated projectile damage. Elements representing skin, and sections of stringers, longerons and bulkheads were systematically deleted to represent projectile damage. The structure was loaded in a manner to represent the flight loads that would be imposed on the tail boom at a 130 knot cruise. The deflection of four points on the rear of the tail boom relative to the position of these points for the unloaded, undamaged condition of the tail boom was used as a measure of the loss of structural rigidity. The same procedure was then used with the material properties of the aluminum alloys replaced with the material properties of T300/5208 high strength graphite/epoxy fibrous composite material, (0, + or - 45, 90)s for the skin and (0, + or - 45)s for the longerons, stringers, and bulk heads.

  8. SPITZER IRAC SECONDARY ECLIPSE PHOTOMETRY OF THE TRANSITING EXTRASOLAR PLANET HAT-P-1b

    We report Spitzer/IRAC photometry of the transiting giant exoplanet HAT-P-1b during its secondary eclipse. This planet lies near the postulated boundary between the pM and pL-class of hot Jupiters, and is important as a test of models for temperature inversions in hot Jupiter atmospheres. We derive eclipse depths for HAT-P-1b, in units of the stellar flux, that are: 0.080% ± 0.008% [3.6 μm], 0.135% ± 0.022% [4.5 μm], 0.203% ± 0.031% [5.8 μm], and 0.238% ± 0.040% [8.0 μm]. These values are best fit using an atmosphere with a modest temperature inversion, intermediate between the archetype inverted atmosphere (HD 209458b) and a model without an inversion. The observations also suggest that this planet is radiating a large fraction of the available stellar irradiance on its dayside, with little available for redistribution by circulation. This planet has sometimes been speculated to be inflated by tidal dissipation, based on its large radius in discovery observations, and on a non-zero orbital eccentricity allowed by the radial velocity data. The timing of the secondary eclipse is very sensitive to orbital eccentricity, and we find that the central phase of the eclipse is 0.4999 ± 0.0005. The difference between the expected and observed phase indicates that the orbit is close to circular, with a 3σ limit of |e cos ω| < 0.002.

  9. Characterization of the Very Low Mass Secondary in the GJ 660.1AB System

    Aganze, Christian; Faherty, Jacqueline K; Choban, Caleb; Escala, Ivanna; Lopez, Mike A; Jin, Yuhui; Tamiya, Tomoki; Tallis, Melisa; Rockward, Willie

    2015-01-01

    We present spectroscopic analysis of the low mass binary star system GJ 660.1AB, a pair of nearby M dwarfs for which we have obtained separated near-infrared spectra (0.9-2.5 $\\mu$m) with the SpeX spectrograph. The spectrum of GJ 660.1B is distinctly peculiar, with a triangular-shaped 1.7 $\\mu$m peak that initially suggests it to be a low surface gravity, young brown dwarf. However, we rule out this hypothesis and determine instead that this companion is a mild subdwarf (d/sdM7) based on the subsolar metallicity of the primary, [Fe/H] = $-$0.63$\\pm$0.06. Comparison of the near-infrared spectrum of GJ 660.1B to two sets of spectral models yields conflicting results, with a common effective temperature T$_{eff}$ = 2550-2650 K, but alternately low surface gravity ($\\log{g}$ = 4.4$\\pm$0.5 cgs) and very low metallicity ([M/H] = $-$0.96$^{+0.19}_{-0.24}$), or high surface gravity ($\\log{g}$ = 5.0-5.5) and slightly subsolar metallicity ([M/H] =$-$0.20$^{+0.13}_{-0.19}$). We conjecture that insufficient condensate op...

  10. Direct interaction and functional coupling between human 5-HT6 receptor and the light chain 1 subunit of the microtubule-associated protein 1B (MAP1B-LC1.

    Soon-Hee Kim

    Full Text Available Serotonin (5-HT receptors of type 6 (5-HT6R play important roles in mood, psychosis, and eating disorders. Recently, a growing number of studies support the use of 5-HT6R-targeting compounds as promising drug candidates for treating cognitive dysfunction associated with Alzheimer's disease. However, the mechanistic linkage between 5-HT6R and such functions remains poorly understood. By using yeast two-hybrid, GST pull-down, and co-immunoprecipitation assays, here we show that human 5-HT6R interacts with the light chain 1 (LC1 subunit of MAP1B protein (MAP1B-LC1, a classical microtubule-associated protein highly expressed in the brain. Functionally, we have found that expression of MAP1B-LC1 regulates serotonin signaling in a receptor subtype-specific manner, specifically controlling the activities of 5-HT6R, but not those of 5-HT4R and 5-HT7R. In addition, we have demonstrated that MAP1B-LC1 increases the surface expression of 5-HT6R and decreases its endocytosis, suggesting that MAP1B-LC1 is involved in the desensitization and trafficking of 5-HT6R via a direct interaction. Together, we suggest that signal transduction pathways downstream of 5-HT6R are regulated by MAP1B, which might play a role in 5-HT6R-mediated signaling in the brain.

  11. Ab initio no core full configuration approach for light nuclei

    Kim, Youngman; Shin, Ik Jae; Maris, Pieter; Vary, James P.; Forssén, Christian; Rotureau, Jimmy

    2015-10-01

    Comprehensive understanding of the structure and reactions of light nuclei poses theoretical and computational challenges. Still, a number of ab initio approaches have been developed to calculate the properties of atomic nuclei using fundamental interactions among nucleons. Among them, we work with the ab initio no core full configuration (NCFC) method and ab initio no core Gamow Shell Model (GSM). We first review these approaches and present some recent results.

  12. Workshop on automated beam steering and shaping (ABS). Proceedings

    A workshop on Automated Beam Steering and Shaping (ABS) was held at CERN in December 1998. This was the first workshop dedicated to this subject. The workshop had two major goals: to review the present status of ABS algorithms and systems around the world and to create a worldwide ABS community. These proceedings contain summary reports from all sessions, contributions from several presentations held at the workshop, and a complete set of abstracts for all presentations. (orig.)

  13. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 interactions with western corn rootworm midgut membrane binding sites.

    Huarong Li

    Full Text Available BACKGROUND: Bacillus thuringiensis (Bt Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interactions are one line of evidence that Bt protein mechanisms of action differ and that the probability of receptor-mediated cross-resistance is low. METHODOLOGY/PRINCIPAL FINDINGS: Binding site interactions were investigated between Cry34Ab1/Cry35Ab1 and coleopteran active insecticidal proteins Cry3Aa, Cry6Aa, and Cry8Ba on western corn rootworm midgut brush border membrane vesicles (BBMV. Competitive binding of radio-labeled proteins to western corn rootworm BBMV was used as a measure of shared binding sites. Our work shows that (125I-Cry35Ab1 binds to rootworm BBMV, Cry34Ab1 enhances (125I-Cry35Ab1 specific binding, and that (125I-Cry35Ab1 with or without unlabeled Cry34Ab1 does not share binding sites with Cry3Aa, Cry6Aa, or Cry8Ba. Two primary lines of evidence presented here support the lack of shared binding sites between Cry34Ab1/Cry35Ab1 and the aforementioned proteins: 1 No competitive binding to rootworm BBMV was observed for competitor proteins when used in excess with (125I-Cry35Ab1 alone or combined with unlabeled Cry34Ab1, and 2 No competitive binding to rootworm BBMV was observed for unlabeled Cry34Ab1 and Cry35Ab1, or a combination of the two, when used in excess with (125I-Cry3Aa, or (125I-Cry8Ba. CONCLUSIONS/SIGNIFICANCE: Combining two or more insecticidal proteins active against the same target pest is one tactic to delay the onset of resistance to either protein. We conclude that Cry34Ab1/Cry35Ab1 are compatible with Cry3Aa, Cry6Aa, or Cry8Ba

  14. Ising and Heisenberg models on ferrimagnetic AB sub 2 chains

    Vitoriano, C; Raposo, E P

    2002-01-01

    We study the Ising and Heisenberg models on one-dimensional ferrimagnetic bipartite chains with the special AB sub 2 unit-cell topology and experimental motivation in inorganic and organic magnetic polymers. The spin-1/2 AB sub 2 Ising case is exactly solved in the presence of an external magnetic field. We also derive asymptotical low- and high-temperature limits of several thermodynamical quantities of the zero-field classical AB sub 2 Heisenberg model. Further, the quantum spin-1/2 AB sub 2 Heisenberg model in a field is studied using a mean-field approach.

  15. Markov chain Monte Carlo searches for galactic binaries in Mock LISA Data Challenge 1B data sets

    We are developing a Bayesian approach based on Markov chain Monte Carlo techniques to search for and extract information about white dwarf binary systems with the laser interferometer space antenna (LISA). Here we present results obtained by applying an initial implementation of this method to some of the data sets released in round 1B of the Mock LISA Data Challenges. For Challenges 1B.1.1a and 1b the signals were recovered with parameters lying within the 95.5% posterior probability interval and the correlation between the true and recovered waveform is in excess of 99%. Results were not submitted for Challenge 1B.1.1c due to some convergence problems of the algorithm; despite this, the signal was detected in a search over a 2 mHz band

  16. GLAS/ICESat L1B Global Waveform-based Range Corrections Data (HDF5) V033

    National Aeronautics and Space Administration — The level 1B waveform parameterization data will contain waveform-based range corrections and surface characteristics at the full 40 per second resolution. Data...

  17. MAP1B binds to the NMDA receptor subunit NR3A and affects NR3A protein concentrations

    Eriksson, Maria; Samuelsson, Helena; Björklund, Stefan;

    2010-01-01

    protein interaction between NR3A and microtubule associated-protein (MAP) 1B, which both are localized to dendritic shafts and filopodia. NR3A protein levels were increased in MAP1B deficient (-/-) mice, with a corresponding decrease in NR1 levels, but the fraction of filopodia immunoreactive for NR3A was...... equal in cells from -/- and wild type (WT) mice. NR3A has previously been shown to interact with another member of the MAP1 family, MAP1S. We showed that MAP1S binds to microtubules in a similar manner as MAP1B, and suggest that MAP1S and MAP1B both are involved in regulating trafficking of NR3A...

  18. The E3 ubiquitin ligase activity of RING1B is not essential for early mouse development

    Illingworth, Robert S.; Moffat, Michael; Mann, Abigail R.; Read, David; Hunter, Chris J; Pradeepa, Madapura M.; Adams, Ian R.; Bickmore, Wendy A.

    2015-01-01

    Illingworth et al. show that the ability of Ring1B, a core component of PRC1, to ubiquitinate histone H2A is dispensable for early mouse embryonic development and much of the gene repression activity of PRC1.

  19. SAGE III Meteor-3M L1B Solar Event Transmission Data (HDF-EOS) V004

    National Aeronautics and Space Administration — Level 1B pixel group transmission profiles for a single solar event (Suggested Usage: Vertical transmission profiles for input into an inversion algorithm)

  20. SAGE III Meteor-3M L1B Solar Event Transmission Data (HDF-EOS) V003

    National Aeronautics and Space Administration — Level 1B pixel group transmission profiles for a single solar event (Suggested Usage: Vertical transmission profiles for input into an inversion algorithm)

  1. Vickers hardness, indentation creep and corrosion behaviour of Al-5Ti-1B alloy with copper content

    Said Gouda, El; Nassar, Amira

    2014-11-01

    The effects of 1, 3 and 5 wt.% Cu additions on structure, Vickers hardness, indentation creep and corrosion behaviour of Al-5Ti-1B ternary alloy were studied and analyzed. The Al-5Ti-1B alloy exhibited a mixture of Al3Ti and TiB2 intermetallic compounds (IMCs), and Al solid solution. Additions of 1 and 3 wt.% Cu showed the same phases, indicating a complete solubility of Cu atoms in Al matrix. In addition, the Al-5Ti-1B-5Cu alloy exhibited a precipitation of CuAl2 IMC. Furthermore, additions of Cu decreased the particle size of Al matrix. This structural behaviour increased rapidly the Vickers hardness number (HV) from 643 to 1395 MPa, increased the indentation creep resistance and improved corrosion behaviour of the Al-5Ti-1B alloy. Cu is anti-corrosion phase when completely dissolved or precipitated as IMC in Al matrix.

  2. Crystal structure of bis[4-(4-chlorobenzylpyridine-κN]bis(thiocyanato-κNzinc

    Julia Werner

    2014-10-01

    Full Text Available In the crystal structure of the title compound, [Zn(NCS2(C12H10ClN2], the Zn2+ cation is N-coordinated by two terminally bonded thiocyante anions and by two 4-(4-chlorobenzylpyridine ligands within a slightly distorted tetrahedron. The asymmetric unit consists of half of the discrete complex, the central Zn2+ cation of which is located on a twofold rotation axis. The discrete complexes are linked into layers via a weak intermolecular hydrogen-bonding interaction, with a H...Cl distance of 2.85 Å and a C—H...Cl angle of 151°. These layers extend parallel to the ab plane and are held together by dispersion forces only.

  3. A Significant Role of the Truncated Ghrelin Receptor GHS-R1b in Ghrelin-induced Signaling in Neurons.

    Navarro, Gemma; Aguinaga, David; Angelats, Edgar; Medrano, Mireia; Moreno, Estefanía; Mallol, Josefa; Cortés, Antonio; Canela, Enric I; Casadó, Vicent; McCormick, Peter J; Lluís, Carme; Ferré, Sergi

    2016-06-17

    The truncated non-signaling ghrelin receptor growth hormone secretagogue R1b (GHS-R1b) has been suggested to simply exert a dominant negative role in the trafficking and signaling of the full and functional ghrelin receptor GHS-R1a. Here we reveal a more complex modulatory role of GHS-R1b. Differential co-expression of GHS-R1a and GHS-R1b, both in HEK-293T cells and in striatal and hippocampal neurons in culture, demonstrates that GHS-R1b acts as a dual modulator of GHS-R1a function: low relative GHS-R1b expression potentiates and high relative GHS-R1b expression inhibits GHS-R1a function by facilitating GHS-R1a trafficking to the plasma membrane and by exerting a negative allosteric effect on GHS-R1a signaling, respectively. We found a preferential Gi/o coupling of the GHS-R1a-GHS-R1b complex in HEK-293T cells and, unexpectedly, a preferential Gs/olf coupling in both striatal and hippocampal neurons in culture. A dopamine D1 receptor (D1R) antagonist blocked ghrelin-induced cAMP accumulation in striatal but not hippocampal neurons, indicating the involvement of D1R in the striatal GHS-R1a-Gs/olf coupling. Experiments in HEK-293T cells demonstrated that D1R co-expression promotes a switch in GHS-R1a-G protein coupling from Gi/o to Gs/olf, but only upon co-expression of GHS-R1b. Furthermore, resonance energy transfer experiments showed that D1R interacts with GHS-R1a, but only in the presence of GHS-R1b. Therefore, GHS-R1b not only determines the efficacy of ghrelin-induced GHS-R1a-mediated signaling but also determines the ability of GHS-R1a to form oligomeric complexes with other receptors, promoting profound qualitative changes in ghrelin-induced signaling. PMID:27129257

  4. Ectodomains of the LDL receptor-related proteins LRP1b and LRP4 have anchorage independent functions in vivo.

    Martin F Dietrich

    Full Text Available BACKGROUND: The low-density lipoprotein (LDL receptor gene family is a highly conserved group of membrane receptors with diverse functions in developmental processes, lipoprotein trafficking, and cell signaling. The low-density lipoprotein (LDL receptor-related protein 1b (LRP1B was reported to be deleted in several types of human malignancies, including non-small cell lung cancer. Our group has previously reported that a distal extracellular truncation of murine Lrp1b that is predicted to secrete the entire intact extracellular domain (ECD is fully viable with no apparent phenotype. METHODS AND PRINCIPAL FINDINGS: Here, we have used a gene targeting approach to create two mouse lines carrying internally rearranged exons of Lrp1b that are predicted to truncate the protein closer to the N-terminus and to prevent normal trafficking through the secretary pathway. Both mutations result in early embryonic lethality, but, as expected from the restricted expression pattern of LRP1b in vivo, loss of Lrp1b does not cause cellular lethality as homozygous Lrp1b-deficient blastocysts can be propagated normally in culture. This is similar to findings for another LDL receptor family member, Lrp4. We provide in vitro evidence that Lrp4 undergoes regulated intramembraneous processing through metalloproteases and gamma-secretase cleavage. We further demonstrate negative regulation of the Wnt signaling pathway by the soluble extracellular domain. CONCLUSIONS AND SIGNIFICANCE: Our results underline a crucial role for Lrp1b in development. The expression in mice of truncated alleles of Lrp1b and Lrp4 with deletions of the transmembrane and intracellular domains leads to release of the extracellular domain into the extracellular space, which is sufficient to confer viability. In contrast, null mutations are embryonically (Lrp1b or perinatally (Lrp4 lethal. These findings suggest that the extracellular domains of both proteins may function as a scavenger for

  5. Childhood adversity moderates the effect of ADH1B on risk for alcohol-related phenotypes in Jewish Israeli drinkers

    Meyers, Jacquelyn L; Shmulewitz, Dvora; Wall, Melanie M.; Keyes, Katherine M; Aharonovich, Efrat; Spivak, Baruch; Weizman, Abraham; Frisch, Amos; Edenberg, Howard J.; Gelernter, Joel; Grant, Bridget F.; Hasin, Deborah

    2013-01-01

    Childhood adversity and genetic variant ADH1B-rs1229984 have each been shown to influence heavy alcohol consumption and disorders. However, little is known about how these factors jointly influence these outcomes. We assessed the main and additive interactive effects of childhood adversity (abuse, neglect, parental divorce) and the ADH1B-rs1229984 on the quantitative phenotypes “maximum drinks in a day” (Maxdrinks) and DSM-Alcohol Use Disorder (AUD) severity, adjusting for demographic variabl...

  6. Circulating Levels of IL-1B+IL-6 Cause ER Stress and Dysfunction in Islets From Prediabetic Male Mice

    O'Neill, Christina M.; Lu, Christine; Corbin, Kathryn L.; Sharma, Poonam R.; Dula, Stacey B.; Carter, Jeffrey D.; Ramadan, James W.; Xin, Wenjun; Lee, Jae K.; Nunemaker, Craig S.

    2013-01-01

    Elevated levels of circulating proinflammatory cytokines are associated with obesity and increased risk of type 2 diabetes, but the mechanism is unknown. We tested whether proinflammatory cytokines IL-1B+IL-6 at low picogram per milliliter concentrations (consistent with serum levels) could directly trigger pancreatic islet dysfunction. Overnight exposure to IL-1B+IL-6 in islets isolated from normal mice and humans disrupted glucose-stimulated intracellular calcium responses; cytokine-induced...

  7. Leptin induces CYP1B1 expression in MCF-7 cells through ligand-independent activation of the ERα pathway

    Khanal, Tilak; Kim, Hyung Gyun; Do, Minh Truong; Choi, Jae Ho; Won, Seong Su [Department of Toxicology, College of Pharmacy, Chungnam National University, Daejeon (Korea, Republic of); Kang, Wonku [College of Pharmacy, Yeungnam University, Gyeongsan (Korea, Republic of); Chung, Young Chul [Department of Food Science and Culinary, International University of Korea, Jinju (Korea, Republic of); Jeong, Tae Cheon, E-mail: taecheon@ynu.ac.kr [College of Pharmacy, Yeungnam University, Gyeongsan (Korea, Republic of); Jeong, Hye Gwang, E-mail: hgjeong@cnu.ac.kr [Department of Toxicology, College of Pharmacy, Chungnam National University, Daejeon (Korea, Republic of)

    2014-05-15

    Leptin, a hormone with multiple biological actions, is produced predominantly by adipose tissue. Among its functions, leptin can stimulate tumour cell growth. Oestrogen receptor α (ERα), which plays an essential role in breast cancer development, can be transcriptionally activated in a ligand-independent manner. In this study, we investigated the effect of leptin on CYP1B1 expression and its mechanism in breast cancer cells. Leptin induced CYP1B1 protein, messenger RNA expression and promoter activity in ERα-positive MCF-7 cells but not in ERα-negative MDA-MB-231 cells. Additionally, leptin increased 4-hydroxyoestradiol in MCF-7 cells. Also, ERα knockdown by siRNA significantly blocked the induction of CYP1B1 expression by leptin, indicating that leptin induced CYP1B1 expression via an ERα-dependent mechanism. Transient transfection with CYP1B1 deletion promoter constructs revealed that the oestrogen response element (ERE) plays important role in the up-regulation of CYP1B1 by leptin. Furthermore, leptin stimulated phosphorylation of ERα at serine residues 118 and 167 and increased ERE-luciferase activity, indicating that leptin induced CYP1B1 expression by ERα activation. Finally, we found that leptin activated ERK and Akt signalling pathways, which are upstream kinases related to ERα phosphorylation induced by leptin. Taken together, our results indicate that leptin-induced CYP1B1 expression is mediated by ligand-independent activation of the ERα pathway as a result of the activation of ERK and Akt in MCF-7 cells. - Highlights: • Leptin increased 4-hydroxyoestradiol in MCF-7 breast cancer cells. • Leptin activated ERK and Akt kinases related to ERα phosphorylation. • Leptin induces phosphorylation of ERα at serine residues 118 and 167. • Leptin induces ERE-luciferase activity.

  8. Formulation and Characterization of “Ready to Use” 1B4M-DTPA-rituximab for Lu-177 Labeling

    Gorgieva, Darinka; Smilkov, Katarina; Janevik-Ivanovska, Emilija

    2014-01-01

    Investigations for NHL treatment are oriented towards radiolabelled therapeutics. This research focuses on formulation and characterization of a new, ready to label immunoconjugate, 1B4M-DTPA-rituximab, which is suitable for labeling with Lu-177. The conjugation was performed using 20-fold molar excess of the bifunctional chelating agent, 1B4M-DTPA and subsequent lyophilization. The characterization of the (radio)immunoconjugate was performed using SE-HPLC, SDS-PAGE and MALDI-TOF-...

  9. Rapid screening of antineoplastic candidates for the human organic anion transporter OATP1B3 substrates using fluorescent probes

    Yamaguchi, Hiroaki; KOBAYASHI, Minako; Okada, Masahiro; Takeuchi, Toshiko; Unno, Michiaki; ABE, Takaaki; Goto, Junichi; Hishinuma, Takanori; Mano, Nariyasu

    2008-01-01

    A rapid screening system has been established to extract novel candidates that exhibit potent inhibition of the transport of fluorescent substrate by organic anion transporting polypeptide (OATP) 1B3. OATP1B3 is abundantly expressed in solid digestive organ cancers. Thus, the identification of new substrates leads to novel strategies for effective cancer chemotherapy with minimal adverse effects. We used an automated image acquisition and analysis system (IN Cell Analyzer 1000) to visualize ...

  10. Corpus callosum abnormalities, intellectual disability, speech impairment, and autism in patients with haploinsufficiency of ARID1B

    Hansen, Christina Halgren; Kjaergaard, S; Bak, M;

    2011-01-01

    Corpus callosum abnormalities, intellectual disability, speech impairment, and autism in patients with haploinsufficiency of ARID1B. Corpus callosum abnormalities are common brain malformations with a wide clinical spectrum ranging from severe intellectual disability to normal cognitive function......), agenesis of corpus callosum (CC), intellectual disability, severe speech impairment, and autism. The chromosome 6 breakpoint truncated ARID1B which was also truncated in a recently published translocation patient with a similar phenotype. Quantitative polymerase chain reaction (Q-PCR) data showed that a...

  11. Leptin induces CYP1B1 expression in MCF-7 cells through ligand-independent activation of the ERα pathway

    Leptin, a hormone with multiple biological actions, is produced predominantly by adipose tissue. Among its functions, leptin can stimulate tumour cell growth. Oestrogen receptor α (ERα), which plays an essential role in breast cancer development, can be transcriptionally activated in a ligand-independent manner. In this study, we investigated the effect of leptin on CYP1B1 expression and its mechanism in breast cancer cells. Leptin induced CYP1B1 protein, messenger RNA expression and promoter activity in ERα-positive MCF-7 cells but not in ERα-negative MDA-MB-231 cells. Additionally, leptin increased 4-hydroxyoestradiol in MCF-7 cells. Also, ERα knockdown by siRNA significantly blocked the induction of CYP1B1 expression by leptin, indicating that leptin induced CYP1B1 expression via an ERα-dependent mechanism. Transient transfection with CYP1B1 deletion promoter constructs revealed that the oestrogen response element (ERE) plays important role in the up-regulation of CYP1B1 by leptin. Furthermore, leptin stimulated phosphorylation of ERα at serine residues 118 and 167 and increased ERE-luciferase activity, indicating that leptin induced CYP1B1 expression by ERα activation. Finally, we found that leptin activated ERK and Akt signalling pathways, which are upstream kinases related to ERα phosphorylation induced by leptin. Taken together, our results indicate that leptin-induced CYP1B1 expression is mediated by ligand-independent activation of the ERα pathway as a result of the activation of ERK and Akt in MCF-7 cells. - Highlights: • Leptin increased 4-hydroxyoestradiol in MCF-7 breast cancer cells. • Leptin activated ERK and Akt kinases related to ERα phosphorylation. • Leptin induces phosphorylation of ERα at serine residues 118 and 167. • Leptin induces ERE-luciferase activity

  12. A tandem segmental duplication (TSD) in the green revolution gene Rht-D1b region underlies plant height variation

    Semi-dwarfing genes Rht-B1b (Rht1) and Rht-D1b (Rht2), known as the “Green revolution” genes, have made a significant contribution to wheat production worldwide. Rht-D1c (Rht10) carried by Chinese wheat line Aibian 1 is an allele at the Rht-D1 locus. It has the strongest effect among all dwarfing...

  13. Oocyte specific oolemmal SAS1B involved in sperm binding through intra-acrosomal SLLP1 during fertilization

    Sachdev, Monika; Mandal, Arabinda; Mulders, Sabine; Digilio, Laura C.; Panneerdoss, Subbarayalu; Suryavathi, Viswanadhapalli; Pires, Eusebio; Klotz, Kenneth L.; Hermens, Laura; Herrero, Maria Belen; Flickinger, Charles J.; van Duin, Marcel; Herr, John C.

    2011-01-01

    Molecular mechanisms by which fertilization competent acrosome-reacted sperm bind to the oolemma remain uncharacterized. To identify oolemmal binding partner(s) for sperm acrosomal ligands, affinity panning was performed with mouse oocyte lysates using sperm acrosomal protein, SLLP1 as a target. An oocyte specific membrane metalloproteinase, SAS1B (Sperm Acrosomal SLLP1 Binding), was identified as a SLLP1 binding partner. cDNA cloning revealed six SAS1B splice variants, each containing a zinc...

  14. Localization of PTP-1B, SHP-2, and Src Exclusively in Rat Brain Mitochondria and Functional Consequences*

    Arachiche, Amal; Augereau, Olivier; Decossas, Marion; Pertuiset, Claire; Gontier, Etienne; Letellier, Thierry; Dachary-Prigent, Jeanne

    2008-01-01

    An immunodetection study of protein tyrosine phosphatase 1B (PTP-1B), SHP-2, and Src in isolated mitochondria from different rat tissues (brain, muscle, heart, liver, and kidney) revealed their exclusive localization in the brain. Given this result, we sought whether mitochondria respond to ATP and to the general tyrosine phosphatase inhibitor orthovanadate and found little or no change in the tyrosine phosphorylation profile of mitochondria from muscle, heart, liver, ...

  15. Cytochrome P450 1b1 in polycyclic aromatic hydrocarbon (PAH)-induced skin carcinogenesis: Tumorigenicity of individual PAHs and coal-tar extract, DNA adduction and expression of select genes in the Cyp1b1 knockout mouse

    Siddens, Lisbeth K. [Department of Environmental and Molecular Toxicology, Oregon State University, Corvallis, OR 97331 (United States); Superfund Research Center, Oregon State University, Corvallis, OR 97331 (United States); Bunde, Kristi L. [College of Veterinary Medicine, Oregon State University, Corvallis, OR 97331 (United States); Harper, Tod A. [Department of Environmental and Molecular Toxicology, Oregon State University, Corvallis, OR 97331 (United States); Linus Pauling Institute, Oregon State University, Corvallis, OR 97331 (United States); Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States); McQuistan, Tammie J. [Superfund Research Center, Oregon State University, Corvallis, OR 97331 (United States); Linus Pauling Institute, Oregon State University, Corvallis, OR 97331 (United States); Löhr, Christiane V. [Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States); College of Veterinary Medicine, Oregon State University, Corvallis, OR 97331 (United States); Bramer, Lisa M. [Applied Statistics and Computational Modeling, Pacific Northwest National Laboratory, Richland, WA 99352 (United States); Waters, Katrina M. [Superfund Research Center, Oregon State University, Corvallis, OR 97331 (United States); Biological Sciences Division, Pacific Northwest National Laboratory, Richland, WA 99352 (United States); Tilton, Susan C. [Department of Environmental and Molecular Toxicology, Oregon State University, Corvallis, OR 97331 (United States); Superfund Research Center, Oregon State University, Corvallis, OR 97331 (United States); Krueger, Sharon K. [Department of Environmental and Molecular Toxicology, Oregon State University, Corvallis, OR 97331 (United States); Superfund Research Center, Oregon State University, Corvallis, OR 97331 (United States); Linus Pauling Institute, Oregon State University, Corvallis, OR 97331 (United States); and others

    2015-09-01

    FVB/N mice wild-type, heterozygous or null for Cyp 1b1 were used in a two-stage skin tumor study comparing PAH, benzo[a]pyrene (BaP), dibenzo[def,p]chrysene (DBC), and coal tar extract (CTE, SRM 1597a). Following 20 weeks of promotion with TPA the Cyp 1b1 null mice, initiated with DBC, exhibited reductions in incidence, multiplicity, and progression. None of these effects were observed with BaP or CTE. The mechanism of Cyp 1b1-dependent alteration of DBC skin carcinogenesis was further investigated by determining expression of select genes in skin from DBC-treated mice 2, 4 and 8 h post-initiation. A significant reduction in levels of Cyp 1a1, Nqo1 at 8 h and Akr 1c14 mRNA was observed in Cyp 1b1 null (but not wt or het) mice, whereas no impact was observed in Gst a1, Nqo 1 at 2 and 4 h or Akr 1c19 at any time point. Cyp 1b1 mRNA was not elevated by DBC. The major covalent DNA adducts, dibenzo[def,p]chrysene-(±)-11,12-dihydrodiol-cis and trans-13,14-epoxide-deoxyadenosine (DBCDE-dA) were quantified by UHPLC-MS/MS 8 h post-initiation. Loss of Cyp1 b1 expression reduced DBCDE-dA adducts in the skin but not to a statistically significant degree. The ratio of cis- to trans-DBCDE-dA adducts was higher in the skin than other target tissues such as the spleen, lung and liver (oral dosing). These results document that Cyp 1b1 plays a significant role in bioactivation and carcinogenesis of DBC in a two-stage mouse skin tumor model and that loss of Cyp 1b1 has little impact on tumor response with BaP or CTE as initiators. - Highlights: • Cyp1b1 null mice exhibit lower skin cancer sensitivity to DBC but not BaP or CTE. • Cyp1b1 expression impacts expression of other PAH metabolizing enzymes. • cis/trans-DBCDE-dA ratio significantly higher in the skin than the spleen, lung or liver • Potency of DBC and CTE in mouse skin is higher than predicted by RPFs.

  16. Cytochrome P450 1b1 in polycyclic aromatic hydrocarbon (PAH)-induced skin carcinogenesis: Tumorigenicity of individual PAHs and coal-tar extract, DNA adduction and expression of select genes in the Cyp1b1 knockout mouse

    FVB/N mice wild-type, heterozygous or null for Cyp 1b1 were used in a two-stage skin tumor study comparing PAH, benzo[a]pyrene (BaP), dibenzo[def,p]chrysene (DBC), and coal tar extract (CTE, SRM 1597a). Following 20 weeks of promotion with TPA the Cyp 1b1 null mice, initiated with DBC, exhibited reductions in incidence, multiplicity, and progression. None of these effects were observed with BaP or CTE. The mechanism of Cyp 1b1-dependent alteration of DBC skin carcinogenesis was further investigated by determining expression of select genes in skin from DBC-treated mice 2, 4 and 8 h post-initiation. A significant reduction in levels of Cyp 1a1, Nqo1 at 8 h and Akr 1c14 mRNA was observed in Cyp 1b1 null (but not wt or het) mice, whereas no impact was observed in Gst a1, Nqo 1 at 2 and 4 h or Akr 1c19 at any time point. Cyp 1b1 mRNA was not elevated by DBC. The major covalent DNA adducts, dibenzo[def,p]chrysene-(±)-11,12-dihydrodiol-cis and trans-13,14-epoxide-deoxyadenosine (DBCDE-dA) were quantified by UHPLC-MS/MS 8 h post-initiation. Loss of Cyp1 b1 expression reduced DBCDE-dA adducts in the skin but not to a statistically significant degree. The ratio of cis- to trans-DBCDE-dA adducts was higher in the skin than other target tissues such as the spleen, lung and liver (oral dosing). These results document that Cyp 1b1 plays a significant role in bioactivation and carcinogenesis of DBC in a two-stage mouse skin tumor model and that loss of Cyp 1b1 has little impact on tumor response with BaP or CTE as initiators. - Highlights: • Cyp1b1 null mice exhibit lower skin cancer sensitivity to DBC but not BaP or CTE. • Cyp1b1 expression impacts expression of other PAH metabolizing enzymes. • cis/trans-DBCDE-dA ratio significantly higher in the skin than the spleen, lung or liver • Potency of DBC and CTE in mouse skin is higher than predicted by RPFs

  17. Cloning and characterization of human RTVP-1b, a novel splice variant of RTVP-1 in glioma cells

    Here, we report the cloning and characterization of RTVP-1b, a novel splice variant of human RTVP-1, which was isolated from the U87 glioma cell line. Sequence analysis revealed that RTVP-1b contains an additional 71 base exon between exons 2 and 3 that is missing in RTVP-1, leading to a frame-shift and a different putative protein. The deduced protein was 237 amino acids in length, sharing the N-terminal 141 amino acids with RTVP-1. RT-PCR analysis demonstrated that RTVP-1b was expressed in a wide range of tissues and that its expression was different from that of RTVP-1. In contrast, RTVP-1 and RTVP-1b showed similar patterns of expression in astrocytic tumors; highly expressed in glioblastomas as compared to normal brains, low-grade astrocytomas and anaplastic oligodendrogliomas. Overexpression of RTVP-1b increased glioma cell proliferation but did not affect cell migration. Our results suggest that RTVP-1b represents a potential prognostic marker and therapeutic target in gliomas

  18. Synthesis and Analgesic Effects of μ-TRTX-Hhn1b on Models of Inflammatory and Neuropathic Pain

    Yu Liu

    2014-08-01

    Full Text Available μ-TRTX-Hhn1b (HNTX-IV is a 35-amino acid peptide isolated from the venom of the spider, Ornithoctonus hainana. It inhibits voltage-gated sodium channel Nav1.7, which has been considered as a therapeutic target for pain. The goal of the present study is to elucidate the analgesic effects of synthetic μ-TRTX-Hhn1b on animal models of pain. The peptide was first synthesized and then successfully refolded/oxidized. The synthetic peptide had the same inhibitory effect on human Nav1.7 current transiently expressed in HEK 293 cells as the native toxin. Furthermore, the analgesic potentials of the synthetic peptide were examined on models of inflammatory pain and neuropathic pain. μ-TRTX-Hhn1b produced an efficient reversal of acute nociceptive pain in the abdominal constriction model, and significantly reduced the pain scores over the 40-min period in the formalin model. The efficiency of μ-TRTX-Hhn1b on both models was equivalent to that of morphine. In the spinal nerve model, the reversal effect of μ-TRTX-Hhn1b on allodynia was longer and higher than mexiletine. These results demonstrated that μ-TRTX-Hhn1b efficiently alleviated acute inflammatory pain and chronic neuropathic pain in animals and provided an attractive template for further clinical analgesic drug design.

  19. Impact of Chronic Hepatitis C Virus Genotype 1b Infection on Triglyceride Concentration in Serum Lipoprotein Fractions

    Tomohisa Nagano

    2015-08-01

    Full Text Available Reduced low-density lipoprotein (LDL cholesterol level is a characteristic feature of dyslipidemia in chronic hepatitis C virus (HCV infection. However, abnormality in serum triglyceride (TG has not been fully investigated. To clarify the impact of HCV genotype 1b (G1b infection and advanced fibrosis on serum TG profiles, TG concentrations in lipoprotein fractions were examined in fasting sera from 185 subjects with active or cleared HCV infection by high-performance liquid chromatography. Serum lipoproteins were fractionated into four classes: chylomicron, very low-density lipoprotein (VLDL, LDL, and high-density lipoprotein (HDL. Then, the significance of HCV G1b infection on TG levels in each lipoprotein fraction was determined using multiple regression models. We found that active HCV G1b infection was positively associated with high HDL-TG levels and low VLDL-TG levels, independent of other factors included in the regression model. In VLDL sub-fractions, active HCV infection was only found to be associated with low levels of large VLDL-TG. Similarly, advanced liver fibrosis in chronic HCV G1b infection was associated with high levels of LDL-TG, HDL-TG, and small VLDL-TG, independent of other clinical factors. These findings indicate that active HCV G1b infection and advanced fibrosis are closely associated with abnormal serum TG profiles.

  20. In Silico Approach for SAR Analysis of the Predicted Model of DEPDC1B: A Novel Target for Oral Cancer.

    Ahuja, Palak; Singh, Kailash

    2016-01-01

    With the incidence rate of oral carcinogenesis increasing in the Southeast-Asian countries, due to increase in the consumption of tobacco and betel quid as well as infection from human papillomavirus, specifically type 16, it becomes crucial to predict the transition of premalignant lesion to cancerous tissue at an initial stage in order to control the process of oncogenesis. DEPDC1B, downregulated in the presence of E2 protein, was recently found to be overexpressed in oral cancer, which can possibly be explained by the disruption of the E2 open reading frame upon the integration of viral genome into the host genome. DEPDC1B mediates its effect by directly interacting with Rac1 protein, which is known to regulate important cell signaling pathways. Therefore, DEPDC1B can be a potential biomarker as well as a therapeutic target for diagnosing and curing the disease. However, the lack of 3D model of the structure makes the utilization of DEPDC1B as a therapeutic target difficult. The present study focuses on the prediction of a suitable 3D model of the protein as well as the analysis of protein-protein interaction between DEPDC1B and Rac1 protein using PatchDock web server along with the identification of allosteric or regulatory sites of DEPDC1B. PMID:27034663

  1. In Silico Approach for SAR Analysis of the Predicted Model of DEPDC1B: A Novel Target for Oral Cancer

    Palak Ahuja

    2016-01-01

    Full Text Available With the incidence rate of oral carcinogenesis increasing in the Southeast-Asian countries, due to increase in the consumption of tobacco and betel quid as well as infection from human papillomavirus, specifically type 16, it becomes crucial to predict the transition of premalignant lesion to cancerous tissue at an initial stage in order to control the process of oncogenesis. DEPDC1B, downregulated in the presence of E2 protein, was recently found to be overexpressed in oral cancer, which can possibly be explained by the disruption of the E2 open reading frame upon the integration of viral genome into the host genome. DEPDC1B mediates its effect by directly interacting with Rac1 protein, which is known to regulate important cell signaling pathways. Therefore, DEPDC1B can be a potential biomarker as well as a therapeutic target for diagnosing and curing the disease. However, the lack of 3D model of the structure makes the utilization of DEPDC1B as a therapeutic target difficult. The present study focuses on the prediction of a suitable 3D model of the protein as well as the analysis of protein-protein interaction between DEPDC1B and Rac1 protein using PatchDock web server along with the identification of allosteric or regulatory sites of DEPDC1B.

  2. Ahcyl2 upregulates NBCe1-B via multiple serine residues of the PEST domain-mediated association

    Park, Pil Whan; Ahn, Jeong Yeal

    2016-01-01

    Inositol-1,4,5-triphosphate [IP3] receptors binding protein released with IP3 (IRBIT) was previously reported as an activator of NBCe1-B. Recent studies have characterized IRBIT homologue S-Adenosylhomocysteine hydrolase-like 2 (AHCYL2). AHCYL2 is highly homologous to IRBIT (88%) and heteromerizes with IRBIT. The two important domains in the N-terminus of AHCYL2 are a PEST domain and a coiled-coil domain which are highly comparable to those in IRBIT. Therefore, in this study, we tried to identify the role of those domains in mouse AHCYL2 (Ahcyl2), and we succeeded in identifying PEST domain of Ahcyl2 as a regulation region for NBCe1-B activity. Site directed mutagenesis and coimmunoprecipitation assay showed that NBCe1-B binds to the N-terminal Ahcyl2-PEST domain, and its binding is determined by the phosphorylation of 4 critical serine residues (Ser151, Ser154, Ser157, and Ser160) in Ahcyl2 PEST domain. Also we revealed that 4 critical serine residues in Ahcyl2 PEST domain are indispensable for the activation of NBCe1-B using measurement of intracellular pH experiment. Thus, these results suggested that the NBCe1-B is interacted with 4 critical serine residues in Ahcyl2 PEST domain, which play an important role in intracellular pH regulation through NBCe1-B.

  3. Guiding ab initio calculations by alchemical derivatives

    to Baben, M.; Achenbach, J. O.; von Lilienfeld, O. A.

    2016-03-01

    We assess the concept of alchemical transformations for predicting how a further and not-tested change in composition would change materials properties. This might help to guide ab initio calculations through multidimensional property-composition spaces. Equilibrium volumes, bulk moduli, and relative lattice stability of fcc and bcc 4d transition metals Zr, Nb, Mo, Tc, Ru, Rh, Pd, and Ag are calculated using density functional theory. Alchemical derivatives predict qualitative trends in lattice stability while equilibrium volumes and bulk moduli are predicted with less than 9% and 28% deviation, respectively. Predicted changes in equilibrium volume and bulk moduli for binary and ternary mixtures of Rh-Pd-Ag are in qualitative agreement even for predicted bulk modulus changes as large as +100% or -50%. Based on these results, it is suggested that alchemical transformations could be meaningful for enhanced sampling in the context of virtual high-throughput materials screening projects.

  4. Ab Initio Path to Heavy Nuclei

    Binder, Sven; Calci, Angelo; Roth, Robert

    2014-01-01

    We present the first ab initio calculations of nuclear ground states up into the domain of heavy nuclei, spanning the range from 16-O to 132-Sn based on two- plus three-nucleon interactions derived within chiral effective field theory. We employ the similarity renormalization group for preparing the Hamiltonian and use coupled-cluster theory to solve the many-body problem for nuclei with closed sub-shells. Through an analysis of theoretical uncertainties resulting from various truncations in this framework, we identify and eliminate the technical hurdles that previously inhibited the step beyond medium-mass nuclei, allowing for reliable validations of nuclear Hamiltonians in the heavy regime. Following this path we show that chiral Hamiltonians qualitatively reproduce the systematics of nuclear ground-state energies up to the neutron-rich Sn isotopes.

  5. Operator evolution for ab initio nuclear theory

    Schuster, Micah D; Johnson, Calvin W; Jurgenson, Eric D; Navratil, Petr

    2014-01-01

    The past two decades have seen a revolution in ab initio calculations of nuclear properties. One key element has been the development of a rigorous effective interaction theory, applying unitary transformations to soften the nuclear Hamiltonian and hence accelerate the convergence as a function of the model space size. For consistency, however, one ought to apply the same transformation to other operators when calculating transitions and mean values from the eigenstates of the renormalized Hamiltonian. Working in a translationally-invariant harmonic oscillator basis for the two- and three-nucleon systems, we evolve the Hamiltonian, square-radius and total dipole strength operators by the similarity renormalization group (SRG). The inclusion of up to three-body matrix elements in the 4He nucleus all but completely restores the invariance of the expectation values under the transformation. We also consider a Gaussian operator with adjustable range and find at short ranges an increased contribution from such ind...

  6. Discovering chemistry with an ab initio nanoreactor

    Martinez, Todd

    Traditional approaches for modeling chemical reaction networks such as those involved in combustion have focused on identifying individual reactions and using theoretical approaches to explore the underlying mechanisms. Recent advances involving graphical processing units (GPUs), commodity products developed for the videogaming industry, have made it possible to consider a distinct approach wherein one attempts to discover chemical reactions and mechanisms. We provide a brief summary of these developments and then discuss the concept behind the ``ab initio nanoreactor'' which explores the space of possible chemical reactions and molecular species for a given stoichiometry. The nanoreactor concept is exemplified with an example to the Urey-Miller reaction network which has been previously advanced as a potential model for prebiotic chemistry. We briefly discuss some of the future directions envisioned for the development of this nanoreactor concept.

  7. Ab initio molar volumes and Gaussian radii.

    Parsons, Drew F; Ninham, Barry W

    2009-02-12

    Ab initio molar volumes are calculated and used to derive radii for ions and neutral molecules using a spatially diffuse model of the electron distribution with Gaussian spread. The Gaussian radii obtained can be used for computation of nonelectrostatic ion-ion dispersion forces that underlie Hofmeister specific ion effects. Equivalent hard-sphere radii are also derived, and these are in reasonable agreement with crystalline ionic radii. The Born electrostatic self-energy is derived for a Gaussian model of the electronic charge distribution. It is shown that the ionic volumes used in electrostatic calculations of strongly hydrated cosmotropic ions ought best to include the first hydration shell. Ionic volumes for weakly hydrated chaotropic metal cations should exclude electron overlap (in electrostatic calculations). Spherical radii are calculated as well as nonisotropic ellipsoidal radii for nonspherical ions, via their nonisotropic static polarizability tensors. PMID:19140766

  8. Ab initio alpha-alpha scattering.

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  9. Ab initio alpha-alpha scattering

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Luu, Thomas; Meißner, Ulf-G.

    2015-12-01

    Processes such as the scattering of alpha particles (4He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei—nuclei with even and equal numbers of protons and neutrons—is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the ‘adiabatic projection method’ to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  10. Ablation dynamics in laser sclerotomy ab externo

    Brinkmann, Ralf; Droege, Gerit; Mohrenstecher, Dirk; Scheu, M.; Birngruber, Reginald

    1996-01-01

    Laser sclerostomy ab externo with flashlamp excited mid-IR laser systems emitting in the 2-3 micrometer spectral range is in phase II clinical trials. Although acutely high success rates were achieved, the restenosis rate after several months is about 40%. Laser pulses of several hundreds of microseconds, known to induce thermo-mechanical explosive evaporation were used for this procedure. We investigated the ablation dynamics in tissue and the cavitation bubble dynamics in water by means of an Er:YAG laser system to estimate the extent of mechanical damage zones in the sclera and in the anterior chamber, which may contribute to the clinical failure. We found substantial mechanical tissue deformation during the ablation process caused by the cavitation effects. Stress waves up to several bar generated by explosive evaporization were measured. The fast mechanical stretching and collapsing of the scleral tissue induced by cavitation resulted in tissue dissection as could be proved by flash photography and histology. The observed high restenosis might be a result of a subsequent enhanced wound healing process. Early fistula occlusions due to iris adherences, observed in about 20% of the clinical cases may be attributed to intraocular trauma induced by vapor bubble expansion through the anterior chamber after scleral perforation. An automatic feedback system minimizing adverse effects by steering and terminating the laser process during scleral fistulization is demonstrated. Moreover, a new approach in laser sclerostomy ab externo is presented using a cw-IR laser diode system emitting at the 1.94 micrometer mid-IR water absorption peak. This system was used in vitro and showed smaller damage zones compared to the pulsed laser radiation.

  11. GRACE L1b inversion through a self-consistent modified radial basis function approach

    Yang, Fan; Kusche, Juergen; Rietbroek, Roelof; Eicker, Annette

    2016-04-01

    Implementing a regional geopotential representation such as mascons or, more general, RBFs (radial basis functions) has been widely accepted as an efficient and flexible approach to recover the gravity field from GRACE (Gravity Recovery and Climate Experiment), especially at higher latitude region like Greenland. This is since RBFs allow for regionally specific regularizations over areas which have sufficient and dense GRACE observations. Although existing RBF solutions show a better resolution than classical spherical harmonic solutions, the applied regularizations cause spatial leakage which should be carefully dealt with. It has been shown that leakage is a main error source which leads to an evident underestimation of yearly trend of ice-melting over Greenland. Unlike some popular post-processing techniques to mitigate leakage signals, this study, for the first time, attempts to reduce the leakage directly in the GRACE L1b inversion by constructing an innovative modified (MRBF) basis in place of the standard RBFs to retrieve a more realistic temporal gravity signal along the coastline. Our point of departure is that the surface mass loading associated with standard RBF is smooth but disregards physical consistency between continental mass and passive ocean response. In this contribution, based on earlier work by Clarke et al.(2007), a physically self-consistent MRBF representation is constructed from standard RBFs, with the help of the sea level equation: for a given standard RBF basis, the corresponding MRBF basis is first obtained by keeping the surface load over the continent unchanged, but imposing global mass conservation and equilibrium response of the oceans. Then, the updated set of MRBFs as well as standard RBFs are individually employed as the basis function to determine the temporal gravity field from GRACE L1b data. In this way, in the MRBF GRACE solution, the passive (e.g. ice melting and land hydrology response) sea level is automatically

  12. Evaluation of Al-5Ti-1B and Al-10Sr in LM6 sand castings

    Y.P. Lim

    2009-05-01

    Full Text Available Purpose: of this paper is to study the separate effects of grain refiner and modifier on the metallurgical properties of LM6 sand castings. The research aims to determine how grain refiner and modifier will influence the microstructure of LM6 sand casting and the associated mechanical properties of hardness, ultimate tensile strength and engineering strain.Design/methodology/approach: A grain refiner consists of 0.5wt% Al-5Ti-1B and a modifier consists of 0.5wt% Al-10Sr have been introduced separately into the melt of hypoeutectic LM6 Al-Si alloy to produce slab castings by CO2 sand casting process. The geometry of the slab casting is designed to have different section moduli to induce directional solidification. Temperature profile of cooling process is taken to correlate between the section modulus and cooling rate. This enables the effect of cooling rate on microstructure and mechanical properties to be studied for grain refined and modified LM6 sand castings.Findings: The significant finding is that a nearly full eutectic solidification at 540°C is achieved in the Sr-modified casting with faster cooling rates than those of solely grain-refined and original LM6. The hardness and ultimate tensile strength can be improved respectively between 20~40% and 11~18% by Al-10Sr modifier. It is observed that the Al-5Ti-1B grain refiner and Al-10Sr modifier increase the strain at UTS by 11% and 22% respectively. The metallographic observations show that the eutectic phase is finer and in fibrous form in the Sr-modified LM6.Research limitations/implications: Further research can study a wider range of inoculant percentage.Practical implications: This eutectic solidification at 540°C achieved in Sr-modified LM6 is lower than the solidus temperature of LM6 to reduce superheat and save electrical energy consumption while ensuring complete liquid mould filling.Originality/value: This is the original work of slab casting of LM6 and the effects of Sr

  13. Evaluation of group A1B erythrocytes converted to type as group O: studies of markers of function and compatibility

    Gao, Hong-Wei; Zhuo, Hai-Long; Zhang, Xue; Ji, Shou-Ping; Tan, Ying-Xia; Li, Su-Bo; Jia, Yan-Jun; Xu, Hua; Wu, Qing-Fa; Yun, Zhi-Min; Luo, Qun; Gong, Feng

    2016-01-01

    Background Enzymatic conversion of blood group A1B red blood cells (RBC) to group O RBC (ECO) was achieved by combined treatment with α-galactosidase and α-N-acetylgalactosaminidase. The aim of this study was to evaluate the function and safety of these A1B-ECO RBC in vitro. Materials and methods A 20% packed volume of A1B RBC was treated with enzymes in 250 mM glycine buffer, pH 6.8. The efficiency of the conversion of A and B antigen was evaluated by traditional typing in test tubes, gel column agglutination technology and fluorescence-activated cell sorting (FACS) analysis. The physiological and metabolic parameters of native and ECO RBC were compared, including osmotic fragility, erythrocyte deformation index, levels of 2,3-diphosphoglycerate, ATP, methaemoglobin, free Na+, and free K+. The morphology of native and ECO RBC was observed by scanning electron microscopy. Residual α-galactosidase or α-N-acetylgalactosaminidase in A1B-ECO RBC was detected by double-antibody sandwich ELISA method. Manual cross-matching was applied to ensure blood compatibility. Results The RBC agglutination tests and FACS results showed that A1B RBC were efficiently converted to O RBC. Functional analysis suggested that the conversion process had little impact on the physiological and metabolic parameters of the RBC. The residual amounts of either α-galactosidase or α-N-acetylgalactosaminidase in the A1B-ECO RBC were less than 10 ng/mL of packed RBC. About 18% of group B and 55% of group O sera reacted with the A1B-ECO RBC in a sensitive gel column cross-matching test. Discussion The conversion process does not appear to affect the morphological, physiological or metabolic parameters of A1B-ECO RBC. However, the A1B-ECO RBC still reacted with some antigens. More research on group O and B sera, which may partly reflect the complexity of group A1 the safety of A1B-ECO RBC is necessary before the application of these RBC in clinical transfusion. PMID:26509826

  14. Dicty_cDB: FCL-AB06 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AB06 (Link to dictyBase) - - - Contig-U15603-1 FCL-AB06P ...(Link to Original site) FCL-AB06F 694 FCL-AB06Z 573 FCL-AB06P 1267 - - Show FCL-AB06 Library FCL (Link to library) Clone ID FCL-...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AB/FCL-AB06Q....Seq.d/ Representative seq. ID FCL-AB06P (Link to Original site) Representative DNA sequence >FCL-AB06 (FCL-AB06Q) /CSM/FCL/FCL-...AB/FCL-AB06Q.Seq.d/ CAATTTTATCGGAACCATCAATTCATGCAGGTTCTGTATTTAGTATTAATTTAACCAAAT CTAGACA

  15. Secondhand cigarette smoke exposure causes upregulation of cerebrovascular 5-HT(1) (B) receptors via the Raf/ERK/MAPK pathway in rats

    Cao, L; Xu, C B; Zhang, Y; Cao, Y X; Edvinsson, L

    2013-01-01

    Cigarette smoke exposure increases the risk of stroke. Upregulation of 5-hydroxytryptamine 1B (5-HT(1) (B) ) receptors is associated with the pathogenesis of cerebral ischaemia. This study examined the hypothesis that the expression of 5-HT(1) (B) receptors is altered in brain vessels after secon...... secondhand smoke (SHS) exposure.......Cigarette smoke exposure increases the risk of stroke. Upregulation of 5-hydroxytryptamine 1B (5-HT(1) (B) ) receptors is associated with the pathogenesis of cerebral ischaemia. This study examined the hypothesis that the expression of 5-HT(1) (B) receptors is altered in brain vessels after...

  16. Sudden Bilateral Sensorineural Hearing Loss Associated with HLA A1-B8-DR3 Haplotype.

    Psillas, G; Daniilidis, M; Gerofotis, A; Veros, K; Vasilaki, A; Vital, I; Markou, K

    2013-01-01

    Sudden sensorineural hearing loss may be present as a symptom in systemic autoimmune diseases or may occur as a primary disorder without another organ involvement (autoimmune inner ear disease). The diagnosis of autoimmune inner ear disease is still predicated on clinical features, and to date specific diagnostic tests are not available. We report a case of bilateral sudden hearing loss, tinnitus, intense rotatory vertigo, and nausea in a female patient in which the clinical manifestations, in addition to raised levels of circulating immune complexes, antithyroglobulin antibodies, and the presence of the HLA A1-B8-DR3 haplotype, allowed us to hypothesize an autoimmune inner ear disease. Cyclosporine-A immunosuppressive treatment in addition to steroids helped in hearing recovery that occurred progressively with normalization of the hearing function after a five-month treatment. Cyclosporine-A could be proposed as a therapeutic option in case of autoimmune inner ear disease allowing the suspension of corticosteroids that, at high dose, expose patients to potentially serious adverse events. PMID:24106629

  17. Sudden Bilateral Sensorineural Hearing Loss Associated with HLA A1-B8-DR3 Haplotype

    G. Psillas

    2013-01-01

    Full Text Available Sudden sensorineural hearing loss may be present as a symptom in systemic autoimmune diseases or may occur as a primary disorder without another organ involvement (autoimmune inner ear disease. The diagnosis of autoimmune inner ear disease is still predicated on clinical features, and to date specific diagnostic tests are not available. We report a case of bilateral sudden hearing loss, tinnitus, intense rotatory vertigo, and nausea in a female patient in which the clinical manifestations, in addition to raised levels of circulating immune complexes, antithyroglobulin antibodies, and the presence of the HLA A1-B8-DR3 haplotype, allowed us to hypothesize an autoimmune inner ear disease. Cyclosporine-A immunosuppressive treatment in addition to steroids helped in hearing recovery that occurred progressively with normalization of the hearing function after a five-month treatment. Cyclosporine-A could be proposed as a therapeutic option in case of autoimmune inner ear disease allowing the suspension of corticosteroids that, at high dose, expose patients to potentially serious adverse events.

  18. F-spondin/spon1b expression patterns in developing and adult zebrafish.

    Veronica Akle

    Full Text Available F-spondin, an extracellular matrix protein, is an important player in embryonic morphogenesis and CNS development, but its presence and role later in life remains largely unknown. We generated a transgenic zebrafish in which GFP is expressed under the control of the F-spondin (spon1b promoter, and used it in combination with complementary techniques to undertake a detailed characterization of the expression patterns of F-spondin in developing and adult brain and periphery. We found that F-spondin is often associated with structures forming long neuronal tracts, including retinal ganglion cells, the olfactory bulb, the habenula, and the nucleus of the medial longitudinal fasciculus (nMLF. F-spondin expression coincides with zones of adult neurogenesis and is abundant in CSF-contacting secretory neurons, especially those in the hypothalamus. Use of this new transgenic model also revealed F-spondin expression patterns in the peripheral CNS, notably in enteric neurons, and in peripheral tissues involved in active patterning or proliferation in adults, including the endoskeleton of zebrafish fins and the continuously regenerating pharyngeal teeth. Moreover, patterning of the regenerating caudal fin following fin amputation in adult zebrafish was associated with F-spondin expression in the blastema, a proliferative region critical for tissue reconstitution. Together, these findings suggest major roles for F-spondin in the CNS and periphery of the developing and adult vertebrate.

  19. A combined transmission spectrum of the Earth-sized exoplanets TRAPPIST-1 b and c

    de Wit, Julien; Wakeford, Hannah R.; Gillon, Michaël; Lewis, Nikole K.; Valenti, Jeff A.; Demory, Brice-Olivier; Burgasser, Adam J.; Burdanov, Artem; Delrez, Laetitia; Jehin, Emmanuël; Lederer, Susan M.; Queloz, Didier; Triaud, Amaury H. M. J.; Van Grootel, Valérie

    2016-09-01

    Three Earth-sized exoplanets were recently discovered close to the habitable zone of the nearby ultracool dwarf star TRAPPIST-1 (ref. 3). The nature of these planets has yet to be determined, as their masses remain unmeasured and no observational constraint is available for the planetary population surrounding ultracool dwarfs, of which the TRAPPIST-1 planets are the first transiting example. Theoretical predictions span the entire atmospheric range, from depleted to extended hydrogen-dominated atmospheres. Here we report observations of the combined transmission spectrum of the two inner planets during their simultaneous transits on 4 May 2016. The lack of features in the combined spectrum rules out cloud-free hydrogen-dominated atmospheres for each planet at ≥10σ levels; TRAPPIST-1 b and c are therefore unlikely to have an extended gas envelope as they occupy a region of parameter space in which high-altitude cloud/haze formation is not expected to be significant for hydrogen-dominated atmospheres. Many denser atmospheres remain consistent with the featureless transmission spectrum—from a cloud-free water-vapour atmosphere to a Venus-like one.

  20. Discovery of the magnetic field of the B1/B2V star \\sigma Lupi

    Henrichs, H F; Plaggenborg, B; Marsden, S C; Waite, I A; Landstreet, J; Grunhut, J; Oksala, M; Wade, G

    2011-01-01

    In our search for new magnetic massive stars we use the strongest indirect indicator of a magnetic field in B stars, which is periodic variability of UV stellar wind lines occurring in a velocity range symmetric around zero. Our aim is to obtain follow-up spectropolarimetry to search for a magnetic field in magnetic candidate stars. We quantify UV wind line variability, and analyse its time behaviour. The B1/B2V star sigma Lup emerged as a new magnetic candidate star. AAT spectropolarimetric measurements with SEMPOL were obtained. The stellar wind line variations of sigma Lup are similar to what is known in magnetic B stars, but no periodicity could be determined. We detected a longitudinal magnetic field with varying strength and amplitude of about 100 G with error bars of typically 20 G, which supports an oblique magnetic-rotator configuration. The equivalent width variations of the UV lines, the magnetic and the optical line variations are consistent with the well-known photometric period of 3.02 days, whi...