WorldWideScience

Sample records for aa spatial evaluation

  1. MDCT evaluation of acute aortic syndrome (AAS).

    Valente, Tullio; Rossi, Giovanni; Lassandro, Francesco; Rea, Gaetano; Marino, Maurizio; Muto, Maurizio; Molino, Antonio; Scaglione, Mariano

    2016-05-01

    Non-traumatic acute thoracic aortic syndromes (AAS) describe a spectrum of life-threatening aortic pathologies with significant implications on diagnosis, therapy and management. There is a common pathway for the various manifestations of AAS that eventually leads to a breakdown of the aortic intima and media. Improvements in biology and health policy and diffusion of technology into the community resulted in an associated decrease in mortality and morbidity related to aortic therapeutic interventions. Hybrid procedures, branched and fenestrated endografts, and percutaneous aortic valves have emerged as potent and viable alternatives to traditional surgeries. In this context, current state-of-the art multidetector CT (MDCT) is actually the gold standard in the emergency setting because of its intrinsic diagnostic value. Management of acute aortic disease has changed with the increasing realization that endovascular therapies may offer distinct advantages in these situations. This article provides a summary of AAS, focusing especially on the MDCT technique, typical and atypical findings and common pitfalls of AAS, as well as recent concepts regarding the subtypes of AAS, consisting of aortic dissection, intramural haematoma, penetrating atherosclerotic ulcer and unstable aortic aneurysm or contained aortic rupture. MDCT findings will be related to pathophysiology, timing and management options to achieve a definite and timely diagnostic and therapeutic definition. In the present article, we review the aetiology, pathophysiology, clinical presentation, outcomes and therapeutic approaches to acute aortic syndromes. PMID:27033344

  2. EValuation of the thixoformability of AA7004 and AA7075 alloys

    Eugenio José Zoqui

    2010-09-01

    Full Text Available This study involved a complete evaluation of the thixoformability of AA7004 and AA7075 alloys, from their microstructural characterization to their viscous behavior. The alloys were subjected to globularization heat treatments for 0, 30, 90 and 210 seconds in two conditions of solid fractions, 45 and 60%, and to viscosity assays under the same conditions. Heat treatments promote the globularization of primary phase particles; hence, the best viscosity results were achieved for alloys with low solid fractions heat-treated for 210 seconds. Alloys AA7004 and AA7075 showed an apparent viscosity of 10(4 to 10(5 (Pa.s. The behavior of materials in this range is similar to that of molten glass and they show high formability. However, the AA7075 alloy showed a better performance than the AA7004 due to the smaller size of its primary particles and original grains, their lower growth during reheating, and depending on the condition, their viscosity of 10(4 Pa.s, which is extremely low for thixoforming standards.

  3. New photopolymers with high environmental compatibility: biophotopol compared to PVA/AA materials at zero spatial frequency limit

    Gallego, S.; Márquez, A.; Ortuño, M.; Marini, S.; Méndez, D.; Pascual, I.

    2010-05-01

    Photopolymers are useful for different applications such as in the development of holographic memories or holographic optical elements. Photopolymers have an undesirable feature, the toxicity of their components and their low environmental compatibility, particularly if we analyse the life cycle of the devices made with these materials and their interaction with the environment. In this sense the University of Alicante has patented new dry biocompatible photopolymer: Biophotopol. Initially this new photopolymer was optimized to holographic memories application. The main goal of the previous works was to achieve thick stable layers. On the other hand polyvinyl/acrylamide (PVA/AA) photopolymers have been widely studied by many research teams. The main drawback of an AA-based photopolymer as far as the environment is concerned is the acrylamide, a substance which has been known to be carcinogenic for many years. Recent investigations have characterized PVA/AA based photopolymers at very low spatial frequencies. In previous works we have proposed the application of interferometric techniques, both in transmission and in reflection, to characterize in real-time the modulation performance of the photopolymers. We used this approach to characterize the optical modulation properties of a PVA/AA photopolymer. With this scheme we mainly characterize the properties at very low spatial frequencies, which can be useful to analyze the applicability of holographic recording materials in another range of applications, such as recording of diffractive optical elements (DOEs). In this work we have compared Biophotopol to PVA/AA photopolymers.

  4. Diffraction efficiency improvement in high spatial frequency holographic gratings stored in PVA/AA photopolymers: several ACPA concentrations

    High spatial frequency in holographic gratings is difficult to obtain due to limitations of the recording material. In this paper, the results obtained after storing holographic transmission gratings with a spatial frequency of 2656 lines/mm in a material based on polyvinyl alcohol and acrylamide (PVA/AA) are presented. A chain transfer agent, 4, 4′-azobis (4-cyanopentanoic acid) (ACPA) was incorporated in the composition of the material to improve the response of the material at a high spatial frequency. Different concentrations of ACPA were used in order to find the optimal concentration giving maximum diffraction efficiency for high spatial frequencies. (paper)

  5. Evaluation of Perceived Spatial Audio Quality

    Jan Berg

    2006-04-01

    Full Text Available The increased use of audio applications capable of conveying enhanced spatial quality puts focus on how such a quality should be evaluated. Different approaches to evaluation of perceived quality are briefly discussed and a new technique is introduced. In a series of experiment, attributes were elicited from subjects, tested and subsequently used for derivation of evaluation scales that were feasible for subjective evaluation of the spatial quality of certain multichannel stimuli. The findings of these experiments led to the development of a novel method for evaluation of spatial audio in surround sound systems. Parts of the method were subsequently implemented in the OPAQUE software prototype designed to facilitate the elicitation process. The prototype was successfully tested in a pilot experiment. The experiments show that attribute scales derived from subjects' personal constructs are functional for evaluation of perceived spatial audio quality. Finally, conclusions on the importance of spatial quality evaluation of new applications are made.

  6. Ultrasonic evaluation of friction stud welded AA 6063/AISI 1030 steel joints

    Highlights: • Friction stud welding of AA 6063 and AISI 1030 was done successfully. • Ultrasonic evaluation of interfacial properties. • EDX analysis confirms intermetallic compound (FeAl) in the interfacial region. - Abstract: Friction stud welding is a promising technique in many applications related to oil and gas industries. It is used to attach grating to offshore oil platforms in areas where arc welding is not permitted because of the risk of causing a fire or explosion. Attachment of anodes inside seawater discharge pipelines in a gas processing plant is performed by this process. This solid state joining process permits metal combinations such as welding of aluminum studs to steel which would be problematic with arc welding because of the formation of thick and brittle inter-metallic compounds. In the present work, AA 6063 is joined to AISI 1030 steel using friction stud welding machine. Properties that are of interest to manufacturing applications such as Young’s modulus, longitudinal velocity, bulk modulus and shear modulus are evaluated by means of an ultrasonic flaw detector. At the interface of the joint, there is an increase of 4.4%, 1.8%, 1.15% and 4.42% is observed for the properties Young’s modulus, longitudinal velocity, bulk modulus and shear modulus respectively. This is due to the formation of intermetallic compound and increase in hardness at the interfacial region. Energy Dispersive X-ray analysis confirms the presence of FeAl as the intermetallic compound. Scanning Electron Microscope evaluation shows the presence of an unbound zone at the center of the inner region which is due to the minimum rotational speed and low axial load experienced at that point. In the unbound zone, there is an incomplete bond between dissimilar metals and it is detrimental to joint strength. Optimum value of friction time and usage of pure aluminum interlayer during the friction stud welding process hinders the formation of unbound zone and enhances the

  7. Evaluation of 7Be fallout spatial variability

    The cosmogenic radionuclide beryllium-7 (Be) is produced in the atmosphere by cosmic particle reactions and is being used as a tracer for soil erosion and climatic processes research. After the production, 7Be bonds to aerosol particles in the atmosphere and is deposited on the soil surface with other radionuclide species by rainfall. Because of the high adsorption on soil particles and its short half-life of 53.2 days, this radionuclide follows of the erosion process and can be used as a tracer to evaluate the sediment transport that occurs during a single rain event or short period of rain events. A key assumption for the erosion evaluation through this radiotracer is the uniformity of the spatial distribution of the 7Be fallout. The 7Be method was elaborated recently and due to its few applications, some assumptions related to the method were not yet properly investigated yet, and the hypothesis of 7Be fallout uniformity needs to be evaluated. The aim of this study was to evaluate the 7Be fallout spatial distribution through the rain water 7Be activity analysis of the first five millimeters of single rain events. The rain water was sampled using twelve collectors distributed on an experimental area of about 300 m2 , located in the campus of Sao Paulo University, Piracicaba. The 7Be activities were measured using a 53% efficiency gamma-ray spectrometer from the Radioisotope laboratory of CENA. The 7Be activities in rain water varied from 0.26 to 1.81 Sq.L-1, with the highest values in summer and lowest in spring. In each one of the 5 single events, the spatial variability of 7Se activity in rain water was high, showing the high randomness of the fallout spatial distribution. A simulation using the 7Be spatial variability values obtained here and 7Se average reference inventories taken from the literature was performed determining the lowest detectable erosion rate estimated by 7Be model. The importance of taking a representative number of samples to determine the

  8. Ontology Based Quality Evaluation for Spatial Data

    Yılmaz, C.; Cömert, Ç.

    2015-08-01

    Many institutions will be providing data to the National Spatial Data Infrastructure (NSDI). Current technical background of the NSDI is based on syntactic web services. It is expected that this will be replaced by semantic web services. The quality of the data provided is important in terms of the decision-making process and the accuracy of transactions. Therefore, the data quality needs to be tested. This topic has been neglected in Turkey. Data quality control for NSDI may be done by private or public "data accreditation" institutions. A methodology is required for data quality evaluation. There are studies for data quality including ISO standards, academic studies and software to evaluate spatial data quality. ISO 19157 standard defines the data quality elements. Proprietary software such as, 1Spatial's 1Validate and ESRI's Data Reviewer offers quality evaluation based on their own classification of rules. Commonly, rule based approaches are used for geospatial data quality check. In this study, we look for the technical components to devise and implement a rule based approach with ontologies using free and open source software in semantic web context. Semantic web uses ontologies to deliver well-defined web resources and make them accessible to end-users and processes. We have created an ontology conforming to the geospatial data and defined some sample rules to show how to test data with respect to data quality elements including; attribute, topo-semantic and geometrical consistency using free and open source software. To test data against rules, sample GeoSPARQL queries are created, associated with specifications.

  9. Lamb wave ultrasonic evaluation of welded AA2024 specimens at tensile static and fatigue testing

    Burkov, M. V.; Byakov, A. V.; Shah, R. T.; Lyubutin, P. S.; Panin, S. V.

    2015-10-01

    The paper deals with the investigation of Lamb waves ultrasonic testing technique applied for evaluation of different stress-strain and damaged state of aluminum specimens at static and fatigue loading in order to develop a Structural Health Monitoring (SHM) approach. The experimental results of tensile testing of AA2024T3 specimens with welded joints are presented. Piezoelectric transducers used as actuators and sensors were adhesively bonded to the specimen's surface using two component epoxy. The set of static and cyclic tensile tests with two frequencies of acoustic testing (50 kHz and 335 kHz) were performed. The recorded signals were processed to calculate the maximum envelope in order to evaluate the changes of the stress-strain state of the specimen and its microstructure during static tension. The registered data are analyzed and discussed in terms of signal attenuation due to the formation of fatigue defects during cyclic loading. Understanding the relations between acoustic signal features and fatigue damages will provide us the ability to determine the damage state of the structure and its residual lifetime in order to design a robust SHM system.

  10. Covert Auditory Spatial Orienting: An Evaluation of the Spatial Relevance Hypothesis

    Roberts, Katherine L.; Summerfield, A. Quentin; Hall, Deborah A.

    2009-01-01

    The spatial relevance hypothesis (J. J. McDonald & L. M. Ward, 1999) proposes that covert auditory spatial orienting can only be beneficial to auditory processing when task stimuli are encoded spatially. We present a series of experiments that evaluate 2 key aspects of the hypothesis: (a) that "reflexive activation of location-sensitive neurons is…

  11. Seasonal trend of AOD and \\AA ngstr\\"om exponent($\\alpha)$ over Indian megacities in varying spatial resolution

    Banerjee, Subhasis

    2014-01-01

    Aerosol optical characteristics AOD and \\AA ngstr\\"om exponent is often used to asses environmental aerosol loading. AOD or Aerosol Optical Depth is an indirect measure of atmospheric aerosol loading by means of total extinction of incoming solar radiation due to scattering and absorption whereas \\AA ngstr\\"om exponent($\\alpha)$ is used to get qualitative understanding of aerosol particle size. Analysis of long term time series AOD data reveals how AOD vis-\\`a-vis aerosol on a particular place changes over time. Similar study with \\AA ngstr\\"om exponent($\\alpha)$ gives an idea how particle size distribution is changing over some area. Such studies cannot be conducted by data measured by ground based stations alone because they are inadequate in numbers on earth moreover such data for considerably long period are not available for most places. To overcome this, radiance data sensed by MODIS instruments on board Aqua and Terra satellite have been used by many authors. In this study 13 years of MODIS level 2 dat...

  12. Effect of Initial Crack Location on Spatial Randomness of Fatigue Crack Growth Resistance in Friction Stir Welded AA7075-T651 Plates

    In the present paper, the effects of initial crack location on spatial randomness of fatigue crack growth resistance (FCGR) in friction stir welded (FSWed) AA7075-T651 plates were studied. The objective of this study is to characterize the statistical properties of FCGR for three different types of initial crack location (ICL) specimens. In this work, the FCGR coefficients were treated as a spatial random process. It was found that the FCGR coefficients for all initial crack location specimens closely followed a two parameter Weibull distribution. The shape parameter of the Weibull distribution for BM-ICL specimens showed the largest value of 7.50, and that for the WM-ICL specimens showed the smallest value of 2.61. In addition, the autocorrelation functions for all the ICL specimens followed the exponential function

  13. Effect of Initial Crack Location on Spatial Randomness of Fatigue Crack Growth Resistance in Friction Stir Welded AA7075-T651 Plates

    Kim, Seon Jin [Pukyong National University, Busan (Korea, Republic of)

    2014-09-15

    In the present paper, the effects of initial crack location on spatial randomness of fatigue crack growth resistance (FCGR) in friction stir welded (FSWed) AA7075-T651 plates were studied. The objective of this study is to characterize the statistical properties of FCGR for three different types of initial crack location (ICL) specimens. In this work, the FCGR coefficients were treated as a spatial random process. It was found that the FCGR coefficients for all initial crack location specimens closely followed a two parameter Weibull distribution. The shape parameter of the Weibull distribution for BM-ICL specimens showed the largest value of 7.50, and that for the WM-ICL specimens showed the smallest value of 2.61. In addition, the autocorrelation functions for all the ICL specimens followed the exponential function.

  14. Comparative evaluation of tungsten inert gas and laser beam welding of AA5083-H321

    K Subbaiah; M Geetha; B Shanmugarajan; S R Koteswara Rao

    2012-10-01

    In this study, the bead-on-plate welds were made on AA5083-H321 alloy plates using both tungsten inert gas (TIG) welding and laser beam (LB) welding processes to study the enhancement of mechanical properties such as weld yield strength and hardness. The low heat input of laser beam welding effectively reduced the size of the fusion zone and heat affected zone compared to tungsten inert gas welding process. High speed LB welding and fast heating and cooling of LB welding process hinders grain growth compared to TIG welding process. The effect of vapourization of volatile alloying elements is also considered. It seems that magnesium evaporation is relatively less in LB welding compared to TIG welding. Tensile testing of the welded joints revealed that LB welding results in superior mechanical properties. It is concluded that LB welding process is more suitable to join AA5083-H321.

  15. Performance evaluation of the GCR block ACK mechanism in IEEE 802.11aa networks

    Li, Qihao

    2013-01-01

    With the growing demand for multimedia services, video streams have become major traffic sources in the Internet. However, it is challenging to transmit multimedia streams over IEEE 802.11 Wireless Local Area Networks (WLANs) with high performance and reliability. As a solution to improve system efficiency, a new standard, 802.11aa, is introduced to provide much more reliable and robust transfer of video stream by introducing several new service features. In this thesis, we ana...

  16. MODEL OF SPATIAL EVALUATION FOR TOURISM ECO-RENT

    Maja Fredotović

    2011-02-01

    Full Text Available Tourism is extremely interacted with the environment. Taking into account that tourism uses the space and related resources, it seems right to pay for the damages caused to the environment. This is the basis of the tourist spatial eco rent. The paper evaluates the space and resources used by tourism as the basis for the introduction of the tourism eco-rent in the area of Makarska Riviera, a traditional tourism destination. It is divided into three main spatial units: urban areas, bathing zone (beaches, Biokovo Park of Nature. According to natural and geographical reasoning, a number of zones with different spatial values within each spatial unit has been identified. Each unit, i.e. zone was evaluated according to various criteria relevant to the evaluation of space for tourism and tourism development purposes. Having ranked zones within each unit, using the multiriteria ranking method PROMETHEE II, comparative analysis of the obtained results was carried out as well.

  17. Evaluation of the Mechanical Properties of AA 6063 Processed by Severe Plastic Deformation

    Jafarlou, Davoud Mashhadi; Zalnezhad, Erfan; Hamouda, Abdelmagid Salem; Faraji, Ghader; Mardi, Noor Azizi Bin; Hassan Mohamed, Mohsen Abdelnaeim

    2015-05-01

    In this study, the mechanical properties, including surface hardness, tensile strength, fatigue, and fretting fatigue behavior of AA 6063 processed by equal channel angular pressing as the most efficient severe shear plastic deformation (SPD) technique, were investigated. Following the SPD process, samples were subjected to heat treatment (HT), hard anodizing (HA), and a combination of HT and HA. Rotating-bending fretting fatigue tests were performed to explore the samples' response to the fretting condition. From the experimental fatigue and fretting fatigue tests, it was apparent that the SPD treatment had a positive effect on enhancing the fatigue and fretting fatigue lives of the samples at low and high-cyclic loads compared with the HT technique by 78 and 67 pct, and 131 and 154 pct respectively. The results also indicate that the SPD + HT technique significantly increased the fatigue and fretting fatigue lives of the samples at high and low cycles by 15.56 and 8.33 pct, and 14.4 and 5.1 pct respectively, compared with the SPD method. HA of AA6063 increased the fatigue and fretting fatigue lives of SPD + HT-processed samples at low cycle by 15.5 and 18.4 pct respectively; however, at high cycle, HA had reverse effects, whereby the fatigue and fretting fatigue lives of SPD + HT-processed samples decreased by 16.7 and 30 pct, respectively.

  18. Air quality evaluation of some industrial cities of Pakistan using INAA and AAS

    Instrumental neutron activation analysis technique (INAA) and atomic absorption spectrometry (AAS) have been employed for the characterization of 40 trace elements in suspended particulate matter (SPM) and soil samples from Pakistan's industrially important cities of Gujranwala and Faisalabad. The air particulates, which were collected from five different locations of each city, indicate moderate to unhealthy air quality with SPM levels above the World Health Organization (WHO) guidelines. Enrichment factors (EF) for all the elements have been calculated with respect to their concentrations in the soils. Some of the areas of Gujranwala show high EF values for Pb, Cr, Cu, Cd and Ca, which may indicate contributions due to heavy traffic with automotive exhaust, tanneries and many other acute anthropogenic activities in this area. The presence of high concentration of Cr is due to chrome plating units and leather industry in the adjoining areas. Similarly few sites from Faisalabad have high Pb, Cd and Sb contents from vehicular aerosols with the contributions from coal combustion, battery manufacturing industries, lead smelters and numerous other industries. IAEA Reference Materials were analyzed for the validation of INAA and AAS procedures employed and to ensure the accuracy and precision of the characterized data. (orig.)

  19. AA Index

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  20. Hematotoxicity and genotoxicity evaluations in Swiss mice intraperitoneally exposed to Bacillus thuringiensis (var kurstaki) spore crystals genetically modified to express individually Cry1Aa, Cry1Ab, Cry1Ac, or Cry2Aa.

    Mezzomo, Bélin Poletto; Miranda-Vilela, Ana Luisa; Barbosa, Lilian Carla Pereira; Albernaz, Vanessa Lima; Grisolia, Cesar Koppe

    2016-08-01

    Bacillus thuringiensis (Bt) has been widely used in foliar sprays as part of integrated pest management strategies against insect pests of agricultural crops. Since the advent of genetically modified plants expressing Bt δ-endotoxins, the bioavailability of Cry proteins has increased, and therefore for biosafety reasons their adverse effects should be studied, mainly for nontarget organisms. We evaluated, in Swiss mice, the hematotoxicity and genotoxicity of the genetically modified strains of Bt spore crystals Cry1Aa, 1Ab, 1Ac, or 2Aa at 27 mg/kg, and Cry1Aa, 1Ab and 2Aa also at 136 and 270 mg/kg, administered with a single intraperitoneal injection 24 h before euthanasia. Controls received filtered water or cyclophosphamide. Blood samples collected by cardiac puncture were used to perform hemogram, and bone marrow was extracted for the micronucleus test. Bt spore crystals presented toxicity for lymphocytes when in higher doses, which varied according to the type of spore crystal studied, besides promoting cytotoxic and genotoxic effects for the erythroid lineage of bone marrow, mainly at highest doses. Although the profile of such adverse side effects can be related to their high level of exposure, which is not commonly found in the environment, results indicated that these Bt spore crystals were not harmless to mice. This suggests that a more specific approach should be taken to increase knowledge about their toxicological properties and to establish the toxicological risks to nontarget organisms. © 2015 Wiley Periodicals, Inc. Environ Toxicol 31: 970-978, 2016. PMID:25899034

  1. The spatial evaluation of neighborhood clusters of birth defects

    Frisch, J.D.

    1990-04-16

    Spatial statistics have recently been applied in epidemiology to evaluate clusters of cancer and birth defects. Their use requires a comparison population, drawn from the population at risk for disease, that may not always be readily available. In this dissertation the plausibility of using data on all birth defects, available from birth defects registries, as a surrogate for the spatial distribution of all live births in the analysis of clusters is assessed. Three spatial statistics that have been applied in epidemiologic investigations of clusters, nearest neighbor distance, average interpoint distance, and average distance to a fixed point, were evaluated by computer simulation for their properties in a unit square, and in a zip code region. Comparison of spatial distributions of live births and birth defects was performed by drawing samples of live births and birth defects from Santa Clara County, determining the street address at birth, geocoding this address and evaluating the resultant maps using various statistical techniques. The proposed method was then demonstrated on a previously confirmed cluster of oral cleft cases. All live births for the neighborhood were geocoded, as were all birth defects. Evaluation of this cluster using the nearest neighbor and average interpoint distance statistics was performed using randomization techniques with both the live births population and the birth defect population as comparison groups. 113 refs., 36 figs., 16 tabs.

  2. Rating AAs.

    Carter, Susan J.

    2001-01-01

    Why alternative investments? In a word: performance. Many higher education endowment and foundation managers are making increasing commitments to alternative investments, or AAs, in order to obtain higher returns and broader diversification for their investment portfolios than public securities instruments can usually provide. Learn how to handle…

  3. EVALUATING THREE INTERFACE TECHNOLOGIES IN ASSISTING PEDESTRIANS' SPATIAL KNOWLEDGE ACQUISITION

    H. Huang

    2012-07-01

    Full Text Available Recent years have seen raising interests in mobile pedestrian navigation systems. Different interface technologies can be used to communicate/convey route directions to pedestrians, such as mobile maps, voices, and augmented reality (AR. Many field experiments have been conducted to study the effectiveness of different interface technologies in guiding pedestrians to their destinations. In contrast to other field studies, this article aims at investigating the influence of different interface technologies on spatial knowledge acquisition (spatial learning. With sufficient spatial knowledge about an environment, people can still find their way when navigation systems fail (e.g. out of battery. The goal of this article is to empirically evaluate three GPS-based navigation prototypes (implementing mobile map-based, AR-based, and voice-based guidance respectively in supporting spatial knowledge acquisition. The field test showed that in terms of spatial knowledge acquisition, the three interface technologies led to comparable poor results, which were also not significantly different from each other. This article concludes with some implications for designing mobile pedestrian navigation systems.

  4. Distributed multi-criteria model evaluation and spatial association analysis

    Scherer, Laura; Pfister, Stephan

    2015-04-01

    Model performance, if evaluated, is often communicated by a single indicator and at an aggregated level; however, it does not embrace the trade-offs between different indicators and the inherent spatial heterogeneity of model efficiency. In this study, we simulated the water balance of the Mississippi watershed using the Soil and Water Assessment Tool (SWAT). The model was calibrated against monthly river discharge at 131 measurement stations. Its time series were bisected to allow for subsequent validation at the same gauges. Furthermore, the model was validated against evapotranspiration which was available as a continuous raster based on remote sensing. The model performance was evaluated for each of the 451 sub-watersheds using four different criteria: 1) Nash-Sutcliffe efficiency (NSE), 2) percent bias (PBIAS), 3) root mean square error (RMSE) normalized to standard deviation (RSR), as well as 4) a combined indicator of the squared correlation coefficient and the linear regression slope (bR2). Conditions that might lead to a poor model performance include aridity, a very flat and steep relief, snowfall and dams, as indicated by previous research. In an attempt to explain spatial differences in model efficiency, the goodness of the model was spatially compared to these four phenomena by means of a bivariate spatial association measure which combines Pearson's correlation coefficient and Moran's index for spatial autocorrelation. In order to assess the model performance of the Mississippi watershed as a whole, three different averages of the sub-watershed results were computed by 1) applying equal weights, 2) weighting by the mean observed river discharge, 3) weighting by the upstream catchment area and the square root of the time series length. Ratings of model performance differed significantly in space and according to efficiency criterion. The model performed much better in the humid Eastern region than in the arid Western region which was confirmed by the

  5. Spatial evaluation of volcanic ash forecasts using satellite observations

    Harvey, N. J.; Dacre, H. F.

    2016-01-01

    The decision to close airspace in the event of a volcanic eruption is based on hazard maps of predicted ash extent. These are produced using output from volcanic ash transport and dispersion (VATD) models. In this paper the fractions skill score has been used for the first time to evaluate the spatial accuracy of VATD simulations relative to satellite retrievals of volcanic ash. This objective measure of skill provides more information than traditional point-by-point metrics, such as success index and Pearson correlation coefficient, as it takes into the account spatial scale over which skill is being assessed. The FSS determines the scale over which a simulation has skill and can differentiate between a "near miss" and a forecast that is badly misplaced. The idealized scenarios presented show that even simulations with considerable displacement errors have useful skill when evaluated over neighbourhood scales of 200-700 (km)2. This method could be used to compare forecasts produced by different VATDs or using different model parameters, assess the impact of assimilating satellite-retrieved ash data and evaluate VATD forecasts over a long time period.

  6. Smart tools of urban climate evaluation for smart spatial planning

    Středová Hana

    2015-09-01

    Full Text Available Air temperature and humidity conditions were monitored in Hradec Králové, Czech Republic, by a network of meteorological stations. Meteorological sensors were placed across a representative variety of urban and suburban environments. The data collected over the 2011–2014 period are analysed in this paper. The data from reference standard meteorological stations were used for comparison and modelling purposes. Air temperatures at the points of interest were successfully modelled using regression relationships. The spatial expression of point measurements of air temperatures was provided by GIS methods in combination with CORINE land cover layer, and satellite thermal images were used to evaluate the significance of these methods. The use of standard climate information has low priority for urban planners. The impact of the urban heat island on city residents and visitors was evaluated using the HUMIDEX index, as it is more understandable for urban planners than temperature conditions as such. The aim of this paper is the modification, description and presentation of urban climate evaluation methods that are easily useable for spatial planning purposes. These methods are based on comprehensible, easily available but quality data and results. This unified methodology forms a theoretical basis for better urban planning policies to mitigate the urban heat island effects.

  7. An Evaluation of Database Solutions to Spatial Object Association

    Kumar, V S; Kurc, T; Saltz, J; Abdulla, G M; Kohn, S; Matarazzo, C

    2008-06-24

    Object association is a common problem encountered in many applications. Spatial object association, also referred to as crossmatch of spatial datasets, is the problem of identifying and comparing objects in two datasets based on their positions in a common spatial coordinate system--one of the datasets may correspond to a catalog of objects observed over time in a multi-dimensional domain; the other dataset may consist of objects observed in a snapshot of the domain at a time point. The use of database management systems to the solve the object association problem provides portability across different platforms and also greater flexibility. Increasing dataset sizes in today's applications, however, have made object association a data/compute-intensive problem that requires targeted optimizations for efficient execution. In this work, we investigate how database-based crossmatch algorithms can be deployed on different database system architectures and evaluate the deployments to understand the impact of architectural choices on crossmatch performance and associated trade-offs. We investigate the execution of two crossmatch algorithms on (1) a parallel database system with active disk style processing capabilities, (2) a high-throughput network database (MySQL Cluster), and (3) shared-nothing databases with replication. We have conducted our study in the context of a large-scale astronomy application with real use-case scenarios.

  8. Evaluation of Spatial Agreement of Distinct Landslide Prediction Models

    Sterlacchini, Simone; Bordogna, Gloria; Frigerio, Ivan

    2013-04-01

    derived to test agreement among the maps. Nevertheless, no information was made available about the location where the prediction of two or more maps agreed and where they did not. Thus we wanted to study if also the spatial agreements of the models predicted the same or similar values. To this end we adopted a soft image fusion approach proposed in. It is defined as a group decision making model for ranking spatial alternatives based on a soft fusion of coherent evaluations. In order to apply this approach, the prediction maps were categorized into 10 distinct classes by using an equal-area criterion to compare the predicted results. Thus we applied soft fusion of the prediction maps regarded as evaluations of distinct human experts. The fusion process needs the definition of the concept of "fuzzy majority", provided by a linguistic quantifier, in order to determine the coherence of a majority of maps in each pixel of the territory. Based on this, the overall spatial coherence among the majority of the prediction maps was evaluated. The spatial coherence among a fuzzy majority is defined based on the Minkowski OWA operators. The result made it possible to spatially identify sectors of the study area in which the predictions were in agreement for the same or for close classes of susceptibility, or discordant, or even distant classes. We studied the spatial agreement among a "fuzzy majority" defined as "80% of the 13 coherent maps", thus requiring that at least 11 out of 13 agree, since from previous results we knew that two maps were in disagreement. So the fuzzy majority AtLeast80% was defined by a quantifier with linear increasing membership function (0.8, 1). The coherence metric used was the Euclidean distance. We thus computed the soft fusion of AtLeast80% coherent maps for homogeneous groups of classes. We considered as homogeneous classes the highest two classes (9 and 10), the lowest two classes, and the central classes (4, 5 and 6). We then fused the maps

  9. Spatial augmented reality for product appearance design evaluation

    Min Ki Park

    2015-01-01

    Full Text Available Augmented reality based on projection, called “Spatial Augmented Reality (SAR”, is a new technology that can produce immersive contents by overlapping virtuality and real-world environment. It has been paid attention as the next generation digital contents in media art and human–computer interaction (HCI. In this paper, we present a new methodology to evaluate the product appearance design more intuitively by means of SAR technique. The proposed method first projects the high-quality rendered image considering the optical property of materials onto the mock-up of a product. We also conduct a projector-camera calibration to compensate a color distortion according to a projector, a projection surface and environment lighting. The design evaluation methodology we propose offers more flexible and intuitive evaluation environment to a designer and user (evaluator than previous methods that are performed via a digital display. At the end of this research, we have conducted a case study for designing and evaluating appearance design of an automobile.

  10. Evaluating Michigan's community hospital access: spatial methods for decision support

    Varnakovida Pariwate

    2006-09-01

    Full Text Available Abstract Background Community hospital placement is dictated by a diverse set of geographical factors and historical contingency. In the summer of 2004, a multi-organizational committee headed by the State of Michigan's Department of Community Health approached the authors of this paper with questions about how spatial analyses might be employed to develop a revised community hospital approval procedure. Three objectives were set. First, the committee needed visualizations of both the spatial pattern of Michigan's population and its 139 community hospitals. Second, the committee required a clear, defensible assessment methodology to quantify access to existing hospitals statewide, taking into account factors such as distance to nearest hospital and road network density to estimate travel time. Third, the committee wanted to contrast the spatial distribution of existing community hospitals with a theoretical configuration that best met statewide demand. This paper presents our efforts to first describe the distribution of Michigan's current community hospital pattern and its people, and second, develop two models, access-based and demand-based, to identify areas with inadequate access to existing hospitals. Results Using the product from the access-based model and contiguity and population criteria, two areas were identified as being "under-served." The lower area, located north/northeast of Detroit, contained the greater total land area and population of the two areas. The upper area was centered north of Grand Rapids. A demand-based model was applied to evaluate the existing facility arrangement by allocating daily bed demand in each ZIP code to the closest facility. We found 1,887 beds per day were demanded by ZIP centroids more than 16.1 kilometers from the nearest existing hospital. This represented 12.7% of the average statewide daily bed demand. If a 32.3 kilometer radius was employed, unmet demand dropped to 160 beds per day (1

  11. Numerical Weather Predictions Evaluation Using Spatial Verification Methods

    Tegoulias, I.; Pytharoulis, I.; Kotsopoulos, S.; Kartsios, S.; Bampzelis, D.; Karacostas, T.

    2014-12-01

    During the last years high-resolution numerical weather prediction simulations have been used to examine meteorological events with increased convective activity. Traditional verification methods do not provide the desired level of information to evaluate those high-resolution simulations. To assess those limitations new spatial verification methods have been proposed. In the present study an attempt is made to estimate the ability of the WRF model (WRF -ARW ver3.5.1) to reproduce selected days with high convective activity during the year 2010 using those feature-based verification methods. Three model domains, covering Europe, the Mediterranean Sea and northern Africa (d01), the wider area of Greece (d02) and central Greece - Thessaly region (d03) are used at horizontal grid-spacings of 15km, 5km and 1km respectively. By alternating microphysics (Ferrier, WSM6, Goddard), boundary layer (YSU, MYJ) and cumulus convection (Kain-­-Fritsch, BMJ) schemes, a set of twelve model setups is obtained. The results of those simulations are evaluated against data obtained using a C-Band (5cm) radar located at the centre of the innermost domain. Spatial characteristics are well captured but with a variable time lag between simulation results and radar data. Acknowledgements: This research is co­financed by the European Union (European Regional Development Fund) and Greek national funds, through the action "COOPERATION 2011: Partnerships of Production and Research Institutions in Focused Research and Technology Sectors" (contract number 11SYN_8_1088 - DAPHNE) in the framework of the operational programme "Competitiveness and Entrepreneurship" and Regions in Transition (OPC II, NSRF 2007-­-2013).

  12. Evaluation of five reaction media for AS(III) determination in model solutions containing AS(V) by Hg AAS

    Complete text of publication follows. Many methodologies exist for the speciation analysis of As in water samples. Selective reduction procedure based on the highly pH-dependent reaction between arsenic species and NaBH4 to generate arsine in HG AAS system is relatively commonly used. In this case, for As(V) strongly acidic solution is required (pH ≤ 1), while for As(III) hydride formation occurs in mildly acidic solutions. The aim of this study was to critically evaluate the most frequently used reaction media for the speciation analysis of arsenite in the presence of arsenate. Five different reaction media has been used to achieve a selective volatilization of arsenite: 1.5 M HCl (pH <1.0), 0.1 M acetic acid (pH ∼2.9), citrate buffer (pH ∼3.1), acetate buffer (pH ∼5.0) and phosphate buffer (pH ∼7.2). All the studied reaction media can be used for the selective volatilization of As(III) but the serious problem caused by the interference of As(V) was observed (in 0.1 M acetic acid, citrate buffer and acetate buffer) when relative content of As(III) was less than 10% (from all the present arsenic). Natural waters usually contain less than 10% of As(III), so speciation in the real samples should be accompanied with another speciation analysis procedure to confirm the accuracy of obtained data. This problem was not observed in phosphate buffer but in this case the sensitivity was significantly lower and the speciation analysis in this medium can be done only if relatively high contents of As(III) in the samples are present. The work was supported by Slovak Research and Development Agency under the contracts No. APVT-20-010204, LPP-0038-06, LPP-0188-06, LPP-0146-09 and SK-CZ-0044-07, by Scientific Grant Agency of Ministry of Education of Slovak Republic and the Slovak Academy of Sciences under the contracts No. VEGA 1/4463/07, VEGA 1/4464/07 and VEGA 1/0272/08 and by Ministry of Education, Youth and Sports of Czech Republic under the contract No. MEB 080813.

  13. Coefficient shifts in geographical ecology: an empirical evaluation of spatial and non-spatial regression

    Bini, L. M.; Diniz-Filho, J. A. F.; Rangel, T. F. L. V. B.; Akre, T. S. B.; Albaladejo, R. G.; Albuquerque, F. S.; Aparicio, A.; Araújo, M. B.; Baselga, A.; Beck, J.; Bellocq, M. I.; Böhning-Gaese, K.; Borges, P. A. V.; Castro-Parga, I.; Chey, V. K.; Chown, S. L.; Marco, P.; Dobkin, D. S.; Ferrer-Castán, D.; Field, R.; Filloy, J.; Fleishman, E.; Gómez, J. F.; Hortal, J.; Iverson, J. B.; Kerr, J. T.; Kissling, W. D.; Kitching, I. J.; León-Cortés, J. L.; Lobo, J. M.; Montoya, D.; Morales-Castilla, I.; Moreno, J. C.; Oberdorff, T.; Olalla-Tárraga, M. Á.; Pausas, J. G.; Qian, H.; Rahbek, Carsten; Rodríguez, M. Á.; Rueda, M.; Ruggiero, A.; Sackmann, P.; Sanders, N. J.; Terribile, L. C.; Vetaas, O. R.; Hawkins, B. A.

    2009-01-01

    A major focus of geographical ecology and macroecology is to understand the causes of spatially structured ecological patterns. However, achieving this understanding can be complicated when using multiple regression, because the relative importance of explanatory variables, as measured by regress...

  14. An Evaluation of University World Geography Textbook Questions for Components of Spatial Thinking

    Scholz, Michael A.; Huynh, Niem Tu; Brysch, Carmen P.; Scholz, Ruojing Wang

    2014-01-01

    Geography textbooks contain chapter or review questions that may engage students in spatial thinking. This research used Jo and Bednarz's (2009) "Taxonomy of Spatial Thinking" to evaluate the percentage of spatial thinking questions in four university-level world geography course textbooks. The results from this study were then…

  15. ACCOUNTING FOR SPATIAL CHARACTERISTICS OF WATERSHEDS IN EVALUATING WATER POLLUTION ABATEMENT POLICIES

    Qiu, Zeyuan; Prato, Anthony A.

    1999-01-01

    This study evaluates three agricultural nonpoint pollution abatement policies: regulating the spatial pattern of agricultural activities, ambient tax, and abatement tax/subsidy. All three policies incorporate spatial characteristics of agricultural emission loading and movement for an agricultural watershed in the Midwest. The effects of spatial variation in natural conditions and landscape features on agricultural emissions and crop yield are evaluated using a newly developed biophysical sim...

  16. Spatial Fourier transform method for evaluating SQUID gradiometers

    A simple method of measuring the spatial transfer function of a gradiometer, consisting of a flux transformer coupled to a SQUID, is presented and it is compared with theoretical predictions. Based, on this approach, a new method of reporting a gradiometer's performance is proposed; the rejection factor is expressed in decibels obtained directly from the transfer function plot

  17. Developing Bilateral and Spatial Concepts in Primary School-aged Children: An Empirical Evaluation of the Anker Bilateral Spatial System

    Janet E. Richmond PhD

    2014-07-01

    Full Text Available Background: Visual-spatial and visual-motor perceptual difficulties contribute to school-aged learning problems. Hence, a need exists to address children’s visual-spatial and visual-motor perceptual difficulties as early as possible in the child’s school career. Thus, this study reports on the evaluation of the Anker Bilateral Spatial System’s (ABSS effectiveness in remediating primary school children’s perceptual difficulties. Method: Thirty-one children (17 boys and 14 girls aged 6 to 12 years who had been identified by their classroom teacher as having observable visual-spatial and visual-motor perceptual difficulties participated in a 10-week pre/posttest intervention study. The study’s pre/posttest assessments included the Developmental Test of Visual-Motor Integration (VMI, the Spatial Awareness Skills Program Test (SASP, and two subscales of the School Function Assessment (SFA. Results: Paired t-test statistics were calculated on the pre/post intervention scores. Paired t-test statistics calculated (p = .05 that significant change had occurred in the writing speed (t = -3.978, p < .001. Conclusion: Given that the study’s Year 1 students made progress in more areas of remediation than did any other year level, it is evident that the ABSS is particularly effective with this year group.

  18. A Perceptual Image Quality Evaluation based on Local Spatial Information

    Girard, Nathalie; Baudrier, Etienne; Ogier, Jean-Marc

    2009-01-01

    This paper presents a new comparative objective method for image quality evaluation. This method relies on two keys points: a local objective evaluation and a perceptual gathering. The local evaluation concerns the dissimilarities between the degraded image and the reference image ; it is based on a graylevel local Hausdorff distance. This new Hausdorff distance uses a generalized distance transform which is studied here. The evaluation result is a local dissimilarity map (LDMap). In order to...

  19. Evaluating stream health based environmental justice model performance at different spatial scales

    Daneshvar, Fariborz; Nejadhashemi, A. Pouyan; Zhang, Zhen; Herman, Matthew R.; Shortridge, Ashton; Marquart-Pyatt, Sandra

    2016-07-01

    This study evaluated the effects of spatial resolution on environmental justice analysis concerning stream health. The Saginaw River Basin in Michigan was selected since it is an area of concern in the Great Lakes basin. Three Bayesian Conditional Autoregressive (CAR) models (ordinary regression, weighted regression and spatial) were developed for each stream health measure based on 17 socioeconomic and physiographical variables at three census levels. For all stream health measures, spatial models had better performance compared to the two non-spatial ones at the census tract and block group levels. Meanwhile no spatial dependency was found at the county level. Multilevel Bayesian CAR models were also developed to understand the spatial dependency at the three levels. Results showed that considering level interactions improved models' prediction. Residual plots also showed that models developed at the block group and census tract (in contrary to county level models) are able to capture spatial variations.

  20. Evaluation of Spatial Agreement of Distinct Landslide Prediction Models

    Sterlacchini, S.; Frigerio, I; Bordogna, G,

    2013-01-01

    The aim of the study was to assess the degree of spatial agreement of different predicted patterns in a majority of coherent landslide prediction maps with almost similar success and prediction rate curves. If two or more models have a similar performance, the choice of the best one is not a trivial operation and cannot be based on success and prediction rate curves only. In fact, it may happen that two or more prediction maps with similar accuracy and predictive power do not have the same de...

  1. Nondestructive evaluation of internal maturity of tomatoes using spatially offset Raman spectroscopy

    This research explored the use of spatially offset Raman spectroscopy (SORS) for nondestructive evaluation of internal maturity of tomatoes. A Raman spectroscopy system using a 785 nm laser was developed to collect spatially-offset spectra in the wavenumber range of 200 – 2500. The SORS measuremen...

  2. Antiproton Accumulator (AA)

    Photographic Service

    1980-01-01

    The AA in its final stage of construction, before it disappeared from view under concrete shielding. Antiprotons were first injected, stochastically cooled and accumulated in July 1980. From 1981 on, the AA provided antiprotons for collisions with protons, first in the ISR, then in the SPS Collider. From 1983 on, it also sent antiprotons, via the PS, to the Low-Energy Antiproton Ring (LEAR). The AA was dismantled in 1997 and shipped to Japan.

  3. AA magnet measurement team

    1978-01-01

    Quickly improvised measurement equipment for the AA (Antiproton Accumulator) was all the tight schedule permitted, but the high motivation of the team made up for the lack of convenience. From left to right: Roy Billinge (Joint AA Project Leader, the other one was Simon van der Meer); Bruno Autin, Brian Pincott, Colin Johnson.

  4. Spatial and sonic evaluation of urban public ambiances

    Marry, Solène

    2010-01-01

    Our study, which is based on a qualitative survey, attempts to understand everyday sound perception in urban public spaces. Parameters influencing sound perception are investigated. The elaboration of a complex methodological protocal allows us to match qualitative and quantitative data (questionnaires, focus groups, pictures, acoustic measurements, interviews, sonic mind maps). The results presented in the paper illustrate the importance of sonic perception in the evaluation of urban ambiances.

  5. Sediment spatial distribution evaluated by three methods and its relation to some soil properties

    An investigation of rates and spatial distribution of sediments on an agricultural field cultivated with sugarcane was undertaken using the 137Cs technique, USLE and WEPP models. The study was carried out on the Ceveiro watershed of the Piracicaba river basin, state of Sao Paulo, Brazil, experiencing severe soil degradation due to soil erosion. The objectives of the study were to compare the spatial distribution of sediments evaluated by the three methods and its relation to some soil properties. Erosion and sedimentation rates and their spatial distribution estimated by the three methods were completely different. Although not able to show sediment deposition, the spatial distribution of erosion rates evaluated by USLE presented the best correlation with other studied soil properties. (author)

  6. Evaluation of Image Registration Spatial Accuracy Using a Bayesian Hierarchical Model

    Liu, Suyu; Yuan, Ying; Castillo, Richard; Guerrero, Thomas; Johnson, Valen E.

    2014-01-01

    To evaluate the utility of automated deformable image registration (DIR) algorithms, it is necessary to evaluate both the registration accuracy of the DIR algorithm itself, as well as the registration accuracy of the human readers from whom the ”gold standard” is obtained. We propose a Bayesian hierarchical model to evaluate the spatial accuracy of human readers and automatic DIR methods based on multiple image registration data generated by human readers and automatic DIR methods. To fully a...

  7. AAS 227: Day 3

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  8. AAS 227: Welcome!

    Kohler, Susanna

    2016-01-01

    Greetings from the 227th American Astronomical Society meeting in Kissimmee, Florida! This week, along with several fellow authors from astrobites, Iwill bewritingupdates on selectedevents at themeeting and posting at the end of each day. You can follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.If youre an author or referee (or plan to be!) and youre here at the meeting, consider joining us at our Author and Referee Workshop on Wednesday in the Tallahassee room, where well be sharingsome of the exciting new features of the AAS journals. You can drop intoeither of the two-hour sessions(10 AM 12 PM or 1 PM 3 PM), and there will be afree buffet lunch at noon.Heres the agenda:Morning SessionTopic Speaker10:00 am 10:05 amIntroductionsJulie Steffen10:05 am 10:35 amChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac10:35 am 11:00 amThe Peer Review ProcessButler Burton11:00 am 11:15 amAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler11:15 am 11:30 amFixing Software and Instrumentation Publishing: New Paper Styles in AAS JournalsChris Lintott11:30 am 11:45 amMaking Article Writing Easier with the New AASTeX v6.0Greg Schwarz11:45 am 12:00 pmBringing JavaScript and Interactivity to Your AAS Journal FiguresGus MuenchLunch SessionTopic Speaker12:00 pm 12:15 pmUnified Astronomy ThesaurusKatie Frey12:15 pm 12:30 pmAAS/ADS ORCID Integration ToolAlberto Accomazzi12:30 pm 12:45 pmWorldWide Telescope and Video AbstractsJosh Peek12:45 pm 01:00 pmArizona Astronomical Data Hub (AADH)Bryan HeidornAfternoon SessionTopic Speaker01:00 pm 01:05 pmIntroductionsJulie Steffen01:05 pm 01:35 pmChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac01:35 pm 02:00 pmThe Peer Review ProcessButler Burton02:00 pm 02:15 pmAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler02:15 pm 02:30 pm

  9. Geomagnetic aa Indices

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa indices are the continuation of the series beginning in the year 1868. A full description of these indices is given in the International...

  10. A high-performance spatial database based approach for pathology imaging algorithm evaluation

    Fusheng Wang

    2013-01-01

    Full Text Available Background: Algorithm evaluation provides a means to characterize variability across image analysis algorithms, validate algorithms by comparison with human annotations, combine results from multiple algorithms for performance improvement, and facilitate algorithm sensitivity studies. The sizes of images and image analysis results in pathology image analysis pose significant challenges in algorithm evaluation. We present an efficient parallel spatial database approach to model, normalize, manage, and query large volumes of analytical image result data. This provides an efficient platform for algorithm evaluation. Our experiments with a set of brain tumor images demonstrate the application, scalability, and effectiveness of the platform. Context: The paper describes an approach and platform for evaluation of pathology image analysis algorithms. The platform facilitates algorithm evaluation through a high-performance database built on the Pathology Analytic Imaging Standards (PAIS data model. Aims: (1 Develop a framework to support algorithm evaluation by modeling and managing analytical results and human annotations from pathology images; (2 Create a robust data normalization tool for converting, validating, and fixing spatial data from algorithm or human annotations; (3 Develop a set of queries to support data sampling and result comparisons; (4 Achieve high performance computation capacity via a parallel data management infrastructure, parallel data loading and spatial indexing optimizations in this infrastructure. Materials and Methods: We have considered two scenarios for algorithm evaluation: (1 algorithm comparison where multiple result sets from different methods are compared and consolidated; and (2 algorithm validation where algorithm results are compared with human annotations. We have developed a spatial normalization toolkit to validate and normalize spatial boundaries produced by image analysis algorithms or human annotations. The

  11. Standard Reticle Slide To Objectively Evaluate Spatial Resolution and Instrument Performance in Imaging Mass Spectrometry.

    Zubair, Faizan; Prentice, Boone M; Norris, Jeremy L; Laibinis, Paul E; Caprioli, Richard M

    2016-07-19

    Spatial resolution is a key parameter in imaging mass spectrometry (IMS). Aside from being a primary determinant in overall image quality, spatial resolution has important consequences on the acquisition time of the IMS experiment and the resulting file size. Hardware and software modifications during instrumentation development can dramatically affect the spatial resolution achievable using a given imaging mass spectrometer. As such, an accurate and objective method to determine the working spatial resolution is needed to guide instrument development and ensure quality IMS results. We have used lithographic and self-assembly techniques to fabricate a pattern of crystal violet as a standard reticle slide for assessing spatial resolution in matrix-assisted laser desorption/ionization (MALDI) IMS experiments. The reticle is used to evaluate spatial resolution under user-defined instrumental conditions. Edgespread analysis measures the beam diameter for a Gaussian profile and line scans measure an "effective" spatial resolution that is a convolution of beam optics and sampling frequency. The patterned crystal violet reticle was also used to diagnose issues with IMS instrumentation such as intermittent losses of pixel data. PMID:27299987

  12. A Framework for Evaluation of Marine Spatial Data Geoportals Using Case Studies

    Tavra Marina

    2014-12-01

    Full Text Available Need for a Marine Spatial Data Infrastructure (MSDI as a component of a National Spatial Data Infrastructure (NSDI is widely recognized. An MSDI is relevant not only for hydrographers and government planners, but also for many other sectors which takes interest in marine spatial data, whether they are data users, data providers, or data managers [9]. An MSDI encompasses marine and coastal geographic and business information. For efficient use of Marine Spatial Data, it is necessary to ensure its valid and accessible distribution. A geoportal is a specialized web portal for sharing spatial information at different levels over the Internet. This paper re-examines the implementation of an MSDI and what it means for data custodians and end users. Several geoportals are reviewed (German and Australian to determine their web services functionality, capabilities and the scope to which they support the sharing and reuse of Marine Spatial Data to assist the development of the Croatian MSDI Geoportal. This framework provides a context for better understanding the information bases on spatial data standards and a tool for evaluation of MSDI dissemination - Geoportal.

  13. Evaluation of the MIND Research Institute's Spatial-Temporal Math (ST Math) Program in California

    Wendt, Staci; Rice, John; Nakamoto, Jonathan

    2014-01-01

    The MIND Research Institute contracted with the Evaluation Research Program at WestEd to conduct an independent assessment of mathematics outcomes in elementary school grades across California that were provided with the ST Math program. Spatial-Temporal (ST) Math is a game-based instructional software designed to boost K-5 and secondary-level…

  14. Evaluating the Value of High Spatial Resolution in National Capacity Expansion Models using ReEDS

    Krishnan, Venkat; Cole, Wesley

    2016-07-18

    This poster is based on the paper of the same name, presented at the IEEE Power & Energy Society General Meeting, July18, 2016. Power sector capacity expansion models (CEMs) have a broad range of spatial resolutions. This paper uses the Regional Energy Deployment System (ReEDS) model, a long-term national scale electric sector CEM, to evaluate the value of high spatial resolution for CEMs. ReEDS models the United States with 134 load balancing areas (BAs) and captures the variability in existing generation parameters, future technology costs, performance, and resource availability using very high spatial resolution data, especially for wind and solar modeled at 356 resource regions. In this paper we perform planning studies at three different spatial resolutions - native resolution (134 BAs), state-level, and NERC region level - and evaluate how results change under different levels of spatial aggregation in terms of renewable capacity deployment and location, associated transmission builds, and system costs. The results are used to ascertain the value of high geographically resolved models in terms of their impact on relative competitiveness among renewable energy resources.

  15. AAS Career Services

    Marvel, Kevin B.

    2012-08-01

    The American Astronomical Society provides substantial programs in the area of Career Services.Motivated by the Society's mission to enhance and share humanity's understanding of the Universe, the AAS provides a central resource for advertising positions, interviewing opportunities at its annual winter meeting and information, workshops and networks to enable astronomers to find employment.The programs of the Society in this area are overseen by an active committee on employment and the AAS Council itself.Additional resources that help characterize the field, its growth and facts about employment such as salaries and type of jobs available are regularly summarized and reported on by the American Institute of Physics.

  16. Selecting statistical or machine learning techniques for regional landslide susceptibility modelling by evaluating spatial prediction

    Goetz, Jason; Brenning, Alexander; Petschko, Helene; Leopold, Philip

    2015-04-01

    With so many techniques now available for landslide susceptibility modelling, it can be challenging to decide on which technique to apply. Generally speaking, the criteria for model selection should be tied closely to end users' purpose, which could be spatial prediction, spatial analysis or both. In our research, we focus on comparing the spatial predictive abilities of landslide susceptibility models. We illustrate how spatial cross-validation, a statistical approach for assessing spatial prediction performance, can be applied with the area under the receiver operating characteristic curve (AUROC) as a prediction measure for model comparison. Several machine learning and statistical techniques are evaluated for prediction in Lower Austria: support vector machine, random forest, bundling with penalized linear discriminant analysis, logistic regression, weights of evidence, and the generalized additive model. In addition to predictive performance, the importance of predictor variables in each model was estimated using spatial cross-validation by calculating the change in AUROC performance when variables are randomly permuted. The susceptibility modelling techniques were tested in three areas of interest in Lower Austria, which have unique geologic conditions associated with landslide occurrence. Overall, we found for the majority of comparisons that there were little practical or even statistically significant differences in AUROCs. That is the models' prediction performances were very similar. Therefore, in addition to prediction, the ability to interpret models for spatial analysis and the qualitative qualities of the prediction surface (map) are considered and discussed. The measure of variable importance provided some insight into the model behaviour for prediction, in particular for "black-box" models. However, there were no clear patterns in all areas of interest to why certain variables were given more importance over others.

  17. Infrared chemical imaging: Spatial resolution evaluation and super-resolution concept

    Offroy, Marc [Laboratoire de Spectrochimie Infrarouge et Raman, LASIR, CNRS UMR 8516, Bat. C5, Universite des Sciences et Technologies de Lille, 59655 Villeneuve d' Ascq Cedex (France); Roggo, Yves [F. Hoffmann-La Roche A.G., Basel (Switzerland); Milanfar, Peyman [Multi-Dimensional Signal Processing Laboratory, Electrical Engineering Department, Baskin School of Engineering, University of California, 1156 High Street, Mailcode SOE2, Santa Cruz, CA 95064 (United States); Duponchel, Ludovic, E-mail: ludovic.duponchel@univ-lille1.fr [Laboratoire de Spectrochimie Infrarouge et Raman, LASIR, CNRS UMR 8516, Bat. C5, Universite des Sciences et Technologies de Lille, 59655 Villeneuve d' Ascq Cedex (France)

    2010-08-03

    Chemical imaging systems help to solve many challenges in various scientific fields. Able to deliver rapid spatial and chemical information, modern infrared spectrometers using Focal Plane Array detectors (FPA) are of great interest. Considering conventional infrared spectrometers with a single element detector, we can consider that the diffraction-limited spatial resolution is more or less equal to the wavelength of the light (i.e. 2.5-25 {mu}m). Unfortunately, the spatial resolution of FPA spectroscopic setup is even lower due to the detector pixel size. This becomes a real constraint when micron-sized samples are analysed. New chemometrics methods are thus of great interest to overcome such resolution drawback, while keeping our far-field infrared imaging spectrometers. The aim of the present work is to evaluate the super-resolution concept in order to increase the spatial resolution of infrared imaging spectrometers using FPA detectors. The main idea of super-resolution is the fusion of several low-resolution images of the same sample to obtain a higher-resolution image. Applying the super-resolution concept on a relatively low number of FPA acquisitions, it was possible to observe a 30% decrease in spatial resolution.

  18. Infrared chemical imaging: Spatial resolution evaluation and super-resolution concept

    Chemical imaging systems help to solve many challenges in various scientific fields. Able to deliver rapid spatial and chemical information, modern infrared spectrometers using Focal Plane Array detectors (FPA) are of great interest. Considering conventional infrared spectrometers with a single element detector, we can consider that the diffraction-limited spatial resolution is more or less equal to the wavelength of the light (i.e. 2.5-25 μm). Unfortunately, the spatial resolution of FPA spectroscopic setup is even lower due to the detector pixel size. This becomes a real constraint when micron-sized samples are analysed. New chemometrics methods are thus of great interest to overcome such resolution drawback, while keeping our far-field infrared imaging spectrometers. The aim of the present work is to evaluate the super-resolution concept in order to increase the spatial resolution of infrared imaging spectrometers using FPA detectors. The main idea of super-resolution is the fusion of several low-resolution images of the same sample to obtain a higher-resolution image. Applying the super-resolution concept on a relatively low number of FPA acquisitions, it was possible to observe a 30% decrease in spatial resolution.

  19. Wavelet-based spatial comparison technique for analysing and evaluating two-dimensional geophysical model fields

    S. Saux Picart

    2011-11-01

    Full Text Available Complex numerical models of the Earth's environment, based around 3-D or 4-D time and space domains are routinely used for applications including climate predictions, weather forecasts, fishery management and environmental impact assessments. Quantitatively assessing the ability of these models to accurately reproduce geographical patterns at a range of spatial and temporal scales has always been a difficult problem to address. However, this is crucial if we are to rely on these models for decision making. Satellite data are potentially the only observational dataset able to cover the large spatial domains analysed by many types of geophysical models. Consequently optical wavelength satellite data is beginning to be used to evaluate model hindcast fields of terrestrial and marine environments. However, these satellite data invariably contain regions of occluded or missing data due to clouds, further complicating or impacting on any comparisons with the model. A methodology has recently been developed to evaluate precipitation forecasts using radar observations. It allows model skill to be evaluated at a range of spatial scales and rain intensities. Here we extend the original method to allow its generic application to a range of continuous and discontinuous geophysical data fields, and therefore allowing its use with optical satellite data. This is achieved through two major improvements to the original method: (i all thresholds are determined based on the statistical distribution of the input data, so no a priori knowledge about the model fields being analysed is required and (ii occluded data can be analysed without impacting on the metric results. The method can be used to assess a model's ability to simulate geographical patterns over a range of spatial scales. We illustrate how the method provides a compact and concise way of visualising the degree of agreement between spatial features in two datasets. The application of the new method, its

  20. Fundamental study on an evaluation method for the geological environment with spatially heterogeneous characteristics

    In order to count the spatially heterogeneous environment itself as one of components of the engineering system, the following procedures must be considered: recognition of the importance to the engineering system of evaluations of the geological environment with spatially heterogeneous characteristics; designing a strategy for the investigation in the light of the above; and development of an uncertainty analysis methodology as a quality control on the evaluation method of the spatially heterogeneous environment. Focusing on a firm scientific and technological basis for the research and development of the high-level radioactive waste geological disposal, a study of these procedure is reported in this paper. Consequently an 'uncertainty analysis methodology associated with the characterization of the geological environment' was developed for the spatially heterogeneous characteristics of a geological environment. The developed uncertainty analysis methodology adopts a new approach, where all the possible options in models and datasets that cannot be excluded in the light of evidence available, are identified. This approach enables uncertainties associated with the understanding at a given stage of the site characterization to be made explicit, based on the classification of uncertainties into variability and ignorance. The uncertainties could be reduced by screening to exclude models and data-sets that can be denied in the light of additional evidences obtained in subsequent stages. (author)

  1. AAS Oral History Project

    Buxner, Sanlyn; Holbrook, Jarita; AAS Oral History Team

    2016-06-01

    Now in its fourth year, the AAS Oral History Project has interviewed over 80 astronomers from all over the world. Led by the AAS Historical Astronomy Division (HAD) and partially funded by the American Institute of Physics Niels Bohr Library and ongoing support from the AAS, volunteers have collected oral histories from astronomers at professional meetings starting in 2015, including AAS, DPS, and the IAU general assembly. Each interview lasts one and a half to two hours and focuses on interviewees’ personal and professional lives. Questions include those about one’s family, childhood, strong influences on one’s scientific career, career path, successes and challenges, perspectives on how astronomy is changing as a field, and advice to the next generation. Each interview is audio recorded and transcribed, the content of which is checked with each interviewee. Once complete, interview transcripts are posted online as part of a larger oral history library at https://www.aip.org/history-programs/niels-bohr-library/oral-histories. Future analysis will reveal a rich story of astronomers and will help the community address issues of diversity, controversies, and the changing landscape of science. We are still recruiting individuals to be interviewed from all stages of career from undergraduate students to retired and emeritus astronomers. Contact Jarita Holbrook to schedule an interview or to find out more information about the project (astroholbrook@gmail.com). Also, contact Jarita Holbrook if you would like to become an interviewer for the project.

  2. Comparing apples with apples: Using spatially distributed time series of monitoring data for model evaluation

    Solazzo, E.; Galmarini, S.

    2015-07-01

    A more sensible use of monitoring data for the evaluation and development of regional-scale atmospheric models is proposed. The motivation stems from observing current practices in this realm where the quality of monitoring data is seldom questioned and model-to-data deviation is uniquely attributed to model deficiency. Efforts are spent to quantify the uncertainty intrinsic to the measurement process, but aspects connected to model evaluation and development have recently emerged that remain obscure, such as the spatial representativeness and the homogeneity of signals subjects of our investigation. By using time series of hourly records of ozone for a whole year (2006) collected by the European AirBase network the area of representativeness is firstly analysed showing, for similar class of stations (urban, suburban, rural), large heterogeneity and high sensitivity to the density of the network and to the noise of the signal, suggesting the mere station classification to be not a suitable candidate to help select the pool of stations used in model evaluation. Therefore a novel, more robust technique is developed based on the spatial properties of the associativity of the spectral components of the ozone time series, in an attempt to determine the level of homogeneity. The spatial structure of the associativity among stations is informative of the spatial representativeness of that specific component and automatically tells about spatial anisotropy. Time series of ozone data from North American networks have also been analysed to support the methodology. We find that the low energy components (especially the intra-day signal) suffer from a too strong influence of country-level network set-up in Europe, and different networks in North America, showing spatial heterogeneity exactly at the administrative border that separates countries in Europe and at areas separating different networks in North America. For model evaluation purposes these elements should be treated

  3. AgesGalore-A software program for evaluating spatially resolved luminescence data

    Low-light luminescence is usually recorded by photomultiplier tubes (PMTs) yielding integrated photon-number data. Highly sensitive CCD (charged coupled device) detectors allow for the spatially resolved recording of luminescence. The resulting two-dimensional images require suitable software for data processing. We present a recently developed software program specially designed for equivalent-dose evaluation in the framework of optically stimulated luminescence (OSL) dating. The software is capable of appropriate CCD data handling, parameter estimation using a Bayesian approach, and the pixel-wise fitting of functions for time and dose dependencies to the luminescence signal. The results of the fitting procedure and the equivalent-dose evaluation can be presented and analyzed both as spatial and as frequency distributions

  4. Spatial decentralization and program evaluation: Theory and an example from Indonesia

    Pitt, Mark M.; Menon, Nidhiya

    2010-01-01

    This paper proposes a novel instrumental variable method for program evaluation that only requires a single cross-section of data on the spatial intensity of programs and outcomes. The instruments are derived from a simple theoretical model of government decision-making in which governments are responsive to the attributes of places and their populations, rather than to the attributes of individuals, in making allocation decisions across space, and have a social welfare function that is spati...

  5. Multi Criteria Evaluation Module for RiskChanges Spatial Decision Support System

    Olyazadeh, Roya; Jaboyedoff, Michel; van Westen, Cees; Bakker, Wim

    2015-04-01

    Multi-Criteria Evaluation (MCE) module is one of the five modules of RiskChanges spatial decision support system. RiskChanges web-based platform aims to analyze changes in hydro-meteorological risk and provides tools for selecting the best risk reduction alternative. It is developed under CHANGES framework (changes-itn.eu) and INCREO project (increo-fp7.eu). MCE tool helps decision makers and spatial planners to evaluate, sort and rank the decision alternatives. The users can choose among different indicators that are defined within the system using Risk and Cost Benefit analysis results besides they can add their own indicators. Subsequently the system standardizes and prioritizes them. Finally, the best decision alternative is selected by using the weighted sum model (WSM). The Application of this work is to facilitate the effect of MCE for analyzing changing risk over the time under different scenarios and future years by adopting a group decision making into practice and comparing the results by numeric and graphical view within the system. We believe that this study helps decision-makers to achieve the best solution by expressing their preferences for strategies under future scenarios. Keywords: Multi-Criteria Evaluation, Spatial Decision Support System, Weighted Sum Model, Natural Hazard Risk Management

  6. A spatial assessment framework for evaluating flood risk under extreme climates.

    Chen, Yun; Liu, Rui; Barrett, Damian; Gao, Lei; Zhou, Mingwei; Renzullo, Luigi; Emelyanova, Irina

    2015-12-15

    Australian coal mines have been facing a major challenge of increasing risk of flooding caused by intensive rainfall events in recent years. In light of growing climate change concerns and the predicted escalation of flooding, estimating flood inundation risk becomes essential for understanding sustainable mine water management in the Australian mining sector. This research develops a spatial multi-criteria decision making prototype for the evaluation of flooding risk at a regional scale using the Bowen Basin and its surroundings in Queensland as a case study. Spatial gridded data, including climate, hydrology, topography, vegetation and soils, were collected and processed in ArcGIS. Several indices were derived based on time series of observations and spatial modeling taking account of extreme rainfall, evapotranspiration, stream flow, potential soil water retention, elevation and slope generated from a digital elevation model (DEM), as well as drainage density and proximity extracted from a river network. These spatial indices were weighted using the analytical hierarchy process (AHP) and integrated in an AHP-based suitability assessment (AHP-SA) model under the spatial risk evaluation framework. A regional flooding risk map was delineated to represent likely impacts of criterion indices at different risk levels, which was verified using the maximum inundation extent detectable by a time series of remote sensing imagery. The result provides baseline information to help Bowen Basin coal mines identify and assess flooding risk when making adaptation strategies and implementing mitigation measures in future. The framework and methodology developed in this research offers the Australian mining industry, and social and environmental studies around the world, an effective way to produce reliable assessment on flood risk for managing uncertainty in water availability under climate change. PMID:26318687

  7. A reference dataset for deformable image registration spatial accuracy evaluation using the COPDgene study archive

    Castillo, Richard; Castillo, Edward; Fuentes, David; Ahmad, Moiz; Wood, Abbie M.; Ludwig, Michelle S.; Guerrero, Thomas

    2013-05-01

    Landmark point-pairs provide a strategy to assess deformable image registration (DIR) accuracy in terms of the spatial registration of the underlying anatomy depicted in medical images. In this study, we propose to augment a publicly available database (www.dir-lab.com) of medical images with large sets of manually identified anatomic feature pairs between breath-hold computed tomography (BH-CT) images for DIR spatial accuracy evaluation. Ten BH-CT image pairs were randomly selected from the COPDgene study cases. Each patient had received CT imaging of the entire thorax in the supine position at one-fourth dose normal expiration and maximum effort full dose inspiration. Using dedicated in-house software, an imaging expert manually identified large sets of anatomic feature pairs between images. Estimates of inter- and intra-observer spatial variation in feature localization were determined by repeat measurements of multiple observers over subsets of randomly selected features. 7298 anatomic landmark features were manually paired between the 10 sets of images. Quantity of feature pairs per case ranged from 447 to 1172. Average 3D Euclidean landmark displacements varied substantially among cases, ranging from 12.29 (SD: 6.39) to 30.90 (SD: 14.05) mm. Repeat registration of uniformly sampled subsets of 150 landmarks for each case yielded estimates of observer localization error, which ranged in average from 0.58 (SD: 0.87) to 1.06 (SD: 2.38) mm for each case. The additions to the online web database (www.dir-lab.com) described in this work will broaden the applicability of the reference data, providing a freely available common dataset for targeted critical evaluation of DIR spatial accuracy performance in multiple clinical settings. Estimates of observer variance in feature localization suggest consistent spatial accuracy for all observers across both four-dimensional CT and COPDgene patient cohorts.

  8. Spatial resolution requirements for traffic-related air pollutant exposure evaluations

    Batterman, Stuart; Chambliss, Sarah; Isakov, Vlad

    2014-09-01

    Vehicle emissions represent one of the most important air pollution sources in most urban areas, and elevated concentrations of pollutants found near major roads have been associated with many adverse health impacts. To understand these impacts, exposure estimates should reflect the spatial and temporal patterns observed for traffic-related air pollutants. This paper evaluates the spatial resolution and zonal systems required to estimate accurately intraurban and near-road exposures of traffic-related air pollutants. The analyses use the detailed information assembled for a large (800 km2) area centered on Detroit, Michigan, USA. Concentrations of nitrogen oxides (NOx) due to vehicle emissions were estimated using hourly traffic volumes and speeds on 9700 links representing all but minor roads in the city, the MOVES2010 emission model, the RLINE dispersion model, local meteorological data, a temporal resolution of 1 h, and spatial resolution as low as 10 m. Model estimates were joined with the corresponding shape files to estimate residential exposures for 700,000 individuals at property parcel, census block, census tract, and ZIP code levels. We evaluate joining methods, the spatial resolution needed to meet specific error criteria, and the extent of exposure misclassification. To portray traffic-related air pollutant exposure, raster or inverse distance-weighted interpolations are superior to nearest neighbor approaches, and interpolations between receptors and points of interest should not exceed about 40 m near major roads, and 100 m at larger distances. For census tracts and ZIP codes, average exposures are overestimated since few individuals live very near major roads, the range of concentrations is compressed, most exposures are misclassified, and high concentrations near roads are entirely omitted. While smaller zones improve performance considerably, even block-level data can misclassify many individuals. To estimate exposures and impacts of traffic

  9. The Antiproton Accumulator (AA)

    1980-01-01

    Section 06 - 08*) of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A vacuum-tank, two bending magnets (BST06 and BST07 in blue) with a quadrupole (QDN07, in red) in between, another vacuum-tank, a wide quadrupole (QFW08) and a further tank . The tanks are covered with heating tape for bake-out. The tank left of BST06 contained the stack core pickup for stochastic cooling (see 7906193, 7906190, 8005051), the two other tanks served mainly as vacuum chambers in the region where the beam was large. Peter Zettwoch works on BST06. *) see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984)

  10. Integrated planning and spatial evaluation of megasite remediation and reuse options

    Schädler, Sebastian; Morio, Maximilian; Bartke, Stephan; Finkel, Michael

    2012-01-01

    Redevelopment of large contaminated brownfields (megasites) is often hampered by a lack of communication and harmonization among diverse stakeholders with potentially conflicting interests. Decision support is required to provide integrative yet transparent evaluation of often complex spatial information to stakeholders with different areas of expertise. It is considered crucial for successful redevelopment to identify a shared vision of how the respective contaminated site could be remediated and redeveloped. We describe a framework of assessment methods and models that analyzes and visualizes site- and land use-specific spatial information at the screening level, with the aim to support the derivation of recommendable land use layouts and to initiate further and more detailed planning. The framework integrates a GIS-based identification of areas to be remediated, an estimation of associated clean-up costs, a spatially explicit market value appraisal, and an assessment of the planned future land use's contribution to sustainable urban and regional development. Case study results show that derived options are potentially favorable in both a sustainability and an economic sense and that iterative re-planning is facilitated by the evaluation and visualization of economic, ecological and socio-economic aspects. The framework supports an efficient early judgment about whether and how abandoned land may be assigned a sustainable and marketable land use.

  11. AA, bending magnet, BLG

    1980-01-01

    The very particular lattice of the AA required 2 types of dipole (bending magnets; BLG, long and narrow; BST, short and wide). The BLG had a steel length of 4.70 m, a good field width of 0.24 m, and a weight of about 70 t. Jean-Claude Brunet inspects the lower half of a BLG. For the BST magnets see 7811105 and 8006036.

  12. The Antiproton Accumulator (AA)

    1980-01-01

    A section of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A large vacuum-tank, a quadrupole (QDN09*), a bending magnet (BST08), another vacuum-tank, a wide quadrupole (QFW08) and (in the background) a further bending magnet (BST08). The tanks are covered with heating tape for bake-out. The tank left of QDN09 contained the kickers for stochastic pre-cooling (see 790621, 8002234, 8002637X), the other one served mainly as vacuum chamber in the region where the beam was large. Peter Zettwoch works on QFW08. * see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984) See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  13. Enhancement of Spatial Resolution Using a Metamaterial Sensor in Nondestructive Evaluation

    Adriana Savin

    2015-11-01

    Full Text Available The current stage of non-destructive evaluation techniques imposes the development of new electromagnetic methods that are based on high spatial resolution and increased sensitivity. Printed circuit boards, integrated circuit boards, composite materials with polymeric matrix containing conductive fibers, as well as some types of biosensors are devices of interest in using such evaluation methods. In order to achieve high performance, the work frequencies must be either radiofrequencies or microwaves. At these frequencies, at the dielectric/conductor interface, plasmon polaritons can appear, propagating between conductive regions as evanescent waves. Detection of these waves, containing required information, can be done using sensors with metamaterial lenses. We propose in this paper the enhancement of the spatial resolution using electromagnetic methods, which can be accomplished in this case using evanescent waves that appear in the current study in slits of materials such as the spaces between carbon fibers in Carbon Fibers Reinforced Plastics or in materials of interest in the nondestructive evaluation field with industrial applications, where microscopic cracks are present. We propose herein a unique design of the metamaterials for use in nondestructive evaluation based on Conical Swiss Rolls configurations, which assure the robust concentration/focusing of the incident electromagnetic waves (practically impossible to be focused using classical materials, as well as the robust manipulation of evanescent waves. Applying this testing method, spatial resolution of approximately λ/2000 can be achieved. This testing method can be successfully applied in a variety of applications of paramount importance such as defect/damage detection in materials used in a variety of industrial applications, such as automotive and aviation technologies.

  14. Basic evaluation of sampling step angle and spatial resolution in continuous rotating acquisition with SPECT

    In the data sampling in single photon emission computed tomography (SPECT), the continuous rotating acquisition method has high clinical utility. There have been various reports about the optimum sampling step angle for continuous rotating acquisition. Objective evaluation was performed visually and by measuring spatial resolution with a column phantom to find the optimum sampling step angle for continuous rotating acquisition. In locations far from the rotation center, a large sampling step angle produced artificial images with tangential elongation. The spatial resolution was 11.58±0.19 mm full width half maximum (FWHM) as measured at a sampling step angle of 3 degrees and at 10 cm away from the rotation center. Increasing the sampling step angle to more than 3 degrees resulted in an increase of FWHM in the tangential direction. The optimum sampling step angle for continuous rotating acquisition in SPECT needs to be below that calculated from the sampling theorem. (author)

  15. Wavelet-based spatial comparison technique for analysing and evaluating two-dimensional geophysical model fields

    S. Saux Picart

    2012-02-01

    Full Text Available Complex numerical models of the Earth's environment, based around 3-D or 4-D time and space domains are routinely used for applications including climate predictions, weather forecasts, fishery management and environmental impact assessments. Quantitatively assessing the ability of these models to accurately reproduce geographical patterns at a range of spatial and temporal scales has always been a difficult problem to address. However, this is crucial if we are to rely on these models for decision making. Satellite data are potentially the only observational dataset able to cover the large spatial domains analysed by many types of geophysical models. Consequently optical wavelength satellite data is beginning to be used to evaluate model hindcast fields of terrestrial and marine environments. However, these satellite data invariably contain regions of occluded or missing data due to clouds, further complicating or impacting on any comparisons with the model. This work builds on a published methodology, that evaluates precipitation forecast using radar observations based on predefined absolute thresholds. It allows model skill to be evaluated at a range of spatial scales and rain intensities. Here we extend the original method to allow its generic application to a range of continuous and discontinuous geophysical data fields, and therefore allowing its use with optical satellite data. This is achieved through two major improvements to the original method: (i all thresholds are determined based on the statistical distribution of the input data, so no a priori knowledge about the model fields being analysed is required and (ii occluded data can be analysed without impacting on the metric results. The method can be used to assess a model's ability to simulate geographical patterns over a range of spatial scales. We illustrate how the method provides a compact and concise way of visualising the degree of agreement between spatial features in two

  16. Homogeneity evaluation of spatial electric marginal load forecasting error; Avaliacao da homogeneidade do erro de previsao espacial de carga marginal

    Arango, Hector Gustavo; Lambert-Torres, Germano; Silva, Alexandre P. Alves da [Escola Federal de Engenharia de Itajuba, MG (Brazil)]. E-mail: gustavo@iee.efei.br

    1999-07-01

    A proposal of two methods for the evaluation of the load spatial error which are coherent with two different philosophies of load spatial prediction is presented. One method takes into consideration the differences between the real and the estimated values for each sub-area. The second method analyses the error of the localization of the next load unit also named marginal load localization.

  17. Counterstatement to Article Entitled "A Framework for Evaluation of Marine Spatial Data Geoportals Using Case Studies"

    Seip Christian

    2015-12-01

    Full Text Available In December 2014 in volume 60 issue 4 a paper was published entitled “A Framework for Evaluation of Marine Spatial Data Geoportals Using Case Studies” by Marina Tavra, Vlado Cetl and Tea Duplancic Leder which is suspected to constitute academic misconduct. This comment reasons that the core of the paper was taken from another source and thus does not offer new and original scientific work and therefore does not add knowledge to the body of science. Furthermore it argues that apart from the plagiarism the paper shows major weaknesses and thus should have not been published even it was not plagiarized.

  18. Spatial Quality Evaluation of Resampled Unmanned Aerial Vehicle-Imagery for Weed Mapping

    Borra-Serrano, Irene; Peña, José Manuel; Torres-Sánchez, Jorge; Mesas-Carrascosa, Francisco Javier; López-Granados, Francisca

    2015-01-01

    Unmanned aerial vehicles (UAVs) combined with different spectral range sensors are an emerging technology for providing early weed maps for optimizing herbicide applications. Considering that weeds, at very early phenological stages, are similar spectrally and in appearance, three major components are relevant: spatial resolution, type of sensor and classification algorithm. Resampling is a technique to create a new version of an image with a different width and/or height in pixels, and it has been used in satellite imagery with different spatial and temporal resolutions. In this paper, the efficiency of resampled-images (RS-images) created from real UAV-images (UAV-images; the UAVs were equipped with two types of sensors, i.e., visible and visible plus near-infrared spectra) captured at different altitudes is examined to test the quality of the RS-image output. The performance of the object-based-image-analysis (OBIA) implemented for the early weed mapping using different weed thresholds was also evaluated. Our results showed that resampling accurately extracted the spectral values from high spatial resolution UAV-images at an altitude of 30 m and the RS-image data at altitudes of 60 and 100 m, was able to provide accurate weed cover and herbicide application maps compared with UAV-images from real flights. PMID:26274960

  19. Spatial Quality Evaluation of Resampled Unmanned Aerial Vehicle-Imagery for Weed Mapping.

    Borra-Serrano, Irene; Peña, José Manuel; Torres-Sánchez, Jorge; Mesas-Carrascosa, Francisco Javier; López-Granados, Francisca

    2015-01-01

    Unmanned aerial vehicles (UAVs) combined with different spectral range sensors are an emerging technology for providing early weed maps for optimizing herbicide applications. Considering that weeds, at very early phenological stages, are similar spectrally and in appearance, three major components are relevant: spatial resolution, type of sensor and classification algorithm. Resampling is a technique to create a new version of an image with a different width and/or height in pixels, and it has been used in satellite imagery with different spatial and temporal resolutions. In this paper, the efficiency of resampled-images (RS-images) created from real UAV-images (UAV-images; the UAVs were equipped with two types of sensors, i.e., visible and visible plus near-infrared spectra) captured at different altitudes is examined to test the quality of the RS-image output. The performance of the object-based-image-analysis (OBIA) implemented for the early weed mapping using different weed thresholds was also evaluated. Our results showed that resampling accurately extracted the spectral values from high spatial resolution UAV-images at an altitude of 30 m and the RS-image data at altitudes of 60 and 100 m, was able to provide accurate weed cover and herbicide application maps compared with UAV-images from real flights. PMID:26274960

  20. Spatial Quality Evaluation of Resampled Unmanned Aerial Vehicle-Imagery for Weed Mapping

    Irene Borra-Serrano

    2015-08-01

    Full Text Available Unmanned aerial vehicles (UAVs combined with different spectral range sensors are an emerging technology for providing early weed maps for optimizing herbicide applications. Considering that weeds, at very early phenological stages, are similar spectrally and in appearance, three major components are relevant: spatial resolution, type of sensor and classification algorithm. Resampling is a technique to create a new version of an image with a different width and/or height in pixels, and it has been used in satellite imagery with different spatial and temporal resolutions. In this paper, the efficiency of resampled-images (RS-images created from real UAV-images (UAV-images; the UAVs were equipped with two types of sensors, i.e., visible and visible plus near-infrared spectra captured at different altitudes is examined to test the quality of the RS-image output. The performance of the object-based-image-analysis (OBIA implemented for the early weed mapping using different weed thresholds was also evaluated. Our results showed that resampling accurately extracted the spectral values from high spatial resolution UAV-images at an altitude of 30 m and the RS-image data at altitudes of 60 and 100 m, was able to provide accurate weed cover and herbicide application maps compared with UAV-images from real flights.

  1. New nondestructive method based on spatial-temporal speckle correlation technique for evaluation of apples quality during shelf-life

    K. Konstankiewicz; L. Frankevych; L.I. Muravsky; A. Zdunek

    2007-01-01

    This paper presents a new spatial-temporal speckle correlation technique applied for quality evaluation of apples. Evaluations were performed using a nondestructive and noninvasive method based on the interpretation of an optical phenomenon that occurs when the fruit is illuminated with coherent light, referred as biospeckle. The temporal and spatial changes of speckle patterns created by laser light scattered in fruit have been measured through their correlation functions. The cross-correlat...

  2. From site measurements to spatial modelling - multi-criteria model evaluation

    Gottschalk, Pia; Roers, Michael; Wechsung, Frank

    2015-04-01

    Hydrological models are traditionally evaluated at gauge stations for river runoff which is assumed to be the valid and global test for model performance. One model output is assumed to reflect the performance of all implemented processes and parameters. It neglects the complex interactions of landscape processes which are actually simulated by the model but not tested. The application of a spatial hydrological model however offers a vast potential of evaluation aspects which shall be presented here with the example of the eco-hydrological model SWIM. We present current activities to evaluate SWIM at the lysimeter site Brandis, the eddy-co-variance site Gebesee and with spatial crop yields of Germany to constrain model performance additionally to river runoff. The lysimeter site is used to evaluate actuall evapotranspiration, total runoff below the soil profile and crop yields. The eddy-covariance site Gebesee offers data to study crop growth via net-ecosystem carbon exchange and actuall evapotranspiration. The performance of the vegetation module is tested via spatial crop yields at county level of Germany. Crop yields are an indirect measure of crop growth which is an important driver of the landscape water balance and therefore eventually determines river runoff as well. First results at the lysimeter site show that simulated soil water dynamics are less sensitive to soil type than measured soil water dynamics. First results from the simulation of actuall evapotranspiration and carbon exchange at Gebesee show a satisfactorily model performance with however difficulties to capture initial vegetation growth in spring. The latter is a hint at problems capturing winter growth conditions and subsequent impacts on crop growth. This is also reflected in the performance of simulated crop yields for Germany where the model reflects crop yields of silage maize much better than of winter wheat. With the given approach we would like to highlight the advantages and

  3. Evaluation and Comparision of Common Spatial Patterns (CSP and Intelligent Segmentation in P300 Detection

    Zahra Amini1

    2011-05-01

    Full Text Available In This Paper, two different feature extraction methods were studied and their performances in pattern recognition based- P300 detection were compared. These two methods were Common Spatial Pattern (CSP and intelligent segmentation. Data set II (P300 speller from the BCI competition 2005 was used. After pre-processing and feature extraction, these features were compared. For this purpose, first, a statistical analysis had been applied for evaluating the fitness of each feature in discriminating between target and non target signals. Then, each of these two groups of features was evaluated by a Linear Discriminant Analysis (LDA classifier. Furthermore by using Stepwise Linear Discriminant Analysis (SWLDA, the best set of features was selected. Finally in this research, the best result for P300 detection was 95.25% for intelligent segmentation as a feature extraction method. This result shows that intelligent segmentation is better than CSP method for P300 detection.

  4. Spatially Varying Coefficient Inequalities: Evaluating How the Impact of Patient Characteristics on Breast Cancer Survival Varies by Location

    Hsieh, Jeff Ching-Fu; Cramb, Susanna M.; McGree, James M.; Dunn, Nathan A. M.; Baade, Peter D.; Mengersen, Kerrie L.

    2016-01-01

    An increasing number of studies have identified spatial differences in breast cancer survival. However little is known about whether the structure and dynamics of this spatial inequality are consistent across a region. This study aims to evaluate the spatially varying nature of predictors of spatial inequality in relative survival for women diagnosed with breast cancer across Queensland, Australia. All Queensland women aged less than 90 years diagnosed with invasive breast cancer from 1997 to 2007 and followed up to the end of 2008 were extracted from linked Queensland Cancer Registry and BreastScreen Queensland data. Bayesian relative survival models were fitted using various model structures (a spatial regression model, a varying coefficient model and a finite mixture of regressions model) to evaluate the relative excess risk of breast cancer, with the use of Markov chain Monte Carlo computation. The spatially varying coefficient models revealed that some covariate effects may not be constant across the geographic regions of the study. The overall spatial patterns showed lower survival among women living in more remote areas, and higher survival among the urbanised south-east corner. Notwithstanding this, the spatial survival pattern for younger women contrasted with that for older women as well as single women. This complex spatial interplay may be indicative of different factors impacting on survival patterns for these women. PMID:27149274

  5. Dimensional Upgrade Approach for Spatial-Temporal Fusion of Trend Series in Subsidence Evaluation

    Shih-Jung Wang

    2015-05-01

    Full Text Available Physical models and grey system models (GSMs are commonly used to evaluate and predict physical behavior. A physical model avoids the incorrect trend series of a GSM, whereas a GSM avoids the assumptions and uncertainty of a physical model. A technique that combines the results of physical models and GSMs would make prediction more reasonable and reliable. This study proposes a fusion method for combining two trend series, calculated using two one-dimensional models, respectively, that uses a slope criterion and a distance weighting factor in the temporal and spatial domains. The independent one-dimensional evaluations are upgraded to a spatially and temporally connected two-dimensional distribution. The proposed technique was applied to a subsidence problem in Jhuoshuei River Alluvial Fan, Taiwan. The fusion results show dramatic decreases of subsidence quantity and rate compared to those estimated by the GSM. The subsidence behavior estimated using the proposed method is physically reasonable due to a convergent trend of subsidence under the assumption of constant discharge of groundwater. The technique proposed in this study can be used in fields that require a combination of two trend series from physical and nonphysical models.

  6. Spatial Data Envelopment Analysis Method for the Evaluation of Regional Infrastructure Disparities

    Birutė Galinienė

    2012-12-01

    Full Text Available Purpose—to achieve a more detailed assessment of regional differences, exploring regional infrastructure and human capital usage efficiency and to display analysis capabilities of spatial data efficient frontier method.Design/methodology/approach—the data envelopment analysis (DEA is applied to find the efficient frontier, which extends the application of production function of the regions. This method of mathematical programming optimization allows assessing the effectiveness of the regional spatial aspects presented. In recent studies this method is applied for evaluating the European Union regional policy issues.Findings—the application of DEA reveals its feasibility for regional input and output studies to evaluate more detailed and more reasonable fund allocation between Lithuanian regions. This analysis shows that in the comparatively efficient Lithuanian regions, such as Vilnius and Klaipėda, “the bottleneck” of usage of transport infrastructure and regional specific human capital is reached. It is stated that decision-making units could enhance region attractiveness for private investors by improving indirect factors in these regions. For practical significance of the study the results are compared with German regional analysis, conducted by Schaffer and other researchers (2011.Practical implications—the practical value of this work is based on giving more accurate planning tools for fund allocation decisions in Lithuanian regions while planning infrastructure and human capital development. The regional indicators were analyzed for 2010.Research type—case study.

  7. Spatial Data Envelopment Analysis Method for the Evaluation of Regional Infrastructure Disparities

    Birutė Galinienė

    2013-02-01

    Full Text Available Purpose—to achieve a more detailed assessment of regional differences, exploring regional infrastructure and human capital usage efficiency and to display analysis capabilities of spatial data efficient frontier method. Design/methodology/approach—the data envelopment analysis (DEA is applied to find the efficient frontier, which extends the application of production function of the regions. This method of mathematical programming optimization allows assessing the effectiveness of the regional spatial aspects presented. In recent studies this method is applied for evaluating the European Union regional policy issues. Findings—the application of DEA reveals its feasibility for regional input and output studies to evaluate more detailed and more reasonable fund allocation between Lithuanian regions. This analysis shows that in the comparatively efficient Lithuanian regions, such as Vilnius and Klaipėda, “the bottleneck” of usage of transport infrastructure and regional specific human capital is reached. It is stated that decision-making units could enhance region attractiveness for private investors by improving indirect factors in these regions. For practical significance of the study the results are compared with German regional analysis, conducted by Schaffer and other researchers (2011. Practical implications—the practical value of this work is based on giving more accurate planning tools for fund allocation decisions in Lithuanian regions while planning infrastructure and human capital development. The regional indicators were analyzed for 2010. Research type—case study.

  8. Evaluating the Value of High Spatial Resolution in National Capacity Expansion Models using ReEDS: Preprint

    Krishnan, Venkat; Cole, Wesley

    2016-07-01

    Power sector capacity expansion models (CEMs) have a broad range of spatial resolutions. This paper uses the Regional Energy Deployment System (ReEDS) model, a long-term national scale electric sector CEM, to evaluate the value of high spatial resolution for CEMs. ReEDS models the United States with 134 load balancing areas (BAs) and captures the variability in existing generation parameters, future technology costs, performance, and resource availability using very high spatial resolution data, especially for wind and solar modeled at 356 resource regions. In this paper we perform planning studies at three different spatial resolutions--native resolution (134 BAs), state-level, and NERC region level--and evaluate how results change under different levels of spatial aggregation in terms of renewable capacity deployment and location, associated transmission builds, and system costs. The results are used to ascertain the value of high geographically resolved models in terms of their impact on relative competitiveness among renewable energy resources.

  9. EVALUATION OF SPATIAL AND TEMPORAL DISTRIBUTION CHANGES OF LST USING LANDSAT IMAGES (CASE STUDY:TEHRAN

    H. Kachar

    2015-12-01

    Full Text Available In traditional approach, the land surface temperature (LST is estimated by the permanent or portable ground-based weather stations. Due to the lack of adequate distribution of weather stations, a uniform LST could not be achieved. Todays, With the development of remote sensing from space, satellite data offer the only possibility for measuring LST over the entire globe with sufficiently high temporal resolution and with complete spatially averaged rather than point values. the remote sensing imageries with relatively high spatial and temporal resolution are used as suitable tools to uniformly LST estimation. Time series, generated by remote sensed LST, provide a rich spatial-temporal infrastructure for heat island’s analysis. in this paper, a time series was generated by Landsat8 and Landsat7 satellite images to analysis the changes in the spatial and temporal distribution of the Tehran’s LST. In this process, The Normalized Difference Vegetation Index (NDVI threshold method was applied to extract the LST; then the changes in spatial and temporal distribution of LST over the period 1999 to 2014 were evaluated by the statistical analysis. Finally, the achieved results show the very low temperature regions and the middle temperature regions were reduced by the rate of 0.54% and 5.67% respectively. On the other hand, the high temperature and the very high temperature regions were increased by 3.68% and 0.38% respectively. These results indicate an incremental procedure on the distribution of the hot regions in Tehran in this period. To quantitatively compare urban heat islands (UHI, an index called Urban Heat Island Ratio Index(URI was calculated. It can reveal the intensity of the UHI within the urban area. The calculation of the index was based on the ratio of UHI area to urban area. The greater the index, the more intense the UHI was. Eventually, Considering URI between 1999 and 2014, an increasing about 0.03 was shown. The reasons

  10. Evaluation of Spatial and Temporal Distribution Changes of LST Using Landsat Images (case STUDY:TEHRAN)

    Kachar, H.; Vafsian, A. R.; Modiri, M.; Enayati, H.; Safdari Nezhad, A. R.

    2015-12-01

    In traditional approach, the land surface temperature (LST) is estimated by the permanent or portable ground-based weather stations. Due to the lack of adequate distribution of weather stations, a uniform LST could not be achieved. Todays, With the development of remote sensing from space, satellite data offer the only possibility for measuring LST over the entire globe with sufficiently high temporal resolution and with complete spatially averaged rather than point values. the remote sensing imageries with relatively high spatial and temporal resolution are used as suitable tools to uniformly LST estimation. Time series, generated by remote sensed LST, provide a rich spatial-temporal infrastructure for heat island's analysis. in this paper, a time series was generated by Landsat8 and Landsat7 satellite images to analysis the changes in the spatial and temporal distribution of the Tehran's LST. In this process, The Normalized Difference Vegetation Index (NDVI) threshold method was applied to extract the LST; then the changes in spatial and temporal distribution of LST over the period 1999 to 2014 were evaluated by the statistical analysis. Finally, the achieved results show the very low temperature regions and the middle temperature regions were reduced by the rate of 0.54% and 5.67% respectively. On the other hand, the high temperature and the very high temperature regions were increased by 3.68% and 0.38% respectively. These results indicate an incremental procedure on the distribution of the hot regions in Tehran in this period. To quantitatively compare urban heat islands (UHI), an index called Urban Heat Island Ratio Index(URI) was calculated. It can reveal the intensity of the UHI within the urban area. The calculation of the index was based on the ratio of UHI area to urban area. The greater the index, the more intense the UHI was. Eventually, Considering URI between 1999 and 2014, an increasing about 0.03 was shown. The reasons responsible for the changes

  11. Influence of 4,4’-azobis (4-cyanopentanoic acid in Transmission and Reflection Gratings Stored in a PVA/AA Photopolymer

    Elena Fernandez

    2016-03-01

    Full Text Available Holographic transmission gratings with a spatial frequency of 2658 lines/mm and reflection gratings with a spatial frequency of 4553 lines/mm were stored in a polyvinyl alcohol (PVA/acrylamide (AA based photopolymer. This material can reach diffraction efficiencies close to 100% for spatial frequencies about 1000 lines/mm. However, for higher spatial frequencies, the diffraction efficiency decreases considerably as the spatial frequency increases. To enhance the material response at high spatial frequencies, a chain transfer agent, the 4,4’-azobis (4-cyanopentanoic acid, ACPA, is added to the composition of the material. Different concentrations of ACPA are incorporated into the main composition of the photopolymer to find the concentration value that provides the highest diffraction efficiency. Moreover, the refractive index modulation and the optical thickness of the transmission and reflection gratings were obtained, evaluated and compared to procure more information about the influence of the ACPA on them.

  12. AAS 228: Day 1 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  13. Mapping the spatial dimensions of participatory practice: A discussion of context in evaluation.

    Chouinard, Jill Anne; Milley, Peter

    2016-02-01

    In participatory or collaborative evaluation practice, context is considered a complex, relational and social phenomenon that frames the parameters of the inquiry process in profound ways. To help us expand upon our understanding of context, we borrow the concept of "space" from the critical geographers, as it provides a bridge between the social and geographic complexities of context, enabling us to more fully capture the social and relational dynamic that fundamentally defines participatory evaluation. Our focus is on understanding context and relationships as two interconnected, dynamic and constituent parts of evaluation practices that feature participatory spaces. We then turn to a comparative analysis of participatory practice across two published reviews of distinct sets of empirical studies as a way to extend our understanding of participatory evaluation in relation to its practical, and frequently complex, contextual expressions in the field. This comparative analysis enables us to develop a set of five dimensions (epistemic, temporal/historical, cultural, economic/organizational, political) that we believe captures the spatial and contextual characteristics and contours of participatory practice. PMID:26476858

  14. AAS 227: Day 2

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  15. Cloven-hoofed animals spatial activity evaluation methods in Doupov Mountains in the Czech Republic

    J. Jarolímek, J. Masner, M. Ulman, S. Dvořák

    2012-09-01

    Full Text Available The focus of the project „Collection and interpretation of positional data“ is placed on the use of positional data (or the information about a moving object in the scientific research and educational activities in various fields such as environmental science, logistics, spatial data infrastructure, information management, and others. The objective of this effort is to create an universal model for collection and presentation of moving objects data retrieved through GPS (Global Positioning System, and to verify the model in practice.Several different approaches to process and visualize data about sika deer (Cervus nippon spatial movements in Doupov Mountains are described in the paper. The data base is represented with large data files created through the cooperation of the Faculty of Forestry and Wood Sciences at the Czech University of Life Sciences in Prague and the Military Forests and Estates of the Czech Republic, a state-owned enterprise.Pieces of knowledge introduced in this paper resulted from solution of an institutional research intention. Internal grant agency of the Faculty of Economics and Management, Czech University of Life Sciences in Prague, grant no. 20121043, „Sběr a interpretace pozičních dat“.The results of the cloven-hoofed animals spatial activity evaluation methods will be available for Research Program titled “Economy of the Czech Agriculture Resources and Their Efficient Use within the Framework of the Multifunctional Agri-food Systems” of the Czech Ministry of Education, Youth and Sports number VZ MSM 6046070906.

  16. Design and evaluation of microfluidic devices for two-dimensional spatial separations.

    Davydova, Ekaterina; Wouters, Sam; Deridder, Sander; Desmet, Gert; Eeltink, Sebastiaan; Schoenmakers, Peter J

    2016-02-19

    Various designs of chips for comprehensive two-dimensional spatial liquid chromatography were investigated. The performance of these chips was initially evaluated using computational fluid dynamics (CFD). A bifurcating distributor with an angle of 140° between branches was implemented in order to achieve a homogeneous velocity field. The cross-sectional area of the channels of the flow distributor was fixed at 0.5 × 0.5 mm, which allows a robust micromilling technique to be used for chip manufacturing. Experiments were performed with chips featuring purposely introduced imperfections in the structure of the bifurcating flow distributor to study its capacity of overcoming potential local clogging. Split peaks were observed when 75% of one of the flow channels was obstructed, in line with the CFD predictions. The main bottlenecks for the performance of the spatial two-dimensional chips were identified, viz. sample injected in the first dimension diverging into the flow distributor and channel discretization (i.e., remixing of first-dimension separation peaks because of finite number of second-dimension channels). Solutions to the former problem were studied by applying a flow resistance in the vertical segments that formed the outlets of the flow distributor and by simulating the presence of constrictions. It was found that a flow resistance of 1.0×10(11) m(-2) reduced the amount of sample diverging into the flow distributor by a factor of 10. The presence of a constriction of 90% of the segment area and 50% of the segment length decreased the diverging flow by a factor of 5. The influence of the linear velocity was significant. Solutions to the channel discretization problem were sought by investigating different designs of spatial two-dimensional chips. PMID:26810803

  17. AAS 227: Day 2

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  18. AAS 227: Day 1

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or at astrobites.com, or catch ourlive-tweeted updates from the @astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto have so many people tell us that they already know about and useastrobites, and we were excited to introduce a new cohort of students at AAS to astrobites for the first time.Tuesday morning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended today.Opening Address (by Becky Smethurst)The President of the AAS, aka our fearless leader Meg Urry kicked off the meeting this morning at the purely coffee powered hour of 8am this morning. She spoke about the importance of young astronomers at the meeting (heres looking at you reader!) and also the importance of the new Working Group for Accessibility and Disabilities (aka WGAD pronounced like wicked) at the AAS. The Society has made extra effort this year to make the conference accessible to all,a message which was very well received by everyone in attendance.Kavli Lecture: New Horizons Alan Stern (by Becky Smethurst)We were definitely spoilt with the first Plenary lecture at this years conference Alan Stern gave us a a review of the New Horizons mission of the Pluto Fly By (astrobites covered the mission back in July with this post). We were treated to beautiful images, wonderful results and a foray into geology.Before (Hubble) and after #NewHorizons. #thatisall #science #astro alanstern #aas227 pic.twitter.com/kkMt6RsSIR Science News (@topsciencething) January 5, 2016Some awesome facts from the lecture that blew my mind:New Horizons is now 2AU (!) beyond Pluto

  19. [Nutrient spatial variability of tobacco soil restoration area and fertility suitability level evaluation].

    Xu, Da-Bing; Deng, Jian-Qiang; Liu, Dong-Bi; Si, Guo-Han; Peng, Cheng-Lin; Yuan, Jia-Fu; Zhao, Shu-Jun; Wang, Rui

    2014-03-01

    By using geographic information system technology (GIS) and geostatistics methods, this paper studied the spatial variability of soil properties and available nutrients in the new regulation area units located in Qingjiangyuan modern tobacco agriculture science and technology park (Enshi, Hubei), suburb of Enshi City and the Baiyang base of Lichuan City, and further evaluation of the soil fertility suitability index (SFI) was carried out by use fuzzy mathematics. The results indicated that the effects of land restoration on the soil available phosphorus content variability and spatial distribution were very obvious, possibly due to the landform characteristics and restoration extent. The effect of land restoration on soil pH was small, however, serious soil acidification was detected in the soil sampled from Baiyang (pH < 5.5). Low SFI was found in 77.6%, 17.1% and 31.4% of the soils taken from the suburb, Baiyang and Qingjiangyuan, respectively. In conclusion, attentions should be paid on soil acidification in Baiyang, soil fertility and equalization in the suburb, and soil fertility in the region of Qingjiangyuan with low SFI. PMID:24984498

  20. Stochastic simulation for imaging spatial uncertainty: Comparison and evaluation of available algorithms

    Gotway, C.A. [Nebraska Univ., Lincoln, NE (United States). Dept. of Biometry; Rutherford, B.M. [Sandia National Labs., Albuquerque, NM (United States)

    1993-09-01

    Stochastic simulation has been suggested as a viable method for characterizing the uncertainty associated with the prediction of a nonlinear function of a spatially-varying parameter. Geostatistical simulation algorithms generate realizations of a random field with specified statistical and geostatistical properties. A nonlinear function is evaluated over each realization to obtain an uncertainty distribution of a system response that reflects the spatial variability and uncertainty in the parameter. Crucial management decisions, such as potential regulatory compliance of proposed nuclear waste facilities and optimal allocation of resources in environmental remediation, are based on the resulting system response uncertainty distribution. Many geostatistical simulation algorithms have been developed to generate the random fields, and each algorithm will produce fields with different statistical properties. These different properties will result in different distributions for system response, and potentially, different managerial decisions. The statistical properties of the resulting system response distributions are not completely understood, nor is the ability of the various algorithms to generate response distributions that adequately reflect the associated uncertainty. This paper reviews several of the algorithms available for generating random fields. Algorithms are compared in a designed experiment using seven exhaustive data sets with different statistical and geostatistical properties. For each exhaustive data set, a number of realizations are generated using each simulation algorithm. The realizations are used with each of several deterministic transfer functions to produce a cumulative uncertainty distribution function of a system response. The uncertainty distributions are then compared to the single value obtained from the corresponding exhaustive data set.

  1. Probabilistic evaluation method of stability of ground and slope considering spatial randomness of soil properties

    In the JEAG4601-1987 (Japan Electric Association Guide for earthquake resistance design), either the conventional deterministic method or probabilistic method is used for evaluating the stability of ground foundations and surrounding slopes in nuclear power plants. The deterministic method, in which the soil properties of 'mean ± coefficient x standard deviation' is adopted for the calculations, is generally used in the design stage to data. On the other hand, the probabilistic method, in which the soil properties assume to have probabilistic distributions, is stated as a future method. The deterministic method facilitates the evaluation, however, it is necessary to clarify the relation with the probabilistic method. In this paper, the relationship between the deterministic and the probabilistic methods are investigated. To do that, a simple model that can take into account the dynamic effect of structures and a simplified method for accounting the spatial randomness are proposed and used for the studies. As the results of studies, it is found that the strength of soil properties is most importation factor for the stability of ground structures and the probability below the safety factor evaluated with the soil properties of mean -1.0 x standard deviation' by the deterministic method is of much lower. (author)

  2. Visual and quantitative evaluation of selected image combination schemes in ultrasound spatial compound scanning

    Wilhjelm, Jens E.; Jensen, M.S.; Jespersen, S.K.;

    2004-01-01

    , mean-excluding-maximum (mem), root-mean-square (rms), geometric mean and maximum) on image quality (tissue delineation and artifacts), speckle signal-to-noise ratio (SNRs) and contrast. The evaluation is based on in vitro SAI (+/-21degrees in steps of Deltatheta = 7degrees) of formalin fixed porcine......Multi-angle spatial compound images are normally generated by averaging the recorded single-angle images (SAIs). To exploit possible advantages associated with alternative combination schemes, this paper investigates both the effect of number of angles (Ntheta) as well as operator (mean, median...... reflectors, provide some improvement in this regard. When combining the SAI with the mean operator, the SNRs increases-in general-with N-theta. For N-theta = 2, the SNRs increases with Deltatheta as expected. When N-theta = 7, the highest SNRs is obtained for the mem, rms, and geometric mean operators, while...

  3. Integrating neighborhoods in the evaluation of fitness promotes cooperation in the spatial prisoner's dilemma game

    Wang, Zhen; Cao, Xian-Bin; Zhang, Lian-Zhong

    2010-01-01

    A fundamental question of human society is the evolution of cooperation. Many previous studies explored this question via setting spatial background, where players obtain their payoffs by playing game with their nearest neighbors. Another undoubted fact is that environment plays an important role in the individual development. Inspired by these phenomena, we reconsider the definition of individual fitness which integrates the environment, denoted by the average payoff of all individual neighbors, with the traditional individual payoffs by introducing a selection parameter $u$. Tuning $u$ equal to zero returns the traditional version, while increasing $u$ bears the influence of environment. We find that considering the environment, i.e. integrating neighborhoods in the evaluation of fitness, promotes cooperation. If we enhance the value of $u$, the invasion of defection could be resisted better. We also provide quantitative explanations and complete phase diagrams presenting the influence of environment on the...

  4. Application of Spatial and Network Analysis to Evaluate Shelter Plan for Tsunami Evacuation

    Sutikno S.

    2015-09-01

    Full Text Available This study proposes a method for evaluating shelter plan for emergency evacuation prior to a tsunami based on service area analysis. The evacuation service areas are generated using both spatial and network analysis based on Geographic Information System (GIS. A case study in Pacitan city, East Java Province, Indonesia which is located in the South coastal area of Java Island, is picked as study area. The field has a possibility of suffering tsunami disaster because of the movement of Indo-Australian plate and Eurasian plate. The simulation result shows that the current evacuation shelters arranged by local government are not easy to access if tsunami occurs. About 50% of the residents do not have enough time to evacuate to the shelters because many shelters are located far from residential area. Utilizing public buildings around residential area for temporary shelters proposed in this study, about 96% residents in inundation area have sufficient time to evacuate to the shelters.

  5. Evaluation of spatial resolution in image acquisition by optical flatbed scanners for radiochromic film dosimetry

    Asero, G.; Greco, C.; Gueli, A. M.; Raffaele, L.; Spampinato, S.

    2016-03-01

    Introduction: Radiochromic films are two-dimensional dosimeters that do not require developing and give values of absorbed dose with accuracy and precision. Since this dosimeter colours directly after irradiation, it can be digitized with commercial optical flatbed scanners to obtain a calibration curve that links blackening of the film with dose. Although the film has an intrinsic high spatial resolution, the scanner determines the actual resolution of this dosimeter, in particular the "dot per inch" (dpi) parameter. The present study investigates the effective spatial resolution of a scanner used for Gafchromic® XR-QA2 film (designed for radiology Quality Assurance) analysis. Material and methods: The quantitative evaluation of the resolution was performed with the Modulation Transfer Function (MTF) method, comparing the nominal resolution with the experimental one. The analysis was performed with two procedures. First, the 1951 USAF resolution test chart, a tool that tests the performance of optical devices, was used. Secondly, a combined system of mammography X-ray tube, XR-QA2 film and a bar pattern object was used. In both cases the MTF method has been applied and the results were compared. Results: The USAF and the film images have been acquired with increasing dpi and a standard protocol for radiochromic analysis, to evaluate horizontal and vertical and resolution. The effective resolution corresponds to the value of the MTF at 50%. In both cases and for both procedures, it was verified that, starting from a dpi value, the effective resolution saturates. Conclusion: The study found that, for dosimetric applications, the dpi of the scanner have to be adjusted to a reasonable value because, if too high, it requires high scanning and computational time without providing additional information.

  6. Evaluating spatial patterns of dioxins in sediments to aid determination of potential implications for marine reptiles

    Hermanussen, S.; Gaus, C. [National Research Centre for Environmental Toxicology, Brisbane (Australia); Limpus, C.J. [Queensland Environmental Protection Agency, Brisbane (Australia); Paepke, O. [ERGO Forschungsgesellschaft mbH, Hamburg (Germany); Blanshard, W. [Sea World, Gold Coast (Australia); Connell, D. [School of Public Health, Griffith Univ., Brisbane (Australia)

    2004-09-15

    Recent investigations have identified elevated concentrations of polychlorinated dibenzo-p-dioxins (dioxins) in marine sediments and wildlife of Queensland, Australia. While it has been demonstrated that the contamination is widespread and predominantly land-based, limited information exists on the pathways and fate of these compounds within the near-shore marine system. This environment supports unique and threatened species including green sea turtles (Chelonia mydas). Adult green turtles are predominantly herbivorous, feeding on seagrass and algae. Apart from initial migration to feeding grounds (at {proportional_to}10 years of age) and intermittent migrations to breeding grounds (at {proportional_to}30-50 years and thereafter), green turtles remain and feed within relatively small home ranges. Long life-span (50 years or more), near-shore feeding grounds and highly specialized food requirements render green turtles potentially vulnerable to contaminant exposure. Recent studies have shown a relationship between PCDD/F concentrations found in herbivorous marine wildlife and concentrations in sediments of their habitats. Hence, the spatial evaluation of sediment PCDD/F distribution may assist the assessment of green turtle exposure and its potential implications. The present study provides baseline information on green turtle PCDD/F concentrations in Queensland, Australia and investigates exposure pathways. In addition, spatial distribution of PCDD/Fs in sediments from known green turtle feeding regions is assessed using geographic information systems. This represents the first stage of a large scale investigation into the exposure and sensitivity of marine reptiles to dioxins and dioxin-like compounds and to evaluate whether poor health status observed in some populations may be related to contaminant exposure.

  7. Evaluation of spatial resolution in image acquisition by optical flatbed scanners for radiochromic film dosimetry

    Introduction: Radiochromic films are two-dimensional dosimeters that do not require developing and give values of absorbed dose with accuracy and precision. Since this dosimeter colours directly after irradiation, it can be digitized with commercial optical flatbed scanners to obtain a calibration curve that links blackening of the film with dose. Although the film has an intrinsic high spatial resolution, the scanner determines the actual resolution of this dosimeter, in particular the 'dot per inch' (dpi) parameter. The present study investigates the effective spatial resolution of a scanner used for Gafchromic® XR-QA2 film (designed for radiology Quality Assurance) analysis. Material and methods: The quantitative evaluation of the resolution was performed with the Modulation Transfer Function (MTF) method, comparing the nominal resolution with the experimental one. The analysis was performed with two procedures. First, the 1951 USAF resolution test chart, a tool that tests the performance of optical devices, was used. Secondly, a combined system of mammography X-ray tube, XR-QA2 film and a bar pattern object was used. In both cases the MTF method has been applied and the results were compared. Results: The USAF and the film images have been acquired with increasing dpi and a standard protocol for radiochromic analysis, to evaluate horizontal and vertical and resolution. The effective resolution corresponds to the value of the MTF at 50%. In both cases and for both procedures, it was verified that, starting from a dpi value, the effective resolution saturates. Conclusion: The study found that, for dosimetric applications, the dpi of the scanner have to be adjusted to a reasonable value because, if too high, it requires high scanning and computational time without providing additional information

  8. AAS 228: Day 4

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  9. A Framework for Evaluation of Marine Spatial Data Geoportals Using Case Studies

    Tavra Marina; Cetl Vlado; Duplančić Leder Tea

    2014-01-01

    Need for a Marine Spatial Data Infrastructure (MSDI) as a component of a National Spatial Data Infrastructure (NSDI) is widely recognized. An MSDI is relevant not only for hydrographers and government planners, but also for many other sectors which takes interest in marine spatial data, whether they are data users, data providers, or data managers [9]. An MSDI encompasses marine and coastal geographic and business information. For efficient use of Marine Spatial Data, it is necessary to ensur...

  10. Spatial Analysis of Pollution-free Land for Tea Plantation and Comprehensive Evaluation of Soil Suitability

    Ximei; WEN; Yang; LU; Anjun; LAN; Hong; TAN

    2013-01-01

    To survey the tea resource advantages in Guizhou’s mountainous areas and complete rational layout of pollution-free tea planting areas, we take the case of Guiding County in Guizhou Province to establish the comprehensive evaluation indicator system of pollution-free land for tea plantation and comprehensive evaluation model of soil suitability of land for tea plantation according to the Environmental Conditions Standard for Pollution-free Food-Tea Producing Areas by the Ministry of Agriculture (NY 5020-2001), using land use data, remote sensing data, soil data, temperature, precipitation, light, DEM and other critical basic data, combined with the spatial analysis statistical method. The results show that the area of land suitable for planting tea is 1265 km2, accounting for 77.57% of the entire study area; the area of land with soil quality, climatic conditions and terrain conditions to meet the planting standard of pollution-free tea is 1232.51 km2, accounting for 75.57% of the total land area; the area of land most suitable for the planting of pollution-free tea is 128.71 km2, accounting for 7.89% of the total land area. The above studies can provide scientific basis and decision support for the implementation of tea planting industry standards in the specific areas, and provide reference for the comprehensive assessment of tea planting in other areas.

  11. Evaluation of a commercially-available block for spatially fractionated radiation therapy.

    Buckey, Courtney; Stathakis, Sotirios; Cashon, Ken; Gutierrez, Alonso; Esquivel, Carlos; Shi, Chengyu; Papanikolaou, Nikos

    2010-01-01

    In this paper, we present the dosimetric characteristics of a commercially-produced universal GRID block for spatially fractioned radiation therapy. The dosimetric properties of the GRID block were evaluated. Ionization chamber and film measurements using both Kodak EDR2 and Gafchromic EBT film were performed in a solid water phantom to determine the relative output of the GRID block as well as its spatial dosimetric characteristics. The surface dose under the block and at the openings was measured using ultra thin TLDs. After introducing the GRID block into the treatment planning system, a treatment plan was created using the GRID block and also by creating a GRID pattern using the multi-leaf collimator. The percent depth doses measured with film showed that there is a shift of the dmax towards shallower depths for both energies (6 MV and 18 MV) under investigation. It was observed that the skin dose at the GRID openings was higher than the corresponding open field by a factor as high as 50% for both photon energies. The profiles showed the transmission under the block was in the order of 15-20% for 6 MV and 30% for 18 MV. The MUs calculated for a real patient using the block were about 80% less than the corresponding MUs for the same plan using the multileaf collimator to define the GRID. Based on this investigation, this brass GRID compensator is a viable alternative to other solid compensators or MLC-based fields currently in use. Its ease of creation and use give it decided advantages. Its ability to be created once and used for multiple patients (by varying the collimation of the linear accelerator jaws) makes it attractive from a cost perspective. We believe this compensator can be put to clinical use, and will allow more centers to offer GRID therapy to their patients. PMID:20717082

  12. The Drentsche Aa valley system

    This thesis is composed of five papers concerned with Late Quaternary geology and geomorphology of the Aa valley system. The correlation and chronostratigraphic position of the layers have been established by radiocarbon dating. (Auth.)

  13. AAS 227: Day 4

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  14. AAS 228: Day 4

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  15. Development of a high spatial resolution neutron imaging system and performance evaluation

    Cao, Lei

    The combination of a scintillation screen and a charged coupled device (CCD) camera is a digitized neutron imaging technology that has been widely employed for research and industry application. The maximum of spatial resolution of scintillation screens is in the range of 100 mum and creates a bottleneck for the further improvement of the overall system resolution. In this investigation, a neutron sensitive micro-channel plate (MCP) detector with pore pitch of 11.4 mum is combined with a cooled CCD camera with a pixel size of 6.8 mum to provide a high spatial resolution neutron imaging system. The optical path includes a high reflection front surface mirror for keeping the camera out of neutron beam and a macro lens for achieving the maximum magnification that could be achieved. All components are assembled into an aluminum light tight box with heavy radiation shielding to protect the camera as well as to provide a dark working condition. Particularly, a remote controlled stepper motor is also integrated into the system to provide on-line focusing ability. The best focus is guaranteed through use of an algorithm instead of perceptual observation. An evaluation routine not previously utilized in the field of neutron radiography is developed in this study. Routines like this were never previously required due to the lower resolution of other systems. Use of the augulation technique to obtain presampled MTF addresses the problem of aliasing associated with digital sampling. The determined MTF agrees well with the visual inspection of imaging a testing target. Other detector/camera combinations may be integrated into the system and their performances are also compared. The best resolution achieved by the system at the TRIGA Mark II reactor at the University of Texas at Austin is 16.2 lp/mm, which is equivalent to a minimum resolvable spacing of 30 mum. The noise performance of the device is evaluated in terms of the noise power spectrum (NPS) and the detective quantum

  16. Spatial variability of maximum and minimum monthly temperature in Spain during 1981-2010 evaluated by correlation decay distance (CDD)

    Pena-Angulo, D.; Cortesi, N.; Brunetti, M.; González-Hidalgo, J. C.

    2015-10-01

    The spatial variability of monthly diurnal and nocturnal mean values of temperature in Spain has been analysed to evaluate the optimal threshold distance between neighbouring stations that make a meteorological network (in terms of stations' density) well representative of the conterminous land of Spain. To this end, the correlation decay distance has been calculated using the highest quality monthly available temperature series (1981-2010) from AEMet (National Spanish Meteorological Agency). In the conterminous land of Spain, the distance at which couples of stations have a common variance above the selected threshold (50 %, r Pearson ˜0.70) for both maximum and minimum temperature on average does not exceed 400 km, with relevant spatial and temporal differences, and in extended areas of Spain, this value is lower than 200 km. The spatial variability for minimum temperature is higher than for maximum, except in cold months when the reverse is true. Spatially, highest values are located in both diurnal and nocturnal temperatures to the southeastern coastland and lower spatial variability is found to the inland areas, and thus the spatial variability shows a clear coastland-to-inland gradient at annual and monthly scale. Monthly analyses show that the highest spatial variability in maximum and minimum temperatures occur in July and August, when radiation is maximum, and in lowland areas, (correlation values highly variable in Spanish land, an average of threshold distance of about 200 km as a limit value for a well representative network should be recommended for climate analyses,.

  17. Comparison of recrystallization and recrystallization textures in cold-rolled DC and CC AA 5182 aluminum alloys

    The recrystallization and recrystallization textures in cold-rolled direct chill cast (DC) and continuous cast (CC) AA 5182 aluminum alloys were investigated. The recrystallization behavior of cold-rolled DC and CC AA 5182 aluminum alloys was evaluated by tensile properties. The evolution of recrystallization textures in cold-rolled DC and CC AA 5182 aluminum alloys was determined by X-ray diffraction. The results showed that the recrystallization temperature of cold-rolled DC AA 5182 aluminum alloy was somewhat lower than that of cold-rolled CC AA 5182 aluminum alloy. The resulting recrystallization textures of cold-rolled AA 5182 aluminum alloy were characterized by the strong R orientation and the cube orientation with strong scattering about the rolling direction towards the Goss orientation. CC AA 5182 aluminum alloy showed slightly weaker recrystallization textures than DC AA 5182 aluminum alloy

  18. Evaluation of spatial resolution on fast spin-echo images. Effect of echo train length and interecho spacing

    Fast spin echo (FSE) imaging technique has been indispensable in clinical MRI. This technique reduces acquisition time compared with conventional spin echo sequences. However, this technique introduces new factors, such as echo train length (ETL) and interecho spacing and is susceptible to a new set of artifacts, such as image blurring secondary to nonuniform sampling of K-space. Therefore, the effects of spatial resolution of FSE images on echo train length and interecho spacing were measured using the final MTF. FSE images of the chart phantom with some ETLs and bandwidth were exposed on laser films and measured by micro-densitometer in the phase-encoding direction. Using the final MTF method, the FSE images were evaluated for spatial resolution. Increasing ETL reduced spatial resolution on FSE images. The proton-density-weighted images were more conspicuous. Decreasing the bandwidth reduced spatial resolution on FSE images because of increasing interecho spacing. (author)

  19. GIS-based evaluation and spatial distribution characteristics of land degradation in Bijiang watershed.

    Zhao, Xiaoqing; Dai, Jinhua; Wang, Jianping

    2013-01-01

    Land degradation is one of the significant issues the human beings are confronted with, which has become a bottleneck of restricting the sustainable development of the regional society and economy. In order to ascertain the root causes contributed to the land degradation and characteristics of land degradation, Bijiang watershed, the most important Lead-Zinc mine area of Lanping county of Yunnan Province, was selected as the study area. One evaluation index system for land degradation that consists of 5 single factors(water-soil erosion intensity, geological disaster risk, cultivation intensity of arable land, pollution of heavy metals in soil and biodiversity deterioration) was established and 13 indicators were chosen, and the entropy method was adopted to assign weights to each single factor. By using the tools of Geographic Information System (GIS), the land degradation degree was evaluated and one spatial distribution map for land degradation was accomplished. In this study, the land of the whole watershed was divided into 4 types, including extremely-severe degradation area, severely-degraded area, moderately-degraded area and slightly-degraded area, and some solutions for ecological restoration and rehabilitation were also put forward in this study. The study results indicated that: (1) Water-soil erosion intension and pollution of heavy metals in soil have made greater contribution to the comprehensive land degradation in Bijiang watershed; (2) There is an apparent difference regarding land degradation degree in Bijiang watershed. The moderately-degraded area accounts for the most part in the region, which covers 79.66% of the whole watershed. The severely-degraded area accounts for 15.98% and the slightly-degraded regions and extremely severe degradation area accounts for 1.08% and 3.28% respectively; (3) There is an evident regularity of spatial distribution in land degradation in Bijiang watershed. The moderately-degraded areas mainly distribute in the

  20. Use of detrended correspondence analysis to evaluate factors controlling spatial distribution of benthic insects

    Leland, H.V.; Carter, J.L.; Fend, S.V.

    1986-01-01

    Detrended correspondence analysis (DCA) was evaluated for its effectiveness in displaying factors controlling the spatial distribution of benthic insects in an oligotrophic stream where an experimental gradient (copper) that selectively affects population abundances was imposed. DCA proved to be highly sensitive to differences among samples and consistently provided ecologically meaningful species ordinations. Seasonality of taxa was the major gradient displayed by DCA prior to copper exposure when data for all sampling dates were included. Sensitivity of taxa to copper was a more important factor affecting community structure than was seasonality during periods of continuous exposure to copper (2.5 to 15 ??g l-1 CuT; approximately 12 to 75 ng l-1 Cu2+. When pre-dose data for each sampling date were ordinated independently, substratum composition and biological interactions were the major gradients displayed in species ordinations. During periods of exposure, sensitivity of taxa to copper was the primary gradient. This gradient also reflected a generally greater sensitivity to copper of herbivorous than of detritivorous or predatory benthic insects. DCA revealed the persistence, eleven months after dosing ceased, of differences in community structure between the control and high treatment (5 and 10 ??g l-1 CuT) sections. Differences between sections were not evident on this sampling date from total biomass or total density (numerical) estimates. ?? 1986 Dr W. Junk Publishers.

  1. An Improved Fitness Evaluation Mechanism with Memory in Spatial Prisoner's Dilemma Game on Regular Lattices

    WANG Juan; LIU Li-Na; DONG En-Zeng; WANG Li

    2013-01-01

    To deeply understand the emergence of cooperation in natural,social and economical systems,we present an improved fitness evaluation mechanism with memory in spatial prisoner's dilemma game on regular lattices.In our model,the individual fitness is not only determined by the payoff in the current game round,but also by the payoffs in previous round bins.A tunable parameter,termed as the memory strength (μ),which lies between 0 and 1,is introduced into the model to regulate the ratio of payoffs of current and previous game rounds in the individual fitness calculation.When μ =0,our model is reduced to the standard prisoner's dilemma game; while μ =1 represents the case in which the payoff is totally determined by the initial strategies and thus it is far from the realistic ones.Extensive numerical simulations indicate that the memory effect can substantially promote the evolution of cooperation.For μ < 1,the stronger the memory effect,the higher the cooperation level,but μ = 1 leads to a pathological state of cooperation,but can partially enhance the cooperation in the very large temptation parameter.The current results are of great significance for us to account for the role of memory effect during the evolution of cooperation among selfish players.

  2. Evaluation des politiques de transports et équité spatiale

    Bonnafous, Alain; Masson, Sophie

    2003-01-01

    JEL classification: D61, D63, R40, R53 International audience Assessment of transport policy and spatial equity. - The set up of a transport system in a place generates inequalities in accessibility at the local, national or international level. This raises the problem of the unequal access to transport and local public goods, hereafter designated as the spatial inequity. In the assessment of transport policies, dealing with spatial equity leads to several problems mainly because of the...

  3. AAS 227: Day 4

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  4. Climate-physiographically differentiated Pan-European landslide susceptibility assessment using spatial multi-criteria evaluation and transnational landslide information

    Gunther, Andreas; Van Den Eeckhaut, Miet; Malet, Jean-Philippe; Reichenbach, Paola; HERVAS JAVIER

    2014-01-01

    With the adoption of the EU Thematic Strategy for Soil Protection in 2006, small-scale (1:1 M) assessments of threats affecting soils over Europe received increasing attention. As landslides have been recognized as one of eight threats requiring a Pan-European evaluation,we present an approach for landslide susceptibility evaluation at the continental scale over Europe. Unlike previous continental and global scale landslide susceptibility studies not utilizing spatial information on the event...

  5. Monitoring and evaluation of spatially managed areas: A generic framework for implementation of ecosystem based marine management and its application

    Stelzenmüller, Vanessa; Breen, Patricia; Stamford, Tammy;

    2013-01-01

    This study introduces a framework for the monitoring and evaluation of spatially managed areas (SMAs), which is currently being tested by nine European case studies. The framework provides guidance on the selection, mapping, and assessment of ecosystem components and human pressures, the evaluation...... challenges, such as the lack of operational objectives within SMAs, particularly for transnational cases, data access, and stakeholder involvement. Furthermore, the emerging challenges of integrating the framework assessment using scientific information with a structured governance research analysis based...

  6. Spatial Evaluation of Heavy Metals Concentrations in the Surface Sediment of Taihu Lake

    Yong Niu

    2015-11-01

    Full Text Available With regard to the size of China’s freshwater lakes, Taihu Lake ranks third and it plays an important role in the supply of drinking water, flood prevention, farming and navigation, as well as in the travelling industry. The problem of environmental pollution has attracted widespread attention in recent years. In order to understand the levels, distribution and sources of heavy metals in sediments of Taihu Lake, random selection was carried out to obtain 59 samples of surface sediment from the entire lake and study the concentrations of Pb, Cd, Cu, Zn, Cr and Ni. Toxic units were also calculated to normalize the toxicities caused by various heavy metals. As a result, Cd and Cu in sediment were considered lower than the effect range low (ERL at all regions where samples were gathered, while Pb and Ni were categorized into ERL-effect range median (ERM at over 22% of the regions where samples were obtained. Nevertheless, all average concentrations of the samples were below the level of potential effect. According to the findings of this research, significant spatial heterogeneity existed in the above heavy metals. In conclusion, the distribution areas of heavy metals with higher concentrations were mainly the north bays, namely Zhushan Bay, Meiliang Bay as well as Gonghu Bay. The distribution areas of Cu, Zn, Cr and Ni with higher concentration also included the lake’s central region, whereas the uniform distribution areas of those with lower concentrations were the lake’s southeast region. In addition, it was most probable that the spatial distribution of heavy metals was determined by river inputs, whereas atmospheric precipitation caused by urban and traffic contamination also exerted considerable effects on the higher concentrations of Pb and Cd. Through evaluating the total amount of toxic units (ΣTU, it was found that higher toxicity existed primarily in the north bays and central region of the lake. If the heavy metals were sorted by

  7. Spatial Evaluation of Heavy Metals Concentrations in the Surface Sediment of Taihu Lake.

    Niu, Yong; Jiao, Wei; Yu, Hui; Niu, Yuan; Pang, Yong; Xu, Xiangyang; Guo, Xiaochun

    2015-12-01

    With regard to the size of China's freshwater lakes, Taihu Lake ranks third and it plays an important role in the supply of drinking water, flood prevention, farming and navigation, as well as in the travelling industry. The problem of environmental pollution has attracted widespread attention in recent years. In order to understand the levels, distribution and sources of heavy metals in sediments of Taihu Lake, random selection was carried out to obtain 59 samples of surface sediment from the entire lake and study the concentrations of Pb, Cd, Cu, Zn, Cr and Ni. Toxic units were also calculated to normalize the toxicities caused by various heavy metals. As a result, Cd and Cu in sediment were considered lower than the effect range low (ERL) at all regions where samples were gathered, while Pb and Ni were categorized into ERL-effect range median (ERM) at over 22% of the regions where samples were obtained. Nevertheless, all average concentrations of the samples were below the level of potential effect. According to the findings of this research, significant spatial heterogeneity existed in the above heavy metals. In conclusion, the distribution areas of heavy metals with higher concentrations were mainly the north bays, namely Zhushan Bay, Meiliang Bay as well as Gonghu Bay. The distribution areas of Cu, Zn, Cr and Ni with higher concentration also included the lake's central region, whereas the uniform distribution areas of those with lower concentrations were the lake's southeast region. In addition, it was most probable that the spatial distribution of heavy metals was determined by river inputs, whereas atmospheric precipitation caused by urban and traffic contamination also exerted considerable effects on the higher concentrations of Pb and Cd. Through evaluating the total amount of toxic units (ΣTU), it was found that higher toxicity existed primarily in the north bays and central region of the lake. If the heavy metals were sorted by the reduction of mean

  8. Evaluation of spatial variability of metal bioavailability in soils using geostatistics

    Owsianiak, Mikolaj; Hauschild, Michael Zwicky; Rosenbaum, Ralph K.

    2012-01-01

    performed using ArcGIS Geostatistical Analyst. Results show that BFs of copper span a range of 6 orders of magnitude, and have signifficant spatial variability at local and continental scales. The model nugget variance is signifficantly higher than zero, suggesting the presence of spatial variability at...

  9. Evaluation of corrosion of steel embedded in concrete exposed to carbonation AAS using a factorial experiment with repeated measures. Evaluación de la corrosión del acero embebido en concreto AAS, expuesto a carbonatación mediante un experimento factorial con medidas repetidas.

    W Aperador Chaparro

    2013-03-01

    Full Text Available This article presents various techniques for assessing corrosion, the linear polarization resistance and galvanostatic pulse, the analysis was performed using analysis of variance models using a factorial experiment with three factors, one repeated measure, because on the same experimental unit (reinforced concrete, it experienced several samples to be measured in time (0 h=1, 350 h=2, 700 h=3, 1050 h=4, 1700 h=5 y 2600 h=6. This makes the observations are not independent, the other two factors relate to, the binder (ce: 1 = activatedslag [AAS] and 2 = ordinary Portland concrete [OPC] and the exposure condition (ca: 1 = y 2 = environmental exposure accelerated carbonation. These factors were discussed according to the results of the electrochemical properties. Initially performed the statistical processing of each of the variables in relation to the properties and analyzed the interaction between them. Where they established the differences in materials used as coating steel, concrete, OPC and AAS. OPC concrete specimens, exhibited a resting potential, polarization resistance and ohmic (CO2 condition than those obtained for reinforced concrete in AAS.En este artículo se presentan las técnicas de evaluación de la corrosión, tales como potencial de corrosión, resistencia lineal a la polarización y pulso galvanostático a los concretos de activación alcalina (AAS y Portland tipo I (OPC. El estudio se realizó por medio de modelos de análisis de varianza, aplicando un experimento factorial con tres factores, uno de ellos medida repetida, debido a que sobre la misma unidad experimental (concreto armado AAS y OPC se ensayaron varias muestras para medirlas en el tiempo (0 h=1, 350 h=2, 700 h=3, 1050 h=4, 1700 h=5 y 2600 h=6, lo que hace que las observaciones no sean independientes; los otros dos factores corresponden al cementante (ce: 1=escoria activada alcalinamente [AAS] y 2=concreto Portland ordinario [OPC] y la condición de exposici

  10. Evaluation of a spatially resolved forest fire smoke model for population-based epidemiologic exposure assessment.

    Yao, Jiayun; Eyamie, Jeff; Henderson, Sarah B

    2016-05-01

    Exposure to forest fire smoke (FFS) is associated with multiple adverse health effects, mostly respiratory. Findings for cardiovascular effects have been inconsistent, possibly related to the limitations of conventional methods to assess FFS exposure. In previous work, we developed an empirical model to estimate smoke-related fine particulate matter (PM2.5) for all populated areas in British Columbia (BC), Canada. Here, we evaluate the utility of our model by comparing epidemiologic associations between modeled and measured PM2.5. For each local health area (LHA), we used Poisson regression to estimate the effects of PM2.5 estimates and measurements on counts of medication dispensations and outpatient physician visits. We then used meta-regression to estimate the overall effects. A 10 μg/m(3) increase in modeled PM2.5 was associated with increased sabutamol dispensations (RR=1.04, 95% CI 1.03-1.06), and physician visits for asthma (1.06, 1.04-1.08), COPD (1.02, 1.00-1.03), lower respiratory infections (1.03, 1.00-1.05), and otitis media (1.05, 1.03-1.07), all comparable to measured PM2.5. Effects on cardiovascular outcomes were only significant using model estimates in all LHAs during extreme fire days. This suggests that the exposure model is a promising tool for increasing the power of epidemiologic studies to detect the health effects of FFS via improved spatial coverage and resolution. PMID:25294305

  11. Evaluating the spatial and temporal solar energy potential in South Korea

    Oh, Si-Young; Park, Jin-Ki; Park, Jong-Hwa

    2012-11-01

    Recent issues of climate changes and natural disasters have brought many changes in world energy utilization. Especially due to the Japan's earthquake and tsunami, potential of nuclear power have made negative. And thus many countries are looking for a new renewable energy that can replace. Of which solar energy has emerged as a useful alternative. Under these circumstances, it is highly desirable that detailed information about the availability of solar radiation on the surface is essential for the optimum design and study of solar energy systems. And its components at a given location are very essential. Hence the solar radiation data is one of the key parameters required to be monitored at any meteorological station. But solar radiation measurements are not easily available due to the cost and maintenance requirements of the measuring equipment. Therefore, solar resource modeling or mapping is one of the essential tools for proper design, planning, maintenance and pricing of solar energy system. In this study, the feasibility of a regression model using image fusion for the prediction of solar energy potential in Republic of Korea was investigated. Meteorological and geographical data of 22 cities in South Korea for period of 10 years (2001-2011) were used. Meteorological and geographical data (latitude, longitude, altitude, month, sunshine duration, temperature, and relative humidity) were used as inputs to the model, while the regional solar radiation was used as the output of the model. The model for evaluating the spatial and temporal solar radiation was executed for South Korea. The annual mean solar radiation estimates in South Korea vary from a minimum of 5.48 MJ/m2/day to a maximum of 19.51 MJ/m2/day. Our proposed annual mean solar radiation is 13.5 MJ/m2/day. These compare favorably with the observed data as expected. This study has shown that a simple method can accurately predict solar radiation potential in South Korea.

  12. New nondestructive method based on spatial-temporal speckle correlation technique for evaluation of apples quality during shelf-life

    K. Konstankiewicz

    2007-09-01

    Full Text Available This paper presents a new spatial-temporal speckle correlation technique applied for quality evaluation of apples. Evaluations were performed using a nondestructive and noninvasive method based on the interpretation of an optical phenomenon that occurs when the fruit is illuminated with coherent light, referred as biospeckle. The temporal and spatial changes of speckle patterns created by laser light scattered in fruit have been measured through their correlation functions. The cross-correlation coefficient of biospeckle patterns decrease or increase in fruits with different speeds subject to conditions of their freshness, moisture and preservation. Significant exponential changes of the cross-correlation coefficient value difference Ct=15 were observed during apple shelf life. This shows that the method can be utilized for quality evaluation of apples.

  13. Evaluation of Fuzzy-Logic Framework for Spatial Statistics Preserving Methods for Estimation of Missing Precipitation Data

    El Sharif, H.; Teegavarapu, R. S.

    2012-12-01

    Spatial interpolation methods used for estimation of missing precipitation data at a site seldom check for their ability to preserve site and regional statistics. Such statistics are primarily defined by spatial correlations and other site-to-site statistics in a region. Preservation of site and regional statistics represents a means of assessing the validity of missing precipitation estimates at a site. This study evaluates the efficacy of a fuzzy-logic methodology for infilling missing historical daily precipitation data in preserving site and regional statistics. Rain gauge sites in the state of Kentucky, USA, are used as a case study for evaluation of this newly proposed method in comparison to traditional data infilling techniques. Several error and performance measures will be used to evaluate the methods and trade-offs in accuracy of estimation and preservation of site and regional statistics.

  14. Evaluating agri-environmental schemes using a spatially explicit agent-based modelling approach

    Schouten, M.A.H.; Polman, N.B.P.; Westerhof, E.J.G.M.; Opdam, P.F.M.

    2012-01-01

    Networks of nature reserves are being proposed as a solution when the degree of fragmentation is considered to endanger the long-term persistence of species diversity. Agri-environmental schemes are supposed to make a positive contribution to these networks. The spatially explicit agent-based model presented in this chapter combines spatial dynamics in land ownership, land use and the importance of agri-environmental schemes in conserving biodiversity by capturing the heterogeneity of individ...

  15. Energy Efficiency Evaluation of Cellular Networks Based on Spatial Distributions of Traffic Load and Power Consumption

    Xiang, Lin; Ge, Xiaohu; Wang, Cheng-Xiang; Li, Frank Y.; Reichert, Frank

    2014-01-01

    Energy efficiency has gained its significance when service providers' operational costs burden with the rapidly growing data traffic demand in cellular networks. In this paper, we propose an energy efficiency model for Poisson-Voronoi tessellation (PVT) cellular networks considering spatial distributions of traffic load and power consumption. The spatial distributions of traffic load and power consumption are derived for a typical PVT cell, and can be directly extended to the whole PVT cellul...

  16. Electrochemical techniques for practical evaluation of corrosion inhibitor effectiveness. Performance of cerium nitrate as corrosion inhibitor for AA2024T3 alloy

    In this work, a split-cell technique and image-assisted electrochemical noise analysis, which provide minimal perturbation of the freely corroding system and good time resolution, are proposed as a tool for simultaneous investigation of the corrosion inhibition mechanism and assessment of performance. The results obtained are compared with results from traditional electrochemical impedance spectroscopy, disclosing the advantages of these techniques in the evaluation of inhibitor performance. Specific attention is also given to the investigation of corrosion inhibition by cerium nitrate.

  17. Ensembles of adaptive spatial filters increase BCI performance: an online evaluation

    Sannelli, Claudia; Vidaurre, Carmen; Müller, Klaus-Robert; Blankertz, Benjamin

    2016-08-01

    Objective: In electroencephalographic (EEG) data, signals from distinct sources within the brain are widely spread by volume conduction and superimposed such that sensors receive mixtures of a multitude of signals. This reduction of spatial information strongly hampers single-trial analysis of EEG data as, for example, required for brain–computer interfacing (BCI) when using features from spontaneous brain rhythms. Spatial filtering techniques are therefore greatly needed to extract meaningful information from EEG. Our goal is to show, in online operation, that common spatial pattern patches (CSPP) are valuable to counteract this problem. Approach: Even though the effect of spatial mixing can be encountered by spatial filters, there is a trade-off between performance and the requirement of calibration data. Laplacian derivations do not require calibration data at all, but their performance for single-trial classification is limited. Conversely, data-driven spatial filters, such as common spatial patterns (CSP), can lead to highly distinctive features; however they require a considerable amount of training data. Recently, we showed in an offline analysis that CSPP can establish a valuable compromise. In this paper, we confirm these results in an online BCI study. In order to demonstrate the paramount feature that CSPP requires little training data, we used them in an adaptive setting with 20 participants and focused on users who did not have success with previous BCI approaches. Main results: The results of the study show that CSPP adapts faster and thereby allows users to achieve better feedback within a shorter time than previous approaches performed with Laplacian derivations and CSP filters. The success of the experiment highlights that CSPP has the potential to further reduce BCI inefficiency. Significance: CSPP are a valuable compromise between CSP and Laplacian filters. They allow users to attain better feedback within a shorter time and thus reduce BCI

  18. Empirical evaluation of confidence and prediction intervals for spatial models of forest structure in Jalisco, Mexico

    Robin M. Reich; C. Aguirre-Bravo; Vanessa A. Bravo; Martin Mendoza Brise(n)o

    2011-01-01

    In recent years there has been an increasing interest in developing spatial statistical models for data sets that are seemingly spatially independent.This lack of spatial structure makes it difficult, if not impossible to use optimal predictors such as ordinary kriging for modeling the spatial variability in the data.In many instances, the data still contain a wealth of information that could be used to gain flexibility and precision in estimation.In this paper we propose using a combination of regression analysis to describe the large-scale spatial variability in a set of survey data and a tree-based stratification design to enhance the estimation process of the small-scale spatial variability.With this approach,sample units (i.e., pixel of a satellite image) are classified with respect to predictions of error attributes into homogeneous classes, and the classes are then used as strata in the stratified analysis.Independent variables used as a basis of stratification included terrain data and satellite imagery.A decision rule was used to identify a tree size that minimized the error in estimating the variance of the mean response and prediction uncertainties at new spatial locations.This approach was applied to a set of n=937 forested plots from a state-wide inventory conducted in 2006 in the Mexican State of Jalisco.The final models accounted for 62% to 82% of the variability observed in canopy closure (%), basal area (m2·ha-l), cubic volumes (m3·ha-1) and biomass (t·ha-1) on the sample plots.The spatial models provided unbiased estimates and when averaged over all sample units in the population, estimates of forest structure were very close to those obtained using classical estimates based on the sampling strategy used in the state-wide inventory.The spatial models also provided unbiased estimates of model variances leading to confidence and prediction coverage rates close to the 0.95 nominal rate.

  19. Impact of spatial resolution on correlation between segmentation evaluation metrics and forest classification accuracy

    Švab Lenarčič, Andreja; Ritlop, Klemen; Äńurić, Nataša.; Čotar, Klemen; Oštir, Krištof

    2015-10-01

    Slovenia is one of the most forested countries in Europe. Its forest management authorities need information about the forest extent and state, as their responsibility lies in forest observation and preservation. Together with appropriate geographic information system mapping methods the remotely sensed data represent essential tool for an effective and sustainable forest management. Despite the large data availability, suitable mapping methods still present big challenge in terms of their speed which is often affected by the huge amount of data. The speed of the classification method could be maximised, if each of the steps in object-based classification was automated. However, automation is hard to achieve, since segmentation requires choosing optimum parameter values for optimal classification results. This paper focuses on the analysis of segmentation and classification performance and their correlation in a range of segmentation parameter values applied in the segmentation step. In order to find out which spatial resolution is still suitable for forest classification, forest classification accuracies obtained by using four images with different spatial resolutions were compared. Results of this study indicate that all high or very high spatial resolutions are suitable for optimal forest segmentation and classification, as long as appropriate scale and merge parameters combinations are used in the object-based classification. If computation interval includes all segmentation parameter combinations, all segmentation-classification correlations are spatial resolution independent and are generally high. If computation interval includes over- or optimal-segmentation parameter combinations, most segmentation-classification correlations are spatial resolution dependent.

  20. Impact of spatially constrained sampling of temporal contact networks on the evaluation of the epidemic risk

    Vestergaard, Christian L; Génois, Mathieu; Poletto, Chiara; Colizza, Vittoria; Barrat, Alain

    2016-01-01

    The ability to directly record human face-to-face interactions increasingly enables the development of detailed data-driven models for the spread of directly transmitted infectious diseases at the scale of individuals. Complete coverage of the contacts occurring in a population is however generally unattainable, due for instance to limited participation rates or experimental constraints in spatial coverage. Here, we study the impact of spatially constrained sampling on our ability to estimate the epidemic risk in a population using such detailed data-driven models. The epidemic risk is quantified by the epidemic threshold of the susceptible-infectious-recovered-susceptible model for the propagation of communicable diseases, i.e. the critical value of disease transmissibility above which the disease turns endemic. We verify for both synthetic and empirical data of human interactions that the use of incomplete data sets due to spatial sampling leads to the underestimation of the epidemic risk. The bias is howev...

  1. Precipitation hardening and hydrogen embrittlement of aluminum alloy AA7020

    Santosh Kumar; T K G Namboodhiri

    2011-04-01

    AA7020 Al–Mg–Zn, a medium strength aluminium alloy, is used in welded structures in military and aerospace applications. As it may be subjected to extremes of environmental exposures, including high pressure liquid hydrogen, it could suffer hydrogen embrittlement. Hydrogen susceptibility of alloy AA7020 was evaluated by slow strain-rate tensile testing, and delayed failure testing of hydrogen-charged specimens of air-cooled, duplexaged, and water-quenched duplex agedmaterials. The resistance to hydrogen embrittlement of the alloy was found to be in the order of air-cooled duplex aged alloy > as-received (T6 condition) > water quenched duplex aged material.

  2. Is amyloid A (AA) amyloidosis always secondary?

    Maury, C P; Törnroth, T; Wegelius, O

    1985-01-01

    The case is reported of a patient with systemic AA amyloidosis associated with non-specific mesenteric lymphadenitis and chronic sideropenia. Renal, small bowel, and rectal biopsies showed amyloid deposits containing AA protein, as defined by potassium permanganate sensitivity and by reactivity with AA antiserum. Reversal of the nephrotic syndrome occurred during steroid-azathioprine therapy.

  3. Evaluation of spatial models to predict vulnerability of forest birds to brood parasitism by cowbirds

    Gustafson, E.J.; Knutson, M.G.; Niemi, G.J.; Friberg, M.

    2002-01-01

    We constructed alternative spatial models at two scales to predict Brown-headed Cowbird (Molothrus ater) parasitism rates from land cover maps. The local-scale models tested competing hypotheses about the relationship between cowbird parasitism and distance of host nests from a forest edge (forest-nonforest boundary). The landscape models tested competing hypotheses about how landscape features (e.g., forests, agricultural fields) interact to determine rates of cowbird parasitism. The models incorporate spatial neighborhoods with a radius of 2.5 km in their formulation, reflecting the scale of the majority of cowbird commuting activity. Field data on parasitism by cowbirds (parasitism rate and number of cowbird eggs per nest) were collected at 28 sites in the Driftless Area Ecoregion of Wisconsin, Minnesota, and Iowa and were compared to the predictions of the alternative models. At the local scale, there was a significant positive relationship between cowbird parasitism and mean distance of nest sites from the forest edge. At the landscape scale, the best fitting models were the forest-dependent and forest-fragmentation-dependent models, in which more heavily forested and less fragmented landscapes had higher parasitism rates. However, much of the explanatory power of these models results from the inclusion of the local-scale relationship in these models. We found lower rates of cowbird parasitism than did most Midwestern studies, and we identified landscape patterns of cowbird parasitism that are opposite to those reported in several other studies of Midwestern songbirds. We caution that cowbird parasitism patterns can be unpredictable, depending upon ecoregional location and the spatial extent, and that our models should be tested in other ecoregions before they are applied there. Our study confirms that cowbird biology has a strong spatial component, and that improved spatial models applied at multiple spatial scales will be required to predict the effects of

  4. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor

    Pérez, Claudia; Fernandez, Luisa E.; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S.; Soberón, Mario; Bravo, Alejandra

    2005-01-01

    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa bind...

  5. Evaluating the Spatial Distributions of Ethnic Populations: A Quantitative Exercise for Undergraduates.

    Rivizzigno, Victoria L.

    This exercise teaches undergraduate geography students to use the Lorenz Curve and the Index of Dissimilarity to assess the spatial distributions of the White, Black, and American Indian populations of the United States in 1980. Specific procedures for implementing the exercise are provided; solutions to the exercise are also included. Students…

  6. Testing of spatial ability: construction and evaluation of a new instrument

    Květon, Petr; Jelínek, Martin; Vobořil, Dalibor

    2014-01-01

    Roč. 56, č. 3 (2014), s. 233-252. ISSN 0039-3320 R&D Projects: GA ČR(CZ) GAP407/11/2397 Institutional support: RVO:68081740 Keywords : spatial ability * testing * psychometrics Subject RIV: AN - Psychology Impact factor: 0.442, year: 2014

  7. Field evaluation of four spatial repellent devices against Arkansas rice-land mosquitoes

    Four commercially available spatial repellent devices were tested in a rice land habitat near Stuttgart, Arkansas after semi-field level assessments had been made at the Center for Medical, Agricultural, and Veterinary Entomology, ARS, USDA in Gainesville, FL. OFF! Clip-On® (a.i. metofluthrin, S.C....

  8. Spatial shrinkage/expansion patterns between breast density measured in two MRI scans evaluated by non-rigid registration

    Lin Muqing; Chen, Jeon-Hor; Bahri, Shadfar; Nalcioglu, Orhan; Su Minying [Tu and Yuen Center for Functional Onco-Imaging, Department of Radiological Sciences, University of California, Irvine, CA (United States); Mehta, Rita S [Department of Medicine, University of California, Irvine, CA (United States); Chan Siwa, E-mail: msu@uci.edu [Department of Radiology, Taichung Veterans General Hospital, Taichung, Taiwan (China)

    2011-09-21

    Breast MRI acquires many images from the breast, and computer-aided algorithms and display tools are often used to assist the radiologist's interpretation. Women with lifetime risk greater than 20% of developing breast cancer are recommended to receive annual screening MRI, but the current breast MRI computer-aided-diagnosis systems do not provide the necessary function for comparison of images acquired at different times. The purpose of this work was to develop registration methods for evaluating the spatial change pattern of fibroglandular tissue between two breast MRI scans of the same woman taken at different times. The registration method is based on rigid alignment followed by a non-rigid Demons algorithm. The method was tested on three different subjects who had different degrees of changes in the fibroglandular tissue, including two patients who showed different spatial shrinkage patterns after receiving neoadjuvant chemotherapy before surgery, and one control case from a normal volunteer. Based on the transformation matrix, the collapse of multiple voxels on the baseline images to one voxel on the follow-up images is used to calculate the shrinkage factor. Conversely, based on the reverse transformation matrix the expansion factor can be calculated. The shrinkage/expansion factor, the deformation magnitude and direction, as well as the Jacobian determinate at each location can be displayed in a 3D rendering view to show the spatial changes between two MRI scans. These different parameters show consistent results and can be used for quantitative evaluation of the spatial change patterns. The presented registration method can be further developed into a clinical tool for evaluating therapy-induced changes and for early diagnosis of breast cancer in screening MRI.

  9. Spatial shrinkage/expansion patterns between breast density measured in two MRI scans evaluated by non-rigid registration

    Breast MRI acquires many images from the breast, and computer-aided algorithms and display tools are often used to assist the radiologist's interpretation. Women with lifetime risk greater than 20% of developing breast cancer are recommended to receive annual screening MRI, but the current breast MRI computer-aided-diagnosis systems do not provide the necessary function for comparison of images acquired at different times. The purpose of this work was to develop registration methods for evaluating the spatial change pattern of fibroglandular tissue between two breast MRI scans of the same woman taken at different times. The registration method is based on rigid alignment followed by a non-rigid Demons algorithm. The method was tested on three different subjects who had different degrees of changes in the fibroglandular tissue, including two patients who showed different spatial shrinkage patterns after receiving neoadjuvant chemotherapy before surgery, and one control case from a normal volunteer. Based on the transformation matrix, the collapse of multiple voxels on the baseline images to one voxel on the follow-up images is used to calculate the shrinkage factor. Conversely, based on the reverse transformation matrix the expansion factor can be calculated. The shrinkage/expansion factor, the deformation magnitude and direction, as well as the Jacobian determinate at each location can be displayed in a 3D rendering view to show the spatial changes between two MRI scans. These different parameters show consistent results and can be used for quantitative evaluation of the spatial change patterns. The presented registration method can be further developed into a clinical tool for evaluating therapy-induced changes and for early diagnosis of breast cancer in screening MRI.

  10. Spatial evaluation and modeling of Dengue seroprevalence and vector density in Rio de Janeiro, Brazil.

    Nildimar Alves Honório

    Full Text Available BACKGROUND: Rio de Janeiro, Brazil, experienced a severe dengue fever epidemic in 2008. This was the worst epidemic ever, characterized by a sharp increase in case-fatality rate, mainly among younger individuals. A combination of factors, such as climate, mosquito abundance, buildup of the susceptible population, or viral evolution, could explain the severity of this epidemic. The main objective of this study is to model the spatial patterns of dengue seroprevalence in three neighborhoods with different socioeconomic profiles in Rio de Janeiro. As blood sampling coincided with the peak of dengue transmission, we were also able to identify recent dengue infections and visually relate them to Aedes aegypti spatial distribution abundance. We analyzed individual and spatial factors associated with seroprevalence using Generalized Additive Model (GAM. METHODOLOGY/PRINCIPAL FINDINGS: Three neighborhoods were investigated: a central urban neighborhood, and two isolated areas characterized as a slum and a suburban area. Weekly mosquito collections started in September 2006 and continued until March 2008. In each study area, 40 adult traps and 40 egg traps were installed in a random sample of premises, and two infestation indexes calculated: mean adult density and mean egg density. Sera from individuals living in the three neighborhoods were collected before the 2008 epidemic (July through November 2007 and during the epidemic (February through April 2008. Sera were tested for DENV-reactive IgM, IgG, Nested RT-PCR, and Real Time RT-PCR. From the before-after epidemics paired data, we described seroprevalence, recent dengue infections (asymptomatic or not, and seroconversion. Recent dengue infection varied from 1.3% to 14.1% among study areas. The highest IgM seropositivity occurred in the slum, where mosquito abundance was the lowest, but household conditions were the best for promoting contact between hosts and vectors. By fitting spatial GAM we found

  11. Evaluation of {sup 7}Be fallout spatial variability; Avaliacao da variabilidade espacial do fallout do {sup 7}Be

    Pinto, Victor Meriguetti

    2011-07-01

    The cosmogenic radionuclide beryllium-7 (Be) is produced in the atmosphere by cosmic particle reactions and is being used as a tracer for soil erosion and climatic processes research. After the production, {sup 7}Be bonds to aerosol particles in the atmosphere and is deposited on the soil surface with other radionuclide species by rainfall. Because of the high adsorption on soil particles and its short half-life of 53.2 days, this radionuclide follows of the erosion process and can be used as a tracer to evaluate the sediment transport that occurs during a single rain event or short period of rain events. A key assumption for the erosion evaluation through this radiotracer is the uniformity of the spatial distribution of the {sup 7}Be fallout. The {sup 7}Be method was elaborated recently and due to its few applications, some assumptions related to the method were not yet properly investigated yet, and the hypothesis of {sup 7}Be fallout uniformity needs to be evaluated. The aim of this study was to evaluate the {sup 7}Be fallout spatial distribution through the rain water {sup 7}Be activity analysis of the first five millimeters of single rain events. The rain water was sampled using twelve collectors distributed on an experimental area of about 300 m2 , located in the campus of Sao Paulo University, Piracicaba. The {sup 7}Be activities were measured using a 53% efficiency gamma-ray spectrometer from the Radioisotope laboratory of CENA. The {sup 7}Be activities in rain water varied from 0.26 to 1.81 Sq.L{sup -}1, with the highest values in summer and lowest in spring. In each one of the 5 single events, the spatial variability of {sup 7}Se activity in rain water was high, showing the high randomness of the fallout spatial distribution. A simulation using the {sup 7}Be spatial variability values obtained here and {sup 7}Se average reference inventories taken from the literature was performed determining the lowest detectable erosion rate estimated by {sup 7}Be model

  12. Silicon microstrip detectors for digital mammography - evaluation and spatial resolution study

    Mali, T; Mikuz, M

    2001-01-01

    Silicon microstrip detectors were used to build an experimental X-ray imaging setup. The detectors were used in an 'edge-on' geometry, with the photons hitting the detector from the side. Efficiencies up to 90% at 20 keV photon energy could be achieved. The system was tested using a standard mammographic phantom. Images of modeled microcalcifications with various diameters down to 200 mu m and images of modeled tumors were made. Spatial resolution of the system was studied on an X-ray test pattern with frequency of line-pairs between 1 and 10l p/mm. An appropriate scanning step combined with knowledge of the system's line spread function was used to deconvolve the measured image and increase the spatial resolution. In this way the effective pixel size was reduced as much as for a factor of approx 3.

  13. Evaluation of charge-sharing effects on the spatial resolution of the PICASSO detector

    Rigon, L., E-mail: luigi.rigon@ts.infn.i [Istituto Nazionale di Fisica Nucleare (INFN), Sezione di Trieste, Via Valerio 2, 34127 Trieste (Italy); Arfelli, F. [Istituto Nazionale di Fisica Nucleare (INFN), Sezione di Trieste, Via Valerio 2, 34127 Trieste (Italy); Dipartimento di Fisica, Universita di Trieste, Via Valerio 2, 34127 Trieste (Italy); Bergamaschi, A. [Paul Scherrer Institut (PSI), CH-5232 Villigen (Switzerland); Chen, R.C. [Istituto Nazionale di Fisica Nucleare (INFN), Sezione di Trieste, Via Valerio 2, 34127 Trieste (Italy); Shanghai Institute of Applied Physics, CAS, Shanghai 201800 (China); Dreossi, D. [Istituto Nazionale di Fisica Nucleare (INFN), Sezione di Trieste, Via Valerio 2, 34127 Trieste (Italy); Sincrotrone Trieste SCpA, S.S. 14 km 163.5, 34012 Basovizza (Italy); Longo, R. [Istituto Nazionale di Fisica Nucleare (INFN), Sezione di Trieste, Via Valerio 2, 34127 Trieste (Italy); Dipartimento di Fisica, Universita di Trieste, Via Valerio 2, 34127 Trieste (Italy); Menk, R.-H. [Sincrotrone Trieste SCpA, S.S. 14 km 163.5, 34012 Basovizza (TS) (Italy); Schmitt, B. [Paul Scherrer Institut (PSI), CH-5232 Villigen (Switzerland); Vallazza, E. [Istituto Nazionale di Fisica Nucleare (INFN), Sezione di Trieste, Via Valerio 2, 34127 Trieste (Italy); Castelli, E. [Istituto Nazionale di Fisica Nucleare (INFN), Sezione di Trieste, Via Valerio 2, 34127 Trieste (Italy); Dipartimento di Fisica, Universita di Trieste, Via Valerio 2, 34127 Trieste (Italy)

    2010-05-21

    A double -layer 'edge-on' silicon microstrip detector has been designed and realized in the frame of the PICASSO (Phase Imaging for Clinical Application with Silicon detector and Synchrotron radiatiOn) project at the SYRMEP (SYnchrotron Radiation for MEdical Physics) beamline of Elettra (Trieste, Italy). The detector meets the requirements for synchrotron radiation mammography with patients inregarding: (a) size, since it covers the full beam width (210 mm); (b) spatial resolution, determined by the 0.05 mm strip pitch; (c) single-photon counting capabilities, because it is able to handle more than 10{sup 6} photons/(pixelxs); (d) contrast resolution, thanks to a threshold trim DAC that equalizes the channel sensitivity; (e) efficiency, due to the high absorption in the 15-20 mm sensor depth. Experimental measurements evidence charge sharing, though not compromising the spatial resolution.

  14. Spatial Differentiation and Evaluation of Tourism Performance of Slovakia and Its Specificities

    Kasagranda Anton

    2015-12-01

    Full Text Available The aim of this paper is to quantify tourists (both domestic and international of Slovakia and their chronology throughout the years. Firstly, a brief development of them is introduced (absolute number and proportion of the total traffic from 1985 to 2013. Subsequently, the structure of their nationality, spatial differentiation (at municipal level and seasonality is discussed (respective distribution during the year. The aim of this study is to discover a spatial context in space and time. To quantify the number of tourists, the data from the Statistical Office of the Slovak Republic and also from the Ministry of Transport, Construction and Regional Development, are used. These data are interpreted in analyses and confirmed by tables, graphs and pictures.

  15. Evaluating the use of local ecological knowledge to monitor hunted tropicalforest wildlife over large spatial scales

    Luke Parry; Peres, Carlos A.

    2015-01-01

    Monitoring the distribution and abundance of hunted wildlife is critical to achieving sustainable resource use, yet adequate data are sparse for most tropical regions. Conventional methods for monitoring hunted forest-vertebrate species require intensive in situ survey effort, which severely constrains spatial and temporal replication. Integrating local ecological knowledge (LEK) into monitoring and management is appealing because it can be cost-effective, enhance community participation, and...

  16. AN ECONOMIC EVALUATION OF THE NEW AGRICULTURAL TRADE NEGOTIATIONS: A NONLINEAR IMPERFECTLY COMPETITIVE SPATIAL EQUILIBRIUM APPROACH

    Maeda, Koushi; Suzuki, Xohuhiro; Kaiser, Harry M.

    2001-01-01

    The objective of the research reported here is to develop a more flexible and comprehensive policy simulation model for imperfectly competitive international agricultural trade with various trade and domestic support policies. The model is a nonlinear imperfectly competitive spatial equilibrium model formulated as a MCP. The model is flexible in that it can simulate the economic effects of the following trade policies: specific duties, ad valorem tariffs, tariff-rate quotas, export subsidies,...

  17. Evaluating Spatial Interaction Models for Regional Mobility in Sub-Saharan Africa.

    Wesolowski, Amy; O'Meara, Wendy Prudhomme; Eagle, Nathan; Tatem, Andrew J; Buckee, Caroline O

    2015-07-01

    Simple spatial interaction models of human mobility based on physical laws have been used extensively in the social, biological, and physical sciences, and in the study of the human dynamics underlying the spread of disease. Recent analyses of commuting patterns and travel behavior in high-income countries have led to the suggestion that these models are highly generalizable, and as a result, gravity and radiation models have become standard tools for describing population mobility dynamics for infectious disease epidemiology. Communities in Sub-Saharan Africa may not conform to these models, however; physical accessibility, availability of transport, and cost of travel between locations may be variable and severely constrained compared to high-income settings, informal labor movements rather than regular commuting patterns are often the norm, and the rise of mega-cities across the continent has important implications for travel between rural and urban areas. Here, we first review how infectious disease frameworks incorporate human mobility on different spatial scales and use anonymous mobile phone data from nearly 15 million individuals to analyze the spatiotemporal dynamics of the Kenyan population. We find that gravity and radiation models fail in systematic ways to capture human mobility measured by mobile phones; both severely overestimate the spatial spread of travel and perform poorly in rural areas, but each exhibits different characteristic patterns of failure with respect to routes and volumes of travel. Thus, infectious disease frameworks that rely on spatial interaction models are likely to misrepresent population dynamics important for the spread of disease in many African populations. PMID:26158274

  18. Evaluating Spatial Interaction Models for Regional Mobility in Sub-Saharan Africa.

    Amy Wesolowski

    2015-07-01

    Full Text Available Simple spatial interaction models of human mobility based on physical laws have been used extensively in the social, biological, and physical sciences, and in the study of the human dynamics underlying the spread of disease. Recent analyses of commuting patterns and travel behavior in high-income countries have led to the suggestion that these models are highly generalizable, and as a result, gravity and radiation models have become standard tools for describing population mobility dynamics for infectious disease epidemiology. Communities in Sub-Saharan Africa may not conform to these models, however; physical accessibility, availability of transport, and cost of travel between locations may be variable and severely constrained compared to high-income settings, informal labor movements rather than regular commuting patterns are often the norm, and the rise of mega-cities across the continent has important implications for travel between rural and urban areas. Here, we first review how infectious disease frameworks incorporate human mobility on different spatial scales and use anonymous mobile phone data from nearly 15 million individuals to analyze the spatiotemporal dynamics of the Kenyan population. We find that gravity and radiation models fail in systematic ways to capture human mobility measured by mobile phones; both severely overestimate the spatial spread of travel and perform poorly in rural areas, but each exhibits different characteristic patterns of failure with respect to routes and volumes of travel. Thus, infectious disease frameworks that rely on spatial interaction models are likely to misrepresent population dynamics important for the spread of disease in many African populations.

  19. Cloven-hoofed animals spatial activity evaluation methods in Doupov Mountains in the Czech Republic

    J. Jarolímek, J. Masner, M. Ulman, S. Dvořák

    2012-01-01

    The focus of the project „Collection and interpretation of positional data“ is placed on the use of positional data (or the information about a moving object) in the scientific research and educational activities in various fields such as environmental science, logistics, spatial data infrastructure, information management, and others. The objective of this effort is to create an universal model for collection and presentation of moving objects data retrieved through GPS (Global Positioning S...

  20. Spatial distribution and pollution evaluation of heavy metals in Yangtze estuary sediment.

    Liu, Ruimin; Men, Cong; Liu, Yongyan; Yu, Wenwen; Xu, Fei; Shen, Zhenyao

    2016-09-15

    To analyze the spatial distribution patterns and ecological risks of heavy metals, 30 sediment samples were taken in the Yangtze River Estuary (YRE) in May 2011. The content of Al, As, Cr, Cu, Fe, Mn, Ni and Pb increased as follows: inner-regionCARB) and As was related to organic-associated (OM) which is more stable than CARB. The fractions played an important role in the contamination assessment of heavy metals. PMID:27267116

  1. Expansion about a local Maxwellian for evaluating the spatially dependent neutron spectrum

    The problem of the spatial variation of thermal neutron fluxes is investigated in the framework of energy-dependent diffusion theory, with the aim of reaching practical solutions for application in reactor physics. Neutron flux is expanded here in terms of Laguerre polynomials in energy, weighted with a local Maxwellian distribution in which the neutron temperature depends on the space variable. The method proposed is applied to the diffusion of thermal neutrons in moderating systems with a non-uniform temperature profile

  2. Residential Greenness and Birth Outcomes: Evaluating the Influence of Spatially Correlated Built-Environment Factors

    2014-01-01

    Background: Half the world’s population lives in urban areas. It is therefore important to identify characteristics of the built environment that are beneficial to human health. Urban greenness has been associated with improvements in a diverse range of health conditions, including birth outcomes; however, few studies have attempted to distinguish potential effects of greenness from those of other spatially correlated exposures related to the built environment. Objectives: We aimed to investi...

  3. Residential Greenness and Birth Outcomes : Evaluating the Influence of Spatially Correlated Built-Environment Factors

    Hystad, Perry; Davies, Hugh W; Frank, Lawrence; Loon, Josh Van; Gehring, Ulrike; Tamburic, Lillian; Brauer, Michael

    2014-01-01

    Background: Half the world’s population lives in urban areas. It is therefore important to identify characteristics of the built environment that are beneficial to human health. Urban greenness has been associated with improvements in a diverse range of health conditions, including birth outcomes; however, few studies have attempted to distinguish potential effects of greenness from those of other spatially correlated exposures related to the built environment. Objectives: We aimed to investi...

  4. A human spatial-chromatic vision model for evaluating electronic displays

    Lloyd, Charles J. C.

    1990-01-01

    This dissertation examines those attributes of full-color display systems (particularly color matrix displays) which degrade image quality. Based on this analysis, it is suggested that a comprehensive metric should measure image quality in terms of transmitted signal and noise modulation, both achromatic and chromatic. Moreover, it is suggested that these signal and noise measurements be weighted in terms of human spatial-chromatic visual characteristics. A review of extant...

  5. Nondestructive quality evaluation and monitoring of Braeburn apples by Spatially Resolved Spectroscopy.

    Do Trong, Nghia Nguyen; Tsuta, Mizuki; Erkinbaev, Chyngyz; Mathijs, Frank; Moreda Cantero, Guillermo P.; Barreiro Elorza, Pilar; Verboven, Pieter; Nicolai, Bart; Saeys, Wouter

    2013-01-01

    Contact Spatially Resolved Spectroscopy (SRS) measurements by means of a fiber-optics probe were employed for nondestructive assessment and monitoring of Braeburn apples during shelflife storage. SRS measurements and estimation of optical properties were calibrated and validated by means of liquid optical phantoms with known optical properties and a metamodeling method. The acquired optical properties (absorption and reduced scattering coefficients) for the apples during shelf-life storage we...

  6. Evaluation of spatial database management systems: A performance-based comparison

    Arbesser-Rastburg, Thomas

    2009-01-01

    This analytical research paper investigates the question which of three Spatial Database Management Systems (Oracle 11g, PostgreSQL 8.3 with PostGIS 1.2 and MySQL 5) installed on a Linux platform performs best in queries used in typical GIS applications. It assesses the components responsible for performance and identifies a suitable methodology for a comprehensible comparison of database management systems. An application is developed to precisely measure the response from the database syste...

  7. Evaluation of a Computer-Based Training Program for Enhancing Arithmetic Skills and Spatial Number Representation in Primary School Children

    Rauscher, Larissa; Kohn, Juliane; Käser, Tanja; Mayer, Verena; Kucian, Karin; McCaskey, Ursina; Esser, Günter; von Aster, Michael

    2016-01-01

    Calcularis is a computer-based training program which focuses on basic numerical skills, spatial representation of numbers and arithmetic operations. The program includes a user model allowing flexible adaptation to the child's individual knowledge and learning profile. The study design to evaluate the training comprises three conditions (Calcularis group, waiting control group, spelling training group). One hundred and thirty-eight children from second to fifth grade participated in the study. Training duration comprised a minimum of 24 training sessions of 20 min within a time period of 6–8 weeks. Compared to the group without training (waiting control group) and the group with an alternative training (spelling training group), the children of the Calcularis group demonstrated a higher benefit in subtraction and number line estimation with medium to large effect sizes. Therefore, Calcularis can be used effectively to support children in arithmetic performance and spatial number representation. PMID:27445889

  8. Evaluating the Spatial Distribution of Toxic Air Contaminants in Multiple Ecosystem Indicators in the Sierra Nevada-Southern Cascades

    Nanus, L.; Simonich, S. L.; Rocchio, J.; Flanagan, C.

    2013-12-01

    Toxic air contaminants originating from agricultural areas of the Central Valley in California threaten vulnerable sensitive receptors including surface water, vegetation, snow, sediments, fish, and amphibians in the Sierra Nevada-Southern Cascades region. The spatial distribution of toxic air contaminants in different ecosystem indicators depends on variation in atmospheric concentrations and deposition, and variation in air toxics accumulation in ecosystems. The spatial distribution of organic air toxics and mercury at over 330 unique sampling locations and sample types over two decades (1990-2009) in the Sierra Nevada-Southern Cascades region were compiled and maps were developed to further understand spatial patterns and linkages between air toxics deposition and ecological effects. Potential ecosystem impacts in the Sierra Nevada-Southern Cascades region include bioaccumulation of air toxics in both aquatic and terrestrial ecosystems, reproductive disruption, and immune suppression. The most sensitive ecological end points in the region that are affected by bioaccumulation of toxic air contaminants are fish. Mercury was detected in all fish and approximately 6% exceeded human consumption thresholds. Organic air toxics were also detected in fish yielding variable spatial patterns. For amphibians, which are sensitive to pesticide exposure and potential immune suppression, increasing trends in current and historic use pesticides are observed from north to south across the region. In other indicators, such as vegetation, pesticide concentrations in lichen increase with increasing elevation. Current and historic use pesticides and mercury were also observed in snowpack at high elevations in the study area. This study shows spatial patterns in toxic air contaminants, evaluates associated risks to sensitive receptors, and identifies data gaps. Future research on atmospheric modeling and information on sources is needed in order to predict which ecosystems are the

  9. Lu AA21004, a novel multimodal antidepressantwith activity exerted through serotonergic targets

    Mork, A.; Pehrson, A.; Montezinho, L. C. P.;

    2012-01-01

    levels [serotonin (5-HT), noradrenaline (NA), dopamine (DA), acetylcholine (ACh), histamine (Hist)] were measured by microdialysis. Antidepressant potential was assessed in the forced swim test using Flinders Sensitive Line (FSL) rats. Moreover, effects of Lu AA21004 on acquisition, consolidation and...... recall of contextual memory in rats were studied in the fear conditioning paradigm, and episodic memory was evaluated in the novel object recognition test. Results: Administration of Lu AA21004 (0.1-10 mg/kg, sc) demonstrated that the compound dose-dependently occupied the studied targets. Moreover, Lu...... AA21004 increased extracellular levels of 5-HT, NA, DA, ACh and Hist in the brain. Lu AA21004 counteracted the immobility of FSL rats in the forced swim test and enhanced memory of the rats in the cognition models. Conclusions: Lu AA21004 in vivo engages relevant targets and affects several...

  10. Performance evaluation of spatial vector routing protocol for wireless sensor networks

    WSNs (Wireless Sensor Networks) is an emerging area of research. Researchers worldwide are working on the issues faced by sensor nodes. Communication has been a major issue in wireless networks and the problem is manifolds in WSN s because of the limited resources. The routing protocol in such networks plays a pivotal role, as an effective routing protocol could significantly reduce the energy consumed in transmitting and receiving data packets throughout a network. In this paper the performance of SVR (Spatial Vector Routing) an energy efficient, location aware routing protocol is compared with the existing location aware protocols. The results from the simulation trials show the performance of SVR. (author)

  11. Laboratory Astrophysics Division of the AAS (LAD)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-01-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  12. Evaluating Methods of Estimation and Modelling Spatial Distribution of Evapotranspiration in the Middle Heihe River Basin, China

    Chuanyan Zhao; Zhongren Nan; Guodong Cheng

    2005-01-01

    Seven models commonly used to estimate the daily reference evapotranspiration (ET0) were evaluated in the middle Heihe River Basin of the arid northwestern part of China. The objectives of the study are to choose the appropriate model for estimating the areal distribution of ET0 and to explain the spatial-temporal distribution of the same through GIS in the study area. The results indicated that the FAO-Penman model is the best way to estimate ET0; its RMSE ranged from 1.11 to 1.70 mm, and r2...

  13. Evaluating the Effect of Aquatic Extract of Cannabis sativa Seed on Spatial Memory Consolidation in Rats

    M. Tehranipour; S. Ebrahimpour

    2009-01-01

    As the point of physiology, memory form, from changes in the conducting message in the neural webs. These changes cause to formation of long-term potentiation. Δ9-THC is Psychotropic component 4-of Cannabis sativa plant; studies show this matter can bind cannabinoid receptor in CA1 area of hippocampus. Thus the aim of this study is evaluation the effect of aquatic extraction Cannabis sativa seed on spatial 7-memory consolidation in Rats. Forty male wistar Rats (3-4 mounth, 320-260 g) were com...

  14. Numerical evaluation of multilayer holographic data storage with a varifocal lens generated with a spatial light modulator

    Nobukawa, Teruyoshi; Nomura, Takanori

    2015-08-01

    A multilayer recording using a varifocal lens generated with a phase-only spatial light modulator (SLM) is proposed. A phase-only SLM is used for not only improving interference efficiency between signal and reference beams but also shifting a focus plane along an optical axis. A focus plane can be shifted by adding a spherical phase to a phase modulation pattern displayed on a phase-only SLM. A focal shift with adding a spherical phase was numerically confirmed. In addition, shift selectivity and recording performance of the proposed multilayer recording method were numerically evaluated in coaxial holographic data storage.

  15. Evaluation Of Geo-Spatial Proximity Of Mobile Communication GSM Base Transceiver Stations To Buildings In Ile-Ife Nigeria

    Badru

    2015-08-01

    Full Text Available Efficient placement of radio facilities for the communication base transceiver station CBS of the two small global system for mobile communication GSM has being an area of research due to fast growing of GSM market in Nigeria. In line with this development Nigerian Communication Commission NCC and Nigeria Environmental Standard and Regulation Enforcement Agency NESREA have stated the setback between communication base station and the nearest infrastructure as 5 m and 10 m respectively. To evaluate the degree of the implementation of these setbacks in Ile-Ife the study area the research study identified the spatial locations of the CBS using a global communication for satellite GPS receiver and also employed the use of a high resolution satellite imagery which were processed using geo-spatial techniques. The results of this study revealed that 45.6 and 59.5 of the CBS had setback to building structures at 5 m and 10 m respectively with spatial variability between 30 m to 17074 m at elevation between 193 m to 377 m.

  16. Evaluating Methods of Estimation and Modelling Spatial Distribution of Evapotranspiration in the Middle Heihe River Basin, China

    Chuanyan Zhao

    2005-01-01

    Full Text Available Seven models commonly used to estimate the daily reference evapotranspiration (ET0 were evaluated in the middle Heihe River Basin of the arid northwestern part of China. The objectives of the study are to choose the appropriate model for estimating the areal distribution of ET0 and to explain the spatial-temporal distribution of the same through GIS in the study area. The results indicated that the FAO-Penman model is the best way to estimate ET0; its RMSE ranged from 1.11 to 1.70 mm, and r2 from 0.59 to 0.93. The spatial variations of ET0 are higher in the western part than in the middle-eastern part of the study area. The temporal variations of daily differences in ET0 rates are mainly due to the differences in irradiance (Rn and to daily differences in the vapor pressure deficit (D. The spatially modeled ET0 results (r2 = 0.88 are in agreement with the corresponding data in situ on the 15th of each month.

  17. Spatial Analysis of Pollution-free Land for Tea Plantation and Comprehensive Evaluation of Soil Suitability

    Wen, Ximei; Lu, Yang; Lan, Anjun; Tan, Hong

    2013-01-01

    To survey the tea resource advantages in Guizhou's mountainous areas and complete rational layout of pollution-free tea planting areas, we take the case of Guiding County in Guizhou Province to establish the comprehensive evaluation indicator system of pollution-free land for tea plantation and comprehensive evaluation model of soil suitability of land for tea plantation according to the Environmental Conditions Standard for Pollution-free Food-Tea Producing Areas by the Ministry of Agricultu...

  18. AAS 228: Day 1 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  19. Evaluating influence of active tectonics on spatial distribution pattern of floods along eastern Tamil Nadu, India

    Selvakumar, R.; Ramasamy, SM.

    2014-12-01

    Flooding is a naturally recurrent phenomenon that causes severe damage to lives and property. Predictions on flood-prone zones are made based on intensity-duration of rainfall, carrying capacity of drainage, and natural or man-made obstructions. Particularly, the lower part of the drainage system and its adjacent geomorphic landforms like floodplains and deltaic plains are considered for analysis, but stagnation in parts of basins that are far away from major riverine systems is less unveiled. Similarly, uncharacteristic flooding in the upper and middle parts of drainage, especially in zones of an anomalous drainage pattern, is also least understood. Even though topographic differences are attributed for such anomalous spatial occurrence of floods, its genetic cause has to be identified for effective management practice. Added to structural and lithological variations, tectonic movements too impart micro-scale terrain undulations. Because active tectonic movements are slow-occurring, long-term geological processes, its resultant topographical variations and drainage anomalies are least correlated with floods. The recent floods of Tamil Nadu also exhibit a unique distribution pattern emphasizing the role of tectonics over it. Hence a detailed geoinformatics-based analysis was carried out to envisage the relationship between spatial distribution of flood and active tectonic elements such as regional arches and deeps, block faults, and graben and drainage anomalies such as deflected drainage, compressed meander, and eyed drainages. The analysis reveals that micro-scale topographic highs and lows imparted by active tectonic movements and its further induced drainage anomalies have substantially controlled the distribution pattern of flood.

  20. A spatial intensity phase evaluator (SIPHER) for perceptual object detection in images

    Drake, Andrew; Hirsch, Herb

    2012-06-01

    SIPHER was first revealed in a US Air Force Research Laboratory Information Directorate (AFRL/RIEC) project concerned with polarimetric and SAR processing techniques. It is a means to make objects in a digital image vary in intensity (amplitude) with respect to other objects or backgrounds, in an unusual manner which promotes object or target cognitive perception. We describe this phenomenon as objects being in or out of spatial intensity phase with one another, somewhat analogous to how different signals' amplitudes differ at any instance due to their relative phases. Simple surface reflectivity and a single, static illumination source provide no special means to distinguish objects from backgrounds, other than their reflectivity differences. However, if different surfaces are illuminated from different source positions or with different amplitudes, like from a moving spotlight, different pixels with the same reflectivity may have different amplitudes at different instances within the source's dynamic behavior. The problem is that we cannot necessarily control source dynamics or collect images over sufficient time to benefit from these dynamics. SIPHER simulates source dynamics in a single, static image. It creates apparent reflectivity changes in an image taken at one instance, as if the illumination source's intensity and position was changing, as a function of algorithm threshold settings. This produces a series of processed images wherein object and background pixel amplitudes are out of phase with one another due to their orientation and surface characteristics (flat, curved, etc.), and become more perceptible. Cognitive perception is enhanced by creating a video sequence of the processed image series. This produces an apparent motion effect in the object relative to its surroundings, or renders an apparent threedimensional effect where the object appears to "jump out" from its surroundings. We first define this spatial intensity phase quantity mathematically

  1. A software system for evaluation and training of spatial reasoning and neuroanatomical knowledge in a virtual environment.

    Armstrong, Ryan; de Ribaupierre, Sandrine; Eagleson, Roy

    2014-04-01

    This paper describes the design and development of a software tool for the evaluation and training of surgical residents using an interactive, immersive, virtual environment. Our objective was to develop a tool to evaluate user spatial reasoning skills and knowledge in a neuroanatomical context, as well as to augment their performance through interactivity. In the visualization, manually segmented anatomical surface images of MRI scans of the brain were rendered using a stereo display to improve depth cues. A magnetically tracked wand was used as a 3D input device for localization tasks within the brain. The movement of the wand was made to correspond to movement of a spherical cursor within the rendered scene, providing a reference for localization. Users can be tested on their ability to localize structures within the 3D scene, and their ability to place anatomical features at the appropriate locations within the rendering. PMID:24524753

  2. Evaluation of MRI and cannabinoid type 1 receptor PET templates constructed using DARTEL for spatial normalization of rat brains

    Kronfeld, Andrea; Müller-Forell, Wibke [Institute of Neuroradiology, University Medical Center of the Johannes Gutenberg University Mainz, Langenbeckstraße 1, Mainz 55131 (Germany); Buchholz, Hans-Georg; Maus, Stephan; Reuss, Stefan; Schreckenberger, Mathias; Miederer, Isabelle, E-mail: isabelle.miederer@unimedizin-mainz.de [Department of Nuclear Medicine, University Medical Center of the Johannes Gutenberg University Mainz, Langenbeckstraße 1, Mainz 55131 (Germany); Lutz, Beat [Institute of Physiological Chemistry, University Medical Center of the Johannes Gutenberg University Mainz, Duesbergweg 6, Mainz 55128 (Germany)

    2015-12-15

    Purpose: Image registration is one prerequisite for the analysis of brain regions in magnetic-resonance-imaging (MRI) or positron-emission-tomography (PET) studies. Diffeomorphic anatomical registration through exponentiated Lie algebra (DARTEL) is a nonlinear, diffeomorphic algorithm for image registration and construction of image templates. The goal of this small animal study was (1) the evaluation of a MRI and calculation of several cannabinoid type 1 (CB1) receptor PET templates constructed using DARTEL and (2) the analysis of the image registration accuracy of MR and PET images to their DARTEL templates with reference to analytical and iterative PET reconstruction algorithms. Methods: Five male Sprague Dawley rats were investigated for template construction using MRI and [{sup 18}F]MK-9470 PET for CB1 receptor representation. PET images were reconstructed using the algorithms filtered back-projection, ordered subset expectation maximization in 2D, and maximum a posteriori in 3D. Landmarks were defined on each MR image, and templates were constructed under different settings, i.e., based on different tissue class images [gray matter (GM), white matter (WM), and GM + WM] and regularization forms (“linear elastic energy,” “membrane energy,” and “bending energy”). Registration accuracy for MRI and PET templates was evaluated by means of the distance between landmark coordinates. Results: The best MRI template was constructed based on gray and white matter images and the regularization form linear elastic energy. In this case, most distances between landmark coordinates were <1 mm. Accordingly, MRI-based spatial normalization was most accurate, but results of the PET-based spatial normalization were quite comparable. Conclusions: Image registration using DARTEL provides a standardized and automatic framework for small animal brain data analysis. The authors were able to show that this method works with high reliability and validity. Using DARTEL

  3. Evaluation of MRI and cannabinoid type 1 receptor PET templates constructed using DARTEL for spatial normalization of rat brains

    Purpose: Image registration is one prerequisite for the analysis of brain regions in magnetic-resonance-imaging (MRI) or positron-emission-tomography (PET) studies. Diffeomorphic anatomical registration through exponentiated Lie algebra (DARTEL) is a nonlinear, diffeomorphic algorithm for image registration and construction of image templates. The goal of this small animal study was (1) the evaluation of a MRI and calculation of several cannabinoid type 1 (CB1) receptor PET templates constructed using DARTEL and (2) the analysis of the image registration accuracy of MR and PET images to their DARTEL templates with reference to analytical and iterative PET reconstruction algorithms. Methods: Five male Sprague Dawley rats were investigated for template construction using MRI and [18F]MK-9470 PET for CB1 receptor representation. PET images were reconstructed using the algorithms filtered back-projection, ordered subset expectation maximization in 2D, and maximum a posteriori in 3D. Landmarks were defined on each MR image, and templates were constructed under different settings, i.e., based on different tissue class images [gray matter (GM), white matter (WM), and GM + WM] and regularization forms (“linear elastic energy,” “membrane energy,” and “bending energy”). Registration accuracy for MRI and PET templates was evaluated by means of the distance between landmark coordinates. Results: The best MRI template was constructed based on gray and white matter images and the regularization form linear elastic energy. In this case, most distances between landmark coordinates were <1 mm. Accordingly, MRI-based spatial normalization was most accurate, but results of the PET-based spatial normalization were quite comparable. Conclusions: Image registration using DARTEL provides a standardized and automatic framework for small animal brain data analysis. The authors were able to show that this method works with high reliability and validity. Using DARTEL templates

  4. Using of Spatial multi criteria evaluation for landslide zoning Case study Malach Aram basin -north of Iran

    Naeimi-Nezamabad, A.; Hoseini Sarrafi, N.; Sadat Mousavi, S. H.

    2009-04-01

    Land slide is one of the major disasters which usually happens in specific area and causes different kinds of financial damage and loss of lives. Different places in IRAN are susceptible for occurring landslide. The study area, Malach Aram basin in Ramian County which is located in north part of Iran, is extended about 3500 hectare. Ever different methods are using for zoning and evaluation this natural disaster. Spatial multi criteria evaluation (SMCE) is a structure that implements statistical analysis of multi criteria evaluation on the Georefrence data. This model can be implemented on the GIS software, Ilwis and ArcGIS are major software for running this study. With defining criterion and sub criteria that are effective in occurring landslide and also specifying in groups and inter groups weight of values on the data layers and defining objectives in this classification and with using different effective criteria that are related to this issue, landslide zoning in the case study area has been prepared. The most important criteria that have been used for running this model are Topography, Slope, Aspect, Hillshade,landuse, climate (mouthy, seasonal and annual precipitation during 15 years ago from 2001 until 2007), state of earth dynamic ( earthquake density, distance of faults and others factors), state of existing flora ( density and percentage flora, kind of specious) geomorphology (geomorphology unit , landforms and fancies geomorphologic). After running the this model, output of this model is classification and part of area defined with height potential of landslide occurring. Output of classification landslide zoning with survey GPS pointes that defined real position landslide used in artificial neural network with supervised learning (Multi-Layer Perceptions) . Recently have defined that 5 area of total of suitable area with height potential landslide occurring are important areas with highly positional landslide occurring. Key words: Land slide- Natural

  5. AA, closed orbit observation pickup

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. Werner Sax contemplates his achievement. See also 8001383, 8010042, 8010045.

  6. AA, closed orbit observation pickup

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles QFW, at maximum dispersion. See also 8001372, 8001383, 8010045

  7. AA, closed orbit observation pickup

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. See also 8001372, 8010042, 8010045

  8. AA, closed orbit observation pickup

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles, QFW, at maximum dispersion. See also 8001372,8001383, 8010042

  9. Final method evaluation: development of spatially resolved emission inventories for Milan and Athens

    Emission inventories have been prepared for the Milan province, Italy, and for the greater Athens area, Greece using the methodology developed and refined in earlier work packages of the EC-funded IMPRESAREO project. Emission totals have been spatially-disaggregated onto a 1x1 km2 grid CORINE land-cover data derived from earth observation (EO) was used as the main input for distributing the emission totals (taken as the totals of the bottom-up inventory). As in the earlier applications of the IMPRESAREO methodology, additional non-EO information was included to improve the spatial disaggregation - this was specifically census data, the road network and traffic counts, and centrally available data on point source emissions. Emission inventories for Milan were generated for three compounds (NOx, NMVOC and CO), while emission inventories of SO2 and CO2 were prepared for Athens in addition to these three pollutants. Distributing emissions to the respective land use type was based on the use of 'emission weighting factors' which had been derived in previous work packages of the IMPRESAREO project. The resulting top-down inventories were compared to the existing bottom up inventories using a number of quantitative and qualitative methods, which had been developed during previous stages of the project, or newly developed here. The results prove that the IMPRESAREO methodology provides useful emission inventories. The needs of a user can be taken to steer the effort (and the costs) which have to be put into the inventory. Tables are provided that describe the return in number of 'acceptable' grid cells depending on the detail level of the inventory. Also, the high importance of the traffic grid to a map representation of the inventory is shown, and the influence single point sources may have on the overall emission total, even of an urban region, is indicated. For environmental assessment purposes, this emphasises the need for a proper assessment of these point source

  10. EVALUATING THE EULER-POINCARÉ CHARACTERISTIC OF A SET USING A SPATIAL TESSELLATION

    Jean-Paul Jernot

    2011-05-01

    Full Text Available A new formula is established to evaluate the Euler-Poincaré characteristic of a polyconvex subset X in Rd starting only from measurements of X in the cells of a tessellation. Simplifications occur when X is a union of cells of the tessellation, leading to another formula that unifies and extends several classical digitization results.

  11. Objective evaluation of the sweet spot size in spatial sound reproduction using elevated loudspeakers

    Lacouture Parodi, Yesenia; Rubak, Per

    2010-01-01

    , the least-squares methods outperformed the method based on the minimum-phase decomposition. However, the evaluation was only done for the best-case scenario, where the transfer functions used to design the filters correspond to the listener's transfer functions and his/her location and orientation...

  12. Simultaneous evaluation of multiple key material properties of complex stratified structures with large spatial extent

    Fallahpour, M.; Kajbaf, H.; Ghasr, M. T.; Case, J. T.; Zoughi, R.

    2012-05-01

    Measured complex reflection coefficient of a spatially-extended stratified composite structure, using an open-ended waveguide, can be effectively used to extract key material and geometrical characteristics of any given layer. This is accomplished using a combination of an electromagnetic model and corresponding measurement data. Previously, it was shown that one parameter can be extracted if all others are known. However, practically it is desirable to extract as many pieces of information as possible. To this end the model must be "inverted". However, there is no closed-form solution for the inverse problem, given the mathematical complexity of the forward model. Consequently, we introduce a forward-iterative optimization method to simultaneously extract several pieces of information about the structure. This method defines key unknowns and uses an analytical approach to estimate the reflection coefficient by minimizing a cost-function using conjugate gradient descent (CGD) as optimizer. This paper presents this method along with an experimental result. Information such as thickness and dielectric properties of a layer in a stratified structure is shown to be extracted concurrently.

  13. Evaluating public health responses to reintroduced smallpox via dynamic, socially structured, and spatially distributed metapopulation models.

    Glasser, John W; Foster, Stanley O; Millar, J Donald; Lane, J Michael

    2008-03-15

    The risk of smallpox reintroduction has motivated preparations in potential target countries. After reproducing the spatiotemporal pattern after the 1972 importation into Yugoslavia via coupled, biologically realistic systems of ordinary differential equations, we developed dynamic population models with current US age distributions and typical spatially distributed social structures. Surveillance and containment (S&C) coupled with vaccination of 95% of hospital-based health care workers (HCWs) within 2 days after the first diagnosis (estimated to be 18 days after aerosol release) were modeled after simulated exposure of 10, 50, or 10,000 people in various settings. If 90% of patients were isolated within days after symptom onset and 75% of contacts were vaccinated and monitored, S&C would reduce cases by 82%-99%. Preemptive immunization of HCWs, closing of schools, and even vaccination of as many as 80% within 1 week would have small marginal benefits. Preparations should emphasize stockpiling vaccine, training HCWs, improving laboratory capacity, and fostering an understanding of S&C. PMID:18284358

  14. Correlations of trace elements in breast human tissues: Evaluation of spatial distribution using {mu}-XRF

    Piacenti da Silva, Marina; Silva, Deisy Mara da; Ribeiro-Silva, Alfredo; Poletti, Martin Eduardo [Departamento de Fisica, FFCLRP/USP, Av. dos Bandeirantes n. 3900, 14040-901 Ribeirao Preto - SP (Brazil); Departamento de Patologia, HCFM/USP, Av. dos Bandeirantes n. 3900, 14040-901 Ribeirao Preto - SP (Brazil); Departamento de Fisica, FFCLRP/USP, Av. dos Bandeirantes n. 3900, 14040-901 Ribeirao Preto - SP (Brazil)

    2012-05-17

    The aim of this work is to investigate microscopic correlations between trace elements in breast human tissues. A synchrotron X-ray fluorescence microprobe system ({mu}-XRF) was used to obtain two-dimensional distribution of trace element Ca, Fe, Cu and Zn in normal (6 samples) and malignant (14 samples) breast tissues. The experiment was performed in X-ray Fluorescence beam line at Laboratorio Nacional de Luz Sincrotron (LNLS), Campinas, Brazil. The white microbeam was generated with a fine conical capillary with a 20 {mu}m output diameter. The samples were supported on a XYZ table. An optical microscope with motorized zoom was used for sample positioning and choice the area to be scanned. Automatic two-dimensional scans were programmed and performed with steps of 30 {mu}m in each direction (x, y) on the selected area. The fluorescence signals were recorded using a Si(Li) detector, positioned at 90 degrees with respect to the incident beam, with a collection time of 10 s per point. The elemental maps obtained from each sample were overlap to observe correlation between trace elements. Qualitative results showed that the pairs of elements Ca-Zn and Fe-Cu could to be correlated in malignant breast tissues. Quantitative results, achieved by Spearman correlation tests, indicate that there is a spatial correlation between these pairs of elements (p < 0.001) suggesting the importance of these elements in metabolic processes associated with the development of the tumor.

  15. The two-layer geochemical structure of modern biogeochemical provinces and its significance for spatially adequate ecological evaluations and decisions

    Korobova, Elena; Romanov, Sergey

    2014-05-01

    Contamination of the environment has reached such a scale that ecogeochemical situation in any area can be interpreted now as a result of the combined effect of natural and anthropogenic factors. The areas that appear uncomfortable for a long stay can have natural and anthropogenic genesis, but the spatial structure of such biogeochemical provinces is in any case formed of a combination of natural and technogenic fields of chemical elements. Features of structural organization and the difference in factors and specific time of their formation allow their separation on one hand and help in identification of areas with different ecological risks due to overlay of the two structures on the other. Geochemistry of soil cover reflects the long-term result of the naturally balanced biogeochemical cycles, therefore the soil geochemical maps of the undisturbed areas may serve the basis for evaluation of the natural geochemical background with due regard to the main factors of geochemical differentiation in biosphere. Purposeful and incidental technogenic concentrations and dispersions of chemical elements of specific (mainly mono- or polycentric) structure are also fixed in soils that serve as secondary sources of contamination of the vegetation cover and local food chains. Overlay of the two structures forms specific heterogeneity of modern biogeochemical provinces with different risk for particular groups of people, animals and plants adapted to specific natural geochemical background within particular concentration interval. The developed approach is believed to be helpful for biogeochemical regionalizing of modern biosphere (noosphere) and for spatially adequate ecogeochemical evaluation of the environment and landuse decisions. It allows production of a set of applied geochemical maps such as: 1) health risk due to chemical elements deficiency and technogenic contamination accounting of possible additive effects; 2) adequate soil fertilization and melioration with due

  16. Spatial-temporal distribution and fuzzy comprehensive evaluation of total phosphorus and total nitrogen in the Yangtze River Estuary.

    Liu, Ruimin; Chen, Yaxin; Yu, Wenwen; Xu, Fei; Shen, Zhenyao

    2016-01-01

    Based on water sample data collected from the Yangtze River Estuary (YRE) during four sampling periods in 2010 and 2011, the total nitrogen (TN) and total phosphorus (TP) content were evaluated using the traditional single-factor evaluation (TSE) and the fuzzy comprehensive evaluation (FCE). Statistical analyses showed that the average TN and TP for the four periods were 2.60 mg/L and 0.11 mg/L, respectively. August 2010 showed the lowest TN (1.57 mg/L), and February 2011 showed the highest TP (0.15 mg/L). The annual spatial distribution results indicated that an area of high TN concentration (TN ≥ 3.0 mg/L) occurred in the adjacent sea and increased on an eastward gradient. An area of high TP concentration (TP ≥0.10 mg/L) occurred in the inner YRE and decreased on an eastward gradient. There were significant differences in the results of TSE and FCE. The TSE results only reflected the TN evaluation results for certain locations of the YRE. The FCE method combined the effects of the TN and TP factors, and the results indicate that the Chinese water quality classification of Class 5 was dominant in the YRE. PMID:26901737

  17. AAS 228: Day 3 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  18. Cost-effectiveness of dryland forest restoration evaluated by spatial analysis of ecosystem services

    Birch, Jennifer C.; Newton, Adrian C.; Aquino, Claudia Alvarez; Cantarello, Elena; Echeverría, Cristian; Kitzberger, Thomas; Schiappacasse, Ignacio; Garavito, Natalia Tejedor

    2010-01-01

    Although ecological restoration is widely used to combat environmental degradation, very few studies have evaluated the cost-effectiveness of this approach. We examine the potential impact of forest restoration on the value of multiple ecosystem services across four dryland areas in Latin America, by estimating the net value of ecosystem service benefits under different reforestation scenarios. The values of selected ecosystem services were mapped under each scenario, supported by the use of ...

  19. GIS-based evaluation and spatial distribution characteristics of land degradation in Bijiang watershed

    Zhao, Xiaoqing; Dai, Jinhua; Wang, Jianping

    2013-01-01

    Land degradation is one of the significant issues the human beings are confronted with, which has become a bottleneck of restricting the sustainable development of the regional society and economy. In order to ascertain the root causes contributed to the land degradation and characteristics of land degradation, Bijiang watershed, the most important Lead-Zinc mine area of Lanping county of Yunnan Province, was selected as the study area. One evaluation index system for land degradation that co...

  20. CCTV Coverage Index Based on Surveillance Resolution and Its Evaluation Using 3D Spatial Analysis

    Kyoungah Choi

    2015-09-01

    Full Text Available We propose a novel approach to evaluating how effectively a closed circuit television (CCTV system can monitor a targeted area. With 3D models of the target area and the camera parameters of the CCTV system, the approach produces surveillance coverage index, which is newly defined in this study as a quantitative measure for surveillance performance. This index indicates the proportion of the space being monitored with a sufficient resolution to the entire space of the target area. It is determined by computing surveillance resolution at every position and orientation, which indicates how closely a specific object can be monitored with a CCTV system. We present full mathematical derivation for the resolution, which depends on the location and orientation of the object as well as the geometric model of a camera. With the proposed approach, we quantitatively evaluated the surveillance coverage of a CCTV system in an underground parking area. Our evaluation process provided various quantitative-analysis results, compelling us to examine the design of the CCTV system prior to its installation and understand the surveillance capability of an existing CCTV system.

  1. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor.

    Pérez, Claudia; Fernandez, Luisa E; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S; Soberón, Mario; Bravo, Alejandra

    2005-12-20

    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa binding to Aedes aegypti brush border membrane vesicles enhanced the binding of biotinylated-Cry11Aa. The Cyt1Aa- and Cry11Aa-binding epitopes were mapped by means of the yeast two-hybrid system, peptide arrays, and heterologous competition assays with synthetic peptides. Two exposed regions in Cyt1Aa, loop beta6-alphaE and part of beta7, bind Cry11Aa. On the other side, Cry11Aa binds Cyt1Aa proteins by means of domain II-loop alpha8 and beta-4, which are also involved in midgut receptor interaction. Characterization of single-point mutations in Cry11Aa and Cyt1Aa revealed key Cry11Aa (S259 and E266) and Cyt1Aa (K198, E204 and K225) residues involved in the interaction of both proteins and in synergism. Additionally, a Cyt1Aa loop beta6-alphaE mutant (K198A) with enhanced synergism to Cry11Aa was isolated. Data provided here strongly indicates that Cyt1Aa synergizes or suppresses resistance to Cry11Aa toxin by functioning as a membrane-bound receptor. Bacillus thuringiensis subsp. israelensis is a highly effective pathogenic bacterium because it produces a toxin and also its functional receptor, promoting toxin binding to the target membrane and causing toxicity. PMID:16339907

  2. AAS 228: Day 3 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  3. Clinical utility of spatially normalized PET and SPECT to evaluate patients with memory and cognitive impairments

    We assessed cerebral metabolism and blood flow in patients with memory and other cognitive impairment using the easy Z score imaging system (eZIS) and statistical parametric mapping (SPM) of FDG-PET and SPECT scans. Twenty patients with dementia (12 Alzheimer's disease (AD), 3 diffuse Lewy body disease (DLB), and 2 frontotemporal dementia (FTD)) and twenty with diffuse axonal injury (DAI) and cognitive impairments were studied with FDG-PET and ECD-SPECT. All images were analyzed using eZIS with the same processing procedures, including smoothing, normalization, and z-transformation, and compared to a database of normals. Z score maps were super-imposed on 3D MRI brain images. Group analyses were performed using SPM. Age-related declines in cerebral metabolism and blood flow were observed in the anterior cingulate association area. In contrast, reductions in these cerebral functions correlated best with severity of AD in the posterior cingulate association areas. In DLB and FTD, eZIS analysis of PET and SPECT revealed reductions of cerebral functions in specific areas. DAI showed low metabolism and blood flow in mesiofrontal cortex including the anterior cingulate association area. Dysfunction of the anterior cingulate association area in DAI, which resembled age-related cognitive decline, may be responsible for cognitive impairments. Overall, PET and SPECT scans showed significant correlations according to the type of dementia. Spatially normalized maps contributed to PET and SPECT image interpretation for patients with memory and cognitive impairments because better 3D visualization allowed more objective and systematic investigations. (author)

  4. Spatial and temporal evaluation of erosion with RUSLE: a case study in an olive orchard microcatchment in Spain

    E. V. Taguas

    2010-09-01

    Full Text Available Soil loss is commonly estimated using the Revised Universal Soil Loss Equation (RUSLE. Since RUSLE is an empirically based soil-loss model derived from surveys on plots, the high spatial and temporal variability of erosion in Mediterranean environments and scale effects mean that it is necessary to evaluate the model in other spatial units such as the microcatchment. In this study, a series of topographic and soil surveys was carried out on a microcatchment of 6.7 ha in a mountainous area under no-tillage farming with bare soil in order to examine spatial and temporal results produced by RUSLE. GPS measurements of the microrelief height differences were used in a control area in the microcatchment to compare observed erosion and deposition with RUSLE predictions. Erosion points located in certain areas correlate very closely with RUSLE predictions, while the distribution of deposition points showed no correlations with RUSLE predictions. Secondly, a time series of daily rainfall data was used to calculate annual erosivity values, which were fitted to an appropriate distribution function. It was determined that the rainfall distribution best fitted the Pearson type III distribution function. Next, efforts were made to quantify the long term erosion and to check the suitability of the land-use and management under different thresholds of tolerance. It was found that values of erosivity in the study area with a return period of 10 years generate a mean annual erosion of 5 t ha−1 yr−1. On the study scale, RUSLE allowed us to locate the most erosive areas and to combine the suitability of the soil land-use and the management with the frequency of the annual erosivity. In addition, an annual sediment delivery ratio of approximately 47% was estimated for the period 2005–2006.

  5. Spatial and model-order based reactor signal analysis methodology for BWR core stability evaluation

    A new methodology for the boiling water reactor core stability evaluation from measured noise signals has been recently developed and adopted at the Paul Scherrer Institut (PSI). This methodology consists in a general reactor noise analysis where as much as possible information recorded during the tests is investigated prior to determining core representative stability parameters, i.e. the decay ratio (DR) and the resonance frequency, along with an associated estimate of the uncertainty range. A central part in this approach is that the evaluation of the core stability parameters is performed not only for a few but for ALL recorded neutron flux signals, allowing thereby the assessment of signal-related uncertainties. In addition, for each signal, three different model-order optimization methods are systematically employed to take into account the sensitivity upon the model-order. The current methodology is then applied to the evaluation of the core stability measurements performed at the Leibstadt NPP, Switzerland, during cycles 10, 13 and 19. The results show that as the core becomes very stable, the method-related uncertainty becomes the major contributor to the overall uncertainty range while for intermediate DR values, the signal-related uncertainty becomes dominant. However, as the core stability deteriorates, the method-related and signal-related spreads have similar contributions to the overall uncertainty, and both are found to be small. The PSI methodology identifies the origin of the different contributions to the uncertainty. Furthermore, in order to assess the results obtained with the current methodology, a comparative study is for completeness carried out with respect to results from previously developed and applied procedures. The results show a good agreement between the current method and the other methods

  6. A Status Report on the AAS Astronomy Ambassadors Program

    Fienberg, Richard Tresch; Fraknoi, Andrew; Gurton, Suzanne; Hurst, Anna; Schatz, Dennis L.

    2014-06-01

    The American Astronomical Society, in partnership with the Astronomical Society of the Pacific (ASP), has launched a series of professional-development workshops and a community of practice designed to improve early-career astronomers’ ability to communicate effectively with students and the public. Called AAS Astronomy Ambassadors, the program provides training and mentoring for young astronomers, from advanced undergraduates to beginning faculty; it also provides them access to resources and a network of contacts within the astronomy education and public outreach (EPO) community. Ambassadors are provided with a library of outreach activities and resource materials suitable for a range of venues and audiences. For much of this library we are using resources developed by organizations such as the ASP, the Pacific Science Center, and the Center for Astronomy Education for other outreach programs, though some resources have been created by one of us (AF) specifically for this program. After a period of evaluation and revision, the program’s “Menu of Outreach Opportunities for Science Education” (MOOSE) is now posted on the AAS website at http://aas.org/outreach/moose-menu-outreach-opportunities-science-education.The first two Astronomy Ambassadors workshops were held at AAS meetings in January 2013 and January 2014; each served 30 young astronomers chosen from about twice that many applicants. Web-based follow-up activities are being provided through a website at the ASP designed to keep cohorts of educators trained in their programs in touch with one another. The AAS is exploring ways to fund additional workshops at future winter meetings; suggestions are most welcome. Meanwhile, the Astronomy Ambassadors trained to date have logged more than 150 outreach events, reaching many thousands of children and adults across the U.S. and Canada.

  7. Lamination sheet of AA BST magnet

    1979-01-01

    The AA had 2 types of bending magnets: BLG (window-frame, long and narrow)and BST (H-type, short and wide). The BST had a very wide aperture, 0.564 m of "good field". To demonstrate the size, the petite AA secretary, Val Mansfield, poses with a lamination sheet. See also 7811105, 7906163, 8006050.

  8. Evaluating remote sensing of deciduous forest phenology at multiple spatial scales using PhenoCam imagery

    S. T. Klosterman

    2014-02-01

    forest cover. These results quantify the effect of landscape heterogeneity when aggregating to the coarser spatial scales of remote sensing, and demonstrate the importance of accurate curve fitting and vegetation index selection when analyzing and interpreting phenology time series.

  9. Substantial enhancement in the anticorrosivity of AA6061 by Doxycycline hydrochloride drug

    Mudigere Krishnegowda Pavithra; Thimmappa Venkatarangaiah Venkatesha; Mudigere Krishnegowda Punith Kumar; Nanjanagudu Subba Rao Anantha

    2015-01-01

    The significant anticorrosive property of the antibiotic drug doxycycline hydrochloride (DCH) was investigated by electrochemical techniques such as potentiodynamic polarization, electrochemical impedance and chronoamperometric techniques. DCH inhibited the pitting corrosion of aluminium alloy 6061 (AA6061) in 3.5% NaCl media with 90% efficiency. The adsorption of DCH on AA6061 conform Langmuir isotherm by means of physisorption.  Quantum chemical calculations were evaluated to ascertain the ...

  10. Evaluation of spatial pressure distribution during ice-structure interaction using pressure indicating film

    Kim Hyunwook

    2014-09-01

    Full Text Available Understanding of ‘spatial’ pressure distribution is required to determine design loads on local structures, such as plating and framing. However, obtaining a practical ‘spatial’ pressure distribution is a hard task due to the sensitivity of the data acquisition frequency and resolution. High-resolution Pessure-Idicating Flm (PIF was applied to obtain pressure distribution and pressure magnitude using stepped crushing method. Different types of PIF were stacked at each test to creating a pressure distribution plot at specific time steps. Two different concepts of plotting ‘spatial’ pressure-area curve was introduced and evaluated. Diverse unit pixel size was chosen to investigate the effect of the resolution in data analysis. Activated area was not significantly affected by unit pixel size; however, total force was highly sensitive

  11. The thioacetate-ω(γ-lactam carboxamide) HDAC inhibitor ST7612AA1 as HIV-1 latency reactivation agent.

    Badia, Roger; Grau, Judith; Riveira-Muñoz, Eva; Ballana, Ester; Giannini, Giuseppe; Esté, José A

    2015-11-01

    Antiretroviral therapy (ART) is unable to cure HIV infection. The ability of HIV to establish a subset of latent infected CD4(+) T cells, which remain undetectable to the immune system, becomes a major roadblock to achieve viral eradication. Histone deacetylase inhibitors (HDACi) have been shown to potently induce the reactivation of latent HIV. Here, we show that a new thiol-based HDACi, the thioacetate-ω(γ-lactam carboxamide) derivative ST7612AA1, is a potent inducer of HIV reactivation. We evaluated HIV reactivation activity of ST7612AA1 compared to panobinostat (PNB), romidepsin (RMD) and vorinostat (VOR) in cell culture models of HIV-1 latency, in latently infected primary CD4(+) T lymphocytes and in PBMCs from HIV(+) patients. ST7612AA1 potently induced HIV-1 reactivation at submicromolar concentrations with comparable potency to panobinostat or superior to vorinostat. The presence of known antiretrovirals did not affect ST7612AA1-induced reactivation and their activity was not affected by ST7612AA1. Cell proliferation and cell activation were not affected by ST7612AA1, or any other HDACi used. In conclusion, our results indicate that ST7612AA1 is a potent activator of latent HIV and that reactivation activity of ST7612AA1 is exerted without activation or proliferation of CD4(+) T cells. ST7612AA1 is a suitable candidate for further studies of HIV reactivation strategies and potential new therapies to eradicate the viral reservoirs. PMID:26348004

  12. Evaluation of a low-dose digital X-ray system with improved spatial resolution

    We present results from an evaluation of a significantly improved version of the Siberian Digital Radiographic Device (SDRD). The SDRD is already in clinical use in Novosibirsk and Moscow where it produces images of high diagnostic value at considerably lower doses than conventional film-screen combinations. It uses a fast multiwire proportional chamber with highly parallel readout as a detector. Improvements in the readout system have given a reduction by a factor of two in the pixel size. We have used well established methods to compare imaging performance of the new SDRD with the old version as well as with a film-screen combination used in routine clinical practice in the UK. At the same level of exposure the threshold contrast for objects of the order of the pixel size is two times better for the new SDRD than for the old one, and the minimum size of objects visible in the image is two times smaller (0.25 mm) for the new system than for the old SDRD (0.5 mm). ((orig.))

  13. Performance Evaluation of Closed-Loop Spatial Multiplexing Codebook Based on Indoor MIMO Channel Measurement

    Junjun Gao

    2012-01-01

    Full Text Available Closed-loop MIMO technique standardized in LTE can support different layer transmissions through precoding operation to match the channel multiplexing capability. However, the performance of the limited size codebook still needs to be evaluated in real channel environment for further insights. Based on the wideband MIMO channel measurement in a typical indoor scenario, capacity loss (CL of the limited size codebook relative to perfect precoding is studied first in two extreme channel conditions. The results show that current codebook design for single layer transmission is nearly capacity lossless, and the CL will increase with the number of transmitted layers. Furthermore, the capacity improvement of better codebook selection criterions is very limited compared to CL. Then we define the maximum capacity boost achieved by frequency domain layer adaption (FDLA and investigate its sensitivity to SNR and channel condition. To survey the effect of frequency domain channel variation on MIMO-OFDM system, we define a function to measure the fluctuation levels of the key channel metrics within a subband and reveal the inherent relationship between them. Finally, a capacity floor resulted as the feedback interval increases in frequency domain.

  14. Evaluation of the spatial patterns and risk factors, including backyard pigs, for classical swine fever occurrence in Bulgaria using a Bayesian model

    Beatriz Martínez-López; Tsviatko Alexandrov; Lina Mur; Fernando Sánchez-Vizcaíno; Sánchez-Vizcaíno, José M.

    2014-01-01

    The spatial pattern and epidemiology of backyard pig farming and other low bio-security pig production systems and their role in the occurrence of classical swine fever (CSF) is described and evaluated. A spatial Bayesian model was used to explore the risk factors, including human demographics, socioeconomic and environmental factors. The analyses were performed for Bulgaria, which has a large number of backyard farms (96% of all pig farms in the country are classified as backyard farms), and...

  15. Clinical evaluation of PET image reconstruction using a spatial resolution model

    Purpose: PET image resolution is variable across the measured field-of-view and described by the point spread function (PSF). When accounting for the PSF during PET image reconstruction image resolution is improved and partial volume effects are reduced. Here, we evaluate the effect of PSF-based reconstruction on lesion quantification in routine clinical whole-body (WB) PET/CT imaging. Materials and methods: 41 oncology patients were referred for a WB-PET/CT examination (Biograph 40 TruePoint). Emission data were acquired at 2.5 min/bed at 1 h pi of 400 MBq [18F]-FDG. Attenuation-corrected PET images were reconstructed on 336 × 336-matrices using: (R1) standard AW-OSEM (4 iter, 8 subsets, 4 mm Gaussian) and (R2) AW-OSEM with PSF (3 iter, 21 subsets, 2 mm). Blinded and randomised reading of R1- and R2-PET images was performed. Individual lesions were located and counted independently on both sets of images. The relative change in PET quantification (SUVmax, SUVmean, volume) of lesions seen on R1 and R2 is reported as (R2 − R1)/R1. Furthermore, SUVmax and SUVmean was measured for a 3 cm spherical norm region in the right lobe of the healthy liver for R1 and R2. Results: Clinical reading revealed 91 and 103 positive lesions for R1 and R2, respectively. For all lesions SUVmax (R2) was higher than SUVmax (R1). Regression analysis indicated that the relative increase in SUVmax (and SUVmean) decreased with lesion size, whilst it increased with increasing radial distance from the centre of the field of view (FOV). There was no significant difference in SUVmean in homogenous liver tissue between R1 and R2. Conclusion: In whole-body FDG-PET/CT using routine clinical protocols, PSF-based PET reconstruction increases lesion detection and affects SUVmax measurements compared to standard AW-OSEM PET reconstruction

  16. The power of alternative assessments (AAs)

    张千茜

    2013-01-01

    This article starts by discussing the potential disadvantages of traditional assessment towards young English as a Second Language (ESL) learners within the American public school education system. In response to such disadvantages, researchers ’call for the implementation of alternative assessments (AAs) is therefore introduced along with the various benefits of AAs. However, the current mainstream education policy in the US, namely No Child Left Behind (NCLB) Policy, is still largely based on the tra-ditional ways of testing, making policy-oriented implementation of AAs on large scales remarkably difficult. After careful analysis, the author points out several implications concerning how, under such an existing policy of NCLB, can practitioners effectively accommodate young ESL learners by applying the power of AAs.

  17. Friction Stir Weldabilities of AA1050-H24 and AA6061-T6 Aluminum Alloys

    Huijie LIU; Hidetoshi FUJIN; Masakatsu MAEDA; Kiyoshi NOGI

    2005-01-01

    The friction stir weldabilities of the strain-hardened AA1050-H24 and precipitate-hardened AA6061-T6 aluminum alloys were examined to reveal the effects of material properties on the friction stir welding behavior. The experimental results are obtlained. (1) For AA1050-H24, the weld can possess smoother surface ripples; there is no elliptical weld nugget in the weld; there is no discernible interface between the stir zone and the thermomechanically affected zone;and the internal defect of the weld looks like a long crack and is located in the lower part of the weld. (2) For AA6061-T6, the weld usually possesses slightly rougher surface ripples; an elliptical weld nugget clearly exists in the weld; there are discernible interfaces among the weld nugget, thermomechanically affected zone and heat affected zone; and the internal defect of the weld is similar to that of the AA1050-H24 weld. (3) The effective range of welding parameters for AA1050-H24 is narrow, while the one for AA6061-T6 is very wide. (4) The maximum tensile strength efficiency of the AA1050-H24 joints is similar to that of the AA6061-T6 joints, i.e. 79% and 77%, respectively.

  18. AAS 228: Day 3 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session 2015 Newton Lacy Pierce Prize Lecture: The Elephant in the Room: Effects of Distant, Massive Companions on Planetary System Architectures (by Leonardo dos Santos)The first session on Wednesday at 228th AAS Meeting was the Newton Lacy Pierce Prize Lecture by Heather Knutson (California Institute of Technology). This talk featured a broad range of research efforts on exoplanets, with the main focus on how we study the composition of their atmospheres, and how multi-body interactions carve the structure of the planetary systems we observe.One of her first points is the well-known idea that the Solar System is an oddball, compared to the exoplanet systems we have found so far: most of these systems contain hot Jupiters and mini-Neptunes at very close-in orbits around their host stars. Moreover, even when studying their transmission spectra, it is difficult to know the exact composition of their atmospheres.Knutson: it is difficult to constrain atmospheric composition of exoplanets (H-poor or H-rich+clouds?) #aas228pic.twitter.com/LdyN4o9RC7 astrobites (@astrobites) June 15, 2016The main proposal on how these systems formed is the migration scenario. In order to validate this idea, Dr. Knutson and her group The Friends of Hot Jupiters study systems with close-in gas giants and their frequency of binary companions, which are supposed to be the main culprits causing gas-giant migration. They found that approximately half of the observed systems have long-distance companions, providing strong validation of the migration scenario. Moreover, Dr. Knutson speculates that wide binaries have more

  19. Magnetic horn of the Antiproton Accumulator (AA)

    Photographic Service

    1988-01-01

    In the 1960s, the invention of this "current sheet lens" has helped to greatly improve the flux of neutrino beams. It was used again at the AA, collecting antiprotons from the production target at angles too large to fit into the acceptance of the AA. It was machined from aluminium to a thickness of 1.4 mm and pulsed at 400 kA for 15 microseconds (half-sine).

  20. Evaluation of processes controlling the geochemical constituents in deep groundwater in Bangladesh: Spatial variability on arsenic and boron enrichment

    Forty-six deep groundwater samples from highly arsenic affected areas in Bangladesh were analyzed in order to evaluate the processes controlling geochemical constituents in the deep aquifer system. Spatial trends of solutes, geochemical modeling and principal component analysis indicate that carbonate dissolution, silicate weathering and ion exchange control the major-ion chemistry. The groundwater is dominantly of Na-Cl type brackish water. Approximately 17% of the examined groundwaters exhibit As concentrations higher than the maximum acceptable limit of 10 μg/L for drinking water. Strong correlation (R2 = 0.67) of Fe with dissolved organic carbon (DOC) and positive saturation index of siderite suggests that the reductive dissolution of Fe-oxyhydroxide in presence of organic matter is considered to be the dominant process to release high content of Fe (median 0.31 mg/L) in the deep aquifer. In contrast, As is not correlated with Fe and DOC. Boron concentration in the 26% samples exceeds the standard limit of 500 μg/L, for water intended for human consumption. Negative relationships of B/Cl ratio with Cl and boron with Na/Ca ratio demonstrate the boron in deep groundwater is accompanied by brackish water and cation exchange within the clayey sediments.

  1. An expert-based approach to forest road network planning by combining Delphi and spatial multi-criteria evaluation.

    Hayati, Elyas; Majnounian, Baris; Abdi, Ehsan; Sessions, John; Makhdoum, Majid

    2013-02-01

    Changes in forest landscapes resulting from road construction have increased remarkably in the last few years. On the other hand, the sustainable management of forest resources can only be achieved through a well-organized road network. In order to minimize the environmental impacts of forest roads, forest road managers must design the road network efficiently and environmentally as well. Efficient planning methodologies can assist forest road managers in considering the technical, economic, and environmental factors that affect forest road planning. This paper describes a three-stage methodology using the Delphi method for selecting the important criteria, the Analytic Hierarchy Process for obtaining the relative importance of the criteria, and finally, a spatial multi-criteria evaluation in a geographic information system (GIS) environment for identifying the lowest-impact road network alternative. Results of the Delphi method revealed that ground slope, lithology, distance from stream network, distance from faults, landslide susceptibility, erosion susceptibility, geology, and soil texture are the most important criteria for forest road planning in the study area. The suitability map for road planning was then obtained by combining the fuzzy map layers of these criteria with respect to their weights. Nine road network alternatives were designed using PEGGER, an ArcView GIS extension, and finally, their values were extracted from the suitability map. Results showed that the methodology was useful for identifying road that met environmental and cost considerations. Based on this work, we suggest future work in forest road planning using multi-criteria evaluation and decision making be considered in other regions and that the road planning criteria identified in this study may be useful. PMID:22565600

  2. Effect of supplementation of arachidonic acid (AA) or a combination of AA plus docosahexaenoic acid on breastmilk fatty acid composition

    Smit, EN; Koopmann, M; Boersma, ER; Muskiet, FAJ

    2000-01-01

    We investigated whether supplementation with arachidonic acid (20:4 omega 6; AA), ora combination of AA and docosahexaenoic acid (22:6 omega 3; DHA) would affect human milk polyunsaturated fatty acid (PUFA) composition. Ten women were daily supplemented with 300 mg AA, eight with 300 mg AA, 110 mg e

  3. Spatial variability of POPs in European background air

    A. K. Halse

    2010-10-01

    Full Text Available Persistent organic pollutants (POPs are recognized for their potential to create harmful effects in remote areas and several monitoring programs have been established which measure POPs in air. Active air sampling (AAS has so far been the recommended method used under the EMEP (co-operative programme for monitoring and evaluation of the long-range transmissions of air pollutants in Europe measurement program. The number of EMEP AAS stations is still limited and mainly located in the north western part of Europe. Passive air sampling (PAS methods, which have become increasingly popular in recent years, offer an opportunity as a complementary sampling strategy which could improve sampling coverage under EMEP. To gain further insight into spatial patterns of POPs in European background air and to evaluate PAS as an alternative sampling technique under EMEP, PAS were deployed at 86 European background sites during summer 2006. Duplicate PAS samplers were also deployed at EMEP AAS sites to allow for a comparison of results obtained using both methods. The PAS were analyzed for selected PCBs, HCHs, DDTs, PAHs, chlordanes and HCB, and air concentrations were calculated on the basis of losses of performance reference compounds. Air concentrations of PCBs were generally lowest in more remote areas of Northern Europe with elevated levels in more densely populated areas. γ-HCH was found at elevated levels in more central parts of Europe, whereas α-HCH, β-HCH and DDTs showed higher concentrations in the southeastern part. There was no clear spatial pattern in the concentrations for PAHs, indicative of influence by local sources, rather than long range atmospheric transport (LRAT. HCB was evenly distributed across Europe, while the concentrations of chlordanes were typically low or non-detectable. Co-deployed PAS samples showed a fair agreement between the duplicates, typically within 30%. Larger differences were seen when comparing results obtained on

  4. Spatial variability of POPs in European background air

    Halse, A. K.; Schlabach, M.; Eckhardt, S.; Sweetman, A.; Jones, K. C.; Breivik, K.

    2010-10-01

    Persistent organic pollutants (POPs) are recognized for their potential to create harmful effects in remote areas and several monitoring programs have been established which measure POPs in air. Active air sampling (AAS) has so far been the recommended method used under the EMEP (co-operative programme for monitoring and evaluation of the long-range transmissions of air pollutants in Europe) measurement program. The number of EMEP AAS stations is still limited and mainly located in the north western part of Europe. Passive air sampling (PAS) methods, which have become increasingly popular in recent years, offer an opportunity as a complementary sampling strategy which could improve sampling coverage under EMEP. To gain further insight into spatial patterns of POPs in European background air and to evaluate PAS as an alternative sampling technique under EMEP, PAS were deployed at 86 European background sites during summer 2006. Duplicate PAS samplers were also deployed at EMEP AAS sites to allow for a comparison of results obtained using both methods. The PAS were analyzed for selected PCBs, HCHs, DDTs, PAHs, chlordanes and HCB, and air concentrations were calculated on the basis of losses of performance reference compounds. Air concentrations of PCBs were generally lowest in more remote areas of Northern Europe with elevated levels in more densely populated areas. γ-HCH was found at elevated levels in more central parts of Europe, whereas α-HCH, β-HCH and DDTs showed higher concentrations in the southeastern part. There was no clear spatial pattern in the concentrations for PAHs, indicative of influence by local sources, rather than long range atmospheric transport (LRAT). HCB was evenly distributed across Europe, while the concentrations of chlordanes were typically low or non-detectable. Co-deployed PAS samples showed a fair agreement between the duplicates, typically within 30%. Larger differences were seen when comparing results obtained on the basis of AAS

  5. A Flare Observed in Coronal, Transition Region and Helium I 10830 \\AA\\ Emissions

    Zeng, Zhicheng; Cao, Wenda; Judge, Philip G

    2014-01-01

    On June 17, 2012, we observed the evolution of a C-class flare associated with the eruption of a filament near a large sunspot in the active region NOAA 11504. We obtained high spatial resolution filtergrams using the 1.6 m New Solar Telescope at the Big Bear Solar Observatory in broad-band TiO at 706 nm (bandpass:10 \\AA) and He I 10830 \\AA\\ narrow-band (bandpass: 0.5 \\AA, centered 0.25 \\AA\\ to the blue). We analyze the spatio-temporal behavior of the He I 10830 \\AA\\ data, which were obtained over a 90" X 90" field of view with a cadence of 10 sec. We also analyze simultaneous data from the Atmospheric Imaging Assembly and Extreme Ultraviolet Variability Experiment instruments on board the Solar Dynamics Observatory spacecraft, and data from Reuven Ramaty High Energy Solar Spectroscopic Imager and GOES spacecrafts. Non-thermal effects are ignored in this analysis. Several quantitative aspects of the data, as well as models derived using the "0D" Enthalpy-Based Thermal Evolution of Loops model (EBTEL: Klimchuk...

  6. AAS 228: Day 1 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session: From Space Archeology to Serving the World Today: A 20-year Journey from the Jungles of Guatemala to a Network of Satellite Remote Sensing Facilities Around the World(by Michael Zevin)In the conferences second plenary session, NASAs Daniel Irwin turned the eyes of the conference back to Earth by highlighting the huge impact that NASA missions play in protecting and developing our own planet.Daniel Irwin: using satellite imagery to detect differences in vegetation and find ancient Mayan cities. #aas228 pic.twitter.com/9LFPQdCHTM astrobites (@astrobites) June 13, 2016Irwin came to be involved in NASA through his work mapping Guatemalan jungles, where he would spend 22 days at a time exploring the treacherous jungles on foot armed with a 1st generation GPS, a compass, and a machete. A colleague introduced Irwin to the satellite imagery thathe was exploring, demonstratinghow these images are a strong complement to field work. The sharing of this satellite data with nearby villages helped to show the encroachment of agriculture and the necessity of connecting space to the village. Satellite imagery also played a role in archeological endeavors, uncovering dozens of Mayan cities that have been buried for over a millennia by vegetation, and it provided evidence that the fall of the Mayan civilization may have been due to massive deforestation that ledto drought.Glacial retreat in Chile imaged by ISERV.Irwin displayed the constellation of NASAs Earth-monitoring satellites that have played an integral role in conserving our planet and alerting the world of natural disasters. He also showed

  7. Are Gender Differences in Spatial Ability Real or an Artifact? Evaluation of Measurement Invariance on the Revised PSVT:R

    Maeda, Yukiko; Yoon, So Yoon

    2016-01-01

    We investigated the extent to which the observed gender differences in mental rotation ability among the 2,468 freshmen studying engineering at a Midwest public university attributed to the gender bias of a test. The Revised Purdue Spatial Visualization Tests: Visualization of Rotations (Revised PSVT:R) is a spatial test frequently used to measure…

  8. Spatial resolution evaluation with a pair of two four-layer DOI detectors for small animal PET scanner: jPET-RD

    Nishikido, Fumihiko [National Institute of Radiological Sciences, Anagawa 4-9-1 Inage-ku, Chiba-shi, Chiba 263-8555 (Japan)], E-mail: funis@nirs.go.jp; Tsuda, Tomoaki [Shimadzu Corporation, Nishinokyo Kuwabaracho 1 Nakagyo-ku, Kyoto-shi, Kyoto 604-8511 (Japan); Yoshida, Eiji; Inadama, Naoko; Shibuya, Kengo; Yamaya, Taiga [National Institute of Radiological Sciences, Anagawa 4-9-1 Inage-ku, Chiba-shi, Chiba 263-8555 (Japan); Kitamura, Keishi [Shimadzu Corporation, Nishinokyo Kuwabaracho 1 Nakagyo-ku, Kyoto-shi, Kyoto 604-8511 (Japan); Takahashi, Kei [National Institute of Radiological Sciences, Anagawa 4-9-1 Inage-ku, Chiba-shi, Chiba 263-8555 (Japan); Graduate School of Science and Technology, Chiba University, Yayoi-cho 1-33, Inage-ku, Chiba-shi, Chiba 263-8522 (Japan); Ohmura, Atsushi [National Institute of Radiological Sciences, Anagawa 4-9-1 Inage-ku, Chiba-shi, Chiba 263-8555 (Japan); Graduate School of Advanced Science and Engineering, Waseda University, Okubo 3-4-1, Shinjuku-ku, Tokyo 169-8555 (Japan); Murayama, Hideo [National Institute of Radiological Sciences, Anagawa 4-9-1 Inage-ku, Chiba-shi, Chiba 263-8555 (Japan)

    2008-01-01

    We are developing a small animal PET scanner, 'jPET-RD' to achieve high sensitivity as well as high spatial resolution by using four-layer depth-of-interaction (DOI) detectors. The jPET-RD is designed with two detector rings. Each detector ring is composed of six DOI detectors arranged hexagonally. The diameter of the field-of-view (FOV) is 8.8 cm, which is smaller than typical small animal PET scanners on the market now. Each detector module consists of a crystal block and a 256-channel flat panel position-sensitive photomultiplier tube. The crystal block, consisting of 32x32x4 crystal (4096 crystals, each 1.46 mmx1.46 mmx4.5 mm) and a reflector, is mounted on the 256ch FP-PMT. In this study, we evaluated the spatial resolution of reconstructed images with the evaluation system of two four-layer DOI detectors which consist of 32x32x4 LYSO (Lu: 98%, Y: 2%) crystals coupled on the 256ch FP-PMT by using RTV rubber. The spatial resolution of 1.5 mm was obtained at the center of the FOV by the filtered back projection. The spatial resolution, better than 2 mm in the whole FOV, was also achieved with DOI while the spatial resolution without DOI was degraded to 3.3 mm.

  9. Spatial Analysis of the National Evaluation of Scholastic Achievement (ENLACE in Schools of the Municipality of Juarez, Chihuahua

    Luis Ernesto Cervera Gómez

    2008-05-01

    Full Text Available This research was focused on analyzing the results of the first National Assessment of Academic Achievement for Scholar Centers (ENLACE; acronym in Spanish applied during the year 2006 in the Municipality of Juarez (State of Chihuahua, Mexico. In order to conduct the spatial analysis a geographical information system (GIS was used to make a georeferenced database were all variables were connected to a point representing a school. Results of the examinations expressed as deficient, elemental, good en excellent were spatially distributed over the urban area of Ciudad Juárez. Apparently there is a high spatial correlation between ENLACE’s results with the socioeconomic level of people. In this way results going from good to excellent were spatially located over the sectors more developed of the city. Poor results going from Insufficient to Elemental were spatially located at places with higher deficits of infrastructure and low socioeconomic levels.

  10. The AA disappearing under concrete shielding

    1982-01-01

    When the AA started up in July 1980, the machine stood freely in its hall, providing visitors with a view through the large window in the AA Control Room. The target area, in which the high-intensity 26 GeV/c proton beam from the PS hit the production target, was heavily shielded, not only towards the outside but also towards the AA-Hall. However, electrons and pions emanating from the target with the same momentum as the antiprotons, but much more numerous, accompanied these through the injection line into the AA ring. The pions decayed with a half-time corresponding to approximately a revolution period (540 ns), whereas the electrons lost energy through synchrotron radiation and ended up on the vacuum chamber wall. Electrons and pions produced the dominant component of the radiation level in the hall and the control room. With operation times far exceeding original expectations, the AA had to be buried under concrete shielding in order to reduce the radiation level by an order of magnitude.

  11. Bt rice expressing Cry2Aa does not harm Cyrtorhinus lividipennis, a main predator of the nontarget herbivore Nilapavarta lugens.

    Yu Han

    Full Text Available T2A-1 is a newly developed transgenic rice that expresses a synthesized cry2Aa gene driven by the maize ubiquitin promoter. T2A-1 exhibits high resistance against lepidopteran pests of rice. The brown planthopper, Nilapavarta lugens (Stål, is a main nontarget sap-sucking insect pest of rice, and Cyrtorhinus lividipennis (Reuter is the major predator of the eggs and young nymphs of planthoppers. As C. lividipennis may expose to the Cry2Aa protein via N. lugens, it is therefore essential to assess the potential effects of transgenic cry2Aa rice on this predator. In the present study, three experiments were conducted to evaluate the ecological risk of transgenic cry2Aa rice to C. lividipennis: (1 a direct feeding experiment in which C. lividipennis was fed an artificial diet containing Cry2Aa at the dose of 10-time higher than that it may encounter in the realistic field condition; (2 a tritrophic experiment in which the Cry2Aa protein was delivered to C. lividipennis indirectly through prey eggs or nymphs; (3 a realistic field experiment in which the population dynamics of C. lividipennis were investigated using vacuum-suction. Both direct exposure to elevated doses of the Cry2Aa protein and prey-mediated exposure to realistic doses of the protein did not result in significant detrimental effects on the development, survival, female ratio and body weight of C. lividipennis. No significant differences in population density and population dynamics were observed between C. lividipennis in transgenic cry2Aa and nontransgenic rice fields. It may be concluded that transgenic cry2Aa rice had no detrimental effects on C. lividipennis. This study represents the first report of an assessment continuum for the effects of transgenic cry2Aa rice on C. lividipennis.

  12. Dicty_cDB: FCL-AA03 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA03 (Link to dictyBase) - - - Contig-U15092-1 FCL-AA03E ...(Link to Original site) - - - - - - FCL-AA03E 627 Show FCL-AA03 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA03Q.Seq.d/ Representative seq. ID FCL-AA...03E (Link to Original site) Representative DNA sequence >FCL-AA03 (FCL-AA03Q) /CSM/FCL/FCL-AA/FCL-AA...03Q.Seq.d/ ACATAATGTTCCAAAAGAAAGCAATTGTTATTGATGGCAAAGGTCATTTGTTAGGTCGTT TAGCCTCCGTTGTTGCTAAATCCCTCCTCTCTGGTCAAAA

  13. Dicty_cDB: FCL-AA02 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA02 (Link to dictyBase) - - - Contig-U16560-1 FCL-AA02F ...(Link to Original site) FCL-AA02F 620 - - - - - - Show FCL-AA02 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ Representative seq. ID FCL-AA...02F (Link to Original site) Representative DNA sequence >FCL-AA02 (FCL-AA02Q) /CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ ATTAA...ATACAAAATACAAATACAAATAACAAATACTTTACTATAGCTTTTTTTTCTTATT TATTTCTCCAAATAATTTTTTAATATGCAAATCTTTGTTAAAA

  14. Dicty_cDB: FCL-AA09 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA09 (Link to dictyBase) - - - Contig-U16453-1 FCL-AA09F ...(Link to Original site) FCL-AA09F 485 - - - - - - Show FCL-AA09 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ Representative seq. ID FCL-AA...09F (Link to Original site) Representative DNA sequence >FCL-AA09 (FCL-AA09Q) /CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ GACAA...AAGTAAATAAAACATGTCCGCAAGTAATAAAGATGACCAACTCATGAAAAATGAG TTCGAAAGTACCTACGACAAAATTGTCGATTCATTCGACAA

  15. Dicty_cDB: FCL-AA08 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA08 (Link to dictyBase) - - - Contig-U16200-1 FCL-AA08Z ...(Link to Original site) - - FCL-AA08Z 574 - - - - Show FCL-AA08 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA08Q.Seq.d/ Representative seq. ID FCL-AA...08Z (Link to Original site) Representative DNA sequence >FCL-AA08 (FCL-AA08Q) /CSM/FCL/FCL-AA/FCL-AA...08Q.Seq.d/ XXXXXXXXXXTCGAAGCCAAAGGTCGTCTCGAAGAAGAATTCCATCGCTCGTACCAACTC TGATCGTTCAAGAAAGAGACTCGAAGCTGAAA

  16. Dicty_cDB: FC-AA09 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA09 (Link to dictyBase) - - - Contig-U15086-1 FC-AA09E (Li...nk to Original site) - - - - - - FC-AA09E 562 Show FC-AA09 Library FC (Link to library) Clone ID FC-AA09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA09Q.Seq.d/ Representative seq. ID FC-AA...09E (Link to Original site) Representative DNA sequence >FC-AA09 (FC-AA09Q) /CSM/FC/FC-AA/FC-AA09Q.Seq....d/ GATACATTATCACCATGGCAGGAAAAAAAGTCAAATCTAACACACCAAAACAAGACTTAT CTGTCTCTAAATCAAAGCTCACCAGCATTAAAGCCCCAGCTGCTGCCATCAAAGCTAAA

  17. Dicty_cDB: FC-AA14 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA14 (Link to dictyBase) - - - Contig-U15088-1 FC-AA14E (Li...nk to Original site) - - - - - - FC-AA14E 431 Show FC-AA14 Library FC (Link to library) Clone ID FC-AA14 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA14Q.Seq.d/ Representative seq. ID FC-AA...14E (Link to Original site) Representative DNA sequence >FC-AA14 (FC-AA14Q) /CSM/FC/FC-AA/FC-AA14Q.Seq.d/ CTATGTCTGAAATCAAAA...CTGAAGAACTCGCTTGCATCTACTCCGGTCTTTTATTACAAG ATGACGGTATTGAAATCACCGCTGATAAAATCAAAACCTTATTAGAAGCTGCCAA

  18. Dicty_cDB: FCL-AA04 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA04 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA04Z ...(Link to Original site) - - FCL-AA04Z 530 - - - - Show FCL-AA04 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA04Q.Seq.d/ Representative seq. ID FCL-AA...04Z (Link to Original site) Representative DNA sequence >FCL-AA04 (FCL-AA04Q) /CSM/FCL/FCL-AA/FCL-AA...04Q.Seq.d/ XXXXXXXXXXCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTTCAGTCAAAGAAATT AAAAGAGGTATGGTCGCTGGTGACTCCAAAAACGATCCACCACAAGAAA

  19. Dicty_cDB: FC-AA20 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA20 (Link to dictyBase) - - - Contig-U16455-1 FC-AA20Z (Li...nk to Original site) - - FC-AA20Z 607 - - - - Show FC-AA20 Library FC (Link to library) Clone ID FC-AA20 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA20Q.Seq.d/ Representative seq. ID FC-AA...20Z (Link to Original site) Representative DNA sequence >FC-AA20 (FC-AA20Q) /CSM/FC/FC-AA/FC-AA20Q.Seq....d/ XXXXXXXXXXCTTTGCCCCAGCTGGTCTCTCAACTGAAGTCAAATCAGTCGAAATGCATC ACGAACAACTCCCAGAAGCCCGTCCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTT CAGTCAA

  20. Dicty_cDB: FCL-AA15 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA15 (Link to dictyBase) - - - Contig-U16011-1 FCL-AA15Z ...(Link to Original site) - - FCL-AA15Z 442 - - - - Show FCL-AA15 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA15Q.Seq.d/ Representative seq. ID FCL-AA...15Z (Link to Original site) Representative DNA sequence >FCL-AA15 (FCL-AA15Q) /CSM/FCL/FCL-AA/FCL-AA...15Q.Seq.d/ XXXXXXXXXXCCATTCATCTGTCCAATCGATTGTCGTCGTGGTCTCTACAAGAATATCGT CTTATCTGGTGGTTCAACCATGTTTAAAGATTTTGGTAAACGTCTTCAA

  1. Dicty_cDB: FC-AA13 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA13 (Link to dictyBase) - - - Contig-U15674-1 FC-AA13Z (Li...nk to Original site) - - FC-AA13Z 528 - - - - Show FC-AA13 Library FC (Link to library) Clone ID FC-AA13 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA13Q.Seq.d/ Representative seq. ID FC-AA...13Z (Link to Original site) Representative DNA sequence >FC-AA13 (FC-AA13Q) /CSM/FC/FC-AA/FC-AA13Q.Seq.d/ XXXXXXXXXXAAAGCAAA...CTCGTGCTGGTCAACGTACCCGTTTCAAGGCTTTCGTCGTTG TTGGTGATCACAACGGTCATGTAGGTCTCGGTGTTAAATGCGCTAAGGAA

  2. Dicty_cDB: FCL-AA20 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA20 (Link to dictyBase) - - - Contig-U15052-1 FCL-AA20E ...(Link to Original site) - - - - - - FCL-AA20E 1159 Show FCL-AA20 Library FCL (Link to library) Clone ID FCL-AA...L http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ Representative seq. ID FCL-AA...20E (Link to Original site) Representative DNA sequence >FCL-AA20 (FCL-AA20Q) /CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ AAAA...CATTTACAAATGATGACCACAGAAGATGTACAACCAATTGAAACTACCAAAGATGG TGTAGTAGTATTAAATTATAGCGATTTAATTGCAGGTAAA

  3. Dicty_cDB: FC-AA23 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA23 (Link to dictyBase) - - - Contig-U16090-1 FC-AA23E (Li...nk to Original site) - - - - - - FC-AA23E 387 Show FC-AA23 Library FC (Link to library) Clone ID FC-AA23 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA23Q.Seq.d/ Representative seq. ID FC-AA...23E (Link to Original site) Representative DNA sequence >FC-AA23 (FC-AA23Q) /CSM/FC/FC-AA/FC-AA23Q.Seq.d/ AAACTCGATTATATTCTTAA...TCTTAAAGTTCAAGATTTCATGGAAAGACGTCTCCAAACT TTAGTCTTCAAAAATGGTCTTGCCAAATCAATCCATCACGCTCGTGTTTTAATCAAA

  4. Dicty_cDB: FC-AA12 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA12 (Link to dictyBase) - - - Contig-U15087-1 FC-AA12E (Li...nk to Original site) - - - - - - FC-AA12E 454 Show FC-AA12 Library FC (Link to library) Clone ID FC-AA12 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA12Q.Seq.d/ Representative seq. ID FC-AA...12E (Link to Original site) Representative DNA sequence >FC-AA12 (FC-AA12Q) /CSM/FC/FC-AA/FC-AA12Q.Seq.d/ AAATAATAATAATATAAAAA...TGGAAATTAAAGTTTTAGCTAAAAGAAAAGTATCAGCAAA ACGTGCAAATGAAATATTAGGAAAATTTATTTTAGAAAGAAAAGCAAATGAAGAAAA

  5. Dicty_cDB: FC-AA01 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA01 (Link to dictyBase) - - - Contig-U15084-1 FC-AA01E (Li...nk to Original site) - - - - - - FC-AA01E 701 Show FC-AA01 Library FC (Link to library) Clone ID FC-AA01 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA01Q.Seq.d/ Representative seq. ID FC-AA...01E (Link to Original site) Representative DNA sequence >FC-AA01 (FC-AA01Q) /CSM/FC/FC-AA/FC-AA01Q.Seq.d/ GAGAAATATTTCTTATTAA...CAATTGCATGCGTTGTATTCAACCCAACATGGTGGAATATT ACAGCAAGAATGGAATATAATGCTAATAAATAACAACCATTTTCTTTACTTCCACAAA

  6. Dicty_cDB: FCL-AA10 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA10 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA10Z ...(Link to Original site) - - FCL-AA10Z 627 - - - - Show FCL-AA10 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA10Q.Seq.d/ Representative seq. ID FCL-AA...10Z (Link to Original site) Representative DNA sequence >FCL-AA10 (FCL-AA10Q) /CSM/FCL/FCL-AA/FCL-AA...10Q.Seq.d/ XXXXXXXXXXTAAACCAGGTATGGTCGTCACCTTTTGCCCCAGCTGGTCTCTCAACTGAA GTCAAATCAGTCGAAATGCATCACGAACAACTCCCAGAA

  7. Dicty_cDB: FC-AA19 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA19 (Link to dictyBase) - - - Contig-U16072-1 FC-AA19F (Li...nk to Original site) FC-AA19F 539 - - - - - - Show FC-AA19 Library FC (Link to library) Clone ID FC-AA19 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA19Q.Seq.d/ Representative seq. ID FC-AA...19F (Link to Original site) Representative DNA sequence >FC-AA19 (FC-AA19Q) /CSM/FC/FC-AA/FC-AA19Q.Seq.d/ CAGAAA...TCACTGGTTTTTCATTCCAATTATTTAATATTATCAGTATTTGGAATGTTGATC AAACATCATTCAATAGCTACAGTCTTCCAATTTGGTTACCAGCCATTCAA

  8. Dicty_cDB: FC-AA02 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA02Q.Seq.d/ Representative seq. ID FC-AA...02Z (Link to Original site) Representative DNA sequence >FC-AA02 (FC-AA02Q) /CSM/FC/FC-AA/FC-AA02Q.Seq.d/ XXXXXXXXXXCAAAAA...GGCTCCTGGTCCGGAAGGATTGGGTAATCATTTGAATTTCCTAC GTAACTGGGCTTGATCTTTGTAATTATTGATCATAAACGAGGAATTCCTTGTAAGCGTAA

  9. Dicty_cDB: FCL-AA24 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA24 (Link to dictyBase) - - - Contig-U16467-1 FCL-AA24E ...(Link to Original site) - - - - - - FCL-AA24E 779 Show FCL-AA24 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA24Q.Seq.d/ Representative seq. ID FCL-AA...24E (Link to Original site) Representative DNA sequence >FCL-AA24 (FCL-AA24Q) /CSM/FCL/FCL-AA/FCL-AA...24Q.Seq.d/ CTAGAAATTTCTAAACAATTATTTATTTGAAGAGGTTTTTTAAAAAAAGAAAAAAATCAG AGCATCCAAATAATAACCGCAGTAAGGGGGGGATGGTTGTTAA

  10. Dicty_cDB: FCL-AA05 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA05 (Link to dictyBase) - - - Contig-U16473-1 FCL-AA05Z ...(Link to Original site) - - FCL-AA05Z 603 - - - - Show FCL-AA05 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA05Q.Seq.d/ Representative seq. ID FCL-AA...05Z (Link to Original site) Representative DNA sequence >FCL-AA05 (FCL-AA05Q) /CSM/FCL/FCL-AA/FCL-AA...05Q.Seq.d/ XXXXXXXXXXTGGCGCCATCATTACTGGTGGAGGTGGTGTTGCTATCACTCAAGCTCAAC CATCATACCAAGCTGATGCCGTTGCCACTTACATCAAAA

  11. AAS 228: Day 2 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  12. AAS 228: Day 2 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  13. AAS 228: Day 2 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  14. Spatial planning

    Dimitrov, Nikola; Koteski, Cane

    2016-01-01

    The professional book ,, Space planning "processed chapters on: space, concept and definition of space, space as a system, spatial economics, economic essence of space, space planning, social determinants of spatial planning, spatial planning as a process, factors development and elements in spatial planning, methodology, components and content of spatial planning stages and types of preparation of spatial planning, spatial planning and industrialization, industrialization, urbanization and s...

  15. Multicomponent He I 10830 {\\AA} profiles in an active filament

    Sasso, C; Solanki, S K

    2011-01-01

    We present new spectropolarimetric observations of the chromospheric He I 10830 {\\AA} multiplet observed in a filament during its phase of activity. The data were recorded with the new Tenerife Infrared Polarimeter (TIP-II) at the German Vacuum Tower Telescope (VTT) on 2005 May 18. We inverted the He Stokes profiles using multiple atmospheric components. The observed He Stokes profiles display a remarkably wide variety of shapes. Most of the profiles show very broad Stokes I absorptions and complex and spatially variable Stokes V signatures. The inversion of the profiles shows evidence of different atmospheric blue- and redshifted components of the He I lines within the resolution element (1 arcsec), with supersonic velocities of up to 100 km/s. Up to five different atmospheric components are found in the same profile. We show that even these complex profiles can be reliably inverted.

  16. AAS 228: Day 2 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  17. [Evaluating the performance of the UCLA method for spatially downscaling soil moisture products using three Ts/VI indices].

    Ling, Zi-Wei; He, Long-Bin; Zeng, Hui

    2014-02-01

    Soil moisture products derived from microwave remote sensing data are commonly used in the studies of large-scale water resources or climate change. However, the spatial resolutions of these products are usually too coarse to be used in regional- or watershed-scale studies. Therefore, it is necessary to spatially downscale the coarse-resolution soil moisture products for use in regional- or watershed-scale studies. The UCLA method is one of the methods for spatially downscaling soil moisture products. In this method, the spatial indices (Ts/VI indices) calculated from land surface temperature and vegetation index are used as auxiliary variables for spatial downscaling. In this paper, we compared the performance of the UCLA method for spatially downscaling the coarse-resolution AMSR-E soil moisture products, using three Ts/VI indices as auxiliary variables, i. e., the soil wetness index (SW), temperature vegetation dryness index (TVDI), and vegetation temperature condition index (VTCI). These auxiliary variables were calculated from the products of MODIS land surface temperature (MYD11A1) and MODIS vegetation index (MYD13A2). The downscaled results using the three Ts/VI indices were all reasonable. However, the downscaled results using TVDI and VTCI were better than using SW. Therefore, we concluded that TVDI and VTCI are more suitable than SW to be used as the auxiliary variable when applying the UCLA method for downscaling soil moisture products. Finally, we discussed the error sources of applying the UCLA method, such as measurement errors of coarse resolution soil products, calculation errors from spatial indices, and errors from the UCLA method itself, and we also discussed the potential improvements of future research. PMID:24830256

  18. Modelling and Pareto optimization of mechanical properties of friction stir welded AA7075/AA5083 butt joints using neural network and particle swarm algorithm

    Highlights: ► Defect-free friction stir welds have been produced for AA5083-O/AA7075-O. ► Back-propagation was sufficient for predicting hardness and tensile strength. ► A hybrid multi-objective algorithm is proposed to deal with this MOP. ► Multi-objective particle swarm optimization was used to find the Pareto solutions. ► TOPSIS is used to rank the given alternatives of the Pareto solutions. -- Abstract: Friction Stir Welding (FSW) has been successfully used to weld similar and dissimilar cast and wrought aluminium alloys, especially for aircraft aluminium alloys, that generally present with low weldability by the traditional fusion welding process. This paper focuses on the microstructural and mechanical properties of the Friction Stir Welding (FSW) of AA7075-O to AA5083-O aluminium alloys. Weld microstructures, hardness and tensile properties were evaluated in as-welded condition. Tensile tests indicated that mechanical properties of the joint were better than in the base metals. An Artificial Neural Network (ANN) model was developed to simulate the correlation between the Friction Stir Welding parameters and mechanical properties. Performance of the ANN model was excellent and the model was employed to predict the ultimate tensile strength and hardness of butt joint of AA7075–AA5083 as functions of weld and rotational speeds. The multi-objective particle swarm optimization was used to obtain the Pareto-optimal set. Finally, the Technique for Order Preference by Similarity to the Ideal Solution (TOPSIS) was applied to determine the best compromised solution.

  19. Evaluation of a Global Soil Moisture Product from Finer Spatial Resolution SAR Data and Ground Measurements at Irish Sites

    Chiara Pratola

    2014-08-01

    Full Text Available In the framework of the European Space Agency Climate Change Initiative, a global, almost daily, soil moisture (SM product is being developed from passive and active satellite microwave sensors, at a coarse spatial resolution. This study contributes to its validation by using finer spatial resolution ASAR Wide Swath and in situ soil moisture data taken over three sites in Ireland, from 2007 to 2009. This is the first time a comparison has been carried out between three sets of independent observations from different sensors at very different spatial resolutions for such a long time series. Furthermore, the SM spatial distribution has been investigated at the ASAR scale within each Essential Climate Variable (ECV pixel, without adopting any particular model or using a densely distributed network of in situ stations. This approach facilitated an understanding of the extent to which geophysical factors, such as soil texture, terrain composition and altitude, affect the retrieved ECV SM product values in temperate grasslands. Temporal and spatial variability analysis provided high levels of correlation (p < 0.025 and low errors between the three datasets, leading to confidence in the new ECV SM global product, despite limitations in its ability to track the driest and wettest conditions.

  20. Evaluation of structure specification in linear mixed models for modeling the spatial effects in tree height-diamater relationships

    Junfeng Lu

    2013-07-01

    Full Text Available In recent years, linear mixed models (LMM have become more popular to deal with spatial effects in forestry and ecological data. In this study, different structure specifications of linear mixed model were applied to model tree height-diameter relationships, including LMM with random blocks only (LMM-block, LMM with spatial covariance only (LMM-covariance, and the combination of the last two (LMM-block-covariance. Further, the between-group heterogeneous variances were incorporated into LMM-covariance and LMM-block-covariance. The results indicated that, in general, LMM-covariance significantly reduced spatial autocorrelation in model residuals, while LMM-block was effective in dealing with spatial heterogeneity. LMM-block treated the blocks as random effects and avoided the estimation of parameters of the variogram model. Thus, it produced better model predictions than LMM-covariance. LMM-block-covariance took both block effects and spatial covariance into account, and significantly improve model fitting. However, it did not produce better model predictions due to the increase of model complexity and estimation of the local variogram within each block. 

  1. Evaluation of structure specification in linear mixed models for modeling the spatial effects in tree height-diamater relationships

    Junfeng Lu

    2013-05-01

    Full Text Available In recent years, linear mixed models (LMM have become more popularto deal with spatial effects in forestry and ecological data. In this study, different structure specifications of linear mixed model were applied to model tree height-diameter relationships, including LMM with random blocks only (LMM-block, LMM with spatial covariance only (LMM-covariance, and the combination of the last two (LMM-block-covariance. Further, the between group heterogeneous variances were incorporated into LMM-covariance and LMM-block-covariance. The results indicated that, in general, LMM-covariance significantly reduced spatial autocorrelation in model residuals, while LMM-block was effective in dealing with spatial heterogeneity. LMM-blocktreated the blocks as random effects and avoided the estimation of parameters of the variogram model. Thus, it produced better model predictions than LMM-covariance. LMM-block-covariance took both block effects and spatial covariance into account, and significantly improve model fitting. However, it did not produce better model predictions due to the increase of model complexity and estimation of the local variogram within each block.

  2. Experimental hut evaluation of linalool spatial repellent agar gel against Anopheles gambiae sensu stricto mosquitoes in a semi-field system in Bagamoyo, Tanzania

    Tambwe, Mgeni; Mbeyela, Edgar; Massinda, Brian; Moore, Sarah; Maia, Marta

    2014-01-01

    Background Malaria vector control is in need of new tools to face its current challenges such as the spread of pyrethroid-resistance and the increase of outdoor feeding mosquitoes. New strategies such as spatial repellents need to be evaluated as supplemental tools to existing control measures such as insecticide treated bed nets and indoor residual spraying. Linalool is a naturally occurring terpene alcohol commonly found in flowers and spices with reportedly repellent properties. Methods Fo...

  3. SPATIAL AND SUPPLY/DEMAND AGGLOMERATION ECONOMIES: AN EVALUATION OF STATE-AND-INDUSTRY-LINKAGES IN THE U.S. FOOD SYSTEM

    Cohen, Jeffrey P.; Morrison Paul, Catherine J.

    2001-01-01

    In this paper we postulate, measure, and evaluate the importance of cost-impacts from spatial and industrial spillovers for analysis of economic performance. To accomplish this, we incorporate measures of "activity levels" of related states and industries in a cost function model, and estimate their associated thick market and agglomeration effects in terms of shadow values and elasticities. We focus on the food processing sector, the proximity of own-industry activity in neighboring states, ...

  4. Spatial and Supply/Demand Agglomeration Economies: An Evaluation of State- and Industry-Linkages in the U.S. Food System

    Cohen, Jeffrey P.; Morrison Paul, Catherine J.

    2001-01-01

    In this paper we postulate, measure, and evaluate the importance of cost-impacts from spatial and industrial spillovers for analysis of economic performance. To accomplish this, we incorporate measures of "activity levels" of related states and industries in a cost function model, and estimate their associated thick market and agglomeration effects in terms of shadow values and elasticities. We focus on the food processing sector, the proximity of own-industry activity in neighboring states...

  5. Evaluation of Geostatistical Techniques for Mapping Spatial Distribution of Soil PH, Salinity and Plant Cover Affected by Environmental Factors in Southern Iran

    Mohammad ZARE-MEHRJARDI; Ruhollah TAGHIZADEH-MEHRJARDI; Ali AKBARZADEH

    2010-01-01

    The study presented in this paper attempts to evaluate some interpolation techniques for mapping spatial distribution of soil pH, salinity and plant cover in Hormozgan province, Iran. The relationships among environmental factors and distribution of vegetation types were also investigated. Plot sampling was applied in the study area. Landform parameters of each plot were recorded and canopy cover percentages of each species were measured while stoniness and browsing damage were estimated. Res...

  6. The potential of distance e-learning in the Spatial information sciences – an evaluation of a pilot programme at the dublin institute of Technology

    Mooney, Kevin; Martin, Audrey

    2003-01-01

    The authors describe a pilot course in ‘Co-ordinate and reference systems for spatial information’, delivered via the Internet, to staff of the Irish national mapping agency, Ordnance Survey Ireland (OSi). The pilot represented the first course delivered by the Dublin Institute of Technology (DIT) via the medium of its newly installed WebCT® E-Learning system. The aim of the pilot project was to evaluate the suitability of a distance E-Learning environment for the continuing profe...

  7. Ecosystem Services Evaluation and Its Spatial Characteristics in Central Asia’s Arid Regions: A Case Study in Altay Prefecture, China

    Qi Fu

    2015-06-01

    Full Text Available Ecosystem services are important foundations to realize the sustainable development of economy and society. The question of how to quantitatively evaluate ecosystem services in a scientific way is a hot topic among international researchers. Studying the spatial characteristics of ecosystem services in arid regions can provide the theoretical and practical basis for coordinating a sustainable man-land relationship. Altay Prefecture of China, a typical arid region in Central Asia, was taken as the study area. It is on the Silk Road economic belt, which is a key region in the program of developing Western China. Three ecosystem services: water yield, soil conservation, and net primary productivity were quantitatively evaluated. The results show that (1 the spatial distribution pattern has a distinct characteristic of zonality; (2 mountain zone and mountain-oasis ecotone are the hotspots of ecosystem services; and (3 the correlation between water yield and net primary productivity shows a gradual increasing trend as altitude decreases. Objective analysis from the aspect of mechanism is given by discussing the causes of this particular pattern. It is found that altitude and slope have great influence on spatial distributions of ecosystem services, zones with the most amount of services are distributed in 1.5–2 km-altitude and 15–25°-slope. Different human activities in different regions and spatial distance decay of ecosystem services also contribute to the formation of spatial pattern. Thus, overgrazing, logging and mining are prohibited in mountain zones and mountain-oasis ecotones. Scholars are encouraged to focus on desert-ecosystem services in the future.

  8. AA, vacuum tank for stochastic precooling

    1979-01-01

    The vaccum tank in which the fast stochastic precooling kicker was installed. It is clad with heating jackets for bake-out to 200 deg C, indispensable for reaching the operational vacuum of 7E-11 Torr. Alain Poncet, responsible for AA vacuum, is looking on. See also 7910268, 8002234.

  9. AA, mating of BST magnet halves

    1980-01-01

    The AA had 2 types of bending magnets: BLG (window-frame,long and narrow) and BST (H-type, short and wide). The BST had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the mating of two BST halves.

  10. A full Bayes before-after study accounting for temporal and spatial effects: Evaluating the safety impact of new signal installations.

    Sacchi, Emanuele; Sayed, Tarek; El-Basyouny, Karim

    2016-09-01

    Recently, important advances in road safety statistics have been brought about by methods able to address issues other than the choice of the best error structure for modeling crash data. In particular, accounting for spatial and temporal interdependence, i.e., the notion that the collision occurrence of a site or unit times depend on those of others, has become an important issue that needs further research. Overall, autoregressive models can be used for this purpose as they can specify that the output variable depends on its own previous values and on a stochastic term. Spatial effects have been investigated and applied mostly in the context of developing safety performance functions (SPFs) to relate crash occurrence to highway characteristics. Hence, there is a need for studies that attempt to estimate the effectiveness of safety countermeasures by including the spatial interdependence of road sites within the context of an observational before-after (BA) study. Moreover, the combination of temporal dynamics and spatial effects on crash frequency has not been explored in depth for SPF development. Therefore, the main goal of this research was to carry out a BA study accounting for spatial effects and temporal dynamics in evaluating the effectiveness of a road safety treatment. The countermeasure analyzed was the installation of traffic signals at unsignalized urban/suburban intersections in British Columbia (Canada). The full Bayes approach was selected as the statistical framework to develop the models. The results demonstrated that zone variation was a major component of total crash variability and that spatial effects were alleviated by clustering intersections together. Finally, the methodology used also allowed estimation of the treatment's effectiveness in the form of crash modification factors and functions with time trends. PMID:27249403

  11. 7 CFR 51.596 - U.S. Grade AA.

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false U.S. Grade AA. 51.596 Section 51.596 Agriculture... Consumer Standards for Celery Stalks Grades § 51.596 U.S. Grade AA. U.S. Grade AA shall consist of stalks of celery of similar varietal characteristics, which are well developed, and have good...

  12. Application of spatial synoptic classification in evaluating links between heat stress and cardiovascular mortality and morbidity in Prague, Czech Republic

    Urban, Aleš; Kyselý, Jan

    -, - (2016). ISSN 0020-7128 R&D Projects: GA ČR(CZ) GAP209/11/1985 Institutional support: RVO:68378289 Keywords : spatial synoptic classification * mortality * morbidity * cardiovascular diseases * Central Europe Subject RIV: DG - Athmosphere Sciences, Meteorology Impact factor: 3.246, year: 2014 http://link.springer.com/article/10.1007%2Fs00484-015-1055-1

  13. A size-structured simulation model for evaluating management strategies in gillnet fisheries exploiting spatially differentiated populations.

    Pet, J.S.; Machiels, M.A.M.; Densen, van W.L.T.

    1996-01-01

    A length-structured simulation model is presented as a tool in decision making for gillnet fisheries management. The analytical model simulates the fish population dynamics and impact of the fisheries, taking into account size-dependent spatial distribution patterns and migration of the fish. The da

  14. Spatial and Temporal Evaluation of Soil Erosion with RUSLE: A case Study in an Olive Orchard Microcathment in Spain

    Soil loss is commonly estimated using the Revised Universal Soil Loss Equation (RUSLE). Since RUSLE is an empirically based soil loss model derived from surveys on plots, the high spatial and temporal variability of erosion in Mediterranean environments and scale effects provo...

  15. Processing and Optimization of Dissimilar Friction Stir Welding of AA 2219 and AA 7039 Alloys

    Venkateswarlu, D.; Nageswara rao, P.; Mahapatra, M. M.; Harsha, S. P.; Mandal, N. R.

    2015-12-01

    The present paper discusses the optimization of dissimilar friction stir welding of AA 2219 and AA 7039 alloys with respect to tool design issues including microstructural study of weld. The optimized ultimate tensile strength was ~280 MPa, and % elongation was ~11.5. It was observed that the extent of tool shoulder flat surface and tool rotational speed influenced the weld quality significantly. A mathematical model was also developed using response surface regression analysis to predict the effects of tool geometry and process variables on dissimilar AA 2219 and AA 7039 alloys welds. The microstructure evolution and mechanical properties were investigated by employing electron backscatter diffraction technique, Vickers microhardness, and tensile testing, respectively. The microstructural observations indicated that the grain size obtained at advancing side (AA 2219 alloy side) was much finer compared to the retreating side (AA 7039 alloy side). Hardness distribution in the stir zone was inhomogeneous, which might be due to inadequate mixing of weld zone material. The hardness values observed at the weld zone were lower than that in the base materials.

  16. Spatial response surface modelling in the presence of data paucity for the evaluation of potential human health risk due to the contamination of potable water resources.

    Liu, Shen; McGree, James; Hayes, John F; Goonetilleke, Ashantha

    2016-10-01

    Potential human health risk from waterborne diseases arising from unsatisfactory performance of on-site wastewater treatment systems is driven by landscape factors such as topography, soil characteristics, depth to water table, drainage characteristics and the presence of surface water bodies. These factors are present as random variables which are spatially distributed across a region. A methodological framework is presented that can be applied to model and evaluate the influence of various factors on waterborne disease potential. This framework is informed by spatial data and expert knowledge. For prediction at unsampled sites, interpolation methods were used to derive a spatially smoothed surface of disease potential which takes into account the uncertainty due to spatial variation at any pre-determined level of significance. This surface was constructed by accounting for the influence of multiple variables which appear to contribute to disease potential. The framework developed in this work strengthens the understanding of the characteristics of disease potential and provides predictions of this potential across a region. The study outcomes presented constitutes an innovative approach to environmental monitoring and management in the face of data paucity. PMID:27277208

  17. Optimization-Based Design of a Small Pneumatic-Actuator-Driven Parallel Mechanism for a Shoulder Prosthetic Arm with Statics and Spatial Accessibility Evaluation

    Masashi Sekine

    2013-07-01

    Full Text Available Human arms undertake most tasks in the activities of daily living (ADLs. When designing shoulder prostheses for high‐level upper‐limb amputees, we should consider not only how to realize high degrees of freedom under weight and shape constraints but also the user’s individual task space in daily life. An appropriate mechanical structure that can make full use of state‐of‐the‐art actuators and a scheme to optimize the structure’s configuration to match users’ spatial access and manipulability requirements are essential. In our previous research, a small pneumatic‐actuator‐driven parallel mechanism was studied as a shoulder prosthetic arm. In this paper, a systematic procedure is proposed to design the mechanism for a shoulder prosthesis considering force and spatial accessibility. This procedure includes ADL measurements to obtain the task spaces for individual subjects, indexes to evaluate the force and spatial accessibility and an optimization process based on kinematic and statics models. With this approach, the parallel mechanism was optimized for one important ADL task group, considering the trade‐off between its required force and working space. Moreover, it was confirmed that the proposed design procedure could find solutions for various spatial specifications. That is, the approach could be used for individualized shoulder prosthesis design.

  18. First evaluation of drug-resistant Mycobacterium tuberculosis clinical isolates from Congo revealed misdetection of fluoroquinolone resistance by line probe assay due to a double substitution T80A-A90G in GyrA.

    Alexandra Aubry

    Full Text Available BACKGROUND: Tuberculosis (TB is one of the major public health problems in Congo. However, data concerning Mycobacterium tuberculosis drug resistance are lacking because of the insufficient processing capacity. So, the aim of this study was to investigate for the first time the resistance patterns and the strain lineages of a sample of M. tuberculosis complex (MTBC isolates collected in the two main cities of Congo. METHODS: Over a 9-day period, 114 smear-positive sputa isolated from 114 patients attending centers for the diagnosis and treatment of TB in Brazzaville and Pointe Noire were collected for culture and drug susceptibility testing (DST. Detection of mutations conferring drug resistance was performed by using line probe assays (GenoType MTBDRplus and MTBDRsl and DNA sequencing. Strain lineages were determined by MIRU-VNTR genotyping. RESULTS: Of the 114 sputa, 46 were culture positive for MTBC. Twenty-one (46% were resistant to one or more first-line antiTB drugs. Of these, 15 (71% were multidrug resistant (MDR. The most prevalent mutations involved in rifampin and isoniazid resistance, D516V (60% in rpoB and S315T (87% in katG respectively, were well detected by MTBDRplus assay. All the 15 MDR strains were susceptible to fluoroquinolone and injectable second-line drug. No mutation was detected in the rrs locus involved in resistance to amikacin and capreomycin by both the MTBDRsl assay and DNA sequencing. By contrast, 9 MDR strains belonging to the same cluster related to T-family were identified as being falsely resistant to fluoroquinolone by the MTBDRsl assay due to the presence of a double substitution T80A-A90G in GyrA. CONCLUSIONS: Taken together, these data revealed a possible spread of a particular MDR clone in Congo, misidentified as fluoroquinolone resistant by MTBDRsl assay. Thus, this test cannot replace gold-standard culture method and should be interpreted carefully in view of the patient's native land.

  19. Evolution of geomagnetic aa index near sunspot minimum

    Kane, R. P.

    2002-01-01

    The smoothed values of the minima of sunspot number Rz and the geomagnetic index aa were compared for sunspot cycles 12–23. In one cycle, aa(min) occurred earlier than Rz(min), but remained at that low from a few months before Rz(min) to a few months after Rz(min). In two cycles, Rz(min) and aa(min) coincided within a month or two. In nine cycles, aa(min) occurred more than three months later than Rz(min). The aa(min) coincided with the minima of some solar radio e...

  20. Evaluating Mesoscale Numerical Weather Predictions and Spatially Distributed Meteorologic Forcing Data for Developing Accurate SWE Forecasts over Large Mountain Basins

    Hedrick, A. R.; Marks, D. G.; Winstral, A. H.; Marshall, H. P.

    2014-12-01

    The ability to forecast snow water equivalent, or SWE, in mountain catchments would benefit many different communities ranging from avalanche hazard mitigation to water resource management. Historical model runs of Isnobal, the physically based energy balance snow model, have been produced over the 2150 km2 Boise River Basin for water years 2012 - 2014 at 100-meter resolution. Spatially distributed forcing parameters such as precipitation, wind, and relative humidity are generated from automated weather stations located throughout the watershed, and are supplied to Isnobal at hourly timesteps. Similarly, the Weather Research & Forecasting (WRF) Model provides hourly predictions of the same forcing parameters from an atmospheric physics perspective. This work aims to quantitatively compare WRF model output to the spatial meteorologic fields developed to force Isnobal, with the hopes of eventually using WRF predictions to create accurate hourly forecasts of SWE over a large mountainous basin.

  1. Preliminary evaluation of a monolithic detector module for integrated PET/MRI scanner with high spatial resolution

    The proposal of Mindview European Project concerns with the development of a very high resolution and high efficiency brain dedicated PET scanner simultaneously working with a Magnetic Resonance scanner, that expects to visualize neurotransmitter pathways and their disruptions in the quest to better diagnose schizophrenia. On behalf of this project, we propose a low cost PET module for the first prototype, based on monolithic crystals, suitable to be integrated with a head Radio Frequency (RF) coil. The aim of the suggested module is to achieve high performances in terms of efficiency, planar spatial resolution (expected about 1 mm) and discrimination of gamma Depth Of Interaction (DOI) in order to reduce the parallax error. Our preliminary results are very promising: a DOI resolution of about 3 mm, a spatial resolution ranging from about 1 to 1.5 mm and a good position linearity

  2. Dicty_cDB: FC-AA03 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA03 (Link to dictyBase) - - - Contig-U15331-1 FC-AA03P (Li...nk to Original site) FC-AA03F 595 FC-AA03Z 546 FC-AA03P 1141 - - Show FC-AA03 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA03Q.Seq.d/ Representative seq. ID FC-AA...03P (Link to Original site) Representative DNA sequence >FC-AA03 (FC-AA03Q) /CSM/FC/FC-AA/FC-AA03Q.Seq.d/ AA...AATGTCATCTTATTTATTCACTAGTGAATCCGTCACCGAAGTCATCCAGATAAAATCT GTGATCAAGTATCAGATGCTGTTCTCGATGCTTGTTTAGCTCAA

  3. Dicty_cDB: FC-AA04 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA04 (Link to dictyBase) - - - Contig-U15354-1 FC-AA04P (Li...nk to Original site) FC-AA04F 546 FC-AA04Z 484 FC-AA04P 1030 - - Show FC-AA04 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA04Q.Seq.d/ Representative seq. ID FC-AA...04P (Link to Original site) Representative DNA sequence >FC-AA04 (FC-AA04Q) /CSM/FC/FC-AA/FC-AA04Q.Seq.d/ AA...TAATACACATAAAAAATTTATTAAATAAAAATGACTACAACAACAACAAATGAAGTTT ATATAGTTGATTGTATTCGTACACCAATTGGTAGAGGATATAGTAA

  4. Dicty_cDB: FC-AA10 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA10 (Link to dictyBase) - - - Contig-U16358-1 FC-AA10P (Li...nk to Original site) FC-AA10F 659 FC-AA10Z 544 FC-AA10P 1203 - - Show FC-AA10 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA10Q.Seq.d/ Representative seq. ID FC-AA...10P (Link to Original site) Representative DNA sequence >FC-AA10 (FC-AA10Q) /CSM/FC/FC-AA/FC-AA10Q.Seq.d/ AA...ATGACTACCTTTAACGAATATCCATTCTTGGCTGAATTAGGCATTAAAGCTGAAAATA ATGATGGAGTCTTCAATGGAAAATGGGGAGGTGCTGGTGAAATCATCAA

  5. Modeling spatial-temporal dynamics of global wetlands: comprehensive evaluation of a new sub-grid TOPMODEL parameterization and uncertainties

    Zhang, Z.; Zimmermann, N. E.; Poulter, B.

    2015-11-01

    Simulations of the spatial-temporal dynamics of wetlands are key to understanding the role of wetland biogeochemistry under past and future climate variability. Hydrologic inundation models, such as TOPMODEL, are based on a fundamental parameter known as the compound topographic index (CTI) and provide a computationally cost-efficient approach to simulate wetland dynamics at global scales. However, there remains large discrepancy in the implementations of TOPMODEL in land-surface models (LSMs) and thus their performance against observations. This study describes new improvements to TOPMODEL implementation and estimates of global wetland dynamics using the LPJ-wsl dynamic global vegetation model (DGVM), and quantifies uncertainties by comparing three digital elevation model products (HYDRO1k, GMTED, and HydroSHEDS) at different spatial resolution and accuracy on simulated inundation dynamics. In addition, we found that calibrating TOPMODEL with a benchmark wetland dataset can help to successfully delineate the seasonal and interannual variations of wetlands, as well as improve the spatial distribution of wetlands to be consistent with inventories. The HydroSHEDS DEM, using a river-basin scheme for aggregating the CTI, shows best accuracy for capturing the spatio-temporal dynamics of wetlands among the three DEM products. The estimate of global wetland potential/maximum is ∼ 10.3 Mkm2 (106 km2), with a mean annual maximum of ∼ 5.17 Mkm2 for 1980-2010. This study demonstrates the feasibility to capture spatial heterogeneity of inundation and to estimate seasonal and interannual variations in wetland by coupling a hydrological module in LSMs with appropriate benchmark datasets. It additionally highlights the importance of an adequate investigation of topographic indices for simulating global wetlands and shows the opportunity to converge wetland estimates across LSMs by identifying the uncertainty associated with existing wetland products.

  6. Evaluating the roles of biotransformation, spatial concentration differences, organism home range, and field sampling design on trophic magnification factors.

    Kim, Jaeshin; Gobas, Frank A P C; Arnot, Jon A; Powell, David E; Seston, Rita M; Woodburn, Kent B

    2016-05-01

    Trophic magnification factors (TMFs) are field-based measurements of the bioaccumulation behavior of chemicals in food-webs. TMFs can provide valuable insights into the bioaccumulation behavior of chemicals. However, bioaccumulation metrics such as TMF may be subject to considerable uncertainty as a consequence of systematic bias and the influence of confounding variables. This study seeks to investigate the role of systematic bias resulting from spatially-variable concentrations in water and sediments and biotransformation rates on the determination of TMF. For this purpose, a multibox food-web bioaccumulation model was developed to account for spatial concentration differences and movement of organisms on chemical concentrations in aquatic biota and TMFs. Model calculated and reported field TMFs showed good agreement for persistent polychlorinated biphenyl (PCB) congeners and biotransformable phthalate esters (PEs) in a marine aquatic food-web. Model testing showed no systematic bias and good precision in the estimation of the TMF for PCB congeners but an apparent underestimation of model calculated TMFs, relative to reported field TMFs, for PEs. A model sensitivity analysis showed that sampling designs that ignore the presence of concentration gradients may cause systematically biased and misleading TMF values. The model demonstrates that field TMFs are most sensitive to concentration gradients and species migration patterns for substances that are subject to a low degree of biomagnification or trophic dilution. The model is useful in anticipating the effect of spatial concentration gradients on the determination of the TMF; guiding species collection strategies in TMF studies; and interpretation of the results of field bioaccumulation studies in study locations where spatial differences in chemical concentration exist. PMID:26891010

  7. Neuroticism and self-evaluation measures are related to the ability to form cognitive maps critical for spatial orientation.

    Burles, Ford; Guadagni, Veronica; Hoey, Felecia; Arnold, Aiden E G F; Levy, Richard M; O'Neill, Thomas; Iaria, Giuseppe

    2014-09-01

    Trait neuroticism is suggested to be related to measures of volume and function of the hippocampus, a brain structure located in the medial temporal lobe that is critical for human navigation and orientation. In this study, we assessed whether measures of trait neuroticism and self-concept are correlated with the human ability to orient by means of cognitive maps (i.e. mental representations of an environment that include landmarks and their spatial relationships). After controlling for gender differences, which are well-known in spatial orientation abilities, we found that measures of neuroticism (i.e. negative affect, emotional stability) and self-concept (i.e. self-esteem) were correlated with individual differences in the rate at which cognitive maps were formed; the same measures were generally unrelated to the ability to make use of cognitive maps, as well as the ability to orient using visual path integration. The relationships (and lack thereof) between personality traits and the spatial orientation skills, as reported in the present study, are consistent with specific neural correlates underlying these factors, and may have important implications for treatment of disorders related to them. PMID:24914460

  8. Evaluation of Spatial Resolution and Noise Sensitivity of sLORETA Method for EEG Source Localization Using Low-Density Headsets

    Saha, Sajib; Tahtali, Murat; Gureyev, Timur E

    2014-01-01

    Electroencephalography (EEG) has enjoyed considerable attention over the past century and has been applied for diagnosis of epilepsy, stroke, traumatic brain injury and other disorders where 3D localization of electrical activity in the brain is potentially of great diagnostic value. In this study we evaluate the precision and accuracy of spatial localization of electrical activity in the brain delivered by a popular reconstruction technique sLORETA applied to EEG data collected by two commonly used low-density headsets with 14 and 19 measurement channels, respectively. Numerical experiments were performed for a realistic head model obtained by segmentation of MRI images. The EEG source localization study was conducted with a simulated single active dipole, as well as with two spatially separated simultaneously active dipoles, as a function of dipole positions across the neocortex, with several different noise levels in the EEG signals registered on the scalp. The results indicate that while the reconstructio...

  9. AA, inner conductor of a magnetic horn

    1981-01-01

    At the start-up of the AA and during its initial operation, magnetic horns focused the antiprotons emanating from the production target. These "current-sheet lenses" had a thin inner conductor (for minimum absorption of antiprotons), machined from aluminium to wall thicknesses of 0.7 or 1 mm. The half-sine pulses rose to 150 kA in 8 microsec. The angular acceptance was 50 mrad.

  10. AA Prototype-Quadrupole on Measurement Stand

    1978-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although not very long (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built in 1978. Here we see it on its test stand, with Ray Brown positioning the measurement coil.

  11. AA Prototype-Quadrupole on Measurement Stand

    1979-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although rather short (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built at CERN in 1978. Here we see it on its test stand, with a measurement coil inserted, Brian Pincott taking readings.

  12. Research in development: the approach of AAS

    Dugan, P.; Apgar, M.; Douthwaite, B.

    2013-01-01

    The CGIAR Research Program on Aquatic Agricultural Systems (AAS) is pursuing a Research in Development approach that emphasizes the importance of embedding research in the development context. Reflecting this emphasis the six elements of this approach are a commitment to people and place, participatory action research, gender transformative research, learning and networking, partnerships, and capacity building. It is through the careful pursuit of these six elements that we believe that the p...

  13. AA, assembly of wide bending magnet

    1980-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets; BST, short and wide; BLG, long and narrow). The wide ones had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the copper coils being hoisted onto the lower half of a BST. See also 7811105, 8006050. For a BLG, see 8001044.

  14. AAS Publishing News: Astronomical Software Citation Workshop

    Kohler, Susanna

    2015-07-01

    Do you write code for your research? Use astronomical software? Do you wish there were a better way of citing, sharing, archiving, or discovering software for astronomy research? You're not alone! In April 2015, AAS's publishing team joined other leaders in the astronomical software community in a meeting funded by the Sloan Foundation, with the purpose of discussing these issues and potential solutions. In attendance were representatives from academic astronomy, publishing, libraries, for-profit software sharing platforms, telescope facilities, and grantmaking institutions. The goal of the group was to establish “protocols, policies, and platforms for astronomical software citation, sharing, and archiving,” in the hopes of encouraging a set of normalized standards across the field. The AAS is now collaborating with leaders at GitHub to write grant proposals for a project to develop strategies for software discoverability and citation, in astronomy and beyond. If this topic interests you, you can find more details in this document released by the group after the meeting: http://astronomy-software-index.github.io/2015-workshop/ The group hopes to move this project forward with input and support from the broader community. Please share the above document, discuss it on social media using the hashtag #astroware (so that your conversations can be found!), or send private comments to julie.steffen@aas.org.

  15. Evaluation of socio-spatial vulnerability of citydwellers and analysis of risk perception: industrial and seismic risks in Mulhouse

    Glatron, S.; Beck, E.

    2008-10-01

    Social vulnerability has been studied for years with sociological, psychological and economical approaches. Our proposition focuses on perception and cognitive representations of risks by city dwellers living in a medium size urban area, namely Mulhouse (France). Perception, being part of the social vulnerability and resilience of the society to disasters, influences the potential damage; for example it leads to adequate or inadequate behaviour in the case of an emergency. As geographers, we assume that the spatial relationship to danger or hazard can be an important factor of vulnerability and we feel that the spatial dimension is a challenging question either for better knowledge or for operational reasons (e.g. management of preventive information). We interviewed 491 people, inhabitants and workers, regularly distributed within the urban area to get to know their opinion on hazards and security measures better. We designed and mapped a vulnerability index on the basis of their answers. The results show that the social vulnerability depends on the type of hazard, and that the distance to the source of danger influences the vulnerability, especially for hazards with a precise location (industrial for example). Moreover, the effectiveness of the information campaigns is doubtful, as the people living close to hazardous industries (target of specific preventive information) are surprisingly more vulnerable and less aware of industrial risk.

  16. Evaluation of socio-spatial vulnerability of citydwellers and analysis of risk perception: industrial and seismic risks in Mulhouse

    S. Glatron

    2008-10-01

    Full Text Available Social vulnerability has been studied for years with sociological, psychological and economical approaches. Our proposition focuses on perception and cognitive representations of risks by city dwellers living in a medium size urban area, namely Mulhouse (France. Perception, being part of the social vulnerability and resilience of the society to disasters, influences the potential damage; for example it leads to adequate or inadequate behaviour in the case of an emergency. As geographers, we assume that the spatial relationship to danger or hazard can be an important factor of vulnerability and we feel that the spatial dimension is a challenging question either for better knowledge or for operational reasons (e.g. management of preventive information. We interviewed 491 people, inhabitants and workers, regularly distributed within the urban area to get to know their opinion on hazards and security measures better. We designed and mapped a vulnerability index on the basis of their answers. The results show that the social vulnerability depends on the type of hazard, and that the distance to the source of danger influences the vulnerability, especially for hazards with a precise location (industrial for example. Moreover, the effectiveness of the information campaigns is doubtful, as the people living close to hazardous industries (target of specific preventive information are surprisingly more vulnerable and less aware of industrial risk.

  17. Dicty_cDB: FC-AA11 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA11 (Link to dictyBase) - - - Contig-U16273-1 FC-AA11P (Li...nk to Original site) FC-AA11F 631 FC-AA11Z 502 FC-AA11P 1133 - - Show FC-AA11 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA11Q.Seq.d/ Representative seq. ID FC-AA...11P (Link to Original site) Representative DNA sequence >FC-AA11 (FC-AA11Q) /CSM/FC/FC-AA/FC-AA...11Q.Seq.d/ GGTGAATTAATTGTTGAACCAGTTGATCAAAAATATATTTTCAAGACTGAACGTAAAGTT CCAAGAATGGGTGTTATGATTGTTGGTTTATGTGGTAACAATGGTACAA

  18. Dicty_cDB: FC-AA18 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA18 (Link to dictyBase) - - - Contig-U15943-1 FC-AA18P (Li...nk to Original site) FC-AA18F 506 FC-AA18Z 293 FC-AA18P 799 - - Show FC-AA18 Library FC (Link to library) Clone ID FC-AA...al site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA18Q.Seq.d/ Representative seq. ID FC-AA...18P (Link to Original site) Representative DNA sequence >FC-AA18 (FC-AA18Q) /CSM/FC/FC-AA/FC-AA18Q.Seq.d/ AAA...AGATAGAGAAGAAAGAAAACTTGAACGTGAGAAGGAACTTGAACGTGAACGTGAGAA AGAACTTGAGCGTGAGCGTGAACGTGAACAACGTCGTCTTGAAA

  19. Dicty_cDB: FCL-AA07 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA07 (Link to dictyBase) - - - Contig-U14973-1 FCL-AA07P ...(Link to Original site) FCL-AA07F 527 FCL-AA07Z 253 FCL-AA07P 780 - - Show FCL-AA07 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA07Q....Seq.d/ Representative seq. ID FCL-AA07P (Link to Original site) Representative DNA sequence >FCL-AA07 (FCL-AA07Q) /CSM/FCL/FCL-AA.../FCL-AA07Q.Seq.d/ CAAAATAAAAAATGTTATCAAATTTTTTAAAAGTCAACAGTAAAGCACTAGGACATATAA GAACTTTTGCCTCAAAGAGTGGTGAAATTAAA

  20. Dicty_cDB: FCL-AA12 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA12 (Link to dictyBase) - - - Contig-U16034-1 FCL-AA12P ...(Link to Original site) FCL-AA12F 629 FCL-AA12Z 540 FCL-AA12P 1169 - - Show FCL-AA12 Library FCL (Link to library) Clone ID FCL-AA...4-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA12Q....Seq.d/ Representative seq. ID FCL-AA12P (Link to Original site) Representative DNA sequence >FCL-AA12 (FCL-AA12Q) /CSM/FCL/FCL-AA.../FCL-AA12Q.Seq.d/ ATCAAATGTTTATTCAACAACAACCATCAGATTCAATTGTTTGTAATCGTTATATTCATC CAGCCATTGTTGTTTTGGTTGACCAA

  1. Dicty_cDB: FCL-AA21 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA21 (Link to dictyBase) - - - Contig-U14936-1 FCL-AA21P ...(Link to Original site) FCL-AA21F 520 FCL-AA21Z 356 FCL-AA21P 876 - - Show FCL-AA21 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA21Q....Seq.d/ Representative seq. ID FCL-AA21P (Link to Original site) Representative DNA sequence >FCL-AA21 (FCL-AA21Q) /CSM/FCL/FCL-AA.../FCL-AA21Q.Seq.d/ ATCATAATCATATATTTTTAATAGATATTGATATATATATTTAAAAAAATAAAATAAAAT AAAATAAAAAATGTCAACAGAGGAAACAAAAA

  2. Dicty_cDB: FCL-AA01 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA01 (Link to dictyBase) - - - Contig-U16033-1 FCL-AA01P ...(Link to Original site) FCL-AA01F 603 FCL-AA01Z 411 FCL-AA01P 1014 - - Show FCL-AA01 Library FCL (Link to library) Clone ID FCL-AA...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA01Q....Seq.d/ Representative seq. ID FCL-AA01P (Link to Original site) Representative DNA sequence >FCL-AA01 (FCL-AA01Q) /CSM/FCL/FCL-AA.../FCL-AA01Q.Seq.d/ GCAAATAATAATATTATGGGTATTGACTTTGGTACACATTTCGCATGTGTTGGTATTTTC AAGAATGAAAGAATTGAAATCTGTCCAAA

  3. Dicty_cDB: FCL-AA13 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA13 (Link to dictyBase) - - - - FCL-AA13P (Link to Original site) FCL-AA...13F 635 FCL-AA13Z 350 FCL-AA13P 985 - - Show FCL-AA13 Library FCL (Link to library) Clone ID FCL-AA...dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ Representative seq. ID FCL-AA...13P (Link to Original site) Representative DNA sequence >FCL-AA13 (FCL-AA13Q) /CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ CATATTTATAA...TTATATCTTTTTTGTTTAATAAAAAAGAAAGAATACCAACATGAGACTT TTATTGTGTTTAATTTTCTTAGTTTTTGTTTTCAATTTTGCATTATCAA

  4. Dicty_cDB: FC-AA06 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA06 (Link to dictyBase) - - - Contig-U15909-1 FC-AA06P (Li...nk to Original site) FC-AA06F 532 FC-AA06Z 501 FC-AA06P 1033 - - Show FC-AA06 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA06Q.Seq.d/ Representative seq. ID FC-AA...06P (Link to Original site) Representative DNA sequence >FC-AA06 (FC-AA06Q) /CSM/FC/FC-AA/FC-AA...06Q.Seq.d/ GTGAATATAACGATTTAGATTTAGTGTATGATAAAGATGTTTATCAAAAATTAATAGAGA ATGGTGTAGATTCATTATTATCAAAA

  5. Dicty_cDB: FC-AA08 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA08 (Link to dictyBase) - - - Contig-U15942-1 FC-AA08P (Li...nk to Original site) FC-AA08F 620 FC-AA08Z 510 FC-AA08P 1130 - - Show FC-AA08 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA08Q.Seq.d/ Representative seq. ID FC-AA...08P (Link to Original site) Representative DNA sequence >FC-AA08 (FC-AA08Q) /CSM/FC/FC-AA/FC-AA...08Q.Seq.d/ ATCAGTTACATGTACTGCACCAGTTAATATTGCAGTTATCAAATATTGGGGAAAGAGAGA TGAAAATATTATTTTACCATTAAATTCATCACTCAGTGGAA

  6. Mechanical properties of aluminium–copper–lithium alloy AA2195 at cryogenic temperatures

    Highlights: • 4 mm thick sheet of AA2195 was imparted T87 temper. • 7% cold work to impart T87 was given by combination of cold rolling and stretching. • Mechanical properties were evaluated at RT and cryogenic temperatures. • Strength of AA2195 are superior to the conventional aluminum alloy 2219 at all temperatures. • Strength decreases with decrease in temperature whereas ductility remains unchanged. - Abstract: Tensile testing was performed on a 4 mm thick sheet of the aluminum–lithium alloy AA2195 in T87 (solution treatment + water quenching + 7% cold work + peak aging) temper which was subjected to 7% cold working by combination of cold rolling and stretching, over a temperature range from ambient to liquid hydrogen (20 K) conditions. Properties were evaluated in longitudinal as well as transverse directions to characterize anisotropy with respect to strength and ductility. Strength and ductility were compared to the conventional aluminum alloy AA2219-T87, developed for similar cryogenic applications. Decreases in test temperature led to higher strengths with little or no change in ductility. As the temperature decreases, the differences between ultimate tensile strength as well as yield strength for two different combinations of cold roll and stretch studied in the present work, narrows down and become equal at 20 K

  7. Spatial landuse planning using land evaluation and dynamic system to define sustainable area of paddy field: Case study in Karawang Regency, West Java, Indonesia

    Widiatmaka, Widiatmaka; Ambarwulan, Wiwin; Firmansyah, Irman; Munibah, Khursatul; Santoso, Paulus B. K.

    2015-04-01

    Indonesia is the country with the 4th largest population in the worlds; the population reached more than 237 million people. With rice as the staple food for more than 95 percent of the population, there is an important role of paddy field in Indonesian food security. Actually, paddy field in Java has produced 52,6% of the total rice production in Indonesia, showing the very high dependence of Indonesia on food production from paddy fields in Java island. Karawang Regency is one of the regions in West Java Province that contribute to the national food supply, due to its high soil fertility and its high extent of paddy field. Dynamics of land use change in this region are high because of its proximity to urban area; this dynamics has led to paddy field conversion to industry and residential landuse, which in turn change the regional rice production capacity. Decreasing paddy field landuse in this region could be serve as an example case of the general phenomena which occurred in Javanese rice production region. The objective of this study were: (i) to identify the suitable area for paddy field, (ii) to modelize the decreasing of paddy field in socio-economic context of the region, and (iii) to plan the spatial priority area of paddy field protection according to model prediction. A land evaluation for paddy was completed after a soil survey, while IKONOS imagery was analyzed to delineate paddy fields. Dynamic system model of paddy field land use is built, and then based on the model built, the land area of paddy field untill 2040 in some scenarios was developped. The research results showed that the land suitability class for paddy fields in Karawang Regency ranged from very suitable (S1) to marginally suitable (S3), with various land characteristics as limiting factors. The model predicts that if the situation of paddy field land use change continues in its business as usual path, paddy field area that would exist in the region in 2040 will stay half of the recent

  8. Determination and correlation of spatial distribution of trace elements in normal and neoplastic breast tissues evaluated by {mu}-XRF

    Silva, M.P.; Oliveira, M.A.; Poletti, M.E. [Universidade de Sao Paulo (USP),Ribeirao Preto, SP (Brazil)

    2012-07-01

    Full text: Some trace elements, naturally present in breast tissues, participate in a large number of biological processes, which include among others, activation or inhibition of enzymatic reactions and changes on cell membranes permeability, suggesting that these elements may influence carcinogenic processes. Thus, knowledge of the amounts of these elements and their spatial distribution in normal and neoplastic tissues may help in understanding the role of these elements in the carcinogenic process and tumor progression of breast cancers. Concentrations of trace elements like Ca, Fe, Cu and Zn, previously studied at LNLS using TXRF and conventional XRF, were elevated in neoplastic breast tissues compared to normal tissues. In this study we determined the spatial distribution of these elements in normal and neoplastic breast tissues using {mu}-XRF technique. We analyzed 22 samples of normal and neoplastic breast tissues (malignant and benign) obtained from paraffin blocks available for study at the Department of Pathology HC-FMRP/USP. From the blocks, a small fraction of material was removed and subjected to histological sections of 60 {mu}m thick made with a microtome. The slices where placed in holder samples and covered with ultralen film. Tissue samples were irradiated with a white beam of synchrotron radiation. The samples were positioned at 45 degrees with respect to the incident beam on a table with 3 freedom degrees (x, y and z), allowing independent positioning of the sample in these directions. The white beam was collimated by a 20 {mu}m microcapillary and samples were fully scanned. At each step, a spectrum was detected for 10 s. The fluorescence emitted by elements present in the sample was detected by a Si (Li) detector with 165 eV at 5.9 keV energy resolution, placed at 90 deg with respect to the incident beam. Results reveal that trace elements Ca-Zn and Fe-Cu could to be correlated in malignant breast tissues. Quantitative results, achieved by

  9. Evaluating spatial-temporal dynamics of net primary productivity of different forest types in northeastern China based on improved FORCCHN.

    Zhao, Junfang; Yan, Xiaodong; Guo, Jianping; Jia, Gensuo

    2012-01-01

    An improved individual-based forest ecosystem carbon budget model for China (FORCCHN) was applied to investigate the spatial-temporal dynamics of net primary productivity of different forest types in northeastern China. In this study, the forests of northeastern China were categorized into four ecological types according to their habitats and generic characteristics (evergreen broadleaf forest, deciduous broadleaf forest, evergreen needleleaf forest and deciduous needleleaf forest). The results showed that distribution and change of forest NPP in northeastern China were related to the different forest types. From 1981 to 2002, among the forest types in northeastern China, per unit area NPP and total NPP of deciduous broadleaf forest were the highest, with the values of 729.4 gC/(m(2)•yr) and 106.0 TgC/yr, respectively, followed by mixed broadleaf- needleleaf forest, deciduous needleleaf forest and evergreen needleleaf forest. From 1981 to 2002, per unit area NPP and total NPP of different forest types in northeastern China exhibited significant trends of interannual increase, and rapid increase was found between the 1980s and 1990s. The contribution of the different forest type's NPP to total NPP in northeastern China was clearly different. The greatest was deciduous broadleaf forest, followed by mixed broadleaf- needleleaf forest and deciduous needleleaf forest. The smallest was evergreen needleleaf forest. Spatial difference in NPP between different forest types was remarkable. High NPP values of deciduous needleleaf forest, mixed broadleaf- needleleaf forest and deciduous broadleaf forest were found in the Daxing'anling region, the southeastern of Xiaoxing'anling and Jilin province, and the Changbai Mountain, respectively. However, no regional differences were found for evergreen needleleaf NPP. This study provided not only an estimation NPP of different forest types in northeastern China but also a useful methodology for estimating forest carbon storage at

  10. Influencia de los parámetros de la soldadura metálica fría en las aleaciones AA5083 y AA6061//Influence of the colt metal welding parameters on the AA5083 and AA6061 aluminum

    René Eduardo de‐Luna‐Alanís

    2015-01-01

    Full Text Available El trabajo tuvo como objetivo evaluar la influencia de la velocidad de la soldadura y de las correcciones del arco y pulso en el proceso de Transferencia Metálica Fría sobre las propiedades mecánicas de las aleaciones AA5083 y AA6061. Se desarrolló un diseño experimental de tipo factorial multinivel, con 4 factores independientes (Corrección de Arco, Pulso, Velocidad de Soldadura y Aleación. Los parámetros fundamentales fueron: Corriente de base 250 A; Voltaje de arco 21 V y Polaridad (Direct current electrode positive, DCEP. La evaluación se realizó a través de un ensayo de tracción transversal sobre probetas planas obtenidas de los cupones soldados. Se demuestra que el modelo aplicado es adecuado, revelándose en los experimentos diferencias sustanciales en las propiedades Tensión de fluencia 29,56 %, Módulo de elasticidad 51,16 % y Trabajo específico de deformación elástica 42,30 %, el cual no posee una dependencia lineal con elresto de las propiedades anteriores.Palabras claves: transferencia metálica fría, aleación AA5083, aleación AA6061, propiedades mecánicas._______________________________________________________________________________AbstractThe work objective was to evaluatethe influence of Cold Metal Transfer process arc and pulse corrections and welding speed on the mechanical properties of AA5083 and AA6061 aluminum alloys. For it, a Factorial Multilevel experimental design whit 4 independent factor (arc correction, pulse correction, welding speed and alloy was developed. The essential welding parameters employed were: base current 250 A; arc voltage 21 V and polarity (DCEP. The evaluation was made whit a transverse traction test of plate welded coupons. The experimental model applied wasadequate and substantial differences was showed between yield tensile strength 29,56 %, elasticity module (51,16 % and specific work of elastic deformation 42,30 %, which it does not possess a lineal dependence whit the rest

  11. A spatial entropy reflecting distribution of spatial objects

    Youn-Kyung Jang; Byeong-Seob You; Ho-Seok Kim; Kyoung-Bae Kim; Hae-Young Bae

    2007-01-01

    Decision trees are mainly used to classify data and predict data classes. A spatial decision tree has been designed using Euclidean distance between objects for reflecting spatial data characteristic. Even though this method explains the distance of objects in spatial dimension, it fails to represent distributions of spatial data and their relationships. But distributions of spatial data and relationships with their neighborhoods are very important in real world. This paper proposes decision tree based on spatial entropy that represents distributions of spatial data with dispersion and dissimilarity. The rate of dispersion by dissimilarity presents how related distribution of spatial data and non-spatial attributes. The experiment evaluates the accuracy and building time of decision tree as compared to previous methods and it shows that the proposed method makes efficient and scalable classification for spatial decision support.

  12. Comparison between ARB and CARB processes on an AA5754/AA6061 composite

    Verstraete, K.; Helbert, A.-L.; Brisset, F.; Baudin, T.

    2014-08-01

    The present work aims to compare two processes: Accumulative Roll Bonding and Cross Accumulative Roll Bonding (CARB). Both processes consist in the repetition of rolling but the second technique adds a 90° rotation of the sheet around its normal direction between each rolling. Microstructure, mechanical properties and texture were compared for both processes on an AA5754/AA6061 composite. As a result a thinner and less elongated microstructure was obtained in the CARB process leading to an isotropy and an improvement of the mechanical properties. Besides, the texture was characterized by the rotated Cube component for both processes but for CARB it is of less strength.

  13. Quantitative evaluation of the lactate signal loss and its spatial dependence in press localized (1)H NMR spectroscopy.

    Jung, W I; Bunse, M; Lutz, O

    2001-10-01

    Localized (1)H NMR spectroscopy using the 90 degrees -t(1)-180 degrees -t(1)+t(2)-180 degrees -t(2)-Acq. PRESS sequence can lead to a signal loss for the lactate doublet compared with signals from uncoupled nuclei which is dependent on the choice of t(1) and t(2). The most striking signal loss of up to 78% of the total signal occurs with the symmetrical PRESS sequence (t(1)=t(2)) at an echo time of 2/J (approximately 290 ms). Calculations have shown that this signal loss is related to the pulse angle distributions produced by the two refocusing pulses which leads to the creation of single quantum polarization transfer (PT) as well as to not directly observable states (NDOS) of the lactate AX(3) spin system: zero- and multiple-quantum coherences, and longitudinal spin orders. In addition, the chemical shift dependent voxel displacement (VOD) leads to further signal loss. By calculating the density operator for various of the echo times TE=n/J, n=1, 2, 3,..., we calculated quantitatively the contributions of these effects to the signal loss as well as their spatial distribution. A maximum signal loss of 75% can be expected from theory for the symmetrical PRESS sequence and TE=2/J for Hamming filtered sinc pulses, whereby 47% are due to the creation of NDOS and up to 28% arise from PT. Taking also the VOD effect into account (2 mT/m slice selection gradients, 20-mm slices) leads to 54% signal loss from NDOS and up to 24% from PT, leading to a maximum signal loss of 78%. Using RE-BURP pulses with their more rectangular pulse angle distributions reduces the maximum signal loss to 44%. Experiments at 1.5 T using a lactate solution demonstrated a maximum lactate signal loss for sinc pulses of 82% (52% NDOS, 30% PT) at TE=290 ms using the symmetrical PRESS sequence. The great signal loss and its spatial distribution is of importance for investigations using a symmetrical PRESS sequence at TE=2/J. PMID:11567573

  14. Quantitative Evaluation of the Lactate Signal Loss and Its Spatial Dependence in PRESS Localized 1H NMR Spectroscopy

    Jung, Wulf-Ingo; Bunse, Michael; Lutz, Otto

    2001-10-01

    Localized 1H NMR spectroscopy using the 90°-t1-180°-t1+t2-180°-t2-Acq. PRESS sequence can lead to a signal loss for the lactate doublet compared with signals from uncoupled nuclei which is dependent on the choice of t1 and t2. The most striking signal loss of up to 78% of the total signal occurs with the symmetrical PRESS sequence (t1=t2) at an echo time of 2/J (≃290 ms). Calculations have shown that this signal loss is related to the pulse angle distributions produced by the two refocusing pulses which leads to the creation of single quantum polarization transfer (PT) as well as to not directly observable states (NDOS) of the lactate AX3 spin system: zero- and multiple-quantum coherences, and longitudinal spin orders. In addition, the chemical shift dependent voxel displacement (VOD) leads to further signal loss. By calculating the density operator for various of the echo times TE=n/J, n=1, 2, 3, …, we calculated quantitatively the contributions of these effects to the signal loss as well as their spatial distribution. A maximum signal loss of 75% can be expected from theory for the symmetrical PRESS sequence and TE=2/J for Hamming filtered sinc pulses, whereby 47% are due to the creation of NDOS and up to 28% arise from PT. Taking also the VOD effect into account (2 mT/m slice selection gradients, 20-mm slices) leads to 54% signal loss from NDOS and up to 24% from PT, leading to a maximum signal loss of 78%. Using RE-BURP pulses with their more rectangular pulse angle distributions reduces the maximum signal loss to 44%. Experiments at 1.5 T using a lactate solution demonstrated a maximum lactate signal loss for sinc pulses of 82% (52% NDOS, 30% PT) at TE=290 ms using the symmetrical PRESS sequence. The great signal loss and its spatial distribution is of importance for investigations using a symmetrical PRESS sequence at TE=2/J.

  15. Investigation and Evaluation of the open source ETL tools GeoKettle and Talend Open Studio in terms of their ability to process spatial data

    Kuhnert, Kristin; Quedenau, Jörn

    2016-04-01

    Integration and harmonization of large spatial data sets is not only since the introduction of the spatial data infrastructure INSPIRE a big issue. The process of extracting and combining spatial data from heterogeneous source formats, transforming that data to obtain the required quality for particular purposes and loading it into a data store, are common tasks. The procedure of Extraction, Transformation and Loading of data is called ETL process. Geographic Information Systems (GIS) can take over many of these tasks but often they are not suitable for processing large datasets. ETL tools can make the implementation and execution of ETL processes convenient and efficient. One reason for choosing ETL tools for data integration is that they ease maintenance because of a clear (graphical) presentation of the transformation steps. Developers and administrators are provided with tools for identification of errors, analyzing processing performance and managing the execution of ETL processes. Another benefit of ETL tools is that for most tasks no or only little scripting skills are required so that also researchers without programming background can easily work with it. Investigations on ETL tools for business approaches are available for a long time. However, little work has been published on the capabilities of those tools to handle spatial data. In this work, we review and compare the open source ETL tools GeoKettle and Talend Open Studio in terms of processing spatial data sets of different formats. For evaluation, ETL processes are performed with both software packages based on air quality data measured during the BÄRLIN2014 Campaign initiated by the Institute for Advanced Sustainability Studies (IASS). The aim of the BÄRLIN2014 Campaign is to better understand the sources and distribution of particulate matter in Berlin. The air quality data are available in heterogeneous formats because they were measured with different instruments. For further data analysis

  16. Evaluating the effect of corridors and landscape heterogeneity on dispersal probability: a comparison of three spatially explicit modelling approaches

    Jepsen, J. U.; Baveco, J. M.; Topping, C. J.;

    2004-01-01

    populations in space given a specific configuration of habitat patches. We evaluated how the choice of model influenced predictions regarding the effect of patch- and corridor configuration on dispersal probabilities and the number of successful immigrants of a simulated small mammal. Model results were...... analysed both at the level of the entire habitat network and at the level of individual patches....

  17. Characterization of AA7050 aluminium alloy processed by ECAP; Caracterizacao da liga de aluminio AA7050 processada por ECAP

    Cardoso, K.R.; Guido, V. [Universidade do Vale do Paraiba (UNIVAP), Sao Jose dos Campos, SP (Brazil). Inst. de Pesquisa e Desenvolvimento; Travessa, D.N. [Empresa Brasileira de Aeronautica (EMBRAER), Sao Jose dos Campos, SP (Brazil); Jorge Junior, A.M. [Universidade Federal de Sao Carlos (DEMa/UFSCar), SP (Brazil). Dept. de Engenharia de Materiais

    2010-07-01

    The commercial AA7050 aluminium alloy in the solution heat treated condition (W) was processed by ECAP through route A. Two pressing temperatures (room and 150 deg C and velocities (5 and 30mm/min) were used, as well as different number of passes. The effect of such variables on the microstructure evolution was evaluated using optical and transmission electron microscopy with EDX microanalysis, and xray diffraction. It was found that the microstructure has been refined by ECAP, as a result of subgrains formed within deformation bands. ECAP at 150 deg C resulted in intense precipitation of plate like {eta} phase, which evolves to equiaxial morphology as the number of passes increases. (author)

  18. AAS Special Session: Policy Making in Astronomy

    Cardelli, J. A.; Massa, D.

    1995-12-01

    The professional astronomical community today is more diverse than at any time in its history. Individuals participating in creative research programs can be found in a wide range of positions. This type of diversity, which mixes research, education, and service (e.g. contract) work, represents the strength of contemporary astronomy. While recognizing the unavoidable reductions in funding and restructuring of organizations like NASA, it is imperative that the significance of the current diversity be considered during these processes. Creative ideas are one of the cornerstones of quality research, and they can originate anywhere. Consequently, it is essential that adequate research resources remain available for free and open competition by all astronomers. Our goal in this session is to bring together officials from the AAS, NASA, and the NSF to discuss how the policy and decision making process operates and whether it should be changed to better serve the general needs of the professional astronomical community. Examples of the issues we believe are important include: In establishing new policy, how can the needs of the average research astronomer be better addressed? How could input from such astronomers be provided to those who craft NASA/NSF policy? How can/should the AAS serve as an interface between policy/decision making bodies and its membership? Should the AAS membership become more actively/effectively involved in the decision making process and, if so, how? More information on this session and related issues can be found at the Association of Research Astronomers Home Page: http://www.phy.vill.edu/astro/faculty/ara/ara_home.htm

  19. Analysis of Resource and Emission Impacts: An Emergy-Based Multiple Spatial Scale Framework for Urban Ecological and Economic Evaluation

    Lixiao Zhang

    2011-03-01

    Full Text Available The development of the complex and multi-dimensional urban socio-economic system creates impacts on natural capital and human capital, which range from a local to a global scale. An emergy-based multiple spatial scale analysis framework and a rigorous accounting method that can quantify the values of human-made and natural capital losses were proposed in this study. With the intent of comparing the trajectory of Beijing over time, the characteristics of the interface between different scales are considered to explain the resource trade and the impacts of emissions. In addition, our improved determination of emergy analysis and acceptable management options that are in agreement with Beijing’s overall sustainability strategy were examined. The results showed that Beijing’s economy was closely correlated with the consumption of nonrenewable resources and exerted rising pressure on the environment. Of the total emergy use by the economic system, the imported nonrenewable resources from other provinces contribute the most, and the multi‑scale environmental impacts of waterborne and airborne pollution continued to increase from 1999 to 2006. Given the inputs structure, Beijing was chiefly making greater profits by shifting resources from other provinces in China and transferring the emissions outside. The results of our study should enable urban policy planners to better understand the multi-scale policy planning and development design of an urban ecological economic system.

  20. Comparative Study for determination of iron content in soils by AAS and calorimetry. Estudio comparativo de la determinacion por AAS y colorimetria del contenido de hierro en suelos

    Manuel-Vez, M.P.; Garcia-Vargas, M. (Universidad de Cadiz. Departamento de Qumica Analitica. Cadiz (Spain))

    1992-12-01

    In order to evaluate the accuracy and reliability of a new calorimetric method for the determination of iron in soils, a comparative study with atomic absorption spectrometry (AAS) was conducted. the first method results very selective and is based in the formation of a complex between the reactant picolinoilhidrazone of 2.2 dipiridilketone and Fe (II), of green color and stechiometry 2:1 (nm, and ''alpha''=7.0 x 10''3 1 mol''-4 cm''-1 in water ethanol solution). Soil samples were analysed by means of a AAS standard method. after data processing of the results obtained it could be concluded that both method led to results statistically equivalent. (Author).

  1. Simon van der Meer in the AA Control Room

    1984-01-01

    Simon van der Meer, spiritus rector of the Antiproton Accumulator, in the AA Control Room. Inventor of stochastic cooling, on which the AA was based, and of the magnetic horn, with which the antiprotons were focused, he also wrote most of the software with which the AA was controlled, and spent uncountable numbers of hours in this chair to tickle the AA to top performance. 8 months after this picture was taken, he received, in October 1984, the Nobel prize, together with Carlo Rubbia, the moving force behind the whole Proton-Antiproton Collider project that led to the discovery, in 1983, of the W and Z intermediate bosons.

  2. Flow Injection and Atomic Absorption Spectrometry (FI-AAS) -

    Hansen, Elo Harald

    1996-01-01

    absorption spectrometry (AAS). Initially with flame-AAS (fAAS) procedures, later for hydride generation (HG) techniques, and most recently in combination with electrothermal AAS (ETAAS). The common denominator for all these procedures is the inherently precise and strictly reproducible timing in FI from the......One of the advantages of the flow injection (FI) concept is that it is compatible with virtually all detection techniques. Being a versatile vehicle for enhancing the performance of the individual detection devices, the most spectacular results have possibly been obtained in conjunction with atomic...

  3. AA, Inner Conductor of Magnetic Horn

    1979-01-01

    Antiprotons emerging at large angles from the production target (hit by an intense 26 GeV proton beam from the PS), were focused into the acceptance of the injection line of the AA by means of a "magnetic horn" (current-sheet lens). Here we see an early protype of the horn's inner conductor, machined from solid aluminium to a thickness of less than 1 mm. The 1st version had to withstand pulses of 150 kA, 15 us long, every 2.4 s. See 8801040 for a later version.

  4. Wooden Model of Wide AA Bending Magnet

    1978-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets: BLG, long and narrow; BST, short and wide). A wide one had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. A wooden model was build in 1978, to gain dimensional experience. Here, Peter Zettwoch, one of the largest men at CERN at that time, is putting a hand in the mouth of the wooden BST monster.

  5. Atlas of Vega: 3850 -- 6860 \\AA

    Kim, Hyun-Sook; Valyavin, G; Lee, Byeong-Cheol; Shimansky, V; Galazutdinov, G A

    2009-01-01

    We present a high resolving power ($\\lambda$ / $\\Delta\\lambda$ = 90,000) and high signal-to-noise ratio ($\\sim$700) spectral atlas of Vega covering the 3850 -- 6860 \\AA wavelength range. The atlas is a result of averaging of spectra recorded with the aid of the echelle spectrograph BOES fed by the 1.8-m telescope at Bohyunsan observatory (Korea). The atlas is provided only in machine-readable form (electronic data file) and will be available in the SIMBAD database upon publication.

  6. Toughness behavior in roll-bonded laminates based on AA6061/SiCp composites

    Hosseini Monazzah, A. [Department of Materials Science and Engineering, Sharif University of Technology, P.O. Box 11155-9466, Tehran (Iran, Islamic Republic of); Pouraliakbar, H. [Department of Advanced Materials, WorldTech Scientific Research Center (WT-SRC), Tehran (Iran, Islamic Republic of); Bagheri, R., E-mail: rezabagh@sharif.edu [Department of Materials Science and Engineering, Sharif University of Technology, P.O. Box 11155-9466, Tehran (Iran, Islamic Republic of); Seyed Reihani, S.M. [Department of Materials Science and Engineering, Sharif University of Technology, P.O. Box 11155-9466, Tehran (Iran, Islamic Republic of)

    2014-03-01

    Lamination has been shown to enhance damage tolerance of discontinuously reinforced aluminum (DRA) composites. Doing this technique, DRA layers could be laminated with ductile interlayers. In this research, two types of laminates consisting similar DRA layers and a ductile AA1050 interlayer were fabricated by means of hot roll-bonding. AA6061–5 vol% SiCp and AA6061–15 vol% SiCp composites were considered as exterior layers. Different rolling strains, was applied to control the interfacial strength which was examined by shear test. Toughness behavior of laminates was evaluated by three-point bending test in crack-divider orientation. Based on obtained results, the plastic deformation of ductile interlayer and delamination are challenging toughening mechanisms which were influenced by the degree of interfacial bonding and ceramic particle content. An increment in reinforcement content alters the toughness behavior of laminates in the way that the governing mechanism in laminates containing 5 vol% SiCp is interfacial adhesion since in laminates having 15 vol% SiCp the dominant mechanism is AA1050 deformability. Meanwhile, optical and scanning electron microscopy observations proved the importance of toughening mechanisms in each type of materials. Also, shear test results revealed that the interfacial strength of laminates increases by the number of rolling passes and deteriorated by higher reinforcement contents.

  7. Toughness behavior in roll-bonded laminates based on AA6061/SiCp composites

    Lamination has been shown to enhance damage tolerance of discontinuously reinforced aluminum (DRA) composites. Doing this technique, DRA layers could be laminated with ductile interlayers. In this research, two types of laminates consisting similar DRA layers and a ductile AA1050 interlayer were fabricated by means of hot roll-bonding. AA6061–5 vol% SiCp and AA6061–15 vol% SiCp composites were considered as exterior layers. Different rolling strains, was applied to control the interfacial strength which was examined by shear test. Toughness behavior of laminates was evaluated by three-point bending test in crack-divider orientation. Based on obtained results, the plastic deformation of ductile interlayer and delamination are challenging toughening mechanisms which were influenced by the degree of interfacial bonding and ceramic particle content. An increment in reinforcement content alters the toughness behavior of laminates in the way that the governing mechanism in laminates containing 5 vol% SiCp is interfacial adhesion since in laminates having 15 vol% SiCp the dominant mechanism is AA1050 deformability. Meanwhile, optical and scanning electron microscopy observations proved the importance of toughening mechanisms in each type of materials. Also, shear test results revealed that the interfacial strength of laminates increases by the number of rolling passes and deteriorated by higher reinforcement contents

  8. Experimental immunologically mediated aplastic anemia (AA) in mice: cyclosporin A fails to protect against AA

    Immunologically mediated aplastic anemia (AA) in mice was induced by the i.v. injection of 10(7) lymph node cells (LNC) from H-2k identical but Mls mismatched CBA/J donor mice into previously irradiated (600 rad total body gamma) C3H/HeJ mice. Cyclosporin A (CsA), 25 mg/kg, was administered subcutaneously from day -1 to day 30. Control mice included C3H/HeJ mice which received 600 rad alone, C3H/HeJ mice which received 600 rad plus CsA as above, and C3H/HeJ mice which received 600 rad total body irradiation followed by 10(7) LNC from CBA/J donors. CsA failed to prevent lethal AA. These results suggest that the pathogenetic mechanisms operating in immunologically mediated AA differ from the mechanisms operating in rodents transplanted with allogeneically mismatched marrow or spleen cells which develop graft-versus-host disease. The results are consistent with a non-T cell-dependent mechanism causing the AA

  9. Study on Fabrication of AA4032/AA6069 Cladding Billet Using Direct Chill Casting Process

    Han, Xing; Zhang, Haitao; Shao, Bo; Li, Lei; Liu, Xuan; Cui, Jianzhong

    2016-04-01

    AA4032/AA6069 cladding billet in size of φ130 mm/φ110 mm was prepared by the modified direct chill casting process, and the parametric effect on casting performance was investigated using numerical simulation. Microstructures, elements distribution, and mechanical properties of the bonding interface were examined. The results show that metallurgical bonding interface can be obtained with the optimal parameters: the casting speed of 130 to 140 mm/min, the internal liquid level height of 50 to 60 mm, and the contact height of 40 to 50 mm. The metallurgical bonding interface is free of any discontinuities due to the fact that the alloying elements diffused across the interface and formed Ni-containing phase. Tensile strength of the cladding billet reaches 225.3 MPa, and the fracture position was located in AA6069 side, suggesting that the interface bonding strength is higher than the strength of AA6069. The interfacial shearing strength is 159.3 MPa, indicating excellent metallurgical bonding.

  10. An evaluation of spatial and temporal scales of differentiation in the Tuolumne Batholith, Central Sierra Nevada (Invited)

    Paterson, S. R.; Memeti, V.; Krause, J.

    2010-12-01

    minerals disclose further details about these processes. Oscillatory zoning of Ba in K-feldspar with asymmetric sharp elevated to gradually outward decreasing levels indicates recurring magma replenishment/mixing events and subsequent Ba fractionation during crystallization. Decreasing anorthite content towards single plagioclase rims and in plagioclase populations from outer to inner magmatic units supports fractionation. Trace element distributions of K-feldspar indicate at least 2-3 different crystal populations, all of which are overgrown by a thin rim with similar Ba compositions. These mineral patterns are particularly well established in the lobes, indicating that fractionates and other magmas were mixing during ascent and possibly at the emplacement level before the lobe wide compositional patterns were established (#2 and #3 above). Interestingly, evidence of mixing of magmas from different sources is best preserved at the largest and smallest spatial scales (#1, #2 and #8 above), whereas fractionation of previously mixed magma is best preserved at intermediate spatial scales (#3 to #7).

  11. Evaluating the use of local ecological knowledge to monitor hunted tropical-forest wildlife over large spatial scales

    Luke Parry

    2015-09-01

    Full Text Available Monitoring the distribution and abundance of hunted wildlife is critical to achieving sustainable resource use, yet adequate data are sparse for most tropical regions. Conventional methods for monitoring hunted forest-vertebrate species require intensive in situ survey effort, which severely constrains spatial and temporal replication. Integrating local ecological knowledge (LEK into monitoring and management is appealing because it can be cost-effective, enhance community participation, and provide novel insights into sustainable resource use. We develop a technique to monitor population depletion of hunted forest wildlife in the Brazilian Amazon, based on the local ecological knowledge of rural hunters. We performed rapid interview surveys to estimate the landscape-scale depletion of ten large-bodied vertebrate species around 161 Amazonian riverine settlements. We assessed the explanatory and predictive power of settlement and landscape characteristics and were able to develop robust estimates of local faunal depletion. By identifying species-specific drivers of depletion and using secondary data on human population density, land form, and physical accessibility, we then estimated landscape- and regional-scale depletion. White-lipped peccary (Tayassu pecari, for example, were estimated to be absent from 17% of their putative range in Brazil's largest state (Amazonas, despite 98% of the original forest cover remaining intact. We found evidence that bushmeat consumption in small urban centers has far-reaching impacts on some forest species, including severe depletion well over 100 km from urban centers. We conclude that LEK-based approaches require further field validation, but have significant potential for community-based participatory monitoring as well as cost-effective, large-scale monitoring of threatened forest species.

  12. Modeling Spatial Sustainability: Spatial Welfare Economics versus Ecological Footprint

    Grazi, Fabio; Van Den Bergh, Jeroen C.J.M.; Rietveld, Piet

    2006-01-01

    A spatial welfare framework for the analysis of the spatial dimensions of sustainability is developed. It incorporates agglomeration effects, interregional trade, negative environmental externalities and various land use categories. The model is used to compare rankings of spatial configurations according to evaluations based on social welfare and ecological footprint indicators. Five spatial configurations are considered for this purpose. The exercise is operationalized with the help of a tw...

  13. Evaluation of Habitat Suitability for Rhino (Rhinoceros unicornis) in Orang National Park Using Geo-Spatial Tools

    Sarma, Pranjit Kumar; B. S. Mipun; Talukdar, Bibhab Kumar; Kumar, Rajeev; Basumatary, Ajit Kumar

    2011-01-01

    Orang National Park (Orang NP) is one of the important conservation areas in the Brahmaputra valley within North East India biogeographic zone covering an area of 78.8 km2. It is one of the prime habitats of one horned rhino (Rhinoceros unicornis) in its distribution range in south Asia. Satellite imagery of November 2008 was used to evaluate the rhino habitat pattern in the park. A habitat suitability model for one horned rhino was prepared using primary and secondary sources. Result indicat...

  14. Evaluation of the spatial patterns and risk factors, including backyard pigs, for classical swine fever occurrence in Bulgaria using a Bayesian model

    Beatriz Martínez-López

    2014-05-01

    Full Text Available The spatial pattern and epidemiology of backyard pig farming and other low bio-security pig production systems and their role in the occurrence of classical swine fever (CSF is described and evaluated. A spatial Bayesian model was used to explore the risk factors, including human demographics, socioeconomic and environmental factors. The analyses were performed for Bulgaria, which has a large number of backyard farms (96% of all pig farms in the country are classified as backyard farms, and it is one of the countries for which both backyard pig and farm counts were available. Results reveal that the high-risk areas are typically concentrated in areas with small family farms, high numbers of outgoing pig shipments and low levels of personal consumption (i.e. economically deprived areas. Identification of risk factors and high-risk areas for CSF will allow to targeting risk-based surveillance strategies leading to prevention, control and, ultimately, elimination of the disease in Bulgaria and other countries with similar socio-epidemiological conditions.

  15. A web-based multicriteria evaluation of spatial trade-offs between environmental and economic implications from hydraulic fracturing in a shale gas region in Ohio.

    Liu, X; Gorsevski, P V; Yacobucci, M M; Onasch, C M

    2016-06-01

    Planning of shale gas infrastructure and drilling sites for hydraulic fracturing has important spatial implications. The evaluation of conflicting and competing objectives requires an explicit consideration of multiple criteria as they have important environmental and economic implications. This study presents a web-based multicriteria spatial decision support system (SDSS) prototype with a flexible and user-friendly interface that could provide educational or decision-making capabilities with respect to hydraulic fracturing site selection in eastern Ohio. One of the main features of this SDSS is to emphasize potential trade-offs between important factors of environmental and economic ramifications from hydraulic fracturing activities using a weighted linear combination (WLC) method. In the prototype, the GIS-enabled analytical components allow spontaneous visualization of available alternatives on maps which provide value-added features for decision support processes and derivation of final decision maps. The SDSS prototype also facilitates nonexpert participation capabilities using a mapping module, decision-making tool, group decision module, and social media sharing tools. The logical flow of successively presented forms and standardized criteria maps is used to generate visualization of trade-off scenarios and alternative solutions tailored to individual user's preferences that are graphed for subsequent decision-making. PMID:27230428

  16. Evaluation of Geostatistical Techniques for Mapping Spatial Distribution of Soil PH, Salinity and Plant Cover Affected by Environmental Factors in Southern Iran

    Mohammad ZARE-MEHRJARDI

    2010-12-01

    Full Text Available The study presented in this paper attempts to evaluate some interpolation techniques for mapping spatial distribution of soil pH, salinity and plant cover in Hormozgan province, Iran. The relationships among environmental factors and distribution of vegetation types were also investigated. Plot sampling was applied in the study area. Landform parameters of each plot were recorded and canopy cover percentages of each species were measured while stoniness and browsing damage were estimated. Results indicated that there was a significant difference in vegetation cover for high and low slope steepness. Also, vegetation cover was greater than other cases in the mountains with calcareous lithology. In general, there were no significant relationships among vegetation cover and soil properties such as pH, EC, and texture. Other soil properties, such as soil depth and gravel percentage were significantly affected by vegetation cover. Moreover, the geostatistical results showed that kriging and cokriging methods were better than inverse distance weighting (IDW method for prediction of the spatial distribution of soil properties. Also, the results indicated that all the concerned soil and plant parameters were better determined by means of a cokriging method. Land elevation, which was highly correlated with studied parameters, was used as an auxiliary parameter.

  17. Comparison of direct mercury analyzer and FIA-CV-AAS in determination of methylmercury in fish

    Ulrich, J. C.; Hortellani, M. A.; Sarkis, J. E. S.; Nakatsubo, M. A.

    2016-07-01

    Methylmercury (MeHg) has been determined in fish reference materials by direct mercury analyzer (DMA 80) and FIA-CV-AAS. In order to evaluate accuracy, certified reference materials (Fish protein, NRCC - Dorm 4 and fish material, Ipen - Dourada 1) were analyzed after extraction and separation of mercury species. Good agreement of the results have been obtained (relative error of the determination between the methods varied from 1.5% to 39%). The repeatability of the results varied from 4% to 26%.

  18. Pharmacokinetic Drug Interactions Involving Vortioxetine (Lu AA21004), a Multimodal Antidepressant

    Chen, Grace; Lee, Ronald; Højer, Astrid-Maria; Buchbjerg, Jeppe Klint; Serenko, Michael; Zhao, Zhen

    2013-01-01

    Background and Objective The identification and quantification of potential drug–drug interactions is important for avoiding or minimizing the interaction-induced adverse events associated with specific drug combinations. Clinical studies in healthy subjects were performed to evaluate potential pharmacokinetic interactions between vortioxetine (Lu AA21004) and co-administered agents, including fluconazole (cytochrome P450 [CYP] 2C9, CYP2C19 and CYP3A inhibitor), ketoconazole (CYP3A and P-glyc...

  19. Microstructure evolution of AA7050 Al alloy during Equal-Channel Angular Pressing

    Katia Regina Cardoso; Dilermando Nagle Travessa; Alberto Moreira Jorge Junior; Walter José Botta

    2012-01-01

    High strength AA7050 aluminum alloy was processed by ECAP through route A in the T7451 condition. Samples were processed at 423 K, with 1 and 3 passes. The resulting microstructure was evaluated by optical microscopy (OM), scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The phases were identified by X-ray diffraction (XRD) using monochromatic Cu Kα radiation. Rockwell B hardness and tensile tests were performed for assessment of mechanical properties. The m...

  20. Dicty_cDB: FC-AA22 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA22 (Link to dictyBase) - - - Contig-U14948-1 FC-AA22E (Li...nk to Original site) - - - - - - FC-AA22E 576 Show FC-AA22 Library FC (Link to library) Clone ID FC-AA22 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA22Q.Seq.d/ Representative seq. ID FC-AA...22E (Link to Original site) Representative DNA sequence >FC-AA22 (FC-AA22Q) /CSM/FC/FC-AA/FC-AA22Q.Seq.d/ ATGAA...TACGATGATAGTGATTCAGACTTTTGACCAATTGAAAAAACCAGCAACAGAAATG GTACTGGTTTGGTCTCCTCCACTTTTAAGGTTGCCCCTTCCTTCTCTACCATTCAAAAAC AACAA

  1. Dicty_cDB: FC-AA15 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA15 (Link to dictyBase) - G01144 DDB0204372 Contig-U15089-1 FC-AA...15E (Link to Original site) - - - - - - FC-AA15E 522 Show FC-AA15 Library FC (Link to library) Clone ID FC-AA...9-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA15Q.Se...q.d/ Representative seq. ID FC-AA15E (Link to Original site) Representative DNA sequence >FC-AA15 (FC-AA15Q) /CSM/FC/FC-AA/FC-AA...15Q.Seq.d/ CAAATCACACATAAAAGTTTAATATAAAAATGGGTACACCAATTAAAAAGATTAGTACAG TAATTATTAAAATGGTTTCATCAGCCAA

  2. Dicty_cDB: FC-AA17 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA17 (Link to dictyBase) - - - Contig-U15091-1 FC-AA17E (Li...nk to Original site) - - - - - - FC-AA17E 347 Show FC-AA17 Library FC (Link to library) Clone ID FC-AA17 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA17Q.Seq.d/ Representative seq. ID FC-AA...17E (Link to Original site) Representative DNA sequence >FC-AA17 (FC-AA17Q) /CSM/FC/FC-AA/FC-AA17Q.Seq.d/ CCCAAAAGCCCGTAA...GACTCACTGTGTCAAGTGCAACAAACACACCCCACACAAGGTTAC CCAATACAAAGCTGGTAAACCAAGTCTTTTCGCACAAGGTAAAAGACGTTACGATCGTAA ACAA

  3. Dicty_cDB: FC-AA05 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA05 (Link to dictyBase) - G01143 DDB0190243 Contig-U15085-1 FC-AA...05E (Link to Original site) - - - - - - FC-AA05E 675 Show FC-AA05 Library FC (Link to library) Clone ID FC-AA...5-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA05Q.Se...q.d/ Representative seq. ID FC-AA05E (Link to Original site) Representative DNA sequence >FC-AA05 (FC-AA05Q) /CSM/FC/FC-AA/FC-AA...05Q.Seq.d/ AAACAAAAAAAAAAGGTATGGAAATTTTTGCATTTGTACCATTAGCAGTGTTAACAGCAT TATGTGTTGTTATTTCACTCTTTGTTAAAAGAGAGAAA

  4. Dicty_cDB: FCL-AA23 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA23 (Link to dictyBase) - G01759 DDB0201558 Contig-U15118-1 FCL-AA...23E (Link to Original site) - - - - - - FCL-AA23E 1045 Show FCL-AA23 Library FCL (Link to library) Clone ID FCL-AA...ig-U15118-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...23Q.Seq.d/ Representative seq. ID FCL-AA23E (Link to Original site) Representative DNA sequence >FCL-AA23 (FCL-AA...23Q) /CSM/FCL/FCL-AA/FCL-AA23Q.Seq.d/ ATAACTATATAACTATGTCTAACCAAAAGAAAAACGACGTATCTTCATTTGTTAAAGATT CTTTAA

  5. Dicty_cDB: FC-AA21 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA21 (Link to dictyBase) - - - Contig-U15450-1 FC-AA21E (Li...nk to Original site) - - - - - - FC-AA21E 839 Show FC-AA21 Library FC (Link to library) Clone ID FC-AA21 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA21Q.Seq.d/ Representative seq. ID FC-AA...21E (Link to Original site) Representative DNA sequence >FC-AA21 (FC-AA21Q) /CSM/FC/FC-AA/FC-AA21Q.Seq.d/ AATTATTTTCATTAA...TTTTAGCTTTATTCCTTGTCAACTCCGCTGTTGTCTCTTCACTCG ACTCATGTAGTATTTGTGTTGATTTTGTTGGTAACTCACTCAATGATCTTTTAAATATTA TCCTTAA

  6. Dicty_cDB: FCL-AA22 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA22 (Link to dictyBase) - G01758 DDB0229949 Contig-U15119-1 FCL-AA...22E (Link to Original site) - - - - - - FCL-AA22E 840 Show FCL-AA22 Library FCL (Link to library) Clone ID FCL-AA...g-U15119-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...22Q.Seq.d/ Representative seq. ID FCL-AA22E (Link to Original site) Representative DNA sequence >FCL-AA22 (FCL-AA...22Q) /CSM/FCL/FCL-AA/FCL-AA22Q.Seq.d/ AAAATGAGCAAAATCTCAAGCGACCAAGTTAGATCAATCGTCTCCCAACTTTTCAAAGAA GCACAAGAATCCAAAA

  7. Dicty_cDB: FCL-AA06 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA06 (Link to dictyBase) - G24322 DDB0216974 Contig-U15228-1 FCL-AA...06E (Link to Original site) - - - - - - FCL-AA06E 791 Show FCL-AA06 Library FCL (Link to library) Clone ID FCL-AA...g-U15228-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...06Q.Seq.d/ Representative seq. ID FCL-AA06E (Link to Original site) Representative DNA sequence >FCL-AA06 (FCL-AA...06Q) /CSM/FCL/FCL-AA/FCL-AA06Q.Seq.d/ AAAATCCCAATTTCATTAGCAGTGGAAGTAACGGAATGAATTGGGGTGGTTCTTTGAACA CTTGTGACTCTGGAGGATTCAA

  8. Dicty_cDB: FCL-AA18 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA18 (Link to dictyBase) - G24323 DDB0191144 Contig-U15229-1 FCL-AA...18Z (Link to Original site) - - FCL-AA18Z 623 - - - - Show FCL-AA18 Library FCL (Link to library) Clone ID FCL-AA...g-U15229-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...18Q.Seq.d/ Representative seq. ID FCL-AA18Z (Link to Original site) Representative DNA sequence >FCL-AA18 (FCL-AA...18Q) /CSM/FCL/FCL-AA/FCL-AA18Q.Seq.d/ XXXXXXXXXXGTCAATGTCATTATTGGTGAACAATCTGATGGTTCGTTGGAACAAATCGC TAGAAATCCACAACCAA

  9. Dicty_cDB: FC-AA16 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA16 (Link to dictyBase) - G22556 DDB0204121 Contig-U15090-1 FC-AA...16E (Link to Original site) - - - - - - FC-AA16E 933 Show FC-AA16 Library FC (Link to library) Clone ID FC-AA...0-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA16Q.Se...q.d/ Representative seq. ID FC-AA16E (Link to Original site) Representative DNA sequence >FC-AA16 (FC-AA16Q) /CSM/FC/FC-AA/FC-AA...16Q.Seq.d/ GGGCAGGATCATCATTTAATACTAAAGATTCAACAATAATTGCAAAAACTCAATTTTATC AAAAAAATATTCAAATTTATAAAGGTGATCAA

  10. Microstructural features, texture and strengthening mechanisms of nanostructured AA6063 alloy processed by powder metallurgy

    Research highlights: → Nanostructured AA6063 (NS-Al) alloy contains Cu and P texture components. → The microstructure consists of nano-size grains and ultrafine grains (200-400 nm). → NS-Al exhibits a lower work hardening compared to coarse-grained Al alloy. → Grain boundary strengthening mechanism plays an important role for NS-Al. - Abstract: Nanostructured AA6063 (NS-Al) powder with an average grain size of ∼100 nm was synthesized by high-energy attrition milling of gas-atomized AA6063 powder followed by hot extrusion. The microstructural features of the consolidated specimen were studied by transmission electron microscopy (TEM) and electron backscatter diffraction (EBSD) techniques and compared with those of coarse-grained AA6063 (CG-Al) produced by hot powder extrusion of gas-atomized powder (without using mechanical milling). The consolidated NS-Al alloy consisted of elongated ultrafine grains (aspect ratio of ∼2.9) and equiaxed nanostructured grains. A high fraction (∼78%) of high-angle grain boundaries with average misorientation angle of 33o was noticed. Microtexture evaluation by plotting pole-figures and orientation distribution function (ODF) analysis showed Copper and P texture components for both the consolidated Al alloys. Tensile test at room temperature and microhardness measurement revealed that a significant improvement in the strength of AA6063 alloy is obtained through refinement of the grain structure. The strengthening mechanisms are discussed based on the dislocation-based models. The role of high-angle and low-angle grain boundaries on the strengthening mechanisms is discussed.

  11. Bardoxolone methyl (BARD) ameliorates aristolochic acid (AA)-induced acute kidney injury through Nrf2 pathway

    Bardoxolone methyl (BARD) is an antioxidant modulator that acts through induction of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway. This study aimed to investigate the role of BARD in protecting kidneys from aristolochic acid (AA)-induced acute kidney injury (AKI). Male C57BL/6 mice received intraperitoneal (i.p.) injections of aristolochic acid I (AAI) (5 mg/kg/day) for 5 days to produce acute AA nephropathy (AAN) model. BARD (10 mg/kg/day, i.p.) was applied for 7 consecutive days, starting 2 days prior to AAI administration. The mice in the AA group showed AKI as evidenced by worsening kidney function evaluated by blood urea nitrogen (BUN) and serum creatinine (SCr) levels, and severe tubulointerstitial injury marked by massive tubule necrosis in kidney tissues. BARD significantly reduced BUN and SCr levels which were elevated by AAI. Additionally, AAI-induced histopathological renal damage was ameliorated by BARD. Furthermore, the expression of Nrf2 was reduced, and its repressor Kelch-like ECH-associated protein 1 (Keap1) was increased significantly, whereas heme oxygenase-1 (HO-1) was upregulated and NAD(P)H quinone oxidoreductase-1 (NQO1) was barely increased in the cytoplasm of tubules in kidneys after treatment with AAI. BARD significantly upregulated renal Nrf2, NQO1 and HO-1 expression and downregulated Keap1 expression compared with those in the AA group. Moreover, it was found that Nrf2 was expressed both in the cytoplasm and nuclear of glomeruli and tubules, whereas NQO1 and HO-1 were localized in the cytoplasm of tubules only. In conclusion, AA-induced acute renal injury was associated with impaired Nrf2 activation and expression of its downstream target genes in renal tissues. BARD prevented renal damage induced by AAI, and this renoprotective effect may be exerted by activating the Nrf2 signaling pathway and increasing expression of the downstream target genes

  12. A GIS TOOL TO EVALUATE THE SPATIAL EVOLUTION OF HYDRO-THERMIC FEATURES DURING GROWING SEASON OF VEGETABLE CROPS IN ELBE RIVER LOWLAND (POLABI

    VERA POTOP

    2012-11-01

    Full Text Available A GIS tool to evaluate the spatial evolution of hydro-thermic features during growing season of vegetable crops in Elbe River lowland (Polabi. This article presents the results of the first study on combined mezoclimatological, microclimatological and topographical tools for evaluating precision farming in the growth of vegetable crops in the Elbe River lowland (Polabi region from the Czech Republic. We assess the variability of basically climatological characteristics in relation to topographic characteristics at the regional (Polabi and local (agricultural farm scales. At regional scale, interpolation approach is based on local linear regression and universal kriging interpolation. At local scale, two conventional interpolation methods, spline and local ordinary kriging with a Gaussian model variance across the fields, were applied. The local spline interpolators have been used in developing digital elevation models (DEMs and to determine the slope angle inclination of vegetable fields. The DEMs of the vegetable crops fields was developed at a 10 m x 10 m resolution based on elevation data collected in the field by a hand-held RTK- Global Positioning System receiver. This tool allowed the distinction of microclimatic conditions that produce altitude-slope-related patterns of the spatial-temporal distribution of the basic meteorological elements during growing season of vegetable crops. The effect of slope on diurnal extreme temperatures in the vegetable cropped field conditions was more pronounced than that of elevation. Accordingly to developed maps, the warmest and longest duration of sunshine, and the least precipitation totals during growing season occurred in the middle part of Polabi.

  13. Land drainage system detection using IR and visual imagery taken from autonomous mapping airship and evaluation of physical and spatial parameters of suggested method

    Koska, Bronislav; Křemen, Tomáš; Štroner, Martin; Pospíšil, Jiří; Jirka, Vladimír.

    2014-10-01

    An experimental approach to the land drainage system detection and its physical and spatial parameters evaluation by the form of pilot project is presented in this paper. The novelty of the approach is partly based on using of unique unmanned aerial vehicle - airship with some specific properties. The most important parameters are carrying capacity (15 kg) and long flight time (3 hours). A special instrumentation was installed for physical characteristic testing in the locality too. The most important is 30 meter high mast with 3 meter length bracket at the top with sensors recording absolute and comparative temperature, humidity and wind speed and direction in several heights of the mast. There were also installed several measuring units recording local condition in the area. Recorded data were compared with IR images taken from airship platform. The locality is situated around village Domanín in the Czech Republic and has size about 1.8 x 1.5 km. There was build a land drainage system during the 70-ties of the last century which is made from burnt ceramic blocks placed about 70 cm below surface. The project documentation of the land drainage system exists but real state surveying haveńt been never realized. The aim of the project was land surveying of land drainage system based on infrared, visual and its combination high resolution orthophotos (10 cm for VIS and 30 cm for IR) and spatial and physical parameters evaluation of the presented procedure. The orthophoto in VIS and IR spectrum and its combination seems to be suitable for the task.

  14. Clinical Evaluation of Spatial Accuracy of a Fusion Imaging Technique Combining Previously Acquired Computed Tomography and Real-Time Ultrasound for Imaging of Liver Metastases

    Purpose: This study was designed to evaluate the spatial accuracy of matching volumetric computed tomography (CT) data of hepatic metastases with real-time ultrasound (US) using a fusion imaging system (VNav) according to different clinical settings. Methods: Twenty-four patients with one hepatic tumor identified on enhanced CT and US were prospectively enrolled. A set of three landmarks markers was chosen on CT and US for image registration. US and CT images were then superimposed using the fusion imaging display mode. The difference in spatial location between the tumor visible on the CT and the US on the overlay images (reviewer no. 1, comment no. 2) was measured in the lateral, anterior–posterior, and vertical axis. The maximum difference (Dmax) was evaluated for different predictive factors.CT performed 1–30 days before registration versus immediately before. Use of general anesthesia for CT and US versus no anesthesia.Anatomic landmarks versus landmarks that include at least one nonanatomic structure, such as a cyst or a calcificationResultsOverall, Dmax was 11.53 ± 8.38 mm. Dmax was 6.55 ± 7.31 mm with CT performed immediately before VNav versus 17.4 ± 5.18 with CT performed 1–30 days before (p < 0.0001). Dmax was 7.05 ± 6.95 under general anesthesia and 16.81 ± 6.77 without anesthesia (p < 0.0015). Landmarks including at least one nonanatomic structure increase Dmax of 5.2 mm (p < 0.0001). The lowest Dmax (1.9 ± 1.4 mm) was obtained when CT and VNav were performed under general anesthesia, one immediately after the other. Conclusions: VNav is accurate when adequate clinical setup is carefully selected. Only under these conditions (reviewer no. 2), liver tumors not identified on US can be accurately targeted for biopsy or radiofrequency ablation using fusion imaging.

  15. Evolution of geomagnetic aa index near sunspot minimum

    R. P. Kane

    Full Text Available The smoothed values of the minima of sunspot number Rz and the geomagnetic index aa were compared for sunspot cycles 12–23. In one cycle, aa(min occurred earlier than Rz(min, but remained at that low from a few months before Rz(min to a few months after Rz(min. In two cycles, Rz(min and aa(min coincided within a month or two. In nine cycles, aa(min occurred more than three months later than Rz(min. The aa(min coincided with the minima of some solar radio emission indices originating in the solar corona. For sunspot cycles 21, 22, 23, the minimum of solar wind velocity V occurred 0–9 months later than the aa(min. The minimum of solar wind total magnetic field B occurred near Rz(min. The solar wind ion density N had maxima (instead of minima near Rz(min, and again near Rz(max, indicating a  ~5-year periodicity, instead of an 11-year periodicity. The maxima of aa, V and B occurred near Rz(max and/or later in the declining phase of Rz. The aa index was very well correlated with the functions BV and BV 2.Key words. Geomagnetism and paleomagnetism (time variations, diurnal to secular – time variations, secular and long term Interplanetary physics (interplanetary magnetic field

  16. Spatializing Time

    Thomsen, Bodil Marie Stavning

    2011-01-01

    The article analyses some of artist Søren Lose's photographic installations in which time, history and narration is reflected in the creation of allegoric, spatial relations.......The article analyses some of artist Søren Lose's photographic installations in which time, history and narration is reflected in the creation of allegoric, spatial relations....

  17. Spatial Operations

    Anda VELICANU

    2010-09-01

    Full Text Available This paper contains a brief description of the most important operations that can be performed on spatial data such as spatial queries, create, update, insert, delete operations, conversions, operations on the map or analysis on grid cells. Each operation has a graphical example and some of them have code examples in Oracle and PostgreSQL.

  18. Spatial variability of POPs in European background air

    A. K. Halse

    2011-02-01

    Full Text Available Passive air samplers (PAS were deployed at 86 European background sites during summer 2006 in order (i to gain further insight into spatial patterns of persistent organic pollutants (POPs in European background air and, (ii to evaluate PAS as an alternative sampling technique under EMEP (Co-operative programme for monitoring and evaluation of the long-range transmissions of air pollutants in Europe. The samples were analyzed for selected PCBs, HCHs, DDTs, HCB, PAHs and chlordanes, and air concentrations were calculated on the basis of losses of performance reference compounds. Air concentrations of PCBs were generally lowest in more remote areas of northern Europe with elevated levels in more densely populated areas. γ-HCH was found at elevated levels in more central parts of Europe, whereas α-HCH, β-HCH and DDTs showed higher concentrations in the south-eastern part. There was no clear spatial pattern in the concentrations for PAHs, indicative of influence by local sources, rather than long range atmospheric transport (LRAT. HCB was evenly distributed across Europe, while the concentrations of chlordanes were typically low or non-detectable. A comparison of results obtained on the basis of PAS and active air sampling (AAS illustrated that coordinated PAS campaigns have the potential serve as useful inter-comparison exercises within and across existing monitoring networks. The results also highlighted limitations of the current EMEP measurement network with respect to spatial coverage. We finally adopted an existing Lagrangian transport model (FLEXPART as recently modified to incorporate key processes relevant for POPs to evaluate potential source regions affecting observed concentrations at selected sites. Using PCB-28 as an example, the model predicted concentrations which agreed within a factor of 3 with PAS measurements for all except 1 out of the 17 sites selected for this analysis.

  19. Spatial-temporal water quality parameters evaluation of the Santa Rita river (BA with respect to the release of manipueira

    Franklin Delano Porto Júnior

    2012-12-01

    Full Text Available The watershed of the river Santa Rita includes the towns of Simão and Campinhos, where exists about 150 flour houses. Campinhos is among the largest cassava processing facilities in the region, generating many direct and indirect jobs. Manipueira is a liquid residue originating from the cassava pressing and presents high pollutant potential due to its high amount of glucose and fructose, this potential is 25 times greater than the one from domestic sewer. This work had as objective the evaluation of possible impacts of manipueira release in the water quality of Santa Rita river. For this, the land use map was elaborated and the physiographic characterization developed, besides being performed six campaigns for water samples collection in four sampling points along the river. The obtained results indicated that the watershed is elongated, with low drainage efficiency and it is not prone to flooding. Estimated water quality parameters indicated that organic effluents from Campinhos and Simão impact the values of dissolved oxygen, electrical conductivity, salinity, ammonia, nitrite, nitrate and zinc, suggesting that the water quality of the river Santa Rita is affected by manipueira release. The concentrations of total phosphorus, iron and cooper were superior downstream of the Sewer Treatment Station. The river water was saline in the three sampling points most affected by the release of manipueira.

  20. Combined Multivariate Statistical Techniques, Water Pollution Index (WPI) and Daniel Trend Test Methods to Evaluate Temporal and Spatial Variations and Trends of Water Quality at Shanchong River in the Northwest Basin of Lake Fuxian, China

    Wang, Quan; Wu, Xianhua; Zhao, Bin; Qin, Jie; Peng, Tingchun

    2015-01-01

    Understanding spatial and temporal variations in river water quality and quantitatively evaluating the trend of changes are important in order to study and efficiently manage water resources. In this study, an analysis of Water Pollution Index (WPI), Daniel Trend Test, Cluster Analysis and Discriminant Analysis are applied as an integrated approach to quantitatively explore the spatial and temporal variations and the latent sources of water pollution in the Shanchong River basin, Northwest Ba...

  1. Failure analysis of fusion clad alloy system AA3003/AA6xxx sheet under bending

    Shi, Y., E-mail: shiyh@mcmaster.ca [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada); Jin, H. [Novelis Global Technology Center, P.O. Box 8400, Kingston, Ontario, Canada K7L 5L9 (Canada); Wu, P.D. [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada); Lloyd, D.J. [Aluminum Materials Consultants, 106 Nicholsons Point Road, Bath, Ontario, Canada K0H 1G0 (Canada); Embury, D. [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada)

    2014-07-29

    An ingot of AA6xxx Al–Si–Mg–Cu alloy clad with AA3003 Al–Mn alloy was co-cast by Fusion technology. Bending tests and numerical modeling were performed to investigate the potential for sub-surface cracking for this laminate system. To simulate particle-induced crack initiation and growth, both random and stringer particles have been selected to mimic the particle distribution in the tested samples. The morphology of cracking in the model was similar to that observed in clad sheet tested in the Cantilever bend test. The crack initiated in the core close to the clad-core interface where the strain in the core is highest, between particles or near particles and propagates along local shear bands in the core, while the clad layer experiences extreme thinning before failure.

  2. AA, shims and washers on quadrupole ends

    CERN PhotoLab

    1981-01-01

    Due to the fact that much of the field of the quadrupoles was outside the iron (in particular with the wide quadrupoles) and that thus the fields of quadrupoles and bending magnets interacted, the lattice properties of the AA could not be predicted with the required accuracy. After a first running period in 1980, during which detailed measurements were made with proton test beams, corrections to the quadrupoles were made in 1981, in the form of laminated shims at the ends of the poles, and with steel washers. With the latter ones, further refinements were made in an iterative procedure with measurements on the circulating beam. This eventually resulted, amongst other things, in a very low chromaticity, with the Q-values being constant to within +- 0.001 over the total momentum range of 6 %. Here we see the shims and washers on a narrow qudrupole (QFN, QDN). See also 8103203, 8103204, 8103205, 8103206.

  3. Spatial development

    Desmet, Klaus; Rossi-Hansberg, Esteban

    2010-01-01

    We present a theory of spatial development. Manufacturing and services firms located in a continuous geographic area choose each period how much to innovate. Firms trade subject to transport costs and technology diffuses spatially across locations. The result is a spatial endogenous growth theory that can shed light on the link between the evolution of economic activity over time and space. We apply the model to study the evolution of the U.S. economy in the last few decades and find that the...

  4. Electrochemical characterisation of aluminium AA7075-T6 and solution heat treated AA7075 using a micro-capillary cell

    Localised corrosion of 7xxx aluminium alloys initiates at cathodic intermetallics containing Cu and Fe due to a strong galvanic coupling with the matrix. In order to study this galvanic coupling, the electrochemical behaviour of AA7075-T6 and solution heat treated AA7075 has been investigated by means of complementary techniques: micro-capillary cell, scanning Kelvin probe force microscopy (SKPFM) and scanning electron microscopy (SEM). Characterisation with the micro-capillary cell showed that the intermetallics cause a more cathodic breakdown potential in the solution heat treated AA7075 compared with the AA7075-T6. This is associated with a higher Volta potential difference between the intermetallics and the matrix in the solution heat treated AA7075, indicating a stronger galvanic coupling for this temper. From these results, it is concluded that the breakdown potential of areas containing the intermetallics is related to the Volta potential difference between the intermetallics and the matrix

  5. Justice… spatiale !

    Gervais-Lambony, Philippe; Dufaux, Frédéric

    2009-01-01

    International audience The notion of spatial justice was developed by Anglo-Saxon radical geographyin the 1970’s. Today it is often used in different contexts, mostly within thefield of urban studies. The central idea in this paper is to demonstrate thata revisited form of the concept of « spatial justice » may be used to promoteinteraction between the very diverse contemporary approaches of geography atevery scale. The theoretical background of political philosophy is presented first,we t...

  6. Evaluation to Obtain the Image According to the Spatial Domain Filtering of Various Convolution Kernels in the Multi-Detector Row Computed Tomography

    Our objective was to evaluate the image of spatial domain filtering as an alternative to additional image reconstruction using different kernels in MDCT. Derived from thin collimated source images were generated using water phantom and abdomen B10(very smooth), B20(smooth), B30(medium smooth), B40 (medium), B50(medium sharp), B60(sharp), B70(very sharp) and B80(ultra sharp) kernels. MTF and spatial resolution measured with various convolution kernels. Quantitative CT attenuation coefficient and noise measurements provided comparable HU(Hounsfield) units in this respect. CT attenuation coefficient(mean HU) values in the water were values in the water were 1.1∼1.8 HU, air(-998∼-1000 HU) and noise in the water(5.4∼44.8 HU), air(3.6∼31.4 HU). In the abdominal fat a CT attenuation coefficient(-2.2∼0.8 HU) and noise(10.1∼82.4 HU) was measured. In the abdominal was CT attenuation coefficient(53.3∼54.3 HU) and noise(10.4∼70.7 HU) in the muscle and in the liver parenchyma of CT attenuation coefficient(60.4∼62.2 HU) and noise (7.6∼63.8 HU) in the liver parenchyma. Image reconstructed with a convolution kernel led to an increase in noise, whereas the results for CT attenuation coefficient were comparable. Image scanned with a high convolution kernel(B80) led to an increase in noise, whereas the results for CT attenuation coefficient were comparable. Image medications of image sharpness and noise eliminate the need for reconstruction using different kernels in the future. Adjusting CT various kernels, which should be adjusted to take into account the kernels of the CT undergoing the examination, may control CT images increase the diagnostic accuracy.

  7. Evaluation of TRMM Multi-satellite Precipitation Analysis (TMPA) performance in the Central Andes region and its dependency on spatial and temporal resolution

    Scheel, M. L. M.; Rohrer, M.; Huggel, Ch.; Santos Villar, D.; Silvestre, E.; Huffman, G. J.

    2011-08-01

    Climate time series are of major importance for base line studies for climate change impact and adaptation projects. However, for instance, in mountain regions and in developing countries there exist significant gaps in ground based climate records in space and time. Specifically, in the Peruvian Andes spatially and temporally coherent precipitation information is a prerequisite for ongoing climate change adaptation projects in the fields of water resources, disasters and food security. The present work aims at evaluating the ability of Tropical Rainfall Measurement Mission (TRMM) Multi-satellite Precipitation Analysis (TMPA) to estimate precipitation rates at daily 0.25° × 0.25° scale in the Central Andes and the dependency of the estimate performance on changing spatial and temporal resolution. Comparison of the TMPA product with gauge measurements in the regions of Cuzco, Peru and La Paz, Bolivia were carried out and analysed statistically. Large biases are identified in both investigation areas in the estimation of daily precipitation amounts. The occurrence of strong precipitation events was well assessed, but their intensities were underestimated. TMPA estimates for La Paz show high false alarm ratio. The dependency of the TMPA estimate quality with changing resolution was analysed by comparisons of 1-, 7-, 15- and 30-day sums for Cuzco, Peru. The correlation of TMPA estimates with ground data increases strongly and almost linearly with temporal aggregation. The spatial aggregation to 0.5°, 0.75° and 1° grid box averaged precipitation and its comparison to gauge data of the same areas revealed no significant change in correlation coefficients and estimate performance. In order to profit from the TMPA combination product on a daily basis, a procedure to blend it with daily precipitation gauge measurements is proposed. Different sources of errors and uncertainties introduced by the sensors, sensor-specific algorithm aspects and the TMPA processing scheme

  8. Evaluation of TRMM Multi-satellite Precipitation Analysis (TMPA performance in the Central Andes region and its dependency on spatial and temporal resolution

    M. L. M. Scheel

    2010-10-01

    Full Text Available Climate time series are of major importance for base line studies for climate change impact and adaptation projects. However, in mountain regions and in developing countries there exist significant gaps in ground based climate records in space and time. Specifically, in the Peruvian Andes spatially and temporally coherent precipitation information is a prerequisite for ongoing climate change adaptation projects in the fields of water resources, disasters and food security. The present work aims at evaluating the ability of Tropical Rainfall Measurement Mission (TRMM Multi-satellite Precipitation Analysis (TMPA to estimate precipitation rates at daily 0.25° × 0.25° scale in the Central Andes and the dependency of the estimate performance on changing spatial and temporal resolution. Comparison of the TMPA product with gauge measurements in the regions of Cuzco, Peru and La Paz, Bolivia were carried out and analysed statistically. Large biases are identified in both investigation areas in the estimation of daily precipitation amounts. The occurrence of strong precipitation events was well assessed, but their intensities were underestimated. TMPA estimates for La Paz show high false alarm ratio.

    The dependency of the TMPA estimate quality with changing resolution was analysed by comparisons of 1-, 7-, 15- and 30-day sums for Cuzco, Peru. The correlation of TMPA estimates with ground data increases strongly and almost linearly with temporal aggregation. The spatial aggregation to 0.5°, 0.75° and 1° grid box averaged precipitation and its comparison to gauge data of the same areas revealed no significant change in correlation coefficients and estimate performance.

    In order to profit from the TMPA combination product on a daily basis, a procedure to blend it with daily precipitation gauge measurements is proposed.

    Different sources of errors and uncertainties introduced by the sensors, sensor-specific algorithm aspects

  9. Evaluation of TRMM Multi-satellite Precipitation Analysis (TMPA performance in the Central Andes region and its dependency on spatial and temporal resolution

    M. L. M. Scheel

    2011-08-01

    Full Text Available Climate time series are of major importance for base line studies for climate change impact and adaptation projects. However, for instance, in mountain regions and in developing countries there exist significant gaps in ground based climate records in space and time. Specifically, in the Peruvian Andes spatially and temporally coherent precipitation information is a prerequisite for ongoing climate change adaptation projects in the fields of water resources, disasters and food security. The present work aims at evaluating the ability of Tropical Rainfall Measurement Mission (TRMM Multi-satellite Precipitation Analysis (TMPA to estimate precipitation rates at daily 0.25° × 0.25° scale in the Central Andes and the dependency of the estimate performance on changing spatial and temporal resolution. Comparison of the TMPA product with gauge measurements in the regions of Cuzco, Peru and La Paz, Bolivia were carried out and analysed statistically. Large biases are identified in both investigation areas in the estimation of daily precipitation amounts. The occurrence of strong precipitation events was well assessed, but their intensities were underestimated. TMPA estimates for La Paz show high false alarm ratio.

    The dependency of the TMPA estimate quality with changing resolution was analysed by comparisons of 1-, 7-, 15- and 30-day sums for Cuzco, Peru. The correlation of TMPA estimates with ground data increases strongly and almost linearly with temporal aggregation. The spatial aggregation to 0.5°, 0.75° and 1° grid box averaged precipitation and its comparison to gauge data of the same areas revealed no significant change in correlation coefficients and estimate performance.

    In order to profit from the TMPA combination product on a daily basis, a procedure to blend it with daily precipitation gauge measurements is proposed.

    Different sources of errors and uncertainties introduced by the sensors, sensor

  10. Evaluation of the Event Driven Phenology Model Coupled with the VegET Evapotranspiration Model Through Comparisons with Reference Datasets in a Spatially Explicit Manner

    Kovalskyy, V.; Henebry, G. M.; Adusei, B.; Hansen, M.; Roy, D. P.; Senay, G.; Mocko, D. M.

    2011-01-01

    A new model coupling scheme with remote sensing data assimilation was developed for estimation of daily actual evapotranspiration (ET). The scheme represents a mix of the VegET, a physically based model to estimate ET from a water balance, and an event driven phenology model (EDPM), where the EDPM is an empirically derived crop specific model capable of producing seasonal trajectories of canopy attributes. In this experiment, the scheme was deployed in a spatially explicit manner within the croplands of the Northern Great Plains. The evaluation was carried out using 2007-2009 land surface forcing data from the North American Land Data Assimilation System (NLDAS) and crop maps derived from remotely sensed data of NASA's Moderate Resolution Imaging Spectroradiometer (MODIS). We compared the canopy parameters produced by the phenology model with normalized difference vegetation index (NDVI) data derived from the MODIS nadir bi-directional reflectance distribution function (BRDF) adjusted reflectance (NBAR) product. The expectations of the EDPM performance in prognostic mode were met, producing determination coefficient (r2) of 0.8 +/-.0.15. Model estimates of NDVI yielded root mean square error (RMSE) of 0.1 +/-.0.035 for the entire study area. Retrospective correction of canopy dynamics with MODIS NDVI brought the errors down to just below 10% of observed data range. The ET estimates produced by the coupled scheme were compared with ones from the MODIS land product suite. The expected r2=0.7 +/-.15 and RMSE = 11.2 +/-.4 mm per 8 days were met and even exceeded by the coupling scheme0 functioning in both prognostic and retrospective modes. Minor setbacks of the EDPM and VegET performance (r2 about 0.5 and additional 30 % of RMSR) were found on the peripheries of the study area and attributed to the insufficient EDPM training and to spatially varying accuracy of crop maps. Overall the experiment provided sufficient evidence of soundness and robustness of the EDPM and

  11. Dicty_cDB: FCL-AA17 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA17 (Link to dictyBase) - G03264 DDB0191099 Contig-U15602-1 FCL-AA...17P (Link to Original site) FCL-AA17F 547 FCL-AA17Z 610 FCL-AA17P 1157 - - Show FCL-AA17 Library F...CL (Link to library) Clone ID FCL-AA17 (Link to dictyBase) Atlas ID - NBRP ID G03264 dictyBase ID DDB0191099... Link to Contig Contig-U15602-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA17Q.Seq.d/ Representative seq. ID FCL-AA17P (Link to Original site) Representative DNA sequence >FCL-AA

  12. Dicty_cDB: FCL-AA14 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA14 (Link to dictyBase) - G03263 DDB0218474 Contig-U16035-1 FCL-AA...14P (Link to Original site) FCL-AA14F 647 FCL-AA14Z 550 FCL-AA14P 1197 - - Show FCL-AA14 Library F...CL (Link to library) Clone ID FCL-AA14 (Link to dictyBase) Atlas ID - NBRP ID G03263 dictyBase ID DDB0218474... Link to Contig Contig-U16035-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA14Q.Seq.d/ Representative seq. ID FCL-AA14P (Link to Original site) Representative DNA sequence >FCL-AA

  13. Dicty_cDB: FCL-AA19 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA19 (Link to dictyBase) - G01757 DDB0230128 Contig-U16036-1 FCL-AA...19P (Link to Original site) FCL-AA19F 246 FCL-AA19Z 568 FCL-AA19P 814 - - Show FCL-AA19 Library FC...L (Link to library) Clone ID FCL-AA19 (Link to dictyBase) Atlas ID - NBRP ID G01757 dictyBase ID DDB0230128 ...Link to Contig Contig-U16036-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...19Q.Seq.d/ Representative seq. ID FCL-AA19P (Link to Original site) Representative DNA sequence >FCL-AA

  14. Dielectric barrier discharge: Critical evaluation of a novel AAS atomizer

    Kratzer, Jan; Svoboda, Milan; Boušek, J.; Mester, Z.; Sturgeon, R. E.; Dědina, Jiří

    Praha, 2014. s. 102-102. ISBN 978-80-905704-1-2. [European Symposium on Atomic Spectrometry ESAS 2014 & Czech-Slovak Spectroscopic Conference /15./. 16.03.2014-21.03.2014, Praha] R&D Projects: GA AV ČR(CZ) M200311202 Institutional support: RVO:68081715 Keywords : dielectric barrier discharge * bismuthine * atomic absorption spectrometry Subject RIV: CB - Analytical Chemistry, Separation

  15. Relative accuracy of spatial predictive models for lynx Lynx canadensis derived using logistic regression-AIC, multiple criteria evaluation and Bayesian approaches

    Hejun KANG; Shelley M.ALEXANDER

    2009-01-01

    We compared probability surfaces derived using one set of environmental variables in three Geographic Information Systems (GIS) -based approaches: logistic regression and Akaike's Information Criterion (AIC),Multiple Criteria Evaluation (MCE),and Bayesian Analysis (specifically Dempster-Shafer theory). We used lynx Lynx canadensis as our focal species,and developed our environment relationship model using track data collected in Banff National Park,Alberta,Canada,during winters from 1997 to 2000. The accuracy of the three spatial models were compared using a contingency table method. We determined the percentage of cases in which both presence and absence points were correctly classified (overall accuracy),the failure to predict a species where it occurred (omission error) and the prediction of presence where there was absence (commission error). Our overall accuracy showed the logistic regression approach was the most accurate (74.51% ). The multiple criteria evaluation was intermediate (39.22%),while the Dempster-Shafer (D-S) theory model was the poorest (29.90%). However,omission and commission error tell us a different story: logistic regression had the lowest commission error,while D-S theory produced the lowest omission error. Our results provide evidence that habitat modellers should evaluate all three error measures when ascribing confidence in their model. We suggest that for our study area at least,the logistic regression model is optimal. However,where sample size is small or the species is very rare,it may also be useful to explore and/or use a more ecologically cautious modelling approach (e.g. Dempster-Shafer) that would over-predict,protect more sites,and thereby minimize the risk of missing critical habitat in conservation plans.

  16. The A&A Experience With Impact Factors

    Sandqvist, A

    2004-01-01

    There is a widespread impression that the scientific journal "Astronomy & Astrophysics" (A&A) has a smaller impact, as measured by citations to articles, than some of the other major astronomy journals. This impression was apparently supported - and probably created - by the Journal Citation Report (JCR), which is prepared annually by the Institute of Scientific Information (ISI) Web of Knowledge. The published poor impact factor of A&A was in fact wrong and was due to a serious flaw in the method used by ISI Web of Knowledge to determine it. The resulting damage inflicted upon A&A by the JCR is incalculable.

  17. Corrosion issues of powder coated AA6060 aluminium profiles

    Din, Rameez Ud; Valgarðsson, Smári; Jellesen, Morten Stendahl;

    2015-01-01

    In this study detailed microstructural investigation of the reason for unexpected corrosion of powder coated aluminium alloy AA6060 windows profiles has been performed. The results from this study reveals that the failure of the window profiles was originated from the surface defects present...... on the extruded AA6060 aluminium profile after metallurgical process prior to powder coating. Surface defects are produced due to intermetallic particles in the alloy, which disturb the flow during the extrusion process. The corrosion mechanism leading to the failure of the powder coated AA6060 aluminium profiles...

  18. NCBI nr-aa BLAST: CBRC-RNOR-15-0027 [SEVENS

    Full Text Available CBRC-RNOR-15-0027 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 2e-30 98% ...

  19. NCBI nr-aa BLAST: CBRC-AGAM-07-0022 [SEVENS

    Full Text Available CBRC-AGAM-07-0022 ref|ZP_01789747.1| hypothetical protein CGSHiAA_08330 [Haemophilus influenza...e PittAA] gb|EDK08473.1| hypothetical protein CGSHiAA_08330 [Haemophilus influenzae PittAA] ZP_01789747.1 2e-14 23% ...

  20. NCBI nr-aa BLAST: CBRC-HSAP-02-0031 [SEVENS

    Full Text Available CBRC-HSAP-02-0031 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 6e-09 52% ...

  1. NCBI nr-aa BLAST: CBRC-OLAT-13-0071 [SEVENS

    Full Text Available CBRC-OLAT-13-0071 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 0.14 37% ...

  2. NCBI nr-aa BLAST: CBRC-PTRO-02-0026 [SEVENS

    Full Text Available CBRC-PTRO-02-0026 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-09 50% ...

  3. NCBI nr-aa BLAST: CBRC-HSAP-02-0029 [SEVENS

    Full Text Available CBRC-HSAP-02-0029 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 5e-11 48% ...

  4. NCBI nr-aa BLAST: CBRC-RNOR-08-0315 [SEVENS

    Full Text Available CBRC-RNOR-08-0315 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-25 73% ...

  5. NCBI nr-aa BLAST: CBRC-GGAL-35-0091 [SEVENS

    Full Text Available CBRC-GGAL-35-0091 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 2e-08 34% ...

  6. NCBI nr-aa BLAST: CBRC-PTRO-27-0055 [SEVENS

    Full Text Available CBRC-PTRO-27-0055 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-09 53% ...

  7. NCBI nr-aa BLAST: CBRC-ACAR-01-0367 [SEVENS

    Full Text Available CBRC-ACAR-01-0367 ref|ZP_01790024.1| hypothetical protein CGSHiAA_05974 [Haemophilus influenza...e PittAA] gb|EDK08288.1| hypothetical protein CGSHiAA_05974 [Haemophilus influenzae PittAA] ZP_01790024.1 4.0 29% ...

  8. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Gueutin, Victor; Langlois, Anne-Lyse; Shehwaro, Nathalie; Elharraqui, Ryme; Rouvier, Philippe; Izzedine, Hassane

    2013-01-01

    Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported. PMID:24558629

  9. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Victor Gueutin; Anne-Lyse Langlois; Nathalie Shehwaro; Ryme Elharraqui; Philippe Rouvier; Hassane Izzedine

    2013-01-01

    Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported.

  10. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Victor Gueutin

    2013-01-01

    Full Text Available Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported.

  11. Evaluation of the edge-effect on the farmland production environment in hilly and mountainous areas, 1: Spatial and temporal changes of solar radiation environment

    The objective of this study is quantification of the solar radiation in the farmland located in the hilly and mountainous areas, considering the effect of the shelter adjacent to the field, such as the forest (This effect is called the edge-effect in this study.). To evaluate the edge-effect on the solar radiation environment in the farmland, solar radiations are measured at the center and edge of the study site adjacent to the forest. The simulation model is composed, coupling with the fish-eye projection method and procedure for the separating direct and diffuse solar radiations. Using this model, the diurnal solar radiations are simulated at the center and edge of the study site. The simulation result showed good agreement with the observation. The spatial distribution of the solar radiation in an observational field is quantified by this method, considering the edge-effect. The simulation result indicated that the solar radiation environment on the field surface was affected by the shelter adjacent to the field and the field direction

  12. Evaluating the strategic capacity of collaborative spatial planning initiatives by the performance of its process, output and outcomes: The case of the southern Randstad Holland

    Harteveld, E.; Waterhout, B.; Broekhans, B.; Zonneveld, W.A.M.

    2015-01-01

    Spatial planning practices are constantly evolving to be more effective in a dynamic context. In the face of the latest developments, the practice of collaborative spatial planning through the formation of regional collaborations has emerged as the contemporary solution. The practice of working with a multitude of public actors that cooperate to formulate spatial strategies for issues that transcend their own planning capacity is relatively new and the ideal structure, organization and scope ...

  13. Spatial heavy metals Zn and Cr distribution in soil samples taken from Tatra Mountains

    The basic issue of presented report is showing the spatial heavy metals (Zn and Cr) distribution in soil samples taken from High Mts area. The expertise was done using two analytical techniques: AAS (atomic absorption spectroscopy) and micro-PIXIE (proton induced X-ray emission).Given heavy metals concentration were originated either from soil surface (10 cm depth) or from the whole soil profile. Our evaluation indicates that the Zn and Cr levels measured for mountains region were comparable to the data presented by other authors. Furthermore, the amount of heavy metals is strongly correlated with its natural concentration in parental rock.We also observed that zinc was prone to accumulate in surface, rich in organic matter, soil levels. (author)

  14. AAS Committee on Employment Panel Introduction

    Borne, Kirk; Fanelli, M. N.; Storrie-Lombardi, L. J.; Krishnamurthi, A.

    2006-12-01

    Many younger astronomers are unaware of the dangers and pitfalls that await them in the job market. Issues related to fringe benefits (if any), moving expenses, medical coverage for family members, teaching versus research expectations, etc. can lead to misunderstandings and to serious difficulties if these are not addressed early in the job interview process. The AAS Committee on Employment has often received letters from concerned junior members of the society, who feel that they needed more guidance and assistance in entering the job market for the first time. The major areas of concern have included those just listed, but there may be others. The session is structured as a panel presentation, whose members are asked to prepare in advance their top 10 questions that job applicants should ask, and we will instruct our panel members not to discuss their list at all with the other panel members prior to their presentations. This will ensure independent viewpoints and novel responses. The panel will consist of astronomers who have different perspectives on this issue, including old and young, postdoc and beyond, academic and non-academic. To kick off the session, we will invite a brief humorous presentation of the Top Ten List, in the style of The Night Show host David Letterman.

  15. Outcomes From AAS Hack Day at the 227th AAS Meeting

    Kohler, Susanna

    2016-01-01

    Editors Note:This is a final post from the 227th AAS Meeting in Kissimmee, FL. This special summary of AAS Hack Day, a meeting of AAS members to collaboratively work on various small projects, was written by Meredith Rawls (@Merrdiff) and was originally posted on astrobites.com.As the 227thAmerican Astronomical Society meeting drew to a close (see highlights from Day 1, Day 2, Day 3, and Day 4), a group of at least 50 attendees spent Day 4working on small projects fondly called hacks. Thanks to sponsorship from LSST and Northrup Grumman, the industrious hackers werewell-caffeinated and fed so we could devote time and energy toworking in groups on one-day projects.TheHack Day beganat 10am with pitches. Anybody with a project idea was welcome to briefly speak and try to convince others to work with them. Only someideas panned out, but the enthusiasm was palpable. Its not every day you get a full room of astronomers and affiliates eager to spend hours working on fun and useful projects to benefit the community.#hackAAS is getting underway! #aas227 pic.twitter.com/yX7jlOnSCK James R A Davenport (@jradavenport) January 8, 2016Here is a rundown of what we accomplished. Pretty impressive for a single day! Many thanks to fellow astrobiter Erika Nesvold (now at Carnegie DTM; @erikanesvold) whose hack was live-documenting all the other hacks. Her tweets as @astrobites appeared with the #hackaas hashtag, and her notes made this recap post infinitely easier to write.Interested in joining the fun? Sign up for Hack Day at the 2017 JanuaryAAS meeting (its free with meeting registration), and consider applying for the .Astronomy conference this summer.Towards Optimal Session Scheduling:Adrian Price-Whelan (Columbia), David Hogg (NYU), and Scott Idem (AAS) began writing a program to take all submitted abstracts to a conference like AAS and sort them using keywords to avoid scheduling similar talks in parallel sessions. Its impossible to make everyone happy, but minimizing conflicts

  16. Astronomy Career Profiles from the AAS Newsletter Archives

    Metcalfe, Travis; Belkora, Leila; McDaid, Liam; Bullock, Blake; Pulliam, Christine; Williams, Peter; Roth, Joshua; Whitney, Barb; Olsen, Knut; Howell, Andy; Keller, Luke

    2011-01-01

    This is a collection of articles that were originally published in the Newsletter of the American Astronomical Society (AAS) between May 2008 and September 2011 by the Committee on Employment. Authors representing a wide range of career paths tell their stories and provide insight and advice that is relevant to success in various job sectors. Although all of these articles are available individually from the AAS archives, we are posting the complete collection here to make them more accessibl...

  17. Systemic AA amyloidosis induced by liver cell adenoma.

    Fievet, P; Sevestre, H; Boudjelal, M; Noel, L H; Kemeny, F; D. Franco; Delamarre, J; Capron, J.P.

    1990-01-01

    Systemic AA amyloidosis is a rare complication of benign tumours. This report describes a patient with hepatocellular adenoma associated with reactive AA amyloidosis. He had a nephrotic syndrome with deteriorating renal function and an increase of serum concentrations of acute phase proteins, mainly C-reactive protein. Resection of the tumour was followed by improvement in renal function and a marked decrease of the serum concentrations of acute phase proteins.

  18. AA amyloidosis as a complication of primary lymphedema.

    Beloncle, François; Sayegh, Johnny; Eymerit-Morin, Caroline; Duveau, Agnès; Augusto, Jean-François

    2014-03-01

    Primary lymphedema is a rare disease caused by a disorder of lymphangiogenesis. Clinical presentation and age at onset are variable. AA amyloidosis is usually due to chronic inflammatory diseases, malignant tumors or less frequently chronic infectious diseases. We report here the first two cases of AA amyloidosis present with renal failure and nephrotic syndrome in patients with primary lymphedema-induced chronic leg ulcers. The first patient was a 62-year-old female who presented with chronic untreated leg ulcers for 8 years secondary to primary lymphedema. A kidney biopsy done for nephrotic syndrome allowed the diagnosis of AA amyloidosis. The second patient was a 54-year-old male who presented with hereditary lymphedema and elephantiasis since the age of 12. A salivary gland biopsy allowed the diagnosis of AA amyloidosis. Renal function deteriorated progressively needing chronic haemodialysis. Chronic leg ulcers have been rarely reported to induce AA amyloidosis. Only five other cases have been reported in the literature, but none of them with chronic lymphedema. We believe that the relation between lymphedema, chronic leg ulcers and AA amyloidosis is underestimated. PMID:23964754

  19. Spatial distribution

    Borregaard, Michael Krabbe; Hendrichsen, Ditte Katrine; Nachman, Gøsta Støger

    2008-01-01

    , depending on the nature of intraspecific interactions between them: while the individuals of some species repel each other and partition the available area, others form groups of varying size, determined by the fitness of each group member. The spatial distribution pattern of individuals again strongly...

  20. Ultra-narrow Negative Flare Front Observed in Helium-10830~\\AA\\ using the 1.6 m New Solar Telescope

    Xu, Yan; Ding, Mingde; Kleint, Lucia; Su, Jiangtao; Liu, Chang; Ji, Haisheng; Chae, Jongchul; Jing, Ju; Cho, Kyuhyoun; Cho, Kyungsuk; Gary, Dale; Wang, Haimin

    2016-01-01

    Solar flares are sudden flashes of brightness on the Sun and are often associated with coronal mass ejections and solar energetic particles which have adverse effects in the near Earth environment. By definition, flares are usually referred to bright features resulting from excess emission. Using the newly commissioned 1.6~m New Solar Telescope at Big Bear Solar Observatory, here we show a striking "negative" flare with a narrow, but unambiguous "dark" moving front observed in He I 10830 \\AA, which is as narrow as 340 km and is associated with distinct spectral characteristics in H-alpha and Mg II lines. Theoretically, such negative contrast in He I 10830 \\AA\\ can be produced under special circumstances, by nonthermal-electron collisions, or photoionization followed by recombination. Our discovery, made possible due to unprecedented spatial resolution, confirms the presence of the required plasma conditions and provides unique information in understanding the energy release and radiative transfer in astronomi...

  1. The OIV 1407.3\\AA /1401.1\\AA\\ emission-line ratio in a plasma

    Nessib, Nabil Ben; Qindeel, Rabia; Sahal-Bréchot, Sylvie; Dimitrijević, Milan S

    2013-01-01

    Line ratio of O IV 1407.3 \\AA/1401.1 \\AA\\- is calculated using mostly our own atomic and collisional data. Energy levels and oscillator strengths needed for this calculation have been calculated using a Hartree-Fock relativistic (HFR) approach. The electron collision strengths introduced in the statistic equilibrium equations are fitted by Line ratio of O IV 1407.3 \\AA/1401.1 \\AA\\- is calculated using mostly our own atomic and collisional data. Energy levels and oscillator strengths needed for this calculation have been calculated using a Hartree-Fock relativistic (HFR) approach. The electron collision strengths introduced in the statistic equilibrium equations are fitted by polynomials for different energies. Comparison has also been made with available theoretical results. The provided line ratio has been obtained for a set of electron densities from $10^{8}$ cm$^{-3}$ to $10^{13}$ cm$^{-3}$ and for a fixed temperature of 50 000 K.

  2. Carbon Nanotube Addition to Simultaneously Enhance Strength and Ductility of Hybrid AZ31/AA5083 Alloy

    Muralidharan Paramsothy; Manoj Gupta; Jimmy Chan; Richard Kwok

    2011-01-01

    AZ31/AA5083 hybrid alloy nanocomposite containing CNT nanoparticle reinforcement was fabricated using solidification processing followed by hot extrusion. The AZ31/AA5083 hybrid alloy nanocomposite exhibited similar grain size to monolithic AZ31/AA5083 hybrid alloy, reasonable CNT nanoparticle distribution, non-dominant (0 0 0 2) texture in the longitudinal direction, and 20% higher hardness than monolithic AZ31/AA5083 hybrid alloy. Compared to monolithic AZ31/AA5083 hybrid alloy (in tension)...

  3. Spatially explicit non-Mendelian diploid model

    Lanchier, N; 10.1214/09-AAP598

    2009-01-01

    We introduce a spatially explicit model for the competition between type $a$ and type $b$ alleles. Each vertex of the $d$-dimensional integer lattice is occupied by a diploid individual, which is in one of three possible states or genotypes: $aa$, $ab$ or $bb$. We are interested in the long-term behavior of the gene frequencies when Mendel's law of segregation does not hold. This results in a voter type model depending on four parameters; each of these parameters measures the strength of competition between genes during meiosis. We prove that with or without a spatial structure, type $a$ and type $b$ alleles coexist at equilibrium when homozygotes are poor competitors. The inclusion of a spatial structure, however, reduces the parameter region where coexistence occurs.

  4. Development and Evaluation of a Web Map Mind Tool Environment with the Theory of Spatial Thinking and Project-Based Learning Strategy

    Hou, Huei-Tse; Yu, Tsai-Fang; Wu, Yi-Xuan; Sung, Yao-Ting; Chang, Kuo-En

    2016-01-01

    The theory of spatial thinking is relevant to the learning and teaching of many academic domains. One promising method to facilitate learners' higher-order thinking is to utilize a web map mind tool to assist learners in applying spatial thinking to cooperative problem solving. In this study, an environment is designed based on the theory of…

  5. The OIV 1407.3\\AA /1401.1\\AA\\ emission-line ratio in a plasma

    Nessib, Nabil Ben; Alonizan, Norah; Qindeel, Rabia; Sahal-Bréchot, Sylvie; Dimitrijević, Milan S

    2013-01-01

    Line ratio of O IV 1407.3 \\AA/1401.1 \\AA\\- is calculated using mostly our own atomic and collisional data. Energy levels and oscillator strengths needed for this calculation have been calculated using a Hartree-Fock relativistic (HFR) approach. The electron collision strengths introduced in the statistic equilibrium equations are fitted by polynomials for different energies. Comparison has also been made with available theoretical results. The provided line ratio has been obtained for a set o...

  6. Rupture locations of friction stir welded joints of AA2017-T351 and AA6061-T6 aluminum alloys

    LIU Hui-jie; FENG Ji-cai; H. Fujii; M. Maeda; K. Nogi

    2005-01-01

    The tensile rupture locations of friction stir welded joints of AA2017-T351 and AA6061-T6 aluminum alloys were examined. The experiments show that the rupture locations of the joints are different for the two aluminum alloys, which are influenced by the welding parameters. When the joints are free of welding defects, the AA2017-T351 joints are ruptured in the weld nugget adjacent to the thermo-mechanically affected zone on the advancing side and the rupture surfaces appear as oval contours of the weld nugget, while the AA6061-T6 joints are ruptured in the heat affected zone on the retreating side and the rupture surfaces are inclined at a certain degree to the bottom surfaces of the joints. When welding defects are present in the joints, the AA2017-T351 joints are ruptured in the weld center, while the AA6061-T6 joints are ruptured on the retreating side near the weld center. The rupture locations of the joints are dependent on the internal structures of the joints and can be explained through them.

  7. HCI-Evaluation of the GeoCitizen-reporting App for citizen participation in spatial planning and community management among members of marginalized communities in Cali, Colombia . GI_Forum|GI_Forum 2016, Volume 1 – open:spatial:interfaces|

    Parra Arteaga, Andres; Eitzinger, Anton; Marin, Beatriz Eugenia; Gonzalez Quintero, Bryan; Atzmanstorfer, Karl; Resl, Richard

    2016-01-01

    Increasingly, geospatial web applications such as www.fixmystreet.com or www.seeclickfix.com are being integrated within citizen participation processes in spatial planning and the provision of communal services. Recently, several of these platforms have been launched in Latin America and other countries of the Global South. This development raises the questions of whether citizens with low ICT-skills can fully access and use these tools, and hence whether they are empowered to participate in...

  8. Spatial Culture

    Reeh, Henrik

    2012-01-01

    Spatial Culture – A Humanities Perspective Abstract of introductory essay by Henrik Reeh Secured by alliances between socio-political development and cultural practices, a new field of humanistic studies in spatial culture has developed since the 1990s. To focus on links between urban culture and...... modern society is, however, an intellectual practice which has a much longer history. Already in the 1980s, the debate on the modern and the postmodern cited Paris and Los Angeles as spatio-cultural illustrations of these major philosophical concepts. Earlier, in the history of critical studies, the work...... Michel Foucault considered a constitutive feature of 20th-century thinking and one that continues to occupy intellectual and cultural debates in the third millennium. A conceptual framework is, nevertheless, necessary, if the humanities are to adequa-tely address city and space – themes that have long...

  9. Spatial Networks

    Barthelemy, Marc

    2010-01-01

    Complex systems are very often organized under the form of networks where nodes and edges are embedded in space. Transportation and mobility networks, Internet, mobile phone networks, power grids, social and contact networks, neural networks, are all examples where space is relevant and where topology alone does not contain all the information. Characterizing and understanding the structure and the evolution of spatial networks is thus crucial for many different fields ranging from urbanism t...

  10. Evaluation of an index of biotic integrity approach used to assess biological condition in western U.S. streams and rivers at varying spatial scales

    Meador, M.R.; Whittier, T.R.; Goldstein, R.M.; Hughes, R.M.; Peck, D.V.

    2008-01-01

    Consistent assessments of biological condition are needed across multiple ecoregions to provide a greater understanding of the spatial extent of environmental degradation. However, consistent assessments at large geographic scales are often hampered by lack of uniformity in data collection, analyses, and interpretation. The index of biotic integrity (IBI) has been widely used in eastern and central North America, where fish assemblages are complex and largely composed of native species, but IBI development has been hindered in the western United States because of relatively low fish species richness and greater relative abundance of alien fishes. Approaches to developing IBIs rarely provide a consistent means of assessing biological condition across multiple ecoregions. We conducted an evaluation of IBIs recently proposed for three ecoregions of the western United States using an independent data set covering a large geographic scale. We standardized the regional IBIs and developed biological condition criteria, assessed the responsiveness of IBIs to basin-level land uses, and assessed their precision and concordance with basin-scale IBIs. Standardized IBI scores from 318 sites in the western United States comprising mountain, plains, and xeric ecoregions were significantly related to combined urban and agricultural land uses. Standard deviations and coefficients of variation revealed relatively low variation in IBI scores based on multiple sampling reaches at sites. A relatively high degree of corroboration with independent, locally developed IBIs indicates that the regional IBIs are robust across large geographic scales, providing precise and accurate assessments of biological condition for western U.S. streams. ?? Copyright by the American Fisheries Society 2008.

  11. Evaluating Spatial Heterogeneity and Environmental Variability Inferred from Branched Glycerol Dialkyl Glycerol Tetraethers (GDGTs) Distribution in Soils from Valles Caldera, New Mexic

    Contreras Quintana, S. H.; Werne, J. P.; Brown, E. T.; Halbur, J.; Sinninghe Damsté, , J.; Schouten, S.; Correa-Metrio, A.; Fawcett, P. J.

    2014-12-01

    Branched glycerol dialkyl glycerol tetraethers (GDGTs) are recently discovered bacterial membrane lipids, ubiquitously present in peat bogs and soils, as well as in rivers, lakes and lake sediments. Their distribution appears to be controlled mainly by soil pH and annual mean air temperature (MAT) and they have been increasingly used as paleoclimate proxies in sedimentary records. In order to validate their application as paleoclimate proxies, it is essential evaluate the influence of small scale environmental variability on their distribution. Initial application of the original soil-based branched GDGT distribution proxy to lacustrine sediments from Valles Caldera, New Mexico (NM) was promising, producing a viable temperature record spanning two glacial/interglacial cycles. In this study, we assess the influence of analytical and spatial soil heterogeneity on the concentration and distribution of 9 branched GDGTs in soils from Valles Caldera, and show how this variability is propagated to MAT and pH estimates using multiple soil-based branched GDGT transfer functions. Our results show that significant differences in the abundance and distribution of branched GDGTs in soil can be observed even within a small area such as Valles Caldera. Although the original MBT-CBT calibration appears to give robust MAT estimates and the newest calibration provides pH estimates in better agreement with modern local soils in Valles Caldera, the environmental heterogeneity (e.g. vegetation type and soil moisture) appears to affect the precision of MAT and pH estimates. Furthermore, the heterogeneity of soils leads to significant variability among samples taken even from within a square meter. While such soil heterogeneity is not unknown (and is typically controlled for by combining multiple samples), this study quantifies heterogeneity relative to branched GDGT-based proxies for the first time, indicating that care must be taken with samples from heterogeneous soils in MAT and p

  12. Regional left ventricular myocardial contraction abnormalities and asynchrony in patients with hypertrophic cardiomyopathy evaluated by magnetic resonance spatial modulation of magnetization myocardial tagging

    Global left ventricular (LV) pump function is generally preserved in patients with hypertrophic cardiomyopathy (HCM). However, it is unknown whether regional myocardial contractility is impaired, especially in nonhypertrophied regions. The purpose of this study was to evaluate regional LV myocardial contraction in patients with HCM using magnetic resonance (MR) spatial modulation of magnetization (SPAMM) myocardial tagging. The study group comprised 20 patients with asymmetric septal hypertrophy (HCM group) and 16 age-matched normal patients (control group), and data were collected using transthoracic M-mode and 2-dimensional echocardiography, and MR SPAMM myocardial tagging. The systolic strain ratio, maximum systolic strain velocity, and time from end-diastole to maximum systolic strain (ΔT) in the anterior, ventricular septal, inferior and lateral regions for 2 LV short-axis sections at the levels of the chordae tendineae and papillary muscles were measured at 50-ms intervals by MR myocardial tagging. The end-diastolic anterior and ventricular septal wall thicknesses and LV mass index were significantly different between the HCM and control groups. The systolic strain ratio for all 4 walls, particularly the anterior and ventricular septal regions, was significantly lower in the HCM group. In the HCM group, the maximum systolic strain velocity was significantly lower and ΔT was significantly shorter for all 4 walls, particularly the anterior and ventricular septal regions. The standard deviation for the ΔT, calculated from the ΔT for the 8 regions of the 2 LV short-axis sections, was significantly greater in the HCM group. In conclusion, regional LV myocardial contraction is impaired in both hypertrophied and nonhypertrophied regions, and systolic LV wall asynchrony occurs in patients with HCM. (author)

  13. Spatial alexia.

    Ardila, A; Rosselli, M

    1994-05-01

    Twenty-one patients with right hemisphere damage were studied (11 men, 10 women; average age = 41.33; range = 19-65). Patients were divided in two groups: pre-Rolandic (six patients) and retro-Rolandic (15 patients) right hemisphere damage. A special reading test was given to each patient. The observed errors included: literal errors (substitutions, additions, and omissions of letters), substitutions of syllables and pseudowords for meaningful words, left hemispatial neglect, confabulation, splitting of words, verbal errors (substitutions, additions, and omission of words), grouping of letters belonging to two different words, misuse of punctuation marks, and errors in following lines. It was proposed that spatial alexia is characterized by: (1) some difficulties in the recognition of the spatial orientation in letters; (2) left hemispatial neglect; (3) tendency to "complete" the sense of words and sentences; (4) inability to follow lines when reading texts, and sequentially explore the spatial distribution of the written material; and (5) grouping and fragmentation of words, most likely as a consequence of the inability to interpret the relative value of spaces between letters correctly. PMID:7960468

  14. PRIVACY AWARE SPATIAL QUERIES

    Dr. V. Shanthi

    2012-09-01

    Full Text Available The advancement in mobile communications and its integration with Geographical Information System result in tremendous increase in Location aware computing. Users thirst for Geo-Point of interest leads to exploration of different classes of spatial queries like nearest neighbor, range queries etc in location based computing. Eachquery type is unique and there is no frame work to combine these spatial queries. In this paper, we introduce a PASQAR: Privacy aware Spatial Query Assessor on Road Networks that processes the different types of queries based on user inputs. Further PASQAR masks the user identity using encryption technique. The experimental evaluation reflects result of applying various optimization techniques in query processing and proves the efficiency of PASQAR model.

  15. The Pasadena Recommendations: Five Years After AAS Endorsement

    Knezek, Patricia; Frattare, L.; Ulvestad, J.

    2010-01-01

    It has been five years since the AAS Council unanimously endorsed the document, known as "Equity Now: The Pasadena Recommendations for Gender Equality in Astronomy," in January 2005. This document was the main product of the conference entitled "Women in Astronomy II: Ten Years After” (WIA II), held in June 2003 in Pasadena, CA. Participants of that 2003 meeting assessed the progress for women in science, offering insights into causes of the slower advancement of women, and discussed strategies to accelerate the achievement of equality. These insights and strategies were then incorporated into the "Pasadena Recommendations" by the CSWA. It was subsequently released to the entire AAS community for review and comments prior to its endorsement by the AAS. We will discuss the Recommendations and their impact since the endorsement by the AAS, including the process that is in place for organizations and departments to formally endorse the Pasadena Recommendations, thus making an organizational commitment to their implementation (see http://www.aas.org/cswa/pasadena_endorse.html).

  16. Integration of GIS, Geostatistics, and 3-D Technology to Assess the Spatial Distribution of Soil Moisture

    Betts, M.; Tsegaye, T.; Tadesse, W.; Coleman, T. L.; Fahsi, A.

    1998-01-01

    The spatial and temporal distribution of near surface soil moisture is of fundamental importance to many physical, biological, biogeochemical, and hydrological processes. However, knowledge of these space-time dynamics and the processes which control them remains unclear. The integration of geographic information systems (GIS) and geostatistics together promise a simple mechanism to evaluate and display the spatial and temporal distribution of this vital hydrologic and physical variable. Therefore, this research demonstrates the use of geostatistics and GIS to predict and display soil moisture distribution under vegetated and non-vegetated plots. The research was conducted at the Winfred Thomas Agricultural Experiment Station (WTAES), Hazel Green, Alabama. Soil moisture measurement were done on a 10 by 10 m grid from tall fescue grass (GR), alfalfa (AA), bare rough (BR), and bare smooth (BS) plots. Results indicated that variance associated with soil moisture was higher for vegetated plots than non-vegetated plots. The presence of vegetation in general contributed to the spatial variability of soil moisture. Integration of geostatistics and GIS can improve the productivity of farm lands and the precision of farming.

  17. Rare earth conversion coatings grown on AA6061 aluminum alloys. Corrosion studies

    The present work is aimed to investigate the corrosion resistance of rare earth protective coatings deposited by spontaneous deposition on AA6061 aluminum alloy substrates. Coatings were deposited from water-based Ce(NO3)3 and La(NO3)3 solutions by varing parameters such as rare earth solution concentration, bath temperature and immersion time. The values of the Tafel slopes indicate that the cathodic process is favored by concentration polarization rather than activation polarization. Chemical and morphological characterizations of the surface before and after electrochemical evaluations were performed by X-ray photoelectron spectroscopy and scanning electron microscopy. (Author)

  18. Aluminium Alloy AA6060 surface treatment with high temperature steam containing chemical additives

    Din, Rameez Ud; Tabrizian, Naja; Jellesen, Morten S.;

    2015-01-01

    The steam treatment process was employed to produce a conversion coating on aluminium alloy AA6060. The changes in microstructure and its effect on corrosion resistance properties were investigated. Various concentrations of KMnO4 containing Ce(NO3)3 was injected into the steam and its effect on...... the formation of steam-based conversion coating was evaluated. The use of Mn-Ce into the steam resulted in incorporation of these species into the conversion coating, which resulted in improved corrosion resistance of the alloy substrate....

  19. Rare earth conversion coatings grown on AA6061 aluminum alloys. Corrosion studies

    Brachetti S, S. B. [Instituto Tecnologico de Ciudad Madero, Av. 1o. de Mayo y Sor Juana I. de la Cruz, Col. Los Mangos, 89440 Ciudad Madero, Tanaulipas (Mexico); Dominguez C, M. A.; Torres H, A. M.; Onofre B, E. [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada - Altamira, Carretera Tampico-Puerto Industrial Altamira Km. 14.5, 89600 Altamira, Tamaulipas (Mexico); De la Cruz H, W., E-mail: mdominguezc@ipn.mx [UNAM, Centro de Nanociencias y Nanotecnologia, Apdo. Postal 2681, 22800 Ensenada, Baja California (Mexico)

    2014-07-01

    The present work is aimed to investigate the corrosion resistance of rare earth protective coatings deposited by spontaneous deposition on AA6061 aluminum alloy substrates. Coatings were deposited from water-based Ce(NO{sub 3}){sub 3} and La(NO{sub 3}){sub 3} solutions by varing parameters such as rare earth solution concentration, bath temperature and immersion time. The values of the Tafel slopes indicate that the cathodic process is favored by concentration polarization rather than activation polarization. Chemical and morphological characterizations of the surface before and after electrochemical evaluations were performed by X-ray photoelectron spectroscopy and scanning electron microscopy. (Author)

  20. Effect of cooling rate on microstructure of friction-stir welded AA1100 aluminum alloy

    Yi, D.; Mironov, S.; Sato, Y. S.; Kokawa, H.

    2016-06-01

    In this work, the microstructural changes occurring during cooling of friction-stir welded aluminum alloy AA1100 were evaluated. To this end, friction-stir welding (FSW) was performed in a wide range of cooling rates of 20-62 K/s and the evolved microstructures were studied by using electron backscatter diffraction. Below 0.6 Tm (Tm being the melting point), the stir zone material was found to experience no significant changes during cooling. At higher FSW temperatures, however, notable changes occurred in the welded material, including grain growth, sharpening of texture, reduction of the fraction of high-angle boundaries and material softening.

  1. Effect of Weld Tool Geometry on Friction Stir Welded AA2219-T87 Properties

    Querin, Joseph A.; Schneider, Judy A.

    2008-01-01

    In this study, flat panels of AA2219-T87 were friction stir welded (FSWed) using weld tools with tapered pins The three pin geometries of the weld tools included: 0 (straight cylinder), 30 , and 60 angles on the frustum. For each weld tool geometry, the FSW process parameters were optimized to eliminate defects. A constant heat input was maintained while varying the process parameters of spindle rpm and travel speed. This provided a constant heat input for each FSW weld panel while altering the hot working conditions imparted to the workpiece. The resulting mechanical properties were evaluated from tensile test results of the FSW joint.

  2. Evaluation of the impact of information and communication technologies (ICTs on spatial change in terms of urban and regional planning discipline

    Havva Filiz Alkan Meşhur

    2012-07-01

    Full Text Available Information and communication technologies (ICTs have progressed rapidly during the last twenty years and the spatial effects of these technologies have been debated since 1980’s. Although there is no absolute consensus of opinion what the spatial impact will be on, all authorities and academics have agreed in respect of ICTs have important role on spatial structure. These improvements will impact both spatial development and spatial planning. In this context, in order to debate about the spatial effects of ICTs, basic factors this behind spatial change should be defined. The studies done upon the meaning of space, distance and time have showed that these factors are no longer a negative component by means of information networks and communication. In the literature there are a number of studies which deal with the development of the information society and the important role of ICTs in this process. On the other hand, the urban and spatial effects of these developments has been dealt with mostly only by researchers and this discussion has been highly modest among urban planners. This article explicates the need and possibilities to develop urban and regional planning discipline due to the impact of ICTs on urban and spatial change. The findings are based on the views represented in literature and on the opinions of Turkish urban planners. The objective of the field survey is to search for opinions of Turkish urban planners about the effects of the ICTs and its implications on the spatial developments of urban and rural areas and also urban planning. In the fieldwork, the opinions of Turkish planners were surveyed in a questionnaire for this article. The questionnaire contained different statements about the effects of ICTs on spatial development and the development of planning practices. Surveys were conducted to urban planners working in public and private institutions in Turkey. The likert scale was used to measure respondents’ attitudes

  3. The Spatial Politics of Spatial Representation

    Olesen, Kristian; Richardson, Tim

    2011-01-01

    spatial planning in Denmark reveals how fuzzy spatial representations and relational spatial concepts are being used to depoliticise strategic spatial planning processes and to camouflage spatial politics. The paper concludes that, while relational geography might play an important role in building...

  4. Effect of pressurized steam on AA1050 aluminium

    Jariyaboon, Manthana; Møller, Per; Ambat, Rajan

    2012-01-01

    measurements were used to study corrosion behavior. Findings - A 590?nm boehmite oxide layer was generated on AA1050 associated with partially dissolved and/or fallen off Fe-containing intermetallic particles after exposure to pressurized steam. A significant reduction (25 times) in anodic and cathodic......Purpose - The purpose of this paper is to understand the effect of pressurized steam on surface changes, structures of intermetallic particles and corrosion behavior of AA1050 aluminium. Design/methodology/approach - Industrially pure aluminium (AA1050, 99.5 per cent) surfaces were exposed to...... pressurized steam produced from a commercial pressure cooker at the maximum temperature of 116oC for 10?min. Surface morphology was observed using SEM-EDX and FIB-SEM. Phase identification and compositional depth profiling were investigated using XRD and GDOES, respectively. Potentiodynamic polarization...

  5. Flexibility Analysis of Bacillus thuringiensis Cry1Aa

    ZHAO Xin Min; XIA Li Qiu; YANG Xiao Ping; PENG Xiao Yun

    2015-01-01

    Objective To investigate the flexibility and mobility of the Bacillus thuringiensis toxin Cry1Aa. Methods The graph theory-based program Constraint Network Analysis and normal mode-based program NMsim were used to analyze the global and local flexibility indices as well as the fluctuation of individual residues in detail. Results The decrease in Cry1Aa network rigidity with the increase of temperature was evident. Two phase transition points in which the Cry1Aa structure lost rigidity during the thermal simulation were identified. Two rigid clusters were found in domains I and II. Weak spots were found in C-terminal domain III. Several flexible regions were found in all three domains;the largest residue fluctuation was present in the apical loop2 of domain II. Conclusion Although several flexible regions could be found in all the three domains, the most flexible regions were in the apical loops of domain II.

  6. Numerical semigroups II: pseudo-symmetric AA-Semigroups

    García-Marco, Ignacio; Ramirez Alfonsin, Jorge; Rodseth, Oystein J.

    2016-01-01

    This paper is a continuation of the paper " Numerical Semigroups: Apéry Sets and Hilbert Series". We consider the general numerical AA-semigroup, i.e., semigroups consisting of all non-negative integer linear combinations of relatively prime positive integers of the form $a, a+d, a+2d,. .. , a+kd, c$. We first prove that, in contrast to arbitrary numerical semigroups, there exists an upper bound for the type of AA-semigroups that only depends on the number of generators of the semigroup. We t...

  7. Injektointimassan kehittäminen AA-tiiviysluokan tunnelialueille

    Parkkonen, Ilari

    2012-01-01

    Tutkimuksen tarkoituksena oli kehittää uusi kallioinjektointimassa AA-luokan tiiviysalueille, koska ennen käytetty injektointimassa sitoutui sekä kovettui liian hitaasti, mikä puolestaan hidasti louhintaa merkittävästi. Tutkimuksessa keskityttiin uuden injektointireseptin kehittämiseen uudella sementtivalmisteella. Kehittämisellä pyrittiin korvaamaan BB-sementti AA-sementillä, koska uusi sementti sitoutuu nopeammin kuin ennestään käytetty. Tutkimusmenetelmänä käytettiin Kalliotilojen inje...

  8. Evaluation of dual energy quantitative CT for determining the spatial distributions of red marrow and bone for dosimetry in internal emitter radiation therapy

    Purpose: To evaluate a three-equation three-unknown dual-energy quantitative CT (DEQCT) technique for determining region specific variations in bone spongiosa composition for improved red marrow dose estimation in radionuclide therapy. Methods: The DEQCT method was applied to 80/140 kVp images of patient-simulating lumbar sectional body phantoms of three sizes (small, medium, and large). External calibration rods of bone, red marrow, and fat-simulating materials were placed beneath the body phantoms. Similar internal calibration inserts were placed at vertebral locations within the body phantoms. Six test inserts of known volume fractions of bone, fat, and red marrow were also scanned. External-to-internal calibration correction factors were derived. The effects of body phantom size, radiation dose, spongiosa region segmentation granularity [single (∼17 × 17 mm) region of interest (ROI), 2 × 2, and 3 × 3 segmentation of that single ROI], and calibration method on the accuracy of the calculated volume fractions of red marrow (cellularity) and trabecular bone were evaluated. Results: For standard low dose DEQCT x-ray technique factors and the internal calibration method, the RMS errors of the estimated volume fractions of red marrow of the test inserts were 1.2–1.3 times greater in the medium body than in the small body phantom and 1.3–1.5 times greater in the large body than in the small body phantom. RMS errors of the calculated volume fractions of red marrow within 2 × 2 segmented subregions of the ROIs were 1.6–1.9 times greater than for no segmentation, and RMS errors for 3 × 3 segmented subregions were 2.3–2.7 times greater than those for no segmentation. Increasing the dose by a factor of 2 reduced the RMS errors of all constituent volume fractions by an average factor of 1.40 ± 0.29 for all segmentation schemes and body phantom sizes; increasing the dose by a factor of 4 reduced those RMS errors by an average factor of 1.71 ± 0.25. Results

  9. Evaluation of dual energy quantitative CT for determining the spatial distributions of red marrow and bone for dosimetry in internal emitter radiation therapy

    Goodsitt, Mitchell M., E-mail: goodsitt@umich.edu; Shenoy, Apeksha; Howard, David; Christodoulou, Emmanuel; Dewaraja, Yuni K. [Department of Radiology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Shen, Jincheng [Department of Biostatistics, University of Michigan, 1415 Washington Heights, Ann Arbor, Michigan 48109 (United States); Schipper, Matthew J. [Department of Radiation Oncology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Wilderman, Scott [Department of Nuclear Engineering, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Chun, Se Young [Ulsan National Institute of Science and Technology (UNIST), School of Electrical and Computer Engineering, Ulsan 689-798 (Korea, Republic of)

    2014-05-15

    Purpose: To evaluate a three-equation three-unknown dual-energy quantitative CT (DEQCT) technique for determining region specific variations in bone spongiosa composition for improved red marrow dose estimation in radionuclide therapy. Methods: The DEQCT method was applied to 80/140 kVp images of patient-simulating lumbar sectional body phantoms of three sizes (small, medium, and large). External calibration rods of bone, red marrow, and fat-simulating materials were placed beneath the body phantoms. Similar internal calibration inserts were placed at vertebral locations within the body phantoms. Six test inserts of known volume fractions of bone, fat, and red marrow were also scanned. External-to-internal calibration correction factors were derived. The effects of body phantom size, radiation dose, spongiosa region segmentation granularity [single (∼17 × 17 mm) region of interest (ROI), 2 × 2, and 3 × 3 segmentation of that single ROI], and calibration method on the accuracy of the calculated volume fractions of red marrow (cellularity) and trabecular bone were evaluated. Results: For standard low dose DEQCT x-ray technique factors and the internal calibration method, the RMS errors of the estimated volume fractions of red marrow of the test inserts were 1.2–1.3 times greater in the medium body than in the small body phantom and 1.3–1.5 times greater in the large body than in the small body phantom. RMS errors of the calculated volume fractions of red marrow within 2 × 2 segmented subregions of the ROIs were 1.6–1.9 times greater than for no segmentation, and RMS errors for 3 × 3 segmented subregions were 2.3–2.7 times greater than those for no segmentation. Increasing the dose by a factor of 2 reduced the RMS errors of all constituent volume fractions by an average factor of 1.40 ± 0.29 for all segmentation schemes and body phantom sizes; increasing the dose by a factor of 4 reduced those RMS errors by an average factor of 1.71 ± 0.25. Results

  10. Evaluation.

    McAnany, Emile G.; And Others

    1980-01-01

    Two lead articles set the theme for this issue devoted to evaluation as Emile G. McAnany examines the usefulness of evaluation and Robert C. Hornik addresses four widely accepted myths about evaluation. Additional articles include a report of a field evaluation done by the Accion Cultural Popular (ACPO); a study of the impact of that evaluation by…

  11. Strangeness Production in AA and pp Collisions

    Satz, P Castorina ad H

    2016-01-01

    Boost-invariant hadron production in high energy collisions occurs in causally disconnected regions of finite space-time size. As a result, globally conserved quantum numbers (charge, strangeness, baryon number) are conserved locally in spatially restricted correlation clusters. Their size is determined by two time scales: the equilibration time specifying the formation of a quark-gluon plasma, and the hadronization time, specifying the onset of confinement. The expected values for these scales provide the theoretical basis for the suppression observed for strangeness production in elementary interactions ($pp$, $e^+e^-$) below LHC energies. In contrast, the space-time superposition of individual collisions in high energy heavy ion interactions leads to higher energy densities, resulting in much later hadronization and hence much larger hadronization volumes. This largely removes the causality constraints and results in an ideal hadronic resonance gas in full chemical equilibrium. In the present paper, we det...

  12. The 9aaTAD Transactivation Domains: From Gal4 to p53.

    Piskacek, Martin; Havelka, Marek; Rezacova, Martina; Knight, Andrea

    2016-01-01

    The family of the Nine amino acid Transactivation Domain, 9aaTAD family, comprises currently over 40 members. The 9aaTAD domains are universally recognized by the transcriptional machinery from yeast to man. We had identified the 9aaTAD domains in the p53, Msn2, Pdr1 and B42 activators by our prediction algorithm. In this study, their competence to activate transcription as small peptides was proven. Not surprisingly, we elicited immense 9aaTAD divergence in hundreds of identified orthologs and numerous examples of the 9aaTAD species' convergence. We found unforeseen similarity of the mammalian p53 with yeast Gal4 9aaTAD domains. Furthermore, we identified artificial 9aaTAD domains generated accidentally by others. From an evolutionary perspective, the observed easiness to generate 9aaTAD transactivation domains indicates the natural advantage for spontaneous generation of transcription factors from DNA binding precursors. PMID:27618436

  13. NCBI nr-aa BLAST: CBRC-PTRO-07-0067 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  14. NCBI nr-aa BLAST: CBRC-TGUT-05-0032 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  15. NCBI nr-aa BLAST: CBRC-DRER-20-0002 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  16. NCBI nr-aa BLAST: CBRC-TBEL-01-1883 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  17. NCBI nr-aa BLAST: CBRC-TNIG-14-0023 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  18. NCBI nr-aa BLAST: CBRC-GACU-18-0022 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  19. NCBI nr-aa BLAST: CBRC-FRUB-02-0074 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  20. NCBI nr-aa BLAST: CBRC-LAFR-01-1734 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  1. NCBI nr-aa BLAST: CBRC-CJAC-01-1332 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  2. NCBI nr-aa BLAST: CBRC-OLAT-24-0009 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  3. NCBI nr-aa BLAST: CBRC-TNIG-10-0006 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  4. NCBI nr-aa BLAST: CBRC-MMUS-04-0013 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  5. NCBI nr-aa BLAST: CBRC-OANA-01-2200 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  6. NCBI nr-aa BLAST: CBRC-ACAR-01-0845 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  7. NCBI nr-aa BLAST: CBRC-RNOR-05-0081 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  8. NCBI nr-aa BLAST: CBRC-DNOV-01-3023 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0195 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  10. NCBI nr-aa BLAST: CBRC-HSAP-06-0074 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  11. NCBI nr-aa BLAST: CBRC-EEUR-01-1648 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  12. NCBI nr-aa BLAST: CBRC-OCUN-01-1522 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  13. NCBI nr-aa BLAST: CBRC-ETEL-01-1516 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  14. NCBI nr-aa BLAST: CBRC-RMAC-04-0050 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  15. NCBI nr-aa BLAST: CBRC-CFAM-12-0016 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  16. NCBI nr-aa BLAST: CBRC-FCAT-01-1020 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  17. NCBI nr-aa BLAST: CBRC-PABE-07-0058 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  18. Experimental induction and oral transmission of avian AA amyloidosis in vaccinated white hens.

    Murakami, Tomoaki; Muhammad, Naeem; Inoshima, Yasuo; Yanai, Tokuma; Goryo, Masanobu; Ishiguro, Naotaka

    2013-06-01

    Avian AA amyloidosis is commonly observed in adult birds afflicted with bacterial infections or chronic inflammatory disorders. Experimental AA amyloidosis in birds can be induced by repeated inflammatory stimulation, such as injection with casein or vaccination with oil-emulsified bacterins. However, the transmission of amyloidosis among avian species has not been studied well to date. In the present study, we confirm the potential induction of avian AA amyloidosis by inoculation of Salmonella enteritidis (SE) vaccine or Mycoplasma gallisepticum vaccine. To determine the transmission of chicken AA amyloidosis among white hens, we induced experimental AA amyloidosis in vaccinated chickens by intravenous or oral administration of chicken AA fibrils. Amyloid deposits were observed in chickens injected with SE and inoculated with chicken AA fibrils intravenously (21/26: 81%) and orally (8/12: 67%). These results suggest that chicken AA amyloidosis can be induced by vaccinations, and may be transmitted among like species by oral administration. PMID:23548152

  19. Application of the Spatial Synoptic Classification in Evaluating Links between Heat Stress and Cardiovascular Mortality and Morbidity in Prague, Czech Republic

    Urban, Aleš; Kyselý, Jan

    Phoenix: American Meteorological Society, 2015. s. 329. [AMS Annual Meeting /95./ and Conference on Climate Variability and Change /27./. 04.01.2015–08.01.2015, Phoenix] Institutional support: RVO:68378289 Keywords : spatial synoptic classification * cardiovascular diseases Subject RIV: DG - Athmosphere Sciences, Meteorology https://ams.confex.com/ams/95Annual/webprogram/Paper257805.html

  20. Species-specific toxicity of aristolochic acid (AA) in vitro.

    Huljic, S; Bruske, E I; Pfitzenmaier, N; O'Brien, E; Dietrich, D R

    2008-08-01

    Differences in toxicity and carcinogenicity of the nephrotoxic compound aristolochic acid between rodents and humans suggest a species-dependent mechanism of action. The goal of this study was to investigate constitutive differences in the susceptibility of renal cortex cells originating from human, rat and porcine origin in vitro. Effects of 24 and 48 h AA exposure on cell number and MTT reduction were studied. Furthermore, using the effective concentrations causing 20 and 50% reduction (cell number), cell cycle, 3H-thymidine incorporation and DNA damage analyses were conducted. AA cytotoxicity was observed in all cell types in a time- and concentration dependent manner with species-specific differences, with porcine cells being the most sensitive. AA had a comparable effect on the cell cycle in primary human and porcine cells and the rat NRK-52E cell line following 48 h exposure, also corroborated by the reduced 3H-thymidine incorporation in NRK-52E cells. In addition, DNA unwinding, suggestive of enhanced DNA damage, was observed in primary porcine cells. These results provide an initial insight into the sensitivity and suitability of different in vitro-systems and suggest that primary porcine renal cortex cells could be a valuable in vitro-system to study AA toxicity. PMID:18499390

  1. Slot-type pickup/kicker for AA stochastic cooling

    1979-01-01

    A "slotted transmission line" was used for both pickups and kickers of the stochastic cooling systems of the AA. They served for the cooling of the high-density antiproton stack, in momentum and both transverse planes. In the beginning in a single band, 1-2 GHz, later in 2 bands, 2-4 and 4-8 GHz. See also 7906190, 7906193.

  2. Lead induced intergranular fracture in aluminum alloy AA6262

    De Hosson, JTM

    2003-01-01

    The influence of lead on the fracture behavior of aluminum alloy AA6262 is investigated. Under certain conditions, the mode of fracture changes from transgranular microvoid coalescence to an intergranular mechanism. Three different intergranular fracture mechanisms are observed: liquid metal embritt

  3. Backend solutions for AA in the MUSE network supporting FMC

    Neerbos, A.N.R. van; Prins, M.; Melander, B.; Pimilla Larrucea, I.; Thakur, M.J.; Fredricx, F.

    2007-01-01

    The European MUSE project investigated fixed-mobile convergence from the perspective of an unbundled fixed network. A major part of the work consisted of finding solutions for the authentication and authorisation of users who roam from their home network to a visited network. This paper shows how AA

  4. Diagnostic performance of amyloid A protein quantification in fat tissue of patients with clinical AA amyloidosis

    Hazenberg, Bouke P. C.; Bijzet, Johannes; Limburg, Pieter C.; Skinner, Martha; Hawkins, Philip N.; Butrimiene, Irena; Livneh, Avi; Lesnyak, Olga; Nasonov, Evgeney L.; Filipowicz-Sosnowska, Anna; Guel, Ahmet; Merlini, Giampaolo; Wiland, Piotr; Oezdogan, Huri; Gorevic, Peter D.; Ben Maiz, Hedi; Benson, Merrill D.; Direskeneli, Haner; Kaarela, Kalevi; Garceau, Denis; Hauck, Wendy; van Rijswijk, Martin

    2007-01-01

    Objective. Amyloid A protein quantification in fat tissue is a new immunochemical method for detecting AA amyloidosis, a rare but serious disease. The objective was to assess diagnostic performance in clinical AA amyloidosis. Methods. Abdominal subcutaneous fat tissue of patients with AA amyloidosis

  5. NCBI nr-aa BLAST: CBRC-DRER-16-0004 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-151 77% ...

  6. NCBI nr-aa BLAST: CBRC-MEUG-01-0507 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 3e-64 69% ...

  7. NCBI nr-aa BLAST: CBRC-FRUB-02-0462 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 3e-65 50% ...

  8. NCBI nr-aa BLAST: CBRC-MEUG-01-2097 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-54 61% ...

  9. NCBI nr-aa BLAST: CBRC-PHAM-01-0260 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-111 55% ...

  10. NCBI nr-aa BLAST: CBRC-PHAM-01-0937 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 3e-76 39% ...

  11. NCBI nr-aa BLAST: CBRC-DRER-23-0030 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-161 56% ...

  12. NCBI nr-aa BLAST: CBRC-GGAL-35-0346 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-97 52% ...

  13. NCBI nr-aa BLAST: CBRC-MDOM-02-0208 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-67 40% ...

  14. NCBI nr-aa BLAST: CBRC-PHAM-01-1761 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-47 62% ...

  15. NCBI nr-aa BLAST: CBRC-MDOM-01-0434 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-78 89% ...

  16. NCBI nr-aa BLAST: CBRC-MDOM-01-0045 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 4e-68 81% ...

  17. NCBI nr-aa BLAST: CBRC-GGOR-01-1471 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 5e-69 49% ...

  18. NCBI nr-aa BLAST: CBRC-GGOR-01-1505 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-72 85% ...

  19. NCBI nr-aa BLAST: CBRC-FRUB-02-0378 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 5e-47 36% ...

  20. NCBI nr-aa BLAST: CBRC-DRER-24-0040 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-65 43% ...

  1. NCBI nr-aa BLAST: CBRC-DRER-26-0240 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-120 58% ...

  2. NCBI nr-aa BLAST: CBRC-DRER-26-0003 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-129 67% ...

  3. NCBI nr-aa BLAST: CBRC-OPRI-01-0928 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 9e-41 30% ...

  4. NCBI nr-aa BLAST: CBRC-MDOM-01-0559 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-100 54% ...

  5. NCBI nr-aa BLAST: CBRC-MDOM-04-0486 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 4e-75 60% ...

  6. NCBI nr-aa BLAST: CBRC-MDOM-05-0082 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-84 90% ...

  7. NCBI nr-aa BLAST: CBRC-DRER-26-0272 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-121 61% ...

  8. NCBI nr-aa BLAST: CBRC-PHAM-01-0191 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-72 42% ...

  9. NCBI nr-aa BLAST: CBRC-PHAM-01-0989 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-83 37% ...

  10. NCBI nr-aa BLAST: CBRC-HSAP-19-0022 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 3e-41 48% ...

  11. NCBI nr-aa BLAST: CBRC-PHAM-01-0701 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 5e-93 49% ...

  12. NCBI nr-aa BLAST: CBRC-PVAM-01-1393 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-45 32% ...

  13. NCBI nr-aa BLAST: CBRC-HSAP-16-0043 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-40 49% ...

  14. NCBI nr-aa BLAST: CBRC-MDOM-01-0427 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 1e-126 87% ...

  15. NCBI nr-aa BLAST: CBRC-PMAR-01-0034 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-32 35% ...

  16. NCBI nr-aa BLAST: CBRC-PMAR-01-0589 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-74 53% ...

  17. NCBI nr-aa BLAST: CBRC-MDOM-02-0443 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-57 61% ...

  18. NCBI nr-aa BLAST: CBRC-MMUS-03-0022 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 2e-27 40% ...

  19. NCBI nr-aa BLAST: CBRC-DMEL-04-0079 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 0.0 91% ...

  20. NCBI nr-aa BLAST: CBRC-MDOM-01-0492 [SEVENS

    Full Text Available with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] gb|EAK89192.1|... very large probable mucin, 11700 aa long protein with signal peptide and pronounced Thr repeat (308 aa long) [Cryptosporidium parvum Iowa II] XP_626655.1 6e-80 72% ...