WorldWideScience

Sample records for aa household alkaline

  1. Alkaline phosphatases and aminopeptidases are altered in a Cry11Aa resistant strain of Aedes aegypti.

    Lee, Su-Bum; Aimanova, Karlygash G; Gill, Sarjeet S

    2014-11-01

    Bacillus thuringiensis subsp. israelensis (Bti) is widely used for the biological control of mosquito populations. However, the mechanism of Bti toxins is still not fully understood. To further elucidate the mechanism of Bti toxins, we developed an Aedes aegypti resistant strain that shows high-level resistance to Cry11Aa toxin. After 27 selections with Cry11Aa toxin, the larvae showed a 124-fold resistance ratio for Cry11Aa (strain G30). G30 larvae showed cross-resistance to Cry4Aa (66-fold resistance), less to Cry4Ba (13-fold), but not to Cry11Ba (2-fold). Midguts from these resistant larvae did not show detectable difference in the processing of the Cry11Aa toxin compared to that in susceptible larvae (WT). Brush border membrane vesicles (BBMV) from resistant larvae bound slightly less Cry11Aa compared to WT BBMV. To identify potential proteins associated with Cry11A resistance, not only transcript changes in the larval midgut were analyzed using Illumina sequencing and qPCR, but alterations of previously identified receptor proteins were investigated using immunoblots. The transcripts of 375 genes were significantly increased and those of 208 genes were down regulated in the resistant larvae midgut compared to the WT. None of the transcripts for previously identified receptors of Cry11Aa (Aedes cadherin, ALP1, APN1, and APN2) were altered in these analyses. The genes for the identified functional receptors in resistant larvae midgut did not contain any mutation in their sequences nor was there any change in their transcript expression levels compared to WT. However, ALP proteins were expressed at reduced levels (∼ 40%) in the resistant strain BBMV. APN proteins and their activity were also slightly reduced in resistance strain. The transcript levels of ALPs (AAEL013330 and AAEL015070) and APNs (AAEL008158, AAEL008162) were significantly reduced. These results strongly suggest that ALPs and APNs could be associated with Cry11Aa resistance in Ae. aegypti. PMID

  2. Influence of the degree of polishing of alloy AA 5083 on its behaviour against localised alkaline corrosion

    A study has been conducted of the influence of the surface finish on the behaviour against the corrosion of samples of alloy AA 5083 immersed in aerated solutions of NaCl at 3.5%. Samples polished from 80 to 1200 grit have been tested, utilising as experimental techniques, measurements of weight loss, optical and scanning electron microscopy, linear polarisations and electrochemical noise measurement (ENM). In the conditions studied, the principal corrosion process that takes place is localised alkaline corrosion (LAC). This type of corrosion occurs as a consequence of the alkalinisation of the area surrounding the Al(Mn,Fe,Cr) cathodic precipitates that exist in the alloy. The results obtained indicate that the samples polished to 1200 grit present a greater susceptibility to processes of localised alkaline corrosion than the samples polished to 80 grit. It has been found that the degree of polishing conditions the number of intermetallic particles exposed. Hence the differences of behaviour observed between the sets of results obtained have been interpreted as an effect function of the density of cathodic intermetallic particles exposed on the surface

  3. The effect of nickel on alloy microstructure and electrochemical behaviour of AA1050 aluminium alloy in acid and alkaline solutions

    The study investigates the influence of nickel and magnesium additions to AA1050 aluminium alloy on the alloy electrochemical behaviour in sodium hydroxide and hydrochloric solutions under conditions relevant to industries that use alkaline etching as a standard surface treatment procedure and to the lithographic and electronic industries where surface convolution is assisted by pitting in hydrochloric acid. Scanning and transmission electron microscopes were used to characterize the intermetallic particles, and scanning Kelvin probe microscopy was utilised in monitoring the surface potential. Nickel is shown to be incorporated into second phase particles, which mostly consisted of Al3Fe and α-(AlFeSi) phases, resulting in enhanced cathodic activity on the aluminium surface. Consequently, the dissolution rates of the superpure aluminium, alloys without nickel addition and alloy with nickel addition are increased respectively in sodium hydroxide, and increased pitting is respectively promoted in hydrochloric acid. In contrast, the addition of magnesium to the alloy had negligible influence on the etching and pitting behaviour.

  4. Evolution of the corrosion process of AA 2024-T3 in an alkaline NaCl solution with sodium dodecylbenzenesulfonate and lanthanum chloride inhibitors

    Zhou, Biner; Wang, Yishan; Zuo, Yu

    2015-12-01

    The evolution of the corrosion process of AA 2024-T3 in 0.58 g L-1 NaCl solution (pH 10) with sodium dodecylbenzenesulfonate (SDBS) and lanthanum chloride inhibitors was studied with electrochemical and surface analysis methods. With the addition of the compounded LaCl3 and SDBS inhibitors, in the early stage the polarization behavior of AA 2024-T3 changed from active corrosion to passivation, and both the general corrosion and pitting corrosion were inhibited. However, with the immersion time extended, the passive behavior gradually disappeared and pitting happened at the Cu-rich phases. After 24 h immersion, the compounded inhibitors still showed good inhibition for general corrosion, but the polarization curve again presented the characteristic similar to active polarization. The compounded inhibitors also inhibited the pitting corrosion to some extent. The acting mechanism of the inhibitors SDBS and La3Cl on the corrosion process of AA 2024-T3 in the test solution was discussed.

  5. Household Finance

    Campbell, John

    2006-01-01

    The welfare benefits of financial markets depend in large part on how effectively households use these markets. The study of household finance is challenging because household behavior is difficult to measure accurately, and because households face constraints that are not captured by textbook models, including fixed costs, uninsurable income risk, borrowing constraints, and contracts that are non-neutral with respect to inflation. Evidence on participation, diversification, and the exercise ...

  6. AA Index

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  7. Household Products

    The products you use for cleaning, carpentry, auto repair, gardening, and many other household uses can contain ingredients that can harm you, your family, and the environment. These include Oven and ...

  8. Rating AAs.

    Carter, Susan J.

    2001-01-01

    Why alternative investments? In a word: performance. Many higher education endowment and foundation managers are making increasing commitments to alternative investments, or AAs, in order to obtain higher returns and broader diversification for their investment portfolios than public securities instruments can usually provide. Learn how to handle…

  9. Rural Households

    Bruun, Ole

    2013-01-01

    Based on a comprehensive survey and subsequent fieldwork, this chapter introduces the socio-economic characteristics and common livelihood strategies of rural households in Quang Nam, Central Vietnam. It demonstrates the basic premise of self-reliance in rural society and the decreasing economic ...... limitations of informal organization and community adaptive capacities, and finally, it discusses the issues of vulnerability and adaptation to climatic and environmental change from a household perspective.......Based on a comprehensive survey and subsequent fieldwork, this chapter introduces the socio-economic characteristics and common livelihood strategies of rural households in Quang Nam, Central Vietnam. It demonstrates the basic premise of self-reliance in rural society and the decreasing economic...

  10. Household Savings

    Browning, Martin; Lusardi, Annamaria

    suggested in the informal saving literature can be captured in the standard optimizing model. Particular attention is given to recent work on the precautionary motive and its implications for saving and consumption behavior. We also discuss the "behavioral" or "psychological" approach that eschews the use...... the recent empirical literature on the precautionary motive. We conclude that although some households do seem to have a significant precautionary motive at some points in their life cycle, this motive is not so strong empirically as some investigators suggest......In this survey, we review the recent theoretical and empirical literature on household saving and consumption. The discussion is structured around a list of motives for saving and how well the standard theory captures these motives. We show that almost all of the motives for saving that have been...

  11. Household Saving in Australia

    Richard Finlay; Fiona Price

    2014-01-01

    This paper investigates household saving behaviour in Australia, as well as the drivers behind the recent rise in the aggregate household saving ratio. Our results explaining differences in saving behaviour across households are consistent with theory and previous findings. As might be expected, households' saving ratios tend to increase with income, but decrease with wealth and gearing. Financially constrained and migrant households tend to save more than other households, all else equal. Wh...

  12. Antibacterials in Household Products

    ... products such as soaps, detergents, health and skincare products and household cleaners. How do antibacterials work? ♦ Antibacterials may be ... contain triclosan or other biocide agents? Antibacterials in household products Are there any risks associated with triclosan-containing ...

  13. Household Safety: Preventing Choking

    ... Tropical Delight: Melon Smoothie Pregnant? Your Baby's Growth Household Safety: Preventing Choking KidsHealth > For Parents > Household Safety: ... and often contain small parts. Make sure small refrigerator magnets are out of your child's reach. Check ...

  14. ALP (Alkaline Phosphatase) Test

    ... Also known as: ALK PHOS; Alkp Formal name: Alkaline Phosphatase Related tests: AST ; ALT ; GGT ; Bilirubin ; Liver Panel ; Bone Markers ; Alkaline Phosphatase Isoenzymes; Bone Specific ALP All content on ...

  15. Culture and Household Saving

    Guin, Benjamin

    2015-01-01

    In this paper, I examine the role of culture for households' saving decisions. Exploiting historical language borders within Switzerland, I isolate the effect of culture from economic, institutional, demographic and geographic factors for a homogeneous and representative sample of households. The analysis is based on the Swiss Household Panel that I complement with geographic and socio-economic data. I show that households located in the Romanic-speaking part (Italian, French) are more than 1...

  16. Unemployment and Household formation

    Ebrahim, Amina; Woolard, Ingrid; Leibbrandt, Murray

    2013-01-01

    In comparison to other continents, Africa has received little scholarly attention with regard to household composition. Household composition is endogenous to a variety of welfare issues and little is understood about the determinants of this composition. Understanding the household composition and formation decision may improve our understanding of how the unemployed gain access to resources and how household composition could provide a safety net to the unemployed. However, increasingly, mo...

  17. Antiproton Accumulator (AA)

    Photographic Service

    1980-01-01

    The AA in its final stage of construction, before it disappeared from view under concrete shielding. Antiprotons were first injected, stochastically cooled and accumulated in July 1980. From 1981 on, the AA provided antiprotons for collisions with protons, first in the ISR, then in the SPS Collider. From 1983 on, it also sent antiprotons, via the PS, to the Low-Energy Antiproton Ring (LEAR). The AA was dismantled in 1997 and shipped to Japan.

  18. Gambling households in Canada.

    MacDonald, Martha; McMullan, John L; Perrier, David C

    2004-01-01

    This paper examines the distribution of gambling dollars in Nova Scotia, Saskatchewan and Canada and studies the impact of this spending on households. We focus first on how gambling expenditures are related to the level and source of household income as well as to other demographic characteristics such as age, education, household composition, geographical area, and sources of income. Next we analyze how gambling expenditures are distributed among those households that gamble. We show how expenditure patterns differ in the intensity of gambling as measured by the proportion of household income or total amount of dollars spent on gambling. Then we study the affects that gambling has on spending on household necessities, changes in net worth, retirement savings and household debt. Finally we determine whether gambling expenditures act as a substitute or a complement to other recreational spending on entertainment products and services. Throughout the paper we offer a comparative analysis of provincial and national data. PMID:15353922

  19. AA magnet measurement team

    1978-01-01

    Quickly improvised measurement equipment for the AA (Antiproton Accumulator) was all the tight schedule permitted, but the high motivation of the team made up for the lack of convenience. From left to right: Roy Billinge (Joint AA Project Leader, the other one was Simon van der Meer); Bruno Autin, Brian Pincott, Colin Johnson.

  20. Consumer Behaviour of Households

    Netrdová, Blanka

    2013-01-01

    The thesis is focused on the consumer behavior of the households in the period from 2003 to 2013. The theoretical part is divided into two parts, household consumption from the perspective of marketing, and from the perspective of economics. In the marketing section explains the concepts of consumer, household, consumer credit, consumer behavior, consumer predisposition and the buying decision process. In the section dedicated to economics concepts are explained, the budget line consumption, ...

  1. Household hazardous waste

    Fjelsted, Lotte; Christensen, Thomas Højlund

    2007-01-01

    .) comprised 15-25% and foreign items comprised 10-20%. Water-based paint was the dominant part of the paint waste. The chemical composition of the paint waste and the paint-like waste was characterized by an analysis of 27 substances in seven waste fractions. The content of critical substances was tow and the...... incinerated. Allowing household paint waste to be collected with ordinary household waste is expected to reduce the cost of handling household hazardous waste, since paint waste in Denmark comprises the major fraction of household hazardous waste....

  2. AAS 228: Day 1 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  3. AAS 227: Welcome!

    Kohler, Susanna

    2016-01-01

    Greetings from the 227th American Astronomical Society meeting in Kissimmee, Florida! This week, along with several fellow authors from astrobites, Iwill bewritingupdates on selectedevents at themeeting and posting at the end of each day. You can follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.If youre an author or referee (or plan to be!) and youre here at the meeting, consider joining us at our Author and Referee Workshop on Wednesday in the Tallahassee room, where well be sharingsome of the exciting new features of the AAS journals. You can drop intoeither of the two-hour sessions(10 AM 12 PM or 1 PM 3 PM), and there will be afree buffet lunch at noon.Heres the agenda:Morning SessionTopic Speaker10:00 am 10:05 amIntroductionsJulie Steffen10:05 am 10:35 amChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac10:35 am 11:00 amThe Peer Review ProcessButler Burton11:00 am 11:15 amAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler11:15 am 11:30 amFixing Software and Instrumentation Publishing: New Paper Styles in AAS JournalsChris Lintott11:30 am 11:45 amMaking Article Writing Easier with the New AASTeX v6.0Greg Schwarz11:45 am 12:00 pmBringing JavaScript and Interactivity to Your AAS Journal FiguresGus MuenchLunch SessionTopic Speaker12:00 pm 12:15 pmUnified Astronomy ThesaurusKatie Frey12:15 pm 12:30 pmAAS/ADS ORCID Integration ToolAlberto Accomazzi12:30 pm 12:45 pmWorldWide Telescope and Video AbstractsJosh Peek12:45 pm 01:00 pmArizona Astronomical Data Hub (AADH)Bryan HeidornAfternoon SessionTopic Speaker01:00 pm 01:05 pmIntroductionsJulie Steffen01:05 pm 01:35 pmChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac01:35 pm 02:00 pmThe Peer Review ProcessButler Burton02:00 pm 02:15 pmAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler02:15 pm 02:30 pm

  4. Geomagnetic aa Indices

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa indices are the continuation of the series beginning in the year 1868. A full description of these indices is given in the International...

  5. Household electricity demand profiles

    Marszal, Anna Joanna; Heiselberg, Per Kvols; Larsen, Olena Kalyanova

    2016-01-01

    Highlights •A 1-min resolution household electricity load model is presented. •Model adapts a bottom-up approach with single appliance as the main building block. •Load profiles are used to analyse the flexibility potential of household appliances. •Load profiles can be applied in other domains, e...

  6. Anodes for alkaline electrolysis

    Soloveichik, Grigorii Lev

    2011-02-01

    A method of making an anode for alkaline electrolysis cells includes adsorption of precursor material on a carbonaceous material, conversion of the precursor material to hydroxide form and conversion of precursor material from hydroxide form to oxy-hydroxide form within the alkaline electrolysis cell.

  7. Alkaline "Permanent" Paper.

    Pacey, Antony

    1991-01-01

    Discussion of paper manufacturing processes and their effects on library materials focuses on the promotion of alkaline "permanent" paper, with less acid, by Canadian library preservation specialists. Standards for paper acidity are explained; advantages of alkaline paper are described, including decreased manufacturing costs; and recyclability is…

  8. Promoting household energy conservation

    It is commonly assumed that households must change their behaviour to reduce the problems caused by increasing levels of fossil energy use. Strategies for behaviour change will be more effective if they target the most important causes of the behaviour in question. Therefore, this paper first discusses the factors influencing household energy use. Three barriers to fossil fuel energy conservation are discussed: insufficient knowledge of effective ways to reduce household energy use, the low priority and high costs of energy savings, and the lack of feasible alternatives. Next, the paper elaborates on the effectiveness and acceptability of strategies aimed to promote household energy savings. Informational strategies aimed at changing individuals' knowledge, perceptions, cognitions, motivations and norms, as well as structural strategies aimed at changing the context in which decisions are made, are discussed. This paper focuses on the psychological literature on household energy conservation, which mostly examined the effects of informational strategies. Finally, this paper lists important topics for future research

  9. Ruthenium determination in synthetic Purex waste solutions by AAS

    A method for the determination of ruthenium in synthetic Purex waste solutions by flame AAS is described. With the usual flames and a lanthanum buffer, only cerium interference in the air-acetylene flame need be considered under the conditions applied. Ruthenium nitrosyl nitrate, ruthenium(IV) hydroxychloride and alkaline ruthenate samples gave identical results, showing that the extraordinarily stable Ru-NO bond does not hinder atomization. The preparation and standardization of the ruthenium nitrosyl solutions, and the alkaline fusion, are briefly described. (author)

  10. Alkaline battery operational methodology

    Sholklapper, Tal; Gallaway, Joshua; Steingart, Daniel; Ingale, Nilesh; Nyce, Michael

    2016-08-16

    Methods of using specific operational charge and discharge parameters to extend the life of alkaline batteries are disclosed. The methods can be used with any commercial primary or secondary alkaline battery, as well as with newer alkaline battery designs, including batteries with flowing electrolyte. The methods include cycling batteries within a narrow operating voltage window, with minimum and maximum cut-off voltages that are set based on battery characteristics and environmental conditions. The narrow voltage window decreases available capacity but allows the batteries to be cycled for hundreds or thousands of times.

  11. Household Chemical Emergencies

    ... and disposing of the material according to the manufacturer’s directions. It is critical to store household chemicals in places where children cannot access them. Remember that products such as aerosol cans of hair spray and deodorant, nail polish ...

  12. Household hazardous waste

    Fjelsted, Lotte; Christensen, Thomas Højlund

    2007-01-01

    .) comprised 15-25% and foreign items comprised 10-20%. Water-based paint was the dominant part of the paint waste. The chemical composition of the paint waste and the paint-like waste was characterized by an analysis of 27 substances in seven waste fractions. The content of critical substances was tow and the......'Paint waste', a part of the 'household hazardous waste', amounting to approximately 5 tonnes was collected from recycling stations in two Danish cities. Sorting and analyses of the waste showed paint waste comprised approximately 65% of the mass, paint-like waste (cleaners, fillers, etc...... paint waste was less contaminated with heavy metals than was the ordinary household waste. This may suggest that households no longer need to source-segregate their paint if the household waste is incinerated, since the presence of a small quantity of solvent-based paint will not be harmful when...

  13. AAS Career Services

    Marvel, Kevin B.

    2012-08-01

    The American Astronomical Society provides substantial programs in the area of Career Services.Motivated by the Society's mission to enhance and share humanity's understanding of the Universe, the AAS provides a central resource for advertising positions, interviewing opportunities at its annual winter meeting and information, workshops and networks to enable astronomers to find employment.The programs of the Society in this area are overseen by an active committee on employment and the AAS Council itself.Additional resources that help characterize the field, its growth and facts about employment such as salaries and type of jobs available are regularly summarized and reported on by the American Institute of Physics.

  14. Uranium in alkaline rocks

    Geologic and geochemical criteria were developed for the occurrence of economic uranium deposits in alkaline igneous rocks. A literature search, a limited chemical analytical program, and visits to three prominent alkaline-rock localities (Ilimaussaq, Greenland; Pocos de Caldas, Brazil; and Powderhorn, Colorado) were made to establish criteria to determine if a site had some uranium resource potential. From the literature, four alkaline-intrusive occurrences of differing character were identified as type-localities for uranium mineralization, and the important aspects of these localities were described. These characteristics were used to categorize and evaluate U.S. occurrences. The literature search disclosed 69 U.S. sites, encompassing nepheline syenite, alkaline granite, and carbonatite. It was possible to compare two-thirds of these sites to the type localities. A ranking system identified ten of the sites as most likely to have uranium resource potential

  15. Uranium in alkaline rocks

    Murphy, M.; Wollenberg, H.; Strisower, B.; Bowman, H.; Flexser, S.; Carmichael, I.

    1978-04-01

    Geologic and geochemical criteria were developed for the occurrence of economic uranium deposits in alkaline igneous rocks. A literature search, a limited chemical analytical program, and visits to three prominent alkaline-rock localities (Ilimaussaq, Greenland; Pocos de Caldas, Brazil; and Powderhorn, Colorado) were made to establish criteria to determine if a site had some uranium resource potential. From the literature, four alkaline-intrusive occurrences of differing character were identified as type-localities for uranium mineralization, and the important aspects of these localities were described. These characteristics were used to categorize and evaluate U.S. occurrences. The literature search disclosed 69 U.S. sites, encompassing nepheline syenite, alkaline granite, and carbonatite. It was possible to compare two-thirds of these sites to the type localities. A ranking system identified ten of the sites as most likely to have uranium resource potential.

  16. Household Hazards to Pets

    ... pennies (those minted after 1982 contain zinc) and alkaline batteries (like those in your remote controls) can ... artist’s or other specialty paints may contain heavy metals or volatile substances that could become harmful if ...

  17. AAS Oral History Project

    Buxner, Sanlyn; Holbrook, Jarita; AAS Oral History Team

    2016-06-01

    Now in its fourth year, the AAS Oral History Project has interviewed over 80 astronomers from all over the world. Led by the AAS Historical Astronomy Division (HAD) and partially funded by the American Institute of Physics Niels Bohr Library and ongoing support from the AAS, volunteers have collected oral histories from astronomers at professional meetings starting in 2015, including AAS, DPS, and the IAU general assembly. Each interview lasts one and a half to two hours and focuses on interviewees’ personal and professional lives. Questions include those about one’s family, childhood, strong influences on one’s scientific career, career path, successes and challenges, perspectives on how astronomy is changing as a field, and advice to the next generation. Each interview is audio recorded and transcribed, the content of which is checked with each interviewee. Once complete, interview transcripts are posted online as part of a larger oral history library at https://www.aip.org/history-programs/niels-bohr-library/oral-histories. Future analysis will reveal a rich story of astronomers and will help the community address issues of diversity, controversies, and the changing landscape of science. We are still recruiting individuals to be interviewed from all stages of career from undergraduate students to retired and emeritus astronomers. Contact Jarita Holbrook to schedule an interview or to find out more information about the project (astroholbrook@gmail.com). Also, contact Jarita Holbrook if you would like to become an interviewer for the project.

  18. Household skills and low wages

    Dale, Kristin

    2008-01-01

    Household skills provide job skills when tasks in jobs and household production are similar and jobs produce substitutes for home-made services. Opportunity costs of higher education are foregone earnings during schooling and foregone household production while studying and later in life. I show that individuals in jobs requiring household skills accept lower wage rates than traditional human capital theory predicts, and that individuals with low household skills tend to enter higher educatio...

  19. Household Tax Compliance in Albania

    Edward Christie; Mario Holzner

    2005-01-01

    This paper applies a set of indicators of tax compliance to the household sector in Albania. These estimates are performed using available data for the years 1996 to 2003. Estimates of income declaration rates and of corresponding undeclared household income are computed using household final consumption data from national accounts and household survey data as well as detailed data on household taxation. Specific aspects such as remittances and the role of agriculture are explicitly taken int...

  20. Use of Internet by households

    Humlová, Veronika

    2011-01-01

    This work is engaged in analysis of internet usage by the households by Czech households. The first part of work defines the basic concepts of Internet such as internet history, types of internet connection or the possibilities of its use. I tis followed by concrete analysis of trends in Internet usage by households in the Czech Republic, according to several aspects. The basic aspect is the share of households connected to the Internet to the total number of households. Next the work analyze...

  1. The Antiproton Accumulator (AA)

    1980-01-01

    Section 06 - 08*) of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A vacuum-tank, two bending magnets (BST06 and BST07 in blue) with a quadrupole (QDN07, in red) in between, another vacuum-tank, a wide quadrupole (QFW08) and a further tank . The tanks are covered with heating tape for bake-out. The tank left of BST06 contained the stack core pickup for stochastic cooling (see 7906193, 7906190, 8005051), the two other tanks served mainly as vacuum chambers in the region where the beam was large. Peter Zettwoch works on BST06. *) see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984)

  2. AA, bending magnet, BLG

    1980-01-01

    The very particular lattice of the AA required 2 types of dipole (bending magnets; BLG, long and narrow; BST, short and wide). The BLG had a steel length of 4.70 m, a good field width of 0.24 m, and a weight of about 70 t. Jean-Claude Brunet inspects the lower half of a BLG. For the BST magnets see 7811105 and 8006036.

  3. Lighting and social practices - what role does lighting play for low energy house (LEH) households and LED frontrunners?

    Jensen, Charlotte Louise

    dimensions influence how people use and relate to lighting. Assessing how very distinctive contexts of households (that diverge from an exemplary kind of household), such as low energy houses and LED frontrunner households, use and understand lighting, may give some insight into what may trigger or hamper a......As lighting in Danish households consume approximately 1.3 TWh every year, reducing electricity consumption from lighting is important. Studies have shown that a mere substitution of inefficient lighting technologies towards more efficient ones may not be possible, as many social and cultural...... transition towards less electricity-consuming lighting patterns....

  4. The Antiproton Accumulator (AA)

    1980-01-01

    A section of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A large vacuum-tank, a quadrupole (QDN09*), a bending magnet (BST08), another vacuum-tank, a wide quadrupole (QFW08) and (in the background) a further bending magnet (BST08). The tanks are covered with heating tape for bake-out. The tank left of QDN09 contained the kickers for stochastic pre-cooling (see 790621, 8002234, 8002637X), the other one served mainly as vacuum chamber in the region where the beam was large. Peter Zettwoch works on QFW08. * see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984) See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  5. Study of the alloying additives and alkaline zincate solution effects on the commercial aluminum as galvanic anode for use in alkaline batteries

    Rashvand avei, M. [Department of Chemistry, K.N. Toosi University of Technology, P.O. Box 15875-4416, Tehran (Iran, Islamic Republic of); Jafarian, M., E-mail: mjafarian@kntu.ac.ir [Department of Chemistry, K.N. Toosi University of Technology, P.O. Box 15875-4416, Tehran (Iran, Islamic Republic of); Moghanni Bavil Olyaei, H. [Department of Chemistry, K.N. Toosi University of Technology, P.O. Box 15875-4416, Tehran (Iran, Islamic Republic of); Gobal, F. [Department of Chemistry, Sharif University of Technology, P.O. Box 11365-8516, Tehran (Iran, Islamic Republic of); Hosseini, S.M. [Jahad Organization – Science and Technology Center, Tehran (Iran, Islamic Republic of); Mahjani, M.G. [Department of Chemistry, K.N. Toosi University of Technology, P.O. Box 15875-4416, Tehran (Iran, Islamic Republic of)

    2013-12-16

    The corrosion behavior of different grades of commercial aluminum such as AA1040, AA5083, AA6060 and AA7075 in ZnO-containing 4 M NaOH has been determined by using open circuit potential-time measurements (OCP), galvanostatic and potentiodynamic polarization and electrochemical impedance spectroscopy (EIS). The results of scanning electron microscopy (SEM) and energy dispersive analysis of X-ray (EDAX) reveal that ZnO produces the inhibition effect by the formation of a zinc-containing deposit layer on the surface of aluminum electrodes. Although the influence of zincating on the performance of aluminum alloys and considering the amount of alloying elements such as zinc, magnesium and manganese in AA7075 and AA5083 alloys is much more than AA6060 one, the AA6060 aluminum exhibits negligible corrosion rate. Alloying aluminum with other elements and modifying the composition of the electrolyte is a necessary condition for reducing the self-corrosion of the aluminum anodes, whereas the proportion of the amount of additive elements is sufficient and important condition. As AA6060 with a low amount of Zn and Mg, but the high value of the ratio of (Mg/Zn) content (>400) can serve as a good galvanic anode in the alkaline media. - Highlights: • Decreasing the corrosion rate of tested alloys in 4 M NaOH solution specially AA6060. • Lowering the extent of anodic polarization at a current density of 50 mA cm{sup −2}. • High inhibitor efficiency about 97% for AA6060.

  6. Study of the alloying additives and alkaline zincate solution effects on the commercial aluminum as galvanic anode for use in alkaline batteries

    The corrosion behavior of different grades of commercial aluminum such as AA1040, AA5083, AA6060 and AA7075 in ZnO-containing 4 M NaOH has been determined by using open circuit potential-time measurements (OCP), galvanostatic and potentiodynamic polarization and electrochemical impedance spectroscopy (EIS). The results of scanning electron microscopy (SEM) and energy dispersive analysis of X-ray (EDAX) reveal that ZnO produces the inhibition effect by the formation of a zinc-containing deposit layer on the surface of aluminum electrodes. Although the influence of zincating on the performance of aluminum alloys and considering the amount of alloying elements such as zinc, magnesium and manganese in AA7075 and AA5083 alloys is much more than AA6060 one, the AA6060 aluminum exhibits negligible corrosion rate. Alloying aluminum with other elements and modifying the composition of the electrolyte is a necessary condition for reducing the self-corrosion of the aluminum anodes, whereas the proportion of the amount of additive elements is sufficient and important condition. As AA6060 with a low amount of Zn and Mg, but the high value of the ratio of (Mg/Zn) content (>400) can serve as a good galvanic anode in the alkaline media. - Highlights: • Decreasing the corrosion rate of tested alloys in 4 M NaOH solution specially AA6060. • Lowering the extent of anodic polarization at a current density of 50 mA cm−2. • High inhibitor efficiency about 97% for AA6060

  7. AAS 228: Day 1 morning

    Kohler, Susanna

    2016-06-01

    extraterrestrial life. The jets are highly alkaline and may contain molecular hydrogen, which links the inorganic and living worlds as a reactant and energy source. Although Cassinis very fruitful mission will come to a close in 2017 with a death spiral into Saturn, the future is still bright for Enceladus. Glein closed with a preview of the next mission to this special moon: ELF, the Enceladus Life Finder, will fly through and analyze Enceladuss icy plume in unprecedented detail using state-of-the-art instruments and is predicted to fly in 2031. 102: The NASA K2 Mission (by Meredith Rawls)Everyones favorite planet finding telescope continues to impress. In this morning session, we heard highlights about how the repurposed Kepler mission (K2) is contributing to research in areas ranging from nearby brown dwarfs to extragalactic supernovae. The session kicked off with an overview by Knicole Colon, who happily reported extended funding for K2 through 2018, when its fuel is projected to run out. Colon: despite a glitch in the celebratory cake, #K2mission has been extended until the end of life! #aas228 pic.twitter.com/9umZozOy0n Geert Barentsen (@GeertHub) June 13, 2016Bradley Tucker discussed recent extragalactic results from K2, and supernovae in particular. So far, the Kepler Extragalactic Survey has found 17 supernovae and they hope to find at least 20 more in the next three years. Because Kepler observations are so frequent, they reveal previously hidden subtleties in how supernovae fade over time..@btucker22: #K2mission is providing a statistical sample of high-precision supernova lightcurves! #aas228 pic.twitter.com/GWZUJhtmRW Geert Barentsen (@GeertHub) June 13, 2016Of course, exoplanet science is still a primary goal for the K2 team. Matthew Penny updated us on the status of the in-progress microlensing campaign, which uses Kepler to search for one-off brightening events that indicate the presence of a planet due to gravitational microlensing. Work is also underway by

  8. The Rise in Household Saving

    Richard Finlay; Fiona Price

    2014-01-01

    This article investigates household saving behaviour in Australia and the drivers behind the sharp rise in saving that occurred in the late 2000s after an extended period of decline. Saving behaviour is important as, among other things, it influences household consumption, which accounts for a little over half of GDP. The rise in household saving appears to have been underpinned by precautionary motives, a reduction in expected future income gains for some types of households and an effort to...

  9. Efficient Intra-Household Allocations

    Browning, Martin

    households which have more than one member. We make minimal assumptions about how the individual members of the household resolve conflicts. All we assume is that however decisions are made, outcomes are efficient. We refer to this as the collective setting. We show that in the collective setting household...

  10. Alkaline quinone flow battery.

    Lin, Kaixiang; Chen, Qing; Gerhardt, Michael R; Tong, Liuchuan; Kim, Sang Bok; Eisenach, Louise; Valle, Alvaro W; Hardee, David; Gordon, Roy G; Aziz, Michael J; Marshak, Michael P

    2015-09-25

    Storage of photovoltaic and wind electricity in batteries could solve the mismatch problem between the intermittent supply of these renewable resources and variable demand. Flow batteries permit more economical long-duration discharge than solid-electrode batteries by using liquid electrolytes stored outside of the battery. We report an alkaline flow battery based on redox-active organic molecules that are composed entirely of Earth-abundant elements and are nontoxic, nonflammable, and safe for use in residential and commercial environments. The battery operates efficiently with high power density near room temperature. These results demonstrate the stability and performance of redox-active organic molecules in alkaline flow batteries, potentially enabling cost-effective stationary storage of renewable energy. PMID:26404834

  11. Is knowledge shared within households?

    Basu, Kaushik; Narayan, Ambar; Ravallion, Martin

    1999-01-01

    According to theory, a member of a collective-action household may or may not share knowledge with others in that household. Shared income gains from shared knowledge may well be offset by a shift in the balance of power within the family. But do literate members of the household share the benefits of literacy with other members of the household in practice? Using household survey data for Bangladesh, the authors find that education has strong external effects on individual earnings. When a r...

  12. Alkaline broadening in Stars

    De Kertanguy, A

    2015-01-01

    Giving new insight for line broadening theory for atoms with more structure than hydrogen in most stars. Using symbolic software to build precise wave functions corrected for ds;dp quantum defects. The profiles obtained with that approach, have peculiar trends, narrower than hydrogen, all quantum defects used are taken from atomic database topbase. Illustration of stronger effects of ions and electrons on the alkaline profiles, than neutral-neutral collision mechanism. Keywords : Stars: fundamental parameters - Atomic processes - Line: profiles.

  13. Alkaline quinone flow battery

    Lin, Kaixiang; Chen, Qing; Gerhardt, Michael; Tong, Liuchuan; Kim, Sang Bok; Eisenach, Louise Ann; Valle, Alvaro West; Hardee, D.; Gordon, Roy Gerald; Aziz, Michael J.; Marshak, M

    2015-01-01

    Storage of photovoltaic and wind electricity in batteries could solve the mismatch problem between the intermittent supply of these renewable resources and variable demand. Flow batteries permit more economical long-duration discharge than solid-electrode batteries by using liquid electrolytes stored outside of the battery. We report an alkaline flow battery based on redox-active organic molecules that are composed entirely of Earth-abundant elements and are nontoxic, nonflammable, and safe f...

  14. AAS 227: Day 2

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  15. AAS 227: Day 2

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  16. AAS 227: Day 1

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or at astrobites.com, or catch ourlive-tweeted updates from the @astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto have so many people tell us that they already know about and useastrobites, and we were excited to introduce a new cohort of students at AAS to astrobites for the first time.Tuesday morning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended today.Opening Address (by Becky Smethurst)The President of the AAS, aka our fearless leader Meg Urry kicked off the meeting this morning at the purely coffee powered hour of 8am this morning. She spoke about the importance of young astronomers at the meeting (heres looking at you reader!) and also the importance of the new Working Group for Accessibility and Disabilities (aka WGAD pronounced like wicked) at the AAS. The Society has made extra effort this year to make the conference accessible to all,a message which was very well received by everyone in attendance.Kavli Lecture: New Horizons Alan Stern (by Becky Smethurst)We were definitely spoilt with the first Plenary lecture at this years conference Alan Stern gave us a a review of the New Horizons mission of the Pluto Fly By (astrobites covered the mission back in July with this post). We were treated to beautiful images, wonderful results and a foray into geology.Before (Hubble) and after #NewHorizons. #thatisall #science #astro alanstern #aas227 pic.twitter.com/kkMt6RsSIR Science News (@topsciencething) January 5, 2016Some awesome facts from the lecture that blew my mind:New Horizons is now 2AU (!) beyond Pluto

  17. The Household Registration System

    2000-06-01

    Full Text Available Although longitudinal experimental community health research is crucial to testing hypotheses about the demographic impact of health technologies, longitudinal demographic research field stations are rare, owing to the complexity and high cost of developing requisite computer software systems. This paper describes the Household Registration System (HRS, a software package that has been used for the rapid development of eleven surveillance systems in sub-Saharan Africa and Asia. Features of the HRS automate software generation for a family of surveillance applications, obviating the need for new and complex computer software systems for each new longitudinal demographic study.

  18. Feedback on household electricity consumption

    Grønhøj, Alice; Thøgersen, John

    2011-01-01

    In this paper, we present results from a project aiming to develop a new feedback technology to support sustainable living in private households. Against the backdrop of a review of the relevant literature and based on qualitative family interviews and registration of the households' electricity...... consumption, we evaluate the effects of giving households detailed feedback about their electricity consumption on a small liquid crystal display (LCD) screen. Twenty Danish households participated in the study over a 5-month period. A new feedback system was developed in a user-involved innovation process....... The average electricity saving in participating households is estimated to 8.1%, compared with a 0.8% saving in the control group. The qualitative interviews revealed that the feedback made household electricity consumption more visible and salient, and empowered electricity consumers to take action...

  19. Survival strategies of Serbian households

    Babović Marija

    2002-01-01

    Full Text Available Concept of household strategies was firstly used in poverty surveys in Africa and Latin America, and lately developed in economic changes surveys in Western developed societies. Connecting the structure and action, macro and micro level of analysis and focusing on households, rather than individual as basic unit of analysis, the concept opened possibilities for better understanding of household economic behavior during social and economic changes. New developments concept experienced in numerous surveys in post-socialist as well as 'post-fordists' societies. The economic household strategies surveys were conducted in Serbia in two waves - in summer of 2000. and autumn of 2002. Comparative analysis of results has not show significant changes in socio-economic position of households. However, changes were evident in the field of action (economic strategies of households and individuals. Decreasing of passive and defensive strategies and increasing of pro-active, particularly working strategies were significant trends from survey.

  20. Alkaline Phosphatase in Stem Cells

    Kateřina Štefková

    2015-01-01

    Full Text Available Alkaline phosphatase is an enzyme commonly expressed in almost all living organisms. In humans and other mammals, determinations of the expression and activity of alkaline phosphatase have frequently been used for cell determination in developmental studies and/or within clinical trials. Alkaline phosphatase also seems to be one of the key markers in the identification of pluripotent embryonic stem as well as related cells. However, alkaline phosphatases exist in some isoenzymes and isoforms, which have tissue specific expressions and functions. Here, the role of alkaline phosphatase as a stem cell marker is discussed in detail. First, we briefly summarize contemporary knowledge of mammalian alkaline phosphatases in general. Second, we focus on the known facts of its role in and potential significance for the identification of stem cells.

  1. AAS 227: Day 3

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  2. The Multitasking of Household Production

    Kalenkoski, Charlene Marie; Foster, Gigi

    2010-01-01

    The standard household production model does not incorporate multitasking, although time-diary data reveal that individuals regularly multi-task. We formulate a model where time spent in child care can be sole-tasked or multitasked with other household production activities. This model implies associations between household productivity factors and both child outcomes and parental time use. We then use data from the Longitudinal Study of Australian Children and the Australian Time Use Surveys...

  3. Alkaline fuel cells applications

    Kordesch, Karl; Hacker, Viktor; Gsellmann, Josef; Cifrain, Martin; Faleschini, Gottfried; Enzinger, Peter; Fankhauser, Robert; Ortner, Markus; Muhr, Michael; Aronson, Robert R.

    On the world-wide automobile market technical developments are increasingly determined by the dramatic restriction on emissions as well as the regimentation of fuel consumption by legislation. Therefore there is an increasing chance of a completely new technology breakthrough if it offers new opportunities, meeting the requirements of resource preservation and emission restrictions. Fuel cell technology offers the possibility to excel in today's motive power techniques in terms of environmental compatibility, consumer's profit, costs of maintenance and efficiency. The key question is economy. This will be decided by the costs of fuel cell systems if they are to be used as power generators for future electric vehicles. The alkaline hydrogen-air fuel cell system with circulating KOH electrolyte and low-cost catalysed carbon electrodes could be a promising alternative. Based on the experiences of Kordesch [K. Kordesch, Brennstoffbatterien, Springer, Wien, 1984, ISBN 3-387-81819-7; K. Kordesch, City car with H 2-air fuel cell and lead-battery, SAE Paper No. 719015, 6th IECEC, 1971], who operated a city car hybrid vehicle on public roads for 3 years in the early 1970s, improved air electrodes plus new variations of the bipolar stack assembly developed in Graz are investigated. Primary fuel choice will be a major issue until such time as cost-effective, on-board hydrogen storage is developed. Ammonia is an interesting option. The whole system, ammonia dissociator plus alkaline fuel cell (AFC), is characterised by a simple design and high efficiency.

  4. AAS 228: Day 4

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  5. Characterization and function analysis of a Halo-alkaline-adaptable Trk K~+ uptake system in Alkalimonas amylolytica strain N10

    2009-01-01

    By functional complementation of Escherichia coli mutants defective in potassium (K+) uptake, two genes that are required for K+ uptake in halo-alkaliphilic Alkalimonas amylolytica strain N10 were cloned. These two genes, Aa-trkA (1337 bp) and Aa-trkH (1452 bp), were adjacent on the A. amylolytica N10 chromosome and transcribed in opposite directions. Complementation experiments revealed that Aa-TrkA and Aa-TrkH from A. amylolytica strain N10 restored the ability to grow at low K+ concentration in E. coli △trkA and △trkG △trkH strains, respectively. In addition, Aa-TrkAH supported the growth of an E. coli △sapD strain, indicating that the ATP-binding protein TrkE was dispensable for the Trk system of A. amylolytica strain N10. The net K+ uptake was detected at different pH levels and the critical NaCl concentration indicated that Aa-TrkAH is an alkaline-adaptable and partially halo-adaptable K+ transporter. Kinetics determined by heterogeneous K+ transport experiments with an E. coli △trkA strain revealed that Aa-TrkAH has an alkaline pH optimum close to 8.5 or higher. Site-directed mutagenesis of Aa-TrkH showed that Phe103 and Ser229 play certain key roles in K+ selection and transportation. The molecular chaperones groES-groEL and tig promoted Aa-TrkH and Aa-TrkA overexpression in vitro.

  6. Characterization and function analysis of a Halo-alkaline-adaptable Trk K~+ uptake system in Alkalimonas amylolytica strain N10

    GUO YongHao; XUE YanFen; LIU Jun; WANG QuanHui; MA YanHe

    2009-01-01

    By functional complementation of Escherichia coli mutants defective in potassium (K~+) uptake, two genes that are required for K~+ uptake in halo-alkaliphilic Alkalimonas amylolytica strain N10 were cloned. These two genes, Aa-trkA (1337 bp) and Aa-trkH (1452 bp), were adjacent on the A. amylolytica N10 chromosome and transcribed in opposite directions. Complementation experiments revealed that Aa-TrkA and Aa-TrkH from A. amylolytica strain N10 restored the ability to grow at low K~+ concentration in E. coli △trkA and △trkG △trkH strains, respectively. In addition, Aa-TrkAH supported the growth of an E. coli △sapD strain, indicating that the ATP-binding protein TrkE was dispensable for the Trk system of A. amylolytica strain N10. The net K~+ uptake was detected at different pH levels and the critical NaCl concentration indicated that Aa-TrkAH is an alkaline-adaptable and partially halo-adaptable K~+ transporter. Kinetics determined by heterogeneous K~+ transport experiments with an E. coli △trkA strain revealed that Aa-TrkAH has an alkaline pH optimum close to 8.5 or higher. Site-directed mutagenesis of Aa-TrkH showed that Phe103 and Ser229 play certain key roles in K~+ selection and transportation. The molecular chaperones groES-groEL and tig promoted Aa-TrkH and Aa-TrkA overexpression in vitro.

  7. The Drentsche Aa valley system

    This thesis is composed of five papers concerned with Late Quaternary geology and geomorphology of the Aa valley system. The correlation and chronostratigraphic position of the layers have been established by radiocarbon dating. (Auth.)

  8. AAS 227: Day 4

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  9. Bifunctional alkaline oxygen electrodes

    Swette, L.; Kackley, N.; Mccatty, S. A.

    1991-01-01

    The authors describe the identification and testing of electrocatalysts and supports for the positive electrode of moderate-temperature, single-unit, rechargeable alkaline fuel cells. Recent work on Na(x)Pt3O4, a potential bifunctional catalyst, is described, as well as the application of novel approaches to the development of more efficient bifunctional electrode structures. The three dual-character electrodes considered here showed similar superior performance; the Pt/RhO2 and Rh/RhO2 electrodes showed slightly better performance than the Pt/IrO2 electrode. It is concluded that Na(x)Pt3O4 continues to be a promising bifunctional oxygen electrode catalyst but requires further investigation and development.

  10. Silica in alkaline brines

    Jones, B.F.; Rettig, S.L.; Eugster, H.P.

    1967-01-01

    Analysis of sodium carbonate-bicarbonate brines from closed basins in volcanic terranes of Oregon and Kenya reveals silica contents of up to 2700 parts per million at pH's higher than 10. These high concentrations of SiO 2 can be attributed to reaction of waters with silicates, and subsequent evaporative concentration accompanied by a rise in pH. Supersaturation with respect to amorphous silica may occur and persist for brines that are out of contact with silicate muds and undersaturated with respect to trona; correlation of SiO2 with concentration of Na and total CO2 support this interpretation. Addition of moredilute waters to alkaline brines may lower the pH and cause inorganic precipitation of substantial amounts of silica.

  11. AAS 228: Day 4

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  12. Changing Age and Household Patterns

    Højbjerg Jacobsen, Rasmus; Hougaard Jensen, Svend E.

    2014-01-01

    , lone parents and cohabiting couples. Focusing on components of welfare services with noticeable differences in unit costs across age and household status, we find that changes in age structures have improved public finances by 1.6% of GDP whereas changing household structures have worsened public......This paper studies the effects on tax revenues and welfare expenditures in Denmark caused by changes in age and household structures over the years 1982-2007. During that period, there has been a minor fall in the old-age dependency ratio, and a major increase in the number of people living alone...... finances by almost 1% of GDP on the yearly budget. While the net fiscal effect of changing household structures is minor, the gross effects are substantial. In a future characterized by population ageing, public finances may be adversely affected by changes in both age and household structures, thus...

  13. AAS 227: Day 4

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  14. Household vehicles energy consumption 1994

    NONE

    1997-08-01

    Household Vehicles Energy Consumption 1994 reports on the results of the 1994 Residential Transportation Energy Consumption Survey (RTECS). The RTECS is a national sample survey that has been conducted every 3 years since 1985. For the 1994 survey, more than 3,000 households that own or use some 6,000 vehicles provided information to describe vehicle stock, vehicle-miles traveled, energy end-use consumption, and energy expenditures for personal vehicles. The survey results represent the characteristics of the 84.9 million households that used or had access to vehicles in 1994 nationwide. (An additional 12 million households neither owned or had access to vehicles during the survey year.) To be included in then RTECS survey, vehicles must be either owned or used by household members on a regular basis for personal transportation, or owned by a company rather than a household, but kept at home, regularly available for the use of household members. Most vehicles included in the RTECS are classified as {open_quotes}light-duty vehicles{close_quotes} (weighing less than 8,500 pounds). However, the RTECS also includes a very small number of {open_quotes}other{close_quotes} vehicles, such as motor homes and larger trucks that are available for personal use.

  15. Food discard practices of householders.

    Van Garde, S J; Woodburn, M J

    1987-03-01

    Food discard patterns and reasons were determined for a sample of 243 households in Oregon. Personal interviews were conducted, and 7-day records of discards were collected. Discards over a 3-day period also were collected from a subsample of 50. The householder's estimate of amount, converted from measures to grams using food composition tables, was found to be 97% of the actual grams of food, as weighed in the laboratory. Households discarded an average of 1,587 gm ($2.88) food in a 7-day period on the basis of the 79% completed usable records. Major reasons were poor quality for fruits and vegetables; storage time for meat, fish, and poultry; non-use of leftovers for combination dishes; and plate waste for cereals and dairy products. Twenty-nine percent of the discarded food (by cost) was considered to be unsafe to eat by the householder. Aesthetic factors dominated decisions by the 18- to 25-year age group, but experiences related to food storage were the basis for decisions by half of the respondents more than 65 years old. Discards increased with number of members in the household and were influenced by age of children. Household income was not linearly related to amount of discard. As household refrigerator temperatures increased from 1.7 degrees C to 20 degrees C, the amount of discards also increased. Consumers generally lacked criteria for evaluating the safety of foods. PMID:3819252

  16. Modulators of intestinal alkaline phosphatase.

    Bobkova, Ekaterina V; Kiffer-Moreira, Tina; Sergienko, Eduard A

    2013-01-01

    Small molecule modulators of phosphatases can lead to clinically useful drugs and serve as invaluable tools to study functional roles of various phosphatases in vivo. Here, we describe lead discovery strategies for identification of inhibitors and activators of intestinal alkaline phosphatases. To identify isozyme-selective inhibitors and activators of the human and mouse intestinal alkaline phosphatases, ultrahigh throughput chemiluminescent assays, utilizing CDP-Star as a substrate, were developed for murine intestinal alkaline phosphatase (mIAP), human intestinal alkaline phosphatase (hIAP), human placental alkaline phosphatase (PLAP), and human tissue-nonspecific alkaline phosphatase (TNAP) isozymes. Using these 1,536-well assays, concurrent HTS screens of the MLSMR library of 323,000 compounds were conducted for human and mouse IAP isozymes monitoring both inhibition and activation. This parallel screening approach led to identification of a novel inhibitory scaffold selective for murine intestinal alkaline phosphatase. SAR efforts based on parallel testing of analogs against different AP isozymes generated a potent inhibitor of the murine IAP with IC50 of 540 nM, at least 65-fold selectivity against human TNAP, and >185 selectivity against human PLAP. PMID:23860652

  17. Alkaline battery, separator therefore

    Schmidt, George F. (Inventor)

    1980-01-01

    An improved battery separator for alkaline battery cells has low resistance to electrolyte ion transfer and high resistance to electrode ion transfer. The separator is formed by applying an improved coating to an electrolyte absorber. The absorber, preferably, is a flexible, fibrous, and porous substrate that is resistant to strong alkali and oxidation. The coating composition includes an admixture of a polymeric binder, a hydrolyzable polymeric ester and inert fillers. The coating composition is substantially free of reactive fillers and plasticizers commonly employed as porosity promoting agents in separator coatings. When the separator is immersed in electrolyte, the polymeric ester of the film coating reacts with the electrolyte forming a salt and an alcohol. The alcohol goes into solution with the electrolyte while the salt imbibes electrolyte into the coating composition. When the salt is formed, it expands the polymeric chains of the binder to provide a film coating substantially permeable to electrolyte ion transfer but relatively impermeable to electrode ion transfer during use.

  18. Saving for Retirement: Household Bargaining and Household Net Worth

    Shelly J. Lundberg; Jennifer Ward-Batts

    2000-01-01

    Traditional economic models of savings treat the household as a single individual, and do not allow for the separate preferences of and possible conflicts of interest between husbands and wives. Since wives are typically younger than their husbands and life expectancy for women exceeds that for men, wives may prefer to save more for retirement than do their husbands. This suggests that households in which wives have greater relative bargaining power may accumulate greater net worth as they ap...

  19. Household vehicles energy consumption 1991

    1993-12-09

    The purpose of this report is to provide information on the use of energy in residential vehicles in the 50 States and the District of Columbia. Included are data about: the number and type of vehicles in the residential sector, the characteristics of those vehicles, the total annual Vehicle Miles Traveled (VMT), the per household and per vehicle VMT, the vehicle fuel consumption and expenditures, and vehicle fuel efficiencies. The data for this report are based on the household telephone interviews from the 1991 RTECS, conducted during 1991 and early 1992. The 1991 RTECS represents 94.6 million households, of which 84.6 million own or have access to 151.2 million household motor vehicles in the 50 States and the District of Columbia.

  20. Car use within the household

    de Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

    2013-01-01

    In this paper we study the demand for car kilometres in two-car households, focusing on the substitution between cars in response to fuel price changes. We use a large sample of detailed Danish data on two-car households to estimate—for each car owned by the household—own and cross-price effects...... of increases in fuel costs per kilometre. The empirical results show that failure to capture substitution between cars within the household can result in substantial misspecification biases. Ignoring substitution, we estimate fuel price elasticities of –0.81 and -0.65 for the primary and secondary cars...... efficient car, finding partial support for the underlying hypothesis. More importantly, the results of this extended model emphasize the importance of behavioural differences related to the position of the most fuel efficient car in the household, suggesting that households’ fuel efficiency choices...

  1. Marriage in Rural Philippine Households

    Evenson, Robert E.

    1994-01-01

    Utilizing intergenerational data from a sample of rural households in Laguna Province, this article tests the proposition that rural families are responsive to economic conditions as choices are made regarding children’s educational needs, their location and occupation choices.

  2. Household finances and social interaction

    Brown, S; Taylor, K.

    2012-01-01

    In this paper, we investigate the relationship between social interaction and household finances using data from the British Household Panel Survey. We explore how social interaction influences the probability of holding different types of unsecured debt and assets, as well as how social interaction influences the levels of unsecured debt, financial assets and net worth held. Our findings suggest that social interaction has a positive influence upon the types of financial assets held, which i...

  3. Households' Interest-bearing Assets

    Ellis Connolly; Fiona Fleming; Jarkko Jääskelä

    2012-01-01

    Households invest around two-fifths of their financial assets in interest-bearing assets. These assets are predominantly held directly in deposits and also via superannuation and other investment funds. Deposits have grown strongly in recent years, although there has been no growth in interest-bearing securities. Compared with other advanced economies, interest-bearing assets represent a relatively small share of financial assets. For the household sector as a whole, interest-bearing assets a...

  4. Simulating Household Waste Management Behaviours

    Peter Tucker; Andrew Smith

    1999-01-01

    The paper reports the outcome of research to demonstrate the proof of concept for simulating individual, collective and interactive household waste management behaviours to provide a tool for efficient integrated waste management planning. The developed model simulates whole communities as distributions of individual households engaged in managing their own domestic waste, through home composting or recycling activities. The research addresses the personal hierarchical ordering of these activ...

  5. Sale of electricity to households

    The Company Slovenske elektrarne (SE) Predaj has after two years of presence in the market expanded their business activities to the households segment. The first customers can be particularly employees of Slovenske elektrarne. This chance will be provided to them starting from 1 October of this year. 'The electricity supplies for households will only be supplementary segment of sales at SE Predaj Company. We will still focus mainly at businesses with higher consumption,' says director of the Company Mr. Stanislav Reguli. (author)

  6. Household Consumption and Personal Bankruptcy

    Ning Zhu

    2011-01-01

    This paper utilizes the population of personal bankruptcy filers in the state of Delaware during 2003 and finds that household expenditures on durable consumption goods, such as houses and automobiles, contribute significantly to personal bankruptcy filings. Medical conditions also lead to personal bankruptcy filings, but other adverse events, such as divorce and unemployment, have marginal effects. My findings suggest that consumption patterns make households financially overstretched and mo...

  7. Education, Preferences, and Household Welfare

    Fafchamps, Marcel; Shilpi, Forhad

    2011-01-01

    Using census data from Nepal, we examine how the marginal effects of male and female education on various household welfare indicators vary with education levels. Parental education is associated with better household outcomes, but marginal effects vary with education level. Higher child survival for instace, is associated with higher primary education for mothers and higher secondary education for fathers. We calculate conditional marginal effects that correct for assortative matching of ...

  8. Effects of pH and chloride concentration on pitting corrosion of AA6061 aluminum alloy

    Zaid, B. [Division de Technologie du Combustible, Departement de Metallurgie, Centre de Recherche Nucleaire de Draria, BP. 43 Seballa, Draria (Algeria)], E-mail: zaidbachir@yahoo.com; Saidi, D. [Division de Technologie du Combustible, Departement de Metallurgie, Centre de Recherche Nucleaire de Draria, BP. 43 Seballa, Draria (Algeria); Benzaid, A. [Divisionde Physique et Application Nucleaires, Departement Application Nucleaires, Centre de Recherche Nucleaire de Draria, BP. 43 Seballa, Draria (Algeria); Hadji, S. [Division de Technologie du Combustible, Departement du combustible, Centre de Recherche Nucleaire de Draria, BP. 43 Seballa, Draria (Algeria)

    2008-07-15

    Effects of pH solution and chloride (Cl{sup -}) ion concentration on the corrosion behaviour of alloy AA6061 immersed in aqueous solutions of NaCl have been investigated using measurements of weight loss, potentiodynamic polarisation, linear polarisation, cyclic polarisation experiment combined with open circuit potential transient technique and optical or scanning electron microscopy. The corrosion behaviour of the AA6061 aluminum alloy was found to be dependant on the pH and chloride concentration [NaCl] of solution. In acidic or slightly neutral solutions, general and pitting corrosion occurred simultaneously. In contrast, exposure to alkaline solutions results in general corrosion. Experience revealed that the alloy AA6061 was susceptible to pitting corrosion in all chloride solution of concentration ranging between 0.003 wt% and 5.5 wt% NaCl and an increase in the chloride concentration slightly shifted both the pitting E{sub pit} and corrosion E{sub cor} potentials to more active values. In function of the conditions of treatment, the sheets of the alloy AA6061 undergo two types of localised corrosion process, leading to the formation of hemispherical and crystallographic pits. Polarisation resistance measurements in acidic (pH = 2) and alkaline chloride solutions (pH = 12) which are in good agreement with those of weight loss, show that the corrosion kinetic is minimised in slightly neutral solutions (pH = 6)

  9. The alkaline and alkaline-carbonatite magmatism from Southern Brazil

    Ruberti, E.; Gomes, C. D. B.; Comin-Chiaramonti, P.

    2015-12-01

    Early to Late Cretaceous lasting to Paleocene alkaline magmatism from southern Brazil is found associated with major extensional structural features in and around the Paraná Basin and grouped into various provinces on the basis of several data. Magmatism is variable in size, mode of occurrence and composition. The alkaline rocks are dominantly potassic, a few occurrences showing sodic affinity. The more abundant silicate rocks are evolved undersaturated to saturated in silica syenites, displaying large variation in igneous forms. Less evolved types are restricted to subvolcanic environments and outcrops of effusive suites occur rarely. Cumulatic mafic and ultramafic rock types are very common, particularly in the alkali-carbonatitic complexes. Carbonatite bodies are represented by Ca-carbonatites and Mg-carbonatites and more scarcely by Fe-carbonatites. Available radiometric ages for the alkaline rocks fit on three main chronological groups: around 130 Ma, subcoveal with the Early Cretaceous flood tholeiites of the Paraná Basin, 100-110 Ma and 80-90 Ma (Late Cretaceous). The alkaline magmatism also extends into Paleocene times, as indicated by ages from some volcanic lavas. Geochemically, alkaline potassic and sodic rock types are distinguished by their negative and positive Nb-Ta anomalies, respectively. Negative spikes in Nb-Ta are also a feature common to the associated tholeiitic rocks. Sr-Nd-Pb systematics confirm the contribution of both HIMU and EMI mantle components in the formation of the alkaline rocks. Notably, Early and Late Cretaceous carbonatites have the same isotopic Sr-Nd initial ratios of the associated alkaline rocks. C-O isotopic Sr-Nd isotopic ratios indicate typical mantle signature for some carbonatites and the influence of post-magmatic processes in others. Immiscibility of liquids of phonolitic composition, derived from mafic alkaline parental magmas, has been responsible for the origin of the carbonatites. Close association of alkaline

  10. Is amyloid A (AA) amyloidosis always secondary?

    Maury, C P; Törnroth, T; Wegelius, O

    1985-01-01

    The case is reported of a patient with systemic AA amyloidosis associated with non-specific mesenteric lymphadenitis and chronic sideropenia. Renal, small bowel, and rectal biopsies showed amyloid deposits containing AA protein, as defined by potassium permanganate sensitivity and by reactivity with AA antiserum. Reversal of the nephrotic syndrome occurred during steroid-azathioprine therapy.

  11. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor

    Pérez, Claudia; Fernandez, Luisa E.; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S.; Soberón, Mario; Bravo, Alejandra

    2005-01-01

    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa bind...

  12. Alkaline protease from Thermoactinomyces sp. RS1 mitigates industrial pollution.

    Verma, Amit; Ansari, Mohammad W; Anwar, Mohmmad S; Agrawal, Ruchi; Agrawal, Sanjeev

    2014-05-01

    Proteases have found a wide application in the several industrial processes, such as laundry detergents, protein recovery or solubilization, prion degradation, meat tenderizations, and in bating of hides and skins in leather industries. But the main hurdle in industrial application of proteases is their economical production on a large scale. The present investigation aimed to exploit the locally available inexpensive agricultural and household wastes for alkaline protease production using Thermoactinomyces sp. RS1 via solid-state fermentation (SSF) technique. The alkaline enzyme is potentially useful as an additive in commercial detergents to mitigate pollution load due to extensive use of caustic soda-based detergents. Thermoactinomyces sp. RS1 showed good protease production under SSF conditions of 55 °C, pH 9, and 50 % moisture content with potato peels as solid substrate. The presented findings revealed that crude alkaline protease produced by Thermoactinomyces sp. RS1 via SSF is of potential application in silver recovery from used X-ray films. PMID:24122212

  13. Have Labour Market Outcomes Affected Household Structure in South Africa? A Descriptive Analysis of Households

    Farah Pirouz

    2005-01-01

    This paper seeks to investigate how the demography of households relates to individual labour market outcomes. We comprehensively examine household size and structures in the October Household Surveys 1995, 1997, 1999 and the Labour Force Surveys September 2001 and 2002. Over the 1995-2002 period, the number of households has increased in the face of rising unemployment and the average household size has decreased signifi cantly. A rising proportion of single households mostly drives this res...

  14. Determinants of Soviet Household Income

    by Kenneth Smith

    2007-06-01

    Full Text Available World Values Survey data are used to examine household income in the Soviet Union. The data, gathered Summer/Fall 1990, provide a rare opportunity to empirically examine microeconomic factors influencing a Soviet household’s position in the regional/national income distribution. The survey contains data - collected regionally - from the three Baltic republics, Belarus, and the Moscow region. The data indicate certain patterns that existed and determined Soviet household income though there are often considerable regional variations. Further, there are marked differences between income distribution determinants in the Soviet Union and the U.S. and West Germany though similarities exist as well

  15. Households' Appetite for Financial Risk

    Susan Black; Lamorna Rogers; Albina Soultanaeva

    2012-01-01

    Australian households’ appetite for risk appears to have declined in recent years with households having actively shifted their portfolios away from riskier financial assets. The change in the composition of financial assets has been seen across most age and income groups. The shift in households’ actual risk exposures also accords with changes in self-reported preferences for risk.

  16. Burning Issue: Handling Household Burns

    ... take steps to avoid household burns. Never leave cooking food unattended on the stove. Set your water heater’s thermostat to 120 °F or lower to prevent scalding burns. And install smoke alarms on every floor of your home. Keep yourself and your family safe from unexpected ...

  17. Inflation differentials among Czech households

    Janský, Petr; Hait, Pavel

    2016-01-01

    Roč. 25, č. 1 (2016), s. 71-84. ISSN 1210-0455 R&D Projects: GA TA ČR(CZ) TD020188 Institutional support: RVO:67985998 Keywords : households * inflation * inflation differentials Subject RIV: AH - Economics Impact factor: 0.500, year: 2014

  18. Households' recycling efforts

    Bruvoll, Annegrete; Halvorsen, Bente [Research Department, Statistics Norway, 8131 Dep, N-0033 Oslo (Norway); Nyborg, Karine [The Ragnar Frisch Centre of Economic Research, Gaustadalleen 21, N-0349 Oslo (Norway)

    2002-11-01

    Households' recycling effort is often argued to be of an insignificant size. It is also frequently argued that this contribution, if significant, is not a cost to households, since it is voluntary. Thus households' use of time and energy are frequently disregarded in cost-benefit analyses of stricter recycling targets. In this survey, based on 1162 interviews, we find that sorting at source involves significant extra use of time and energy in the households. On average, each of those asked reported that they use close to half an hour a week for cleaning, sorting and transporting recyclable waste. On average, 185 h is used per tonne of waste. Four out of ten reported that they use warm or hot water to clean the materials. When investigating the motives for sorting waste, we find that many perceive sorting as mandatory, while some in fact find it a pleasant activity in itself. Moral motives for sorting at source are also widespread. A majority would prefer that a company took over the sorting if this were possible, and on average, the respondents are willing to pay US$ 20/year for this service.

  19. 2nd Generation Alkaline Electrolysis

    Yde, Lars; Kjartansdóttir, Cecilia Kristin; Allebrod, Frank; Mogensen, Mogens Bjerg; Møller, Per; Hilbert, Lisbeth R.; Nielsen, Peter Tommy; Mathiesen, Troels; Jensen, Jørgen; Andersen, Lars; Dierking, Alexander

    This report provides the results of the 2nd Generation Alkaline Electrolysis project which was initiated in 2008. The project has been conducted from 2009-2012 by a consortium comprising Århus University Business and Social Science – Centre for Energy Technologies (CET (former HIRC)), Technical...

  20. Laboratory Astrophysics Division of the AAS (LAD)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-01-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  1. A Picture of Subsidized Households 2009

    Department of Housing and Urban Development — Picture of Subsidized Households describes the nearly 5 million households living in HUD-subsidized housing in the United States for the year 2009. Picture 2009...

  2. Household Credit and Saving: Does Policy Matter?

    Peter Lawrence

    2002-01-01

    This paper surveys the existing literature on the determinants of household savings and credit in developing countries and examines the ways in which macro-level policies might impact on household financial behaviour.

  3. Household Safety: Preventing Poisoning (For Parents)

    ... spend a lot of time there). continue Cleaning Products and Other Household Chemicals Never put cleaning products in old soda ... poison on the floors of your home. Store household cleaning products and aerosol sprays in a high cabinet far ...

  4. Recent Refrigeration Cycle Technologies for Household Refrigerators

    Nagatomo, Shigemi

    The household refrigerator is one of the most important and the biggest energy-consuming home appliances. This paper summarize recent refrigeration cycle developments in the field of domestic household refrigerators based on a survey of publications.

  5. Households borrowing during a creditless recovery

    Jaanika Meriküll

    2012-01-01

    This paper investigates the contribution of households to the creditless recovery. We use Estonian cross-sectional microdata on households' assets, liabilities, income, expectations and intention to use credit in 2001-2010. The results indicate that (1) there was a large-scale drop in households demand for credit during the recession and sluggish recovery after the recession. (2) One third of the sluggish recovery in credit demand is explained by changed household endowments such as income re...

  6. Household Food Demand in Rural China

    Davis, John

    2008-01-01

    Abstract This paper explores rural household food consumption behaviour in China using a large household data set from Jilin Province. Data are classified into four main food groups?grain, vegetable products, animal products and other foods. A household food demand system, incorporating four household characteristics, is estimated using an LA-AIDS model, assuming a three-stage budgeting procedure. Expenditure elasticities for a range of food groups are estimated, with a particular...

  7. Household Willingness to Pay for Organic Products

    Griffith, Rachel; Nesheim, Lars

    2008-01-01

    We use hedonic prices and purchase quantities to consider what can be learned about household willingness to pay for baskets of organic products and how this varies across households. We use rich scanner data on food purchases by a large number of households to compute household specific lower and upper bounds on willingness to pay for various baskets of organic products. These bounds provide information about willingness to pay for organic without imposing restrictive assumptions on preferen...

  8. Household Behavior and the Marriage Market

    Del Boca, Daniela; Flinn, Christopher

    2012-01-01

    There is some controversy in the field of household economics regarding the efficiency of household decisions. We make the point that a flexible specification of spousal preferences and the household production technology precludes the possibility of using revealed preference data on household time allocations to determine the manner in which spouses interact: efficiently or inefficiently. Under strong, but standard, assumptions regarding marriage market equilibria, marital sorting patterns c...

  9. Household formation and the great recession

    Timothy Dunne

    2012-01-01

    During the Great Recession, the rate at which Americans formed households fell sharply. Though the rate has recently picked up, it isn’t fast enough to make up for the shortfall in household formation that occurred over the last several years. An analysis of recent household formation patterns shows that the greatest shortfall occurred among young adults and that it is related to weak economic conditions. Housing choices have shifted as well, with a greater proportion of young households livi...

  10. Intergenerational Developments in Household Saving Behaviour

    Mark Vink

    2014-01-01

    This paper examines the saving behaviour of different generations of households in New Zealand over the period 1984 to 2010 using data from the Household Economic Survey. The paper employs a life-cycle framework to estimate regression models that identify the influence of age and birth year on household saving rates. Consistent with the life-cycle hypothesis, the results show that household saving rates exhibit a hump shape over the life cycle. The results also indicate significant difference...

  11. Remittances, household expenditure and investment in Guatemala

    Adams, Richard H. Jr.

    2005-01-01

    The author uses a large household data set from Guatemala to analyze how the receipt of internal remittances (from Guatemala) and international remittances (from the United States) affects the marginal spending behavior of households on various consumption and investment goods. Contrary to other studies, the author finds that households receiving remittances actually spend less at the margin on consumption-food and consumer goods and durables-than do households receiving no remittances. Inste...

  12. Characterization of household food waste in Denmark

    Edjabou, Vincent Maklawe Essonanawe; Petersen, C.; Scheutz, Charlotte;

    This paper presents a methodology and the results of compositional analysis of food waste from Danish families living in single-family houses. Residual household waste was sampled and manually sorted from 211 single-family houses in the suburb of Copenhagen. The main fractions contributing to the...... household food waste were avoidable vegetable food waste and non-avoidable vegetable food waste. Statistical analysis found a positive linear relationship between household size and the amount of the household food waste....

  13. ASSESSMENT OF HOUSEHOLD CARBON FOOTPRINT REDUCTION POTENTIALS

    Masanet, Eric

    2010-01-01

    The term ?household carbon footprint? refers to the total annual carbon emissions associated with household consumption of energy, goods, and services. In this project, Lawrence Berkeley National Laboratory developed a carbon footprint modeling framework that characterizes the key underlying technologies and processes that contribute to household carbon footprints in California and the United States. The approach breaks down the carbon footprint by 35 different household fuel end uses and 3...

  14. ICT and Household-Firm Relations

    Lindbeck, Assar; Wikström, Solveig

    1999-01-01

    This paper discusses how ICT and emerging electronic commerce in consumer products influence the relative efficiency in production of households and firms, resulting in changes in the division of tasks between these two types of agents. Increased information and competence of households, in combination with stiffer competition among firms, will also increase the power of households relative to firms, at least in a long-term perspective with free entry of firms. Households will also get more p...

  15. Does Reducing Malaria Improve Household Living Standards?

    Laxminarayan, Ramanan

    2003-01-01

    Living in malaria-endemic regions places an economic burden on households even if they do not actually suffer an episode of malaria. Households living with endemic malaria are less likely to have access to economic opportunities and may have to modify agricultural practices and other household behavior to adapt to their disease environment. Data from Vietnam demonstrate that reductions in malaria incidence through government-financed malaria control programs can contribute to higher household...

  16. Household energy and consumption and expenditures, 1990

    The purpose of this supplement to the Household Energy Consumption and Expenditures 1990 report is to provide information on the use of energy in residential housing units, specifically at the four Census regions and nine Census division levels. This report includes household energy consumption, expenditures, and prices for natural gas, electricity, fuel oil, liquefied petroleum gas (LPG), and kerosene as well as household wood consumption. For national-level data, see the main report, Household Energy Consumption and Expenditures 1990

  17. EXPLAINING RURAL HOUSEHOLD PARTICIPATION IN RECYCLING

    Jakus, Paul M.; Tiller, Kelly; Park, William M., 1952-

    1997-01-01

    Rising landfill costs have forced solid waste managers to consider waste stream reduction alternatives such as household recycling. Explaining the factors which motivate households to recycle is important to regions where households must bear a large portion of the recycling cost because unit-based garbage disposal fees and curbside recycling are not feasible options. Empirical results indicate that residents are responsive to constraints introduced by the household production technology, suc...

  18. Financial fragility of euro area households

    Ampudia, Miguel; van Vlokhoven, Has; Żochowski, Dawid

    2014-01-01

    We propose a novel framework to identify distressed households by taking account of both the solvency and the liquidity situation of an individual household. Using the data from the Household Finance and Consumption Survey and the country-level data on non-performing loans we calibrate our metric of distress and estimate stress-test elasticities in response to an interest rate shock, an income shock and a house price shock. We find that, albeit euro area households are relatively resilient as...

  19. Household Consumption, Investment and Life Insurance

    Bruhn, Kenneth; Steffensen, Mogens

    2011-01-01

    This paper develops a continuous-time Markov model for utility optimization of households. The household optimizes expected future utility from consumption by controlling consumption, investments and purchase of lifeinsurance for each person in the household. The optimal controls are investigated...

  20. Spending time and money within the household

    Browning, Martin; Gørtz, Mette

    We consider theoretically and empirically the allocation of time and money within the household. The novelty of our empirical work is that we have a survey which provides information on both time use and the allocation of some goods within the household, for the same households. We can consider...

  1. Division of household tasks and financial management

    Antonides, G.

    2011-01-01

    Both the standard economic model and bargaining theory make predictions about financial management and the division of household labor between household partners. Using a large Internet survey, we have tested several predictions about task divisions reported by Dutch household partners. The division

  2. AA, closed orbit observation pickup

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. Werner Sax contemplates his achievement. See also 8001383, 8010042, 8010045.

  3. AA, closed orbit observation pickup

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles QFW, at maximum dispersion. See also 8001372, 8001383, 8010045

  4. AA, closed orbit observation pickup

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. See also 8001372, 8010042, 8010045

  5. AA, closed orbit observation pickup

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles, QFW, at maximum dispersion. See also 8001372,8001383, 8010042

  6. Development of alkaline fuel cells.

    Hibbs, Michael R.; Jenkins, Janelle E.; Alam, Todd Michael; Janarthanan, Rajeswari [Colorado School of Mines, Golden, CO; Horan, James L. [Colorado School of Mines, Golden, CO; Caire, Benjamin R. [Colorado School of Mines, Golden, CO; Ziegler, Zachary C. [Colorado School of Mines, Golden, CO; Herring, Andrew M. [Colorado School of Mines, Golden, CO; Yang, Yuan [Colorado School of Mines, Golden, CO; Zuo, Xiaobing [Argonne National Laboratory, Argonne, IL; Robson, Michael H. [University of New Mexico, Albuquerque, NM; Artyushkova, Kateryna [University of New Mexico, Albuquerque, NM; Patterson, Wendy [University of New Mexico, Albuquerque, NM; Atanassov, Plamen Borissov [University of New Mexico, Albuquerque, NM

    2013-09-01

    This project focuses on the development and demonstration of anion exchange membrane (AEM) fuel cells for portable power applications. Novel polymeric anion exchange membranes and ionomers with high chemical stabilities were prepared characterized by researchers at Sandia National Laboratories. Durable, non-precious metal catalysts were prepared by Dr. Plamen Atanassov's research group at the University of New Mexico by utilizing an aerosol-based process to prepare templated nano-structures. Dr. Andy Herring's group at the Colorado School of Mines combined all of these materials to fabricate and test membrane electrode assemblies for single cell testing in a methanol-fueled alkaline system. The highest power density achieved in this study was 54 mW/cm2 which was 90% of the project target and the highest reported power density for a direct methanol alkaline fuel cell.

  7. Regional gross disposable household income

    Eddie Holmes

    2008-01-01

    Presents estimates published in May 2008, an overview of methodology used and future plans for regional economic dataThis article looks at estimates for regional gross disposable household income (GDHI) at current basic prices, published in May 2008. These data are published using the European Union Nomenclature of Units for Territorial Statistics (NUTS) regions. Data are published for the NUTS1, NUTS2 and NUTS3 levels for the period 1995 to 2006. There is an overview of the methodology used ...

  8. Households credits and financial stability

    Cécile Bastidon

    2014-01-01

    This paper develops a theoretical model of financial intermediation with three original features: first, consideration of all sectors within total outstanding credits, including households; second, the possibility of a non monotic relationship between prices and funding supply volumes in periods of high financial strains; last, the link between interbank credit rationing and other sectors funding rationing. The central bank conducts an unconventional type monetary policy. We show that the int...

  9. Household income, poverty and wealth

    Hauser, Richard

    2009-01-01

    "This paper concentrates on official statistics on household income, poverty, and wealth. It characterizes the main research questions in this field, and it presents an overview of the available statistics and Scientific Use Files produced by the four Research Data Centers (RDC) in Germany. (RDC of the Federal Statistical Office; RDC of the Statistical Offices of the German states; RDC of the German Labor Office; RCD of the German Pension Insurance). We support the recommendations of a peer r...

  10. Smart Energy Management for Households

    Sonja van Dam

    2013-01-01

    The aim of the research presented in this thesis was to infer design-related insights and guidelines to improve the use and effectiveness of home energy management systems (HEMS). This was done through an empirical evaluation of the longitudinal effectiveness of these devices and an exploration of factors that influence their use and effectiveness. Three case studies executed with three different HEMS in households, a life cycle assessment (LCA) on those three HEMS, as well as a reflection on...

  11. Household Poverty Dynamics in Malawi

    Bokosi, Fanwell Kenala

    2006-01-01

    This paper’s goal is to identify the sources of expenditure and poverty dynamics among Malawian households between 1998 and 2002 and to model poverty transitions in Malawi using a bivariate probit model with endogenous selection to address the "initial conditions' problem. The exogeneity of the initial state is strongly rejected and could result in considerable overstatement of the effects of the explanatory factors. The results of the bivariate probit model do indicate that education of th...

  12. Householder triangularization of a quasimatrix

    Trefethen, Lloyd N.

    2008-01-01

    A standard algorithm for computing the QR factorization of a matrix A is Householder triangularization. Here this idea is generalized to the situation in which A is a quasimatrix, that is, a “matrix” whose “columns” are functions defined on an interval [a,b]. Applications are mentioned to quasimatrix leastsquares fitting, singular value decomposition, and determination of ranks, norms, and condition numbers, and numerical illustrations are presented using the chebfun system.

  13. Inconsistent pathways of household waste

    The aim of this study was to provide policy-makers and waste management planners with information about how recycling programs affect the quantities of specific materials recycled and disposed of. Two questions were addressed: which factors influence household waste generation and pathways? and how reliable are official waste data? Household waste flows were studied in 35 Swedish municipalities, and a wide variation in the amount of waste per capita was observed. When evaluating the effect of different waste collection policies, it was found to be important to identify site-specific factors influencing waste generation. Eleven municipal variables were investigated in an attempt to explain the variation. The amount of household waste per resident was higher in populous municipalities and when net commuting was positive. Property-close collection of dry recyclables led to increased delivery of sorted metal, plastic and paper packaging. No difference was seen in the amount of separated recyclables per capita when weight-based billing for the collection of residual waste was applied, but the amount of residual waste was lower. Sixteen sources of error in official waste statistics were identified and the results of the study emphasize the importance of reliable waste generation and composition data to underpin waste management policies.

  14. Cloning of an alkaline lipase gene from Penicillium cyclopium and its expression in Escherichia coli.

    Wu, Minchen; Qian, Zhikang; Jiang, Peihong; Min, Taishan; Sun, Chongrong; Huang, Weida

    2003-03-01

    The gene encoding an alkaline lipase of Penicillium cyclopium PG37 was cloned with four steps of PCR amplification based on different principles. The cloned gene was 1,480 nucleotides in length, consisted of 94 bp of promoter region, and had 6 exons and 5 short introns ranging from 50 to 70 nucleotides. The open reading frame encoded a protein of 285 amino acid residues consisting of a 27-AA signal peptide and a 258-AA mature peptide, with a conserved motif of Gly-X-Ser-X-Gly shared by all types of alkaline lipases. However, this protein had a low homology with lipases of P. camembertii (22.9%), Humicola lanuginosa (25.6%), and Rhizomucor miehei (22.3%) at the amino acid level. The mature peptide-encoding cDNA was cloned and expressed in Escherichia coli on pET-30a for confirmation. A distinct band with a M.W. of 33 kDa was detected on SDS-PAGE. Results of a Western blot analysis and an enzyme activity assay verified the recombinant 33-kDa protein as an alkaline lipase. Its catalytic properties were not changed when compared with its natural counterpart. PMID:12784858

  15. AAS 228: Day 3 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  16. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor.

    Pérez, Claudia; Fernandez, Luisa E; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S; Soberón, Mario; Bravo, Alejandra

    2005-12-20

    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa binding to Aedes aegypti brush border membrane vesicles enhanced the binding of biotinylated-Cry11Aa. The Cyt1Aa- and Cry11Aa-binding epitopes were mapped by means of the yeast two-hybrid system, peptide arrays, and heterologous competition assays with synthetic peptides. Two exposed regions in Cyt1Aa, loop beta6-alphaE and part of beta7, bind Cry11Aa. On the other side, Cry11Aa binds Cyt1Aa proteins by means of domain II-loop alpha8 and beta-4, which are also involved in midgut receptor interaction. Characterization of single-point mutations in Cry11Aa and Cyt1Aa revealed key Cry11Aa (S259 and E266) and Cyt1Aa (K198, E204 and K225) residues involved in the interaction of both proteins and in synergism. Additionally, a Cyt1Aa loop beta6-alphaE mutant (K198A) with enhanced synergism to Cry11Aa was isolated. Data provided here strongly indicates that Cyt1Aa synergizes or suppresses resistance to Cry11Aa toxin by functioning as a membrane-bound receptor. Bacillus thuringiensis subsp. israelensis is a highly effective pathogenic bacterium because it produces a toxin and also its functional receptor, promoting toxin binding to the target membrane and causing toxicity. PMID:16339907

  17. AAS 228: Day 3 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  18. Lamination sheet of AA BST magnet

    1979-01-01

    The AA had 2 types of bending magnets: BLG (window-frame, long and narrow)and BST (H-type, short and wide). The BST had a very wide aperture, 0.564 m of "good field". To demonstrate the size, the petite AA secretary, Val Mansfield, poses with a lamination sheet. See also 7811105, 7906163, 8006050.

  19. The householders' guide to radon

    This guide is a follow-up to the leaflet Radon in Houses which was issued previously by the Department of the Environment. It is intended for people who live in areas with high levels of radon. It is written particularly for householders whose homes have already been tested and found to have an appreciable level of radon. It explains what radon is, how it gets into houses and what the effects on health may be. It also outlines some of the ways of reducing the level of radon and gives guidance both on how to get the work done and likely costs. (author)

  20. Financial planning for young households

    Pedersen, Anne Marie Boiden; Weissensteiner, Alex; Poulsen, Rolf

    2013-01-01

    uncertainty is described by a scenario tree generated from a vector auto-regressive process for equity returns and interest rate evolution. We find strong evidence of the importance of taking into account the multi-stage nature of the problem, as well as the need to consider the asset and liability sides......We analyze the financial planning problems of young households whose main decisions are how to finance the purchase of a house (liabilities) and how to allocate investments in pension savings schemes (assets). The problems are solved using a multi-stage stochastic programming model where the...

  1. Households in the smart grid

    Christensen, Toke Haunstrup; Friis, Freja; Gram-Hanssen, Kirsten

    It is a widespread assumption within the energy sector that the “smart grid” will be a crucial element of a future low-carbon energy system, and households are assigned an important role in this (particularly in relation to balancing consumption and production). However, this raises questions about...... the integration of consumers’ everyday life practices in this system. This paper introduces the ideas of the smart grid and review relevant demonstration projects. Special focus is on the role of consumers and electric vehicles. The paper ends with introducing major research questions and presents a new research...

  2. Alkaline fuel cell performance investigation

    Martin, R. E.; Manzo, M. A.

    1988-01-01

    An exploratory experimental fuel cell test program was conducted to investigate the performance characteristics of alkaline laboratory research electrodes. The objective of this work was to establish the effect of temperature, pressure, and concentration upon performance and evaluate candidate cathode configurations having the potential for improved performance. The performance characterization tests provided data to empirically establish the effect of temperature, pressure, and concentration upon performance for cell temperatures up to 300 F and reactant pressures up to 200 psia. Evaluation of five gold alloy cathode catalysts revealed that three doped gold alloys had more that two times the surface areas of reference cathodes and therefore offered the best potential for improved performance.

  3. Development of electrochemical biosensor based on the immobilisation of alkaline fosfatase for the determination of 2,4-dichlorophenoxyacetic acid

    An electrochemical biosensor based on the immobilisation of alkaline phosphatase was developed for the determination of 2,4-dichlorophenoxyacetic acid (2,4-D). The biosensor was constructed from the immobilization of alkaline phosphatase enzyme onto a screen-printed electrode (SPE). The ascorbic acid 2-phosphate (AA2P) was used as substrate for the enzymic reaction. The enzyme was entrapped in a hybrid sol-gel/ chitosan material with certain fixed composition. The determination of toxicity of 2,4-D pesticides quantitatively and qualitatively could be carried out by the inhibition of the alkaline phosphatase. A potential of +600 mV was suitable to be used for the oxidation of the products from the enzyme-substrate reaction, where the reaction pH was at 8.5. The linear response range of the biosensor to the AA2P substrates was 10 μM - 80 μM. The inhibition of the alkaline phosphatase enzyme of the 2,4-D biosensor was maximum at 80 ppm 2,4-D (50 % inhibition). (author)

  4. Excessive household debt: causes, trends and consequences

    Péter Bauer; Mariann Endrész; Regina Kiss; Zsolt Kovalszky; Ádám Martonosi; Olivér Rácz; István Schindler

    2013-01-01

    The decade preceding the 2008 recession was marked by a rapid rise in household debt in several regions. Strong household lending prior to the recession boosted economic growth in the affected countries, but indebtedness then became one of the main sources of vulnerability of these countries with the onset of the economic crisis. Economies that saw a rapid rise in household debt were characterised by a stronger drop in domestic demand and a longer-than-average recovery time. This analysis foc...

  5. Education Financing of Rural Households in China

    Wang, Hua-shu; Moll, Henk

    2010-01-01

    The purpose of this paper was to examine children’s education financing alternatives among households in rural China. Data on education financing was from a household survey conducted in three poverty villages in Guizhou, China. The difference in financing education by households was verified through non-parametric testing. Findings show that private savings is dominant in financing education of children in school. Formal loans are almost absent even in the highest wealth group examined. The ...

  6. Spending time and money within the household

    Martin BROWNING; Gørtz, Metter

    2006-01-01

    We consider, both theoretically and empirically, the allocation of time and money within the household. The research question is whether a married person who enjoys more leisure than their partner also receives more consumption (which seems to indicate the outcome of power within the household) or receives less consumption (which seems to indicate differing intrahousehold preferences). We develop a simple parametric structural model with household production that is tested on survey data. We ...

  7. Demographics of South African Households - 1995

    Rantho, Lillian

    2003-01-01

    This paper provides an overview of the demographics of the South African population based on the October Household Survey (OHS) and the Income and Expenditure Survey (IES), both conducted by Statistics South Africa in 1995. Figures and tables are used throughout to paint a picture of the structure of the South African population, both at household level (IES data) and individual level (OHS data). Specific reference is made to the racial and spatial composition of households and individuals, t...

  8. Carbon Dioxide, Energy Taxes and Household Income

    Cathal O'Donoghue

    1997-01-01

    This paper examines the impact of a carbon tax on the income distribution in Ireland using the 1987 Household Budget Survey. Previous studies have focused on the direct impact of the carbon tax on expenditures on domestic fuels. This study however, drawing on previous work expands the analysis to cover the indirect impact of carbon taxes on other household purchases> A direct and indirect tax would have a less regressive effect on the income distribution than a simple direct tax on household ...

  9. Impact of Weather Shocks on MENA Households

    Wodon, Quentin; Liverani, Andrea

    2014-01-01

    Do households living in climate affected areas in the MENA region believe that changes in climate patterns and their environment are taking place? Have households been affected by extreme weather events, and if so to what extent and which events have had the largest impact? What are the coping strategies that households declare having used, or could be using to cope with climate change and...

  10. Factor Shares from Household Survey Data

    Rodrigo García Verdú

    2005-01-01

    This paper proposes a method for estimating the factor shares of labor and capital using cross sectional household survey data containing detailed information on household income by source. It then applies the method to the case of Mexico, a country where factor shares are almost the opposite of those in the United States. The application of this method using data from every available household survey that is representative at the national level, corresponding to the years 1968, 1977, 1984, 1...

  11. GENERATION OF RECYCLABLES BY RURAL HOUSEHOLDS

    Jakus, Paul M.; Tiller, Kelly; Park, William M.

    1996-01-01

    Rising landfill costs have forced solid waste managers to consider ways to reduce the waste stream. Using survey data, models explaining the weight of recyclables generated by households are estimated for paper and glass. Results indicate that households respond to the time cost of recycling paper but not glass. The waste generation models imply total monthly willingness to pay for recycling is $5.78 per household. Waste managers may increase the weight of recycled waste stream with programs ...

  12. The Impact of Superannuation on Household Saving

    Ellis Connolly; Marion Kohler

    2004-01-01

    Over the last 20 years superannuation has grown to be the second largest component of household wealth in Australia after ownership of dwellings. This paper analyses the impact on household saving behaviour of the substantial rise in compulsory contributions to superannuation funds. Our analysis takes account of other macroeconomic developments that are likely to have had a strong influence on the household saving rate over this period, especially the financial deregulation of the 1980s and t...

  13. Household Demand for Broadband Internet in 2010

    Rosston Gregory L.; Savage Scott J; Waldman Donald M.

    2010-01-01

    This paper uses data from a nationwide survey administered during late 2009 and early 2010 to estimate a random utility model of household preferences for broadband Internet service. Reliability and speed are important service characteristics: the representative household is willing to pay $20 per month for more reliable service; $45 for an improvement in speed from slow to fast; and $48 for an improvement in speed from slow to very fast. A representative household would be willing to pay $79...

  14. Financial Satisfaction from Intra-Household Perspectives

    Namkee Ahn; Victoria Ateca; Arantza Ugidos

    2007-01-01

    We address individuals’ financial satisfaction from the intra-household perspective. Our purpose is twofold. First, we want to contrast the hypothesis of relative income within the household. Does the income level of one individual relative to that of other members of the same household matter in his/her income satisfaction? Second, we want to test procedural utility hypothesis in that different sources of income may contribute differentially to individuals’ income satisfaction. In particular...

  15. Demand for Nutrients: The Household Production Approach

    Chung, Rebecca H.; Lee, Jonq-Ying; Mark G. Brown

    1998-01-01

    This study uses the household production theory to study the demand for nutrients, i.e., households purchase a combination of food items from the market and produce the needed nutrients from these food items. By following the traditional household production approach, shadow prices for nutrients in food consumption are calculated. The cost function that generates the shadow prices appears plausible in terms of its elasticities of substitution and factor demand. After obtaining the calculated ...

  16. Grace DAKASEP alkaline battery separator

    Giovannoni, R. T.; Lundquist, J. T.; Choi, W. M.

    1987-01-01

    The Grace DAKASEP separator was originally developed as a wicking layer for nickel-zinc alkaline batteries. The DAKASEP is a filled non-woven separator which is flexible and heat sealable. Through modification of formulation and processing variables, products with a variety of properties can be produced. Variations of DAKASEP were tested in Ni-H2, Ni-Zn, Ni-Cd, and primary alkaline batteries with good results. The properties of DAKASEP which are optimized for Hg-Zn primary batteries are shown in tabular form. This separator has high tensile strength, 12 micron average pore size, relatively low porosity at 46-48 percent, and consequently moderately high resistivity. Versions were produced with greater than 70 percent porosity and resistivities in 33 wt percent KOH as low as 3 ohm cm. Performance data for Hg-Zn E-1 size cells containing DAKASEP with the properties shown in tabular form, are more reproducible than data obtained with a competitive polypropylene non-woven separator. In addition, utilization of active material is in general considerably improved.

  17. Household energy consumption and expenditures, 1990

    This report, Household Energy Consumption and Expenditures 1990, is based upon data from the 1990 Residential Energy Consumption Survey (RECS). Focusing on energy end-use consumption and expenditures of households, the 1990 RECS is the eighth in a series conducted since 1978 by the Energy Information Administration (EIA). Over 5,000 households were surveyed, providing information on their housing units, housing characteristics, energy consumption and expenditures, stock of energy-consuming appliances, and energy-related behavior. The information provided represents the characteristics and energy consumption of 94 million households nationwide

  18. Storage Stability Improvement of Copolymer Grafted Polypropylene-AcrylicAcid (PP-AA), by means of Various After Treatment Processes

    Polypropylene yams that have been subjected to irradiation induced graftco-polymerization with acrylic acid, have gained its moisture regain and dyeability, that fulfilled the requirement as textile material for garment.However, the copolymer grafted PP-AA has suffered from degradation in thestorage, which was indicated in the previous study that the strengthretention has dropped tremendously by photo-oxidation or photo-degradation.After treatments of PP-AA yams with chemical compound that was able toprevent further photo-oxidation, will be expected to improve the stability ofPP-AA in storage. In this research activity, the polypropylene (PP) yams weresubjected to irradiation induced graft co-polymerization by means ofγ-Ray Co-60 as irradiation source with acrylic acid (AA) as monomer.Various after treatments were subjected to the grafted PP-AA yams such asalkalisation process; dyeing (anionic dyes, cationic dyes and nonionic dyes);as well as processing with optical brightening agent and UV stabilizer,separately. The PP-AA yams (before and after treatment) were subjected tostorage from 1 month up to 42 months, and then being tested for theirmoisture regain, strength retention and elongation at breaks. The samplesbeing stored for 12 months were subjected to radical analysis. It isconcluded from the experiment that after treatment of grafted PP-AA by meansof those various processes were able to improve the stability of copolymergrafted PP-AA in storage. The presence of peroxide radical in the ESR(electron spin resonance) spectrum on PP-AA yams before treatment and theones after treated with alkaline and being stored for 12 months haveindicated the presence of photo oxidation or photo degradation, while thepresence of poly enyl radical in the ESR spectrum of after treated PP-AA withdyes having azo and azine compound as chromophore, as well as with UVstabilizer with carbonyl as chromophore and being stored for 12 months haveproved that its presence have protected such

  19. Alkaline and alkaline earth metal phosphate halides and phosphors

    Lyons, Robert Joseph; Setlur, Anant Achyut; Cleaver, Robert John

    2012-11-13

    Compounds, phosphor materials and apparatus related to nacaphite family of materials are presented. Potassium and rubidium based nacaphite family compounds and phosphors designed by doping divalent rare earth elements in the sites of alkaline earth metals in the nacaphite material families are descried. An apparatus comprising the phosphors based on the nacaphite family materials are presented herein. The compounds presented is of formula A.sub.2B.sub.1-yR.sub.yPO.sub.4X where the elements A, B, R, X and suffix y are defined such that A is potassium, rubidium, or a combination of potassium and rubidium and B is calcium, strontium, barium, or a combination of any of calcium, strontium and barium. X is fluorine, chlorine, or a combination of fluorine and chlorine, R is europium, samarium, ytterbium, or a combination of any of europium, samarium, and ytterbium, and y ranges from 0 to about 0.1.

  20. Progress of research on the influence of alkaline cation and alkaline solution on bentonite properties

    Based on the previous laboratory studies and numerical simulation on bentonite in alkaline environments, the effects of alkaline cation and alkaline solution on mineral composition, microstructure, swelling capacity and hydraulic properties of bentonite are emphasized in this paper, temperature, pH values and concentration are discussed as main affecting factors. When bentonite is exposed to alkaline cation or alkaline solution, microstructure of bentonite will be changed due to the dissolution of montmorillonite and the formation of secondary minerals, which results in the decrease of swelling pressure. The amount of the reduction of swelling pressure depends on the concentration of alkaline solution. Temperature, polyvalent cation, salinity and concentration are the main factors affecting hydraulic properties of bentonite under alkaline conditions. Therefore, future research should focus on the mechanism of coupling effects of weak alkaline solutions on the mineral composition, microstructure, swelling capacity and hydraulic properties of bentonite under different temperatures and different pH values. (authors)

  1. Households and food security: lessons from food secure households in East Africa.

    Silvestri, Silvia; Douxchamps, Sabine; Kristjanson, Patti; Förch, Wiebke; Radeny, Maren; Mutie, Lanetta; Quiros, F.C.; Herrero, M.; Ndungu, Anthony; Claessens, L.F.G.

    2015-01-01

    BackgroundWhat are the key factors that contribute to household-level food security? What lessons can we learn from food secure households? What agricultural options and management strategies are likely to benefit female-headed households in particular? This paper addresses these questions using a unique dataset of 600 households that allows us to explore a wide range of indicators capturing different aspects of performance and well-being for different types of households—female-headed, male-...

  2. HOUSEHOLD EXPENDITURE PATTERNS: EVIDENCE FROM WORKING-COUPLE HOUSEHOLDS IN TURKEY

    Bircan BODUR, Fatma; Mukiyyen AVCİ, Gizem

    2016-01-01

    Gender roles in household consumption patterns have been studied in the literature in relation to two models of household behavior; household production model and the unitary versus non-unitary models of the family decision making. The implications of the first model relate to the changes in household expenditure patterns as a result of the withdrawal of the wives from the traditional gender responsibilities at home due to their involvement in paid-labor activities. The studies testing the un...

  3. Personal Exposure to Household Particulate Matter, Household Activities and Heart Rate Variability among Housewives

    Huang, Ya-Li; Chen, Hua-Wei; Han, Bor-Cheng; Liu, Chien-Wei; Chuang, Hsiao-Chi; Lin, Lian-Yu; Chuang, Kai-Jen

    2014-01-01

    Background The association between indoor air pollution and heart rate variability (HRV) has been well-documented. Little is known about effects of household activities on indoor air quality and HRV alteration. To investigate changes in HRV associated with changes in personal exposure to household particulate matter (PM) and household activities. Methods We performed 24-h continuous monitoring of electrocardiography and measured household PM exposure among 50 housewives. The outcome variables...

  4. ATTITUDES AND HOUSEHOLD CHARACTERISTICS INFLUENCING SOLID WASTE GENERATION: A HOUSEHOLD GARBAGE ANALYSIS

    Epp, Donald J.; Mauger, Paul C.

    1989-01-01

    A survey of household decision-makers and an analysis of their garbage was used to suggest factors affecting the weight of household contributions to municipal solid waste. Iterative regression was used to build a model from the data that is hypothesized to explain garbage weight. Food expenditure, environmental attitude, consumption of soft drinks in plastic bottles, and cats in the household were significant for all households. Self-sufficiency and energy-conscious behavioral scales also af...

  5. Financial behaviour of dutch households: analysis of the dnb household survey 2003

    P.J.A. van Els; W.A. van den End; M.C.J. van Rooij

    2003-01-01

    This paper presents an analysis of the financial behaviour of Dutch households on the basis of the DNB Household Survey. The results of this survey provide insight into the backgrounds and consequences of the persistent rise of household debt. The increase in mortgage debt is related to mortgage equity withdrawal. The financial vulnerability of households turns out to have increased, especially the sensitivity to interest rate movements. This contribution also looks into investors' response t...

  6. Smart Energy Management for Households

    Sonja van Dam

    2013-06-01

    Full Text Available The aim of the research presented in this thesis was to infer design-related insights and guidelines to improve the use and effectiveness of home energy management systems (HEMS. This was done through an empirical evaluation of the longitudinal effectiveness of these devices and an exploration of factors that influence their use and effectiveness. Three case studies executed with three different HEMS in households, a life cycle assessment (LCA on those three HEMS, as well as a reflection on the challenges of both researching and implementing HEMS in existing housing gave a comprehensive picture of the opportunities and barriers for HEMS. The research revealed five typical use patterns that emerged amongst households. It also revealed average energy savings of 7.8%, which however decreased in the follow-up that was conducted, and factors that may influence the use and effectiveness of HEMS. Nonetheless, the LCA calculations divulged that the HEMS can achieve net energy savings when taking their embedded energy into account.Problem statementThe goal of reducing the energy consumption of existing housing formed the basis for this research. There are many facets to this energy consumption, including the characteristics of the house, its appliances, and the behaviours of its inhabitants. Because of this complexity, addressing only one of these facets is not effective in substantially reducing the overall energy consumption of households. This called for an interdisciplinary approach, merging the domains of design for sustainability, sustainable housing transformation and environmental psychology. In this thesis, HEMS were chosen as the intervention to address the various elements that contribute to household energy consumption, thereby functioning as a pivot. By giving feedback and/or helping manage consumption they can assist households in changing their behaviour and help save energy. However, in analysing literature on HEMS, four critique points

  7. Food Insecurity in Households with Children: Prevalence, Severity, and Household Characteristics. Economic Information Bulletin Number 56

    Nord, Mark

    2009-01-01

    Eighty-four percent of U.S. households with children were food secure throughout 2007, meaning that they had consistent access to adequate food for active, healthy lives for all household members. Nearly 16 percent of households with children were food insecure sometime during the year, including 8.3 percent in which children were food insecure…

  8. The power of alternative assessments (AAs)

    张千茜

    2013-01-01

    This article starts by discussing the potential disadvantages of traditional assessment towards young English as a Second Language (ESL) learners within the American public school education system. In response to such disadvantages, researchers ’call for the implementation of alternative assessments (AAs) is therefore introduced along with the various benefits of AAs. However, the current mainstream education policy in the US, namely No Child Left Behind (NCLB) Policy, is still largely based on the tra-ditional ways of testing, making policy-oriented implementation of AAs on large scales remarkably difficult. After careful analysis, the author points out several implications concerning how, under such an existing policy of NCLB, can practitioners effectively accommodate young ESL learners by applying the power of AAs.

  9. Alkaline azide mutagenicity in cowpea

    Sodium azide is known as a potent mutagen in cereals and legumes. It is very effective in acidic medium in barley. Here an attempt is made to measure the effectiveness of sodium azide in alkaline medium (pH 7.4) on cowpea (Vigna unguiculata (L.) Walp., variety FS-68). Seeds pre-soaked in distilled water for 5 hours were treated with different concentrations (10-6, 10-5, 10-4 and 10-3M) of sodium azide (NaN3) for 4 hours at 28± 2 deg. C. Bottles were intermittently shaken, then the seeds were thoroughly washed in running tap water and subsequently planted in pots. The treatment caused significant biological damage such as reduction in seed germination, length of root and shoot, number of nodules and pods per plant and morphological leaf variations. Morphological, as well as chlorophyll mutants, were detected in M2

  10. Friction Stir Weldabilities of AA1050-H24 and AA6061-T6 Aluminum Alloys

    Huijie LIU; Hidetoshi FUJIN; Masakatsu MAEDA; Kiyoshi NOGI

    2005-01-01

    The friction stir weldabilities of the strain-hardened AA1050-H24 and precipitate-hardened AA6061-T6 aluminum alloys were examined to reveal the effects of material properties on the friction stir welding behavior. The experimental results are obtlained. (1) For AA1050-H24, the weld can possess smoother surface ripples; there is no elliptical weld nugget in the weld; there is no discernible interface between the stir zone and the thermomechanically affected zone;and the internal defect of the weld looks like a long crack and is located in the lower part of the weld. (2) For AA6061-T6, the weld usually possesses slightly rougher surface ripples; an elliptical weld nugget clearly exists in the weld; there are discernible interfaces among the weld nugget, thermomechanically affected zone and heat affected zone; and the internal defect of the weld is similar to that of the AA1050-H24 weld. (3) The effective range of welding parameters for AA1050-H24 is narrow, while the one for AA6061-T6 is very wide. (4) The maximum tensile strength efficiency of the AA1050-H24 joints is similar to that of the AA6061-T6 joints, i.e. 79% and 77%, respectively.

  11. AAS 228: Day 3 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session 2015 Newton Lacy Pierce Prize Lecture: The Elephant in the Room: Effects of Distant, Massive Companions on Planetary System Architectures (by Leonardo dos Santos)The first session on Wednesday at 228th AAS Meeting was the Newton Lacy Pierce Prize Lecture by Heather Knutson (California Institute of Technology). This talk featured a broad range of research efforts on exoplanets, with the main focus on how we study the composition of their atmospheres, and how multi-body interactions carve the structure of the planetary systems we observe.One of her first points is the well-known idea that the Solar System is an oddball, compared to the exoplanet systems we have found so far: most of these systems contain hot Jupiters and mini-Neptunes at very close-in orbits around their host stars. Moreover, even when studying their transmission spectra, it is difficult to know the exact composition of their atmospheres.Knutson: it is difficult to constrain atmospheric composition of exoplanets (H-poor or H-rich+clouds?) #aas228pic.twitter.com/LdyN4o9RC7 astrobites (@astrobites) June 15, 2016The main proposal on how these systems formed is the migration scenario. In order to validate this idea, Dr. Knutson and her group The Friends of Hot Jupiters study systems with close-in gas giants and their frequency of binary companions, which are supposed to be the main culprits causing gas-giant migration. They found that approximately half of the observed systems have long-distance companions, providing strong validation of the migration scenario. Moreover, Dr. Knutson speculates that wide binaries have more

  12. Magnetic horn of the Antiproton Accumulator (AA)

    Photographic Service

    1988-01-01

    In the 1960s, the invention of this "current sheet lens" has helped to greatly improve the flux of neutrino beams. It was used again at the AA, collecting antiprotons from the production target at angles too large to fit into the acceptance of the AA. It was machined from aluminium to a thickness of 1.4 mm and pulsed at 400 kA for 15 microseconds (half-sine).

  13. Characterization of household waste in Greenland

    The composition of household waste in Greenland was investigated for the first time. About 2 tonnes of household waste was sampled as every 7th bag collected during 1 week along the scheduled collection routes in Sisimiut, the second largest town in Greenland with about 5400 inhabitants. The collection bags were sorted manually into 10 material fractions. The household waste composition consisted primarily of biowaste (43%) and the combustible fraction (30%), including anything combustible that did not belong to other clean fractions as paper, cardboard and plastic. Paper (8%) (dominated by magazine type paper) and glass (7%) were other important material fractions of the household waste. The remaining approximately 10% constituted of steel (1.5%), aluminum (0.5%), plastic (2.4%), wood (1.0%), non-combustible waste (1.8%) and household hazardous waste (1.2%). The high content of biowaste and the low content of paper make Greenlandic waste much different from Danish household waste. The moisture content, calorific value and chemical composition (55 elements, of which 22 were below detection limits) were determined for each material fraction. These characteristics were similar to what has been found for material fractions in Danish household waste. The chemical composition and the calorific value of the plastic fraction revealed that this fraction was not clean but contained a lot of biowaste. The established waste composition is useful in assessing alternative waste management schemes for household waste in Greenland.

  14. Spending Time and Money within the Household

    Browning, Martin; Gørtz, Mette

    2012-01-01

    We consider, both theoretically and empirically, the allocation of time and money within the household. The research question is whether a married person who enjoys more leisure than their partner also receives more consumption (which seems to indicate the outcome of power within the household) or...

  15. Household energy expenditures, 1982–2005

    David B. Cashin; Leslie McGranahan

    2006-01-01

    While energy's share of total expenditures has risen in recent years, it remains below the shares seen in the early and mid-1980s. Furthermore, the impact of the price increases on a household differs, based on the household's specific energy consumption patterns.

  16. Passenger transport and household activity patterns

    Jørgensen, Kaj

    1997-01-01

    Review of Danish passenger transport patterns and analysis of energy consumption, emissions and safety impacts for selected typical households' travelling......Review of Danish passenger transport patterns and analysis of energy consumption, emissions and safety impacts for selected typical households' travelling...

  17. Household income distribution in the USA

    Efthimiou, Costas J.; Wearne, Adam

    2016-03-01

    In this article we present an alternative model for the distribution of household incomes in the United States. We provide arguments from two differing perspectives which both yield the proposed income distribution curve, and then fit this curve to empirical data on household income distribution obtained from the United States Census Bureau.

  18. Poverty orderings and intra-household inequality

    Eugenio Peluso; Alain Trannoy

    2008-01-01

    We investigate under which conditions it is possible to infer the evolution of poverty at the individual level from the knowledge of poverty among households. The analysis is based on a reduced household model (Peluso and Trannoy 2007) and provides results in terms of preservation of poverty orderings...

  19. Characterization of household waste in Greenland

    Eisted, Rasmus; Christensen, Thomas Højlund

    2011-01-01

    The composition of household waste in Greenland was investigated for the first time. About 2tonnes of household waste was sampled as every 7th bag collected during 1week along the scheduled collection routes in Sisimiut, the second largest town in Greenland with about 5400 inhabitants. The...... collection bags were sorted manually into 10 material fractions. The household waste composition consisted primarily of biowaste (43%) and the combustible fraction (30%), including anything combustible that did not belong to other clean fractions as paper, cardboard and plastic. Paper (8%) (dominated by...... magazine type paper) and glass (7%) were other important material fractions of the household waste. The remaining approximately 10% constituted of steel (1.5%), aluminum (0.5%), plastic (2.4%), wood (1.0%), non-combustible waste (1.8%) and household hazardous waste (1.2%). The high content of biowaste and...

  20. Capitalization of Local Products through Agro- Household

    Ramona Ciolac

    2010-10-01

    Full Text Available In every household there are many family activities that provide the necessary income or living foods. Some activities are related to cultivation of land, others for breeding other means services provided by the vilagers. The products of the own household must cover 40% of meals offered to tourists. These products are produced by the householder work in their household, the tourist having the opportunity to observe how the products are produced and participate effectively in this production. Specific rural household products can be recovered through tourism by both indirect and direct ways. Both variants can generate increased profitability and interest of the tourist business activity and impose a sense of satisfaction for quality benefit, issues that may be, in turn, assumptions favorable to the extension of this work.

  1. Household consumption and environment. 2011 edition

    This report presents and comments numerous data and indicators concerning the constraints and impacts on the environment related to household consumption and behaviour. After a presentation of context indicators (household number and size, household consumption expenses) and of some global indicators (water and carbon footprint of household consumption), several specific aspects are addressed: housing (electric and electronic equipment, water, space and energy consumption, renewable energies, CO2 emissions), transport (general statistics on travels, CO2 and pollutant emissions related to motor cars), food (water print and carbon print related to household food, consumption of bio-agriculture products and of conditioned beverages), and wastes (production and composition, electronic and electric equipment wastes, waste treatment)

  2. Effect of supplementation of arachidonic acid (AA) or a combination of AA plus docosahexaenoic acid on breastmilk fatty acid composition

    Smit, EN; Koopmann, M; Boersma, ER; Muskiet, FAJ

    2000-01-01

    We investigated whether supplementation with arachidonic acid (20:4 omega 6; AA), ora combination of AA and docosahexaenoic acid (22:6 omega 3; DHA) would affect human milk polyunsaturated fatty acid (PUFA) composition. Ten women were daily supplemented with 300 mg AA, eight with 300 mg AA, 110 mg e

  3. Household energy: Problems, policies and prospects

    McGranahan, G.; Kaijser, A.

    1993-10-01

    This paper examines household energy problems in the Third World, focusing on past problems and future prospects for household energy policy. Whether or not there is a general household energy crisis, household energy problems can be severe, and are of particular importance to the poor. Most of these problems are largely independent of oil prices, and a poor household foraging for ever more scarce fuelwood is no better off because its fuel collection is not the cause of the declining supply. In the energy sector, as in virtually every other sector, the problems of the poor are the most intractable. Many of the difficulties encountered in attempts to deal with the household energy problems of the poor are analogous to those encountered in other poverty oriented programmes. It would indeed be unfortunate if, having recognized that many past efforts in the household energy sector were misconceived, household energy problems were to suffer from equally ill-conceived neglect. The memorandum attempts to draw some general conclusions about the form a more appropriate approach could take. Probably well over 90 % of public funds allocated to the household sector over the past two decades have been devoted to subsidizing commercial fuels such as electricity and kerosene, benefiting primarily the better-off households. This has helped to create energy problems, and done little to ease the problems of the poor. Most of the lessons to be drawn from experiences with such subsidies are negative. On the other hand, the relatively small proportion of funding devoted to activities such as stove programmes and biofuel supply enhancement should be viewed as exploratory in nature. (49 refs., 3 tabs.)

  4. AAS 228: Day 1 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session: From Space Archeology to Serving the World Today: A 20-year Journey from the Jungles of Guatemala to a Network of Satellite Remote Sensing Facilities Around the World(by Michael Zevin)In the conferences second plenary session, NASAs Daniel Irwin turned the eyes of the conference back to Earth by highlighting the huge impact that NASA missions play in protecting and developing our own planet.Daniel Irwin: using satellite imagery to detect differences in vegetation and find ancient Mayan cities. #aas228 pic.twitter.com/9LFPQdCHTM astrobites (@astrobites) June 13, 2016Irwin came to be involved in NASA through his work mapping Guatemalan jungles, where he would spend 22 days at a time exploring the treacherous jungles on foot armed with a 1st generation GPS, a compass, and a machete. A colleague introduced Irwin to the satellite imagery thathe was exploring, demonstratinghow these images are a strong complement to field work. The sharing of this satellite data with nearby villages helped to show the encroachment of agriculture and the necessity of connecting space to the village. Satellite imagery also played a role in archeological endeavors, uncovering dozens of Mayan cities that have been buried for over a millennia by vegetation, and it provided evidence that the fall of the Mayan civilization may have been due to massive deforestation that ledto drought.Glacial retreat in Chile imaged by ISERV.Irwin displayed the constellation of NASAs Earth-monitoring satellites that have played an integral role in conserving our planet and alerting the world of natural disasters. He also showed

  5. Household Consumption Characteristics of Cookies: The Case of Uganda

    Fu, Shengfei; Florkowski, Wojciech J.; Nambiar, Padmanand Madhavan; Resurreccion, Anna V.A.; Chinnan, Manjeet S.

    2013-01-01

    The cookie consumption and purchase characteristics of households were investigated in six cities in Uganda using household survey data. Cookies can be fortified with vitamins to improve child nutrition. The application of a Logit model permitted the identification of factors significantly affecting household decision to eat cookies. They are household food buyer/preparer’s age, employment status, education level, household monthly income, household location, number of children from 4 to 18 y...

  6. ASSESSMENT OF HOUSEHOLD CARBON FOOTPRINT REDUCTION POTENTIALS

    Kramer, Klaas Jan; Homan, Greg; Brown, Rich; Worrell, Ernst; Masanet, Eric

    2009-04-15

    The term ?household carbon footprint? refers to the total annual carbon emissions associated with household consumption of energy, goods, and services. In this project, Lawrence Berkeley National Laboratory developed a carbon footprint modeling framework that characterizes the key underlying technologies and processes that contribute to household carbon footprints in California and the United States. The approach breaks down the carbon footprint by 35 different household fuel end uses and 32 different supply chain fuel end uses. This level of end use detail allows energy and policy analysts to better understand the underlying technologies and processes contributing to the carbon footprint of California households. The modeling framework was applied to estimate the annual home energy and supply chain carbon footprints of a prototypical California household. A preliminary assessment of parameter uncertainty associated with key model input data was also conducted. To illustrate the policy-relevance of this modeling framework, a case study was conducted that analyzed the achievable carbon footprint reductions associated with the adoption of energy efficient household and supply chain technologies.

  7. Sources of household salt in South Africa.

    Jooste, Pieter L

    2005-01-01

    Marketing of non-iodized salt through unconventional distribution channels is one of the factors weakening the national salt iodization program in South Africa. The aim of this study was therefore to quantify the various sources of household salt, and to relate this information to socio-economic status. Questionnaire information was collected by personal interview during home visits from a multistage, cluster, probability sample of 2164 adults representative of the adult population. Nationally 77.7% of households obtained their table salt from the typical food shops distributing iodized salt. However, in the nine different provinces between 8 and 37.3% of households used unconventional sources, distributing mainly non-iodized salt, to obtain their household salt. These alternative sources include distributors of agricultural salt, small general dealer shops called spaza shops, in peri-urban and rural townships, street vendors and salt saches placed in the packaging of maize meal bags. Country-wide around 30% of low socio-economic households obtained their salt from unconventional sources compared to less than 5% in high socio-economic households, emphasizing the vulnerability of low socio-economic groups to the use of non-iodized salt. Intervention strategies should mobilize all role players involved in unconventional marketing channels of household salt to provide only iodized salt to consumers, as required by law. PMID:15927933

  8. The Household Market for Electric Vehicles: Testing the Hybrid Household Hypothesis -- A Reflexively Designed Survey of New-Car-Buying Multi-Vehicle California Households

    Turrentine, Thomas; Kurani, Kenneth S

    2001-01-01

    We report the results of a survey of the potential demand for electric vehicles (EVs) among a subset of California households. We limit our analysis to one group of potential hybrid households. These households own two or more light duty vehicles and buy new vehicles of the body styles we expect will be offered as electric vehicles. These characteristics identify households who may be able to incorporate at least one limited range vehicle into their household vehicle holdings with no, or mini...

  9. Financial Assets of Private Households in Austria

    Peter Mooslechner

    1995-01-01

    The stock of financial assets owned by private households at the end of 1993 was estimated at almost Sch 2,100 billion. For the individual household this amounts to financial assets worth about Sch 660,000 on average, while indebtedness was slightly higher than Sch 260,000. These amounts may seem high but the financial wealth of Austrian households is low in an international comparison. While in the U.S., Japan, and the United Kingdom financial assets are more than twice as high as nominal gr...

  10. Substitution between cars within the household

    De Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

    The purpose of this paper is to study to what extent two-car households substitute the use of their less fuel efficient car by the use of their more fuel efficient car after an increase in fuel prices. Based on a simple theoretical framework we use a large sample of detailed Danish data on two-car...... households to estimate, for each car owned by the household, own and cross-price effects of increases in fuel costs per kilometer. The empirical results point at important substitution effects, so that models that estimate responses to fuel prices on the implicit or explicit assumption of one car per...

  11. Price elasticity of household fuel comsumption

    Clerc, M.; Marcus, V.

    2009-01-01

    The high levels reached by world oil prices and fuel prices in mid 2008 have raised notable concerns about the risk of future significant drops in household purchasing power. In the framework of a national strategy to reduce CO2 emissions, a tax reform on fossil fuels is also being studied. In this context, this paper aims to identify the categories of households that are most exposed to an energy-price increase and to assess the sensitivity of household consumption to changes in fuel prices ...

  12. Alkaline sorbent injection for mercury control

    Madden, Deborah A.; Holmes, Michael J.

    2003-01-01

    A mercury removal system for removing mercury from combustion flue gases is provided in which alkaline sorbents at generally extremely low stoichiometric molar ratios of alkaline earth or an alkali metal to sulfur of less than 1.0 are injected into a power plant system at one or more locations to remove at least between about 40% and 60% of the mercury content from combustion flue gases. Small amounts of alkaline sorbents are injected into the flue gas stream at a relatively low rate. A particulate filter is used to remove mercury-containing particles downstream of each injection point used in the power plant system.

  13. Alkaline rocks and the occurrence of uranium

    Many alkaline complexes contain uranium and other minerals in low concentrations and are regarded as constituting valuable potential reserves. Certain complex metallurgical problems, however, remain to be solved. Alkaline rocks occur in a number of forms and environments and it is noted that they are generated during periods of geological quiescence emplaced mainly in stable aseismic areas. Many occur along the extensions of oceanic transform faults beneath the continental crust and the application of this concept to areas not currently known to host alkaline complexes may prove useful in identifying potential target areas for prospecting operations

  14. Effects of applied potential on the stress corrosion cracking behavior of 7003 aluminum alloy in acid and alkaline chloride solutions

    Zhang, Xiao-yan; Song, Ren-guo; Sun, Bin; Lu, Hai; Wang, Chao

    2016-07-01

    Potentiodynamic polarization tests and slow strain rate test (SSRT) in combination with fracture morphology observations were conducted to investigate the stress corrosion cracking (SCC) behavior of 7003 aluminum alloy (AA7003) in acid and alkaline chloride solutions under various applied potentials ( E a). The results show that AA7003 is to a certain extent susceptible to SCC via anodic dissolution (AD) at open-circuit potential (OCP) and is highly susceptible to hydrogen embrittlement (HE) at high negative E a in the solutions with pH levels of 4 and 11. The susceptibility increases with negative shift in the potential when E a is less than -1000 mV vs. SCE. However, the susceptibility distinctly decreases because of the inhibition of AD when E a is equal to -1000 mV vs. SCE. In addition, the SCC susceptibility of AA7003 in the acid chloride solution is higher than that in the alkaline solution at each potential. Moreover, the effect of hydrogen on SCC increases with increasing hydrogen ion concentration.

  15. MDCT evaluation of acute aortic syndrome (AAS).

    Valente, Tullio; Rossi, Giovanni; Lassandro, Francesco; Rea, Gaetano; Marino, Maurizio; Muto, Maurizio; Molino, Antonio; Scaglione, Mariano

    2016-05-01

    Non-traumatic acute thoracic aortic syndromes (AAS) describe a spectrum of life-threatening aortic pathologies with significant implications on diagnosis, therapy and management. There is a common pathway for the various manifestations of AAS that eventually leads to a breakdown of the aortic intima and media. Improvements in biology and health policy and diffusion of technology into the community resulted in an associated decrease in mortality and morbidity related to aortic therapeutic interventions. Hybrid procedures, branched and fenestrated endografts, and percutaneous aortic valves have emerged as potent and viable alternatives to traditional surgeries. In this context, current state-of-the art multidetector CT (MDCT) is actually the gold standard in the emergency setting because of its intrinsic diagnostic value. Management of acute aortic disease has changed with the increasing realization that endovascular therapies may offer distinct advantages in these situations. This article provides a summary of AAS, focusing especially on the MDCT technique, typical and atypical findings and common pitfalls of AAS, as well as recent concepts regarding the subtypes of AAS, consisting of aortic dissection, intramural haematoma, penetrating atherosclerotic ulcer and unstable aortic aneurysm or contained aortic rupture. MDCT findings will be related to pathophysiology, timing and management options to achieve a definite and timely diagnostic and therapeutic definition. In the present article, we review the aetiology, pathophysiology, clinical presentation, outcomes and therapeutic approaches to acute aortic syndromes. PMID:27033344

  16. The AA disappearing under concrete shielding

    1982-01-01

    When the AA started up in July 1980, the machine stood freely in its hall, providing visitors with a view through the large window in the AA Control Room. The target area, in which the high-intensity 26 GeV/c proton beam from the PS hit the production target, was heavily shielded, not only towards the outside but also towards the AA-Hall. However, electrons and pions emanating from the target with the same momentum as the antiprotons, but much more numerous, accompanied these through the injection line into the AA ring. The pions decayed with a half-time corresponding to approximately a revolution period (540 ns), whereas the electrons lost energy through synchrotron radiation and ended up on the vacuum chamber wall. Electrons and pions produced the dominant component of the radiation level in the hall and the control room. With operation times far exceeding original expectations, the AA had to be buried under concrete shielding in order to reduce the radiation level by an order of magnitude.

  17. Cloning and sequence analysis of complete gene encoding an alkaline lipase from Penicillium cyclopium.

    Zhang, H M; Wu, M C; Guo, J; Li, J F

    2011-01-01

    The complete gene (PG37 lipI) encoding an alkaline lipase (PG37 LipI) was cloned from the genomic DNA of Penicillium cyclopium PG37. The cloned PG37 lipI is 2020 bp in length, consisting of 632 bp of the 5' flanking promoter region and 1388 bp of the downstream fragment that contains 6 exons and 5 short introns. The promoter region harbors putative TATA box, CAAT box and several transcription factor binding sites. The open reading frame (ORF) encodes a PG37 LipI of 285 amino acid residues, which was predicted to contain a 20-aa signal peptide, a 7-aa propeptide and a 258-aa mature peptide with a conserved motif Gly-X-Ser-X-Gly. However, PG37 LipI shows only 32%, 30%, 28% and 26% identity with lipases of Aspergillus parasiticus, Penicillium camembertii, Thermomyces lanuginosus and Rhizomucor miehei, respectively. It was predicted that the main secondary structures of PG37 LipI are alpha-helix and random coil. Three amino acid residues, Ser132-Asp188-His241, compose the enzymatic active center in the tertiary structure. PMID:22288192

  18. Dicty_cDB: FCL-AA03 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA03 (Link to dictyBase) - - - Contig-U15092-1 FCL-AA03E ...(Link to Original site) - - - - - - FCL-AA03E 627 Show FCL-AA03 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA03Q.Seq.d/ Representative seq. ID FCL-AA...03E (Link to Original site) Representative DNA sequence >FCL-AA03 (FCL-AA03Q) /CSM/FCL/FCL-AA/FCL-AA...03Q.Seq.d/ ACATAATGTTCCAAAAGAAAGCAATTGTTATTGATGGCAAAGGTCATTTGTTAGGTCGTT TAGCCTCCGTTGTTGCTAAATCCCTCCTCTCTGGTCAAAA

  19. Dicty_cDB: FCL-AA02 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA02 (Link to dictyBase) - - - Contig-U16560-1 FCL-AA02F ...(Link to Original site) FCL-AA02F 620 - - - - - - Show FCL-AA02 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ Representative seq. ID FCL-AA...02F (Link to Original site) Representative DNA sequence >FCL-AA02 (FCL-AA02Q) /CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ ATTAA...ATACAAAATACAAATACAAATAACAAATACTTTACTATAGCTTTTTTTTCTTATT TATTTCTCCAAATAATTTTTTAATATGCAAATCTTTGTTAAAA

  20. Dicty_cDB: FCL-AA09 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA09 (Link to dictyBase) - - - Contig-U16453-1 FCL-AA09F ...(Link to Original site) FCL-AA09F 485 - - - - - - Show FCL-AA09 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ Representative seq. ID FCL-AA...09F (Link to Original site) Representative DNA sequence >FCL-AA09 (FCL-AA09Q) /CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ GACAA...AAGTAAATAAAACATGTCCGCAAGTAATAAAGATGACCAACTCATGAAAAATGAG TTCGAAAGTACCTACGACAAAATTGTCGATTCATTCGACAA

  1. Dicty_cDB: FCL-AA08 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA08 (Link to dictyBase) - - - Contig-U16200-1 FCL-AA08Z ...(Link to Original site) - - FCL-AA08Z 574 - - - - Show FCL-AA08 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA08Q.Seq.d/ Representative seq. ID FCL-AA...08Z (Link to Original site) Representative DNA sequence >FCL-AA08 (FCL-AA08Q) /CSM/FCL/FCL-AA/FCL-AA...08Q.Seq.d/ XXXXXXXXXXTCGAAGCCAAAGGTCGTCTCGAAGAAGAATTCCATCGCTCGTACCAACTC TGATCGTTCAAGAAAGAGACTCGAAGCTGAAA

  2. Dicty_cDB: FC-AA09 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA09 (Link to dictyBase) - - - Contig-U15086-1 FC-AA09E (Li...nk to Original site) - - - - - - FC-AA09E 562 Show FC-AA09 Library FC (Link to library) Clone ID FC-AA09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA09Q.Seq.d/ Representative seq. ID FC-AA...09E (Link to Original site) Representative DNA sequence >FC-AA09 (FC-AA09Q) /CSM/FC/FC-AA/FC-AA09Q.Seq....d/ GATACATTATCACCATGGCAGGAAAAAAAGTCAAATCTAACACACCAAAACAAGACTTAT CTGTCTCTAAATCAAAGCTCACCAGCATTAAAGCCCCAGCTGCTGCCATCAAAGCTAAA

  3. Dicty_cDB: FC-AA14 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA14 (Link to dictyBase) - - - Contig-U15088-1 FC-AA14E (Li...nk to Original site) - - - - - - FC-AA14E 431 Show FC-AA14 Library FC (Link to library) Clone ID FC-AA14 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA14Q.Seq.d/ Representative seq. ID FC-AA...14E (Link to Original site) Representative DNA sequence >FC-AA14 (FC-AA14Q) /CSM/FC/FC-AA/FC-AA14Q.Seq.d/ CTATGTCTGAAATCAAAA...CTGAAGAACTCGCTTGCATCTACTCCGGTCTTTTATTACAAG ATGACGGTATTGAAATCACCGCTGATAAAATCAAAACCTTATTAGAAGCTGCCAA

  4. Dicty_cDB: FCL-AA04 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA04 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA04Z ...(Link to Original site) - - FCL-AA04Z 530 - - - - Show FCL-AA04 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA04Q.Seq.d/ Representative seq. ID FCL-AA...04Z (Link to Original site) Representative DNA sequence >FCL-AA04 (FCL-AA04Q) /CSM/FCL/FCL-AA/FCL-AA...04Q.Seq.d/ XXXXXXXXXXCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTTCAGTCAAAGAAATT AAAAGAGGTATGGTCGCTGGTGACTCCAAAAACGATCCACCACAAGAAA

  5. Dicty_cDB: FC-AA20 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA20 (Link to dictyBase) - - - Contig-U16455-1 FC-AA20Z (Li...nk to Original site) - - FC-AA20Z 607 - - - - Show FC-AA20 Library FC (Link to library) Clone ID FC-AA20 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA20Q.Seq.d/ Representative seq. ID FC-AA...20Z (Link to Original site) Representative DNA sequence >FC-AA20 (FC-AA20Q) /CSM/FC/FC-AA/FC-AA20Q.Seq....d/ XXXXXXXXXXCTTTGCCCCAGCTGGTCTCTCAACTGAAGTCAAATCAGTCGAAATGCATC ACGAACAACTCCCAGAAGCCCGTCCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTT CAGTCAA

  6. Dicty_cDB: FCL-AA15 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA15 (Link to dictyBase) - - - Contig-U16011-1 FCL-AA15Z ...(Link to Original site) - - FCL-AA15Z 442 - - - - Show FCL-AA15 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA15Q.Seq.d/ Representative seq. ID FCL-AA...15Z (Link to Original site) Representative DNA sequence >FCL-AA15 (FCL-AA15Q) /CSM/FCL/FCL-AA/FCL-AA...15Q.Seq.d/ XXXXXXXXXXCCATTCATCTGTCCAATCGATTGTCGTCGTGGTCTCTACAAGAATATCGT CTTATCTGGTGGTTCAACCATGTTTAAAGATTTTGGTAAACGTCTTCAA

  7. Dicty_cDB: FC-AA13 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA13 (Link to dictyBase) - - - Contig-U15674-1 FC-AA13Z (Li...nk to Original site) - - FC-AA13Z 528 - - - - Show FC-AA13 Library FC (Link to library) Clone ID FC-AA13 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA13Q.Seq.d/ Representative seq. ID FC-AA...13Z (Link to Original site) Representative DNA sequence >FC-AA13 (FC-AA13Q) /CSM/FC/FC-AA/FC-AA13Q.Seq.d/ XXXXXXXXXXAAAGCAAA...CTCGTGCTGGTCAACGTACCCGTTTCAAGGCTTTCGTCGTTG TTGGTGATCACAACGGTCATGTAGGTCTCGGTGTTAAATGCGCTAAGGAA

  8. Dicty_cDB: FCL-AA20 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA20 (Link to dictyBase) - - - Contig-U15052-1 FCL-AA20E ...(Link to Original site) - - - - - - FCL-AA20E 1159 Show FCL-AA20 Library FCL (Link to library) Clone ID FCL-AA...L http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ Representative seq. ID FCL-AA...20E (Link to Original site) Representative DNA sequence >FCL-AA20 (FCL-AA20Q) /CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ AAAA...CATTTACAAATGATGACCACAGAAGATGTACAACCAATTGAAACTACCAAAGATGG TGTAGTAGTATTAAATTATAGCGATTTAATTGCAGGTAAA

  9. Dicty_cDB: FC-AA23 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA23 (Link to dictyBase) - - - Contig-U16090-1 FC-AA23E (Li...nk to Original site) - - - - - - FC-AA23E 387 Show FC-AA23 Library FC (Link to library) Clone ID FC-AA23 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA23Q.Seq.d/ Representative seq. ID FC-AA...23E (Link to Original site) Representative DNA sequence >FC-AA23 (FC-AA23Q) /CSM/FC/FC-AA/FC-AA23Q.Seq.d/ AAACTCGATTATATTCTTAA...TCTTAAAGTTCAAGATTTCATGGAAAGACGTCTCCAAACT TTAGTCTTCAAAAATGGTCTTGCCAAATCAATCCATCACGCTCGTGTTTTAATCAAA

  10. Dicty_cDB: FC-AA12 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA12 (Link to dictyBase) - - - Contig-U15087-1 FC-AA12E (Li...nk to Original site) - - - - - - FC-AA12E 454 Show FC-AA12 Library FC (Link to library) Clone ID FC-AA12 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA12Q.Seq.d/ Representative seq. ID FC-AA...12E (Link to Original site) Representative DNA sequence >FC-AA12 (FC-AA12Q) /CSM/FC/FC-AA/FC-AA12Q.Seq.d/ AAATAATAATAATATAAAAA...TGGAAATTAAAGTTTTAGCTAAAAGAAAAGTATCAGCAAA ACGTGCAAATGAAATATTAGGAAAATTTATTTTAGAAAGAAAAGCAAATGAAGAAAA

  11. Dicty_cDB: FC-AA01 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA01 (Link to dictyBase) - - - Contig-U15084-1 FC-AA01E (Li...nk to Original site) - - - - - - FC-AA01E 701 Show FC-AA01 Library FC (Link to library) Clone ID FC-AA01 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA01Q.Seq.d/ Representative seq. ID FC-AA...01E (Link to Original site) Representative DNA sequence >FC-AA01 (FC-AA01Q) /CSM/FC/FC-AA/FC-AA01Q.Seq.d/ GAGAAATATTTCTTATTAA...CAATTGCATGCGTTGTATTCAACCCAACATGGTGGAATATT ACAGCAAGAATGGAATATAATGCTAATAAATAACAACCATTTTCTTTACTTCCACAAA

  12. Dicty_cDB: FCL-AA10 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA10 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA10Z ...(Link to Original site) - - FCL-AA10Z 627 - - - - Show FCL-AA10 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA10Q.Seq.d/ Representative seq. ID FCL-AA...10Z (Link to Original site) Representative DNA sequence >FCL-AA10 (FCL-AA10Q) /CSM/FCL/FCL-AA/FCL-AA...10Q.Seq.d/ XXXXXXXXXXTAAACCAGGTATGGTCGTCACCTTTTGCCCCAGCTGGTCTCTCAACTGAA GTCAAATCAGTCGAAATGCATCACGAACAACTCCCAGAA

  13. Dicty_cDB: FC-AA19 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA19 (Link to dictyBase) - - - Contig-U16072-1 FC-AA19F (Li...nk to Original site) FC-AA19F 539 - - - - - - Show FC-AA19 Library FC (Link to library) Clone ID FC-AA19 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA19Q.Seq.d/ Representative seq. ID FC-AA...19F (Link to Original site) Representative DNA sequence >FC-AA19 (FC-AA19Q) /CSM/FC/FC-AA/FC-AA19Q.Seq.d/ CAGAAA...TCACTGGTTTTTCATTCCAATTATTTAATATTATCAGTATTTGGAATGTTGATC AAACATCATTCAATAGCTACAGTCTTCCAATTTGGTTACCAGCCATTCAA

  14. Dicty_cDB: FC-AA02 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA02Q.Seq.d/ Representative seq. ID FC-AA...02Z (Link to Original site) Representative DNA sequence >FC-AA02 (FC-AA02Q) /CSM/FC/FC-AA/FC-AA02Q.Seq.d/ XXXXXXXXXXCAAAAA...GGCTCCTGGTCCGGAAGGATTGGGTAATCATTTGAATTTCCTAC GTAACTGGGCTTGATCTTTGTAATTATTGATCATAAACGAGGAATTCCTTGTAAGCGTAA

  15. Dicty_cDB: FCL-AA24 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA24 (Link to dictyBase) - - - Contig-U16467-1 FCL-AA24E ...(Link to Original site) - - - - - - FCL-AA24E 779 Show FCL-AA24 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA24Q.Seq.d/ Representative seq. ID FCL-AA...24E (Link to Original site) Representative DNA sequence >FCL-AA24 (FCL-AA24Q) /CSM/FCL/FCL-AA/FCL-AA...24Q.Seq.d/ CTAGAAATTTCTAAACAATTATTTATTTGAAGAGGTTTTTTAAAAAAAGAAAAAAATCAG AGCATCCAAATAATAACCGCAGTAAGGGGGGGATGGTTGTTAA

  16. Dicty_cDB: FCL-AA05 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA05 (Link to dictyBase) - - - Contig-U16473-1 FCL-AA05Z ...(Link to Original site) - - FCL-AA05Z 603 - - - - Show FCL-AA05 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA05Q.Seq.d/ Representative seq. ID FCL-AA...05Z (Link to Original site) Representative DNA sequence >FCL-AA05 (FCL-AA05Q) /CSM/FCL/FCL-AA/FCL-AA...05Q.Seq.d/ XXXXXXXXXXTGGCGCCATCATTACTGGTGGAGGTGGTGTTGCTATCACTCAAGCTCAAC CATCATACCAAGCTGATGCCGTTGCCACTTACATCAAAA

  17. AAS 228: Day 2 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  18. AAS 228: Day 2 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  19. AAS 228: Day 2 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  20. Substitution between Cars within the Household

    de Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

    In this paper we study the demand for car kilometres in two-car households, focusing on the substitution between cars in response to fuel price changes. We use a large sample of detailed Danish data on two-car households to estimate—for each car owned by the household—own and cross-price effects of...... increases in fuel costs per kilometre. The empirical results show that failure to capture substitution between cars within the household can result in substantial misspecification biases. Ignoring substitution, we estimate fuel price elasticities of –0.81 and -0.65 for the primary and secondary cars...... efficient car, finding partial support for the underlying hypothesis. More importantly, the results of this extended model emphasize the importance of behavioural differences related to the position of the most fuel efficient car in the household, suggesting that households’ fuel efficiency choices are...

  1. Substitution between cars within the household

    De Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

    2016-01-01

    In this paper we study the demand for car kilometres in two-car households, focusing on the substitution between cars of different fuel efficiency in response to fuel price changes. We use a large sample of detailed Danish data on two-car households to estimate – for each car owned by the household...... – own and cross-price effects of increases in fuel costs per kilometre. The empirical results show that failure to capture substitution between cars within the household can result in substantial misspecification biases. Ignoring substitution, the basic model yielded fuel price elasticities of 0.98 and...... 1.41 for the primary and secondary cars, respectively. Accounting for substitution effects, these figures reduce to, respectively, 0.32 and 0.45. Consistent with substitution behaviour, we find that the fuel price elasticity of fuel demand exceeds the elasticity of kilometre demands with respect to...

  2. Medical Expenditure Panel Survey Household Component

    U.S. Department of Health & Human Services — The Medical Expenditure Panel Survey (MEPS) Household Component (HC) collects data from a sample of families and individuals in selected communities across the...

  3. Household energy consumption and expenditures 1993

    NONE

    1995-10-05

    This presents information about household end-use consumption of energy and expenditures for that energy. These data were collected in the 1993 Residential Energy Consumption Survey; more than 7,000 households were surveyed for information on their housing units, energy consumption and expenditures, stock of energy-consuming appliances, and energy-related behavior. The information represents all households nationwide (97 million). Key findings: National residential energy consumption was 10.0 quadrillion Btu in 1993, a 9% increase over 1990. Weather has a significant effect on energy consumption. Consumption of electricity for appliances is increasing. Houses that use electricity for space heating have lower overall energy expenditures than households that heat with other fuels. RECS collected data for the 4 most populous states: CA, FL, NY, TX.

  4. Households' ICT use in an energy perspective

    Røpke, Inge; Gram-Hanssen, Kirsten; Jensen, Jesper Ole

    2008-01-01

    considering ICT in an energy perspective. In particular, the paper focuses on the integration of ICT in households and the energy impacts related to changing everyday practices. As this has not received much attention in previous research, the paper has an explorative character. Firstly, the paper reviews...... some of the previous studies on ICT and energy and the consumption perspective is introduced. Secondly, the integration of ICT in everyday practices and the dynamics behind the changes are outlined, inspired by a historical perspective. Thirdly, a figure of the relationships between changing everyday...... practices and the related energy impacts is presented, followed by descriptions of direct energy consumption related to household ICT, indirect energy consumption outside households, and derived impacts both within and outside households. The paper concludes with some remarks on political implications and...

  5. Alkalinity in oil field waters - what alkalinity is and how it is measured

    The alkalinity is an important parameter in the description of pH-behaviour, buffer capacity and scaling potentials in oil field waters. Although the alkalinity is widely used, it seems to be considerable confusion in connection with the concept. It is often used incorrectly and different authors define the concept in different ways. Several different methods for the determination of alkalinity can be found in the literature. This paper discusses the definition of alkalinity and how to use alkalinity in oil field waters to obtain data of importance for scale and pH predictions. There is also shown how a simple titration of oil field waters can give both the alkalinity and the content of organic acids in these waters. It is obvious from these findings that most of the methods used to day may give considerable errors when applied to oil field waters with high contents of organic acids. 8 refs., 8 figs., 5 tabs

  6. Effects of household size and composition on consumption in rural households in Matabeleland South, Zimbabwe

    Young, Trevor; Hamdok, Abdalla A.

    1994-01-01

    This study, using a survey of rural households in Zimbabwe in 1990 j91, focuses on the effects of changing household composition on patterns of expenditure and provides estimates of the 'cost of a child' as well as of family members in other age groups. In addition to age differences in the size and direction of responses to changing family composition, the paper highlights significant differences across product groups. These effects are more muted in larger households.

  7. MICROECONOMIC ADJUSTMENTS OF HOUSEHOLDS TO MACROECONOMIC SHOCKS: HOUSEHOLD LEVEL WELFARE IMPACTS OF THE INDONESIAN ECONOMIC CRISIS

    Fabiosa, Jacinto F.; Jensen, Helen H.

    2002-01-01

    The macroeconomic crisis in Indonesia in the late 1990s reduced real per capita income by 74 percent and increased prices of some food groups by 92-445 percent. Adjustments in the consumption decisions of households during this period was analyzed using SUSENAS data. The data showed a very strong pattern of adjustment in the consumption decisions of households. That is, households substituted away from more expensive food groups to cheaper alternatives. Of the nine food groups examined, per c...

  8. Household Formation, Poverty and Unemployment – The Case of Rural Households in South Africa

    Sonja Keller

    2004-01-01

    The paper examines household formation and composition decisions within the context of risk reduction and risk mitigation strategies of the poor in South Africa. A multi-level heckprobit estimator is employed in order to capture the influence of various factors at the individual, household and regional level, and we focus on the implications of the presence of pensioners and the unemployment on household composition and structure. Results are consistent with earlier findings that pensions are...

  9. Rising Food Insecurity: Dimensions in Farm Households

    Okezie C. Austin; Aloysius C. Nwosu; Amir H. Baharuddin

    2011-01-01

    Problem statement: Nigeria runs the risk of slowing further progress toward the achievement of MDG-1 to eradicate extreme hunger and poverty; the fourth goal, to reduce child mortality since over 30% of child deaths are attributable to malnutrition and the fifth goal relating to reduction in maternal mortality. This study evaluated the manifestation of food insecurity in households in Abia State, Nigeria. Approach: Systematic sampling was adopted in selecting households from the three geopoli...

  10. Do disaster expectations explain household portfolios?

    Alan, Sule

    2012-01-01

    Quantitative Economics 3 (2012), 1–28 1759-7331/20120001 Do disaster expectations explain household portfolios? Sule Alan Faculty of Economics and CFAP, University of Cambridge and College of Administrative Sciences, Koc University It has been argued that rare economic disasters can explain most asset pricing puzzles. If this is the case, perceived risk associated with a disaster in stock mar-kets should be revealed in household portfolios. That is, the framework that sol...

  11. A Comparison of Farm and Nonfarm Households

    Katchova, Ani L.

    2005-01-01

    This study compares the economic well-being of farm and nonfarm households using data from the 2001 Agricultural Resource Management Survey and the 2001 Survey of Consumer Finances. Comparisons are made in terms of income and wealth using Tukey-Kramer mean separation tests, regression analysis, and Gini coefficients. The results show that income and wealth of rural residence and intermediate farms are comparable to those of nonfarm households without businesses, while the well-being of commer...

  12. Sustainable reverse logistics for household plastic waste

    Bing, X.

    2014-01-01

    Summary of the thesis titled “Sustainable Reverse Logistics for Household Plastic Waste” PhD Candidate: Xiaoyun Bing Recycled plastic can be used in the manufacturing of plastic products to reduce the use of virgin plastics material. The cost of recycled plastics is usually lower than that of virgin plastics. Therefore, it is environmentally and economically beneficial to improve the plastic recycling system to ensure more plastic waste from households is properly collected and pr...

  13. Questions about Household Consumption in Surveys

    Savić Mirko

    2007-01-01

    Household total expenditure (consumption) is a very important phenomenon in many research areas. The problem is how to get precise information about the consumption from each household and at the same time not to make the questionnaire so long and involved that it becomes a burden to the respondent. In this paper is evidence from several sources on the usefulness of recall consumption questions. Valid information can be collected by adding specific recall questions to general purpose surveys....

  14. Preventing epidemics in a community of households.

    Hall, R; Becker, N G

    1996-01-01

    The occurrence of epidemics of vaccine-preventable diseases, and the immunization coverage required to prevent them, is affected by the presence of households and heterogeneity in the community. We consider a community where individuals live in households and are of different types, according to infectivity and/or susceptibility to infection. We describe a method for computing the critical immunization coverage to prevent epidemics in such communities and discuss the effectiveness of immuniza...

  15. Banded Householder representation of linear subspaces

    Irving, Geoffrey

    2011-01-01

    We show how to compactly represent any $n$-dimensional subspace of $R^m$ as a banded product of Householder reflections using $n(m - n)$ floating point numbers. This is optimal since these subspaces form a Grassmannian space $Gr_n(m)$ of dimension $n(m - n)$. The representation is stable and easy to compute: any matrix can be factored into the product of a banded Householder matrix and a square matrix using two to three QR decompositions.

  16. Researches of odour emitted by household waste

    Eglė Marčiulaitienė; Tadas Lukauskas

    2015-01-01

    The article deals with odour emitted by household waste, the chemical composition of household waste. The experiment was made with food waste (1000 g) placed in 5 litter containers. Food waste was containing products of animal origin (meat, fish, dairy products) and plant origin (vegetables, fruit) waste. Time of the experiment was 14 days 19±3 °C at environment temperature. Odour concentration is determined by dynamic olfactometry method. Studies have shown that the strongest odour of all ho...

  17. Equity in dental care among Canadian households

    Grootendorst Paul; Quiñonez Carlos

    2011-01-01

    Abstract Background Changes in third party financing, whether public or private, are linked to a household's ability to access dental care. By removing costs at point of purchase, changes in financing influence the need to reach into one's pocket, thus facilitating or limiting access. This study asks: How have historical changes in dental care financing influenced household out-of-pocket expenditures for dental care in Canada? Methods This is a mixed methods study, comprised of an historical ...

  18. Financial literacy, retirement planning, and household wealth

    Rooij, Maarten van; Lusardi, Annamaria; Alessie, Rob J. M.

    2011-01-01

    There is ample empirical evidence documenting widespread financial illiteracy and limited pension knowledge. At the same time, the distribution of wealth is widely dispersed and many workers arrive on the verge of retirement with few or no personal assets. In this paper, we investigate the relationship between financial literacy and household net worth, relying on comprehensive measures of financial knowledge designed for a special module of the DNB (De Nederlandsche Bank) Household Survey. O...

  19. Property Rights and Intra-Household Bargaining

    Shing-Yi Wang

    2013-01-01

    This paper examines whether an individual-level transfer of property rights increases the individual's bargaining power within the household. The question is analyzed in the context of a housing reform that occurred in China that gave existing tenants the opportunity to purchase the homes that they had been renting from their state employers. The rights to each housing unit were granted to a particular employee, so property rights were defined at the individual level rather than the household...

  20. Modeling Social Ties and Household Mobility

    Metcalf, Sara S.

    2013-01-01

    Underlying the aggregate phenomena of persistent problems such as urban sprawl and spatial socio-economic disparity is the individual choice of where to live. This study develops an agent-based model to simulate social and economic influences on neighborhood choice. With Danville, Illinois as an empirical context, a pattern-oriented approach is employed to examine the role of social ties in shaping intra-urban household mobility. In the model, household agents decide whether and where to relo...

  1. AAS 228: Day 2 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  2. Technetium recovery from high alkaline solution

    Nash, Charles A.

    2016-07-12

    Disclosed are methods for recovering technetium from a highly alkaline solution. The highly alkaline solution can be a liquid waste solution from a nuclear waste processing system. Methods can include combining the solution with a reductant capable of reducing technetium at the high pH of the solution and adding to or forming in the solution an adsorbent capable of adsorbing the precipitated technetium at the high pH of the solution.

  3. Alkaline tolerant dextranase from streptomyces anulatus

    Decker, Stephen R.; Adney, William S.; Vinzant, Todd B.; Himmel, Michael E.

    2003-01-01

    A process for production of an alkaline tolerant dextranase enzyme comprises culturing a dextran-producing microorganism Streptomyces anulatus having accession no. ATCC PTA-3866 to produce an alkaline tolerant dextranase, Dex 1 wherein the protein in said enzyme is characterized by a MW of 63.3 kDa and Dex 2 wherein its protein is characterized by a MW of 81.8 kDa.

  4. Domestic energy use and householders' energy behaviour

    This paper discusses domestic energy use and energy behaviour. It shows some improvement in domestic energy consumption and adoption of good energy practice. The survey conducted indicated that 35% of homes could improve their energy efficiency by improved tank insulation. In the last 5 years condensing boilers have been installed only in 3% of homes, indicating that householders are unaware of their advantages. Although 88% of surveyed homes had purchased a major appliance in the last 2 years, only 16% had any idea of the energy rating of their new appliances. Use of energy saving light bulbs is predominant in kitchens compared to other rooms. 70–80% of householders undertook some kind of day-to-day energy efficiency measures. 20–35% of householders would like to invest in energy-saving measures but found cost to be a key barrier. Approximately 84% of those surveyed were unaware of the energy rating of their household appliances. Price and brand were the most important factors determining the purchase of a new appliance. Significant energy-saving could be achieved by providing appropriate information to the general public regarding temperature control, efficiency of appliances and energy-saving heating systems. - Highlights: ▶ Good practice in household energy use is being adopted but actual use is rising. ▶ Cost is dominant in energy related decisions purchasing of household appliances. ▶ Energy behaviour is improving but level of awareness needs more work.

  5. Household energy requirement and value patterns

    For an effective consumer energy policy, it is important to know why some households require more energy than others. The aim of the study described here was to examine whether there is a relationship between the total household energy requirement, on one hand, and value patterns, the motivation to save energy or the problem perception of climate change, on the other. To examine these relationships, we held a consumer survey among 2304 respondent households. We did not find significant differences in the energy requirement of groups of households with different value patterns, taking into account the differences in the socio-economic situation of households. Only for the 'motivation to save energy' we did find that the least motivated group requires 10 GJ more energy than the average and most motivated groups; this is about 4% of the total household energy requirement. This means that a self-regulating energy policy, solely based on the fact that a strategy of internalising environmental responsibility will not be effective in saving energy. There are indications that a social dilemma is one of the reasons why people's consumption patterns do not conform to their value patterns, problem perception or motivation to save energy

  6. Chemical Associations of Lead, Cadmium, Chromium, Nickel and Zinc in Household Dust of Kathmandu Metropolitan Area

    Dust samples were collected from roadside houses of seven major locations in Kathmandu metropolitan area and trace element compositions was determined by atomic absorption spectrophotometer (AAS). Results show significant concentrations of Zn, Pb, Ni, Cr and Cd in the test household dusts as compared to the undisturbed (control) area. The mean concentrations of all the studied locations were found to be 76.2 mg/kg for Zn, 40.6 mg/kg for Pb, 29.9 mg/kg for Cr, 23.9 mg/kg for Ni and 8.2 mg/kg for Cd, respectively. Increase in these trace metals in the dust can most likely be attributed to rapid urbanization, increased vehicle emissions to the atmosphere and other anthropogenic sources. Elevated Zn abundance in household dust probably originates from traffic sources. Besides, enrichment factor reveals that the household dust was most severely affected by Cd in almost all the locations. Also, correlations between metal levels in dust samples for all the metals were investigated. (author)

  7. Alkaline Water and Longevity: A Murine Study

    Magro, Massimiliano; Corain, Livio; Ferro, Silvia; Baratella, Davide; Bonaiuto, Emanuela; Terzo, Milo; Corraducci, Vittorino; Salmaso, Luigi; Vianello, Fabio

    2016-01-01

    The biological effect of alkaline water consumption is object of controversy. The present paper presents a 3-year survival study on a population of 150 mice, and the data were analyzed with accelerated failure time (AFT) model. Starting from the second year of life, nonparametric survival plots suggest that mice watered with alkaline water showed a better survival than control mice. Interestingly, statistical analysis revealed that alkaline water provides higher longevity in terms of “deceleration aging factor” as it increases the survival functions when compared with control group; namely, animals belonging to the population treated with alkaline water resulted in a longer lifespan. Histological examination of mice kidneys, intestine, heart, liver, and brain revealed that no significant differences emerged among the three groups indicating that no specific pathology resulted correlated with the consumption of alkaline water. These results provide an informative and quantitative summary of survival data as a function of watering with alkaline water of long-lived mouse models. PMID:27340414

  8. Households Touched by Crime, 1987. Bureau of Justice Statistics Bulletin.

    Rand, Michael R.; And Others

    For the year 1987, 24.4 % of American households were touched by crime. A household is considered touched by crime if during the year it was affected by a burglarly, auto theft, or household theft or if a household member was raped, robbed, or assaulted or was a victim of personal theft, no matter where the crime occurred. These offenses, which…

  9. 21 CFR 864.7660 - Leukocyte alkaline phosphatase test.

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Leukocyte alkaline phosphatase test. 864.7660... Leukocyte alkaline phosphatase test. (a) Identification. A leukocyte alkaline phosphatase test is a device used to identify the enzyme leukocyte alkaline phosphatase in neutrophilic granulocytes...

  10. Households' characteristics and the modes of remittances in Bangladesh

    Chowdhury, Mehdi

    2014-01-01

    The modes of remittances of households in Bangladesh have been categorised as `No Remit- tances', `Internal Remittances' and `International Remittances'. This paper using a Multinomial Logit Model studies the associations between these modes and the households' basic character- istics. The study reveals that household level variables like rural-urban locations, age and sex of the households heads, religion, ratio of male, adult and young members etc. are potentially significant in households'...