WorldWideScience

Sample records for aa genome oryza

  1. Rapid diversification of five Oryza AA genomes associated with rice adaptation

    Zhang, Qun-Jie; Zhu, Ting; Xia, En-Hua; Shi, Chao; Liu, Yun-Long; Zhang, Yun; Liu, Yuan; Jiang, Wen-Kai; Zhao, You-Jie; Mao, Shu-Yan; Zhang, Li-Ping; Huang, Hui; Jiao, Jun-Ying; Xu, Ping-Zhen; Yao, Qiu-Yang

    2014-01-01

    Asian rice (Oryza sativa) is among the world’s most important crops. The genus Oryza has become a model for the study of plant genome structure, function, and evolution. We have undertaken de novo, full-genome sequence analysis of five diploid AA-genome species that are closely related to O. sativa. These species are native to quite different environments, representing four continents, thus exhibiting very different adaptations. Our studies identify specific genetic changes, in both gene copy...

  2. Relationships of wild and domesticated rices (Oryza AA genome species) based upon whole chloroplast genome sequences

    Wambugu, Peterson W.; Marta Brozynska; Agnelo Furtado; Daniel L. Waters; Robert J. Henry

    2015-01-01

    Rice is the most important crop in the world, acting as the staple food for over half of the world’s population. The evolutionary relationships of cultivated rice and its wild relatives have remained contentious and inconclusive. Here we report on the use of whole chloroplast sequences to elucidate the evolutionary and phylogenetic relationships in the AA genome Oryza species, representing the primary gene pool of rice. This is the first study that has produced a well resolved and strongly su...

  3. Complete chloroplast and ribosomal sequences for 30 accessions elucidate evolution of Oryza AA genome species

    Kyunghee Kim; Sang-Choon Lee; Junki Lee; Yeisoo Yu; Kiwoung Yang; Beom-Soon Choi; Hee-Jong Koh; Nomar Espinosa Waminal; Hong-Il Choi; Nam-Hoon Kim; Woojong Jang; Hyun-Seung Park; Jonghoon Lee; Hyun Oh Lee; Ho Jun Joh

    2015-01-01

    Cytoplasmic chloroplast (cp) genomes and nuclear ribosomal DNA (nR) are the primary sequences used to understand plant diversity and evolution. We introduce a high-throughput method to simultaneously obtain complete cp and nR sequences using Illumina platform whole-genome sequence. We applied the method to 30 rice specimens belonging to nine Oryza species. Concurrent phylogenomic analysis using cp and nR of several of specimens of the same Oryza AA genome species provides insight into the evo...

  4. Relationships of wild and domesticated rices (Oryza AA genome species) based upon whole chloroplast genome sequences.

    Wambugu, Peterson W; Brozynska, Marta; Furtado, Agnelo; Waters, Daniel L; Henry, Robert J

    2015-01-01

    Rice is the most important crop in the world, acting as the staple food for over half of the world's population. The evolutionary relationships of cultivated rice and its wild relatives have remained contentious and inconclusive. Here we report on the use of whole chloroplast sequences to elucidate the evolutionary and phylogenetic relationships in the AA genome Oryza species, representing the primary gene pool of rice. This is the first study that has produced a well resolved and strongly supported phylogeny of the AA genome species. The pan tropical distribution of these rice relatives was found to be explained by long distance dispersal within the last million years. The analysis resulted in a clustering pattern that showed strong geographical differentiation. The species were defined in two primary clades with a South American/African clade with two species, O glumaepatula and O longistaminata, distinguished from all other species. The largest clade was comprised of an Australian clade including newly identified taxa and the African and Asian clades. This refined knowledge of the relationships between cultivated rice and the related wild species provides a strong foundation for more targeted use of wild genetic resources in rice improvement and efforts to ensure their conservation. PMID:26355750

  5. Complete chloroplast and ribosomal sequences for 30 accessions elucidate evolution of Oryza AA genome species

    Kim, Kyunghee; Lee, Sang-Choon; Lee, Junki; Yu, Yeisoo; Yang, Kiwoung; Choi, Beom-Soon; Koh, Hee-Jong; Waminal, Nomar Espinosa; Choi, Hong-Il; Kim, Nam-Hoon; Jang, Woojong; Park, Hyun-Seung; Lee, Jonghoon; Lee, Hyun Oh; Joh, Ho Jun; Lee, Hyeon Ju; Park, Jee Young; Perumal, Sampath; Jayakodi, Murukarthick; Lee, Yun Sun; Kim, Backki; Copetti, Dario; Kim, Soonok; Kim, Sunggil; Lim, Ki-Byung; Kim, Young-Dong; Lee, Jungho; Cho, Kwang-Su; Park, Beom-Seok; Wing, Rod A.; Yang, Tae-Jin

    2015-01-01

    Cytoplasmic chloroplast (cp) genomes and nuclear ribosomal DNA (nR) are the primary sequences used to understand plant diversity and evolution. We introduce a high-throughput method to simultaneously obtain complete cp and nR sequences using Illumina platform whole-genome sequence. We applied the method to 30 rice specimens belonging to nine Oryza species. Concurrent phylogenomic analysis using cp and nR of several of specimens of the same Oryza AA genome species provides insight into the evolution and domestication of cultivated rice, clarifying three ambiguous but important issues in the evolution of wild Oryza species. First, cp-based trees clearly classify each lineage but can be biased by inter-subspecies cross-hybridization events during speciation. Second, O. glumaepatula, a South American wild rice, includes two cytoplasm types, one of which is derived from a recent interspecies hybridization with O. longistminata. Third, the Australian O. rufipogan-type rice is a perennial form of O. meridionalis. PMID:26506948

  6. Seed Length Controlled by Same Locus in Four Different AA Genome Species of Genus Oryza

    ZHANG Yu; LI Jing; ZHOU Jia-wu; XU Peng; DENG Xian-neng; YANG Fei; DENG Wei; HU Feng-yi; TAO Da-yun

    2014-01-01

    To broaden the genetic basis and overcome the yield plateau in Asian cultivated rice, the exploitation and utilization of favorable alleles from rice species with the AA genome has become important and urgent in modern breeding programs. Four different interspecific populations were used to detect quantitative trait locus (QTL) for seed length, including a BC4F2 population derived from Oryza glumaepatula crossed with Dianjingyou 1 (a japonica cultivar), a BC4F2 population derived from O. nivara crossed with Dianjingyou 1, a BC7F1 population derived from a cross between O. longistaminata and RD23 (an indica cultivar), and a BC8F1 population derived from a cross between O. glaberrima and Dianjingyou 1. The QTLs for seed length in four different populations were termed as SL-3a, SL-3b, SL-3c and SL-3d, respectively. They had good collinearity and accounted for 49% to 60% of the phenotypic variations. Sequencing data indicated that four QTLs were different alleles of GS3 which were responsible for the seed length variation between O. sativa and its four AA genome relatives. These results will be valuable for confirming the evolution of GS3 and also be helpful for rice breeding.

  7. Genomic-associated Markers and comparative Genome Maps of Xanthomonas oryzae pv. oryzae and X. oryzae pv. oryzicola.

    Feng, Wenjie; Wang, Yi; Huang, Lisha; Feng, Chuanshun; Chu, Zhaohui; Ding, Xinhua; Yang, Long

    2015-09-01

    Xanthomonas oryzae pv. oryzae (Xoo) and X. oryzae pv. oryzicola (Xoc) cause two major seed quarantine diseases in rice, bacterial blight and bacterial leaf streak, respectively. Xoo and Xoc share high similarity in genomic sequence, which results in hard differentiation of the two pathogens. Genomic-associated Markers and comparative Genome Maps database (GMGM) is an integrated database providing comprehensive information including compared genome maps and full genomic-coverage molecular makers of Xoo and Xoc. This database was established based on bioinformatic analysis of complete sequenced genomes of several X. oryzae pathovars of which the similarity of the genomes was up to 91.39 %. The program was designed with a series of specific PCR primers, including 286 pairs of Xoo dominant markers, 288 pairs of Xoc dominant markers, and 288 pairs of Xoo and Xoc co-dominant markers, which were predicted to distinguish two pathovars. Test on a total of 40 donor pathogen strains using randomly selected 120 pairs of primers demonstrated that over 52.5 % of the primers were efficacious. The GMGM web portal ( http://biodb.sdau.edu.cn/gmgm/ ) will be a powerful tool that can present highly specific diagnostic markers, and it also provides information about comparative genome maps of the two pathogens for future evolution study. PMID:26093644

  8. Genome sequence and rapid evolution of the rice pathogen Xanthomonas oryzae pv. oryzae PXO99A

    Szurek Boris

    2008-05-01

    Full Text Available Abstract Background Xanthomonas oryzae pv. oryzae causes bacterial blight of rice (Oryza sativa L., a major disease that constrains production of this staple crop in many parts of the world. We report here on the complete genome sequence of strain PXO99A and its comparison to two previously sequenced strains, KACC10331 and MAFF311018, which are highly similar to one another. Results The PXO99A genome is a single circular chromosome of 5,240,075 bp, considerably longer than the genomes of the other strains (4,941,439 bp and 4,940,217 bp, respectively, and it contains 5083 protein-coding genes, including 87 not found in KACC10331 or MAFF311018. PXO99A contains a greater number of virulence-associated transcription activator-like effector genes and has at least ten major chromosomal rearrangements relative to KACC10331 and MAFF311018. PXO99A contains numerous copies of diverse insertion sequence elements, members of which are associated with 7 out of 10 of the major rearrangements. A rapidly-evolving CRISPR (clustered regularly interspersed short palindromic repeats region contains evidence of dozens of phage infections unique to the PXO99A lineage. PXO99A also contains a unique, near-perfect tandem repeat of 212 kilobases close to the replication terminus. Conclusion Our results provide striking evidence of genome plasticity and rapid evolution within Xanthomonas oryzae pv. oryzae. The comparisons point to sources of genomic variation and candidates for strain-specific adaptations of this pathogen that help to explain the extraordinary diversity of Xanthomonas oryzae pv. oryzae genotypes and races that have been isolated from around the world.

  9. Construction of Oryza Sativa genome contigs by fingerprint strategy

    TAOQUAZHOU; GUOFANHONG; 等

    1995-01-01

    We described the construction of BAC contigs of the genome of a indica variety of Oryza sativa.Guang Lu Ai 4. An entire representative(Sixfold coverage of rice chromosomes)and genetically stable BAC library of rice genome constructed in this lab has been systematically analysed by restriction enzyme fragmentation and polyacrylamide gel electrophoresis.And all the images thus obtained were subject to image-processing,which consisted of preliminary location of bands,cooperative tracking of lanes by correlation of adjacent bads.a precise densitometric pass,alignment at the marker bands with the standard,optional interactive editing,and normalization of the accepted bands.The contigs were generated based on the Computer Software specially designed for genome mapping.The number of contigs with 600 kb in length on average was 464.of contigs with 1000kb in length on average was 107; of contigs with 1500 kb in length on average was Construction of Oryza Sativa genome contigs.23.Therefor,all the contigs we have obtained ampunted up to 420 megabases in length.Considering the size of rice genome(430 megabased),the contigs generated in this lab have covered nearly 98% of the rice genome.We are now in the process of mapping the contigs to chromosomes.

  10. Development and validation of cross-transferable and polymorphic DNA markers for detecting alien genome introgression in Oryza sativa from Oryza brachyantha.

    Ray, Soham; Bose, Lotan K; Ray, Joshitha; Ngangkham, Umakanta; Katara, Jawahar L; Samantaray, Sanghamitra; Behera, Lambodar; Anumalla, Mahender; Singh, Onkar N; Chen, Meingsheng; Wing, Rod A; Mohapatra, Trilochan

    2016-08-01

    African wild rice Oryza brachyantha (FF), a distant relative of cultivated rice Oryza sativa (AA), carries genes for pests and disease resistance. Molecular marker assisted alien gene introgression from this wild species to its domesticated counterpart is largely impeded due to the scarce availability of cross-transferable and polymorphic molecular markers that can clearly distinguish these two species. Availability of the whole genome sequence (WGS) of both the species provides a unique opportunity to develop markers, which are cross-transferable. We observed poor cross-transferability (~0.75 %) of O. sativa specific sequence tagged microsatellite (STMS) markers to O. brachyantha. By utilizing the genome sequence information, we developed a set of 45 low cost PCR based co-dominant polymorphic markers (STS and CAPS). These markers were found cross-transferrable (84.78 %) between the two species and could distinguish them from each other and thus allowed tracing alien genome introgression. Finally, we validated a Monosomic Alien Addition Line (MAAL) carrying chromosome 1 of O. brachyantha in O. sativa background using these markers, as a proof of concept. Hence, in this study, we have identified a set molecular marker (comprising of STMS, STS and CAPS) that are capable of detecting alien genome introgression from O. brachyantha to O. sativa. PMID:27299359

  11. Characterization of Interspecific Hybrids Between Oryza sativa L. and Three Wild Rice Species of China by Genomic In Situ Hybridization

    Guang-Xuan Tan; Zhi-Yong Xiong; Hua-Jun Jin; Gang Li; Li-Li Zhu; Li-Hui Shu; Guang-Cun He

    2006-01-01

    In the genus Oryza, interspecific hybrids are useful bridges for transferring the desired genes from wild species to cultivated rice (Oryza sativa L.). In the present study, hybrids between O. sativa (AA genome)and three Chinese wild rices, namely O. rufipogon (AA genome), O. officinalis (CC genome), and O. meyeriana (GG genome), were produced. Agricultural traits of the F1 hybrids surveyed were intermediate between their parents and appreciably resembled wild rice parents. Except for the O. sativa × O. rufipogon hybrid,the other F1 hybrids were completely sterile. Genomic in situ hybridization (GISH) was used for hybrid verification. Wild rice genomic DNAs were used as probes and cultivated rice DNA was used as a block. With the exception of O. rufipogon chromosomes, this method distinguished the other two wild rice and cultivated rice chromosomes at the stage of mitotic metaphase with different blocking ratios. The results suggest that a more distant phylogenetic relationship exists between O. meyeriana and O. sativa and that O. rufipogon and O. sativa share a high degree of sequence homology. The average mitotic chromosome length of O. officinalis and O. meyeriana was 1.25- and 1.51-fold that of O. sativa, respectively. 4',6'-Diamidino2-phenylindole staining showed that the chromosomes of O. officinalis and O. meyeriana harbored more heterochromatin, suggesting that the C and G genomes were amplified with repetitive sequences compared with the A genome. Although chromocenters formed by chromatln compaction were detected with wild rice-specific signals corresponding to the C and G genomes in discrete domains of the F1 hybrid interphase nuclei, the size and number of O. meyeriana chromocenters were bigger and greater than those of O. officinalis. The present results provide an important understanding of the genomic relationships and a tool for the transfer of useful genes from three native wild rice species in China to cultivars.

  12. Comparative analysis of A, B,C and D genomes in the genus Oryza with C0t-1 DNA of C genome

    LAN Weizhen; QIN Rui; LI Gang; HE Guangcun

    2006-01-01

    Fluorescence in situ hybridization (FISH)was applied to somatic chromosomes preparations of Oryza officinalis Wall. (CC), O. sativa L. (AA)×O. officinalis F1 hybrid (AC), backcross progenies BC1 (AAC and ACC), O. latifolia Desv. (CCDD), O. alta Swallen (CCDD) and O. punctata Kotschy (BBCC)with a labelled probe of Cot-1 DNA from O. officinalis.In O. officinalis, the homologous chromosomes showed similar signal bands probed by C0t-1 DNA and karyotype analysis was conducted based on the band patterns. Using no blocking DNA, the probe identified the chromosomes of C genome clearly, but detected few signals on chromosomes of A genome in the F1 hybrid and two backcross progenies of BC1.It is obvious that the highly and moderately repetitive DNA sequences were considerably different between C and A genomes. The chromosomes of C genome were also discriminated from the chromosomes of D-and B-genome in the tetraploid species O. latifolia, O.alta and O. punctata by C0t-1 DNA-FISH. Comparison of the fluorescence intensity on the chromosomes of B, C and D genomes in O. latifolia, O. alta,and O. punctata indicated that the differentiations between C and D genomes are less than that between C and B genomes. The relationship between C and D genomes in O. alta is closer than that of C and D genomes in O. latifolia. This would be one of the causes for the fact that both the genomes are of the same karyotype (CCDD) but belong to different species. The above results showed that the C0t-1 DNA had a high specificity of genome and species. In this paper, the origin of allotetraploid in genus Oryza is also discussed.

  13. A Microarray Based Genomic Hybridization Method for Identification of New Genes in Plants: Case Analyses of Arabidopsis and Oryza

    Chuanzhu Fan; Maria D. Vibranovski; Ying Chen; Manyuan Long

    2007-01-01

    To systematically estimate the gene duplication events in closely related species, we have to use comparative genomic approaches, either through genomic sequence comparison or comparative genomic hybridization (CGH). Given the scarcity of complete genomic sequences of plant species, in the present study we adopted an array based CGH to investigate gene duplications in the genus Arabidopsis. Fragment genomic DNA from four species, namely Arabidopsis thaliana, A. lyrata subsp. lyrata, A. lyrata subsp. petraea, and A. halleri, was hybridized to Affymetrix (Santa Clara, CA, USA) tiling arrays that are designed from the genomic sequences of A. thaliana. Pairwise comparisons of signal intensity were made to infer the potential duplicated candidates along each phylo-genetic branch. Ninety-four potential candidates of gene duplication along the genus were identified. Among them, the majority (69 of 94) were A. thaliana lineage specific. This result indicates that the array based CGH approach may be used to identify candidates of duplication in other plant genera containing closely related species, such as Oryza, particularly for the AA genome species. We compared the degree of gene duplication through retrotransposon between O. sativa and A. thaliana and found a strikingly higher number of chimera retroposed genes in rice. The higher rate of gene duplication through retroposition and other mechanisms may indicate that the grass species is able to adapt to more diverse environments.

  14. Genome analysis of rice-blast fungus Magnaporthe oryzae field isolates from southern India

    Malali Gowda; Meghana D. Shirke; Mahesh, H. B.; Pinal Chandarana; Anantharamanan Rajamani; Chattoo, Bharat B

    2015-01-01

    The Indian subcontinent is the center of origin and diversity for rice (Oryza sativa L.). The O. sativa ssp. indica is a major food crop grown in India, which occupies the first and second position in area and production, respectively. Blast disease caused by Magnaporthe oryzae is a major constraint to rice production. Here, we report the analysis of genome architecture and sequence variation of two field isolates, B157 and MG01, of the blast fungus from southern India. The 40 Mb genome of B1...

  15. Improved annotation through genome-scale metabolic modeling of Aspergillus oryzae

    Vongsangnak, Wanwipa; Olsen, Peter; Hansen, Kim;

    2008-01-01

    Background: Since ancient times the filamentous fungus Aspergillus oryzae has been used in the fermentation industry for the production of fermented sauces and the production of industrial enzymes. Recently, the genome sequence of A. oryzae with 12,074 annotated genes was released but the number...... of hypothetical proteins accounted for more than 50% of the annotated genes. Considering the industrial importance of this fungus, it is therefore valuable to improve the annotation and further integrate genomic information with biochemical and physiological information available for this microorganism and other...... related fungi. Here we proposed the gene prediction by construction of an A. oryzae Expressed Sequence Tag (EST) library, sequencing and assembly. We enhanced the function assignment by our developed annotation strategy. The resulting better annotation was used to reconstruct the metabolic network leading...

  16. Rapid turnover of antimicrobial-type cysteine-rich protein genes in closely related Oryza genomes.

    Shenton, Matthew R; Ohyanagi, Hajime; Wang, Zi-Xuan; Toyoda, Atsushi; Fujiyama, Asao; Nagata, Toshifumi; Feng, Qi; Han, Bin; Kurata, Nori

    2015-10-01

    Defensive and reproductive protein genes undergo rapid evolution. Small, cysteine-rich secreted peptides (CRPs) act as antimicrobial agents and function in plant intercellular signaling and are over-represented among reproductively expressed proteins. Because of their roles in defense, reproduction and development and their presence in multigene families, CRP variation can have major consequences for plant phenotypic and functional diversification. We surveyed the CRP genes of six closely related Oryza genomes comprising Oryza sativa ssp. japonica and ssp. indica, Oryza glaberrima and three accessions of Oryza rufipogon to observe patterns of evolution in these gene families and the effects of variation on their gene expression. These Oryza genomes, like other plant genomes, have accumulated large reservoirs of CRP sequences, comprising 26 groups totaling between 676 and 843 genes, in contrast to antimicrobial CRPs in animal genomes. Despite the close evolutionary relationships between the genomes, we observed rapid changes in number and structure among CRP gene families. Many CRP sequences are in gene clusters generated by local duplications, have undergone rapid turnover and are more likely to be silent or specifically expressed. By contrast, conserved CRP genes are more likely to be highly and broadly expressed. Variable CRP genes created by repeated duplication, gene modification and inactivation can gain new functions and expression patterns in newly evolved gene copies. For the CRP proteins, the process of gain/loss by deletion or duplication at gene clusters seems to be an important mechanism in evolution of the gene families, which also contributes to their expression evolution. PMID:25842177

  17. Genomic organization of a novel victorivirus from the rice blast fungus Magnaporthe oryzae.

    Tang, Lihua; Hu, Yanping; Liu, Lijiang; Wu, Songsong; Xie, Jiatao; Cheng, Jiasen; Fu, Yanping; Zhang, Guoming; Ma, Juntao; Wang, Yongli; Zhang, Liyan

    2015-11-01

    Two double-stranded RNA (dsRNA) mycoviruses were found in isolate QSP5 of the rice blast fungus Magnaporthe oryzae. Sequence analysis of the two dsRNA mycoviruses revealed that one is closely related to Magnaporthe oryzae virus 2 (MoV2), and the other one is related to Magnaporthe oryzae chrysovirus 1-A (MoCV1-A). Therefore, they were named Magnaporthe oryzae virus 3 (MoV3) and Magnaporthe oryzae chrysovirus 1-C (MoCV1-C), respectively. In this paper, the molecular and structural characteristics of MoV3 were analyzed in detail. The full genome sequence (5181 bp) of MoV3 was obtained by cDNA cloning. Sequence analysis indicated that MoV3 has two overlapping open reading frames (ORF1 and ORF2). The 5'-proximal ORF1 encodes a putative coat protein (CP) with a molecular weight of 80,939 Da; the 3'-proximal ORF2 encodes a putative RNA-dependent RNA polymerase (RdRp) with a molecular weight of 90,506 Da. The stop codon of ORF1 overlaps the start codon of ORF2, with the tetranucleotide sequence AUGA, which is characteristic of members of the genus Victorivirus of the family Totiviridae. Phylogenetic analysis of RdRp and CP further supported the view that MoV3, a novel mycovirus, belongs to the genus Victorivirus of the family Totiviridae. PMID:26271150

  18. Genome analysis of rice-blast fungus Magnaporthe oryzae field isolates from southern India

    Malali Gowda

    2015-09-01

    Full Text Available The Indian subcontinent is the center of origin and diversity for rice (Oryza sativa L.. The O. sativa ssp. indica is a major food crop grown in India, which occupies the first and second position in area and production, respectively. Blast disease caused by Magnaporthe oryzae is a major constraint to rice production. Here, we report the analysis of genome architecture and sequence variation of two field isolates, B157 and MG01, of the blast fungus from southern India. The 40 Mb genome of B157 and 43 Mb genome of MG01 contained 11,344 and 11,733 predicted genes, respectively. Genomic comparisons unveiled a large set of SNPs and several isolate specific genes in the Indian blast isolates. Avr genes were analyzed in several sequenced Magnaporthe strains; this analysis revealed the presence of Avr-Pizt and Avr-Ace1 genes in all the sequenced isolates. Availability of whole genomes of field isolates from India will contribute to global efforts to understand genetic diversity of M. oryzae population and to track the emergence of virulent pathotypes.

  19. Genome information of Methylobacterium oryzae, a plant-probiotic methylotroph in the phyllosphere.

    Min-Jung Kwak

    Full Text Available Pink-pigmented facultative methylotrophs in the Rhizobiales are widespread in the environment, and many Methylobacterium species associated with plants produce plant growth-promoting substances. To gain insights into the life style at the phyllosphere and the genetic bases of plant growth promotion, we determined and analyzed the complete genome sequence of Methylobacterium oryzae CBMB20T, a strain isolated from rice stem. The genome consists of a 6.29-Mb chromosome and four plasmids, designated as pMOC1 to pMOC4. Among the 6,274 coding sequences in the chromosome, the bacterium has, besides most of the genes for the central metabolism, all of the essential genes for the assimilation and dissimilation of methanol that are either located in methylotrophy islands or dispersed. M. oryzae is equipped with several kinds of genes for adaptation to plant surfaces such as defense against UV radiation, oxidative stress, desiccation, or nutrient deficiency, as well as high proportion of genes related to motility and signaling. Moreover, it has an array of genes involved in metabolic pathways that may contribute to promotion of plant growth; they include auxin biosynthesis, cytokine biosynthesis, vitamin B12 biosynthesis, urea metabolism, biosorption of heavy metals or decrease of metal toxicity, pyrroloquinoline quinone biosynthesis, 1-aminocyclopropane-1-carboxylate deamination, phosphate solubilization, and thiosulfate oxidation. Through the genome analysis of M. oryzae, we provide information on the full gene complement of M. oryzae that resides in the aerial parts of plants and enhances plant growth. The plant-associated lifestyle of M. oryzae pertaining to methylotrophy and plant growth promotion, and its potential as a candidate for a bioinoculant targeted to the phyllosphere and focused on phytostimulation are illuminated.

  20. Chromatin immunoprecipitation cloning reveals rapid evolutionary patterns of centromeric DNA in Oryza species

    Lee, Hye-Ran; Zhang, Wenli; Langdon, Tim; Jin, Weiwei; Yan, Huihuang; Cheng, Zhukuan; Jiang, Jiming

    2005-01-01

    The functional centromeres of rice (Oryza sativa, AA genome) chromosomes contain two key DNA components: the CRR centromeric retrotransposons and a 155-bp satellite repeat, CentO. However, several wild Oryza species lack the CentO repeat. We developed a chromatin immunoprecipitation-based technique to clone DNA fragments derived from chromatin containing the centromeric histone H3 variant CenH3. Chromatin immunoprecipitation cloning was carried out in the CentO-less species Oryza rhizomatis (...

  1. The Genomes of Oryza sativa: a history of duplications.

    Jun Yu

    2005-02-01

    Full Text Available We report improved whole-genome shotgun sequences for the genomes of indica and japonica rice, both with multimegabase contiguity, or almost 1,000-fold improvement over the drafts of 2002. Tested against a nonredundant collection of 19,079 full-length cDNAs, 97.7% of the genes are aligned, without fragmentation, to the mapped super-scaffolds of one or the other genome. We introduce a gene identification procedure for plants that does not rely on similarity to known genes to remove erroneous predictions resulting from transposable elements. Using the available EST data to adjust for residual errors in the predictions, the estimated gene count is at least 38,000-40,000. Only 2%-3% of the genes are unique to any one subspecies, comparable to the amount of sequence that might still be missing. Despite this lack of variation in gene content, there is enormous variation in the intergenic regions. At least a quarter of the two sequences could not be aligned, and where they could be aligned, single nucleotide polymorphism (SNP rates varied from as little as 3.0 SNP/kb in the coding regions to 27.6 SNP/kb in the transposable elements. A more inclusive new approach for analyzing duplication history is introduced here. It reveals an ancient whole-genome duplication, a recent segmental duplication on Chromosomes 11 and 12, and massive ongoing individual gene duplications. We find 18 distinct pairs of duplicated segments that cover 65.7% of the genome; 17 of these pairs date back to a common time before the divergence of the grasses. More important, ongoing individual gene duplications provide a never-ending source of raw material for gene genesis and are major contributors to the differences between members of the grass family.

  2. The Genomes of Oryza sativa: a history of duplications.

    Yu, Jun; Wang, Jun; Lin, Wei; Li, Songgang; Li, Heng; Zhou, Jun; Ni, Peixiang; Dong, Wei; Hu, Songnian; Zeng, Changqing; Zhang, Jianguo; Zhang, Yong; Li, Ruiqiang; Xu, Zuyuan; Li, Shengting; Li, Xianran; Zheng, Hongkun; Cong, Lijuan; Lin, Liang; Yin, Jianning; Geng, Jianing; Li, Guangyuan; Shi, Jianping; Liu, Juan; Lv, Hong; Li, Jun; Wang, Jing; Deng, Yajun; Ran, Longhua; Shi, Xiaoli; Wang, Xiyin; Wu, Qingfa; Li, Changfeng; Ren, Xiaoyu; Wang, Jingqiang; Wang, Xiaoling; Li, Dawei; Liu, Dongyuan; Zhang, Xiaowei; Ji, Zhendong; Zhao, Wenming; Sun, Yongqiao; Zhang, Zhenpeng; Bao, Jingyue; Han, Yujun; Dong, Lingli; Ji, Jia; Chen, Peng; Wu, Shuming; Liu, Jinsong; Xiao, Ying; Bu, Dongbo; Tan, Jianlong; Yang, Li; Ye, Chen; Zhang, Jingfen; Xu, Jingyi; Zhou, Yan; Yu, Yingpu; Zhang, Bing; Zhuang, Shulin; Wei, Haibin; Liu, Bin; Lei, Meng; Yu, Hong; Li, Yuanzhe; Xu, Hao; Wei, Shulin; He, Ximiao; Fang, Lijun; Zhang, Zengjin; Zhang, Yunze; Huang, Xiangang; Su, Zhixi; Tong, Wei; Li, Jinhong; Tong, Zongzhong; Li, Shuangli; Ye, Jia; Wang, Lishun; Fang, Lin; Lei, Tingting; Chen, Chen; Chen, Huan; Xu, Zhao; Li, Haihong; Huang, Haiyan; Zhang, Feng; Xu, Huayong; Li, Na; Zhao, Caifeng; Li, Shuting; Dong, Lijun; Huang, Yanqing; Li, Long; Xi, Yan; Qi, Qiuhui; Li, Wenjie; Zhang, Bo; Hu, Wei; Zhang, Yanling; Tian, Xiangjun; Jiao, Yongzhi; Liang, Xiaohu; Jin, Jiao; Gao, Lei; Zheng, Weimou; Hao, Bailin; Liu, Siqi; Wang, Wen; Yuan, Longping; Cao, Mengliang; McDermott, Jason; Samudrala, Ram; Wang, Jian; Wong, Gane Ka-Shu; Yang, Huanming

    2005-02-01

    We report improved whole-genome shotgun sequences for the genomes of indica and japonica rice, both with multimegabase contiguity, or almost 1,000-fold improvement over the drafts of 2002. Tested against a nonredundant collection of 19,079 full-length cDNAs, 97.7% of the genes are aligned, without fragmentation, to the mapped super-scaffolds of one or the other genome. We introduce a gene identification procedure for plants that does not rely on similarity to known genes to remove erroneous predictions resulting from transposable elements. Using the available EST data to adjust for residual errors in the predictions, the estimated gene count is at least 38,000-40,000. Only 2%-3% of the genes are unique to any one subspecies, comparable to the amount of sequence that might still be missing. Despite this lack of variation in gene content, there is enormous variation in the intergenic regions. At least a quarter of the two sequences could not be aligned, and where they could be aligned, single nucleotide polymorphism (SNP) rates varied from as little as 3.0 SNP/kb in the coding regions to 27.6 SNP/kb in the transposable elements. A more inclusive new approach for analyzing duplication history is introduced here. It reveals an ancient whole-genome duplication, a recent segmental duplication on Chromosomes 11 and 12, and massive ongoing individual gene duplications. We find 18 distinct pairs of duplicated segments that cover 65.7% of the genome; 17 of these pairs date back to a common time before the divergence of the grasses. More important, ongoing individual gene duplications provide a never-ending source of raw material for gene genesis and are major contributors to the differences between members of the grass family. PMID:15685292

  3. Draft Genome Sequence of "Candidatus Phytoplasma oryzae" Strain Mbita1, the Causative Agent of Napier Grass Stunt Disease in Kenya.

    Fischer, Anne; Santana-Cruz, Ivette; Wambua, Lillian; Olds, Cassandra; Midega, Charles; Dickinson, Matthew; Kawicha, Praphat; Khan, Zeyaur; Masiga, Daniel; Jores, Joerg; Schneider, Bernd

    2016-01-01

    Phytoplasmas are bacterial plant pathogens with devastating impact on agricultural production worldwide. In eastern Africa, Napier grass stunt disease causes serious economic losses in the smallholder dairy industry. This draft genome sequence of " ITALIC! CandidatusPhytoplasma oryzae" strain Mbita1 provides insight into its genomic organization and the molecular basis of pathogenicity. PMID:27103722

  4. Comparative analysis of the genomes of two field isolates of the rice blast fungus Magnaporthe oryzae.

    Minfeng Xue

    Full Text Available Rice blast caused by Magnaporthe oryzae is one of the most destructive diseases of rice worldwide. The fungal pathogen is notorious for its ability to overcome host resistance. To better understand its genetic variation in nature, we sequenced the genomes of two field isolates, Y34 and P131. In comparison with the previously sequenced laboratory strain 70-15, both field isolates had a similar genome size but slightly more genes. Sequences from the field isolates were used to improve genome assembly and gene prediction of 70-15. Although the overall genome structure is similar, a number of gene families that are likely involved in plant-fungal interactions are expanded in the field isolates. Genome-wide analysis on asynonymous to synonymous nucleotide substitution rates revealed that many infection-related genes underwent diversifying selection. The field isolates also have hundreds of isolate-specific genes and a number of isolate-specific gene duplication events. Functional characterization of randomly selected isolate-specific genes revealed that they play diverse roles, some of which affect virulence. Furthermore, each genome contains thousands of loci of transposon-like elements, but less than 30% of them are conserved among different isolates, suggesting active transposition events in M. oryzae. A total of approximately 200 genes were disrupted in these three strains by transposable elements. Interestingly, transposon-like elements tend to be associated with isolate-specific or duplicated sequences. Overall, our results indicate that gain or loss of unique genes, DNA duplication, gene family expansion, and frequent translocation of transposon-like elements are important factors in genome variation of the rice blast fungus.

  5. Mitochondrial Genome Analysis of Wild Rice (Oryza minuta) and Its Comparison with Other Related Species

    Asaf, Sajjad; Khan, Abdul Latif; Khan, Abdur Rahim; Waqas, Muhammad; Kang, Sang-Mo; Khan, Muhammad Aaqil; Shahzad, Raheem; Seo, Chang-Woo; Shin, Jae-Ho; Lee, In-Jung

    2016-01-01

    Oryza minuta (Poaceae family) is a tetraploid wild relative of cultivated rice with a BBCC genome. O. minuta has the potential to resist against various pathogenic diseases such as bacterial blight (BB), white backed planthopper (WBPH) and brown plant hopper (BPH). Here, we sequenced and annotated the complete mitochondrial genome of O. minuta. The mtDNA genome is 515,022 bp, containing 60 protein coding genes, 31 tRNA genes and two rRNA genes. The mitochondrial genome organization and the gene content at the nucleotide level are highly similar (89%) to that of O. rufipogon. Comparison with other related species revealed that most of the genes with known function are conserved among the Poaceae members. Similarly, O. minuta mt genome shared 24 protein-coding genes, 15 tRNA genes and 1 ribosomal RNA gene with other rice species (indica and japonica). The evolutionary relationship and phylogenetic analysis revealed that O. minuta is more closely related to O. rufipogon than to any other related species. Such studies are essential to understand the evolutionary divergence among species and analyze common gene pools to combat risks in the current scenario of a changing environment. PMID:27045847

  6. The organelle genomes of Hassawi rice (Oryza sativa L.) and its hybrid in saudi arabia: genome variation, rearrangement, and origins.

    Zhang, Tongwu; Hu, Songnian; Zhang, Guangyu; Pan, Linlin; Zhang, Xiaowei; Al-Mssallem, Ibrahim S; Yu, Jun

    2012-01-01

    Hassawi rice (Oryza sativa L.) is a landrace adapted to the climate of Saudi Arabia, characterized by its strong resistance to soil salinity and drought. Using high quality sequencing reads extracted from raw data of a whole genome sequencing project, we assembled both chloroplast (cp) and mitochondrial (mt) genomes of the wild-type Hassawi rice (Hassawi-1) and its dwarf hybrid (Hassawi-2). We discovered 16 InDels (insertions and deletions) but no SNP (single nucleotide polymorphism) is present between the two Hassawi cp genomes. We identified 48 InDels and 26 SNPs in the two Hassawi mt genomes and a new type of sequence variation, termed reverse complementary variation (RCV) in the rice cp genomes. There are two and four RCVs identified in Hassawi-1 when compared to 93-11 (indica) and Nipponbare (japonica), respectively. Microsatellite sequence analysis showed there are more SSRs in the genic regions of both cp and mt genomes in the Hassawi rice than in the other rice varieties. There are also large repeats in the Hassawi mt genomes, with the longest length of 96,168 bp and 96,165 bp in Hassawi-1 and Hassawi-2, respectively. We believe that frequent DNA rearrangement in the Hassawi mt and cp genomes indicate ongoing dynamic processes to reach genetic stability under strong environmental pressures. Based on sequence variation analysis and the breeding history, we suggest that both Hassawi-1 and Hassawi-2 originated from the Indonesian variety Peta since genetic diversity between the two Hassawi cultivars is very low albeit an unknown historic origin of the wild-type Hassawi rice. PMID:22870184

  7. Genomic organization and sequence dynamics of the AvrPiz-t locus in Magnaporthe oryzae

    Ping LI; Bin BAI; Hong-yan ZHANG; Heng ZHOU; Bo ZHOU

    2012-01-01

    Plants utilize multiple layers of defense mechanisms to fight against the invasion of diverse pathogens.The R gene mediates resistance,in most cases,dependent on the co-existence of its cognate pathogen-derived avirulence (Avr) gene.The rice blast R gene Piz-t corresponds in gene-for-gene fashion to the Magnaporthe oryzae Avrgene AvrPiz-t.In this study,we determined and compared the genomic sequences surrounding the AvrPiz-t gene in both avirulent and virulent isolates,designating as AvrPiz-t-ZB15 and avrPiz-t-70-15 regions,respectively.The sequence of the AvrPiz-t-ZB15 region is 120966 bp whereas avrPiz-t-70-15 is 146292 bp in length.The extreme sequence similarity and good synteny in gene order and content along with the absence of two predicted genes in the avrPiz-t-70-15 region were observed in the predicted protein-coding regions in the AvrPiz-t locus.Nevertheless,frequent presence/absence and highly dynamic organization of transposable elements (TEs) were identified,representing the major variation of the AvrPiz-t locus between different isolates.Moreover,TEs constitute 27.3% and 43.2%of the genomic contents of the AvrPiz-t-ZB15 and avrPiz-t-70-15 regions,respectively,indicating that TEs contribute largely to the organization and evolution of AvrPiz-t locus.The findings of this study suggest that M.oryzae could benefit in an evolutionary sense from the presence of active TEs in genes conferring avirulence and provide an ability to rapidly change and thus to overcome host R genes.

  8. Single molecule real-time sequencing of Xanthomonas oryzae genomes reveals a dynamic structure and complex TAL (transcription activator-like) effector gene relationships

    Booher, Nicholas J.; Carpenter, Sara C. D.; Sebra, Robert P.; Wang, Li; Salzberg, Steven L.; Leach, Jan E.; Bogdanove, Adam J.

    2016-01-01

    Pathogen-injected, direct transcriptional activators of host genes, TAL (transcription activator-like) effectors play determinative roles in plant diseases caused by Xanthomonas spp. A large domain of nearly identical, 33–35 aa repeats in each protein mediates DNA recognition. This modularity makes TAL effectors customizable and thus important also in biotechnology. However, the repeats render TAL effector (tal) genes nearly impossible to assemble using next-generation, short reads. Here, we demonstrate that long-read, single molecule real-time (SMRT) sequencing solves this problem. Taking an ensemble approach to first generate local, tal gene contigs, we correctly assembled de novo the genomes of two strains of the rice pathogen X. oryzae completed previously using the Sanger method and even identified errors in those references. Sequencing two more strains revealed a dynamic genome structure and a striking plasticity in tal gene content. Our results pave the way for population-level studies to inform resistance breeding, improve biotechnology and probe TAL effector evolution.

  9. Genome-Wide Comparative Analysis and Expression Pattern of TCP Gene Families in Arabidopsis thaliana and Oryza sativa

    Xuan Yao; Hong Ma; Jian Wang; Dabing Zhang

    2007-01-01

    Several TCP genes have been reported to play important roles in plant development; the TCP homologs encode a plant-specific family of putative transcription factors. To understand the evolutionary relationship of TCP genes of Arabidopsis thaliana and Oryza sativa L. (hereafter called rice), we have identified 23 and 22 TCP genes in the Arabidopsls and rice genomes, respectively. Using phylogenetic analysis, we grouped these TCP genes into three classes. In addition, the motifs outside the TCP domain further support the evolutionary relationships among these genes. The genome distribution of the TCP genes strongly supports the hypothesis that genome-wide and tandem duplication contributed to the expansion of the TCP gene family. The expression pattern of the TCP genes was analyzed further, providing useful clues about the function of these genes.

  10. Population structure and diversity of the aa genome of rice based on simple sequence repeats variation in organelle genome

    Maternally inherited mitochondrial and chloroplast genomes based Simple Sequence Repeat (SSR) variations were examined for their contribution to diversity of rice genome. Population structure and diversity analysis based on mitochondria and chloroplast inherited genome has been studied less as compared to nuclear genome inheritance. The present study was designed to evaluate the population structure and diversity of rice grown in Pakistan along with other countries based on maternally inherited mitochondria and chloroplast genome. The mitochondrial and chloroplast genomes were analyzed by using 42 mitochondrial and 20 chloroplast pairs of SSR primers. A slightly higher percentage of polymorphism was observed in chloroplast (30 percentage) than mitochondria (28.57 percentage). The average gene diversity for both mitochondrial and chloroplast was 0.32 oscillating from 0.041 to 0.620. The Polymorphism Information Content (PIC) value ranged from 0.040 to 0.543 with an average of 0.282, while the allelic richness ranged from two to four alleles with an average of 2.779 alleles. Mononucleotide repeats stood first (50 percentage polymorphic) for detecting polymorphism for organelle genomes followed by tri- (25 percentage), tetra- (14.29 percentage) and dinucleotide (12.5 percentage), respectively. Cluster and population structure analysis revealed two groups of accessions. On the basis of our results the AA genome of Asian cultivated rice diverges from the same origin during evolution. (author)

  11. Genome-scale analysis of the high-efficient protein secretion system of Aspergillus oryzae

    Liu, Lifang; Feizi, Amir; Osterlund, Tobias; Hjort, Carsten; Nielsen, Jens

    2014-01-01

    Background: The koji mold, Aspergillus oryzae is widely used for the production of industrial enzymes due to its particularly high protein secretion capacity and ability to perform post-translational modifications. However, systemic analysis of its secretion system is lacking, generally due to the...... related fungal species such as Aspergillus nidulans and Aspergillus niger. To evaluate the defined component list, we performed transcriptome analysis on three a-amylase over-producing strains with varying levels of secretion capacities. Specifically, secretory components involved in the ER...... overproducing amylase. Conclusion: In combination with the transcriptome data, the most complete secretory component list and the putative secretome, we improved the systemic understanding of the secretory machinery of A. oryzae in response to high levels of protein secretion. The roles of many newly predicted...

  12. Identification of rhizome-specific genes by genome-wide differential expression Analysis in Oryza longistaminata

    Li Qiong; Li Lijuan; Zhang Fan; Zhu Linghua; Sun Haixi; Zhang Ting; Zhao Xiuqin; Wang Di; Hu Fengyi; Tao Dayun; Fu Binying; Li Zhikang

    2011-01-01

    Abstract Background Rhizomatousness is a key component of perenniality of many grasses that contribute to competitiveness and invasiveness of many noxious grass weeds, but can potentially be used to develop perennial cereal crops for sustainable farmers in hilly areas of tropical Asia. Oryza longistaminata, a perennial wild rice with strong rhizomes, has been used as the model species for genetic and molecular dissection of rhizome development and in breeding efforts to transfer rhizome-relat...

  13. Genome-wide analysis of basic leucine zipper transcription factor families in Arabidopsis thaliana, Oryza saliva and Populus trichocarpa

    JI Qian; ZHANG Liang-sheng; WANG Yi-fei; WANG Jian

    2009-01-01

    The basic leucine zipper (bZIP) transcription factors form a large gene family that is important in pathogen defense, light and stress signaling, etc. The Completed whole genome sequences of model plants Arabidopsis (Arabidopsis thaliana), rice (Oryza saliva) and poplar (Populus trichocarpa) constitute a valuable resource for genome-wide analysis and genomic comparative analysis, as they are representatives of the two major evolutionary lineages within the angiosperms: the monocotyledons and the dicotyledons. In this study, bioinformatics analysis identified 74, 89 and 88 bZIP genes respectively in Arabidopsis, rice and poplar. Moreover, a comprehensive overview of this gene family is presented, including the gene structure, phylogeny, chromosome distribution, conserved motifs. As a result, the plant bZIPs were organized into 10 subfamilies on basis of phylogenetic relationship. Gene duplication events during the family evolution history were also investigated. And it was further concluded that chromosomal/segmental duplication might have played a key role in gene expansion of bZIP gene family.

  14. The oryza map alignment project: the golden path to unlocking the genetic potential of wild rice species.

    Wing, Rod A; Ammiraju, Jetty S S; Luo, Meizhong; Kim, Hyeran; Yu, Yeisoo; Kudrna, Dave; Goicoechea, Jose L; Wang, Wenming; Nelson, Will; Rao, Kiran; Brar, Darshan; Mackill, Dave J; Han, Bin; Soderlund, Cari; Stein, Lincoln; SanMiguel, Phillip; Jackson, Scott

    2005-09-01

    The wild species of the genus Oryza offer enormous potential to make a significant impact on agricultural productivity of the cultivated rice species Oryza sativa and Oryza glaberrima. To unlock the genetic potential of wild rice we have initiated a project entitled the 'Oryza Map Alignment Project' (OMAP) with the ultimate goal of constructing and aligning BAC/STC based physical maps of 11 wild and one cultivated rice species to the International Rice Genome Sequencing Project's finished reference genome--O. sativa ssp. japonica c. v. Nipponbare. The 11 wild rice species comprise nine different genome types and include six diploid genomes (AA, BB, CC, EE, FF and GG) and four tetrapliod genomes (BBCC, CCDD, HHKK and HHJJ) with broad geographical distribution and ecological adaptation. In this paper we describe our strategy to construct robust physical maps of all 12 rice species with an emphasis on the AA diploid O. nivara--thought to be the progenitor of modern cultivated rice. PMID:16217601

  15. Genome-wide association study of rice (Oryza sativa L.) leaf traits with a high-throughput leaf scorer.

    Yang, Wanneng; Guo, Zilong; Huang, Chenglong; Wang, Ke; Jiang, Ni; Feng, Hui; Chen, Guoxing; Liu, Qian; Xiong, Lizhong

    2015-09-01

    Leaves are the plant's solar panel and food factory, and leaf traits are always key issues to investigate in plant research. Traditional methods for leaf trait measurement are time-consuming. In this work, an engineering prototype has been established for high-throughput leaf scoring (HLS) of a large number of Oryza sativa accessions. The mean absolute per cent of errors in traditional measurements versus HLS were below 5% for leaf number, area, shape, and colour. Moreover, HLS can measure up to 30 leaves per minute. To demonstrate the usefulness of HLS in dissecting the genetic bases of leaf traits, a genome-wide association study (GWAS) was performed for 29 leaf traits related to leaf size, shape, and colour at three growth stages using HLS on a panel of 533 rice accessions. Nine associated loci contained known leaf-related genes, such as Nal1 for controlling the leaf width. In addition, a total of 73, 123, and 177 new loci were detected for traits associated with leaf size, colour, and shape, respectively. In summary, after evaluating the performance with a large number of rice accessions, the combination of GWAS and high-throughput leaf phenotyping (HLS) has proven a valuable strategy to identify the genetic loci controlling rice leaf traits. PMID:25796084

  16. Inheritance of Blast Resistance (Pyricularia grisea Sacc.) on Interspecific Crossing between IR64 and Oryza rufipogon Griff

    DWINITA WIKAN UTAMI; HAJRIAL ASWIDINNOOR; SUGIONO MOELJOPAWIRO; IDA HANARIDA; REFLINUR

    2006-01-01

    Blast disease affected by Pyricularia grisea causes high percentage of yield losses in rice production. The improvement of durable Blast resistance is difficult due to the complexity of the inheritance of this trait. This study was conducted to evaluate the genetic control and inheritance of Blast resistance trait in interspesific population between IR 64 (accepted Indonesian rice type, medium resistant to Indonesian Blast pathogen) and Oryza rufipogon (AA genome; acc. No.IRGC#105491; donor f...

  17. Construction of a promoter probe vector autonomously maintained in Aspergillus and characterization of promoter regions derived from A. niger and A. oryzae genomes.

    Ozeki, K; Kanda, A; Hamachi, M; Nunokawa, Y

    1996-03-01

    We used a plasmid carrying a sequence for autonomous maintenance in Aspergillus (AMA1) and the E. coli uidA gene as a reporter gene to search the A. oryzae and A. niger genomes for DNA fragments having strong promoter activity. Beta-glucuronidase (GUS)-producing A. oryzae transformants containing the No. 8AN derived from A. niger, or the No. 9AO derived from A. oryzae, were constitutive for the expression of the uidA gene when cultivated in the presence of a variety of carbon and nitrogen sources. When the GUS-producing transformants were grown in liquid culture, the No. 8AN showed an increase of approximately 3-fold in GUS activity compared to the amyB (alpha-amylase encoding gene) promoter. There was also a corresponding increase in the amount of GUS gene-specific mRNA. When these transformants were grown as rice-koji, the No. 8AN showed an increase of approximately 6-fold compared to the amyB promoter, and the amount of GUS protein produced also increased. These strong promoter regions might be applicable to the production of other heterologous proteins in Aspergillus species. PMID:8901095

  18. Revisiting the chlorophyll biosynthesis pathway using genome scale metabolic model of Oryza sativa japonica.

    Chatterjee, Ankita; Kundu, Sudip

    2015-01-01

    Chlorophyll is one of the most important pigments present in green plants and rice is one of the major food crops consumed worldwide. We curated the existing genome scale metabolic model (GSM) of rice leaf by incorporating new compartment, reactions and transporters. We used this modified GSM to elucidate how the chlorophyll is synthesized in a leaf through a series of bio-chemical reactions spanned over different organelles using inorganic macronutrients and light energy. We predicted the essential reactions and the associated genes of chlorophyll synthesis and validated against the existing experimental evidences. Further, ammonia is known to be the preferred source of nitrogen in rice paddy fields. The ammonia entering into the plant is assimilated in the root and leaf. The focus of the present work is centered on rice leaf metabolism. We studied the relative importance of ammonia transporters through the chloroplast and the cytosol and their interlink with other intracellular transporters. Ammonia assimilation in the leaves takes place by the enzyme glutamine synthetase (GS) which is present in the cytosol (GS1) and chloroplast (GS2). Our results provided possible explanation why GS2 mutants show normal growth under minimum photorespiration and appear chlorotic when exposed to air. PMID:26443104

  19. Purification and enzymatic characterization of secretory glycoside hydrolase family 3 (GH3) aryl β-glucosidases screened from Aspergillus oryzae genome.

    Kudo, Kanako; Watanabe, Akira; Ujiie, Seiryu; Shintani, Takahiro; Gomi, Katsuya

    2015-12-01

    By a global search of the genome database of Aspergillus oryzae, we found 23 genes encoding putative β-glucosidases, among which 10 genes with a signal peptide belonging to glycoside hydrolase family 3 (GH3) were overexpressed in A. oryzae using the improved glaA gene promoter. Consequently, crude enzyme preparations from three strains, each harboring the genes AO090038000223 (bglA), AO090103000127 (bglF), and AO090003001511 (bglJ), showed a substrate preference toward p-nitrophenyl-β-d-glucopyranoside (pNPGlc) and thus were purified to homogeneity and enzymatically characterized. All the purified enzymes (BglA, BglF, and BglJ) preferentially hydrolyzed aryl β-glycosides, including pNPGlc, rather than cellobiose, and these enzymes were proven to be aryl β-glucosidases. Although the specific activity of BglF toward all the substrates tested was significantly low, BglA and BglJ showed appreciably high activities toward pNPGlc and arbutin. The kinetic parameters of BglA and BglJ for pNPGlc suggested that both the enzymes had relatively higher hydrolytic activity toward pNPGlc among the fungal β-glucosidases reported. The thermal and pH stabilities of BglA were higher than those of BglJ, and BglA was particularly stable in a wide pH range (pH 4.5-10). In contrast, BglJ was the most heat- and alkaline-labile among the three β-glucosidases. Furthermore, BglA was more tolerant to ethanol than BglJ; as a result, it showed much higher hydrolytic activity toward isoflavone glycosides in the presence of ethanol than BglJ. This study suggested that the mining of novel β-glucosidases exhibiting higher activity from microbial genome sequences is of great use for the production of beneficial compounds such as isoflavone aglycones. PMID:25936960

  20. Fine de novo sequencing of a fungal genome using only SOLiD short read data: verification on Aspergillus oryzae RIB40.

    Myco Umemura

    Full Text Available The development of next-generation sequencing (NGS technologies has dramatically increased the throughput, speed, and efficiency of genome sequencing. The short read data generated from NGS platforms, such as SOLiD and Illumina, are quite useful for mapping analysis. However, the SOLiD read data with lengths of <60 bp have been considered to be too short for de novo genome sequencing. Here, to investigate whether de novo sequencing of fungal genomes is possible using only SOLiD short read sequence data, we performed de novo assembly of the Aspergillus oryzae RIB40 genome using only SOLiD read data of 50 bp generated from mate-paired libraries with 2.8- or 1.9-kb insert sizes. The assembled scaffolds showed an N50 value of 1.6 Mb, a 22-fold increase than those obtained using only SOLiD short read in other published reports. In addition, almost 99% of the reference genome was accurately aligned by the assembled scaffold fragments in long lengths. The sequences of secondary metabolite biosynthetic genes and clusters, whose products are of considerable interest in fungal studies due to their potential medicinal, agricultural, and cosmetic properties, were also highly reconstructed in the assembled scaffolds. Based on these findings, we concluded that de novo genome sequencing using only SOLiD short reads is feasible and practical for molecular biological study of fungi. We also investigated the effect of filtering low quality data, library insert size, and k-mer size on the assembly performance, and recommend for the assembly use of mild filtered read data where the N50 was not so degraded and the library has an insert size of ∼2.0 kb, and k-mer size 33.

  1. Use of the p-SINE1-r2 in inferring evolutionary relationships of Thai rice varieties with AA genome

    Preecha Prathepha; Supachai Samappito

    2006-01-01

    In a previous study we described the prevalence and distribution in Thailand of the retroposon p- SINE1-r2, in the intron 10 of the waxy gene in cultivated and wild rice with the AA genome. In this study, additional varieties of rice were collected and sequencing was used to further characterize p-SINE1-r2. It was found that the length of the p-SINE1-r2 nucleotide sequences was about 125 bp, flanked by identical direct repeats of a 14 bp sequence. These sequences were compared and found to be...

  2. Polyploid evolution in Oryza officinalis complex of the genus Oryza

    Li Changbao

    2009-10-01

    Full Text Available Abstract Background Polyploidization is a prominent process in plant evolution, whereas the mechanism and tempo-spatial process remained poorly understood. Oryza officinalis complex, a polyploid complex in the genus Oryza, could exemplify the issues not only for it covering a variety of ploidy levels, but also for the pantropical geographic pattern of its polyploids in Asia, Africa, Australia and Americas, in which a pivotal genome, the C-genome, witnessed all the polyploidization process. Results Tracing the C-genome evolutionary history in Oryza officinalis complex, this study revealed the genomic relationships, polyploid forming and diverging times, and diploidization process, based on phylogeny, molecular-clock analyses and fluorescent in situ hybridization using genome-specific probes. Results showed that C-genome split with B-genome at ca. 4.8 Mya, followed by a series of speciation of C-genome diploids (ca. 1.8-0.9 Mya, which then partook in successive polyploidization events, forming CCDD tetraploids in ca. 0.9 Mya, and stepwise forming BBCC tetraploids between ca. 0.3-0.6 Mya. Inter-genomic translocations between B- and C-genomes were identified in BBCC tetraploid, O. punctata. Distinct FISH (fluorescent in situ hybridization patterns among three CCDD species were visualized by C-genome-specific probes. B-genome was modified before forming the BBCC tetraploid, O. malampuzhaensis. Conclusion C-genome, shared by all polyploid species in the complex, had experienced different evolutionary history particularly after polyploidization, e.g., inter-genomic exchange in BBCC and genomic invasion in CCDD tetraploids. It diverged from B-genome at 4.8 Mya, then participated in the tetraploid formation spanning from 0.9 to 0.3 Mya, and spread into tropics of the disjunct continents by transcontinentally long-distance dispersal, instead of vicariance, as proposed by this study, given that the continental splitting was much earlier than the C-genome

  3. Production of Haploid Tissues and SNP Analysis of the Genome in Musa acuminata cv.'Matti'(AA)

    Haploid and doubled haploid plants are of considerable value in genetic studies, genomics and plant breeding, allowing characterization and exploitation of genes where only one allele is present. Inbred banana lines have not been developed and with very few haploids or homozygotes reported, we aimed to develop new materials for genetic and genomic studies and to see if protocols could be improved using a range of genetic material not previously investigated. Anther culture was carried out using four Musa acuminata (AA) cultivars grown in homestead cultivation in Kerala, southern India. Protocols based on using modified MS medium supplemented with 2,4-D and BA (0.1 mg 1-1 each) were used. Embryogenic callus was regenerated from 4% of anthers of cv. Matti. The callus produced somatic embryosthat developed small leaves but haploid plant regeneration was not achieved. Regenerated leaf tissues had a haploid set of chromosome complements. The haploid tissuesprovided a source of DNA which may be suitable for whole genome shotgun approaches to re-sequencing, where the high levels of heterozygosity in Musa would impair assembly. (author)

  4. Genome-wide analysis of the phospholipase D family in Oryza sativa and functional characterization of PLDβ1 in seed germination

    Gang Li; Fang Lin; Hong-Wei Xue

    2007-01-01

    Phospholipase D(PLD)plays a critical role in plant growth and development,as well as in hormone and stress re-sponses.PLD encoding genes constitute a large gene family that are present in higher plants.There are 12 members ofthe PLD family in Arabidopsis thaliana and several of them have been functionally characterized;however,the membersofthe PLD family in Oryza sativa remain to be fully described.Through genome-wide analysis,17 PLD members foundin difrerent chromosomes have been identified in rice.Protein domain structural analysis reveals a novel subfamily,besides the C2-PLDs and PXPH@LDs,that is present in rice-the SP-PLD.SP-PLD harbors a signal peptide insteadof the C2 or PXPH domains at the N-terminus.Expression pattern analysis indicates that most PLD-encoding genes aredifferentially expressed in various tissues,or are induced by hormones or stress conditions,suggesting the involvement of PLD in multiple developmental processes.Transgenic studies have shown that the suppressed expression of rice PLDβ1results in reduced sensitivity to exogenous ABA during seed germination.Further analysis of the expression of ABAsignaling-related genes has revealed that PLDβ1 stimulates ABA signaling by activating SAPK,thus repressing G Amybexpression and inhibiting seed germination.

  5. Genetic relatedness of genus Oryza from Eastern Himalayan region as revealed by chloroplast matK gene

    Doris Zodinpuii

    2013-12-01

    Full Text Available Phylogenetic relationship was studied in wild and cultivated rice using the chloroplast matK gene. The aligned sequence fragments were 826bp in length with 7.02% variable and 4.47% phylogenetically informative sites and the estimated Transition/Transversion bias (R was 1.97. Seven hundred and two characters were constant, 74 variable characters were parsimony-uninformative and 50 were parsimony–informative. Haplotypes of Mizoram rice and wild relatives (A genome were more similar than those of distantly related species (B, C/CD, E and G genomes. It further revealed that the EE genome species is most closely related to the CC genome and CCDD genomes. The BBCC genome species had different origins, and their maternal parents had either the BB or CC genome. An additional genome type, HHKK was recognized in O. coarctata and O. schlechteri. Within the AA genome the African, O. glaberrima and O. longistaminatea and American, O. glumipatula and O. barthii were closer to the Indian Oryza species, O. nivara and O. rufipogon. The unknown genome O. malampuzhaensis from India is closer to BB and BBCC genome containing respectively O. punctata from Cameroon and O. minuta from Philippines. CpG rich matK sequences were rich in GG and FF genotypes, whereas CpA rich sequences belonged to BB and BBCC related genomes variety.

  6. Genome-wide association mapping revealed a diverse genetic basis of seed dormancy across subpopulations in rice (Oryza sativa L.)

    Magwa, Risper Auma; Zhao, Hu; Xing, Yongzhong

    2016-01-01

    Background Seed dormancy is an adaptive trait employed by flowering plants to avoid harsh environmental conditions for the continuity of their next generations. In cereal crops, moderate seed dormancy could help prevent pre-harvest sprouting and improve grain yield and quality. We performed a genome wide association study (GWAS) for dormancy, based on seed germination percentage (GP) in freshly harvested seeds (FHS) and after-ripened seeds (ARS) in 350 worldwide accessions that were character...

  7. Recurrent parent genome recovery analysis in a marker-assisted backcrossing program of rice (Oryza sativa L.).

    Miah, Gous; Rafii, Mohd Y; Ismail, Mohd R; Puteh, Adam B; Rahim, Harun A; Latif, Mohammad A

    2015-02-01

    Backcross breeding is the most commonly used method for incorporating a blast resistance gene into a rice cultivar. Linkage between the resistance gene and undesirable units can persist for many generations of backcrossing. Marker-assisted backcrossing (MABC) along with marker-assisted selection (MAS) contributes immensely to overcome the main limitation of the conventional breeding and accelerates recurrent parent genome (RPG) recovery. The MABC approach was employed to incorporate (a) blast resistance gene(s) from the donor parent Pongsu Seribu 1, the blast-resistant local variety in Malaysia, into the genetic background of MR219, a popular high-yielding rice variety that is blast susceptible, to develop a blast-resistant MR219 improved variety. In this perspective, the recurrent parent genome recovery was analyzed in early generations of backcrossing using simple sequence repeat (SSR) markers. Out of 375 SSR markers, 70 markers were found polymorphic between the parents, and these markers were used to evaluate the plants in subsequent generations. Background analysis revealed that the extent of RPG recovery ranged from 75.40% to 91.3% and from 80.40% to 96.70% in BC1F1 and BC2F1 generations, respectively. In this study, the recurrent parent genome content in the selected BC2F2 lines ranged from 92.7% to 97.7%. The average proportion of the recurrent parent in the selected improved line was 95.98%. MAS allowed identification of the plants that are more similar to the recurrent parent for the loci evaluated in backcross generations. The application of MAS with the MABC breeding program accelerated the recovery of the RP genome, reducing the number of generations and the time for incorporating resistance against rice blast. PMID:25553855

  8. Use of the p-SINE1-r2 in inferring evolutionary relationships of Thai rice varieties with AA genome

    Preecha Prathepha

    2006-01-01

    Full Text Available In a previous study we described the prevalence and distribution in Thailand of the retroposon p- SINE1-r2, in the intron 10 of the waxy gene in cultivated and wild rice with the AA genome. In this study, additional varieties of rice were collected and sequencing was used to further characterize p-SINE1-r2. It was found that the length of the p-SINE1-r2 nucleotide sequences was about 125 bp, flanked by identical direct repeats of a 14 bp sequence. These sequences were compared and found to be similar to the sequences of p- SINE1-r2 found in Nipponbare, a rice strain discussed in a separate study. However, when compared the 48 DNA sequences identified in this study, much dissimilarity was found within the nucleotide sequences of p- SINE1-r2, in the form of base substitution mutations. Phylogenetic relationships inferred from the nucleotide sequences of these elements in cultivated rice (O. sativa and wild rice (O. nivara. It was found that rice accessions collected from the same geographical distribution have been placed in the same clade. The phylogenetic tree supports the origin and distribution of these rice strains.

  9. Post-genomic insights into the plant polysaccharide degradation potential of Aspergillus nidulans and comparison to Aspergillus niger and Aspergillus oryzae

    Coutinho, Pedro M.; Andersen, Mikael Rørdam; Kolenova, Katarina; vanKuyk, Patricia A.; Benoit, Isabelle; Gruben, Birgit S.; Trejo-Aguilar, Blanca; Visser, Hans; van Solingen, Piet; Pakula, Tiina; Seiboth, Bernard; Battaglia, Evy; Aguilar-Osorio, Guillermo; de Jong, Jan F.; Ohm, Robin A.; Aguilar, Mariana; Henrissat, Bernard; Nielsen, Jens; Stålbrand, Henrik; de Vries, Ronald P.

    The plant polysaccharide degradative potential of Aspergillus nidulans was analysed in detail and compared to that of Aspergillus niger and Aspergillus oryzae using a combination of bioinformatics, physiology and transcriptomics. Manual verification indicated that 28.4% of the A. nidulans ORFs...

  10. QTL analysis of novel genomic regions associated with yield and yield related traits in new plant type based recombinant inbred lines of rice (Oryza sativa L.

    Marathi Balram

    2012-08-01

    Full Text Available Abstract Background Rice is staple food for more than half of the world’s population including two billion Asians, who obtain 60-70% of their energy intake from rice and its derivatives. To meet the growing demand from human population, rice varieties with higher yield potential and greater yield stability need to be developed. The favourable alleles for yield and yield contributing traits are distributed among two subspecies i.e., indica and japonica of cultivated rice (Oryza sativa L.. Identification of novel favourable alleles in indica/japonica will pave way to marker-assisted mobilization of these alleles in to a genetic background to break genetic barriers to yield. Results A new plant type (NPT based mapping population of 310 recombinant inbred lines (RILs was used to map novel genomic regions and QTL hotspots influencing yield and eleven yield component traits. We identified major quantitative trait loci (QTLs for days to 50% flowering (R2 = 25%, LOD = 14.3, panicles per plant (R2 = 19%, LOD = 9.74, flag leaf length (R2 = 22%, LOD = 3.05, flag leaf width (R2 = 53%, LOD = 46.5, spikelets per panicle (R2 = 16%, LOD = 13.8, filled grains per panicle (R2 = 22%, LOD = 15.3, percent spikelet sterility (R2 = 18%, LOD = 14.24, thousand grain weight (R2 = 25%, LOD = 12.9 and spikelet setting density (R2 = 23%, LOD = 15 expressing over two or more locations by using composite interval mapping. The phenotypic variation (R2 ranged from 8 to 53% for eleven QTLs expressing across all three locations. 19 novel QTLs were contributed by the NPT parent, Pusa1266. 15 QTL hotpots on eight chromosomes were identified for the correlated traits. Six epistatic QTLs effecting five traits at two locations were identified. A marker interval (RM3276-RM5709 on chromosome 4 harboring major QTLs for four traits was identified. Conclusions The present study reveals that favourable alleles for

  11. Sensitive detection of Xanthomonas oryzae Pathovars oryzae and oryzicola by loop-mediated isothermal amplification.

    Lang, Jillian M; Langlois, Paul; Nguyen, Marian Hanna R; Triplett, Lindsay R; Purdie, Laura; Holton, Timothy A; Djikeng, Appolinaire; Vera Cruz, Casiana M; Verdier, Valérie; Leach, Jan E

    2014-08-01

    Molecular diagnostics for crop diseases can enhance food security by enabling the rapid identification of threatening pathogens and providing critical information for the deployment of disease management strategies. Loop-mediated isothermal amplification (LAMP) is a PCR-based tool that allows the rapid, highly specific amplification of target DNA sequences at a single temperature and is thus ideal for field-level diagnosis of plant diseases. We developed primers highly specific for two globally important rice pathogens, Xanthomonas oryzae pv. oryzae, the causal agent of bacterial blight (BB) disease, and X. oryzae pv. oryzicola, the causal agent of bacterial leaf streak disease (BLS), for use in reliable, sensitive LAMP assays. In addition to pathovar distinction, two assays that differentiate X. oryzae pv. oryzae by African or Asian lineage were developed. Using these LAMP primer sets, the presence of each pathogen was detected from DNA and bacterial cells, as well as leaf and seed samples. Thresholds of detection for all assays were consistently 10(4) to 10(5) CFU ml(-1), while genomic DNA thresholds were between 1 pg and 10 fg. Use of the unique sequences combined with the LAMP assay provides a sensitive, accurate, rapid, simple, and inexpensive protocol to detect both BB and BLS pathogens. PMID:24837384

  12. Rice (Oryza) hemoglobins

    Hemoglobins (Hbs) corresponding to non-symbiotic (nsHb) and truncated (tHb) Hbs have been identified in rice (Oryza). This review discusses the major findings from the current studies on rice Hbs. At the molecular level, a family of the nshb genes, consisting of hb1, hb2, hb3, hb4 and hb5, and a sin...

  13. The distribution and copy number of copia-like retrotransposons in rice (Oryza sativa L.) and their implications in the organization and evolution of the rice genome

    Wang, Shiping; Liu, Nan; Peng, Kaiman; Zhang, Qifa

    1999-01-01

    We used 22 fragments corresponding to the reverse transcriptase domain of copia-like retrotransposons as representatives to study the organization and distribution of these elements in the rice genome. The loci detected by these 22 fragments were assigned to 47 locations in the molecular-linkage map involving all 12 chromosomes. The distributional features of copia-like retrotransposons found in the rice genome indicated that (i) the loci detected were located mainly in one arm of each chromo...

  14. The chemical heritage of Aspergillus flavus in A. oryzae RIB 40

    Rank, Christian; Klejnstrup, Marie Louise; Petersen, Lene Maj; Frisvad, Jens Christian; Larsen, Thomas Ostenfeld

    Aspergillus oryzae is a very important species in biotechnology and has been used for centuries in traditional Asian fermentation. The RIB40 strain is particularly interesting as it was one of the first genome sequenced Aspergilli together with A. flavus, a prominent food and feed contaminant...... with indications to specific genetic changes. Several new metabolites and changes in biosynthetic routes have been found in A. oryzae, indicating subtle changes in the genomic heritage from A. flavus....

  15. Physical mapping and cloning of genome-specific repetitive DNA sequences in O. rufipogon

    The repetitive sequences play an important role in genetic evolution of Oryza. Over 20 candidate positive BAC clones containing specific repetitive sequences have been identified by dot blot hybridization using DNA of O. rufipogon (AA genome) and O.officinalis (CC genome) as genomic probes. Four true positive BAC clones were subcloned and select positive subclones were sequenced. BLASTn analysis showed that eleven out of sequenced 20 subclones belonged to RIRE3- like, three RIRE2-like, one RIRE8-like, and one Retrosat1-2-like retrotransposon repetitive sequences. Southern blot were performed using A6, A8 and A15 (belong to RIRE8, RIRE3 and RIRE2-like retrotransposon, respectively) as probes. The results showed that they were genome.specific repetitive sequence with high copies in AA genome of rice. The above subclones were selected to hybridize with metaphase chromosome of O.rufipogon by FISH. The hybridization signals could be found at sub-terminal sites, the middle parts and centromere region on one to three pair of different chromosomes. Based on the conservative sequences of LTR from A8, A15 subclones and sequence of classical reverse transcriptase, three pairs primers were designed for developing new molecular markers by transposon display (TD) technology. Different amplification bands were detected among different genomes including AA, ABB, ABBCC, ACC. The result also showed that obvious different bands were identified between indica and japonica. These TD markers would be very useful markers to distinguish indica and japonica. Our results indicated that the species or subspecies-specific markers would be developed from genome-specific repetitive sequence, which can be used as molecular markers for evolution study, identification of species in Oryza and varieties in rice. (author)

  16. Genome-wide gene responses in a transgenic rice line carrying the maize resistance gene Rxo1 to the rice bacterial streak pathogen, Xanthomonas oryzae pv. oryzicola

    Fu Bin-Ying

    2010-02-01

    Full Text Available Abstract Background Non-host resistance in rice to its bacterial pathogen, Xanthomonas oryzae pv. oryzicola (Xoc, mediated by a maize NBS-LRR type R gene, Rxo1 shows a typical hypersensitive reaction (HR phenotype, but the molecular mechanism(s underlying this type of non-host resistance remain largely unknown. Results A microarray experiment was performed to reveal the molecular mechanisms underlying HR of rice to Xoc mediated by Rxo1 using a pair of transgenic and non-transgenic rice lines. Our results indicated that Rxo1 appeared to function in the very early step of the interaction between rice and Xoc, and could specifically activate large numbers of genes involved in signaling pathways leading to HR and some basal defensive pathways such as SA and ET pathways. In the former case, Rxo1 appeared to differ from the typical host R genes in that it could lead to HR without activating NDR1. In the latter cases, Rxo1 was able to induce a unique group of WRKY TF genes and a large set of genes encoding PPR and RRM proteins that share the same G-box in their promoter regions with possible functions in post-transcriptional regulation. Conclusions In conclusion, Rxo1, like most host R genes, was able to trigger HR against Xoc in the heterologous rice plants by activating multiple defensive pathways related to HR, providing useful information on the evolution of plant resistance genes. Maize non-host resistance gene Rxo1 could trigger the pathogen-specific HR in heterologous rice, and ultimately leading to a localized programmed cell death which exhibits the characteristics consistent with those mediated by host resistance genes, but a number of genes encoding pentatricopeptide repeat and RNA recognition motif protein were found specifically up-regulated in the Rxo1 mediated disease resistance. These results add to our understanding the evolution of plant resistance genes.

  17. Cytological mechanisms of interspecific incrossability and hybrid sterility between Oryza sativa L. and O.alta Swallen

    FU XueLin; LU YongGen; LIU XiangDong; Li JinQuan; Feng JiuHuan

    2007-01-01

    Oryza sativa and O. alta belong to AA and CCDD genomes in Oryza, respectively. Interspecific reproductive isolation limits the transfer of favorable genes from O. alta into O. sativa. The cytological mechanisms of interspecific incrossability and hybrid sterility between O. sativa and O. alta were studied systematically in this paper. We indentified two cytological causes of interspecific incrossability. First, we observed embryo sac incompatibility that caused fertilization barriers of variable severity such as non-fertilization, fertilization stagnation and egg cell single-fertilization. Second, we observed hybrid inviability, the major cause for incrossability, apparent from hybrid embryo developmental stagnation and embryo abortion. Hybrid sterility included both embryo sac sterility and pollen sterility.The hybrid embryo sac was completely sterile and exhibited mainly embryo sac degeneration. Hybrid pollen was also sterile and mainly typical abortive. Hybrid sterility was mainly caused by severely abnormal meioses of megasporocytes and pollen mother cells; it is the most important abnormality, being chromosome sterility. Several methods are suggested to overcome the interspecific reproductive isolation between O. sativa and O. alta.

  18. AA Index

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  19. Fine De Novo Sequencing of a Fungal Genome Using only SOLiD Short Read Data: Verification on Aspergillus oryzae RIB40

    Myco Umemura; Yoshinori Koyama; Itaru Takeda; Hiroko Hagiwara; Tsutomu Ikegami; Hideaki Koike; Masayuki Machida

    2013-01-01

    The development of next-generation sequencing (NGS) technologies has dramatically increased the throughput, speed, and efficiency of genome sequencing. The short read data generated from NGS platforms, such as SOLiD and Illumina, are quite useful for mapping analysis. However, the SOLiD read data with lengths of

  20. Crossability Barriers in the Interspecific Hybridization between Oryza sativa and O. meyeriana

    Xue-Lin Fu; Yong-Gen Lu; Xiang-Dong Liu; Jin-Quan Li

    2009-01-01

    Oryza meyerlana Baill (GG genome) Is a precious germplaem in the tertiary gene pool of cultivated rice (AA genome), and possesses important traits such as resistance and tolerance to biotic and abiotic stress. However, interspecific crossability barrier, a critical bottleneck restricting genes transfer from O. meyeriana to cultivars has led to no hybrids through conventional reproduction. Therefore, the reasons undedying incrossability were investigated in the present report. The results showed that: (ⅰ) at 3-7 d after pollination (DAP), many hybdd embryos degenerated at the earlier globular-shaped stage, and could not develop into the later pear-shaped stage. Meanwhile, free endosperm nuclei started to degenerate at 1 DAP, and cellular endosperm could not form st 3 DAP, leading to nutrition starvation for young embryo development; (ⅱ) st 11-13 DAP, almost all hybrid ovaries aborted. Even though 72.22% of hybrid young embryos were produced in the interspecific hybridization between O. sativa and O. meyeriana, young embryos were not able to further develop into hybrid plantlets via culturing in vitro. The main reason for the incrossability was hybrid embryo inviability, presenting as embryo development stagnation and degeneration since 3 DAP. Some possible approaches to overcome the crossability banders in the interspecific hybridization between O. sativa and O. meyeriana are discussed.

  1. Developing high throughput genotyped chromosome segment substitution lines based on population whole-genome re-sequencing in rice (Oryza sativa L.

    Gu Minghong

    2010-11-01

    Full Text Available Abstract Background Genetic populations provide the basis for a wide range of genetic and genomic studies and have been widely used in genetic mapping, gene discovery and genomics-assisted breeding. Chromosome segment substitution lines (CSSLs are the most powerful tools for the detection and precise mapping of quantitative trait loci (QTLs, for the analysis of complex traits in plant molecular genetics. Results In this study, a wide population consisting of 128 CSSLs was developed, derived from the crossing and back-crossing of two sequenced rice cultivars: 9311, an elite indica cultivar as the recipient and Nipponbare, a japonica cultivar as the donor. First, a physical map of the 128 CSSLs was constructed on the basis of estimates of the lengths and locations of the substituted chromosome segments using 254 PCR-based molecular markers. From this map, the total size of the 142 substituted segments in the population was 882.2 Mb, was 2.37 times that of the rice genome. Second, every CSSL underwent high-throughput genotyping by whole-genome re-sequencing with a 0.13× genome sequence, and an ultrahigh-quality physical map was constructed. This sequencing-based physical map indicated that 117 new segments were detected; almost all were shorter than 3 Mb and were not apparent in the molecular marker map. Furthermore, relative to the molecular marker-based map, the sequencing-based map yielded more precise recombination breakpoint determination and greater accuracy of the lengths of the substituted segments, and provided more accurate background information. Third, using the 128 CSSLs combined with the bin-map converted from the sequencing-based physical map, a multiple linear regression QTL analysis mapped nine QTLs, which explained 89.50% of the phenotypic variance for culm length. A large-effect QTL was located in a 791,655 bp region that contained the rice 'green revolution' gene. Conclusions The present results demonstrated that high

  2. RNA-mediated gene silencing in the phytopathogenic fungus Bipolaris oryzae.

    Moriwaki, Akihiro; Ueno, Makoto; Arase, Sakae; Kihara, Junichi

    2007-04-01

    The Ascomycetous fungus Bipolaris oryzae is the causal agent of brown leaf spot disease in rice and is a model for studying photomorphogenetic responses by near-UV radiation. Targeted gene disruption (knockout) for functional analysis of photomorphogenesis-related genes in B. oryzae can be achieved by homologous recombination with low efficiency. Here, the applicability of RNA silencing (knockdown) as a tool for targeting endogenous genes in B. oryzae is reported. A polyketide synthase gene (PKS1), involved in fungal DHN melanin biosynthesis pathways, was targeted by gene silencing as a marker. The silencing vector encoding hairpin RNA of the PKS1 fragment was constructed in a two-step PCR-based cloning, and introduced into the B. oryzae genomic DNA. Silencing of the PKS1 gene resulted in albino phenotypes and reduction of PKS1 mRNA expression. These results demonstrate the applicability of targeted gene silencing as a useful reverse-genetics approach in B. oryzae. PMID:17227462

  3. Genome wide association mapping of grain arsenic, copper, molybdenum and zinc in rice (Oryza sativa L. grown at four international field sites.

    Gareth J Norton

    Full Text Available The mineral concentrations in cereals are important for human health, especially for individuals who consume a cereal subsistence diet. A number of elements, such as zinc, are required within the diet, while some elements are toxic to humans, for example arsenic. In this study we carry out genome-wide association (GWA mapping of grain concentrations of arsenic, copper, molybdenum and zinc in brown rice using an established rice diversity panel of ∼ 300 accessions and 36.9 k single nucleotide polymorphisms (SNPs. The study was performed across five environments: one field site in Bangladesh, one in China and two in the US, with one of the US sites repeated over two years. GWA mapping on the whole dataset and on separate subpopulations of rice revealed a large number of loci significantly associated with variation in grain arsenic, copper, molybdenum and zinc. Seventeen of these loci were detected in data obtained from grain cultivated in more than one field location, and six co-localise with previously identified quantitative trait loci. Additionally, a number of candidate genes for the uptake or transport of these elements were located near significantly associated SNPs (within 200 kb, the estimated global linkage disequilibrium previously employed in this rice panel. This analysis highlights a number of genomic regions and candidate genes for further analysis as well as the challenges faced when mapping environmentally-variable traits in a highly genetically structured diversity panel.

  4. Gene Ontology annotation of the rice blast fungus, Magnaporthe oryzae

    Deng Jixin

    2009-02-01

    Full Text Available Abstract Background Magnaporthe oryzae, the causal agent of blast disease of rice, is the most destructive disease of rice worldwide. The genome of this fungal pathogen has been sequenced and an automated annotation has recently been updated to Version 6 http://www.broad.mit.edu/annotation/genome/magnaporthe_grisea/MultiDownloads.html. However, a comprehensive manual curation remains to be performed. Gene Ontology (GO annotation is a valuable means of assigning functional information using standardized vocabulary. We report an overview of the GO annotation for Version 5 of M. oryzae genome assembly. Methods A similarity-based (i.e., computational GO annotation with manual review was conducted, which was then integrated with a literature-based GO annotation with computational assistance. For similarity-based GO annotation a stringent reciprocal best hits method was used to identify similarity between predicted proteins of M. oryzae and GO proteins from multiple organisms with published associations to GO terms. Significant alignment pairs were manually reviewed. Functional assignments were further cross-validated with manually reviewed data, conserved domains, or data determined by wet lab experiments. Additionally, biological appropriateness of the functional assignments was manually checked. Results In total, 6,286 proteins received GO term assignment via the homology-based annotation, including 2,870 hypothetical proteins. Literature-based experimental evidence, such as microarray, MPSS, T-DNA insertion mutation, or gene knockout mutation, resulted in 2,810 proteins being annotated with GO terms. Of these, 1,673 proteins were annotated with new terms developed for Plant-Associated Microbe Gene Ontology (PAMGO. In addition, 67 experiment-determined secreted proteins were annotated with PAMGO terms. Integration of the two data sets resulted in 7,412 proteins (57% being annotated with 1,957 distinct and specific GO terms. Unannotated proteins

  5. Rating AAs.

    Carter, Susan J.

    2001-01-01

    Why alternative investments? In a word: performance. Many higher education endowment and foundation managers are making increasing commitments to alternative investments, or AAs, in order to obtain higher returns and broader diversification for their investment portfolios than public securities instruments can usually provide. Learn how to handle…

  6. A recent duplication revisited: phylogenetic analysis reveals an ancestral duplication highly-conserved throughout the Oryza genus and beyond

    Cooke Richard

    2009-12-01

    Full Text Available Abstract Background The role of gene duplication in the structural and functional evolution of genomes has been well documented. Analysis of complete rice (Oryza sativa genome sequences suggested an ancient whole genome duplication, common to all the grasses, some 50-70 million years ago and a more conserved segmental duplication between the distal regions of the short arms of chromosomes 11 and 12, whose evolutionary history is controversial. Results We have carried out a comparative analysis of this duplication within the wild species of the genus Oryza, using a phylogenetic approach to specify its origin and evolutionary dynamics. Paralogous pairs were isolated for nine genes selected throughout the region in all Oryza genome types, as well as in two outgroup species, Leersia perrieri and Potamophila parviflora. All Oryza species display the same global evolutionary dynamics but some lineage-specific features appear towards the proximal end of the duplicated region. The same level of conservation is observed between the redundant copies of the tetraploid species Oryza minuta. The presence of orthologous duplicated blocks in the genome of the more distantly-related species, Brachypodium distachyon, strongly suggests that this duplication between chromosomes 11 and 12 was formed as part of the whole genome duplication common to all Poaceae. Conclusion Our observations suggest that recurrent but heterogeneous concerted evolution throughout the Oryza genus and in related species has led specifically to the extremely high sequence conservation occurring in this region of more than 2 Mbp.

  7. Reconstruction of putative DNA virus from endogenous rice tungro bacilliform virus-like sequences in the rice genome: implications for integration and evolution

    Kishima Yuji

    2004-10-01

    Full Text Available Abstract Background Plant genomes contain various kinds of repetitive sequences such as transposable elements, microsatellites, tandem repeats and virus-like sequences. Most of them, with the exception of virus-like sequences, do not allow us to trace their origins nor to follow the process of their integration into the host genome. Recent discoveries of virus-like sequences in plant genomes led us to set the objective of elucidating the origin of the repetitive sequences. Endogenous rice tungro bacilliform virus (RTBV-like sequences (ERTBVs have been found throughout the rice genome. Here, we reconstructed putative virus structures from RTBV-like sequences in the rice genome and characterized to understand evolutionary implication, integration manner and involvements of endogenous virus segments in the corresponding disease response. Results We have collected ERTBVs from the rice genomes. They contain rearranged structures and no intact ORFs. The identified ERTBV segments were shown to be phylogenetically divided into three clusters. For each phylogenetic cluster, we were able to make a consensus alignment for a circular virus-like structure carrying two complete ORFs. Comparisons of DNA and amino acid sequences suggested the closely relationship between ERTBV and RTBV. The Oryza AA-genome species vary in the ERTBV copy number. The species carrying low-copy-number of ERTBV segments have been reported to be extremely susceptible to RTBV. The DNA methylation state of the ERTBV sequences was correlated with their copy number in the genome. Conclusions These ERTBV segments are unlikely to have functional potential as a virus. However, these sequences facilitate to establish putative virus that provided information underlying virus integration and evolutionary relationship with existing virus. Comparison of ERTBV among the Oryza AA-genome species allowed us to speculate a possible role of endogenous virus segments against its related disease.

  8. Molecular detection of Xanthomonas oryzae pv. oryzae, Xanthomonas oryzae pv. oryzicola, and Burkholderia glumae in infected rice seeds and leaves

    Polymerase chain reaction (PCR) is particularly useful for plant pathogen detection. In the present study, multiplex PCR and SYBR green real-time PCR were developed to facilitate simultaneous detection of three important rice pathogens, Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, and Bur...

  9. Estimation of genome length

    2001-01-01

    The genome length is a fundamental feature of a species. This note outlined the general concept and estimation method of the physical and genetic length. Some formulae for estimating the genetic length were derived in detail. As examples, the genome genetic length of Pinus pinaster Ait. and the genetic length of chromosome Ⅵ of Oryza sativa L. were estimated from partial linkage data.

  10. Promises and challenges of genomics for rice pathology

    Publically available genome sequences of Magnaporthe oryzae, Rhizoctonia solani, and Oryza sativa are being used to study host-pathogen interactions. Comparative genomic analyses on natural alleles of major resistance (R) genes and the corresponding avirulence (AVR) genes have provided new clues for...

  11. Identification of Chromosomes from Multiple Rice Genomes Using a Universal Molecular Cytogenetic Marker System

    Xiaomin Tang; Weidong Bao; Wenli Zhang; Zhukuan Cheng

    2007-01-01

    To develop reliable techniques for chromosome identification is critical for cytogenetic research, especially for genomes with a large number and smaller-sized chromosomes. An efficient approach using bacterial artificial chromosome (BAG) clones as molecular cytological markers has been developed for many organisms. Herein, we present a set of chromosomal arm-specific molecular cytological markers derived from the gene-enriched regions of the sequenced rice genome. All these markers are able to generate very strong signals on the pachytene chromosomes of Oryza satlva L. (AA genome) when used as fluorescence in situ hybridization (FISH) probes. We further probed those markers to the pachytene chromosomes of O. punctata (BB genome) and O. officinalis (CC genome) and also got very strong signals on the relevant pachytene chromosomes. The signal position of each marker on the related chromosomes from the three different rice genomes was pretty much stable, which enabled us to identify different chromosomes among various rice genomes. We also constructed the karyotype for both O. punctata and O. officinalis with the BB and CC genomes, respectively, by analysis of 10 pachytene cells anchored by these chromosomal arm-specific markers.

  12. In planta gene expression analysis of Xanthomonas oryzae pathovar oryzae, African strain MAI1

    Verdier Valérie

    2010-06-01

    Full Text Available Abstract Background Bacterial leaf blight causes significant yield losses in rice crops throughout Asia and Africa. Although both the Asian and African strains of the pathogen, Xanthomonas oryzae pv. oryzae (Xoo, induce similar symptoms, they are nevertheless genetically different, with the African strains being more closely related to the Asian X. oryzae pv. oryzicola (Xoc. Results Changes in gene expression of the African Xoo strain MAI1 in the susceptible rice cultivar Nipponbare were profiled, using an SSH Xoo DNA microarray. Microarray hybridization was performed comparing bacteria recovered from plant tissues at 1, 3, and 6 days after inoculation (dai with bacteria grown in vitro. A total of 710 bacterial genes were found to be differentially expressed, with 407 up-regulated and 303 down-regulated. Expression profiling indicated that less than 20% of the 710 bacterial transcripts were induced in the first 24 h after inoculation, whereas 63% were differentially expressed at 6 dai. The 710 differentially expressed genes were one-end sequenced. 535 sequences were obtained from which 147 non-redundant sequences were identified. Differentially expressed genes were related to metabolism, secretion and transport, pathogen adherence to plant tissues, plant cell-wall degradation, IS elements, and virulence. In addition, various other genes encoding proteins with unknown function or showing no similarity to other proteins were also induced. The Xoo MAI1 non-redundant set of sequences was compared against several X. oryzae genomes, revealing a specific group of genes that was present only in MAI1. Numerous IS elements were also found to be differentially expressed. Quantitative real-time PCR confirmed 86% of the identified profile on a set of 14 genes selected according to the microarray analysis. Conclusions This is the first report to compare the expression of Xoo genes in planta across different time points during infection. This work shows that

  13. Comparative chemistry of Aspergillus oryzae (RIB40) and A. flavus (NRRL 3357)

    Rank, Christian; Klejnstrup, Marie Louise; Petersen, Lene Maj;

    2012-01-01

    Aspergillus oryzae and A. flavus are important species in industrial biotechnology and food safety and have been some of the first aspergilli to be fully genome sequenced. Bioinformatic analysis has revealed 99.5% gene homology between the two species pointing towards a large coherence in the...

  14. Antimicrobial peptide melittin against Xanthomonas oryzae pv. oryzae, the bacterial leaf blight pathogen in rice

    SHI, Wei; Li, Caiyun; Li, Man; Zong, Xicui; Han, Dongju; Chen, Yuqing

    2016-01-01

    Xanthomonas oryzae pv. oryzae is a destructive bacterial disease of rice, and the development of an environmentally safe bactericide is urgently needed. Antimicrobial peptides, as antibacterial sources, may play important roles in bactericide development. In the present study, we found that the antimicrobial peptide melittin had the desired antibacterial activity against X. oryzae pv. oryzae. The antibacterial mechanism was investigated by examining its effects on cell membranes, energy metab...

  15. Stationary-Phase Variation Due to Transposition of Novel Insertion Elements in Xanthomonas oryzae pv. oryzae

    Rajeshwari, R.; Sonti, R. V.

    2000-01-01

    Xanthomonas oryzae pv. oryzae causes bacterial leaf blight, a serious disease of rice. Spontaneous mutants which are deficient for virulence and extracellular polysaccharide (Eps) production accumulate in large numbers in stationary-phase cultures of this bacterium, a phenomenon which we have called stationary-phase variation. A clone (pSD1) carrying the Eps biosynthetic gene (gum) cluster of X. oryzae pv. oryzae restored Eps production and virulence to several spv (for stationary-phase varia...

  16. A novel non-thermostable deuterolysin from Aspergillus oryzae.

    Maeda, Hiroshi; Katase, Toru; Sakai, Daisuke; Takeuchi, Michio; Kusumoto, Ken-Ichi; Amano, Hitoshi; Ishida, Hiroki; Abe, Keietsu; Yamagata, Youhei

    2016-09-01

    Three putative deuterolysin (EC 3.4.24.29) genes (deuA, deuB, and deuC) were found in the Aspergillus oryzae genome database ( http://www.bio.nite.go.jp/dogan/project/view/AO ). One of these genes, deuA, was corresponding to NpII gene, previously reported. DeuA and DeuB were overexpressed by recombinant A. oryzae and were purified. The degradation profiles against protein substrates of both enzymes were similar, but DeuB showed wider substrate specificity against peptidyl MCA-substrates compared with DeuA. Enzymatic profiles of DeuB except for thermostability also resembled those of DeuA. DeuB was inactivated by heat treatment above 80° C, different from thermostable DeuA. Transcription analysis in wild type A. oryzae showed only deuB was expressed in liquid culture, and the addition of the proteinous substrate upregulated the transcription. Furthermore, the NaNO3 addition seems to eliminate the effect of proteinous substrate for the transcription of deuB. PMID:27050120

  17. Functional genomics in the rice blast fungus to unravel the fungal pathogenicity

    Junhyun JEON; Jaehyuk CHOI; Jongsun PARK; Yong-Hwan LEE

    2008-01-01

    A rapidly growing number of successful genome sequencing projects in plant pathogenic fungi greatly increase the demands for tools and methodologies to study fungal pathogenicity at genomic scale. Magnaporthe oryzae is an economically important plant pathogenic fungus whose genome is fully sequenced. Recently we have reported the development and application of functional genomics platform technologies in M. oryzae. This model approach would have many practical ramifications in design and implementation of upcoming functional genomics studies of filamentous fungi aimed at understanding fungal pathogenicity.

  18. OryzaPG-DB: Rice Proteome Database based on Shotgun Proteogenomics

    Tomita Masaru

    2011-04-01

    Full Text Available Abstract Background Proteogenomics aims to utilize experimental proteome information for refinement of genome annotation. Since mass spectrometry-based shotgun proteomics approaches provide large-scale peptide sequencing data with high throughput, a data repository for shotgun proteogenomics would represent a valuable source of gene expression evidence at the translational level for genome re-annotation. Description Here, we present OryzaPG-DB, a rice proteome database based on shotgun proteogenomics, which incorporates the genomic features of experimental shotgun proteomics data. This version of the database was created from the results of 27 nanoLC-MS/MS runs on a hybrid ion trap-orbitrap mass spectrometer, which offers high accuracy for analyzing tryptic digests from undifferentiated cultured rice cells. Peptides were identified by searching the product ion spectra against the protein, cDNA, transcript and genome databases from Michigan State University, and were mapped to the rice genome. Approximately 3200 genes were covered by these peptides and 40 of them contained novel genomic features. Users can search, download or navigate the database per chromosome, gene, protein, cDNA or transcript and download the updated annotations in standard GFF3 format, with visualization in PNG format. In addition, the database scheme of OryzaPG was designed to be generic and can be reused to host similar proteogenomic information for other species. OryzaPG is the first proteogenomics-based database of the rice proteome, providing peptide-based expression profiles, together with the corresponding genomic origin, including the annotation of novelty for each peptide. Conclusions The OryzaPG database was constructed and is freely available at http://oryzapg.iab.keio.ac.jp/.

  19. Antiproton Accumulator (AA)

    Photographic Service

    1980-01-01

    The AA in its final stage of construction, before it disappeared from view under concrete shielding. Antiprotons were first injected, stochastically cooled and accumulated in July 1980. From 1981 on, the AA provided antiprotons for collisions with protons, first in the ISR, then in the SPS Collider. From 1983 on, it also sent antiprotons, via the PS, to the Low-Energy Antiproton Ring (LEAR). The AA was dismantled in 1997 and shipped to Japan.

  20. Xanthomonas oryzae pv oryzae triggers immediate transcriptomic modulations in rice

    Grewal Rumdeep K

    2012-01-01

    Full Text Available Abstract Background Xanthomonas oryzae pv oryzae is a devastating pathogen of rice and has been extensively studied as a model pathogen of monocotyledons. Expressional studies in both the contenders have been undertaken in past to understand the molecular mechanism underlying the compatible and incompatible interactions in the pathosystem. Continuous update on database and gene annotations necessitates constant updating on the roles of the new entities as well as reinterpretation of regulations of the previous ones. Moreover the past endeavors have addressed the middle or late defense responses of the rice plant whereas in the present study an attempt has been made to investigate the early defense responses taking place immediately after inoculation. Results Microarray was used to study the transcriptional modulations in eighteen days old rice seedling leaves of both susceptible and resistant genotypes one hour after inoculation. In resistant plants as compared to susceptible ones 274 genes were found to be differentially expressed. Annotations could be assigned to 112 up- and 73 down-regulated transcripts and gene interaction maps were generated for 86 transcripts. Expressional data and interaction maps were used to develop a hypothetical scheme of the molecular events taking place during early defense response. Network analysis with the differential transcripts showed up-regulation of major clusters of cell signaling proteins and transcription factors while growth and basal metabolic components were largely found to be down-regulated. Conclusions This study provides an understanding of the early defense signaling in rice cells. Components of the calcium and lipid signaling as well as MAPK cascade were modulated, by signals from surface receptors and cytosolic R-proteins, to arouse jasmonic acid and ethylene signaling and suppress auxin signaling through various transcription factors. Abscisic acid modulation was also evident through the

  1. The rice proteogenomics database OryzaPG-DB: development, expansion and new features

    Mohamed eHelmy

    2012-04-01

    Full Text Available Proteogenomics is the utilization of large-scale proteome data in genome annotation refinement. Our recently developed rice proteogenomics database (OryzaPG-DB is the first sustainable resource for rice shotgun-based proteogenomics, providing information on peptides identified in rice protein digested peptides measured by means of liquid chromatography-tandem mass spectrometry (LC-MS/MS, and mapping of the peptides to their genomic origins and the genomic novelty of each peptide. The sequences of the peptides, proteins, cDNAs and genes, and the gene annotations are available for download in FASTA and GFF3 formats, respectively. Further, an annotated visualization of the gene models, corresponding peptides and genomic novelty is available for each gene, and MS/MS spectra are available for each peptide. In this article, we discuss the utilization of OryzaPG-DB and report on its development, recent content expansions and newly added features in the current version (OryzaPG-DB v1.1.

  2. AA magnet measurement team

    1978-01-01

    Quickly improvised measurement equipment for the AA (Antiproton Accumulator) was all the tight schedule permitted, but the high motivation of the team made up for the lack of convenience. From left to right: Roy Billinge (Joint AA Project Leader, the other one was Simon van der Meer); Bruno Autin, Brian Pincott, Colin Johnson.

  3. Antibacterial phycocyanin from Anabaena oryzae SOS13

    Mahmoud Sitohy; Ali Osman; Abdel Ghany Abdel Ghany; Ali Salama

    2015-01-01

    Summary. The antimicrobial activity of phycocyanin extracted from Anabaena oryzae SOS13 was assayed against 4 pathogenic bacteria using agar well-diffusion assay and using benzyl Penicillin, Clindamycin, Ofloxacin and Doxycycline as positive controls. The concentration inhibiting 50% bacterial growth and the minimum inhibition concentration (MIC). The mode of action of phycocyanin on bacteria was explored using electron microscopy (SEM & TEM). Phycocyanin from Anabaena oryzae SOS13 has α and ...

  4. Diversity of Aspergillus oryzae genotypes (RFLP) isolated from traditional soy sauce production within Malaysia and Southeast Asia

    DNA fingerprinting was performed on 64 strains of Aspergillus oryzae and one strain of A. sojae isolated from soysauce factories within Malaysia and Southeast Asia that use primitive traditional methods in producing 'tamari type' Cantonese soy sauce. PstI digests of total genomic DNA from each isol...

  5. The transfer RNA genes in Oryza sativa L.ssp.indica

    王希胤; 史晓黎; 郝柏林

    2002-01-01

    The availability of the draft genome sequence of Oryza sativa L. ssp. indica has made it possible to study the rice tRNA genes. A total of 596 tRNA genes, including 3 selenocysteine tRNA genes and one suppressor tRNA gene are identified in 127551 rice contigs. There are 45 species of tRNA genes and the revised wobble hypothesis proposed by Guthrie and Abelson is perfectly obeyed. The relationship between codon usage and the number of corresponding tRNA genes is discussed. Redundancy may exist in the present list of tRNA genes and novel ones may be found in the future. A set of 33 tRNA genes is discovered in the complete chloroplast genome of Oryza sativa L. ssp. indica. These tRNA genes are identical to those in ssp. japonica identified by us independently from the origional annotation.

  6. Isolation and Characterization of Microsatellite Loci in the Asian Rice Gall Midge (Orseolia oryzae) (Diptera: Cecidomyiidae)

    Jagadish S. Bentur; Sinha, Deepak Kumar; Padmavathy,; Revathy, Charagonda; Muthulakshmi, Mayandi; Nagaraju, Javaregowda

    2011-01-01

    Microsatellite loci were isolated from the genomic DNA of the Asian rice gall midge, Orseolia oryzae (Wood-Mason) using a hybridization capture approach. A total of 90 non-redundant primer pairs, representing unique loci, were designed. These simple sequence repeat (SSR) markers represented di (72%), tri (15.3%), and complex repeats (12.7%). Three biotypes of gall midge (20 individuals for each biotype) were screened using these SSRs. The results revealed that 15 loci were hyper variable and ...

  7. Predicting the Interactome of Xanthomonas oryzae pathovar oryzae for target selection and DB service

    Yoon Kyong-Oh

    2008-01-01

    Full Text Available Abstract Background Protein-protein interactions (PPIs play key roles in various cellular functions. In addition, some critical inter-species interactions such as host-pathogen interactions and pathogenicity occur through PPIs. Phytopathogenic bacteria infect hosts through attachment to host tissue, enzyme secretion, exopolysaccharides production, toxins release, iron acquisition, and effector proteins secretion. Many such mechanisms involve some kind of protein-protein interaction in hosts. Our first aim was to predict the whole protein interaction pairs (interactome of Xanthomonas oryzae pathovar oryzae (Xoo that is an important pathogenic bacterium that causes bacterial blight (BB in rice. We developed a detection protocol to find possibly interacting proteins in its host using whole genome PPI prediction algorithms. The second aim was to build a DB server and a bioinformatic procedure for finding target proteins in Xoo for developing pesticides that block host-pathogen protein interactions within critical biochemical pathways. Description A PPI network in Xoo proteome was predicted by bioinformatics algorithms: PSIMAP, PEIMAP, and iPfam. We present the resultant species specific interaction network and host-pathogen interaction, XooNET. It is a comprehensive predicted initial PPI data for Xoo. XooNET can be used by experimentalists to pick up protein targets for blocking pathological interactions. XooNET uses most of the major types of PPI algorithms. They are: 1 Protein Structural Interactome MAP (PSIMAP, a method using structural domain of SCOP, 2 Protein Experimental Interactome MAP (PEIMAP, a common method using public resources of experimental protein interaction information such as HPRD, BIND, DIP, MINT, IntAct, and BioGrid, and 3 Domain-domain interactions, a method using Pfam domains such as iPfam. Additionally, XooNET provides information on network properties of the Xoo interactome. Conclusion XooNET is an open and free public

  8. AAS 227: Welcome!

    Kohler, Susanna

    2016-01-01

    Greetings from the 227th American Astronomical Society meeting in Kissimmee, Florida! This week, along with several fellow authors from astrobites, Iwill bewritingupdates on selectedevents at themeeting and posting at the end of each day. You can follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.If youre an author or referee (or plan to be!) and youre here at the meeting, consider joining us at our Author and Referee Workshop on Wednesday in the Tallahassee room, where well be sharingsome of the exciting new features of the AAS journals. You can drop intoeither of the two-hour sessions(10 AM 12 PM or 1 PM 3 PM), and there will be afree buffet lunch at noon.Heres the agenda:Morning SessionTopic Speaker10:00 am 10:05 amIntroductionsJulie Steffen10:05 am 10:35 amChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac10:35 am 11:00 amThe Peer Review ProcessButler Burton11:00 am 11:15 amAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler11:15 am 11:30 amFixing Software and Instrumentation Publishing: New Paper Styles in AAS JournalsChris Lintott11:30 am 11:45 amMaking Article Writing Easier with the New AASTeX v6.0Greg Schwarz11:45 am 12:00 pmBringing JavaScript and Interactivity to Your AAS Journal FiguresGus MuenchLunch SessionTopic Speaker12:00 pm 12:15 pmUnified Astronomy ThesaurusKatie Frey12:15 pm 12:30 pmAAS/ADS ORCID Integration ToolAlberto Accomazzi12:30 pm 12:45 pmWorldWide Telescope and Video AbstractsJosh Peek12:45 pm 01:00 pmArizona Astronomical Data Hub (AADH)Bryan HeidornAfternoon SessionTopic Speaker01:00 pm 01:05 pmIntroductionsJulie Steffen01:05 pm 01:35 pmChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac01:35 pm 02:00 pmThe Peer Review ProcessButler Burton02:00 pm 02:15 pmAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler02:15 pm 02:30 pm

  9. Geomagnetic aa Indices

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa indices are the continuation of the series beginning in the year 1868. A full description of these indices is given in the International...

  10. Differentiation of Indica-Japonica rice revealed by insertion/deletion (InDel) fragments obtained from the comparative genomic study of DNA sequences between 93-11 (Indica) and Nipponbare (Japonica)

    CAI Xingxing; LIU Jing; QIU Yinqiu; ZHAO Wei; SONG Zhiping; LU Baorong

    2007-01-01

    DNA polymorphisms from nucleotide insertion/deletions (InDels) in genomic sequences are the basis for developing InDel molecular markers.To validate the InDel primer pairs on the basis of the comparative genomic study on DNA sequences between an Indica rice 93-11 and a Japonica rice Nipponbare for identifying Indica and Japonica rice varieties and studying wild Oryza species,we studied 49 Indica,43 Japonica,and 24 wild rice accessions collected from ten Asian countries using 45 InDel primer pairs.Results indicated that of the 45 InDel primer pairs,41 can accurately identify Indica and Japonica rice varieties with a reliability of over 80%.The scatter plotting data of the principal component analysis (PCA) indicated that:(i) the InDel primer pairs can easily distinguish Indica from Japonica rice varieties,in addition to revealing their genetic differentiation;(ii) the AA-genome wild rice species showed a relatively close genetic relationship with the Indica rice varieties;and (iii)the non-AA genome wild rice species did not show evident differentiation into the Indica and Japonica types.It is concluded from the study that most of the InDel primer pairs obtained from DNA sequences of 93-11 and Nipponbare can be used for identifying lndica and Japonica rice varieties,and for studying genetic relationships of wild rice species,particularly in terms of the Indica-Japonica differentiation.

  11. Genome annotations - KOME | LSDB Archive [Life Science Database Archive metadata

    Full Text Available ated to rice genomes in GenBank blastn/blastx results. Related to rice genomes is defined as follows: The word... Oryza sativa or rice is included in the definition of the entry and the word BAC, PAC, chromosome Genomic

  12. Characterization and expression analysis of a maltose-utilizing (MAL) cluster in Aspergillus oryzae.

    Hasegawa, Sachiko; Takizawa, Masahiro; Suyama, Haruhiko; Shintani, Takahiro; Gomi, Katsuya

    2010-01-01

    Starch and maltooligosaccharides such as maltose and maltotriose induce the production of amylolytic enzymes including alpha-amylase in Aspergillus oryzae. A transcriptional activator gene amyR, required for maltose induction of amylolytic enzymes, has been cloned and characterized. The amyR gene deletion mutant showed significantly poor growth on starch medium but normal growth on maltose medium. This indicated the existence of another maltose-utilizing system, whose expression might not be controlled by amyR. We have identified a gene cluster homologous to the MAL cluster of Saccharomyces cerevisiae in the A. oryzae genome. The cluster consists of a MAL61 homolog (designated malP), a MAL62 homolog (designated malT), and a MAL63 homolog (designated malR). Overexpression of malT in A. oryzae resulted in a significant increase in intracellular alpha-glucosidase activity, and that of malP allowed S. cerevisiaemal61Delta to grow on maltose. The expression of both malP and malT genes was highly up-regulated in the presence of maltose, but malR expressed constitutively irrespective of carbon sources. Disruption of malR resulted in the loss of malP and malT expression and thus in restricted growth on maltose medium. In addition, a malP disruptant showed a significantly reduced expression of malT and malR and exhibited a growth defect on maltose similar to the malR disruptant. These results suggest that the MAL cluster of A. oryzae is responsible for the assimilation of maltose in A. oryzae. PMID:19850146

  13. Phylogeography of Asian wild rice, Oryza rufipogon, reveals multiple independent domestications of cultivated rice, Oryza sativa

    Londo, Jason P.; Chiang, Yu-Chung; Hung, Kuo-Hsiang; Chiang, Tzen-Yuh; Schaal, Barbara A.

    2006-01-01

    Cultivated rice, Oryza sativa L., represents the world’s most important staple food crop, feeding more than half of the human population. Despite this essential role in world agriculture, the history of cultivated rice’s domestication from its wild ancestor, Oryza rufipogon, remains unclear. In this study, DNA sequence variation in three gene regions is examined in a phylogeographic approach to investigate the domestication of cultivated rice. Results indicate that India and Indochina may rep...

  14. AAS Career Services

    Marvel, Kevin B.

    2012-08-01

    The American Astronomical Society provides substantial programs in the area of Career Services.Motivated by the Society's mission to enhance and share humanity's understanding of the Universe, the AAS provides a central resource for advertising positions, interviewing opportunities at its annual winter meeting and information, workshops and networks to enable astronomers to find employment.The programs of the Society in this area are overseen by an active committee on employment and the AAS Council itself.Additional resources that help characterize the field, its growth and facts about employment such as salaries and type of jobs available are regularly summarized and reported on by the American Institute of Physics.

  15. Lethal and mutagenic effects of ion beams and γ-rays in Aspergillus oryzae

    Highlights: ► We investigated the effects of different LET radiation in A. oryzae. ► Both γ-rays and ion beams induced base substitutions, frameshifts, deletions. ► Both γ-rays and ion beams induced genome-wide large-scale mutations in A. oryzae. ► Some differences in the types and frequencies of mutations were found. ► Our results provide new basic insights into the mutation breeding of A. oryzae. - Abstract: Aspergillus oryzae is a fungus that is used widely in traditional Japanese fermentation industries. In this study, the lethal and mutagenic effects of different linear energy transfer (LET) radiation in freeze-dried conidia of A. oryzae were investigated. The lethal effect, which was evaluated by a 90% lethal dose, was dependent on the LET value of the ionizing radiation. The most lethal ionizing radiation among that tested was 12C5+ ion beams with an LET of 121 keV/μm. The 12C5+ ion beams had a 3.6-times higher lethal effect than low-LET (0.2 keV/μm) γ-rays. The mutagenic effect was evaluated by the frequency of selenate resistant mutants. 12C6+ ion beams with an LET of 86 keV/μm were the most effective in inducing selenate resistance. The mutant frequency following exposure to 12C6+ ion beams increased with an increase in dose and reached 3.47 × 10−3 at 700 Gy. In the dose range from 0 to 700 Gy, 12C5+ ion beams were the second most effective in inducing selenate resistance, the mutant frequency of which reached a maximum peak (1.67 × 10−3) at 400 Gy. To elucidate the characteristics of mutation induced by ionizing radiation, mutations in the sulphate permease gene (sB) and ATP sulfurylase gene (sC) loci, the loss of function of which results in a selenate resistant phenotype, were compared between 12C5+ ion beams and γ-rays. We detected all types of transversions and transitions. For frameshifts, the frequency of a +1 frameshift was the highest in all cases. Although the incidence of deletions >2 bp was generally low, deletions >20

  16. Antimicrobial peptide melittin against Xanthomonas oryzae pv. oryzae, the bacterial leaf blight pathogen in rice.

    Shi, Wei; Li, Caiyun; Li, Man; Zong, Xicui; Han, Dongju; Chen, Yuqing

    2016-06-01

    Xanthomonas oryzae pv. oryzae is a destructive bacterial disease of rice, and the development of an environmentally safe bactericide is urgently needed. Antimicrobial peptides, as antibacterial sources, may play important roles in bactericide development. In the present study, we found that the antimicrobial peptide melittin had the desired antibacterial activity against X. oryzae pv. oryzae. The antibacterial mechanism was investigated by examining its effects on cell membranes, energy metabolism, and nucleic acid, and protein synthesis. The antibacterial effects arose from its ability to interact with the bacterial cell wall and disrupt the cytoplasmic membrane by making holes and channels, resulting in the leakage of the cytoplasmic content. Additionally, melittin is able to permeabilize bacterial membranes and reach the cytoplasm, indicating that there are multiple mechanisms of antimicrobial action. DNA/RNA binding assay suggests that melittin may inhibit macromolecular biosynthesis by binding intracellular targets, such as DNA or RNA, and that those two modes eventually lead to bacterial cell death. Melittin can inhibit X. oryzae pv. oryzae from spreading, alleviating the disease symptoms, which indicated that melittin may have potential applications in plant protection. PMID:26948237

  17. Identification and analysis of in planta expressed genes of Magnaporthe oryzae

    Mitchell Thomas K

    2010-02-01

    Full Text Available Abstract Background Infection of plants by pathogens and the subsequent disease development involves substantial changes in the biochemistry and physiology of both partners. Analysis of genes that are expressed during these interactions represents a powerful strategy to obtain insights into the molecular events underlying these changes. We have employed expressed sequence tag (EST analysis to identify rice genes involved in defense responses against infection by the blast fungus Magnaporthe oryzae and fungal genes involved in infectious growth within the host during a compatible interaction. Results A cDNA library was constructed with RNA from rice leaves (Oryza sativa cv. Hwacheong infected with M. oryzae strain KJ201. To enrich for fungal genes, subtraction library using PCR-based suppression subtractive hybridization was constructed with RNA from infected rice leaves as a tester and that from uninfected rice leaves as the driver. A total of 4,148 clones from two libraries were sequenced to generate 2,302 non-redundant ESTs. Of these, 712 and 1,562 ESTs could be identified to encode fungal and rice genes, respectively. To predict gene function, Gene Ontology (GO analysis was applied, with 31% and 32% of rice and fungal ESTs being assigned to GO terms, respectively. One hundred uniESTs were found to be specific to fungal infection EST. More than 80 full-length fungal cDNA sequences were used to validate ab initio annotated gene model of M. oryzae genome sequence. Conclusion This study shows the power of ESTs to refine genome annotation and functional characterization. Results of this work have advanced our understanding of the molecular mechanisms underpinning fungal-plant interactions and formed the basis for new hypothesis.

  18. AAS Oral History Project

    Buxner, Sanlyn; Holbrook, Jarita; AAS Oral History Team

    2016-06-01

    Now in its fourth year, the AAS Oral History Project has interviewed over 80 astronomers from all over the world. Led by the AAS Historical Astronomy Division (HAD) and partially funded by the American Institute of Physics Niels Bohr Library and ongoing support from the AAS, volunteers have collected oral histories from astronomers at professional meetings starting in 2015, including AAS, DPS, and the IAU general assembly. Each interview lasts one and a half to two hours and focuses on interviewees’ personal and professional lives. Questions include those about one’s family, childhood, strong influences on one’s scientific career, career path, successes and challenges, perspectives on how astronomy is changing as a field, and advice to the next generation. Each interview is audio recorded and transcribed, the content of which is checked with each interviewee. Once complete, interview transcripts are posted online as part of a larger oral history library at https://www.aip.org/history-programs/niels-bohr-library/oral-histories. Future analysis will reveal a rich story of astronomers and will help the community address issues of diversity, controversies, and the changing landscape of science. We are still recruiting individuals to be interviewed from all stages of career from undergraduate students to retired and emeritus astronomers. Contact Jarita Holbrook to schedule an interview or to find out more information about the project (astroholbrook@gmail.com). Also, contact Jarita Holbrook if you would like to become an interviewer for the project.

  19. The Perennial Ryegrass GenomeZipper – Targeted Use of Genome Resources for Comparative Grass Genomics

    Pfeiffer, Matthias; Martis, Mihaela; Asp, Torben;

    2013-01-01

    (Lolium perenne) genome on the basis of conserved synteny to barley (Hordeum vulgare) and the model grass genome Brachypodium (Brachypodium distachyon) as well as rice (Oryza sativa) and sorghum (Sorghum bicolor). A transcriptome-based genetic linkage map of perennial ryegrass served as a scaffold to...... assignment of 3,315 out of 8,876 previously unmapped genes to the respective chromosomes. In total, the GenomeZipper incorporates 4,035 conserved grass gene loci, which were used for the first genome-wide sequence divergence analysis between perennial ryegrass, barley, Brachypodium, rice, and sorghum. The...

  20. Suppressive effects of mycoviral proteins encoded by Magnaporthe oryzae chrysovirus 1 strain A on conidial germination of the rice blast fungus.

    Urayama, Syun-Ichi; Kimura, Yuri; Katoh, Yu; Ohta, Tomoko; Onozuka, Nobuya; Fukuhara, Toshiyuki; Arie, Tsutomu; Teraoka, Tohru; Komatsu, Ken; Moriyama, Hiromitsu

    2016-09-01

    Magnaporthe oryzae chrysovirus 1 strain A (MoCV1-A) is the causal agent of growth repression and attenuated virulence (hypovirulence) of the rice blast fungus, Magnaporthe oryzae. We previously revealed that heterologous expression of the MoCV1-A ORF4 protein resulted in cytological damage to the yeasts Saccharomyces cerevisiae and Cryptococcus neoformans. Since the ORF4 protein is one of the components of viral particles, we evaluated the inhibitory effects of the purified virus particle against the conidial germination of M. oryzae, and confirmed its suppressive effects. Recombinant MoCV1-A ORF4 protein produced in Pichia pastoris was also effective for suppression of conidial germination of M. oryzae. MoCV1-A ORF4 protein sequence showed significant similarity to 6 related mycoviral proteins; Botrysphaeria dothidea chrysovirus 1, two Fusarium graminearum viruses, Fusarium oxysporum f. sp. dianthi mycovirus 1, Penicillium janczewski chrysovirus and Agaricus bisporus virus 1 in the Chrysoviridae family. Multiple alignments of the ORF4-related protein sequences showed that their central regions (210-591 aa in MoCV1-A ORF4) are relatively conserved. Indeed, yeast transformants expressing the conserved central region of MoCV1-A ORF4 protein (325-575 aa) showed similar impaired growth phenotypes as those observed in yeasts expressing the full-length MoCV1-A ORF4 protein. These data suggest that the mycovirus itself and its encoded viral protein can be useful as anti-fungal proteins to control rice blast disease caused by M. oryzae and other pathogenic fungi. PMID:27329666

  1. Molecular cloning, sequence analysis and expression of a novel gene induced by near-UV light in Bipolaris oryzae.

    Kihara, J; Sato, A; Okajima, S; Kumagai, T

    2001-09-01

    A cDNA clone derived from a novel gene (uvi-1) that is inducible by near-UV light was isolated by a differential screening procedure from a cDNA library of the fungus Bipolaris oryzae and characterized further. Sequence analysis of the clone revealed that uvi-1 encodes a protein with a putative molecular mass of 17 kDa; the UVI-1 protein shows significant similarity to a putative protein encoded by a cDNA which is expressed during appressorium formation in the rice blast fungus, Magnaporthe grisea. The corresponding genomic clone was also isolated, and Southern analysis of genomic DNA indicated the presence of a single copy of the uvi-1 gene in B. oryzae. Northern analysis showed that the uvi-1 transcripts are induced by exposure to near-UV light, but not by blue or red light. Furthermore, accumulation of uvi-1 transcripts is observed during differentiation of the appressorium. PMID:11589579

  2. Analysis of the Proteins Secreted from the Oryza meyeriana Suspension-Cultured Cells Induced by Xanthomonas oryzae pv. oryzae

    Chen, Xian; Dong, Yan; Yu, Chulang; Fang, XianPing; Deng, Zhiping; Yan, Chengqi; Chen, Jianping

    2016-01-01

    Oryza meyeriana, a wild species of rice from China, shows high resistance to Xanthomonas oryzae pv. oryzae (Xoo), the cause of rice bacterial blight, one of the most serious rice pathogens. To better understand the resistance mechanism, a proteomic study was conducted to identify changes in the proteins secreted in embryo cell suspension cultures in response to Xoo. After two-dimensional difference gel electrophoresis (2D-DIGE), 72 differentially expressed protein spots corresponding to 34 proteins were identified by Matrix-Assisted Laser Desorption/ Ionization Time of Flight Mass Spectrometry. Of the 34 proteins, 10 were up regulated and 24 down regulated. The secreted proteins identified were predicted to be involved in various biological processes, including signal transduction, defense, ROS and cell wall modification. 77% of the 34 proteins were predicted to have a signal peptide by Signal P. Quantitative Real-Time PCR showed that transcript levels of 14 secreted proteins were not well correlated with secreted protein levels. Peroxidase activity was up regulated in both O. meyriana and susceptible rice but was about three times higher in O. meyeriana. This suggests that peroxidases may play an important role in the early response to Xoo in O. meyeriana. These results not only provide a better understanding of the resistance mechanism of O. meyeriana, but have implications for studies of the interactions between other plants and their pathogens. PMID:27196123

  3. Analysis of the Proteins Secreted from the Oryza meyeriana Suspension-Cultured Cells Induced by Xanthomonas oryzae pv. oryzae.

    Chen, Xian; Dong, Yan; Yu, Chulang; Fang, XianPing; Deng, Zhiping; Yan, Chengqi; Chen, Jianping

    2016-01-01

    Oryza meyeriana, a wild species of rice from China, shows high resistance to Xanthomonas oryzae pv. oryzae (Xoo), the cause of rice bacterial blight, one of the most serious rice pathogens. To better understand the resistance mechanism, a proteomic study was conducted to identify changes in the proteins secreted in embryo cell suspension cultures in response to Xoo. After two-dimensional difference gel electrophoresis (2D-DIGE), 72 differentially expressed protein spots corresponding to 34 proteins were identified by Matrix-Assisted Laser Desorption/ Ionization Time of Flight Mass Spectrometry. Of the 34 proteins, 10 were up regulated and 24 down regulated. The secreted proteins identified were predicted to be involved in various biological processes, including signal transduction, defense, ROS and cell wall modification. 77% of the 34 proteins were predicted to have a signal peptide by Signal P. Quantitative Real-Time PCR showed that transcript levels of 14 secreted proteins were not well correlated with secreted protein levels. Peroxidase activity was up regulated in both O. meyriana and susceptible rice but was about three times higher in O. meyeriana. This suggests that peroxidases may play an important role in the early response to Xoo in O. meyeriana. These results not only provide a better understanding of the resistance mechanism of O. meyeriana, but have implications for studies of the interactions between other plants and their pathogens. PMID:27196123

  4. The Antiproton Accumulator (AA)

    1980-01-01

    Section 06 - 08*) of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A vacuum-tank, two bending magnets (BST06 and BST07 in blue) with a quadrupole (QDN07, in red) in between, another vacuum-tank, a wide quadrupole (QFW08) and a further tank . The tanks are covered with heating tape for bake-out. The tank left of BST06 contained the stack core pickup for stochastic cooling (see 7906193, 7906190, 8005051), the two other tanks served mainly as vacuum chambers in the region where the beam was large. Peter Zettwoch works on BST06. *) see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984)

  5. AA, bending magnet, BLG

    1980-01-01

    The very particular lattice of the AA required 2 types of dipole (bending magnets; BLG, long and narrow; BST, short and wide). The BLG had a steel length of 4.70 m, a good field width of 0.24 m, and a weight of about 70 t. Jean-Claude Brunet inspects the lower half of a BLG. For the BST magnets see 7811105 and 8006036.

  6. Differential Gene Expression Reflects Morphological Characteristics and Physiological Processes in Rice Immunity against Blast Pathogen Magnaporthe oryzae

    Azizi, Parisa; Rafii, Mohd Y.; Mahmood, Maziah; Abdullah, Siti N. A.; Hanafi, Mohamed M.; Nejat, Naghmeh; Latif, Muhammad A.; Sahebi, Mahbod

    2015-01-01

    The rice blast fungus Magnaporthe oryzae is a serious pathogen that jeopardises the world’s most important food-security crop. Ten common Malaysian rice varieties were examined for their morphological, physiological and genomic responses to this rice blast pathogen. qPCR quantification was used to assess the growth of the pathogen population in resistant and susceptible rice varieties. The chlorophyll content and photosynthesis were also measured to further understand the disruptive effects t...

  7. Discovery and analysis of an active long terminal repeat-retrotransposable element in Aspergillus oryzae.

    Jie Jin, Feng; Hara, Seiichi; Sato, Atsushi; Koyama, Yasuji

    2014-01-01

    Wild-type Aspergillus oryzae RIB40 contains two copies of the AO090005001597 gene. We previously constructed A. oryzae RIB40 strain, RKuAF8B, with multiple chromosomal deletions, in which the AO090005001597 copy number was found to be increased significantly. Sequence analysis indicated that AO090005001597 is part of a putative 6,000-bp retrotransposable element, flanked by two long terminal repeats (LTRs) of 669 bp, with characteristics of retroviruses and retrotransposons, and thus designated AoLTR (A. oryzae LTR-retrotransposable element). AoLTR comprised putative reverse transcriptase, RNase H, and integrase domains. The deduced amino acid sequence alignment of AoLTR showed 94% overall identity with AFLAV, an A. flavus Tf1/sushi retrotransposon. Quantitative real-time RT-PCR showed that AoLTR gene expression was significantly increased in the RKuAF8B, in accordance with the increased copy number. Inverse PCR indicated that the full-length retrotransposable element was randomly integrated into multiple genomic locations. However, no obvious phenotypic changes were associated with the increased AoLTR gene copy number. PMID:24646755

  8. OryzaExpress: An Integrated Database of Gene Expression Networks and Omics Annotations in Rice

    Hamada, Kazuki; Hongo, Kohei; Suwabe, Keita; Shimizu, Akifumi; Nagayama, Taishi; Abe, Reina; Kikuchi, Shunsuke; Yamamoto, Naoki; Fujii, Takaaki; Yokoyama, Koji; Tsuchida, Hiroko; Sano, Kazumi; Mochizuki, Takako; Oki, Nobuhiko; Horiuchi, Youko; Fujita, Masahiro; Watanabe, Masao; Matsuoka, Makoto; Kurata, Nori; Yano, Kentaro

    2011-01-01

    Similarity of gene expression profiles provides important clues for understanding the biological functions of genes, biological processes and metabolic pathways related to genes. A gene expression network (GEN) is an ideal choice to grasp such expression profile similarities among genes simultaneously. For GEN construction, the Pearson correlation coefficient (PCC) has been widely used as an index to evaluate the similarities of expression profiles for gene pairs. However, calculation of PCCs for all gene pairs requires large amounts of both time and computer resources. Based on correspondence analysis, we developed a new method for GEN construction, which takes minimal time even for large-scale expression data with general computational circumstances. Moreover, our method requires no prior parameters to remove sample redundancies in the data set. Using the new method, we constructed rice GENs from large-scale microarray data stored in a public database. We then collected and integrated various principal rice omics annotations in public and distinct databases. The integrated information contains annotations of genome, transcriptome and metabolic pathways. We thus developed the integrated database OryzaExpress for browsing GENs with an interactive and graphical viewer and principal omics annotations (http://riceball.lab.nig.ac.jp/oryzaexpress/). With integration of Arabidopsis GEN data from ATTED-II, OryzaExpress also allows us to compare GENs between rice and Arabidopsis. Thus, OryzaExpress is a comprehensive rice database that exploits powerful omics approaches from all perspectives in plant science and leads to systems biology. PMID:21186175

  9. The Antiproton Accumulator (AA)

    1980-01-01

    A section of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A large vacuum-tank, a quadrupole (QDN09*), a bending magnet (BST08), another vacuum-tank, a wide quadrupole (QFW08) and (in the background) a further bending magnet (BST08). The tanks are covered with heating tape for bake-out. The tank left of QDN09 contained the kickers for stochastic pre-cooling (see 790621, 8002234, 8002637X), the other one served mainly as vacuum chamber in the region where the beam was large. Peter Zettwoch works on QFW08. * see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984) See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  10. Rice Snl6, a cinnamoyl-CoA reductase-like gene family member, is required for NH1-mediated immunity to Xanthomonas oryzae pv. oryzae.

    Rebecca S Bart

    2010-09-01

    Full Text Available Rice NH1 (NPR1 homolog 1 is a key mediator of innate immunity. In both plants and animals, the innate immune response is often accompanied by rapid cell death at the site of pathogen infection. Over-expression of NH1 in rice results in resistance to the bacterial pathogen, Xanthomonas oryzae pv. oryzae (Xoo, constitutive expression of defense related genes and enhanced benzothiadiazole (BTH- mediated cell death. Here we describe a forward genetic screen that identified a suppressor of NH1-mediated lesion formation and resistance, snl6. Comparative genome hybridization and fine mapping rapidly identified the genomic location of the Snl6 gene. Snl6 is a member of the cinnamoyl-CoA reductase (CCR-like gene family. We show that Snl6 is required for NH1-mediated resistance to Xoo. Further, we show that Snl6 is required for pathogenesis-related gene expression. In contrast to previously described CCR family members, disruption of Snl6 does not result in an obvious morphologic phenotype. Snl6 mutants have reduced lignin content and increased sugar extractability, an important trait for the production of cellulosic biofuels. These results suggest the existence of a conserved group of CCR-like genes involved in the defense response, and with the potential to alter lignin content without affecting development.

  11. Secondary Metabolites of Curvularia oryzae MTCC 2605

    Siddhardha Busi

    2009-10-01

    Full Text Available Curvularia oryzae MTCC 2605 was exploited for the production of secondary metabolites. The major compounds from the crude extract were purified by silica gel column chromatography and identified to be 11-α-methoxycurvularin and (S-5-ethyl-8, 8-dimethylnonanal by NMR and Mass spectral data. Bioassays showed that 11-α-methoxycurvularin was active against bacteria, fungi and 4th instar Spodoptera litura larvae

  12. Elimination of Sitophilus oryzae (L.) by irradiation

    Food treatment by exposure to ionizing radiation, known as food irradiation, presents several attractive features such as: leaving no residues, posing no threat to consumer health, usually causing no damage to sensory or nutritional properties and acting uniformly throughout the volume of the products. This work investigated the efficiency of irradiation for eliminating Sitophilus oryzae (L.), also known as 'the rice weevil', a small beetle frequently found in infested grains. A total of 444 individuals of Sitophilus oryzae (L.) found in corn meal and noodles supplies were irradiated with gamma ray doses of 0, 0.6, 0.9, 1.0, 1.2, 1.5 and 2.0 kGy and then visually monitored for 4 days in order to determine the number of insects still alive. The least-squares fitting method was used to determine the survival curves as functions of post-irradiation time and dose. The living fraction of the irradiated population was found to decrease exponentially with time. The results indicated that doses of 2.0, 1.5 and 0.6 kGy cause immediate death, instantaneous immobility and death of the species within one week, respectively. The findings suggest that disinfestation of Sitophilus oryzae (L.) by irradiation is an interesting option to the dangerous use of toxic chemicals. (author)

  13. Elimination of Sitophilus oryzae (L.) by irradiation

    Castro, Fernanda Peixoto [Exercito Brasileiro, Brasilia, DF (Brazil). Diretoria de Suprimento. Dept. Logistico]. E-mail: peixotocastro@dlog.eb.mil.br; Vital, Helio de Carvalho [Centro Tecnologico do Exercito (CTEx), Rio de Janeiro, RJ (brazil)]. E-mail: vital@ctex.eb.br

    2005-07-01

    Food treatment by exposure to ionizing radiation, known as food irradiation, presents several attractive features such as: leaving no residues, posing no threat to consumer health, usually causing no damage to sensory or nutritional properties and acting uniformly throughout the volume of the products. This work investigated the efficiency of irradiation for eliminating Sitophilus oryzae (L.), also known as 'the rice weevil', a small beetle frequently found in infested grains. A total of 444 individuals of Sitophilus oryzae (L.) found in corn meal and noodles supplies were irradiated with gamma ray doses of 0, 0.6, 0.9, 1.0, 1.2, 1.5 and 2.0 kGy and then visually monitored for 4 days in order to determine the number of insects still alive. The least-squares fitting method was used to determine the survival curves as functions of post-irradiation time and dose. The living fraction of the irradiated population was found to decrease exponentially with time. The results indicated that doses of 2.0, 1.5 and 0.6 kGy cause immediate death, instantaneous immobility and death of the species within one week, respectively. The findings suggest that disinfestation of Sitophilus oryzae (L.) by irradiation is an interesting option to the dangerous use of toxic chemicals. (author)

  14. The structure of the lipooligosaccharide from Xanthomonas oryzae pv. Oryzae: the causal agent of the bacterial leaf blight in rice.

    Di Lorenzo, Flaviana; Palmigiano, Angelo; Silipo, Alba; Desaki, Yoshitake; Garozzo, Domenico; Lanzetta, Rosa; Shibuya, Naoto; Molinaro, Antonio

    2016-06-01

    The structure of the lipooligosaccharide (LOS) from the rice pathogen Xanthomonas oryzae pv. oryzae has been elucidated. The characterization of the core oligosaccharide structure was obtained by the employment of two chemical degradation protocols and by analysis of the products via NMR spectroscopy. The structure of the lipid A portion was achieved by MALDI mass spectrometry analysis on purified lipid A. The LOS from Xanthomonas oryzae pv. oryzae revealed to possess the same core structure of Xanthomonas campestris pv. campestris and interesting novel features on its lipid A domain. The evaluation of the biological activity of both LOS and isolated lipid A was also executed. PMID:27085742

  15. Mapping of a new gene for brown planthopper resistance in cultivated rice introgressed from Oryza eichingeri

    2001-01-01

    Wild rice species is an important source of useful genes for cultivated rice improvement. Some accessions of Oryza eichingeri (2n = 24, CC) from Africa confer strong resistance to brown planthopper (BPH), whitebacked planthopper (WBPH) and bacterial blight (BB). In the present study, restriction fragments length polymorphism (RFLP) and simple sequence repeats (SSR) analysis were performed on disomic backcross plants between Oryza sativa (2n = 24, AA) and O. eichingeri in order to identify the presenee of O. eichingeri segments and further to localize BPH-resistant gene. In the introgression lines, 1-6O. eichingeri segments were detected on rice chromosomes 1, 2, 6, or/and 10. The dominant BPH resistant gene, tentatively named Bph13(t), was mapped to chromosome 2, being 6.1 and 5.5 cM away from two microsatellite markers RM240 and RM250, respectively. The transfer and localization of this gene from O. eichingeri will contribute to the improvement of BPH resistance in cultivated rice.``

  16. Elucidation of the hrp Clusters of Xanthomonas oryzae pv. oryzicola That Control the Hypersensitive Response in Nonhost Tobacco and Pathogenicity in Susceptible Host Rice

    Zou, Li-fang; Wang, Xing-ping; Xiang, Yong; Zhang, Bing; Li, Yu-Rong; Xiao, You-lun; Wang, Jin-sheng; Walmsley, Adrian R; Chen, Gong-You

    2006-01-01

    Xanthomonas oryzae pv. oryzicola, the cause of bacterial leaf streak in rice, possesses clusters of hrp genes that determine its ability to elicit a hypersensitive response (HR) in nonhost tobacco and pathogenicity in host rice. A 27-kb region of the genome of X. oryzae pv. oryzicola (RS105) was identified and sequenced, revealing 10 hrp, 9 hrc (hrp conserved), and 8 hpa (hrp-associated) genes and 7 regulatory plant-inducible promoter boxes. While the region from hpa2 to hpaB and the hrpF ope...

  17. Isolation and Characterization of Microsatellite Loci in the Asian Rice Gall Midge (Orseolia oryzae) (Diptera: Cecidomyiidae)

    Charagonda Revathy; Javaregowda Nagaraju; Ch. Padmavathy; Mayandi Muthulakshmi; Deepak Kumar Sinha; Jagadish S. Bentur

    2011-01-01

    Microsatellite loci were isolated from the genomic DNA of the Asian rice gall midge, Orseolia oryzae (Wood-Mason) using a hybridization capture approach. A total of 90 non-redundant primer pairs, representing unique loci, were designed. These simple sequence repeat (SSR) markers represented di (72%), tri (15.3%), and complex repeats (12.7%). Three biotypes of gall midge (20 individuals for each biotype) were screened using these SSRs. The results revealed that 15 loci were hyper variable and ...

  18. Genetic relationships between interspecific lines derived from Oryza glaberrima and Oryza sativa crosses using microsatellites and agro-morphological markers

    Yonnelle D. Moukoumbi

    2015-06-01

    Full Text Available New Rice(s for Africa (NERICA are high yielding rice varieties mostly cultivated in Sub-Saharan Africa and developed by the Africa Rice Center. This study is aimed at investigating the proportion of introgression of parental genomic contribution of 60 lowland NERICA varieties and establishment of molecular profiling. Agro-morphological data from 17 characteristics was recorded and significant (p<0.05 to high significant (p<0.0001 differences were obtained with leaf length and width, plant height at maturity, days to heading, maturity, primary and secondary branching of panicles, and grain width and grain thickness. A total of 114 microsatellite polymorphic markers covering 2183.13 cM of the rice genome showed the proportions of alleles introgressed from the donor parent (Oryza glaberrima into 52 lowland NERICA lines (TOG5681 and IR64as follows: 11% for BC2, 6.07% for BC3, and 7.55% for BC4. The introgression proportions for the eight remaining lowland NERICA lines derived from other crosses ranged from 5.5 to 11.3%. The proportion recorded with the recurrent parent was 83.99%. The highest introgression proportions of the O. glaberrima allele for all 60 lowland NERICA lines were found on chromosomes 2, 6, and 12 (TOG5681/IR64 and on chromosome 3 with NERIC-L-29 (TOG5681/IR1529-680-3-2. Multivariate analyses performed using an association of agro-morphological and molecular data revealed two major groups according to the distribution of the lowland NERICAs including the lowland NERICAs released were found in cluster 1 of the dendrogram. Genetic and genomic studies, QTL identification and analysis using agro-morphologically significant traits revealed should be used to develop mega-varieties adapted in rice growth conditions in Sub-Saharan Africa.

  19. Detection of Magnaporthe oryzae chrysovirus 1 in Japan and establishment of a rapid, sensitive and direct diagnostic method based on reverse transcription loop-mediated isothermal amplification.

    Komatsu, Ken; Urayama, Syun-Ichi; Katoh, Yu; Fuji, Shin-Ichi; Hase, Shu; Fukuhara, Toshiyuki; Arie, Tsutomu; Teraoka, Tohru; Moriyama, Hiromitsu

    2016-02-01

    Magnaporthe oryzae chrysovirus 1 (MoCV1) is a mycovirus with a dsRNA genome that infects the rice blast fungus Magnaporthe oryzae and impairs its growth. To date, MoCV1 has only been found in Vietnamese isolates of M. oryzae, and the distribution of this virus in M. oryzae isolates from other parts of the world remains unknown. In this study, using a one-step reverse transcription PCR (RT-PCR) assay, we detected a MoCV1-related virus in M. oryzae in Japan (named MoCV1-AK) whose sequence shares considerable similarity with that of the MoCV1 Vietnamese isolate. To establish a system for a comprehensive survey of MoCV1 infection in the field, we developed a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for direct detection of the virus. The sensitivity of the RT-LAMP assay was at least as high as that of the one-step RT-PCR assay. In addition, we detected MoCV1-AK in M. oryzae-infected oatmeal agar plates and lesions on rice leaves using the RT-LAMP assay without dsRNA extraction, by simple sampling with a toothpick. Preliminary screening of MoCV1 in Japanese M. oryzae isolates indicated that MoCV1 is currently distributed in rice fields in Japan. Our results provide a first example of the application of RT-LAMP for the detection of mycoviruses, which will accelerate surveys for mycovirus infection. PMID:26547578

  20. 21 CFR 173.130 - Carbohydrase derived from Rhizopus oryzae.

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Carbohydrase derived from Rhizopus oryzae. 173.130 Section 173.130 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES..., Phycomycetes; order, Mucorales; family, Mucoraceae; genus, Rhizopus; species, Rhizopus oryzae. (b) The...

  1. REACTION OF RICE (ORYZA SATIVA) CULTIVARS TO PENETRATION AND INFECTION BY CURVULARIA TUBERCULATA AND C. ORYZAE

    Isolates of Curvularia species were collected from weedy Cyperaceae species and are being evaluated as possible biocontrol agents of sedge weeds in rice (Oryza sativa). Curvularia species have been reported from rice; thus cultivars of rice were tested to determine rice seedling responses to these ...

  2. Monitoring homologous recombination in rice (Oryza sativa L.)

    Here we describe a system to assay homologous recombination during the complete life cycle of rice (Oryza sativa L.). Rice plants were transformed with two copies of non-functional GUS reporter overlap fragments as recombination substrate. Recombination was observed in all plant organs examined, from the seed stage until the flowering stage of somatic plant development. Embryogenic cells exhibited the highest recombination ability with an average of 3 x 10-5 recombination events per genome, which is about 10-fold of that observed in root cells, and two orders of that observed in leaf cells. Histological analysis revealed that recombination events occurred in diverse cell types, but preferentially in cells with small size. Examples of this included embryogenic cells in callus, phloem cells in the leaf vein, and cells located in the root apical meristem. Steady state RNA analysis revealed that the expression levels of rice Rad51 homologs are positively correlated with increased recombination rates in embryogenic calli, roots and anthers. Finally, radiation treatment of plantlets from distinct recombination lines increased the recombination frequency to different extents. These results showed that homologous recombination frequency can be effectively measured in rice using a transgene reporter assay. This system will facilitate the study of DNA damage signaling and homologous recombination in rice, a model monocot.

  3. Monitoring homologous recombination in rice (Oryza sativa L.)

    Yang Zhuanying; Tang Li [Guangdong Provincial Key Lab of Biotechnology for Plant Development, College of Life Sciences, South China Normal University, Guangzhou 510631 (China); Li Meiru [South China Botanic Garden, Chinese Academy of Sciences, Guangzhou 510650 (China); Chen Lei; Xu Jie [Guangdong Provincial Key Lab of Biotechnology for Plant Development, College of Life Sciences, South China Normal University, Guangzhou 510631 (China); Wu Goujiang [South China Botanic Garden, Chinese Academy of Sciences, Guangzhou 510650 (China); Li Hongqing, E-mail: hqli@scnu.edu.cn [Guangdong Provincial Key Lab of Biotechnology for Plant Development, College of Life Sciences, South China Normal University, Guangzhou 510631 (China)

    2010-09-10

    Here we describe a system to assay homologous recombination during the complete life cycle of rice (Oryza sativa L.). Rice plants were transformed with two copies of non-functional GUS reporter overlap fragments as recombination substrate. Recombination was observed in all plant organs examined, from the seed stage until the flowering stage of somatic plant development. Embryogenic cells exhibited the highest recombination ability with an average of 3 x 10{sup -5} recombination events per genome, which is about 10-fold of that observed in root cells, and two orders of that observed in leaf cells. Histological analysis revealed that recombination events occurred in diverse cell types, but preferentially in cells with small size. Examples of this included embryogenic cells in callus, phloem cells in the leaf vein, and cells located in the root apical meristem. Steady state RNA analysis revealed that the expression levels of rice Rad51 homologs are positively correlated with increased recombination rates in embryogenic calli, roots and anthers. Finally, radiation treatment of plantlets from distinct recombination lines increased the recombination frequency to different extents. These results showed that homologous recombination frequency can be effectively measured in rice using a transgene reporter assay. This system will facilitate the study of DNA damage signaling and homologous recombination in rice, a model monocot.

  4. AAS 227: Day 2

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  5. NCBI nr-aa BLAST: CBRC-GGAL-03-0025 [SEVENS

    Full Text Available CBRC-GGAL-03-0025 ref|YP_450021.1| aminotransferase [Xanthomonas oryzae pv. oryzae ...MAFF 311018] ref|YP_199733.6| aspartate aminotransferase [Xanthomonas oryzae pv. oryzae KACC10331] dbj|BAE67...747.1| aminotransferase [Xanthomonas oryzae pv. oryzae MAFF 311018] YP_450021.1 5.5 30% ...

  6. Cloning, expression, crystallization and preliminary X-ray crystallographic analysis of glutamyl-tRNA synthetase (Xoo1504) from Xanthomonas oryzae pv. oryzae

    Glutamyl-tRNA synthetase (GluRS) is an essential enzyme for protein translation and has been considered as a target for drug development. In this paper, the cloning, expression and purification of the GluRS protein encoded by the gltX gene (Xoo1504) and its preliminarily crystallographic analysis are reported. The gltX gene from Xanthomonas oryzae pv. oryzae (Xoo1504) encodes glutamyl-tRNA synthetase (GluRS), one of the most important enzymes involved in bacterial blight (BB), which causes huge production losses of rice worldwide. GluRS is a class I-type aminoacyl-tRNA synthetase (aaRS) that is primarily responsible for the glutamylation of tRNAGlu. It plays an essential role in protein synthesis, as well as the regulation of cells, in all organisms. As it represents an important target for the development of new antibacterial drugs against BB, determination of the three-dimensional structure of GluRS is essential in order to understand its catalytic mechanism. In order to analyze its structure and function, the gltX gene was cloned and the GluRS enzyme was expressed, purified and then crystallized. A GluRS crystal belonging to the monoclinic space group C2 diffracted to 2.8 Å resolution and had unit-cell parameters a = 186.8, b = 108.4, c = 166.1 Å, β = 96.3°. The unit-cell volume of the crystal allowed the presence of six to eight monomers in the asymmetric unit, with a corresponding Matthews coefficient (VM) range of 2.70–2.02 Å3 Da−1 and a solvent-content range of 54.5–39.3%

  7. AAS 227: Day 2

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  8. AAS 227: Day 1

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or at astrobites.com, or catch ourlive-tweeted updates from the @astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto have so many people tell us that they already know about and useastrobites, and we were excited to introduce a new cohort of students at AAS to astrobites for the first time.Tuesday morning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended today.Opening Address (by Becky Smethurst)The President of the AAS, aka our fearless leader Meg Urry kicked off the meeting this morning at the purely coffee powered hour of 8am this morning. She spoke about the importance of young astronomers at the meeting (heres looking at you reader!) and also the importance of the new Working Group for Accessibility and Disabilities (aka WGAD pronounced like wicked) at the AAS. The Society has made extra effort this year to make the conference accessible to all,a message which was very well received by everyone in attendance.Kavli Lecture: New Horizons Alan Stern (by Becky Smethurst)We were definitely spoilt with the first Plenary lecture at this years conference Alan Stern gave us a a review of the New Horizons mission of the Pluto Fly By (astrobites covered the mission back in July with this post). We were treated to beautiful images, wonderful results and a foray into geology.Before (Hubble) and after #NewHorizons. #thatisall #science #astro alanstern #aas227 pic.twitter.com/kkMt6RsSIR Science News (@topsciencething) January 5, 2016Some awesome facts from the lecture that blew my mind:New Horizons is now 2AU (!) beyond Pluto

  9. Genomewide survey and characterization of metacaspase gene family in rice (Oryza sativa)

    Likai Wang; Hua Zhang

    2014-04-01

    Metacaspases (MCs), which are cysteine-dependent proteases found in plants, fungi, and protozoa, may be involved in programmed cell death processes, being distant relatives of metazoan caspases. In this study, we analysed the structures, phylogenetic relationship, genome localizations, expression patterns and domestic selections of eight MC genes identified in rice (OsMC). Alignment analysis of the corresponding protein sequences suggested OsMC proteins can be classified into two sub-types. The expression profiles of eight OsMC genes were analysed in 27 tissues covering the whole life cycle of rice. There are four OsMC genes uniquely expressed in mature tissues, indicating that these genes might play certain roles in senescence. Under abiotic and biotic stresses, four OsMC genes were expressed with treatments of one or more of Magnaporthe oryzae (M. oryzae) infected, pest damaged, cold stress and drought stress, indicating they might be involved in plant defense. In addition, gene trees and genetic diversity $(\\pi)$ were performed to measure whether candidate genes were selected during rice domestication. The results suggested that all the type I genes could not be domestication genes. However, two of five type II OsMC genes showed strong evidence for selective sweep, suggesting that these genes might be involved in cultivated rice domestication. These results provide a foundation for future functional genomic studies of this family in rice.

  10. Variation suggestive of horizontal gene transfer at a lipopolysaccharide (lps biosynthetic locus in Xanthomonas oryzae pv. oryzae, the bacterial leaf blight pathogen of rice

    Sonti Ramesh V

    2004-10-01

    Full Text Available Abstract Background In animal pathogenic bacteria, horizontal gene transfer events (HGT have been frequently observed in genomic regions that encode functions involved in biosynthesis of the outer membrane located lipopolysaccharide (LPS. As a result, different strains of the same pathogen can have substantially different lps biosynthetic gene clusters. Since LPS is highly antigenic, the variation at lps loci is attributed to be of advantage in evading the host immune system. Although LPS has been suggested as a potentiator of plant defense responses, interstrain variation at lps biosynthetic gene clusters has not been reported for any plant pathogenic bacterium. Results We report here the complete sequence of a 12.2 kb virulence locus of Xanthomonas oryzae pv. oryzae (Xoo encoding six genes whose products are homologous to functions involved in LPS biosynthesis and transport. All six open reading frames (ORFs have atypical G+C content and altered codon usage, which are the hallmarks of genomic islands that are acquired by horizontal gene transfer. The lps locus is flanked by highly conserved genes, metB and etfA, respectively encoding cystathionine gamma lyase and electron transport flavoprotein. Interestingly, two different sets of lps genes are present at this locus in the plant pathogens, Xanthomonas campestris pv. campestris (Xcc and Xanthomonas axonopodis pv. citri (Xac. The genomic island is present in a number of Xoo strains from India and other Asian countries but is not present in two strains, one from India (BXO8 and another from Nepal (Nepal624 as well as the closely related rice pathogen, Xanthomonas oryzae pv. oryzicola (Xoor. TAIL-PCR analysis indicates that sequences related to Xac are present at the lps locus in both BXO8 and Nepal624. The Xoor strain has a hybrid lps gene cluster, with sequences at the metB and etfA ends, being most closely related to sequences from Xac and the tomato pathogen, Pseudomonas syringae pv. tomato

  11. AAS 227: Day 3

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  12. AAS 228: Day 4

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  13. Two ancient rounds of polyploidy in rice genome

    ZHANG Yang; XU Guo-hua; GUO Xing-yi; FAN Long-jiang

    2005-01-01

    An ancient genome duplication (PPP 1) that predates divergence ofthe cereals has recently been recognihere another potentially older large-scale duplication (PPP2) event that predates monocot-dicot divergence in the genome of rice (Oryza sativa L.), as inferred from the age distribution of pairs of duplicate genes based on recent genome data for rice. Our results suggest that paleopolyploidy was widespread and played an important role in the evolution of rice.

  14. Screening of gamma radiation-induced pathogen resistance rice lines against Xanthomonas oryzae pv. oryzae

    Lim, Chan Ju; Lee, Ha Yeon; Kim, Woong Bom; Ahmad, Raza; Moon, Jae Sun; Kwon, Suk Yoon [Korea Research Institute of Beoscience and Biotechnology, Daejeon (Korea, Republic of); Kim, Dong Sub [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)

    2010-09-15

    Bacterial blight is one of the most serious diseases of rice (Oryza sativa L.), and it has been known that Xanthomonas oryzae pv. oryzae (Xoo) causes this disease symptom. To develop resistance rice cultivars against Xoo, 3,000 lines of M{sub 3}, which were irradiated with gamma ray, were tested by 'scissor-dip method' primarily, and 191 putative resistant lines were selected. In M{sub 4} generation, these lines were screened again with various ways such as measuring of symptom of bacterial blight in leaf, number of tiller, fresh weight, and phenotypic segregation ratio in next generation. Finally, six resistance lines were selected. RT-PCR analysis revealed that these lines displayed high level of R-genes such as Xa21, Pi36, and Pi-ta. These results indicate that mutations by gamma ray cause disruptions of regulatory signal transduction systems of these R-genes. Furthermore, these selected mutants could be useful for the development of rice cultivar resistant to Xoo.

  15. Screening of gamma radiation-induced pathogen resistance rice lines against Xanthomonas oryzae pv. oryzae

    Bacterial blight is one of the most serious diseases of rice (Oryza sativa L.), and it has been known that Xanthomonas oryzae pv. oryzae (Xoo) causes this disease symptom. To develop resistance rice cultivars against Xoo, 3,000 lines of M3, which were irradiated with gamma ray, were tested by 'scissor-dip method' primarily, and 191 putative resistant lines were selected. In M4 generation, these lines were screened again with various ways such as measuring of symptom of bacterial blight in leaf, number of tiller, fresh weight, and phenotypic segregation ratio in next generation. Finally, six resistance lines were selected. RT-PCR analysis revealed that these lines displayed high level of R-genes such as Xa21, Pi36, and Pi-ta. These results indicate that mutations by gamma ray cause disruptions of regulatory signal transduction systems of these R-genes. Furthermore, these selected mutants could be useful for the development of rice cultivar resistant to Xoo

  16. The Drentsche Aa valley system

    This thesis is composed of five papers concerned with Late Quaternary geology and geomorphology of the Aa valley system. The correlation and chronostratigraphic position of the layers have been established by radiocarbon dating. (Auth.)

  17. Lethal and mutagenic effects of ion beams and γ-rays in Aspergillus oryzae

    Toyoshima, Yoshiyuki, E-mail: toyoshima@yamasa.com [Soy Sauce Laboratory, Yamasa Corporation, 2-10-1 Araoicho, Choshi, Chiba 288-0056 (Japan); Takahashi, Akemi; Tanaka, Hisaki; Watanabe, Jun; Mogi, Yoshinobu; Yamazaki, Tatsuo [Soy Sauce Laboratory, Yamasa Corporation, 2-10-1 Araoicho, Choshi, Chiba 288-0056 (Japan); Hamada, Ryoko; Iwashita, Kazuhiro [Fundamental Research Division, National Research Institute of Brewing, 3-7-1 Kagamiyama, Higashihiroshima, Hiroshima 739-0046 (Japan); Satoh, Katsuya; Narumi, Issay [Ion Beam Mutagenesis Research Group, Quantum Beam Science Directorate, Japan Atomic Energy Agency, 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan)

    2012-12-15

    Highlights: ► We investigated the effects of different LET radiation in A. oryzae. ► Both γ-rays and ion beams induced base substitutions, frameshifts, deletions. ► Both γ-rays and ion beams induced genome-wide large-scale mutations in A. oryzae. ► Some differences in the types and frequencies of mutations were found. ► Our results provide new basic insights into the mutation breeding of A. oryzae. - Abstract: Aspergillus oryzae is a fungus that is used widely in traditional Japanese fermentation industries. In this study, the lethal and mutagenic effects of different linear energy transfer (LET) radiation in freeze-dried conidia of A. oryzae were investigated. The lethal effect, which was evaluated by a 90% lethal dose, was dependent on the LET value of the ionizing radiation. The most lethal ionizing radiation among that tested was {sup 12}C{sup 5+} ion beams with an LET of 121 keV/μm. The {sup 12}C{sup 5+} ion beams had a 3.6-times higher lethal effect than low-LET (0.2 keV/μm) γ-rays. The mutagenic effect was evaluated by the frequency of selenate resistant mutants. {sup 12}C{sup 6+} ion beams with an LET of 86 keV/μm were the most effective in inducing selenate resistance. The mutant frequency following exposure to {sup 12}C{sup 6+} ion beams increased with an increase in dose and reached 3.47 × 10{sup −3} at 700 Gy. In the dose range from 0 to 700 Gy, {sup 12}C{sup 5+} ion beams were the second most effective in inducing selenate resistance, the mutant frequency of which reached a maximum peak (1.67 × 10{sup −3}) at 400 Gy. To elucidate the characteristics of mutation induced by ionizing radiation, mutations in the sulphate permease gene (sB) and ATP sulfurylase gene (sC) loci, the loss of function of which results in a selenate resistant phenotype, were compared between {sup 12}C{sup 5+} ion beams and γ-rays. We detected all types of transversions and transitions. For frameshifts, the frequency of a +1 frameshift was the highest in all

  18. AAS 227: Day 4

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  19. Partial purification and characterization of an exonuclease from Xanthomonas oryzae.

    Farber, M B; Ehrlich, M

    1980-01-01

    An exonuclease with a strong preference for single-stranded deoxyribonucleic acid over double-stranded deoxyribonucleic acid has been purified 500-fold from Xanthomonas oryzae. This enzyme liberates 5'-mononucleotides in a reaction which requires Mg2+.

  20. AAS 228: Day 4

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  1. HrcQ is necessary for Xanthomonas oryzae pv. oryzae HR-induction in non-host tobacco and pathogenicity in host rice

    Xiaoping Zhang

    2013-12-01

    Full Text Available Bacterial blight, caused by Xanthomonas oryzae pv. oryzae (Xoo, is one of the most destructive diseases of rice (Oryza sativa L. worldwide. The type III secretion system (T3SS of Xoo, encoded by the hrp (hypersensitive response and pathogenicity genes, plays critical roles in conferring pathogenicity in host rice and triggering a hypersensitive response (HR in non-host plants. To investigate the major genes conferring the pathogenicity and avirulence of Xoo, we previously constructed a random Tn5-insertion mutant library of Xoo strain PXO99A. We report here the isolation and characterization of a Tn5-insertion mutant PXM69. Tn5-insertion mutants were screened on indica rice JG30, which is highly susceptible to PXO99A, by leaf-cutting inoculation. Four mutants with reduced virulence were obtained after two rounds of screening. Among them, the mutant PXM69 had completely lost virulence to the rice host and ability to elicit HR in non-host tobacco. Southern blotting analysis showed a single copy of a Tn5-insertion in the genome of PXM69. PCR walking and sequencing analysis revealed that the Tn5 transposon was inserted at nucleotide position 70,192–70,201 in the genome of PXO99A, disrupting the type III hrc (hrp-conserved gene hrcQ, the first gene in the D operon of the hrp cluster in Xoo. To confirm the relationship between the Tn5-insertion and the avirulence phenotype of PXM69, we used the marker exchange mutagenesis to create a PXO99A mutant, ΔhrcQ::KAN, in which the hrcQ was disrupted by a kanamycin-encoding gene cassette at the same site as that of the Tn5-insertion. ΔhrcQ::KAN showed the same phenotype as mutant PXM69. Reintroduction of the wild-type hrcQ gene partially complemented the pathogenic function of PXM69. RT-PCR and cellulase secretion assays showed that the Tn5-disruption of hrcQ did not affect transcription of downstream genes in the D operon and function of the type II secretion system. Our results provide new insights into

  2. Three extracellular dipeptidyl peptidases found in Aspergillus oryzae show varying substrate specificities.

    Maeda, Hiroshi; Sakai, Daisuke; Kobayashi, Takuji; Morita, Hiroto; Okamoto, Ayako; Takeuchi, Michio; Kusumoto, Ken-Ichi; Amano, Hitoshi; Ishida, Hiroki; Yamagata, Youhei

    2016-06-01

    Three extracellular dipeptidyl peptidase genes, dppB, dppE, and dppF, were unveiled by sequence analysis of the Aspergillus oryzae genome. We investigated their differential enzymatic profiles, in order to gain an understanding of the diversity of these genes. The three dipeptidyl peptidases were expressed using Aspergillus nidulans as the host. Each recombinant enzyme was purified and subsequently characterized. The enzymes displayed similar optimum pH values, but optimum temperatures, pH stabilities, and substrate specificities varied. DppB was identified as a Xaa-Prolyl dipeptidyl peptidase, while DppE scissile substrates were similar to the substrates for Aspergillus fumigatus DPPV (AfDPPV). DppF was found to be a novel enzyme that could digest both substrates for A. fumigatus DPPIV and AfDPPV. Semi-quantitative PCR revealed that the transcription of dppB in A. oryzae was induced by protein substrates and repressed by the addition of an inorganic nitrogen source, despite the presence of protein substrates. The transcription of dppE depended on its growth time, while the transcription of dppF was not affected by the type of the nitrogen source in the medium, and it started during the early stage of the fungal growth. Based on these results, we conclude that these enzymes may represent the nutrition acquisition enzymes. Additionally, DppF may be one of the sensor peptidases responsible for the detection of the protein substrates in A. oryzae environment. DppB may be involved in nitrogen assimilation control, since the transcription of dppB was repressed by NaNO3, despite the presence of protein substrates. PMID:26846741

  3. Niclosamide inhibits leaf blight caused by Xanthomonas oryzae in rice

    Sung-Il Kim; Jong Tae Song; Jin-Yong Jeong; Hak Soo Seo

    2016-01-01

    Rice leaf blight, which is caused by the bacterial pathogen Xanthomonas oryzae pv. oryzae (Xoo), results in huge losses in grain yield. Here, we show that Xoo-induced rice leaf blight is effectively controlled by niclosamide, an oral antihelminthic drug and molluscicide, which also functions as an anti-tumor agent. Niclosamide directly inhibited the growth of the three Xoo strains PXO99, 10208 and K3a. Niclosamide moved long distances from the site of local application to distant rice tissues...

  4. Immobilization of Isolated Lipase From Moldy Copra (Aspergillus Oryzae)

    Seniwati

    2012-01-01

    Enzyme immobilization is a recovery technique that has been studied in several years, using support as a media to help enzyme dissolutions to the reaction substrate. Immobilization method used in this study was adsorption method, using specific lipase from Aspergillus oryzae. Lipase was partially purified from the culture supernatant of Aspergillus oryzae. Enzyme was immobilized by adsorbed on silica gel. Studies on free and immobilized lipase systems for determination of op...

  5. Immobilization of Isolated Lipase From Moldy Copra (Aspergillus Oryzae)

    Seniwati Dali; A. B. D. Rauf Patong; M.Noor Jalaluddin; Pirman; Baharuddin Hamzah

    2011-01-01

    Enzyme immobilization is a recovery technique that has been studied in several years, using support as a media to help enzyme dissolutions to the reaction substrate. Immobilization method used in this study was adsorption method, using specific lipase from Aspergillus oryzae. Lipase was partially purified from the culture supernatant of Aspergillus oryzae. Enzyme was immobilized by adsorbed on silica gel. Studies on free and immobilized lipase systems for determination of optimum pH, optimum ...

  6. NCBI nr-aa BLAST: CBRC-DDIS-03-0106 [SEVENS

    Full Text Available CBRC-DDIS-03-0106 ref|YP_450521.1| hypothetical protein XOO_1492 [Xanthomonas oryza...e pv. oryzae MAFF 311018] ref|YP_200246.6| hypothetical protein XOO1607 [Xanthomonas oryzae pv. oryzae KACC1...0331] dbj|BAE68247.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae MAFF 311018] YP_450521.1 7e-31 28% ...

  7. AAS 227: Day 4

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  8. Crystallization and preliminary crystallographic studies of LipA, a secretory lipase/esterase from Xanthomonas oryzae pv. oryzae

    The crystallization and preliminary crystallographic studies of LipA, a lipase/esterase secreted by X. oryzae pv. oryzae during its infection of rice plants, are reported. Xanthomonas oryzae pv. oryzae is the causal agent of bacterial leaf blight, a serious disease of rice. Several enzymes that are secreted through the type II secretion system of this bacterium play an important role in the plant–microbe interaction, being important for virulence and also being able to induce potent host defence responses. One of these enzymes is a secretory lipase/esterase, LipA, which shows a very weak homology to other bacterial lipases and gives a positive tributyrin plate assay. In this study, LipA was purified from the culture supernatant of an overexpressing clone of X. oryzae pv. oryzae and two types of crystals belonging to space group C2 but with two different unit-cell parameters were obtained using the hanging-drop vapour-diffusion method. Type I crystals diffract to a maximum resolution of 1.89 Å and have unit-cell parameters a = 93.1, b = 62.3, c = 66.1 Å, β = 90.8°. Type II crystals have unit-cell parameters a = 103.6, b = 54.6, c = 66.3 Å, β = 92.6° and diffract to 1.86 Å. Solvent-content analysis shows one monomer in the asymmetric unit in both the crystal forms

  9. Differential Gene Expression Reflects Morphological Characteristics and Physiological Processes in Rice Immunity against Blast Pathogen Magnaporthe oryzae.

    Azizi, Parisa; Rafii, Mohd Y; Mahmood, Maziah; Abdullah, Siti N A; Hanafi, Mohamed M; Nejat, Naghmeh; Latif, Muhammad A; Sahebi, Mahbod

    2015-01-01

    The rice blast fungus Magnaporthe oryzae is a serious pathogen that jeopardises the world's most important food-security crop. Ten common Malaysian rice varieties were examined for their morphological, physiological and genomic responses to this rice blast pathogen. qPCR quantification was used to assess the growth of the pathogen population in resistant and susceptible rice varieties. The chlorophyll content and photosynthesis were also measured to further understand the disruptive effects that M. oryzae has on infected plants of these varieties. Real-time PCR was used to explore the differential expression of eight blast resistance genes among the ten local varieties. Blast disease has destructive effects on the growth of rice, and the findings of our study provide evidence that the Pikh, Pi9, Pi21, and Osw45 genes are involved in defence responses in the leaves of Malaysian rice at 31 h after inoculation with M. oryzae pathotype P7.2. Both the chlorophyll content and photosynthesis were reduced, but the levels of Pikh gene expression remained constant in susceptible varieties, with a developed pathogen population and mild or severe symptoms. The Pi9, Pi21, and Osw45 genes, however, were simultaneously upregulated in infected rice plants. Therefore, the presence of the Pikh, Pi9, Pi21, and Osw45 genes in the germplasm is useful for improving the resistance of rice varieties. PMID:26001124

  10. Roles of Forkhead-box Transcription Factors in Controlling Development, Pathogenicity, and Stress Response in Magnaporthe oryzae

    Jaejin Park

    2014-06-01

    Full Text Available Although multiple transcription factors (TFs have been characterized via mutagenesis to understand their roles in controlling pathogenicity and infection-related development in Magnaporthe oryzae, the causal agent of rice blast, if and how forkhead-box (FOX TFs contribute to these processes remain to be characterized. Four putative FOX TF genes were identified in the genome of M. oryzae, and phylogenetic analysis suggested that two of them (MoFKH1 and MoHCM1 correspond to Ascomycota-specific members of the FOX TF family while the others (MoFOX1 and MoFOX2 are Pezizomycotina-specific members. Deletion of MoFKH1 (ΔMofkh1 resulted in reduced mycelial growth and conidial germination, abnormal septation and stress response, and reduced virulence. Similarly, ΔMohcm1 exhibited reduced mycelial growth and conidial germination. Conidia of ΔMofkh1 and ΔMohcm1 were more sensitive to one or both of the cell cycle inhibitors hydroxyurea and benomyl, suggesting their role in cell cycle control. On the other hand, loss of MoFOX1 (ΔMofox1 did not show any noticeable changes in development, pathogenicity, and stress response. Deletion of MoFOX2 was not successful even after repeated attempts. Taken together, these results suggested that MoFKH1 and Mo-HCM1 are important in fungal development and that MoFKH1 is further implicated in pathogenicity and stress response in M. oryzae.

  11. Dissection of the genetic architecture of rice resistance to the blast fungus Magnaporthe oryzae.

    Kang, Houxiang; Wang, Yue; Peng, Shasha; Zhang, Yanli; Xiao, Yinghui; Wang, Dan; Qu, Shaohong; Li, Zhiqiang; Yan, Shuangyong; Wang, Zhilong; Liu, Wende; Ning, Yuese; Korniliev, Pavel; Leung, Hei; Mezey, Jason; McCouch, Susan R; Wang, Guo-Liang

    2016-08-01

    Resistance in rice cultivars to the rice blast fungus Magnaporthe oryzae is complex and is controlled by both major genes and quantitative trait loci (QTLs). We undertook a genome-wide association study (GWAS) using the rice diversity panel 1 (RDP1) that was genotyped using a high-density (700 000 single nucleotide polymorphisms) array and inoculated with five diverse M. oryzae isolates. We identified 97 loci associated with blast resistance (LABRs). Among them, 82 were new regions and 15 co-localized with known blast resistance loci. The top 72 LABRs explained up to 98% of the phenotypic variation. The candidate genes in the LABRs encode nucleotide-binding site leucine-rich repeat (NBS-LRR) resistance proteins, receptor-like protein kinases, transcription factors and defence-related proteins. Among them, LABR_64 was strongly associated with resistance to all five isolates. We analysed the function of candidate genes underlying LABR_64 using RNA interference (RNAi) technology and identified two new resistance alleles at the Pi5 locus. We demonstrate an efficient strategy for rapid allele discovery using the power of GWAS, coupled with RNAi technology, for the dissection of complex blast resistance in rice. PMID:26574735

  12. DNA Polymorphism Among Yewei B, V20B, and Oryza minuta J. S. Presl. ex C. B. Presl.

    Bing-Ran ZHAO; Quan-Hua XING; Hong-Ai XIA; He-Hua YANG; De-Min JIN; Xia LIU; Song-Wen WANG; Bin WANG; Long-Ping YUAN

    2005-01-01

    The new cytoplasmic male sterile (CMS) line YeweiA and its maintainer line Yewei B, with better agronomic characteristics, have been developed from a mutant of V20B (a rice maintainer line) through transformation of genomic DNA of wild rice (Oryza minuta J. S. Presl. ex C. B. Presl.). Analysis of molecular markers, DNA sequences, and Southern blot revealed that high DNA polymorphism exists between the mutant and its receptor, indicating that the special DNA fragment from O. minuta may be integrated into the genome of Yewei B. Therefore, transformation of genomic DNA from distant relatives to the plant of a target receptor may open an avenue for creating a new rice germplasm.

  13. Polygalacturonase from Sitophilus oryzae: Possible horizontal transfer of a pectinase gene from fungi to weevils

    Zhicheng Shen

    2003-08-01

    Full Text Available Endo-polygalacturonase, one of the group of enzymes known collectively as pectinases, is widely distributed in bacteria, plants and fungi. The enzyme has also been found in several weevil species and a few other insects, such as aphids, but not in Drosophila melanogaster, Anopheles gambiae, or Caenorhabditis elegans or, as far as is known, in any more primitive animal species. What, then, is the genetic origin of the polygalacturonases in weevils? Since some weevil species harbor symbiotic microorganisms, it has been suggested, reasonably, that the symbionts' genomes of both aphids and weevils, rather than the insects' genomes, could encode polygalacturonase. We report here the cloning of a cDNA that encodes endo-polygalacturonase in the rice weevil, Sitophilus oryzae (L., and investigations based on the cloned cDNA. Our results, which include analysis of genes in antibiotic-treated rice weevils, indicate that the enzyme is, in fact, encoded by the insect genome. Given the apparent absence of the gene in much of the rest of the animal kingdom, it is therefore likely that the rice weevil polygalacturonase gene was incorporated into the weevil's genome by horizontal transfer, possibly from a fungus.

  14. Purification and characterization of a novel hypersensitive response-inducing elicitor from Magnaporthe oryzae that triggers defense response in rice.

    Mingjia Chen

    Full Text Available BACKGROUND: Magnaporthe oryzae, the rice blast fungus, might secrete certain proteins related to plant-fungal pathogen interactions. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we report the purification, characterization, and gene cloning of a novel hypersensitive response-inducing protein elicitor (MoHrip1 secreted by M. oryzae. The protein fraction was purified and identified by de novo sequencing, and the sequence matched the genomic sequence of a putative protein from M. oryzae strain 70-15 (GenBank accession No. XP_366602.1. The elicitor-encoding gene mohrip1 was isolated; it consisted of a 429 bp cDNA, which encodes a polypeptide of 142 amino acids with a molecular weight of 14.322 kDa and a pI of 4.53. The deduced protein, MoHrip1, was expressed in E. coli. And the expression protein collected from bacterium also forms necrotic lesions in tobacco. MoHrip1 could induce the early events of the defense response, including hydrogen peroxide production, callose deposition, and alkalization of the extracellular medium, in tobacco. Moreover, MoHrip1-treated rice seedlings possessed significantly enhanced systemic resistance to M. oryzae compared to the control seedlings. The real-time PCR results indicated that the expression of some pathogenesis-related genes and genes involved in signal transduction could also be induced by MoHrip1. CONCLUSION/SIGNIFICANCE: The results demonstrate that MoHrip1 triggers defense responses in rice and could be used for controlling rice blast disease.

  15. NCBI nr-aa BLAST: CBRC-XTRO-01-0645 [SEVENS

    Full Text Available CBRC-XTRO-01-0645 ref|YP_451034.1| hypothetical protein XOO_2005 [Xanthomonas oryza...e pv. oryzae MAFF 311018] dbj|BAE68760.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae MAFF 311018] YP_451034.1 2e-41 40% ...

  16. NCBI nr-aa BLAST: CBRC-LAFR-01-0180 [SEVENS

    Full Text Available CBRC-LAFR-01-0180 ref|YP_453064.1| hypothetical protein XOO_4035 [Xanthomonas oryza...e pv. oryzae MAFF 311018] dbj|BAE70790.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae MAFF 311018] YP_453064.1 6.5 37% ...

  17. NCBI nr-aa BLAST: CBRC-ACAR-01-0713 [SEVENS

    Full Text Available CBRC-ACAR-01-0713 ref|YP_200709.1| glucose-galactose transporter [Xanthomonas oryza...e pv. oryzae KACC10331] gb|AAW75324.1| fucose permease [Xanthomonas oryzae pv. oryzae KACC10331] YP_200709.1 3.6 35% ...

  18. NCBI nr-aa BLAST: CBRC-ACAR-01-0713 [SEVENS

    Full Text Available CBRC-ACAR-01-0713 ref|YP_450980.1| glucose-galactose transporter [Xanthomonas oryza...e pv. oryzae MAFF 311018] dbj|BAE68706.1| glucose-galactose transporter [Xanthomonas oryzae pv. oryzae MAFF 311018] YP_450980.1 4.7 35% ...

  19. Cloning and characterization of a new actin gene from Oryza sativa L.

    LIANG Weihong; TANG Chaorong; WU Naihu

    2004-01-01

    Using Rho family member osRACD as bait, a new member of actin gene family -Act was isolated from Oryza sativa by yeast two-hybrid system. The full-length cDNA was cloned with 5' RACE technology, which contains an open reading frame of 1134 bp with a predicted protein of 377 amino acids. Sequence alignment revealed 96% to 81.8% identities with some known actin proteins in plants. The method of bioinformatics was used to analyze the protein modification sites, structure and evolution of the gene. Southern blot analysis showed that Act is a single-copy gene in the genome. The result of RT-PCR showed it is ubiquitously expressed in root, shoot, callus and panicle in a temporal fashion. The relationship between Rho family and actin family in evolution and function was also studied.

  20. Molecular Cloning and Characterization of Citrate Synthase Gene in Rice( Oryza sativa)

    ZHANG Shan-shan; MING Feng; LU Qun; GUO Bin; SHEN Da-leng

    2005-01-01

    The full-length OsCS encoding citrate synthase was isolated from rice (Oryza sativa L. subsp. japonica). OsCS is 1477-bp long and encodes a 474 amino acid polypeptide. Its putative protein sequence is highly identical to Daucus carota, Nicotiana tabacum,Beta vulgaris subsp., Arabidopsis thaliana, and Citrus junos (>70%). The deduced amino-terminal sequence of OsCS showes characteristics of mitochondrial targeting signal. Southern blot analysis using ORF of the OsCS as the probe indicated that this gene exists in multiple copies in rice genome. The band with predicated size of 82 kD was detected by Western blot after being induced by 0.4 mmol/L IPTG.

  1. Trichoderma harzianum: a biocontrol agent against Bipolaris oryzae.

    Abdel-Fattah, Gamal M; Shabana, Yasser M; Ismail, Adel E; Rashad, Younes Mohamed

    2007-08-01

    Rice brown spot, caused by Bipolaris oryzae, can be a serious disease causing a considerable yield loss. Trichoderma harzianum is an effective biocontrol agent for a number of plant fungal diseases. Thus, this research was carried out to investigate the mechanisms of action by which T. harzianum antagonizes Bipolaris oryzae in vitro, and the efficacy of spray application of a spore suspension of T. harzianum for control of rice brown spot disease under field conditions. In vitro, the antagonistic behavior of T. harzianum resulted in the overgrowth of B. oryzae by T. harzianum, while the antifungal metabolites of T. harzianum completely prevented the linear growth of B. oryzae. Light and scanning electron microscope (SEM) observations showed no evidence that mycoparasitism contributed to the aggressive nature of the tested isolate of T. harzianum against B. oryzae. Under field conditions, spraying of a spore suspension of T. harzianum at 10(8)spore ml(-1) significantly reduced the disease severity (DS) and disease incidence (DI) on the plant leaves, and also significantly increased the grain yield, total grain carbohydrate, and protein, and led to a significant increase in the total photosynthetic pigments (chlorophyll a and b and carotenoids) in rice leaves. PMID:17592758

  2. Current Commercial Perspective of Rhizopus oryzae: A Review

    Rina Rani Ray

    2011-01-01

    Full Text Available The present study reviews the potentiality of Rhizopus oryzae, a potent saprophytic and pathogenic fungus to produce a wide spectrum of metabolites, in the form of enzymes, esters, organic acids, volatile materials, polymers and bioalcohols. A number of extra and intra cellular enzymes are found to be synthesized by various strains of Rhizopus oryzae that includes cellulaes, hemicellulases, pectinases, tannase, phytase, amylase, lipase, protease and other enzymes of immense industrial importance. The fungus is a rich source of lactic acid and is widely studied as a commercially perspective producer of L(+-LA. In many strains, the end product of glycolysis is channeled to ethanol by the enzyme pyruvate decarboxylase and therefore may be used for the production of alcohol. Biodiesel can also be produced by methanolysis and transesterification reactions employing specific strains of R. oryzae having the relevant enzymes. Dry mycelium of Rhizopus oryzae are proved effective for efficiently catalyzing the synthesis of different flavor esters. Since the Joint FAO/WHO expert committee on food Additives (JEFCA and Food and Drug Administration, Department of Health and Human Services, USA certified the enzymes extracted from Rhizopus oryzae may be used as food additives for human consumption, this fungal group may be exhaustively used for commercial purposes.

  3. Morphological and molecular characterization of fungal pathogen, Magnaphorthe oryzae

    Rice is arguably the most crucial food crops supplying quarter of calories intake. Fungal pathogen, Magnaphorthe oryzae promotes blast disease unconditionally to gramineous host including rice species. This disease spurred an outbreaks and constant threat to cereal production. Global rice yield declining almost 10-30% including Malaysia. As Magnaphorthe oryzae and its host is model in disease plant study, the rice blast pathosystem has been the subject of intense interest to overcome the importance of the disease to world agriculture. Therefore, in this study, our prime objective was to isolate samples of Magnaphorthe oryzae from diseased leaf obtained from MARDI Seberang Perai, Penang, Malaysia. Molecular identification was performed by sequences analysis from internal transcribed spacer (ITS) region of nuclear ribosomal RNA genes. Phylogenetic affiliation of the isolated samples were analyzed by comparing the ITS sequences with those deposited in the GenBank database. The sequence of the isolate demonstrated at least 99% nucleotide identity with the corresponding sequence in GenBank for Magnaphorthe oryzae. Morphological observed under microscope demonstrated that the structure of conidia followed similar characteristic as M. oryzae. Finding in this study provide useful information for breeding programs, epidemiology studies and improved disease management

  4. Morphological and molecular characterization of fungal pathogen, Magnaphorthe oryzae

    Hasan, Nor’Aishah, E-mail: aishahnh@ns.uitm.edu.my [Faculty of Applied Science, UniversitiTeknologi MARA (UiTM), Kuala Pilah, Negeri Sembilan (Malaysia); Rafii, Mohd Y., E-mail: mrafii@upm.edu.my [Institute of Tropical Agriculture, Universiti Putra Malaysia (UPM), Serdang, Selangor (Malaysia); Department of Crop Science, Universiti Putra Malaysia (UPM), Serdang, Selangor (Malaysia); Rahim, Harun A. [Agrotechnology & Bioscience Division, Malaysian Nuclear Agency, Bangi, Kajang, Selangor (Malaysia); Ali, Nusaibah Syd [Department of Plant Protection, Universiti Putra Malaysia (UPM), Serdang, Selangor (Malaysia); Mazlan, Norida [Department of Agriculture Technology, Universiti Putra Malaysia (UPM), Serdang, Selangor (Malaysia); Abdullah, Shamsiah [Faculty of Plantation and Agrotechnology, UniversitiTeknologi MARA (UiTM), Shah Alam, Selangor (Malaysia)

    2016-02-01

    Rice is arguably the most crucial food crops supplying quarter of calories intake. Fungal pathogen, Magnaphorthe oryzae promotes blast disease unconditionally to gramineous host including rice species. This disease spurred an outbreaks and constant threat to cereal production. Global rice yield declining almost 10-30% including Malaysia. As Magnaphorthe oryzae and its host is model in disease plant study, the rice blast pathosystem has been the subject of intense interest to overcome the importance of the disease to world agriculture. Therefore, in this study, our prime objective was to isolate samples of Magnaphorthe oryzae from diseased leaf obtained from MARDI Seberang Perai, Penang, Malaysia. Molecular identification was performed by sequences analysis from internal transcribed spacer (ITS) region of nuclear ribosomal RNA genes. Phylogenetic affiliation of the isolated samples were analyzed by comparing the ITS sequences with those deposited in the GenBank database. The sequence of the isolate demonstrated at least 99% nucleotide identity with the corresponding sequence in GenBank for Magnaphorthe oryzae. Morphological observed under microscope demonstrated that the structure of conidia followed similar characteristic as M. oryzae. Finding in this study provide useful information for breeding programs, epidemiology studies and improved disease management.

  5. Cloning and expression of a IuxRhomologue from Xanthomonas oryzae pv.Oryzae

    Liang Bin; Guo Bin; Yang Chen; Zhang Xinjun; Dai Luyuan; Yu Tengqiong; Shen Daleng

    2006-01-01

    LuxR homologues are the main components of LuxR/LuxI circuit in Quorum Sensing(QS)of Gram-negative bacteria.A luxR homologue,designated as xooR,was cloned from Ⅹ.oryzae pv.oryzae.The xooR gene is atranscription factor with 765 bp inlength,and encodes a 254-amino acid putative protein with a molecular weight and an isoelectric point of 28.3 ku and 8.72 respectively.Amino acids 15 to 171 from the N-terminus are the Autoin-bind domain of XooR whereas amino acids 191 to 245 form a helix-turn-helix(HTH)motif that serves as the DNA-binding domain.In this study,XooR was expressed as a fusion protein along with green fluorescent protein(GFP),using pET-24a-d(+),a prokaryotic expression vector.Western blot showed that the xooR gene was successfully expressed in vitro in E.coli as a XooR-GFP fusion protein with a size of 54 ku.

  6. Cloning and characterization of filamentous temperature-sensitive protein Z from Xanthomonas oryzae pv. Oryzae.

    Dai, Leng; Huang, Yunhong; Chen, Yang; Long, Zhong-Er

    2016-01-01

    The ftsZ gene from Xanthomonas oryzae pv. Oryzae was amplified by PCR with the specific primers, and the recombinant plasmid pET-22b-ftsZ was constructed successfully. The FtsZ with a 6× His tag was overexpressed in a soluble form in Escherichia coli BL21 and purified through a Ni-NTA agarose column. The purified recombinant FtsZ showed a single band on SDS-PAGE with an apparent molecular mass of about 44 kDa, and confirmed by western blotting analysis. The optimum temperature for GTPase activity of the recombined FtsZ was 50 °C, and the optimum pH was 7.0. The recombinant FtsZ showed good stability and retained >95 % activity at 50 °C for 240 min. The GTPase activity followed Michaelis-Menten kinetics with the KM of 1.750 mM and the Vmax of 0.155 nmol Pi/min/nmol FtsZ respectively. PMID:27026842

  7. DgcA, a diguanylate cyclase from Xanthomonas oryzae pv. oryzae regulates bacterial pathogenicity on rice

    Su, Jianmei; Zou, Xia; Huang, Liangbo; Bai, Tenglong; Liu, Shu; Yuan, Meng; Chou, Shan-Ho; He, Ya-Wen; Wang, Haihong; He, Jin

    2016-01-01

    Xanthomonas oryzae pv. oryzae (Xoo) is the causal agent of rice blight disease as well as a serious phytopathogen worldwide. It is also one of the model organisms for studying bacteria-plant interactions. Current progress in bacterial signal transduction pathways has identified cyclic di-GMP as a major second messenger molecule in controlling Xanthomonas pathogenicity. However, it still remains largely unclear how c-di-GMP regulates the secretion of bacterial virulence factors in Xoo. In this study, we focused on the important roles played by DgcA (XOO3988), one of our previously identified diguanylate cyclases in Xoo, through further investigating the phenotypes of several dgcA-related mutants, namely, the dgcA-knockout mutant ΔdgcA, the dgcA overexpression strain OdgcA, the dgcA complemented strain CdgcA and the wild-type strain. The results showed that dgcA negatively affected virulence, EPS production, bacterial autoaggregation and motility, but positively triggered biofilm formation via modulating the intracellular c-di-GMP levels. RNA-seq data further identified 349 differentially expressed genes controlled by DgcA, providing a foundation for a more solid understanding of the signal transduction pathways in Xoo. Collectively, the present study highlights DgcA as a major regulator of Xoo virulence, and can serve as a potential target for preventing rice blight diseases. PMID:27193392

  8. A new function of graphene oxide emerges: inactivating phytopathogenic bacterium Xanthomonas oryzae pv. Oryzae

    Chen Juanni; Wang Xiuping; Han Heyou, E-mail: hyhan@mail.hzau.edu.cn [College of Science, Huazhong Agricultural University, State Key Laboratory of Agricultural Microbiology (China)

    2013-05-15

    Xanthomonas oryzae pv. oryzae (Xoo) is one representative phytopathogenic bacterium causing bacteria infections in rice. The antibacterial activity of graphene suspended in different dispersants against Xoo was first investigated. Bacteriological test data, fluorescence microscope and transmission electron microscopy images are provided, which yield insight into the antibacterial action of the nanoscale materials. Surprisingly, the results showed graphene oxide (GO) exhibits superior bactericidal effect even at extremely low dose in water (250 {mu}g/mL), almost killing 94.48% cells, in comparison to common bactericide bismerthiazol with only 13.3% mortality. The high efficiency in inactivating the bacteria on account of considerable changes in the cell membranes caused by the extremely sharp edges of graphene oxide and generation of reactive oxygen species, which may be the fatal factor for bacterial inactivation. Given the superior antibacterial effect of GO and the fact that GO can be mass-produced with low cost, we expect a new application could be developed as bactericide for controlling plant disease, which may be a matter of great importance for agricultural development.

  9. DgcA, a diguanylate cyclase from Xanthomonas oryzae pv. oryzae regulates bacterial pathogenicity on rice.

    Su, Jianmei; Zou, Xia; Huang, Liangbo; Bai, Tenglong; Liu, Shu; Yuan, Meng; Chou, Shan-Ho; He, Ya-Wen; Wang, Haihong; He, Jin

    2016-01-01

    Xanthomonas oryzae pv. oryzae (Xoo) is the causal agent of rice blight disease as well as a serious phytopathogen worldwide. It is also one of the model organisms for studying bacteria-plant interactions. Current progress in bacterial signal transduction pathways has identified cyclic di-GMP as a major second messenger molecule in controlling Xanthomonas pathogenicity. However, it still remains largely unclear how c-di-GMP regulates the secretion of bacterial virulence factors in Xoo. In this study, we focused on the important roles played by DgcA (XOO3988), one of our previously identified diguanylate cyclases in Xoo, through further investigating the phenotypes of several dgcA-related mutants, namely, the dgcA-knockout mutant ΔdgcA, the dgcA overexpression strain OdgcA, the dgcA complemented strain CdgcA and the wild-type strain. The results showed that dgcA negatively affected virulence, EPS production, bacterial autoaggregation and motility, but positively triggered biofilm formation via modulating the intracellular c-di-GMP levels. RNA-seq data further identified 349 differentially expressed genes controlled by DgcA, providing a foundation for a more solid understanding of the signal transduction pathways in Xoo. Collectively, the present study highlights DgcA as a major regulator of Xoo virulence, and can serve as a potential target for preventing rice blight diseases. PMID:27193392

  10. Identification and QTL mapping of blast resistance in wild Oryza species

    Leaf blast disease of rice (Oryza sativa L.) caused by Magnaporthe oryzae B. Couch is one of the most devastating rice fungal diseases worldwide. Wild relatives of rice (Oryza spp.) may contain novel genes for biotic and abiotic stress resistance lost during domestication. A collection of 67 wild ...

  11. AvrXa3:A novel member of avrBs3 gene family from Xanthomonas oryzae pv.oryzae has a dual function

    LI Ping; LONG Juying; HUANG Yingchun; ZHANG Yan; WANG Jinsheng

    2004-01-01

    Two positive clones pUAV45 and pUAV47 were identified from the cDNA library of JxoⅢ, a race 3 strain of Xanthomonas oryzae pv. Oryzae Dye (Xoo) in Japanese system, using Tn5 based technology. pUAV45 clone contained a 25.4 kb Xoo genomic DNA insert. Southern blot analysis with avrXa10 as the probe showed that DNA insert in pUAV45 shares homology with avrX10. Furthermore within the Xoo insert, a smaller 5.7 kb KpnI fragment (pUAVSk) was identified through hybridization with avrXa10. The transformation of pUAV45 and pUAV5k into the strain Pxo99 (race 6 in Philippine system) led to the decrease of Pxo99pathogenicity on rice cultivar Wase Aikoku 3 (Xa3) and the increase of the pathogen pathogenicity on Cas209 (Xa10). The result of sequence analysis showed that there is a 2598 bp open reading frame (ORF) within the 5.7 kb Kpn 1 fragment (pUAVSk). The ORF shared high identity (97 % ) with avrXa10. The deduced sequence of the ORF contained 8.5 tandem repeat units of 34-amino-acids, one leucine zipper (LZ), three nuclear localization signal (NLS) motifs, and an acidic activation transcriptional domain (AAD) at C-terminus.We named this ORF avrXa3 and it is classified as a new member of avrBs3 (avr/pth) family with the dual-function determined by alternations of avirulence and aggressiveness on rice cultivars carrying different ‘ R' genes.

  12. Complete Genome Sequence of Bacillus thuringiensis Serovar Israelensis Strain HD-789

    Doggett, Norman A.; Stubben, Chris J; Chertkov, Olga; Bruce, David C.; Detter, J Chris; Johnson, Shannon L.; Han, Cliff S.

    2013-01-01

    Bacillus thuringiensis is an important microbial insecticide for controlling agricultural pests. We report the finished genome sequence of Bacillus thuringiensis serovar israelensis strain HD-789, which contains genes encoding 7 parasporal crystals consisting of Cry4Aa3, Cry4Ba5 (2 genes), Cry10Aa3, Cry11Aa3, Cry60Ba3, and Cry60Aa3, plus 3 Cyt toxin genes and 1 hemagglutinin gene.

  13. Exploring the hidden threat of gaseous pollutants using rice (oryza sativa l.) plants in Pakistan

    Three rice (Oryza sativa L.) varieties (Basmati-Pak, Basmati-370 and IRRI-9) of Pakistan were grown for their entire life cycle in open top field chambers to investigate the impacts of ambient ozone (O/sub 3/), nitrogen dioxide (NO/sub 2/), and sulphur dioxide (SO/sub 2/) on the biomass, growth physiology, and yield. The treatments were charcoal filtered air (FA), unfiltered air (UFA) and ambient air (AA). O/sub 3/, NO/sub 2/, and SO/sub 2/ concentrations recorded at the experimental site were 75, 29 and 18 ppb as 8 h daily mean, respectively. Microclimate conditions inside and outside the chamber environment remained virtually similar. All the rice cultivars showed severe depression in biomass (20-30%) due to reductions in number of tillers (20-27%) and leaves per plant (21-29%) during vegetative growth phase with maximum reductions seen in both Basmati-370 and IRRI-9 in UFA treatments compared with FA. These reductions were primarily due to decreased transpiration rate (10-20%), stomatal conductance (12-23%), net photosynthetic rate (9-22%) and photosynthetic efficiency (6-12%) of plants in UFA. Yield losses in total seed weight per plant in UFA were more or less similar in IRRI-9 (37%) and Basmati-370 (36%), followed by lower reduction in cv. Basmati-Pak (29%). Reductions in number of panicles per plant (18-25%), filled seeds per panicles (8-11%), seeds weight per panicle (13-17%) and 1000-seeds weight (5-8%) in UFA contributed significantly towards greater yield depression. Percent seed sterility was also higher in UFA and AA treatment plants. Starch contents of seeds in UFA were reduced by 14%, 19% and 21% in Basmati-Pak, Basmati-370 and IRRI-9, respectively when compared to FA control. (author)

  14. Production of biologically active recombinant human lactoferrin in Aspergillus oryzae.

    Ward, P P; Lo, J Y; Duke, M; May, G S; Headon, D R; Conneely, O M

    1992-07-01

    We report the production of recombinant human lactoferrin in Aspergillus oryzae. Expression of human lactoferrin (hLF), a 78 kD glycoprotein, was achieved by placing the cDNA under the control of the A. oryzae alpha-amylase promoter and the 3' flanking region of the A. niger glucoamylase gene. Using this system, hLF is expressed and secreted into the growth medium at levels up to 25 mg/l. The recombinant lactoferrin is indistinguishable from human milk lactoferrin with respect to its size, immunoreactivity, and iron-binding capacity. The recombinant protein appears to be appropriately N-linked glycosylated and correctly processed at the N-terminus by the A. oryzae secretory apparatus. Lactoferrin is the largest heterologous protein and the first mammalian glycoprotein expressed in the Aspergillus system to date. Hence, this expression system appears suitable for the large-scale production and secretion of biologically active mammalian glycoproteins. PMID:1368268

  15. Is amyloid A (AA) amyloidosis always secondary?

    Maury, C P; Törnroth, T; Wegelius, O

    1985-01-01

    The case is reported of a patient with systemic AA amyloidosis associated with non-specific mesenteric lymphadenitis and chronic sideropenia. Renal, small bowel, and rectal biopsies showed amyloid deposits containing AA protein, as defined by potassium permanganate sensitivity and by reactivity with AA antiserum. Reversal of the nephrotic syndrome occurred during steroid-azathioprine therapy.

  16. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor

    Pérez, Claudia; Fernandez, Luisa E.; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S.; Soberón, Mario; Bravo, Alejandra

    2005-01-01

    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa bind...

  17. Bipolaris oryzae, a novel fungal opportunist causing keratitis.

    Wang, Luxia; Al-Hatmi, Abdullah M S; Lai, Xuwen; Peng, Lianghong; Yang, Chuanhong; Lai, Huangwen; Li, Jianxun; Meis, Jacques F; de Hoog, G Sybren; Zhuo, Chao; Chen, Min

    2016-05-01

    We report a case of mycotic keratitis caused by Bipolaris oryzae with predisposing trauma from a foreign body. The fungus was identified by sequencing the internal transcribed spacer region, translation elongation factor 1α (TEF1) gene, and partial glyceraldehyde-3-phosphate dehydrogenase (GPDH) gene, and the species identity was confirmed on the basis of its characteristic conidial phenotype. The patient was treated with surgical intervention and antifungal agents, including intravenous fluconazole (FLC), oral itraconazole, topical 0.15% amphotericin B eye drops, and 0.5% FLC eye drops. To our knowledge, this is the first report of mycotic keratitis caused by B. oryzae worldwide. PMID:26976720

  18. Analysis of DNA repair helicase UvrD from Arabidopsis thaliana and Oryza sativa.

    Tuteja, Renu; Tuteja, Narendra

    2013-10-01

    Mismatch repair (MMR) proteins play important roles in maintaining genome stability in all the organisms. Studies of MMR genes in plants have identified several homologs of the Escherichia coli genes. Crop yield is directly related to genome stability, which is crucially required for optimal plant growth and development. Numerous genotoxic stresses such as UV light, radiations, pollutants and heavy metals cause DNA damage leading to genome instability, which can interfere with the plant growth and crop productivity. But the efficient repair mechanisms can help to overcome the deleterious effects of the damage. Therefore it is important to study the genes involved in various repair pathways in the plants in greater detail. UvrD helicase is a component of MMR complex and plays an essential role in the DNA repair by providing the unwinding function. In the present manuscript we present an in silico analysis of UvrD helicase from two plant species (Arabidopsis and rice). The Arabidopsis thaliana and Oryza sativa UvrD are 1149 (~129 kDa) and 1165 amino-acids (~130 kDa) proteins, respectively. These proteins contain all the conserved domains and are larger than the E. coli UvrD because they contain a longer N-terminal extension. In order to decipher the role of plant UvrD in various stresses it will be important to study the biochemical and functional properties of this enzyme. PMID:23974358

  19. Crystallization and preliminary crystallographic studies of CbsA, a secretory exoglucanase from Xanthomonas oryzae pv. oryzae

    The exoglucanase CbsA from X. oryzae has been overexpressed, purified and crystallized. The crystal diffracted to a resolution of 1.86 Å. The bacterial pathogen Xanthomonas oryzae pv. oryzae causes bacterial leaf blight, a serious disease of rice. The secreted exoglucanase CbsA is an important virulence factor of this pathogen. It belongs to the glycosyl hydrolase 6 family of proteins based on the carbohydrate-active enzyme (CAZY) classification. In this study, CbsA has been overexpressed, purified and crystallized. The crystal diffracted to a resolution of 1.86 Å and belonged to space group P212121. It contained one monomer per asymmetric unit, with a solvent content of 45.8%

  20. Development of a novel strategy for fungal transformation based on a mutant locus conferring carboxin-resistance in Magnaporthe oryzae.

    Guo, Min; Zhu, Xiaolei; Li, Hongxia; Tan, Leyong; Pan, Yuemin

    2016-12-01

    The accurate manipulation of genomic integration of mutant alleles or fluorescent fusion-protein constructs is necessary for understanding of pathogenic mechanism of Magnaporthe oryzae. Recently, this can be achieved by integrating of exogenous DNA randomly into genome of this pathogen, but ectopic integration may result in alteration of gene expression or gene disruption due to unpredictable position effects and/or disruption of protein-coding regions. In this study, we establish a novel strategy for locus-specific integration of exogenous DNA via carboxin-resistance reconstitution by a point-mutation (H245L) on succinate dehydrogenase subunit Mosdi1. Independent transformants derived from the same reconstitution construct showed consistent fluorescent signal and undiversified phenotypes, including hyphae growth, conidiation and pathogenicity, in M. oryzae. Meanwhile, 96 % of all transformants integrate correctly into the Mosdi1 locus as a single copy. Furthermore, we provide a vector carrying yeast recombination cassette and thus allow assembly of multiple overlapping DNA fragments by yeast in vivo recombination for gene complementation and protein localization assay. PMID:27558019

  1. A Novel Manganese Efflux System, YebN, Is Required for Virulence by Xanthomonas oryzae pv. oryzae

    Chunxia Li; Jun Tao; Daqing Mao; Chaozu He

    2011-01-01

    Manganese ions (Mn(2+)) play a crucial role in virulence and protection against oxidative stress in bacterial pathogens. Such pathogens appear to have evolved complex mechanisms for regulating Mn(2+) uptake and efflux. Despite numerous studies on Mn(2+) uptake, however, only one efflux system has been identified to date. Here, we report on a novel Mn(2+) export system, YebN, in Xanthomonas oryzae pv. oryzae (Xoo), the causative agent of bacterial leaf blight. Compared with wild-type PXO99, th...

  2. EFFECT OF FUNGICIDES IN THE CONTROL OF RICE BLAST Pyricularia oryzae AND Helminthosporium oryzae EFEITO DE FUNGICIDAS NO CONTROLE DE BRUSONE (Pyricularia oryzae E MANCHA PARDA (Helminthosporium oryzae NO ARROZ

    Cláudio Aparecido da Silveira

    2007-09-01

    Full Text Available

    The effect of the fungicides ethiltrianol and edifenphos was evaluated, on level of field, aiming control rice blast (Pyricularia oryzae and Helminthosporium oryzae in variety IAC - 47. The fungicides were pulverized one or two times in different concentrations in the stage of panicles emission. The results showed that, as to infection level in the panicles, grain lesions and productivity there was no significant statistical difference between treatments. Refering to infection level in the banner leaves, there was significant statistical difference between treatments and the control.

    Foi avaliado, a nível de campo, o efeito dos fungicidas ethiltrianol e edifienphos no controle de brusone (Pyricularia oryzae Cav. e Helminthosporium oryzae Breda de Haan na cultura do arroz, variedade IAC - 47. Os fungicidas foram pulverizados uma ou duas vezes, em diferentes concentrações a partir da emissão das panículas. Os resultados apurados indicaram que quanto a lesões nas panículas, nos grãos e produtividade, não houve diferença significativa entre os tratamentos. Com relação ao parâmetro lesões nas folhas bandeiras houve diferença entre todos os tratamentos com fungicidas e a testemunha.

  3. Fungicide sensitivity in the wild rice pathogen Bipolaris oryzae

    In recent years the occurrence of fungal brown spot, caused by Bipolaris oryzae has increased in cultivated wild rice (Zizania palustris) paddies in spite of the use of fungicides. To implement an efficient integrated disease management system, we are exploring whether field isolates have developed ...

  4. Study on the structures of papilla of lemma in Oryza

    2001-01-01

    @@ Structures of papilla of lemma among 23 Oryza species were investigated and classified into 6 kinds by scanning electron microscopy. The lemma surface was composed of papilla pedestals with multi-row longitudinal ordered arrangements and the papilla was inserted into pedestal. The morphology and characterization of papilla varied among species.

  5. Kinetics of alpha-amylase secretion in Aspergillus oryzae

    Henriksen, Anne Laurence Santerre; Carlsen, Morten; Bang de, H.; Nielsen, Jens Bredal

    1999-01-01

    Pulse and pulse-chase experiments have been performed to study L-[S-35] methionine incorporation and protein secretion kinetics in Aspergillus oryzae. Pulse experiments confirmed the mechanism of methionine uptake reported previously for Penicillium chrysogenum (Benko et al., 1967). Pulse...

  6. ESTUDOS NUTRICIONAIS COM ARROZ (Oryza sativa, L.

    Alfredo LAM-SÁNCHEZ

    2009-07-01

    Full Text Available

    RESUMO: Estudos com arroz (Oryza sativa, L. foram realizados a fim de determinar a variabilidade do teor de proteína em coleções de cultivares e a possibilidade de utilizar as camadas periféricas do grão na alimentação humana. Foram analisadas 626 linhagens e cultivares de arroz que mostraram uma variação quanto ao teor de proteína de 4.00 a 14.31 g/100 g de amostra. Para se extrair as camadas periféricas do grão, foi desenvolvida uma máquina experimental, que removia as camadas superficiais dos grãos de arroz integral (inteiros somente com a casca removida. Verificou-se que a quantidade de proteína do grão diminui de fora para dentro. O resíduo, que era constituído de grande parte de restos de endosperma com um teor protéico menor mas incluía o embrião, que é a primeira estrutura a se deslocar de grão no beneficiamento e contém proteínas, vitaminas, sais minerais e lípides, tinha um bom valor nutritivo. Desenvolveu-se também uma fórmula para alimentação infantil a partir da mistura de leite de vaca com arroz, com composição semelhante à do leite materno, a ser utilizada sob a forma de bebida ou mingau. Formulações com 40%-20% arroz + 60%-80% leite de vaca proporcionaram valores de Coeficiente de Eficiência Protéica (2,39 e 2,38, respectivamente que não diferiam estatisticamente do valor de 2,43 obtido na fórmula com 100% de leite de vaca. Seus preços foram 59% e 65% do obtido para o leite de vaca integral. PALAVRAS-CHAVE: Arroz; qualidade do grão; proteína; camadas periféricas; misturas arroz-leite; nutrição humana.

  7. ANTAGONISTIC ACTIVITY OF SERRATIA MARCESCENS AGAINST PYRICULARIA ORYZAE

    V. JAIGANESH

    2007-08-01

    Full Text Available Rice is an important crop, widely affected by quite a number of diseases that results in higher yield losses. Among the fungal diseases, blast incited by Pyricularia oryzae is a major disease. The biological method of plant disease management seems to be an alternative to chemical fungicides in managing the blast disease. A new bio control agent viz., Serratia marcescens appears to be an ideal agent for the control of P. oryzae, because it produces chitinolytic enzymes which causes degradation of the fungal cell walls, induction of plant defence reaction and certain antifungal low molecular weight molecules. A study was undertaken to investigate the effect of a new bio control agent like S. marcescens against P. oryzae. The talc based formulation of S. marcescens (@ 1.0, 1.5, 2.0 and 2.5 kg/ha was sprayed on old IR 50 rice plants in fields. Out of the six-bio protectants tested, S. marcescens was found very effective against P. oryzae under in vitro conditions. S. marcescens could be isolated from shoots as well as roots emerging from the treated seeds and the plant parts from treated seeds inhibited P. oryzae. The antagonist S. marcescens survived in the phyllosphere even 80 days after spray. The results revealed that rice blast control was achieved by spraying S. marcescens @ 1.0 kg/ha. The increasing dose of talc-based inoculum when applied on foliage increased the phyllosphere population of S. marcescens and controlled rice blast. The maximum disease control was achieved when inoculum was applied at 2.5 kg/ha.

  8. Laboratory Astrophysics Division of the AAS (LAD)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-01-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  9. AAS 228: Day 1 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  10. Transcriptomic Analysis and the Expression of Disease-Resistant Genes in Oryza meyeriana under Native Condition.

    Bin He

    Full Text Available Oryza meyeriana (O. meyeriana, with a GG genome type (2n = 24, accumulated plentiful excellent characteristics with respect to resistance to many diseases such as rice shade and blast, even immunity to bacterial blight. It is very important to know if the diseases-resistant genes exist and express in this wild rice under native conditions. However, limited genomic or transcriptomic data of O. meyeriana are currently available. In this study, we present the first comprehensive characterization of the O. meyeriana transcriptome using RNA-seq and obtained 185,323 contigs with an average length of 1,692 bp and an N50 of 2,391 bp. Through differential expression analysis, it was found that there were most tissue-specifically expressed genes in roots, and next to stems and leaves. By similarity search against protein databases, 146,450 had at least a significant alignment to existed gene models. Comparison with the Oryza sativa (japonica-type Nipponbare and indica-type 93-11 genomes revealed that 13% of the O. meyeriana contigs had not been detected in O. sativa. Many diseases-resistant genes, such as bacterial blight resistant, blast resistant, rust resistant, fusarium resistant, cyst nematode resistant and downy mildew gene, were mined from the transcriptomic database. There are two kinds of rice bacterial blight-resistant genes (Xa1 and Xa26 differentially or specifically expressed in O. meyeriana. The 4 Xa1 contigs were all only expressed in root, while three of Xa26 contigs have the highest expression level in leaves, two of Xa26 contigs have the highest expression profile in stems and one of Xa26 contigs was expressed dominantly in roots. The transcriptomic database of O. meyeriana has been constructed and many diseases-resistant genes were found to express under native condition, which provides a foundation for future discovery of a number of novel genes and provides a basis for studying the molecular mechanisms associated with disease

  11. Characterisation of some Accessions of Indigenous Rice (Oryza glaberrima Steud) in Ghana

    African rice (Oryza glaberrima Steud), a relative of the commonly consumed Asian (white) rice (Oryza sativa L.) is resistant to a number of biotic and abiotic stress factors and contains higher amounts of some essential mineral elements required for human health and growth, compared to the latter. Seventeen local accessions collected from four geographical regions in Ghana were characterised alongside NERICA 1, a high yielding, protein-rich hybrid line purposely bred for Africa, using 32 IBPGR-IRRI agro-botanical traits. Molecular characterisation was done using 24 standard simple sequence repeat markers. The accessions were also evaluated for seven essential mineral elements: calcium (Ca), copper (Cu), iron (Fe), magnesium (Mg), Manganese (Mn), potassium (K) and zinc (Zn) in the caryopsis, using Atomic Absorption Spectrophotometry (AAS) supported by Neutron Activation Analysis (NAA). The aim was to assess genetic diversity of the accessions and identify superior ones for incorporation in future breeding programmes. Cluster analysis (UPGMA), principal component analysis (Axes), correlation and population genetic analysis were used to group the accessions. The single link cluster technique classified the qualitative and quantitative traits of 18 accessions into six and four clusters respectively while the use of molecular traits grouped them into four clusters. Principal component analysis (PCA) re-ordered the accessions into four broad groups which had within-cluster and inter-cluster variations. Two pairs of duplicate accessions were revealed from the dendogram generated using morphological characters. SSRs were highly polymorphic, more discriminatory and informative at 77.3% and 80.0% similarity distance respectively, they were able to discriminate between these pairs of accessions earlier identified as duplicates using botanical descriptors. The overall genetic diversity of the accessions was relatively high (He = 0.625; Nei's He = 0.608 and I = 1.178) with

  12. AA, closed orbit observation pickup

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. Werner Sax contemplates his achievement. See also 8001383, 8010042, 8010045.

  13. AA, closed orbit observation pickup

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles QFW, at maximum dispersion. See also 8001372, 8001383, 8010045

  14. AA, closed orbit observation pickup

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. See also 8001372, 8010042, 8010045

  15. AA, closed orbit observation pickup

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles, QFW, at maximum dispersion. See also 8001372,8001383, 8010042

  16. NCBI nr-aa BLAST: CBRC-PMAR-01-0384 [SEVENS

    Full Text Available CBRC-PMAR-01-0384 ref|YP_200844.1| putative manganese transport protein MntH [Xanthomonas... oryzae pv. oryzae KACC10331] gb|AAW75459.1| manganese transport protein [Xanthomonas oryzae pv. oryzae KACC10331] YP_200844.1 1.7 33% ...

  17. NCBI nr-aa BLAST: CBRC-LAFR-01-0066 [SEVENS

    Full Text Available CBRC-LAFR-01-0066 ref|YP_201438.1| drug resistance translocase [Xanthomonas oryzae ...pv. oryzae KACC10331] gb|AAW76053.1| drug resistance translocase [Xanthomonas oryzae pv. oryzae KACC10331] YP_201438.1 2.2 31% ...

  18. NCBI nr-aa BLAST: CBRC-TNIG-22-0185 [SEVENS

    Full Text Available CBRC-TNIG-22-0185 ref|YP_200844.1| putative manganese transport protein MntH [Xanthomonas... oryzae pv. oryzae KACC10331] gb|AAW75459.1| manganese transport protein [Xanthomonas oryzae pv. oryzae KACC10331] YP_200844.1 0.030 28% ...

  19. NCBI nr-aa BLAST: CBRC-TBEL-01-1996 [SEVENS

    Full Text Available CBRC-TBEL-01-1996 ref|YP_202056.1| hypothetical protein XOO3417 [Xanthomonas oryzae... pv. oryzae KACC10331] gb|AAW76671.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae KACC10331] YP_202056.1 2.5 23% ...

  20. NCBI nr-aa BLAST: CBRC-MEUG-01-2504 [SEVENS

    Full Text Available CBRC-MEUG-01-2504 ref|YP_001915750.1| hypothetical protein PXO_02997 [Xanthomonas o...ryzae pv. oryzae PXO99A] gb|ACD61218.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae PXO99A] YP_001915750.1 0.33 35% ...

  1. NCBI nr-aa BLAST: CBRC-TNIG-22-0185 [SEVENS

    Full Text Available CBRC-TNIG-22-0185 ref|YP_451103.1| manganese transport protein [Xanthomonas oryzae ...pv. oryzae MAFF 311018] dbj|BAE68829.1| manganese transport protein [Xanthomonas oryzae pv. oryzae MAFF 311018] YP_451103.1 0.030 28% ...

  2. NCBI nr-aa BLAST: CBRC-DYAK-04-0090 [SEVENS

    Full Text Available CBRC-DYAK-04-0090 ref|YP_451289.1| YapH protein [Xanthomonas oryzae pv. oryzae MAFF... 311018] dbj|BAE69015.1| YapH protein [Xanthomonas oryzae pv. oryzae MAFF 311018] YP_451289.1 0.044 24% ...

  3. NCBI nr-aa BLAST: CBRC-LAFR-01-0180 [SEVENS

    Full Text Available CBRC-LAFR-01-0180 ref|YP_202918.1| hypothetical protein XOO4279 [Xanthomonas oryzae... pv. oryzae KACC10331] gb|AAW77533.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae KACC10331] YP_202918.1 5.0 37% ...

  4. NCBI nr-aa BLAST: CBRC-BTAU-01-2358 [SEVENS

    Full Text Available CBRC-BTAU-01-2358 ref|YP_200700.1| hypothetical protein XOO2061 [Xanthomonas oryzae... pv. oryzae KACC10331] gb|AAW75315.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae KACC10331] YP_200700.1 2.4 31% ...

  5. NCBI nr-aa BLAST: CBRC-XTRO-01-0645 [SEVENS

    Full Text Available CBRC-XTRO-01-0645 ref|YP_200775.1| hypothetical protein XOO2136 [Xanthomonas oryzae... pv. oryzae KACC10331] gb|AAW75390.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae KACC10331] YP_200775.1 3e-41 40% ...

  6. NCBI nr-aa BLAST: CBRC-ACAR-01-0222 [SEVENS

    Full Text Available CBRC-ACAR-01-0222 ref|YP_201677.1| hypothetical protein XOO3038 [Xanthomonas oryzae... pv. oryzae KACC10331] gb|AAW76292.1| conserved hypothetical protein [Xanthomonas oryzae pv. oryzae KACC10331] YP_201677.1 0.004 27% ...

  7. Oryza Tag Line, a phenotypic mutant database for the Genoplante rice insertion line library

    Larmande, Pierre; Gay, Celine; Lorieux, Mathias; Perin, Christophe; Bouniol, Matthieu; Droc, Gaëtan; Sallaud, Christophe; Perez, Pascual; Barnola, Isabelle; Biderre-Petit, Corinne; Martin, Jérôme; Morel, Jean-Benoit; Johnson, Alexander A. T.; Bourgis, Fabienne; Ghesquière, Alain

    2008-01-01

    International audience To organize data resulting from the phenotypic characterization of a library of 30,000 T-DNA enhancer trap (ET) insertion lines of rice (Oryza sativa L cv. Nipponbare), we developed the Oryza Tag Line (OTL) database (http://urgi.versailles.inra.fr/OryzaTagLine/). OTL structure facilitates forward genetic search for specific phenotypes, putatively resulting from gene disruption, and/or for GUSA or GFP reporter gene expression patterns, reflecting ET-mediated endogenou...

  8. Utilization of Aspergillus oryzae to produce pectin lyase from various agro-industrial residues

    Safia Koser; Zahid Anwar; Zafar Iqbal; Awais Anjum; Tahir Aqil; Sajid Mehmood; Muhammad Irshad

    2014-01-01

    The present study was aimed to investigate the culture influence on pectin lyase production potential of fungal strain Aspergillus oryzae. The enzyme profile of A. oryzae showed highest activity of pectin lyase after 3rd day of incubation on lemon peel waste under solid state fermentation conditions. To induce the pectin lyase synthesis capability of A. oryzae at optimal level various culture variables including physical and nutritional parameters were optimized by adopting classical optimiza...

  9. AAS 228: Day 3 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  10. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor.

    Pérez, Claudia; Fernandez, Luisa E; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S; Soberón, Mario; Bravo, Alejandra

    2005-12-20

    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa binding to Aedes aegypti brush border membrane vesicles enhanced the binding of biotinylated-Cry11Aa. The Cyt1Aa- and Cry11Aa-binding epitopes were mapped by means of the yeast two-hybrid system, peptide arrays, and heterologous competition assays with synthetic peptides. Two exposed regions in Cyt1Aa, loop beta6-alphaE and part of beta7, bind Cry11Aa. On the other side, Cry11Aa binds Cyt1Aa proteins by means of domain II-loop alpha8 and beta-4, which are also involved in midgut receptor interaction. Characterization of single-point mutations in Cry11Aa and Cyt1Aa revealed key Cry11Aa (S259 and E266) and Cyt1Aa (K198, E204 and K225) residues involved in the interaction of both proteins and in synergism. Additionally, a Cyt1Aa loop beta6-alphaE mutant (K198A) with enhanced synergism to Cry11Aa was isolated. Data provided here strongly indicates that Cyt1Aa synergizes or suppresses resistance to Cry11Aa toxin by functioning as a membrane-bound receptor. Bacillus thuringiensis subsp. israelensis is a highly effective pathogenic bacterium because it produces a toxin and also its functional receptor, promoting toxin binding to the target membrane and causing toxicity. PMID:16339907

  11. AAS 228: Day 3 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  12. Improvement in rice resistance to Pyricularia oryzae through mutagenesis

    Rice (Oryza sativa L.) is the staple diet of Costa Ricans. Normally, people eat rice at least twice daily. This cereal is very important both for production and consumption. The sowing area in Costa Rica is approximately 70,000 ha/a. The rice area is characterized by high temperature and high humidity, which are also the conditions required for the high inoculation of pathogens. Of the diseases that prevail under such conditions, blast disease, caused by Pyricularia oryzae, is one of the most severe, resulting in yield losses of up to 90% when attacks are severe. Use of induced mutations in cereals has been shown to be an excellent tool, often using gamma rays as the mutagen agent for crop improvement. The main objective of our work was to induce resistance to blast disease in the commercial variety CR-1113, which is the most important cultivar in Costa Rica. 4 refs

  13. Niclosamide inhibits leaf blight caused by Xanthomonas oryzae in rice.

    Kim, Sung-Il; Song, Jong Tae; Jeong, Jin-Yong; Seo, Hak Soo

    2016-01-01

    Rice leaf blight, which is caused by the bacterial pathogen Xanthomonas oryzae pv. oryzae (Xoo), results in huge losses in grain yield. Here, we show that Xoo-induced rice leaf blight is effectively controlled by niclosamide, an oral antihelminthic drug and molluscicide, which also functions as an anti-tumor agent. Niclosamide directly inhibited the growth of the three Xoo strains PXO99, 10208 and K3a. Niclosamide moved long distances from the site of local application to distant rice tissues. Niclosamide also increased the levels of salicylate and induced the expression of defense-related genes such as OsPR1 and OsWRKY45, which suppressed Xoo-induced leaf wilting. Niclosamide had no detrimental effects on vegetative/reproductive growth and yield. These combined results indicate that niclosamide can be used to block bacterial leaf blight in rice with no negative side effects. PMID:26879887

  14. Molecular progress on the mapping and cloning of functional genes for blast disease in rice (Oryza sativa L.): current status and future considerations.

    Ashkani, S; Rafii, M Y; Shabanimofrad, M; Ghasemzadeh, A; Ravanfar, S A; Latif, M A

    2016-01-01

    Rice blast disease, which is caused by the fungal pathogen Magnaporthe oryzae, is a recurring problem in all rice-growing regions of the world. The use of resistance (R) genes in rice improvement breeding programmes has been considered to be one of the best options for crop protection and blast management. Alternatively, quantitative resistance conferred by quantitative trait loci (QTLs) is also a valuable resource for the improvement of rice disease resistance. In the past, intensive efforts have been made to identify major R-genes as well as QTLs for blast disease using molecular techniques. A review of bibliographic references shows over 100 blast resistance genes and a larger number of QTLs (∼500) that were mapped to the rice genome. Of the blast resistance genes, identified in different genotypes of rice, ∼22 have been cloned and characterized at the molecular level. In this review, we have summarized the reported rice blast resistance genes and QTLs for utilization in future molecular breeding programmes to introgress high-degree resistance or to pyramid R-genes in commercial cultivars that are susceptible to M. oryzae. The goal of this review is to provide an overview of the significant studies in order to update our understanding of the molecular progress on rice and M. oryzae. This information will assist rice breeders to improve the resistance to rice blast using marker-assisted selection which continues to be a priority for rice-breeding programmes. PMID:25394538

  15. Aspergillus oryzae type III polyketide synthase CsyA is involved in the biosynthesis of 3,5-dihydroxybenzoic acid.

    Seshime, Yasuyo; Juvvadi, Praveen Rao; Kitamoto, Katsuhiko; Ebizuka, Yutaka; Nonaka, Takamasa; Fujii, Isao

    2010-08-15

    As a novel superfamily of type III polyketide synthases in microbes, four genes csyA, csyB, csyC, and csyD, were found in the genome of Aspergillus oryzae, an industrially important filamentous fungus. In order to analyze their functions, we carried out the overexpression of csyA under the control of alpha-amylase promoter in A. oryzae and identified 3,5-dihydroxybenzoic acid (DHBA) as the major product. Feeding experiments using (13)C-labeled acetates confirmed that the acetate labeling pattern of DHBA coincided with that of orcinol derived from orsellinic acid, a polyketide formed by the condensation and cyclization of four acetate units. Further oxidation of methyl group of orcinol by the host fungus could lead to the production of DHBA. Comparative molecular modeling of CsyA with the crystal structure of Neurospora crassa 2'-oxoalkylresorcylic acid synthase indicated that CsyA cavity size can only accept short-chain acyl starter and tetraketide formation. Thus, CsyA is considered to be a tetraketide alkyl-resorcinol/resorcylic acid synthase. PMID:20630753

  16. SSR Marker Analysis on indica-japonica Differentiation of Natural Population of Oryza rufipogon in Yuanjiang, Yunnan Province

    LI Ya-li; YANG Xiao-xi; ZHAO Feng-ping; XU Ming-hui

    2006-01-01

    By using 19 pairs of primers that could identify two subspecies (indica and japonica) of cultivated rice (Oryza sativa L.), the indica-japonica differentiation of 56 individuals from the natural population of common wild rice (Oryza rufipogon Griff.) in Yuanjiang was analyzed by SSR (microsatellite DNAs, or simple sequence repeat). Of the 19 pairs of primers, 17 pairs (89.47%) could amplify only one kind of band type among ail of the individuals, but primers RM251 and RM18 could amplify polymorphic band types. The bands amplified by 16 pairs of primers (84.21%) were identical to the indica-japonica diagnostic bands of relevant locus in cultivated rice, including 11 japonica-like loci and 4 indica-like loci. The bands amplified by the other three pairs of primers (RM18, RM202,RM205) were different from indica or japonica diagnostic bands of cultivated rice. The results showed that according to 19 loci analyzed, 84.21% of SSR loci in genomic DNA of common wild rice in Yuanjiang displayed indica-japonica differentiation and 13.79% of the loci still kept primitive, and most of the detected loci were homogenetic in the natural population.

  17. Photosynthetic activity in rice seedlings infected with Piricularia oryzae Cavara

    Changes in photosynthetic activity in the rice seedlings infected with piricularia oryzae Cavara (blast disease) were examined comparing with the non-infected seedlings. The assimilated 14C radioactivity was about 50% lower in the infected rice seedlings than in the non-infected seedlings. A little difference in the distribution of 14C radioactivity was observed. The 14C activity in the cationic fraction of ethanol soluble fractions was a little higher in the infected seedling. (auth.)

  18. Isolation and Characterization of Aspergillus oryzae Vacuolar Protein Sorting Mutants

    Ohneda, Mamoru; Arioka, Manabu; Kitamoto, Katsuhiko

    2005-01-01

    The vacuolar protein sorting (vps) system in the filamentous fungus Aspergillus oryzae, which has unique cell polarity and the ability to secrete large amounts of proteins, was evaluated by using mutants that missort vacuolar proteins into the medium. Vacuolar carboxypeptidase Y (CPY) fused with enhanced green fluorescent protein (EGFP) was used as a vacuolar marker. Twenty dfc (dim EGFP fluorescence in conidia) mutants with reduced intracellular EGFP fluorescence in conidia were isolated by ...

  19. Multiple translocation of the AVR-Pita effector gene among chromosomes of the rice blast fungus Magnaporthe oryzae and related species.

    Izumi Chuma

    2011-07-01

    Full Text Available Magnaporthe oryzae is the causal agent of rice blast disease, a devastating problem worldwide. This fungus has caused breakdown of resistance conferred by newly developed commercial cultivars. To address how the rice blast fungus adapts itself to new resistance genes so quickly, we examined chromosomal locations of AVR-Pita, a subtelomeric gene family corresponding to the Pita resistance gene, in various isolates of M. oryzae (including wheat and millet pathogens and its related species. We found that AVR-Pita (AVR-Pita1 and AVR-Pita2 is highly variable in its genome location, occurring in chromosomes 1, 3, 4, 5, 6, 7, and supernumerary chromosomes, particularly in rice-infecting isolates. When expressed in M. oryzae, most of the AVR-Pita homologs could elicit Pita-mediated resistance, even those from non-rice isolates. AVR-Pita was flanked by a retrotransposon, which presumably contributed to its multiple translocation across the genome. On the other hand, family member AVR-Pita3, which lacks avirulence activity, was stably located on chromosome 7 in a vast majority of isolates. These results suggest that the diversification in genome location of AVR-Pita in the rice isolates is a consequence of recognition by Pita in rice. We propose a model that the multiple translocation of AVR-Pita may be associated with its frequent loss and recovery mediated by its transfer among individuals in asexual populations. This model implies that the high mobility of AVR-Pita is a key mechanism accounting for the rapid adaptation toward Pita. Dynamic adaptation of some fungal plant pathogens may be achieved by deletion and recovery of avirulence genes using a population as a unit of adaptation.

  20. Lamination sheet of AA BST magnet

    1979-01-01

    The AA had 2 types of bending magnets: BLG (window-frame, long and narrow)and BST (H-type, short and wide). The BST had a very wide aperture, 0.564 m of "good field". To demonstrate the size, the petite AA secretary, Val Mansfield, poses with a lamination sheet. See also 7811105, 7906163, 8006050.

  1. Reduction of aflatoxins by Rhizopus oryzae and Trichoderma reesei.

    Hackbart, H C S; Machado, A R; Christ-Ribeiro, A; Prietto, L; Badiale-Furlong, E

    2014-08-01

    This study evaluated the ability of the microorganisms Rhizopus oryzae (CCT7560) and Trichoderma reesei (QM9414), producers of generally recognized as safe (GRAS) enzymes, to reduce the level of aflatoxins B1, B2, G1, G2, and M1. The variables considered to the screening were the initial number of spores in the inoculum and the culture time. The culture was conducted in contaminated 4 % potato dextrose agar (PDA) medium, and the residual mycotoxins were determined every 24 h by HPLC-FL. The fungus R. oryzae has reduced aflatoxins B1, B2, and G1 in the 96 h and aflatoxins M1 and G2 in the range of 120 h of culture by approximately 100 %. The fungus T. reesei has reduced aflatoxins B1, B2, and M1 in the 96 h and aflatoxin G1 in the range of 120 h of culture by approximately 100 %. The highest reduction occurred in the middle of R. oryzae culture. PMID:24925827

  2. A novel l-arabinose-responsive regulator discovered in the rice-blast fungus Pyricularia oryzae (Magnaporthe oryzae).

    Klaubauf, Sylvia; Zhou, Miaomiao; Lebrun, Marc-Henri; de Vries, Ronald P; Battaglia, Evy

    2016-02-01

    In this study we identified the l-arabinose-responsive regulator of Pyricularia oryzae that regulates l-arabinose release and catabolism. Previously we identified the Zn2Cys6 transcription factor (TF), AraR, that has this role in the Trichocomaceae family (Eurotiales), but is absent in other fungi. Candidate Zn2Cys6 TF genes were selected according to their transcript profiles on l-arabinose. Deletion mutants of these genes were screened for their growth phenotype on l-arabinose. One mutant, named Δara1, was further analyzed. Our analysis demonstrated that Ara1 from P. oryzae is the functional analog of AraR from A. niger, while there is no significant sequence similarity between them. PMID:26790567

  3. A novel single-stranded RNA virus isolated from the rice-pathogenic fungus Magnaporthe oryzae with similarity to members of the family Tombusviridae.

    Ai, Ye-Ping; Zhong, Jie; Chen, Chuan-Yuan; Zhu, Hong-Jian; Gao, Bi-Da

    2016-03-01

    Here, we report a novel virus isolated from rice blast fungus, Magnaporthe oryzae, an important plant pathogen. This virus has an RNA genome of 3246 nucleotides. Its genome possesses two in-frame open reading frames (ORFs). The smaller ORF1 encodes a protein with significant similarity to a protein encoded by the ssRNA mycovirus Diaporthe ambigua RNA virus 1 (DaRV1). The larger ORF2 encodes a protein with similarity to RNA-dependent RNA polymerases (RdRp) of DaRV1 and other plant viruses of the family Tombusviridae. In silico analysis and comparisons with DaRV1 genome expression suggest that ORF2 is translated via a readthrough mechanism together with ORF1. Based upon results of this study, this virus, for which the provisional name Magnaporthe oryzae virus A (MoVA) is proposed, belongs to a new virus species. Furthermore, MoVA along with DaRV1 belong to a new taxon of mycoviruses that are evolutionarily related to plant viruses belonging to the family Tombusviridae. PMID:26650038

  4. AAS 228: Day 1 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  5. The thiG Gene Is Required for Full Virulence of Xanthomonas oryzae pv. oryzae by Preventing Cell Aggregation.

    Xiaoyue Yu

    Full Text Available Bacterial blight of rice is an important serious bacterial diseases of rice in many rice-growing regions, caused by Xanthomonas oryzae pv. oryzae (Xoo. The thiG gene from Xoo strain ZJ173, which is involved with thiazole moiety production in the thiamine biosynthesis pathway, is highly conserved among the members of Xanthomonas. The thiG deletion mutant displayed impaired virulence and growth in thiamine-free medium but maintained its normal growth rate in the rice tissues, indicating that the thiG gene is involved in Xoo virulence. Compared to the wild type strain, the formation of cell-cell aggregates was affected in thiG deletion mutants. Although biofilm formation was promoted, motility and migration in rice leaves were repressed in the thiG mutants, and therefore limited the expansion of pathogen infection in rice. Quorum sensing and extracellular substance are two key factors that contribute to the formation of cell-cell aggregates. Our study found that in the thiG mutant the expression of two genes, rpfC and rpfG, which form a two-component regulatory signal system involved in the regulation of biofilm formation by a second messenger cyclic di-GMP is down-regulated. In addition, our study showed that xanthan production was not affected but the expression of some genes associated with xanthan biosynthesis, like gumD, gumE, gumH and gumM, were up-regulated in thiG mutants. Taken together, these findings are the first to demonstrate the role of the thiazole biosynthsis gene, thiG, in virulence and the formation of aggregates in Xanthomonas oryzae pv. oryzae.

  6. A genome-wide SNP panel for genetic diversity, mapping and breeding studies in rice

    A genome-wide SNP resource was developed for rice using the GoldenGate assay and used to genotype 400 landrace accessions of O. sativa. SNPs were originally discovered using Perlegen re-sequencing technology in 20 diverse landraces of O. sativa as part of OryzaSNP project (http://irfgc.irri.org). An...

  7. STUDI ENZIM LIPASE DARI Aspergillus oryzae PADA KOPRA BERJAMUR SEBAGAI BIOKATALISATOR UNTUK HIDROLISIS MINYAK KELAPA MENJADI DIASILGLISEROL

    seniwati

    2012-01-01

    SENIWATI DALI. Studi Enzim Lipase dari Aspergillus oryzae pada Kopra Berjamur Sebagai Biokatalisator untuk Hidrolisis Minyak Kelapa Menjadi Diasilgliserol (dibimbing oleh Abd. Rauf Patong, M. Noor Jalaluddin dan Pirman AP). Penelitian ini bertujuan (1) menentukan kondisi optimum produksi enzim lipase dari A. oryzae pada kopra berjamur, (2) memurnikan dan mengkarakterisasi enzim lipase dari A. oryzae, (3) menentukan unjuk kerja enzim lipase imobil dari A. oryzae sebagai bi...

  8. Genome sequence of the cultivated cotton Gossypium arboreum

    Cotton is one of the most economically important natural fiber crops in the world, and the complex tetraploid nature of its genome (AADD, 2n = 52) makes genetic, genomic and functional analyses extremely challenging. Here we sequenced and assembled 98.3% of the 1.7-gigabase G. arboreum (AA, 2n = 26...

  9. Characterization of field isolates of Magnaporthe oryzae with mating type, DNA fingerprinting, and pathogenicity assays

    Due to the harmful nature of the rice blast fungus, Magnaporthe oryzae, it is beneficial to characterize field isolates to help aid in the deployment of resistance (R) genes in rice. In the present study, 190 field isolates of M. oryzae, collected from rice fields of Yunnan province in China, were a...

  10. Soft Rot on Cucumis melo var. makuwa Caused by Rhizopus oryzae

    Kwon, Jin-Hyeuk; Kim, Jinwoo; Lee, Yong-Hwan; Shim, Hong-Sik

    2010-01-01

    Rhizopus oryzae is reported for the first time on Cucumis melo L. var. makuwa Makino. A detailed description of this Korean specimen is given, along with its rDNA internal transcribed spacer sequence. On the basis of mycological characteristics and molecular data, the fungus was identified as R. oryzae Went & Prinsen Geerligs.

  11. First Report of Rhizopus oryzae as a Postharvest Pathogen of Apple in Korea

    Kwon, Jin-Hyeuk; Kim, Jinwoo; Kim, Won-Il

    2011-01-01

    Soft rot in apple caused by Rhizopus oryzae was found for the first time in Korea. A detailed description of the specimen is given along with its internal transcribed spacer rDNA sequence. The fungus was identified as Rhizopus oryzae based on the mycological characteristics, molecular data, and pathogenicity testing.

  12. Comparative Study of Substrates and Inhibitors of Azospirillum lipoferum and Pyricularia oryzae Laccases

    Faure, D.; Bouillant, M.; Bally, R

    1995-01-01

    Azospirillum lipoferum and Pyricularia oryzae laccases were compared, using several substrates and inhibitors. Sixteen phenolic or nonphenolic compounds were found to be substrates of both fungal and bacterial laccases. In the presence of different phenol oxidase inhibitors, P. oryzae and A. lipoferum laccase activities had similar properties.

  13. Secreted fungal sulfhydryl oxidases: sequence analysis and characterisation of a representative flavin-dependent enzyme from Aspergillus oryzae

    Faccio Greta

    2010-08-01

    Full Text Available Abstract Background Sulfhydryl oxidases are flavin-dependent enzymes that catalyse the formation of de novo disulfide bonds from free thiol groups, with the reduction of molecular oxygen to hydrogen peroxide. Sulfhydryl oxidases have been investigated in the food industry to remove the burnt flavour of ultraheat-treated milk and are currently studied as potential crosslinking enzymes, aiming at strengthening wheat dough and improving the overall bread quality. Results In the present study, potential sulfhydryl oxidases were identified in the publicly available fungal genome sequences and their sequence characteristics were studied. A representative sulfhydryl oxidase from Aspergillus oryzae, AoSOX1, was expressed in the fungus Trichoderma reesei. AoSOX1 was produced in relatively good yields and was purified and biochemically characterised. The enzyme catalysed the oxidation of thiol-containing compounds like glutathione, D/L-cysteine, beta-mercaptoethanol and DTT. The enzyme had a melting temperature of 57°C, a pH optimum of 7.5 and its enzymatic activity was completely inhibited in the presence of 1 mM ZnSO4. Conclusions Eighteen potentially secreted sulfhydryl oxidases were detected in the publicly available fungal genomes analysed and a novel proline-tryptophan dipeptide in the characteristic motif CXXC, where X is any amino acid, was found. A representative protein, AoSOX1 from A. oryzae, was produced in T. reesei in an active form and had the characteristics of sulfhydryl oxidases. Further testing of the activity on thiol groups within larger peptides and on protein level will be needed to assess the application potential of this enzyme.

  14. Genome-wide pooling approach identifies SPATA5 as a new susceptibility locus for alopecia areata

    2011-01-01

    Abstract Alopecia areata (AA) is a common hair loss disorder which is thought to be a tissue-specific autoimmune disease. Previous research has identified a few AA susceptibility genes, most of which are implicated in autoimmunity. To identify new genetic variants and further elucidate the genetic basis of AA, we performed a genome-wide association study using the strategy of pooled DNA genotyping (729 cases; 656 controls). The strongest association was for variants in the HLA regi...

  15. Identification of a New Rice Blast Resistance Gene, Pid3, by Genomewide Comparison of Paired Nucleotide-Binding Site–Leucine-Rich Repeat Genes and Their Pseudogene Alleles Between the Two Sequenced Rice Genomes

    Shang, Junjun; Tao, Yong; Chen, Xuewei; Zou, Yan; Lei, Cailin; Wang, Jing; Li, Xiaobing; Zhao, Xianfeng; Zhang, Meijun; Lu, Zhike; Xu, Jichen; Cheng, Zhukuan; Wan, Jianmin; Zhu, Lihuang

    2009-01-01

    Rice blast, caused by Magnaporthe oryzae, is one of the most devastating diseases. The two major subspecies of Asian cultivated rice (Oryza sativa L.), indica and japonica, have shown obvious differences in rice blast resistance, but the genomic basis that underlies the difference is not clear. We performed a genomewide comparison of the major class of resistant gene family, the nucleotide-binding site–leucine-rich repeat (NBS–LRR) gene family, between 93-11 (indica) and Nipponbare (japonica)...

  16. The Subtelomere of Oryza sativa Chromosome 3 Short Arm as a Hot Bed of New Gene Origination in Rice

    Chuanzhu Fan; Yong Zhang; Yeisoo Yu; Steve Rounsley; Manyuan Long; Rod A.Wing

    2008-01-01

    Despite general observations of non-random genomic distribution of new genes,it is unclear whether or not new genes preferentially occur in certain genomic regions driven by related molecular mechanisms.Using 1.5 Mb of genomic sequences from short arms of chromosome 3 of Oryza glaberrima and O.punctata,we conducted a comparative genomic analysis with the reference O.sativa ssp-japonica genome.We identified a 60-kb segment Iocated in the middle of the subtelomeric region of chromosome 3,which is unique to the species O.sativa.The region contained gene duplicares that occurred in Asian cultivated rice species that diverged from the ancestor of Asian and African cultivated rice one million years ago(MYA).For the 12 genes and one complete retrotransposon identified in this segment in O.sativa ssp.japonica,we searched for their parental genes.The high similarity between duplicated paralogs further supports the recent origination of these genes.We found that this segment was recently generated through multiple independent gene recombination and transposon insertion events.Among the 12 genes,we found that five had chimeric gene structures derived from multiple parental genes.Nine out of the 12 new genes seem to be functional,as suggested by Ka/Ks analysis and the presence of cDNA and/or MPSS data.Furthermore,for the eight transcribed genes,at least two genes could be classified as defense or stress response-related genes.Given these findings,and the fact that subtelomeres are associated with high rates of recombination and transcription,it is likely that subtelomeres may facilitate gene recombination and transposon insertions and serve as hot spots for new gene origination in rice genomes.

  17. Incidence de la bactérie Xhantomonas oryzae pv oryzae sur la production du riz (Oriza sativa L. au Niger

    Basso, A.

    2013-01-01

    Full Text Available Incidence of Xhantomonas oryzae pv oryzae on the Production of Rice (Oriza sativa L. in Niger. Rice bacterial blight due to Xhantomonas oryzae pv. oryzae is one of the diseases causing economic damage on rice in Niger. Investigations were led in the two most important irrigated rice producing areas (along the river Niger and the river Komadougou yobé in order to evaluate its importance. It comes out from the study that bacterial blight is present in both rice producing areas, with a prevalence of 10 to 75% and production losses ranging from 19 to 63%, which amounts from 200.000 to more than 500.000 FCFA/ha. It was noted that some cultural practices such as phased transplanting favor the development of bacterial outbreaks. The search for alternative hosts to the bacterium made it possible to identify 13 species. These hosts belong to Poaceae (more than 80% and Cyperaceae (nearly 20% families.

  18. Suppression of Rice Blast by Preinoculation with Avirulent Pyricularia oryzae and the Nonrice Pathogen Bipolaris sorokiniana.

    Manandhar, H K; Lyngs Jørgensen, H J; Mathur, S B; Smedegaard-Petersen, V

    1998-07-01

    ABSTRACT Avirulent isolates of Pyricularia oryzae and isolates of Bipolaris sorokiniana, a nonrice pathogen, were used to suppress rice blast caused by P. oryzae. In greenhouse experiments, both fungi substantially reduced leaf blast when applied 24 h or more before the pathogen. B. sorokiniana, but not avirulent isolates of P. oryzae, systemically reduced disease in leaf 5 when applied to whole plants at the four-leaf stage. In field experiments, both fungi were able to reduce neck blast significantly. No increase in grain yield was obtained by using avirulent isolates of P. oryzae, whereas five sprays with B. sorokiniana from seedling to heading stages increased the grain yield in two of three experiments conducted at two locations in Nepal. The significant increase in yield was observed under high inoculum pressure of P. oryzae. Induced resistance is suggested to be involved in the suppression of disease. PMID:18944948

  19. Characterization and Mapping of a Salt-Sensitive Mutant in Rice (Oryza sativa L.)

    Jingwei Zhou; Fuzheng Wang; Ping Deng; Wen Jing; Wenhua Zhang

    2013-01-01

    A salt-sensitive mutant designated rice salt sensitive 2 (rss2) was isolated from the M2 generation of the rice cultivar Nipponbare (Oryza sativa L.ssp.japonica) mutagenized with ethyl methanesulfonate (EMS).This mutant exhibited a greater decrease in salt tolerance with a significant increase in Na+ content in its shoots.Genetic analysis indicated that the increase in Na+ in rss2 was controlled by a single recessive gene.Further genome-wide analysis of the linkage map constructed from the F2 population of rss2/Zhaiyeqing 8 (ZYQ8) showed that two quantitative trait loci (QTLs) on chromosomes 1 and 6 were responsible for the Na+ concentration in shoots,which explained 14.5% and 53.3%,respectively,of the phenotypic variance.The locus on chromosome 1,but not that on chromosome 6,was also detected in the F2 population of Nipponbare/ZYQ8,suggesting that the QTL on chromosome 6 was responsible for the salt sensitivity in rss2.By analyzing the recombination events in 220 mutant individuals of an enlarged mapping population of rss2/ZYQ8,the rss2 locus was precisely mapped to an interval of 605.3 kb between insertion/deletion (InDel) markers IM21962 and IM22567.This finding will facilitate the cloning of the rss2 locus and provide insight into the physiological mechanisms of salt sensitivity in rice.

  20. Isolation and characterization of microsatellite loci in the Asian rice gall midge (Orseolia oryzae) (Diptera: Cecidomyiidae).

    Bentur, Jagadish S; Sinha, Deepak Kumar; Padmavathy; Revathy, Charagonda; Muthulakshmi, Mayandi; Nagaraju, Javaregowda

    2011-01-01

    Microsatellite loci were isolated from the genomic DNA of the Asian rice gall midge, Orseolia oryzae (Wood-Mason) using a hybridization capture approach. A total of 90 non-redundant primer pairs, representing unique loci, were designed. These simple sequence repeat (SSR) markers represented di (72%), tri (15.3%), and complex repeats (12.7%). Three biotypes of gall midge (20 individuals for each biotype) were screened using these SSRs. The results revealed that 15 loci were hyper variable and showed polymorphism among different biotypes of this pest. The number of alleles ranged from two to 11 and expected heterozygosity was above 0.5. Inheritance studies with three markers (observed to be polymorphic between sexes) revealed sex linked inheritance of two SSRs (Oosat55 and Oosat59) and autosomal inheritance of one marker (Oosat43). These markers will prove to be a useful tool to devise strategies for integrated pest management and in the study of biotype evolution in this important rice pest. PMID:21340012

  1. Isolation and Characterization of Microsatellite Loci in the Asian Rice Gall Midge (Orseolia oryzae (Diptera: Cecidomyiidae

    Charagonda Revathy

    2011-01-01

    Full Text Available Microsatellite loci were isolated from the genomic DNA of the Asian rice gall midge, Orseolia oryzae (Wood-Mason using a hybridization capture approach. A total of 90 non-redundant primer pairs, representing unique loci, were designed. These simple sequence repeat (SSR markers represented di (72%, tri (15.3%, and complex repeats (12.7%. Three biotypes of gall midge (20 individuals for each biotype were screened using these SSRs. The results revealed that 15 loci were hyper variable and showed polymorphism among different biotypes of this pest. The number of alleles ranged from two to 11 and expected heterozygosity was above 0.5. Inheritance studies with three markers (observed to be polymorphic between sexes revealed sex linked inheritance of two SSRs (Oosat55 and Oosat59 and autosomal inheritance of one marker (Oosat43. These markers will prove to be a useful tool to devise strategies for integrated pest management and in the study of biotype evolution in this important rice pest.

  2. Sequence analysis of ORF IV RTBV isolated from tungro infected Oryza sativa L. cv Ciherang

    Hastilestari, Bernadetta Rina; Astuti, Dwi; Estiati, Amy; Nugroho, Satya

    2015-09-01

    The Effort to increase rice production is often constrained by pest and disease such as Tungro. The Tungro disease is caused by the joint infection with two dissimilar viruses; a bacil-form-DNA virus, the Rice tungro bacilliform virus(RTBV) and the spherical RNA virus, Rice tungro spherical virus (RTSV) and transmitted by Green leafhopper (Nephotettix virescens). The symptom of disease is caused by the presence of RTBV. The genome of RTBV consists of four Open reading frames (ORFs) which encode functional proteins. Of the four, ORF IV is unique because it exists only in RTBV. The most efficient method of generating disease resistance plants is to look for natural sources of resistance genes in wild or germplasm and then transfer the gene and the accompanying resistance in cultivated crop varieties. The aim of this study is, therefore, to isolate and analyze of 1170 bp gene of ORF 4 of Tungro virus isolated from an Indonesian rice cultivar, Ciherang (Oryza sativa L. cv Indica). DNA sequencing analysis using BLAST showed 94% similarity with the reference sequence gen bank Acc.M65026.1. The comparisons and mutation analysis of DNA sequences were discussed in this research.

  3. Ripening for improving the quality of inoculated cheese Rhizopus oryzae

    ARTINI PANGASTUTI

    2010-01-01

    Full Text Available Estikomah SA, Sutarno, Pangastuti A 2010. Ripening for improving the quality of inoculated cheese Rhizopus oryzae. Nusantara Bioscience 2: 1-6. Cheese is dairy product resulted from fermented milk in which the fermentation process can be done by lactic acid bacteria or fungus. Rhizopus oryzae is able to produce lactic acid, protease and lipase. The ripening process changes the taste and texture. The purpose of this study is ripening to improve the quality of inoculated cheese R. oryzae. In this research the ripening was conducted the concentration variation of temperature (5oC, 10oC, 15oC, and time (7 days, 14 days. The procedure of research consisted of two steps, namely un-ripened cheese preparation followed by ripening cheese preparation. Cheese produced in this study analyzed the value of pH, fat content, protein content, amino acid levels and identification of microbe with ANOVA then followed by DMRT at 5% level of significance. Data results were analyzed with the like’s nonparametric statistical test, followed by Fridman Wilcoxon Signed Rank Test (WSRT at 5% level significance. The results showed that the preferred ripened cheese panelist was at a temperature of 15oC for 14 days. Ripening conditions affect pH, fat content, protein content and do not affect the levels of amino acids that formed ripened cheese. The best quality ripened cheese i.e. at a temperature of 15°C for 14 days, had a pH value of 4.40, the highest protein content of 9.78%, and fat content of 35.02%. The results of identified microbe in un-ripened cheese and ripened cheese include Enterococcus hirae (Enterococcus faecalis, Bacillus subtilis, and Aspergillus sp.

  4. Pemeraman untuk meningkatkan kualitas keju yang diinnokulasi Rhizopus oryzae

    SOLIKAH ANA ESTIKOMAH

    2010-11-01

    Full Text Available Estikomah SA, Sutarno, Pangastuti A. 2010. Pemeraman untuk meningkatkaan kualitas keju yang diinokulasi Rhizopus oryzae. Bioteknologi 7: 55-62. Keju merupakan makanan hasil fermentasi dari susu yang proses fermentasinya dilakukan oleh bakteri asam laktat maupun jamur. Rhizopus oryzae diketahui mampu menghasilkan asam laktat, protease, dan lipase. Perubahan cita rasa dan tekstur keju terjadi selama pemeraman keju. Tujuan penelitian ini adalah untuk meningkatkan kualitas keju yang diinokulasi R. oryzae melalui pemeraman. Pemeraman dilakukan dengan variasi waktu (7, 14 hari dan suhu (5ºC, 10ºC, 15ºC. Penelitian ini terdiri dua tahap, yaitu pembuataan keju mentah diikuti pemeraman keju mentah tersebut. Keju penelitian dianalisis nilai pH, kadar lemak, kadar protein, kadar asam amino dan diidentifikasi mikrobanya. Data hasil penellitian dianalisis dengan uji siidik ragam (ANAVA, kemudian dilanjutkan dengan uji berjarak ganda Duncan (DMRT pada taraf signifikansi 5%. Data hasil tingkat kesukaan dianalisis dengan statistik nonparametrik uji Fridman yang dilanjutkaan dengan Wilcoxon Signed Rank Test (WSRT pada taraf sigifikansi 5%. Hasil penelitian menunjukkan bahwa keju peram yang disukai panelis adalah keju peram pada suhu 15ºC selama 14 hari. Kondisi pemeraman berpengaruh terhadap nilai pH, kadar lemak,, kadar proteinn dan tidak berpengaruh pada kadar asam amino. Kualitas keju peram terbaik terdapat pada kondisi suhu 15°C selama 14 hari, memiliki nilai pH 4,40, kadar protein tertinggi yaitu sebesar 99,78%, dan kadar lemak sebesar 35,02%. Hasil identifikasi mikroba pada keju mentah dan keju peram meliputi Enterococcus hirae (Enterococcus faecalis, Bacillus subtilis, dan Aspergillus sp.

  5. The power of alternative assessments (AAs)

    张千茜

    2013-01-01

    This article starts by discussing the potential disadvantages of traditional assessment towards young English as a Second Language (ESL) learners within the American public school education system. In response to such disadvantages, researchers ’call for the implementation of alternative assessments (AAs) is therefore introduced along with the various benefits of AAs. However, the current mainstream education policy in the US, namely No Child Left Behind (NCLB) Policy, is still largely based on the tra-ditional ways of testing, making policy-oriented implementation of AAs on large scales remarkably difficult. After careful analysis, the author points out several implications concerning how, under such an existing policy of NCLB, can practitioners effectively accommodate young ESL learners by applying the power of AAs.

  6. Friction Stir Weldabilities of AA1050-H24 and AA6061-T6 Aluminum Alloys

    Huijie LIU; Hidetoshi FUJIN; Masakatsu MAEDA; Kiyoshi NOGI

    2005-01-01

    The friction stir weldabilities of the strain-hardened AA1050-H24 and precipitate-hardened AA6061-T6 aluminum alloys were examined to reveal the effects of material properties on the friction stir welding behavior. The experimental results are obtlained. (1) For AA1050-H24, the weld can possess smoother surface ripples; there is no elliptical weld nugget in the weld; there is no discernible interface between the stir zone and the thermomechanically affected zone;and the internal defect of the weld looks like a long crack and is located in the lower part of the weld. (2) For AA6061-T6, the weld usually possesses slightly rougher surface ripples; an elliptical weld nugget clearly exists in the weld; there are discernible interfaces among the weld nugget, thermomechanically affected zone and heat affected zone; and the internal defect of the weld is similar to that of the AA1050-H24 weld. (3) The effective range of welding parameters for AA1050-H24 is narrow, while the one for AA6061-T6 is very wide. (4) The maximum tensile strength efficiency of the AA1050-H24 joints is similar to that of the AA6061-T6 joints, i.e. 79% and 77%, respectively.

  7. AAS 228: Day 3 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session 2015 Newton Lacy Pierce Prize Lecture: The Elephant in the Room: Effects of Distant, Massive Companions on Planetary System Architectures (by Leonardo dos Santos)The first session on Wednesday at 228th AAS Meeting was the Newton Lacy Pierce Prize Lecture by Heather Knutson (California Institute of Technology). This talk featured a broad range of research efforts on exoplanets, with the main focus on how we study the composition of their atmospheres, and how multi-body interactions carve the structure of the planetary systems we observe.One of her first points is the well-known idea that the Solar System is an oddball, compared to the exoplanet systems we have found so far: most of these systems contain hot Jupiters and mini-Neptunes at very close-in orbits around their host stars. Moreover, even when studying their transmission spectra, it is difficult to know the exact composition of their atmospheres.Knutson: it is difficult to constrain atmospheric composition of exoplanets (H-poor or H-rich+clouds?) #aas228pic.twitter.com/LdyN4o9RC7 astrobites (@astrobites) June 15, 2016The main proposal on how these systems formed is the migration scenario. In order to validate this idea, Dr. Knutson and her group The Friends of Hot Jupiters study systems with close-in gas giants and their frequency of binary companions, which are supposed to be the main culprits causing gas-giant migration. They found that approximately half of the observed systems have long-distance companions, providing strong validation of the migration scenario. Moreover, Dr. Knutson speculates that wide binaries have more

  8. Sensory acceptability evaluation of irradiated rice, oryza sativa indica

    The non-glutinous and glutinous types of polished rice, Oryza sativa indica were subjected to gamma rays at ambient temperature and stored at 27+-10C for one week. The irradiated rice was cooked and tasted by members of trained panel. Using Hedonic scale and Triangle test, the acceptability of irradiated rice was justified. Gamma irradiation up to 100 krads did not significantly cause off-color, off-odor and off flavor in irradiated non-glutino rice. Glutinous rice irradiated at 60 krads could not be significantly differentiated from non-irradiated sample

  9. Gamma radiation effects in Sitophilus oryzae (Linne, 1763) (Coleoptera, Curculionidae)

    Lethal effects were studied for the egg, larval and pupal stages as well as sterilization of adults of Sitophilus oryzae (L.) by the application of gamma radiation. Irradiation of pupae with an estimated dosis of 7887 ± 158 rad inhibits adult emergency. Hypotheses have been suggested that the apparent density and (or) nutrient value of food substrates decisively influence the sterilizing dosis for this insect. Thus, in rice and maize which are apparently denser and (or) of higher nutrient value than maccaroni, insects are sterilized by a dosis of 7 krad, while in maccaroni the sterilizing dosis decreases to 5 krad. (author)

  10. Magnetic horn of the Antiproton Accumulator (AA)

    Photographic Service

    1988-01-01

    In the 1960s, the invention of this "current sheet lens" has helped to greatly improve the flux of neutrino beams. It was used again at the AA, collecting antiprotons from the production target at angles too large to fit into the acceptance of the AA. It was machined from aluminium to a thickness of 1.4 mm and pulsed at 400 kA for 15 microseconds (half-sine).

  11. Evolutionary Genomics of Weedy Rice in the USA

    Kenneth M. Olsen; Ana L. Caicedo; Yulin Jia

    2007-01-01

    Red rice is an interfertile, weedy form of cultivated rice (Oryza sativa L.) that competes aggressively with the crop in the southern US, reducing yields and contaminating harvests. No wild Oryza species occur in North America and the weed has been proposed to have evolved through multiple mechanisms, including "de-domestication" of US crop cultivars, accidental introduction of Asian weeds, and hybridization between US crops and Asian wild/weedy Oryza strains. The phenotype of US red rice ranges from "crop mimics", which share some domestication traits with the crop, to strains closely resembling Asian wild Oryza species. Assessments of genetic diversity have indicated that many weed strains are closely related to Asian taxa (including indica and aus rice varieties, which have never been cultivated in the US, and the Asian crop progenitor O. rufipogon), whereas others show genetic similarity to the tropical japonlca varieties cultivated in the southern US. Herein, we review what is known about the evolutionary origins and genetic diversity of US red rice and describe an ongoing research project to further characterize the evolutionary genomics of this aggressive weed.

  12. Mutation of Oryza sativa CORONATINE INSENSITIVE 1b (OsCOI1b) delays leaf senescence

    Sang-Hwa Lee; Yasuhito Sakuraba; Taeyoung Lee; Kyu-Won Kim; Gynheung An; Han Yong Lee; Nam-Chon Paek

    2015-01-01

    Jasmonic acid (JA) functions in plant development, including senescence and immunity. Arabidopsis thaliana CORONATINE INSENSITIVE 1 encodes a JA receptor and functions in the JA‐responsive signaling pathway. The Arabidopsis genome harbors a single COI gene, but the rice (Oryza sativa) genome harbors three COI homologs, OsCOI1a, OsCOI1b, and OsCOI2. Thus, it remains unclear whether each OsCOI has distinct, additive, synergistic, or redundant func-tions in development. Here, we use the oscoi1b‐1 knockout mutants to show that OsCOI1b mainly affects leaf senescence under senescence‐promoting conditions. oscoi1b‐1 mutants stayed green during dark‐induced and natural senescence, with substantial retention of chlorophylls and photosyn-thetic capacity. Furthermore, several senescence‐associated genes were downregulated in oscoi1b‐1 mutants, including homologs of Arabidopsis thaliana ETHYLENE INSENSITIVE 3 and ORESARA 1, important regulators of leaf senescence. These results suggest that crosstalk between JA signaling and ethylene signaling affects leaf senescence. The Arabidopsis coi1‐1 plants containing 35S:OsCOI1a or 35S:OsCOI1b rescued the delayed leaf senescence during dark incubation, sug-gesting that both OsCOI1a and OsCOI1b are required for promoting leaf senescence in rice. oscoi1b‐1 mutants showed significant decreases in spikelet fertility and grain weight, leading to severe reduction of grain yield, indicating that OsCOI1‐mediated JA signaling affects spikelet fertility and grain filling.

  13. De Novo Transcriptome Sequencing of Oryza officinalis Wall ex Watt to Identify Disease-Resistance Genes

    Bin He

    2015-12-01

    Full Text Available Oryza officinalis Wall ex Watt is one of the most important wild relatives of cultivated rice and exhibits high resistance to many diseases. It has been used as a source of genes for introgression into cultivated rice. However, there are limited genomic resources and little genetic information publicly reported for this species. To better understand the pathways and factors involved in disease resistance and accelerating the process of rice breeding, we carried out a de novo transcriptome sequencing of O. officinalis. In this research, 137,229 contigs were obtained ranging from 200 to 19,214 bp with an N50 of 2331 bp through de novo assembly of leaves, stems and roots in O. officinalis using an Illumina HiSeq 2000 platform. Based on sequence similarity searches against a non-redundant protein database, a total of 88,249 contigs were annotated with gene descriptions and 75,589 transcripts were further assigned to GO terms. Candidate genes for plant–pathogen interaction and plant hormones regulation pathways involved in disease-resistance were identified. Further analyses of gene expression profiles showed that the majority of genes related to disease resistance were all expressed in the three tissues. In addition, there are two kinds of rice bacterial blight-resistant genes in O. officinalis, including two Xa1 genes and three Xa26 genes. All 2 Xa1 genes showed the highest expression level in stem, whereas one of Xa26 was expressed dominantly in leaf and other 2 Xa26 genes displayed low expression level in all three tissues. This transcriptomic database provides an opportunity for identifying the genes involved in disease-resistance and will provide a basis for studying functional genomics of O. officinalis and genetic improvement of cultivated rice in the future.

  14. Effect of supplementation of arachidonic acid (AA) or a combination of AA plus docosahexaenoic acid on breastmilk fatty acid composition

    Smit, EN; Koopmann, M; Boersma, ER; Muskiet, FAJ

    2000-01-01

    We investigated whether supplementation with arachidonic acid (20:4 omega 6; AA), ora combination of AA and docosahexaenoic acid (22:6 omega 3; DHA) would affect human milk polyunsaturated fatty acid (PUFA) composition. Ten women were daily supplemented with 300 mg AA, eight with 300 mg AA, 110 mg e

  15. Evidence for biotrophic lifestyle and biocontrol potential of dark septate endophyte Harpophora oryzae to rice blast disease.

    Zhen-Zhu Su

    Full Text Available The mutualism pattern of the dark septate endophyte (DSE Harpophora oryzae in rice roots and its biocontrol potential in rice blast disease caused by Magnaporthe oryzae were investigated. Fluorescent protein-expressing H. oryzae was used to monitor the colonization pattern. Hyphae invaded from the epidermis to the inner cortex, but not into the root stele. Fungal colonization increased with root tissue maturation, showing no colonization in the meristematic zone, slight colonization in the elongation zone, and heavy colonization in the differentiation zone. H. oryzae adopted a biotrophic lifestyle in roots accompanied by programmed cell death. Real-time PCR facilitated the accurate quantification of fungal growth and the respective plant response. The biocontrol potential of H. oryzae was visualized by inoculation with eGFP-tagged M. oryzae in rice. H. oryzae protected rice from M. oryzae root invasion by the accumulation of H2O2 and elevated antioxidative capacity. H. oryzae also induced systemic resistance against rice blast. This systemic resistance was mediated by the OsWRKY45-dependent salicylic acid (SA signaling pathway, as indicated by the strongly upregulated expression of OsWRKY45. The colonization pattern of H. oryzae was consistent with the typical characteristics of DSEs. H. oryzae enhanced local resistance by reactive oxygen species (ROS and high antioxidative level and induced OsWRKY45-dependent SA-mediated systemic resistance against rice blast.

  16. Identification and gene prediction of a 24 kb region containing xa5, a recessive bacterial blight resistance gene in rice (Oryza sativa L.)

    ZHONG Yiming; JIANG Guanghuai; CHEN Xuewei; XIA Zhihui; LI Xiaobing; ZHU Lihuang; ZHAI Wenxue

    2003-01-01

    Rice xa5 gene provides recessive, race-specific resistance to bacterial blight disease caused by the pathogen Xanthomonas oryzae pv. oryzae and has great value for research and breeding. In an effort to clone xa5, an F2 population of 4892 individuals was developed from the xa5 near isogenic lines, IR24 and IRBB5. A fine mapping procedure was conducted and tightly linked RFLP markers were used to screen a BAC library of IRBB56, a resistant rice line containing the xa5 gene. A 213 kb contig covering the xa5 locus was constructed. According to the sequences from the International Rice Genome Sequening Project (IRGSP), the Chinese Superhybrid Rice Genome Project (SRGP) and some sub-clones of the contig, twelve SSLP and CAPS markers were developed for fine mapping. The xa5 gene was mapped to a 0.3 cM interval between markers K5 and T4, which spanned an interval of approximately 24 kb, co-segregating with marker T2. Sequence analysis of the 24 kb region revealed that an ABC transporter and a basal transcription factor (TFIIa) were potential candidates for the xa5 resistance gene product. The molecular mechanism by which the xa5 gene provides recessive, race-specific resistance to bacterial blight will be elucidated by the functional tests of the 24 kb DNA and the candidate genes.

  17. Identification of Intergeneric Hybrid Plants Between Oryza sativa and O. minuta via GISH and RAPD

    YU Shun-wu; CHEN Bao-tang; TAO Ai-lin; ZHANG Duan-pin

    2003-01-01

    To transfer desirable resistance traits from O. minuta to O. sativa, intergeneric hybrid plants between O. sativa (AA, 2n=2X=24) and O. minuta (BBCC, 2n=4X=48) were produced by embryo rescue after sexual cross. Morphological observation and chromosome counts indicated their hybrid status (ABC, 2n =3X=36). Genomic in situ hybridization (GISH) was further applied to confirm the parentage of the chromosomes of F1 hybrids. Chromosomes of O. minuta and O. sativa were distinguishable in the hybrids in different fluorescence colors. GISH indicated that A and BC chromosomes were not randomly assembled in a cell.RAPD profiles unequivocally revealed their hybrids with double parent patterns. The results of blast tests showed that the hybrids had obtained disease resistance from O. minuta, and had a level of susceptibility between the parents.

  18. AAS 228: Day 1 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session: From Space Archeology to Serving the World Today: A 20-year Journey from the Jungles of Guatemala to a Network of Satellite Remote Sensing Facilities Around the World(by Michael Zevin)In the conferences second plenary session, NASAs Daniel Irwin turned the eyes of the conference back to Earth by highlighting the huge impact that NASA missions play in protecting and developing our own planet.Daniel Irwin: using satellite imagery to detect differences in vegetation and find ancient Mayan cities. #aas228 pic.twitter.com/9LFPQdCHTM astrobites (@astrobites) June 13, 2016Irwin came to be involved in NASA through his work mapping Guatemalan jungles, where he would spend 22 days at a time exploring the treacherous jungles on foot armed with a 1st generation GPS, a compass, and a machete. A colleague introduced Irwin to the satellite imagery thathe was exploring, demonstratinghow these images are a strong complement to field work. The sharing of this satellite data with nearby villages helped to show the encroachment of agriculture and the necessity of connecting space to the village. Satellite imagery also played a role in archeological endeavors, uncovering dozens of Mayan cities that have been buried for over a millennia by vegetation, and it provided evidence that the fall of the Mayan civilization may have been due to massive deforestation that ledto drought.Glacial retreat in Chile imaged by ISERV.Irwin displayed the constellation of NASAs Earth-monitoring satellites that have played an integral role in conserving our planet and alerting the world of natural disasters. He also showed

  19. Toward understanding of rice innate immunity against Magnaporthe oryzae.

    Azizi, P; Rafii, M Y; Abdullah, S N A; Nejat, N; Maziah, M; Hanafi, M M; Latif, M A; Sahebi, M

    2016-01-01

    The blast fungus, Magnaporthe oryzae, causes serious disease on a wide variety of grasses including rice, wheat and barley. The recognition of pathogens is an amazing ability of plants including strategies for displacing virulence effectors through the adaption of both conserved and variable pathogen elicitors. The pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and effector-triggered immunity (ETI) were reported as two main innate immune responses in plants, where PTI gives basal resistance and ETI confers durable resistance. The PTI consists of extracellular surface receptors that are able to recognize PAMPs. PAMPs detect microbial features such as fungal chitin that complete a vital function during the organism's life. In contrast, ETI is mediated by intracellular receptor molecules containing nucleotide-binding (NB) and leucine rich repeat (LRR) domains that specifically recognize effector proteins produced by the pathogen. To enhance crop resistance, understanding the host resistance mechanisms against pathogen infection strategies and having a deeper knowledge of innate immunity system are essential. This review summarizes the recent advances on the molecular mechanism of innate immunity systems of rice against M. oryzae. The discussion will be centered on the latest success reported in plant-pathogen interactions and integrated defense responses in rice. PMID:25198435

  20. Some studies of alpha-amylase production using Aspergillus oryzae.

    Esfahanibolandbalaie, Z; Rostami, K; Mirdamadi, S S

    2008-11-15

    The extracellular alpha-amylase production by Aspergillus oryzae was studied in submerged fermentation using an Adlof-Kuhner orbital shaker. The effect of initial pH values in the range of 4 to 7.5 on enzyme production was investigated and initial pH medium of 6.2 +/- 0.1 resulted in enhanced alpha-amylase production. The effect of carbon and nitrogen source and composition was examined and it has been observed that corn starch concentration of 15 g L(-1) has sound effect on enzyme production. The medium containing corn starch, sodium nitrate resulted in considerable higher enzyme production. Further, the yeast extract of 2.5 g L(-1) in the medium produced higher enzyme in view to other organic nitrogen sources. The effect of temperature on alpha-amylase production from 20 to 40 degrees C has been studied and at 35 +/- 1 degrees C higher alpha-amylase has been obtained. The effect of shaker's speed on alpha-amylase production from 50 to 200 rpm was investigated. And at about 180 rpm higher enzyme production has been observed. In the present study, it has been found that glucose has repressing effect on a-amylase production using A. oryzae PTCC5164. PMID:19260332

  1. Bioremediation of dyes in textile effluents by Aspergillus oryzae.

    Corso, Carlos Renato; Maganha de Almeida, Ana Carolina

    2009-02-01

    In this study Aspergillus oryzae was utilized to remove azo dyes from aqueous solution. Physically induced in its paramorphogenic form to produce standardized mycelial pellets, the non-autoclaved and autoclaved hyphae biomass was applied to biosorb the reactive dyes Procion Red HE7B (PR-HE7B) and Procion Violet H3R (PV-H3R) at different pH values (2.50, 4.50, and 6.50). The best pH for biosorption was 2.50, though the autoclaved demonstrated a higher biosorption capacity than the non-autoclaved pellets. The toxicity level was determined using the Trimmed Spearman-Karber method with Daphnia similis in all bioassays. The calculated toxicity of PV-H3R (LC100 62.50 microg mL(-1)) was higher than to PR-HE7B (LC100 300.00 microg mL(-1)), and its results brought out that the decrease of toxicity levels to zero might be accomplished by adding small quantities of pelletized A. oryzae to the solutions. PMID:18989608

  2. WRKY transcription factor genes in wild rice Oryza nivara.

    Xu, Hengjian; Watanabe, Kenneth A; Zhang, Liyuan; Shen, Qingxi J

    2016-08-01

    The WRKY transcription factor family is one of the largest gene families involved in plant development and stress response. Although many WRKY genes have been studied in cultivated rice (Oryza sativa), the WRKY genes in the wild rice species Oryza nivara, the direct progenitor of O. sativa, have not been studied. O. nivara shows abundant genetic diversity and elite drought and disease resistance features. Herein, a total of 97 O. nivara WRKY (OnWRKY) genes were identified. RNA-sequencing demonstrates that OnWRKY genes were generally expressed at higher levels in the roots of 30-day-old plants. Bioinformatic analyses suggest that most of OnWRKY genes could be induced by salicylic acid, abscisic acid, and drought. Abundant potential MAPK phosphorylation sites in OnWRKYs suggest that activities of most OnWRKYs can be regulated by phosphorylation. Phylogenetic analyses of OnWRKYs support a novel hypothesis that ancient group IIc OnWRKYs were the original ancestors of only some group IIc and group III WRKYs. The analyses also offer strong support that group IIc OnWRKYs containing the HVE sequence in their zinc finger motifs were derived from group Ia WRKYs. This study provides a solid foundation for the study of the evolution and functions of WRKY genes in O. nivara. PMID:27345721

  3. Genome-wide association study of age at menarche in African-American women

    Demerath, Ellen W; Liu, Ching-Ti; Franceschini, Nora; Chen, Gary; Palmer, Julie R.; Smith, Erin N.; Chen, Christina T. L.; Ambrosone, Christine B.; Arnold, Alice M.; Bandera, Elisa V.; Berenson, Gerald S.; Bernstein, Leslie; Britton, Angela; Cappola, Anne R.; Carlson, Christopher S.

    2013-01-01

    African-American (AA) women have earlier menarche on average than women of European ancestry (EA), and earlier menarche is a risk factor for obesity and type 2 diabetes among other chronic diseases. Identification of common genetic variants associated with age at menarche has a potential value in pointing to the genetic pathways underlying chronic disease risk, yet comprehensive genome-wide studies of age at menarche are lacking for AA women. In this study, we tested the genome-wide associati...

  4. Comparative analysis of three Magnaporthaceae mitochondrial genomes reveals group I introns in the soil-inhabiting pathogens

    A comparison of the mitochrondrial genomes of two soilborne grass pathogens, M. poae of turfgrass and Gaemannomyces graminis var. triciti (Ggt) of wheat, was made to the foliar rice blast pathogen, Magnaporthe oryzae. We sought to extend observations from nuclear-coded genes that the soilborne patho...

  5. Ricebase: a breeding and genetics platform for rice, integrating individual molecular markers, pedigrees, and whole-genome-based data

    Ricebase (http://ricebase.org) is an integrative genomic database for rice (Oryza sativa) with an emphasis on combining data sets in a way that maintains the key links between past and current genetic studies. Ricebase includes DNA sequence data, gene annotations, nucleotide variation data, and mol...

  6. Chemical rationale for selection of isolates for genome sequencing

    Rank, Christian; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian

    The advances in gene sequencing will in the near future enable researchers to affordably acquire the full genomes of handpicked isolates. We here present a method to evaluate the chemical potential of an entire species and select representatives for genome sequencing. The selection criteria for new...... strains to be sequenced can be manifold, but for studying the functional phenotype, using a metabolome based approach offers a cheap and rapid assessment of critical strains to cover the chemical diversity. We have applied this methodology on the complex A. flavus/A. oryzae group. Though these two species...

  7. Non-host resistance to penetration and hyphal growth of Magnaporthe oryzae in Arabidopsis

    Misato Nakao; Ryotaro Nakamura; Kaori Kita; Ryuya Inukai; Atsushi Ishikawa

    2011-01-01

    Rice blast caused by Magnaporthe oryzae is a devastating disease of rice. Mechanisms of rice resistance to blast have been studied extensively, and the rice–M. oryzae pathosystem has become a model for plant–microbe interaction studies. However, the mechanisms of non-host resistance (NHR) to rice blast in other plants remain poorly understood. We found that penetration resistance to M. oryzae in multiple mutants, including pen2 NahG pmr5 agb1 and pen2 NahG pmr5 mlo2 plants, was severely compr...

  8. Synthesis, characterization, and antibacterial activity of chitosan/TiO2 nanocomposite against Xanthomonas oryzae pv. oryzae.

    Li, Bin; Zhang, Yang; Yang, Yingzi; Qiu, Wen; Wang, Xiaoxuan; Liu, Baoping; Wang, Yanli; Sun, Guochang

    2016-11-01

    This present study deals with synthesis, characterization and antibacterial activity of chitosan/TiO2 nanocomposites. Results indicated that chitosan/TiO2 nanocomposite at the ratio of 1:5 showed the strongest inhibition in growth of rice bacterial pathogen Xanthomonas oryzae pv. oryzae (Xoo). Furthermore, the antibacterial activity of chitosan/TiO2 nanocomposite against Xoo is significantly higher than that of the two individual components under both light and dark conditions. Regardless of the presence or absence of extracellular polymeric substances, chitosan/TiO2 nanocomposite showed strong antibacterial activity, however, the absence increased the sensitivity of Xoo to chitosan/TiO2 nanocomposite. In addition, the surface morphology and physicochemical properties of chitosan/TiO2 nanocomposite is different from the two individual components based on scanning electron microscopic observation, fourier transform infrared spectra, and X-ray diffraction pattern, as well as elemental and thermo gravimetric analysis. Overall, this study indicated that this synthesized chitosan/TiO2 nanocomposite is promising to be developed as a new antibacterial material. PMID:27516334

  9. The Fd-GOGAT1 mutant gene lc7 confers resistance to Xanthomonas oryzae pv. Oryzae in rice.

    Chen, Honglin; Li, Chunrong; Liu, Liping; Zhao, Jiying; Cheng, Xuzhen; Jiang, Guanghuai; Zhai, Wenxue

    2016-01-01

    Disease resistance is an important goal of crop improvement. The molecular mechanism of resistance requires further study. Here, we report the identification of a rice leaf color mutant, lc7, which is defective in chlorophyll synthesis and photosynthesis but confers resistance to Xanthomonas oryzae pv. Oryzae (Xoo). Map-based cloning revealed that lc7 encodes a mutant ferredoxin-dependent glutamate synthase1 (Fd-GOGAT1). Fd-GOGAT1 has been proposed to have great potential for improving nitrogen-use efficiency, but its function in bacterial resistance has not been reported. The lc7 mutant accumulates excessive levels of ROS (reactive oxygen species) in the leaves, causing the leaf color to become yellow after the four-leaf stage. Compared to the wild type, lc7 mutants have a broad-spectrum high resistance to seven Xoo strains. Differentially expressed genes (DEGs) and qRT-PCR analysis indicate that many defense pathways that are involved in this broad-spectrum resistance are activated in the lc7 mutant. These results suggest that Fd-GOGAT1 plays an important role in broad-spectrum bacterial blight resistance, in addition to modulating nitrogen assimilation and chloroplast development. PMID:27211925

  10. The AA disappearing under concrete shielding

    1982-01-01

    When the AA started up in July 1980, the machine stood freely in its hall, providing visitors with a view through the large window in the AA Control Room. The target area, in which the high-intensity 26 GeV/c proton beam from the PS hit the production target, was heavily shielded, not only towards the outside but also towards the AA-Hall. However, electrons and pions emanating from the target with the same momentum as the antiprotons, but much more numerous, accompanied these through the injection line into the AA ring. The pions decayed with a half-time corresponding to approximately a revolution period (540 ns), whereas the electrons lost energy through synchrotron radiation and ended up on the vacuum chamber wall. Electrons and pions produced the dominant component of the radiation level in the hall and the control room. With operation times far exceeding original expectations, the AA had to be buried under concrete shielding in order to reduce the radiation level by an order of magnitude.

  11. MDCT evaluation of acute aortic syndrome (AAS).

    Valente, Tullio; Rossi, Giovanni; Lassandro, Francesco; Rea, Gaetano; Marino, Maurizio; Muto, Maurizio; Molino, Antonio; Scaglione, Mariano

    2016-05-01

    Non-traumatic acute thoracic aortic syndromes (AAS) describe a spectrum of life-threatening aortic pathologies with significant implications on diagnosis, therapy and management. There is a common pathway for the various manifestations of AAS that eventually leads to a breakdown of the aortic intima and media. Improvements in biology and health policy and diffusion of technology into the community resulted in an associated decrease in mortality and morbidity related to aortic therapeutic interventions. Hybrid procedures, branched and fenestrated endografts, and percutaneous aortic valves have emerged as potent and viable alternatives to traditional surgeries. In this context, current state-of-the art multidetector CT (MDCT) is actually the gold standard in the emergency setting because of its intrinsic diagnostic value. Management of acute aortic disease has changed with the increasing realization that endovascular therapies may offer distinct advantages in these situations. This article provides a summary of AAS, focusing especially on the MDCT technique, typical and atypical findings and common pitfalls of AAS, as well as recent concepts regarding the subtypes of AAS, consisting of aortic dissection, intramural haematoma, penetrating atherosclerotic ulcer and unstable aortic aneurysm or contained aortic rupture. MDCT findings will be related to pathophysiology, timing and management options to achieve a definite and timely diagnostic and therapeutic definition. In the present article, we review the aetiology, pathophysiology, clinical presentation, outcomes and therapeutic approaches to acute aortic syndromes. PMID:27033344

  12. Dicty_cDB: FCL-AA03 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA03 (Link to dictyBase) - - - Contig-U15092-1 FCL-AA03E ...(Link to Original site) - - - - - - FCL-AA03E 627 Show FCL-AA03 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA03Q.Seq.d/ Representative seq. ID FCL-AA...03E (Link to Original site) Representative DNA sequence >FCL-AA03 (FCL-AA03Q) /CSM/FCL/FCL-AA/FCL-AA...03Q.Seq.d/ ACATAATGTTCCAAAAGAAAGCAATTGTTATTGATGGCAAAGGTCATTTGTTAGGTCGTT TAGCCTCCGTTGTTGCTAAATCCCTCCTCTCTGGTCAAAA

  13. Dicty_cDB: FCL-AA02 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA02 (Link to dictyBase) - - - Contig-U16560-1 FCL-AA02F ...(Link to Original site) FCL-AA02F 620 - - - - - - Show FCL-AA02 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ Representative seq. ID FCL-AA...02F (Link to Original site) Representative DNA sequence >FCL-AA02 (FCL-AA02Q) /CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ ATTAA...ATACAAAATACAAATACAAATAACAAATACTTTACTATAGCTTTTTTTTCTTATT TATTTCTCCAAATAATTTTTTAATATGCAAATCTTTGTTAAAA

  14. Dicty_cDB: FCL-AA09 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA09 (Link to dictyBase) - - - Contig-U16453-1 FCL-AA09F ...(Link to Original site) FCL-AA09F 485 - - - - - - Show FCL-AA09 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ Representative seq. ID FCL-AA...09F (Link to Original site) Representative DNA sequence >FCL-AA09 (FCL-AA09Q) /CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ GACAA...AAGTAAATAAAACATGTCCGCAAGTAATAAAGATGACCAACTCATGAAAAATGAG TTCGAAAGTACCTACGACAAAATTGTCGATTCATTCGACAA

  15. Dicty_cDB: FCL-AA08 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA08 (Link to dictyBase) - - - Contig-U16200-1 FCL-AA08Z ...(Link to Original site) - - FCL-AA08Z 574 - - - - Show FCL-AA08 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA08Q.Seq.d/ Representative seq. ID FCL-AA...08Z (Link to Original site) Representative DNA sequence >FCL-AA08 (FCL-AA08Q) /CSM/FCL/FCL-AA/FCL-AA...08Q.Seq.d/ XXXXXXXXXXTCGAAGCCAAAGGTCGTCTCGAAGAAGAATTCCATCGCTCGTACCAACTC TGATCGTTCAAGAAAGAGACTCGAAGCTGAAA

  16. Dicty_cDB: FC-AA09 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA09 (Link to dictyBase) - - - Contig-U15086-1 FC-AA09E (Li...nk to Original site) - - - - - - FC-AA09E 562 Show FC-AA09 Library FC (Link to library) Clone ID FC-AA09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA09Q.Seq.d/ Representative seq. ID FC-AA...09E (Link to Original site) Representative DNA sequence >FC-AA09 (FC-AA09Q) /CSM/FC/FC-AA/FC-AA09Q.Seq....d/ GATACATTATCACCATGGCAGGAAAAAAAGTCAAATCTAACACACCAAAACAAGACTTAT CTGTCTCTAAATCAAAGCTCACCAGCATTAAAGCCCCAGCTGCTGCCATCAAAGCTAAA

  17. Dicty_cDB: FC-AA14 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA14 (Link to dictyBase) - - - Contig-U15088-1 FC-AA14E (Li...nk to Original site) - - - - - - FC-AA14E 431 Show FC-AA14 Library FC (Link to library) Clone ID FC-AA14 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA14Q.Seq.d/ Representative seq. ID FC-AA...14E (Link to Original site) Representative DNA sequence >FC-AA14 (FC-AA14Q) /CSM/FC/FC-AA/FC-AA14Q.Seq.d/ CTATGTCTGAAATCAAAA...CTGAAGAACTCGCTTGCATCTACTCCGGTCTTTTATTACAAG ATGACGGTATTGAAATCACCGCTGATAAAATCAAAACCTTATTAGAAGCTGCCAA

  18. Dicty_cDB: FCL-AA04 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA04 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA04Z ...(Link to Original site) - - FCL-AA04Z 530 - - - - Show FCL-AA04 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA04Q.Seq.d/ Representative seq. ID FCL-AA...04Z (Link to Original site) Representative DNA sequence >FCL-AA04 (FCL-AA04Q) /CSM/FCL/FCL-AA/FCL-AA...04Q.Seq.d/ XXXXXXXXXXCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTTCAGTCAAAGAAATT AAAAGAGGTATGGTCGCTGGTGACTCCAAAAACGATCCACCACAAGAAA

  19. Dicty_cDB: FC-AA20 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA20 (Link to dictyBase) - - - Contig-U16455-1 FC-AA20Z (Li...nk to Original site) - - FC-AA20Z 607 - - - - Show FC-AA20 Library FC (Link to library) Clone ID FC-AA20 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA20Q.Seq.d/ Representative seq. ID FC-AA...20Z (Link to Original site) Representative DNA sequence >FC-AA20 (FC-AA20Q) /CSM/FC/FC-AA/FC-AA20Q.Seq....d/ XXXXXXXXXXCTTTGCCCCAGCTGGTCTCTCAACTGAAGTCAAATCAGTCGAAATGCATC ACGAACAACTCCCAGAAGCCCGTCCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTT CAGTCAA

  20. Dicty_cDB: FCL-AA15 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA15 (Link to dictyBase) - - - Contig-U16011-1 FCL-AA15Z ...(Link to Original site) - - FCL-AA15Z 442 - - - - Show FCL-AA15 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA15Q.Seq.d/ Representative seq. ID FCL-AA...15Z (Link to Original site) Representative DNA sequence >FCL-AA15 (FCL-AA15Q) /CSM/FCL/FCL-AA/FCL-AA...15Q.Seq.d/ XXXXXXXXXXCCATTCATCTGTCCAATCGATTGTCGTCGTGGTCTCTACAAGAATATCGT CTTATCTGGTGGTTCAACCATGTTTAAAGATTTTGGTAAACGTCTTCAA

  1. Dicty_cDB: FC-AA13 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA13 (Link to dictyBase) - - - Contig-U15674-1 FC-AA13Z (Li...nk to Original site) - - FC-AA13Z 528 - - - - Show FC-AA13 Library FC (Link to library) Clone ID FC-AA13 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA13Q.Seq.d/ Representative seq. ID FC-AA...13Z (Link to Original site) Representative DNA sequence >FC-AA13 (FC-AA13Q) /CSM/FC/FC-AA/FC-AA13Q.Seq.d/ XXXXXXXXXXAAAGCAAA...CTCGTGCTGGTCAACGTACCCGTTTCAAGGCTTTCGTCGTTG TTGGTGATCACAACGGTCATGTAGGTCTCGGTGTTAAATGCGCTAAGGAA

  2. Dicty_cDB: FCL-AA20 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA20 (Link to dictyBase) - - - Contig-U15052-1 FCL-AA20E ...(Link to Original site) - - - - - - FCL-AA20E 1159 Show FCL-AA20 Library FCL (Link to library) Clone ID FCL-AA...L http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ Representative seq. ID FCL-AA...20E (Link to Original site) Representative DNA sequence >FCL-AA20 (FCL-AA20Q) /CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ AAAA...CATTTACAAATGATGACCACAGAAGATGTACAACCAATTGAAACTACCAAAGATGG TGTAGTAGTATTAAATTATAGCGATTTAATTGCAGGTAAA

  3. Dicty_cDB: FC-AA23 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA23 (Link to dictyBase) - - - Contig-U16090-1 FC-AA23E (Li...nk to Original site) - - - - - - FC-AA23E 387 Show FC-AA23 Library FC (Link to library) Clone ID FC-AA23 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA23Q.Seq.d/ Representative seq. ID FC-AA...23E (Link to Original site) Representative DNA sequence >FC-AA23 (FC-AA23Q) /CSM/FC/FC-AA/FC-AA23Q.Seq.d/ AAACTCGATTATATTCTTAA...TCTTAAAGTTCAAGATTTCATGGAAAGACGTCTCCAAACT TTAGTCTTCAAAAATGGTCTTGCCAAATCAATCCATCACGCTCGTGTTTTAATCAAA

  4. Dicty_cDB: FC-AA12 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA12 (Link to dictyBase) - - - Contig-U15087-1 FC-AA12E (Li...nk to Original site) - - - - - - FC-AA12E 454 Show FC-AA12 Library FC (Link to library) Clone ID FC-AA12 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA12Q.Seq.d/ Representative seq. ID FC-AA...12E (Link to Original site) Representative DNA sequence >FC-AA12 (FC-AA12Q) /CSM/FC/FC-AA/FC-AA12Q.Seq.d/ AAATAATAATAATATAAAAA...TGGAAATTAAAGTTTTAGCTAAAAGAAAAGTATCAGCAAA ACGTGCAAATGAAATATTAGGAAAATTTATTTTAGAAAGAAAAGCAAATGAAGAAAA

  5. Dicty_cDB: FC-AA01 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA01 (Link to dictyBase) - - - Contig-U15084-1 FC-AA01E (Li...nk to Original site) - - - - - - FC-AA01E 701 Show FC-AA01 Library FC (Link to library) Clone ID FC-AA01 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA01Q.Seq.d/ Representative seq. ID FC-AA...01E (Link to Original site) Representative DNA sequence >FC-AA01 (FC-AA01Q) /CSM/FC/FC-AA/FC-AA01Q.Seq.d/ GAGAAATATTTCTTATTAA...CAATTGCATGCGTTGTATTCAACCCAACATGGTGGAATATT ACAGCAAGAATGGAATATAATGCTAATAAATAACAACCATTTTCTTTACTTCCACAAA

  6. Dicty_cDB: FCL-AA10 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA10 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA10Z ...(Link to Original site) - - FCL-AA10Z 627 - - - - Show FCL-AA10 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA10Q.Seq.d/ Representative seq. ID FCL-AA...10Z (Link to Original site) Representative DNA sequence >FCL-AA10 (FCL-AA10Q) /CSM/FCL/FCL-AA/FCL-AA...10Q.Seq.d/ XXXXXXXXXXTAAACCAGGTATGGTCGTCACCTTTTGCCCCAGCTGGTCTCTCAACTGAA GTCAAATCAGTCGAAATGCATCACGAACAACTCCCAGAA

  7. Dicty_cDB: FC-AA19 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA19 (Link to dictyBase) - - - Contig-U16072-1 FC-AA19F (Li...nk to Original site) FC-AA19F 539 - - - - - - Show FC-AA19 Library FC (Link to library) Clone ID FC-AA19 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA19Q.Seq.d/ Representative seq. ID FC-AA...19F (Link to Original site) Representative DNA sequence >FC-AA19 (FC-AA19Q) /CSM/FC/FC-AA/FC-AA19Q.Seq.d/ CAGAAA...TCACTGGTTTTTCATTCCAATTATTTAATATTATCAGTATTTGGAATGTTGATC AAACATCATTCAATAGCTACAGTCTTCCAATTTGGTTACCAGCCATTCAA

  8. Dicty_cDB: FC-AA02 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA02Q.Seq.d/ Representative seq. ID FC-AA...02Z (Link to Original site) Representative DNA sequence >FC-AA02 (FC-AA02Q) /CSM/FC/FC-AA/FC-AA02Q.Seq.d/ XXXXXXXXXXCAAAAA...GGCTCCTGGTCCGGAAGGATTGGGTAATCATTTGAATTTCCTAC GTAACTGGGCTTGATCTTTGTAATTATTGATCATAAACGAGGAATTCCTTGTAAGCGTAA

  9. Dicty_cDB: FCL-AA24 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA24 (Link to dictyBase) - - - Contig-U16467-1 FCL-AA24E ...(Link to Original site) - - - - - - FCL-AA24E 779 Show FCL-AA24 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA24Q.Seq.d/ Representative seq. ID FCL-AA...24E (Link to Original site) Representative DNA sequence >FCL-AA24 (FCL-AA24Q) /CSM/FCL/FCL-AA/FCL-AA...24Q.Seq.d/ CTAGAAATTTCTAAACAATTATTTATTTGAAGAGGTTTTTTAAAAAAAGAAAAAAATCAG AGCATCCAAATAATAACCGCAGTAAGGGGGGGATGGTTGTTAA

  10. Dicty_cDB: FCL-AA05 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA05 (Link to dictyBase) - - - Contig-U16473-1 FCL-AA05Z ...(Link to Original site) - - FCL-AA05Z 603 - - - - Show FCL-AA05 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA05Q.Seq.d/ Representative seq. ID FCL-AA...05Z (Link to Original site) Representative DNA sequence >FCL-AA05 (FCL-AA05Q) /CSM/FCL/FCL-AA/FCL-AA...05Q.Seq.d/ XXXXXXXXXXTGGCGCCATCATTACTGGTGGAGGTGGTGTTGCTATCACTCAAGCTCAAC CATCATACCAAGCTGATGCCGTTGCCACTTACATCAAAA

  11. AAS 228: Day 2 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  12. AAS 228: Day 2 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  13. AAS 228: Day 2 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  14. AAS 228: Day 2 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  15. Cultivation characteristics of immobilized Aspergillus oryzae for kojic acid production.

    Kwak, M Y; Rhee, J S

    1992-04-15

    Aspergillus oryzae in situ grown from spores entrapped in calcium alginate gel beads was used for the production of kojic acid. The immobilized cells in flask cultures produced kojic acid in a linear proportion while maintaining the stable metabolic activity for a prolonged production period. Kojic acid was accumulated up to a high concentration of 83 g/L, at which the kojic acid began to crystallize, and, thus, the culture had to be replaced with fresh media for the next batch culture. The overall productivities of two consecutive cultivations were higher than that of free mycelial fermentation. However, the production rate of kojic acid by the immobilized cells was suddenly decreased with the appearance of central cavernae inside the immobilized gel beads after 12 days of the third batch cultivation. PMID:18601027

  16. Monoolein production by triglycerides hydrolysis using immobilized Rhizopus oryzae lipase.

    Ghattas, Nesrine; Abidi, Ferid; Galai, Said; Marzouki, M Nejib; Salah, Abderraouf Ben

    2014-07-01

    Lipase extracted from Rhizopus oryzae was immobilized in alginate gel beads. The effects of the immobilization conditions, such as, alginate concentration, CaCl2 concentration and amount of initial enzyme on retained activity (specific activity ratio of entrapped active lipase to free lipase) were investigated. The optimal conditions for lipase entrapment were determined: 2% (w/v) alginate concentration, 100mM CaCl2 and enzyme ratio of 2000IU/mL.In such conditions, immobilized lipase by inclusion in alginate showed a highest stability and activity, on olive oil hydrolysis reaction where it could be reused for 10 cycles. After 15min of hydrolysis reaction, the mass composition of monoolein, diolein and triolein were about 78%, 10% and 12%. Hydrolysis' products purification by column chromatography lead to a successful separation of reaction compounds and provide a pure fraction of monoolein which is considered as the widest used emulsifier in food and pharmaceutical industries. PMID:24755261

  17. EFICIÊNCIA DE FUNGICIDAS NO CONTROLE DE MANCHA PARDA (Bipolaris oryzae EM ARROZ (Oryza sativa EFFICIENCY OF FUNGICIDES IN THE CONTROL OF RICE (Oryza sativa BROWN SPOT (Bipolaris oryzae

    Eric Guicherit

    2007-09-01

    Full Text Available

    Em situações nas quais a brusone tem pouca importância na sanidade da lavoura de arroz, o controle da mancha parda (Bipolaris Oryzõe pode mostrar-se altamente eficiente com pulverizações de fungicidas no campo. Assim, realizou-se um experimento em Indiara (GO com o objetivo de comparar a eficácia de diferentes produtos fungicidas no controle da mancha parda em condições pouco favoráveis à brusone. Foram comparados difenoconazole, propiconazole e tryfloxystrobin em diferentes combinações e dosagens, e os resultados mostraram que, em situações nas quais a brusone tem pouca importância na sanidade da lavoura do arroz, o controle da mancha parda pode mostrar-se altamente eficiente com pulverizações de fungicidas no campo.

    PALAVRAS-CHAVE: Helminthosporium oryzae; controle químico; patógeno; doença.

    In situations where the blight (Pyricularia grisea is not limiting the rice crop, the brown spot (Bipolaris oryzae control can be extremely efficient with field sprayings. This experiment was conduced in Indiara (GO aiming to compare the efficiency of different fungicides in one or two dosages in the control of brown spot under low blight conditions. All treatments showed efficiency in the control of brown spot, with no signifficant difference among them.

    KEY-WORDS: Chemical control; pathogens; disease.

  18. Growth in rice cells requires de novo purine biosynthesis by the blast fungus Magnaporthe oryzae

    Jessie Fernandez; Kuan Ting Yang; Kathryn M. Cornwell; Wright, Janet D.; Richard A. Wilson

    2013-01-01

    Increasing incidences of human disease, crop destruction and ecosystem perturbations are attributable to fungi and threaten socioeconomic progress and food security on a global scale. The blast fungus Magnaporthe oryzae is the most devastating pathogen of cultivated rice, but its metabolic requirements in the host are unclear. Here we report that a purine-requiring mutant of M. oryzae could develop functional appressoria, penetrate host cells and undergo the morphogenetic transition to elabor...

  19. Crucial Roles of Abscisic Acid Biogenesis in Virulence of Rice Blast Fungus Magnaporthe oryzae

    Spence, Carla A.; Lakshmanan, Venkatachalam; Donofrio, Nicole; Bais, Harsh P.

    2015-01-01

    Rice suffers dramatic yield losses due to blast pathogen Magnaporthe oryzae. Pseudomonas chlororaphis EA105, a bacterium that was isolated from the rice rhizosphere, inhibits M. oryzae. It was shown previously that pre-treatment of rice with EA105 reduced the size of blast lesions through jasmonic acid (JA)- and ethylene (ETH)-mediated ISR. Abscisic acid (ABA) acts antagonistically toward salicylic acid (SA), JA, and ETH signaling, to impede plant defense responses. EA105 may be reducing the ...

  20. Uji Efektivitas Beberapa Rimpang Zingiberceae Terhadap Kumbang Beras (Sitophylus oryzae L.) Di laboratorium

    Parinduri, Muhammad Asmui

    2011-01-01

    Muhammad Asmui Parinduri, Effectiveness Test Against Multiple Zingiberceae Rhizome Weevil Rice (Sitophylus oryzae L.) in the laboratory. This research aims to determine the effectiveness of some zingiberaceae rhizome against Sitophylus oryzae L. on rice in the laboratory. This research was conducted in the laboratory of Plant Pests and Diseases Faculty of Agriculture, University of North Sumatra with elevation of ± 32 m above sea level. This research was conducted from March 2010 to M...

  1. Feeding of Aspergillus oryzae fermentation culture (AOFC) to growing sheep: 2. Growth rate and feed efficiency

    2002-01-01

    Utilization of yeast and or filamentous fungi as feed additive to ruminants has been of interest since the late 1980’s. Two fungi species have been commercially produced in the United States, (1) Yea-Sacc containing living cells of Saccharomyces cerevisiae and (2) Amaferm bearing Aspergillus oryzae fermentation extract. It has been demonstrated and proven that the cultures can enhance rumen development and function in young ruminants. This paper concerns the use of Aspergillus oryzae fermen...

  2. Current Commercial Perspective of Rhizopus oryzae: A Review

    Rina Rani Ray; Barnita Ghosh

    2011-01-01

    The present study reviews the potentiality of Rhizopus oryzae, a potent saprophytic and pathogenic fungus to produce a wide spectrum of metabolites, in the form of enzymes, esters, organic acids, volatile materials, polymers and bioalcohols. A number of extra and intra cellular enzymes are found to be synthesized by various strains of Rhizopus oryzae that includes cellulaes, hemicellulases, pectinases, tannase, phytase, amylase, lipase, protease and other enzymes of immense industrial importa...

  3. Uji Beberapa Jenis Insektisida Nabati Terhadap Pengendalian Kumbang Beras (Sitophylus oryzae L.) Di laboratorium.

    Sijabat, Voltra

    2011-01-01

    Voltra Sijabat, Test for Some Types of Botanical Insecticides Against Rice Beetle Control (Sitophylus oryzae L.) in the Laboratory. This study aims to determine the effectiveness of botanical insecticides in controlling Sitophylus oryzae on rice in the laboratory. This research was conducted in the laboratory of Plant Pests and Diseases, Faculty of Agriculture, University of North Sumatra with ± 25 m altitude above sea level. This research was conducted in December 2010. This research used Co...

  4. Studies on Aspergillus oryzae Mutants for the Production of Single Cell Proteins from Deoiled Rice Bran

    Ravinder, Rudravaram; Venkateshwar Rao, Linga; Ravindra, Pogaku

    2003-01-01

    Ethyl methyl sulphonate was used to induce point mutation in Aspergillus oryzae (MTCC 1846). Incubation with ethyl methyl sulphonate for 1 h resulted in 98 % killing of spores. By screening the survived colonies three hypermorphs were found (Shan1, Shan2 and Shan3). These three mutants along with the A. oryzae (MTCC 1846) were used for the production of single cell proteins. They grew profusely on deoiled rice bran and produced higher percentage of protein. Among the three mutants Shan2 ha...

  5. A genomic glimpse of aminoacyl-tRNA synthetases in malaria parasite Plasmodium falciparum

    Santoni Daniele

    2009-12-01

    Full Text Available Abstract Background Plasmodium parasites are causative agents of malaria which affects >500 million people and claims ~2 million lives annually. The completion of Plasmodium genome sequencing and availability of PlasmoDB database has provided a platform for systematic study of parasite genome. Aminoacyl-tRNA synthetases (aaRSs are pivotal enzymes for protein translation and other vital cellular processes. We report an extensive analysis of the Plasmodium falciparum genome to identify and classify aaRSs in this organism. Results Using various computational and bioinformatics tools, we have identified 37 aaRSs in P. falciparum. Our key observations are: (i fraction of proteome dedicated to aaRSs in P. falciparum is very high compared to many other organisms; (ii 23 out of 37 Pf-aaRS sequences contain signal peptides possibly directing them to different cellular organelles; (iii expression profiles of Pf-aaRSs vary considerably at various life cycle stages of the parasite; (iv several PfaaRSs posses very unusual domain architectures; (v phylogenetic analyses reveal evolutionary relatedness of several parasite aaRSs to bacterial and plants aaRSs; (vi three dimensional structural modelling has provided insights which could be exploited in inhibitor discovery against parasite aaRSs. Conclusion We have identified 37 Pf-aaRSs based on our bioinformatics analysis. Our data reveal several unique attributes in this protein family. We have annotated all 37 Pf-aaRSs based on predicted localization, phylogenetics, domain architectures and their overall protein expression profiles. The sets of distinct features elaborated in this work will provide a platform for experimental dissection of this family of enzymes, possibly for the discovery of novel drugs against malaria.

  6. EFFECT OF CHEMICAL SEED TREATMENT IN THE CONTROL OF BLAST DISEASE AND BROWN SPOT OF RICE EFEITO DO TRATAMENTO QUÍMICO DE SEMENTES NO CONTROLE DE BRUSONE (Pyricularia oryzae) E MANCHA PARDA (Helminthosporium oryzae) DO ARROZ

    Valácia Lemes da Silva; Wilson Ferreira de Oliveira; Meire Aparecida Damaceno

    2007-01-01

    With the objective of controlling blast disease (Pyricularia oryzae) and brown spot (Helminthosporium oryzae) of rice (Oryza sativa), different fungicides were tested, through seeds treatment, at field culture in low land soil. The results showed, preliminarily and in general terms that fungicides dichlofluanid and terbuconazole propitiated in the stand increase superior to 30% when confronted with standard fungici...

  7. Linoleic and linolenic acids analysis of soybean tofu with Rhizopus oryzae and Rhizopus oligosporus as coagulant

    SUPYANI

    2009-07-01

    Full Text Available Sudaryatiningsih C, Supyani. 2009. Linoleic and linolenic acids analysis of soybean tofu with Rhizopus oryzae and Rhizopus oligosporus as coagulant. Nusantara Bioscience 1: 110-116. The aims of this research are to know the potency of Rhizopus oligosporus and Rhizopus oryzae as a coagulant in tofu processing for increasing the amount of linoleic and linolenic acids, and to know the time that needed by R. oligosporus and R. oryzae for increasing the amount of linoleic and linolenic acids. It uses PDA for inoculating fungi, and it is done at Sub-Lab Chemistry, Central Laboratory for Mathematics and Natural Sciences, Sebelas Maret University, Surakarta. The tofu making was done in “Dele Emas” Tofu Factory, Surakarta. Analysis of linoleic and linolenic acids were done by Gas Chromatography, in LPPT-UGM Yogyakarta. The conclusion of this research are R. oligosporus dan R. oryzae having a potency as a coagulant in tofu processing for increasing the amount of linoleic and linolenic acids. R. oryzae needs 18 hours to coagulate the tofu, and R. oligosporus needs 12 hours for the same process. The highest amount of linoleic and linolenic acids were obtained by R. oryzae at 6 hours of fermentation (0.26% and 0.14%, and 24 hours of fermentation by R. oligosporus (0.06% and 0.04%.

  8. Micromonospora endophytica sp. nov., an endophytic actinobacteria of Thai upland rice (Oryza sativa).

    Thanaboripat, Dusanee; Thawai, Chitti; Kittiwongwattana, Chokchai; Laosinwattana, Chamroon; Koohakan, Prommart; Parinthawong, Nonglak

    2015-11-01

    An actinobacterial strain, DCWR9-8-2(T), was isolated from a leaf of Thai upland rice (Oryza sativa) collected in Chumporn province, Thailand. Strain DCWR9-8-2(T) is Gram-stain-positive aerobic bacteria that produce single spores directly on the vegetative hypha. Cell wall peptidoglycan of this strain exhibits meso-diaminopimelic acid and glycine, the reducing sugars of whole-cell hydrolysate are arabinose, glucose, ribose, xylose and small amount of mannose. The phospholipid profiles in the membrane are comprised of phosphatidylethanolamine, diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol, phosphatidylinositol mannosides. The major menaquinones are MK-9(H4) and MK-10(H6). The diagnostic cellular fatty acids are iso-C16:0 and iso-C15:0. The G+C content of the genomic DNA is 72.5 mol%. The result of 16S rRNA sequence analysis of the strain revealed that this strain was closely related to Micromonospora auratinigra TT1-11(T) (99.25%). On the other hand, the result of gyrB gene sequence analysis revealed that this strain was closed to M. eburnea JCM 12345(T) (96.30%). In addition, a combination of DNA-DNA hybridization results and some phenotypic properties supported that this strain should be judged as a novel species of the genus Micromonospora, for which the name M. endophytica sp. nov. is proposed. The type strain is DCWR9-8-2(T) (=BCC 67267(T)=NBRC 110008(T)). PMID:25966850

  9. Molecular Evolution of the TAC1 Gene from Rice (Oryza sativa L.)

    Jiahuan Jiang; Lubin Tan; Zuofeng Zhu; Yongcai Fu; Fengxia Liu; Hongwei Cai; Chuanqing Sun

    2012-01-01

    Tiller angle is a key feature of the architecture of cultivated rice (Oryza sativa),since it determines planting density and influences rice yield.Our previous work identified Tiller Angle Control 1 (TAC1) as a major quantitative trait locus that controls rice tiller angle.To further clarify the evolutionary characterization of the TAC1 gene,we compared a TAC1-containing 3164-bp genomic region among 113 cultivated varieties and 48 accessions of wild rice,including 43 accessions of O.rufipogon and five accessions of O.nivara.Only one single nucleotide polymorphism (SNP),a synonymous substitution,was detected in TAC1 coding regions of the cultivated rice varieties,whereas one synonymous and one nonsynonymous SNP were detected among the TAC1 coding regions of wild rice accessions.These data indicate that little natural mutation and modification in the TAC1 coding region occurred within the cultivated rice and its progenitor during evolution.Nucleotide diversities in the TAC1 gene regions of O.sativa and O.rufipogon of 0.00116 and 0.00112,respectively,further indicate that TAC1 has been highly conserved during the course of rice domestication.A functional nucleotide polymorphism (FNP) of TAC1 was only found in the japonica rice group.A neutrality test revealed strong selection,especially in the 3'-flanking region of the TAC1 coding region containing the FNP in the japonica rice group.However,no selection occurred in the indica and wild-rice groups.A phylogenetic tree derived from TAC1 sequence analysis suggests that the indica and japonica subspecies arose independently during the domestication of wild rice.

  10. AA, vacuum tank for stochastic precooling

    1979-01-01

    The vaccum tank in which the fast stochastic precooling kicker was installed. It is clad with heating jackets for bake-out to 200 deg C, indispensable for reaching the operational vacuum of 7E-11 Torr. Alain Poncet, responsible for AA vacuum, is looking on. See also 7910268, 8002234.

  11. AA, mating of BST magnet halves

    1980-01-01

    The AA had 2 types of bending magnets: BLG (window-frame,long and narrow) and BST (H-type, short and wide). The BST had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the mating of two BST halves.

  12. A novel manganese efflux system, YebN, is required for virulence by Xanthomonas oryzae pv. oryzae.

    Chunxia Li

    Full Text Available Manganese ions (Mn(2+ play a crucial role in virulence and protection against oxidative stress in bacterial pathogens. Such pathogens appear to have evolved complex mechanisms for regulating Mn(2+ uptake and efflux. Despite numerous studies on Mn(2+ uptake, however, only one efflux system has been identified to date. Here, we report on a novel Mn(2+ export system, YebN, in Xanthomonas oryzae pv. oryzae (Xoo, the causative agent of bacterial leaf blight. Compared with wild-type PXO99, the yebN mutant was highly sensitive to Mn(2+ and accumulated high concentrations of intracellular manganese. In addition, we found that expression of yebN was positively regulated by Mn(2+ and the Mn(2+-dependent transcription regulator, MntR. Interestingly, the yebN mutant was more tolerant to methyl viologen and H(2O(2 in low Mn(2+ medium than PXO99, but more sensitive in high Mn(2+ medium, implying that YebN plays an important role in Mn(2+ homoeostasis and detoxification of reactive oxygen species (ROS. Notably, deletion of yebN rendered Xoo sensitive to hypo-osmotic shock, suggesting that YebN may protect against such stress. That mutation of yebN substantially reduced the Xoo growth rate and lesion formation in rice implies that YebN could be involved in Xoo fitness in host. Although YebN has two DUF204 domains, it lacks homology to any known metal transporter. Hence, this is the first report of a novel metal export system that plays essential roles in hypo-osmotic and oxidative stress, and virulence. Our results lay the foundations for elucidating the complex and fascinating relationship between metal homeostasis and host-pathogen interactions.

  13. Identification of an avirulence gene,avrxa5,from the rice pathogen Xanthomonas oryzae pv.oryzae

    2010-01-01

    Xanthomonas oryzae pv.oryzae,the causal agent of bacterial blight in rice,interacts with rice plants in a gene-for-gene manner.The specificity of the interaction is dictated by avirulence(avr) genes in the pathogen and resistance(R) genes in the host.To date,no avr genes that correspond to recessive R genes have been isolated.We isolated an avrBs3/pthA family gene,avrxa5,from our previously isolated clone p58,which was originally from strain JXOIII.The avrxa5 gene converted the PXO99A strain from compatible to incompatible in rice cultivars containing the recessive xa5 gene,but not in those containing the dominant Xa5 gene.Sequencing indicated that avrxa5,which is highly similar to members of the avrBs3/pthA family,encodes a protein of 1238 amino acid residues with a conserved carboxy-terminal region containing three nuclear localization signals and a transcription activation domain.It has 19.5 34-amino-acid direct repeats,but the 13th amino acid is missing in the fifth and ninth repetitive units.Domain swapping of the repetitive regions between avrxa5 and avrXa7 changed the avirulence specificity of the genes in xa5 and Xa7 rice lines,respectively.This indicates that avrxa5 is distinct from previously characterized avrBs3/pthA members.The specificity of avrxa5 toward recessive xa5 in rice could help us better understand the molecular mechanisms of plant-pathogen specific interactions.

  14. Transcriptional Profiling of Rice Early Response to Magnaporthe oryzae Identified OsWRKYs as Important Regulators in Rice Blast Resistance

    WEI, Tong; Ou, Bin; Li, Jinbin; Zhao, Yang; Guo, Dongshu; Zhu, Youyong; Chen, Zhangliang; Gu, Hongya; Li, Chengyun; Qin, Genji; Qu, Li-Jia

    2013-01-01

    Rice blast disease is a major threat to rice production worldwide, but the mechanisms underlying rice resistance to the causal agent Magnaporthe oryzae remain elusive. Therefore, we carried out a transcriptome study on rice early defense response to M. oryzae. We found that the transcriptional profiles of rice compatible and incompatible interactions with M. oryzae were mostly similar, with genes regulated more prominently in the incompatible interactions. The functional analysis showed that ...

  15. 7 CFR 51.596 - U.S. Grade AA.

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false U.S. Grade AA. 51.596 Section 51.596 Agriculture... Consumer Standards for Celery Stalks Grades § 51.596 U.S. Grade AA. U.S. Grade AA shall consist of stalks of celery of similar varietal characteristics, which are well developed, and have good...

  16. Endogenous florendoviruses are major components of plant genomes and hallmarks of virus evolution

    Maumus, Florian; Copetti, Dario; Choisne, Nathalie; Zwickl, Derrick J; Zytnicki, Matthias; McTaggart, Alistair R.; Scalabrin, Simone; Vezzulli, Silvia; Wing, Rod A.; Quesneville, Hadi; Teycheney, Pierre-Yves

    2014-01-01

    The extent and importance of endogenous viral elements have been extensively described in animals but are much less well understood in plants. Here we describe a new genus of Caulimoviridae called ‘Florendovirus’, members of which have colonized the genomes of a large diversity of flowering plants, sometimes at very high copy numbers (>0.5% total genome content). The genome invasion of Oryza is dated to over 1.8 million years ago (MYA) but phylogeographic evidence points to an even older age ...

  17. Integrated syntenic and phylogenomic analyses reveal an ancient genome duplication in monocots.

    Jiao, Yuannian; Li, Jingping; Tang, Haibao; Paterson, Andrew H

    2014-07-01

    Unraveling widespread polyploidy events throughout plant evolution is a necessity for inferring the impacts of whole-genome duplication (WGD) on speciation, functional innovations, and to guide identification of true orthologs in divergent taxa. Here, we employed an integrated syntenic and phylogenomic analyses to reveal an ancient WGD that shaped the genomes of all commelinid monocots, including grasses, bromeliads, bananas (Musa acuminata), ginger, palms, and other plants of fundamental, agricultural, and/or horticultural interest. First, comprehensive phylogenomic analyses revealed 1421 putative gene families that retained ancient duplication shared by Musa (Zingiberales) and grass (Poales) genomes, indicating an ancient WGD in monocots. Intergenomic synteny blocks of Musa and Oryza were investigated, and 30 blocks were shown to be duplicated before Musa-Oryza divergence an estimated 120 to 150 million years ago. Synteny comparisons of four monocot (rice [Oryza sativa], sorghum [Sorghum bicolor], banana, and oil palm [Elaeis guineensis]) and two eudicot (grape [Vitis vinifera] and sacred lotus [Nelumbo nucifera]) genomes also support this additional WGD in monocots, herein called Tau (τ). Integrating synteny and phylogenomic comparisons achieves better resolution of ancient polyploidy events than either approach individually, a principle that is exemplified in the disambiguation of a WGD series of rho (ρ)-sigma (σ)-tau (τ) in the grass lineages that echoes the alpha (α)-beta (β)-gamma (γ) series previously revealed in the Arabidopsis thaliana lineage. PMID:25082857

  18. What can comparative genomics tell us about species concepts in the genus Aspergillus?

    Rokas, Antonis; payne, gary; Federova, Natalie D.; Baker, Scott E.; Machida, Masa; yu, Jiujiang; georgianna, D. R.; Dean, Ralph A.; Bhatnagar, Deepak; Cleveland, T. E.; Wortman, Jennifer R.; Maiti, R.; Joardar, V.; Amedeo, Paolo; Denning, David W.; Nierman, William C.

    2007-12-15

    Understanding the nature of species" boundaries is a fundamental question in evolutionary biology. The availability of genomes from several species of the genus Aspergillus allows us for the first time to examine the demarcation of fungal species at the whole-genome level. Here, we examine four case studies, two of which involve intraspecific comparisons, whereas the other two deal with interspecific genomic comparisons between closely related species. These four comparisons reveal significant variation in the nature of species boundaries across Aspergillus. For example, comparisons between A. fumigatus and Neosartorya fischeri (the teleomorph of A. fischerianus) and between A. oryzae and A. flavus suggest that measures of sequence similarity and species-specific genes are significantly higher for the A. fumigatus - N. fischeri pair. Importantly, the values obtained from the comparison between A. oryzae and A. flavus are remarkably similar to those obtained from an intra-specific comparison of A. fumigatus strains, giving support to the proposal that A. oryzae represents a distinct ecotype of A. flavus and not a distinct species. We argue that genomic data can aid Aspergillus taxonomy by serving as a source of novel and unprecedented amounts of comparative data, as a resource for the development of additional diagnostic tools, and finally as a knowledge database about the biological differences between strains and species.

  19. EValuation of the thixoformability of AA7004 and AA7075 alloys

    Eugenio José Zoqui

    2010-09-01

    Full Text Available This study involved a complete evaluation of the thixoformability of AA7004 and AA7075 alloys, from their microstructural characterization to their viscous behavior. The alloys were subjected to globularization heat treatments for 0, 30, 90 and 210 seconds in two conditions of solid fractions, 45 and 60%, and to viscosity assays under the same conditions. Heat treatments promote the globularization of primary phase particles; hence, the best viscosity results were achieved for alloys with low solid fractions heat-treated for 210 seconds. Alloys AA7004 and AA7075 showed an apparent viscosity of 10(4 to 10(5 (Pa.s. The behavior of materials in this range is similar to that of molten glass and they show high formability. However, the AA7075 alloy showed a better performance than the AA7004 due to the smaller size of its primary particles and original grains, their lower growth during reheating, and depending on the condition, their viscosity of 10(4 Pa.s, which is extremely low for thixoforming standards.

  20. Processing and Optimization of Dissimilar Friction Stir Welding of AA 2219 and AA 7039 Alloys

    Venkateswarlu, D.; Nageswara rao, P.; Mahapatra, M. M.; Harsha, S. P.; Mandal, N. R.

    2015-12-01

    The present paper discusses the optimization of dissimilar friction stir welding of AA 2219 and AA 7039 alloys with respect to tool design issues including microstructural study of weld. The optimized ultimate tensile strength was ~280 MPa, and % elongation was ~11.5. It was observed that the extent of tool shoulder flat surface and tool rotational speed influenced the weld quality significantly. A mathematical model was also developed using response surface regression analysis to predict the effects of tool geometry and process variables on dissimilar AA 2219 and AA 7039 alloys welds. The microstructure evolution and mechanical properties were investigated by employing electron backscatter diffraction technique, Vickers microhardness, and tensile testing, respectively. The microstructural observations indicated that the grain size obtained at advancing side (AA 2219 alloy side) was much finer compared to the retreating side (AA 7039 alloy side). Hardness distribution in the stir zone was inhomogeneous, which might be due to inadequate mixing of weld zone material. The hardness values observed at the weld zone were lower than that in the base materials.

  1. Rice-Map: a new-generation rice genome browser

    Luo Jingchu

    2011-03-01

    Full Text Available Abstract Background The concurrent release of rice genome sequences for two subspecies (Oryza sativa L. ssp. japonica and Oryza sativa L. ssp. indica facilitates rice studies at the whole genome level. Since the advent of high-throughput analysis, huge amounts of functional genomics data have been delivered rapidly, making an integrated online genome browser indispensable for scientists to visualize and analyze these data. Based on next-generation web technologies and high-throughput experimental data, we have developed Rice-Map, a novel genome browser for researchers to navigate, analyze and annotate rice genome interactively. Description More than one hundred annotation tracks (81 for japonica and 82 for indica have been compiled and loaded into Rice-Map. These pre-computed annotations cover gene models, transcript evidences, expression profiling, epigenetic modifications, inter-species and intra-species homologies, genetic markers and other genomic features. In addition to these pre-computed tracks, registered users can interactively add comments and research notes to Rice-Map as User-Defined Annotation entries. By smoothly scrolling, dragging and zooming, users can browse various genomic features simultaneously at multiple scales. On-the-fly analysis for selected entries could be performed through dedicated bioinformatic analysis platforms such as WebLab and Galaxy. Furthermore, a BioMart-powered data warehouse "Rice Mart" is offered for advanced users to fetch bulk datasets based on complex criteria. Conclusions Rice-Map delivers abundant up-to-date japonica and indica annotations, providing a valuable resource for both computational and bench biologists. Rice-Map is publicly accessible at http://www.ricemap.org/, with all data available for free downloading.

  2. Complete Genome Sequence of Bacillus velezensis CBMB205, a Phosphate-Solubilizing Bacterium Isolated from the Rhizoplane of Rice in the Republic of Korea

    Hwangbo, Kyeong; Um, Yurry; Kim, Ki Yoon; Madhaiyan, Munusamy; Sa, Tong Min

    2016-01-01

    Bacillus velezensis CBMB205 (= KACC 13105T = NCCB 100236T) was isolated from the rhizoplane of rice (Oryza sativa L. cv. O-dae). According to previous studies, this bacterium has several genes that can promote plant growth, such as the phosphorus-solubilizing protein-coding gene. Here, we present the first complete genome of B. velezensis CBMB205. PMID:27417835

  3. Evolution of geomagnetic aa index near sunspot minimum

    Kane, R. P.

    2002-01-01

    The smoothed values of the minima of sunspot number Rz and the geomagnetic index aa were compared for sunspot cycles 12–23. In one cycle, aa(min) occurred earlier than Rz(min), but remained at that low from a few months before Rz(min) to a few months after Rz(min). In two cycles, Rz(min) and aa(min) coincided within a month or two. In nine cycles, aa(min) occurred more than three months later than Rz(min). The aa(min) coincided with the minima of some solar radio e...

  4. Dicty_cDB: FC-AA03 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA03 (Link to dictyBase) - - - Contig-U15331-1 FC-AA03P (Li...nk to Original site) FC-AA03F 595 FC-AA03Z 546 FC-AA03P 1141 - - Show FC-AA03 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA03Q.Seq.d/ Representative seq. ID FC-AA...03P (Link to Original site) Representative DNA sequence >FC-AA03 (FC-AA03Q) /CSM/FC/FC-AA/FC-AA03Q.Seq.d/ AA...AATGTCATCTTATTTATTCACTAGTGAATCCGTCACCGAAGTCATCCAGATAAAATCT GTGATCAAGTATCAGATGCTGTTCTCGATGCTTGTTTAGCTCAA

  5. Dicty_cDB: FC-AA04 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA04 (Link to dictyBase) - - - Contig-U15354-1 FC-AA04P (Li...nk to Original site) FC-AA04F 546 FC-AA04Z 484 FC-AA04P 1030 - - Show FC-AA04 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA04Q.Seq.d/ Representative seq. ID FC-AA...04P (Link to Original site) Representative DNA sequence >FC-AA04 (FC-AA04Q) /CSM/FC/FC-AA/FC-AA04Q.Seq.d/ AA...TAATACACATAAAAAATTTATTAAATAAAAATGACTACAACAACAACAAATGAAGTTT ATATAGTTGATTGTATTCGTACACCAATTGGTAGAGGATATAGTAA

  6. Dicty_cDB: FC-AA10 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA10 (Link to dictyBase) - - - Contig-U16358-1 FC-AA10P (Li...nk to Original site) FC-AA10F 659 FC-AA10Z 544 FC-AA10P 1203 - - Show FC-AA10 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA10Q.Seq.d/ Representative seq. ID FC-AA...10P (Link to Original site) Representative DNA sequence >FC-AA10 (FC-AA10Q) /CSM/FC/FC-AA/FC-AA10Q.Seq.d/ AA...ATGACTACCTTTAACGAATATCCATTCTTGGCTGAATTAGGCATTAAAGCTGAAAATA ATGATGGAGTCTTCAATGGAAAATGGGGAGGTGCTGGTGAAATCATCAA

  7. Development of Oryza rufipogon and O. sativa Introgression Lines and Assessment for Yield-related Quantitative Trait Loci

    Lubin Tan; Fengxia Liu; Wei Xue; Guijuan Wang; Sheng Ye; Zuofeng Zhu; Yongcai Fu; Xiangkun Wang; Chuanqing Sun

    2007-01-01

    Introgression lines population was effectively used in mapping quantitative trait loci (QTLs), identifying favorable genes, discovering hidden genetic variation, evaluating the action or interaction of QTLs in multiple conditions and providing the favorable experimental materials for plant breeding and genetic research. In this study, an advanced backcross and consecutive selfing strategy was used to develop introgression lines (ILs), which derived from an accession of Oryza rufipogon Griff, collected from Yuanjiang County, Yunnan Province of China, as the donor, and an elite indica cultivar Teqing (O. sativa L.), as the recipient. Introgression segments from O. rufipogon were screened using 179 polymorphic simple sequence repeats (SSR) markers in the genome of each IL. Introgressed segments carried by the introgression lines population contained 120 ILs covering the whole O. rufipogon genome. The mean number of homozygous O. rufipogon segments per introgression line was about 3.88. The average length of introgressed segments was approximate 25.5 cM, and about 20.8% of these segments had sizes less than 10 cM. The genome of each IL harbored the chromosomal fragments of O. rufipogon ranging from 0.54% to 23.7%, with an overall average of 5.79%. At each locus, the ratio of substitution of O. rufipogon alleles had a range of 1.67-9.33, with an average of 5.50. A wide range of alterations in morphological and yield-related traits were also found in the introgression lines population. Using single-point analysis, a total of 37 putative QTLs for yield and yield components were detected at two sites with 7%-20% explaining the phenotypic variance. Nineteen QTLs (51.4%) were detected at both sites, and the alleles from O. rufipogon at fifteen loci (40.5%) improved the yield and yield components in the Teqing background. These O. rufipogon-O. sativa introgression lines will serve as genetic materials for identifying and using favorable genes from common wild rice.

  8. Natural variation of the rice blast resistance gene Pi-ta in Oryza species and its corresponding avirulence gene AVR-Pita in Magnaporthe oryzae

    The Pi-ta gene prevents the infections of M. oryzae races containing the corresponding avirulence gene AVR-Pita in a gene-for-gene manner. Pi-ta is a putative NBS type major resistance gene, and can directly recognize the AVR-Pita putative metalloprotease in triggering effective resistance. We hav...

  9. Cloning, expression, crystallization and preliminary X-ray crystallographic analysis of malonyl-CoA–acyl carrier protein transacylase (FabD) from Xanthomonas oryzae pv. oryzae

    Bacterial blight is the most destructive bacterial disease of rice and is caused by X. oryzae pv. oryzae (Xoo). Xoo0880 (FabD), a malonyl-CoA–acyl carrier protein transacylase, from Xoo was cloned, purified and crystallized. Xanthomonas oryzae pv. oryzae (Xoo) causes bacterial blight in rice, which is one of the most devastating diseases in rice-cultivating countries. The Xoo0880 (fabD) gene coding for a malonyl-CoA–acyl carrier protein transacylase (MCAT) from Xoo was cloned and expressed in Escherichia coli. MCAT is an essential enzyme that catalyzes a key reaction of fatty-acid synthesis in bacteria and plants: the conversion of malonyl-CoA to malonyl-acyl carrier protein. The FabD enzyme was purified and crystallized in order to elucidate its three-dimensional structure and to determine its enzymatic reaction mechanism and biological importance. The crystal obtained diffracted to 1.9 Å resolution and belonged to the orthorhombic space group P212121, with unit-cell parameters a = 41.4, b = 74.6, c = 98.5 Å. According to Matthews coefficient calculations, the crystallographic structure contains only one monomeric unit in the asymmetric unit with a VM of 2.21 Å3 Da−1 and a solvent content of 44.3%

  10. Cloning, expression, crystallization and preliminary X-ray crystallographic analysis of 3-dehydroquinate synthase, Xoo1243, from Xanthomonas oryzae pv. oryzae

    Bacterial blight is a destructive disease of rice that is caused by X. oryzae pv. oryzae (Xoo). Dehydroquinate synthase, which is the second enzyme of the shikimate pathway, was cloned from Xoo1243 (aroB), purified and crystallized in order to elucidate its three-dimensional structure. The disease bacterial blight results in serious production losses of rice in Asian countries. The aroB gene encoding dehydroquinate synthase (DHQS), which is a potential antibiotic target, was identified from the plant-pathogenic bacterium Xanthomonas oryzae pv. oryzae (Xoo). DHQS plays an essential role in the synthesis of aromatic compounds in the shikimate pathway. The aroB gene (Xoo1243) was cloned from Xoo and the corresponding DHQS protein was subsequently overexpressed in Escherichia coli. The purified protein was crystallized using the hanging-drop vapour-diffusion method and yielded crystals that diffracted to 2.5 Å resolution. The crystals belonged to the tetragonal space group P43212, with unit-cell parameters a = b = 118.2, c = 98.2 Å. According to a Matthews coefficient calculation, the crystal contained two molecules in the asymmetric unit, with a corresponding VM of 2.06 Å3 Da−1 and a solvent content of 40.4%

  11. The quantitative regulation of the hrp regulator HrpX is involved in sugar-source-dependent hrp gene expression in Xanthomonas oryzae pv. oryzae.

    Ikawa, Yumi; Tsuge, Seiji

    2016-05-01

    In Xanthomonas oryzae pv. oryzae, the pathogen of bacterial leaf blight of rice, hrp gene expression is regulated by the key hrp regulators HrpG and HrpX. HrpG regulates hrpX and hrpA, and HrpX regulates the other hrp genes on hrpB-hrpF operons. We previously examined the expression of the HrpX-regulated hrp gene hrcU and demonstrated that hrp gene expression is highly induced in a certain nutrient-poor medium containing xylose. In the present study, we found that the induction level of HrpX-regulated hrp genes was higher in medium with xylose than in media with any other sugar sources (glucose, sucrose and fructose), but that expression of hrpG, hrpX and hrpA was independent of the sugar sources. In western blot analysis, the accumulation of HrpX was reduced in media with a sugar other than xylose, probably as a result of proteolysis, but the addition of xylose canceled this reduced accumulation of the protein. The results suggest that proteolysis of HrpX is an important hrp regulatory mechanism and that xylose specifically suppresses this proteolysis, resulting in active hrp gene expression in X. oryzae pv. oryzae. PMID:27020414

  12. Resistência de cultivares de arroz a Rhizoctonia solani e Rhizoctonia oryzae Resistance of rice cultivars to Rhizoctonia solani and Rhizoctonia oryzae

    Anne Sitarama Prabhu

    2002-05-01

    Full Text Available Isolados de Rhizoctonia solani e Rhizoctonia oryzae, agentes causais da queima-da-bainha e mancha-da-bainha, respectivamente, foram coletados em lavouras de arroz irrigado no Estado do Tocantins. O objetivo deste trabalho foi avaliar a resistência de 12 cultivares de arroz a essas doenças, sob condições artificiais de inoculação, em casa de vegetação. Não houve correlação entre resistência das cultivares a R. oryzae e R. solani quanto ao comprimento da lesão na bainha infectada pelo método de palito de dentes. A relação entre tamanho da lesão na bainha e folha foi linear e significativamente negativa (r = -0,66, PIsolates of Rhizoctonia solani and Rhizoctonia oryzae, the causal agents of sheath blight and sheath rot diseases, respectively, were collected from irrigated rice fields in the State of Tocantins, Brazil. The main objective of the investigation was to assess the resistance of 12 genotypes to these diseases, under artificial inoculation tests in greenhouse condition. There was no correlation between the resistance of cultivars to R. oryzae and R. solani for lesion extension on sheath infection obtained by the toothpick method. The relationship between lesion size on sheath and leaf was linear and significantly negative (r = -0.66, P<=0.05, thereby indicating that there is no relationship between resistance of sheath and leaf to infection by R. solani in rice cultivars. Among the early maturing genotypes Labelle was highly susceptible in all methods of inoculation. The area under disease progress curve based on lesion height on the culm and the inoculation method with rice husk and grain were found more adequate for determining the differences in the degree of resistance among cultivars. Leaves exhibited resistance to infection by R. oryzae in inoculation tests with mycelial discs.

  13. AA, inner conductor of a magnetic horn

    1981-01-01

    At the start-up of the AA and during its initial operation, magnetic horns focused the antiprotons emanating from the production target. These "current-sheet lenses" had a thin inner conductor (for minimum absorption of antiprotons), machined from aluminium to wall thicknesses of 0.7 or 1 mm. The half-sine pulses rose to 150 kA in 8 microsec. The angular acceptance was 50 mrad.

  14. AA Prototype-Quadrupole on Measurement Stand

    1978-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although not very long (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built in 1978. Here we see it on its test stand, with Ray Brown positioning the measurement coil.

  15. AA Prototype-Quadrupole on Measurement Stand

    1979-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although rather short (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built at CERN in 1978. Here we see it on its test stand, with a measurement coil inserted, Brian Pincott taking readings.

  16. Research in development: the approach of AAS

    Dugan, P.; Apgar, M.; Douthwaite, B.

    2013-01-01

    The CGIAR Research Program on Aquatic Agricultural Systems (AAS) is pursuing a Research in Development approach that emphasizes the importance of embedding research in the development context. Reflecting this emphasis the six elements of this approach are a commitment to people and place, participatory action research, gender transformative research, learning and networking, partnerships, and capacity building. It is through the careful pursuit of these six elements that we believe that the p...

  17. AA, assembly of wide bending magnet

    1980-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets; BST, short and wide; BLG, long and narrow). The wide ones had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the copper coils being hoisted onto the lower half of a BST. See also 7811105, 8006050. For a BLG, see 8001044.

  18. The WRKY Gene Family in Rice (Oryza sativa)

    Christian A. Ross; Yue Liu; Qingxi J. Shen

    2007-01-01

    WRKYgenes encode transcription factors that are involved in the regulation of various biological processes. These zinc-finger proteins, especially those members mediating stress responses, are uniquely expanded in plants. To facilitate the study of the evolutionary history and functions of this supergene family, we performed an exhaustive search for WRKY genes using HMMER and a Hidden Markov Model that was specifically trained for rice. This work resulted in a comprehensive list of WRKY gene models in Oryza sativa L. ssp. indica and L. ssp. japonica. Mapping of these genes to individual chromosomes facilitated elimination of the redundant, leading to the identification of 98 WRKY genes in japonica and 102 in indica rice. These genes were further categorized according to the number and structure of their zinc-finger domains. Based on a phylogenetic tree of the conserved WRKY domains and the graphic display of WRKY loci on corresponding indica and japonica chromosomes, we identified possible WRKY gene duplications within, and losses between the two closely related rice subspecies. Also reviewed are the roles of WRKY genes in disease resistance and responses to salicylic acid and jasmonic acid, seed development and germination mediated by gibberellins, other developmental processes including senescence, and responses to abiotic stresses and abscisic acid in rice and other plants. The signaling pathways mediating WRKY gene expression are also discussed.

  19. Improvement of heterologous protein production in Aspergillus oryzae by RNA interference with alpha-amylase genes.

    Nemoto, Takashi; Maruyama, Jun-ichi; Kitamoto, Katsuhiko

    2009-11-01

    Aspergillus oryzae RIB40 has three alpha-amylase genes (amyA, amyB, and amyC), and secretes alpha-amylase abundantly. However, large amounts of endogenous secretory proteins such as alpha-amylase can compete with heterologous protein in the secretory pathway and decrease its production yields. In this study, we examined the effects of suppression of alpha-amylase on heterologous protein production in A. oryzae, using the bovine chymosin (CHY) as a reporter heterologous protein. The three alpha-amylase genes in A. oryzae have nearly identical DNA sequences from those promoters to the coding regions. Hence we performed silencing of alpha-amylase genes by RNA interference (RNAi) in the A. oryzae CHY producing strain. The silenced strains exhibited a reduction in alpha-amylase activity and an increase in CHY production in the culture medium. This result suggests that suppression of alpha-amylase is effective in heterologous protein production in A. oryzae. PMID:19897917

  20. Rhizomucor miehei triglyceride lipase is processed and secreted from transformed Aspergillus oryzae.

    Huge-Jensen, B; Andreasen, F; Christensen, T; Christensen, M; Thim, L; Boel, E

    1989-09-01

    The cDNA encoding the precursor of the Rhizomucor miehei triglyceride lipase was inserted in an Aspergillus oryzae expression vector. In this vector the expression of the lipase cDNA is under control of the Aspergillus oryzae alpha-amylase gene promoter and the Aspergillus niger glucoamylase gene terminator. The recombinant plasmid was introduced into Aspergillus oryzae, and transformed colonies were selected and screened for lipase expression. Lipase-positive transformants were grown in a small fermentor, and recombinant triglyceride lipase was purified from the culture broth. The purified enzymatically active recombinant lipase (rRML) secreted from A. oryzae was shown to have the same characteristics with respect to mobility on reducing SDS-gels and amino acid composition as the native enzyme. N-terminal amino acid sequencing indicated that approximately 70% of the secreted rRML had the same N-terminal sequence as the native Rhizomucor miehei enzyme, whereas 30% of the secreted rRML was one amino acid residue shorter in the N-terminal. The recombinant lipase precursor, which has a 70 amino acid propeptide, is thus processed in and secreted from Aspergillus oryzae. We have hereby demonstrated the utility of this organism as a host for the production of recombinant triglyceride lipases. PMID:2586234

  1. Utilization of Aspergillus oryzae to produce pectin lyase from various agro-industrial residues

    Safia Koser

    2014-07-01

    Full Text Available The present study was aimed to investigate the culture influence on pectin lyase production potential of fungal strain Aspergillus oryzae. The enzyme profile of A. oryzae showed highest activity of pectin lyase after 3rd day of incubation on lemon peel waste under solid state fermentation conditions. To induce the pectin lyase synthesis capability of A. oryzae at optimal level various culture variables including physical and nutritional parameters were optimized by adopting classical optimization technique. Therefore, through fermentation process optimization the production of pectin lyase was substantially induced up to the level of 875 U/mL, when fermentation medium of lemon peel waste inoculated with 5 mL spore suspension of A. oryzae. The optimal fermentation conditions for maximum pectin lyase yield were as: optimum pH 5, 70% moisture level and incubated at 40 °C in addition with 1% sterile glucose solution as readily available carbon source and 0.2% yeast extract as an inexpensive nitrogen supplement (1%. The results obtained in current investigation so far demonstrated that culture conditions have great influence on the pectin lyase production potential of A. oryzae.

  2. Transcriptome analysis of Rhizopus oryzae in response to xylose during fumaric acid production.

    Xu, Qing; Liu, Ying; Li, Shuang; Jiang, Ling; Huang, He; Wen, Jianping

    2016-08-01

    Xylose is one of the most abundant lignocellulosic components, but it cannot be used by R. oryzae for fumaric acid production. Here, we applied high-throughput RNA sequencing to generate two transcriptional maps of R. oryzae following fermentation in glucose or xylose. The differential expression analysis showed that, genes involved in amino acid metabolism, fatty acid metabolism, and gluconeogenesis, were up-regulated in response to xylose. Moreover, we discovered the potential presence of oxidative stress in R. oryzae during xylose fermentation. To adapt to this unfavorable condition, R. oryzae displayed reduced growth and induce of a number of antioxidant enzymes, including genes involved in glutathione, trehalose synthesis, and the proteasomal pathway. These responses might divert the flow of carbon required for the accumulation of fumaric acid. Furthermore, using high-throughput RNA sequencing, we identified a large number of novel transcripts and a substantial number of genes that underwent alternative splicing. Our analysis provides remarkable insight into the mechanisms underlying xylose fermentation by R. oryzae. These results may reveal potential target genes or strategies to improve xylose fermentation. PMID:27170374

  3. AAS Publishing News: Astronomical Software Citation Workshop

    Kohler, Susanna

    2015-07-01

    Do you write code for your research? Use astronomical software? Do you wish there were a better way of citing, sharing, archiving, or discovering software for astronomy research? You're not alone! In April 2015, AAS's publishing team joined other leaders in the astronomical software community in a meeting funded by the Sloan Foundation, with the purpose of discussing these issues and potential solutions. In attendance were representatives from academic astronomy, publishing, libraries, for-profit software sharing platforms, telescope facilities, and grantmaking institutions. The goal of the group was to establish “protocols, policies, and platforms for astronomical software citation, sharing, and archiving,” in the hopes of encouraging a set of normalized standards across the field. The AAS is now collaborating with leaders at GitHub to write grant proposals for a project to develop strategies for software discoverability and citation, in astronomy and beyond. If this topic interests you, you can find more details in this document released by the group after the meeting: http://astronomy-software-index.github.io/2015-workshop/ The group hopes to move this project forward with input and support from the broader community. Please share the above document, discuss it on social media using the hashtag #astroware (so that your conversations can be found!), or send private comments to julie.steffen@aas.org.

  4. Dicty_cDB: FC-AA11 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA11 (Link to dictyBase) - - - Contig-U16273-1 FC-AA11P (Li...nk to Original site) FC-AA11F 631 FC-AA11Z 502 FC-AA11P 1133 - - Show FC-AA11 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA11Q.Seq.d/ Representative seq. ID FC-AA...11P (Link to Original site) Representative DNA sequence >FC-AA11 (FC-AA11Q) /CSM/FC/FC-AA/FC-AA...11Q.Seq.d/ GGTGAATTAATTGTTGAACCAGTTGATCAAAAATATATTTTCAAGACTGAACGTAAAGTT CCAAGAATGGGTGTTATGATTGTTGGTTTATGTGGTAACAATGGTACAA

  5. Dicty_cDB: FC-AA18 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA18 (Link to dictyBase) - - - Contig-U15943-1 FC-AA18P (Li...nk to Original site) FC-AA18F 506 FC-AA18Z 293 FC-AA18P 799 - - Show FC-AA18 Library FC (Link to library) Clone ID FC-AA...al site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA18Q.Seq.d/ Representative seq. ID FC-AA...18P (Link to Original site) Representative DNA sequence >FC-AA18 (FC-AA18Q) /CSM/FC/FC-AA/FC-AA18Q.Seq.d/ AAA...AGATAGAGAAGAAAGAAAACTTGAACGTGAGAAGGAACTTGAACGTGAACGTGAGAA AGAACTTGAGCGTGAGCGTGAACGTGAACAACGTCGTCTTGAAA

  6. Dicty_cDB: FCL-AA07 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA07 (Link to dictyBase) - - - Contig-U14973-1 FCL-AA07P ...(Link to Original site) FCL-AA07F 527 FCL-AA07Z 253 FCL-AA07P 780 - - Show FCL-AA07 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA07Q....Seq.d/ Representative seq. ID FCL-AA07P (Link to Original site) Representative DNA sequence >FCL-AA07 (FCL-AA07Q) /CSM/FCL/FCL-AA.../FCL-AA07Q.Seq.d/ CAAAATAAAAAATGTTATCAAATTTTTTAAAAGTCAACAGTAAAGCACTAGGACATATAA GAACTTTTGCCTCAAAGAGTGGTGAAATTAAA

  7. Dicty_cDB: FCL-AA12 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA12 (Link to dictyBase) - - - Contig-U16034-1 FCL-AA12P ...(Link to Original site) FCL-AA12F 629 FCL-AA12Z 540 FCL-AA12P 1169 - - Show FCL-AA12 Library FCL (Link to library) Clone ID FCL-AA...4-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA12Q....Seq.d/ Representative seq. ID FCL-AA12P (Link to Original site) Representative DNA sequence >FCL-AA12 (FCL-AA12Q) /CSM/FCL/FCL-AA.../FCL-AA12Q.Seq.d/ ATCAAATGTTTATTCAACAACAACCATCAGATTCAATTGTTTGTAATCGTTATATTCATC CAGCCATTGTTGTTTTGGTTGACCAA

  8. Dicty_cDB: FCL-AA21 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA21 (Link to dictyBase) - - - Contig-U14936-1 FCL-AA21P ...(Link to Original site) FCL-AA21F 520 FCL-AA21Z 356 FCL-AA21P 876 - - Show FCL-AA21 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA21Q....Seq.d/ Representative seq. ID FCL-AA21P (Link to Original site) Representative DNA sequence >FCL-AA21 (FCL-AA21Q) /CSM/FCL/FCL-AA.../FCL-AA21Q.Seq.d/ ATCATAATCATATATTTTTAATAGATATTGATATATATATTTAAAAAAATAAAATAAAAT AAAATAAAAAATGTCAACAGAGGAAACAAAAA

  9. Dicty_cDB: FCL-AA01 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA01 (Link to dictyBase) - - - Contig-U16033-1 FCL-AA01P ...(Link to Original site) FCL-AA01F 603 FCL-AA01Z 411 FCL-AA01P 1014 - - Show FCL-AA01 Library FCL (Link to library) Clone ID FCL-AA...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA01Q....Seq.d/ Representative seq. ID FCL-AA01P (Link to Original site) Representative DNA sequence >FCL-AA01 (FCL-AA01Q) /CSM/FCL/FCL-AA.../FCL-AA01Q.Seq.d/ GCAAATAATAATATTATGGGTATTGACTTTGGTACACATTTCGCATGTGTTGGTATTTTC AAGAATGAAAGAATTGAAATCTGTCCAAA

  10. Dicty_cDB: FCL-AA13 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA13 (Link to dictyBase) - - - - FCL-AA13P (Link to Original site) FCL-AA...13F 635 FCL-AA13Z 350 FCL-AA13P 985 - - Show FCL-AA13 Library FCL (Link to library) Clone ID FCL-AA...dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ Representative seq. ID FCL-AA...13P (Link to Original site) Representative DNA sequence >FCL-AA13 (FCL-AA13Q) /CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ CATATTTATAA...TTATATCTTTTTTGTTTAATAAAAAAGAAAGAATACCAACATGAGACTT TTATTGTGTTTAATTTTCTTAGTTTTTGTTTTCAATTTTGCATTATCAA

  11. Dicty_cDB: FC-AA06 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA06 (Link to dictyBase) - - - Contig-U15909-1 FC-AA06P (Li...nk to Original site) FC-AA06F 532 FC-AA06Z 501 FC-AA06P 1033 - - Show FC-AA06 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA06Q.Seq.d/ Representative seq. ID FC-AA...06P (Link to Original site) Representative DNA sequence >FC-AA06 (FC-AA06Q) /CSM/FC/FC-AA/FC-AA...06Q.Seq.d/ GTGAATATAACGATTTAGATTTAGTGTATGATAAAGATGTTTATCAAAAATTAATAGAGA ATGGTGTAGATTCATTATTATCAAAA

  12. Dicty_cDB: FC-AA08 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA08 (Link to dictyBase) - - - Contig-U15942-1 FC-AA08P (Li...nk to Original site) FC-AA08F 620 FC-AA08Z 510 FC-AA08P 1130 - - Show FC-AA08 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA08Q.Seq.d/ Representative seq. ID FC-AA...08P (Link to Original site) Representative DNA sequence >FC-AA08 (FC-AA08Q) /CSM/FC/FC-AA/FC-AA...08Q.Seq.d/ ATCAGTTACATGTACTGCACCAGTTAATATTGCAGTTATCAAATATTGGGGAAAGAGAGA TGAAAATATTATTTTACCATTAAATTCATCACTCAGTGGAA

  13. Significance of bed porosity, bran and specific surface area in solid-state cultivation of Aspergillus oryzae

    Rahardjo, Y.S.P.; Jolink, F.; Haemers, S.; Tramper, J.; Rinzema, A.

    2005-01-01

    In this paper, the effects of bed porosity, bran and specific surface area on the oxygen uptake rate and ¿-amylase production during growth of Aspergillus oryzae on wheat grain and wheat¿flour substrate are reported. The high oxygen uptake rate found during cultivation of A. oryzae on wheat¿flour su

  14. Cancer genomics

    Norrild, Bodil; Guldberg, Per; Ralfkiær, Elisabeth Methner

    2007-01-01

    Almost all cells in the human body contain a complete copy of the genome with an estimated number of 25,000 genes. The sequences of these genes make up about three percent of the genome and comprise the inherited set of genetic information. The genome also contains information that determines whe...

  15. Data set from the phosphoproteomic analysis of Magnaporthe oryzae-responsive proteins in susceptible and resistant rice cultivars

    Yunfeng Li

    2015-06-01

    Full Text Available Rice blast, caused by the fungal pathogen Magnaporthe oryzae, is the most destructive disease of rice and causes tremendous losses of rice yield worldwide. To explore the molecular mechanisms involved in the rice–M. oryzae interaction, we conducted a time-course phosphoproteomic analysis of leaf samples from resistant and susceptible rice cultivars infected with M. oryzae. This data article contains additional results and analysis of M. oryzae-regulated phosphoproteins in rice leaves [1]. We report the analysis of M. oryzae-regulated phosphoproteins at all time points, including Venn diagram analysis, close-up views, relative intensities, and functional category, and the MS spectra of representative phosphoprotein and representative phosphorylated peptides.

  16. Fermentation Kinetics of Media Optimization for the Production of Alpha Amylase by a New Isolate of Aspergillus Oryzae

    Ikram-ul-Haq; Roheena Abdullah; Hamid Mukhtar; Muhammad Nauman Aftab

    2007-01-01

    The present study is concerned with the isolation and screening of different strains of Aspergillus oryzae for the production of alpha amylase. Ninety strains were isolated from soil and tested for the production of alpha amylase in shake flasks. Of all the strains tested,Aspergillus oryzae GCB-32 and Aspergillus oryzae GCB-35 gave maximum production of alpha amylase. Different culture media were screened for maximum production of alpha amylase by both the strains Aspergillus oryzae GCB-32 and Aspergillus oryzae GCB-35. Kinetic analysis revealed that the values of product yield coefficient (Yp/x) and specific product yield coefficient( qp ) were found highly significant (p ≤ 0.05 ) when medium M1 was used for the enzyme production.

  17. alpha-Amylase production in high cell density submerged cultivation of Aspergillus oryzae and A. nidulans.

    Agger, T; Spohr, A B; Nielsen, J

    2001-01-01

    The effect of biomass concentration on the formation of Aspergillus oryzae alpha-amylase during submerged cultivation with A. oryzae and recombinant A. nidulans strains has been investigated. It was found that the specific rate of alpha-amylase formation in chemostats decreased significantly with increasing biomass concentration in the range of approx. 2-12 g dry weight kg(-1). When using a recombinant A. nidulans strain in which the gene responsible for carbon catabolite repression of the A. oryzae alpha-amylase gene (creA) was deleted, no significant decrease in the specific rate of alpha-amylase formation was observed. On the basis of the experimental results, it is suggested that the low value of the specific alpha-amylase productivity observed at high biomass concentration is caused by slow mixing of the concentrated feed solution in the viscous fermentation medium. PMID:11234963

  18. First case of Tritirachium oryzae as agent of onychomycosis and its susceptibility to antifungal drugs.

    Naseri, Ali; Fata, Abdolmajid; Najafzadeh, Mohammad Javad

    2013-08-01

    The first case of Tritirachium oryzae isolated from an Iranian patient is reported. A 44-year-old woman with a lesion in her fingernail was examined for onychomycosis. Direct microscopic examination of the nail clippings revealed fungal filaments and inoculation of portions of the nail clippings on cultures media yielded T. oryzae after 8 days. The isolate was identified as Tritirachium spp. on the basis of gross morphological characteristics of the fungal colony and microscopic characterization of slide cultures. The diagnosis of T. oryzae was confirmed by PCR sequencing of the internal transcribed spacer domain of the rDNA gene. In vitro antifungal susceptibility test demonstrated that the fungus was susceptible to itraconazole and posaconazole. The patient was treated with oral itraconazole. PMID:23591624

  19. Comparative Analysis of the Korean Population of Magnaporthe oryzae by Multilocus Microsatellite Typing

    Jaehyuk Choi

    2013-12-01

    Full Text Available Rice blast fungus, Magnaporthe oryzae, inflicts serious damage to global rice production. Due to high variability of this fungal pathogen, resistance of newly-released rice cultivars is easily broken down. To understand the population structure of M. oryzae, we analyzed the genetic diversity of the Korean population using multilocus microsatellite typing. Eleven microsatellite markers were applied to the population of 190 rice isolates which had been collected in Korea for two decades since the 1980’s. Average values of gene diversity and allele frequency were 0.412 and 6.5, respectively. Comparative analysis of the digitized allele information revealed that the Korean population exhibited a similar level of allele diversity to the integrated diversity of the world populations, suggesting a particularly high diversity of the Korean population. Therefore, these microsatellite markers and the comprehensive collection of field isolates will be useful genetic resources to identify the genetic diversity of M. oryzae population.

  20. Enhanced L-(+)-lactic acid production by an adapted strain of Rhizopus oryzae using corncob hydrolysate

    Bai, Dongmei; Li, S.Z.; Liu, Z.L.;

    2008-01-01

    -added production of a variety of bioproducts. Lactic acid can be used as a precursor for poly-lactic acid production. Although current industrial lactic acid is produced by lactic acid bacteria using enriched medium, production by Rhizopus oryzae is preferred due to its exclusive formation of the-isomer and a...... simple nutrition requirement by the fungus. Production of-L-(+)-lactic acid by R. oryzae using xylose has been reported; however, its yield and conversion rate are poor compared with that of using glucose. In this study, we report an adapted R. oryzae strain HZS6 that significantly improved efficiency of...... substrate utilization and enhanced production of L-(+)-lactic acid from corncob hydrolysate. It increased L-(+)-lactic acid final concentration, yield, and volumetric productivity more than twofold compared with its parental strain. The optimized growth and fermentation conditions for Strain HZS6 were...

  1. Morphological and molecular characterization of Magnaporthe oryzae (fungus) from infected rice leaf samples

    Muni, Nurulhidayah Mat; Nadarajah, Kalaivani

    2014-09-01

    Magnaporthe oryzae is a plant-pathogenic fungus that causes a serious disease affecting rice called rice blast. Outbreaks of rice blast have been a threat to the global production of rice. This fungal disease is estimated to cause production losses of US55 million each year in South and Southeast Asia. It has been used as a primary model for elucidating various aspects of the host-pathogen interaction with its host. We have isolated five isolates of Magnaporthe oryzae from diseased leaf samples obtained from the field at Kompleks Latihan MADA, Kedah, Malaysia. We have identified the isolates using morphological and microscopic studies on the fungal spores and the lesions on the diseased leaves. Amplification of the internal transcribed spacer (ITS) was carried out with universal primers ITS1 and ITS4. The sequence of each isolates showed at least 99% nucleotide identity with the corresponding sequence in GenBank for Magnaporthe oryzae.

  2. Fine mapping of a gene for low-tiller number, Ltn, in japonica rice (Oryza sativa L.) variety Aikawa 1.

    Fujita, Daisuke; Ebron, Leodegario A; Araki, Etsuko; Kato, Hiroshi; Khush, Gurdev S; Sheehy, John E; Lafarge, Tanguy; Fukuta, Yoshimichi; Kobayashi, Nobuya

    2010-04-01

    Tillering is one of the most important agronomic traits related to grain production in rice (Oryza sativa L.). A japonica-type variety, Aikawa 1, is known to have low-tiller number. The detailed location of a low-tillering gene, Ltn, which has been localized on chromosome 8 in Aikawa 1, was confirmed by molecular mapping. Using BC5F2 individuals derived from a cross between IR64 and Aikawa 1, the low-tillering gene was mapped to an interval defined by SSR markers ssr5816-3 and A4765. This was designated as Ltn because there was no reported gene for tillering in the region of chromosome 8. Through high-resolution linkage analysis, the candidate region of Ltn was located between DNA markers ssr6049-23 and ind6049-1 corresponding to 38.6 kbp on the Nipponbare genome sequence. These DNA markers, which were tightly linked to Ltn, are useful for marker-assisted selection in breeding studies. PMID:20062964

  3. Exploration of plant genomes in the FLAGdb++ environment

    Leplé Jean-Charles

    2011-03-01

    Full Text Available Abstract Background In the contexts of genomics, post-genomics and systems biology approaches, data integration presents a major concern. Databases provide crucial solutions: they store, organize and allow information to be queried, they enhance the visibility of newly produced data by comparing them with previously published results, and facilitate the exploration and development of both existing hypotheses and new ideas. Results The FLAGdb++ information system was developed with the aim of using whole plant genomes as physical references in order to gather and merge available genomic data from in silico or experimental approaches. Available through a JAVA application, original interfaces and tools assist the functional study of plant genes by considering them in their specific context: chromosome, gene family, orthology group, co-expression cluster and functional network. FLAGdb++ is mainly dedicated to the exploration of large gene groups in order to decipher functional connections, to highlight shared or specific structural or functional features, and to facilitate translational tasks between plant species (Arabidopsis thaliana, Oryza sativa, Populus trichocarpa and Vitis vinifera. Conclusion Combining original data with the output of experts and graphical displays that differ from classical plant genome browsers, FLAGdb++ presents a powerful complementary tool for exploring plant genomes and exploiting structural and functional resources, without the need for computer programming knowledge. First launched in 2002, a 15th version of FLAGdb++ is now available and comprises four model plant genomes and over eight million genomic features.

  4. Comparison between ARB and CARB processes on an AA5754/AA6061 composite

    Verstraete, K.; Helbert, A.-L.; Brisset, F.; Baudin, T.

    2014-08-01

    The present work aims to compare two processes: Accumulative Roll Bonding and Cross Accumulative Roll Bonding (CARB). Both processes consist in the repetition of rolling but the second technique adds a 90° rotation of the sheet around its normal direction between each rolling. Microstructure, mechanical properties and texture were compared for both processes on an AA5754/AA6061 composite. As a result a thinner and less elongated microstructure was obtained in the CARB process leading to an isotropy and an improvement of the mechanical properties. Besides, the texture was characterized by the rotated Cube component for both processes but for CARB it is of less strength.

  5. The complete genome sequence and genome structure of passion fruit mosaic virus.

    Song, Yeon Sook; Ryu, Ki Hyun

    2011-06-01

    In this study, we determined the complete sequence of the genomic RNA of a Florida isolate of maracuja mosaic virus (MarMV-FL) and compared it to that of a Peru isolate of the virus (MarMV-P) and those of other known tobamoviruses. Complete sequence analysis revealed that the isolate should be considered a member of a new species and named passion fruit mosaic virus (PafMV). The genomic RNA of PafMV consists of 6,791 nucleotides and encodes four open reading frames (ORFs) coding for proteins of 125 kDa (1,101 aa), 184 kDa (1,612 aa), 34 kDa (311 aa) and 18 kDa (164 aa) in consecutive order from the 5' to the 3' end. The sequence homologies of the four ORFs of PafMV were from 78.8% to 81.6% to those of MarMV-P at the amino acid level. The sequence homologies of the four ORFs of PafMV ranged from 36.0% to 77.9% and from 21.7% to 81.6% to those of other tobamoviruses, at the nucleotide and amino acid level, respectively. Phylogenetic analysis revealed that these PafMV-encoded proteins are closely related to those of MarMV-P. In conclusion, the results indicate that PafMV and MarMV-P belong to different species within the genus Tobamovirus. PMID:21547441

  6. Influence of medium composition and pH on the production of polygalacturonases by Aspergillus oryzae

    Eloane Malvessi; Mauricio Moura da Silveira

    2004-01-01

    A liquid medium containing wheat bran, salts and a source of inducer (pectin) was found to be suitable for the production of exo- and endo-polygalacturonases by Aspergillus oryzae CCT3940. Induction of polygalacturonases by purified pectin was significantly higher than when rinds of citrus fruits were used as inducer. A. oryzae growth was favoured by pH close to 4, although a drop of pH to around 3 was needed for enzymes production. Afterwards, decreasing activities were observed with the nor...

  7. Influence of carbon source on alpha-amylase production by Aspergillus oryzae

    Carlsen, Morten; Nielsen, Jens

    2001-01-01

    The influence of the carbon source on a-amylase production by Aspergillus oryzae was quantified in carbon-limited chemostat cultures. The following carbon sources were investigated: maltose, maltodextrin (different chain lengths), glucose, fructose, galactose, sucrose, glycerol, mannitol and...... acetate. A. oryzae did not grow on galactose as the sole carbon source, but galactose was co-metabolized together with glucose. Relative to that on low glucose concentration (below 10 mg/l), productivity was found to be higher during growth on maltose and maltodextrins, whereas it was lower during growth...

  8. Polyol accumulation by Aspergillus oryzae at low water activity in solid-state fermentation

    Ruijter, G J G; J. Visser; Rinzema, A.

    2004-01-01

    Polyol accumulation and metabolism were examined in Aspergillus oryzae cultured on whole wheat grains or on wheat dough as a model for solid-state culture. In solid-state fermentation (SSF), water activity (a(w)) is typically low resulting in osmotic stress. In addition to a high level of mannitol, which is always present in the cells, A. oryzae accumulated high concentrations of glycerol, erythritol and arabitol at relatively low a(w) (0(.)96-0(.)97) in SSF. Accumulation of such a mixture of...

  9. SET DOMAIN GROUP 708, a histone H3 lysine 36-specific methyltransferase, controls flowering time in rice (Oryza sativa).

    Liu, Bing; Wei, Gang; Shi, Jinlei; Jin, Jing; Shen, Ting; Ni, Ting; Shen, Wen-Hui; Yu, Yu; Dong, Aiwu

    2016-04-01

    As a key epigenetic modification, the methylation of histone H3 lysine 36 (H3K36) modulates chromatin structure and is involved in diverse biological processes. To better understand the language of H3K36 methylation in rice (Oryza sativa), we chose potential histone methylation enzymes for functional exploration. In particular, we characterized rice SET DOMAIN GROUP 708 (SDG708) as an H3K36-specific methyltransferase possessing the ability to deposit up to three methyl groups on H3K36. Compared with the wild-type, SDG708-knockdown rice mutants displayed a late-flowering phenotype under both long-day and short-day conditions because of the down-regulation of the key flowering regulatory genes Heading date 3a (Hd3a), RICE FLOWERING LOCUS T1 (RFT1), and Early heading date 1 (Ehd1). Chromatin immunoprecipitation experiments indicated that H3K36me1, H3K36me2, and H3K36me3 levels were reduced at these loci in SDG708-deficient plants. More importantly, SDG708 was able to directly target and effect H3K36 methylation on specific flowering genes. In fact, knockdown of SDG708 led to misexpression of a set of functional genes and a genome-wide decrease in H3K36me1/2/3 levels during the early growth stages of rice. SDG708 is a methyltransferase that catalyses genome-wide deposition of all three methyl groups on H3K36 and is involved in many biological processes in addition to flowering promotion. PMID:26639303

  10. AAS Special Session: Policy Making in Astronomy

    Cardelli, J. A.; Massa, D.

    1995-12-01

    The professional astronomical community today is more diverse than at any time in its history. Individuals participating in creative research programs can be found in a wide range of positions. This type of diversity, which mixes research, education, and service (e.g. contract) work, represents the strength of contemporary astronomy. While recognizing the unavoidable reductions in funding and restructuring of organizations like NASA, it is imperative that the significance of the current diversity be considered during these processes. Creative ideas are one of the cornerstones of quality research, and they can originate anywhere. Consequently, it is essential that adequate research resources remain available for free and open competition by all astronomers. Our goal in this session is to bring together officials from the AAS, NASA, and the NSF to discuss how the policy and decision making process operates and whether it should be changed to better serve the general needs of the professional astronomical community. Examples of the issues we believe are important include: In establishing new policy, how can the needs of the average research astronomer be better addressed? How could input from such astronomers be provided to those who craft NASA/NSF policy? How can/should the AAS serve as an interface between policy/decision making bodies and its membership? Should the AAS membership become more actively/effectively involved in the decision making process and, if so, how? More information on this session and related issues can be found at the Association of Research Astronomers Home Page: http://www.phy.vill.edu/astro/faculty/ara/ara_home.htm

  11. NCBI nr-aa BLAST: CBRC-OSAT-02-0002 [SEVENS

    Full Text Available CBRC-OSAT-02-0002 ref|NP_001045675.1| Os02g0115900 [Oryza sativa (japonica cultivar-group)] dbj| ... BAD07938.1| putative dnaK-type molecular ... chaperone BiP [Oryza sativa (japonica cultivar-gro ... up)] dbj|BAD07713.1| putative dnaK-type molecular ... chaperone BiP [Oryza sativa (japonica cultivar-gro ...

  12. Simon van der Meer in the AA Control Room

    1984-01-01

    Simon van der Meer, spiritus rector of the Antiproton Accumulator, in the AA Control Room. Inventor of stochastic cooling, on which the AA was based, and of the magnetic horn, with which the antiprotons were focused, he also wrote most of the software with which the AA was controlled, and spent uncountable numbers of hours in this chair to tickle the AA to top performance. 8 months after this picture was taken, he received, in October 1984, the Nobel prize, together with Carlo Rubbia, the moving force behind the whole Proton-Antiproton Collider project that led to the discovery, in 1983, of the W and Z intermediate bosons.

  13. Flow Injection and Atomic Absorption Spectrometry (FI-AAS) -

    Hansen, Elo Harald

    1996-01-01

    absorption spectrometry (AAS). Initially with flame-AAS (fAAS) procedures, later for hydride generation (HG) techniques, and most recently in combination with electrothermal AAS (ETAAS). The common denominator for all these procedures is the inherently precise and strictly reproducible timing in FI from the......One of the advantages of the flow injection (FI) concept is that it is compatible with virtually all detection techniques. Being a versatile vehicle for enhancing the performance of the individual detection devices, the most spectacular results have possibly been obtained in conjunction with atomic...

  14. AA, Inner Conductor of Magnetic Horn

    1979-01-01

    Antiprotons emerging at large angles from the production target (hit by an intense 26 GeV proton beam from the PS), were focused into the acceptance of the injection line of the AA by means of a "magnetic horn" (current-sheet lens). Here we see an early protype of the horn's inner conductor, machined from solid aluminium to a thickness of less than 1 mm. The 1st version had to withstand pulses of 150 kA, 15 us long, every 2.4 s. See 8801040 for a later version.

  15. Wooden Model of Wide AA Bending Magnet

    1978-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets: BLG, long and narrow; BST, short and wide). A wide one had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. A wooden model was build in 1978, to gain dimensional experience. Here, Peter Zettwoch, one of the largest men at CERN at that time, is putting a hand in the mouth of the wooden BST monster.

  16. Atlas of Vega: 3850 -- 6860 \\AA

    Kim, Hyun-Sook; Valyavin, G; Lee, Byeong-Cheol; Shimansky, V; Galazutdinov, G A

    2009-01-01

    We present a high resolving power ($\\lambda$ / $\\Delta\\lambda$ = 90,000) and high signal-to-noise ratio ($\\sim$700) spectral atlas of Vega covering the 3850 -- 6860 \\AA wavelength range. The atlas is a result of averaging of spectra recorded with the aid of the echelle spectrograph BOES fed by the 1.8-m telescope at Bohyunsan observatory (Korea). The atlas is provided only in machine-readable form (electronic data file) and will be available in the SIMBAD database upon publication.

  17. Experimental immunologically mediated aplastic anemia (AA) in mice: cyclosporin A fails to protect against AA

    Immunologically mediated aplastic anemia (AA) in mice was induced by the i.v. injection of 10(7) lymph node cells (LNC) from H-2k identical but Mls mismatched CBA/J donor mice into previously irradiated (600 rad total body gamma) C3H/HeJ mice. Cyclosporin A (CsA), 25 mg/kg, was administered subcutaneously from day -1 to day 30. Control mice included C3H/HeJ mice which received 600 rad alone, C3H/HeJ mice which received 600 rad plus CsA as above, and C3H/HeJ mice which received 600 rad total body irradiation followed by 10(7) LNC from CBA/J donors. CsA failed to prevent lethal AA. These results suggest that the pathogenetic mechanisms operating in immunologically mediated AA differ from the mechanisms operating in rodents transplanted with allogeneically mismatched marrow or spleen cells which develop graft-versus-host disease. The results are consistent with a non-T cell-dependent mechanism causing the AA

  18. Study on Fabrication of AA4032/AA6069 Cladding Billet Using Direct Chill Casting Process

    Han, Xing; Zhang, Haitao; Shao, Bo; Li, Lei; Liu, Xuan; Cui, Jianzhong

    2016-04-01

    AA4032/AA6069 cladding billet in size of φ130 mm/φ110 mm was prepared by the modified direct chill casting process, and the parametric effect on casting performance was investigated using numerical simulation. Microstructures, elements distribution, and mechanical properties of the bonding interface were examined. The results show that metallurgical bonding interface can be obtained with the optimal parameters: the casting speed of 130 to 140 mm/min, the internal liquid level height of 50 to 60 mm, and the contact height of 40 to 50 mm. The metallurgical bonding interface is free of any discontinuities due to the fact that the alloying elements diffused across the interface and formed Ni-containing phase. Tensile strength of the cladding billet reaches 225.3 MPa, and the fracture position was located in AA6069 side, suggesting that the interface bonding strength is higher than the strength of AA6069. The interfacial shearing strength is 159.3 MPa, indicating excellent metallurgical bonding.

  19. Genome-Wide Association of Body Fat Distribution in African Ancestry Populations Suggests New Loci

    Liu, Ching-Ti; Keri L Monda; Taylor, Kira C.; Lange, Leslie; Demerath, Ellen W; Palmas, Walter; Wojczynski, Mary K.; Jaclyn C Ellis; Mara Z Vitolins; Liu, Simin; Papanicolaou, George J.; Irvin, Marguerite R.; Xue, Luting; Griffin, Paula J.; Michael A Nalls

    2013-01-01

    Central obesity, measured by waist circumference (WC) or waist-hip ratio (WHR), is a marker of body fat distribution. Although obesity disproportionately affects minority populations, few studies have conducted genome-wide association study (GWAS) of fat distribution among those of predominantly African ancestry (AA). We performed GWAS of WC and WHR, adjusted and unadjusted for BMI, in up to 33,591 and 27,350 AA individuals, respectively. We identified loci associated with fat distribution in...

  20. Patogenicidade de Helminthosporium oryzae a algumas espécies de gramíneas Pathogenicity of Helminthosporium oryzae against some grass species

    V.H. Artigiani Filho

    1995-04-01

    Full Text Available O fungo Helminthosporium oryzae é um patógeno do arroz. Devido a sua variabilidade patogênica, foi investigada a possibilidade deste fungo infectar outras gramíneas. Através de inoculação artificial, ficou demonstrada a capacidade deste patógeno provocar infecção em aveia, cana, centeio, sorgo, trigo, Brachiaria decumbens e Panicum maximum. Assim, estas espécies vegetais podem ser consideradas potenciais hospedeiros do fungo na natureza.Helminthosporium oryzae is a rice pathogen. Due to its variability in pathogenicity, the possibility of this fungus Infecting other grasses was investigated. The capacity of this pathogen was demonstrated to be able to infect oat, sugar-cane, rye, sorghum, wheat, Brachiaria decumbens and Panicum maximum through artificial inoculations. Therefore, those plant species can be considered potencial hosts for the fungus in nature.

  1. Cloning, expression, crystallization and preliminary X-ray crystallographic analysis of the co-chaperonin XoGroES from Xanthomonas oryzae pv. oryzae

    Bacterial blight, an infectious disease caused by X. oryzae pv. oryzae (Xoo), causes huge rice-production losses in most rice-cultivating countries. The co-chaperonin of Xoo, XoGroES, an important protein for protein folding, was cloned from Xoo, purified and crystallized for atomic resolution structure determination. Bacterial blight (BB), a devastating disease caused by Xanthomonas oryzae pv. oryzae (Xoo), causes serious production losses of rice in Asian countries. Protein misfolding may interfere with the function of proteins in all living cells and must be prevented to avoid cellular disaster. All cells naturally contain molecular chaperones that assist the unfolded proteins in folding into the native structure. One of the well characterized chaperone complexes is GroEL–GroES. GroEL, which consists of two chambers, captures misfolded proteins and refolds them. GroES is a co-chaperonin protein that assists the GroEL protein as a lid that temporarily closes the chamber during the folding process. Xoo4289, the GroES gene from Xoo, was cloned and expressed for X-ray crystallographic study. The purified protein (XoGroES) was crystallized using the hanging-drop vapour-diffusion method and a crystal diffracted to 2.0 Å resolution. The crystal belonged to the hexagonal space group P61, with unit-cell parameters a = 64.4, c = 36.5 Å. The crystal contains a single molecule in the asymmetric unit, with a corresponding VM of 2.05 Å3 Da−1 and a solvent content of 39.9%

  2. Cloning, expression, crystallization and preliminary X-ray crystallographic analysis of β-ketoacyl-ACP synthase III (FabH) from Xanthomonas oryzae pv. oryzae

    The ketoacyl-acyl carrier protein synthase III (KASIII) encoded by the fabH gene of X. oryzae pv. oryzae is responsible for elongation by two C atoms in fatty-acid synthesis. The fabH gene was cloned, the KASIII enzyme was expressed and preliminary crystallographic study was performed with the aim of understanding the reaction mechanism. The bacterial β-ketoacyl-ACP synthase III (KASIII) encoded by the gene fabH (Xoo4209) from Xanthomonas oryzae pv. oryzae, a plant pathogen, is an important enzyme in the elongation steps of fatty-acid biosynthesis. It is expected to be one of the enzymes responsible for bacterial blight (BB), a serious disease that results in huge production losses of rice. As it represents an important target for the development of new antibacterial drugs against BB, determination of the crystal structure of the KAS III enzyme is essential in order to understand its reaction mechanism. In order to analyze the structure and function of KAS III, the fabH (Xoo4209) gene was cloned and the enzyme was expressed and purified. The KASIII crystal diffracted to 2.05 Å resolution and belonged to the orthorhombic space group P21212, with unit-cell parameters a = 69.8, b = 79.5, c = 62.3 Å. The unit-cell volume of the crystal is compatible with the presence of a single monomer in the asymmetric unit, with a corresponding Matthews coefficient VM of 2.27 Å3 Da−1 and a solvent content of 45.8%

  3. Applications of the double-barreled data in whole-genome shotgun sequence assembly and analysis

    HAN Yujun; WANG Jing; GU Xiaocheng; YU Jun; LI Songgang; NI Peixiang; L(U) Hong; YE Jia; HU Jianfei; CHEN Chen; HUANG Xiangang; CONG Lijuan; LI Guangyuan

    2005-01-01

    Double-barreled (DB) data have been widely used for the assembly of large genomes. Based on the experience of building the whole-genome working draft of Oryza sativa L.ssp. Indica, we present here the prevailing and improved uses of DB data in the assembly procedure and report on novel applications during the following data-mining processes such as acquiring precise insert fragment information of each clone across the genome, and a new kind of Iow-cost whole-genome microarray. With the increasing number of organisms being sequenced,we believe that DB data will play an important role both in other assembly procedures and infuture genomic studies.

  4. Expression of Magnaporthe oryzae genes encoding cysteine-rich proteins secreted during nitrogen starvation and interaction with its host, Oryza sativa.

    Yang, J; Liang, M L; Yan, J L; Yang, Y Q; Liu, L; Liu, C; Yang, L J; L, C Y

    2015-01-01

    Previous studies have shown that the blast fungus, Magnaporthe oryzae, may experience nitrogen starvation during infection of its plant host (rice,Oryza sativa). Here, we studied the expression of seven genes encoding cysteine-rich proteins with N-terminal signal peptides during nitrogen limitation and throughout the infection process. Some genes were upregulated to a greater extent in weak pathogenic strains than in strong pathogenic strains when they were cultured in complete media, and the expression of some genes was higher in both weak and strong pathogenic strains cultured in 1/10-N and nitrogen starvation media. Furthermore, the expression of these genes was upregulated to different extents in the early stages of M. oryzae infection. These data demonstrate that the genes of interest are highly expressed in weak and strong pathogenic strains cultured under nitrogen limitation and at the early stage of the infection process. This indicates that cysteine-rich secreted proteins in the blast fungus might be involved in establishing disease in the host and that they are sensitive to nitrogen levels. Thus, their role in sensing nitrogen availability within the host is implied, which provides a basis for further functional identification of these genes and their products during plant infection. PMID:26681057

  5. DNA Microarray and Gene Ontology Enrichment Analysis Reveals That a Mutation in opsX Affects Virulence and Chemotaxis in Xanthomonas oryzae pv. oryzae

    Kim, Hong-Il; Park, Young-Jin

    2016-01-01

    Xanthomonas oryzae pv. oryzae (Xoo) causes bacterial leaf blight (BLB) in rice (Oryza sativa L.). In this study, we investigated the effect of a mutation in opsX (XOO1056), which encodes a saccharide biosynthesis regulatory protein, on the virulence and bacterial chemotaxis of Xoo. We performed DNA microarray analysis, which showed that 63 of 2,678 genes, including genes related to bacterial motility (flagellar and chemotaxis proteins) were significantly downregulated (<−2 log2 fold changes) by the mutation in opsX. Indeed, motility assays showed that the mutant strain was nonmotile on semisolid agar swarm plates. In addition, a mutant strain (opsX::Tn5) showed decreased virulence against the susceptible rice cultivar, IR24. Quantitative real-time RT-PCR reaction was performed to confirm the expression levels of these genes, including those related to flagella and chemotaxis, in the opsX mutant. Our findings revealed that mutation of opsX affects both virulence and bacterial motility. These results will help to improve our understanding of Xoo and provide insight into Xoo-rice interactions. PMID:27298594

  6. The durably resistant rice cultivar Digu activates defence gene expression before the full maturation of Magnaporthe oryzae appressorium.

    Li, Weitao; Liu, Ya; Wang, Jing; He, Min; Zhou, Xiaogang; Yang, Chao; Yuan, Can; Wang, Jichun; Chern, Mawsheng; Yin, Junjie; Chen, Weilan; Ma, Bingtian; Wang, Yuping; Qin, Peng; Li, Shigui; Ronald, Pamela; Chen, Xuewei

    2016-04-01

    Rice blast caused by the fungal pathogen Magnaporthe oryzae is one of the most destructive diseases worldwide. Although the rice-M. oryzae interaction has been studied extensively, the early molecular events that occur in rice before full maturation of the appressorium during M. oryzae invasion are unknown. Here, we report a comparative transcriptomics analysis of the durably resistant rice variety Digu and the susceptible rice variety Lijiangxintuanheigu (LTH) in response to infection by M. oryzae (5, 10 and 20 h post-inoculation, prior to full development of the appressorium). We found that the transcriptional responses differed significantly between these two rice varieties. Gene ontology and pathway analyses revealed that many biological processes, including extracellular recognition and biosynthesis of antioxidants, terpenes and hormones, were specifically activated in Digu shortly after infection. Forty-eight genes encoding receptor kinases (RKs) were significantly differentially regulated by M. oryzae infection in Digu. One of these genes, LOC_Os08g10300, encoding a leucine-rich repeat RK from the LRR VIII-2 subfamily, conferred enhanced resistance to M. oryzae when overexpressed in rice. Our study reveals that a multitude of molecular events occur in the durably resistant rice Digu before the full maturation of the appressorium after M. oryzae infection and that membrane-associated RKs play important roles in the early response. PMID:26095454

  7. Agrobacterium tumefaciens-mediated transformation: An efficient tool for insertional mutagenesis and targeted gene disruption in Harpophora oryzae.

    Liu, Ning; Chen, Guo-Qing; Ning, Guo-Ao; Shi, Huan-Bin; Zhang, Chu-Long; Lu, Jian-Ping; Mao, Li-Juan; Feng, Xiao-Xiao; Liu, Xiao-Hong; Su, Zhen-Zhu; Lin, Fu-Cheng

    2016-01-01

    The endophytic filamentous fungus Harpophora oryzae is a beneficial endosymbiont isolated from the wild rice. H. oryzae could not only effectively improve growth rate and biomass yield of rice crops, but also induce systemic resistance against the rice blast fungus, Magnaporthe oryzae. In this study, Agrobacterium tumefaciens-mediated transformation (ATMT) was employed and optimized to modify the H. oryzae genes by either random DNA fragment integration or targeted gene replacement. Our results showed that co-cultivation of H. oryzae conidia with A. tumefaciens in the presence of acetosyringone for 48 h at 22 °C could lead to a relatively highest frequency of transformation, and 200 μM acetosyringone (AS) pre-cultivation of A. tumefaciens is also suggested. ATMT-mediated knockout mutagenesis was accomplished with the gene-deletion cassettes using a yeast homologous recombination method with a yeast-Escherichia-Agrobacterium shuttle vector pKOHo. Using the ATMT-mediated knockout mutagenesis, we successfully deleted three genes of H. oryzae (HoATG5, HoATG7, and HoATG8), and then got the null mutants ΔHoatg5, ΔHoatg7, and ΔHoatg8. These results suggest that ATMT is an efficient tool for gene modification including randomly insertional mutagenesis and gene deletion mutagenesis in H. oryzae. PMID:26686612

  8. RSIADB, a collective resource for genome and transcriptome analyses in Rhizoctonia solani AG1 IA

    Chen, Lei; Ai, Peng; Zhang, Jinfeng; Deng, Qiming; Wang, Shiquan; Li, Shuangcheng; Zhu, Jun; Li, Ping; Zheng, Aiping

    2016-01-01

    Rice [Oryza sativa (L.)] feeds more than half of the world’s population. Rhizoctonia solani is a major fungal pathogen of rice causing extreme crop losses in all rice-growing regions of the world. R. solani AG1 IA is a major cause of sheath blight in rice. In this study, we constructed a comprehensive and user-friendly web-based database, RSIADB, to analyse its draft genome and transcriptome. The database was built using the genome sequence (10 489 genes) and annotation information for R. sol...

  9. EFEITO DO TRATAMENTO QUÍMICO DE SEMENTES NO CONTROLE DE BRUSONE (Pyricularia oryzae) E MANCHA PARDA (Helminthosporium oryzae) DO ARROZ EFFECT OF CHEMICAL SEED TREATMENT IN THE CONTROL OF BLAST DISEASE AND BROWN SPOT OF RICE

    Wilson Ferreira de Oliveira; Valácia Lemes da Silva; Meire Aparecida Damaceno

    2007-01-01

    Com o objetivo de controlar brusone (Pyricularia oryzae) e mancha parda (Helminthosporium oryzae) do arroz (Oryza sativa), diferentes fungicidas foram testados, através do tratamento de sementes, a nível de campo em solo de várzea (glei pouco húmico). Os resultados mostraram, preliminarmente e de modo geral, que os fungicidas dichlofluanid e terbuconazole propiciaram aumento no “stand” superiores a 30% quando compar...

  10. Role of the MoYAK1 protein kinase gene in Magnaporthe oryzae development and pathogenicity.

    Han, Joon-Hee; Lee, Hye-Min; Shin, Jong-Hwan; Lee, Yong-Hwan; Kim, Kyoung Su

    2015-11-01

    Conidiation and appressorium differentiation are key processes for polycyclic dissemination and infection in many pathogens. Our previous study using DNA microarray led to the discovery of the MoYAK1 gene in Magnaporthe oryzae that is orthologous to YAK1 in Saccharomyces cerevisiae. Although the mechanistic roles of YAK1 in S. cerevisiae have been described, roles of MoYAK1 in M. oryzae, a phytopathogenic fungus responsible for rice blast, remain uncharacterized. Targeted disruption of MoYAK1 results in pleiotropic defects in M. oryzae development and pathogenicity. The ΔMoyak1 mutant exhibits a severe reduction in aerial hyphal formation and conidiation. Conidia in the ΔMoyak1 are delayed in germination and demonstrate decreased glycogen content in a conidial age-dependent manner. The expression of hydrophobin-coding genes is dramatically changed in the ΔMoyak1 mutant, leading to a loss of surface hydrophobicity. Unlike the complete inability of the ΔMoyak1 mutant to develop appressoria on an inductive surface, the mutant forms appressoria of abnormal morphology in response to exogenous cyclic adenosine-5'-monophosphate and host-driven signals, which are all defective in penetrating host tissues due to abnormalities in glycogen and lipid metabolism, turgor generation and cell wall integrity. These data indicate that MoYAK1 is a protein kinase important for the development and pathogenicity of M. oryzae. PMID:26248223

  11. Natural variation of rice blast resistant gene Pi-ta in Oryza species

    The Pi-ta gene in rice is a putative NBS type cytoplasmic receptor conferring resistance to races of Magnaporthe oryzae in a gene-for-gene manner. A Functional Nucleotide Polymorphism (FNP) change resulting in an amino acid substitution of Alanine to Serine at position 918 (nucleotide G to T at posi...

  12. An unusual ulcer: A case of cutaneous mucormycosis caused by Rhizopus oryzae

    Bradley J. Gardiner

    2015-03-01

    Full Text Available Mucormycoses are high-mortality infections feared by clinicians worldwide. They predominantly affect immunocompromised hosts and are associated with a spectrum of disease. We describe a case of cutaneous mucormycosis caused by Rhizopus oryzae in a patient with multiple risk factors cured with complete surgical excision and a short course of antifungal therapy.

  13. Morphological characterization of recombinant strains of Aspergillus oryzae producing alpha-amylase during batch cultivations

    Spohr, Anders Bendsen; Carlsen, Morten; Nielsen, Jens Bredal;

    1997-01-01

    Three alpha-amylase producing strains of Aspergillus oryzae used for recombinant protein production have been studied with respect to growth and protein production. By comparing the three strains with respect to morphology and protein production it is shown that a morphological mutant with a more...... dense mycelium is more efficient in producing alpha-amylase....

  14. A New Eudesmane Sesquiterpene from Nigrospora oryzae, an Endophytic Fungus of Aquilaria sinensis

    Dongli Li

    2014-07-01

    Full Text Available A new eudesmane-type sesquiterpene, 11 -hydroxy capitulatin B (1 , along with a known related sesquiterpene, capitulatin B (2, was isolated from the endophytic fungus Nigrospora oryzae A8 from Aquilaria sinensis, the only plant resource for agarwood production in China. This research demonstrates that the endophytic fungi from A. sinensis might play a role in the formation of agarwood.

  15. Studying Pellet Formation of a Filamentous Fungus Rhizopus oryzae to Enhance Organic Acid Production

    Liao, Wei; Liu, Yan; Chen, Shulin

    Using pelletized fungal biomass can effectively improve the fermentation performance for most of fugal strains. This article studied the effects of inoculum and medium compositions such as potato dextrose broth (PDB) as carbon source, soybean peptone, calcium carbonate, and metal ions on pellet formation of Rhizopus oryzae. It has been found that metal ions had significantly negative effects on pellet formation whereas soybean peptone had positive effects. In addition PDB and calcium carbonate were beneficial to R. oryzae for growing small smooth pellets during the culture. The study also demonstrated that an inoculum size of less than 1.5×109 spores/L had no significant influence on pellet formation. Thus, a new approach to form pellets has been developed using only PDB, soybean peptone, and calcium carbonate. Meanwhile, palletized fungal fermentation significantly enhanced organic acid production. Lactic acid concentration reached 65.0 g/L in 30 h using pelletized R. oryzae NRRL 395, and fumeric acid concentration reached 31.0 g/L in 96 h using pelletized R. oryzae ATCC 20344.

  16. Toxic effects of essential plant oils in adult Sitophilus oryzae (Linnaeus (Coleoptera, Curculionidae

    Andréa Roveré Franz

    2011-03-01

    Full Text Available Toxic effects of essential plant oils in adult Sitophilus oryzae (Linnaeus (Coleoptera, Curculionidae. Stored grains are subject to losses in quality nutritional value and in sanitation from the time they are stored to the time they are consumed. Botanical insecticides may offer an alternative solution for pest control. The objective was to test the insecticidal properties of the essential oils of Cymbopogon citratus (leaf, Zingiber officinale (root and Mentha sp. (leaf. The efficacy of these oils was tested to control the rice weevil, S. oryzae, using hydrodistillation. Chemical analysis of the essential oils was carried out by gas chromatography. Major components of C. citratus were geranial (48% and neral (31%, of Z. officinale were α-zingibereno (13%, geranial (16%, neral (10% and α-farneseno (5% and of Mentha sp. was menthol (92%. Bioassays were carried out by fumigation and topical application. In topical application assays, the essential oil of C. citratus had greater toxicity (LC50 0.027 µL mL-1 and shorter exposure time than the oils of the other two plants. After 24 h and 48 h, 70% and 100% mortality of S. oryzae occurred, respectively. In fumigation assays, essential oil of Z. officinale had a lower LC50 (1.18 µL cm-2 and 70% mortality after 24 h exposure. Therefore, we recommend the use of essential oils of C. citratus and Z. officinale to control the rice weevil S. oryzae.

  17. Kinetic properties of Rhizopus oryzae RPG1 endo-polygalacturonase hydrolyzing galacturonic acid oligomers

    Future fuel and specialty chemical production will benefit from the use of agricultural biomass. Efficient and effective use of agricultural biomass requires conversion to simple sugars by chemical pre-treatments and enzymes into simple sugars. Rhizopus oryzae, a filamentous fungus, makes enzymes ca...

  18. Transcriptome Analysis of Early Responsive Genes in Rice during Magnaporthe oryzae Infection

    Yiming Wang

    2014-12-01

    Full Text Available Rice blast disease caused by Magnaporthe oryzae is one of the most serious diseases of cultivated rice (Oryza sativa L. in most rice-growing regions of the world. In order to investigate early response genes in rice, we utilized the transcriptome analysis approach using a 300 K tilling microarray to rice leaves infected with compatible and incompatible M. oryzae strains. Prior to the microarray experiment, total RNA was validated by measuring the differential expression of rice defense-related marker genes (chitinase 2, barwin, PBZ1, and PR-10 by RT-PCR, and phytoalexins (sakuranetin and momilactone A with HPLC. Microarray analysis revealed that 231 genes were up-regulated (>2 fold change, p < 0.05 in the incompatible interaction compared to the compatible one. Highly expressed genes were functionally characterized into metabolic processes and oxidation-reduction categories. The oxidative stress response was induced in both early and later infection stages. Biotic stress overview from MapMan analysis revealed that the phytohormone ethylene as well as signaling molecules jasmonic acid and salicylic acid is important for defense gene regulation. WRKY and Myb transcription factors were also involved in signal transduction processes. Additionally, receptor-like kinases were more likely associated with the defense response, and their expression patterns were validated by RT-PCR. Our results suggest that candidate genes, including receptor-like protein kinases, may play a key role in disease resistance against M. oryzae attack.

  19. Measurement and analysis on optical characteristics of Aspergillus oryzae spores in infrared band

    Li, Le; Hu, Yihua; Gu, Youlin; Chen, Wei; Xu, Shilong; Zhao, Xinying

    2015-10-01

    Spore is an important part of bioaerosols. The optical characteristics of spore is a crucial parameter for study on bioaerosols. The reflection within the waveband of 2.5 to15μm were measured by squash method. Based on the measured data, Complex refractive index of Aspergillus oryzae spores within the waveband of 3 to 5μm and 8 to 14 μm were calculated by using Krames-Kronig (K-K) relationship. Then,the mass extinction coefficient of Aspergillus oryzae spores within the waveband of 3 to 5μm and 8 to 14μm were obtained by utilizing Mie scattering theory, and the results were analyzed and discussed. The average mass extinction coefficient of Aspergillus oryzae spores is 0.51 m2/g in the range of 3 to 5μm and 0.48m2/g in the range of 8 to 14μm. Compared with common inorganic compounds, Aspergillus oryzae spores possesses a good extinction performance in infrared band.

  20. Gamma radiation effects on rice, substrate for Sitophilus oryzae (L.) rearing

    The gamma radiation effects (800 Krad, 60Co) on rice are studied. Degraded substances by the radiation and how this degradation affects the biology of Sitophilus oryzae (L.) are searched. The vitamins, proteins and stard of the rice are affected by the radiation. (M.A.C.)

  1. Expression and characterization of fifteen Rhizopus oryzae 99-880 polygalacturonase enzymes in Pichia pastoris

    Polygalacturonase enzymes hydrolyze the long polygalacturonic acid chains found in the smooth regions of pectin. Interest in this enzyme class continues due to their ability to macerate tissues of economically important crops and their use in a number of industrial processes. Rhizopus oryzae has a l...

  2. Polyol accumulation by Aspergillus oryzae at low water activity in solid-state fermentation

    Ruijter, G.J.G.; Visser, J.; Rinzema, A.

    2004-01-01

    Polyol accumulation and metabolism were examined in Aspergillus oryzae cultured on whole wheat grains or on wheat dough as a model for solid-state culture. In solid-state fermentation (SSF), water activity (a(w)) is typically low resulting in osmotic stress. In addition to a high level of mannitol,

  3. Analysis of the temporal variation of radiation balance components in arid rice (Oryza sativa L.) culture

    The time variation of measured radiation balance components in a cultived rice area (Oryza sativa L.) under arid conditions in the Brazil central-west region was analysed. The relation between global solar radiation, radiation balance, reflected radiation and terrestrial effective radiation in three different stages of the culture development: vegetative stage; blooming and maturation, was determined. (M.C.K.)

  4. Production of Ammonium Lactate by Fed-batch Fermentation of Rhizopus oryzae from Corncob Hydrolysate

    BAI Dong-mei; LI Shi-zhong; LIN Fang-qian

    2004-01-01

    L- (+)-Lactic acid production from corncob hydrolysate as a cheap carbohydrate source by fed-batch fermentation of Rhizopus oryzae HZS6 was studied. After 96 h of fermentation in a 5 L fermentor, the final concentration of ammonium L-(+)-lactate, average productivity(based on initial xylose concentration) and max(+)-lactate was 98.8%.

  5. STANDARDIZATION OF METHODOLOGY FOR STUDYING PATHOGENECITY OF XANTHOMONAS CAMPESTRIS PV ORYZAE TO RICE

    Jaya Bhagat*, P Shukla and PK Mishra

    2013-01-01

    Rice is the most important food crop of India and its production has increased significantly during last few years. However, Infection of Xanthomonas campestris pv. Oryzae considerably decrease its productivity. It is important to study pathogenecity of causative organism before any defense strategy is decided. Present paper deals with standardization of technology for microscopic study of pathogen.

  6. Synthesis of quarternary ammonium salts with dithiocarbamate moiety and their antifungal activities against Helminthosporium oryzae

    Mandeep Singh; Anita Garg; Anjali Sidhu; Vineet Kumar

    2013-05-01

    Quaternary ammonium salts containing dithiocarbamate moiety were synthesized and evaluated for their antifungal activities against Helminthosporium oryzae. All the synthesized compounds showed moderate to promising fungitoxicity against the test. Some of the synthesized compounds inflicted antifungal activity greater than the standard fungicide.

  7. Use of Harvested Rice (Oryza Sativa) Fields for Diazinon Runoff Mitigation

    In landscapes defined by intensive agriculture, management practices are often needed to abate effects of potential non-point source pollution. Innovative research focuses on using rice (Oryza sativa), a wetland cereal crop, for pesticide mitigation both pre- and post-harvest. Because rice fields ...

  8. Dicty_cDB: FC-AA22 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA22 (Link to dictyBase) - - - Contig-U14948-1 FC-AA22E (Li...nk to Original site) - - - - - - FC-AA22E 576 Show FC-AA22 Library FC (Link to library) Clone ID FC-AA22 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA22Q.Seq.d/ Representative seq. ID FC-AA...22E (Link to Original site) Representative DNA sequence >FC-AA22 (FC-AA22Q) /CSM/FC/FC-AA/FC-AA22Q.Seq.d/ ATGAA...TACGATGATAGTGATTCAGACTTTTGACCAATTGAAAAAACCAGCAACAGAAATG GTACTGGTTTGGTCTCCTCCACTTTTAAGGTTGCCCCTTCCTTCTCTACCATTCAAAAAC AACAA

  9. Dicty_cDB: FC-AA15 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA15 (Link to dictyBase) - G01144 DDB0204372 Contig-U15089-1 FC-AA...15E (Link to Original site) - - - - - - FC-AA15E 522 Show FC-AA15 Library FC (Link to library) Clone ID FC-AA...9-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA15Q.Se...q.d/ Representative seq. ID FC-AA15E (Link to Original site) Representative DNA sequence >FC-AA15 (FC-AA15Q) /CSM/FC/FC-AA/FC-AA...15Q.Seq.d/ CAAATCACACATAAAAGTTTAATATAAAAATGGGTACACCAATTAAAAAGATTAGTACAG TAATTATTAAAATGGTTTCATCAGCCAA

  10. Dicty_cDB: FC-AA17 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA17 (Link to dictyBase) - - - Contig-U15091-1 FC-AA17E (Li...nk to Original site) - - - - - - FC-AA17E 347 Show FC-AA17 Library FC (Link to library) Clone ID FC-AA17 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA17Q.Seq.d/ Representative seq. ID FC-AA...17E (Link to Original site) Representative DNA sequence >FC-AA17 (FC-AA17Q) /CSM/FC/FC-AA/FC-AA17Q.Seq.d/ CCCAAAAGCCCGTAA...GACTCACTGTGTCAAGTGCAACAAACACACCCCACACAAGGTTAC CCAATACAAAGCTGGTAAACCAAGTCTTTTCGCACAAGGTAAAAGACGTTACGATCGTAA ACAA

  11. Dicty_cDB: FC-AA05 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA05 (Link to dictyBase) - G01143 DDB0190243 Contig-U15085-1 FC-AA...05E (Link to Original site) - - - - - - FC-AA05E 675 Show FC-AA05 Library FC (Link to library) Clone ID FC-AA...5-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA05Q.Se...q.d/ Representative seq. ID FC-AA05E (Link to Original site) Representative DNA sequence >FC-AA05 (FC-AA05Q) /CSM/FC/FC-AA/FC-AA...05Q.Seq.d/ AAACAAAAAAAAAAGGTATGGAAATTTTTGCATTTGTACCATTAGCAGTGTTAACAGCAT TATGTGTTGTTATTTCACTCTTTGTTAAAAGAGAGAAA

  12. Dicty_cDB: FCL-AA23 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA23 (Link to dictyBase) - G01759 DDB0201558 Contig-U15118-1 FCL-AA...23E (Link to Original site) - - - - - - FCL-AA23E 1045 Show FCL-AA23 Library FCL (Link to library) Clone ID FCL-AA...ig-U15118-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...23Q.Seq.d/ Representative seq. ID FCL-AA23E (Link to Original site) Representative DNA sequence >FCL-AA23 (FCL-AA...23Q) /CSM/FCL/FCL-AA/FCL-AA23Q.Seq.d/ ATAACTATATAACTATGTCTAACCAAAAGAAAAACGACGTATCTTCATTTGTTAAAGATT CTTTAA

  13. Dicty_cDB: FC-AA21 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA21 (Link to dictyBase) - - - Contig-U15450-1 FC-AA21E (Li...nk to Original site) - - - - - - FC-AA21E 839 Show FC-AA21 Library FC (Link to library) Clone ID FC-AA21 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA21Q.Seq.d/ Representative seq. ID FC-AA...21E (Link to Original site) Representative DNA sequence >FC-AA21 (FC-AA21Q) /CSM/FC/FC-AA/FC-AA21Q.Seq.d/ AATTATTTTCATTAA...TTTTAGCTTTATTCCTTGTCAACTCCGCTGTTGTCTCTTCACTCG ACTCATGTAGTATTTGTGTTGATTTTGTTGGTAACTCACTCAATGATCTTTTAAATATTA TCCTTAA

  14. Dicty_cDB: FCL-AA22 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA22 (Link to dictyBase) - G01758 DDB0229949 Contig-U15119-1 FCL-AA...22E (Link to Original site) - - - - - - FCL-AA22E 840 Show FCL-AA22 Library FCL (Link to library) Clone ID FCL-AA...g-U15119-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...22Q.Seq.d/ Representative seq. ID FCL-AA22E (Link to Original site) Representative DNA sequence >FCL-AA22 (FCL-AA...22Q) /CSM/FCL/FCL-AA/FCL-AA22Q.Seq.d/ AAAATGAGCAAAATCTCAAGCGACCAAGTTAGATCAATCGTCTCCCAACTTTTCAAAGAA GCACAAGAATCCAAAA

  15. Dicty_cDB: FCL-AA06 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA06 (Link to dictyBase) - G24322 DDB0216974 Contig-U15228-1 FCL-AA...06E (Link to Original site) - - - - - - FCL-AA06E 791 Show FCL-AA06 Library FCL (Link to library) Clone ID FCL-AA...g-U15228-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...06Q.Seq.d/ Representative seq. ID FCL-AA06E (Link to Original site) Representative DNA sequence >FCL-AA06 (FCL-AA...06Q) /CSM/FCL/FCL-AA/FCL-AA06Q.Seq.d/ AAAATCCCAATTTCATTAGCAGTGGAAGTAACGGAATGAATTGGGGTGGTTCTTTGAACA CTTGTGACTCTGGAGGATTCAA

  16. Dicty_cDB: FCL-AA18 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA18 (Link to dictyBase) - G24323 DDB0191144 Contig-U15229-1 FCL-AA...18Z (Link to Original site) - - FCL-AA18Z 623 - - - - Show FCL-AA18 Library FCL (Link to library) Clone ID FCL-AA...g-U15229-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...18Q.Seq.d/ Representative seq. ID FCL-AA18Z (Link to Original site) Representative DNA sequence >FCL-AA18 (FCL-AA...18Q) /CSM/FCL/FCL-AA/FCL-AA18Q.Seq.d/ XXXXXXXXXXGTCAATGTCATTATTGGTGAACAATCTGATGGTTCGTTGGAACAAATCGC TAGAAATCCACAACCAA

  17. Dicty_cDB: FC-AA16 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA16 (Link to dictyBase) - G22556 DDB0204121 Contig-U15090-1 FC-AA...16E (Link to Original site) - - - - - - FC-AA16E 933 Show FC-AA16 Library FC (Link to library) Clone ID FC-AA...0-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA16Q.Se...q.d/ Representative seq. ID FC-AA16E (Link to Original site) Representative DNA sequence >FC-AA16 (FC-AA16Q) /CSM/FC/FC-AA/FC-AA...16Q.Seq.d/ GGGCAGGATCATCATTTAATACTAAAGATTCAACAATAATTGCAAAAACTCAATTTTATC AAAAAAATATTCAAATTTATAAAGGTGATCAA

  18. Evolution of geomagnetic aa index near sunspot minimum

    R. P. Kane

    Full Text Available The smoothed values of the minima of sunspot number Rz and the geomagnetic index aa were compared for sunspot cycles 12–23. In one cycle, aa(min occurred earlier than Rz(min, but remained at that low from a few months before Rz(min to a few months after Rz(min. In two cycles, Rz(min and aa(min coincided within a month or two. In nine cycles, aa(min occurred more than three months later than Rz(min. The aa(min coincided with the minima of some solar radio emission indices originating in the solar corona. For sunspot cycles 21, 22, 23, the minimum of solar wind velocity V occurred 0–9 months later than the aa(min. The minimum of solar wind total magnetic field B occurred near Rz(min. The solar wind ion density N had maxima (instead of minima near Rz(min, and again near Rz(max, indicating a  ~5-year periodicity, instead of an 11-year periodicity. The maxima of aa, V and B occurred near Rz(max and/or later in the declining phase of Rz. The aa index was very well correlated with the functions BV and BV 2.Key words. Geomagnetism and paleomagnetism (time variations, diurnal to secular – time variations, secular and long term Interplanetary physics (interplanetary magnetic field

  19. Genetic and physical mapping of AvrPi7, a novel avirulence gene of Magnaporthe oryzae using physical position-ready markers

    FENG ShuJie; WANG Ling; MA JunHong; LIN Fei; PAN QingHua

    2007-01-01

    Rice blast, caused by the fungal pathogen Magnaporthe oryzae, is one of the most devastating crop diseases worldwide. The avirulence gene corresponding to rice blast resistance gene Pi7 in field isolate CHL346 was inherited as a single gene, designated AvrPi7, in a segregating population consisting of 189 ascospore progenies derived from a cross between field isolates CHL346 and CHL42. In order to determine the chromosomal location of the AvrPi7 locus, a total of 121 simple sequence repeat (SSR) markers were developed based on the whole-genome sequence of reference isolate 70-15 of M. oryzae.Linkage analysis of the locus with these SSR markers showed that eight SSR markers on chromosome1 were linked to the locus, among which the closest flanking markers MS1-9 and MS1-15 were 3.2 and 16.4 cM from the locus, respectively. For fine mapping, additional PCR-based makers including eight SSR markers and three candidate avirulence gene (CAG) markers were developed in the region flanking both markers. The AvrPi7 locus was genetically delimited within a 1.6-cM region flanked by markers MS1-21 and MS1-22, and co-segregated with the marker CAG2. To construct a physical map of the AvrPi7 locus, molecular markers linked to the Avr gene were mapped on the supercontigs of the reference isolate 70-15 through bioinformation analysis (BIA). Consequently, the AvrPi7 locus was delimited to a 75-kb interval flanked by markers MS1-21 and MS1-22 based on the reference sequence.Merodiploids observed in this study are also discussed.

  20. A comparative genomics strategy for targeted discovery of single-nucleotide polymorphisms and conserved-noncoding sequences in orphan crops.

    Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H

    2006-04-01

    Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031

  1. Failure analysis of fusion clad alloy system AA3003/AA6xxx sheet under bending

    Shi, Y., E-mail: shiyh@mcmaster.ca [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada); Jin, H. [Novelis Global Technology Center, P.O. Box 8400, Kingston, Ontario, Canada K7L 5L9 (Canada); Wu, P.D. [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada); Lloyd, D.J. [Aluminum Materials Consultants, 106 Nicholsons Point Road, Bath, Ontario, Canada K0H 1G0 (Canada); Embury, D. [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada)

    2014-07-29

    An ingot of AA6xxx Al–Si–Mg–Cu alloy clad with AA3003 Al–Mn alloy was co-cast by Fusion technology. Bending tests and numerical modeling were performed to investigate the potential for sub-surface cracking for this laminate system. To simulate particle-induced crack initiation and growth, both random and stringer particles have been selected to mimic the particle distribution in the tested samples. The morphology of cracking in the model was similar to that observed in clad sheet tested in the Cantilever bend test. The crack initiated in the core close to the clad-core interface where the strain in the core is highest, between particles or near particles and propagates along local shear bands in the core, while the clad layer experiences extreme thinning before failure.

  2. AA, shims and washers on quadrupole ends

    CERN PhotoLab

    1981-01-01

    Due to the fact that much of the field of the quadrupoles was outside the iron (in particular with the wide quadrupoles) and that thus the fields of quadrupoles and bending magnets interacted, the lattice properties of the AA could not be predicted with the required accuracy. After a first running period in 1980, during which detailed measurements were made with proton test beams, corrections to the quadrupoles were made in 1981, in the form of laminated shims at the ends of the poles, and with steel washers. With the latter ones, further refinements were made in an iterative procedure with measurements on the circulating beam. This eventually resulted, amongst other things, in a very low chromaticity, with the Q-values being constant to within +- 0.001 over the total momentum range of 6 %. Here we see the shims and washers on a narrow qudrupole (QFN, QDN). See also 8103203, 8103204, 8103205, 8103206.

  3. Identification of a Rice stripe necrosis virus resistance locus and yield component QTLs using Oryza sativa × O. glaberrima introgression lines

    Prado Gustavo

    2010-01-01

    Full Text Available Abstract Background Developing new population types based on interspecific introgressions has been suggested by several authors to facilitate the discovery of novel allelic sources for traits of agronomic importance. Chromosome segment substitution lines from interspecific crosses represent a powerful and useful genetic resource for QTL detection and breeding programs. Results We built a set of 64 chromosome segment substitution lines carrying contiguous chromosomal segments of African rice Oryza glaberrima MG12 (acc. IRGC103544 in the genetic background of Oryza sativa ssp. tropical japonica (cv. Caiapó. Well-distributed simple-sequence repeats markers were used to characterize the introgression events. Average size of the substituted chromosomal segments in the substitution lines was about 10 cM and covered the whole donor genome, except for small regions on chromosome 2 and 4. Proportions of recurrent and donor genome in the substitution lines were 87.59% and 7.64%, respectively. The remaining 4.78% corresponded to heterozygotes and missing data. Strong segregation distortion was found on chromosomes 3 and 6, indicating the presence of interspecific sterility genes. To illustrate the advantages and the power of quantitative trait loci (QTL detection using substitution lines, a QTL detection was performed for scored traits. Transgressive segregation was observed for several traits measured in the population. Fourteen QTLs for plant height, tiller number per plant, panicle length, sterility percentage, 1000-grain weight and grain yield were located on chromosomes 1, 3, 4, 6 and 9. Furthermore, a highly significant QTL controlling resistance to the Rice stripe necrosis virus was located between SSR markers RM202-RM26406 (44.5-44.8 cM on chromosome 11. Conclusions Development and phenotyping of CSSL libraries with entire genome coverage represents a useful strategy for QTL discovery. Mapping of the RSNV locus represents the first identification

  4. Electrochemical characterisation of aluminium AA7075-T6 and solution heat treated AA7075 using a micro-capillary cell

    Localised corrosion of 7xxx aluminium alloys initiates at cathodic intermetallics containing Cu and Fe due to a strong galvanic coupling with the matrix. In order to study this galvanic coupling, the electrochemical behaviour of AA7075-T6 and solution heat treated AA7075 has been investigated by means of complementary techniques: micro-capillary cell, scanning Kelvin probe force microscopy (SKPFM) and scanning electron microscopy (SEM). Characterisation with the micro-capillary cell showed that the intermetallics cause a more cathodic breakdown potential in the solution heat treated AA7075 compared with the AA7075-T6. This is associated with a higher Volta potential difference between the intermetallics and the matrix in the solution heat treated AA7075, indicating a stronger galvanic coupling for this temper. From these results, it is concluded that the breakdown potential of areas containing the intermetallics is related to the Volta potential difference between the intermetallics and the matrix

  5. NCBI nr-aa BLAST: CBRC-ATHA-03-0013 [SEVENS

    Full Text Available CBRC-ATHA-03-0013 dbj|BAC81152.1| putative sex ... determination protein tasselseed 2 [Oryza sativa ... japonica cultivar-group)] dbj|BAD31435.1| putative sex ... determination protein tasselseed 2 [Oryza sativa ( ...

  6. Tc1-like transposable elements in plant genomes

    2014-01-01

    Background The Tc1/mariner superfamily of transposable elements (TEs) is widespread in animal genomes. Mariner-like elements, which bear a DDD triad catalytic motif, have been identified in a wide range of flowering plant species. However, as the founding member of the superfamily, Tc1-like elements that bear a DD34E triad catalytic motif are only known to unikonts (animals, fungi, and Entamoeba). Results Here we report the identification of Tc1-like elements (TLEs) in plant genomes. These elements bear the four terminal nucleotides and the characteristic DD34E triad motif of Tc1 element. The two TLE families (PpTc1, PpTc2) identified in the moss (Physcomitrella patens) genome contain highly similar copies. Multiple copies of PpTc1 are actively transcribed and the transcripts encode intact full length transposase coding sequences. TLEs are also found in angiosperm genome sequence databases of rice (Oryza sativa), dwarf birch (Betula nana), cabbage (Brassica rapa), hemp (Cannabis sativa), barley (Hordium valgare), lettuce (Lactuta sativa), poplar (Populus trichocarpa), pear (Pyrus x bretschneideri), and wheat (Triticum urartu). Conclusions This study extends the occurrence of TLEs to the plant phylum. The elements in the moss genome have amplified recently and may still be capable of transposition. The TLEs are also present in angiosperm genomes, but apparently much less abundant than in moss. PMID:24926322

  7. Methodical characterization of rice ( Oryza sativa bran oil from Pakistan

    Mahmood, Zahid

    2005-06-01

    Full Text Available The hexane-extracted oil content of four varieties of rice (Oryza sativa viz. Super Kernel, 386, 385 and Basmati, bran was ranged 14.70-19.10 %. Other physical and chemical parameters of the extracted oils were as follow: Iodine value 112.40, 109.80, 105.1 and 103.70; refractive index ( 40 °C 1.4650, 1.4680, 1.4657 and 1.4660; density ( 40 °C 0.919, 0.913, 0.909 and 0.911; saponification value 183, 177, 186 and 190; unsaponifiable matter 6.15, 5.60, 4.98 and 5.40 % respectively. Tocopherols ( α, γ and δ in the oils were: 284.00, 175.12, 180.42, 300.06; 83.40, 98.70, 120.70, 90.60; 75.16, 57.20, 39.32, 83.00 mg/kg respectively. The contents of tocotrienols ( α, γ and δ in the oils were: 120.30, 106.00, 95.20, 135.74; 196.00, 125.00, 210.0, 276.41; 72.50, 20.00, 39.30, 64.00 mg/kg respectively. The amount of γ - Oryzanol in the investigated oils was ranged 415.12-802.05 The induction periods (Rancimat, 20 L/h, 120 °C of the crude oils were 6.81, 5.99, 6.39 and 7.40 h respectively. The major sterol fractions of the oils consisted of campesterol ranged (10.10-19.20%, stigmasterol (14.00-19.28 %, b -sitosterol (49.30-58.20 %, and D5 ,avenasterol (8.14-13.05 %. The investigated varieties ( Super Kernel, 386, 385 and Basmati of rice bran oil were found to contain high levels of oleic acid 42.67, 38.59, 40.68 and 36.78 % followed by linoleic and palmitic acids 31.58, 33.80, 28.70, 30.51 and 17.00, 14.88, 19.63, 20.00 % respectively. The contents of myristic, stearic and arachidic acids was 1.50, 2.02, 4.28, 1.00; 2.64, 2.87, 4.02, 7.48; and 1.28, 3.00, 1.00, 1.00 % respectively. A number of parameters of the investigated rice bran oils indigenous to Pakistan were comparable to those of typical rice bran and some other vegetable oils, reported in the literature. The results of the present analysis as compared with those of different vegetable oils demonstrated rice bran to be a potential oil source and thus could be useful

  8. Variability in aggressiveness of rice blast (Magnaporthe oryzae) isolates originating from rice leaves and necks: a case of pathogen specialization?

    Ghatak, Abhijeet; Savary, Serge; Kumar, Jatinder

    2013-01-01

    Rice blast, caused by Magnaporthe oryzae, causes yield losses associated with injuries on leaves and necks, the latter being in general far more important than the former. Many questions remain on the relationships between leaf and neck blast, including questions related to the population biology of the pathogen. Our objective was to test the hypothesis of adaptation of M. oryzae isolates to the type of organ they infect. To that aim, the components of aggressiveness of isolates originating f...

  9. South-East Asia is the center of origin, diversity and dispersion of the rice blast fungus, Magnaporthe oryzae

    Saleh, Dounia; Milazzo, Joëlle; Adreit, Henri; Fournier, Elisabeth; Tharreau, Didier

    2013-01-01

    Inferring invasion routes and identifying reservoirs of diversity of plant pathogens are essential in proposing new strategies for their control. Magnaporthe oryzae, the fungus responsible for rice blast disease, has invaded all rice growing areas. Virulent genotypes regularly (re)emerge, causing rapid resistance breakdowns. However, the world-wide genetic subdivision of M. oryzae populations on rice and its past history of invasion have never been elucidated. In order to investigate the cent...

  10. Over-expression of gluconic acid in Aspergillus oryzae RP-21 mutants generated by a random mutagenesis approach

    Raksha, Sunhare; Srinivasan, Sharmila; Prasant, Garima; Prabu, Rajagopalan

    2012-01-01

    Random mutagenesis with N-methyl-N′ nitro-N-nitrosoguanidine (NTG) was used to mutate Aspergillus oryzae RP-21 to develop high gluconic acid-producing mutants. Forty mutant colonies (designated as A. oryzae strains RP-NTG-01 to RP-NTG-40) screened for gluconic acid, glucose dehydrogenase and glucose oxidase production using a 12-well plate method showed that 17 strains (positive mutants) produced high concentrations of these three products, whereas 12 strains (negative mutants) showed low con...

  11. A MAP kinase gene, BMK1, is required for conidiation and pathogenicity in the rice leaf spot pathogen Bipolaris oryzae.

    Moriwaki, Akihiro; Kihara, Junichi; Mori, Chie; Arase, Sakae

    2007-01-01

    We isolated and characterized BMK1, a gene encoding a mitogen-activated protein kinase (MAPK), from the rice leaf spot pathogen Bipolaris oryzae. The deduced amino acid sequence showed significant homology with Fus3/Kss1 MAPK homologues from other phytopathogenic fungi. The BMK1 disruptants showed impaired hyphal growth, no conidial production, and loss of virulence against rice leaves, indicating that the BMK1 is essential for conidiation and pathogenicity in B. oryzae. PMID:16546358

  12. Comparative study on the antifungal activity of hydroalcoholic extract of Iranian Propolis and Royal jelly against Rhizopus oryzae

    Moghim Hassan; Taghipoor Simin; Shahinfard Najmeh; Kheiri Soleiman; Khabbazi Hamideh

    2015-01-01

    Introduction: Mucormycosis is an opportunistic fungal infection. Rhizopus oryzae is major cause of mucormycosis in humans. This disease is the most common form of the acute fungal infection with rapid progress. Iranian Propolis extract and Royal jelly are honey bee products which have been used by human over the past centuries in traditional medicine. In this study the effects of Iranian Propolis and Royal jelly were investigated against Rhizopus oryzae and Candida albicans. Methods: The used...

  13. A Pmk1-Interacting Gene Is Involved in Appressorium Differentiation and Plant Infection in Magnaporthe oryzae

    Zhang, Haifeng; Xue, Chaoyang; Kong, Lingan; Li, Guotian; Xu, Jin-Rong

    2011-01-01

    In the rice blast fungus Magnaporthe oryzae, the PMK1 mitogen-activated protein (MAP) kinase gene regulates appressorium formation and infectious growth. Its homologs in many other fungi also play critical roles in fungal development and pathogenicity. However, the targets of this important MAP kinase and its interacting genes are not well characterized. In this study, we constructed two yeast two-hybrid libraries of M. oryzae and screened for Pmk1-interacting proteins. Among the nine Pmk1-in...

  14. Antifungal Activity of Colistin against Mucorales Species In Vitro and in a Murine Model of Rhizopus oryzae Pulmonary Infection▿

    Ben-Ami, Ronen; Lewis, Russell E.; Tarrand, Jeffrey; Leventakos, Konstantinos; Kontoyiannis, Dimitrios P.

    2009-01-01

    In immunosuppressed hosts, mucormycosis is a life-threatening infection with few treatment options. We studied the activity of colistin (polymyxin E) against Mucorales species in vitro and in a murine model of pulmonary Rhizopus oryzae infection. Colistin exhibited fungicidal activity in vitro against Mucorales spores and mycelia. At the colistin MIC, initial R. oryzae hyphal damage was followed by rapid regrowth; however, regrowth was prevented by combining colistin with a subinhibitory conc...

  15. Uji Antagonisme Jamur Endofit Dari Tanaman Padi Terhadap Cercospora oryzae Miyake dan Curvularia lunata (Wakk) Boed. di Laboratorium

    Manurung, Ida Rumia

    2015-01-01

    Ida Rumia Manurung. 2014. “Antagonism Test Between Endophytic Fungi From Rice Against Cercospora oryzae Miyake and Curvularia lunata (Wakk) Boed. in Laboratory”, supervised by Mukhtar Iskandar Pinem and Lahmuddin Lubis. This research aimed to know antagonism ability of endophytic fungi to control C. oryzae and C. lunata in laboratory. This research was held at Plant Disease Laboratory, Agroecotechnology Program Study, Faculty of Agriculture, University of Sumatera Utara with ...

  16. Dicty_cDB: FCL-AA17 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA17 (Link to dictyBase) - G03264 DDB0191099 Contig-U15602-1 FCL-AA...17P (Link to Original site) FCL-AA17F 547 FCL-AA17Z 610 FCL-AA17P 1157 - - Show FCL-AA17 Library F...CL (Link to library) Clone ID FCL-AA17 (Link to dictyBase) Atlas ID - NBRP ID G03264 dictyBase ID DDB0191099... Link to Contig Contig-U15602-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA17Q.Seq.d/ Representative seq. ID FCL-AA17P (Link to Original site) Representative DNA sequence >FCL-AA

  17. Dicty_cDB: FCL-AA14 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA14 (Link to dictyBase) - G03263 DDB0218474 Contig-U16035-1 FCL-AA...14P (Link to Original site) FCL-AA14F 647 FCL-AA14Z 550 FCL-AA14P 1197 - - Show FCL-AA14 Library F...CL (Link to library) Clone ID FCL-AA14 (Link to dictyBase) Atlas ID - NBRP ID G03263 dictyBase ID DDB0218474... Link to Contig Contig-U16035-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA14Q.Seq.d/ Representative seq. ID FCL-AA14P (Link to Original site) Representative DNA sequence >FCL-AA

  18. Dicty_cDB: FCL-AA19 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA19 (Link to dictyBase) - G01757 DDB0230128 Contig-U16036-1 FCL-AA...19P (Link to Original site) FCL-AA19F 246 FCL-AA19Z 568 FCL-AA19P 814 - - Show FCL-AA19 Library FC...L (Link to library) Clone ID FCL-AA19 (Link to dictyBase) Atlas ID - NBRP ID G01757 dictyBase ID DDB0230128 ...Link to Contig Contig-U16036-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...19Q.Seq.d/ Representative seq. ID FCL-AA19P (Link to Original site) Representative DNA sequence >FCL-AA

  19. Comparative study on the antifungal activity of hydroalcoholic extract of Iranian Propolis and Royal jelly against Rhizopus oryzae

    Moghim Hassan

    2015-07-01

    Full Text Available Introduction: Mucormycosis is an opportunistic fungal infection. Rhizopus oryzae is major cause of mucormycosis in humans. This disease is the most common form of the acute fungal infection with rapid progress. Iranian Propolis extract and Royal jelly are honey bee products which have been used by human over the past centuries in traditional medicine. In this study the effects of Iranian Propolis and Royal jelly were investigated against Rhizopus oryzae and Candida albicans. Methods: The used method in this study was microdilution. To perform it, the prepared dilutions of Royal jelly and alcoholic extract of Iranian Propolis were added to tubes containing Sabouraud dextrose broth culture media except to control group and then Rhizopus oryzae suspension was added to all microtubes. In the next stage, microtubes were maintained in incubator at 25oC for 48 hours and then 10 ml of the content of each microtube was transferred to Sabouraud dextrose agar media. The minimum inhibitory concentration (MIC and minimum fungicidal concentration (MFC of the agents were calculated. Results: In this study, the MIC and MFC of Iranian Propolis alcoholic extract on Rhizopus oryzae were respectively 0.1 and 0.25 mg/ml and the MFC of Royal jelly on Rhizopus oryzae were respectively 100 ± 34 and 133 ± 46 mg/ml. Conclusion: The results indicate that Propolis might be used as an ideal combination for the treatment of fungal infections like Rhizopus oryzae. However, clinical studies are needed to confirm the effects of these drugs.

  20. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D;

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... plausible explanations for patterns of variation in domesticated rice varieties. If selective sweeps are indeed the explanation for the observed nucleotide data of domesticated rice, it suggests that strong selection can leave its imprint on genome-wide polymorphism patterns, contrary to expectations that...

  1. Genome-wide transcription analyses in rice using tiling microarrays

    Li, Lei; Wang, Xiangfeng; Stolc, Viktor;

    2006-01-01

    Sequencing and computational annotation revealed several features, including high gene numbers, unusual composition of the predicted genes and a large number of genes lacking homology to known genes, that distinguish the rice (Oryza sativa) genome from that of other fully sequenced model species....... We report here a full-genome transcription analysis of the indica rice subspecies using high-density oligonucleotide tiling microarrays. Our results provided expression data support for the existence of 35,970 (81.9%) annotated gene models and identified 5,464 unique transcribed intergenic regions...... that share similar compositional properties with the annotated exons and have significant homology to other plant proteins. Elucidating and mapping of all transcribed regions revealed an association between global transcription and cytological chromosome features, and an overall similarity of...

  2. Herbarium genomics

    Bakker, Freek T.; Lei, Di; Yu, Jiaying;

    2016-01-01

    Herbarium genomics is proving promising as next-generation sequencing approaches are well suited to deal with the usually fragmented nature of archival DNA. We show that routine assembly of partial plastome sequences from herbarium specimens is feasible, from total DNA extracts and with specimens...... up to 146 years old. We use genome skimming and an automated assembly pipeline, Iterative Organelle Genome Assembly, that assembles paired-end reads into a series of candidate assemblies, the best one of which is selected based on likelihood estimation. We used 93 specimens from 12 different...... correlation between plastome coverage and nuclear genome size (C value) in our samples, but the range of C values included is limited. Finally, we conclude that routine plastome sequencing from herbarium specimens is feasible and cost-effective (compared with Sanger sequencing or plastome...

  3. Endogenous florendoviruses are major components of plant genomes and hallmarks of virus evolution.

    Geering, Andrew D W; Maumus, Florian; Copetti, Dario; Choisne, Nathalie; Zwickl, Derrick J; Zytnicki, Matthias; McTaggart, Alistair R; Scalabrin, Simone; Vezzulli, Silvia; Wing, Rod A; Quesneville, Hadi; Teycheney, Pierre-Yves

    2014-01-01

    The extent and importance of endogenous viral elements have been extensively described in animals but are much less well understood in plants. Here we describe a new genus of Caulimoviridae called 'Florendovirus', members of which have colonized the genomes of a large diversity of flowering plants, sometimes at very high copy numbers (>0.5% total genome content). The genome invasion of Oryza is dated to over 1.8 million years ago (MYA) but phylogeographic evidence points to an even older age of 20-34 MYA for this virus group. Some appear to have had a bipartite genome organization, a unique characteristic among viral retroelements. In Vitis vinifera, 9% of the endogenous florendovirus loci are located within introns and therefore may influence host gene expression. The frequent colocation of endogenous florendovirus loci with TA simple sequence repeats, which are associated with chromosome fragility, suggests sequence capture during repair of double-stranded DNA breaks. PMID:25381880

  4. Preformed expression of defense is a hallmark of partial resistance to rice blast fungal pathogen Magnaporthe oryzae

    Tharreau D

    2010-09-01

    Full Text Available Abstract Background Partial resistance to plant pathogens is extensively used in breeding programs since it could contribute to resistance durability. Partial resistance often builds up during plant development and confers quantitative and usually broad-spectrum resistance. However, very little is known on the mechanisms underlying partial resistance. Partial resistance is often explained by poorly effective induction of plant defense systems. By exploring rice natural diversity, we asked whether expression of defense systems before infection could explain partial resistance towards the major fungal pathogen Magnaporthe oryzae. The constitutive expression of 21 defense-related genes belonging to the defense system was monitored in 23 randomly sampled rice cultivars for which partial resistance was measured. Results We identified a strong correlation between the expression of defense-related genes before infection and partial resistance. Only a weak correlation was found between the induction of defense genes and partial resistance. Increasing constitutive expression of defense-related genes also correlated with the establishment of partial resistance during plant development. Some rice genetic sub-groups displayed a particular pattern of constitutive expression, suggesting a strong natural polymorphism for constitutive expression of defense. Constitutive levels of hormones like salicylic acid and ethylene cannot explain constitutive expression of defense. We could identify an area of the genome that contributes to explain both preformed defense and partial resistance. Conclusion These results indicate that constitutive expression of defense-related genes is likely responsible for a large part of partial resistance in rice. The finding of this preformed defense system should help guide future breeding programs and open the possibility to identify the molecular mechanisms behind partial resistance.

  5. Association Mapping for Drought Tolerance of Rice (Oryza sativa L.) at Vegetative Stage

    Yulong XIAO; Chuanyuan YU; Jianguo LEI; Quirino D; DELA CRUZ; Jonalyn M.YABES; Dindo A.TABANAo

    2012-01-01

    [Objective] This study aimed to identify possible quantitative trait loci (QTL) for vegetative drought tolerance traits of rice (Oryza sativa L.). [Method] A total of 184 rice genotypes were field screened and 156 SSR markers randomly distributed at each 3 Mb bin were used through genome-wide scanning method and association analysis to detect QTLs for vegetative drought tolerance traits leaf rolling (LER), leaf drying (LED) and drought recovery rate (DRR). [Result] The experimental rice geno- types showed varied response under vegetative drought, LER, LED and DRR were highly correlated. Population structure was detected at K=3 and K=7, certain extent of admixture existed in the experimental rice genotypes, relative kinship of the rice genotypes ranged from 0 to 0.924 5. Significant linkage disequilibrium among SSR markers was detected. Sixteen SSR markers have been detected to be associated with vegetative drought tolerance traits, four for LER, eight for LED and four for DDR. Most of the markers were associated with more than one trait, indicating a single mechanism might involve in expression of several related traits, i.e. osmotic adjustment. RM107 (Chr.9) was associated with all the three traits and fell exactly within or closely nearby to previous reported regions, was a major QTL for vegeta- tive drought tolerance, RM477 (Chr.8) was significantly associated with DRR and ex- tremely significantly associated with LER was probably another major QTL for vege- tative drought tolerance. [Conclusion] Association mapping is a very effective method for describing complex traits like drought tolerance.

  6. The A&A Experience With Impact Factors

    Sandqvist, A

    2004-01-01

    There is a widespread impression that the scientific journal "Astronomy & Astrophysics" (A&A) has a smaller impact, as measured by citations to articles, than some of the other major astronomy journals. This impression was apparently supported - and probably created - by the Journal Citation Report (JCR), which is prepared annually by the Institute of Scientific Information (ISI) Web of Knowledge. The published poor impact factor of A&A was in fact wrong and was due to a serious flaw in the method used by ISI Web of Knowledge to determine it. The resulting damage inflicted upon A&A by the JCR is incalculable.

  7. Corrosion issues of powder coated AA6060 aluminium profiles

    Din, Rameez Ud; Valgarðsson, Smári; Jellesen, Morten Stendahl;

    2015-01-01

    In this study detailed microstructural investigation of the reason for unexpected corrosion of powder coated aluminium alloy AA6060 windows profiles has been performed. The results from this study reveals that the failure of the window profiles was originated from the surface defects present...... on the extruded AA6060 aluminium profile after metallurgical process prior to powder coating. Surface defects are produced due to intermetallic particles in the alloy, which disturb the flow during the extrusion process. The corrosion mechanism leading to the failure of the powder coated AA6060 aluminium profiles...

  8. Biological Control of Rice Blast (Magnaporthe oryzae by use of Streptomyces sindeneusis isolate 263 in Greenhouse

    M. E. Zarandi

    2009-01-01

    Full Text Available Soil Actinomycetes particularly Streptomyces spp. have antagonistic activity against wide range of plant pathogens. In the recent decades they have attracted high interests as biocontrol agents. In search for finding such principles, in vitro suppression of Magnaporthe oryzae the causal agent of rice blast disease was studied by use of Streptomyces sindeneusis isolate 263 in greenhouse. Spray of rice seedling-leaves with of mixed spore suspension of the pathogen and S. sindeneusis isolate 263 resulted in strong inhibition of the pathogen and suppression of leaf symptoms. Propagation of the antagonist crude sap was performed in aqueous cultures and bioactivity was monitored in shaked cultures. Ongoing goals of this research include isolation, characterization and identification of the active metabolites and future goals include identification of active genes for use in development of recombinant DNAs in transgenic rice varieties bearing elevated resistance to infections by M. oryzae.

  9. Production of alpha-amylase with Aspergillus oryzae on spent brewing grain by solid substrate fermentation.

    Bogar, B; Szakacs, G; Tengerdy, R P; Linden, J C; Pandey, A

    2002-01-01

    Ten Aspergillus oryzae strains were screened in solid substrate fermentation for alpha-amylase production on spent brewing grain (SBG) and on corn fiber. SBG proved to be a better substrate for enzyme production than corn fiber. A Plackett-Burman experimental design was used to optimize the medium composition for the best strain. Solid substrate fermentation on optimized medium with A. oryzae NRRL 1808 (=ATCC 12892) strain in stationary 500-mL Erlenmeyer flask culture yielded 4519 U of alpha-amylase/g of dry matter substrate in 3 d. The whole solid substrate fermentation material (crude enzyme, in situ enzyme) may be considered a cheap biocatalytic material for animal feed rations and for bioalcohol production from starchy materials. PMID:12396145

  10. Identification and toxigenic potential of the industrially important fungi, Aspergillus oryzae and Aspergillus sojae

    Jørgensen, Thomas R

    2007-01-01

    Mold strains belonging to the species Aspergillus oryzae and Aspergillus sojae are highly valued as koji molds in the traditional preparation of fermented foods, such as miso, sake, and shoyu, and as protein production hosts in modern industrial processes. A. oryzae and A. sojae are relatives of...... the wild molds Aspergillus flavus and Aspergillus parasiticus. All four species are classified to the A. flavus group. Strains of the A. flavus group are characterized by a high degree of morphological similarity. Koji mold species are generally perceived of as being nontoxigenic, whereas wild molds...... are associated with the carcinogenic aflatoxins. Thus, reliable identification of individual strains is very important for application purposes. This review considers the pheno- and genotypic markers used in the classification of A. flavus group strains and specifically in the identification of A...

  11. Efeito da irradiação gama nas características físico-químicas e sensoriais do arroz (Oryza sativa L.) e no desenvolvimento de Sitophilus oryzae L. Effect of gamma irradiation on physico-chemical and sensorial characteristics of rice (Oryza sativa L.) and on the development of Sitophilus oryzae L.

    Cíntia Fernanda Pedroso Zanão; Solange Guidolin Canniatti-Brazaca; Silene Bruder Silveira Sarmento; Valter Arthur

    2009-01-01

    A pesquisa teve como objetivo verificar a viabilidade da radiação gama como método de conservação do arroz polido (Oryza sativa L.). As amostras foram irradiadas com doses 0,5; 1,0; 3,0; e 5,0 kGy. Foram realizadas análises da quebra do grão no beneficiamento, da longevidade e reprodução do Sitophilus oryzae L., a composição centesimal, o conteúdo de amilose aparente e propriedades de pasta dos amidos, e análises para cor (instrumental) e análise sensorial do arroz cru e cozido. Foi utilizado...

  12. Kinetic studies of acid inactivation of alpha-amylase from Aspergillus oryzae

    Carlsen, Morten; Nielsen, Jens Bredal; Villadsen, John

    1996-01-01

    The stability of alpha-amylase from Aspergillus oryzae has been studied at different pH. The enzyme is extremely stable at neutral pH (pH 5-8), whereas outside this pH-range a substantial loss of activity is observed. The acid-inactivation of alpha-amylase from A. oryzae was monitored on-line by a...... regains part of its activity, and the reactivation process also follows first-order kinetics. The irreversible loss of activity is found not to result from a protease contamination of the protein samples. A proposed model, where irreversibly inactivated a-amylase is formed both directly from the active...

  13. Mitotic stopwatch for the blast fungus Magnaporthe oryzae during invasion of rice cells.

    Jones, Kiersun; Jenkinson, Cory B; Borges Araújo, Maíra; Zhu, Jie; Kim, Rebecca Y; Kim, Dong Won; Khang, Chang Hyun

    2016-08-01

    To study nuclear dynamics of Magnaporthe oryzae, we developed a novel mitotic reporter strain with GFP-NLS (localized in nuclei during interphase but in the cytoplasm during mitosis) and H1-tdTomato (localized in nuclei throughout the cell cycle). Time-lapse confocal microscopy of the reporter strain during host cell invasion provided several new insights into nuclear division and migration in M. oryzae: (i) mitosis lasts about 5min; (ii) mitosis is semi-closed; (iii) septal pores are closed during mitosis; and (iv) a nucleus exhibits extreme constriction (approximately from 2μm to 0.5μm), elongation (over 5μm), and long migration (over 16μm). Our observations raise new questions about mechanisms controlling the mitotic dynamics, and the answers to these questions may result in new means to prevent fungal proliferation without negatively affecting the host cell cycle. PMID:27321562

  14. Physiological characterization of the high malic acid-producing Aspergillus oryzae strain 2103a-68

    Knuf, Christoph; Nookaew, Intawat; Remmers, Ilse;

    2014-01-01

    Malic acid is a C4 dicarboxylic acid that is currently mainly used in the food and beverages industry as an acidulant. Because of the versatility of the group of C4 dicarboxylic acids, the chemical industry has a growing interest in this chemical compound. As malic acid will be considered as a bulk...... chemical, microbial production requires organisms that sustain high rates, yields, and titers. Aspergillus oryzae is mainly known as an industrial enzyme producer, but it was also shown that it has a very competitive natural production capacity for malic acid. Recently, an engineered A. oryzae strain, 2103......a-68, was presented which overexpressed pyruvate carboxylase, malate dehydrogenase, and a malic acid transporter. In this work, we report a detailed characterization of this strain including detailed rates and yields under malic acid production conditions. Furthermore, transcript levels of the genes...

  15. Investigating the biology of plant infection by the rice blast fungus Magnaporthe oryzae.

    Martin-Urdiroz, Magdalena; Oses-Ruiz, Miriam; Ryder, Lauren S; Talbot, Nicholas J

    2016-05-01

    The rice blast fungus, Magnaporthe oryzae, is responsible for the most serious disease of rice and is a continuing threat to ensuring global food security. The fungus has also, however, emerged as a model experimental organism for understanding plant infection processes by pathogenic fungi. This is largely due to its amenability to both classical and molecular genetics, coupled with the efforts of a very large international research community. This review, which is based on a plenary presentation at the 28th Fungal Genetics Conference in Asilomar, California in March 2015, describes recent progress in understanding how M. oryzae uses specialised cell called appressoria to bring about plant infection and the underlying biology of this developmental process. We also review how the fungus is then able to proliferate within rice tissue, deploying effector proteins to facilitate its spread by suppressing plant immunity and promoting growth and development of the fungus. PMID:26703899

  16. NCBI nr-aa BLAST: CBRC-RNOR-15-0027 [SEVENS

    Full Text Available CBRC-RNOR-15-0027 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 2e-30 98% ...

  17. NCBI nr-aa BLAST: CBRC-AGAM-07-0022 [SEVENS

    Full Text Available CBRC-AGAM-07-0022 ref|ZP_01789747.1| hypothetical protein CGSHiAA_08330 [Haemophilus influenza...e PittAA] gb|EDK08473.1| hypothetical protein CGSHiAA_08330 [Haemophilus influenzae PittAA] ZP_01789747.1 2e-14 23% ...

  18. NCBI nr-aa BLAST: CBRC-HSAP-02-0031 [SEVENS

    Full Text Available CBRC-HSAP-02-0031 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 6e-09 52% ...

  19. NCBI nr-aa BLAST: CBRC-OLAT-13-0071 [SEVENS

    Full Text Available CBRC-OLAT-13-0071 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 0.14 37% ...

  20. NCBI nr-aa BLAST: CBRC-PTRO-02-0026 [SEVENS

    Full Text Available CBRC-PTRO-02-0026 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-09 50% ...

  1. NCBI nr-aa BLAST: CBRC-HSAP-02-0029 [SEVENS

    Full Text Available CBRC-HSAP-02-0029 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 5e-11 48% ...

  2. NCBI nr-aa BLAST: CBRC-RNOR-08-0315 [SEVENS

    Full Text Available CBRC-RNOR-08-0315 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-25 73% ...

  3. NCBI nr-aa BLAST: CBRC-GGAL-35-0091 [SEVENS

    Full Text Available CBRC-GGAL-35-0091 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 2e-08 34% ...

  4. NCBI nr-aa BLAST: CBRC-PTRO-27-0055 [SEVENS

    Full Text Available CBRC-PTRO-27-0055 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-09 53% ...

  5. NCBI nr-aa BLAST: CBRC-ACAR-01-0367 [SEVENS

    Full Text Available CBRC-ACAR-01-0367 ref|ZP_01790024.1| hypothetical protein CGSHiAA_05974 [Haemophilus influenza...e PittAA] gb|EDK08288.1| hypothetical protein CGSHiAA_05974 [Haemophilus influenzae PittAA] ZP_01790024.1 4.0 29% ...

  6. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Gueutin, Victor; Langlois, Anne-Lyse; Shehwaro, Nathalie; Elharraqui, Ryme; Rouvier, Philippe; Izzedine, Hassane

    2013-01-01

    Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported. PMID:24558629

  7. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Victor Gueutin; Anne-Lyse Langlois; Nathalie Shehwaro; Ryme Elharraqui; Philippe Rouvier; Hassane Izzedine

    2013-01-01

    Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported.

  8. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Victor Gueutin

    2013-01-01

    Full Text Available Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported.

  9. Two distinct secretion systems facilitate tissue invasion by the rice blast fungus Magnaporthe oryzae.

    Giraldo, Martha C.; Dagdas, Yasin F.; Gupta, Yogesh K.; Mentlak, Thomas A.; Yi, Mihwa; Martinez-Rocha, Ana Lilia; Saitoh, Hiromasa; Terauchi, Ryohei; Talbot, Nicholas J.; Valent, Barbara

    2013-01-01

    To cause plant diseases, pathogenic micro-organisms secrete effector proteins into host tissue to suppress immunity and support pathogen growth. Bacterial pathogens have evolved several distinct secretion systems to target effector proteins, but whether fungi, which cause the major diseases of most crop species, also require different secretory mechanisms is not known. Here we report that the rice blast fungus Magnaporthe oryzae possesses two distinct secretion systems to target effectors dur...

  10. Germination and infectivity of microconidia in the rice blast fungus Magnaporthe oryzae

    Zhang, Huili; Wu, Zhongshou; Wang, Chenfang; Li, Yang; Xu, Jin-Rong

    2014-01-01

    The rice blast fungus Magnaporthe oryzae is a model for studying fungal–plant interactions. Although it produces two types of spores (microconidia and macroconidia), previous infection studies have exclusively dealt with macroconidia. Germination of microconidia has not been reported, and their role in plant infection is not defined. Here we show that approximately 10% of microconidia germinate on plant surfaces, and that colonies derived from germinated microconidia are normal in growth and ...

  11. Production of amylase in liquid culture by a strain of Aspergillus oryzae.

    Kundu, A K; Das, S

    1970-04-01

    The effect of different media and pH on the formation of amylase by Aspergillus oryzae EI 212 is described. Depending upon the composition of the medium and growth conditions, the fungus was found to secrete alpha- or beta-amylase, or both. Some of the properties of the partially purified alpha-amylase were found to be different from alpha-amylases from other sources. PMID:5418942

  12. Investigation of Malic Acid Production in Aspergillus oryzae under Nitrogen Starvation Conditions

    Knuf, C.; Nookaew, I.; Brown, S H; McCulloch, M.; BERRY, A.; Nielsen, J.

    2013-01-01

    Malic acid has great potential for replacing petrochemical building blocks in the future. For this application, high yields, rates, and titers are essential in order to sustain a viable biotechnological production process. Natural high-capacity malic acid producers like the malic acid producer Aspergillus flavus have so far been disqualified because of special growth requirements or the production of mycotoxins. As A. oryzae is a very close relative or even an ecotype of A. flavus, it is like...

  13. Directional Fermentation of Aspergillus Oryzae%米曲霉的定向发酵

    杨秋明; 肖安风; 杨远帆; 蔡慧农

    2011-01-01

    Aspergillus oryzae is a common-used fungus for proteinase production. In this paper, the metabolic kinetics of multi-enzyme in Aspergillus oryzae fermentation was investigated when the strain was cultured with fish protein ( fish meal) as nitrogen source. To study the change of proteinase activity during fermentation, Folin method and ninhydrin colorimetric method were adopted to measure enzyme activity, formaldehyde titration method was adopted to determine the concentration of amino nitrogen, and SDS-PAGE gel-electrophoresis was adopted to measure the molecular weight of the production from hydrolyzing casein and liquid substrate. Compared with fed-batch, more kinds of proteases and higher enzyme activity were obtained in the batch fermentation of Aspergillus oryzae. This result is useful for carrying out further studies on Aspergillus oryzae to produce new characteristic proteinase.%用鱼蛋白(鱼粉)为氮源培养米曲霉,取样分析培养物的蛋白酶活力、氨基酸态氮含量、分子量及用培养物为酶源水解酪蛋白后的分子量变化.通过对比,研究了米曲霉在分批和补糖2种发酵条件下分泌蛋白酶及菌体生长的特点.结果表明:在用鱼蛋白为氮源培养米曲霉的过程中,米曲霉产生了多种不同的蛋白酶,蛋白酶的活力与种类随培养时间而变化,分批发酵的总酶活力比补糖发酵时的总酶活力强.

  14. Pemanfaatan Jerami Padi (Oryza sativa L.) sebagai Bahan Baku Pembuatan Karboksimetil Selulosa

    Hasibuan, Irma Fitri

    2016-01-01

    Background: Paddy straw (Oryza sativa L.) is agricultural waste which can be used as the source of cellulose since it contains 36 % of cellulose. Carboxymeythyl cellulose is a linear polymear cellulose ether and anionic compoud. Objective: To make carboxymethyl cellulose (CMC) from paddy straw and to compare the CMC characteristic of paddy straw with commercial CMC. Method: Carboxymethyl cellulose of paddy straw (KSJP) was made by processing delignifacation in order to obtain a-cellulos...

  15. Heterologous Expression of AtWRKY57 Confers Drought Tolerance in Oryza sativa

    Jiang, Yanjuan; Qiu, Yuping; Hu, Yanru; Yu, Diqiu

    2016-01-01

    Drought stress is a severe environmental factor that greatly restricts plant distribution and crop production. Recently, we have found that overexpressing AtWRKY57 enhanced drought tolerance in Arabidopsis thaliana. In this study, we further reported that the Arabidopsis WRKY57 transcription factor was able to confer drought tolerance to transgenic rice (Oryza sativa) plants. The enhanced drought tolerance of transgenic rice was resulted from the lower water loss rates, cell death, malondiald...

  16. Toxic effects of essential plant oils in adult Sitophilus oryzae (Linnaeus) (Coleoptera, Curculionidae)

    Andréa Roveré Franz; Neiva Knaak; Lidia Mariana Fiuza

    2011-01-01

    Toxic effects of essential plant oils in adult Sitophilus oryzae (Linnaeus) (Coleoptera, Curculionidae). Stored grains are subject to losses in quality nutritional value and in sanitation from the time they are stored to the time they are consumed. Botanical insecticides may offer an alternative solution for pest control. The objective was to test the insecticidal properties of the essential oils of Cymbopogon citratus (leaf), Zingiber officinale (root) and Mentha sp. (leaf). The efficacy of ...

  17. Fungistatic mechanism of human transferrin for Rhizopus oryzae and Trichophyton mentagrophytes: alternative to simple iron deprivation.

    Artis, W M; Patrusky, E; Rastinejad, F; Duncan, R.L.

    1983-01-01

    Human serum, human transferrin (TF), and the iron chelator 1,10-phenanthroline (OP) produce iron-reversible fungistatic activity which has been attributed to simple iron deprivation. In this study, the influence of the size of the inoculum on the inhibitory activity of serum, TF, and OP prepared with the same iron-binding capacity (2.5 micrograms/ml) for Rhizopus oryzae and Trichophyton mentagrophytes was examined. Inhibition was monitored in liquid microcultures maintained at 37 degrees C an...

  18. Rhizopus Soft Rot on Lily Caused by Rhizopus oryzae in Korea

    Soo-Sang Hahm; Gye-Wan Hong; Byung-Ryun Kim; Kwangseop Han; Takyong Choi; Yungyu Nam; Seunghun Yu

    2014-01-01

    Rhizopus soft rot of lily (Lilium longiflorum) caused by Rhizopus oryzae was observed in the experimental field in Taean Lily Experiment Station in Korea, 2012. The typical symptoms were water-soaked lesions on bottom stem and leaf rot. The lesion rapidly expanded and the plant was softened totally. The fungus grew vigorously at an optimum temperature (25oC) and brownish colony and black sporangia were formed on potato dextrose agar medium. Sporangiophores formed on end of sporang...

  19. Soft Rot on Citrus unshiu Caused by Rhizopus oryzae in Korea

    Jin-Hyeuk Kwon; Jinwoo Kim; Jae-Wook Hyun; Yong Hwan Lee; Hong-Sik Shim

    2011-01-01

    Soft rot caused by Rhizopus oryzae occurred on unshiu orange (Citrus unshiu Marc.) sampled from commercial markets in Jinju, Korea, 2010. The first symptom of soft rot on orange is a water-soaked appearance of the affected tissue. The infected parts later disintegrated into a mushy mass of disorganized cells followed by rapid softening of the diseased tissue. The lesion on orange was rapidly softened and rotted, then became brown or dark brown. Optimum temperature for mycelial growth of the c...

  20. Produksi bioethanol dari jerami padi (Oryza sativa) melalui hidrolisis asan dan fermentasi dengan Saccharomyces cerevisiae

    SRI KUSUMASTUTI HAYUNINGTYAS; SUNARTO; SITI LUSI ARUM SARI

    2014-01-01

    Hayuningtyas SK, Sunarto, Sari SLA. 2013. The production of bioethanol from rice straw (Oryza sativa) by acid hydrolysis and fermentation with Saccharomyces cerevisiae. Bioteknologi 11: 1-4. Bioethanol is one of the alternative fuels that are considered more environmentally friendly. Bioethanol can be obtained from material that contains cellulose, such as rice straw. This study aimed to determine the optimum fermentation time to product bioethanol from rice straw hydrolysis and measured of b...

  1. Untersuchungen zur Bedeutung von Histidinkinasen in Magnaporthe oryzae und zum Wirkmechanismus des Fungizids Fludioxonil

    Jacob, Stefan

    2014-01-01

    Das aus wissenschaftlicher und ökonomischer Sicht wichtigste Pflanzenpathogen M. oryzae entwickelte im Laufe der Evolution konservierte aber auch einzigartige Mechanismen zur Signaltransduktion. Das Erforschen dieser Mechanismen und Prozesse ist essenziell für das Verständnis von Differenzierungsprozessen bei der Pathogen-Wirt-Interaktion.rnIm ersten Teil der vorliegenden Arbeit wurde der Signalweg zur Osmoregulation, der „High Osmolarity Glycerol“ (HOG)-Signalweg, erstmals anhand physiologis...

  2. Purification and characterization of a thermostable hypothetical xylanase from Aspergillus oryzae HML366.

    He, Haiyan; Qin, Yongling; Li, Nan; Chen, Guiguang; Liang, Zhiqun

    2015-03-01

    In the current study, fermentation broth of Aspergillus oryzae HML366 in sugar cane bagasse was subjected to ultrafiltration and ion exchange chromatography, and two xylanases, XynH1 and XynH2, were purified. Time-of-flight mass spectrometry coupled with SDS-PAGE analysis revealed that XynH1 is identical to the hypothetical A. oryzae RIB40 protein XP_001826985.1, with a molecular weight of 33.671 kDa. Likewise, XynH2 was identified as xylanase XynF1 with a molecular weight of 35.402 kDa. Sequence analysis indicated that XynH1 belongs to glycosyl hydrolases family 10. The specific activity of XynH1 was measured at 476.9 U/mg. Optimal xylanase activity was observed at pH 6.0, and enzyme remained active within pH 4.0-10.0 and at a temperature below 70 °C. Mg(2+), Mn(2+), Ca(2+), and K(+) enhanced the XynH1 xylanase activity to 146, 122, 114, and 108%, respectively. XynH1 hydrolyzed Birchwood xylan and Larchwood xylan effectively. The K m and V max of XynH1 values determined were 1.16 mM and 336 μmol/min/mg with Birchwood xylan as the substrate. A. oryzae HML366 xylanase XynH1 showed superior heat and pH tolerance, therefore may have significant applications in paper and biofuel industries. These studies constitute the first investigation of the xylanase activities of the hypothetical protein XP_001826985.1 form A. oryzae. PMID:25604952

  3. Tanggap Pertumbuhan dan Produksi Padi (Oryza sativa L.) Varietas Ciherang Terhadap Pemberian Pupuk Organik

    Sari, Vira Irma

    2011-01-01

    VIRA IRMA SARI. Response of Growth and Production of Rice (Oryza sativa L.) Variety Ciherang to The Application of Organic Fertilizer. Scarcity of inorganic fertilizer and the negative effect caused by inorganic fertilizer continuing to make organic fertilizer as a solution to overcome these problems. The availability of organic fertilizers is expected that the farmers can get the optimal production and profit, because the organic fertilizer is cheaper and easy ...

  4. Sensitivity of APSIM/ORYZA model due to estimation errors in solar radiation

    Alexandre Bryan Heinemann; Pepijn A.J. van Oort; Diogo Simões Fernandes; Aline de Holanda Nunes Maia

    2012-01-01

    Crop models are ideally suited to quantify existing climatic risks. However, they require historic climate data as input. While daily temperature and rainfall data are often available, the lack of observed solar radiation (Rs) data severely limits site-specific crop modelling. The objective of this study was to estimate Rs based on air temperature solar radiation models and to quantify the propagation of errors in simulated radiation on several APSIM/ORYZA crop model seasonal outputs, yield, ...

  5. Physiological changes promoted by a strobilurin fungicide in the rice-Bipolaris oryzae interaction.

    Debona, D; Nascimento, K J T; Gomes, J G O; Aucique-Perez, C E; Rodrigues, F A

    2016-06-01

    Strobilurins are among the most important fungicides that are used for plant disease control worldwide. In addition to their fungicide effect, strobilurins can also improve crop physiology. Nonetheless, the impact of azoxystrobin (Az), the main marketed strobilurin, on rice physiology is still unknown. Detailed gas exchange measurements and chlorophyll a fluorescence analysis were used to examine the Az effects on the photosynthetic performance of rice plants (cultivar Metica-1) either challenged or not with Bipolaris oryzae, the causal agent of brown spot. Az impaired carbon (C) fixation in the non-inoculated plants in a manner that was not related to photochemical or biochemical limitations, but rather to decreased stomatal conductance that limited the CO2 influx into the mesophyll cells. The photosynthesis of rice plants that were not sprayed with Az dramatically decreased upon B. oryzae infection, which was chiefly governed by photochemical and biochemical limitations. The energy surplus that was caused by limited C fixation in the rice plants that were treated with Az and inoculated with B. oryzae was thermally and effectively dissipated until 72h after inoculation. In Az absence, however, this mechanism was not sufficient to prevent chronic photoinhibition to photosynthesis. The inoculated plants were not able to fully capture and exploit the collected light energy, but these constraints were greatly limited in the presence of Az. In conclusion, Az impaired the photosynthetic performance of non-infected plants by diffusive constraints, but prevented, to a greater extent, the damage to the photosynthetic apparatus during the infection process of B. oryzae. PMID:27155478

  6. AAS Committee on Employment Panel Introduction

    Borne, Kirk; Fanelli, M. N.; Storrie-Lombardi, L. J.; Krishnamurthi, A.

    2006-12-01

    Many younger astronomers are unaware of the dangers and pitfalls that await them in the job market. Issues related to fringe benefits (if any), moving expenses, medical coverage for family members, teaching versus research expectations, etc. can lead to misunderstandings and to serious difficulties if these are not addressed early in the job interview process. The AAS Committee on Employment has often received letters from concerned junior members of the society, who feel that they needed more guidance and assistance in entering the job market for the first time. The major areas of concern have included those just listed, but there may be others. The session is structured as a panel presentation, whose members are asked to prepare in advance their top 10 questions that job applicants should ask, and we will instruct our panel members not to discuss their list at all with the other panel members prior to their presentations. This will ensure independent viewpoints and novel responses. The panel will consist of astronomers who have different perspectives on this issue, including old and young, postdoc and beyond, academic and non-academic. To kick off the session, we will invite a brief humorous presentation of the Top Ten List, in the style of The Night Show host David Letterman.

  7. Outcomes From AAS Hack Day at the 227th AAS Meeting

    Kohler, Susanna

    2016-01-01

    Editors Note:This is a final post from the 227th AAS Meeting in Kissimmee, FL. This special summary of AAS Hack Day, a meeting of AAS members to collaboratively work on various small projects, was written by Meredith Rawls (@Merrdiff) and was originally posted on astrobites.com.As the 227thAmerican Astronomical Society meeting drew to a close (see highlights from Day 1, Day 2, Day 3, and Day 4), a group of at least 50 attendees spent Day 4working on small projects fondly called hacks. Thanks to sponsorship from LSST and Northrup Grumman, the industrious hackers werewell-caffeinated and fed so we could devote time and energy toworking in groups on one-day projects.TheHack Day beganat 10am with pitches. Anybody with a project idea was welcome to briefly speak and try to convince others to work with them. Only someideas panned out, but the enthusiasm was palpable. Its not every day you get a full room of astronomers and affiliates eager to spend hours working on fun and useful projects to benefit the community.#hackAAS is getting underway! #aas227 pic.twitter.com/yX7jlOnSCK James R A Davenport (@jradavenport) January 8, 2016Here is a rundown of what we accomplished. Pretty impressive for a single day! Many thanks to fellow astrobiter Erika Nesvold (now at Carnegie DTM; @erikanesvold) whose hack was live-documenting all the other hacks. Her tweets as @astrobites appeared with the #hackaas hashtag, and her notes made this recap post infinitely easier to write.Interested in joining the fun? Sign up for Hack Day at the 2017 JanuaryAAS meeting (its free with meeting registration), and consider applying for the .Astronomy conference this summer.Towards Optimal Session Scheduling:Adrian Price-Whelan (Columbia), David Hogg (NYU), and Scott Idem (AAS) began writing a program to take all submitted abstracts to a conference like AAS and sort them using keywords to avoid scheduling similar talks in parallel sessions. Its impossible to make everyone happy, but minimizing conflicts

  8. Anacardic acid induces apoptosis-like cell death in the rice blast fungus Magnaporthe oryzae.

    Muzaffar, Suhail; Bose, Chinchu; Banerji, Ashok; Nair, Bipin G; Chattoo, Bharat B

    2016-01-01

    Anacardic acid (6-pentadecylsalicylic acid), extracted from cashew nut shell liquid, is a natural phenolic lipid well known for its strong antibacterial, antioxidant, and anticancer activities. Its effect has been well studied in bacterial and mammalian systems but remains largely unexplored in fungi. The present study identifies antifungal, cytotoxic, and antioxidant activities of anacardic acid in the rice blast fungus Magnaporthe oryzae. It was found that anacardic acid causes inhibition of conidial germination and mycelial growth in this ascomycetous fungus. Phosphatidylserine externalization, chromatin condensation, DNA degradation, and loss of mitochondrial membrane potential suggest that growth inhibition of fungus is mainly caused by apoptosis-like cell death. Broad-spectrum caspase inhibitor Z-VAD-FMK treatment indicated that anacardic acid induces caspase-independent apoptosis in M. oryzae. Expression of a predicted ortholog of apoptosis-inducing factor (AIF) was upregulated during the process of apoptosis, suggesting the possibility of mitochondria dependent apoptosis via activation of apoptosis-inducing factor. Anacardic acid treatment leads to decrease in reactive oxygen species rather than increase in reactive oxygen species (ROS) accumulation normally observed during apoptosis, confirming the antioxidant properties of anacardic acid as suggested by earlier reports. Our study also shows that anacardic acid renders the fungus highly sensitive to DNA damaging agents like ethyl methanesulfonate (EMS). Treatment of rice leaves with anacardic acid prevents M. oryzae from infecting the plant without affecting the leaf, suggesting that anacardic acid can be an effective antifungal agent. PMID:26381667

  9. Morphological change and enhanced pigment production of monascus when cocultured with saccharomyces cerevisiae or aspergillus oryzae

    Shin; Kim; Kim; Ju

    1998-09-01

    When a Monascus isolate, a producer of Monascus pigments, was cocultured with either Saccharomyces cerevisiae or Aspergillus oryzae in a solid sucrose medium, there were significant morphological changes in Monascus culture. Cocultures exhibited cell mass increases of 2 times and pigment yield increases of 30 to 40 times compared to monocultures of Monascus. However, enhanced cell growth, an increase in pigment production, and morphological change did not occur in coculture with Bacillus cereus. Saccharomyces cerevisiae was more effective at enhancing pigment production than Asp. oryzae. Enhanced cell growth and increased pigment production occurred only in conjunction with morphological changes. Culture filtrates of S. cerevisiae were also effective in inducing morphology change in Monascus, similar to culture broths of S. cerevisiae. The hydrolytic enzymes produced by S. cerevisiae, such as amylase, and chitinase, are thought to be the effectors. The commercial enzymes alpha-amylase and protease from Asp. oryzae both caused a morphological change in Monascus and were effective in enhancing pigment production. However, lysozyme, alpha-amylase and protease from Bacillus species, protease from Staphylococcus, and chitinase from Streptomyces were not effective. The hydrolytic enzymes which cause a morphological change of Monascus culture and enhancement of pigment production are thought to be capable of degrading Monascus cell walls. An approximate 10-fold increase in pigment production was observed in liquid cocultures with S. cerevisiae. Copyright 1998 John Wiley & Sons, Inc. PMID:10099374

  10. Expression of an alpha-galactosidase from Saccharomyces cerevisiae in Aspergillus awamori and Aspergillus oryzae.

    Murphy, R A; Power, R F G

    2002-02-01

    A gene encoding alpha-galactosidase activity was isolated by polymerase chain reaction (PCR) from Saccharomyces cerevisiae NCYC686 and separately placed under the control of transcriptional elements regulating alpha-amylase expression in Aspergillus oryzae and glucoamylase expression in A. awamori. Following transformation of both A. oryzae and A. awamori with their respective expression vectors, induction of heterologous alpha-galactosidase from positively selected clones was effected through the addition of soluble starch (10% wt/vol) to the growth medium. Upon induction in A. oryzae, a transcriptional instability resulted in degradation of mRNA encoding heterologous alpha-galactosidase, thus preventing expression of the active enzyme. The use of a gene fusion strategy in A. awamori overcame this instability and resulted in stable expression of S. cerevisiae alpha-galactosidase. Subsequent to initial (shake flask) experiments, a series of scale-up and optimisation studies led to heterologous expression of the recombinant enzyme in batch fermentation at 51 U mg(-1) total extracellular protein. This was higher than previously published works, which reported extracellular levels of heterologous alpha-galactosidase up to 38 U mg(-1) total protein. Analysis of crude extracts of the fermentation medium revealed significant differences between the activity parameters reported previously in the literature for this enzyme and those observed here. The recombinant enzyme exhibited thermostability properties not previously reported for S. cerevisiae alpha-galactosidase, a trait which would make it suitable for use in processes requiring high temperatures. PMID:12074058

  11. Control of brown spot pathogen of rice (Bipolaris oryzae) using some phenolic antioxidants.

    Shabana, Y M; Abdel-Fattah, G M; Ismail, A E; Rashad, Y M

    2008-07-01

    Bipolaris oryzae is the causal agent of rice brown spot disease and is responsible for significant economic losses. In order to control this disease, three phenolic antioxidants were tested (salicylic acid, benzoic acid and hydroquinone). The antifungal activity of the tested substances were investigated against B. oryzae at different concentrations in vitro, as well as the efficacy of their exogenous application in controlling rice brown spot disease under field conditions. In vitro, benzoic acid or salicylic acid at 9 mM completely inhibited the growth of B. oryzae. Under field conditions, spraying of benzoic acid at 20 mM led to a significant reduction in disease severity (DS) and disease incidence (DI) on the plant leaves, in addition to a significant increase in the grain yield and its components. Some biochemical responses were also detected, where the application of the previous treatment led to a significant increase in the total photosynthetic pigments (chlorophyll a and b and carotenoids) in rice leaves and in the total carbohydrate and protein contents of the yielded grains. PMID:24031243

  12. Physiological and Molecular Alterations Promoted by Schizotetranychus oryzae Mite Infestation in Rice Leaves.

    Buffon, Giseli; Blasi, Édina A R; Adamski, Janete M; Ferla, Noeli J; Berger, Markus; Santi, Lucélia; Lavallée-Adam, Mathieu; Yates, John R; Beys-da-Silva, Walter O; Sperotto, Raul A

    2016-02-01

    Infestation of phytophagous mite Schizotetranychus oryzae in rice causes critical yield losses. To better understand this interaction, we employed Multidimensional Protein Identification Technology (MudPIT) approach to identify differentially expressed proteins. We detected 18 and 872 unique proteins in control and infested leaves, respectively, along with 32 proteins more abundant in control leaves. S. oryzae infestation caused decreased abundance of proteins related to photosynthesis (mostly photosystem II-related), carbon assimilation and energy production, chloroplast detoxification, defense, and fatty acid and gibberellin synthesis. On the contrary, infestation caused increased abundance of proteins involved in protein modification and degradation, gene expression at the translation level, protein partitioning to different organelles, lipid metabolism, actin cytoskeleton remodeling, and synthesis of jasmonate, amino acid, and molecular chaperones. Our results also suggest that S. oryzae infestation promotes cell-wall remodeling and interferes with ethylene biosynthesis in rice leaves. Proteomic data were positively correlated with enzymatic assays and RT-qPCR analysis. Our findings describe the protein expression patterns of infested rice leaves and suggest that the acceptor side of PSII is probably the major damaged target in the photosynthetic apparatus. These data will be useful in future biotechnological approaches aiming to induce phytophagous mite resistance in rice. PMID:26667653

  13. Production optimization and expression of pectin releasing enzyme from Aspergillus oryzae PO.

    Chen, Jia; Yang, Rujian; Chen, Min; Wang, Shaohua; Li, Peng; Xia, Yuelan; Zhou, Li; Xie, Jingli; Wei, Dongzhi

    2014-01-30

    Protopectinase is an enzyme that solubilizes protopectin forming highly polymerized soluble pectin. Protopectinase activity was detected from Aspergillus oryzae PO isolated from soil of persimmon orchard. Response surface methodology of Box-Behnken Design with three fermentation variables (temperature, NaNO3 and apple pomace concentration) was used to optimize protopectinase production of A. oryzae PO, and protopectinase activity was improved to 270.0 U/ml. Endo-polygalacturonase belonged to A-type PPase from A. oryzae PO was cloned and expressed in Pichia pastoris GS115. The endo-polygalacturonase expression was 0.418 mg/ml and the specific activity of purified recombinant endo-polygalacturonase was 7520 U/mg toward polygalacturonic acid. The optimal temperature and pH of recombinant endo-polygalacturonase were 45°C and 5.0, respectively. The recombinant endo-polygalacturonase activity was enhanced by the presence of Mg(2+), while Ca(2+), Ni(2+) Mn(2+), Cu(2+) and SDS strongly inhibited the enzyme activity. The apparent Km value and Vmax value were 5.59 mg/ml and 1.01 μmol/(minml), respectively. PMID:24299753

  14. The Production of Biodiesel from Cottonseed Oil Using Rhizopus oryzae Whole Cell Biocatalysts

    Athalye, Sneha Kishor

    Biodiesel is an environmentally friendly alternative to fossil fuels which have become increasingly expensive in recent times. An alternate approach to alkaline biodiesel production is needed as catalyst miscibility with the glycerol by-product, generation of large amounts of waste water, and saponification of the feedstock are major disadvantages associated with the process. Lipases are water soluble enzymes which act as catalysts in many lipid based reactions. Reuse of lipases can significantly reduce cost of enzymatic biodiesel production; however retention of lipolytic activity still remains a challenge. Use of microbial cells immobilized on various surfaces like sponge, foam and plastics as biocatalysts instead of extracted enzyme could help overcome this problem. A novel, rigid biomass support with high surface area made from recyclable polyethylene (Bioblok(TM)) was used in this study. Several fungal and bacterial species have been reported to possess appreciable levels of lipase activity. The biomass production and immobilization as well as lipase activity of three different species; Candida rugosa (ATCC #38772), Aspergillus oryzae (ATCC #58299), and Rhizopus oryzae (ATTC #34612) were tested. C. rugosa did not attach well to the support particles while A.oryzae had lower biomass accumulation of 6.1 g (dry cell wt)/L compared to 11.8 g (dry cell wt)/L for R.oryzae. Hence Rhizopus oryzae, fungal specie with cell surface bound lipase was selected for the current study. The study investigated the influence of media composition and growth time of the R.oryzae whole cell biocatalysts, immobilized on the BSPs, for FAME production from cottonseed oil. R.oryzae BSPs grown in basal media supplemented with 1% (w/v) of glucose or oil or both for 48 h, 72 h or 90 h were used in a 36 h transesterification reaction with cottonseed oil and methanol. BSPs grown in both glucose and oil supplemented medium for 72 h had the highest conversion of 22.4% (wt/wt) and a biomass

  15. Unfolded protein response is required for Aspergillus oryzae growth under conditions inducing secretory hydrolytic enzyme production.

    Tanaka, Mizuki; Shintani, Takahiro; Gomi, Katsuya

    2015-12-01

    Unfolded protein response (UPR) is an intracellular signaling pathway for adaptation to endoplasmic reticulum (ER) stress. In yeast UPR, Ire1 cleaves the unconventional intron of HAC1 mRNA, and the functional Hac1 protein translated from the spliced HAC1 mRNA induces the expression of ER chaperone genes and ER-associated degradation genes for the refolding or degradation of unfolded proteins. In this study, we constructed an ireA (IRE1 ortholog) conditionally expressing strain of Aspergillus oryzae, a filamentous fungus producing a large amount of amylolytic enzymes, and examined the contribution of UPR to ER stress adaptation under physiological conditions. Repression of ireA completely blocked A. oryzae growth under conditions inducing the production of hydrolytic enzymes, such as amylases and proteases. This growth defect was restored by the introduction of unconventional intronless hacA (hacA-i). Furthermore, UPR was observed to be induced by amylolytic gene expression, and the disruption of the transcriptional activator for amylolytic genes resulted in partial growth restoration of the ireA-repressing strain. In addition, a homokaryotic ireA disruption mutant was successfully generated using the strain harboring hacA-i as a parental host. These results indicated that UPR is required for A. oryzae growth to alleviate ER stress induced by excessive production of hydrolytic enzymes. PMID:26496881

  16. Contribution to the improvement of rice (Oryza sativa L.) by mutation induction with gamma radiation

    The study involved inducing mutations in the varieties Icta-Virginia and Precozicta to obtain genotypes that mature early, are resistant or tolerant to Pyricularia oryzae and have a high yield potential. To optimize the radiation dose for each variety, seeds were irradiated with doses of 0, 150, 200, 250, 300 and 400 Gy. Six thousand seeds of each variety were irradiated with the above doses to establish the M1 generation, in which the physiological effects and somatic mutations were observed. The M2 generation was sown in progeny groups and as the crop developed, mutants with chlorophyll changes, morphological changes, improved yield, tolerance to Phyricularia oryzae and mutants which matured earlier than the original variety were identified and selected. In the M3 generation, derived from the Icta-Virginia and Precozicta varieties, the genetic stability of mutants with morphological changes, chlorophyll changes, tolerance to Pyricularia oryzae (classified as 0-1 on the 0 to 9 scale of the standard rice evaluation system) and those which matured earlier (15 to 20 days) than the original variety was confirmed. (author). 7 refs, 3 tabs

  17. Astronomy Career Profiles from the AAS Newsletter Archives

    Metcalfe, Travis; Belkora, Leila; McDaid, Liam; Bullock, Blake; Pulliam, Christine; Williams, Peter; Roth, Joshua; Whitney, Barb; Olsen, Knut; Howell, Andy; Keller, Luke

    2011-01-01

    This is a collection of articles that were originally published in the Newsletter of the American Astronomical Society (AAS) between May 2008 and September 2011 by the Committee on Employment. Authors representing a wide range of career paths tell their stories and provide insight and advice that is relevant to success in various job sectors. Although all of these articles are available individually from the AAS archives, we are posting the complete collection here to make them more accessibl...

  18. Systemic AA amyloidosis induced by liver cell adenoma.

    Fievet, P; Sevestre, H; Boudjelal, M; Noel, L H; Kemeny, F; D. Franco; Delamarre, J; Capron, J.P.

    1990-01-01

    Systemic AA amyloidosis is a rare complication of benign tumours. This report describes a patient with hepatocellular adenoma associated with reactive AA amyloidosis. He had a nephrotic syndrome with deteriorating renal function and an increase of serum concentrations of acute phase proteins, mainly C-reactive protein. Resection of the tumour was followed by improvement in renal function and a marked decrease of the serum concentrations of acute phase proteins.

  19. Transgenic Expression of the Recombinant Phytase in Rice (Oryza sativa)

    LIU Qiao-quan; LI Qian-feng; JIANG Li; ZHANG Da-jiang; WANG Hong-mei; GU Ming-hong; YAO Quan-hong

    2006-01-01

    In most of the cereal crop, phytic acid is the main storage form of phosphorus, which can decrease the bioavailability of phosphate. Transgenic expression of phytase is regarded as an efficient way to release phosphate from phytate in transgenic plants.In this study, a plant expression vector, containing the recombinant phytase gene driven by the maize ubiquitin (Ubi) promoter was constructed and introduced into an elite rice variety via Agrobacterium-mediated transformation. During the experiment, a total of 15 independent transgenic rice lines were regenerated. The results of PCR and Southern blot indicated that the target gene was integrated into the genome of transgenic rice plants. Moreover, the RT-PCR analysis of total RNAs extracted from the immature seeds of several transgenic lines showed that the recombinant phytase gene could be normally expressed. The inorganic phosphorus content, both in the mature seeds and the leaf was significantly higher in the transgenic plants than in the untransformed wild type.

  20. Two overlapping two-component systems in Xanthomonas oryzae pv. oryzae contribute to full fitness in rice by regulating virulence factors expression.

    Zheng, Dehong; Yao, Xiaoyan; Duan, Meng; Luo, Yufeng; Liu, Biao; Qi, Pengyuan; Sun, Ming; Ruan, Lifang

    2016-01-01

    Two-component signal transduction systems (TCSs) are widely used by bacteria to adapt to the environment. In the present study, StoS (stress tolerance-related oxygen sensor) and SreKRS (salt response kinase, regulator, and sensor) were found to positively regulate extracellular polysaccharide (EPS) production and swarming in the rice pathogen Xanthomonas oryzae pv. oryzae (Xoo). Surprisingly, the absence of stoS or sreKRS did not attenuate virulence. To better understand the intrinsic functions of StoS and SreKRS, quantitative proteomics isobaric tags for relative and absolute quantitation (iTRAQ) was employed. Consistent with stoS and sreK mutants exhibiting a similar phenotype, the signalling circuits of StoS and SreKRS overlapped. Carbohydrate metabolism proteins and chemotaxis proteins, which could be responsible for EPS and swarming regulation, respectively, were reprogrammed in stoS and sreK mutants. Moreover, StoS and SreKRS demonstrated moderate expression of the major virulence factor, hypersensitive response and pathogenicity (Hrp) proteins through the HrpG-HrpX circuit. Most importantly, Xoo equipped with StoS and SreKRS outcompetes strains without StoS or SreKRS in co-infected rice and grows outside the host. Therefore, we propose that StoS and SreKRS adopt a novel strategy involving the moderation of Hrp protein expression and the promotion of EPS and motility to adapt to the environment. PMID:26957113