WorldWideScience

Sample records for aa 2024-t3 substrate

  1. Corrosion of AA2024-T3 Part III: Propagation

    Research highlights: → Corrosion of AA2024 in 0.1 M NaCl was examined for immersion times up to 120 min. → Rings of corrosion product with H2 evolution developed after 5 min immersion. → Intergranular attack penetrated up to 60 μm below the rings within 120 min. → After 240 min mixed intergranular attack and grain etchout were observed. - Abstract: Optical and electron microscopies and EBSD were used to study the early stages of corrosion propagation during stable pit formation on AA2024-T3. Polished AA2024-T3 developed large scale rings of corrosion product, typically a few hundred microns in diameter, within 2 h of exposure to 0.1 M NaCl at room temperature. These features were sectioned using diamond ultramicrotomy and substantial subsurface attack, in the form of intergranular corrosion was observed beneath these sites with virtually no grain etchout. A model is proposed for the mechanism of stable pit progression which involves extensive grain boundary attack, followed by grain etchout leading to open pit formation.

  2. Corrosion protection of AA 2024-T3 by bis-[3-(triethoxysilyl)propyl]tetrasulfide in neutral sodium chloride solution. Part 1: corrosion of AA 2024-T3

    This study consists of two parts. In the first part, the corrosion of 2024-T3 aluminum alloy (AA 2024-T3) was studied using scanning electron microscopy and energy-dispersive X-ray spectroscopy. The results showed that the anodic S phase (Al2CuMg) particles dealloyed Al and Mg during the 3.5 h of immersion in a neutral 0.6 M sodium chloride (NaCl) solution; with the dealloying of Mg being the most severe. Simultaneously, a heavy dissolution was also observed for the surrounding Al matrix of the S phase particles. This Al dissolution is likely to be caused by a local alkalization resulting from the coupled cathodic reaction (water and/or oxygen reduction). Such corrosion in AA 2024-T3, however, can be inhibited efficiently after the treatment of bis-[3-(triethoxysilyl)propyl]tetrasulfide (bis-sulfur silane). The associated studies on bis-sulfur silane treated AA 2024-T3 will be presented in the second part

  3. Corrosion protection of AA 2024-T3 by bis-[3-(triethoxysilyl)propyl]tetrasulfide in neutral sodium chloride solution. Part 1: corrosion of AA 2024-T3

    Zhu Danqing; Ooij, Wim J. van

    2003-10-01

    This study consists of two parts. In the first part, the corrosion of 2024-T3 aluminum alloy (AA 2024-T3) was studied using scanning electron microscopy and energy-dispersive X-ray spectroscopy. The results showed that the anodic S phase (Al{sub 2}CuMg) particles dealloyed Al and Mg during the 3.5 h of immersion in a neutral 0.6 M sodium chloride (NaCl) solution; with the dealloying of Mg being the most severe. Simultaneously, a heavy dissolution was also observed for the surrounding Al matrix of the S phase particles. This Al dissolution is likely to be caused by a local alkalization resulting from the coupled cathodic reaction (water and/or oxygen reduction). Such corrosion in AA 2024-T3, however, can be inhibited efficiently after the treatment of bis-[3-(triethoxysilyl)propyl]tetrasulfide (bis-sulfur silane). The associated studies on bis-sulfur silane treated AA 2024-T3 will be presented in the second part.

  4. Cerium tartrate as a corrosion inhibitor for AA 2024-T3

    Highlights: • Cerium tartrate was found to be an effective inhibitor for AA 2024-T3. • Both anodic and cathodic inhibitions were present during the corrosion process. • The corrosion of Al2CuMg phase was well inhibited by cerium tartrate. - Abstract: A new corrosion inhibitor, cerium tartrate, was synthetized. The inhibition behavior of cerium tartrate for 2024-T3 aluminum alloy was investigated in 0.05 M NaCl solution. The immersion tests indicate that the corrosion of Al2CuMg phase was well inhibited. The electrochemical results show that both anodic and cathodic inhibitions are present during the corrosion process. The surface characterizations reveal that the protective film of cerium tartrate inhibits the dealloying of Al2CuMg phase in the initial stage, and then cerium ions transform to cerium oxide/hydroxides and appear at the Al2CuMg phase, blocking the further corrosion at those corrosion sites

  5. Blister Test for Measurements of Adhesion and Adhesion Degradation of Organic Polymers on AA2024-T3

    Rincon Troconis, Brendy Carolina

    A key parameter for the performance of corrosion protective coatings applied to metals is adhesion. Surface preparation prior to coating application is known to be critical, but there is a lack of understanding of what controls adhesion. Numerous techniques have been developed in the last decades to measure the adhesion strength of coatings to metals. Nonetheless, they are generally non-quantitative, non-reproducible, performed in dry conditions, or overestimate adhesion. In this study, a quantitative and reproducible technique, the Blister Test (BT), is used. The BT offers the ability to study the effects of a range of parameters, including the presence or absence of a wetting liquid, and simulates the stress situation in the coating/substrate interface. The effects of roughness and surface topography were studied by the BT and Optical Profilometry, using AA2024-T3 substrates coated with polyvinyl butyral (PVB). Random abrasion generated a surface with lower average roughness than aligned abrasion due to the continual cross abrasion of the grooves. The BT could discern the effects of different mechanical treatments. An adhesion strength indicator was defined and found to be a useful parameter. The effectiveness of standard adhesion techniques such as ASTM D4541 (Pull-off Test) and ASTM D3359 (Tape Test) was compared to the BT. Also, different attempts to measure adhesion and adhesion degradation of organic polymers to AA2024-T3 were tested. The pull-off test does not produce adhesive failure across the entire interface, while the tape test is a very qualitative technique and does not discern between the effects of different coating systems on the adhesion performance. The BT produces adhesive failure of the primer studied, is very reproducible, and is able to rank different coating systems. Therefore, it was found to be superior to the others. The approaches tested for adhesion degradation were not aggressive enough to have a measurable effect. The effects of

  6. The corrosion protection of AA2024-T3 aluminium alloy by leaching of lithium-containing salts from organic coatings.

    Visser, Peter; Liu, Yanwen; Zhou, Xiaorong; Hashimoto, Teruo; Thompson, George E; Lyon, Stuart B; van der Ven, Leendert G J; Mol, Arjan J M C; Terryn, Herman A

    2015-01-01

    Lithium carbonate and lithium oxalate were incorporated as leachable corrosion inhibitors in model organic coatings for the protection of AA2024-T3. The coated samples were artificially damaged with a scribe. It was found that the lithium-salts are able to leach from the organic coating and form a protective layer in the scribe on AA2024-T3 under neutral salt spray conditions. The present paper shows the first observation and analysis of these corrosion protective layers, generated from lithium-salt loaded organic coatings. The scribed areas were examined by scanning and transmission electron microscopy before and after neutral salt spray exposure (ASTM-B117). The protective layers typically consist of three different layered regions, including a relatively dense layer near the alloy substrate, a porous middle layer and a flake-shaped outer layer, with lithium uniformly distributed throughout all three layers. Scanning electron microscopy and white light interferometry surface roughness measurements demonstrate that the formation of the layer occurs rapidly and, therefore provides an effective inhibition mechanism. Based on the observation of this work, a mechanism is proposed for the formation of these protective layers. PMID:25927079

  7. Growth of PEO ceramic coatings on AA 2024-T3 aluminium alloy

    Forero Sotomonte, S.; Blanco Pinzon, C.; García Vergara, S.

    2016-02-01

    The growth of PEO ceramic coatings on AA 2024-T3 aluminium alloy in an aqueous Na2SiO3 (10.5g/l), KOH (2.8g/l) solution at 310 and 400V for 500 and 710s, was investigated. The morphology, roughness and thickness of the coatings were determined by SEM, digital microscopy, XRD diffraction analysis and thickness measuring instrument. The results show that thicker coatings are produced with longer process times and high applied voltages. Due to the nature of the PEO process, the roughness of the surface coatings increases as the coating become thicker, due to the development of sparks. The coatings are porous, with a crater like morphology and they are mainly amorphous.

  8. Integrated FEM-DBEM simulation of crack propagation in AA2024-T3 FSW butt joints considering manufacturing effects

    Sonne, Mads Rostgaard; Carlone, P.; Citarella, R.;

    2015-01-01

    This paper deals with a numerical and experimental investigation on the influence of residual stresses on fatigue crack growth in AA2024-T3 friction stir welded butt joints. An integrated FEM-DBEM procedure for the simulation of crack propagation is proposed and discussed. A numerical FEM model of...... the welding process of precipitation hardenable AA2024-T3 aluminum alloy is employed to infer the process induced residual stress field. The reliability of the FEM simulations with respect to the induced residual stresses is assessed comparing numerical outcomes with experimental data obtained by...... means of the contour method. The computed stress field is transferred to a DBEM environment and superimposed to the stress field produced by a remote fatigue traction load applied on a friction stir welded cracked specimen. Numerical results are compared with experimental data showing good agreement and...

  9. The influence of rare earth mercaptoacetate on the initiation of corrosion on AA2024-T3 Part II: The influence of intermetallic compositions within heavily attacked sites

    Highlights: • Effect of intermetallic clustering was investigated on the surface of AA2024-T3. • Both rare earth mercaptoacetate inhibitors stifled the corrosion ring formation. • Surface area and the number of domains were critical for severely corroded sites. • Most clustered sites were not always the most severely attacked sites. - Abstract: Localised corrosion is typical on AA2024-T3 due to intermetallic particles embedded in the alloy. The effect of intermetallic compositions on corrosion are not yet fully understood. EPMA data on AA2024-T3 surfaces before and after a 16 min immersion, analyses the influence of intermetallic clustering on the severity attack at local sites. While sites with a high number of domains and a large S-phase surface area typically lead to severe attack, maximising these features did not always lead to severe corrosion attack. Cerium or praseodymium mercaptoacetate inhibited corrosion ring formation. The common trends observed from such attack sites was also discussed

  10. The influence of rare earth mercaptoacetate on the initiation of corrosion on AA2024-T3 Part I: Average statistics of each intermetallic composition

    Highlights: • The effect of intermetallic clustering was investigated on the surface of AA2024-T3. • Both rare earth mercaptoacetate inhibitors stifled the de-alloying process of S-phase. • Each intermetallic particle type appeared to participate in local corrosion reactions. • There was some level of clustering between S-phase and other intermetallic particle types within a 25 μm radius. - Abstract: De-alloying of S-phase in AA2024-T3 in the presence chlorides, is well-known. However, it is unclear how rare earth mercaptoacetate inhibitors affect this process when immersed in a 0.1 M NaCl solution. This paper analyses data obtained using EPMA on AA2024-T3 surfaces before and after a 16 min immersion period. Cerium and praseodymium mercaptoacetate inhibited the de-alloying process of S-phase particles. Although no significant change in composition was observed for cathodic intermetallics, each appeared to participate in local corrosion reactions as evidenced by the development of surface oxides. Clustering between S-phase and one of the Cu-containing intermetallic domains was also evident

  11. Evolution of the corrosion process of AA 2024-T3 in an alkaline NaCl solution with sodium dodecylbenzenesulfonate and lanthanum chloride inhibitors

    Zhou, Biner; Wang, Yishan; Zuo, Yu

    2015-12-01

    The evolution of the corrosion process of AA 2024-T3 in 0.58 g L-1 NaCl solution (pH 10) with sodium dodecylbenzenesulfonate (SDBS) and lanthanum chloride inhibitors was studied with electrochemical and surface analysis methods. With the addition of the compounded LaCl3 and SDBS inhibitors, in the early stage the polarization behavior of AA 2024-T3 changed from active corrosion to passivation, and both the general corrosion and pitting corrosion were inhibited. However, with the immersion time extended, the passive behavior gradually disappeared and pitting happened at the Cu-rich phases. After 24 h immersion, the compounded inhibitors still showed good inhibition for general corrosion, but the polarization curve again presented the characteristic similar to active polarization. The compounded inhibitors also inhibited the pitting corrosion to some extent. The acting mechanism of the inhibitors SDBS and La3Cl on the corrosion process of AA 2024-T3 in the test solution was discussed.

  12. Electro-assisted preparation of dodecyltrimethoxysilane/TiO{sub 2} composite films for corrosion protection of AA2024-T3 (aluminum alloy)

    Li Mei; Yang Yaqin; Liu Liang [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China); Hu Jiming, E-mail: kejmhu@zju.edu.c [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China); Zhang Jianqing [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China)

    2010-03-01

    Thin films of organosilanes have been successfully used as the alternative to toxic chromate coatings for surface pretreatment of metals and alloys. To further improve their corrosion performance, in the present work nano-scaled TiO{sub 2} particles were added to the dodecyltrimethoxysilane (DTMS) films coated onto AA2024-T3 substrates, by using either the dip-coating or the cathodically electro-assisted deposition process. The obtained composite films were investigated by scanning electron microscopy (SEM), atomic force microscopy (AFM), water contact angle measurements, Fourier transform reflection-absorption IR (FTRA-IR) and electrochemical impedance spectroscopy (EIS). The results show that these two techniques (nanoparticles incorporation and the electro-assisted deposition) both facilitate the deposition process of silane films, giving thicker deposit and higher coverage surface along with higher roughness and hydrophobicity, and thereby improve their corrosion resistance. Moreover, the corrosion performance of silane films is further improved by the combined use of nanoparticles modification and electro-assisted deposition.

  13. Electro-assisted preparation of dodecyltrimethoxysilane/TiO2 composite films for corrosion protection of AA2024-T3 (aluminum alloy)

    Thin films of organosilanes have been successfully used as the alternative to toxic chromate coatings for surface pretreatment of metals and alloys. To further improve their corrosion performance, in the present work nano-scaled TiO2 particles were added to the dodecyltrimethoxysilane (DTMS) films coated onto AA2024-T3 substrates, by using either the dip-coating or the cathodically electro-assisted deposition process. The obtained composite films were investigated by scanning electron microscopy (SEM), atomic force microscopy (AFM), water contact angle measurements, Fourier transform reflection-absorption IR (FTRA-IR) and electrochemical impedance spectroscopy (EIS). The results show that these two techniques (nanoparticles incorporation and the electro-assisted deposition) both facilitate the deposition process of silane films, giving thicker deposit and higher coverage surface along with higher roughness and hydrophobicity, and thereby improve their corrosion resistance. Moreover, the corrosion performance of silane films is further improved by the combined use of nanoparticles modification and electro-assisted deposition.

  14. A combinatorial matrix of rare earth chloride mixtures as corrosion inhibitors of AA2024-T3: Optimisation using potentiodynamic polarisation and EIS

    A combinatorial matrix of four rare earth chlorides has been evaluated for the corrosion inhibition of aluminium alloy AA2024-T3 in aqueous solution. Two electrochemical techniques, potentiodynamic polarisation (PP) and electrochemical impedance spectroscopy (EIS), were used to evaluate AA2024-T3 corrosion in 0.1 M NaCl with the addition of 10−3 M of rare earth chloride mixtures at time periods up to 18 h. PP experiments showed rare earth inhibition of up to 98% within the first hour and thereafter corrosion rates were steadily decreased. The open-circuit potential (OCP) of AA2024-T3 decreased as a function of time for all solutions indicating predominantly cathodic inhibition. However, differing trends in the OCP were observed during PP and EIS experiments and are discussed in terms of likely time-dependent mechanisms. A comparative study of optimisation models indicated the best mixture at 10−3 M total inhibitor concentration was predicted to be 72% cerium (Ce) and 28% (praseodymium (Pr)/lanthanum (La)) ions. As the amount of Ce is decreased from this level the corrosion inhibition is predicted to decrease also, regardless of what other rare earths (La, Pr and Nd) are added alone or in combination. Individually, La, Pr and Nd show varying levels of corrosion inhibition activity, all of which are inferior to that of Ce. If Ce is absent entirely, then a mixture of approximately 50% Pr and 50% Nd is predicted to be preferred. This is one of the first applications of combinatorial design for the optimisation of corrosion inhibitor mixtures.

  15. The role of Mg2+ ions in the corrosion behaviour of AA2024-T3 aluminium alloys immersed in chloride-containing environments

    It is well-known the harmful impact of chloride ions in the corrosion behaviour of aluminium and its alloys. The present work investigates the use of Mg2+ ions as corrosion inhibitors of AA2024-T3 samples immersed in chloride-containing electrolytes. AA2024-T3 samples were immersed into an electrolyte containing chloride ions, in absence or presence of Mg2+. The electrochemical behaviour was studied by potentiondynamic polarization and electrochemical impedance spectroscopy techniques. The results showed the beneficial effects afforded by the Mg2+ ions. First, the open circuit potential was shifted towards more cathodic values and, on the other hand, the impedance values obtained for samples tested in presence of Mg2+ were higher, suggesting a slowdown of the corrosion rate. The morphological characterization was performed using scanning electron microscopy and energy dispersive X-ray spectroscopy. The results demonstrated that the presence Mg2+ hinders Mg dealloying of the S phase particles, which delays their change from anodic to cathodic behaviour, so delaying the subsequent Al matrix galvanic attack. An additional protection mechanism is related to the blockage of cathodic areas by the precipitation of Mg(OH)2 in alkaline environments

  16. Protective film formation on AA2024-T3 aluminum alloy by leaching of lithium carbonate from an organic coating

    Liu, Y.; Visser, P.; Zhou, X.; Lyon, S.B.; Hashimoto, T.; Curioni, M.; Gholinia, A.; Thompson, G.E.; Smyth, G.; Gibbon, S.R.; Graham, D.; Mol, J.M.C.; Terryn, H.A.

    2015-01-01

    An investigation into corrosion inhibition properties of a primer coating containing lithium carbonate as corrosion inhibitive pigment for AA2024 aluminum alloy was conducted. It was found that, during neutral salt spray exposure, a protective film of about 0.2 to 1.5 μm thickness formed within the

  17. Protective film formation on AA2024-T3 aluminum alloy by leaching of lithium carbonate from an organic coating

    Liu, Y.; Visser, P; Zhou, X.; Lyon, S B; Hashimoto, T; Curioni, M.; Gholinia, A.; Thompson, G. E.; Smyth, G.; Gibbon, S.R.; Graham, D; Mol, J.M.C.; Terryn, H.A.

    2015-01-01

    An investigation into corrosion inhibition properties of a primer coating containing lithium carbonate as corrosion inhibitive pigment for AA2024 aluminum alloy was conducted. It was found that, during neutral salt spray exposure, a protective film of about 0.2 to 1.5 μm thickness formed within the area where an artificial defect was introduced by scribing through the coating to the base alloy. This film showed a multilayered structure consisting of a relatively compact layer near the alloy s...

  18. Protective Film Formation on AA2024-T3 Aluminum Alloy by Leaching of Lithium Carbonate from an Organic Coating

    Yanwen Liu, Peter Visser, Xiaorong Zhou, Stuart B. Lyon, Teruo Hashimoto, Michele Curioni, Ali Gholinia, George E. Thompson, Gerard Smyth, Simon R. Gibbon, Derek Graham, Johannes M. C. Mol, and Herman Terryn

    2015-01-01

    An investigation into corrosion inhibition properties of a primer coating containing lithium carbonate as corrosion inhibitive pigment for AA2024 aluminum alloy was conducted. It was found that, during neutral salt spray exposure, a protective film of about 0.2 to 1.5 μm thickness formed within the area where an artificial defect was introduced by scribing through the coating to the base alloy. This film showed a multilayered structure consisting of a relatively compact layer near the alloy ...

  19. Análisis numérico de la conformabilidad de chapas de AA2024 - T3 en procesos de conformado incremental mono - punto usando DEFORM - 3D

    Candel Carreras, Zoila

    2015-01-01

    El método de los elementos finitos es un método numérico muy usado en ingeniería para la resolución de problemas complejos . DEFORM™ - 3D es un software de elementos finitos de carácter robusto y basado en cálculo implícito, que tiene además una gran aplicación industrial. En este Trabajo de Fin de Grado se ha modelado en DEFORM™ - 3D un proceso de conformado incremental mono - punto o SPIF (del inglés Single Point Incremental Forming ) para chapas de aleación de aluminio AA2024 - T3, con obj...

  20. On the coupling between precipitation and plastic deformation in relation with friction stir welding of AA2024 T3 aluminium alloy

    Genevois, Cecile [LTPCM, CNRS UMR 5614, Institut National Polytechnique de Grenoble, BP 75, 38 402 St. Martin d' Heres Cedex (France); Fabregue, Damien [LTPCM, CNRS UMR 5614, Institut National Polytechnique de Grenoble, BP 75, 38 402 St. Martin d' Heres Cedex (France); Deschamps, Alexis [LTPCM, CNRS UMR 5614, Institut National Polytechnique de Grenoble, BP 75, 38 402 St. Martin d' Heres Cedex (France)]. E-mail: alexis.deschamps@ltpcm.inpg.fr; Poole, Warren J. [Department of Metals and Materials Engineering, University of British Columbia, Vancouver (Canada)

    2006-12-15

    We have investigated the influence of plastic deformation on the precipitation kinetics of the S'(S) phase in the AA2024 aluminium alloy, with the objective of understanding the microstructures found in friction stir welds of the same alloy. Different types of thermo-mechanical treatments have been investigated, where plastic deformation has been carried out either before heating in a salt bath, or concurrently with the thermal treatment in a Gleeble compression apparatus. The volume fraction of precipitates has been measured by differential scanning calorimetry and the precipitate morphology has been observed by transmission electron microscopy. It is observed that plastic deformation increases the precipitation kinetics in the temperature range below 300 deg. C. This can be attributed both to the increase in the number of nucleation sites and to the increase in the effective diffusion coefficient. At higher temperatures the influence of plasticity on the volume fraction is negligible, however, in the presence of deformation during the heat treatment, the precipitate morphology is profoundly modified. The effect of plastic deformation is observed to be similar, whether plastic deformation is carried out before or during the heat treatment. These results are shown to be valuable tools in understanding the microstructures of friction stir welds of the same material. It is shown that taking into account the effect of plastic deformation is not absolutely necessary in the thermo-mechanically affected zone. However, we show that the precipitate microstructure in some parts of the heat-affected zone is strongly influenced by a small amount of plasticity.

  1. On the coupling between precipitation and plastic deformation in relation with friction stir welding of AA2024 T3 aluminium alloy

    We have investigated the influence of plastic deformation on the precipitation kinetics of the S'(S) phase in the AA2024 aluminium alloy, with the objective of understanding the microstructures found in friction stir welds of the same alloy. Different types of thermo-mechanical treatments have been investigated, where plastic deformation has been carried out either before heating in a salt bath, or concurrently with the thermal treatment in a Gleeble compression apparatus. The volume fraction of precipitates has been measured by differential scanning calorimetry and the precipitate morphology has been observed by transmission electron microscopy. It is observed that plastic deformation increases the precipitation kinetics in the temperature range below 300 deg. C. This can be attributed both to the increase in the number of nucleation sites and to the increase in the effective diffusion coefficient. At higher temperatures the influence of plasticity on the volume fraction is negligible, however, in the presence of deformation during the heat treatment, the precipitate morphology is profoundly modified. The effect of plastic deformation is observed to be similar, whether plastic deformation is carried out before or during the heat treatment. These results are shown to be valuable tools in understanding the microstructures of friction stir welds of the same material. It is shown that taking into account the effect of plastic deformation is not absolutely necessary in the thermo-mechanically affected zone. However, we show that the precipitate microstructure in some parts of the heat-affected zone is strongly influenced by a small amount of plasticity

  2. Characterization of 2024-T3: An aerospace aluminum alloy

    The 2024-T3 aerospace aluminum alloy, reported in this investigation, was acquired from a local aerospace industry: Royal Malaysian Air Force (RMAF). The heat treatable 2024-T3 aluminum alloy has been characterized by use of modern metallographic and material characterization techniques (e.g. EPMA, SEM). The microstructural characterization of the metallographic specimen involved use of an optical microscope linked with a computerized imaging system using MSQ software. The use of EPMA and electron microprobe elemental maps enabled us to detect three types of inclusions: Al-Cu, Al-Cu-Fe-Mn, and Al-Cu-Fe-Si-Mn enriched regions. In particular, the presence of Al2CuMg (S-phase) and the CuAl2 (θ') phases indicated precipitation strengthening in the aluminum alloy

  3. QUANTIFICATION OF SHEAR DAMAGE EVOLUTION IN ALUMINIUM ALLOY 2024T3

    Tang Chak-yin; Fan Jianping; Tsui Chi-pong; Lee Tai-chiu; Chan Luen-chow; Rao Bin

    2007-01-01

    Shear damage may occur in the process of metal machining such as blanking and cutting, where localized shear deformation is developed. Experimental findings indicate that microscopic shear damage evolution in aluminium alloy 2024T3 (Al 2024T3) is a multi-stage mechanism, including particle cracking, micro-shear banding, matrix microcracking and coalescence of microcracks. This study is an attempt to use a set of equations to describe the multi-stage shear damage evolution in Al 2024T3. The shear damage variables in terms of multi-couple parameters of a power-law hardening material have been defined. An evolution curve of shearing damage has been calculated from experimental data. The values of the shear damage variable at different stages of damage have also been calculated. By making use of the findings, the relation between the microscopic shear damage evolution and the macroscopic shear response of the material has been discussed.

  4. Corrosion behaviour of sol-gel coatings doped with cerium salts on 2024-T3 aluminum alloy

    Shi Hongwei; Liu Fuchun [State Key Laboratory for Corrosion and Protection, Institute of Metal Research, Chinese Academy of Sciences, Shenyang 110016 (China); Han Enhou, E-mail: ehhan@imr.ac.cn [State Key Laboratory for Corrosion and Protection, Institute of Metal Research, Chinese Academy of Sciences, Shenyang 110016 (China)

    2010-11-01

    The corrosion behaviour of the sol-gel coatings doped with cerium chloride or cerium nitrate on 2024-T3 aluminum alloy was investigated by using electrochemical impedance spectroscopy (EIS) and immersion tests. The sol-gel matrix was obtained through hydrolysis, condensation of 3-glycidoxypropyltrimethoxysilane (GPTMS) and tetramethoxysilane (TMOS), using diethylentriamine as curing agent. The results indicated that cerium nitrate with concentration of 1 x 10{sup -3} mol L{sup -1} in the silane solution was excellent on self-healing for the sol-gel coating, while cerium chloride had no obvious effect. This result suggested that the introduction of Cl{sup -} promoted the under-film pitting of 2024-T3 substrate. It was found that Ce(OH){sub 3} and Ce(OH){sub 2}{sup 2+} simultaneously existed in the silane solution by X-ray diffraction (XRD) analysis. Ce(OH){sub 2}{sup 2+} transformed to CeO{sub 2} due to high-temperature curing of sol-gel matrix demonstrated by X-ray photoelectron spectroscopy (XPS) analysis. Therefore, it can be considered that Ce(OH){sub 3} and CeO{sub 2} played inhibition roles in the corrosion process of the sol-gel coatings.

  5. A room temperature cured sol-gel anticorrosion pre-treatment for Al 2024-T3 alloys

    The inherent reactivity of the Al-Cu alloys is such that their use for structural, marine, and aerospace components and structures would not be possible without prior application of a corrosion protection system. Historically these corrosion protection systems have been based upon the use of chemicals containing Cr(VI) compounds. Organic-inorganic hybrid silane coatings are of increasing interest in industry due to their potential application for the replacement of current toxic hexavalent chromate based treatments. In the present study, a hybrid epoxy-silica-alumina coating with or without doped cerium nitrate has been prepared using a sol-gel method. The hybrid coatings were applied by a dip-technique to an Al-Cu alloy, Al 2024-T3, and subsequently cured at room temperature. The anticorrosion properties of the coatings within 3.5% NaCl were studied using electrochemical impedance spectroscopy (EIS), and conventional DC polarisation. An exfoliation test method involving immersion in a solution of 4 M NaCl, 0.5 M KNO3 and 0.1 M HNO3 was also used. The cerium nitrate doped sol-gel coating exhibited excellent anticorrosion properties providing an adherent protection film on the Al 2024-T3 substrate. The resistance to corrosion of the sol-gel coating was also evaluated by analysing the morphology of the coating before and after corrosion testing using scanning electron microscopy

  6. Etude du soudage TIG de l'alliage d'aluminium 2024-T3

    OUALLAM, Seddik; MASSE, Jean-Eric; DJEGHLAL, Lamine; Barrallier, Laurent; KABBA, L

    2013-01-01

    Recent programs of aircraft design are characterized in terms of materials, by introducing weldable alloys as alternatives to the traditional technique of riveting, open the way to reduce weight and allow cost reductions in production and maintenance. Understanding the influence of various parameters of TIG welding process applied to the alloy 2024-T3 aluminum should help us to take into account the behavior in service of assemblies, from the design of structures. This work deals with the def...

  7. Effect of aging time and temperature on exfoliation corrosion of aluminum alloys 2024-T3 and 7075-T6

    Khoshnaw, F.M.; Gardi, R.H. [Wolfson School of Mechanical and Manufacturing Engineering Loughborough University, Loughborough, LE11 3TU Leicestershire (United Kingdom)

    2007-05-15

    Two types of aluminum alloys, 2024-T3 and 7075-T6, have been selected in this study to investigate the effect of metallurgical aspects on exfoliation corrosion. To determine and evaluate the metallurgical effects of heat treatments on corrosion behaviour of these alloys, G34 ASTM test was selected to investigate the exfoliation corrosion behaviour. The results showed that with increasing the aging time for the aluminum alloy type 2024-T3 the susceptibility to exfoliation corrosion increases, while for type 7075-T6 decreased. These results refer to precipitation of the intermetallic compound phases such as CuAl{sub 2}, and MgZn{sub 2}, in 2024-T3 and 7075-T6 respectively. The amount of these phases increases with increasing the aging time for both alloys. The investigations showed the phases that initiate in 2024-T3 act as anode sites while in 7075-T6 they act as cathode sites. (Abstract Copyright [2007], Wiley Periodicals, Inc.)

  8. Determination of anisotropy in impact toughness of aluminium alloy 2024 T3 plate

    Siddiqui, M. H.; Hashmi, F.; Junaid, A.

    The research was aimed to quantify the existence of anisotropy in fracture toughness of aluminium alloy 2024 T3 plate (used in aircraft structural members). It was further needed to establish the direction in which the fracture toughness of aluminium alloy 2024 T3 plate is maximum and minimum. This could help ascertain the structural integrity of aircraft structural components; also while designing new components, the knowledge of variation in toughness with respect to direction helps in economizing dead weight of the aircraft. In this research, pursued at the College of Aeronautical Engineering, the anisotropy in toughness of aluminium alloy 2024 T3 plate was analysed using the Charpy V-notch impact toughness test. The effect of specimen orientation on the impact toughness values of the alloy was investigated and compared with known results to verify the reliability of the work and to ascertain the extent of anisotropy in fracture toughness of the said alloy. Charpy impact tests were carried out on ASTM E 23 standard specimens machined at a reference laboratory at room temperature (23° C +/- 2° C). Four different specimen orientations analysed for the purpose of this study were L-S, L-T, T-S and T-L directions. Subsequently, the results obtained at the research centre were then analysed and correlated with morphology of microstructure of the material to establish the reliability of the experimental results. Moreover, an analysis was also done to cater for the possible errors that could affect the fracture toughness values obtained from experimental results. It was concluded that the T-S orientation of the plate had maximum toughness, whereas, minimum toughness was observed in L-T direction.

  9. Adherence of electrodeposited Zn-Ni coatings on EN AW2024 T3 aluminium alloy

    Alexis, Joël; Adrian, Denise; Masri, Talal; Petit, Jacques-Alain

    2004-01-01

    The use of hexavalent chromium in surface treatments will be reduced in the future, as it is suspected to be carcinogenic. Electrodeposition of Zn-Ni, which is currently used on steel, represents a non-chromate alternative surface treatment for the corrosion protection of aluminium alloys. Zn-Ni coatings were electrodeposited onto an EN AW2024 T3 aluminium alloy sheet in a laboratory flow cell. To obtain several percentages of Ni in the coatings, solutions with different Ni2+ concentrations w...

  10. Protection of 2024-T3 aluminium alloy by corrosion resistant phytic acid conversion coating

    Shi, Hongwei; Han, En-Hou; Liu, Fuchun; Kallip, Silvar

    2013-09-01

    The corrosion protection properties of environmentally friendly phytic acid conversion coatings were studied on 2024-T3 aluminium alloy. The films were prepared under acidic conditions with various pH values and characterised by SEM, EDS, ATR-FTIR and electrochemical techniques. The results indicate that the conversion coatings obtained by immersing the alloy in phytic acid solutions at pH from 3 to 5.5 provide excellent corrosion resistance. ATR-FTIR confirms that the film is formed by deposition of reaction products between Al3+ and phosphate groups in phytic acid molecules. The conformation models of the deposition film are proposed.

  11. Friction stir spot welding of 2024-T3 aluminum alloy with SiC nanoparticles

    In this study, the Friction stir spot welding (FSSW) of 2024-T3 aluminum alloy with 1.6 mm thickness was investigated. The effects of the silicon carbide (SiC) nanoparticles on the metallurgical and mechanical properties were discussed. The effects of particles on tension shear and wear tests were also investigated. The process was conducted at a constant rotational speed of 1000 rpm. Results showed that adding SiC nanoparticles to the weld during FSSW had a major effect on the mechanical properties. In fact, the addition of nanoparticles as barriers prevented grain growth in the Stir zone (SZ). The data obtained in the tensile-shear and wear tests showed that tensile-shear load and wear resistance increased with the addition of SiC nanoparticles, which was attributed to the fine grain size produced in the SZ

  12. Friction stir spot welding of 2024-T3 aluminum alloy with SiC nanoparticles

    Paidar, Moslem; Sarab, Mahsa Laali [Islamic Azad University, Tehran (Iran, Islamic Republic of)

    2016-01-15

    In this study, the Friction stir spot welding (FSSW) of 2024-T3 aluminum alloy with 1.6 mm thickness was investigated. The effects of the silicon carbide (SiC) nanoparticles on the metallurgical and mechanical properties were discussed. The effects of particles on tension shear and wear tests were also investigated. The process was conducted at a constant rotational speed of 1000 rpm. Results showed that adding SiC nanoparticles to the weld during FSSW had a major effect on the mechanical properties. In fact, the addition of nanoparticles as barriers prevented grain growth in the Stir zone (SZ). The data obtained in the tensile-shear and wear tests showed that tensile-shear load and wear resistance increased with the addition of SiC nanoparticles, which was attributed to the fine grain size produced in the SZ.

  13. Analysis of the tool plunge in friction stir welding - comparison of aluminium alloys 2024 T3 and 2024 T351

    Veljić Darko

    2016-01-01

    Full Text Available Temperature, plastic strain and heat generation during the plunge stage of the friction stir welding (FSW of high-strength aluminium alloys 2024 T3 and 2024 T351 are considered in this work. The plunging of the tool into the material is done at different rotating speeds. A three-dimensional finite element (FE model for thermomechanical simulation is developed. It is based on arbitrary Lagrangian-Eulerian formulation, and Johnson-Cook material law is used for modelling of material behaviour. From comparison of the numerical results for alloys 2024 T3 and 2024 T351, it can be seen that the former has more intensive heat generation from the plastic deformation, due to its higher strength. Friction heat generation is only slightly different for the two alloys. Therefore, temperatures in the working plate are higher in the alloy 2024 T3 for the same parameters of the plunge stage. Equivalent plastic strain is higher for 2024 T351 alloy, and the highest values are determined under the tool shoulder and around the tool pin. For the alloy 2024 T3, equivalent plastic strain is the highest in the influence zone of the tool pin. [Projekat Ministarstva nauke Republike Srbije, br. TR 34016 i br. TR 35006

  14. Review and study of physics driven pitting corrosion modeling in 2024-T3 aluminum alloys

    Yu, Lingyu; Jata, Kumar V.

    2015-04-01

    Material degradation due to corrosion and corrosion fatigue has been recognized to significantly affect the airworthiness of civilian and military aircraft, especially for the current fleet of airplanes that have served beyond their initial design life. The ability to predict the corrosion damage development in aircraft components and structures, therefore, is of great importance in managing timely maintenance for the aging aircraft vehicles and in assisting the design of new ones. The assessment of aircraft corrosion and its influence on fatigue life relies on appropriate quantitative models that can evaluate the initiation of the corrosion as well as the accumulation during the period of operation. Beyond the aircraft regime, corrosion has also affected the maintenance, safety and reliability of other systems such as nuclear power systems, steam and gas turbines, marine structures and so on. In the work presented in this paper, we reviewed and studied several physics based pitting corrosion models that have been reported in the literature. The classic work of particle induced pitting corrosion by Wei and Harlow is reviewed in detail. Two types of modeling, a power law based simplified model and a microstructure based model, are compared for 2024-T3 alloy. Data from literatures are used as model inputs. The paper ends with conclusions and recommendations for future work.

  15. Evaluating protection systems against marine corrosion of aeronautic alloy Alclad 2024-T3

    William Aperador Chaparro

    2011-05-01

    Full Text Available  This paper shows how two coating systems were obtained as an alternative for protection against corrosion of al clad 2024-T3which is used in battery compartment manufacture for T-41 aircraft. Such systems consist of three types of organic resin: a first layer of P-115 polyester resin as the first coating on both systems, and a second layer of Hetron 197-3 polyester resin in the first system and vinyl-ester resin in the second one. Scanning electron microscopy (SEM was used for surface morphology analysis, showing the roughness produced by surface treatment. The coatings were electrochemically characterised by electro chemical impedance spectroscopy (EIS and Tafel polarization curves; it was found that both systems had good performance against corrosion in a marine environment and the chemical surface preparation system had a superior protective pattern for Alodine5700 + 197-3 Hetron, a 1.42x10-12mpycorrosion rate being obtained while substratum rate was 1.59x10-7 mpy. 

  16. Investigation on a Sol-gel Coating Containing Inhibitors on 2024-T3 Aluminum Alloy

    SHI Hong-wei; LIU Fu-chun; HAN En-hou; SUN Ming-cheng

    2006-01-01

    For a long time, chromate incorporated conversion coatings have been drawn special attention in corrosion protection of aircraft-used aluminum alloys. However,ever-increasing environmental pressures requires that non-chromate conversion coatings be developed because of the detrimental carcinogenic effects of the chromate compounds. In recent years, the sol-gel coatings doped with inhibitors were developed to replace chromate conversion coatings, and showed real promise. A sol-gel coating was prepared and its anti-corrosion behavior was investigated using the potentiodynamic scanning (PDS) and the electrochemical impedance spectroscopy (EIS). It is found that the sol-gel coating obtained by the hydrolysis and condensation of 3-glycidoxypropyltrimethoxysilane (GPTMS) and tetramethoxysilane (TMOS) is prone to form defects if cured at the room temperature, whereas if cured at a higher temperature (100 ℃), these flaws can be avoided. Furthermore, it can be seen that addition of anti-foam agents and surfactants will reduce the faults if cured at the room temperature. Effects of the corrosion inhibitors, CeCl3 and mercaptobenzothiazole (MBT), in the sol-gel coatings on 2024-T3 aluminum alloy were also investigated. Results show that the corrosion resistance of the sol-gel coatings containing CeCl3 proves to be better than that of the pure and MBT added sol-gel coatings by the electrochemical methods.

  17. Organosilane self-assembled layers (SAMs) and hybrid silicate magnesium-rich primers for the corrosion protection of aluminum alloy 2024 T3

    Wang, Duhua

    Although current chromate coatings function very well in corrosion protection for aircraft alloys, such as aluminum alloy 2024 T3, the U.S. Environmental Protection Agency is planning to totally ban the use of chromates as coating materials in the next decade or so because of their extremely toxic effect. For this purpose, both self-assembled layers and silicate magnesium-rich primers were tested to provide the corrosion protection for aluminum alloy. The long-term goal of this research is to develop a coating system to replace the current chromate coating for aircraft corrosion protection. Aluminum alloy 2024 T3 substrates were modified with self-assembled monolayer or multilayer thin films from different alkylsilane compounds. Mono-functional silanes, such as octadecyltrichlorosilane (C18SiCl3), can form a mixed hydrophobic monolayer or multilayer thin film on the aluminum oxide surface to provide a barrier to water and other electrolytes, so the corrosion resistance of the SAMs modified surface was increased significantly. On the other hand, the bi-functional silane self-assembly could attach the aluminum surface through the silicon headgroup while using its functional tailgroup to chemically bond the polymer coating, thus improving the adhesion between the aluminum substrate and coating substantially, and seems to contribute more to corrosion protection of aluminum substrate. Organosilanes were also combined with tetraethyl orthosilicate (TEOS) in propel ratios to form a sol-gel binder to make silicate magnesium-rich primers. Analogue to the inorganic zinc-rich coatings, the silicate magnesium-rich primers also showed excellent adhesion and solvent resistance. The sacrificial magnesium pigments and the chemically inert silicate binder both contribute to the anti-corrosion properties. Future studies will be focused on the formula optimization for better toughness, chemical resistance and anticorrosion performance.

  18. Characterization of fracture behavior of 2024-O and 2024-T3 aluminum alloys; Caracterizacion de la respuesta a fractura de las aleaciones de aluminio 2024-O y 2024-T3

    Monsalve, A.; Morales, R.

    2004-07-01

    The fracture behavior of 2024-O (annealed) and 2024-T3 (precipitation hardened) aluminum alloys used in aeronautical applications have been characterized. The study of the annealed alloy was carried out through the concept of Essential Specific Work of Fracture, using the ESIS protocol. DENT (Double Edge Notch Tension) samples were used, varying the ligament length in order to determine the relationship between the essential specific work of fracture and the thickness of the material. In the case of 2024-T3 alloy, the essential specific work of fracture was determined only for low thicknesses, where the predominant conditions are plane stress. However, for this alloy, the results were not conclusive because of the high fracture toughness of these hardened alloys. Finally, the fracture surface of these alloys was characterized finding a ductile mechanism in the case of the annealed alloy and ductile-brittle mechanism in the case of the hardened alloy. (Author) 9 refs.

  19. Localized coating failure of epoxy-coated aluminium alloy 2024-T3 in 0.5 M NaCl solutions: Correlation between coating degradation, blister formation and local chemistry within blisters

    The role of pH on the nature and rate of the degradation of epoxy coatings on AA2024-T3 panels and subsequent corrosion of the substrate during immersion in NaCl solutions was investigated. In acidic solutions both blister formation and growth are rapid. Blisters become very large (∼1 cm) and new blisters appear to form for a certain time after exposure. Often very small (∼0.1 mm) clear blisters surround these large blisters. Enhanced blister formation is due to irreversibly increased permeability of the coating for chloride ions and protons, the formation of more defect sites within the coating, and the weakening/dissolution of the oxide layer in low pH environments. In neutral pH solutions, coatings fail by forming one, or at most two, active blisters (red in color) within a few days of immersion with the time-to-failure dependent upon coating quality and thickness. Blister growth is a very slow process, and blister diameters rarely exceed a few millimeters even after several weeks. The accumulation of corrosion product within the blister slows down the corrosion rate and blister growth. The chloride concentration in the occluded solutions within the blister is significantly increased over the bulk concentration, and the pH is often in the acidic range. From electrochemical measurements it can be concluded that the anodic and cathodic reactions are confined to the blister and its immediate surroundings, rather than involving more of the surface over which the coating is intact. Based on corrosion morphology it is concluded that replated copper contributes to the overall cathodic reaction

  20. Investigation on the corrosion behaviour and microstructure of 2024-T3 Al alloy treated via plasma electrolytic oxidation

    Fadaee, Hossein; Javidi, Mehdi, E-mail: mjavidi@yahoo.com

    2014-08-01

    Highlights: • Plasma electrolytic oxidation used to improve corrosion resistance of 2024-T3 alloy. • A conventional DC source with low applied voltage was considered for PEO. • Use of glycerin was effective in enhancement of corrosion resistance. • The surface morphology indicated coatings have a dense structure without cracking. • Degradation of coatings with immersion time was investigated. - Abstract: Plasma electrolytic oxidation treatment was performed on 2024-T3 aluminium alloy in a simple and inexpensive electrolyte. It was found that treatment time of 30 min resulted in the most noble corrosion potential and lowest corrosion current density. The surface and cross-sectional morphology indicated that the coating has a dense structure without any cracking. Furthermore, the result of X-ray diffraction analysis indicated that the coating was formed mainly from α-Al{sub 2}O{sub 3}, γ-Al{sub 2}O{sub 3}, Al{sub 3.21}Si{sub 0.47} and small amounts of amorphous phases. The presence of glycerine in the electrolyte composition resulted in not only stabilising the solution but also improving the corrosion resistance.

  1. STUDY THE EFFECTS OF PRESTRAINS IN UNIAXIAL TENSION ON THE FORMING LIMIT DIAGRAM OF ALUMINUM ALLOY SHEETS(2024 T3

    Waleed J. Ali

    2013-05-01

    Full Text Available           The strain path for sheet metal may be changed during forming , this may be affect the forming limit curve (FLC . In this work the FLC before and after prestraining was determined for aluminum alloy (2024 T3 to study the effect of this type of prestraining and in different values on the FLC. This alloy was chosen because it is used widely , specially in aircraft structures .It was shown that the using of uniaxial tension prestrain affects the FLC . The major strain in right side is increased with the increasing in the prestrain , while in the left side the effect is small .  

  2. The effect of hardening laws and thermal softening on modeling residual stresses in FSW of aluminum alloy 2024-T3

    Sonne, Mads Rostgaard; Tutum, Cem Celal; Hattel, Jesper Henri;

    2013-01-01

    and kinematic rules of hardening were used in order to study the effect of the hardening law on the residual stresses as well as on the final yield stress. This numerical model was then applied in two different cases. Firstly, a very simple 1D Satoh test was modeled. Different combinations of either isotropic...... or kinematic hardening together with the metallurgical softening model were applied in order to give a first impression of the tendencies in residual stresses in friction stir welds when choosing different hardening and softening behaviors. Secondly, real friction stir butt welding of aluminum alloy 2024-T3...... conditions toward the choice of hardening rules and especially whether including the softening model or not. --------------------------------------------------------------------------------...

  3. Aplicação de SAM em liga de alumínio AA 2024-T3 com desengraxe alcalino Application of SAM in AA 2024-T3 aluminum alloy with alkaline degrease

    Aline Viomar; André Lazarin Gallina; Isolda Costa; Maico Taras da Cunha; Paulo Rogério Pinto Rodrigues; Everson do Prado Banckzek

    2012-01-01

    As moléculas auto-organizáveis (SAM - Self Assembly Monolayer) são inibidoras de corrosão, devido à capacidade de se organizarem sobre superfícies formando filmes finos. A SAM apresenta elevada afinidade pelo óxido formado sobre o alumínio, porém as interações entre a camada de óxido e as SAM nem sempre são satisfatórias, pois o óxido formado na superfície apresenta heterogeneidades, que interferem na formação do filme de SAM. O objetivo desse trabalho foi estudar a proteção à corrosão do alu...

  4. Effect of Multipath Laser Shock Processing on Microhardness, Surface Roughness, and Wear Resistance of 2024-T3 Al Alloy

    Abdulhadi Kadhim

    2014-01-01

    Full Text Available Laser shock processing (LSP is an innovative surface treatment technique with high peak power, short pulse, and cold hardening for strengthening metal materials. LSP is based on the application of a high intensity pulsed laser beam (I>1 GW/cm2;  t<50 ns at the interface between the metallic target and the surrounding medium (a transparent confining material, normally water forcing a sudden vaporization of the metallic surface into a high temperature and density plasma that immediately develops inducing a shock wave propagating into the material. The shock wave induces plastic deformation and a residual stress distribution in the target material. In this paper we study the increase of microhardness and surface roughness with the increase of laser pulse energy in 2024-T3 Al alloy. The influence of the thickness of the confining layer (water on microhardness and surface roughness is also studied. In addition, the effect of LSP treatment with best conditions on wear behaviors of the alloy was investigated.

  5. A bottom-up approach for optimization of friction stir processing parameters; a study on aluminium 2024-T3 alloy

    Highlights: • An experimental bottom-up approach has been developed for optimizing the process parameters for friction stir processing. • Optimum parameter processed samples were tested and characterized in detail. • Ultimate tensile strength of 1.3 times the base metal strength was obtained. • Residual stresses on the processed surface were only 10% of the yield strength of base metal. • Microstructure observations revealed fine equi-axed grains with precipitate particles at the grain boundaries. - Abstract: Friction stir processing (FSP) is emerging as one of the most competent severe plastic deformation (SPD) method for producing bulk ultra-fine grained materials with improved properties. Optimizing the process parameters for a defect free process is one of the challenging aspects of FSP to mark its commercial use. For the commercial aluminium alloy 2024-T3 plate of 6 mm thickness, a bottom-up approach has been attempted to optimize major independent parameters of the process such as plunge depth, tool rotation speed and traverse speed. Tensile properties of the optimum friction stir processed sample were correlated with the microstructural characterization done using Scanning Electron Microscope (SEM) and Electron Back-Scattered Diffraction (EBSD). Optimum parameters from the bottom-up approach have led to a defect free FSP having a maximum strength of 93% the base material strength. Micro tensile testing of the samples taken from the center of processed zone has shown an increased strength of 1.3 times the base material. Measured maximum longitudinal residual stress on the processed surface was only 30 MPa which was attributed to the solid state nature of FSP. Microstructural observation reveals significant grain refinement with less variation in the grain size across the thickness and a large amount of grain boundary precipitation compared to the base metal. The proposed experimental bottom-up approach can be applied as an effective method for

  6. The Effect of the Solution Heat Treatment on the Mechanical Properties of Aluminum-Copper Alloy (2024-T3 Using Rolling Process

    Khairia Salman Hassan

    2011-01-01

    Full Text Available The effect of solution heat treatment on the mechanical properties of Aluminum-Copper alloy. (2024-T3 by the rolling process is investigated. The solution heat treatment was implemented by heating the sheets to 480 C° and quenching them by water; then forming by rolling for many passes. And then natural aging is done for one month. Mechanical properties (tensile strength and hardness are evaluated and the results are compared with the metal without treatment during the rolling process. ANSYS analysis is used to show the stresses distribution in the sheet during the rolling process. It has been seen that good mechanical properties are evident in the alloy without heat treatment due to the strain hardening and also the mechanical properties are improved after heat treatment and rolling process but with lower forces and stresses when compared with the untreated.

  7. Investigation of the corrosion behaviour of a bilayer cerium-silane pre-treatment on Al 2024-T3 in 0.1 M NaCl

    In the last few years great efforts have been made in order to find environmentally friendly substitutes for Cr6+ pre-treatments applied to aluminium alloys used in the aircraft industry. In this work we have investigated the electrochemical response of a bilayer pre-treatment consisting of a Ce conversion bottom layer and a non-functional silane (bis-1,2-(triethoxysilyl) ethane (BTSE)) top layer applied on Al 2024-T3, and compared its behaviour with monolayer coated samples. The investigation was carried out in 0.1 M NaCl solution, and the electrochemical techniques employed were anodic polarization curves and electrochemical impedance spectroscopy (EIS). EIS experiments performed with bilayer coated samples have shown a continuous increase of the impedance response during the whole test period, which was interpreted on the basis of a pore blocking mechanism supported by scanning electron microscopy (SEM) images and equivalent circuit fitting. Moreover, the impedance of the bilayer coated samples was approximately one order of magnitude higher than that presented by monolayer coated ones. On the other hand, mechanical tests have evidenced the good adhesion of the silane layer to the Ce conversion layer, which can be likely attributed to a better linking between the silane molecules and the cerium bottom layer

  8. Microstructural and electrochemical characterization of Ce conversion layers formed on Al alloy 2024-T3 covered with Cu-rich smut

    In the present work the microstructure of Ce conversion layers formed on Al alloy 2024-T3 covered with a Cu-rich smut was characterized by scanning electron microscopy (SEM), and its electrochemical behaviour in 0.5 M NaCl solution was investigated by open circuit potential (OCP) measurements, anodic polarization curves and electrochemical impedance spectroscopy (EIS). The results of the microstructural characterization have shown that the presence of Cu cathodic particles uniformly deposited on the electrode surface favours the homogeneous nucleation of the conversion layer, apparently reducing the role of intermetallics in the layer precipitation mechanism. Electrochemical measurements have shown that, during the first hour of immersion in the test electrolyte, the samples covered with the conversion layer exhibit a high interfacial activity, characterized by an active anodic behaviour, which was ascribed to an intense electrochemical activity associated with Al-Cu-Mg intermetallics not covered with the conversion layer. However, as the experiment proceeds an improvement on the corrosion behaviour of the sample was observed, which was interpreted on the basis of self-healing properties of the Ce conversion layer as well as on the blocking of the defective sites of the conversion coating by corrosion products. The electrochemical results have also evidenced the beneficial effect of the pre-treatment with benzotriazole in the corrosion response of Ce-coated samples

  9. Corrosion behavior of aluminum alloy 2024-T3 by 8-hydroxy-quinoline and its derivative in 3.5% chloride solution

    LI Song-mei; ZHANG Hong-rui; LIU Jian-hua

    2007-01-01

    The corrosion behavior of aluminum alloy 2024-T3 was studied in 3.5% NaCl solution with two fluorescence quinoline compounds named 8-hydroxy-quinoline(8HQ) and 8-hydroxy-quinoline-5-sulfonic acid(HQS). The open circuit potential(OCP) test result indicates that both compounds change the alloy corrosion potential by adsorbing on the electrode surface. Polarization measurements show that 8HQ is a mixed type inhibitor by blocking the active sites of the metal surface, while HQS is a corrosion accelerator by activating the cathodic reaction. Changes of the impedance parameters in the electrochemical impedance spectroscopy(EIS) are related to the adsorption of 8HQ on the metal surface, which leads to the formation of a protective layer. The impedance diagram in the solution with HQS is similar to the one without additional organic compounds. The morphology and composition of the protective layer were studied by using SEM/EDS. The result confirms the function of the additions that the effect of 8HQ is due to the insoluble aluminum chelate, Al(HQ)3, to prevent adsorption of chloride ion, while the effect of HQS is to break down the oxide film.

  10. Integrated Modelling of Crack Propagation in AA2024-T3 FSW Butt Joints Considering The Residual Stresses from the Manufacturing Process

    Sonne, M. R.; Carlone, P.; Citarella, R.;

    2015-01-01

    conducted to investigate the effect of shunting on nugget size in spot welding of HSLA steel sheets. Different cases with different spacing between weld spots have been examined. The nugget sizes have been measured by metallographic examination and have been compared with 3D finite element simulations. The...

  11. Electrochemical techniques for practical evaluation of corrosion inhibitor effectiveness. Performance of cerium nitrate as corrosion inhibitor for AA2024T3 alloy

    In this work, a split-cell technique and image-assisted electrochemical noise analysis, which provide minimal perturbation of the freely corroding system and good time resolution, are proposed as a tool for simultaneous investigation of the corrosion inhibition mechanism and assessment of performance. The results obtained are compared with results from traditional electrochemical impedance spectroscopy, disclosing the advantages of these techniques in the evaluation of inhibitor performance. Specific attention is also given to the investigation of corrosion inhibition by cerium nitrate.

  12. Effect of welding heat input and post-welded heat treatment on hardness of stir zone for friction stir-welded 2024-T3 aluminum alloy%焊接热输入和焊后热处理对搅拌摩擦焊2024-T3铝合金焊核区硬度的影响

    陈雨; 丁桦; 李继忠; 赵敬伟; 付明杰; 李晓华

    2015-01-01

    在不同焊接热输入条件下对2024-T3铝合金进行搅拌摩擦焊接,并利用透射电镜、差热分析和维氏硬度测试对焊核区的组织和硬度进行分析检测。研究表明,焊核区的硬度受到焊接热输入的影响。在高焊接热输入条件下,焊接速度的提升有利于提升焊核区硬度。而在低焊接热输入条件下,焊核区硬度随着旋转速度的增加而增加。焊后热处理导致组织过时效,焊核区硬度降低。相比于其他参数下获得的焊核区,旋转速度为500 r/min,焊接速度为100 mm/min条件下获得的焊核区拥有较高的抗过时效性能,硬度下降仅为3.8%,而其他焊核区的硬度下降超过10%。焊核区硬度主要受到强化相形态的影响。%The microstructure and hardness of the stir zone (SZ) with different welding heat inputs were investigated for friction stir-welded 2024-T3 aluminum by transmission electron microscopy, differential scanning calorimeter and Vickers micro-hardness test. The results show that welding heat input has a significant effect on the hardness of the SZ. Under high welding heat input condition, a higher welding speed is beneficial for improving the hardness of the SZ. However, when the welding heat input is low, the hardness of the SZ elevates with increasing the rotation speed. The hardness of the SZ decreases after post-welded heat treatment due to overaging. The joints welded at 500 r/min and 100 mm/min show a high resistance to overaging. The reduction of hardness in the SZ is only 3.8%, while in other joints, the reduction is more than 10%. The morphology of strengthening precipitates plays important roles for the improvement of hardness.

  13. Evaluación de diferentes sistemas de protección contra la corrosión marina en la aleación de aplicación aeronáutica Alclad 2024-T3 Evaluating protection systems against marine corrosion of aeronautic alloy Alclad 2024-T3

    Pérez Londoño Fabian Andrés

    2011-05-01

    Full Text Available  

    Se muestra la obtención de dos sistemas de recubrimientos protectores como una alternativa de protección contra la corrosión de la aleación de aluminio Alclad 2024-T3, que es utilizada en la fabricación del compartimiento de la batería de los aviones T-41. Dichos sistemas constan de tres tipos de resinas orgánicas: una primera capa de resina poliéster P-115, a manera de imprimante en ambos sistemas de recubrimientos, y una segunda capa de resina de poliéster Hetron 197-3 en el primer caso, o de resina vinil-éster F-010 en el segundo. El análisis de la morfología superficial se realizó mediante microscopía electrónica de barrido (SEM, observando la rugosidad generada por el tratamiento superficial. El estudio electroquímico de los recubrimientos se desarrolló mediante la técnica de espectroscopía de impedancia electroquímica (EIS y curvas de polarización Tafel; de esta manera se encontró que todos los sistemas presentan un buen desempeño frente a la corrosión en un medio marino, y que el sistema con preparación superficial química muestra un comportamiento protector superior para el Alodine 5700 + Hetron 197-3; se obtuvo una velocidad de corrosión 1,42 x 10-12 mpy, mientras que para el sustrato la velocidad fue de 1,59 x 10-7 mpy.

     

     

  14. Acoustic emission monitoring of tensile testing of corroded and un-corroded clad aluminum 2024-T3 and characterization of effects of corrosion on AE source events and material tensile properties

    Okafor, A. Chukwujekwu; Natarajan, Shridhar

    2014-02-01

    Corrosion damage affects structural integrity and deteriorates material properties of aluminum alloys in aircraft structures. Acoustic Emission (AE) is an effective nondestructive evaluation (NDE) technique for monitoring such damages and predicting failure in large structures of an aircraft. For successful interpretation of data from AE monitoring, sources of AE and factors affecting it need to be identified. This paper presents results of AE monitoring of tensile testing of corroded and un-corroded clad Aluminum 2024-T3 test specimens, and characterization of the effects of strain-rate and corrosion damage on material tensile properties and AE source events. Effect of corrosion was studied by inducing corrosion in the test specimens by accelerated corrosion testing in a Q-Fog accelerated corrosion chamber for 12 weeks. Eight (8) masked dog-bone shaped specimens were placed in the accelerated corrosion chamber at the beginning of the test. Two (2) dog-bone shaped specimens were removed from the corrosion chamber after exposure time of 3, 6, 9, and 12 weeks respectively, and subjected to tension testing till specimen failure along with AE monitoring, as well as two (2) reference samples not exposed to corrosion. Material tensile properties (yield strength, ultimate tensile strength, toughness, and elongation) obtained from tension test and AE parameters obtained from AE monitoring were analyzed and characterized. AE parameters increase with increase in exposure period of the specimens in the corrosive environment. Aluminum 2024-T3 is an acoustically silent material during tensile deformation without any damage. Acoustic emission events increase with increase of corrosion damage and with increase in strain rate above a certain value. Thus AE is suitable for structural health monitoring of corrosion damage. Ultimate tensile strength, toughness and elongation values decrease with increase of exposure period in corrosion chamber.

  15. Corrosion Control of Friction Stir Welded AA2024-T351 Aluminium Alloys

    Younes, Yousif Younes Abo

    2010-01-01

    Friction stir welding (FSW) is a modern solid state welding technique developed at thewelding institute (TWI) in 1991. The joining is achieved by heat generation, materialsoftening and plastic deformation following the travelling of non-consumable pin throughthe gap between the two workpieces to be joined.In present study, joining of AA 2024-T3 aluminium alloy, is achieved by FSW. Theinfluence of the FSW on the alloy microstructure and corrosion behaviour is determined.The effect of laser sur...

  16. Self-assembled monolayer of 3-aminopropyltrimethoxysilane for improved adhesion between aluminum alloy substrate and polyurethane coating

    A good adhesion between a polymer coating and a metal or metal alloy substrate such as Al 2024-T3 plays a critical role in corrosion protection of metal substrates. In our study, a self-assembled monolayer film of 3-aminopropyltrimethoxysilane was formed on Al 2024-T3 substrate by covalent bonding. The adhesion property of a self-priming polyurethane coating was evaluated by pull-off adhesion test, wet tape test and thermal cycling test. All the testing results indicate that both dry and wet adhesion properties of the polyurethane coating were improved significantly after APS treatment of Al 2024-T3 in polar solvents such as methanol and acetone. In nonpolar solvents such as hexane, the APS treatment led to inconsistent improvement or sometime decreased adhesion of polyurethane coating. X-ray photoelectron spectroscopic study revealed that while a monolayer film was formed on the aluminum alloy surface after treating the substrate with APS in methanol and acetone, a multilayer film was formed on the substrate surface when the treatment was conducted in hexane. The APS monolayer film served as a covalent bond linkage between polymer coating and aluminum alloy substrates, which led to the increased adhesion property of polymer coating and corrosion resistance of the metal alloy substrate

  17. “SMART” protective ability of water based epoxy coatings loaded with CaCO3 microbeads impregnated with corrosion inhibitors applied on AA2024 substrates

    Highlights: ► CaCO3 microbeads were used as pH-sensitive reservoirs for corrosion inhibitors. ► The barrier properties of the coating with CaCO3/inhibitors were improved. ► The corrosion inhibitors were released as a result of dissolution of pH sensitive CaCO3. ► LEIS demonstrated the local corrosion inhibition provided by the CaCO3/Ce over localised defect formed in the coating. - Abstract: Corrosion protection of aluminium alloys often relies on the application of a coating on the metallic surface. The coating normally combines a barrier effect that restricts the ingress of corrosive species, with an inhibitive role induced by corrosion inhibitor pigments added to the coating formulation. However, the direct addition of corrosion inhibitors to the coating can cause some detrimental interactions between components, as well as formation of preferential electrolyte pathways, compromising the barrier properties. Moreover, electrolyte uptake and ageing may result in leaching of those corrosion inhibitors. In order to extend the corrosion inhibition ability of organic coatings one possible solution is to store the inhibitors inside nano or microreservoirs compatible with the coating matrix and able to sense the local changes induced by the corrosion process. This strategy has led to the development of a new generation of “smart” coatings for anti-corrosion purposes. The aim of this work is to study the anti-corrosion properties of water-based epoxy coatings loaded with pH sensitive particles, acting as feedback active containers for corrosion inhibitors and applied on the aluminium alloy AA2024-T3. For this purpose micron size calcium carbonate beads were modified with different corrosion inhibitors: cerium nitrate, salicylaldoxime and 2,5-dimercapto-1,3,4-thiadiazolate. These particles act as pH sensitive reservoirs because they dissolve at acidic pH, releasing the corrosion inhibitor, which then suppresses the corrosion activity of the bare metal

  18. Influência da Espessura do Filme Polimérico Intermediário na Resistência Mecânica de Juntas Híbridas de Alumínio 2024-T3 e CF-PPS Produzidas por União Pontual por Fricção

    Natália M. André

    2016-03-01

    Full Text Available Resumo A União Pontual por Fricção (FSpJ é uma técnica inovadora para união de estruturas híbridas metal-polímero e baseia-se na geração de calor por fricção. Juntas de alumínio 2024-T3 e compósito laminado de poli(sulfeto de fenileno com fibra de carbono (CF-PPS foram produzidas com filme intermediário de PPS. Duas espessuras de filme foram investigadas: 100 e 500 µm. Ensaios de cisalhamento sob tração demonstraram que as juntas com filmes de 100 µm são mais resistentes (2093 ± 180 N em relação às juntas com filme de 500 µm (708 ± 69 N. Adicionalmente, as superfícies de fratura das juntas revelaram áreas de união maiores para as juntas com filmes de 100 µm (53 ± 2 contra 40 ± 1 mm2. Para o filme mais fino, a extensão do amolecimento devido ao calor friccional é maior. Consequentemente, a baixa viscosidade atingida com a fusão do polímero favorece a molhabilidade das superfícies dos componentes da junta pelo PPS amolecido, resultando em melhor adesão entre as partes. Ademais, análises microestruturais demonstraram que a formação do cerne metálico e a interdifusão das moléculas de PPS entre compósito e filme também são favorecidas. Portanto, concluiu-se que a adição do filme mais fino produziu juntas mais resistentes.

  19. Preparation of thin film nanofibrous composite NF membrane based on EDC/NHS modified PAN-AA nanofibrous substrate

    Yang, Y.; Wang, X.; Hsiao, B. S.

    2016-07-01

    A novel kind of thin-film nanofibrous composite (TFNC) nanofiltration (NF) membranes consisting of a polyamide (PA) barrier layer were successfully fabricated by interfacial polymerization (IFP) based on electrospun double-layer nanofibrous substrates, which have an ultrathin poly (acrylonitrile-co-acrylic acid) (PAN-AA) nanofibrous layer as top layer and a thicker polyacrylonitrile (PAN) nanofiber layer as bottom porous support layer. Immersing PAN/PAN-AA nanofibrous substrates into 1-ethyl-(3-3-dimethylaminopropyl) carbodiimide hydrochloride/N-hydroxysuccinimide (EDC/NHS) aqueous solution and piperazine (PIP) aqueous solution (0.20 wt%) sequentially for a period of time, the carboxyl groups on PAN-AA nanofibers were activated by carbodiimide and then reacted with the amide groups. The as prepared composite membrane has an integrated structure with high rejection rate (98.0%); high permeate flux (40.4 L/m2h) for MgSO4 aqueous solution (2 g/L).

  20. Microstructure and anisotropic mechanical behavior of friction stir welded AA2024 alloy sheets

    Zhang, Zhihan [State Key Laboratory of Solidification Processing, Shaanxi Key Laboratory of Friction Welding Technologies, Northwestern Polytechnical University, Xi' an 710072, Shaanxi (China); Li, Wenya, E-mail: liwy@nwpu.edu.cn [State Key Laboratory of Solidification Processing, Shaanxi Key Laboratory of Friction Welding Technologies, Northwestern Polytechnical University, Xi' an 710072, Shaanxi (China); Li, Jinglong [State Key Laboratory of Solidification Processing, Shaanxi Key Laboratory of Friction Welding Technologies, Northwestern Polytechnical University, Xi' an 710072, Shaanxi (China); Chao, Y.J. [Department of Mechanical Engineering, University of South Carolina, Columbia, SC 29208 (United States); Vairis, A. [Mechanical Engineering Department, TEI of Crete, Heraklion, Crete 71004 (Greece)

    2015-09-15

    The anisotropic mechanical properties of friction stir welded (FSW) AA2024-T3 alloy joints were investigated based on the uniaxial tensile tests. The joint microstructure was examined by using electron back-scattered diffraction and transmission electron microscope. Results show that the evident anisotropic failure and yielding are present in the FSW joints. With the increase of loading angle from 0° to 90° the ultimate tensile strength and elongation of the specimens consistently decrease, or at first decrease and then increase, depending on the FSW process parameters. The specimen cut from the weld direction, i.e. a loading angle of 0°, exhibits the highest strength and elongation. - Highlights: • Microstructure and anisotropy of friction stir welded joints were studied. • The evident anisotropic failure and yielding are present in joints. • The lowest yield stress and UTS are at 45° and 60° loadings, respectively. • Rotation speed heavily impact on the anisotropy of joints.

  1. Microstructure and anisotropic mechanical behavior of friction stir welded AA2024 alloy sheets

    The anisotropic mechanical properties of friction stir welded (FSW) AA2024-T3 alloy joints were investigated based on the uniaxial tensile tests. The joint microstructure was examined by using electron back-scattered diffraction and transmission electron microscope. Results show that the evident anisotropic failure and yielding are present in the FSW joints. With the increase of loading angle from 0° to 90° the ultimate tensile strength and elongation of the specimens consistently decrease, or at first decrease and then increase, depending on the FSW process parameters. The specimen cut from the weld direction, i.e. a loading angle of 0°, exhibits the highest strength and elongation. - Highlights: • Microstructure and anisotropy of friction stir welded joints were studied. • The evident anisotropic failure and yielding are present in joints. • The lowest yield stress and UTS are at 45° and 60° loadings, respectively. • Rotation speed heavily impact on the anisotropy of joints

  2. Sol-gel hybrid films based on organosilane and montmorillonite for corrosion inhibition of AA2024.

    Dalmoro, V; dos Santos, J H Z; Armelin, E; Alemán, C; Azambuja, D S

    2014-07-15

    The present work reports the production of films on AA2024-T3 composed of vinyltrimethoxysilane (VTMS)/tetraethylorthosilicate (TEOS) with incorporation of montmorillonite (sodium montmorillonite and montmorillonite modified with quaternary ammonium salt, abbreviated Na and 30B, respectively), generated by the sol-gel process. According to FT-IR analyses the incorporation of montmorillonite does not affect silica network. Electrochemical characterization was performed by electrochemical impedance spectroscopy measurement in 0.05 mol L(-1) NaCl solution. Results indicate that montmorillonite incorporation improves the corrosion protection compared to the non-modified system. Scanning electron microscopy micrographs reveal that high concentrations of montmorillonite provide agglomerations on the metallic surface, which is in detriment of the anticorrosive performance. The VTMS/TEOS/30B films with the lowest concentration (22 mg L(-1)) of embedded clay provide the highest corrosion protection. PMID:24863798

  3. Localised corrosion in aluminium alloy 2024-T3 using in situ TEM.

    Malladi, Sairam; Shen, Chenggang; Xu, Qiang; de Kruijff, Tom; Yücelen, Emrah; Tichelaar, Frans; Zandbergen, Henny

    2013-11-28

    An approach to carry out chemical reactions using aggressive gases in situ in a transmission electron microscope (TEM), at ambient pressures of 1.5 bar using a windowed environmental cell, called a nanoreactor, is presented here. The nanoreactor coupled with a specially developed holder with platinum tubing permits the usage of aggressive chemicals like hydrochloric acid (HCl). PMID:24127075

  4. Localised corrosion in aluminium alloy 2024-T3 using in situ TEM

    Malladi, S.; Shen, C.; Xu, Q.; De Kruijff, T.; Yücelen, E.; Tichelaar, F.; Zandbergen, H.

    2013-01-01

    An approach to carry out chemical reactions using aggressive gases in situ in a transmission electron microscope (TEM), at ambient pressures of 1.5 bar using a windowed environmental cell, called a nanoreactor, is presented here. The nanoreactor coupled with a specially developed holder with platinum tubing permits the usage of aggressive chemicals like hydrochloric acid (HCl).

  5. An evaluation of the pressure proof test concept for 2024-T3 aluminium alloy sheet

    Dawicke, D. S.; Poe, C. C., Jr.; Newman, J. C.; Harris, C. E.

    1991-01-01

    The concept of pressure proof testing of fuselage structures with fatigue cracks to insure structural integrity was evaluated from a fracture mechanics viewpoint. A generic analytical and experimental investigation was conducted on uniaxially loaded flat panels with crack configurations and stress levels typical of longitudinal lap splice joints in commercial transport aircraft fuselages. The results revealed that the remaining fatigue life after a proof cycle was longer than that without the proof cycle because of crack growth retardation due to increased crack closure. However, based on a crack length that is slightly less than the critical value at the maximum proof stress, the minimum assured life or proof test interval must be no more than 550 pressure cycles for a 1.33 proof factor and 1530 pressure cycles for a 1.5 proof factor to prevent in-flight failures.

  6. Effect of substrate surface roughening and cold spray coating on the fatigue life of AA2024 specimens

    Highlights: • Investigated effect of CP-Al coatings cold sprayed onto roughened Al2024 substrate. • CP-Al coating improved rotating-bend fatigue strength up to 50% on average. • CP-Al coating diminished stress raisers caused by the surface roughening. • Glass-bead blasting plus coating offered most significant fatigue life improvement. - Abstract: The effects of cold spray coating and substrate surface preparation on crack initiation under cyclic loading have been studied on Al2024 alloy specimens. Commercially pure (CP) aluminum feedstock powder has been deposited on Al2024-T351 samples using a cold-spray coating technique known as high velocity particle consolidation. Substrate specimens were prepared by surface grit blasting or shot peening prior to coating. The fatigue behavior of both coated and uncoated specimens was then tested under rotating bend conditions at two stress levels, 180 MPa and 210 MPa. Scanning electron microscopy was used to analyze failure surfaces and identify failure mechanisms. The results indicate that the fatigue strength was significantly improved on average, up to 50% at 180 MPa and up to 38% at 210 MPa, by the deposition of the cold-sprayed CP-Al coatings. Coated specimens first prepared by glass bead grit blasting experienced the largest average increase in fatigue life over bare specimens. The results display a strong dependency of the fatigue strength on the surface preparation and cold spray parameters

  7. Lamb wave ultrasonic evaluation of welded AA2024 specimens at tensile static and fatigue testing

    Burkov, M. V.; Byakov, A. V.; Shah, R. T.; Lyubutin, P. S.; Panin, S. V.

    2015-10-01

    The paper deals with the investigation of Lamb waves ultrasonic testing technique applied for evaluation of different stress-strain and damaged state of aluminum specimens at static and fatigue loading in order to develop a Structural Health Monitoring (SHM) approach. The experimental results of tensile testing of AA2024T3 specimens with welded joints are presented. Piezoelectric transducers used as actuators and sensors were adhesively bonded to the specimen's surface using two component epoxy. The set of static and cyclic tensile tests with two frequencies of acoustic testing (50 kHz and 335 kHz) were performed. The recorded signals were processed to calculate the maximum envelope in order to evaluate the changes of the stress-strain state of the specimen and its microstructure during static tension. The registered data are analyzed and discussed in terms of signal attenuation due to the formation of fatigue defects during cyclic loading. Understanding the relations between acoustic signal features and fatigue damages will provide us the ability to determine the damage state of the structure and its residual lifetime in order to design a robust SHM system.

  8. Mineralogical Transformation and Electrochemical Nature of Magnesium-Rich Primers during Natural Weathering

    Shashi S. Pathak

    2014-07-01

    Full Text Available Magnesium-rich primers (MgRP have generated great interest as a promising alternative to chromium-based primers for the protection of aluminum substrates but their performance during exterior exposure has not been well documented. This paper focuses on the evaluation of MgRP during natural weathering to gain insight into its mineralogical phase transformation and electrochemical nature. Control studies were conducted on Mg and AA2024-T3 coupons. The results indicate that Mg particles in MgRP transform into a variety of hydroxide, carbonate, and hydroxy carbonates. During natural weathering, CO2 inhibited the dissolution of both Mg and AA2024-T3 as a result of protective carbonate layer formation in the coating.

  9. AA Index

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  10. Caractérisation d'un alliage 2024-T3 assemblé par friction-malaxage

    JEMAL, Nejah; MASSE, Jean-Eric; LANGLOIS, Laurent; TCHERNIAEFF, Serge; GIROT, Franck

    2010-01-01

    Le procédé Friction Stir Welding qui peut se traduire en français par friction malaxage a été inventé par le TWI de Cambridge en 1991. La soudure est réalisée par apport de chaleur provoqué par le frottement d'un outil en rotation et mis en pression sur la pièce. Ce procédé intéresse les utilisateurs d'alliages légers car, sans passer par la fusion, il permet le soudage d'alliages à haute résistance, jusque là inutilisables en raison de leur soudabilité difficile avec les procédés traditionne...

  11. Caractérisation d'un alliage 2024-T3 assemblé par friction-malaxage

    JEMAL, Nejah; MASSE, Jean-Eric; LANGLOIS, Laurent; TCHERNIAEFF, Serge; GIROT, Franck

    2010-01-01

    Le procédé Friction Stir Welding qui peut se traduire en français par friction malaxage a été inventé par le TWI de Cambridge en 1991. La soudure est réalisée par apport de chaleur provoqué par le frottement d’un outil en rotation et mis en pression sur la pièce. Ce procédé intéresse les utilisateurs d’alliages légers car, sans passer par la fusion, il permet le soudage d’alliages à haute résistance, jusque là inutilisables en raison de leur soudabilité difficile avec les procédés traditionne...

  12. Rating AAs.

    Carter, Susan J.

    2001-01-01

    Why alternative investments? In a word: performance. Many higher education endowment and foundation managers are making increasing commitments to alternative investments, or AAs, in order to obtain higher returns and broader diversification for their investment portfolios than public securities instruments can usually provide. Learn how to handle…

  13. Microstructure of AA 2024 fixed joints formed by friction stir welding

    Eliseev, A. A.; Kalashnikova, T. A.; Tarasov, S. Yu.; Rubtsov, V. E.; Fortuna, S. V.; Kolubaev, E. A.

    2015-10-01

    Friction stir welded butt joints on 2024T3 alloy have been obtained using different process parameters. The microstructures of all the weld joint zones have been examined and such structural parameters as grain size, particle size and volume content of particles have been determined in order to find correlations with the microhardness of the corresponding zones of the weld.

  14. Embedded reference electrodes for corrosion potential monitoring, electrochemical characterization, and controlled-potential cathodic protection

    Merten, Bobbi Jo Elizabeth

    A thin wire Ag/AgCl reference electrode was prepared using 50 mum Ag wire in dilute FeCl3. The wire was embedded beneath the polyurethane topcoat of two sacrificial coating systems to monitor their corrosion potential. This is the first report of a reference electrode embedded between organic coating layers to monitor substrate health. The embedded reference electrode (ERE) successfully monitored the corrosion potential of Mg primer on AA 2024-T3 for 800 days of constant immersion in dilute Harrison's solution. Zn primer on steel had low accuracy in comparison. This is in part due to short circuiting by Zn oxidation products, which are much more conductive than Mg corrosion products. Data interpretation was improved through statistical analysis. On average, ERE corrosion potentials are 0.1 to 0.2 V and 0.2 to 0.3 V more positive than a saturated calomel electrode (SCE) in solution for AA 2024-T3 and steel coating systems, respectively. Further research may confirm that ERE obtains corrosion potential information not possible by an exterior, conventional reference electrode. The ERE is stable under polarization. AA 2024-T3 was polarized to -0.95 V vs ERE to emulate controlled potential cathodic protection (CPCP) applications. Polarizations of -0.75 V vs ERE are recommended for future experiments to minimize cathodic delamination. The ERE was utilized to analyze coating mixtures of lithium carbonate, magnesium nitrate, and Mg metal on AA2024-T3. Corrosion potential, low frequency impedance by electrochemical impedance spectroscopy (EIS), and noise resistance by electrochemical noise method (ENM) were reported. Coating performance ranking is consistent with standard electrochemical characterization and visual analyses. The results suggest anti-corrosion resistance superior to a standard Mg primer following 1600 hours of B117 salt spray. Both lithium carbonate and magnesium nitrate are necessary to achieve corrosion protection. Unique corrosion protective coatings for

  15. Antiproton Accumulator (AA)

    Photographic Service

    1980-01-01

    The AA in its final stage of construction, before it disappeared from view under concrete shielding. Antiprotons were first injected, stochastically cooled and accumulated in July 1980. From 1981 on, the AA provided antiprotons for collisions with protons, first in the ISR, then in the SPS Collider. From 1983 on, it also sent antiprotons, via the PS, to the Low-Energy Antiproton Ring (LEAR). The AA was dismantled in 1997 and shipped to Japan.

  16. The effect of polymer morphology on the performance of a corrosion inhibiting polypyrrole/aluminum flake composite pigment

    Two different morphologies of polypyrrole (PPy) aluminum flake composites, namely spherical PPy/Al flake composites and wire PPy/Al flake composites, were synthesized by chemical oxidative polymerization. These composites were characterized by Fourier transform infrared spectroscopy (FT-IR), four point probe conductivity, conductive atomic force microscopy (C-AFM), scanning electron microscopy (SEM), and X-ray photoelectron spectroscopy (XPS). These composites were incorporated into an epoxy primer and coatings were applied on an aluminum alloy (AA 2024-T3) substrate. The coatings were exposed to salt spray according to ASTM B117 and prohesion conditions according to ASTM G85-A5. The corrosion resistance properties were monitored via electrochemical impedance spectroscopy (EIS). The current produced by corrosion reactions on the surface of the substrate was mapped using the scanning vibrating electrode technique (SVET). Galvanic coupling experiments were performed for measurement of galvanic current and mixed potential in controlled environment. It was observed that the morphology of PPy on the surface of aluminum flake has an effect on the conductivity and anticorrosion performance of the pigment. The wire PPy/Al flake composite coatings exhibited better anticorrosion performance than the spherical PPy/Al flake composite coatings and as received aluminum flake coatings. The enhancement in anticorrosion performance was attributed to the unique morphology and electrochemical activity of the PPy on the surface of aluminum flakes. It was also revealed that the wire PPy/Al flake composite coating was sacrificially protecting the AA 2024-T3 substrate in larger defects

  17. AA magnet measurement team

    1978-01-01

    Quickly improvised measurement equipment for the AA (Antiproton Accumulator) was all the tight schedule permitted, but the high motivation of the team made up for the lack of convenience. From left to right: Roy Billinge (Joint AA Project Leader, the other one was Simon van der Meer); Bruno Autin, Brian Pincott, Colin Johnson.

  18. Effect of finite edge radius on ductile fracture ahead of the cutting tool edge in micro-cutting of Al2024-T3

    Subbiah, Sathyan [George W. Woodruff School of Mechanical Engineering, Georgia Institute of Technology, Atlanta, GA 30332 (United States); Melkote, Shreyes N. [George W. Woodruff School of Mechanical Engineering, Georgia Institute of Technology, Atlanta, GA 30332 (United States)], E-mail: shreyes.melkote@me.gatech.edu

    2008-02-15

    Evidence of ductile fracture leading to material separation has been reported recently in ductile metal cutting [S. Subbiah, S.N. Melkote, ASME J. Manuf. Sci. Eng. 28(3) (2006)]. This paper investigates the effect of finite edge radius on such ductile fracture. The basic question of whether such ductile fracture occurs in the presence of a finite edge radius is explored by performing a series of experiments with inserts of different edge radii at various uncut chip thickness values ranging from 15 to 105 {mu}m. Chip-roots are obtained in these experiments using a quick-stop device and examined in a scanning electron microscope. Clear evidence of material separation is seen at the interface zone between the chip and machined surface even when the edge radius is large compared to the uncut chip thickness. Failure is seen to occur at the upper, middle, and/or the lower edges of the interface zone. Based on these observations, a hypothesis is presented for the events leading to the occurrence of this failure when cutting with an edge radius tool. Finite element simulations are performed to study the nature of stress state ahead of the tool edge with and without edge radius. Hydrostatic stress is seen to be tensile in front of the tool and hence favors the occurrence of ductile fracture leading to material separation. The stress components are, however lower than those seen with a sharp tool.

  19. AAS 227: Welcome!

    Kohler, Susanna

    2016-01-01

    Greetings from the 227th American Astronomical Society meeting in Kissimmee, Florida! This week, along with several fellow authors from astrobites, Iwill bewritingupdates on selectedevents at themeeting and posting at the end of each day. You can follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.If youre an author or referee (or plan to be!) and youre here at the meeting, consider joining us at our Author and Referee Workshop on Wednesday in the Tallahassee room, where well be sharingsome of the exciting new features of the AAS journals. You can drop intoeither of the two-hour sessions(10 AM 12 PM or 1 PM 3 PM), and there will be afree buffet lunch at noon.Heres the agenda:Morning SessionTopic Speaker10:00 am 10:05 amIntroductionsJulie Steffen10:05 am 10:35 amChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac10:35 am 11:00 amThe Peer Review ProcessButler Burton11:00 am 11:15 amAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler11:15 am 11:30 amFixing Software and Instrumentation Publishing: New Paper Styles in AAS JournalsChris Lintott11:30 am 11:45 amMaking Article Writing Easier with the New AASTeX v6.0Greg Schwarz11:45 am 12:00 pmBringing JavaScript and Interactivity to Your AAS Journal FiguresGus MuenchLunch SessionTopic Speaker12:00 pm 12:15 pmUnified Astronomy ThesaurusKatie Frey12:15 pm 12:30 pmAAS/ADS ORCID Integration ToolAlberto Accomazzi12:30 pm 12:45 pmWorldWide Telescope and Video AbstractsJosh Peek12:45 pm 01:00 pmArizona Astronomical Data Hub (AADH)Bryan HeidornAfternoon SessionTopic Speaker01:00 pm 01:05 pmIntroductionsJulie Steffen01:05 pm 01:35 pmChanges at AAS Journals; How to Be a Successful AAS AuthorEthan Vishniac01:35 pm 02:00 pmThe Peer Review ProcessButler Burton02:00 pm 02:15 pmAAS Nova: Sharing AAS Authors Research with the Broader CommunitySusanna Kohler02:15 pm 02:30 pm

  20. Geomagnetic aa Indices

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa indices are the continuation of the series beginning in the year 1868. A full description of these indices is given in the International...

  1. AAS Career Services

    Marvel, Kevin B.

    2012-08-01

    The American Astronomical Society provides substantial programs in the area of Career Services.Motivated by the Society's mission to enhance and share humanity's understanding of the Universe, the AAS provides a central resource for advertising positions, interviewing opportunities at its annual winter meeting and information, workshops and networks to enable astronomers to find employment.The programs of the Society in this area are overseen by an active committee on employment and the AAS Council itself.Additional resources that help characterize the field, its growth and facts about employment such as salaries and type of jobs available are regularly summarized and reported on by the American Institute of Physics.

  2. AAS Oral History Project

    Buxner, Sanlyn; Holbrook, Jarita; AAS Oral History Team

    2016-06-01

    Now in its fourth year, the AAS Oral History Project has interviewed over 80 astronomers from all over the world. Led by the AAS Historical Astronomy Division (HAD) and partially funded by the American Institute of Physics Niels Bohr Library and ongoing support from the AAS, volunteers have collected oral histories from astronomers at professional meetings starting in 2015, including AAS, DPS, and the IAU general assembly. Each interview lasts one and a half to two hours and focuses on interviewees’ personal and professional lives. Questions include those about one’s family, childhood, strong influences on one’s scientific career, career path, successes and challenges, perspectives on how astronomy is changing as a field, and advice to the next generation. Each interview is audio recorded and transcribed, the content of which is checked with each interviewee. Once complete, interview transcripts are posted online as part of a larger oral history library at https://www.aip.org/history-programs/niels-bohr-library/oral-histories. Future analysis will reveal a rich story of astronomers and will help the community address issues of diversity, controversies, and the changing landscape of science. We are still recruiting individuals to be interviewed from all stages of career from undergraduate students to retired and emeritus astronomers. Contact Jarita Holbrook to schedule an interview or to find out more information about the project (astroholbrook@gmail.com). Also, contact Jarita Holbrook if you would like to become an interviewer for the project.

  3. The Antiproton Accumulator (AA)

    1980-01-01

    Section 06 - 08*) of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A vacuum-tank, two bending magnets (BST06 and BST07 in blue) with a quadrupole (QDN07, in red) in between, another vacuum-tank, a wide quadrupole (QFW08) and a further tank . The tanks are covered with heating tape for bake-out. The tank left of BST06 contained the stack core pickup for stochastic cooling (see 7906193, 7906190, 8005051), the two other tanks served mainly as vacuum chambers in the region where the beam was large. Peter Zettwoch works on BST06. *) see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984)

  4. AA, bending magnet, BLG

    1980-01-01

    The very particular lattice of the AA required 2 types of dipole (bending magnets; BLG, long and narrow; BST, short and wide). The BLG had a steel length of 4.70 m, a good field width of 0.24 m, and a weight of about 70 t. Jean-Claude Brunet inspects the lower half of a BLG. For the BST magnets see 7811105 and 8006036.

  5. The Antiproton Accumulator (AA)

    1980-01-01

    A section of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A large vacuum-tank, a quadrupole (QDN09*), a bending magnet (BST08), another vacuum-tank, a wide quadrupole (QFW08) and (in the background) a further bending magnet (BST08). The tanks are covered with heating tape for bake-out. The tank left of QDN09 contained the kickers for stochastic pre-cooling (see 790621, 8002234, 8002637X), the other one served mainly as vacuum chamber in the region where the beam was large. Peter Zettwoch works on QFW08. * see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984) See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  6. Integrated Precipitate Simulation for Friction Stir Welding of Age Hardening Aluminium Alloys

    Hersent, Emmanuel

    2010-01-01

    Friction stir welding (FSW) is a recent welding process invented by The Welding Institute (TWI). It is particularly interesting for the aeronautical sector due to its capacity to weld 2XXX and 7XXX age-hardening aluminium alloys, which were previously considered unweldable. This relatively new process is currently the subject of active research. This work aims to simulate the hardness profile of an AA2024-T3 friction stir weld. AA2024-T3 is an age hardening aluminium alloy, so it is necessary...

  7. AAS 227: Day 2

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  8. Incorporation of arachidonic acid (AA) into phosphatidylcholine molecular species of the human neutrophil (PMN)

    Recently the authors proposed that the initial incorporation of AA into 1,2 diacylphosphatidylcholine (PC) was mediated by AA-CoA transferase(s) while the subsequent transfer of AA from 1,2-diacyl- into alkyl, acyl-PC was mediated by a CoA-independent transacylase. Studies here provide further evidence for such a two-step mechanism. PMNs were pulse labeled for 5 min with 3H-AA (.07μM) which was rapidly incorporated into 1,2-diacyl-PC. However, incorporation of AA into 1,2-diacyl-PC was inhibited by incubation with high levels of AA (30 μM). Similarly PMNs were pulsed labeled with 3H-AA for 5 min followed by a 120 min incubation. In these cells, 3H-AA was rapidly transferred from 1,2-diacyl-PC into alkyl, acyl-PC. In the presence of 30 μM AA redistribution of 3H-AA from diacyl to alkyl, acyl-PC was observed. This result implied that the initial incorporation of 3H-AA proceeds via a free acid intermediate while the transfer of 3H-AA from diacyl to alkyl, acyl-PC does not. Using a cell free system, 14C-AACoA was incubated for 5 min and found to be incorporated into 1,2-diacyl-PC containing 16:0, 18:0, and 18:1 at the sn-1 position. Furthermore 14C-AACoA and various 1-radyl, 2-lyso-PC were added to a PMN membrane preparation. The arachidonyl-transferase(s) preferred the 1-acyl, 2-lyso-PC substrate to 1-alkyl, 2-lyso-PC. Thus these studies provide further evidence that AA is initially incorporated into 1,2-diacyl-PC through arachidonyl-CoA transferases

  9. AAS 227: Day 2

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  10. AAS 227: Day 1

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or at astrobites.com, or catch ourlive-tweeted updates from the @astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto have so many people tell us that they already know about and useastrobites, and we were excited to introduce a new cohort of students at AAS to astrobites for the first time.Tuesday morning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended today.Opening Address (by Becky Smethurst)The President of the AAS, aka our fearless leader Meg Urry kicked off the meeting this morning at the purely coffee powered hour of 8am this morning. She spoke about the importance of young astronomers at the meeting (heres looking at you reader!) and also the importance of the new Working Group for Accessibility and Disabilities (aka WGAD pronounced like wicked) at the AAS. The Society has made extra effort this year to make the conference accessible to all,a message which was very well received by everyone in attendance.Kavli Lecture: New Horizons Alan Stern (by Becky Smethurst)We were definitely spoilt with the first Plenary lecture at this years conference Alan Stern gave us a a review of the New Horizons mission of the Pluto Fly By (astrobites covered the mission back in July with this post). We were treated to beautiful images, wonderful results and a foray into geology.Before (Hubble) and after #NewHorizons. #thatisall #science #astro alanstern #aas227 pic.twitter.com/kkMt6RsSIR Science News (@topsciencething) January 5, 2016Some awesome facts from the lecture that blew my mind:New Horizons is now 2AU (!) beyond Pluto

  11. AAS 227: Day 3

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  12. AAS 228: Day 4

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  13. The Drentsche Aa valley system

    This thesis is composed of five papers concerned with Late Quaternary geology and geomorphology of the Aa valley system. The correlation and chronostratigraphic position of the layers have been established by radiocarbon dating. (Auth.)

  14. AAS 227: Day 4

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  15. AAS 228: Day 4

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  16. INTEROGATION OF THE MANUFACTURING ROUTE OF ALUMINIUM AA 1050 USED IN LITHOGRAPHIC APPLICATION

    Witkowska, Malgorzata Danuta

    2013-01-01

    The aluminium AA1050 alloy, known as commercially pure aluminium, contains 99.5% Al, together with Fe and Si as major alloying elements. During fabrication of aluminium substrates for lithographic printing plates in Bridgnorth Aluminium Ltd, the AA 1050 aluminium alloy proceeds through various stages of thermomechanical processing, with the conditions at each processing stage influencing the microstructure of the final coil. Because of its specific gravity, tensile strength, surface performa...

  17. AAS 227: Day 4

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  18. Transformation from AA to AB-Stacked Bilayer Graphene on α-SiO2 under an Electric Field

    LIU Yan; AO Zhi-Min; WANG Tao; WANG Wen-Bo; SHENG Kuang; YU Bin

    2011-01-01

    @@ The energetic and electronic structure of bilayered graphene(BLG) with AA stacking arrangement on a SiO2 substrate is investigated in the presence of an electric field F of different intensities by ab initio density functional calculations.The AA-stacked bilayer graphene is stable on the SiO2 substrate in the absence of an electric field.However, as F increases, the AA-stacked bilayer graphenes are gradually shifted with each other and finally transfers into AB-stacked bilayer graphenes.The bandgap is accordingly changed.

  19. Is amyloid A (AA) amyloidosis always secondary?

    Maury, C P; Törnroth, T; Wegelius, O

    1985-01-01

    The case is reported of a patient with systemic AA amyloidosis associated with non-specific mesenteric lymphadenitis and chronic sideropenia. Renal, small bowel, and rectal biopsies showed amyloid deposits containing AA protein, as defined by potassium permanganate sensitivity and by reactivity with AA antiserum. Reversal of the nephrotic syndrome occurred during steroid-azathioprine therapy.

  20. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor

    Pérez, Claudia; Fernandez, Luisa E.; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S.; Soberón, Mario; Bravo, Alejandra

    2005-01-01

    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa bind...

  1. Laboratory Astrophysics Division of the AAS (LAD)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-01-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  2. Langevin dynamics of A+A reactions in one dimension

    We propose a set of Langevin equations of motion together with a reaction rule for the study of binary reactions. Our scheme is designed to address this problem for arbitrary friction γ and temperature T. It easily accommodates the inclusion of a substrate potential, and it lends itself to straightforward numerical integration. We test this approach on diffusion-limited (γ → ∞) as well as ballistic (γ = 0) A+A → P reactions for which there are extensive exact and approximate theoretical results as well as extensive Monte Carlo results. We reproduce the known results using our integration scheme, and also present new results for the ballistic reactions

  3. AAS 228: Day 1 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  4. AA, closed orbit observation pickup

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. Werner Sax contemplates his achievement. See also 8001383, 8010042, 8010045.

  5. AA, closed orbit observation pickup

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles QFW, at maximum dispersion. See also 8001372, 8001383, 8010045

  6. AA, closed orbit observation pickup

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. See also 8001372, 8010042, 8010045

  7. AA, closed orbit observation pickup

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles, QFW, at maximum dispersion. See also 8001372,8001383, 8010042

  8. AAS 228: Day 3 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  9. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor.

    Pérez, Claudia; Fernandez, Luisa E; Sun, Jianguang; Folch, Jorge Luis; Gill, Sarjeet S; Soberón, Mario; Bravo, Alejandra

    2005-12-20

    Bacillus thuringiensis subsp. israelensis produces crystal proteins, Cry (4Aa, 4Ba, 10Aa, and 11Aa) and Cyt (1Aa and 2Ba) proteins, toxic to mosquito vectors of human diseases. Cyt1Aa overcomes insect resistance to Cry11Aa and Cry4 toxins and synergizes the toxicity of these toxins. However, the molecular mechanism of synergism remains unsolved. Here, we provide evidence that Cyt1Aa functions as a receptor of Cry11Aa. Sequential-binding analysis of Cyt1Aa and Cry11Aa revealed that Cyt1Aa binding to Aedes aegypti brush border membrane vesicles enhanced the binding of biotinylated-Cry11Aa. The Cyt1Aa- and Cry11Aa-binding epitopes were mapped by means of the yeast two-hybrid system, peptide arrays, and heterologous competition assays with synthetic peptides. Two exposed regions in Cyt1Aa, loop beta6-alphaE and part of beta7, bind Cry11Aa. On the other side, Cry11Aa binds Cyt1Aa proteins by means of domain II-loop alpha8 and beta-4, which are also involved in midgut receptor interaction. Characterization of single-point mutations in Cry11Aa and Cyt1Aa revealed key Cry11Aa (S259 and E266) and Cyt1Aa (K198, E204 and K225) residues involved in the interaction of both proteins and in synergism. Additionally, a Cyt1Aa loop beta6-alphaE mutant (K198A) with enhanced synergism to Cry11Aa was isolated. Data provided here strongly indicates that Cyt1Aa synergizes or suppresses resistance to Cry11Aa toxin by functioning as a membrane-bound receptor. Bacillus thuringiensis subsp. israelensis is a highly effective pathogenic bacterium because it produces a toxin and also its functional receptor, promoting toxin binding to the target membrane and causing toxicity. PMID:16339907

  10. AAS 228: Day 3 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  11. Lamination sheet of AA BST magnet

    1979-01-01

    The AA had 2 types of bending magnets: BLG (window-frame, long and narrow)and BST (H-type, short and wide). The BST had a very wide aperture, 0.564 m of "good field". To demonstrate the size, the petite AA secretary, Val Mansfield, poses with a lamination sheet. See also 7811105, 7906163, 8006050.

  12. AAS 228: Day 1 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  13. The power of alternative assessments (AAs)

    张千茜

    2013-01-01

    This article starts by discussing the potential disadvantages of traditional assessment towards young English as a Second Language (ESL) learners within the American public school education system. In response to such disadvantages, researchers ’call for the implementation of alternative assessments (AAs) is therefore introduced along with the various benefits of AAs. However, the current mainstream education policy in the US, namely No Child Left Behind (NCLB) Policy, is still largely based on the tra-ditional ways of testing, making policy-oriented implementation of AAs on large scales remarkably difficult. After careful analysis, the author points out several implications concerning how, under such an existing policy of NCLB, can practitioners effectively accommodate young ESL learners by applying the power of AAs.

  14. Friction Stir Weldabilities of AA1050-H24 and AA6061-T6 Aluminum Alloys

    Huijie LIU; Hidetoshi FUJIN; Masakatsu MAEDA; Kiyoshi NOGI

    2005-01-01

    The friction stir weldabilities of the strain-hardened AA1050-H24 and precipitate-hardened AA6061-T6 aluminum alloys were examined to reveal the effects of material properties on the friction stir welding behavior. The experimental results are obtlained. (1) For AA1050-H24, the weld can possess smoother surface ripples; there is no elliptical weld nugget in the weld; there is no discernible interface between the stir zone and the thermomechanically affected zone;and the internal defect of the weld looks like a long crack and is located in the lower part of the weld. (2) For AA6061-T6, the weld usually possesses slightly rougher surface ripples; an elliptical weld nugget clearly exists in the weld; there are discernible interfaces among the weld nugget, thermomechanically affected zone and heat affected zone; and the internal defect of the weld is similar to that of the AA1050-H24 weld. (3) The effective range of welding parameters for AA1050-H24 is narrow, while the one for AA6061-T6 is very wide. (4) The maximum tensile strength efficiency of the AA1050-H24 joints is similar to that of the AA6061-T6 joints, i.e. 79% and 77%, respectively.

  15. AAS 228: Day 3 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session 2015 Newton Lacy Pierce Prize Lecture: The Elephant in the Room: Effects of Distant, Massive Companions on Planetary System Architectures (by Leonardo dos Santos)The first session on Wednesday at 228th AAS Meeting was the Newton Lacy Pierce Prize Lecture by Heather Knutson (California Institute of Technology). This talk featured a broad range of research efforts on exoplanets, with the main focus on how we study the composition of their atmospheres, and how multi-body interactions carve the structure of the planetary systems we observe.One of her first points is the well-known idea that the Solar System is an oddball, compared to the exoplanet systems we have found so far: most of these systems contain hot Jupiters and mini-Neptunes at very close-in orbits around their host stars. Moreover, even when studying their transmission spectra, it is difficult to know the exact composition of their atmospheres.Knutson: it is difficult to constrain atmospheric composition of exoplanets (H-poor or H-rich+clouds?) #aas228pic.twitter.com/LdyN4o9RC7 astrobites (@astrobites) June 15, 2016The main proposal on how these systems formed is the migration scenario. In order to validate this idea, Dr. Knutson and her group The Friends of Hot Jupiters study systems with close-in gas giants and their frequency of binary companions, which are supposed to be the main culprits causing gas-giant migration. They found that approximately half of the observed systems have long-distance companions, providing strong validation of the migration scenario. Moreover, Dr. Knutson speculates that wide binaries have more

  16. Magnetic horn of the Antiproton Accumulator (AA)

    Photographic Service

    1988-01-01

    In the 1960s, the invention of this "current sheet lens" has helped to greatly improve the flux of neutrino beams. It was used again at the AA, collecting antiprotons from the production target at angles too large to fit into the acceptance of the AA. It was machined from aluminium to a thickness of 1.4 mm and pulsed at 400 kA for 15 microseconds (half-sine).

  17. Effect of supplementation of arachidonic acid (AA) or a combination of AA plus docosahexaenoic acid on breastmilk fatty acid composition

    Smit, EN; Koopmann, M; Boersma, ER; Muskiet, FAJ

    2000-01-01

    We investigated whether supplementation with arachidonic acid (20:4 omega 6; AA), ora combination of AA and docosahexaenoic acid (22:6 omega 3; DHA) would affect human milk polyunsaturated fatty acid (PUFA) composition. Ten women were daily supplemented with 300 mg AA, eight with 300 mg AA, 110 mg e

  18. AAS 228: Day 1 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session: From Space Archeology to Serving the World Today: A 20-year Journey from the Jungles of Guatemala to a Network of Satellite Remote Sensing Facilities Around the World(by Michael Zevin)In the conferences second plenary session, NASAs Daniel Irwin turned the eyes of the conference back to Earth by highlighting the huge impact that NASA missions play in protecting and developing our own planet.Daniel Irwin: using satellite imagery to detect differences in vegetation and find ancient Mayan cities. #aas228 pic.twitter.com/9LFPQdCHTM astrobites (@astrobites) June 13, 2016Irwin came to be involved in NASA through his work mapping Guatemalan jungles, where he would spend 22 days at a time exploring the treacherous jungles on foot armed with a 1st generation GPS, a compass, and a machete. A colleague introduced Irwin to the satellite imagery thathe was exploring, demonstratinghow these images are a strong complement to field work. The sharing of this satellite data with nearby villages helped to show the encroachment of agriculture and the necessity of connecting space to the village. Satellite imagery also played a role in archeological endeavors, uncovering dozens of Mayan cities that have been buried for over a millennia by vegetation, and it provided evidence that the fall of the Mayan civilization may have been due to massive deforestation that ledto drought.Glacial retreat in Chile imaged by ISERV.Irwin displayed the constellation of NASAs Earth-monitoring satellites that have played an integral role in conserving our planet and alerting the world of natural disasters. He also showed

  19. Mechanism of corrosion inhibition of AA2024 by rare-earth compounds.

    Yasakau, Kiryl A; Zheludkevich, Mikhail L; Lamaka, Sviatlana V; Ferreira, Mario G S

    2006-03-23

    The mechanism of corrosion protection of the widely used 2024-T3 aluminum alloy by cerium and lanthanum inhibitors in chloride media is described in detail in the present work. The corrosion process was investigated by means of scanning Kelvin probe force microscopy (SKPFM), in situ atomic force microscopy, and scanning electron microscopy coupled with energy dispersive spectroscopy. Employment of the high-resolution and in situ techniques results in a deep understanding of the details of the physical chemistry and mechanisms of the corrosion processes. The applicability of the SKPFM for mechanistic analysis of the effect of different corrosion inhibitors is demonstrated for the first time. The inhibitors under study show sufficient hindering of the localized corrosion processes especially in the case of pitting formation located around the intermetallic S-phase particles. The main role of Ce(3+) and La(3+) in the corrosion protection is formation of hydroxide deposits on S-phase inclusions buffering the local increase of pH, which is responsible for the acceleration of the intermetallics dealloying. The formed hydroxide precipitates can also act as a diffusion barrier hindering the corrosion processes in active zones. Cerium nitrate exhibits higher inhibition efficiency in comparison with lanthanum nitrate. The higher effect in the case of cerium is obtained due to lower solubility of the respective hydroxide. A detailed mechanism of the corrosion process and its inhibition is proposed based on thermodynamic analysis. PMID:16539491

  20. MDCT evaluation of acute aortic syndrome (AAS).

    Valente, Tullio; Rossi, Giovanni; Lassandro, Francesco; Rea, Gaetano; Marino, Maurizio; Muto, Maurizio; Molino, Antonio; Scaglione, Mariano

    2016-05-01

    Non-traumatic acute thoracic aortic syndromes (AAS) describe a spectrum of life-threatening aortic pathologies with significant implications on diagnosis, therapy and management. There is a common pathway for the various manifestations of AAS that eventually leads to a breakdown of the aortic intima and media. Improvements in biology and health policy and diffusion of technology into the community resulted in an associated decrease in mortality and morbidity related to aortic therapeutic interventions. Hybrid procedures, branched and fenestrated endografts, and percutaneous aortic valves have emerged as potent and viable alternatives to traditional surgeries. In this context, current state-of-the art multidetector CT (MDCT) is actually the gold standard in the emergency setting because of its intrinsic diagnostic value. Management of acute aortic disease has changed with the increasing realization that endovascular therapies may offer distinct advantages in these situations. This article provides a summary of AAS, focusing especially on the MDCT technique, typical and atypical findings and common pitfalls of AAS, as well as recent concepts regarding the subtypes of AAS, consisting of aortic dissection, intramural haematoma, penetrating atherosclerotic ulcer and unstable aortic aneurysm or contained aortic rupture. MDCT findings will be related to pathophysiology, timing and management options to achieve a definite and timely diagnostic and therapeutic definition. In the present article, we review the aetiology, pathophysiology, clinical presentation, outcomes and therapeutic approaches to acute aortic syndromes. PMID:27033344

  1. The AA disappearing under concrete shielding

    1982-01-01

    When the AA started up in July 1980, the machine stood freely in its hall, providing visitors with a view through the large window in the AA Control Room. The target area, in which the high-intensity 26 GeV/c proton beam from the PS hit the production target, was heavily shielded, not only towards the outside but also towards the AA-Hall. However, electrons and pions emanating from the target with the same momentum as the antiprotons, but much more numerous, accompanied these through the injection line into the AA ring. The pions decayed with a half-time corresponding to approximately a revolution period (540 ns), whereas the electrons lost energy through synchrotron radiation and ended up on the vacuum chamber wall. Electrons and pions produced the dominant component of the radiation level in the hall and the control room. With operation times far exceeding original expectations, the AA had to be buried under concrete shielding in order to reduce the radiation level by an order of magnitude.

  2. Dicty_cDB: FCL-AA03 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA03 (Link to dictyBase) - - - Contig-U15092-1 FCL-AA03E ...(Link to Original site) - - - - - - FCL-AA03E 627 Show FCL-AA03 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA03Q.Seq.d/ Representative seq. ID FCL-AA...03E (Link to Original site) Representative DNA sequence >FCL-AA03 (FCL-AA03Q) /CSM/FCL/FCL-AA/FCL-AA...03Q.Seq.d/ ACATAATGTTCCAAAAGAAAGCAATTGTTATTGATGGCAAAGGTCATTTGTTAGGTCGTT TAGCCTCCGTTGTTGCTAAATCCCTCCTCTCTGGTCAAAA

  3. Dicty_cDB: FCL-AA02 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA02 (Link to dictyBase) - - - Contig-U16560-1 FCL-AA02F ...(Link to Original site) FCL-AA02F 620 - - - - - - Show FCL-AA02 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ Representative seq. ID FCL-AA...02F (Link to Original site) Representative DNA sequence >FCL-AA02 (FCL-AA02Q) /CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ ATTAA...ATACAAAATACAAATACAAATAACAAATACTTTACTATAGCTTTTTTTTCTTATT TATTTCTCCAAATAATTTTTTAATATGCAAATCTTTGTTAAAA

  4. Dicty_cDB: FCL-AA09 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA09 (Link to dictyBase) - - - Contig-U16453-1 FCL-AA09F ...(Link to Original site) FCL-AA09F 485 - - - - - - Show FCL-AA09 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ Representative seq. ID FCL-AA...09F (Link to Original site) Representative DNA sequence >FCL-AA09 (FCL-AA09Q) /CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ GACAA...AAGTAAATAAAACATGTCCGCAAGTAATAAAGATGACCAACTCATGAAAAATGAG TTCGAAAGTACCTACGACAAAATTGTCGATTCATTCGACAA

  5. Dicty_cDB: FCL-AA08 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA08 (Link to dictyBase) - - - Contig-U16200-1 FCL-AA08Z ...(Link to Original site) - - FCL-AA08Z 574 - - - - Show FCL-AA08 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA08Q.Seq.d/ Representative seq. ID FCL-AA...08Z (Link to Original site) Representative DNA sequence >FCL-AA08 (FCL-AA08Q) /CSM/FCL/FCL-AA/FCL-AA...08Q.Seq.d/ XXXXXXXXXXTCGAAGCCAAAGGTCGTCTCGAAGAAGAATTCCATCGCTCGTACCAACTC TGATCGTTCAAGAAAGAGACTCGAAGCTGAAA

  6. Dicty_cDB: FC-AA09 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA09 (Link to dictyBase) - - - Contig-U15086-1 FC-AA09E (Li...nk to Original site) - - - - - - FC-AA09E 562 Show FC-AA09 Library FC (Link to library) Clone ID FC-AA09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA09Q.Seq.d/ Representative seq. ID FC-AA...09E (Link to Original site) Representative DNA sequence >FC-AA09 (FC-AA09Q) /CSM/FC/FC-AA/FC-AA09Q.Seq....d/ GATACATTATCACCATGGCAGGAAAAAAAGTCAAATCTAACACACCAAAACAAGACTTAT CTGTCTCTAAATCAAAGCTCACCAGCATTAAAGCCCCAGCTGCTGCCATCAAAGCTAAA

  7. Dicty_cDB: FC-AA14 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA14 (Link to dictyBase) - - - Contig-U15088-1 FC-AA14E (Li...nk to Original site) - - - - - - FC-AA14E 431 Show FC-AA14 Library FC (Link to library) Clone ID FC-AA14 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA14Q.Seq.d/ Representative seq. ID FC-AA...14E (Link to Original site) Representative DNA sequence >FC-AA14 (FC-AA14Q) /CSM/FC/FC-AA/FC-AA14Q.Seq.d/ CTATGTCTGAAATCAAAA...CTGAAGAACTCGCTTGCATCTACTCCGGTCTTTTATTACAAG ATGACGGTATTGAAATCACCGCTGATAAAATCAAAACCTTATTAGAAGCTGCCAA

  8. Dicty_cDB: FCL-AA04 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA04 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA04Z ...(Link to Original site) - - FCL-AA04Z 530 - - - - Show FCL-AA04 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA04Q.Seq.d/ Representative seq. ID FCL-AA...04Z (Link to Original site) Representative DNA sequence >FCL-AA04 (FCL-AA04Q) /CSM/FCL/FCL-AA/FCL-AA...04Q.Seq.d/ XXXXXXXXXXCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTTCAGTCAAAGAAATT AAAAGAGGTATGGTCGCTGGTGACTCCAAAAACGATCCACCACAAGAAA

  9. Dicty_cDB: FC-AA20 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA20 (Link to dictyBase) - - - Contig-U16455-1 FC-AA20Z (Li...nk to Original site) - - FC-AA20Z 607 - - - - Show FC-AA20 Library FC (Link to library) Clone ID FC-AA20 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA20Q.Seq.d/ Representative seq. ID FC-AA...20Z (Link to Original site) Representative DNA sequence >FC-AA20 (FC-AA20Q) /CSM/FC/FC-AA/FC-AA20Q.Seq....d/ XXXXXXXXXXCTTTGCCCCAGCTGGTCTCTCAACTGAAGTCAAATCAGTCGAAATGCATC ACGAACAACTCCCAGAAGCCCGTCCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTT CAGTCAA

  10. Dicty_cDB: FCL-AA15 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA15 (Link to dictyBase) - - - Contig-U16011-1 FCL-AA15Z ...(Link to Original site) - - FCL-AA15Z 442 - - - - Show FCL-AA15 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA15Q.Seq.d/ Representative seq. ID FCL-AA...15Z (Link to Original site) Representative DNA sequence >FCL-AA15 (FCL-AA15Q) /CSM/FCL/FCL-AA/FCL-AA...15Q.Seq.d/ XXXXXXXXXXCCATTCATCTGTCCAATCGATTGTCGTCGTGGTCTCTACAAGAATATCGT CTTATCTGGTGGTTCAACCATGTTTAAAGATTTTGGTAAACGTCTTCAA

  11. Dicty_cDB: FC-AA13 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA13 (Link to dictyBase) - - - Contig-U15674-1 FC-AA13Z (Li...nk to Original site) - - FC-AA13Z 528 - - - - Show FC-AA13 Library FC (Link to library) Clone ID FC-AA13 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA13Q.Seq.d/ Representative seq. ID FC-AA...13Z (Link to Original site) Representative DNA sequence >FC-AA13 (FC-AA13Q) /CSM/FC/FC-AA/FC-AA13Q.Seq.d/ XXXXXXXXXXAAAGCAAA...CTCGTGCTGGTCAACGTACCCGTTTCAAGGCTTTCGTCGTTG TTGGTGATCACAACGGTCATGTAGGTCTCGGTGTTAAATGCGCTAAGGAA

  12. Dicty_cDB: FCL-AA20 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA20 (Link to dictyBase) - - - Contig-U15052-1 FCL-AA20E ...(Link to Original site) - - - - - - FCL-AA20E 1159 Show FCL-AA20 Library FCL (Link to library) Clone ID FCL-AA...L http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ Representative seq. ID FCL-AA...20E (Link to Original site) Representative DNA sequence >FCL-AA20 (FCL-AA20Q) /CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ AAAA...CATTTACAAATGATGACCACAGAAGATGTACAACCAATTGAAACTACCAAAGATGG TGTAGTAGTATTAAATTATAGCGATTTAATTGCAGGTAAA

  13. Dicty_cDB: FC-AA23 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA23 (Link to dictyBase) - - - Contig-U16090-1 FC-AA23E (Li...nk to Original site) - - - - - - FC-AA23E 387 Show FC-AA23 Library FC (Link to library) Clone ID FC-AA23 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA23Q.Seq.d/ Representative seq. ID FC-AA...23E (Link to Original site) Representative DNA sequence >FC-AA23 (FC-AA23Q) /CSM/FC/FC-AA/FC-AA23Q.Seq.d/ AAACTCGATTATATTCTTAA...TCTTAAAGTTCAAGATTTCATGGAAAGACGTCTCCAAACT TTAGTCTTCAAAAATGGTCTTGCCAAATCAATCCATCACGCTCGTGTTTTAATCAAA

  14. Dicty_cDB: FC-AA12 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA12 (Link to dictyBase) - - - Contig-U15087-1 FC-AA12E (Li...nk to Original site) - - - - - - FC-AA12E 454 Show FC-AA12 Library FC (Link to library) Clone ID FC-AA12 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA12Q.Seq.d/ Representative seq. ID FC-AA...12E (Link to Original site) Representative DNA sequence >FC-AA12 (FC-AA12Q) /CSM/FC/FC-AA/FC-AA12Q.Seq.d/ AAATAATAATAATATAAAAA...TGGAAATTAAAGTTTTAGCTAAAAGAAAAGTATCAGCAAA ACGTGCAAATGAAATATTAGGAAAATTTATTTTAGAAAGAAAAGCAAATGAAGAAAA

  15. Dicty_cDB: FC-AA01 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA01 (Link to dictyBase) - - - Contig-U15084-1 FC-AA01E (Li...nk to Original site) - - - - - - FC-AA01E 701 Show FC-AA01 Library FC (Link to library) Clone ID FC-AA01 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA01Q.Seq.d/ Representative seq. ID FC-AA...01E (Link to Original site) Representative DNA sequence >FC-AA01 (FC-AA01Q) /CSM/FC/FC-AA/FC-AA01Q.Seq.d/ GAGAAATATTTCTTATTAA...CAATTGCATGCGTTGTATTCAACCCAACATGGTGGAATATT ACAGCAAGAATGGAATATAATGCTAATAAATAACAACCATTTTCTTTACTTCCACAAA

  16. Dicty_cDB: FCL-AA10 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA10 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA10Z ...(Link to Original site) - - FCL-AA10Z 627 - - - - Show FCL-AA10 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA10Q.Seq.d/ Representative seq. ID FCL-AA...10Z (Link to Original site) Representative DNA sequence >FCL-AA10 (FCL-AA10Q) /CSM/FCL/FCL-AA/FCL-AA...10Q.Seq.d/ XXXXXXXXXXTAAACCAGGTATGGTCGTCACCTTTTGCCCCAGCTGGTCTCTCAACTGAA GTCAAATCAGTCGAAATGCATCACGAACAACTCCCAGAA

  17. Dicty_cDB: FC-AA19 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA19 (Link to dictyBase) - - - Contig-U16072-1 FC-AA19F (Li...nk to Original site) FC-AA19F 539 - - - - - - Show FC-AA19 Library FC (Link to library) Clone ID FC-AA19 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA19Q.Seq.d/ Representative seq. ID FC-AA...19F (Link to Original site) Representative DNA sequence >FC-AA19 (FC-AA19Q) /CSM/FC/FC-AA/FC-AA19Q.Seq.d/ CAGAAA...TCACTGGTTTTTCATTCCAATTATTTAATATTATCAGTATTTGGAATGTTGATC AAACATCATTCAATAGCTACAGTCTTCCAATTTGGTTACCAGCCATTCAA

  18. Dicty_cDB: FC-AA02 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA02Q.Seq.d/ Representative seq. ID FC-AA...02Z (Link to Original site) Representative DNA sequence >FC-AA02 (FC-AA02Q) /CSM/FC/FC-AA/FC-AA02Q.Seq.d/ XXXXXXXXXXCAAAAA...GGCTCCTGGTCCGGAAGGATTGGGTAATCATTTGAATTTCCTAC GTAACTGGGCTTGATCTTTGTAATTATTGATCATAAACGAGGAATTCCTTGTAAGCGTAA

  19. Dicty_cDB: FCL-AA24 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA24 (Link to dictyBase) - - - Contig-U16467-1 FCL-AA24E ...(Link to Original site) - - - - - - FCL-AA24E 779 Show FCL-AA24 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA24Q.Seq.d/ Representative seq. ID FCL-AA...24E (Link to Original site) Representative DNA sequence >FCL-AA24 (FCL-AA24Q) /CSM/FCL/FCL-AA/FCL-AA...24Q.Seq.d/ CTAGAAATTTCTAAACAATTATTTATTTGAAGAGGTTTTTTAAAAAAAGAAAAAAATCAG AGCATCCAAATAATAACCGCAGTAAGGGGGGGATGGTTGTTAA

  20. Dicty_cDB: FCL-AA05 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA05 (Link to dictyBase) - - - Contig-U16473-1 FCL-AA05Z ...(Link to Original site) - - FCL-AA05Z 603 - - - - Show FCL-AA05 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA05Q.Seq.d/ Representative seq. ID FCL-AA...05Z (Link to Original site) Representative DNA sequence >FCL-AA05 (FCL-AA05Q) /CSM/FCL/FCL-AA/FCL-AA...05Q.Seq.d/ XXXXXXXXXXTGGCGCCATCATTACTGGTGGAGGTGGTGTTGCTATCACTCAAGCTCAAC CATCATACCAAGCTGATGCCGTTGCCACTTACATCAAAA

  1. AAS 228: Day 2 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  2. AAS 228: Day 2 afternoon

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  3. AAS 228: Day 2 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  4. AAS 228: Day 2 morning

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  5. Power electronics substrate for direct substrate cooling

    Le, Khiet; Ward, Terence G.; Mann, Brooks S.; Yankoski, Edward P.; Smith, Gregory S.

    2012-05-01

    Systems and apparatus are provided for power electronics substrates adapted for direct substrate cooling. A power electronics substrate comprises a first surface configured to have electrical circuitry disposed thereon, a second surface, and a plurality of physical features on the second surface. The physical features are configured to promote a turbulent boundary layer in a coolant impinged upon the second surface.

  6. AA, vacuum tank for stochastic precooling

    1979-01-01

    The vaccum tank in which the fast stochastic precooling kicker was installed. It is clad with heating jackets for bake-out to 200 deg C, indispensable for reaching the operational vacuum of 7E-11 Torr. Alain Poncet, responsible for AA vacuum, is looking on. See also 7910268, 8002234.

  7. AA, mating of BST magnet halves

    1980-01-01

    The AA had 2 types of bending magnets: BLG (window-frame,long and narrow) and BST (H-type, short and wide). The BST had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the mating of two BST halves.

  8. 7 CFR 51.596 - U.S. Grade AA.

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false U.S. Grade AA. 51.596 Section 51.596 Agriculture... Consumer Standards for Celery Stalks Grades § 51.596 U.S. Grade AA. U.S. Grade AA shall consist of stalks of celery of similar varietal characteristics, which are well developed, and have good...

  9. Processing and Optimization of Dissimilar Friction Stir Welding of AA 2219 and AA 7039 Alloys

    Venkateswarlu, D.; Nageswara rao, P.; Mahapatra, M. M.; Harsha, S. P.; Mandal, N. R.

    2015-12-01

    The present paper discusses the optimization of dissimilar friction stir welding of AA 2219 and AA 7039 alloys with respect to tool design issues including microstructural study of weld. The optimized ultimate tensile strength was ~280 MPa, and % elongation was ~11.5. It was observed that the extent of tool shoulder flat surface and tool rotational speed influenced the weld quality significantly. A mathematical model was also developed using response surface regression analysis to predict the effects of tool geometry and process variables on dissimilar AA 2219 and AA 7039 alloys welds. The microstructure evolution and mechanical properties were investigated by employing electron backscatter diffraction technique, Vickers microhardness, and tensile testing, respectively. The microstructural observations indicated that the grain size obtained at advancing side (AA 2219 alloy side) was much finer compared to the retreating side (AA 7039 alloy side). Hardness distribution in the stir zone was inhomogeneous, which might be due to inadequate mixing of weld zone material. The hardness values observed at the weld zone were lower than that in the base materials.

  10. EValuation of the thixoformability of AA7004 and AA7075 alloys

    Eugenio José Zoqui

    2010-09-01

    Full Text Available This study involved a complete evaluation of the thixoformability of AA7004 and AA7075 alloys, from their microstructural characterization to their viscous behavior. The alloys were subjected to globularization heat treatments for 0, 30, 90 and 210 seconds in two conditions of solid fractions, 45 and 60%, and to viscosity assays under the same conditions. Heat treatments promote the globularization of primary phase particles; hence, the best viscosity results were achieved for alloys with low solid fractions heat-treated for 210 seconds. Alloys AA7004 and AA7075 showed an apparent viscosity of 10(4 to 10(5 (Pa.s. The behavior of materials in this range is similar to that of molten glass and they show high formability. However, the AA7075 alloy showed a better performance than the AA7004 due to the smaller size of its primary particles and original grains, their lower growth during reheating, and depending on the condition, their viscosity of 10(4 Pa.s, which is extremely low for thixoforming standards.

  11. Evolution of geomagnetic aa index near sunspot minimum

    Kane, R. P.

    2002-01-01

    The smoothed values of the minima of sunspot number Rz and the geomagnetic index aa were compared for sunspot cycles 12–23. In one cycle, aa(min) occurred earlier than Rz(min), but remained at that low from a few months before Rz(min) to a few months after Rz(min). In two cycles, Rz(min) and aa(min) coincided within a month or two. In nine cycles, aa(min) occurred more than three months later than Rz(min). The aa(min) coincided with the minima of some solar radio e...

  12. Dicty_cDB: FC-AA03 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA03 (Link to dictyBase) - - - Contig-U15331-1 FC-AA03P (Li...nk to Original site) FC-AA03F 595 FC-AA03Z 546 FC-AA03P 1141 - - Show FC-AA03 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA03Q.Seq.d/ Representative seq. ID FC-AA...03P (Link to Original site) Representative DNA sequence >FC-AA03 (FC-AA03Q) /CSM/FC/FC-AA/FC-AA03Q.Seq.d/ AA...AATGTCATCTTATTTATTCACTAGTGAATCCGTCACCGAAGTCATCCAGATAAAATCT GTGATCAAGTATCAGATGCTGTTCTCGATGCTTGTTTAGCTCAA

  13. Dicty_cDB: FC-AA04 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA04 (Link to dictyBase) - - - Contig-U15354-1 FC-AA04P (Li...nk to Original site) FC-AA04F 546 FC-AA04Z 484 FC-AA04P 1030 - - Show FC-AA04 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA04Q.Seq.d/ Representative seq. ID FC-AA...04P (Link to Original site) Representative DNA sequence >FC-AA04 (FC-AA04Q) /CSM/FC/FC-AA/FC-AA04Q.Seq.d/ AA...TAATACACATAAAAAATTTATTAAATAAAAATGACTACAACAACAACAAATGAAGTTT ATATAGTTGATTGTATTCGTACACCAATTGGTAGAGGATATAGTAA

  14. Dicty_cDB: FC-AA10 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA10 (Link to dictyBase) - - - Contig-U16358-1 FC-AA10P (Li...nk to Original site) FC-AA10F 659 FC-AA10Z 544 FC-AA10P 1203 - - Show FC-AA10 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA10Q.Seq.d/ Representative seq. ID FC-AA...10P (Link to Original site) Representative DNA sequence >FC-AA10 (FC-AA10Q) /CSM/FC/FC-AA/FC-AA10Q.Seq.d/ AA...ATGACTACCTTTAACGAATATCCATTCTTGGCTGAATTAGGCATTAAAGCTGAAAATA ATGATGGAGTCTTCAATGGAAAATGGGGAGGTGCTGGTGAAATCATCAA

  15. Research in development: the approach of AAS

    Dugan, P.; Apgar, M.; Douthwaite, B.

    2013-01-01

    The CGIAR Research Program on Aquatic Agricultural Systems (AAS) is pursuing a Research in Development approach that emphasizes the importance of embedding research in the development context. Reflecting this emphasis the six elements of this approach are a commitment to people and place, participatory action research, gender transformative research, learning and networking, partnerships, and capacity building. It is through the careful pursuit of these six elements that we believe that the p...

  16. AA, inner conductor of a magnetic horn

    1981-01-01

    At the start-up of the AA and during its initial operation, magnetic horns focused the antiprotons emanating from the production target. These "current-sheet lenses" had a thin inner conductor (for minimum absorption of antiprotons), machined from aluminium to wall thicknesses of 0.7 or 1 mm. The half-sine pulses rose to 150 kA in 8 microsec. The angular acceptance was 50 mrad.

  17. AA Prototype-Quadrupole on Measurement Stand

    1978-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although not very long (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built in 1978. Here we see it on its test stand, with Ray Brown positioning the measurement coil.

  18. AA Prototype-Quadrupole on Measurement Stand

    1979-01-01

    The very particular lattice of the AA required 2 types of quadrupoles: narrow ones (QFN, QDN) and wide ones (QFW, QDW). The wide ones, although rather short (steel length 0.54 m), had an unusually large aperture of 0.75 m in width, 0.68 m "good field". A prototype was built at CERN in 1978. Here we see it on its test stand, with a measurement coil inserted, Brian Pincott taking readings.

  19. AA, assembly of wide bending magnet

    1980-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets; BST, short and wide; BLG, long and narrow). The wide ones had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the copper coils being hoisted onto the lower half of a BST. See also 7811105, 8006050. For a BLG, see 8001044.

  20. AAS Publishing News: Astronomical Software Citation Workshop

    Kohler, Susanna

    2015-07-01

    Do you write code for your research? Use astronomical software? Do you wish there were a better way of citing, sharing, archiving, or discovering software for astronomy research? You're not alone! In April 2015, AAS's publishing team joined other leaders in the astronomical software community in a meeting funded by the Sloan Foundation, with the purpose of discussing these issues and potential solutions. In attendance were representatives from academic astronomy, publishing, libraries, for-profit software sharing platforms, telescope facilities, and grantmaking institutions. The goal of the group was to establish “protocols, policies, and platforms for astronomical software citation, sharing, and archiving,” in the hopes of encouraging a set of normalized standards across the field. The AAS is now collaborating with leaders at GitHub to write grant proposals for a project to develop strategies for software discoverability and citation, in astronomy and beyond. If this topic interests you, you can find more details in this document released by the group after the meeting: http://astronomy-software-index.github.io/2015-workshop/ The group hopes to move this project forward with input and support from the broader community. Please share the above document, discuss it on social media using the hashtag #astroware (so that your conversations can be found!), or send private comments to julie.steffen@aas.org.

  1. Dicty_cDB: FC-AA11 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA11 (Link to dictyBase) - - - Contig-U16273-1 FC-AA11P (Li...nk to Original site) FC-AA11F 631 FC-AA11Z 502 FC-AA11P 1133 - - Show FC-AA11 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA11Q.Seq.d/ Representative seq. ID FC-AA...11P (Link to Original site) Representative DNA sequence >FC-AA11 (FC-AA11Q) /CSM/FC/FC-AA/FC-AA...11Q.Seq.d/ GGTGAATTAATTGTTGAACCAGTTGATCAAAAATATATTTTCAAGACTGAACGTAAAGTT CCAAGAATGGGTGTTATGATTGTTGGTTTATGTGGTAACAATGGTACAA

  2. Dicty_cDB: FC-AA18 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA18 (Link to dictyBase) - - - Contig-U15943-1 FC-AA18P (Li...nk to Original site) FC-AA18F 506 FC-AA18Z 293 FC-AA18P 799 - - Show FC-AA18 Library FC (Link to library) Clone ID FC-AA...al site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA18Q.Seq.d/ Representative seq. ID FC-AA...18P (Link to Original site) Representative DNA sequence >FC-AA18 (FC-AA18Q) /CSM/FC/FC-AA/FC-AA18Q.Seq.d/ AAA...AGATAGAGAAGAAAGAAAACTTGAACGTGAGAAGGAACTTGAACGTGAACGTGAGAA AGAACTTGAGCGTGAGCGTGAACGTGAACAACGTCGTCTTGAAA

  3. Dicty_cDB: FCL-AA07 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA07 (Link to dictyBase) - - - Contig-U14973-1 FCL-AA07P ...(Link to Original site) FCL-AA07F 527 FCL-AA07Z 253 FCL-AA07P 780 - - Show FCL-AA07 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA07Q....Seq.d/ Representative seq. ID FCL-AA07P (Link to Original site) Representative DNA sequence >FCL-AA07 (FCL-AA07Q) /CSM/FCL/FCL-AA.../FCL-AA07Q.Seq.d/ CAAAATAAAAAATGTTATCAAATTTTTTAAAAGTCAACAGTAAAGCACTAGGACATATAA GAACTTTTGCCTCAAAGAGTGGTGAAATTAAA

  4. Dicty_cDB: FCL-AA12 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA12 (Link to dictyBase) - - - Contig-U16034-1 FCL-AA12P ...(Link to Original site) FCL-AA12F 629 FCL-AA12Z 540 FCL-AA12P 1169 - - Show FCL-AA12 Library FCL (Link to library) Clone ID FCL-AA...4-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA12Q....Seq.d/ Representative seq. ID FCL-AA12P (Link to Original site) Representative DNA sequence >FCL-AA12 (FCL-AA12Q) /CSM/FCL/FCL-AA.../FCL-AA12Q.Seq.d/ ATCAAATGTTTATTCAACAACAACCATCAGATTCAATTGTTTGTAATCGTTATATTCATC CAGCCATTGTTGTTTTGGTTGACCAA

  5. Dicty_cDB: FCL-AA21 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA21 (Link to dictyBase) - - - Contig-U14936-1 FCL-AA21P ...(Link to Original site) FCL-AA21F 520 FCL-AA21Z 356 FCL-AA21P 876 - - Show FCL-AA21 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA21Q....Seq.d/ Representative seq. ID FCL-AA21P (Link to Original site) Representative DNA sequence >FCL-AA21 (FCL-AA21Q) /CSM/FCL/FCL-AA.../FCL-AA21Q.Seq.d/ ATCATAATCATATATTTTTAATAGATATTGATATATATATTTAAAAAAATAAAATAAAAT AAAATAAAAAATGTCAACAGAGGAAACAAAAA

  6. Dicty_cDB: FCL-AA01 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA01 (Link to dictyBase) - - - Contig-U16033-1 FCL-AA01P ...(Link to Original site) FCL-AA01F 603 FCL-AA01Z 411 FCL-AA01P 1014 - - Show FCL-AA01 Library FCL (Link to library) Clone ID FCL-AA...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA01Q....Seq.d/ Representative seq. ID FCL-AA01P (Link to Original site) Representative DNA sequence >FCL-AA01 (FCL-AA01Q) /CSM/FCL/FCL-AA.../FCL-AA01Q.Seq.d/ GCAAATAATAATATTATGGGTATTGACTTTGGTACACATTTCGCATGTGTTGGTATTTTC AAGAATGAAAGAATTGAAATCTGTCCAAA

  7. Dicty_cDB: FCL-AA13 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA13 (Link to dictyBase) - - - - FCL-AA13P (Link to Original site) FCL-AA...13F 635 FCL-AA13Z 350 FCL-AA13P 985 - - Show FCL-AA13 Library FCL (Link to library) Clone ID FCL-AA...dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ Representative seq. ID FCL-AA...13P (Link to Original site) Representative DNA sequence >FCL-AA13 (FCL-AA13Q) /CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ CATATTTATAA...TTATATCTTTTTTGTTTAATAAAAAAGAAAGAATACCAACATGAGACTT TTATTGTGTTTAATTTTCTTAGTTTTTGTTTTCAATTTTGCATTATCAA

  8. Dicty_cDB: FC-AA06 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA06 (Link to dictyBase) - - - Contig-U15909-1 FC-AA06P (Li...nk to Original site) FC-AA06F 532 FC-AA06Z 501 FC-AA06P 1033 - - Show FC-AA06 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA06Q.Seq.d/ Representative seq. ID FC-AA...06P (Link to Original site) Representative DNA sequence >FC-AA06 (FC-AA06Q) /CSM/FC/FC-AA/FC-AA...06Q.Seq.d/ GTGAATATAACGATTTAGATTTAGTGTATGATAAAGATGTTTATCAAAAATTAATAGAGA ATGGTGTAGATTCATTATTATCAAAA

  9. Dicty_cDB: FC-AA08 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA08 (Link to dictyBase) - - - Contig-U15942-1 FC-AA08P (Li...nk to Original site) FC-AA08F 620 FC-AA08Z 510 FC-AA08P 1130 - - Show FC-AA08 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA08Q.Seq.d/ Representative seq. ID FC-AA...08P (Link to Original site) Representative DNA sequence >FC-AA08 (FC-AA08Q) /CSM/FC/FC-AA/FC-AA...08Q.Seq.d/ ATCAGTTACATGTACTGCACCAGTTAATATTGCAGTTATCAAATATTGGGGAAAGAGAGA TGAAAATATTATTTTACCATTAAATTCATCACTCAGTGGAA

  10. Characterization of Aquifex aeolicus ribonuclease III and the reactivity epitopes of its pre-ribosomal RNA substrates

    Shi, Zhongjie; Nicholson, Rhonda H.; Jaggi, Ritu; Nicholson, Allen W.

    2010-01-01

    Ribonuclease III cleaves double-stranded (ds) structures in bacterial RNAs and participates in diverse RNA maturation and decay pathways. Essential insight on the RNase III mechanism of dsRNA cleavage has been provided by crystallographic studies of the enzyme from the hyperthermophilic bacterium, Aquifex aeolicus. However, the biochemical properties of A. aeolicus (Aa)-RNase III and the reactivity epitopes of its substrates are not known. The catalytic activity of purified recombinant Aa-RNa...

  11. Rare earth conversion coatings grown on AA6061 aluminum alloys. Corrosion studies

    The present work is aimed to investigate the corrosion resistance of rare earth protective coatings deposited by spontaneous deposition on AA6061 aluminum alloy substrates. Coatings were deposited from water-based Ce(NO3)3 and La(NO3)3 solutions by varing parameters such as rare earth solution concentration, bath temperature and immersion time. The values of the Tafel slopes indicate that the cathodic process is favored by concentration polarization rather than activation polarization. Chemical and morphological characterizations of the surface before and after electrochemical evaluations were performed by X-ray photoelectron spectroscopy and scanning electron microscopy. (Author)

  12. Aluminium Alloy AA6060 surface treatment with high temperature steam containing chemical additives

    Din, Rameez Ud; Tabrizian, Naja; Jellesen, Morten S.;

    2015-01-01

    The steam treatment process was employed to produce a conversion coating on aluminium alloy AA6060. The changes in microstructure and its effect on corrosion resistance properties were investigated. Various concentrations of KMnO4 containing Ce(NO3)3 was injected into the steam and its effect on...... the formation of steam-based conversion coating was evaluated. The use of Mn-Ce into the steam resulted in incorporation of these species into the conversion coating, which resulted in improved corrosion resistance of the alloy substrate....

  13. Rare earth conversion coatings grown on AA6061 aluminum alloys. Corrosion studies

    Brachetti S, S. B. [Instituto Tecnologico de Ciudad Madero, Av. 1o. de Mayo y Sor Juana I. de la Cruz, Col. Los Mangos, 89440 Ciudad Madero, Tanaulipas (Mexico); Dominguez C, M. A.; Torres H, A. M.; Onofre B, E. [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada - Altamira, Carretera Tampico-Puerto Industrial Altamira Km. 14.5, 89600 Altamira, Tamaulipas (Mexico); De la Cruz H, W., E-mail: mdominguezc@ipn.mx [UNAM, Centro de Nanociencias y Nanotecnologia, Apdo. Postal 2681, 22800 Ensenada, Baja California (Mexico)

    2014-07-01

    The present work is aimed to investigate the corrosion resistance of rare earth protective coatings deposited by spontaneous deposition on AA6061 aluminum alloy substrates. Coatings were deposited from water-based Ce(NO{sub 3}){sub 3} and La(NO{sub 3}){sub 3} solutions by varing parameters such as rare earth solution concentration, bath temperature and immersion time. The values of the Tafel slopes indicate that the cathodic process is favored by concentration polarization rather than activation polarization. Chemical and morphological characterizations of the surface before and after electrochemical evaluations were performed by X-ray photoelectron spectroscopy and scanning electron microscopy. (Author)

  14. Comparison between ARB and CARB processes on an AA5754/AA6061 composite

    Verstraete, K.; Helbert, A.-L.; Brisset, F.; Baudin, T.

    2014-08-01

    The present work aims to compare two processes: Accumulative Roll Bonding and Cross Accumulative Roll Bonding (CARB). Both processes consist in the repetition of rolling but the second technique adds a 90° rotation of the sheet around its normal direction between each rolling. Microstructure, mechanical properties and texture were compared for both processes on an AA5754/AA6061 composite. As a result a thinner and less elongated microstructure was obtained in the CARB process leading to an isotropy and an improvement of the mechanical properties. Besides, the texture was characterized by the rotated Cube component for both processes but for CARB it is of less strength.

  15. Investigation of photocatalytic activity of titanium dioxide deposited on metallic substrates by DC magnetron sputtering

    Daviðsdóttir, Svava; Canulescu, Stela; Dirscherl, Kai;

    2013-01-01

    The photocatalytic properties of titanium dioxide (TiO2) coating in the anatase crystalline structure deposited on aluminium AA1050 alloy and stainless steel S316L substrates were investigated. The coating was prepared by DC magnetron sputtering. The microstructure and surface morphology of the...

  16. AAS Special Session: Policy Making in Astronomy

    Cardelli, J. A.; Massa, D.

    1995-12-01

    The professional astronomical community today is more diverse than at any time in its history. Individuals participating in creative research programs can be found in a wide range of positions. This type of diversity, which mixes research, education, and service (e.g. contract) work, represents the strength of contemporary astronomy. While recognizing the unavoidable reductions in funding and restructuring of organizations like NASA, it is imperative that the significance of the current diversity be considered during these processes. Creative ideas are one of the cornerstones of quality research, and they can originate anywhere. Consequently, it is essential that adequate research resources remain available for free and open competition by all astronomers. Our goal in this session is to bring together officials from the AAS, NASA, and the NSF to discuss how the policy and decision making process operates and whether it should be changed to better serve the general needs of the professional astronomical community. Examples of the issues we believe are important include: In establishing new policy, how can the needs of the average research astronomer be better addressed? How could input from such astronomers be provided to those who craft NASA/NSF policy? How can/should the AAS serve as an interface between policy/decision making bodies and its membership? Should the AAS membership become more actively/effectively involved in the decision making process and, if so, how? More information on this session and related issues can be found at the Association of Research Astronomers Home Page: http://www.phy.vill.edu/astro/faculty/ara/ara_home.htm

  17. Simon van der Meer in the AA Control Room

    1984-01-01

    Simon van der Meer, spiritus rector of the Antiproton Accumulator, in the AA Control Room. Inventor of stochastic cooling, on which the AA was based, and of the magnetic horn, with which the antiprotons were focused, he also wrote most of the software with which the AA was controlled, and spent uncountable numbers of hours in this chair to tickle the AA to top performance. 8 months after this picture was taken, he received, in October 1984, the Nobel prize, together with Carlo Rubbia, the moving force behind the whole Proton-Antiproton Collider project that led to the discovery, in 1983, of the W and Z intermediate bosons.

  18. Flow Injection and Atomic Absorption Spectrometry (FI-AAS) -

    Hansen, Elo Harald

    1996-01-01

    absorption spectrometry (AAS). Initially with flame-AAS (fAAS) procedures, later for hydride generation (HG) techniques, and most recently in combination with electrothermal AAS (ETAAS). The common denominator for all these procedures is the inherently precise and strictly reproducible timing in FI from the......One of the advantages of the flow injection (FI) concept is that it is compatible with virtually all detection techniques. Being a versatile vehicle for enhancing the performance of the individual detection devices, the most spectacular results have possibly been obtained in conjunction with atomic...

  19. AA, Inner Conductor of Magnetic Horn

    1979-01-01

    Antiprotons emerging at large angles from the production target (hit by an intense 26 GeV proton beam from the PS), were focused into the acceptance of the injection line of the AA by means of a "magnetic horn" (current-sheet lens). Here we see an early protype of the horn's inner conductor, machined from solid aluminium to a thickness of less than 1 mm. The 1st version had to withstand pulses of 150 kA, 15 us long, every 2.4 s. See 8801040 for a later version.

  20. Wooden Model of Wide AA Bending Magnet

    1978-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets: BLG, long and narrow; BST, short and wide). A wide one had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. A wooden model was build in 1978, to gain dimensional experience. Here, Peter Zettwoch, one of the largest men at CERN at that time, is putting a hand in the mouth of the wooden BST monster.

  1. Atlas of Vega: 3850 -- 6860 \\AA

    Kim, Hyun-Sook; Valyavin, G; Lee, Byeong-Cheol; Shimansky, V; Galazutdinov, G A

    2009-01-01

    We present a high resolving power ($\\lambda$ / $\\Delta\\lambda$ = 90,000) and high signal-to-noise ratio ($\\sim$700) spectral atlas of Vega covering the 3850 -- 6860 \\AA wavelength range. The atlas is a result of averaging of spectra recorded with the aid of the echelle spectrograph BOES fed by the 1.8-m telescope at Bohyunsan observatory (Korea). The atlas is provided only in machine-readable form (electronic data file) and will be available in the SIMBAD database upon publication.

  2. Experimental immunologically mediated aplastic anemia (AA) in mice: cyclosporin A fails to protect against AA

    Immunologically mediated aplastic anemia (AA) in mice was induced by the i.v. injection of 10(7) lymph node cells (LNC) from H-2k identical but Mls mismatched CBA/J donor mice into previously irradiated (600 rad total body gamma) C3H/HeJ mice. Cyclosporin A (CsA), 25 mg/kg, was administered subcutaneously from day -1 to day 30. Control mice included C3H/HeJ mice which received 600 rad alone, C3H/HeJ mice which received 600 rad plus CsA as above, and C3H/HeJ mice which received 600 rad total body irradiation followed by 10(7) LNC from CBA/J donors. CsA failed to prevent lethal AA. These results suggest that the pathogenetic mechanisms operating in immunologically mediated AA differ from the mechanisms operating in rodents transplanted with allogeneically mismatched marrow or spleen cells which develop graft-versus-host disease. The results are consistent with a non-T cell-dependent mechanism causing the AA

  3. Study on Fabrication of AA4032/AA6069 Cladding Billet Using Direct Chill Casting Process

    Han, Xing; Zhang, Haitao; Shao, Bo; Li, Lei; Liu, Xuan; Cui, Jianzhong

    2016-04-01

    AA4032/AA6069 cladding billet in size of φ130 mm/φ110 mm was prepared by the modified direct chill casting process, and the parametric effect on casting performance was investigated using numerical simulation. Microstructures, elements distribution, and mechanical properties of the bonding interface were examined. The results show that metallurgical bonding interface can be obtained with the optimal parameters: the casting speed of 130 to 140 mm/min, the internal liquid level height of 50 to 60 mm, and the contact height of 40 to 50 mm. The metallurgical bonding interface is free of any discontinuities due to the fact that the alloying elements diffused across the interface and formed Ni-containing phase. Tensile strength of the cladding billet reaches 225.3 MPa, and the fracture position was located in AA6069 side, suggesting that the interface bonding strength is higher than the strength of AA6069. The interfacial shearing strength is 159.3 MPa, indicating excellent metallurgical bonding.

  4. Dicty_cDB: FC-AA22 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA22 (Link to dictyBase) - - - Contig-U14948-1 FC-AA22E (Li...nk to Original site) - - - - - - FC-AA22E 576 Show FC-AA22 Library FC (Link to library) Clone ID FC-AA22 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA22Q.Seq.d/ Representative seq. ID FC-AA...22E (Link to Original site) Representative DNA sequence >FC-AA22 (FC-AA22Q) /CSM/FC/FC-AA/FC-AA22Q.Seq.d/ ATGAA...TACGATGATAGTGATTCAGACTTTTGACCAATTGAAAAAACCAGCAACAGAAATG GTACTGGTTTGGTCTCCTCCACTTTTAAGGTTGCCCCTTCCTTCTCTACCATTCAAAAAC AACAA

  5. Dicty_cDB: FC-AA15 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA15 (Link to dictyBase) - G01144 DDB0204372 Contig-U15089-1 FC-AA...15E (Link to Original site) - - - - - - FC-AA15E 522 Show FC-AA15 Library FC (Link to library) Clone ID FC-AA...9-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA15Q.Se...q.d/ Representative seq. ID FC-AA15E (Link to Original site) Representative DNA sequence >FC-AA15 (FC-AA15Q) /CSM/FC/FC-AA/FC-AA...15Q.Seq.d/ CAAATCACACATAAAAGTTTAATATAAAAATGGGTACACCAATTAAAAAGATTAGTACAG TAATTATTAAAATGGTTTCATCAGCCAA

  6. Dicty_cDB: FC-AA17 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA17 (Link to dictyBase) - - - Contig-U15091-1 FC-AA17E (Li...nk to Original site) - - - - - - FC-AA17E 347 Show FC-AA17 Library FC (Link to library) Clone ID FC-AA17 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA17Q.Seq.d/ Representative seq. ID FC-AA...17E (Link to Original site) Representative DNA sequence >FC-AA17 (FC-AA17Q) /CSM/FC/FC-AA/FC-AA17Q.Seq.d/ CCCAAAAGCCCGTAA...GACTCACTGTGTCAAGTGCAACAAACACACCCCACACAAGGTTAC CCAATACAAAGCTGGTAAACCAAGTCTTTTCGCACAAGGTAAAAGACGTTACGATCGTAA ACAA

  7. Dicty_cDB: FC-AA05 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA05 (Link to dictyBase) - G01143 DDB0190243 Contig-U15085-1 FC-AA...05E (Link to Original site) - - - - - - FC-AA05E 675 Show FC-AA05 Library FC (Link to library) Clone ID FC-AA...5-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA05Q.Se...q.d/ Representative seq. ID FC-AA05E (Link to Original site) Representative DNA sequence >FC-AA05 (FC-AA05Q) /CSM/FC/FC-AA/FC-AA...05Q.Seq.d/ AAACAAAAAAAAAAGGTATGGAAATTTTTGCATTTGTACCATTAGCAGTGTTAACAGCAT TATGTGTTGTTATTTCACTCTTTGTTAAAAGAGAGAAA

  8. Dicty_cDB: FCL-AA23 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA23 (Link to dictyBase) - G01759 DDB0201558 Contig-U15118-1 FCL-AA...23E (Link to Original site) - - - - - - FCL-AA23E 1045 Show FCL-AA23 Library FCL (Link to library) Clone ID FCL-AA...ig-U15118-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...23Q.Seq.d/ Representative seq. ID FCL-AA23E (Link to Original site) Representative DNA sequence >FCL-AA23 (FCL-AA...23Q) /CSM/FCL/FCL-AA/FCL-AA23Q.Seq.d/ ATAACTATATAACTATGTCTAACCAAAAGAAAAACGACGTATCTTCATTTGTTAAAGATT CTTTAA

  9. Dicty_cDB: FC-AA21 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA21 (Link to dictyBase) - - - Contig-U15450-1 FC-AA21E (Li...nk to Original site) - - - - - - FC-AA21E 839 Show FC-AA21 Library FC (Link to library) Clone ID FC-AA21 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA21Q.Seq.d/ Representative seq. ID FC-AA...21E (Link to Original site) Representative DNA sequence >FC-AA21 (FC-AA21Q) /CSM/FC/FC-AA/FC-AA21Q.Seq.d/ AATTATTTTCATTAA...TTTTAGCTTTATTCCTTGTCAACTCCGCTGTTGTCTCTTCACTCG ACTCATGTAGTATTTGTGTTGATTTTGTTGGTAACTCACTCAATGATCTTTTAAATATTA TCCTTAA

  10. Dicty_cDB: FCL-AA22 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA22 (Link to dictyBase) - G01758 DDB0229949 Contig-U15119-1 FCL-AA...22E (Link to Original site) - - - - - - FCL-AA22E 840 Show FCL-AA22 Library FCL (Link to library) Clone ID FCL-AA...g-U15119-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...22Q.Seq.d/ Representative seq. ID FCL-AA22E (Link to Original site) Representative DNA sequence >FCL-AA22 (FCL-AA...22Q) /CSM/FCL/FCL-AA/FCL-AA22Q.Seq.d/ AAAATGAGCAAAATCTCAAGCGACCAAGTTAGATCAATCGTCTCCCAACTTTTCAAAGAA GCACAAGAATCCAAAA

  11. Dicty_cDB: FCL-AA06 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA06 (Link to dictyBase) - G24322 DDB0216974 Contig-U15228-1 FCL-AA...06E (Link to Original site) - - - - - - FCL-AA06E 791 Show FCL-AA06 Library FCL (Link to library) Clone ID FCL-AA...g-U15228-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...06Q.Seq.d/ Representative seq. ID FCL-AA06E (Link to Original site) Representative DNA sequence >FCL-AA06 (FCL-AA...06Q) /CSM/FCL/FCL-AA/FCL-AA06Q.Seq.d/ AAAATCCCAATTTCATTAGCAGTGGAAGTAACGGAATGAATTGGGGTGGTTCTTTGAACA CTTGTGACTCTGGAGGATTCAA

  12. Dicty_cDB: FCL-AA18 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA18 (Link to dictyBase) - G24323 DDB0191144 Contig-U15229-1 FCL-AA...18Z (Link to Original site) - - FCL-AA18Z 623 - - - - Show FCL-AA18 Library FCL (Link to library) Clone ID FCL-AA...g-U15229-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...18Q.Seq.d/ Representative seq. ID FCL-AA18Z (Link to Original site) Representative DNA sequence >FCL-AA18 (FCL-AA...18Q) /CSM/FCL/FCL-AA/FCL-AA18Q.Seq.d/ XXXXXXXXXXGTCAATGTCATTATTGGTGAACAATCTGATGGTTCGTTGGAACAAATCGC TAGAAATCCACAACCAA

  13. Dicty_cDB: FC-AA16 [Dicty_cDB

    Full Text Available FC (Link to library) FC-AA16 (Link to dictyBase) - G22556 DDB0204121 Contig-U15090-1 FC-AA...16E (Link to Original site) - - - - - - FC-AA16E 933 Show FC-AA16 Library FC (Link to library) Clone ID FC-AA...0-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA16Q.Se...q.d/ Representative seq. ID FC-AA16E (Link to Original site) Representative DNA sequence >FC-AA16 (FC-AA16Q) /CSM/FC/FC-AA/FC-AA...16Q.Seq.d/ GGGCAGGATCATCATTTAATACTAAAGATTCAACAATAATTGCAAAAACTCAATTTTATC AAAAAAATATTCAAATTTATAAAGGTGATCAA

  14. Evolution of geomagnetic aa index near sunspot minimum

    R. P. Kane

    Full Text Available The smoothed values of the minima of sunspot number Rz and the geomagnetic index aa were compared for sunspot cycles 12–23. In one cycle, aa(min occurred earlier than Rz(min, but remained at that low from a few months before Rz(min to a few months after Rz(min. In two cycles, Rz(min and aa(min coincided within a month or two. In nine cycles, aa(min occurred more than three months later than Rz(min. The aa(min coincided with the minima of some solar radio emission indices originating in the solar corona. For sunspot cycles 21, 22, 23, the minimum of solar wind velocity V occurred 0–9 months later than the aa(min. The minimum of solar wind total magnetic field B occurred near Rz(min. The solar wind ion density N had maxima (instead of minima near Rz(min, and again near Rz(max, indicating a  ~5-year periodicity, instead of an 11-year periodicity. The maxima of aa, V and B occurred near Rz(max and/or later in the declining phase of Rz. The aa index was very well correlated with the functions BV and BV 2.Key words. Geomagnetism and paleomagnetism (time variations, diurnal to secular – time variations, secular and long term Interplanetary physics (interplanetary magnetic field

  15. Poly(2,5-bis(N-Methyl-N-HexylaminoPhenylene Vinylene (BAM-PPV as Pretreatment Coating for Aerospace Applications: Laboratory and Field Studies

    Peter Zarras

    2014-12-01

    Full Text Available In this study, an electroactive polymer (EAP, poly(2,5-bis(N-methyl-N-hexylaminophenylene vinylene (BAM-PPV was investigated as a potential alternative surface pretreatment for hexavalent chromium (Cr(VI-based aerospace coatings. BAM-PPV was tested as a pretreatment coating on an aerospace aluminum alloy (AA2024-T3 substrate in combination with a non-Cr(VI epoxy primer and a polyurethane Advanced Performance Coating (APC topcoat. This testing was undertaken to determine BAM-PPV’s adhesion, corrosion-inhibition, compatibility and survivability in laboratory testing and during outdoor field-testing. BAM-PPV showed excellent adhesion and acceptable corrosion performance in laboratory testing. The BAM-PPV aerospace coating system (BAM-PPV, non-Cr(VI epoxy primer and polyurethane APC topcoat was field tested for one year on the rear hatch door of the United States Air Force C-5 cargo plane. After one year of field testing there was no evidence of delamination or corrosion of the BAM-PPV aerospace coating system.

  16. A Nacreous Self-Assembled Nanolaminate for Corrosion Resistance on 2024-Al Alloy

    Gordon, Matthew

    2001-01-01

    Nanometer thick layers of clay and polymer were formed on mica, silicon, and aluminum 2024-T3 alloy using alternating solutions of positively and negatively charged polymer and clay, respectively. Atomic force microscopy was used to observe the morphology of the composite films on mica and silicon. It was found that solution concentrations of clay above 0.02 weight percent lead to the uncontrolled deposition of clay platelets on the substrateâ s surface. By using solution concentrations o...

  17. Failure analysis of fusion clad alloy system AA3003/AA6xxx sheet under bending

    Shi, Y., E-mail: shiyh@mcmaster.ca [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada); Jin, H. [Novelis Global Technology Center, P.O. Box 8400, Kingston, Ontario, Canada K7L 5L9 (Canada); Wu, P.D. [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada); Lloyd, D.J. [Aluminum Materials Consultants, 106 Nicholsons Point Road, Bath, Ontario, Canada K0H 1G0 (Canada); Embury, D. [Department of Mechanical Engineering, McMaster University, 1280 Main Street West, Hamilton, Ontario, Canada L8S 4L7 (Canada)

    2014-07-29

    An ingot of AA6xxx Al–Si–Mg–Cu alloy clad with AA3003 Al–Mn alloy was co-cast by Fusion technology. Bending tests and numerical modeling were performed to investigate the potential for sub-surface cracking for this laminate system. To simulate particle-induced crack initiation and growth, both random and stringer particles have been selected to mimic the particle distribution in the tested samples. The morphology of cracking in the model was similar to that observed in clad sheet tested in the Cantilever bend test. The crack initiated in the core close to the clad-core interface where the strain in the core is highest, between particles or near particles and propagates along local shear bands in the core, while the clad layer experiences extreme thinning before failure.

  18. AA, shims and washers on quadrupole ends

    CERN PhotoLab

    1981-01-01

    Due to the fact that much of the field of the quadrupoles was outside the iron (in particular with the wide quadrupoles) and that thus the fields of quadrupoles and bending magnets interacted, the lattice properties of the AA could not be predicted with the required accuracy. After a first running period in 1980, during which detailed measurements were made with proton test beams, corrections to the quadrupoles were made in 1981, in the form of laminated shims at the ends of the poles, and with steel washers. With the latter ones, further refinements were made in an iterative procedure with measurements on the circulating beam. This eventually resulted, amongst other things, in a very low chromaticity, with the Q-values being constant to within +- 0.001 over the total momentum range of 6 %. Here we see the shims and washers on a narrow qudrupole (QFN, QDN). See also 8103203, 8103204, 8103205, 8103206.

  19. Chromium-free conversion coatings based on inorganic salts (Zr/Ti/Mn/Mo) for aluminum alloys used in aircraft applications

    Santa Coloma, P.; Izagirre, U.; Belaustegi, Y.; Jorcin, J. B.; Cano, F. J.; Lapeña, N.

    2015-08-01

    Novel chromium-free conversion coatings based on Zr/Ti/Mn/Mo compounds were developed at a pilot scale to improve the corrosion resistance of the AA2024-T3 and AA7075-T6 aluminum alloys for aircraft applications. The influence of the presence of Zr and Ti in the Zr/Ti/Mn/Mo conversion bath's formulation on the corrosion resistance of the coated alloys was investigated. The corrosion resistance provided by the conversion coatings was evaluated by salt spray exposure and potentiodynamic sweeps. Optical and scanning electron microscopy coupled with energy dispersive spectroscopy (SEM/EDS) and atomic force microscopy (AFM) operating in the Kelvin Probe mode (SKPFM) were used to provide microstructural information of the coated samples that achieved the best results in the corrosion tests. The salt spray test evidenced the higher corrosion resistance of the coated samples compared to the bare surfaces for both alloys. The potentiodynamic tests showed that the corrosion current density decreased for coated AA7075-T6 and AA2024-T3 alloys, which indicated an obvious improvement of the corrosion resistance with all the processes for both alloys. Although the corrosion resistance of the coated samples appeared to be higher for the alloy AA7075-T6 than for the alloy AA2024-T3, both alloys achieved the best corrosion protection with the coatings deposited from conversion bath formulations containing no titanium salts. The microscopy analysis on the coated AA7075-T6 samples revealed that a local deposition of Zr compounds and, possibly, an oxidation process occurred in the vicinity of the alloy's intermetallic particles. The amount of the Zr deposits at these locations increased with coating's formulations without Ti, which provided the best corrosion resistance. The Cr-free conversion coatings developed in this study for the AA7075-T6 and AA2024-T3 alloys do not meet yet the strict requirements of the aircraft industry. However, they significantly improved the corrosion

  20. Chromium-free conversion coatings based on inorganic salts (Zr/Ti/Mn/Mo) for aluminum alloys used in aircraft applications

    Santa Coloma, P., E-mail: patricia.santacoloma@tecnalia.com [TECNALIA Research & Innovation, Parque Tecnológico de San Sebastián, Mikeletegi Pasealekua 2, E-20009 Donostia-San Sebastián, Gipuzkoa (Spain); Izagirre, U.; Belaustegi, Y.; Jorcin, J.B.; Cano, F.J. [TECNALIA Research & Innovation, Parque Tecnológico de San Sebastián, Mikeletegi Pasealekua 2, E-20009 Donostia-San Sebastián, Gipuzkoa (Spain); Lapeña, N. [Boeing Research & Technology Europe, S.L.U., Avenida Sur del Aeropuerto de Barajas 38, Building 4 – 3rd Floor, E-28042 Madrid (Spain)

    2015-08-01

    Highlights: • Chromium-free conversion coatings for corrosion protection of aluminum alloys. • Salt spray and potentiodynamic sweep tests to study the corrosion behavior. • Local deposits on Cu-rich intermetallic particles enhanced corrosion resistance. • Surface characterization to relate bath's composition and corrosion resistance. • Best corrosion protection with conversion baths without titanium salts. - Abstract: Novel chromium-free conversion coatings based on Zr/Ti/Mn/Mo compounds were developed at a pilot scale to improve the corrosion resistance of the AA2024-T3 and AA7075-T6 aluminum alloys for aircraft applications. The influence of the presence of Zr and Ti in the Zr/Ti/Mn/Mo conversion bath's formulation on the corrosion resistance of the coated alloys was investigated. The corrosion resistance provided by the conversion coatings was evaluated by salt spray exposure and potentiodynamic sweeps. Optical and scanning electron microscopy coupled with energy dispersive spectroscopy (SEM/EDS) and atomic force microscopy (AFM) operating in the Kelvin Probe mode (SKPFM) were used to provide microstructural information of the coated samples that achieved the best results in the corrosion tests. The salt spray test evidenced the higher corrosion resistance of the coated samples compared to the bare surfaces for both alloys. The potentiodynamic tests showed that the corrosion current density decreased for coated AA7075-T6 and AA2024-T3 alloys, which indicated an obvious improvement of the corrosion resistance with all the processes for both alloys. Although the corrosion resistance of the coated samples appeared to be higher for the alloy AA7075-T6 than for the alloy AA2024-T3, both alloys achieved the best corrosion protection with the coatings deposited from conversion bath formulations containing no titanium salts. The microscopy analysis on the coated AA7075-T6 samples revealed that a local deposition of Zr compounds and, possibly, an

  1. Chromium-free conversion coatings based on inorganic salts (Zr/Ti/Mn/Mo) for aluminum alloys used in aircraft applications

    Highlights: • Chromium-free conversion coatings for corrosion protection of aluminum alloys. • Salt spray and potentiodynamic sweep tests to study the corrosion behavior. • Local deposits on Cu-rich intermetallic particles enhanced corrosion resistance. • Surface characterization to relate bath's composition and corrosion resistance. • Best corrosion protection with conversion baths without titanium salts. - Abstract: Novel chromium-free conversion coatings based on Zr/Ti/Mn/Mo compounds were developed at a pilot scale to improve the corrosion resistance of the AA2024-T3 and AA7075-T6 aluminum alloys for aircraft applications. The influence of the presence of Zr and Ti in the Zr/Ti/Mn/Mo conversion bath's formulation on the corrosion resistance of the coated alloys was investigated. The corrosion resistance provided by the conversion coatings was evaluated by salt spray exposure and potentiodynamic sweeps. Optical and scanning electron microscopy coupled with energy dispersive spectroscopy (SEM/EDS) and atomic force microscopy (AFM) operating in the Kelvin Probe mode (SKPFM) were used to provide microstructural information of the coated samples that achieved the best results in the corrosion tests. The salt spray test evidenced the higher corrosion resistance of the coated samples compared to the bare surfaces for both alloys. The potentiodynamic tests showed that the corrosion current density decreased for coated AA7075-T6 and AA2024-T3 alloys, which indicated an obvious improvement of the corrosion resistance with all the processes for both alloys. Although the corrosion resistance of the coated samples appeared to be higher for the alloy AA7075-T6 than for the alloy AA2024-T3, both alloys achieved the best corrosion protection with the coatings deposited from conversion bath formulations containing no titanium salts. The microscopy analysis on the coated AA7075-T6 samples revealed that a local deposition of Zr compounds and, possibly, an

  2. Electrochemical characterisation of aluminium AA7075-T6 and solution heat treated AA7075 using a micro-capillary cell

    Localised corrosion of 7xxx aluminium alloys initiates at cathodic intermetallics containing Cu and Fe due to a strong galvanic coupling with the matrix. In order to study this galvanic coupling, the electrochemical behaviour of AA7075-T6 and solution heat treated AA7075 has been investigated by means of complementary techniques: micro-capillary cell, scanning Kelvin probe force microscopy (SKPFM) and scanning electron microscopy (SEM). Characterisation with the micro-capillary cell showed that the intermetallics cause a more cathodic breakdown potential in the solution heat treated AA7075 compared with the AA7075-T6. This is associated with a higher Volta potential difference between the intermetallics and the matrix in the solution heat treated AA7075, indicating a stronger galvanic coupling for this temper. From these results, it is concluded that the breakdown potential of areas containing the intermetallics is related to the Volta potential difference between the intermetallics and the matrix

  3. Robust plasmonic substrates

    Kostiučenko, Oksana; Fiutowski, Jacek; Tamulevicius, Tomas; Tamulevicius, Sigitas; Silbernagl, Dorothee; Sturm, Heinz; Rubahn, Horst-Günter

    2014-01-01

    Robustness is a key issue for the applications of plasmonic substrates such as tip-enhanced Raman spectroscopy, surface-enhanced spectroscopies, enhanced optical biosensing, optical and optoelectronic plasmonic nanosensors and others. A novel approach for the fabrication of robust plasmonic...... considered robust plasmonic substrates, nanoindentation and wear resistance experiments as well as ablation experiment were performed. The mechanical properties of the layered substrates are tested via atomic force microscopy, evaluating spatially resolved threshold loads both for plastic deformation and...... breaking. DLC coating with thicknesses between 25 and 105 nm is found to considerably increase the mechanical strength of the substrates while at the same time ensuring conservation of sufficient field enhancements of the gold plasmonic substrates....

  4. Dicty_cDB: FCL-AA17 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA17 (Link to dictyBase) - G03264 DDB0191099 Contig-U15602-1 FCL-AA...17P (Link to Original site) FCL-AA17F 547 FCL-AA17Z 610 FCL-AA17P 1157 - - Show FCL-AA17 Library F...CL (Link to library) Clone ID FCL-AA17 (Link to dictyBase) Atlas ID - NBRP ID G03264 dictyBase ID DDB0191099... Link to Contig Contig-U15602-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA17Q.Seq.d/ Representative seq. ID FCL-AA17P (Link to Original site) Representative DNA sequence >FCL-AA

  5. Dicty_cDB: FCL-AA14 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA14 (Link to dictyBase) - G03263 DDB0218474 Contig-U16035-1 FCL-AA...14P (Link to Original site) FCL-AA14F 647 FCL-AA14Z 550 FCL-AA14P 1197 - - Show FCL-AA14 Library F...CL (Link to library) Clone ID FCL-AA14 (Link to dictyBase) Atlas ID - NBRP ID G03263 dictyBase ID DDB0218474... Link to Contig Contig-U16035-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA14Q.Seq.d/ Representative seq. ID FCL-AA14P (Link to Original site) Representative DNA sequence >FCL-AA

  6. Dicty_cDB: FCL-AA19 [Dicty_cDB

    Full Text Available FCL (Link to library) FCL-AA19 (Link to dictyBase) - G01757 DDB0230128 Contig-U16036-1 FCL-AA...19P (Link to Original site) FCL-AA19F 246 FCL-AA19Z 568 FCL-AA19P 814 - - Show FCL-AA19 Library FC...L (Link to library) Clone ID FCL-AA19 (Link to dictyBase) Atlas ID - NBRP ID G01757 dictyBase ID DDB0230128 ...Link to Contig Contig-U16036-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...19Q.Seq.d/ Representative seq. ID FCL-AA19P (Link to Original site) Representative DNA sequence >FCL-AA

  7. Enhancement of wear and ballistic resistance of armour grade AA7075 aluminium alloy using friction stir processing

    I. SUDHAKAR; V. MADHU; G. MADHUSUDHAN REDDY; K. SRINIVASA RAO

    2015-01-01

    Industrial applications of aluminium and its alloys are restricted because of their poor tribological properties. Thermal spraying, laser surfacing, electron beam welding are the most widely used techniques to alter the surface morphology of base metal. Preliminary studies reveal that the coating and layering of aluminium alloys with ceramic particles enhance the ballistic resistance. Furthermore, among aluminium alloys, 7075 aluminium alloy exhibits high strength which can be compared to that of steels and has profound applications in the designing of lightweight fortification structures and integrated protection systems. Having limitations such as poor bond integrity, formation of detrimental phases and interfacial reaction between reinforcement and substrate using fusion route to deposit hard particles paves the way to adopt friction stir processing for fabricating surface composites using different sizes of boron carbide particles as reinforcement on armour grade 7075 aluminium alloy as matrix in the present investigation. Wear and ballistic tests were carried out to assess the performance of friction stir processed AA7075 alloy. Significant improvement in wear resistance of friction stir processed surface composites is attributed to the change in wear mechanism from abrasion to adhesion. It has also been observed that the surface metal matrix composites have shown better ballistic resistance compared to the substrate AA7075 alloy. Addition of solid lubricant MoS2 has reduced the depth of penetration of the projectile to half that of base metal AA7075 alloy. For the first time, the friction stir processing technique was successfully used to improve the wear and ballistic resistances of armour grade high strength AA7075 alloy.

  8. Enhancement of wear and ballistic resistance of armour grade AA7075 aluminium alloy using friction stir processing

    I. Sudhakar

    2015-03-01

    Full Text Available Industrial applications of aluminium and its alloys are restricted because of their poor tribological properties. Thermal spraying, laser surfacing, electron beam welding are the most widely used techniques to alter the surface morphology of base metal. Preliminary studies reveal that the coating and layering of aluminium alloys with ceramic particles enhance the ballistic resistance. Furthermore, among aluminium alloys, 7075 aluminium alloy exhibits high strength which can be compared to that of steels and has profound applications in the designing of lightweight fortification structures and integrated protection systems. Having limitations such as poor bond integrity, formation of detrimental phases and interfacial reaction between reinforcement and substrate using fusion route to deposit hard particles paves the way to adopt friction stir processing for fabricating surface composites using different sizes of boron carbide particles as reinforcement on armour grade 7075 aluminium alloy as matrix in the present investigation. Wear and ballistic tests were carried out to assess the performance of friction stir processed AA7075 alloy. Significant improvement in wear resistance of friction stir processed surface composites is attributed to the change in wear mechanism from abrasion to adhesion. It has also been observed that the surface metal matrix composites have shown better ballistic resistance compared to the substrate AA7075 alloy. Addition of solid lubricant MoS2 has reduced the depth of penetration of the projectile to half that of base metal AA7075 alloy. For the first time, the friction stir processing technique was successfully used to improve the wear and ballistic resistances of armour grade high strength AA7075 alloy.

  9. Corrosion issues of powder coated AA6060 aluminium profiles

    Din, Rameez Ud; Valgarðsson, Smári; Jellesen, Morten Stendahl;

    2015-01-01

    In this study detailed microstructural investigation of the reason for unexpected corrosion of powder coated aluminium alloy AA6060 windows profiles has been performed. The results from this study reveals that the failure of the window profiles was originated from the surface defects present...... on the extruded AA6060 aluminium profile after metallurgical process prior to powder coating. Surface defects are produced due to intermetallic particles in the alloy, which disturb the flow during the extrusion process. The corrosion mechanism leading to the failure of the powder coated AA6060 aluminium profiles...

  10. The A&A Experience With Impact Factors

    Sandqvist, A

    2004-01-01

    There is a widespread impression that the scientific journal "Astronomy & Astrophysics" (A&A) has a smaller impact, as measured by citations to articles, than some of the other major astronomy journals. This impression was apparently supported - and probably created - by the Journal Citation Report (JCR), which is prepared annually by the Institute of Scientific Information (ISI) Web of Knowledge. The published poor impact factor of A&A was in fact wrong and was due to a serious flaw in the method used by ISI Web of Knowledge to determine it. The resulting damage inflicted upon A&A by the JCR is incalculable.

  11. NCBI nr-aa BLAST: CBRC-RNOR-15-0027 [SEVENS

    Full Text Available CBRC-RNOR-15-0027 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 2e-30 98% ...

  12. NCBI nr-aa BLAST: CBRC-AGAM-07-0022 [SEVENS

    Full Text Available CBRC-AGAM-07-0022 ref|ZP_01789747.1| hypothetical protein CGSHiAA_08330 [Haemophilus influenza...e PittAA] gb|EDK08473.1| hypothetical protein CGSHiAA_08330 [Haemophilus influenzae PittAA] ZP_01789747.1 2e-14 23% ...

  13. NCBI nr-aa BLAST: CBRC-HSAP-02-0031 [SEVENS

    Full Text Available CBRC-HSAP-02-0031 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 6e-09 52% ...

  14. NCBI nr-aa BLAST: CBRC-OLAT-13-0071 [SEVENS

    Full Text Available CBRC-OLAT-13-0071 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 0.14 37% ...

  15. NCBI nr-aa BLAST: CBRC-PTRO-02-0026 [SEVENS

    Full Text Available CBRC-PTRO-02-0026 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-09 50% ...

  16. NCBI nr-aa BLAST: CBRC-HSAP-02-0029 [SEVENS

    Full Text Available CBRC-HSAP-02-0029 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 5e-11 48% ...

  17. NCBI nr-aa BLAST: CBRC-RNOR-08-0315 [SEVENS

    Full Text Available CBRC-RNOR-08-0315 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-25 73% ...

  18. NCBI nr-aa BLAST: CBRC-GGAL-35-0091 [SEVENS

    Full Text Available CBRC-GGAL-35-0091 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 2e-08 34% ...

  19. NCBI nr-aa BLAST: CBRC-PTRO-27-0055 [SEVENS

    Full Text Available CBRC-PTRO-27-0055 ref|ZP_01791635.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenza...e PittAA] gb|EDK06802.1| hypothetical protein CGSHiAA_09967 [Haemophilus influenzae PittAA] ZP_01791635.1 8e-09 53% ...

  20. NCBI nr-aa BLAST: CBRC-ACAR-01-0367 [SEVENS

    Full Text Available CBRC-ACAR-01-0367 ref|ZP_01790024.1| hypothetical protein CGSHiAA_05974 [Haemophilus influenza...e PittAA] gb|EDK08288.1| hypothetical protein CGSHiAA_05974 [Haemophilus influenzae PittAA] ZP_01790024.1 4.0 29% ...

  1. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Gueutin, Victor; Langlois, Anne-Lyse; Shehwaro, Nathalie; Elharraqui, Ryme; Rouvier, Philippe; Izzedine, Hassane

    2013-01-01

    Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported. PMID:24558629

  2. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Victor Gueutin; Anne-Lyse Langlois; Nathalie Shehwaro; Ryme Elharraqui; Philippe Rouvier; Hassane Izzedine

    2013-01-01

    Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported.

  3. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Victor Gueutin

    2013-01-01

    Full Text Available Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported.

  4. Lightweight Substrates For Mirrors

    Brown, D. Kyle

    1991-01-01

    New substrate uses conventional quasi-isotropic fabric laminate with surfacing layer of carbon-fiber paper consisting of randomly oriented chopped carbon fibers. Layered structure of fabric and paper relatively easy to manufacture. When impregnated with carbon, structure rigid and stable. Substrates of this type made quite thin, thus keeping areal weights to minimum. Mirrors of this type made faster, and cost less, than predecessors.

  5. AAS Committee on Employment Panel Introduction

    Borne, Kirk; Fanelli, M. N.; Storrie-Lombardi, L. J.; Krishnamurthi, A.

    2006-12-01

    Many younger astronomers are unaware of the dangers and pitfalls that await them in the job market. Issues related to fringe benefits (if any), moving expenses, medical coverage for family members, teaching versus research expectations, etc. can lead to misunderstandings and to serious difficulties if these are not addressed early in the job interview process. The AAS Committee on Employment has often received letters from concerned junior members of the society, who feel that they needed more guidance and assistance in entering the job market for the first time. The major areas of concern have included those just listed, but there may be others. The session is structured as a panel presentation, whose members are asked to prepare in advance their top 10 questions that job applicants should ask, and we will instruct our panel members not to discuss their list at all with the other panel members prior to their presentations. This will ensure independent viewpoints and novel responses. The panel will consist of astronomers who have different perspectives on this issue, including old and young, postdoc and beyond, academic and non-academic. To kick off the session, we will invite a brief humorous presentation of the Top Ten List, in the style of The Night Show host David Letterman.

  6. Outcomes From AAS Hack Day at the 227th AAS Meeting

    Kohler, Susanna

    2016-01-01

    Editors Note:This is a final post from the 227th AAS Meeting in Kissimmee, FL. This special summary of AAS Hack Day, a meeting of AAS members to collaboratively work on various small projects, was written by Meredith Rawls (@Merrdiff) and was originally posted on astrobites.com.As the 227thAmerican Astronomical Society meeting drew to a close (see highlights from Day 1, Day 2, Day 3, and Day 4), a group of at least 50 attendees spent Day 4working on small projects fondly called hacks. Thanks to sponsorship from LSST and Northrup Grumman, the industrious hackers werewell-caffeinated and fed so we could devote time and energy toworking in groups on one-day projects.TheHack Day beganat 10am with pitches. Anybody with a project idea was welcome to briefly speak and try to convince others to work with them. Only someideas panned out, but the enthusiasm was palpable. Its not every day you get a full room of astronomers and affiliates eager to spend hours working on fun and useful projects to benefit the community.#hackAAS is getting underway! #aas227 pic.twitter.com/yX7jlOnSCK James R A Davenport (@jradavenport) January 8, 2016Here is a rundown of what we accomplished. Pretty impressive for a single day! Many thanks to fellow astrobiter Erika Nesvold (now at Carnegie DTM; @erikanesvold) whose hack was live-documenting all the other hacks. Her tweets as @astrobites appeared with the #hackaas hashtag, and her notes made this recap post infinitely easier to write.Interested in joining the fun? Sign up for Hack Day at the 2017 JanuaryAAS meeting (its free with meeting registration), and consider applying for the .Astronomy conference this summer.Towards Optimal Session Scheduling:Adrian Price-Whelan (Columbia), David Hogg (NYU), and Scott Idem (AAS) began writing a program to take all submitted abstracts to a conference like AAS and sort them using keywords to avoid scheduling similar talks in parallel sessions. Its impossible to make everyone happy, but minimizing conflicts

  7. Astronomy Career Profiles from the AAS Newsletter Archives

    Metcalfe, Travis; Belkora, Leila; McDaid, Liam; Bullock, Blake; Pulliam, Christine; Williams, Peter; Roth, Joshua; Whitney, Barb; Olsen, Knut; Howell, Andy; Keller, Luke

    2011-01-01

    This is a collection of articles that were originally published in the Newsletter of the American Astronomical Society (AAS) between May 2008 and September 2011 by the Committee on Employment. Authors representing a wide range of career paths tell their stories and provide insight and advice that is relevant to success in various job sectors. Although all of these articles are available individually from the AAS archives, we are posting the complete collection here to make them more accessibl...

  8. Systemic AA amyloidosis induced by liver cell adenoma.

    Fievet, P; Sevestre, H; Boudjelal, M; Noel, L H; Kemeny, F; D. Franco; Delamarre, J; Capron, J.P.

    1990-01-01

    Systemic AA amyloidosis is a rare complication of benign tumours. This report describes a patient with hepatocellular adenoma associated with reactive AA amyloidosis. He had a nephrotic syndrome with deteriorating renal function and an increase of serum concentrations of acute phase proteins, mainly C-reactive protein. Resection of the tumour was followed by improvement in renal function and a marked decrease of the serum concentrations of acute phase proteins.

  9. AA amyloidosis as a complication of primary lymphedema.

    Beloncle, François; Sayegh, Johnny; Eymerit-Morin, Caroline; Duveau, Agnès; Augusto, Jean-François

    2014-03-01

    Primary lymphedema is a rare disease caused by a disorder of lymphangiogenesis. Clinical presentation and age at onset are variable. AA amyloidosis is usually due to chronic inflammatory diseases, malignant tumors or less frequently chronic infectious diseases. We report here the first two cases of AA amyloidosis present with renal failure and nephrotic syndrome in patients with primary lymphedema-induced chronic leg ulcers. The first patient was a 62-year-old female who presented with chronic untreated leg ulcers for 8 years secondary to primary lymphedema. A kidney biopsy done for nephrotic syndrome allowed the diagnosis of AA amyloidosis. The second patient was a 54-year-old male who presented with hereditary lymphedema and elephantiasis since the age of 12. A salivary gland biopsy allowed the diagnosis of AA amyloidosis. Renal function deteriorated progressively needing chronic haemodialysis. Chronic leg ulcers have been rarely reported to induce AA amyloidosis. Only five other cases have been reported in the literature, but none of them with chronic lymphedema. We believe that the relation between lymphedema, chronic leg ulcers and AA amyloidosis is underestimated. PMID:23964754

  10. The OIV 1407.3\\AA /1401.1\\AA\\ emission-line ratio in a plasma

    Nessib, Nabil Ben; Qindeel, Rabia; Sahal-Bréchot, Sylvie; Dimitrijević, Milan S

    2013-01-01

    Line ratio of O IV 1407.3 \\AA/1401.1 \\AA\\- is calculated using mostly our own atomic and collisional data. Energy levels and oscillator strengths needed for this calculation have been calculated using a Hartree-Fock relativistic (HFR) approach. The electron collision strengths introduced in the statistic equilibrium equations are fitted by Line ratio of O IV 1407.3 \\AA/1401.1 \\AA\\- is calculated using mostly our own atomic and collisional data. Energy levels and oscillator strengths needed for this calculation have been calculated using a Hartree-Fock relativistic (HFR) approach. The electron collision strengths introduced in the statistic equilibrium equations are fitted by polynomials for different energies. Comparison has also been made with available theoretical results. The provided line ratio has been obtained for a set of electron densities from $10^{8}$ cm$^{-3}$ to $10^{13}$ cm$^{-3}$ and for a fixed temperature of 50 000 K.

  11. Carbon Nanotube Addition to Simultaneously Enhance Strength and Ductility of Hybrid AZ31/AA5083 Alloy

    Muralidharan Paramsothy; Manoj Gupta; Jimmy Chan; Richard Kwok

    2011-01-01

    AZ31/AA5083 hybrid alloy nanocomposite containing CNT nanoparticle reinforcement was fabricated using solidification processing followed by hot extrusion. The AZ31/AA5083 hybrid alloy nanocomposite exhibited similar grain size to monolithic AZ31/AA5083 hybrid alloy, reasonable CNT nanoparticle distribution, non-dominant (0 0 0 2) texture in the longitudinal direction, and 20% higher hardness than monolithic AZ31/AA5083 hybrid alloy. Compared to monolithic AZ31/AA5083 hybrid alloy (in tension)...

  12. Preparation of Substrate for Flavorant from Chicken Bone Residue with Hot-Pressure Process.

    Wang, Jin-Zhi; Dong, Xian-Bing; Yue, Jian-Ying; Zhang, Chun-Hui; Jia, Wei; Li, Xia

    2016-03-01

    Hot-pressure extraction (HPE), which is regarded as a "green" technology, was applied to extract nutrients (protein, collagen, and minerals) from chicken bone residue (CBR). Amino acids (AA), color, and volatile flavor compounds of chicken bone extract (CBE) were also investigated. Results showed that contents of protein, total soluble solids, minerals, and collagen of CBE were positively correlated with extraction time and temperature. High ratios of protein (83.51%) and collagen (96.81%) were obtained with 135 °C and 120 min. Essential AA accounted for 31.03% to 47.73% of total AA in CBE. The percentage of bitter AA in TAA decreased from 28.94% to 25.02% at 0 min to 20.19% and 21.41% at 120 min, although fresh AA increased from 46.35% to 50.84% (0 min) to 53.14% (120 min) at 130 and 135 °C, respectively, indicating CBE was nutritionally beneficial with good flavor. Color and volatile flavor of CBE improved significantly after extraction, although calcium in CBE (4.2 to 4.8 mg/100 g) was relatively low compared with that of CBR (1078 mg/100 g). It can be concluded that HPE is a promising way to transform CBR into a nutritious flavorant substrate, but it is not an efficient way to extract calcium. PMID:26809140

  13. The OIV 1407.3\\AA /1401.1\\AA\\ emission-line ratio in a plasma

    Nessib, Nabil Ben; Alonizan, Norah; Qindeel, Rabia; Sahal-Bréchot, Sylvie; Dimitrijević, Milan S

    2013-01-01

    Line ratio of O IV 1407.3 \\AA/1401.1 \\AA\\- is calculated using mostly our own atomic and collisional data. Energy levels and oscillator strengths needed for this calculation have been calculated using a Hartree-Fock relativistic (HFR) approach. The electron collision strengths introduced in the statistic equilibrium equations are fitted by polynomials for different energies. Comparison has also been made with available theoretical results. The provided line ratio has been obtained for a set o...

  14. Triazole and thiazole derivatives as corrosion inhibitors for AA2024 aluminium alloy

    The 1,2,4-triazole, 3-amino-1,2,4-triazole, benzotriazole and 2-mercaptobenzothiazole were evaluated in the present work as corrosion inhibitors for protection of the 2024 aluminium alloy in neutral chloride solutions. The corrosion protection performance was investigated by means of DC polarization and electrochemical impedance spectroscopy (EIS). Scanning Kelvin probe force microscopy (SKPFM) and atomic force microscopy (AFM) were used to study the evolution of the Volta potential distribution and the surface topography during corrosion tests. The results show that all inhibitors under study confer corrosion protection to the AA2024 alloy forming a thin organic layer on the substrate surface. Benzotriazole and 2-mercaptobenzothiazole offer better corrosion protection in comparison with the other two. The inhibitors studied act decreasing the rate of both the anodic and cathodic processes. In the latter case the dealloying of the copper-reach particles is hindered, slowing down the oxygen reduction

  15. Rupture locations of friction stir welded joints of AA2017-T351 and AA6061-T6 aluminum alloys

    LIU Hui-jie; FENG Ji-cai; H. Fujii; M. Maeda; K. Nogi

    2005-01-01

    The tensile rupture locations of friction stir welded joints of AA2017-T351 and AA6061-T6 aluminum alloys were examined. The experiments show that the rupture locations of the joints are different for the two aluminum alloys, which are influenced by the welding parameters. When the joints are free of welding defects, the AA2017-T351 joints are ruptured in the weld nugget adjacent to the thermo-mechanically affected zone on the advancing side and the rupture surfaces appear as oval contours of the weld nugget, while the AA6061-T6 joints are ruptured in the heat affected zone on the retreating side and the rupture surfaces are inclined at a certain degree to the bottom surfaces of the joints. When welding defects are present in the joints, the AA2017-T351 joints are ruptured in the weld center, while the AA6061-T6 joints are ruptured on the retreating side near the weld center. The rupture locations of the joints are dependent on the internal structures of the joints and can be explained through them.

  16. Biaxially textured composite substrates

    Groves, James R.; Foltyn, Stephen R.; Arendt, Paul N.

    2005-04-26

    An article including a substrate, a layer of a metal phosphate material such as an aluminum phosphate material upon the surface of the substrate, and a layer of an oriented cubic oxide material having a rock-salt-like structure upon the metal phosphate material layer is provided together with additional layers such as a HTS top-layer of YBCO directly upon a layer of a buffer material such as a SrTi.sub.x Ru.sub.1-x O.sub.3 layer.

  17. The Pasadena Recommendations: Five Years After AAS Endorsement

    Knezek, Patricia; Frattare, L.; Ulvestad, J.

    2010-01-01

    It has been five years since the AAS Council unanimously endorsed the document, known as "Equity Now: The Pasadena Recommendations for Gender Equality in Astronomy," in January 2005. This document was the main product of the conference entitled "Women in Astronomy II: Ten Years After” (WIA II), held in June 2003 in Pasadena, CA. Participants of that 2003 meeting assessed the progress for women in science, offering insights into causes of the slower advancement of women, and discussed strategies to accelerate the achievement of equality. These insights and strategies were then incorporated into the "Pasadena Recommendations" by the CSWA. It was subsequently released to the entire AAS community for review and comments prior to its endorsement by the AAS. We will discuss the Recommendations and their impact since the endorsement by the AAS, including the process that is in place for organizations and departments to formally endorse the Pasadena Recommendations, thus making an organizational commitment to their implementation (see http://www.aas.org/cswa/pasadena_endorse.html).

  18. Effect of pressurized steam on AA1050 aluminium

    Jariyaboon, Manthana; Møller, Per; Ambat, Rajan

    2012-01-01

    measurements were used to study corrosion behavior. Findings - A 590?nm boehmite oxide layer was generated on AA1050 associated with partially dissolved and/or fallen off Fe-containing intermetallic particles after exposure to pressurized steam. A significant reduction (25 times) in anodic and cathodic......Purpose - The purpose of this paper is to understand the effect of pressurized steam on surface changes, structures of intermetallic particles and corrosion behavior of AA1050 aluminium. Design/methodology/approach - Industrially pure aluminium (AA1050, 99.5 per cent) surfaces were exposed to...... pressurized steam produced from a commercial pressure cooker at the maximum temperature of 116oC for 10?min. Surface morphology was observed using SEM-EDX and FIB-SEM. Phase identification and compositional depth profiling were investigated using XRD and GDOES, respectively. Potentiodynamic polarization...

  19. Flexibility Analysis of Bacillus thuringiensis Cry1Aa

    ZHAO Xin Min; XIA Li Qiu; YANG Xiao Ping; PENG Xiao Yun

    2015-01-01

    Objective To investigate the flexibility and mobility of the Bacillus thuringiensis toxin Cry1Aa. Methods The graph theory-based program Constraint Network Analysis and normal mode-based program NMsim were used to analyze the global and local flexibility indices as well as the fluctuation of individual residues in detail. Results The decrease in Cry1Aa network rigidity with the increase of temperature was evident. Two phase transition points in which the Cry1Aa structure lost rigidity during the thermal simulation were identified. Two rigid clusters were found in domains I and II. Weak spots were found in C-terminal domain III. Several flexible regions were found in all three domains;the largest residue fluctuation was present in the apical loop2 of domain II. Conclusion Although several flexible regions could be found in all the three domains, the most flexible regions were in the apical loops of domain II.

  20. A synergistic combination of tetraethylorthosilicate and multiphosphonic acid offers excellent corrosion protection to AA1100 aluminum alloy

    This work describes a new mechanism for the incorporation of organophosphonic acid into silane self-assembly monolayers, which has been used to protect AA1100 aluminum alloy. The protection improvement has been attributed to the fact that phosphonic structures promote the formation of strongly bonded and densely packed monolayer films, which show higher surface coverage and better adhesion than conventional silane systems. In order to evaluate the linking chemistry offered by phosphonic groups, two functionalized organophosphonic groups have been employed, 1,2-diaminoethanetetrakis methylenephosphonic acid (EDTPO) and aminotrimethylenephosphonic acid (ATMP), and combined with tetraethylorthosilicate (TEOS) films prepared by sol–gel synthesis. Results suggest that phosphonic acids may interact with the surface through a monodentate and bidentate coordination mode and, in addition, form one or more strong and stable linkages with silicon through non-hydrolysable bonds. Therefore, the incorporation of a very low concentration of phosphonic acids on TEOS solutions favors the complete coverage of the aluminum substrate during the silanization process, which is not possible using TEOS alone. The linking capacity of phosphonic acid has been investigated by FTIR-RA spectroscopy, SEM and EDX analysis, X-ray photoelectron spectroscopy (XPS), and quantum mechanical calculations. Finally, electrochemical impedance spectroscopy has been used to study the corrosion protection revealing that EDTPO-containing films afforded more protection to the AA1100 substrate than ATMP-containing films.

  1. A synergistic combination of tetraethylorthosilicate and multiphosphonic acid offers excellent corrosion protection to AA1100 aluminum alloy

    Dalmoro, Viviane [Instituto de Química, Universidade Federal do Rio Grande do Sul (UFRGS) Av. Bento Gonçalves 9500 - CEP 91501-970, Porto Alegre, RS (Brazil); Departament d’Enginyeria Química, ETSEIB, Universitat Politècnica de Catalunya (UPC), Avda. Diagonal 647, Barcelona E-08028 (Spain); Center for Research in Nano-Engineering (CRnE), Universitat Politècnica de Catalunya (UPC), Campus Sud, Edifici C’, C/Pasqual i Vila s/n, Barcelona E-08028 (Spain); Santos, João H.Z. dos [Instituto de Química, Universidade Federal do Rio Grande do Sul (UFRGS) Av. Bento Gonçalves 9500 - CEP 91501-970, Porto Alegre, RS (Brazil); Armelin, Elaine, E-mail: elaine.armelin@upc.edu [Departament d’Enginyeria Química, ETSEIB, Universitat Politècnica de Catalunya (UPC), Avda. Diagonal 647, Barcelona E-08028 (Spain); Center for Research in Nano-Engineering (CRnE), Universitat Politècnica de Catalunya (UPC), Campus Sud, Edifici C’, C/Pasqual i Vila s/n, Barcelona E-08028 (Spain); Alemán, Carlos, E-mail: carlos.aleman@upc.edu [Departament d’Enginyeria Química, ETSEIB, Universitat Politècnica de Catalunya (UPC), Avda. Diagonal 647, Barcelona E-08028 (Spain); Center for Research in Nano-Engineering (CRnE), Universitat Politècnica de Catalunya (UPC), Campus Sud, Edifici C’, C/Pasqual i Vila s/n, Barcelona E-08028 (Spain); and others

    2013-05-15

    This work describes a new mechanism for the incorporation of organophosphonic acid into silane self-assembly monolayers, which has been used to protect AA1100 aluminum alloy. The protection improvement has been attributed to the fact that phosphonic structures promote the formation of strongly bonded and densely packed monolayer films, which show higher surface coverage and better adhesion than conventional silane systems. In order to evaluate the linking chemistry offered by phosphonic groups, two functionalized organophosphonic groups have been employed, 1,2-diaminoethanetetrakis methylenephosphonic acid (EDTPO) and aminotrimethylenephosphonic acid (ATMP), and combined with tetraethylorthosilicate (TEOS) films prepared by sol–gel synthesis. Results suggest that phosphonic acids may interact with the surface through a monodentate and bidentate coordination mode and, in addition, form one or more strong and stable linkages with silicon through non-hydrolysable bonds. Therefore, the incorporation of a very low concentration of phosphonic acids on TEOS solutions favors the complete coverage of the aluminum substrate during the silanization process, which is not possible using TEOS alone. The linking capacity of phosphonic acid has been investigated by FTIR-RA spectroscopy, SEM and EDX analysis, X-ray photoelectron spectroscopy (XPS), and quantum mechanical calculations. Finally, electrochemical impedance spectroscopy has been used to study the corrosion protection revealing that EDTPO-containing films afforded more protection to the AA1100 substrate than ATMP-containing films.

  2. Injektointimassan kehittäminen AA-tiiviysluokan tunnelialueille

    Parkkonen, Ilari

    2012-01-01

    Tutkimuksen tarkoituksena oli kehittää uusi kallioinjektointimassa AA-luokan tiiviysalueille, koska ennen käytetty injektointimassa sitoutui sekä kovettui liian hitaasti, mikä puolestaan hidasti louhintaa merkittävästi. Tutkimuksessa keskityttiin uuden injektointireseptin kehittämiseen uudella sementtivalmisteella. Kehittämisellä pyrittiin korvaamaan BB-sementti AA-sementillä, koska uusi sementti sitoutuu nopeammin kuin ennestään käytetty. Tutkimusmenetelmänä käytettiin Kalliotilojen inje...

  3. Numerical semigroups II: pseudo-symmetric AA-Semigroups

    García-Marco, Ignacio; Ramirez Alfonsin, Jorge; Rodseth, Oystein J.

    2016-01-01

    This paper is a continuation of the paper " Numerical Semigroups: Apéry Sets and Hilbert Series". We consider the general numerical AA-semigroup, i.e., semigroups consisting of all non-negative integer linear combinations of relatively prime positive integers of the form $a, a+d, a+2d,. .. , a+kd, c$. We first prove that, in contrast to arbitrary numerical semigroups, there exists an upper bound for the type of AA-semigroups that only depends on the number of generators of the semigroup. We t...

  4. Precipitation hardening and hydrogen embrittlement of aluminum alloy AA7020

    Santosh Kumar; T K G Namboodhiri

    2011-04-01

    AA7020 Al–Mg–Zn, a medium strength aluminium alloy, is used in welded structures in military and aerospace applications. As it may be subjected to extremes of environmental exposures, including high pressure liquid hydrogen, it could suffer hydrogen embrittlement. Hydrogen susceptibility of alloy AA7020 was evaluated by slow strain-rate tensile testing, and delayed failure testing of hydrogen-charged specimens of air-cooled, duplexaged, and water-quenched duplex agedmaterials. The resistance to hydrogen embrittlement of the alloy was found to be in the order of air-cooled duplex aged alloy > as-received (T6 condition) > water quenched duplex aged material.

  5. The existence of an insulin-stimulated glucose and non-essential but not essential amino acid substrate interaction in diabetic pigs

    Wijdenes Jan

    2011-05-01

    Full Text Available Abstract Background The generation of energy from glucose is impaired in diabetes and can be compensated by other substrates like fatty acids (Randle cycle. Little information is available on amino acids (AA as alternative energy-source in diabetes. To study the interaction between insulin-stimulated glucose and AA utilization in normal and diabetic subjects, intraportal hyperinsulinaemic euglycaemic euaminoacidaemic clamp studies were performed in normal (n = 8 and streptozotocin (120 mg/kg induced diabetic (n = 7 pigs of ~40-45 kg. Results Diabetic vs normal pigs showed basal hyperglycaemia (19.0 ± 2.0 vs 4.7 ± 0.1 mmol/L, P P P P P P P . Essential AA clearance was largely unchanged (72.9 ± 8.5 vs 63.3 ± 8.5 mL/kg· min, however clearances of threonine (P P Conclusions The ratio of insulin-stimulated glucose versus AA clearance was decreased 5.4-fold in diabetic pigs, which was caused by a 3.6-fold decrease in glucose clearance and a 2.0-fold increase in non-essential AA clearance. In parallel with the Randle concept (glucose - fatty acid cycle, the present data suggest the existence of a glucose and non-essential AA substrate interaction in diabetic pigs whereby reduced insulin-stimulated glucose clearance seems to be partly compensated by an increase in non-essential AA clearance whereas essential AA are preferentially spared from an increase in clearance.

  6. NCBI nr-aa BLAST: CBRC-PTRO-07-0067 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  7. NCBI nr-aa BLAST: CBRC-TGUT-05-0032 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  8. NCBI nr-aa BLAST: CBRC-DRER-20-0002 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  9. NCBI nr-aa BLAST: CBRC-TBEL-01-1883 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid

  10. NCBI nr-aa BLAST: CBRC-TNIG-14-0023 [SEVENS

    Full Text Available l cannabinoid receptor emb|CAB42647.1| cannabinoid CB1 receptor [Mus musculus] gb|AAS91800.1| striatal... cannabinoid receptor type 1 protein [Mus musculus] gb|AAS91801.1| striatal cannabinoid