WorldWideScience

Sample records for 8-oxoguanine dna glycosylase

  1. Functional characterization of 8-oxoguanine DNA glycosylase of Trypanosoma cruzi.

    Carolina Furtado

    Full Text Available The oxidative lesion 8-oxoguanine (8-oxoG is removed during base excision repair by the 8-oxoguanine DNA glycosylase 1 (Ogg1. This lesion can erroneously pair with adenine, and the excision of this damaged base by Ogg1 enables the insertion of a guanine and prevents DNA mutation. In this report, we identified and characterized Ogg1 from the protozoan parasite Trypanosoma cruzi (TcOgg1, the causative agent of Chagas disease. Like most living organisms, T. cruzi is susceptible to oxidative stress, hence DNA repair is essential for its survival and improvement of infection. We verified that the TcOGG1 gene encodes an 8-oxoG DNA glycosylase by complementing an Ogg1-defective Saccharomyces cerevisiae strain. Heterologous expression of TcOGG1 reestablished the mutation frequency of the yeast mutant ogg1(-/- (CD138 to wild type levels. We also demonstrate that the overexpression of TcOGG1 increases T. cruzi sensitivity to hydrogen peroxide (H(2O(2. Analysis of DNA lesions using quantitative PCR suggests that the increased susceptibility to H(2O(2 of TcOGG1-overexpressor could be a consequence of uncoupled BER in abasic sites and/or strand breaks generated after TcOgg1 removes 8-oxoG, which are not rapidly repaired by the subsequent BER enzymes. This hypothesis is supported by the observation that TcOGG1-overexpressors have reduced levels of 8-oxoG both in the nucleus and in the parasite mitochondrion. The localization of TcOgg1 was examined in parasite transfected with a TcOgg1-GFP fusion, which confirmed that this enzyme is in both organelles. Taken together, our data indicate that T. cruzi has a functional Ogg1 ortholog that participates in nuclear and mitochondrial BER.

  2. Functional Characterization of 8-Oxoguanine DNA Glycosylase of Trypanosoma cruzi

    Mendes, Isabela Cecília; de Moura, Michelle Barbi; Campos, Priscila Carneiro; Macedo, Andrea Mara; Franco, Glória Regina; Pena, Sérgio Danilo Junho; Teixeira, Santuza Maria Ribeiro; Van Houten, Bennett; Machado, Carlos Renato

    2012-01-01

    The oxidative lesion 8-oxoguanine (8-oxoG) is removed during base excision repair by the 8-oxoguanine DNA glycosylase 1 (Ogg1). This lesion can erroneously pair with adenine, and the excision of this damaged base by Ogg1 enables the insertion of a guanine and prevents DNA mutation. In this report, we identified and characterized Ogg1 from the protozoan parasite Trypanosoma cruzi (TcOgg1), the causative agent of Chagas disease. Like most living organisms, T. cruzi is susceptible to oxidative stress, hence DNA repair is essential for its survival and improvement of infection. We verified that the TcOGG1 gene encodes an 8-oxoG DNA glycosylase by complementing an Ogg1-defective Saccharomyces cerevisiae strain. Heterologous expression of TcOGG1 reestablished the mutation frequency of the yeast mutant ogg1−/− (CD138) to wild type levels. We also demonstrate that the overexpression of TcOGG1 increases T. cruzi sensitivity to hydrogen peroxide (H2O2). Analysis of DNA lesions using quantitative PCR suggests that the increased susceptibility to H2O2 of TcOGG1-overexpressor could be a consequence of uncoupled BER in abasic sites and/or strand breaks generated after TcOgg1 removes 8-oxoG, which are not rapidly repaired by the subsequent BER enzymes. This hypothesis is supported by the observation that TcOGG1-overexpressors have reduced levels of 8-oxoG both in the nucleus and in the parasite mitochondrion. The localization of TcOgg1 was examined in parasite transfected with a TcOgg1-GFP fusion, which confirmed that this enzyme is in both organelles. Taken together, our data indicate that T. cruzi has a functional Ogg1 ortholog that participates in nuclear and mitochondrial BER. PMID:22876325

  3. Synthetic Routes to N-9 Alkylated 8-Oxoguanines; Weak Inhibitors of the Human DNA Glycosylase OGG1

    Tushar R. Mahajan

    2015-09-01

    Full Text Available The human 8-oxoguanine DNA glycosylase OGG1 is involved in base excision repair (BER, one of several DNA repair mechanisms that may counteract the effects of chemo- and radiation therapy for the treatment of cancer. We envisage that potent inhibitors of OGG1 may be found among the 9-alkyl-8-oxoguanines. Thus we explored synthetic routes to 8-oxoguanines and examined these as OGG1 inhibitors. The best reaction sequence started from 6-chloroguanine and involved N-9 alkylation, C-8 bromination, and finally simultaneous hydrolysis of both halides. Bromination before N-alkylation should only be considered when the N-substituent is not compatible with bromination conditions. The 8-oxoguanines were found to be weak inhibitors of OGG1. 6-Chloro-8-oxopurines, byproducts in the hydrolysis of 2,6-halopurines, turned out to be slightly better inhibitors than the corresponding 8-oxoguanines.

  4. Exercise improves import of 8-oxoguanine DNA glycosylase into the mitochondrial matrix of skeletal muscle and enhances the relative activity

    Radak, Zsolt; Atalay, Mustafa; Jakus, Judit; Boldogh, István; Davies, Kelvin; Goto, Sataro

    2008-01-01

    Exercise has been shown to modify the level/activity of the DNA damage repair enzyme 8-oxoguanine-DNA glycosylase (OGG1) in skeletal muscle. We have studied the impact of regular physical training (8 weeks of swimming) and detraining (8 weeks of rest after an 8-week training session) on the activity of OGG1 in the nucleus and mitochondria as well as its targeting to the mitochondrial matrix in skeletal muscle. Neither exercise training nor detraining altered the overall levels of reactive spe...

  5. Triphlorethol-A from Ecklonia cava Up-Regulates the Oxidant Sensitive 8-Oxoguanine DNA Glycosylase 1

    Ki Cheon Kim

    2014-10-01

    Full Text Available This study investigated the protective mechanisms of triphlorethol-A, isolated from Ecklonia cava, against oxidative stress-induced DNA base damage, especially 8-oxoguanine (8-oxoG, in Chinese hamster lung fibroblast V79-4 cells. 8-Oxoguanine DNA glycosylase-1 (OGG1 plays an important role in the removal of 8-oxoG during the cellular response to DNA base damage. Triphlorethol-A significantly decreased the levels of 8-oxoG induced by H2O2, and this correlated with increases in OGG1 mRNA and OGG1 protein levels. Furthermore, siOGG1-transfected cell attenuated the protective effect of triphlorethol-A against H2O2 treatment. Nuclear factor erythroid 2–related factor 2 (Nrf2 is a transcription factor for OGG1, and Nrf2 combines with small Maf proteins in the nucleus to bind to antioxidant response elements (ARE in the upstream promoter region of the OGG1 gene. Triphlorethol-A restored the expression of nuclear Nrf2, small Maf protein, and the Nrf2-Maf complex, all of which were reduced by oxidative stress. Furthermore, triphlorethol-A increased Nrf2 binding to ARE sequences and the resulting OGG1 promoter activity, both of which were also reduced by oxidative stress. The levels of the phosphorylated forms of Akt kinase, downstream of phosphatidylinositol 3-kinase (PI3K, and Erk, which are regulators of OGG1, were sharply decreased by oxidative stress, but these decreases were prevented by triphlorethol-A. Specific PI3K, Akt, and Erk inhibitors abolished the cytoprotective effects of triphlorethol-A, suggesting that OGG1 induction by triphlorethol-A involves the PI3K/Akt and Erk pathways. Taken together, these data indicate that by activating the DNA repair system, triphlorethol-A exerts protective effects against DNA base damage induced by oxidative stress.

  6. Cadmium exposure down-regulates 8-oxoguanine DNA glycosylase expression in rat lung and alveolar epithelial cells

    The current study tested the hypothesis that the pulmonary carcinogenic potential of cadmium (Cd) is related to its ability to inhibit the expression (mRNA and protein) and activity of 8-oxoguanine-DNA glycosylase (OGG1), a base excision repair (BER) enzyme that functions to preferentially excise pre-mutagenic 7,8-dihydro-8-oxoguanine (8-oxoG) from DNA. We demonstrate that a single Cd aerosol exposure of adult male Lewis rats causes time- and dose-dependent down-regulation in the pulmonary levels of rOGG1 mRNA and OGG1 protein, quantified by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) assays and western analyses, respectively. Immunohistochemical studies confirmed that Cd inhalation reduces the relative amount of OGG1 in lungs of exposed animals without altering its over-all distribution within the lung, which appears to be more prominent within the alveolar epithelium. In agreement with our in vivo studies, we show that OGG1 expression is also attenuated in alveolar epithelial cell cultures exposed to CdCl2 either acutely or by repeated passaging in Cd-containing medium. The effects caused by Cd were observed in cells that show no loss in viability, as assessed by colony forming ability, the MTT assay, and propidium iodide membrane permeability studies. Nuclear extracts prepared from Cd-treated cells also exhibit a reduction in the ability to nick a synthetic oligonucleotide containing 8-oxoG. We conclude from these studies that Cd causes suppression of OGG1 in the lung and that this mechanism may, in part, play a role in the Cd carcinogenic process

  7. Mitochondrial-targeted DNA repair enzyme 8-oxoguanine DNA glycosylase 1 protects against ventilator-induced lung injury in intact mice

    Hashizume, Masahiro; Mouner, Marc; Joshua M. Chouteau; Gorodnya, Olena M.; Ruchko, Mykhaylo V.; Potter, Barry J.; Wilson, Glenn L.; Gillespie, Mark N.; Parker, James C.

    2012-01-01

    This study tested the hypothesis that oxidative mitochondrial-targeted DNA (mtDNA) damage triggered ventilator-induced lung injury (VILI). Control mice and mice infused with a fusion protein targeting the DNA repair enzyme, 8-oxoguanine-DNA glycosylase 1 (OGG1) to mitochondria were mechanically ventilated with a range of peak inflation pressures (PIP) for specified durations. In minimal VILI (1 h at 40 cmH2O PIP), lung total extravascular albumin space increased 2.8-fold even though neither l...

  8. Age-dependent changes in 8-oxoguanine-DNA-glycosylase activity is modulated by adaptive responses to physical exercise in human skeletal muscle

    Radak, Zsolt; Bori, Zoltan; Koltai, Erika; Fatouros, Ioannis G.; JAMURTAS, ATHANASIOS Z.; Douroudos, Ioannis I.; Terzis, Gerasimos; Michalis G. Nikolaidis; Chatzinikolaou, Athanasios; Sovatzidis, Apostolos; Kumagai, Shuzo; Naito, Hisahi; Boldogh, Istvan

    2011-01-01

    8-Oxo-7,8 dihydroguanine (8-oxoG) accumulates in the genome over time and is believed to contribute to the development of aging characteristics of skeletal muscle and various aging-related diseases. Here, we show a significantly increased level of intrahelical 8-oxoG and 8-oxoguanine DNA glycosylase (OGG1) expression in aged human skeletal muscle compared to that of young individuals. In response to exercise, the 8-oxoG level was found to be lastingly elevated in sedentary young and old subje...

  9. "Light-up" Sensing of human 8-oxoguanine DNA glycosylase activity by target-induced autocatalytic DNAzyme-generated rolling circle amplification.

    Kong, Xiang-Juan; Wu, Shuang; Cen, Yao; Yu, Ru-Qin; Chu, Xia

    2016-05-15

    Human 8-oxoguanine DNA glycosylase (hOGG1) plays a crucial role in maintaining the genomic integrity of living organisms for its capability of repairing DNA oxidative damage. The expression level of hOGG1 is closely associated with many diseases including various kinds of cancers. In this study, a novel "light-up" sensor based on target-induced formation of 5' phosphorylated probe and autocatalytic DNAzyme-generated rolling circle amplification has been developed for highly sensitive human 8-oxoguanine DNA glycosylase (hOGG1) activity assay. The approach reaches detection limit as low as 0.001U/mL for hOGG1 via scarcely increased background signal and dual signal amplification strategy. To the best of our knowledge, it is one of the most sensitive methods for the detection of base excision repair enzyme. Moreover, the approach shows excellent specificity over other nonspecific enzymes would interfere with the assay and holds great promise for application in real sample analysis. Hence, the proposed method provides a highly sensitive, selective, and desirable hOGG1 sensing platform. PMID:26765532

  10. The levels of 7,8-dihydrodeoxyguanosine (8-oxoG) and 8-oxoguanine DNA glycosylase 1 (OGG1) - A potential diagnostic biomarkers of Alzheimer's disease.

    Sliwinska, Agnieszka; Kwiatkowski, Dominik; Czarny, Piotr; Toma, Monika; Wigner, Paulina; Drzewoski, Jozef; Fabianowska-Majewska, Krystyna; Szemraj, Janusz; Maes, Michael; Galecki, Piotr; Sliwinski, Tomasz

    2016-09-15

    Evidence indicates that oxidative stress contributes to neuronal cell death in Alzheimer's disease (AD). Increased oxidative DNA damage l, as measured with 8-oxoguanine (8-oxoG), and reduced capacity of proteins responsible for removing of DNA damage, including 8-oxoguanine DNA glycosylase 1 (OGG1), were detected in brains of AD patients. In the present study we assessed peripheral blood biomarkers of oxidative DNA damage, i.e. 8- oxoG and OGG1, in AD diagnosis, by comparing their levels between the patients and the controls. Our study was performed on DNA and serum isolated from peripheral blood taken from 100 AD patients and 110 controls. For 8-oxoG ELISA was employed. The OGG1 level was determined using ELISA and Western blot technique. Levels of 8-oxoG were significantly higher in DNA of AD patients. Both ELISA and Western blot showed decreased levels of OGG1 in serum of AD patients. Our results show that oxidative DNA damage biomarkers detected in peripheral tissue could reflect the changes occurring in the brain of patients with AD. These results also suggest that peripheral blood samples may be useful to measure oxidative stress biomarkers in AD. PMID:27538622

  11. Exercise-Induced Neuroprotection of Hippocampus in APP/PS1 Transgenic Mice via Upregulation of Mitochondrial 8-Oxoguanine DNA Glycosylase

    Hai Bo

    2014-01-01

    Full Text Available Improving mitochondrial function has been proposed as a reasonable therapeutic strategy to reduce amyloid-β (Aβ load and to modify the progression of Alzheimer’s disease (AD. However, the relationship between mitochondrial adaptation and brain neuroprotection caused by physical exercise in AD is poorly understood. This study was undertaken to investigate the effects of long-term treadmill exercise on mitochondrial 8-oxoguanine DNA glycosylase-1 (OGG1 level, mtDNA oxidative damage, and mitochondrial function in the hippocampus of APP/PS1 transgenic mouse model of AD. In the present study, twenty weeks of treadmill training significantly improved the cognitive function and reduced the expression of Aβ-42 in APP/PS1 transgenic (Tg mice. Training also ameliorated mitochondrial respiratory function by increasing the complexes I, and IV and ATP synthase activities, whereas it attenuated ROS generation and mtDNA oxidative damage in Tg mice. Furthermore, the impaired mitochondrial antioxidant enzymes and mitochondrial OGG1 activities seen in Tg mice were restored with training. Acetylation level of mitochondrial OGG1 and MnSOD was markedly suppressed in Tg mice after exercise training, in parallel with increased level of SIRT3. These findings suggest that exercise training could increase mtDNA repair capacity in the mouse hippocampus, which in turn would result in protection against AD-related mitochondrial dysfunction and phenotypic deterioration.

  12. Repair of 8-oxodeoxyguanosine lesions in mitochondrial DNA depends on the oxoguanine DNA glycosylase (OGG1) gene and 8- oxoguanine accumulates in the mitochondrial DNA of OGG1- defective mice

    Souza-Pinto, N.C.; Eide, L.; Hogue, B.A.; Frederiksen, Tanja Thybo; Stevnsner, T.; Seeberg, E.; Klungland, A.; Bohr, V.A.

    2001-01-01

    Mitochondria are not only the major site for generation of reactive oxygen species, but also one of the main targets of oxidative damage. One of the major products of DNA oxidation, 8-oxodeoxyguanosine (8-oxodC), accumulates in mitochondrial DNA (mtDNA) at levels three times higher than in nuclea......DNA isolated from liver from OGG1-null mutant animals contained 20-fold more 8-oxodC than mtDNA From wild-type animals....... DNA, The main pathway for the repair of 8-oxodG is the base excision repair pathway initiated by oxoguanine DNA glycosylase (OGG1), We previously demonstrated that mammalian mitochondria from mice efficiently remove 8-oxodG from their genomes and isolated a protein from rat liver mitochondria with 8......-oxoguanine (8- oxodG) DNA glycosylase/apurinic DNA lyase activity. In the present study, we demonstrated that the mitochondrial 8-oxodG DNA glycosylase/apurinic DNA lyase activity is the mitochondrial isoform of OGG1, Using mouse liver mitochondria isolated from ogg1(-/-) mice, we showed that the OGG1 gene...

  13. 8-Oxoguanine DNA glycosylase 1 (ogg1) maintains the function of cardiac progenitor cells during heart formation in zebrafish

    Genomic damage may devastate the potential of progenitor cells and consequently impair early organogenesis. We found that ogg1, a key enzyme initiating the base-excision repair, was enriched in the embryonic heart in zebrafish. So far, little is known about DNA repair in cardiogenesis. Here, we addressed the critical role of ogg1 in cardiogenesis for the first time. ogg1 mainly expressed in the anterior lateral plate mesoderm (ALPM), the primary heart tube, and subsequently the embryonic myocardium by in situ hybridisation. Loss of ogg1 resulted in severe cardiac morphogenesis and functional abnormalities, including the short heart length, arrhythmia, decreased cardiomyocytes and nkx2.5+ cardiac progenitor cells. Moreover, the increased apoptosis and repressed proliferation of progenitor cells caused by ogg1 deficiency might contribute to the heart phenotype. The microarray analysis showed that the expression of genes involved in embryonic heart tube morphogenesis and heart structure were significantly changed due to the lack of ogg1. Among those, foxh1 is an important partner of ogg1 in the cardiac development in response to DNA damage. Our work demonstrates the requirement of ogg1 in cardiac progenitors and heart development in zebrafish. These findings may be helpful for understanding the aetiology of congenital cardiac deficits. - Highlights: • A key DNA repair enzyme ogg1 is expressed in the embryonic heart in zebrafish. • We found that ogg1 is essential for normal cardiac morphogenesis in zebrafish. • The production of embryonic cardiomyocytes requires appropriate ogg1 expression. • Ogg1 critically regulated proliferation of cardiac progenitor cells in zebrafish. • foxh1 is a partner of ogg1 in the cardiac development in response to DNA damage

  14. 8-Oxoguanine DNA glycosylase 1 (ogg1) maintains the function of cardiac progenitor cells during heart formation in zebrafish

    Yan, Lifeng [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China); Zhou, Yong [Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and Shanghai Jiao Tong University School of Medicine, Shanghai 200025 (China); Yu, Shanhe [Shanghai Institute of Hematology, RuiJin Hospital, Shanghai Jiao Tong University, School of Medicine, Shanghai 200025 (China); Ji, Guixiang [Nanjing Institute of Environmental Sciences/Key Laboratory of Pesticide Environmental Assessment and Pollution Control, Ministry of Environmental Protection, Nanjing 210042 (China); Wang, Lei [Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and Shanghai Jiao Tong University School of Medicine, Shanghai 200025 (China); Liu, Wei [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China); Gu, Aihua, E-mail: aihuagu@njmu.edu.cn [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China)

    2013-11-15

    Genomic damage may devastate the potential of progenitor cells and consequently impair early organogenesis. We found that ogg1, a key enzyme initiating the base-excision repair, was enriched in the embryonic heart in zebrafish. So far, little is known about DNA repair in cardiogenesis. Here, we addressed the critical role of ogg1 in cardiogenesis for the first time. ogg1 mainly expressed in the anterior lateral plate mesoderm (ALPM), the primary heart tube, and subsequently the embryonic myocardium by in situ hybridisation. Loss of ogg1 resulted in severe cardiac morphogenesis and functional abnormalities, including the short heart length, arrhythmia, decreased cardiomyocytes and nkx2.5{sup +} cardiac progenitor cells. Moreover, the increased apoptosis and repressed proliferation of progenitor cells caused by ogg1 deficiency might contribute to the heart phenotype. The microarray analysis showed that the expression of genes involved in embryonic heart tube morphogenesis and heart structure were significantly changed due to the lack of ogg1. Among those, foxh1 is an important partner of ogg1 in the cardiac development in response to DNA damage. Our work demonstrates the requirement of ogg1 in cardiac progenitors and heart development in zebrafish. These findings may be helpful for understanding the aetiology of congenital cardiac deficits. - Highlights: • A key DNA repair enzyme ogg1 is expressed in the embryonic heart in zebrafish. • We found that ogg1 is essential for normal cardiac morphogenesis in zebrafish. • The production of embryonic cardiomyocytes requires appropriate ogg1 expression. • Ogg1 critically regulated proliferation of cardiac progenitor cells in zebrafish. • foxh1 is a partner of ogg1 in the cardiac development in response to DNA damage.

  15. Effect of 8-Oxoguanine on DNA Structure and Deformability

    Dršata, Tomáš; Kara, M.; Zacharias, M.; Lankaš, Filip

    2013-01-01

    Roč. 117, č. 39 (2013), s. 11617-11622. ISSN 1520-6106 Institutional support: RVO:61388963 Keywords : molecular-dynamics simulations * B-DNA * glycosylase MutM Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.377, year: 2013

  16. Molecular dynamics simulation of 8-oxoguanine lesioned DNA complexed with repair enzyme hOGG1

    The molecular dynamics (MD) simulations of DNA mutagenic oxidative lesion - 7,8-dihydro-8-oxoguanine (8-oxoG), single and complexed with the repair enzyme - human oxoguanine glycosylase 1 (hOGG1), were performed for 1 nanosecond (ns) in order to determine structural changes at the DNA molecule and to describe a dynamical process of DNA-enzyme complex formation. The molecule of 8-oxoG was inserted into central part of B-DNA 15-mer d(GCGTCCA'8-oxoG'GTCTACC)2 replacing the native guanine 8. In the case of simulation of single DNA molecule the broken hydrogen bonds resulting in locally collapsed B-DNA structure were observed at the lesion site. In addition the adenine on the complementary strand (separated from 8-oxoG by 1 base pair) was flipped-out of the DNA double helix. In the case of simulation of DNA and repair enzyme hOGG1, the DNA-enzyme complex was formed after 500 picoseconds of MD that lasted stable until the simulation was terminated at 1 ns. Proximity of both molecules in complex satisfied the Van der Waals interactions between the closest atoms. The N-terminus of arginine 313 was located close to the phosphodiester bond of nucleotide with 8-oxoG enabling chemical reactions between amino acid and lesion. Phosphodiester bond at C5' of 8-oxoG was at the position close to the N-terminus of arginine 313. The water mediated hydrogen bonds network was formed in each contact area between DNA and enzyme further enhancing the stability of complex. In the background simulation of the identical molecular system with the native DNA, neither the complex nor the water mediated hydrogen bond network were observed. (author)

  17. Nuclear Magnetic Resonance Solution Structure of DNA Featuring Clustered 2'-Deoxyribonolactone and 8-Oxoguanine Lesions.

    Zálešák, Jan; Constant, Jean-François; Jourdan, Muriel

    2016-07-19

    Ionizing radiation, free radicals, and reactive oxygen species produce hundreds of different DNA lesions. Clustered lesions are typical for ionizing radiation. They compromise the efficiency of the base excision repair (BER) pathway, and as a consequence, they are much more toxic and mutagenic than isolated lesions. Despite their biological relevance, e.g., in cancer radiotherapy and accidental exposure, they are not very well studied from a structural point of view, and while insights provided by structural studies contribute to the understanding of the repair process, only three nuclear magnetic resonance (NMR) studies of DNA containing clusters of lesions were reported. Herein, we report the first NMR solution structure of two DNAs containing a bistranded cluster with the 2'-deoxyribonolactone and 8-oxoguanine lesions. Both DNA duplexes feature a 2'-deoxyribonolactone site in the middle of the sequence of one strand and differ by the relative position of the 8-oxoguanine, staggered 3' or 5' side on the complementary strand at a three-nucleotide distance. Depending on its relative position, the repair of the 8-oxoguanine lesion by the base excision repair protein Fpg is either almost complete or inhibited. We found that the structures of the two DNAs containing a bistranded cluster of two lesions are similar and do not deviate very much from the standard B-form. As no obvious structural deformations were observed between the two duplexes, we concluded that the differences in Fpg activity are not due to differences in their global conformation. PMID:27322640

  18. Efficiency, specificity and DNA polymerase-dependence of translesion replication across the oxidative DNA lesion 8-oxoguanine in human cells

    The oxidation product of guanine, 8-oxoguanine, is a major lesion formed in DNA by intracellular metabolism, ionizing radiation, and tobacco smoke. Using a recently developed method for the quantitative analysis of translesion replication, we have studied the bypass of 8-oxoguanine in vivo by transfecting human cells with a gapped plasmid carrying a site-specific 8-oxoguanine in the ssDNA region. The efficiency of bypass in the human large-cell lung carcinoma cell line H1299 was 80%, and it was similar when assayed in the presence of aphidicolin, an inhibitor of DNA polymerases α, δ and ε. A similar extent of bypass was observed also in XP-V cells, defective in pol η, both in the absence and presence of aphidicolin. DNA sequence analysis indicated that the major nucleotide inserted opposite the 8-oxoguanine was the correct nucleotide C, both in H1299 cells (81%) and in XP-V cells (77%). The major mutagenic event was the insertion of an A, both in H1299 and XP-V cells, and it occurred at a frequency of 16-17%, significantly higher than previously reported. Interestingly, the misinsertion frequency of A opposite 8-oxoguanine was decreased in XP-V cells in the presence of aphidicolin, and misinsertion of G was observed. This modulation of the mutagenic specificity at 8-oxoguanine is consistent with the notion that while not essential for the bypass reaction, pol η and pol δ, when present, are involved in bypass of 8-oxoguanine in vivo

  19. Direct visualization of a DNA glycosylase searching for damage.

    Chen, Liwei; Haushalter, Karl A; Lieber, Charles M; Verdine, Gregory L

    2002-03-01

    DNA glycosylases preserve the integrity of genetic information by recognizing damaged bases in the genome and catalyzing their excision. It is unknown how DNA glycosylases locate covalently modified bases hidden in the DNA helix amongst vast numbers of normal bases. Here we employ atomic-force microscopy (AFM) with carbon nanotube probes to image search intermediates of human 8-oxoguanine DNA glycosylase (hOGG1) scanning DNA. We show that hOGG1 interrogates DNA at undamaged sites by inducing drastic kinks. The sharp DNA bending angle of these non-lesion-specific search intermediates closely matches that observed in the specific complex of 8-oxoguanine-containing DNA bound to hOGG1. These findings indicate that hOGG1 actively distorts DNA while searching for damaged bases. PMID:11927259

  20. Computational study of recognition of DNA damages and their repair. 8-oxoguanine oxidative DNA damage with repair enzyme hOGG1

    The molecular dynamics (MD) simulations of DNA mutagenic oxidative lesion - 7,8-dihydro-8-oxoguanine (8-oxoG), single and complexed with the repair enzyme - human oxoguanine glycosylase 1 (hOGG1) were performed for 1 nanosecond (ns) in order to determine structural changes at the DNA molecule and to describe a dynamical process of DNA-enzyme complex formation. The molecule of 8-oxoG was inserted into central part of B-DNA 15-mer d(GCGTCCA'8-oxoG'GTCTACC)2 replacing the native guanine 8. In the case of simulation of single DNA molecule the broken hydrogen bonds resulting in locally collapsed B-DNA structure were observed at the lesion site. In addition the adenine on the complementary strand (separated from 8-oxoG by 1 base pair) was flipped-out of the DNA double helix. In the case of simulation of DNA and repair enzyme hOGG1, the DNA-enzyme complex was formed after 500 picoseconds of MD that lasted stable until the simulation was terminated at 1 ns. The complex was represented by the overlapping Van der Waals surfaces of DNA and enzyme molecules. The N-terminus of arginine 324 was located close to the phosphodiester bond of nucleotide with 8-oxoG enabling chemical reactions between amino acid and lesion. Phosphodiester bond at C5' of 8-oxoG was at the position close to the N-terminus of arginine 324. The water mediated hydrogen bonds network was formed in each contact area between DNA and enzyme further enhancing the stability of complex. In the background simulation of the identical molecular system with the native DNA, neither the complex nor the water mediated hydrogen bond network were observed. (author)

  1. Deletion of Ogg1 DNA glycosylase results in telomere base damage and length alteration in yeast

    LU, Jian; Liu, Yie

    2009-01-01

    Telomeres consist of short guanine-rich repeats. Guanine can be oxidized to 8-oxo-7,8-dihydroguanine (8-oxoG) and 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyG). 8-oxoguanine DNA glycosylase (Ogg1) repairs these oxidative guanine lesions through the base excision repair (BER) pathway. Here we show that in Saccharomyces cerevisiae ablation of Ogg1p leads to an increase in oxidized guanine level in telomeric DNA. The ogg1 deletion (ogg1Δ) strain shows telomere lengthening that is dependent...

  2. Active DNA Demethylation Mediated by DNA Glycosylases

    Zhu, Jian-Kang

    2009-01-01

    Active DNA demethylation is involved in many vital developmental and physiological processes of plants and animals. Recent genetic and biochemical studies in Arabidopsis have demonstrated that a subfamily of DNA glycosylases function to promote DNA demethylation through a base excision-repair pathway. These specialized bifunctional DNA glycosylases remove the 5-methylcytosine base and then cleave the DNA backbone at the abasic site, resulting in a gap that is then filled with an unmethylated ...

  3. The R46Q, R131Q and R154H Polymorphs of Human DNA Glycosylase/β-Lyase hOgg1 Severely Distort the Active Site and DNA Recognition Site but do not Cause Unfolding†

    Anderson, Peter C.; Daggett, Valerie

    2009-01-01

    Reactive oxygen species can cause widespread cellular damage, including base alterations and strand breaks in DNA. An array of DNA-repair enzymes constitutes an essential part of the line of defense that cells use against oxidative damage to the genome. A DNA glycosylase/β-lyase enzyme, Ogg1, scavenges the genome for 8-oxoguanine, a major mutagenic DNA adduct induced by reactive oxygen species, and catalyzes its excision and subsequent cleavage of the DNA phosphate backbone. Several polymorph...

  4. DNA glycosylases: in DNA repair and beyond

    Jacobs, Angelika L.; Schär, Primo

    2011-01-01

    The base excision repair machinery protects DNA in cells from the damaging effects of oxidation, alkylation, and deamination; it is specialized to fix single-base damage in the form of small chemical modifications. Base modifications can be mutagenic and/or cytotoxic, depending on how they interfere with the template function of the DNA during replication and transcription. DNA glycosylases play a key role in the elimination of such DNA lesions; they recognize and excise damaged bases, thereb...

  5. The Hunt for 8-Oxoguanine Deaminase

    Hall, R.; Fedorov, A; Marti-Arbona, R; Fedorov, E; Kolb, P; Sauder, J; Burley, S; Shoichet, B; Almo, S; et. al.

    2010-01-01

    An enzyme from Pseudomonas aeruginosa, Pa0142 (gi|9945972), that is able to catalyze the deamination of 8-oxoguanine (8-oxoG) to uric acid has been identified for the first time. 8-Oxoguanine is formed by the oxidation of guanine residues within DNA by reactive oxygen species, and this lesion results in G:C to T:A transversions. The value of k{sub cat}/K{sub m} for the deamination of 8-oxoG by Pa0142 at pH 8.0 and 30 C is 2.0 x 10{sup 4} M{sup -1} s{sup -1}. This enzyme can also catalyze the deamination of isocystosine and guanine at rates that are approximately an order of magnitude lower. The three-dimensional structure of a homologous enzyme (gi|44264246) from the Sargasso Sea has been determined by X-ray diffraction methods to a resolution of 2.2 {angstrom} (PDB entry ). The enzyme folds as a ({beta}/{alpha}){sub 8} barrel and is a member of the amidohydrolase superfamily with a single zinc in the active site. This enzyme catalyzes the deamination of 8-oxoG with a k{sub cat}/K{sub m} value of 2.7 x 10{sup 5} M{sup -1} s{sup -1}. Computational docking of potential high-energy intermediates for the deamination reaction to the X-ray crystal structure suggests that active-site binding of 8-oxoG is facilitated by hydrogen-bond interactions from a conserved glutamine that follows {beta}-strand 1 with the carbonyl group at C6, a conserved tyrosine that follows {beta}-strand 2 with N7, and a conserved cysteine residue that follows {beta}-strand 4 with the carbonyl group at C8. A bioinformatic analysis of available protein sequences suggests that {approx}200 other bacteria possess an enzyme capable of catalyzing the deamination of 8-oxoG.

  6. Active destabilization of base pairs by a DNA glycosylase wedge initiates damage recognition

    Kuznetsov, Nikita A.; Bergonzo, Christina; Campbell, Arthur J.; Li, Haoquan; Mechetin, Grigory V.; de los Santos, Carlos; Grollman, Arthur P.; Fedorova, Olga S.; Zharkov, Dmitry O.; Simmerling, Carlos

    2015-01-01

    Formamidopyrimidine-DNA glycosylase (Fpg) excises 8-oxoguanine (oxoG) from DNA but ignores normal guanine. We combined molecular dynamics simulation and stopped-flow kinetics with fluorescence detection to track the events in the recognition of oxoG by Fpg and its mutants with a key phenylalanine residue, which intercalates next to the damaged base, changed to either alanine (F110A) or fluorescent reporter tryptophan (F110W). Guanine was sampled by Fpg, as evident from the F110W stopped-flow traces, but less extensively than oxoG. The wedgeless F110A enzyme could bend DNA but failed to proceed further in oxoG recognition. Modeling of the base eversion with energy decomposition suggested that the wedge destabilizes the intrahelical base primarily through buckling both surrounding base pairs. Replacement of oxoG with abasic (AP) site rescued the activity, and calculations suggested that wedge insertion is not required for AP site destabilization and eversion. Our results suggest that Fpg, and possibly other DNA glycosylases, convert part of the binding energy into active destabilization of their substrates, using the energy differences between normal and damaged bases for fast substrate discrimination. PMID:25520195

  7. Involvement of phylogenetically conserved acidic amino acid residues in catalysis by an oxidative DNA damage enzyme formamidopyrimidine glycosylase.

    Lavrukhin, O V; Lloyd, R S

    2000-12-12

    Formamidopyrimidine glycosylase (Fpg) is an important bacterial base excision repair enzyme, which initiates removal of damaged purines such as the highly mutagenic 8-oxoguanine. Similar to other glycosylase/AP lyases, catalysis by Fpg is known to proceed by a nucleophilic attack by an amino group (the secondary amine of its N-terminal proline) on C1' of the deoxyribose sugar at a damaged base, which results in the departure of the base from the DNA and removal of the sugar ring by beta/delta-elimination. However, in contrast to other enzymes in this class, in which acidic amino acids have been shown to be essential for glycosyl and phosphodiester bond scission, the catalytically essential acidic residues have not been documented for Fpg. Multiple sequence alignments of conserved acidic residues in all known bacterial Fpg-like proteins revealed six conserved glutamic and aspartic acid residues. Site-directed mutagenesis was used to change glutamic and aspartic acid residues to glutamines and asparagines, respectively. While the Asp to Asn mutants had no effect on the incision activity on 8-oxoguanine-containing DNA, several of the substitutions at glutamates reduced Fpg activity on the 8-oxoguanosine DNA, with the E3Q and E174Q mutants being essentially devoid of activity. The AP lyase activity of all of the glutamic acid mutants was slightly reduced as compared to the wild-type enzyme. Sodium borohydride trapping of wild-type Fpg and its E3Q and E174Q mutants on 8-oxoguanosine or AP site containing DNA correlated with the relative activity of the mutants on either of these substrates. PMID:11106507

  8. Oxidized dNTPs and the OGG1 and MUTYH DNA glycosylases combine to induce CAG/CTG repeat instability.

    Cilli, Piera; Ventura, Ilenia; Minoprio, Anna; Meccia, Ettore; Martire, Alberto; Wilson, Samuel H; Bignami, Margherita; Mazzei, Filomena

    2016-06-20

    DNA trinucleotide repeat (TNR) expansion underlies several neurodegenerative disorders including Huntington's disease (HD). Accumulation of oxidized DNA bases and their inefficient processing by base excision repair (BER) are among the factors suggested to contribute to TNR expansion. In this study, we have examined whether oxidation of the purine dNTPs in the dNTP pool provides a source of DNA damage that promotes TNR expansion. We demonstrate that during BER of 8-oxoguanine (8-oxodG) in TNR sequences, DNA polymerase β (POL β) can incorporate 8-oxodGMP with the formation of 8-oxodG:C and 8-oxodG:A mispairs. Their processing by the OGG1 and MUTYH DNA glycosylases generates closely spaced incisions on opposite DNA strands that are permissive for TNR expansion. Evidence in HD model R6/2 mice indicates that these DNA glycosylases are present in brain areas affected by neurodegeneration. Consistent with prevailing oxidative stress, the same brain areas contained increased DNA 8-oxodG levels and expression of the p53-inducible ribonucleotide reductase. Our in vitro and in vivo data support a model where an oxidized dNTPs pool together with aberrant BER processing contribute to TNR expansion in non-replicating cells. PMID:26980281

  9. New Family of Deamination Repair Enzymes in Uracil-DNA Glycosylase Superfamily*

    Lee, Hyun-Wook; Dominy, Brian N.; Cao, Weiguo

    2011-01-01

    DNA glycosylases play a major role in the repair of deaminated DNA damage. Previous investigations identified five families within the uracil-DNA glycosylase (UDG) superfamily. All enzymes within the superfamily studied thus far exhibit uracil-DNA glycosylase activity. Here we identify a new class of DNA glycosylases in the UDG superfamily that lacks UDG activity. Instead, these enzymes act as hypoxanthine-DNA glycosylases in vitro and in vivo. Molecular modeling and structure-guided mutation...

  10. Biosynthesis of the human DNA repair enzyme uracil DNA glycosylase

    Anti-human uracil DNA glycosylase monoclonal antibodies have been used to study the in vitro and in vivo biosynthesis of this human base excision repair enzyme. The in vitro translation of poly(A+)uracil DNA glycosylase mRNA was examined by immunoprecipitation of the [35S]methionine-labeled translation products. As identified by sucrose density analysis, immunoreactive in vitro products of 37,000 daltons and 24,000 daltons were translated from 16S poly(A+)RNA and from 11S poly (A+)RNA, respectively. However, only the 37,000 Mr polypeptide could be detected by immunoblot analysis of crude human placental and fibroblast extracts or by immunoprecipitation of [35S] labeled normal human cell extracts. This relative molecular weight correspond to the molecular weight observed for homogeneous human placental uracil DNA glycosylase. A placental mRNA preparation was used to construct a cDNA library in pUC8. Immunological screening identified two recombinant DNA plasmids each containing a 340 base pair insert. Northern blot analysis demonstrated that the insert hybridized to a 16S poly (A+)mRNA. These results suggest that immunoreactive uracil DNA glycosylase protein was synthesized at its enzymatically active molecular weight as the primary translation product of a 16S poly (A+)mRNA

  11. Age and metabolic risk factors associated with oxidatively damaged DNA in human peripheral blood mononuclear cells

    Løhr, Mille; Jensen, Annie; Eriksen, Louise;

    2015-01-01

    18-93 years. DNA damage was analyzed as strand breaks by the comet assay and levels of formamidopyrimidine (FPG-) and human 8-oxoguanine DNA glycosylase 1 (hOGG1)-sensitive sites There was an association between age and levels of FPG-sensitive sites for women, but not for men. The same tendency was...

  12. Sequence-dependent Structural Variation in DNA Undergoing Intrahelical Inspection by the DNA glycosylase MutM

    Sung, Rou-Jia; Zhang, Michael; Qi, Yan; Verdine, Gregory L. (Harvard-Med); (Harvard)

    2012-08-31

    MutM, a bacterial DNA-glycosylase, plays a critical role in maintaining genome integrity by catalyzing glycosidic bond cleavage of 8-oxoguanine (oxoG) lesions to initiate base excision DNA repair. The task faced by MutM of locating rare oxoG residues embedded in an overwhelming excess of undamaged bases is especially challenging given the close structural similarity between oxoG and its normal progenitor, guanine (G). MutM actively interrogates the DNA to detect the presence of an intrahelical, fully base-paired oxoG, whereupon the enzyme promotes extrusion of the target nucleobase from the DNA duplex and insertion into the extrahelical active site. Recent structural studies have begun to provide the first glimpse into the protein-DNA interactions that enable MutM to distinguish an intrahelical oxoG from G; however, these initial studies left open the important question of how MutM can recognize oxoG residues embedded in 16 different neighboring sequence contexts (considering only the 5'- and 3'-neighboring base pairs). In this study we set out to understand the manner and extent to which intrahelical lesion recognition varies as a function of the 5'-neighbor. Here we report a comprehensive, systematic structural analysis of the effect of the 5'-neighboring base pair on recognition of an intrahelical oxoG lesion. These structures reveal that MutM imposes the same extrusion-prone ('extrudogenic') backbone conformation on the oxoG lesion irrespective of its 5'-neighbor while leaving the rest of the DNA relatively free to adjust to the particular demands of individual sequences.

  13. Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.

    B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1997-01-01

    textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA glyc

  14. Targeted deletion of the genes encoding NTH1 and NEIL1 DNA N-glycosylases reveals the existence of novel carcinogenic oxidative damage to DNA☆

    Chan, Michael K.; Ocampo-Hafalla, Maria T.; Vartanian, Vladimir; Jaruga, Pawel; Kirkali, Güldal; Koenig, Karen L.; Brown, Stuart; Lloyd, R. Stephen; Dizdaroglu, Miral; Teebor, George W.

    2016-01-01

    We have generated a strain of mice lacking two DNA N-glycosylases of base excision repair (BER), NTH1 and NEIL1, homologs of bacterial Nth (endonuclease three) and Nei (endonuclease eight). Although these enzymes remove several oxidized bases from DNA, they do not remove the well-known carcinogenic oxidation product of guanine: 7,8-dihydro-8-oxoguanine (8-OH-Gua), which is removed by another DNA N-glycosylase, OGG1. The Nth1−/−Neil1−/− mice developed pulmonary and hepatocellular tumors in much higher incidence than either of the single knockouts, Nth1−/− and Neil1−/−. The pulmonary tumors contained, exclusively, activating GGT→GAT transitions in codon 12 of K-ras of their DNA. Such transitions contrast sharply with the activating GGT→GTT transversions in codon 12 of K-ras of the pathologically similar pulmonary tumors, which arose in mice lacking OGG1 and a second DNA N-glycosylase, MUTY. To characterize the biochemical phenotype of the knockout mice, the content of oxidative DNA base damage was analyzed from three tissues isolated from control, single and double knockout mice. The content of 8-OH-Gua was indistinguishable among all genotypes. In contrast, the content of 4,6-diamino-5-formamidopyrimidine (FapyAde) and 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua) derived from adenine and guanine, respectively, were increased in some but not all tissues of Neil1−/− and Neil1−/−Nth1−/− mice. The high incidence of tumors in our Nth1−/−Neil1−/− mice together with the nature of the activating mutation in the K-ras gene of their pulmonary tumors, reveal for the first time, the existence of mutagenic and carcinogenic oxidative damage to DNA which is not 8-OH-Gua. PMID:19346169

  15. 5-Methylcytosine-DNA glycosylase activity is present in a cloned G/T mismatch DNA glycosylase associated with the chicken embryo DNA demethylation complex

    Zhu, Bing; Zheng, Yong; Hess, Daniel; Angliker, Herbert; Schwarz, Steffen; Siegmann, Michel; Thiry, Stéphane; Jost, Jean-Pierre

    2000-01-01

    We previously have shown that DNA demethylation by chicken embryo 5-methylcytosine DNA glycosylase (5-MCDG) needs both RNA and proteins. One of these proteins is a RNA helicase. Further peptides were sequenced, and three of them are identical to the mammalian G/T mismatch DNA glycosylase. A 3,233-bp cDNA coding for the chicken homologue of human G/T mismatch DNA glycosylase was isolated and sequenced. The derived amino acid sequence (408 aa) shows 80% identity with the human G/T mismatch DNA ...

  16. Molecular crowding enhances facilitated diffusion of two human DNA glycosylases

    Cravens, Shannen L.; Schonhoft, Joseph D.; Rowland, Meng M.; Rodriguez, Alyssa A.; Anderson, Breeana G.; Stivers, James T.

    2015-01-01

    Intracellular space is at a premium due to the high concentrations of biomolecules and is expected to have a fundamental effect on how large macromolecules move in the cell. Here, we report that crowded solutions promote intramolecular DNA translocation by two human DNA repair glycosylases. The crowding effect increases both the efficiency and average distance of DNA chain translocation by hindering escape of the enzymes to bulk solution. The increased contact time with the DNA chain provides...

  17. Molecular cloning of human uracil-DNA glycosylase, a highly conserved DNA repair enzyme.

    Olsen, L C; Aasland, R; Wittwer, C U; Krokan, H E; Helland, D E

    1989-01-01

    Uracil-DNA glycosylase is the DNA repair enzyme responsible for the removal of uracil from DNA, and it is present in all organisms investigated. Here we report on the cloning and sequencing of a cDNA encoding the human uracil-DNA glycosylase. The sequences of uracil-DNA glycosylases from yeast, Escherichia coli, herpes simplex virus type 1 and 2, and homologous genes from varicella-zoster and Epstein-Barr viruses are known. It is shown in this report that the predicted amino acid sequence of ...

  18. Mitochondrial Targeted Endonuclease III DNA Repair Enzyme Protects against Ventilator Induced Lung Injury in Mice

    Masahiro Hashizume; Marc Mouner; Joshua M. Chouteau; Gorodnya, Olena M.; Ruchko, Mykhaylo V.; Wilson, Glenn L.; Gillespie, Mark N.; Parker, James C.

    2014-01-01

    The mitochondrial targeted DNA repair enzyme, 8-oxoguanine DNA glycosylase 1, was previously reported to protect against mitochondrial DNA (mtDNA) damage and ventilator induced lung injury (VILI). In the present study we determined whether mitochondrial targeted endonuclease III (EndoIII) which cleaves oxidized pyrimidines rather than purines from damaged DNA would also protect the lung. Minimal injury from 1 h ventilation at 40 cmH2O peak inflation pressure (PIP) was reversed by EndoIII pret...

  19. Human polymorphic variants of the NEIL1 DNA glycosylase.

    Roy, Laura M; Jaruga, Pawel; Wood, Thomas G; McCullough, Amanda K; Dizdaroglu, Miral; Lloyd, R Stephen

    2007-05-25

    In mammalian cells, the repair of DNA bases that have been damaged by reactive oxygen species is primarily initiated by a series of DNA glycosylases that include OGG1, NTH1, NEIL1, and NEIL2. To explore the functional significance of NEIL1, we recently reported that neil1 knock-out and heterozygotic mice develop the majority of symptoms of metabolic syndrome (Vartanian, V., Lowell, B., Minko, I. G., Wood, T. G., Ceci, J. D., George, S., Ballinger, S. W., Corless, C. L., McCullough, A. K., and Lloyd, R. S. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 1864-1869). To determine whether this phenotype could be causally related to human disease susceptibility, we have characterized four polymorphic variants of human NEIL1. Although three of the variants (S82C, G83D, and D252N) retained near wild type levels of nicking activity on abasic (AP) site-containing DNA, G83D did not catalyze the wild type beta,delta-elimination reaction but primarily yielded the beta-elimination product. The AP nicking activity of the C136R variant was significantly reduced. Glycosylase nicking activities were measured on both thymine glycol-containing oligonucleotides and gamma-irradiated genomic DNA using gas chromatography/mass spectrometry. Two of the polymorphic variants (S82C and D252N) showed near wild type enzyme specificity and kinetics, whereas G83D was devoid of glycosylase activity. Although insufficient quantities of C136R could be obtained to carry out gas chromatography/mass spectrometry analyses, this variant was also devoid of the ability to incise thymine glycol-containing oligonucleotide, suggesting that it may also be glycosylase-deficient. Extrapolation of these data suggests that individuals who are heterozygous for these inactive variant neil1 alleles may be at increased risk for metabolic syndrome. PMID:17389588

  20. Reactions of the OOH radical with guanine: Mechanisms of formation of 8-oxoguanine and other products

    Kumar, Nagendra; Shukla, P. K.; Mishra, P. C.

    2010-09-01

    The mutagenic product 8-oxoguanine (8-oxoGua) is formed due to intermediacy of peroxyl (OOR) radicals in lipid peroxidation and protein oxidation-induced DNA damage. The mechanisms of these reactions are not yet understood properly. Therefore, in the present study, the mechanisms of formation of 8-oxoGua and other related products due to the reaction of the guanine base of DNA with the hydroperoxyl radical (OOH) were investigated theoretically employing the B3LYP and BHandHLYP hybrid functionals of density functional theory and the polarizable continuum model for solvation. It is found that the reaction of the OOH radical with guanine can occur following seven different mechanisms leading to the formation of various products including 8-oxoGua, its radicals, 5-hydroxy-8-oxoguanine and CO 2. The mechanism that yields 8-oxoGua as an intermediate and 5-hydroxy-8-oxoGua as the final product was found to be energetically most favorable.

  1. Molecular crowding enhances facilitated diffusion of two human DNA glycosylases.

    Cravens, Shannen L; Schonhoft, Joseph D; Rowland, Meng M; Rodriguez, Alyssa A; Anderson, Breeana G; Stivers, James T

    2015-04-30

    Intracellular space is at a premium due to the high concentrations of biomolecules and is expected to have a fundamental effect on how large macromolecules move in the cell. Here, we report that crowded solutions promote intramolecular DNA translocation by two human DNA repair glycosylases. The crowding effect increases both the efficiency and average distance of DNA chain translocation by hindering escape of the enzymes to bulk solution. The increased contact time with the DNA chain provides for redundant damage patrolling within individual DNA chains at the expense of slowing the overall rate of damaged base removal from a population of molecules. The significant biological implication is that a crowded cellular environment could influence the mechanism of damage recognition as much as any property of the enzyme or DNA. PMID:25845592

  2. A DNA glycosylase from human lymphoblasts that releases cis-thymine glycol from oxidized DNA

    An endonuclease (termed the UVX endonuclease) partially purified from cultured human leukemic lymphoblasts (CEM-CCRF line) was previously shown to act specifically on DNA irradiated by ionizing radiation, UV light, or treated with osmium tetroxide. This activity is tightly associated with an endonuclease specific for apurinic /apyrimidinic (AP) sites in DNA, suggesting that the initial attack on the radiation or oxidation induced lesions is by a DNA glycosylase that generates such AP sites. Thymine glycol has been shown to be a product common to γ-irradiated and oxidized DNA and in the present studies the authors have shown that the UVX endonuclease releases free cis-thymine glycol from osmium tetroxide treated DNA. HPLC analysis of the reaction products failed to detect any cis-thymidine glycol or nucleotide material indicating that the activity responsible is truly a DNA glycosylase. This enzyme thus resembles Endonuclease III of E. coli which contains both AP endonuclease and thymine glucol-DNA glycosylase activities

  3. Transcriptional regulation of thymine DNA glycosylase (TDG) by the tumor suppressor protein p53

    da Costa, Nathalia Meireles; Hautefeuille, Agnès; Cros, Marie-Pierre; Melendez, Matias Eliseo; Waters, Timothy; Swann, Peter; Hainaut, Pierre; Pinto, Luis Felipe Ribeiro

    2012-01-01

    Thymine DNA glycosylase (TDG) belongs to the superfamily of uracil DNA glycosylases (UDG) and is the first enzyme in the base-excision repair pathway (BER) that removes thymine from G:T mismatches at CpG sites. This glycosylase activity has also been found to be critical for active demethylation of genes involved in embryonic development. Here we show that wild-type p53 transcriptionally regulates TDG expression. Chromatin immunoprecipitation (ChIP) and luciferase assays indicate that wild-ty...

  4. Linking active DNA demethylation by Thymine DNA Glycosylase with epigenetic regulation of gene expression

    Wirz, Annika

    2014-01-01

    The correct regulation of epigenetic modifications is crucial for cell plasticity and the establishment of cell identity. The underlying molecular mechanisms are not clear, but a role for DNA repair proteins has been implicated in this context, the investigation of which was the overall aim of my PhD thesis. The Thymine DNA Glycosylase (TDG) was described to excise the deamination products of cytosine (C) and 5-methylcytosine (5-mC), thereby initiating base excision repair (BER; Nedderman...

  5. Two DNA glycosylases in Esherichia coli which release primarily 3-methyladenine

    Two enzymes have been partially purified from Escherichia coli and designated 3-methyladenine DNA glycosylases I and II. The apparent molecular weight of glycosylase I is 20,000, and that of II is 27,000. Glycosylase I releases 3-methyladenine (3-MeA) while II releases 3-MeA, 3-methylguanine (3-MeG), 7-methylguanine (7-MeG), and 7-methyladenine (7-MeA). The rate of release of 3-MeA by glycosylase II is 30 times that of 7-MeG. Glycosylase I is missing in mutants tag 1 and tag 2. In crude extracts, the 3-MeA activity of II is approximately 10% of the total 3-MeA activity. A 50% inactivation at 480C required 5 min for I and 65 min for II. The 3-MeA and 7-MeG activities of the glycosylase II preparation could not be separated by isoelectric focusing, by chromatography of DEAE, Sephadex G-100, phosphocellulose, DNA-cellulose, or carboxymethylcellulose, or by heating at 500C

  6. Base excision by thymine DNA glycosylase mediates DNA-directed cytotoxicity of 5-fluorouracil.

    Christophe Kunz

    2009-04-01

    Full Text Available 5-Fluorouracil (5-FU, a chemotherapeutic drug commonly used in cancer treatment, imbalances nucleotide pools, thereby favoring misincorporation of uracil and 5-FU into genomic DNA. The processing of these bases by DNA repair activities was proposed to cause DNA-directed cytotoxicity, but the underlying mechanisms have not been resolved. In this study, we investigated a possible role of thymine DNA glycosylase (TDG, one of four mammalian uracil DNA glycosylases (UDGs, in the cellular response to 5-FU. Using genetic and biochemical tools, we found that inactivation of TDG significantly increases resistance of both mouse and human cancer cells towards 5-FU. We show that excision of DNA-incorporated 5-FU by TDG generates persistent DNA strand breaks, delays S-phase progression, and activates DNA damage signaling, and that the repair of 5-FU-induced DNA strand breaks is more efficient in the absence of TDG. Hence, excision of 5-FU by TDG, but not by other UDGs (UNG2 and SMUG1, prevents efficient downstream processing of the repair intermediate, thereby mediating DNA-directed cytotoxicity. The status of TDG expression in a cancer is therefore likely to determine its response to 5-FU-based chemotherapy.

  7. Microscopic mechanism of DNA damage searching by hOGG1

    Rowland, Meng M.; Schonhoft, Joseph D.; McKibbin, Paige L.; David, Sheila S.; Stivers, James T.

    2014-01-01

    The DNA backbone is often considered a track that allows long-range sliding of DNA repair enzymes in their search for rare damage sites in DNA. A proposed exemplar of DNA sliding is human 8-oxoguanine (oG) DNA glycosylase 1 (hOGG1), which repairs mutagenic oG lesions in DNA. Here we use our high-resolution molecular clock method to show that macroscopic 1D DNA sliding of hOGG1 occurs by microscopic 2D and 3D steps that masquerade as sliding in resolution-limited single-molecule images. Strand...

  8. A novel monofunctional DNA glycosylase activity against thymine glycol in mouse cell nuclei

    Reactive oxygen species continuously oxidize DNA bases and threaten the genetic integrity. Thymine glycol (TG), one of the representative oxidized products, is repaired mainly by base excision repair (BER). In Escherichia coli, endonuclease III (Nth) and endonuclease VIII (Nei) are known to actively remove TG from DNA, and the homologs are well conserved in various organisms. These are bifunctional glycosylases, also associated with apurinic/apyrimidinic (AP) lyase activity. In the present study, a monofunctional TG-DNA glycosylase activity is shown to be one of the predominant nuclear activities present in some mouse tissues. By combining hypertonic extraction and column chromatography, we successfully separated the novel activity from majority of the bifunctional activities. Since it has been reported that mNTH1 may not be a dominant nuclear activity, the monofunctional glycosylase activity, together with mNEIL1, may be the major TG-DNA glycosylases in the mouse nucleus. The optimal reaction conditions for the monofunctional activity were found to be pH 7-8 and 100-150 mM KC1, and the activity was resistant to 20 mM EDTA. High monofunctional activity was detected in the spleen and stomach, while the level was significantly lower in the liver, suggesting that the contribution of the monofunctional activity is variable among organs. (author)

  9. Induction of S.cerevisiae MAG 3-methyladenine DNA glycosylase transcript levels in response to DNA damage.

    J. Chen; Samson, L

    1991-01-01

    We previously showed that the expression of the Saccharomyces cerevisiae MAG 3-methyladenine (3MeA) DNA glycosylase gene, like that of the E. coli alkA 3MeA DNA glycosylase gene, is induced by alkylating agents. Here we show that the MAG induction mechanism differs from that of alkA, at least in part, because MAG mRNA levels are not only induced by alkylating agents but also by UV light and the UV-mimetic agent 4-nitroquinoline-1-oxide. Unlike some other yeast DNA-damage-inducible genes, MAG ...

  10. Trypanosoma cruzi contains a single detectable uracil-DNA glycosylase and repairs uracil exclusively via short patch base excision repair

    Pena Diaz, Javier; Akbari, Mansour; Sundheim, Ottar; Farez-Vidal, M Esther; Andersen, Sonja; Sneve, Ragnhild; Gonzalez-Pacanowska, Dolores; Krokan, Hans E; Slupphaug, Geir

    2004-01-01

    Enzymes involved in genomic maintenance of human parasites are attractive targets for parasite-specific drugs. The parasitic protozoan Trypanosoma cruzi contains at least two enzymes involved in the protection against potentially mutagenic uracil, a deoxyuridine triphosphate nucleotidohydrolase (d......UTPase) and a uracil-DNA glycosylase belonging to the highly conserved UNG-family. Uracil-DNA glycosylase activities excise uracil from DNA and initiate a multistep base-excision repair (BER) pathway to restore the correct nucleotide sequence. Here we report the biochemical characterisation of T.cruzi UNG (Tc......UNG) and its contribution to the total uracil repair activity in T.cruzi. TcUNG is shown to be the major uracil-DNA glycosylase in T.cruzi. The purified recombinant TcUNG exhibits substrate preference for removal of uracil in the order ssU>U:G>U:A, and has no associated thymine-DNA glycosylase activity. T.cruzi...

  11. Cockayne Syndrome group B protein stimulates NEIL2 DNA glycosylase activity

    Aamann, Maria Diget; Hvitby, Christina Poulsen; Popuri, Venkateswarlu;

    2014-01-01

    excision repair and base excision repair. Here, we describe a new interaction partner for CSB, the DNA glycosylase NEIL2. Using both cell extracts and recombinant proteins, CSB and NEIL2 were found to physically interact independently of DNA. We further found that CSB is able to stimulate NEIL2 glycosylase......Cockayne Syndrome is a segmental premature aging syndrome, which can be caused by loss of function of the CSB protein. CSB is essential for genome maintenance and has numerous interaction partners with established roles in different DNA repair pathways including transcription coupled nucleotide...... activity on a 5-hydroxyl uracil lesion in a DNA bubble structure substrate in vitro. A novel 4,6-diamino-5-formamidopyrimidine (FapyA) specific incision activity of NEIL2 was also stimulated by CSB. To further elucidate the biological role of the interaction, immunofluorescence studies were performed...

  12. G-quadruplex DNA structures can interfere with uracil glycosylase activity in vitro.

    Holton, Nate W; Larson, Erik D

    2016-07-01

    Genome sequences that contain tandem repeats of guanine can form stable four-stranded structures known as G-quadruplex, or G4 DNA. While the molecular mechanisms are not fully defined, such guanine-rich loci are prone to mutagenesis and recombination. Various repair pathways function to reduce the potential for genome instability by correcting base damage and replication errors; however, it is not yet fully defined how well these processes function at G4 DNA. One frequent form of base damage occurs from cytidine deamination, resulting in deoxyuracil and UG mismatches. In duplex and single-stranded DNA, uracil bases are recognised and excised by uracil glycosylases. Here, we tested the efficiency of uracil glycosylase activity in vitro on uracil bases located directly adjacent to guanine repeats and G4 DNA. We show that uracil excision by bacterial UDG and human hUNG2 is reduced at uracils positioned directly 5' or 3' of a guanine tetrad. Control reactions using oligonucleotides disrupted for G4 formation or reaction conditions that do not favour G4 formation resulted in full uracil excision activity. Based on these in vitro results, we suggest that folding of guanine-rich DNA into G4 DNA results in a DNA conformation that is resistant to uracil glycosylase-initiated repair and this has the potential to increase the risk of instability at guanine repeats in the genome. PMID:26671821

  13. The oxidative DNA glycosylases of Mycobacterium tuberculosis exhibit different substrate preferences from their Escherichia coli counterparts

    Guo, Yin; Bandaru, Viswanath; Jaruga, Pawel; Zhao, Xiaobei; Burrows, Cynthia J.; Iwai, Shigenori; Dizdaroglu, Miral; Bond, Jeffrey P.; Wallace, Susan S.

    2009-01-01

    The DNA glycosylases that remove oxidized DNA bases fall into two general families: the Fpg/Nei family and the Nth superfamily. Based on protein sequence alignments, we identified four putative Fpg/Nei family members, as well as a putative Nth protein in Mycobacterium tuberculosis H37Rv. All four Fpg/Nei proteins were successfully overexpressed using a bicistronic vector created in our laboratory. The MtuNth protein was also overexpressed in soluble form. The substrate specificities of the pu...

  14. Stimulation of DNA Glycosylase Activities by XPC Protein Complex: Roles of Protein-Protein Interactions

    Yuichiro Shimizu

    2010-01-01

    Full Text Available We showed that XPC complex, which is a DNA damage detector for nucleotide excision repair, stimulates activity of thymine DNA glycosylase (TDG that initiates base excision repair. XPC appeared to facilitate the enzymatic turnover of TDG by promoting displacement from its own product abasic site, although the precise mechanism underlying this stimulation has not been clarified. Here we show that XPC has only marginal effects on the activity of E. coli TDG homolog (EcMUG, which remains bound to the abasic site like human TDG but does not significantly interacts with XPC. On the contrary, XPC significantly stimulates the activities of sumoylated TDG and SMUG1, both of which exhibit quite different enzymatic kinetics from unmodified TDG but interact with XPC. These results point to importance of physical interactions for stimulation of DNA glycosylases by XPC and have implications in the molecular mechanisms underlying mutagenesis and carcinogenesis in XP-C patients.

  15. Uracil-DNA glycosylase-deficient yeast exhibit a mitochondrial mutator phenotype

    Chatterjee, Aditi; Keshav K Singh

    2001-01-01

    Mutations in mitochondrial DNA (mtDNA) have been reported in cancer and are involved in the pathogenesis of many mitochondrial diseases. Uracil-DNA glycosylase, encoded by the UNG1 gene in Saccharomyces cerevisiae, repairs uracil in DNA formed due to deamination of cytosine. Our study demonstrates that inactivation of the UNG1 gene leads to at least a 3-fold increased frequency of mutations in mtDNA compared with the wild-type. Using a Ung1p–green fluorescent protein (GFP) fusion construct, w...

  16. Structure of uracil-DNA glycosylase from Mycobacterium tuberculosis: insights into interactions with ligands

    The molecule of uracil-DNA glycosylase from M. tuberculosis exhibits domain motion on binding to DNA or a proteinaceous inhibitor. The highly conserved DNA-binding region interacts with a citrate ion in the structure. Uracil N-glycosylase (Ung) is the most thoroughly studied of the group of uracil DNA-glycosylase (UDG) enzymes that catalyse the first step in the uracil excision-repair pathway. The overall structure of the enzyme from Mycobacterium tuberculosis is essentially the same as that of the enzyme from other sources. However, differences exist in the N- and C-terminal stretches and some catalytic loops. Comparison with appropriate structures indicate that the two-domain enzyme closes slightly when binding to DNA, while it opens slightly when binding to the proteinaceous inhibitor Ugi. The structural changes in the catalytic loops on complexation reflect the special features of their structure in the mycobacterial protein. A comparative analysis of available sequences of the enzyme from different sources indicates high conservation of amino-acid residues in the catalytic loops. The uracil-binding pocket in the structure is occupied by a citrate ion. The interactions of the citrate ion with the protein mimic those of uracil, in addition to providing insights into other possible interactions that inhibitors could be involved in

  17. EXCISED DAMAGED BASE DETERMINES THE TURNOVER OF HUMAN N-METHYLPURINE-DNA GLYCOSYLASE

    Adhikari, Sanjay; Üren, Aykut; Roy, Rabindra

    2009-01-01

    N-Methylpurine-DNA glycosylase (MPG) initiates base excision repair in DNA by removing a wide variety of alkylated, deaminated, and lipid peroxidation-induced purine adducts. In this study, we tested the role of excised base on MPG’s enzymatic activity. After the reaction, MPG produced two products: free damaged base and AP-site containing DNA. Our results showed that MPG excises 1, N6-ethenoadenine (εA) from εA-containing oligonucleotide (εA-DNA) at a similar or slightly increased efficiency...

  18. Cockayne syndrome group B protein stimulates repair of formamidopyrimidines by NEIL1 DNA glycosylase

    Muftuoglu, Meltem; de Souza-Pinto, Nadja C; Dogan, Arin;

    2009-01-01

    Cockayne syndrome (CS) is a premature aging condition characterized by sensitivity to UV radiation. However, this phenotype does not explain the progressive neurodegeneration in CS patients. It could be due to the hypersensitivity of CSB-deficient cells to oxidative stress. So far most studies on...... for endonuclease VIII-like (NEIL1) DNA glycosylase. Results presented here show that csb(-/-) mice have a higher level of endogenous FapyAde and FapyGua in DNA from brain and kidney than wild type mice as well as higher levels of endogenous FapyAde in genomic DNA and mtDNA from liver. In addition, CSB...

  19. Expression and the Peculiar Enzymatic Behavior of the Trypanosoma cruzi NTH1 DNA Glycosylase

    Ormeño, Fernando; Barrientos, Camila; Ramirez, Santiago; Ponce, Iván; Valenzuela, Lucía; Sepúlveda, Sofía; Bitar, Mainá; Kemmerling, Ulrike; Machado, Carlos Renato; Cabrera, Gonzalo; Galanti, Norbel

    2016-01-01

    Trypanosoma cruzi, the etiological agent of Chagas’ disease, presents three cellular forms (trypomastigotes, epimastigotes and amastigotes), all of which are submitted to oxidative species in its hosts. However, T. cruzi is able to resist oxidative stress suggesting a high efficiency of its DNA repair machinery.The Base Excision Repair (BER) pathway is one of the main DNA repair mechanisms in other eukaryotes and in T. cruzi as well. DNA glycosylases are enzymes involved in the recognition of oxidative DNA damage and in the removal of oxidized bases, constituting the first step of the BER pathway. Here, we describe the presence and activity of TcNTH1, a nuclear T. cruzi DNA glycosylase. Surprisingly, purified recombinant TcNTH1 does not remove the thymine glycol base, but catalyzes the cleavage of a probe showing an AP site. The same activity was found in epimastigote and trypomastigote homogenates suggesting that the BER pathway is not involved in thymine glycol DNA repair. TcNTH1 DNA-binding properties assayed in silico are in agreement with the absence of a thymine glycol removing function of that parasite enzyme. Over expression of TcNTH1 decrease parasite viability when transfected epimastigotes are submitted to a sustained production of H2O2.Therefore, TcNTH1 is the only known NTH1 orthologous unable to eliminate thymine glycol derivatives but that recognizes and cuts an AP site, most probably by a beta-elimination mechanism. We cannot discard that TcNTH1 presents DNA glycosylase activity on other DNA base lesions. Accordingly, a different DNA repair mechanism should be expected leading to eliminate thymine glycol from oxidized parasite DNA. Furthermore, TcNTH1 may play a role in the AP site recognition and processing. PMID:27284968

  20. A 5-methylcytosine DNA glycosylase/lyase demethylates the retrotransposon Tos17 and promotes its transposition in rice

    La, Honggui

    2011-09-06

    DNA 5-methylcytosine (5-meC) is an important epigenetic mark for transcriptional gene silencing in many eukaryotes. In Arabidopsis, 5-meC DNA glycosylase/lyases actively remove 5-meC to counter-act transcriptional gene silencing in a locus-specific manner, and have been suggested to maintain the expression of transposons. However, it is unclear whether plant DNA demethylases can promote the transposition of transposons. Here we report the functional characterization of the DNA glycosylase/lyase DNG701 in rice. DNG701 encodes a large (1,812 amino acid residues) DNA glycosylase domain protein. Recombinant DNG701 protein showed 5-meC DNA glycosylase and lyase activities in vitro. Knockout or knockdown of DNG701 in rice plants led to DNA hypermethylation and reduced expression of the retrotransposon Tos17. Tos17 showed less transposition in calli derived from dng701 knockout mutant seeds compared with that in wild-type calli. Overexpression of DNG701 in both rice calli and transgenic plants substantially reduced DNA methylation levels of Tos17 and enhanced its expression. The overexpression also led to more frequent transposition of Tos17 in calli. Our results demonstrate that rice DNG701 is a 5-meC DNA glycosylase/lyase responsible for the demethylation of Tos17 and this DNA demethylase plays a critical role in promoting Tos17 transposition in rice calli.

  1. Crystal Structure of the Vaccinia Virus Uracil-DNA Glycosylase in Complex with DNA.

    Burmeister, Wim P; Tarbouriech, Nicolas; Fender, Pascal; Contesto-Richefeu, Céline; Peyrefitte, Christophe N; Iseni, Frédéric

    2015-07-17

    Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase catalytic subunit E9 associated with its heterodimeric co-factor A20·D4 required for processive genome synthesis. Although A20 has no known enzymatic activity, D4 is an active uracil-DNA glycosylase (UNG). The presence of a repair enzyme as a component of the viral replication machinery suggests that, for poxviruses, DNA synthesis and base excision repair is coupled. We present the 2.7 Å crystal structure of the complex formed by D4 and the first 50 amino acids of A20 (D4·A201-50) bound to a 10-mer DNA duplex containing an abasic site resulting from the cleavage of a uracil base. Comparison of the viral complex with its human counterpart revealed major divergences in the contacts between protein and DNA and in the enzyme orientation on the DNA. However, the conformation of the dsDNA within both structures is very similar, suggesting a dominant role of the DNA conformation for UNG function. In contrast to human UNG, D4 appears rigid, and we do not observe a conformational change upon DNA binding. We also studied the interaction of D4·A201-50 with different DNA oligomers by surface plasmon resonance. D4 binds weakly to nonspecific DNA and to uracil-containing substrates but binds abasic sites with a Kd of gives new insight into the role of D4 as a co-factor of vaccinia virus DNA polymerase and allows a better understanding of the structural determinants required for UNG action. PMID:26045555

  2. Differential modes of DNA binding by mismatch uracil DNA glycosylase from Escherichia coli: implications for abasic lesion processing and enzyme communication in the base excision repair pathway

    Grippon, Seden; Zhao, Qiyuan; Robinson, Tom; Marshall, Jacqueline J. T.; O’Neill, Rory J.; Manning, Hugh; Kennedy, Gordon; Dunsby, Christopher; Neil, Mark; Halford, Stephen E.; French, Paul M. W.; Baldwin, Geoff S.

    2010-01-01

    Mismatch uracil DNA glycosylase (Mug) from Escherichia coli is an initiating enzyme in the base-excision repair pathway. As with other DNA glycosylases, the abasic product is potentially more harmful than the initial lesion. Since Mug is known to bind its product tightly, inhibiting enzyme turnover, understanding how Mug binds DNA is of significance when considering how Mug interacts with downstream enzymes in the base-excision repair pathway. We have demonstrated differential binding modes o...

  3. Oxidatively damaged DNA in rats exposed by oral gavage to C60 fullerenes and single-walled carbon nanotubes

    Folkmann, Janne K; Risom, Lotte; Jacobsen, Nicklas R;

    2009-01-01

    extent of genotoxicity, whereas corn oil per se generated more genotoxicity than the particles. Although there was increased mRNA expression of 8-oxoguanine DNA glycosylase in the liver of C60 fullerene-treated rats, we found no significant increase in repair activity. CONCLUSIONS: Oral exposure to low...... the initiating event in the development of cancer. OBJECTIVE: In this study we investigated the effect of a single oral administration of C60 fullerenes and SWCNT. METHODS: We measured the level of oxidative damage to DNA as the premutagenic 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) in the colon...

  4. A DNA enzyme with N-glycosylase activity

    Sheppard, Terry L.; Ordoukhanian, Phillip; Joyce, Gerald F.

    2000-01-01

    In vitro evolution was used to develop a DNA enzyme that catalyzes the site-specific depurination of DNA with a catalytic rate enhancement of about 106-fold. The reaction involves hydrolysis of the N-glycosidic bond of a particular deoxyguanosine residue, leading to DNA strand scission at the apurinic site. The DNA enzyme contains 93 nucleotides and is structurally complex. It has an absolute requirement for a divalent metal cation and exhibits optimal activity at about pH 5. The mechanism of...

  5. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [32P]-based oligonucleotide cleavage assay (MPG substrate 5′-CCGCTεAGCGGGTACCGAGCTCGAAT; εA = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 ± 1.67 fmol/μg DNA/h vs 3.47 ± 1.35 fmol/μg DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16–7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  6. Transcriptional regulation of thymine DNA glycosylase (TDG) by the tumor suppressor protein p53.

    da Costa, Nathalia Meireles; Hautefeuille, Agnès; Cros, Marie-Pierre; Melendez, Matias Eliseo; Waters, Timothy; Swann, Peter; Hainaut, Pierre; Pinto, Luis Felipe Ribeiro

    2012-12-15

    Thymine DNA glycosylase (TDG) belongs to the superfamily of uracil DNA glycosylases (UDG) and is the first enzyme in the base-excision repair pathway (BER) that removes thymine from G:T mismatches at CpG sites. This glycosylase activity has also been found to be critical for active demethylation of genes involved in embryonic development. Here we show that wild-type p53 transcriptionally regulates TDG expression. Chromatin immunoprecipitation (ChIP) and luciferase assays indicate that wild-type p53 binds to a domain of TDG promoter containing two p53 consensus response elements (p53RE) and activates its transcription. Next, we have used a panel of cell lines with different p53 status to demonstrate that TDG mRNA and protein expression levels are induced in a p53-dependent manner under different conditions. This panel includes isogenic breast and colorectal cancer cell lines with wild-type or inactive p53, esophageal squamous cell carcinoma cell lines lacking p53 or expressing a temperature-sensitive p53 mutant and normal human bronchial epithelial cells. Induction of TDG mRNA expression is accompanied by accumulation of TDG protein in both nucleus and cytoplasm, with nuclear re-localization occurring upon DNA damage in p53-competent, but not -incompetent, cells. These observations suggest a role for p53 activity in TDG nuclear translocation. Overall, our results show that TDG expression is directly regulated by p53, suggesting that loss of p53 function may affect processes mediated by TDG, thus negatively impacting on genetic and epigenetic stability. PMID:23165212

  7. SPR imaging for label-free multiplexed analyses of DNA N-glycosylase interactions with damaged DNA duplexes

    Base excision repair (BER) is the major mechanism for the correction of damaged nucleobases resulting from the alkylation and oxidation of DNA. The first step in the BER pathway consists of excision of the abnormal base by several specific DNA N-glycosylases. A decrease in BER activity was found to be related to an increased risk of carcinogenesis and aging. To investigate BER activities we set up a new device for DNA repair analysis based on surface plasmon resonance imaging (SPRi). Oligonucleotides bearing an abnormal nucleoside, namely 8-oxo-7,8-dihydro-2'-deoxyguanosine and (5'S)-5',8-cyclo-purine-2'-deoxy-nucleoside, were grafted by a pyrrole electro-copolymerization process on a glass prism coated with a gold layer. The latter label-free DNA sensor chip permits the detection of N-glycosylase/AP-lyase activity as well as the binding of repair proteins to DNA damage without cleavage activity. Thus, the Fapy DNA N-glycosylase (Fpg) protein is shown as expected to bind and then cleave its natural substrate, namely 8-oxo-7,8-dihydro-guanine, together with the resulting abasic site. Using the current SPR imaging-based DNA array we observed an original binding activity of Fpg towards the (5'S)-5',8-cyclod-Adenosine residue. These results altogether show that SPR imaging may be used to simultaneously and specifically detect recognition and excision of several damaged DNA nucleobases, and constitutes an interesting technique to screen inhibitors of DNA repair proteins. (authors)

  8. den V gene of bacteriophage T4 determines a DNA glycosylase specific for pyrimidine dimers in DNA.

    Seawell, P C; Smith, C A; Ganesan, A K

    1980-01-01

    Endonuclease V of bacteriophage T4 has been described as an enzyme, coded for by the denV gene, that incises UV-irradiated DNA. It has recently been proposed that incision of irradiated DNA by this enzyme and the analogous "correndonucleases" I and II of Micrococcus luteus requires the sequential action of a pyrimidine dimer-specific DNA glycosylase and an apyrimidinic/apurinic endonuclease. In support of this two-step mechanism, we found that our preparations of T4 endonuclease V contained a...

  9. Cytosine photoproduct-DNA glycosylase in Escherichia coli and cultured human cells

    Ultraviolet irradiation of DNA produces a variety of pyrimidine base damages. The activities of Escherichia coli endonuclease III and a human lymphoblast endonuclease that incises ultraviolet-irradiated DNA at modified cytosine moieties were compared. Both the bacterial and human enzymes release this cytosine photoproduct as a free base. These glycosylase activities are linear with times of reaction, quantities of enzyme, and irradiation dosages of the substrates. Both enzyme activities are similarly inhibited by the addition of monovalent and divalent cations. Analysis by DNA sequencing identified loci of endonucleolytic incision as cytosines. These are neither cyclobutane pyrimidine dimers, 6-(1,2-dihydro-2-oxo-4-pyrimidinyl)-5-methyl-2,4(1H,3H)-pyrimidinediones, nor apyrimidinic sites. This cytosine photoproduct is separable from unmodified cytosine by high-performance liquid chromatography. This separation should facilitate identification of this modified cytosine and elucidation of its biological significance

  10. Non-productive DNA damage binding by DNA glycosylase-like protein Mag2 from Schizosaccharomyces pombe

    Adhikary, Suraj; Cato, Marilyn C.; McGary, Kris; Rokas, Antonis; Eichman, Brandt F.

    2012-01-01

    Schizosaccharomyces pombe contains two paralogous proteins, Mag1 and Mag2, related to the helix-hairpin-helix (HhH) superfamily of alkylpurine DNA glycosylases from yeast and bacteria. Phylogenetic analysis of related proteins from four Schizosaccharomyces and other fungal species shows that the Mag1/Mag2 duplication is unique to the genus Schizosaccharomyces and most likely occurred in its ancestor. Mag1 excises N3- and N7-alkylguanines and 1,N6-ethenoadenine from DNA, whereas Mag2 has been ...

  11. Repair of Alkylation Damage in Eukaryotic Chromatin Depends on Searching Ability of Alkyladenine DNA Glycosylase.

    Zhang, Yaru; O'Brien, Patrick J

    2015-11-20

    Human alkyladenine DNA glycosylase (AAG) initiates the base excision repair pathway by excising alkylated and deaminated purine lesions. In vitro biochemical experiments demonstrate that AAG uses facilitated diffusion to efficiently search DNA to find rare sites of damage and suggest that electrostatic interactions are critical to the searching process. However, it remains an open question whether DNA searching limits the rate of DNA repair in vivo. We constructed AAG mutants with altered searching ability and measured their ability to protect yeast from alkylation damage in order to address this question. Each of the conserved arginine and lysine residues that are near the DNA binding interface were mutated, and the functional impacts were evaluated using kinetic and thermodynamic analysis. These mutations do not perturb catalysis of N-glycosidic bond cleavage, but they decrease the ability to capture rare lesion sites. Nonspecific and specific DNA binding properties are closely correlated, suggesting that the electrostatic interactions observed in the specific recognition complex are similarly important for DNA searching complexes. The ability of the mutant proteins to complement repair-deficient yeast cells is positively correlated with the ability of the proteins to search DNA in vitro, suggesting that cellular resistance to DNA alkylation is governed by the ability to find and efficiently capture cytotoxic lesions. It appears that chromosomal access is not restricted and toxic sites of alkylation damage are readily accessible to a searching protein. PMID:26317160

  12. Tungsten disulfide nanosheet and exonuclease III co-assisted amplification strategy for highly sensitive fluorescence polarization detection of DNA glycosylase activity

    Herein, we introduced a tungsten disulfide (WS2) nanosheet and exonuclease III (Exo III) co-assisted signal amplification strategy for highly sensitive fluorescent polarization (FP) assay of DNA glycosylase activity. Two DNA glycosylases, uracil-DNA glycosylase (UDG) and human 8-oxoG DNA glycosylase 1 (hOGG1), were tested. A hairpin-structured probe (HP) which contained damaged bases in the stem was used as the substrate. The removal of damaged bases from substrate by DNA glycosylase would lower the melting temperature of HP. The HP was then opened and hybridized with a FAM dye-labeled single strand DNA (DP), generating a duplex with a recessed 3′-terminal of DP. This design facilitated the Exo III-assisted amplification by repeating the hybridization and digestion of DP, liberating numerous FAM fluorophores which could not be adsorbed on WS2 nanosheet. Thus, the final system exhibited a small FP signal. However, in the absence of DNA glycosylases, no hybridization between DP and HP was occurred, hampering the hydrolysis of DP by Exo III. The intact DP was then adsorbed on the surface of WS2 nanosheet that greatly amplified the mass of the labeled-FAM fluorophore, resulting in a large FP value. With the co-assisted amplification strategy, the sensitivity was substantially improved. In addition, this method was applied to detect UDG activity in cell extracts. The study of the inhibition of UDG was also performed. Furthermore, this method is simple in design, easy in implementation, and selective, which holds potential applications in the DNA glycosylase related mechanism research and molecular diagnostics. - Highlights: • A fluorescence polarization strategy for DNA glycosylase activity detection was developed. • The present method was based on WS2 nanosheet and exonuclease III co-assisted signal amplification. • A high sensitivity and desirable selectivity were achieved. • This method provides a promising universal platform for DNA glycosylase activity

  13. Kinetics and binding of the thymine-DNA mismatch glycosylase, Mig-Mth, with mismatch-containing DNA substrates.

    Begley, Thomas J; Haas, Brian J; Morales, Juan C; Kool, Eric T; Cunningham, Richard P

    2003-01-01

    We have examined the removal of thymine residues from T-G mismatches in DNA by the thymine-DNA mismatch glycosylase from Methanobacterium thermoautrophicum (Mig-Mth), within the context of the base excision repair (BER) pathway, to investigate why this glycosylase has such low activity in vitro. Using single-turnover kinetics and steady-state kinetics, we calculated the catalytic and product dissociation rate constants for Mig-Mth, and determined that Mig-Mth is inhibited by product apyrimidinic (AP) sites in DNA. Electrophoretic mobility shift assays (EMSA) provide evidence that the specificity of product binding is dependent upon the base opposite the AP site. The binding of Mig-Mth to DNA containing the non-cleavable substrate analogue difluorotoluene (F) was also analyzed to determine the effect of the opposite base on Mig-Mth binding specificity for substrate-like duplex DNA. The results of these experiments support the idea that opposite strand interactions play roles in determining substrate specificity. Endonuclease IV, which cleaves AP sites in the next step of the BER pathway, was used to analyze the effect of product removal on the overall rate of thymine hydrolysis by Mig-Mth. Our results support the hypothesis that endonuclease IV increases the apparent activity of Mig-Mth significantly under steady-state conditions by preventing reassociation of enzyme to product. PMID:12509271

  14. OGG1 is essential in oxidative stress induced DNA demethylation.

    Zhou, Xiaolong; Zhuang, Ziheng; Wang, Wentao; He, Lingfeng; Wu, Huan; Cao, Yan; Pan, Feiyan; Zhao, Jing; Hu, Zhigang; Sekhar, Chandra; Guo, Zhigang

    2016-09-01

    DNA demethylation is an essential cellular activity to regulate gene expression; however, the mechanism that triggers DNA demethylation remains unknown. Furthermore, DNA demethylation was recently demonstrated to be induced by oxidative stress without a clear molecular mechanism. In this manuscript, we demonstrated that 8-oxoguanine DNA glycosylase-1 (OGG1) is the essential protein involved in oxidative stress-induced DNA demethylation. Oxidative stress induced the formation of 8-oxoguanine (8-oxoG). We found that OGG1, the 8-oxoG binding protein, promotes DNA demethylation by interacting and recruiting TET1 to the 8-oxoG lesion. Downregulation of OGG1 makes cells resistant to oxidative stress-induced DNA demethylation, while over-expression of OGG1 renders cells susceptible to DNA demethylation by oxidative stress. These data not only illustrate the importance of base excision repair (BER) in DNA demethylation but also reveal how the DNA demethylation signal is transferred to downstream DNA demethylation enzymes. PMID:27251462

  15. Oxidative DNA damage and repair in skeletal muscle of humans exposed to high-altitude hypoxia

    Lundby, Carsten; Pilegaard, Henriette; van Hall, Gerrit; Sander, Mikael; Calbet, Jose; Loft, Steffen; Møller, Peter

    Recent research suggests that high-altitude hypoxia may serve as a model for prolonged oxidative stress in healthy humans. In this study, we investigated the consequences of prolonged high-altitude hypoxia on the basal level of oxidative damage to nuclear DNA in muscle cells, a major oxygen...... glycosylase (FPG) protein was unaltered. The expression of 8-oxoguanine DNA glycosylase 1 (OGG1), determined by quantitative RT-PCR of mRNA levels did not significantly change during high-altitude hypoxia, although the data could not exclude a minor upregulation. The expression of heme oxygenase-1 (HO-1) was...... unaltered by prolonged hypoxia, in accordance with the notion that HO-1 is an acute stress response protein. In conclusion, our data indicate high-altitude hypoxia may serve as a good model for oxidative stress and that antioxidant genes are not upregulated in muscle tissue by prolonged hypoxia despite...

  16. The DNA glycosylase AlkD uses a non-base-flipping mechanism to excise bulky lesions

    Mullins, Elwood A.; Shi, Rongxin; Parsons, Zachary D.; Yuen, Philip K.; David, Sheila S.; Igarashi, Yasuhiro; Eichman, Brandt F.

    2015-11-01

    Threats to genomic integrity arising from DNA damage are mitigated by DNA glycosylases, which initiate the base excision repair pathway by locating and excising aberrant nucleobases. How these enzymes find small modifications within the genome is a current area of intensive research. A hallmark of these and other DNA repair enzymes is their use of base flipping to sequester modified nucleotides from the DNA helix and into an active site pocket. Consequently, base flipping is generally regarded as an essential aspect of lesion recognition and a necessary precursor to base excision. Here we present the first, to our knowledge, DNA glycosylase mechanism that does not require base flipping for either binding or catalysis. Using the DNA glycosylase AlkD from Bacillus cereus, we crystallographically monitored excision of an alkylpurine substrate as a function of time, and reconstructed the steps along the reaction coordinate through structures representing substrate, intermediate and product complexes. Instead of directly interacting with the damaged nucleobase, AlkD recognizes aberrant base pairs through interactions with the phosphoribose backbone, while the lesion remains stacked in the DNA duplex. Quantum mechanical calculations revealed that these contacts include catalytic charge-dipole and CH-π interactions that preferentially stabilize the transition state. We show in vitro and in vivo how this unique means of recognition and catalysis enables AlkD to repair large adducts formed by yatakemycin, a member of the duocarmycin family of antimicrobial natural products exploited in bacterial warfare and chemotherapeutic trials. Bulky adducts of this or any type are not excised by DNA glycosylases that use a traditional base-flipping mechanism. Hence, these findings represent a new model for DNA repair and provide insights into catalysis of base excision.

  17. A MATE-family efflux pump rescues the Escherichia coli 8-oxoguanine-repair-deficient mutator phenotype and protects against H(2O(2 killing.

    Javier R Guelfo

    2010-05-01

    Full Text Available Hypermutation may accelerate bacterial evolution in the short-term. In the long-term, however, hypermutators (cells with an increased rate of mutation can be expected to be at a disadvantage due to the accumulation of deleterious mutations. Therefore, in theory, hypermutators are doomed to extinction unless they compensate the elevated mutational burden (deleterious load. Different mechanisms capable of restoring a low mutation rate to hypermutators have been proposed. By choosing an 8-oxoguanine-repair-deficient (GO-deficient Escherichia coli strain as a hypermutator model, we investigated the existence of genes able to rescue the hypermutable phenotype by multicopy suppression. Using an in vivo-generated mini-MudII4042 genomic library and a mutator screen, we obtained chromosomal fragments that decrease the rate of mutation in a mutT-deficient strain. Analysis of a selected clone showed that the expression of NorM is responsible for the decreased mutation rate in 8-oxoguanine-repair-deficient (mutT, mutY, and mutM mutY strains. NorM is a member of the multidrug and toxin extrusion (MATE family of efflux pumps whose role in E. coli cell physiology remains unknown. Our results indicate that NorM may act as a GO-system backup decreasing AT to CG and GC to TA transversions. In addition, the ability of NorM to reduce the level of intracellular reactive oxygen species (ROS in a GO-deficient strain and protect the cell from oxidative stress, including protein carbonylation, suggests that it can extrude specific molecules-byproducts of bacterial metabolism-that oxidize the guanine present in both DNA and nucleotide pools. Altogether, our results indicate that NorM protects the cell from specific ROS when the GO system cannot cope with the damage.

  18. A combinatorial role for MutY and Fpg DNA glycosylases in mutation avoidance in Mycobacterium smegmatis

    Highlights: • We studied the combined role of MutY and Fpg DNA glycosylases in M. smegmatis. • Loss of MutY showed increased sensitivity to oxidative damage. • Loss of MutY together with the Fpg glycosylases showed increased mutation rates. • Our data indicate interplay between these enzymes to control mutagenesis. - Abstract: Hydroxyl radical (·OH) among reactive oxygen species cause damage to nucleobases with thymine being the most susceptible, whilst in contrast, the singlet oxygen (102) targets only guanine bases. The high GC content of mycobacterial genomes predisposes these organisms to oxidative damage of guanine. The exposure of cellular DNA to ·OH and one-electron oxidants results in the formation of two main degradation products, the pro-mutagenic 8-oxo-7,8-dihydroguanine (8-oxoGua) and the cytotoxic 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua). These lesions are repaired through the base excision repair (BER) pathway and we previously, demonstrated a combinatorial role for the mycobacterial Endonuclease III (Nth) and the Nei family of DNA glycosylases in mutagenesis. In addition, the formamidopyrimidine (Fpg/MutM) and MutY DNA glycosylases have also been implicated in mutation avoidance and BER in mycobacteria. In this study, we further investigate the combined role of MutY and the Fpg/Nei DNA glycosylases in Mycobacterium smegmatis and demonstrate that deletion of mutY resulted in enhanced sensitivity to oxidative stress, an effect which was not exacerbated in Δfpg1 Δfpg2 or Δnei1 Δnei2 double mutant backgrounds. However, combinatorial loss of the mutY, fpg1 and fpg2 genes resulted in a significant increase in mutation rates suggesting interplay between these enzymes. Consistent with this, there was a significant increase in C → A mutations with a corresponding change in cell morphology of rifampicin resistant mutants in the Δfpg1 Δfpg2 ΔmutY deletion mutant. In contrast, deletion of mutY together with the nei homologues did

  19. A combinatorial role for MutY and Fpg DNA glycosylases in mutation avoidance in Mycobacterium smegmatis

    Hassim, Farzanah; Papadopoulos, Andrea O.; Kana, Bavesh D.; Gordhan, Bhavna G., E-mail: bhavna.gordhan@nhls.ac.za

    2015-09-15

    Highlights: • We studied the combined role of MutY and Fpg DNA glycosylases in M. smegmatis. • Loss of MutY showed increased sensitivity to oxidative damage. • Loss of MutY together with the Fpg glycosylases showed increased mutation rates. • Our data indicate interplay between these enzymes to control mutagenesis. - Abstract: Hydroxyl radical (·OH) among reactive oxygen species cause damage to nucleobases with thymine being the most susceptible, whilst in contrast, the singlet oxygen ({sup 1}0{sub 2}) targets only guanine bases. The high GC content of mycobacterial genomes predisposes these organisms to oxidative damage of guanine. The exposure of cellular DNA to ·OH and one-electron oxidants results in the formation of two main degradation products, the pro-mutagenic 8-oxo-7,8-dihydroguanine (8-oxoGua) and the cytotoxic 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua). These lesions are repaired through the base excision repair (BER) pathway and we previously, demonstrated a combinatorial role for the mycobacterial Endonuclease III (Nth) and the Nei family of DNA glycosylases in mutagenesis. In addition, the formamidopyrimidine (Fpg/MutM) and MutY DNA glycosylases have also been implicated in mutation avoidance and BER in mycobacteria. In this study, we further investigate the combined role of MutY and the Fpg/Nei DNA glycosylases in Mycobacterium smegmatis and demonstrate that deletion of mutY resulted in enhanced sensitivity to oxidative stress, an effect which was not exacerbated in Δfpg1 Δfpg2 or Δnei1 Δnei2 double mutant backgrounds. However, combinatorial loss of the mutY, fpg1 and fpg2 genes resulted in a significant increase in mutation rates suggesting interplay between these enzymes. Consistent with this, there was a significant increase in C → A mutations with a corresponding change in cell morphology of rifampicin resistant mutants in the Δfpg1 Δfpg2 ΔmutY deletion mutant. In contrast, deletion of mutY together with the nei

  20. Analysis of substrate specificity of Schizosaccharomyces pombe Mag1 alkylpurine DNA glycosylase

    Adhikary, Suraj; Eichman, Brandt F. (Vanderbilt)

    2014-10-02

    DNA glycosylases specialized for the repair of alkylation damage must identify, with fine specificity, a diverse array of subtle modifications within DNA. The current mechanism involves damage sensing through interrogation of the DNA duplex, followed by more specific recognition of the target base inside the active site pocket. To better understand the physical basis for alkylpurine detection, we determined the crystal structure of Schizosaccharomyces pombe Mag1 (spMag1) in complex with DNA and performed a mutational analysis of spMag1 and the close homologue from Saccharomyces cerevisiae (scMag). Despite strong homology, spMag1 and scMag differ in substrate specificity and cellular alkylation sensitivity, although the enzymological basis for their functional differences is unknown. We show that Mag preference for 1,N{sup 6}-ethenoadenine ({var_epsilon}A) is influenced by a minor groove-interrogating residue more than the composition of the nucleobase-binding pocket. Exchanging this residue between Mag proteins swapped their {var_epsilon}A activities, providing evidence that residues outside the extrahelical base-binding pocket have a role in identification of a particular modification in addition to sensing damage.

  1. A germline polymorphism of thymine DNA glycosylase induces genomic instability and cellular transformation.

    Ashley Sjolund

    2014-11-01

    Full Text Available Thymine DNA glycosylase (TDG functions in base excision repair, a DNA repair pathway that acts in a lesion-specific manner to correct individual damaged or altered bases. TDG preferentially catalyzes the removal of thymine and uracil paired with guanine, and is also active on 5-fluorouracil (5-FU paired with adenine or guanine. The rs4135113 single nucleotide polymorphism (SNP of TDG is found in 10% of the global population. This coding SNP results in the alteration of Gly199 to Ser. Gly199 is part of a loop responsible for stabilizing the flipped abasic nucleotide in the active site pocket. Biochemical analyses indicate that G199S exhibits tighter binding to both its substrate and abasic product. The persistent accumulation of abasic sites in cells expressing G199S leads to the induction of double-strand breaks (DSBs. Cells expressing the G199S variant also activate a DNA damage response. When expressed in cells, G199S induces genomic instability and cellular transformation. Together, these results suggest that individuals harboring the G199S variant may have increased risk for developing cancer.

  2. Mutants of the Base Excision Repair Glycosylase, Endonuclease III: DNA Charge Transport as a First Step in Lesion Detection

    Romano, Christine A.; Sontz, Pamela A.; Barton, Jacqueline K.

    2011-01-01

    Endonuclease III (EndoIII) is a base excision repair glycosylase that targets damaged pyrimidines and contains a [4Fe-4S] cluster. We have proposed a model where BER proteins that contain redox-active [4Fe-4S] clusters utilize DNA charge transport (CT) as a first step in the detection of DNA lesions. Here, several mutants of EndoIII were prepared to probe their efficiency of DNA/protein charge transport. Cyclic voltammetry experiments on DNA-modified electrodes show that aromatic residues F30...

  3. 3,N4-ethenocytosine, a highly mutagenic adduct, is a primary substrate for Escherichia coli double-stranded uracil-DNA glycosylase and human mismatch-specific thymine-DNA glycosylase

    Saparbaev, Murat; Laval, Jacques

    1998-01-01

    Exocyclic DNA adducts are generated in cellular DNA by various industrial pollutants such as the carcinogen vinyl chloride and by endogenous products of lipid peroxidation. The etheno derivatives of purine and pyrimidine bases 3,N4-ethenocytosine (ɛC), 1,N6-ethenoadenine (ɛA), N2,3-ethenoguanine, and 1,N2-ethenoguanine cause mutations. The ɛA residues are excised by the human and the Escherichia coli 3-methyladenine-DNA glycosylases (ANPG and AlkA proteins, respectively), but the enzymes repa...

  4. Purification and characterization of a novel UV lesion-specific DNA glycosylase/AP lyase from Bacillus sphaericus.

    Vasquez, D A; Nyaga, S G; Lloyd, R S

    2000-05-31

    The purification and characterization of a pyrimidine dimer-specific glycosylase/AP lyase from Bacillus sphaericus (Bsp-pdg) are reported. Bsp-pdg is highly specific for DNA containing the cis-syn cyclobutane pyrimidine dimer, displaying no detectable activity on oligonucleotides with trans-syn I, trans-syn II, (6-4), or Dewar photoproducts. Like other glycosylase/AP lyases that sequentially cleave the N--glycosyl bond of the 5' pyrimidine of a cyclobutane pyrimidine dimer, and the phosphodiester backbone, this enzyme appears to utilize a primary amine as the attacking nucleophile. The formation of a covalent enzyme-DNA imino intermediate is evidenced by the ability to trap this protein-DNA complex by reduction with sodium borohydride. Also consistent with its AP lyase activity, Bsp-pdg was shown to incise an AP site-containing oligonucleotide, yielding beta- and delta-elimination products. N-terminal amino acid sequence analysis of this 26 kDa protein revealed little amino acid homology to any previously reported protein. This is the first report of a glycosylase/AP lyase enzyme from Bacillus sphaericus that is specific for cis-syn pyrimidine dimers. PMID:10844244

  5. Increase of O6-methylguanine-DNA-methyltransferase and N3-methyladenine glycosylase RNA transcripts in rat hepatoma cells treated with DNA-damaging agents

    A variety of DNA-damaging agents increase the O6-methylguanine-DNA-methyltransferase (transferase) and the N3-methyladenine (3-meAde)-DNA-glycosylase activities in a rat hepatoma cell line (H4 cells). Using two cDNA expressing either the rat 3-meAde-DNA-glycosylase or the transferase, the level of mRNA transcripts was measured by hybridization in H4 cells treated with three different inducing agents, gamma-rays, cis-dichlorodiammine platinum II or N-methyl-9-hydroxy ellipticinium. The two mRNA increased 24 hours after the cell treatments but this enhanced transcription was a transient phenomenon, as it was no longer observed after 96 hours. No significant DNA amplification was detectable in the treated cells

  6. Aag DNA glycosylase promotes alkylation-induced tissue damage mediated by Parp1.

    Jennifer A Calvo

    2013-04-01

    Full Text Available Alkylating agents comprise a major class of front-line cancer chemotherapeutic compounds, and while these agents effectively kill tumor cells, they also damage healthy tissues. Although base excision repair (BER is essential in repairing DNA alkylation damage, under certain conditions, initiation of BER can be detrimental. Here we illustrate that the alkyladenine DNA glycosylase (AAG mediates alkylation-induced tissue damage and whole-animal lethality following exposure to alkylating agents. Aag-dependent tissue damage, as observed in cerebellar granule cells, splenocytes, thymocytes, bone marrow cells, pancreatic β-cells, and retinal photoreceptor cells, was detected in wild-type mice, exacerbated in Aag transgenic mice, and completely suppressed in Aag⁻/⁻ mice. Additional genetic experiments dissected the effects of modulating both BER and Parp1 on alkylation sensitivity in mice and determined that Aag acts upstream of Parp1 in alkylation-induced tissue damage; in fact, cytotoxicity in WT and Aag transgenic mice was abrogated in the absence of Parp1. These results provide in vivo evidence that Aag-initiated BER may play a critical role in determining the side-effects of alkylating agent chemotherapies and that Parp1 plays a crucial role in Aag-mediated tissue damage.

  7. Reaction intermediates in the catalytic mechanism of Escherichia coli MutY DNA glycosylase.

    Manuel, Raymond C; Hitomi, Kenichi; Arvai, Andrew S; House, Paul G; Kurtz, Andrew J; Dodson, M L; McCullough, Amanda K; Tainer, John A; Lloyd, R Stephen

    2004-11-01

    The Escherichia coli adenine DNA glycosylase, MutY, plays an important role in the maintenance of genomic stability by catalyzing the removal of adenine opposite 8-oxo-7,8-dihydroguanine or guanine in duplex DNA. Although the x-ray crystal structure of the catalytic domain of MutY revealed a mechanism for catalysis of the glycosyl bond, it appeared that several opportunistically positioned lysine side chains could participate in a secondary beta-elimination reaction. In this investigation, it is established via site-directed mutagenesis and the determination of a 1.35-A structure of MutY in complex with adenine that the abasic site (apurinic/apyrimidinic) lyase activity is alternatively regulated by two lysines, Lys142 and Lys20. Analyses of the crystallographic structure also suggest a role for Glu161 in the apurinic/apyrimidinic lyase chemistry. The beta-elimination reaction is structurally and chemically uncoupled from the initial glycosyl bond scission, indicating that this reaction occurs as a consequence of active site plasticity and slow dissociation of the product complex. MutY with either the K142A or K20A mutation still catalyzes beta and beta-delta elimination reactions, and both mutants can be trapped as covalent enzyme-DNA intermediates by chemical reduction. The trapping was observed to occur both pre- and post-phosphodiester bond scission, establishing that both of these intermediates have significant half-lives. Thus, the final spectrum of DNA products generated reflects the outcome of a delicate balance of closely related equilibrium constants. PMID:15326180

  8. The DNA glycosylases OGG1 and NEIL3 influence differentiation potential, proliferation, and senescence-associated signs in neural stem cells

    Reis, Amilcar [Linnaeus Center in Developmental Biology for Regenerative Medicine (DBRM), Department of Neuroscience, Karolinska Institutet, SE 17177 Stockholm (Sweden); Hermanson, Ola, E-mail: ola.hermanson@ki.se [Linnaeus Center in Developmental Biology for Regenerative Medicine (DBRM), Department of Neuroscience, Karolinska Institutet, SE 17177 Stockholm (Sweden)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer DNA glycosylases OGG1 and NEIL3 are required for neural stem cell state. Black-Right-Pointing-Pointer No effect on cell viability by OGG1 or NEIL3 knockdown in neural stem cells. Black-Right-Pointing-Pointer OGG1 or NEIL3 RNA knockdown result in decreased proliferation and differentiation. Black-Right-Pointing-Pointer Increased HP1{gamma} immunoreactivity after NEIL3 knockdown suggests premature senescence. -- Abstract: Embryonic neural stem cells (NSCs) exhibit self-renewal and multipotency as intrinsic characteristics that are key parameters for proper brain development. When cells are challenged by oxidative stress agents the resulting DNA lesions are repaired by DNA glycosylases through the base excision repair (BER) pathway as a means to maintain the fidelity of the genome, and thus, proper cellular characteristics. The functional roles for DNA glycosylases in NSCs have however remained largely unexplored. Here we demonstrate that RNA knockdown of the DNA glycosylases OGG1 and NEIL3 decreased NSC differentiation ability and resulted in decreased expression of both neuronal and astrocytic genes after mitogen withdrawal, as well as the stem cell marker Musashi-1. Furthermore, while cell survival remained unaffected, NEIL3 deficient cells displayed decreased cell proliferation rates along with an increase in HP1{gamma} immunoreactivity, a sign of premature senescence. Our results suggest that DNA glycosylases play multiple roles in governing essential neural stem cell characteristics.

  9. Tungsten disulfide nanosheet and exonuclease III co-assisted amplification strategy for highly sensitive fluorescence polarization detection of DNA glycosylase activity

    Zhao, Jingjin; Ma, Yefei [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China); Kong, Rongmei [The Key Laboratory of Life-Organic Analysis, College of Chemistry and Chemical Engineering, Qufu Normal University, Qufu, Shandong 273165 (China); Zhang, Liangliang, E-mail: liangzhang319@163.com [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China); Yang, Wen; Zhao, Shulin [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China)

    2015-08-05

    Herein, we introduced a tungsten disulfide (WS{sub 2}) nanosheet and exonuclease III (Exo III) co-assisted signal amplification strategy for highly sensitive fluorescent polarization (FP) assay of DNA glycosylase activity. Two DNA glycosylases, uracil-DNA glycosylase (UDG) and human 8-oxoG DNA glycosylase 1 (hOGG1), were tested. A hairpin-structured probe (HP) which contained damaged bases in the stem was used as the substrate. The removal of damaged bases from substrate by DNA glycosylase would lower the melting temperature of HP. The HP was then opened and hybridized with a FAM dye-labeled single strand DNA (DP), generating a duplex with a recessed 3′-terminal of DP. This design facilitated the Exo III-assisted amplification by repeating the hybridization and digestion of DP, liberating numerous FAM fluorophores which could not be adsorbed on WS{sub 2} nanosheet. Thus, the final system exhibited a small FP signal. However, in the absence of DNA glycosylases, no hybridization between DP and HP was occurred, hampering the hydrolysis of DP by Exo III. The intact DP was then adsorbed on the surface of WS{sub 2} nanosheet that greatly amplified the mass of the labeled-FAM fluorophore, resulting in a large FP value. With the co-assisted amplification strategy, the sensitivity was substantially improved. In addition, this method was applied to detect UDG activity in cell extracts. The study of the inhibition of UDG was also performed. Furthermore, this method is simple in design, easy in implementation, and selective, which holds potential applications in the DNA glycosylase related mechanism research and molecular diagnostics. - Highlights: • A fluorescence polarization strategy for DNA glycosylase activity detection was developed. • The present method was based on WS{sub 2} nanosheet and exonuclease III co-assisted signal amplification. • A high sensitivity and desirable selectivity were achieved. • This method provides a promising universal platform for DNA

  10. Differential regulation of S-region hypermutation and class-switch recombination by noncanonical functions of uracil DNA glycosylase

    Yousif, Ashraf S.; Stanlie, Andre; Mondal, Samiran; Honjo, Tasuku; Begum, Nasim A.

    2014-01-01

    Uracil DNA glycosylase (UNG) has been known as a critical base excision repair protein required for class switch recombination (CSR) and somatic hypermutation (SHM). On the other hand, its precise function in both CSR and SHM is extremely debatable and elusive. Here, we showed that UNG suppresses S region SHM (s-SHM) by recruiting the faithful DNA repair complex and, in the absence of UNG, the error-prone repair complex that induces s-SHM overrides. Moreover, UNG promotes activation-induced c...

  11. DNA methylation patterns of candidate genes regulated by thymine DNA glycosylase in patients with TP53 germline mutations.

    Fortes, F P; Kuasne, H; Marchi, F A; Miranda, P M; Rogatto, S R; Achatz, M I

    2015-07-01

    Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53 mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results. PMID:25945745

  12. DNA methylation patterns of candidate genes regulated by thymine DNA glycosylase in patients with TP53 germline mutations

    F.P. Fortes

    2015-07-01

    Full Text Available Li-Fraumeni syndrome (LFS is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17 in 30 patients with germline TP53 mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results.

  13. DNA methylation patterns of candidate genes regulated by thymine DNA glycosylase in patients with TP53 germline mutations

    Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results

  14. DNA methylation patterns of candidate genes regulated by thymine DNA glycosylase in patients with TP53 germline mutations

    Fortes, F.P. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Kuasne, H. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Marchi, F.A. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Programa Inter-Institucional em Bioinformtica, Instituto de Matemtica e Estatstica, Universidade So Paulo, So Paulo, SP (Brazil); Miranda, P.M. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Rogatto, S.R. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Achatz, M.I. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Oncogentica, A.C. Camargo Cancer Center, So Paulo, SP (Brazil)

    2015-04-28

    Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results.

  15. Human proteins that specifically bind to 8-oxoguanine-containing RNA and their responses to oxidative stress

    Research highlights: → We performed comprehensive survey for proteins that bind to oxidized RNA. → HNRNPD and HNRNPC proteins were identified as oxidized RNA binding proteins. → Knockdown of HNRNPD/C expression caused increased sensitivity to H2O2. → Amounts of HNRNPD protein rapidly decreased when cells were exposed to H2O2. -- Abstract: Exposure of cells to oxygen radicals damage various biologically important molecules. Among the oxidized bases produced in nucleic acids, 8-oxo-7,8-dihydroguanine (8-oxoguanine) is particularly important since it causes base mispairing. To ensure accurate gene expression, organisms must have a mechanism to discriminate 8-oxoguanine-containing RNA from normal transcripts. We searched for proteins that specifically bind to 8-oxoguanine-containing RNA from human HeLa cell extracts, and the candidate proteins were identified using mass spectrometry. Among the identified candidates, splicing isoform 1 of heterogeneous nuclear ribonucleoprotein D0 (HNRNPD) and splicing isoform C1 of heterogeneous nuclear ribonucleoprotein C1/C2 (HNRNPC) exhibited strong abilities to bind to oxidized RNA. The amount of HNRNPD protein rapidly decreased when cells were exposed to hydrogen peroxide, an agent that enhances oxidative stress. Moreover, the suppression of HNRNPD expression by siRNA caused cells to exhibit an increased sensitivity to hydrogen peroxide. The application of siRNA against HNRNPC also caused an increase in sensitivity to hydrogen peroxide. Since no additive effect was observed with a combined addition of siRNAs for HNRNPD and HNRNPC, we concluded that the two proteins may function in the same mechanism for the accurate gene expression.

  16. Human proteins that specifically bind to 8-oxoguanine-containing RNA and their responses to oxidative stress

    Hayakawa, Hiroshi, E-mail: hiroshi@college.fdcnet.ac.jp [Department of Functional Bioscience and Advanced Science Research Center, Fukuoka Dental College, Fukuoka 814-0193 (Japan); Fujikane, Aya; Ito, Riyoko [Department of Functional Bioscience and Advanced Science Research Center, Fukuoka Dental College, Fukuoka 814-0193 (Japan); Matsumoto, Masaki; Nakayama, Keiichi I. [Department of Molecular and Cellular Biology, Medical Institute of Bioregulation, Kyushu University, Fukuoka 812-8582 (Japan); Sekiguchi, Mutsuo [Department of Functional Bioscience and Advanced Science Research Center, Fukuoka Dental College, Fukuoka 814-0193 (Japan)

    2010-12-10

    Research highlights: {yields} We performed comprehensive survey for proteins that bind to oxidized RNA. {yields} HNRNPD and HNRNPC proteins were identified as oxidized RNA binding proteins. {yields} Knockdown of HNRNPD/C expression caused increased sensitivity to H{sub 2}O{sub 2}. {yields} Amounts of HNRNPD protein rapidly decreased when cells were exposed to H{sub 2}O{sub 2}. -- Abstract: Exposure of cells to oxygen radicals damage various biologically important molecules. Among the oxidized bases produced in nucleic acids, 8-oxo-7,8-dihydroguanine (8-oxoguanine) is particularly important since it causes base mispairing. To ensure accurate gene expression, organisms must have a mechanism to discriminate 8-oxoguanine-containing RNA from normal transcripts. We searched for proteins that specifically bind to 8-oxoguanine-containing RNA from human HeLa cell extracts, and the candidate proteins were identified using mass spectrometry. Among the identified candidates, splicing isoform 1 of heterogeneous nuclear ribonucleoprotein D0 (HNRNPD) and splicing isoform C1 of heterogeneous nuclear ribonucleoprotein C1/C2 (HNRNPC) exhibited strong abilities to bind to oxidized RNA. The amount of HNRNPD protein rapidly decreased when cells were exposed to hydrogen peroxide, an agent that enhances oxidative stress. Moreover, the suppression of HNRNPD expression by siRNA caused cells to exhibit an increased sensitivity to hydrogen peroxide. The application of siRNA against HNRNPC also caused an increase in sensitivity to hydrogen peroxide. Since no additive effect was observed with a combined addition of siRNAs for HNRNPD and HNRNPC, we concluded that the two proteins may function in the same mechanism for the accurate gene expression.

  17. Expansion Mechanisms and Evolutionary History on Genes Encoding DNA Glycosylases and Their Involvement in Stress and Hormone Signaling

    Jiang, Shu-Ye; Ramachandran, Srinivasan

    2016-01-01

    DNA glycosylases catalyze the release of methylated bases. They play vital roles in the base excision repair pathway and might also function in DNA demethylation. At least three families of DNA glycosylases have been identified, which included 3′-methyladenine DNA glycosylase (MDG) I, MDG II, and HhH-GPD (Helix–hairpin–Helix and Glycine/Proline/aspartate (D)). However, little is known on their genome-wide identification, expansion, and evolutionary history as well as their expression profiling and biological functions. In this study, we have genome-widely identified and evolutionarily characterized these family members. Generally, a genome encodes only one MDG II gene in most of organisms. No MDG I or MDG II gene was detected in green algae. However, HhH-GPD genes were detectable in all available organisms. The ancestor species contain small size of MDG I and HhH-GPD families. These two families were mainly expanded through the whole-genome duplication and segmental duplication. They were evolutionarily conserved and were generally under purifying selection. However, we have detected recent positive selection among the Oryza genus, which might play roles in species divergence. Further investigation showed that expression divergence played important roles in gene survival after expansion. All of these family genes were expressed in most of developmental stages and tissues in rice plants. High ratios of family genes were downregulated by drought and fungus pathogen as well as abscisic acid (ABA) and jasmonic acid (JA) treatments, suggesting a negative regulation in response to drought stress and pathogen infection through ABA- and/or JA-dependent hormone signaling pathway. PMID:27026054

  18. Expansion Mechanisms and Evolutionary History on Genes Encoding DNA Glycosylases and Their Involvement in Stress and Hormone Signaling.

    Jiang, Shu-Ye; Ramachandran, Srinivasan

    2016-01-01

    DNA glycosylases catalyze the release of methylated bases. They play vital roles in the base excision repair pathway and might also function in DNA demethylation. At least three families of DNA glycosylases have been identified, which included 3'-methyladenine DNA glycosylase (MDG) I, MDG II, and HhH-GPD (Helix-hairpin-Helix and Glycine/Proline/aspartate (D)). However, little is known on their genome-wide identification, expansion, and evolutionary history as well as their expression profiling and biological functions. In this study, we have genome-widely identified and evolutionarily characterized these family members. Generally, a genome encodes only one MDG II gene in most of organisms. No MDG I or MDG II gene was detected in green algae. However, HhH-GPD genes were detectable in all available organisms. The ancestor species contain small size of MDG I and HhH-GPD families. These two families were mainly expanded through the whole-genome duplication and segmental duplication. They were evolutionarily conserved and were generally under purifying selection. However, we have detected recent positive selection among the Oryza genus, which might play roles in species divergence. Further investigation showed that expression divergence played important roles in gene survival after expansion. All of these family genes were expressed in most of developmental stages and tissues in rice plants. High ratios of family genes were downregulated by drought and fungus pathogen as well as abscisic acid (ABA) and jasmonic acid (JA) treatments, suggesting a negative regulation in response to drought stress and pathogen infection through ABA- and/or JA-dependent hormone signaling pathway. PMID:27026054

  19. DNA oxidation as triggered by H3K9me2 demethylation drives estrogen-induced gene expression.

    Perillo, Bruno; Ombra, Maria Neve; Bertoni, Alessandra; Cuozzo, Concetta; Sacchetti, Silvana; Sasso, Annarita; Chiariotti, Lorenzo; Malorni, Antonio; Abbondanza, Ciro; Avvedimento, Enrico V

    2008-01-11

    Modifications at the N-terminal tails of nucleosomal histones are required for efficient transcription in vivo. We analyzed how H3 histone methylation and demethylation control expression of estrogen-responsive genes and show that a DNA-bound estrogen receptor directs transcription by participating in bending chromatin to contact the RNA polymerase II recruited to the promoter. This process is driven by receptor-targeted demethylation of H3 lysine 9 at both enhancer and promoter sites and is achieved by activation of resident LSD1 demethylase. Localized demethylation produces hydrogen peroxide, which modifies the surrounding DNA and recruits 8-oxoguanine-DNA glycosylase 1 and topoisomeraseIIbeta, triggering chromatin and DNA conformational changes that are essential for estrogen-induced transcription. Our data show a strategy that uses controlled DNA damage and repair to guide productive transcription. PMID:18187655

  20. DNA damage and repair activity after broccoli intake in young healthy smokers

    Riso, Patrizia; Martini, Daniela; Møller, Peter;

    2010-01-01

    compounds, including smokers. The aim of the study was to evaluate the effect of broccoli intake on biomarkers of DNA damage and repair. Twenty-seven young healthy smokers consumed a portion of steamed broccoli (250 g/day) or a control diet for 10 days each within a crossover design with a washout period...... mRNA expression levels of repair and defence enzymes: 8-oxoguanine DNA glycosylase (OGG1), nucleoside diphosphate linked moiety X-type motif 1 (NUDT1) and heme oxygenase 1 (HO-1). After broccoli consumption, the level of oxidised DNA lesions decreased by 41% (95% confidence interval: 10%, 72%) and...... the resistance to H(2)O(2)-induced DNA strand breaks increased by 23% (95% CI: 13%, 34%). Following broccoli intake, a higher protection was observed in subjects with glutathione S-transferase (GST) M1-null genotype. The expression level and activity of repair enzymes was unaltered. In conclusion...

  1. Metal inhibition of human alkylpurine-DNA-N-glycosylase activityin base excision repair

    Wang, Ping; Guliaev, Anton B.; Hang, Bo

    2006-02-28

    Cadmium (Cd{sup 2+}), nickel (Ni{sup 2+}) and cobalt (Co{sup 2+}) are human and/or animal carcinogens. Zinc (Zn{sup 2+}) is not categorized as a carcinogen, and rather an essential element to humans. Metals were recently shown to inhibit DNA repair proteins that use metals for their function and/or structure. Here we report that the divalent ions Cd{sup 2+}, Ni{sup 2+}, and Zn{sup 2+} can inhibit the activity of a recombinant human N-methylpurine-DNA glycosylase (MPG) toward a deoxyoligonucleotide with ethenoadenine (var epsilonA). MPG removes a variety of toxic/mutagenic alkylated bases and does not require metal for its catalytic activity or structural integrity. At concentrations starting from 50 to 1000 {micro}M, both Cd{sup 2+} and Zn{sup 2+} showed metal-dependent inhibition of the MPG catalytic activity. Ni{sup 2+} also inhibited MPG, but to a lesser extent. Such an effect can be reversed with EDTA addition. In contrast, Co{sup 2+} and Mg{sup 2+} did not inhibit the MPG activity in the same dose range. Experiments using HeLa cell-free extracts demonstrated similar patterns of inactivation of the var epsilonA excision activity by the same metals. Binding of MPG to the substrate was not significantly affected by Cd{sup 2+}, Zn{sup 2+}, and Ni{sup 2+} at concentrations that show strong inhibition of the catalytic function, suggesting that the reduced catalytic activity is not due to altered MPG binding affinity to the substrate. Molecular dynamics (MD) simulations with Zn{sup 2+} showed that the MPG active site has a potential binding site for Zn{sup 2+}, formed by several catalytically important and conserved residues. Metal binding to such a site is expected to interfere with the catalytic mechanism of this protein. These data suggest that inhibition of MPG activity may contribute to metal genotoxicity and depressed repair of alkylation damage by metals in vivo.

  2. Sensitive and selective real-time electrochemical monitoring of DNA repair (Presentation Recording)

    Slinker, Jason D.; McWilliams, Marc; Anka, Fadwa; Balkus, Kenneth

    2015-10-01

    Unrepaired DNA damage can lead to mutation, cancer, and death of cells or organisms. However, due to the subtlety of DNA damage, it is difficult to sense the repair of damage products with high selectivity and sensitivity. Here, we show sensitive and selective electrochemical sensing of the repair activity of 8-oxoguanine and uracil glycosylases within DNA monolayers on gold by multiplexed analysis with silicon chips and low-cost electrospun nanofibers. Our approach involves comparing the electrochemical signal of redox probe modified monolayers containing the defect versus the rational control of defect-free monolayers. We find sequence-specific sensitivity thresholds on the order of femtomoles of proteins and dynamic ranges of over two orders of magnitude for each target. For 8-oxoguanine repair, temperature-dependent kinetics are extracted, showing exponential signal loss with time constants of seconds. Electrospun fibers are shown to behave similarly to conventional gold-on-silicon devices, showing the potential of these low-cost devices for sensing applications.

  3. In vivo excision of pyrimidine dimers is mediated by a DNA N-glycosylase in Micrococcus luteus but not in human fibroblasts

    It has been previously shown that Micrococcus luteus possesses a pyrimidine dimer-specific endonuclease which in vitro, functions as both an endonuclease and DNA-glycosylase. To determine if these combined activities function in vivo, the excision products of UV-irradiated M. luteus were isolated and examined. In addition, a procedure was devised to isolate and examine the excision products from UV-irradiated human fibroblasts to determine if an endonuclease/glycosylase activity functions in the excision of UV-induced pyrimidine dimers in human fibroblasts. It was shown that, in vivo, an endonuclease/glycosylase mechanism is utilized extensively in the repair of pyrimidine dimers by M. luteus, but that human fibroblasts do not appear to use this mechanism. (author)

  4. Slow base excision by human alkyladenine DNA glycosylase limits the rate of formation of AP sites and AP endonuclease 1 does not stimulate base excision.

    Maher, Robyn L; Vallur, Aarthy C; Feller, Joyce A; Bloom, Linda B

    2007-01-01

    The base excision repair pathway removes damaged DNA bases and resynthesizes DNA to replace the damage. Human alkyladenine DNA glycosylase (AAG) is one of several damage-specific DNA glycosylases that recognizes and excises damaged DNA bases. AAG removes primarily damaged adenine residues. Human AP endonuclease 1 (APE1) recognizes AP sites produced by DNA glycosylases and incises the phophodiester bond 5' to the damaged site. The repair process is completed by a DNA polymerase and DNA ligase. If not tightly coordinated, base excision repair could generate intermediates that are more deleterious to the cell than the initial DNA damage. The kinetics of AAG-catalyzed excision of two damaged bases, hypoxanthine and 1,N6-ethenoadenine, were measured in the presence and absence of APE1 to investigate the mechanism by which the base excision activity of AAG is coordinated with the AP incision activity of APE1. 1,N6-ethenoadenine is excised significantly slower than hypoxanthine and the rate of excision is not affected by APE1. The excision of hypoxanthine is inhibited to a small degree by accumulated product, and APE1 stimulates multiple turnovers by alleviating product inhibition. These results show that APE1 does not significantly affect the kinetics of base excision by AAG. It is likely that slow excision by AAG limits the rate of AP site formation in vivo such that AP sites are not created faster than can be processed by APE1. PMID:17018265

  5. Opinion: uracil DNA glycosylase (UNG) plays distinct and non-canonical roles in somatic hypermutation and class switch recombination.

    Yousif, Ashraf S; Stanlie, Andre; Begum, Nasim A; Honjo, Tasuku

    2014-10-01

    Activation-induced cytidine deaminase (AID) is essential to class switch recombination (CSR) and somatic hypermutation (SHM). Uracil DNA glycosylase (UNG), a member of the base excision repair complex, is required for CSR. The role of UNG in CSR and SHM is extremely controversial. AID deficiency in mice abolishes both CSR and SHM, while UNG-deficient mice have drastically reduced CSR but augmented SHM raising a possibility of differential functions of UNG in CSR and SHM. Interestingly, UNG has been associated with a CSR-specific repair adapter protein Brd4, which interacts with acetyl histone 4, γH2AX and 53BP1 to promote non-homologous end joining during CSR. A non-canonical scaffold function of UNG, but not the catalytic activity, can be attributed to the recruitment of essential repair proteins associated with the error-free repair during SHM, and the end joining during CSR. PMID:24994819

  6. Novel repair activities of AlkA (3-methyladenine DNA glycosylase II) and endonuclease VIII for xanthine and oxanine, guanine lesions induced by nitric oxide and nitrous acid

    Terato, Hiroaki; Masaoka, Aya; Asagoshi, Kenjiro; Honsho, Akiko; Ohyama, Yoshihiko; Suzuki, Toshinori; Yamada, Masaki; Makino, Keisuke; Yamamoto, Kazuo; Ide, Hiroshi

    2002-01-01

    Nitrosation of guanine in DNA by nitrogen oxides such as nitric oxide (NO) and nitrous acid leads to formation of xanthine (Xan) and oxanine (Oxa), potentially cytotoxic and mutagenic lesions. In the present study, we have examined the repair capacity of DNA N-glycosylases from Escherichia coli for Xan and Oxa. The nicking assay with the defined substrates containing Xan and Oxa revealed that AlkA [in combination with endonuclease (Endo) IV] and Endo VIII recognized Xan in the tested enzymes....

  7. Differential regulation of S-region hypermutation and class-switch recombination by noncanonical functions of uracil DNA glycosylase

    Yousif, Ashraf S.; Stanlie, Andre; Mondal, Samiran; Honjo, Tasuku; Begum, Nasim A.

    2014-01-01

    Activation-induced cytidine deaminase (AID) is essential to class-switch recombination (CSR) and somatic hypermutation (SHM) in both V region SHM and S region SHM (s-SHM). Uracil DNA glycosylase (UNG), a member of the base excision repair (BER) complex, is required for CSR. Strikingly, however, UNG deficiency causes augmentation of SHM, suggesting involvement of distinct functions of UNG in SHM and CSR. Here, we show that noncanonical scaffold functions of UNG regulate s-SHM negatively and CSR positively. The s-SHM suppressive function of UNG is attributed to the recruitment of faithful BER components at the cleaved DNA locus, with competition against error-prone polymerases. By contrast, the CSR-promoting function of UNG enhances AID-dependent S-S synapse formation by recruiting p53-binding protein 1 and DNA-dependent protein kinase, catalytic subunit. Several loss-of-catalysis mutants of UNG discriminated CSR-promoting activity from s-SHM suppressive activity. Taken together, the noncanonical function of UNG regulates the steps after AID-induced DNA cleavage: error-prone repair suppression in s-SHM and end-joining promotion in CSR. PMID:24591630

  8. Differential regulation of S-region hypermutation and class-switch recombination by noncanonical functions of uracil DNA glycosylase.

    Yousif, Ashraf S; Stanlie, Andre; Mondal, Samiran; Honjo, Tasuku; Begum, Nasim A

    2014-03-18

    Activation-induced cytidine deaminase (AID) is essential to class-switch recombination (CSR) and somatic hypermutation (SHM) in both V region SHM and S region SHM (s-SHM). Uracil DNA glycosylase (UNG), a member of the base excision repair (BER) complex, is required for CSR. Strikingly, however, UNG deficiency causes augmentation of SHM, suggesting involvement of distinct functions of UNG in SHM and CSR. Here, we show that noncanonical scaffold functions of UNG regulate s-SHM negatively and CSR positively. The s-SHM suppressive function of UNG is attributed to the recruitment of faithful BER components at the cleaved DNA locus, with competition against error-prone polymerases. By contrast, the CSR-promoting function of UNG enhances AID-dependent S-S synapse formation by recruiting p53-binding protein 1 and DNA-dependent protein kinase, catalytic subunit. Several loss-of-catalysis mutants of UNG discriminated CSR-promoting activity from s-SHM suppressive activity. Taken together, the noncanonical function of UNG regulates the steps after AID-induced DNA cleavage: error-prone repair suppression in s-SHM and end-joining promotion in CSR. PMID:24591630

  9. Sensitive and selective detection of uracil-DNA glycosylase activity with a new pyridinium luminescent switch-on molecular probe.

    Lu, Yu-Jing; Hu, Dong-Ping; Deng, Qiang; Wang, Zheng-Ya; Huang, Bao-Hua; Fang, Yan-Xiong; Zhang, Kun; Wong, Wing-Leung

    2015-09-01

    Uracil-deoxyribonucleic acid glycosylase (UDG) is known to function as an important base-excision repair enzyme and eliminate uracil from DNA molecules to maintain genomic integrity. A new small organic molecule (DID-VP) with interesting structural properties was synthesized as a G-quadruplex selective ligand and was demonstrated to be a sensitive luminescent switch-on probe in a convenient luminescent assay specifically for UDG detection in fetal bovine serum samples under rapid and simple conditions. This newly developed analytical method is based on the UDG enzymatic activity to unwind a duplex DNA substrate, and comprises a G-quadruplex-forming sequence (ON1) and uracil-containing DNA strand (ON2) to generate a remarkable fluorescence signal through the specific interaction of DID-VP with ON1. This luminescent switch-on assay is able to achieve high sensitivity and specificity for UDG over other enzymes. The application range of the present analytical system is found to be 0.05 to 1.00 U mL(-1) UDG with a very low detection limit of 0.005 U mL(-1). The recovery study of UDG in real samples gave a very good performance with 75.05%-102.7% recovery. In addition, an extended application of the assay in screening of UDG inhibitors is demonstrated. A good dose-dependence of the luminescence response with respect to the concentration of UDG inhibitors in samples was observed. PMID:26185800

  10. Accelerated repair and reduced mutagenicity of DNA damage induced by cigarette smoke in human bronchial cells transfected with E.coli formamidopyrimidine DNA glycosylase.

    Mara Foresta

    Full Text Available Cigarette smoke (CS is associated to a number of pathologies including lung cancer. Its mutagenic and carcinogenic effects are partially linked to the presence of reactive oxygen species and polycyclic aromatic hydrocarbons (PAH inducing DNA damage. The bacterial DNA repair enzyme formamidopyrimidine DNA glycosylase (FPG repairs both oxidized bases and different types of bulky DNA adducts. We investigated in vitro whether FPG expression may enhance DNA repair of CS-damaged DNA and counteract the mutagenic effects of CS in human lung cells. NCI-H727 non small cell lung carcinoma cells were transfected with a plasmid vector expressing FPG fused to the Enhanced Green Fluorescent Protein (EGFP. Cells expressing the fusion protein EGFP-FPG displayed accelerated repair of adducts and DNA breaks induced by CS condensate. The mutant frequencies induced by low concentrations of CS condensate to the Na(+K(+-ATPase locus (oua(r were significantly reduced in cells expressing EGFP-FPG. Hence, expression of the bacterial DNA repair protein FPG stably protects human lung cells from the mutagenic effects of CS by improving cells' capacity to repair damaged DNA.

  11. Neil3 DNA Glycosylase in Maintenance and Repair of the Mammalian Brain

    2012-01-01

    The DNA molecule is susceptible to damage induced by cellular metabolites and exogenous DNA damaging agents. Reactive oxygen species (ROS), generated as respiration by-products or arising from inflammatory reactions, are the most abundant endogenous DNA damaging agents and lead to the formation of a number of mutagenic and cytotoxic DNA lesions. To preserve DNA integrity and allow correct transmission of genetic information, several pathways for the repair of such lesions have evolved. Among ...

  12. Pathophysiology of Bronchoconstriction: Role of Oxidatively Damaged DNA Repair

    Bacsi, Attila; Pan, Lang; Ba, Xueqing; Boldogh, Istvan

    2016-01-01

    Purpose of review To provide an overview on the present understanding of roles of oxidative DNA damage repair in cell signaling underlying bronchoconstriction common to, but not restricted to various forms of asthma and chronic obstructive pulmonary disease Recent findings Bronchoconstriction is a tightening of smooth muscle surrounding the bronchi and bronchioles with consequent wheezing and shortness of breath. Key stimuli include air pollutants, viral infections, allergens, thermal and osmotic changes, and shear stress of mucosal epithelium, triggering a wide range of cellular, vascular and neural events. Although activation of nerve fibers, the role of G-proteins, protein kinases and Ca++, and molecular interaction within contracting filaments of muscle are well defined, the overarching mechanisms by which a wide range of stimuli initiate these events are not fully understood. Many, if not all, stimuli increase levels of reactive oxygen species (ROS), which are signaling and oxidatively modifying macromolecules, including DNA. The primary ROS target in DNA is guanine, and 8-oxoguanine is one of the most abundant base lesions. It is repaired by 8-oxoguanine DNA glycosylase1 (OGG1) during base excision repair processes. The product, free 8-oxoG base, is bound by OGG1 with high affinity, and the complex then functions as an activator of small GTPases, triggering pathways for inducing gene expression and contraction of intracellular filaments in mast and smooth muscle cells. Summary Oxidative DNA damage repair-mediated cell activation signaling result in gene expression that “primes” the mucosal epithelium and submucosal tissues to generate mediators of airway smooth muscle contractions. PMID:26694039

  13. Substrate specificity of the Escherichia coli Fpg protein (Formamidopyrimidine - DNA glycosylase): Excision of purine lesions in DNA produced by ionizing radiation or photosensitization

    The authors have investigated the excision of a variety of modified bases from DNA by the Escherichia coli Fpg protein (formamidopyrimidine-DNA glycosylase). DNA used as a substrate was modified either by exposure to ionizing radiation or by photosensitization using visible light in the presence of methylene blue (MB). The technique of gas chromatography/mass spectrometry, which can unambiguously identify and quantitate pyrimidine- and purine-derived lesions in DNA, was used for analysis of hydrolyzed and derivatized DNA samples. Thirteen products resulting from pyrimidines and purines were detected in γ-irradiated DNA, whereas only the formation of 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua) and 8-hydroxyguanine (8-OH-Gua) was observed in visible light/MB-treated DNA. Analysis of γ-irradiated DNA after incubation with the Fpg protein followed by precipitation revealed that the Fpg protein significantly excised 4,6-diamino-5-formamidopyrimidine (FapyAde), FapyGua, and 8-OH-Gua. The excision of a small but detectable amount of 8-hydroxyadenine was also observed. The results suggest that one of the biological roles of the Fpg protein, which is present in bacteria as well as in mammalian cells, is the repair of DNA damage caused by free radicals or by other oxygen-derived species such as singlet oxygen. The Fpg protein appears to be specific for recognition of imidazole ring opened purines and 8-hydroxypurines in DNA and may complement pyrimidine-specific enzymes in repair of DNA damage in vivo

  14. Partial uracil–DNA–glycosylase treatment for screening of ancient DNA

    Rohland, Nadin; Harney, Eadaoin; Mallick, Swapan; Nordenfelt, Susanne; Reich, David

    2015-01-01

    The challenge of sequencing ancient DNA has led to the development of specialized laboratory protocols that have focused on reducing contamination and maximizing the number of molecules that are extracted from ancient remains. Despite the fact that success in ancient DNA studies is typically obtained by screening many samples to identify a promising subset, ancient DNA protocols have not, in general, focused on reducing the time required to screen samples. We present an adaptation of a popula...

  15. DNA glycosylases involved in base excision repair may be associated with cancer risk in BRCA1 and BRCA2 mutation carriers.

    Ana Osorio

    2014-04-01

    Full Text Available Single Nucleotide Polymorphisms (SNPs in genes involved in the DNA Base Excision Repair (BER pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the components of the BER pathway, PARP1 (poly ADP ribose polymerase, and both BRCA1 and BRCA2. In the present study, we have performed a comprehensive analysis of 18 genes involved in BER using a tagging SNP approach in a large series of BRCA1 and BRCA2 mutation carriers. 144 SNPs were analyzed in a two stage study involving 23,463 carriers from the CIMBA consortium (the Consortium of Investigators of Modifiers of BRCA1 and BRCA2. Eleven SNPs showed evidence of association with breast and/or ovarian cancer at p<0.05 in the combined analysis. Four of the five genes for which strongest evidence of association was observed were DNA glycosylases. The strongest evidence was for rs1466785 in the NEIL2 (endonuclease VIII-like 2 gene (HR: 1.09, 95% CI (1.03-1.16, p = 2.7 × 10(-3 for association with breast cancer risk in BRCA2 mutation carriers, and rs2304277 in the OGG1 (8-guanine DNA glycosylase gene, with ovarian cancer risk in BRCA1 mutation carriers (HR: 1.12 95%CI: 1.03-1.21, p = 4.8 × 10(-3. DNA glycosylases involved in the first steps of the BER pathway may be associated with cancer risk in BRCA1/2 mutation carriers and should be more comprehensively studied.

  16. An OGG1 polymorphism is associated with mitochondrial DNA content in pesticide-exposed fruit growers

    Highlights: → Individuals experiencing pesticide exposure had greater mtDNA content. → OGG1 genotype may modulate mtDNA content in pesticide-exposed fruit growers. → No association between MnSOD genotypes and mtDNA content was revealed in this study. -- Abstract: Exposure to pesticides has the capacity to cause mitochondrial dysfunction. An increase mitochondrial DNA (mtDNA) content has also been suggested to relate with DNA damaging agent. In mitochondria, the manganese superoxide dismutase (MnSOD) is a scavenger of reactive oxygen species, and the 8-oxoguanine DNA glycosylase (OGG1) is the major DNA glycosylase for the repair of 8-oxoG lesions. However, the alteration of mtDNA content elicited by pesticide exposure in people with genetic variations in MnSOD or OGG1 has not been investigated. In this study, the mitochondrial to nuclear DNA ratio was quantified in the peripheral blood of 120 fruit growers who experienced pesticide exposure and 106 unexposed controls by real-time quantitative polymerase chain reaction (real-time qPCR). Questionnaires were administered to obtain demographic data and occupational history. The MnSOD and OGG1 genotypes were identified by the PCR based restriction fragment length polymorphism analysis. After adjusting for confounding effects, multiple regression model revealed that subjects experiencing high or low pesticide exposure had a greater mtDNA content than that of controls. The OGG1 Ser-Ser genotype was also associated with an increased mtDNA content. No association between MnSOD genotype and mtDNA content was revealed. Thus, subjects experiencing pesticide exposure had greater mtDNA content and the OGG1 genotype may modulate mtDNA content in pesticide-exposed fruit growers.

  17. Selective inhibition by methoxyamine of the apurinic/apyrimidinic endonuclease activity associated with pyrimidine dimer-DNA glycosylases from Micrococcus luteus and bacteriophage T4

    The UV endonucleases from Micrococcus luteus and bacteriophage T4 possess two catalytic activities specific for the site of cyclobutane pyrimidine dimers in UV-irradiated DNA: a DNA glycosylase that cleaves the 5'-glycosyl bond of the dimerized pyrimidines and an apurinic/apyrimidinic (AP) endonuclease that thereupon incises the phosphodiester bond 3' to the resulting apyrimidinic site. The authors have explored the potential use of methoxyamine, a chemical that reacts at neutral pH with AP sites in DNA, as a selective inhibitor of the AP endonuclease activities residing in the M. luteus and T4 enzymes. The presence of 50 mM methoxyamine during incubation of UV-treated, [3H]thymine-labeled poly(dA) x poly(dT) with either enzyme preparation was found to protect completely the irradiated copolymer from endonucleolytic attack at dimer sites, as assayed by yield of acid-soluble radioactivity. In contrast, the dimer-DNA glycosylase activity of each enzyme remained fully functional, as monitored retrospectively by release of free thymine after either photochemical-(5 kJ/m2, 254 nm) or photoenzymic- (Escherichia coli photolyase plus visible light) induced reversal of pyrimidine dimers in the UV-damaged substrate. The data demonstrate that the inhibition of the strand-incision reaction arises because of chemical modification of the AP sites and is not due to inactivation of the enzyme by methoxyamine. The results, combined with earlier findings for 5'-acting AP endonucleases, strongly suggest that methoxyamine is a highly specific inhibitor of virtually all AP endonucleases, irrespective of their modes of action, and may therefore prove useful in a wide variety of DNA repair studies

  18. Establishment of a non-radioactive cleavage assay to assess the DNA repair capacity towards oxidatively damaged DNA in subcellular and cellular systems and the impact of copper

    Oxidative stress is involved in many diseases, and the search for appropriate biomarkers is one major focus in molecular epidemiology. 8-Oxoguanine (8-oxoG), a potentially mutagenic DNA lesion, is considered to be a sensitive biomarker for oxidative stress. Another approach consists in assessing the repair capacity towards 8-oxoG, mediated predominantly by the human 8-oxoguanine DNA glycosylase 1 (hOGG1). With respect to the latter, during the last few years so-called cleavage assays have been described, investigating the incision of 32P-labelled and 8-oxoG damaged oligonucleotides by cell extracts. Within the present study, a sensitive non-radioactive test system based on a Cy5-labelled oligonucleotide has been established. Sources of incision activity are isolated proteins or extracts prepared from cultured cells and peripheral blood mononuclear cells (PBMC). After comparing different oligonucleotide structures, a hairpin-like structure was selected which was not degraded by cell extracts. Applying this test system the impact of copper on the activity of isolated hOGG1 and on hOGG activity in A549 cells was examined, showing a distinct inhibition of the isolated protein at low copper concentration as compared to a modest inhibition of hOGG activity in cells at beginning cytotoxic concentrations. For investigating PBMC, all reaction conditions, including the amounts of oligonucleotide and cell extract as well as the reaction time have been optimized. The incision activities of PBMC protein extracts obtained from different donors have been investigated, and inter-individual differences have been observed. In summary, the established method is as sensitive and even faster than the radioactive technique, and additionally, offers the advantage of reduced costs and low health risk.

  19. DNA Repair Glycosylases with a [4Fe-4S] Cluster: A Redox Cofactor for DNA-mediated Charge Transport?

    Boal, Amie K.; Yavin, Eylon; Barton, Jacqueline K.

    2007-01-01

    The [4Fe-4S] cluster is ubiquitous to a class of base excision repair enzymes, in organisms ranging from bacteria to man, and was first considered as a structural element, owing to its redox stability under physiological conditions. When studied bound to DNA, two of these repair proteins (MutY and Endonuclease III from Escherichia coli) display DNA-dependent reversible electron transfer with characteristics typical of high potential iron proteins. These results have inspired a reexamination o...

  20. Mechanistic studies of ionizing radiation and oxidative mutagenesis: Genetic effects of a single 8-hydroxyguanine (7-hydro-8-oxoguanine) residue inserted at a unique site in a viral genome

    T4 RNA ligase was used to construct a deoxypentanucleotide containing a single 8-hydroxyguanine (7-hydro-8-oxoguanine; G8-OH) residue, which is one of the putatively mutagenic DNA adducts produced by oxidants and ionizing radiation. The pentamer d(GCTAG8-OH)p was prepared by the ligation of a chemically synthesized acceptor molecule, d(GCTA), to an adducted donor, 8-hydroxy-2'-deoxyguanosine 5',3'-bisphosphate. Following 3'-dephosphorylation, the pentamer was characterized by UV spectroscopy, by high-pressure liquid chromatography, and by gas chromatography-mass spectrometry of the nucleosides released by enzymatic hydrolysis. Both d(GCTAG8-OH) and an unmodified control were 5'-phosphorylated by using [γ-32P]ATP and incorporated covalently by DNA ligase into a five-base gap at a unique NheI restriction site in the otherwise duplex genome of an M13mp19 derivative. The adduct was part of a nonsense codon in a unique restriction site in order to facilitate the identification and selection of mutants generated by the replication of the modified genome in Escherichia coli. Both control and adducted pentamers ligated into the genome at 50% of the maximum theoretical efficiency, and nearly all of the site-specifically adducted products possessed pentanucleotides that were covalently linked at both 5' and 3' termini. Transformation of E. coli strain DL7 with the uniquely modified single-stranded genome resulted in ∼0.5-1.0% of the progeny phase showing the G → T transversion mutation at the original position of G8-OH. The vector containing G8-OH also transformed 50-90% as efficiently as the unmodified control, indicating that the adduct can be both weakly cytotoxic and mutagenic to the phase genome

  1. The Role of Mitochondrial DNA in Mediating Alveolar Epithelial Cell Apoptosis and Pulmonary Fibrosis

    Seok-Jo Kim

    2015-09-01

    Full Text Available Convincing evidence has emerged demonstrating that impairment of mitochondrial function is critically important in regulating alveolar epithelial cell (AEC programmed cell death (apoptosis that may contribute to aging-related lung diseases, such as idiopathic pulmonary fibrosis (IPF and asbestosis (pulmonary fibrosis following asbestos exposure. The mammalian mitochondrial DNA (mtDNA encodes for 13 proteins, including several essential for oxidative phosphorylation. We review the evidence implicating that oxidative stress-induced mtDNA damage promotes AEC apoptosis and pulmonary fibrosis. We focus on the emerging role for AEC mtDNA damage repair by 8-oxoguanine DNA glycosylase (OGG1 and mitochondrial aconitase (ACO-2 in maintaining mtDNA integrity which is important in preventing AEC apoptosis and asbestos-induced pulmonary fibrosis in a murine model. We then review recent studies linking the sirtuin (SIRT family members, especially SIRT3, to mitochondrial integrity and mtDNA damage repair and aging. We present a conceptual model of how SIRTs modulate reactive oxygen species (ROS-driven mitochondrial metabolism that may be important for their tumor suppressor function. The emerging insights into the pathobiology underlying AEC mtDNA damage and apoptosis is suggesting novel therapeutic targets that may prove useful for the management of age-related diseases, including pulmonary fibrosis and lung cancer.

  2. Structural and biophysical analysis of interactions between cod and human uracil-DNA N-glycosylase (UNG) and UNG inhibitor (Ugi)

    Assefa, Netsanet Gizaw [UiT The Arctic University of Norway, 9037 Tromsø (Norway); Niiranen, Laila [UiT The Arctic University of Norway, 9037 Tromsø (Norway); University of Turku, FIN-20014 Turku (Finland); Johnson, Kenneth A.; Leiros, Hanna-Kirsti Schrøder; Smalås, Arne Oskar; Willassen, Nils Peder [UiT The Arctic University of Norway, 9037 Tromsø (Norway); Moe, Elin, E-mail: elin.moe@uit.no [UiT The Arctic University of Norway, 9037 Tromsø (Norway); Universidade Nova de Lisboa, Avenida da Republica (EAN), 2780-157 Oeiras (Portugal)

    2014-08-01

    A structural and biophysical study of the interactions between cod and human uracil-DNA N-glycosylase (UNG) and their inhibitor Ugi is presented. The stronger interaction between cod UNG and Ugi can be explained by a greater positive electrostatic surface potential. Uracil-DNA N-glycosylase from Atlantic cod (cUNG) shows cold-adapted features such as high catalytic efficiency, a low temperature optimum for activity and reduced thermal stability compared with its mesophilic homologue human UNG (hUNG). In order to understand the role of the enzyme–substrate interaction related to the cold-adapted properties, the structure of cUNG in complex with a bacteriophage encoded natural UNG inhibitor (Ugi) has been determined. The interaction has also been analyzed by isothermal titration calorimetry (ITC). The crystal structure of cUNG–Ugi was determined to a resolution of 1.9 Å with eight complexes in the asymmetric unit related through noncrystallographic symmetry. A comparison of the cUNG–Ugi complex with previously determined structures of UNG–Ugi shows that they are very similar, and confirmed the nucleotide-mimicking properties of Ugi. Biophysically, the interaction between cUNG and Ugi is very strong and shows a binding constant (K{sub b}) which is one order of magnitude larger than that for hUNG–Ugi. The binding of both cUNG and hUNG to Ugi was shown to be favoured by both enthalpic and entropic forces; however, the binding of cUNG to Ugi is mainly dominated by enthalpy, while the entropic term is dominant for hUNG. The observed differences in the binding properties may be explained by an overall greater positive electrostatic surface potential in the protein–Ugi interface of cUNG and the slightly more hydrophobic surface of hUNG.

  3. Structural and biophysical analysis of interactions between cod and human uracil-DNA N-glycosylase (UNG) and UNG inhibitor (Ugi)

    A structural and biophysical study of the interactions between cod and human uracil-DNA N-glycosylase (UNG) and their inhibitor Ugi is presented. The stronger interaction between cod UNG and Ugi can be explained by a greater positive electrostatic surface potential. Uracil-DNA N-glycosylase from Atlantic cod (cUNG) shows cold-adapted features such as high catalytic efficiency, a low temperature optimum for activity and reduced thermal stability compared with its mesophilic homologue human UNG (hUNG). In order to understand the role of the enzyme–substrate interaction related to the cold-adapted properties, the structure of cUNG in complex with a bacteriophage encoded natural UNG inhibitor (Ugi) has been determined. The interaction has also been analyzed by isothermal titration calorimetry (ITC). The crystal structure of cUNG–Ugi was determined to a resolution of 1.9 Å with eight complexes in the asymmetric unit related through noncrystallographic symmetry. A comparison of the cUNG–Ugi complex with previously determined structures of UNG–Ugi shows that they are very similar, and confirmed the nucleotide-mimicking properties of Ugi. Biophysically, the interaction between cUNG and Ugi is very strong and shows a binding constant (Kb) which is one order of magnitude larger than that for hUNG–Ugi. The binding of both cUNG and hUNG to Ugi was shown to be favoured by both enthalpic and entropic forces; however, the binding of cUNG to Ugi is mainly dominated by enthalpy, while the entropic term is dominant for hUNG. The observed differences in the binding properties may be explained by an overall greater positive electrostatic surface potential in the protein–Ugi interface of cUNG and the slightly more hydrophobic surface of hUNG

  4. Islet expression of the DNA repair enzyme 8-oxoguanosine DNA glycosylase (Ogg1 in human type 2 diabetes

    Yoon Kun-Ho

    2002-04-01

    Full Text Available Abstract Background It has become increasingly clear that β-cell failure plays a critical role in the pathogenesis of type 2 diabetes. Free-radical mediated β-cell damage has been intensively studied in type 1 diabetes, but not in human type 2 diabetes. Therefore, we studied the protein expression of the DNA repair enzyme Ogg1 in pancreases from type 2 diabetics. Ogg1 was studied because it is the major enzyme involved in repairing 7,8-dihydro-8-oxoguanosine DNA adducts, a lesion previously observed in a rat model of type 2 diabetes. Moreover, in a gene expression screen, Ogg1 was over-expressed in islets from a human type 2 diabetic. Methods Immunofluorescent staining of Ogg1 was performed on pancreatic specimens from healthy controls and patients with diabetes for 2–23 years. The intensity and islet area stained for Ogg1 was evaluated by semi-quantitative scoring. Results Both the intensity and the area of islet Ogg1 staining were significantly increased in islets from the type 2 diabetic subjects compared to the healthy controls. A correlation between increased Ogg1 fluorescent staining intensity and duration of diabetes was also found. Most of the staining observed was cytoplasmic, suggesting that mitochondrial Ogg1 accounts primarily for the increased Ogg1 expression. Conclusion We conclude that oxidative stress related DNA damage may be a novel important factor in the pathogenesis of human type 2 diabetes. An increase of Ogg1 in islet cell mitochondria is consistent with a model in which hyperglycemia and consequent increased β-cell oxidative metabolism lead to DNA damage and the induction of Ogg1 expression.

  5. Mitochondrial Targeted Endonuclease III DNA Repair Enzyme Protects against Ventilator Induced Lung Injury in Mice

    Masahiro Hashizume

    2014-08-01

    Full Text Available The mitochondrial targeted DNA repair enzyme, 8-oxoguanine DNA glycosylase 1, was previously reported to protect against mitochondrial DNA (mtDNA damage and ventilator induced lung injury (VILI. In the present study we determined whether mitochondrial targeted endonuclease III (EndoIII which cleaves oxidized pyrimidines rather than purines from damaged DNA would also protect the lung. Minimal injury from 1 h ventilation at 40 cmH2O peak inflation pressure (PIP was reversed by EndoIII pretreatment. Moderate lung injury due to ventilation for 2 h at 40 cmH2O PIP produced a 25-fold increase in total extravascular albumin space, a 60% increase in W/D weight ratio, and marked increases in MIP-2 and IL-6. Oxidative mtDNA damage and decreases in the total tissue glutathione (GSH and the GSH/GSSH ratio also occurred. All of these indices of injury were attenuated by mitochondrial targeted EndoIII. Massive lung injury caused by 2 h ventilation at 50 cmH2O PIP was not attenuated by EndoIII pretreatment, but all untreated mice died prior to completing the two hour ventilation protocol, whereas all EndoIII-treated mice lived for the duration of ventilation. Thus, mitochondrial targeted DNA repair enzymes were protective against mild and moderate lung damage and they enhanced survival in the most severely injured group.

  6. Mitochondrial Targeted Endonuclease III DNA Repair Enzyme Protects against Ventilator Induced Lung Injury in Mice.

    Hashizume, Masahiro; Mouner, Marc; Chouteau, Joshua M; Gorodnya, Olena M; Ruchko, Mykhaylo V; Wilson, Glenn L; Gillespie, Mark N; Parker, James C

    2014-01-01

    The mitochondrial targeted DNA repair enzyme, 8-oxoguanine DNA glycosylase 1, was previously reported to protect against mitochondrial DNA (mtDNA) damage and ventilator induced lung injury (VILI). In the present study we determined whether mitochondrial targeted endonuclease III (EndoIII) which cleaves oxidized pyrimidines rather than purines from damaged DNA would also protect the lung. Minimal injury from 1 h ventilation at 40 cmH2O peak inflation pressure (PIP) was reversed by EndoIII pretreatment. Moderate lung injury due to ventilation for 2 h at 40 cmH2O PIP produced a 25-fold increase in total extravascular albumin space, a 60% increase in W/D weight ratio, and marked increases in MIP-2 and IL-6. Oxidative mtDNA damage and decreases in the total tissue glutathione (GSH) and the GSH/GSSH ratio also occurred. All of these indices of injury were attenuated by mitochondrial targeted EndoIII. Massive lung injury caused by 2 h ventilation at 50 cmH2O PIP was not attenuated by EndoIII pretreatment, but all untreated mice died prior to completing the two hour ventilation protocol, whereas all EndoIII-treated mice lived for the duration of ventilation. Thus, mitochondrial targeted DNA repair enzymes were protective against mild and moderate lung damage and they enhanced survival in the most severely injured group. PMID:25153040

  7. Research progress of relationship among DNA oxidative damage, its repair enzymes and neoplasms%DNA氧化损伤及其修复酶与肿瘤关系的研究进展

    范国琴

    2015-01-01

    DNA氧化损伤可引起机体功能的改变及疾病的发生.机体可通过多种途径修复DNA氧化损伤,而碱基切除修复(BER)方式是DNA氧化损伤修复最为重要的途径.参与DNA氧化损伤修复的代表酶为8-羟基鸟嘌呤核苷酸酶,即MutT同源酶(MTH)1和8-羟基鸟嘌呤DNA糖苷酶(OGG)1.DNA氧化损伤及其修复酶与肿瘤的发生、肿瘤细胞的生长关系密切.笔者拟就DNA氧化损伤及其修复酶与肿瘤的发生、肿瘤细胞的生长及治疗研究进行综述如下.%DNA oxidative damage can lead to dysfunctions and diseases.There are many pathways to repair DNA oxidative damage and base excision repair (BER) is the most important one.8 oxoguanine nucleotide triphosphatase,also known as MutT homologue (MTH)1,and 8-oxoguanine DNA glycosylase (OGG)I are major repair enzymes,which are closely related with tumorigenesis and growth of tumor cells.This review is about the relationship among tumorigenesis,growth of tumor cells,therapy of neoplasms and DNA oxidative damage and the repair enzymes.

  8. 肿瘤线粒体DNA损伤修复的研究进展%Research progress on mitochondrial DNA damage repair in tumors

    李鹤佳

    2012-01-01

    Mitochondria are organelles in mammalian cells, with the only genetic material outside the nucleus mitochondrial DNA(mtDNA). It supported and participated in many important cellular functions. MtDNA vulnera-bled to a variety of factors and cause damage because of special structures and advancement of genetics. When mtDNA damage happened, some mtDNA repair factors, such as: Mitochondrial transcription factor A, mtDNA poly-merase-γ, 8-oxoguanine DNA glycosylase enzymes take part in the damage repairing. The entire repair process were regulated by related factors.%线粒体是哺乳动物细胞中唯一存在于细胞核外又带有遗传物质线粒体DNA(mtDNA)的细胞器.mtDNA支持和参与诸多重要的细胞功能.mtDNA因其特殊的结构和遗传学地位,易受各种因素的损伤.当损伤发生时,线粒体内的DNA损伤修复因子,诸如线粒体转录因子A、mtDNA聚合酶-γ、8-氧鸟嘌呤DNA糖基化酶等参与修复过程,而整个修复过程受到上游相关因子的调控.

  9. Role of Fapy glycosylase and UvrABC excinuclease in the repair of UVA (320-400 nm)-mediated DNA damage in Escherichia coli

    In contrast to the damage caused by far-UV, the damage caused by UVA (320-400 nm) is largely oxygen dependent, suggesting near-UV-mediated DNA damage involves reactive oxygen species. The DNA repair enzymes that recognize oxidized bases may, therefore, be an important part of the cell's near-UV defense repertoire. To evaluate the relative importance of Fpg (Fapy) glycosy-lase (an enzyme known to remove oxidized bases) and the DNA damage-inducible UvrABC excinuclease in recovery from near-UV-induced stress, we have constructed fpg- and uvrA-derivatives of Escherichia coli and tested the response (survival) of these strains to both UVA and far-UV radiation. Relative to control strains, the fpg- derivatives were found to be consistently more sensitive to the lethal effects of UVA, but not far-UV radiation. In contrast, uvrA- mutants were more sensitive than control strains to both UVA and far-UV radiation. Thymine dimers, known to be produced by far-UV and corrected by UvrABC, were not generated by the UVA fluences used in this study, suggesting that some other UVA-induced lesion(s) is recognized and repaired by this excinuclease. (Author)

  10. Hyperosmotic stress memory in Arabidopsis is mediated by distinct epigenetically labile sites in the genome and is restricted in the male germline by DNA glycosylase activity.

    Wibowo, Anjar; Becker, Claude; Marconi, Gianpiero; Durr, Julius; Price, Jonathan; Hagmann, Jorg; Papareddy, Ranjith; Putra, Hadi; Kageyama, Jorge; Becker, Jorg; Weigel, Detlef; Gutierrez-Marcos, Jose

    2016-01-01

    Inducible epigenetic changes in eukaryotes are believed to enable rapid adaptation to environmental fluctuations. We have found distinct regions of the Arabidopsis genome that are susceptible to DNA (de)methylation in response to hyperosmotic stress. The stress-induced epigenetic changes are associated with conditionally heritable adaptive phenotypic stress responses. However, these stress responses are primarily transmitted to the next generation through the female lineage due to widespread DNA glycosylase activity in the male germline, and extensively reset in the absence of stress. Using the CNI1/ATL31 locus as an example, we demonstrate that epigenetically targeted sequences function as distantly-acting control elements of antisense long non-coding RNAs, which in turn regulate targeted gene expression in response to stress. Collectively, our findings reveal that plants use a highly dynamic maternal 'short-term stress memory' with which to respond to adverse external conditions. This transient memory relies on the DNA methylation machinery and associated transcriptional changes to extend the phenotypic plasticity accessible to the immediate offspring. PMID:27242129

  11. Novel repair activities of AlkA (3-methyladenine DNA glycosylase II) and endonuclease VIII for xanthine and oxanine, guanine lesions induced by nitric oxide and nitrous acid

    Terato, Hiroaki; Masaoka, Aya; Asagoshi, Kenjiro; Honsho, Akiko; Ohyama, Yoshihiko; Suzuki, Toshinori; Yamada, Masaki; Makino, Keisuke; Yamamoto, Kazuo; Ide, Hiroshi

    2002-01-01

    Nitrosation of guanine in DNA by nitrogen oxides such as nitric oxide (NO) and nitrous acid leads to formation of xanthine (Xan) and oxanine (Oxa), potentially cytotoxic and mutagenic lesions. In the present study, we have examined the repair capacity of DNA N-glycosylases from Escherichia coli for Xan and Oxa. The nicking assay with the defined substrates containing Xan and Oxa revealed that AlkA [in combination with endonuclease (Endo) IV] and Endo VIII recognized Xan in the tested enzymes. The activity (Vmax/Km) of AlkA for Xan was 5-fold lower than that for 7-methylguanine, and that of Endo VIII was 50-fold lower than that for thymine glycol. The activity of AlkA and Endo VIII for Xan was further substantiated by the release of [3H]Xan from the substrate. The treatment of E.coli with N-methyl-N′-nitro-N-nitrosoguanidine increased the Xan-excising activity in the cell extract from alkA+ but not alkA– strains. The alkA and nei (the Endo VIII gene) double mutant, but not the single mutants, exhibited increased sensitivity to nitrous acid relative to the wild type strain. AlkA and Endo VIII also exhibited excision activity for Oxa, but the activity was much lower than that for Xan. PMID:12434002

  12. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents

    Shanshan Song; Guichun Xing; Lin Yuan; Jian Wang; Shan Wang; Yuxin Yin; Chunyan Tian; Fuchu He; Lingqiang Zhang

    2012-01-01

    Alkylating agents induce genome-wide base damage,which is repaired mainly by N-methylpurine DNA glycosylase (MPG).An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks.However,the determinant of drug sensitivity or insensitivity still remains unclear.Here,we report that the p53 status coordinates with MPG to play a pivotal role in such process.MPG expression is positive in breast,lung and colon cancers (38.7%,43.4% and 25.3%,respectively) but negative in all adjacent normal tissues.MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells.The overexpression of MPG reduced,whereas depletion of MPG increased,the expression levels of pro-arrest gene downstream of p53 including p21,14-3-3σ and Gadd45 but not pro-apoptotic ones.The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53.Upon DNA alkylation stress,in p53 wild-type tumor cells,p53 dissociated from MPG and induced cell growth arrest.Then,AP sites were repaired efficiently,which led to insensitivity to alkylating agents.By contrast,in p53-mutated cells,the AP sites were repaired with low efficacy.To our knowledge,this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53,and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  13. Ebselen attenuates oxidative DNA damage and enhances its repair activity in the thalamus after focal cortical infarction in hypertensive rats.

    He, Meixia; Xing, Shihui; Yang, Bo; Zhao, Liqun; Hua, Haiying; Liang, Zhijian; Zhou, Wenliang; Zeng, Jinsheng; Pei, Zhong

    2007-11-21

    Oxidative DNA damage has been proposed to be a major contributor to focal cerebral ischemic injury. However, little is known about the role of oxidative DNA damage in remote damage secondary to the primary infarction. In the present study, we investigated oxidative damage within the ventroposterior nucleus (VPN) after distal middle cerebral artery occlusion (MCAO) in hypertensive rats. We also examined the possible protective effect of ebselen, one glutathione peroxidase mimic, on delayed degeneration in the VPN after distal MCAO. Neuronal damage in the ipsilateral VPN was examined by Nissl staining. Oxidative DNA damage and base repair enzyme activity were assessed by analyzing immunoreactivity of 8-hydroxy-2'-deoxyguanosine (8-ohdG) and 8-oxoguanine DNA glycosylase (OGG1), respectively. The number of intact neurons in the ipsilateral VPN decreased by 52% compared to the contralateral side in ischemia group 2 weeks after distal cerebral cortical infarction. The immunoreactivity of 8-ohdG significantly increased while OGG1 immunoreactivity significantly decreased in the ipsilateral VPN 2 weeks after distal cortical infarction (all pVPN (all pVPN region following distal MCAO. Furthermore, ebselen protects against the delayed damage in the VPN when given at 24 h following distal MCAO. PMID:17920569

  14. Biomarkers of oxidative damage to DNA and repair.

    Loft, Steffen; Høgh Danielsen, Pernille; Mikkelsen, Lone; Risom, Lotte; Forchhammer, Lykke; Møller, Peter

    2008-10-01

    Oxidative-stress-induced damage to DNA includes a multitude of lesions, many of which are mutagenic and have multiple roles in cancer and aging. Many lesions have been characterized by MS-based methods after extraction and digestion of DNA. These preparation steps may cause spurious base oxidation, which is less likely to occur with methods such as the comet assay, which are based on nicking of the DNA strand at modified bases, but offer less specificity. The European Standards Committee on Oxidative DNA Damage has concluded that the true levels of the most widely studied lesion, 8-oxodG (8-oxo-7,8-dihydro-2'-deoxyguanosine), in cellular DNA is between 0.5 and 5 lesions per 10(6) dG bases. Base excision repair of oxidative damage to DNA can be assessed by nicking assays based on oligonucleotides with lesions or the comet assay, by mRNA expression levels or, in the case of, e.g., OGG1 (8-oxoguanine DNA glycosylase 1), responsible for repair of 8-oxodG, by genotyping. Products of repair in DNA or the nucleotide pool, such as 8-oxodG, excreted into the urine can be assessed by MS-based methods and generally reflects the rate of damage. Experimental and population-based studies indicate that many environmental factors, including particulate air pollution, cause oxidative damage to DNA, whereas diets rich in fruit and vegetables or antioxidant supplements may reduce the levels and enhance repair. Urinary excretion of 8-oxodG, genotype and expression of OGG1 have been associated with risk of cancer in cohort settings, whereas altered levels of damage, repair or urinary excretion in case-control settings may be a consequence rather than the cause of the disease. PMID:18793191

  15. Dietary elevated sucrose modulation of diesel-induced genotoxicity in the colon and liver of Big Blue rats

    Risom, L.; Moller, P.; Hansen, Max;

    2003-01-01

    liver. The mRNA expression levels of the DNA repair enzymes N-methylpurine DNA glycosylase (MPG), 8-oxoguanine DNA glycosylase (OGG1) and ERCC1 (part of the nucleotide excision repair complex) measured by reverse transcription-polymerase chain reaction were increased in liver by DEP feeding. In colon...

  16. A unique dual recognition hairpin probe mediated fluorescence amplification method for sensitive detection of uracil-DNA glycosylase and endonuclease IV activities.

    Wu, Yushu; Yan, Ping; Xu, Xiaowen; Jiang, Wei

    2016-03-01

    Uracil-DNA glycosylase (UDG) and endonuclease IV (Endo IV) play cooperative roles in uracil base-excision repair (UBER) and inactivity of either will interrupt the UBER to cause disease. Detection of UDG and Endo IV activities is crucial to evaluate the UBER process in fundamental research and diagnostic application. Here, a unique dual recognition hairpin probe mediated fluorescence amplification method was developed for sensitively and selectively detecting UDG and Endo IV activities. For detecting UDG activity, the uracil base in the probe was excised by the target enzyme to generate an apurinic/apyrimidinic (AP) site, achieving the UDG recognition. Then, the AP site was cleaved by a tool enzyme Endo IV, releasing a primer to trigger rolling circle amplification (RCA) reaction. Finally, the RCA reaction produced numerous repeated G-quadruplex sequences, which interacted with N-methyl-mesoporphyrin IX to generate an enhanced fluorescence signal. Alternatively, for detecting Endo IV activity, the uracil base in the probe was first converted into an AP site by a tool enzyme UDG. Next, the AP site was cleaved by the target enzyme, achieving the Endo IV recognition. The signal was then generated and amplified in the same way as those in the UDG activity assay. The detection limits were as low as 0.00017 U mL(-1) for UDG and 0.11 U mL(-1) for Endo IV, respectively. Moreover, UDG and Endo IV can be well distinguished from their analogs. This method is beneficial for properly evaluating the UBER process in function studies and disease prognoses. PMID:26899234

  17. Evidence that OGG1 glycosylase protects neurons against oxidative DNA damage and cell death under ischemic conditions

    Liu, Dong; Croteau, Deborah L; Souza-Pinto, Nadja; Pitta, Michael; Tian, Jingyan; Wu, Christopher; Jiang, Haiyang; Mustafa, Khadija; Keijzers, Guido; Bohr, Vilhelm; Mattson, Mark P

    2011-01-01

    . Cortical neurons isolated from OGG1(-/-) mice were more vulnerable to oxidative insults than were OGG1(+/+) neurons, and OGG1(-/-) mice developed larger cortical infarcts and behavioral deficits after permanent middle cerebral artery occlusion compared with OGG1(+/+) mice. Accumulations of oxidative DNA...

  18. Low-level laser irradiation alters mRNA expression from genes involved in DNA repair and genomic stabilization in myoblasts

    Trajano, L. A. S. N.; Sergio, L. P. S.; Silva, C. L.; Carvalho, L.; Mencalha, A. L.; Stumbo, A. C.; Fonseca, A. S.

    2016-07-01

    Low-level lasers are used for the treatment of diseases in soft and bone tissues, but few data are available regarding their effects on genomic stability. In this study, we investigated mRNA expression from genes involved in DNA repair and genomic stabilization in myoblasts exposed to low-level infrared laser. C2C12 myoblast cultures in different fetal bovine serum concentrations were exposed to low-level infrared laser (10, 35 and 70 J cm‑2), and collected for the evaluation of DNA repair gene expression. Laser exposure increased gene expression related to base excision repair (8-oxoguanine DNA glycosylase and apurinic/apyrimidinic endonuclease 1), nucleotide excision repair (excision repair cross-complementation group 1 and xeroderma pigmentosum C protein) and genomic stabilization (ATM serine/threonine kinase and tumor protein p53) in normal and low fetal bovine serum concentrations. Results suggest that genomic stability could be part of a biostimulation effect of low-level laser therapy in injured muscles.

  19. Regulation of mitochondrial genome replication by hypoxia: The role of DNA oxidation in D-loop region.

    Pastukh, Viktor M; Gorodnya, Olena M; Gillespie, Mark N; Ruchko, Mykhaylo V

    2016-07-01

    Mitochondria of mammalian cells contain multiple copies of mitochondrial (mt) DNA. Although mtDNA copy number can fluctuate dramatically depending on physiological and pathophysiologic conditions, the mechanisms regulating mitochondrial genome replication remain obscure. Hypoxia, like many other physiologic stimuli that promote growth, cell proliferation and mitochondrial biogenesis, uses reactive oxygen species as signaling molecules. Emerging evidence suggests that hypoxia-induced transcription of nuclear genes requires controlled DNA damage and repair in specific sequences in the promoter regions. Whether similar mechanisms are operative in mitochondria is unknown. Here we test the hypothesis that controlled oxidative DNA damage and repair in the D-loop region of the mitochondrial genome are required for mitochondrial DNA replication and transcription in hypoxia. We found that hypoxia had little impact on expression of mitochondrial proteins in pulmonary artery endothelial cells, but elevated mtDNA content. The increase in mtDNA copy number was accompanied by oxidative modifications in the D-loop region of the mitochondrial genome. To investigate the role of this sequence-specific oxidation of mitochondrial genome in mtDNA replication, we overexpressed mitochondria-targeted 8-oxoguanine glycosylase Ogg1 in rat pulmonary artery endothelial cells, enhancing the mtDNA repair capacity of transfected cells. Overexpression of Ogg1 resulted in suppression of hypoxia-induced mtDNA oxidation in the D-loop region and attenuation of hypoxia-induced mtDNA replication. Ogg1 overexpression also reduced binding of mitochondrial transcription factor A (TFAM) to both regulatory and coding regions of the mitochondrial genome without altering total abundance of TFAM in either control or hypoxic cells. These observations suggest that oxidative DNA modifications in the D-loop region during hypoxia are important for increased TFAM binding and ensuing replication of the mitochondrial

  20. Characterization of a novel DNA glycosylase from S. sahachiroi involved in the reduction and repair of azinomycin B induced DNA damage

    Wang, Shan; Liu, Kai; Xiao, Le; Yang, Liyuan; LI Hong; Zhang, Feixue; Lei, Lei; Li, Shengqing; Feng, Xu; Li, Aiying; He, Jing

    2015-01-01

    Azinomycin B is a hybrid polyketide/nonribosomal peptide natural product and possesses antitumor activity by interacting covalently with duplex DNA and inducing interstrand crosslinks. In the biosynthetic study of azinomycin B, a gene (orf1) adjacent to the azinomycin B gene cluster was found to be essential for the survival of the producer, Streptomyces sahachiroi ATCC33158. Sequence analyses revealed that Orf1 belongs to the HTH_42 superfamily of conserved bacterial proteins which are widel...

  1. The basal levels of 8-oxoG and other oxidative modifications in intact mitochondrial DNA are low even in repair-deficient (Ogg1{sup -/-}/Csb{sup -/-}) mice

    Trapp, Christian [Institute of Pharmacy, University of Mainz, D-55099 Mainz (Germany); McCullough, Amanda K. [CROET/Mol. Med. Genetics, Oregon Health and Science University, Portland, OR 97239 (United States); Epe, Bernd [Institute of Pharmacy, University of Mainz, D-55099 Mainz (Germany)], E-mail: epe@uni-mainz.de

    2007-12-01

    Mitochondrial DNA (mtDNA) is assumed to be highly prone to damage by reactive oxygen species (ROS) because of its location in close proximity to the mitochondrial electron transport chain. Accordingly, mitochondrial oxidative DNA damage has been hypothesized to be responsible for various neurological diseases, ageing and cancer. Since 7,8-dihydro-8-oxoguanine (8-oxoG), one of the most frequent oxidative base modifications, is removed from the mitochondrial genome by the glycosylase OGG1, the basal levels of this lesion are expected to be highly elevated in Ogg1{sup -/-} mice. To investigate this hypothesis, we have used a mtDNA relaxation assay in combination with various repair enzymes (Fpg, MutY, endonuclease III, endonuclease IV) to determine the average steady-state number of oxidative DNA modifications within intact (supercoiled) mtDNA from the livers of wild-type mice and those deficient in OGG1 and/or the Cockayne syndrome B (CSB) protein for mice aged up to 23 months. The levels of all types of oxidative modifications were found to be less than 12 per million base pairs, and the difference between wild-type and repair-deficient (Ogg1{sup -/-}/Csb{sup -/-}) mice was not significant. Thus, the increase of 8-oxoG caused by the repair deficiency in intact mtDNA is not much higher than in the nuclear DNA, i.e., not more than a few modifications per million base pairs. Based on these data, it is hypothesized that the load of oxidative base modifications in mtDNA is efficiently reduced during replication even in the absence of excision repair.

  2. [Exercise training in hypoxia prevents hypoxia induced mitochondrial DNA oxidative damage in skeletal muscle].

    Bo, Hai; Li, Ling; Duan, Fu-Qiang; Zhu, Jiang

    2014-10-25

    This study was undertaken to investigate the effect of exercise training on mitochondrial DNA (mtDNA) oxidative damage and 8-oxoguanine DNA glycosylase-1 (OGG1) expression in skeletal muscle of rats under continuous exposure to hypoxia. Male Sprague-Dawley rats were randomly divided into 4 groups (n = 8): normoxia control group (NC), normoxia training group (NT), hypoxia control group (HC), and hypoxia training group (HT). The hypoxia-treated animals were housed in normobaric hypoxic tent containing 11.3% oxygen for consecutive 4 weeks. The exercise-trained animals were exercised on a motor-driven rodent treadmill at a speed of 15 m/min, 5% grade for 60 min/day, 5 days per week for 4 weeks. The results showed that, compared with NC group, hypoxia attenuated complex I, II, IV and ATP synthase activities of the electron transport chain, and the level of mitochondrial membrane potential in HC group (P hypoxia decreased mitochondrial OGG1, MnSOD, and GPx activities (P hypoxia attenuated muscle and mitochondrial [NAD⁺]/ [NADH] ratio, and SIRT3 protein expression (P exercise training in hypoxia elevated complex I, II, IV and ATP synthase activities, and the level of mitochondrial membrane potential in HT group (P exercise training in hypoxia increased MnSOD and GPx activities and mitochondrial OGG1 level (P exercise training in hypoxia increased muscle and mitochondrial [NAD⁺]/[NADH] ratio, as well as SIRT3 protein expression (P exercise training in hypoxia can decrease hypoxia-induced mtDNA oxidative damage in the skeletal muscle through up-regulating exercise-induced mitochondrial OGG1 and antioxidant enzymes. Exercise training in hypoxia may improve hypoxia tolerance in skeletal muscle mitochondria via elevating [NAD⁺]/[NADH] ratio and SIRT3 expression. PMID:25332006

  3. Antioxidant-mediated up-regulation of OGG1 via NRF2 induction is associated with inhibition of oxidative DNA damage in estrogen-induced breast cancer

    Estrogen metabolism-mediated oxidative stress is suggested to play an important role in estrogen-induced breast carcinogenesis. We have earlier demonstrated that antioxidants, vitamin C (Vit C) and butylated hydroxyanisole (BHA) inhibit 17β-estradiol (E2)-mediated oxidative stress and oxidative DNA damage, and breast carcinogenesis in female August Copenhagen Irish (ACI) rats. The objective of the present study was to characterize the mechanism by which above antioxidants prevent DNA damage during breast carcinogenesis. Female ACI rats were treated with E2; Vit C; Vit C + E2; BHA; and BHA + E2 for up to 240 days. mRNA and protein levels of a DNA repair enzyme 8-Oxoguanine DNA glycosylase (OGG1) and a transcription factor NRF2 were quantified in the mammary and mammary tumor tissues of rats after treatment with E2 and compared with that of rats treated with antioxidants either alone or in combination with E2. The expression of OGG1 was suppressed in mammary tissues and in mammary tumors of rats treated with E2. Expression of NRF2 was also significantly suppressed in E2-treated mammary tissues and in mammary tumors. Vitamin C or BHA treatment prevented E2-mediated decrease in OGG1 and NRF2 levels in the mammary tissues. Chromatin immunoprecipitation analysis confirmed that antioxidant-mediated induction of OGG1 was through increased direct binding of NRF2 to the promoter region of OGG1. Studies using silencer RNA confirmed the role of OGG1 in inhibition of oxidative DNA damage. Our studies suggest that antioxidants Vit C and BHA provide protection against oxidative DNA damage and E2-induced mammary carcinogenesis, at least in part, through NRF2-mediated induction of OGG1

  4. Polymorphisms of DNA repair genes OGG1 and XPD and the risk of age-related cataract in Egyptians

    Gharib, Amal F.; Dabour, Sherif A.; Etewa, Rasha L.; Fouad, Rania A.

    2014-01-01

    Purpose To analyze the association of the polymorphisms of xeroderma pigmentosum complementation group D (XPD) and 8-oxoguanine glycosylase-1 (OGG1) genes with the risk of age-related cataract (ARC) in an Egyptian population. Methods This case-control study included 150 patients with ARC and 50 controls. Genotyping of XPD Asp312Asn was performed by amplification refractory mutation system PCR assay and genotyping of OGG1 Ser326Cys was carried out by PCR including confronting two-pair primers....

  5. Use of sequence microdivergence in mycobacterial ortholog to analyze contributions of the water-activating loop histidine of Escherichia coli uracil-DNA glycosylase in reactant binding and catalysis

    Uracil-DNA glycosylase (Ung), a DNA repair enzyme, pioneers uracil excision repair pathway. Structural determinations and mutational analyses of the Ung class of proteins have greatly facilitated our understanding of the mechanism of uracil excision from DNA. More recently, a hybrid quantum-mechanical/molecular mechanical analysis revealed that while the histidine (H67 in EcoUng) of the GQDPYH motif (ω loop) in the active site pocket is important in positioning the reactants, it makes an unfavorable energetic contribution (penalty) in achieving the transition state intermediate. Mutational analysis of this histidine is unavailable from any of the Ung class of proteins. A complication in demonstrating negative role of a residue, especially when located within the active site pocket, is that the mutants with enhanced activity are rarely obtained. Interestingly, unlike the most Ung proteins, the H67 equivalent in the ω loop in mycobacterial Ung is represented by P67. Exploiting this natural diversity to maintain structural integrity of the active site, we transplanted an H67P mutation in EcoUng. Uracil inhibition assays and binding of a proteinaceous inhibitor, Ugi (a transition state substrate mimic), with the mutant (H67P) revealed that its active site pocket was not perturbed. The catalytic efficiency (Vmax/Km) of the mutant was similar to that of the wild type Ung. However, the mutant showed increased Km and Vmax. Together with the data from a double mutation H67P/G68T, these observations provide the first biochemical evidence for the proposed diverse roles of H67 in catalysis by Ung

  6. In vivo repair of alkylating and oxidative DNA damage in the mitochondrial and nuclear genomes of wild-type and glycosylase-deficient Caenorhabditis elegans

    Hunter, Senyene E.; Gustafson, Margaret A; Margillo, Kathleen M; Lee, Sean A; Ryde, Ian T.; Meyer, Joel N.

    2012-01-01

    Base excision repair (BER) is an evolutionarily conserved DNA repair pathway that is critical for repair of many of the most common types of DNA damage generated both by endogenous metabolic pathways and exposure to exogenous stressors such as pollutants. C. elegans is an increasingly important model organism for the study of DNA damage-related processes including DNA repair, genotoxicity, and apoptosis, but BER is not well understood in this organism, and has not previously been measured in ...

  7. Overexpression of transcription factor AP-2 stimulates the PA promoter of the human uracil-DNA glycosylase (UNG) gene through a mechanism involving derepression

    Aas, Per Arne; Pena Diaz, Javier; Liabakk, Nina Beate;

    2009-01-01

    alpha, lacking the activation domain but retaining the DNA binding and dimerization domains, stimulated PA to a level approaching that of full-length AP-2, suggesting that AP-2 overexpression stimulates PA activity by a mechanism involving derepression rather than activation, possibly by neutralizing an...

  8. DNA glycosylases involved in base excision repair may be associated with cancer risk in BRCA1 and BRCA2 mutation carriers

    Osorio, Ana; Milne, Roger L; Kuchenbaecker, Karoline;

    2014-01-01

    Single Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of th...

  9. Alkali-labile lesion and uracil-DNA-glycosylase-sensitive site removal after BrdUrd and UVB treatment of Chinese hamster cells

    A marked cell-cycle dependency for the recovery of cells after BrdUrd UVB treatment has led us to look for similar characteristics in the molecular events associated with DNA repair. Such characteristics are reported for the repair of alkali-labile lesions. When asynchronously growing cells were uniformly substituted with BrdUrd (a condition that results in the greatest cell killing), the repair kinetics followed a simple exponential response with a half-time of approximately 17 min. However, when lesions were restricted to 3-5% of the genome and the repair observed in the mid-S phase (a condition associated with sublethal damage repair), the DNA repair kinetics were complex. The rejoining of the DNA was biphasic with greater than 90% of the lesion with a half-time of less than 6-7 min. Uracil removal followed similar kinetics. Caffeine, a potent inhibitor of cell survival after BrdUrd/UVB treatment, had no measurable effect on either uracil removal or alkali-labile lesion repair. (author)

  10. Molecular dynamics simulation studies of radiation damaged DNA. Molecules and repair enzymes

    Molecular dynamics (MD) studies on several radiation damages to DNA and their recognition by repair enzymes are introduced in order to describe the stepwise description of molecular process observed at radiation lesion sites. MD studies were performed on pyrimidine (thymine dimer, thymine glycol) and purine (8-oxoguanine) lesions using an MD simulation code AMBER 5.0. The force field was modified for each lesion. In all cases the significant structural changes in the DNA double helical structure were observed; a) the breaking of hydrogen bond network between complementary bases and resulting opening of the double helix (8-oxoguanine); b) the sharp bending of the DNA helix centered at the lesion site (thymine dimer, thymine glycol); and c) the flipping-out base on the strand complementary to the lesion (8-oxoguanine). These changes were related to the overall collapsing double helical structure around the lesion and might facilitate the docking of the repair enzyme into the DNA and formation of DNA-enzyme complex. In addition to the structural changes, at lesion sites there were found electrostatic interaction energy values different from those at native sites (thymine dimer -10 kcal/mol, thymine glycol -26 kcal/mol, 8-oxoguanine -48 kcal/mol). These values of electrostatic energy may discriminate lesion from values at native sites (thymine 0 kcal/mol, guanine -37 kcal/mol) and enable a repair enzyme to recognize a lesion during scanning DNA surface. The observed specific structural conformation and energetic properties at the lesions sites are factors that guide a repair enzyme to discriminate lesions from non-damaged native DNA segments. (author)

  11. Assessment of oxidative DNA damage formation by organic complex mixtures from airborne particles PM10

    Gábelová, A.; Valovičová, Z.; Lábaj, J.; Bačová, G.; Binková, Blanka; Farmer, P. B.

    2007-01-01

    Roč. 620, 1-2 (2007), s. 135-144. ISSN 0027-5107 Grant ostatní: EU(EU) 2000-00091 Institutional research plan: CEZ:AV0Z50390512 Source of funding: R - rámcový projekt EK Keywords : airborne particles PM10 * oxidative DNA damage * 8-oxoguanine Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 4.159, year: 2007

  12. Significance of 8-oxoG in the spectrum of DNA damages caused by ionising radiation of different quality

    Štěpán, Václav; Davídková, Marie

    2007-01-01

    Roč. 122, 1-4 (2007), s. 113-115. ISSN 0144-8420. [Symposium on Microdosimetry /14./. Venezia, 13.11.2005-18.11.2005] R&D Projects: GA AV ČR KJB4048401; GA ČR GA202/05/2728 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA damage * 8-oxoguanine * ionizing radiation * theoretical modeling Subject RIV: BO - Biophysics Impact factor: 0.528, year: 2007

  13. hSSB1 (NABP2/OBFC2B) is regulated by oxidative stress.

    Paquet, Nicolas; Adams, Mark N; Ashton, Nicholas W; Touma, Christine; Gamsjaeger, Roland; Cubeddu, Liza; Leong, Vincent; Beard, Sam; Bolderson, Emma; Botting, Catherine H; O'Byrne, Kenneth J; Richard, Derek J

    2016-01-01

    The maintenance of genome stability is an essential cellular process to prevent the development of diseases including cancer. hSSB1 (NABP2/ OBFC2A) is a critical component of the DNA damage response where it participates in the repair of double-strand DNA breaks and in base excision repair of oxidized guanine residues (8-oxoguanine) by aiding the localization of the human 8-oxoguanine glycosylase (hOGG1) to damaged DNA. Here we demonstrate that following oxidative stress, hSSB1 is stabilized as an oligomer which is required for hSSB1 to function in the removal of 8-oxoguanine. Monomeric hSSB1 shows a decreased affinity for oxidized DNA resulting in a cellular 8-oxoguanine-repair defect and in the absence of ATM signaling initiation. While hSSB1 oligomerization is important for the removal of 8-oxoguanine from the genome, it is not required for the repair of double-strand DNA-breaks by homologous recombination. These findings demonstrate a novel hSSB1 regulatory mechanism for the repair of damaged DNA. PMID:27273218

  14. Gas-Phase Studies of Formamidopyrimidine Glycosylase (Fpg) Substrates.

    Kiruba, G S M; Xu, Jiahui; Zelikson, Victoria; Lee, Jeehiun K

    2016-03-01

    Gas-phase thermochemical properties (tautomerism, acidity, and proton affinity) have been measured and calculated for a series of nucleobase derivatives that have not heretofore been examined under vacuum. The studied species are substrates for the enzyme formamidopyrimidine glycosylase (Fpg), which cleaves damaged nucleobases from DNA. The gas-phase results are compared and contrasted to solution-phase data, to afford insight into the Fpg mechanism. Calculations are also used to probe the energetics of various possible mechanisms and to predict isotope effects that could potentially allow for discrimination between different mechanisms. Specifically, (18) O substitution at the ribose O4' is predicted to result in a normal kinetic isotope effect (KIE) for a ring-opening "endocyclic" mechanism and an inverse KIE for a direct base excision "exocyclic" pathway. PMID:26894440

  15. Detection of specific oxidative DNA damage in gill cells and hemocytes of Dreissena polymorpha with the comet assay and OGG1 enzyme

    C.; Michel; Vincent-Hubert, F.

    2009-01-01

    Genotoxicity-end points, such as single strand breaks (SSB) and oxidative DNA damage are highly applicable for monitoring water pollutants effects. In our study, caged zebra mussels are used for monitoring freshwater pollution on urban sites of the Seine basin. After one month of transplantation, an increase amount of SSB was detected with the comet assay. However, mutagenic lesions, especially 8-oxoguanine, are more relevant than SSB for the evaluation of biological effects. Moreover, they h...

  16. Expression of human oxoguanine glycosylase 1 or formamidopyrimidine glycosylase in human embryonic kidney 293 cells exacerbates methylmercury toxicity in vitro

    Ondovcik, Stephanie L.; Preston, Thomas J.; McCallum, Gordon P. [Department of Pharmaceutical Sciences, University of Toronto, Toronto, Ontario M5S 3M2 (Canada); Wells, Peter G., E-mail: pg.wells@utoronto.ca [Department of Pharmaceutical Sciences, University of Toronto, Toronto, Ontario M5S 3M2 (Canada); Department of Pharmacology and Toxicology, University of Toronto, Toronto, Ontario M5S 1A8 (Canada)

    2013-08-15

    Exposure to methylmercury (MeHg) acutely at high levels, or via chronic low-level dietary exposure from daily fish consumption, can lead to adverse neurological effects in both the adult and developing conceptus. To determine the impact of variable DNA repair capacity, and the role of reactive oxygen species (ROS) and oxidatively damaged DNA in the mechanism of toxicity, transgenic human embryonic kidney (HEK) 293 cells that stably express either human oxoguanine glycosylase 1 (hOgg1) or its bacterial homolog, formamidopyrimidine glycosylase (Fpg), which primarily repair the oxidative lesion 8-oxo-2′-deoxyguanosine (8-oxodG), were used to assess the in vitro effects of MeHg. Western blotting confirmed the expression of hOgg1 or Fpg in both the nuclear and mitochondrial compartments of their respective cell lines. Following acute (1–2 h) incubations with 0–10 μM MeHg, concentration-dependent decreases in clonogenic survival and cell growth accompanied concentration-dependent increases in lactate dehydrogenase (LDH) release, ROS formation, 8-oxodG levels and apurinic/apyrimidinic (AP) sites, consistent with the onset of cytotoxicity. Paradoxically, hOgg1- and Fpg-expressing HEK 293 cells were more sensitive than wild-type cells stably transfected with the empty vector control to MeHg across all cellular and biochemical parameters, exhibiting reduced clonogenic survival and cell growth, and increased LDH release and DNA damage. Accordingly, upregulation of specific components of the base excision repair (BER) pathway may prove deleterious potentially due to the absence of compensatory enhancement of downstream processes to repair toxic intermediary abasic sites. Thus, interindividual variability in DNA repair activity may constitute an important risk factor for environmentally-initiated, oxidatively damaged DNA and its pathological consequences. - Highlights: • hOgg1 and Fpg repair oxidatively damaged DNA. • hOgg1- and Fpg-expressing cells are more

  17. Sequence Classification: 891958 [

    Full Text Available ondrial glycosylase/lyase that specifically excises 7,8-dihydro-8-oxoguanine residues located opposite cytosine or thymine residues... in DNA, repairs oxidative damage to mitochondrial DNA; Ogg1p || http://www.ncbi.nlm.nih.gov/protein/6323580 ... ...Non-TMB Non-TMH Non-TMB Non-TMB Non-TMB Non-TMB >gi|6323580|ref|NP_013651.1| Mitoch

  18. Chloroethyinitrosourea-derived ethano cytosine and adenine adducts are substrates for escherichia coli glycosylases excising analogous etheno adducts

    Guliaev, Anton B.; Singer, B.; Hang, Bo

    2004-05-05

    Exocyclic ethano DNA adducts are saturated etheno ring derivatives formed mainly by therapeutic chloroethylnitrosoureas (CNUs), which are also mutagenic and carcinogenic. In this work, we report that two of the ethano adducts, 3,N{sup 4}-ethanocytosine (EC) and 1,N{sup 6}-ethanoadenine (EA), are novel substrates for the Escherichia coli mismatch-specific uracil-DNA glycosylase (Mug) and 3-methyladenine DNA glycosylase II (AlkA), respectively. It has been shown previously that Mug excises 3,N{sup 4}-ethenocytosine ({var_epsilon}C) and AlkA releases 1,N{sup 6}-ethenoadenine ({var_epsilon}A). Using synthetic oligonucleotides containing a single ethano or etheno adduct, we found that both glycosylases had a {approx}20-fold lower excision activity toward EC or EA than that toward their structurally analogous {var_epsilon}C or {var_epsilon}A adduct. Both enzymes were capable of excising the ethano base paired with any of the four natural bases, but with varying efficiencies. The Mug activity toward EC could be stimulated by E. coli endonuclease IV and, more efficiently, by exonuclease III. Molecular dynamics (MD) simulations showed similar structural features of the etheno and ethano derivatives when present in DNA duplexes. However, also as shown by MD, the stacking interaction between the EC base and Phe 30 in the Mug active site is reduced as compared to the {var_epsilon}C base, which could account for the lower EC activity observed in this study.

  19. Overexpression, purification, crystallization and preliminary X-ray analysis of uracil N-glycosylase from Mycobacterium tuberculosis in complex with a proteinaceous inhibitor

    Uracil N-glycosylase from M. tuberculosis has been crystallized in complex with a proteinaceous inhibitor (Ugi) and X-ray diffraction data have been collected. Uracil N-glycosylase is an enzyme which initiates the pathway of uracil-excision repair of DNA. The enzyme from Mycobacterium tuberculosis was co-expressed with a proteinaceous inhibitor from Bacillus subtilis phage and was crystallized in monoclinic space group C2, with unit-cell parameters a = 201.14, b = 64.27, c = 203.68 Å, β = 109.7°. X-ray data from the crystal have been collected for structure analysis

  20. Oxidative DNA damage background estimated by a system model of base excision repair

    Sokhansanj, B A; Wilson, III, D M

    2004-05-13

    Human DNA can be damaged by natural metabolism through free radical production. It has been suggested that the equilibrium between innate damage and cellular DNA repair results in an oxidative DNA damage background that potentially contributes to disease and aging. Efforts to quantitatively characterize the human oxidative DNA damage background level based on measuring 8-oxoguanine lesions as a biomarker have led to estimates varying over 3-4 orders of magnitude, depending on the method of measurement. We applied a previously developed and validated quantitative pathway model of human DNA base excision repair, integrating experimentally determined endogenous damage rates and model parameters from multiple sources. Our estimates of at most 100 8-oxoguanine lesions per cell are consistent with the low end of data from biochemical and cell biology experiments, a result robust to model limitations and parameter variation. Our results show the power of quantitative system modeling to interpret composite experimental data and make biologically and physiologically relevant predictions for complex human DNA repair pathway mechanisms and capacity.

  1. Dispensability of the [4Fe-4S] cluster in novel homologues of adenine glycosylase MutY.

    Trasviña-Arenas, Carlos H; Lopez-Castillo, Laura M; Sanchez-Sandoval, Eugenia; Brieba, Luis G

    2016-02-01

    7,8-Dihydro-8-deoxyguanine (8oG) is one of the most common oxidative lesions in DNA. DNA polymerases misincorporate an adenine across from this lesion. Thus, 8oG is a highly mutagenic lesion responsible for G:C→T:A transversions. MutY is an adenine glycosylase, part of the base excision repair pathway that removes adenines, when mispaired with 8oG or guanine. Its catalytic domain includes a [4Fe-4S] cluster motif coordinated by cysteinyl ligands. When this cluster is absent, MutY activity is depleted and several studies concluded that the [4Fe-4S] cluster motif is an indispensable component for DNA binding, substrate recognition and enzymatic activity. In the present study, we identified 46 MutY homologues that lack the canonical cysteinyl ligands, suggesting an absence of the [4Fe-4S] cluster. A phylogenetic analysis groups these novel MutYs into two different clades. One clade is exclusive of the order Lactobacillales and another clade has a mixed composition of anaerobic and microaerophilic bacteria and species from the protozoan genus Entamoeba. Structural modeling and sequence analysis suggests that the loss of the [4Fe-4S] cluster is compensated by a convergent solution in which bulky amino acids substitute the [4Fe-4S] cluster. We functionally characterized MutYs from Lactobacillus brevis and Entamoeba histolytica as representative members from each clade and found that both enzymes are active adenine glycosylases. Furthermore, chimeric glycosylases, in which the [4Fe-4S] cluster of Escherichia coli MutY is replaced by the corresponding amino acids of LbY and EhY, are also active. Our data indicates that the [4Fe-4S] cluster plays a structural role in MutYs and evidences the existence of alternative functional solutions in nature. PMID:26613369

  2. Repair of DNA treated with γ-irradiation and chemical carcinogens. Progress report, 1980-1983

    We have studied in vitro DNA repair with the isolation and characterization of DNA glycosylases active in the removable of 3-methyladenine and the problem of repair of DNA in chromatin. The second area of focus has been on transposable elements and carcinogen action. The work on DNA adducts with β-propiolactone was done to define potential new substrates useful in a search for new glycosylases

  3. Inactivation by oxidation and recruitment into stress granules of hOGG1 but not APE1 in human cells exposed to sub-lethal concentrations of cadmium

    The induction of mutations in mammalian cells exposed to cadmium has been associated with the oxidative stress triggered by the metal. There is increasing evidence that the mutagenic potential of Cd is not restricted to the induction of DNA lesions. Cd has been shown to inactivate several DNA repair enzymes. Here we show that exposure of human cells to sub-lethal concentrations of Cd leads to a time- and concentration-dependent decrease in hOGG1 activity, the major DNA glycosylase activity responsible for the initiation of the base excision repair (BER) of 8-oxoguanine, an abundant and mutagenic form of oxidized guanine. Although there is a slight effect on the level of hOGG1 transcripts, we show that the inhibition of the 8-oxoguanine DNA glycosylase activity is mainly associated with an oxidation of the hOGG1 protein and its disappearance from the soluble fraction of total cell extracts. Confocal microscopy analyses show that in cells exposed to Cd hOGG1-GFP is recruited to discrete structures in the cytoplasm. These structures were identified as stress granules. Removal of Cd from the medium allows the recovery of the DNA glycosylase activity and the presence of hOGG1 in a soluble form. In contrast to hOGG1, we show here that exposure to Cd does not affect the activity of the second enzyme of the pathway, the major AP endonuclease APE1.

  4. UVA photoactivation of DNA containing halogenated thiopyrimidines induces cytotoxic DNA lesions.

    Brem, Reto; Zhang, Xiaohui; Xu, Yao-Zhong; Karran, Peter

    2015-04-01

    Photochemotherapy, the combination of a photosensitiser and ultraviolet (UV) or visible light, is an effective treatment for skin conditions including cancer. The high mutagenicity and non-selectivity of photochemotherapy regimes warrants the development of alternative approaches. We demonstrate that the thiopyrimidine nucleosides 5-bromo-4-thiodeoxyuridine (SBrdU) and 5-iodo-4-thiodeoxyuridine (SIdU) are incorporated into the DNA of cultured human and mouse cells where they synergistically sensitise killing by low doses of UVA radiation. The DNA halothiopyrimidine/UVA combinations induce DNA interstrand crosslinks, DNA-protein crosslinks, DNA strand breaks, nucleobase damage and lesions that resemble UV-induced pyrimidine(6-4)pyrimidone photoproducts. These are potentially lethal DNA lesions and cells defective in their repair are hypersensitive to killing by SBrdU/UVA and SIdU/UVA. DNA SIdU and SBrdU generate lethal DNA photodamage by partially distinct mechanisms that reflect the different photolabilities of their C-I and C-Br bonds. Although singlet oxygen is involved in photolesion formation, DNA SBrdU and SIdU photoactivation does not detectably increase DNA 8-oxoguanine levels. The absence of significant collateral damage to normal guanine suggests that UVA activation of DNA SIdU or SBrdU might offer a strategy to target hyperproliferative skin conditions that avoids the extensive formation of a known mutagenic DNA lesion. PMID:25747491

  5. Release of 7-methylguanine residues from alkylated DNA by extracts of Micrococcus luteus and Escherichia coli.

    Laval, J; Pierre, J; Laval, F

    1981-01-01

    Cell extracts from Micrococcus luteus release both free 3-methyladenine and free 7-methylguanine from alkylated DNA. The glycosylase activity responsible for the liberation of 7-methylguanine is not 3-methyladenine-DNA glycosylase, which, when purified, does not liberate it. Furthermore, the heat inactivation rates of the two enzymatic activities are different. The release of 7-methylguanine by chemical depurination of ethanol-soluble oligonucleotides has been ruled out. A similar activity re...

  6. In vitro Repair of Oxidative DNA Damage by Human Nucleotide Excision Repair System: Possible Explanation for Neurodegeneration in Xeroderma Pigmentosum Patients

    Reardon, Joyce T.; Bessho, Tadayoshi; Kung, Hsiang Chuan; Bolton, Philip H.; Sancar, Aziz

    1997-08-01

    Xeroderma pigmentosum (XP) patients fail to remove pyrimidine dimers caused by sunlight and, as a consequence, develop multiple cancers in areas exposed to light. The second most common sign, present in 20-30% of XP patients, is a set of neurological abnormalities caused by neuronal death in the central and peripheral nervous systems. Neural tissue is shielded from sunlight-induced DNA damage, so the cause of neurodegeneration in XP patients remains unexplained. In this study, we show that two major oxidative DNA lesions, 8-oxoguanine and thymine glycol, are excised from DNA in vitro by the same enzyme system responsible for removing pyrimidine dimers and other bulky DNA adducts. Our results suggest that XP neurological disease may be caused by defective repair of lesions that are produced in nerve cells by reactive oxygen species generated as by-products of an active oxidative metabolism.

  7. DNA base damage generated in vivo in hepatic chromatin of mice upon whole body γ-irradiation

    DNA base lesions in hepatic chromatin formed upon whole-body irradiation of mice were studied. After γ-irradiating (20-470 Gy) and killing animals, chromatin was isolated from their livers and analysed by GC-MS. Five pyrimidine- and five purine-derived DNA lesions were identified and quantified: 5-hydroxy-5-methylhydantoin, 5-hydroxycytosine, 5-(hydroxymethyl) uracil, 4,6-diamino-5-formamidopyrimidine, 7,8-dihydro-8-oxoadenine, 2-hydroxyadenine, 2,6-diamino-4-hydroxy-5-formamidopyrimidine, 7,8-dihydro-8-oxoguanine, thymine glycol and 5,6-dihydroxy-uracil. Except for the latter two, amounts of these compounds were increased significantly over control levels in the dose range of 100-470 Gy. Above 200 Gy, a deviation from linearity was observed, although yields were increased in most cases up to 470 Gy. (Author)

  8. The hydantoin lesions formed from oxidation of 7,8-dihydro-8-oxoguanine are potnt sources of replication errors in vivo; Henderson, P.T.; Delaney, J.C.; Muller, J. G.; Neeley, W.L.; Tannenbaum, S.R.; Burrows, C.J.; Essigmann, J.M. Biochemistry (accelerate

    Henderson, P; Delaney, J; Muller, J; Neeley, W; Tannenbaum, S; Burrows, C; Essigmann, J

    2003-10-27

    Single-stranded DNA genomes have been constructed that site-specifically contain the 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxoG) oxidation products guanidinohyndantoin (Gh), and the two stable stereoisomers of spiroiminodihydantoin (Sp1 and Sp2). The circular viral genomes were transfected into wild-type AB1157 Escherichia coli and the efficiency of lesion bypass by DNA polymerase(s) was assessed. Viral progeny were analyzed for mutation frequency and type using the recently developed restriction endonuclease and post-labeling (REAP) assay. Gh was bypassed nearly as efficiently as the parent 8-oxoG, but was highly mutagenic, causing almost exclusive G{yields}C transversions. The stereoisomers Sp1 and Sp2 were, in comparison, much stronger blocks to DNA polymerase extension, and caused a mixture of G{yields}T and G{yields}C transversions. The ratio of G{yields}T to G{yields}C mutations for each Sp lesion was dependent on the stereochemical configuration of the base. All observed mutation frequencies were at least an order of magnitude higher than those caused by 8-oxoG. Were these lesions to be formed in vivo, our data show that they are absolutely miscoding, and may be refractory to repair after translesion synthesis.

  9. Reconstitution of DNA base excision-repair with purified human proteins: interaction between DNA polymerase beta and the XRCC1 protein.

    Kubota, Y; Nash, R. A.; Klungland, A; Schär, P; Barnes, D E.; Lindahl, T

    1996-01-01

    Repair of a uracil-guanine base pair in DNA has been reconstituted with the recombinant human proteins uracil-DNA glycosylase, apurinic/apyrimidinic endonuclease, DNA polymerase beta and DNA ligase III. The XRCC1 protein, which is known to bind DNA ligase III, is not absolutely required for the reaction but suppresses strand displacement by DNA polymerase beta, allowing for more efficient ligation after filling of a single nucleotide patch. We show that XRCC1 interacts directly with DNA polym...

  10. Apoptosis and DNA Methylation

    Richard R. Meehan

    2011-04-01

    Full Text Available Epigenetic mechanisms assist in maintaining gene expression patterns and cellular properties in developing and adult tissues. The molecular pathology of disease states frequently includes perturbation of DNA and histone methylation patterns, which can activate apoptotic pathways associated with maintenance of genome integrity. This perspective focuses on the pathways linking DNA methyltransferases and methyl-CpG binding proteins to apoptosis, and includes new bioinformatic analyses to characterize the evolutionary origin of two G/T mismatch-specific thymine DNA glycosylases, MBD4 and TDG.

  11. The Mutyh base excision repair gene influences the inflammatory response in a mouse model of ulcerative colitis.

    Ida Casorelli

    Full Text Available BACKGROUND: The Mutyh DNA glycosylase is involved in the repair of oxidized DNA bases. Mutations in the human MUTYH gene are responsible for colorectal cancer in familial adenomatous polyposis. Since defective DNA repair genes might contribute to the increased cancer risk associated with inflammatory bowel diseases, we compared the inflammatory response of wild-type and Mutyh(-/- mice to oxidative stress. METHODOLOGY/PRINCIPAL FINDINGS: The severity of colitis, changes in expression of genes involved in DNA repair and inflammation, DNA 8-oxoguanine levels and microsatellite instability were analysed in colon of mice treated with dextran sulfate sodium (DSS. The Mutyh(-/- phenotype was associated with a significant accumulation of 8-oxoguanine in colon DNA of treated mice. A single DSS cycle induced severe acute ulcerative colitis in wild-type mice, whereas lesions were modest in Mutyh(-/- mice, and this was associated with moderate variations in the expression of several cytokines. Eight DSS cycles caused chronic colitis in both wild-type and Mutyh(-/- mice. Lymphoid hyperplasia and a significant reduction in Foxp3(+ regulatory T cells were observed only in Mutyh(-/- mice. CONCLUSIONS: The findings indicate that, in this model of ulcerative colitis, Mutyh plays a major role in maintaining intestinal integrity by affecting the inflammatory response.

  12. Catalysts of DNA Strand Cleavage at Apurinic/Apyrimidinic Sites.

    Minko, Irina G; Jacobs, Aaron C; de Leon, Arnie R; Gruppi, Francesca; Donley, Nathan; Harris, Thomas M; Rizzo, Carmelo J; McCullough, Amanda K; Lloyd, R Stephen

    2016-01-01

    Apurinic/apyrimidinic (AP) sites are constantly formed in cellular DNA due to instability of the glycosidic bond, particularly at purines and various oxidized, alkylated, or otherwise damaged nucleobases. AP sites are also generated by DNA glycosylases that initiate DNA base excision repair. These lesions represent a significant block to DNA replication and are extremely mutagenic. Some DNA glycosylases possess AP lyase activities that nick the DNA strand at the deoxyribose moiety via a β- or β,δ-elimination reaction. Various amines can incise AP sites via a similar mechanism, but this non-enzymatic cleavage typically requires high reagent concentrations. Herein, we describe a new class of small molecules that function at low micromolar concentrations as both β- and β,δ-elimination catalysts at AP sites. Structure-activity relationships have established several characteristics that appear to be necessary for the formation of an iminium ion intermediate that self-catalyzes the elimination at the deoxyribose ring. PMID:27363485

  13. Removal of deaminated cytosines and detection of in vivo methylation in ancient DNA

    Briggs, A; Stenzel, U.; Meyer, M; Krause, J.; Kircher, M. (Manfred); Pääbo, S

    2010-01-01

    DNA sequences determined from ancient organisms have high error rates, primarily due to uracil bases created by cytosine deamination. We use synthetic oligonucleotides, as well as DNA extracted from mammoth and Neandertal remains, to show that treatment with uracil–DNA–glycosylase and endonuclease VIII removes uracil residues from ancient DNA and repairs most of the resulting abasic sites, leaving undamaged parts of the DNA fragments intact. Neandertal DNA sequences determined with this proto...

  14. Organisms posses enzymes that function in the repair of DNA damaged by radiations, chemicals and metabolic events

    This report briefly describes the studies on the mechanism of in vivo DNA repairing by the author in Research Reactor Institute, Kyoto Univ. for the past 30 years. First, the ability of UV radiation to induce transformation was investigated with viral DNA. The formation of thymine-thymine dimer was found harmful to organisms and such dimers were removable by UV-radiation at a low frequency. The mutability was determined in three different E.coli strains with mutator gene, mutT, mutS or mutL. The ability to excise 8-oxoguanin developed in primer DNA was deficient in mutT and miss-pairing left after DNA replication could not be recovered in mutL and mutS strains. Further, DNA repairing mechanism was investigated in other microorganisms; single-strand cleavage caused by exposure to BNCB radiation (boron-neutron-captured beam) could not be repaired in E. coli. Whereas for Deinococcus radiodurans, of which survival rate was not decreased by γ-ray radiation at 5 kGy or less, it was found that its single-strand DNA was damaged by γ-radiation to smaller molecules, but it was mended to the similar size to that in the non-irradiated cells during incubation. In addition, the transformation frequency was also recovered in the actinomycetes. Thus, it was demonstrated that de novo protein synthesis is necessary for the repairing system of recombination. (M.N.)

  15. Perturbations of enzymic uracil excision due to purine damage in DNA.

    Duker, N J; Jensen, D E; Hart, D M; Fishbein, D E

    1982-01-01

    Phage PBS-2 DNA, which contains uracil in place of thymine, was selectively damaged and then used as substrate for purified Bacillus subtilis uracil-DNA glycosylase. This enzyme releases uracil from DNA in a limited processive manner. Irradiation by ultraviolet light (greater than 305 nm) in the presence of isopropanol and a free radical photoinitiator introduced covalently bound 8-(2-hydroxy-2-propyl)purines into DNA. Methylation by dimethylsulfate yielded 7-methylguanine. Apurinic sites wer...

  16. Controlled exposure to diesel exhaust and traffic noise - Effects on oxidative stress and activation in mononuclear blood cells

    Hemmingsen, Jette Gjerke; Møller, Peter; Jantzen, Kim;

    2015-01-01

    Particulate air pollution increases risk of cancer and cardiopulmonary disease, partly through oxidative stress. Traffic-related noise increases risk of cardiovascular disease and may cause oxidative stress. In this controlled random sequence study, 18 healthy subjects were exposed for 3h to diesel...... exhaust (DE) at 276μg/m(3) from a passenger car or filtered air, with co-exposure to traffic noise at 48 or 75dB(A). Gene expression markers of inflammation, (interleukin-8 and tumor necrosis factor), oxidative stress (heme oxygenase (decycling-1)) and DNA repair (8-oxoguanine DNA glycosylase (OGG1)) were...... unaltered in peripheral blood mononuclear cells (PBMCs). No significant differences in DNA damage levels, measured by the comet assay, were observed after DE exposure, whereas exposure to high noise levels was associated with significantly increased levels of hOGG1-sensitive sites in PBMCs. Urinary levels...

  17. 3CAPS – a structural AP–site analogue as a tool to investigate DNA base excision repair

    Schuermann, David; Scheidegger, Simon P.; Weber, Alain R.; Bjørås, Magnar; Leumann, Christian J.; Schär, Primo

    2016-01-01

    Abasic sites (AP-sites) are frequent DNA lesions, arising by spontaneous base hydrolysis or as intermediates of base excision repair (BER). The hemiacetal at the anomeric centre renders them chemically reactive, which presents a challenge to biochemical and structural investigation. Chemically more stable AP-site analogues have been used to avoid spontaneous decay, but these do not fully recapitulate the features of natural AP–sites. With its 3′–phosphate replaced by methylene, the abasic site analogue 3CAPS was suggested to circumvent some of these limitations. Here, we evaluated the properties of 3CAPS in biochemical BER assays with mammalian proteins. 3CAPS-containing DNA substrates were processed by APE1, albeit with comparably poor efficiency. APE1-cleaved 3CAPS can be extended by DNA polymerase β but repaired only by strand displacement as the 5′–deoxyribophosphate (dRP) cannot be removed. DNA glycosylases physically and functionally interact with 3CAPS substrates, underlining its structural integrity and biochemical reactivity. The AP lyase activity of bifunctional DNA glycosylases (NTH1, NEIL1, FPG), however, was fully inhibited. Notably, 3CAPS-containing DNA also effectively inhibited the activity of bifunctional glycosylases on authentic substrates. Hence, the chemically stable 3CAPS with its preserved hemiacetal functionality is a potent tool for BER research and a potential inhibitor of bifunctional DNA glycosylases. PMID:26733580

  18. An unprecedented nucleic acid capture mechanism for excision of DNA damage

    Rubinson, Emily H.; Prakasha Gowda, A.S.; Spratt, Thomas E.; Gold, Barry; Eichmanbrand, Brandt F. (Pitt); (Vanderbilt); (Penn)

    2010-11-18

    DNA glycosylases that remove alkylated and deaminated purine nucleobases are essential DNA repair enzymes that protect the genome, and at the same time confound cancer alkylation therapy, by excising cytotoxic N3-methyladenine bases formed by DNA-targeting anticancer compounds. The basis for glycosylase specificity towards N3- and N7-alkylpurines is believed to result from intrinsic instability of the modified bases and not from direct enzyme functional group chemistry. Here we present crystal structures of the recently discovered Bacillus cereus AlkD glycosylase in complex with DNAs containing alkylated, mismatched and abasic nucleotides. Unlike other glycosylases, AlkD captures the extrahelical lesion in a solvent-exposed orientation, providing an illustration for how hydrolysis of N3- and N7-alkylated bases may be facilitated by increased lifetime out of the DNA helix. The structures and supporting biochemical analysis of base flipping and catalysis reveal how the HEAT repeats of AlkD distort the DNA backbone to detect non-Watson-Crick base pairs without duplex intercalation.

  19. Regulation and function of DNA methylation in plants and animals

    He, Xinjian

    2011-02-15

    DNA methylation is an important epigenetic mark involved in diverse biological processes. In plants, DNA methylation can be established through the RNA-directed DNA methylation pathway, an RNA interference pathway for transcriptional gene silencing (TGS), which requires 24-nt small interfering RNAs. In mammals, de novo DNA methylation occurs primarily at two developmental stages: during early embryogenesis and during gametogenesis. While it is not clear whether establishment of DNA methylation patterns in mammals involves RNA interference in general, de novo DNA methylation and suppression of transposons in germ cells require 24-32-nt piwi-interacting small RNAs. DNA methylation status is dynamically regulated by DNA methylation and demethylation reactions. In plants, active DNA demethylation relies on the repressor of silencing 1 family of bifunctional DNA glycosylases, which remove the 5-methylcytosine base and then cleave the DNA backbone at the abasic site, initiating a base excision repair (BER) pathway. In animals, multiple mechanisms of active DNA demethylation have been proposed, including a deaminase- and DNA glycosylase-initiated BER pathway. New information concerning the effects of various histone modifications on the establishment and maintenance of DNA methylation has broadened our understanding of the regulation of DNA methylation. The function of DNA methylation in plants and animals is also discussed in this review. © 2011 IBCB, SIBS, CAS All rights reserved.

  20. The roles of APE1, APE2, DNA polymerase β and mismatch repair in creating S region DNA breaks during antibody class switch

    Schrader, Carol E.; Guikema, Jeroen E.J.; Wu, Xiaoming; Stavnezer, Janet

    2008-01-01

    Immunoglobulin class switch recombination (CSR) occurs by an intrachromosomal deletion requiring generation of double-stranded DNA breaks (DSBs) in immunoglobulin switch region DNA. The initial steps of DSB formation have been elucidated: cytosine deamination by activation-induced cytidine deaminase (AID) and the generation of abasic sites by uracil-DNA glycosylase (UNG). We show that abasic sites are converted into single-strand breaks (SSBs) by apurinic/apyrimidinic endonucleases (APE1 and ...

  1. Non-canonical uracil processing in DNA gives rise to double-strand breaks and deletions

    Bregenhorn, Stephanie; Kallenberger, Lia; Artola-Borán, Mariela;

    2016-01-01

    , repetitive sequences flanking the CHloci, to uracils. Although U/G mispairs arising in this way are generally efficiently repaired to C/Gs by uracil DNA glycosylase (UNG)-initiated base excision repair (BER), uracil processing in S-regions of activated B-cells occasionally gives rise to double strand breaks...

  2. Factors that influence telomeric oxidative base damage and repair by DNA glycosylase OGG1

    Rhee, David B; Ghosh, Avik; Lu, Jian; Bohr, Vilhelm A; Liu, Yie

    2011-01-01

    -telomeric double-stranded substrates. In addition, telomere repeat binding factors TRF1 and TRF2 do not impair OGG1 incision activity. Yet, 8-oxodG in some telomere structures (e.g., fork-opening, 3'-overhang, and D-loop) were less effectively excised by OGG1, depending upon its position in these substrates...

  3. Regulation of MUTYH, a DNA Repair Enzyme, in Renal Proximal Tubular Epithelial Cells

    Jianping Lu

    2015-01-01

    Full Text Available MUTYH is a DNA repair enzyme that initiates a base excision repair (BER by recognizing and removing 8-Oxoguanine (8-oxoG and its paired adenine. We demonstrated that both TGF-β1 and H2O2 treatment led to an increased 8-oxoG in cultured human proximal tubule epithelial (HK-2 cells, while the former induced epithelial-mesenchymal transition and the latter caused cell apoptosis. Without stimulation, HK-2 cells showed MUTYH expression in mitochondria. TGF-β1 triggered a transient upregulation of mitochondrial MUTYH and induced the expression of nuclear isoforms, while H2O2 showed no role on MUTYH expression. Ureteral obstruction (UUO mice exhibited high 8-oxoG reactivity with tubulointerstitial lesions. After obstruction, the MUTYH expression was increased only in tubules at day 3 and decreased with obvious tubular atrophy at day 10. Particularly, MUTYH was primarily located in normal tubular cytoplasm with a dominant mitochondrial form. A few cells with nuclear MUTYH expression were observed in the fibrotic interstitium. We confirmed that increased MUTYH expression was upregulated and positively correlated with the severity of kidney fibrosis. Thus, renal fibrosis caused a cell-type-specific and time-dependent response of oxidative DNA repairs, even within the same tissues. It suggests that intervention of MUTYH might be effective for therapies.

  4. Dicty_cDB: Contig-U08947-1 [Dicty_cDB

    Full Text Available e) Candida dubliniensis CD36 chromo... 98 3e-19 U88620_1( U88620 |pid:none) Human 8-hydroxyguanine glycos...e) Leishmania braziliensis chromoso... 61 3e-08 CP000679_1443( CP000679 |pid:none) Caldicellulosi...as fluorescens SBW25 c... 36 1.1 CU207211_747( CU207211 |pid:none) Herminiimonas arseni.... 35 3.3 CP000644_2306( CP000644 |pid:none) Aeromonas salmonicida subsp. sa... 35 3.3 AE010299_4494( AE010299 |pid:none) Methanos...T46962( T46962 ) 8-oxoguanine DNA-glycosylase [validated] - mouse ... 109 1e-22 Y13479_1( Y13479 |pid:none)

  5. Nitroglycerin induces DNA damage and vascular cell death in the setting of nitrate tolerance.

    Mikhed, Yuliya; Fahrer, Jörg; Oelze, Matthias; Kröller-Schön, Swenja; Steven, Sebastian; Welschof, Philipp; Zinßius, Elena; Stamm, Paul; Kashani, Fatemeh; Roohani, Siyer; Kress, Joana Melanie; Ullmann, Elisabeth; Tran, Lan P; Schulz, Eberhard; Epe, Bernd; Kaina, Bernd; Münzel, Thomas; Daiber, Andreas

    2016-07-01

    Nitroglycerin (GTN) and other organic nitrates are widely used vasodilators. Their side effects are development of nitrate tolerance and endothelial dysfunction. Given the potential of GTN to induce nitro-oxidative stress, we investigated the interaction between nitro-oxidative DNA damage and vascular dysfunction in experimental nitrate tolerance. Cultured endothelial hybridoma cells (EA.hy 926) and Wistar rats were treated with GTN (ex vivo: 10-1000 µM; in vivo: 10, 20 and 50 mg/kg/day for 3 days, s.c.). The level of DNA strand breaks, 8-oxoguanine and O (6)-methylguanine DNA adducts was determined by Comet assay, dot blot and immunohistochemistry. Vascular function was determined by isometric tension recording. DNA adducts and strand breaks were induced by GTN in cells in vitro in a concentration-dependent manner. GTN in vivo administration leads to endothelial dysfunction, nitrate tolerance, aortic and cardiac oxidative stress, formation of DNA adducts, stabilization of p53 and apoptotic death of vascular cells in a dose-dependent fashion. Mice lacking O (6)-methylguanine-DNA methyltransferase displayed more vascular O (6)-methylguanine adducts and oxidative stress under GTN therapy than wild-type mice. Although we were not able to prove a causal role of DNA damage in the etiology of nitrate tolerance, the finding of GTN-induced DNA damage such as the mutagenic and toxic adduct O (6)-methylguanine, and cell death supports the notion that GTN based therapy may provoke adverse side effects, including endothelial function. Further studies are warranted to clarify whether GTN pro-apoptotic effects are related to an impaired recovery of patients upon myocardial infarction. PMID:27357950

  6. Relation between DNA damage measured by comet assay and OGG1 Ser326Cys polymorphism in antineoplastic drugs biomonitoring

    Carina Ladeira; Susana Viegas; Mário Pádua; Elisabete Carolino; Gomes, Manuel C.; Miguel Brito

    2015-01-01

    Antineoplastic drugs are hazardous chemical agents used mostly in the treatment of patients with cancer, however health professionals that handle and administer these drugs can become exposed and develop DNA damage. Comet assay is a standard method for assessing DNA damage in human biomonitoring and, combined with formamidopyrimidine DNA glycosylase (FPG) enzyme, it specifically detects DNA oxidative damage.The aim of this study was to investigate genotoxic effects in workers occupationally e...

  7. FANCJ helicase uniquely senses oxidative base damage in either strand of duplex DNA and is stimulated by replication protein A to unwind the damaged DNA substrate in a strand-specific manner.

    Suhasini, Avvaru N; Sommers, Joshua A; Mason, Aaron C; Voloshin, Oleg N; Camerini-Otero, R Daniel; Wold, Marc S; Brosh, Robert M

    2009-07-01

    FANCJ mutations are genetically linked to the Fanconi anemia complementation group J and predispose individuals to breast cancer. Understanding the role of FANCJ in DNA metabolism and how FANCJ dysfunction leads to tumorigenesis requires mechanistic studies of FANCJ helicase and its protein partners. In this work, we have examined the ability of FANCJ to unwind DNA molecules with specific base damage that can be mutagenic or lethal. FANCJ was inhibited by a single thymine glycol, but not 8-oxoguanine, in either the translocating or nontranslocating strands of the helicase substrate. In contrast, the human RecQ helicases (BLM, RECQ1, and WRN) display strand-specific inhibition of unwinding by the thymine glycol damage, whereas other DNA helicases (DinG, DnaB, and UvrD) are not significantly inhibited by thymine glycol in either strand. In the presence of replication protein A (RPA), but not Escherichia coli single-stranded DNA-binding protein, FANCJ efficiently unwound the DNA substrate harboring the thymine glycol damage in the nontranslocating strand; however, inhibition of FANCJ helicase activity by the translocating strand thymine glycol was not relieved. Strand-specific stimulation of human RECQ1 helicase activity was also observed, and RPA bound with high affinity to single-stranded DNA containing a single thymine glycol. Based on the biochemical studies, we propose a model for the specific functional interaction between RPA and FANCJ on the thymine glycol substrates. These studies are relevant to the roles of RPA, FANCJ, and other DNA helicases in the metabolism of damaged DNA that can interfere with basic cellular processes of DNA metabolism. PMID:19419957

  8. DNA repair in bacterial cultures and plasmid DNA exposed to infrared laser for treatment of pain

    Biostimulation of tissues by low intensity lasers has been described on a photobiological basis and clinical protocols are recommended for treatment of various diseases, but their effects on DNA are controversial. The objective of this work was to evaluate effects of low intensity infrared laser exposure on survival and bacterial filamentation in Escherichia coli cultures, and induction of DNA lesions in bacterial plasmids. In E. coli cultures and plasmids exposed to an infrared laser at fluences used to treat pain, bacterial survival and filamentation and DNA lesions in plasmids were evaluated by electrophoretic profile. Data indicate that the infrared laser (i) increases survival of E. coli wild type in 24 h of stationary growth phase, (ii) induces bacterial filamentation, (iii) does not alter topological forms of plasmids and (iv) does not alter the electrophoretic profile of plasmids incubated with exonuclease III or formamidopyrimidine DNA glycosylase. A low intensity infrared laser at the therapeutic fluences used to treat pain can alter survival of E. coli wild type, induce filamentation in bacterial cells, depending on physiologic conditions and DNA repair, and induce DNA lesions other than single or double DNA strand breaks or alkali-labile sites, which are not targeted by exonuclease III or formamidopyrimidine DNA glycosylase. (letter)

  9. DNA repair in bacterial cultures and plasmid DNA exposed to infrared laser for treatment of pain

    Canuto, K. S.; Sergio, L. P. S.; Marciano, R. S.; Guimarães, O. R.; Polignano, G. A. C.; Geller, M.; Paoli, F.; Fonseca, A. S.

    2013-06-01

    Biostimulation of tissues by low intensity lasers has been described on a photobiological basis and clinical protocols are recommended for treatment of various diseases, but their effects on DNA are controversial. The objective of this work was to evaluate effects of low intensity infrared laser exposure on survival and bacterial filamentation in Escherichia coli cultures, and induction of DNA lesions in bacterial plasmids. In E. coli cultures and plasmids exposed to an infrared laser at fluences used to treat pain, bacterial survival and filamentation and DNA lesions in plasmids were evaluated by electrophoretic profile. Data indicate that the infrared laser (i) increases survival of E. coli wild type in 24 h of stationary growth phase, (ii) induces bacterial filamentation, (iii) does not alter topological forms of plasmids and (iv) does not alter the electrophoretic profile of plasmids incubated with exonuclease III or formamidopyrimidine DNA glycosylase. A low intensity infrared laser at the therapeutic fluences used to treat pain can alter survival of E. coli wild type, induce filamentation in bacterial cells, depending on physiologic conditions and DNA repair, and induce DNA lesions other than single or double DNA strand breaks or alkali-labile sites, which are not targeted by exonuclease III or formamidopyrimidine DNA glycosylase.

  10. Finding and Producing Probiotic Glycosylases for the Biocatalysis of Ginsenosides: A Mini Review

    Seockmo Ku

    2016-05-01

    Full Text Available Various microorganisms have been widely applied in nutraceutical industries for the processing of phytochemical conversion. Specifically, in the Asian food industry and academia, notable attention is paid to the biocatalytic process of ginsenosides (ginseng saponins using probiotic bacteria that produce high levels of glycosyl-hydrolases. Multiple groups have conducted experiments in order to determine the best conditions to produce more active and stable enzymes, which can be applicable to produce diverse types of ginsenosides for commercial applications. In this sense, there are various reviews that cover the biofunctional effects of multiple types of ginsenosides and the pathways of ginsenoside deglycosylation. However, little work has been published on the production methods of probiotic enzymes, which is a critical component of ginsenoside processing. This review aims to investigate current preparation methods, results on the discovery of new glycosylases, the application potential of probiotic enzymes and their use for biocatalysis of ginsenosides in the nutraceutical industry.

  11. Finding and Producing Probiotic Glycosylases for the Biocatalysis of Ginsenosides: A Mini Review.

    Ku, Seockmo

    2016-01-01

    Various microorganisms have been widely applied in nutraceutical industries for the processing of phytochemical conversion. Specifically, in the Asian food industry and academia, notable attention is paid to the biocatalytic process of ginsenosides (ginseng saponins) using probiotic bacteria that produce high levels of glycosyl-hydrolases. Multiple groups have conducted experiments in order to determine the best conditions to produce more active and stable enzymes, which can be applicable to produce diverse types of ginsenosides for commercial applications. In this sense, there are various reviews that cover the biofunctional effects of multiple types of ginsenosides and the pathways of ginsenoside deglycosylation. However, little work has been published on the production methods of probiotic enzymes, which is a critical component of ginsenoside processing. This review aims to investigate current preparation methods, results on the discovery of new glycosylases, the application potential of probiotic enzymes and their use for biocatalysis of ginsenosides in the nutraceutical industry. PMID:27196878

  12. Urinary excretion of 8-oxo-7,8-dihydroguanine as biomarker of oxidative damage to DNA.

    Loft, Steffen; Danielsen, Pernille; Løhr, Mille; Jantzen, Kim; Hemmingsen, Jette G.; Roursgaard, Martin; Karotki, Dorina Gabriela; Møller, Peter

    2012-01-01

    Oxidatively damaged DNA may be important in carcinogenesis. 8-Oxo-7,8-dihydroguanine (8-oxoGua) is an abundant and mutagenic lesion excised by oxoguanine DNA glycosylase 1 (OGG1) and measurable in urine or plasma by chromatographic methods with electrochemical or mass spectrometric detectors, reflecting the rate of damage in steady state. A common genetic OGG1 variant may affect the activity and was associated with increased levels of oxidized purines in leukocytes without apparent effect on ...

  13. The theoretical study of charge transfer through damaged DNA duplexes

    Šebera, Jakub; Humpolíčková, Jana; Hof, Martin; Kratochvílová, Irena; Páv, Ondřej; Rosenberg, Ivan; Nencka, Radim; Tanaka, Y.; Sychrovský, Vladimír

    Nagybörzsöny : -, 2014. [CESTC 2014. Central European Symposium on Theoretical Chemistry. 21.09.2014-25.09.2014, Nagybörzsöny] R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 ; RVO:61388955 ; RVO:68378271 Keywords : charge transfer * 8-oxoguanine * fluorescence spectroscopy Subject RIV: CF - Physical ; Theoretical Chemistry

  14. Association of polymorphisms hOGG1 rs1052133 and hMUTYH rs3219472 with risk of nasopharyngeal carcinoma in a Chinese population

    Xie Y

    2016-02-01

    Full Text Available Ying Xie,2 Yuan Wu,3 Xunzhao Zhou,3 Mengwei Yao,3 Sisi Ning,3 Zhengbo Wei1 1Department of Head and Neck Tumor Surgery, Affiliated Tumor Hospital of Guangxi Medical University, 2Guangxi Key Laboratory for High-Incidence Tumor Prevention and Treatment, Experimental Center of Medical Science of Guangxi Medical University,3Graduate School of Guangxi Medical University, Nanning, People’s Republic of China Abstract: This case–control study investigates the possible relationships between the single-nucleotide polymorphisms rs1052133 in the human 8-oxoguanine DNA glycosylase 1 (hOGG1 gene and rs3219472 in the human MutY glycosylase homologue (hMUTYH gene and the risk of nasopharyngeal carcinoma (NPC. The two polymorphisms were genotyped in 488 unrelated NPC patients and 573 cancer-free controls. Genotype GG at rs1052133 was associated with significantly lower NPC risk than genotypes GC + CC (odds ratio [OR] 0.770, 95% confidence interval [CI] 0.595–0.996, P=0.012. In subgroup analyses, subjects with genotype GG at rs1052133 were at lower risk of NPC than those with GC or CC among individuals older than 40 years (OR 0.706, 95% CI 0.524–0.950, women (OR 0.571, 95% CI 0.337–0.968, and those with no smoking history (OR 0.634, 95% CI 0.463–0.868. No significant association was seen between polymorphisms at hMUTYH rs3219472 and the risk of NPC. However, gene–gene interaction analysis showed that subjects with genotype CC at rs1052133 and genotype AA at rs3219472 (CC/AA were at 2.887-fold higher risk of NPC than those with GG/GG, 3.183-fold higher risk than those with GG/GA, and 3.392-fold higher risk than those with GG/AA. Our results suggest that hOGG1 rs1052133 polymorphism may play an important role in NPC pathogenesis, especially among women, >40 years old, and those with no smoking history. The hMUTYH rs3219472 polymorphism may interact with hOGG1 rs1052133 polymorphism to influence susceptibility to NPC. Keywords: nasopharyngeal

  15. Mutational Analysis of hOGG1 Gene Promoter in Patients with Non-small Cell Lung Cancer

    Xia LIU

    2011-03-01

    Full Text Available Background and objective 8-hydroxygumine DNA glycosylase 1 (OGG1 is a DNA repair enzyme, which can repair damaged DNA by excising 8-dihydro-8-oxoguanine (8-OH-G. Polymorphisms in human OGG1 gene (hOGG1 may alter glycosylase activity, thereby affects its repair to the damaged DNA, resulting in contribution to carcinogenesis. However, an association of genetic variants of hOGG1 promoter with non-small cell lung cancer (NSCLC remains unclear. The present study aims to explore whether there are mutations in the promoter region of hOGG1 and the association of the potential genetic variants with NSCLC. Methods Forty lung cancer patients were enrolled from January, 2003 to December, 2005 in the first affiliated hospital of Soochow University. PCR-SSCP followed by direct sequencing were performed to detect mutations within the promoter region of the hOGG1 gene in NSCLC and corresponding paracancerous lung tissues. Results No abnormal mutation was found in the promoter region of the hOGG1 gene in 40 patients with NSCLC. However, a SNP rs159153 in hOGG1 was significantly associated with higher TNM stage (P=0.008. Moreover, lower frequency of lymph node metastasis was observed in smoker patients with NSCLC (P=0.034. Conclusion The SNP rs159153 in the promoter region of the hOGG1 gene and smoking history may effectively forebode the aggressiveness and metastatic potential of NSCLC.

  16. Acute hypoxia and hypoxic exercise induce DNA strand breaks and oxidative DNA damage in humans

    Møller, P; Loft, S; Lundby, C;

    2001-01-01

    The present study investigated the effect of a single bout of exhaustive exercise on the generation of DNA strand breaks and oxidative DNA damage under normal conditions and at high-altitude hypoxia (4559 meters for 3 days). Twelve healthy subjects performed a maximal bicycle exercise test......; lymphocytes were isolated for analysis of DNA strand breaks and oxidatively altered nucleotides, detected by endonuclease III and formamidipyridine glycosylase (FPG) enzymes. Urine was collected for 24 h periods for analysis of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG), a marker of oxidative DNA damage....... Urinary excretion of 8-oxodG increased during the first day in altitude hypoxia, and there were more endonuclease III-sensitive sites on day 3 at high altitude. The subjects had more DNA strand breaks in altitude hypoxia than at sea level. The level of DNA strand breaks further increased immediately after...

  17. Relationship between the capacity to repair 8-oxoguanine, biomarkers of genotxicity and individual susceptibility in styrene-exposed workers

    Slyšková, Jana; Dušinská, M.; Kuricová, M.; Souček, P.; Vodičková, Ludmila; Susová, S.; Naccarati, Alessio; Tulupová, Elena; Vodička, Pavel

    2007-01-01

    Roč. 634, - (2007), s. 101-111. ISSN 1383-5718 R&D Projects: GA MZd(CZ) NR8563; GA ČR GA310/05/2626 Grant ostatní: EU(SE) 505609 Institutional research plan: CEZ:AV0Z50390512 Source of funding: R - rámcový projekt EK Keywords : Occupational exposure * Styrene * Oxidative damage Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.278, year: 2007

  18. Polymorphisms of DNA repair genes OGG1 and XPD and the risk of age-related cataract in Egyptians

    Gharib, Amal F.; Dabour, Sherif A.; Fouad, Rania A.

    2014-01-01

    Purpose To analyze the association of the polymorphisms of xeroderma pigmentosum complementation group D (XPD) and 8-oxoguanine glycosylase-1 (OGG1) genes with the risk of age-related cataract (ARC) in an Egyptian population. Methods This case-control study included 150 patients with ARC and 50 controls. Genotyping of XPD Asp312Asn was performed by amplification refractory mutation system PCR assay and genotyping of OGG1 Ser326Cys was carried out by PCR including confronting two-pair primers. Results The Asn/Asn genotype of XPD gene was significantly associated with increased risk of ARC (odds ratio [OR] = 2.74, 95% confidence interval [CI] = 1.01–7.43, p = 0.04) and cortical cataract (OR = 5.06, 95% CI = 1.70–15.05, p = 0.002). The Asn312 allele was significantly associated with an increased risk of ARC (OR = 1.75, 95% CI 1.06–2.89, p = 0.03) and cortical cataract (OR = 2.81, 95% CI = 1.56–5.08, p<0.001). The OGG1 Cys/Cys genotype frequency was significantly higher in ARC (OR = 4.13, 95% CI = 0.93–18.21, p = 0.04) and the Cys326 allele (OR = 1.85, 95% CI = 1.07–3.20, p = 0.03). Moreover, the Cys/Cys genotype of the OGG1 gene was significantly higher in cortical cataract (OR = 6.00, 95% CI = 1.24–28.99, p = 0.01) and the Cys326 allele was also significantly associated with cortical cataract (OR = 2.45, 95% CI = 1.30–4.63, p = 0.005). Conclusions The results suggest that the Asn/Asn genotype and Asn312 allele of XPD polymorphism, as well as the Cys/Cys genotype and Cys326 allele of the OGG1 polymorphism, may be associated with increased risk of the development of ARC, particularly the cortical type, in the Egyptian population. PMID:24868140

  19. Error-Prone Translesion DNA Synthesis by Escherichia coli DNA Polymerase IV (DinB on Templates Containing 1,2-dihydro-2-oxoadenine

    Masaki Hori

    2010-01-01

    Full Text Available Escherichia coli DNA polymerase IV (Pol IV is involved in bypass replication of damaged bases in DNA. Reactive oxygen species (ROS are generated continuously during normal metabolism and as a result of exogenous stress such as ionizing radiation. ROS induce various kinds of base damage in DNA. It is important to examine whether Pol IV is able to bypass oxidatively damaged bases. In this study, recombinant Pol IV was incubated with oligonucleotides containing thymine glycol (dTg, 5-formyluracil (5-fodU, 5-hydroxymethyluracil (5-hmdU, 7,8-dihydro-8-oxoguanine (8-oxodG and 1,2-dihydro-2-oxoadenine (2-oxodA. Primer extension assays revealed that Pol IV preferred to insert dATP opposite 5-fodU and 5-hmdU, while it inefficiently inserted nucleotides opposite dTg. Pol IV inserted dCTP and dATP opposite 8-oxodG, while the ability was low. It inserted dCTP more effectively than dTTP opposite 2-oxodA. Pol IV's ability to bypass these lesions decreased in the order: 2-oxodA > 5-fodU~5-hmdU > 8-oxodG > dTg. The fact that Pol IV preferred to insert dCTP opposite 2-oxodA suggests the mutagenic potential of 2-oxodA leading to A:T→G:C transitions. Hydrogen peroxide caused an ~2-fold increase in A:T→G:C mutations in E. coli, while the increase was significantly greater in E. coli overexpressing Pol IV. These results indicate that Pol IV may be involved in ROS-enhanced A:T→G:C mutations.

  20. Association of the hOGG1 Ser326Cys polymorphism with sporadic amyotrophic lateral sclerosis.

    Coppedè, Fabio; Mancuso, Michelangelo; Lo Gerfo, Annalisa; Carlesi, Cecilia; Piazza, Selina; Rocchi, Anna; Petrozzi, Lucia; Nesti, Claudia; Micheli, Dario; Bacci, Andrea; Migliore, Lucia; Murri, Luigi; Siciliano, Gabriele

    2007-06-13

    Amyotropic lateral sclerosis (ALS) is a fatal and progressive neurodegenerative disease causing the loss of motoneurons of the brain and the spinal cord. The etiology of ALS is still uncertain, but males are at increased risk for the disease than females. Several studies have suggested that motoneurons in ALS might be subjected to the double insult of increased DNA oxidative damage and deficiencies in DNA repair systems. Particularly, increased levels of 8-oxoguanine and impairments of the DNA base excision repair system have been observed in neurons of ALS patients. There is evidence that the Ser326Cys polymorphism of the human 8-oxoguanine DNA glycosylase 1 (hOGG1) gene is associated with a reduced DNA repair activity. To evaluate the role of the hOGG1 Ser326Cys polymorphism in sporadic ALS (sALS), we screened 136 patients and 129 matched controls. In the total population, we observed association between both the Cys326 allele (p=0.02) and the combined Ser326Cys+Cys326Cys genotype (OR=1.65, 95% CI=1.06-2.88) and increased risk of disease. After stratification by gender, the Cys326 allele (p=0.01), both the Ser326Cys genotype (OR=2.14, 95% CI=1.09-4.19) and the combined Ser326Cys+Cys326Cys genotype (OR=2.15, 95% CI=1.16-4.01) were associated with sALS risk only in males. No significant association between the Ser326Cys polymorphism and disease phenotype, including age and site of onset and disease progression, was observed. Present results suggest a possible involvement of the hOGG1 Ser326Cys polymorphism in sALS pathogenesis. PMID:17531381

  1. Repair of U/G and U/A in DNA by UNG2-associated repair complexes takes place predominantly by short-patch repair both in proliferating and growth-arrested cells

    Akbari, Mansour; Otterlei, Marit; Pena Diaz, Javier; Aas, Per Arne; Kavli, Bodil; Liabakk, Nina B; Hagen, Lars; Imai, Kohsuke; Durandy, Anne; Slupphaug, Geir; Krokan, Hans E

    2004-01-01

    Nuclear uracil-DNA glycosylase UNG2 has an established role in repair of U/A pairs resulting from misincorporation of dUMP during replication. In antigen-stimulated B-lymphocytes UNG2 removes uracil from U/G mispairs as part of somatic hypermutation and class switch recombination processes. Using...

  2. Oxidatively damaged DNA and its repair after experimental exposure to wood smoke in healthy humans

    Danielsen, Pernille Høgh; Bräuner, Elvira Vaclavik; Barregard, Lars;

    2008-01-01

    exposure, from bedtime until the next morning. We measured the levels of DNA strand breaks (SB), oxidized purines as formamidopyrimidine-DNA-glycosylase (FPG) sites and activity of oxoguanine glycosylase 1 (hOGG1) in PBMC by the comet assay, whereas mRNA levels of hOGG1, nucleoside diphosphate linked...... chromatography with mass spectrometry. The morning following exposure to wood smoke the PBMC levels of SB were significantly decreased and the mRNA levels of hOGG1 significantly increased. FPG sites, hOGG1 activity, expression of hNUDT1 and hHO1, urinary excretion of 8-oxodG and 8-oxoGua did not change...

  3. Characterization of protein interactomes of DNA damages: application to oxidation injuries

    Cyclo-nucleosides are complex DNA damages implying both bases and sugar residues. They are generated by free radicals, in particular by the effect of ionizing radiations, and are not easily covered by cellular mechanisms. Using a protein trapping technique on probes containing these injuries, the negative influence of cyclo-nucleosides on the recognition of its target sequence by a DREF transcription factor and on the interactions of PARP1 with DNA have been identified. Interactions between Fpg bacterial glycosylase and cyclo-nucleosides have been analysed and it has been found that this enzyme has an affinity for them, without excision activity. Finally, a Thermococcus gammatolerans radiation resistant archae has been studied: the formation of simple and complex oxidation injuries at strong radiation doses has been measured and the action mechanism of two new glycosylases has been explained. (author)

  4. Measurement of DNA strand breakage and DNA repair induced with hydrogen peroxide using single cell gel electrophoresis, alkaline DNA unwinding and alkaline elution of DNA

    Three techniques single cell gel electrophoresis (SCGE), alkaline elution of DNA, and alkaline DNA unwinding (ADU) were chosen to compare the sensitivity among these methods in detection of DNA damage and repair in human diploid VH10 cell line after short-term exposure to hydrogen peroxide. Using SCGE technique a dose-dependent increase in DNA migration was found in cell exposed to hydrogen peroxide in concentration range from 10 μmol/l. Alkaline DNA unwinding method detected increased level of single strand breaks (ssb) in concentration range from 25 μmol/l of H2O2, and alkaline elution of DNA estimated increased DNA elution rate from concentration 50 μmol/l of H2O2. In a time course study to evaluate the kinetics of DNA repair, both SCGE and ADU techniques showed that the repair of DNA strand breaks is very rapid; the level of ssb in treated cells has returned to near the background level within two hours. After this time damage remaining in the DNA was in the form of oxidised bases as revealed the incubation of treated cells with specific DNA repair endonuclease, formamidopyridine-DNA glycosylase. (author)

  5. Radiation-induced damage to DNA

    This short survey focuses on the main radiation-induced base lesions that have been identified within cellular DNA. For this purpose, sensitive assays that are aimed at measuring a few modifications per 107 normal bases were set-up. In that respect high performance liquid chromatography - tandem mass spectrometry (CLHP-MS/MS) was found to be able to single out the formation of 9 oxidized nucleosides and two modified nucleo-bases out of the 70 oxidative base lesions that have been identified in model systems. As a striking result, it was found that in the DNA of γ-irradiated human monocytes, the formamide-pyrimidine derivative of guanine is produced in a higher yield than the ubiquitous 8-oxo-7,8-dihydro-guanine damage, both arising from the same radical precursor. However, relatively high doses of ionizing radiation (> 20 Gy) have to be applied in order to detect an increase in the level of the damage. This is due to the low efficiency for both low and high LET radiations to generate oxidative damage to DNA on one hand and the occurrence of artifactual oxidation of the overwhelming normal bases during DNA extraction on the other hand. Interestingly, a modified comet assays that involves the combined use of the alkaline single gel electrophoretic technique and DNA repair N-glycosylases has allowed the detection of three main types of radiation-induced damage within the dose range 0.3 Gy -10 Gy. It appears that the total of frank DNA strand breaks and alkali-labile sites is similar to the sum of oxidized pyrimidine bases and modified purine bases that are recognized by the endonuclease Ill protein and the formamide-pyrimidine DNA N-glycosylase respectively. (author)

  6. Selective enzymatic cleavage and labeling for sensitive capillary electrophoresis laser-induced fluorescence analysis of oxidized DNA bases.

    Li, Cuiping; Wang, Hailin

    2015-08-01

    Oxidatively generated DNA damage is considered to be a significant contributing factor to cancer, aging, and age-related human diseases. It is important to detect oxidatively generated DNA damage to understand and clinically diagnosis diseases caused by oxidative damage. In this study, using selective enzymatic cleavage and quantum dot (QD) labeling, we developed a novel capillary electrophoresis-laser induced fluorescence method for the sensitive detection of oxidized DNA bases. First, oxidized DNA bases are recognized and removed by one DNA base excision repair glycosylase, leaving apurinic and apyrimidinic sites (AP sites) at the oxidized positions. The AP sites are further excised by the AP nicking activity of the chosen glycosylase, generating a nucleotide gap with 5'- and 3'- phosphate groups. After dephosphorylation with one alkaline phosphatase, a biotinylated ddNTP is introduced into the nucleotide space within the DNA strand by DNA polymerase I. The biotin-tagged DNA is further labeled with a QD-streptavidin conjugate via non-covalent interactions. The DNA-bound QD is well-separated from excess DNA-unbound QD by highly efficient capillary electrophoresis and is sensitively detected by online coupled laser-induced fluorescence analysis. Using this method, we can assess the trace levels of oxidized DNA bases induced by the Fenton reaction and UV irradiation. Interestingly, the use of the formamidopyrimidine glycosylase (FPG) protein and endonuclease VIII enables the detection of oxidized purine and pyrimidine bases, respectively. Using the synthesized standard DNA, the approach has low limits of detection of 1.1×10(-19)mol in mass and 2.9pM in concentration. PMID:26105778

  7. Salvia fruticosa reduces intrinsic cellular and H2O2-induced DNA oxidation in HEK 293 cells;assessment using flow cytometry

    Saleem Bani Hani; Mekki Bayachou

    2014-01-01

    Objective:To investigate the role of water-soluble extract of Salvia fruticosa (Greek sage) (S. fruticosa) leaves in reducing both intrinsic cellular and H2O2-induced DNA oxidation in cultured human embryonic kidney 293 cells. S. fruticosa, native to the Eastern-Mediterranean basin, is widely used as a medicinal herb for treatment of various diseases. Methods: Dried leaves of S. fruticosa were extracted in phosphate buffer saline and purified using both vacuum and high pressure filtrations. Each mL of the preparation contained (7.1±1.0) mg of extract. HEK-293 cells were incubated in one set with S. fruticosa extract in the presence of 0.1 mmol/L H2O2, and in the other set with the addition of the extract alone. The DNA oxidation was measured using fluorescence upon fluorescein isothiocyanate derivatization of 8-oxoguanine moieties. The fluorescence was measured using flow cytometry technique. Results:Cells incubated 3 h with 150 µL extract and exposed to 0.1 mmol/L H2O2 showed lower intensity of fluorescence, and thus lower DNA oxidation. Moreover, cells incubated 3 h with 100 µL of the extract showed lower intensity of fluorescence, and thus lower intrinsic cellular DNA oxidation compared to control (without S. fruticosa). Conclusions: The results from this study suggest that the water-soluble extract of S. fruticosa leaves protects against both H2O2-induced and intrinsic cellular DNA oxidation in human embryonic kidney 293 cells.

  8. miR-29 Represses the Activities of DNA Methyltransferases and DNA Demethylases

    Izuho Hatada

    2013-07-01

    Full Text Available Members of the microRNA-29 (miR-29 family directly target the DNA methyltransferases, DNMT3A and DNMT3B. Disturbances in the expression levels of miR-29 have been linked to tumorigenesis and tumor aggressiveness. Members of the miR-29 family are currently thought to repress DNA methylation and suppress tumorigenesis by protecting against de novo methylation. Here, we report that members of the miR-29 family repress the activities of DNA methyltransferases and DNA demethylases, which have opposing roles in control of DNA methylation status. Members of the miR-29 family directly inhibited DNA methyltransferases and two major factors involved in DNA demethylation, namely tet methylcytosine dioxygenase 1 (TET1 and thymine DNA glycosylase (TDG. Overexpression of miR-29 upregulated the global DNA methylation level in some cancer cells and downregulated DNA methylation in other cancer cells, suggesting that miR-29 suppresses tumorigenesis by protecting against changes in the existing DNA methylation status rather than by preventing de novo methylation of DNA.

  9. The tumor suppressor homolog in fission yeast, myh1+, displays a strong interaction with the checkpoint gene rad1+

    The DNA glycosylase MutY is strongly conserved in evolution, and homologs are found in most eukaryotes and prokaryotes examined. This protein is implicated in repair of oxidative DNA damage, in particular adenine mispaired opposite 7,8-dihydro-8-oxoguanine. Previous investigations in Escherichia coli, fission yeast, and mammalian cells show an association of mutations in MutY homologs with a mutator phenotype and carcinogenesis. Eukaryotic MutY homologs physically associate with several proteins with a role in replication, DNA repair, and checkpoint signaling, specifically the trimeric 9-1-1 complex. In a genetic investigation of the fission yeast MutY homolog, myh1+, we show that the myh1 mutation confers a moderately increased UV sensitivity alone and in combination with mutations in several DNA repair genes. The myh1 rad1, and to a lesser degree myh1 rad9, double mutants display a synthetic interaction resulting in enhanced sensitivity to DNA damaging agents and hydroxyurea. UV irradiation of myh1 rad1 double mutants results in severe chromosome segregation defects and visible DNA fragmentation, and a failure to activate the checkpoint. Additionally, myh1 rad1 double mutants exhibit morphological defects in the absence of DNA damaging agents. We also found a moderate suppression of the slow growth and UV sensitivity of rhp51 mutants by the myh1 mutation. Our results implicate fission yeast Myh1 in repair of a wider range of DNA damage than previously thought, and functionally link it to the checkpoint pathway

  10. DNA-dependent protein kinase inhibits AID-induced antibody gene conversion.

    Adam J L Cook

    2007-04-01

    Full Text Available Affinity maturation and class switching of antibodies requires activation-induced cytidine deaminase (AID-dependent hypermutation of Ig V(DJ rearrangements and Ig S regions, respectively, in activated B cells. AID deaminates deoxycytidine bases in Ig genes, converting them into deoxyuridines. In V(DJ regions, subsequent excision of the deaminated bases by uracil-DNA glycosylase, or by mismatch repair, leads to further point mutation or gene conversion, depending on the species. In Ig S regions, nicking at the abasic sites produced by AID and uracil-DNA glycosylases results in staggered double-strand breaks, whose repair by nonhomologous end joining mediates Ig class switching. We have tested whether nonhomologous end joining also plays a role in V(DJ hypermutation using chicken DT40 cells deficient for Ku70 or the DNA-dependent protein kinase catalytic subunit (DNA-PKcs. Inactivation of the Ku70 or DNA-PKcs genes in DT40 cells elevated the rate of AID-induced gene conversion as much as 5-fold. Furthermore, DNA-PKcs-deficiency appeared to reduce point mutation. The data provide strong evidence that double-strand DNA ends capable of recruiting the DNA-dependent protein kinase complex are important intermediates in Ig V gene conversion.

  11. DNA damage by the sulfate radical anion: hydrogen abstraction from the sugar moiety versus one-electron oxidation of guanine.

    Roginskaya, Marina; Mohseni, Reza; Ampadu-Boateng, Derrick; Razskazovskiy, Yuriy

    2016-07-01

    The products of oxidative damage to double-stranded (ds) DNA initiated by photolytically generated sulfate radical anions SO4(•-) were analyzed using reverse-phase (RP) high-performance liquid chromatography (HPLC). Relative efficiencies of two major pathways were compared: production of 8-oxoguanine (8oxoG) and hydrogen abstraction from the DNA 2-deoxyribose moiety (dR) at C1,' C4,' and C5' positions. The formation of 8oxoG was found to account for 87% of all quantified lesions at low illumination doses. The concentration of 8oxoG quickly reaches a steady state at about one 8oxoG per 100 base pairs due to further oxidation of its products. It was found that another guanine oxidation product identified as 2-amino-5-(2'-alkylamino)-4H-imidazol-4-one (X) was released in significant quantities from its tentative precursor 2-amino-5-[(2'-deoxy-β-d-erythro-pentofuranosyl)amino]-4H-imidazol-4-one (dIz) upon treatment with primary amines in neutral solutions. The linear dose dependence of X release points to the formation of dIz directly from guanine and not through oxidation of 8oxoG. The damage to dR was found to account for about 13% of the total damage, with majority of lesions (33%) originating from the C4' oxidation. The contribution of C1' oxidation also turned out to be significant (17% of all dR damages) despite of the steric problems associated with the abstraction of the C1'-hydrogen. However, no evidence of base-to-sugar free valence transfer as a possible alternative to direct hydrogen abstraction at C1' was found. PMID:27043476

  12. SUMO-1 possesses DNA binding activity

    Wieruszeski Jean-Michel

    2010-05-01

    Full Text Available Abstract Background Conjugation of small ubiquitin-related modifiers (SUMOs is a frequent post-translational modification of proteins. SUMOs can also temporally associate with protein-targets via SUMO binding motifs (SBMs. Protein sumoylation has been identified as an important regulatory mechanism especially in the regulation of transcription and the maintenance of genome stability. The precise molecular mechanisms by which SUMO conjugation and association act are, however, not understood. Findings Using NMR spectroscopy and protein-DNA cross-linking experiments, we demonstrate here that SUMO-1 can specifically interact with dsDNA in a sequence-independent fashion. We also show that SUMO-1 binding to DNA can compete with other protein-DNA interactions at the example of the regulatory domain of Thymine-DNA Glycosylase and, based on these competition studies, estimate the DNA binding constant of SUMO1 in the range 1 mM. Conclusion This finding provides an important insight into how SUMO-1 might exert its activity. SUMO-1 might play a general role in destabilizing DNA bound protein complexes thereby operating in a bottle-opener way of fashion, explaining its pivotal role in regulating the activity of many central transcription and DNA repair complexes.

  13. Comet-FISH with strand-specific probes reveals transcription-coupled repair of 8-oxoGuanine in human cells

    Guo, Jia; Hanawalt, Philip C.; Spivak, Graciela

    2013-01-01

    Oxidized bases in DNA have been implicated in cancer, aging and neurodegenerative disease. We have developed an approach combining single-cell gel electrophoresis (comet) with fluorescence in situ hybridization (FISH) that enables the comparative quantification of low, physiologically relevant levels of DNA lesions in the respective strands of defined nucleotide sequences and in the genome overall. We have synthesized single-stranded probes targeting the termini of DNA segments of interest using a polymerase chain reaction-based method. These probes facilitate detection of damage at the single-molecule level, as the lesions are converted to DNA strand breaks by lesion-specific endonucleases or glycosylases. To validate our method, we have documented transcription-coupled repair of cyclobutane pyrimidine dimers in the ataxia telangiectasia-mutated (ATM) gene in human fibroblasts irradiated with 254 nm ultraviolet at 0.1 J/m2, a dose ∼100-fold lower than those typically used. The high specificity and sensitivity of our approach revealed that 7,8-dihydro-8-oxoguanine (8-oxoG) at an incidence of approximately three lesions per megabase is preferentially repaired in the transcribed strand of the ATM gene. We have also demonstrated that the hOGG1, XPA, CSB and UVSSA proteins, as well as actively elongating RNA polymerase II, are required for this process, suggesting cross-talk between DNA repair pathways. PMID:23775797

  14. The role of DNA base damages in the x-ray inactivation of PM2 bacteriophage

    Base and sugar modifications are the predominant class of damages produced in DNA by ionizing radiation. A major radiolysis product of cytosine is uracil. In Escherichia coli misincorporated uracil residues in DNA are removed by the product of the ung gene, uracil-DNA glycosylase. The authors report here that ung/sup -/ mutants of E. coli were about two fold more sensitive to x-rays than ung/sup +/ when irradiated aerobically and about three fold more sensitive under anoxic conditions. Further, ung/sup -/ mutants were not sensitive to ultraviolet light. These results suggest that radiation-induced uracil residues are lethal lesions in E. coli cells. The production of uracil residues in PM2 DNA by ionizing radiation is currently being measured by the appearance of uracil-DNA glycosylase enzyme-sensitive sites and these will be related to the inactivation efficiency of uracil residues in PM2 transfecting DNA. The authors have done similar studies with thymine glycol, the major radiolysis product of thymine, alkali-labile (AP) sites, as well as single and double strand breaks. Thymine glycols accounted for 5.2% of PM2 phage lethal lesions, AP sites 13.8%, single strand breaks 4.2%, and double strand breaks 111.0%

  15. Non-canonical uracil processing in DNA gives rise to double-strand breaks and deletions: relevance to class switch recombination

    Bregenhorn, Stephanie; Kallenberger, Lia; Artola-Borán, Mariela; Peña-Diaz, Javier; Jiricny, Josef

    2016-01-01

    During class switch recombination (CSR), antigen-stimulated B-cells rearrange their immunoglobulin constant heavy chain (CH) loci to generate antibodies with different effector functions. CSR is initiated by activation-induced deaminase (AID), which converts cytosines in switch (S) regions, repetitive sequences flanking the CH loci, to uracils. Although U/G mispairs arising in this way are generally efficiently repaired to C/Gs by uracil DNA glycosylase (UNG)-initiated base excision repair (B...

  16. Infrared laser effects at fluences used for treatment of dentin hypersensitivity on DNA repair in Escherichia coli and plasmids

    Rocha Teixeira, Gleica; da Silva Marciano, Roberta; da Silva Sergio, Luiz Philippe; Castanheira Polignano, Giovanni Augusto; Roberto Guimarães, Oscar; Geller, Mauro; de Paoli, Flavia; de Souza da Fonseca, Adenilson

    2014-12-01

    Low-intensity infrared lasers are proposed in clinical protocols based on biostimulative effects, yet dosimetry is inaccurate and their effects on DNA at therapeutic doses are controversial. The aim of this work was to evaluate the effects of low-intensity infrared laser on survival and induction of filamentation of Escherichia coli cells, and induction of DNA lesions in bacterial plasmids. E. coli cultures were exposed to laser (808 nm, 100 mW, 40 and 60 J/cm2) to study bacterial survival and filamentation. Also, bacterial plasmids were exposed to laser to study DNA lesions by electrophoretic profile and action of DNA repair enzymes. Data indicate low-intensity infrared laser has no effect on survival of E. coli wild type and exonuclease III, but decreases the survival of formamidopyrimidine DNA glycosylase/MutM protein and endonuclease III deficient cells in stationary growth phase, induces bacterial filamentation, does not alter the electrophoretic profile of plasmids in agarose gels and does not alter the electrophoretic profile of plasmids incubated with endonuclease III, formamidopyrimidine DNA glycosylase/MutM protein and exonuclease III. Our findings show that low-intensity laser exposure causes DNA lesions at sub-lethal level and induces cellular mechanisms involved in repair of oxidative lesions in DNA. Studies about laser dosimetry and safety strategies are necessary for professionals and patients exposed to low-intensity lasers at therapeutic doses.

  17. A potential impact of DNA repair on ageing and lifespan in the ageing model organism Podospora anserina

    Soerensen, Mette; Gredilla, Ricardo; Müller-Ohldach, Mathis;

    2009-01-01

    The free radical theory of ageing states that ROS play a key role in age-related decrease in mitochondrial function via the damage of mitochondrial DNA (mtDNA), proteins and lipids. In the sexually reproducing ascomycete Podospora anserina ageing is, as in other eukaryotes, associated with mtDNA...... instability and mitochondrial dysfunction. Part of the mtDNA instabilities may arise due to accumulation of ROS induced mtDNA lesions, which, as previously suggested for mammals, may be caused by an age-related decrease in base excision repair (BER). Alignments of known BER protein sequences with the P....... anserina genome revealed high homology. We report for the first time the presence of BER activities in P. anserina mitochondrial extracts. DNA glycosylase activities decrease with age, suggesting that the increased mtDNA instability with age may be caused by decreased ability to repair mtDNA damage and...

  18. Repair of oxidative DNA base damage in the host genome influences the HIV integration site sequence preference.

    Geoffrey R Bennett

    Full Text Available Host base excision repair (BER proteins that repair oxidative damage enhance HIV infection. These proteins include the oxidative DNA damage glycosylases 8-oxo-guanine DNA glycosylase (OGG1 and mutY homolog (MYH as well as DNA polymerase beta (Polβ. While deletion of oxidative BER genes leads to decreased HIV infection and integration efficiency, the mechanism remains unknown. One hypothesis is that BER proteins repair the DNA gapped integration intermediate. An alternative hypothesis considers that the most common oxidative DNA base damages occur on guanines. The subtle consensus sequence preference at HIV integration sites includes multiple G:C base pairs surrounding the points of joining. These observations suggest a role for oxidative BER during integration targeting at the nucleotide level. We examined the hypothesis that BER repairs a gapped integration intermediate by measuring HIV infection efficiency in Polβ null cell lines complemented with active site point mutants of Polβ. A DNA synthesis defective mutant, but not a 5'dRP lyase mutant, rescued HIV infection efficiency to wild type levels; this suggested Polβ DNA synthesis activity is not necessary while 5'dRP lyase activity is required for efficient HIV infection. An alternate hypothesis that BER events in the host genome influence HIV integration site selection was examined by sequencing integration sites in OGG1 and MYH null cells. In the absence of these 8-oxo-guanine specific glycosylases the chromatin elements of HIV integration site selection remain the same as in wild type cells. However, the HIV integration site sequence preference at G:C base pairs is altered at several positions in OGG1 and MYH null cells. Inefficient HIV infection in the absence of oxidative BER proteins does not appear related to repair of the gapped integration intermediate; instead oxidative damage repair may participate in HIV integration site preference at the sequence level.

  19. Causes and consequences of oxidative stress in spermatozoa.

    Aitken, Robert John; Gibb, Zamira; Baker, Mark A; Drevet, Joel; Gharagozloo, Parviz

    2015-02-01

    Spermatozoa are highly vulnerable to oxidative attack because they lack significant antioxidant protection due to the limited volume and restricted distribution of cytoplasmic space in which to house an appropriate armoury of defensive enzymes. In particular, sperm membrane lipids are susceptible to oxidative stress because they abound in significant amounts of polyunsaturated fatty acids. Susceptibility to oxidative attack is further exacerbated by the fact that these cells actively generate reactive oxygen species (ROS) in order to drive the increase in tyrosine phosphorylation associated with sperm capacitation. However, this positive role for ROS is reversed when spermatozoa are stressed. Under these conditions, they default to an intrinsic apoptotic pathway characterised by mitochondrial ROS generation, loss of mitochondrial membrane potential, caspase activation, phosphatidylserine exposure and oxidative DNA damage. In responding to oxidative stress, spermatozoa only possess the first enzyme in the base excision repair pathway, 8-oxoguanine DNA glycosylase. This enzyme catalyses the formation of abasic sites, thereby destabilising the DNA backbone and generating strand breaks. Because oxidative damage to sperm DNA is associated with both miscarriage and developmental abnormalities in the offspring, strategies for the amelioration of such stress, including the development of effective antioxidant formulations, are becoming increasingly urgent. PMID:27062870

  20. [Ionizing radiation-induced DNA damage and its repair in human cells]. Progress report, [April 1, 1993--February 28, 1994

    1994-07-01

    The excision of radiation-induced lesions in DNA by a DNA repair enzyme complex, namely the UvrABC nuclease complex, has been investigated. Irradiated DNA was treated with the enzyme complex. DNA fractions were analyzed by gas chromatography/isotope-dilution mass spectrometry. The results showed that a number pyrimidine- and purine-derived lesions in DNA were excised by the UvrABC nuclease complex and that the enzyme complex does not act on radiation-induced DNA lesions as a glycosylase. This means that it does not excise individual base products, but it excises oligomers containing these lesions. A number of pyrimidine-derived lesions that were no substrates for other DNA repair enzymes investigated in our laboratory were substrates for the UvrABC nuclease complex.

  1. Epigenetic changes of Arabidopsis genome associated with altered DNA methyltransferase and demethylase expressions after gamma irradiation

    DNA methylation at carbon 5 of cytosines is a hall mark of epigenetic inactivation and heterochromatin in both plants and mammals. In Arabidopsis, DNA methylation has two roles that protect the genome from selfish DNA elements and regulate gene expression. Plant genome has three types of DNA methyltransferase, METHYLTRANSFERASE 1 (MET1), DOMAINREARRANGED METHYLASE (DRM) and CHROMOMETHYLASE 3 (CMT3) that are capable of methylating CG, CHG (where H is A, T, or C) and CHH sites, respectively. MET1 is a maintenance DNA methyltransferase that controls CG methylation. Two members of the DRM family, DRM1 and DRM2, are responsible for de novo methylation of CG, CHG, and CHH sites but show a preference for CHH sites. Finally, CMT3 principally carries out CHG methylation and is involved in both de novo methylation and maintenance. Alternatively, active DNA demethylation may occur through the glycosylase activity by removing the methylcytosines from DNA. It may have essential roles in preventing transcriptional silencing of transgenes and endogenous genes and in activating the expression of imprinted genes. DNA demetylation in Arabidopsis is mediated by the DEMETER (DME) family of bifunctional DNA glycosylase. Three targets of DME are MEA (MEDEA), FWA (FLOWERING WAGENINGEN), and FIS2 (FERTILIZATION INDEPENDENT SEED 2). The DME family contains DEMETER-LIKE 2 (DML2), DML3, and REPRESSOR OF SILENING 1 (ROS1). DNA demetylation by ROS1, DML2, and DML3 protect the hypermethylation of specific genome loci. ROS1 is necessary to suppress the promoter methylation and the silencing of endogenous genes. In contrast, the function of DML2 and DML3 has not been reported. Several recent studies have suggested that epigenetic alterations such as change in DNA methylation and histone modification should be caused in plant genomes upon exposure to ionizing radiation. However, there is a lack of data exploring the underlying mechanisms. Therefore, the present study aims to characterize and

  2. Epigenetic changes of Arabidopsis genome associated with altered DNA methyltransferase and demethylase expressions after gamma irradiation

    Kim, Ji Eun; Cho, Eun Ju; Kim, Ji Hong; Chung, Byung Yeoup; Kim, Jin Hong [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2012-05-15

    DNA methylation at carbon 5 of cytosines is a hall mark of epigenetic inactivation and heterochromatin in both plants and mammals. In Arabidopsis, DNA methylation has two roles that protect the genome from selfish DNA elements and regulate gene expression. Plant genome has three types of DNA methyltransferase, METHYLTRANSFERASE 1 (MET1), DOMAINREARRANGED METHYLASE (DRM) and CHROMOMETHYLASE 3 (CMT3) that are capable of methylating CG, CHG (where H is A, T, or C) and CHH sites, respectively. MET1 is a maintenance DNA methyltransferase that controls CG methylation. Two members of the DRM family, DRM1 and DRM2, are responsible for de novo methylation of CG, CHG, and CHH sites but show a preference for CHH sites. Finally, CMT3 principally carries out CHG methylation and is involved in both de novo methylation and maintenance. Alternatively, active DNA demethylation may occur through the glycosylase activity by removing the methylcytosines from DNA. It may have essential roles in preventing transcriptional silencing of transgenes and endogenous genes and in activating the expression of imprinted genes. DNA demetylation in Arabidopsis is mediated by the DEMETER (DME) family of bifunctional DNA glycosylase. Three targets of DME are MEA (MEDEA), FWA (FLOWERING WAGENINGEN), and FIS2 (FERTILIZATION INDEPENDENT SEED 2). The DME family contains DEMETER-LIKE 2 (DML2), DML3, and REPRESSOR OF SILENING 1 (ROS1). DNA demetylation by ROS1, DML2, and DML3 protect the hypermethylation of specific genome loci. ROS1 is necessary to suppress the promoter methylation and the silencing of endogenous genes. In contrast, the function of DML2 and DML3 has not been reported. Several recent studies have suggested that epigenetic alterations such as change in DNA methylation and histone modification should be caused in plant genomes upon exposure to ionizing radiation. However, there is a lack of data exploring the underlying mechanisms. Therefore, the present study aims to characterize and

  3. Oxidative DNA damage in peripheral leukocytes and its association with expression and polymorphisms of hOGG1: A study of adolescents in a high risk region for hepatocellular carcinoma in China

    Tao Peng; Choon Nam Ong; Han-Ming Shen; Zhi-Ming Liu; Lu-Nan Yan; Min-Hao Peng; Le-Qun Li; Ren-Xiang Liang; Zong-Liang Wei; Barry Halliwell

    2003-01-01

    AIM: To study the oxidative DNA damage to adolescents of hepatocellular carcinoma (HCC) families in Guangxi Zhuang Autonomous Region, China.METHODS: Peripheral leukocytes' DNA 7, 8-dihydro-8-oxoguanine (8-oxoG) and repair enzyme hOGG1 were quantified by flow-cytometry. hOGG1-Cys326Ser single nucleotide polymorphism (SNP) was distinguished by polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP) assay.RESULTS: There was a positive correlation between 8-oxoG and repair enzyme hOGG1 expression (P<0.001). HCC children (n=21) in Fusui county had a higher level of hOGG1(P<0.01) and a lower level of 8-oxoG (P<0.05) than the controls (n=63) in Nanning city. Children in Nanning exposed to passive-smoking had a higher hOGG1 expression (P<0.05)than the non-exposers. 8-oxoG and hOGG1 were negatively correlated with body mass index, while hOGG1 was positively correlated with age. There was a peak of 8-oxoG level nearby the 12 year point. Individuals with the hOGG1 326Ser allele had a significantly marginal higher concentration of leukocyte 8-oxoG level than hOGG1 326Cys allele.CONCLUSION: This is the first report using flow-cytometry to simultaneously quantify both the DNA oxidative damage and its repairing enzyme hOGG1. The results provide new insights towards a better understanding of the mechanisms of oxidative stress in a population highly susceptible to hepatocarcinogenesis.

  4. No effect of 600 grams fruit and vegetables per day on oxidative DNA damage and repair in healthy nonsmokers

    Moller, P.; Vogel, Ulla Birgitte; Pedersen, A.; Dragsted, Lars Ove; Sandstrom, B.; Loft, S.

    2003-01-01

    . Blood and urine samples were collected before, once a week, and 4 weeks after the intervention period. The level of strand breaks, endonuclease III sites, formamidopyrimidine sites, and sensitivity to hydrogen peroxide was assessed in mononuclear blood cells by the comet assay. Excretion of 7-hydro-8...... had no effect on oxidative DNA damage measured in mononuclear cell DNA or urine. Hydrogen peroxide sensitivity, detected by the comet assay, did not differ between the groups. Expression of excision repair cross complementing I and oxoguanine glycosylase I in leukocytes was not related to the diet...

  5. Variation of DNA damage levels in peripheral blood mononuclear cells isolated in different laboratories

    Godschalk, Roger W L; Ersson, Clara; Stępnik, Maciej;

    2014-01-01

    This study investigated the levels of DNA strand breaks and formamidopyrimidine DNA glycosylase (FPG) sensitive sites, as assessed by the comet assay, in peripheral blood mononuclear cells (PBMC) from healthy women from five different countries in Europe. The laboratory in each country (referred to...... as 'centre') collected and cryopreserved PBMC samples from three donors, using a standardised cell isolation protocol. The samples were analysed in 13 different laboratories for DNA damage, which is measured by the comet assay. The study aim was to assess variation in DNA damage in PBMC samples that...... were collected in the same way and processed using the same blood isolation procedure. The inter-laboratory variation was the prominent contributor to the overall variation. The inter-laboratory coefficient of variation decreased for both DNA strand breaks (from 68 to 26%) and FPG sensitive sites (from...

  6. DNA damage in lung after oral exposure to diesel exhaust particles in Big Blue (R) rats

    Müller, Anne Kirstine; Farombi, E.O.; Møller, P.;

    2004-01-01

    . Lung tissue is a target organ for DEP induced cancer following inhalation. Recent studies have provided evidence that the lung is also a target organ for DNA damage and cancer after oral exposure to other complex mixtures of PAHs. The genotoxic effect of oral administration of DEP was investigated, in...... endonuclease III and fapyguanine glycosylase (FPG) sensitive sites increased at the intermediate dose levels. The induction of DNA damage by DEP exposure did not increase the expression of the repair genes OGG1 and ERCC1 at the mRNA level. The present study indicates that the lung is a target organ for primary...... DNA damage following oral exposure to DEP. DNA damage was induced following exposure to relatively low levels of DEP, but under the conditions used in the present experiment DNA damage did not result in an increased mutation rate....

  7. DNA damage in lung after oral exposure to diesel exhaust particles in Big Blue (R) rats

    Müller, Anne Kirstine; Farombi, E.O.; Møller, P.; Autrup, H.N.; Vogel, U.; Wallin, H.; Dragsted, Lars Ove; Loft, S.; Binderup, Mona-Lise

    . Lung tissue is a target organ for DEP induced cancer following inhalation. Recent studies have provided evidence that the lung is also a target organ for DNA damage and cancer after oral exposure to other complex mixtures of PAHs. The genotoxic effect of oral administration of DEP was investigated, in...... endonuclease III and fapyguanine glycosylase (FPG) sensitive sites increased at the intermediate dose levels. The induction of DNA damage by DEP exposure did not increase the expression of the repair genes OGG1 and ERCC1 at the mRNA level. The present study indicates that the lung is a target organ for primary...... DNA damage following oral exposure to DEP. DNA damage was induced following exposure to relatively low levels of DEP, but under the conditions used in the present experiment DNA damage did not result in an increased mutation rate....

  8. Different organization of base excision repair of uracil in DNA in nuclei and mitochondria and selective upregulation of mitochondrial uracil-DNA glycosylase after oxidative stress

    Akbari, M; Otterlei, M; Pena Diaz, Javier; Krokan, H E

    2007-01-01

    proteins also remove the oxidized cytosine derivatives isodialuric acid, alloxan and 5-hydroxyuracil. UNG1 and UNG2 have identical catalytic domain, but different N-terminal regions required for subcellular sorting. We demonstrate that mRNA for UNG1, but not UNG2, is increased after hydrogen peroxide......, indicating regulatory effects of oxidative stress on mitochondrial BER. To examine the overall organization of uracil-BER in nuclei and mitochondria, we constructed cell lines expressing EYFP (enhanced yellow fluorescent protein) fused to UNG1 or UNG2. These were used to investigate the possible presence of...... BER processes are differently organized. Furthermore, the upregulation of mRNA for mitochondrial UNG1 after oxidative stress indicates that it may have an important role in repair of oxidized pyrimidines....

  9. Catalytically impaired hMYH and NEIL1 mutant proteins identified in patients with primary sclerosing cholangitis and cholangiocarcinoma

    Forsbring, Monika; Vik, Erik S.; Dalhus, Bjørn; Karlsen, Tom H.; Bergquist, Annika; Schrumpf, Erik; Bjørås, Magnar; Boberg, Kirsten M.; Alseth, Ingrun

    2009-01-01

    The human hMYH and NEIL1 genes encode DNA glycosylases involved in repair of oxidative base damage and mutations in these genes are associated with certain cancers. Primary sclerosing cholangitis (PSC), a chronic cholestatic liver disease characterized by inflammatory destruction of the biliary tree, is often complicated by the development of cholangiocarcinoma (CCA). Here, we aimed to investigate the influence of genetic variations in the hMYH and NEIL1 genes on risk of CCA in PSC patients. The hMYH and NEIL1 gene loci in addition to the DNA repair genes hOGG1, NTHL1 and NUDT1 were analyzed in 66 PSC patients (37 with CCA and 29 without cancer) by complete genomic sequencing of exons and adjacent intronic regions. Several single-nucleotide polymorphisms and mutations were identified and severe impairment of protein function was observed for three non-synonymous variants. The NEIL1 G83D mutant was dysfunctional for the major oxidation products 7,8-dihydro-8-oxoguanine (8oxoG), thymine glycol and dihydrothymine in duplex DNA, and the ability to perform δ-elimination at abasic sites was significantly reduced. The hMYH R260Q mutant had severe defect in adenine DNA glycosylase activity, whereas hMYH H434D could excise adenines from A:8oxoG pairs but not from A:G mispairs. We found no overall associations between the 18 identified variants and susceptibility to CCA in PSC patients; however, the impaired variants may be of significance for carcinogenesis in general. Our findings demonstrate the importance of complete resequencing of selected candidate genes in order to identify rare genetic variants and their possible contribution to individual susceptibility to cancer development. PMID:19443904

  10. Cu(II) sensitizes pBR322 plasmid DNA to inactivation by UV-B (280-315 nm)

    Copper (II), in the presence of UV-B radiation (280-315 nm), can generate single-strand breaks in the sugar-phosphate backbone of pBr322 plasmid DNA. A low level of single-strand backbone breaks occurs in the presence of Cu(II) alone, but UV-B irradiation increases the rate by the more than 100-fold. Concomitant with the damage to the DNA backbone is a loss of transforming activity. Oxygen is required for generation of the single-strand breaks but not for the loss of transforming activity. A DNA glycosylase (Fpg), which participates in the repair of certain DNA nitrogenous base damage, does not repair plasmid DNA damaged by Cu(II). The hydroxyl radical scavenging compound DMSO is only moderately radioprotective of DNA. (Author)

  11. Characterization of DNA metabolizing enzymes in situ following polyacrylamide gel electrophoresis

    The authors have detected the in situ activities of DNA glycosylase, endonuclease, exonuclease, DNA polymerase, and DNA ligase using a novel polyacrylamide activity gel electrophoresis procedure. DNA metabolizing enzymes were resolved through either native or SDS-polyacrylamide gels containing defined 32P-labeled oligonucleotides annealed to M13 DNA. After electrophoresis, these enzymes catalyzed in situ reactions and their [32P]DNA products were resolved from the gel by a second dimension of electrophoresis through a denaturing DNA sequencing gel. Detection of modified (degraded or elongated) oligonucleotide chains was used to locate various enzyme activities. The catalytic and physical properties of Novikoff hepatoma DNA polymerase β were found to be similar under both in vitro and in situ conditions. With 3'-terminally matched and mismatched [32P]DNA substrates in the same activity gel, DNA polymerase and/or 3' to 5' exonuclease activities of Escherichia coli DNA polymerase I (large fragment), DNA polymerase III (holoenzyme), and exonuclease III were detected and characterized. Several restriction endonucleases and the tripeptide (Lys-Try-Lys), which acts as an apurinic/apyrimidinic endonuclease, were able to diffuse into gels and modify DNA. This ability to create intermediate substrates within activity gels could prove extremely useful in delineating the steps of DNA replication and repair pathways

  12. A functional Ser326Cys polymorphism in hOGG1 is associated with noise-induced hearing loss in a Chinese population.

    Huanxi Shen

    Full Text Available DNA damage to cochlear hair cells caused by 8-oxoguanine (8-oxoG is essential for the development of noise-induced hearing loss (NIHL. Human 8-oxoG DNA glycosylase1 (hOGG1 is a key enzyme in the base excision repair (BER pathway that eliminates 8-oxoG. Many epidemiological and functional studies have suggested that the hOGG1 Ser326Cys polymorphism (rs1052133 is associated with many diseases. The purpose of this investigation was to investigate whether the hOGG1 Ser326Cys polymorphism in the human BER pathway is associated with genetic susceptibility to NIHL in a Chinese population. This polymorphism was genotyped among 612 workers with NIHL and 615 workers with normal hearing. We found that individuals with the hOGG1 Cys/Cys genotype had a statistically significantly increased risk of NIHL compared with those who carried the hOGG1 Ser/Ser genotype (adjusted OR=1.59, 95% CI=1.13-2.25 and this increased risk was more pronounced among the workers in the 15- to 25- and >25-year noise exposure time, 85-92 dB(A noise exposure level, ever smoking, and ever drinking groups, similar effects were also observed in a recessive model. In summary, our data suggested that the hOGG1 Cys/Cys genotype may be a genetic susceptibility marker for NIHL in the Chinese Han population.

  13. Evaluation of genotoxic risk and oxidative DNA damage in mammalian cells exposed to mycotoxins, patulin and citrinin

    Mycotoxins are fungal secondary metabolites with very diversified toxic effects in humans and animals. In the present study, patulin (PAT) and citrinin (CTN), two prevalent mycotoxins, were evaluated for their genotoxic effects and oxidative damage to mammalian cells, including Chinese hamster ovary cells (CHO-K1), human peripheral blood lymphocytes, and human embryonic kidney cells (HEK293). PAT, but not CTN, caused a significant dose-dependent increase in sister chromatid exchange (SCE) frequency in both CHO-K1 and human lymphocytes. PAT also elevated the levels of DNA gap and break in treated CHO-K1. In the single cell gel electrophoresis (SCGE) assay, exposure of HEK293 to concentrations above 15 μM of PAT induced DNA strand breaks; the tail moment values also greatly increased after posttreatment with formamidopyrimidine-DNA glycosylase (Fpg). This suggests that in human cells PAT is a potent clastogen with the ability to cause oxidative damage to DNA. However, no significant change in the tail moment values in CTN-treated cultures was found, suggesting that CTN is not genotoxic to HEK293. Incubation of HEK293 with CTN increased the mRNA level of heat shock protein 70 (HSP70), but not that of human 8-hydroxyguanine DNA glycosylase 1 (hOGG1). PAT treatment did not modulate the expression of either HSP70 or hOGG1 mRNA

  14. Repair of DNA-containing pyrimidine dimers

    Ultraviolet light-induced pyrimidine dimers in DNA are recognized and repaired by a number of unique cellular surveillance systems. The most direct biochemical mechanism responding to this kind of genotoxicity involves direct photoreversal by flavin enzymes that specifically monomerize pyrimidine:pyrimidine dimers monophotonically in the presence of visible light. Incision reactions are catalyzed by a combined pyrimidine dimer DNA-glycosylase:apyrimidinic endonuclease found in some highly UV-resistant organisms. At a higher level of complexity, Escherichia coli has a uvr DNA repair system comprising the UvrA, UvrB, and UvrC proteins responsible for incision. There are several preincision steps governed by this pathway, which includes an ATP-dependent UvrA dimerization reaction required for UvrAB nucleoprotein formation. This complex formation driven by ATP binding is associated with localized topological unwinding of DNA. This same protein complex can catalyze an ATPase-dependent 5'----3'-directed strand displacement of D-loop DNA or short single strands annealed to a single-stranded circular or linear DNA. This putative translocational process is arrested when damaged sites are encountered. The complex is now primed for dual incision catalyzed by UvrC. The remainder of the repair process involves UvrD (helicase II) and DNA polymerase I for a coordinately controlled excision-resynthesis step accompanied by UvrABC turnover. Furthermore, it is proposed that levels of repair proteins can be regulated by proteolysis. UvrB is converted to truncated UvrB* by a stress-induced protease that also acts at similar sites on the E. coli Ada protein. Although UvrB* can bind with UvrA to DNA, it cannot participate in helicase or incision reactions. It is also a DNA-dependent ATPase.21 references

  15. Repair of DNA-containing pyrimidine dimers

    Grossman, L.; Caron, P.R.; Mazur, S.J.; Oh, E.Y.

    1988-08-01

    Ultraviolet light-induced pyrimidine dimers in DNA are recognized and repaired by a number of unique cellular surveillance systems. The most direct biochemical mechanism responding to this kind of genotoxicity involves direct photoreversal by flavin enzymes that specifically monomerize pyrimidine:pyrimidine dimers monophotonically in the presence of visible light. Incision reactions are catalyzed by a combined pyrimidine dimer DNA-glycosylase:apyrimidinic endonuclease found in some highly UV-resistant organisms. At a higher level of complexity, Escherichia coli has a uvr DNA repair system comprising the UvrA, UvrB, and UvrC proteins responsible for incision. There are several preincision steps governed by this pathway, which includes an ATP-dependent UvrA dimerization reaction required for UvrAB nucleoprotein formation. This complex formation driven by ATP binding is associated with localized topological unwinding of DNA. This same protein complex can catalyze an ATPase-dependent 5'----3'-directed strand displacement of D-loop DNA or short single strands annealed to a single-stranded circular or linear DNA. This putative translocational process is arrested when damaged sites are encountered. The complex is now primed for dual incision catalyzed by UvrC. The remainder of the repair process involves UvrD (helicase II) and DNA polymerase I for a coordinately controlled excision-resynthesis step accompanied by UvrABC turnover. Furthermore, it is proposed that levels of repair proteins can be regulated by proteolysis. UvrB is converted to truncated UvrB* by a stress-induced protease that also acts at similar sites on the E. coli Ada protein. Although UvrB* can bind with UvrA to DNA, it cannot participate in helicase or incision reactions. It is also a DNA-dependent ATPase.21 references.

  16. A MATE-Family Efflux Pump Rescues the Escherichia coli 8-Oxoguanine-Repair-Deficient Mutator Phenotype and Protects Against H2O2 Killing

    Guelfo, Javier R.; Alexandro Rodríguez-Rojas; Ivan Matic; Jesús Blázquez

    2010-01-01

    Hypermutation may accelerate bacterial evolution in the short-term. In the long-term, however, hypermutators (cells with an increased rate of mutation) can be expected to be at a disadvantage due to the accumulation of deleterious mutations. Therefore, in theory, hypermutators are doomed to extinction unless they compensate the elevated mutational burden (deleterious load). Different mechanisms capable of restoring a low mutation rate to hypermutators have been proposed. By choosing an 8-oxog...

  17. Oxidative stress, inflammation, and DNA damage in rats after intratracheal instillation or oral exposure to ambient air and wood smoke particulate matter

    Danielsen, Pernille Høgh; Loft, Steffen; Jacobsen, Nicklas Raun;

    2010-01-01

    exposed orally to CB, respectively. Rats orally exposed to PM from the wood stove area and low oxygen combustion WSPM (LOWS) had 35% (95% CI: 0.1-71%) and 45% (95% CI: 10-82%) increased levels of edG in the liver, respectively. No significant differences were observed for bulky DNA adducts. Increased gene...... expression of proinflammatory cytokines, heme oxygenase-1, and oxoguanine DNA glycosylase 1 was observed in the liver following intragastric exposure and in the lung following instillation in particular of LOWS. Exposure to LOWS also increased the proportion of neutrophils in BAL fluid. These results...

  18. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL−1 and 50 μg mL−1 of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair activities

  19. Increased oxidative DNA damage in mononuclear leukocytes in vitiligo

    Giovannelli, Lisa [Department of Preclinical and Clinical Pharmacology, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy)]. E-mail: lisag@pharm.unifi.it; Bellandi, Serena [Department of Dermatological Sciences, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy); Pitozzi, Vanessa [Department of Preclinical and Clinical Pharmacology, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy); Fabbri, Paolo [Department of Dermatological Sciences, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy); Dolara, Piero [Department of Preclinical and Clinical Pharmacology, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy); Moretti, Silvia [Department of Dermatological Sciences, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy)

    2004-11-22

    Vitiligo is an acquired pigmentary disorder of the skin of unknown aetiology. The autocytotoxic hypothesis suggests that melanocyte impairment could be related to increased oxidative stress. Evidences have been reported that in vitiligo oxidative stress might also be present systemically. We used the comet assay (single cell alkaline gel electrophoresis) to evaluate DNA strand breaks and DNA base oxidation, measured as formamidopyrimidine DNA glycosylase (FPG)-sensitive sites, in peripheral blood cells from patients with active vitiligo and healthy controls. The basal level of oxidative DNA damage in mononuclear leukocytes was increased in vitiligo compared to normal subjects, whereas DNA strand breaks (SBs) were not changed. This alteration was not accompanied by a different capability to respond to in vitro oxidative challenge. No differences in the basal levels of DNA damage in polymorphonuclear leukocytes were found between patients and healthy subjects. Thus, this study supports the hypothesis that in vitiligo a systemic oxidative stress exists, and demonstrates for the first time the presence of oxidative alterations at the nuclear level. The increase in oxidative DNA damage shown in the mononuclear component of peripheral blood leukocytes from vitiligo patients was not particularly severe. However, these findings support an adjuvant role of antioxidant treatment in vitiligo.

  20.  Oxidation and deamination of nucleobases as an epigenetic tool

    Jolanta Guz

    2012-05-01

    Full Text Available  Recent discoveries have demonstrated that 5-methylcytosine (5mC may be hydroxymethylated to 5-hydroxymethylcytosine (5hmC in mammals and that genomic DNA may contain about 0.02–0.7�0of 5hmC. The aforementioned modification is the key intermediate of active DNA demethylation and has been named “the sixth base in DNA”.Although active DNA demethylation in mammals is still controversial, the most plausible mechanism/s of active 5mC demethylation include involvement of three families of enzymes; i Tet, which is involved in hydroxylation of 5mC to form 5hmC, which can be further oxidized to 5-formylcytosine (5fC and 5-carboxylcytosine (5caC; ii deamination of 5mC (or 5hmC by AID/APOBEC to form thymine or 5-hydroxymethyluracil (5hmU mispaired with guanine; iii the BER pathway induced by involvement of TDG glycosylase to replace the above described base modification (5fC, 5caC, 5hmU with cytosine to demethylate DNA.A plausible scenario for engagement of TDG glycosylase (or some other G-T glycosylase is through prior deamination of 5-mC to thymine, which generates a G: T substrate for the enzyme. Here cytidine deaminase of the AID/APOBEC family was implicated in the deamination step. It is possible that TDG may act in concert with these deaminases.It seems that mutations are not the only effect of oxidatively modified DNA bases. These, as yet, understudied aspects of the damage suggest a potential for 8-oxoguanine (8-oxoGua to affect gene expression via chromatin relaxation. It is possible that 8-oxoGua presence in specific DNA sequences may be widely used for transcription regulation, which suggests the epigenetic nature of 8-oxoGua presence in DNA.

  1. Effects of Anthocyanins on CAG Repeat Instability and Behaviour in Huntington’s Disease R6/1 Mice

    Møllersen, Linda; Moldestad, Olve; Rowe, Alexander D.; Bjølgerud, Anja; Holm, Ingunn; Tveterås, Linda; Klungland, Arne; Retterstøl, Lars

    2016-01-01

    Background: Huntington’s disease (HD) is a progressive neurodegenerative disorder caused by CAG repeat expansions in the HTT gene. Somatic repeat expansion in the R6/1 mouse model of HD depends on mismatch repair and is worsened by base excision repair initiated by the 7,8-dihydroxy-8-oxoguanine-DNA glycosylase (Ogg1) or Nei-like 1 (Neil1). Ogg1 and Neil1 repairs common oxidative lesions. Methods: We investigated whether anthocyanin antioxidants added daily to the drinking water could affect CAG repeat instability in several organs and behaviour in R6/1 HD mice. In addition, anthocyanin-treated and untreated R6/1 HD mice at 22 weeks of age were tested in the open field test and on the rotarod. Results: Anthocyanin-treated R6/1 HD mice showed reduced instability index in the ears and in the cortex compared to untreated R6/1 mice, and no difference in liver and kidney. There were no significant differences in any of the parameters tested in the behavioural tests among anthocyanin-treated and untreated R6/1 HD mice. Conclusions: Our results indicate that continuous anthocyanin-treatment may have modest effects on CAG repeat instability in the ears and the cortex of R6/1 mice. More studies are required to investigate if anthocyanin-treatment could affect behaviour earlier in the disease course. PMID:27540492

  2. Ancient DNA

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  3. Effects of ionizing radiations on DNA-protein complexes

    The radio-induced destruction of DNA-protein complexes may have serious consequences for systems implicated in important cellular functions. The first system which has been studied is the lactose operon system, that regulates gene expression in Escherichia coli. First of all, the repressor-operator complex is destroyed after irradiation of the complex or of the protein alone. The damaging of the domain of repressor binding to DNA (headpiece) has been demonstrated and studied from the point of view of peptide chain integrity, conformation and amino acids damages. Secondly, dysfunctions of the in vitro induction of an irradiated repressor-unirradiated DNA complex have been observed. These perturbations, due to a decrease of the number of inducer binding sites, are correlated to the damaging of tryptophan residues. Moreover, the inducer protects the repressor when they are irradiated together, both by acting as a scavenger in the bulk, and by the masking of its binding site on the protein. The second studied system is formed by Fpg (for Formamido pyrimidine glycosylase), a DNA repair protein and a DNA with an oxidative lesion. The results show that irradiation disturbs the repair both by decreasing its efficiency of DNA lesion recognition and binding, and by altering its enzymatic activity. (author)

  4. Base Flip in DNA Studied by Molecular Dynamics Simulationsof Differently-Oxidized Forms of Methyl-Cytosine

    Mahdi Bagherpoor Helabad

    2014-07-01

    Full Text Available Distortions in the DNA sequence, such as damage or mispairs, are specifically recognized and processed by DNA repair enzymes. Many repair proteins and, in particular, glycosylases flip the target base out of the DNA helix into the enzyme’s active site. Our molecular dynamics simulations of DNA with intact and damaged (oxidized methyl-cytosine show that the probability of being flipped is similar for damaged and intact methyl-cytosine. However, the accessibility of the different 5-methyl groups allows direct discrimination of the oxidized forms. Hydrogen-bonded patterns that vary between methyl-cytosine forms carrying a carbonyl oxygen atom are likely to be detected by the repair enzymes and may thus help target site recognition.

  5. Modular Nuclease-Responsive DNA Three-Way Junction-Based Dynamic Assembly of a DNA Device and Its Sensing Application.

    Zhu, Jing; Wang, Lei; Xu, Xiaowen; Wei, Haiping; Jiang, Wei

    2016-04-01

    Here, we explored a modular strategy for rational design of nuclease-responsive three-way junctions (TWJs) and fabricated a dynamic DNA device in a "plug-and-play" fashion. First, inactivated TWJs were designed, which contained three functional domains: the inaccessible toehold and branch migration domains, the specific sites of nucleases, and the auxiliary complementary sequence. The actions of different nucleases on their specific sites in TWJs caused the close proximity of the same toehold and branch migration domains, resulting in the activation of the TWJs and the formation of a universal trigger for the subsequent dynamic assembly. Second, two hairpins (H1 and H2) were introduced, which could coexist in a metastable state, initially to act as the components for the dynamic assembly. Once the trigger initiated the opening of H1 via TWJs-driven strand displacement, the cascade hybridization of hairpins immediately switched on, resulting in the formation of the concatemers of H1/H2 complex appending numerous integrated G-quadruplexes, which were used to obtain label-free signal readout. The inherent modularity of this design allowed us to fabricate a flexible DNA dynamic device and detect multiple nucleases through altering the recognition pattern slightly. Taking uracil-DNA glycosylase and CpG methyltransferase M.SssI as models, we successfully realized the butt joint between the uracil-DNA glycosylase and M.SssI recognition events and the dynamic assembly process. Furthermore, we achieved ultrasensitive assay of nuclease activity and the inhibitor screening. The DNA device proposed here will offer an adaptive and flexible tool for clinical diagnosis and anticancer drug discovery. PMID:26943244

  6. Atomic structure of the DNA repair [4Fe-4S] enzyme endonuclease III.

    Kuo, C F; McRee, D E; Fisher, C L; O'Handley, S F; Cunningham, R P; Tainer, J A

    1992-10-16

    The crystal structure of the DNA repair enzyme endonuclease III, which recognizes and cleaves DNA at damaged bases, has been solved to 2.0 angstrom resolution with an R factor of 0.185. This iron-sulfur [4Fe-4S] enzyme is elongated and bilobal with a deep cleft separating two similarly sized domains: a novel, sequence-continuous, six-helix domain (residues 22 to 132) and a Greek-key, four-helix domain formed by the amino-terminal and three carboxyl-terminal helices (residues 1 to 21 and 133 to 211) together with the [4Fe-4S] cluster. The cluster is bound entirely within the carboxyl-terminal loop with a ligation pattern (Cys-X6-Cys-X2-Cys-X5-Cys) distinct from all other known [4Fe-4S] proteins. Sequence conservation and the positive electrostatic potential of conserved regions identify a surface suitable for binding duplex B-DNA across the long axis of the enzyme, matching a 46 angstrom length of protected DNA. The primary role of the [4Fe-4S] cluster appears to involve positioning conserved basic residues for interaction with the DNA phosphate backbone. The crystallographically identified inhibitor binding region, which recognizes the damaged base thymine glycol, is a seven-residue beta-hairpin (residues 113 to 119). Location and side chain orientation at the base of the inhibitor binding site implicate Glu112 in the N-glycosylase mechanism and Lys120 in the beta-elimination mechanism. Overall, the structure reveals an unusual fold and a new biological function for [4Fe-4S] clusters and provides a structural basis for studying recognition of damaged DNA and the N-glycosylase and apurinic/apyrimidinic-lyase mechanisms. PMID:1411536

  7. Macromolecule oxidation and DNA repair in mussel (Mytilus edulis L.) gill following exposure to Cd and Cr(VI)

    The oxidation of DNA and lipid was analysed in the marine mussel (Mytilus edulis) in response to exposure (10 μg/l and 200 μg/l) to cadmium (Cd) and chromium [Cr(VI)]. Concentration dependent uptake of both metals into mussel tissues was established and levels of gill ATP were not depleted at these exposure levels. DNA strand breakage in gill cells (analysed by the comet assay) was elevated by both metals, however, DNA oxidation [measured by DNA strand breakage induced by the DNA repair enzyme formamidopyrimidine glycosylase (FPG)] was not elevated. This was despite a statistically significant increase in both malondialdehyde and 4-hydroxynonenal - indicative of lipid peroxidation - following treatment with Cd. In contrast, both frank DNA stand breaks and FPG-induced DNA strand breaks (indicative of DNA oxidation) were increased following injection of mussels with sodium dichromate (10.4 μg Cr(VI)/mussel). The metals also showed differential inhibitory potential towards DNA repair enzyme activity with Cd exhibiting inhibition of DNA cutting activity towards an oligonucleotide containing 8-oxo-7,8-dihydro-2'-deoxyguanosine and Cr(VI) showing inhibition of such activity towards an oligonucleotide containing ethenoadenosine, both at 200 μg/l. The metals thus show DNA damage activity in mussel gill with distinct mechanisms involving both direct and indirect (oxidative) DNA damage, as well as impairing different DNA repair capacities. A combination of these activities can contribute to adverse effects in these organisms

  8. Macromolecule oxidation and DNA repair in mussel (Mytilus edulis L.) gill following exposure to Cd and Cr(VI)

    Emmanouil, C. [School of Biosciences, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom); Sheehan, T.M.T. [Regional Toxicology Laboratory, City Hospital, Dudley Road, Birmingham B18 7QH (United Kingdom); Chipman, J.K. [School of Biosciences, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom)]. E-mail: J.K.Chipman@bham.ac.uk

    2007-04-20

    The oxidation of DNA and lipid was analysed in the marine mussel (Mytilus edulis) in response to exposure (10 {mu}g/l and 200 {mu}g/l) to cadmium (Cd) and chromium [Cr(VI)]. Concentration dependent uptake of both metals into mussel tissues was established and levels of gill ATP were not depleted at these exposure levels. DNA strand breakage in gill cells (analysed by the comet assay) was elevated by both metals, however, DNA oxidation [measured by DNA strand breakage induced by the DNA repair enzyme formamidopyrimidine glycosylase (FPG)] was not elevated. This was despite a statistically significant increase in both malondialdehyde and 4-hydroxynonenal - indicative of lipid peroxidation - following treatment with Cd. In contrast, both frank DNA stand breaks and FPG-induced DNA strand breaks (indicative of DNA oxidation) were increased following injection of mussels with sodium dichromate (10.4 {mu}g Cr(VI)/mussel). The metals also showed differential inhibitory potential towards DNA repair enzyme activity with Cd exhibiting inhibition of DNA cutting activity towards an oligonucleotide containing 8-oxo-7,8-dihydro-2'-deoxyguanosine and Cr(VI) showing inhibition of such activity towards an oligonucleotide containing ethenoadenosine, both at 200 {mu}g/l. The metals thus show DNA damage activity in mussel gill with distinct mechanisms involving both direct and indirect (oxidative) DNA damage, as well as impairing different DNA repair capacities. A combination of these activities can contribute to adverse effects in these organisms.

  9. Distinct energetics and closing pathways for DNA polymerase β with 8-oxoG template and different incoming nucleotides

    Wang Yanli

    2007-02-01

    Full Text Available Abstract Background 8-Oxoguanine (8-oxoG is a common oxidative lesion frequently encountered by DNA polymerases such as the repair enzyme DNA polymerase β (pol β. To interpret in atomic and energetic detail how pol β processes 8-oxoG, we apply transition path sampling to delineate closing pathways of pol β 8-oxoG complexes with dCTP and dATP incoming nucleotides and compare the results to those of the nonlesioned G:dCTP and G:dATPanalogues. Results Our analyses show that the closing pathways of the 8-oxoG complexes are different from one another and from the nonlesioned analogues in terms of the individual transition states along each pathway, associated energies, and the stability of each pathway's closed state relative to the corresponding open state. In particular, the closed-to-open state stability difference in each system establishes a hierarchy of stability (from high to low as G:C > 8-oxoG:C > 8-oxoG:A > G:A, corresponding to -3, -2, 2, 9 kBT, respectively. This hierarchy of closed state stability parallels the experimentally observed processing efficiencies for the four pairs. Network models based on the calculated rate constants in each pathway indicate that the closed species are more populated than the open species for 8-oxoG:dCTP, whereas the opposite is true for 8-oxoG:dATP. Conclusion These results suggest that the lower insertion efficiency (larger Km for dATP compared to dCTP opposite 8-oxoG is caused by a less stable closed-form of pol β, destabilized by unfavorable interactions between Tyr271 and the mispair. This stability of the closed vs. open form can also explain the higher insertion efficiency for 8-oxoG:dATP compared to the nonlesioned G:dATP pair, which also has a higher overall conformational barrier. Our study offers atomic details of the complexes at different states, in addition to helping interpret the different insertion efficiencies of dATP and dCTP opposite 8-oxoG and G.

  10. DNA damage and repair kinetics of the Alternaria mycotoxins alternariol, altertoxin II and stemphyltoxin III in cultured cells.

    Fleck, Stefanie C; Sauter, Friederike; Pfeiffer, Erika; Metzler, Manfred; Hartwig, Andrea; Köberle, Beate

    2016-03-01

    The Alternaria mycotoxins alternariol (AOH) and altertoxin II (ATX II) have previously been shown to elicit mutagenic and genotoxic effects in bacterial and mammalian cells, although with vastly different activities. For example, ATX II was about 50 times more mutagenic than AOH. We now report that stemphyltoxin III (STTX III) is also highly mutagenic. The more pronounced effects of the perylene quinones ATX II and STTX III at lower concentrations compared to the dibenzo-α-pyrone AOH indicate a marked dependence of the genotoxic potential on the chemical structure and furthermore suggest that the underlying modes of action may be different. We have now further investigated the type of DNA damage induced by AOH, ATX II and STTX III, as well as the repair kinetics and their dependence on the status of nucleotide excision repair (NER). DNA double strand breaks induced by AOH due to poisoning of topoisomerase IIα were completely repaired in less than 2h. Under cell-free conditions, inhibition of topoisomerase IIα could also be measured for ATX II and STTX III at low concentrations, but the perylene quinones were catalytic inhibitors rather than topoisomerase poisons and did not induce DSBs. DNA strand breaks induced by ATX II and STTX III were more persistent and not completely repaired within 24h. A dependence of the repair rate on the NER status could only be demonstrated for STTX III, resulting in an accumulation of DNA damage in NER-deficient cells. Together with the finding that the DNA glycosylase formamidopyrimidine-DNA glycosylase (Fpg), but not T4 endonuclease V, is able to generate additional DNA strand breaks measurable by the alkaline unwinding assay, we conclude that the genotoxicity of the perylene quinones with an epoxide group is probably caused by the formation of DNA adducts which may be converted to Fpg sensitive sites. PMID:26994491