WorldWideScience

Sample records for 8-oxoguanine dna glycosylase

  1. Functional Characterization of 8-Oxoguanine DNA Glycosylase of Trypanosoma cruzi

    Mendes, Isabela Cecília; de Moura, Michelle Barbi; Campos, Priscila Carneiro; Macedo, Andrea Mara; Franco, Glória Regina; Pena, Sérgio Danilo Junho; Teixeira, Santuza Maria Ribeiro; Van Houten, Bennett; Machado, Carlos Renato

    2012-01-01

    The oxidative lesion 8-oxoguanine (8-oxoG) is removed during base excision repair by the 8-oxoguanine DNA glycosylase 1 (Ogg1). This lesion can erroneously pair with adenine, and the excision of this damaged base by Ogg1 enables the insertion of a guanine and prevents DNA mutation. In this report, we identified and characterized Ogg1 from the protozoan parasite Trypanosoma cruzi (TcOgg1), the causative agent of Chagas disease. Like most living organisms, T. cruzi is susceptible to oxidative stress, hence DNA repair is essential for its survival and improvement of infection. We verified that the TcOGG1 gene encodes an 8-oxoG DNA glycosylase by complementing an Ogg1-defective Saccharomyces cerevisiae strain. Heterologous expression of TcOGG1 reestablished the mutation frequency of the yeast mutant ogg1−/− (CD138) to wild type levels. We also demonstrate that the overexpression of TcOGG1 increases T. cruzi sensitivity to hydrogen peroxide (H2O2). Analysis of DNA lesions using quantitative PCR suggests that the increased susceptibility to H2O2 of TcOGG1-overexpressor could be a consequence of uncoupled BER in abasic sites and/or strand breaks generated after TcOgg1 removes 8-oxoG, which are not rapidly repaired by the subsequent BER enzymes. This hypothesis is supported by the observation that TcOGG1-overexpressors have reduced levels of 8-oxoG both in the nucleus and in the parasite mitochondrion. The localization of TcOgg1 was examined in parasite transfected with a TcOgg1-GFP fusion, which confirmed that this enzyme is in both organelles. Taken together, our data indicate that T. cruzi has a functional Ogg1 ortholog that participates in nuclear and mitochondrial BER. PMID:22876325

  2. Functional characterization of 8-oxoguanine DNA glycosylase of Trypanosoma cruzi.

    Carolina Furtado

    Full Text Available The oxidative lesion 8-oxoguanine (8-oxoG is removed during base excision repair by the 8-oxoguanine DNA glycosylase 1 (Ogg1. This lesion can erroneously pair with adenine, and the excision of this damaged base by Ogg1 enables the insertion of a guanine and prevents DNA mutation. In this report, we identified and characterized Ogg1 from the protozoan parasite Trypanosoma cruzi (TcOgg1, the causative agent of Chagas disease. Like most living organisms, T. cruzi is susceptible to oxidative stress, hence DNA repair is essential for its survival and improvement of infection. We verified that the TcOGG1 gene encodes an 8-oxoG DNA glycosylase by complementing an Ogg1-defective Saccharomyces cerevisiae strain. Heterologous expression of TcOGG1 reestablished the mutation frequency of the yeast mutant ogg1(-/- (CD138 to wild type levels. We also demonstrate that the overexpression of TcOGG1 increases T. cruzi sensitivity to hydrogen peroxide (H(2O(2. Analysis of DNA lesions using quantitative PCR suggests that the increased susceptibility to H(2O(2 of TcOGG1-overexpressor could be a consequence of uncoupled BER in abasic sites and/or strand breaks generated after TcOgg1 removes 8-oxoG, which are not rapidly repaired by the subsequent BER enzymes. This hypothesis is supported by the observation that TcOGG1-overexpressors have reduced levels of 8-oxoG both in the nucleus and in the parasite mitochondrion. The localization of TcOgg1 was examined in parasite transfected with a TcOgg1-GFP fusion, which confirmed that this enzyme is in both organelles. Taken together, our data indicate that T. cruzi has a functional Ogg1 ortholog that participates in nuclear and mitochondrial BER.

  3. Synthetic Routes to N-9 Alkylated 8-Oxoguanines; Weak Inhibitors of the Human DNA Glycosylase OGG1

    Tushar R. Mahajan

    2015-09-01

    Full Text Available The human 8-oxoguanine DNA glycosylase OGG1 is involved in base excision repair (BER, one of several DNA repair mechanisms that may counteract the effects of chemo- and radiation therapy for the treatment of cancer. We envisage that potent inhibitors of OGG1 may be found among the 9-alkyl-8-oxoguanines. Thus we explored synthetic routes to 8-oxoguanines and examined these as OGG1 inhibitors. The best reaction sequence started from 6-chloroguanine and involved N-9 alkylation, C-8 bromination, and finally simultaneous hydrolysis of both halides. Bromination before N-alkylation should only be considered when the N-substituent is not compatible with bromination conditions. The 8-oxoguanines were found to be weak inhibitors of OGG1. 6-Chloro-8-oxopurines, byproducts in the hydrolysis of 2,6-halopurines, turned out to be slightly better inhibitors than the corresponding 8-oxoguanines.

  4. Exercise improves import of 8-oxoguanine DNA glycosylase into the mitochondrial matrix of skeletal muscle and enhances the relative activity

    Radak, Zsolt; Atalay, Mustafa; Jakus, Judit; Boldogh, István; Davies, Kelvin; Goto, Sataro

    2008-01-01

    Exercise has been shown to modify the level/activity of the DNA damage repair enzyme 8-oxoguanine-DNA glycosylase (OGG1) in skeletal muscle. We have studied the impact of regular physical training (8 weeks of swimming) and detraining (8 weeks of rest after an 8-week training session) on the activity of OGG1 in the nucleus and mitochondria as well as its targeting to the mitochondrial matrix in skeletal muscle. Neither exercise training nor detraining altered the overall levels of reactive spe...

  5. Triphlorethol-A from Ecklonia cava Up-Regulates the Oxidant Sensitive 8-Oxoguanine DNA Glycosylase 1

    Ki Cheon Kim

    2014-10-01

    Full Text Available This study investigated the protective mechanisms of triphlorethol-A, isolated from Ecklonia cava, against oxidative stress-induced DNA base damage, especially 8-oxoguanine (8-oxoG, in Chinese hamster lung fibroblast V79-4 cells. 8-Oxoguanine DNA glycosylase-1 (OGG1 plays an important role in the removal of 8-oxoG during the cellular response to DNA base damage. Triphlorethol-A significantly decreased the levels of 8-oxoG induced by H2O2, and this correlated with increases in OGG1 mRNA and OGG1 protein levels. Furthermore, siOGG1-transfected cell attenuated the protective effect of triphlorethol-A against H2O2 treatment. Nuclear factor erythroid 2–related factor 2 (Nrf2 is a transcription factor for OGG1, and Nrf2 combines with small Maf proteins in the nucleus to bind to antioxidant response elements (ARE in the upstream promoter region of the OGG1 gene. Triphlorethol-A restored the expression of nuclear Nrf2, small Maf protein, and the Nrf2-Maf complex, all of which were reduced by oxidative stress. Furthermore, triphlorethol-A increased Nrf2 binding to ARE sequences and the resulting OGG1 promoter activity, both of which were also reduced by oxidative stress. The levels of the phosphorylated forms of Akt kinase, downstream of phosphatidylinositol 3-kinase (PI3K, and Erk, which are regulators of OGG1, were sharply decreased by oxidative stress, but these decreases were prevented by triphlorethol-A. Specific PI3K, Akt, and Erk inhibitors abolished the cytoprotective effects of triphlorethol-A, suggesting that OGG1 induction by triphlorethol-A involves the PI3K/Akt and Erk pathways. Taken together, these data indicate that by activating the DNA repair system, triphlorethol-A exerts protective effects against DNA base damage induced by oxidative stress.

  6. Cadmium exposure down-regulates 8-oxoguanine DNA glycosylase expression in rat lung and alveolar epithelial cells

    The current study tested the hypothesis that the pulmonary carcinogenic potential of cadmium (Cd) is related to its ability to inhibit the expression (mRNA and protein) and activity of 8-oxoguanine-DNA glycosylase (OGG1), a base excision repair (BER) enzyme that functions to preferentially excise pre-mutagenic 7,8-dihydro-8-oxoguanine (8-oxoG) from DNA. We demonstrate that a single Cd aerosol exposure of adult male Lewis rats causes time- and dose-dependent down-regulation in the pulmonary levels of rOGG1 mRNA and OGG1 protein, quantified by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) assays and western analyses, respectively. Immunohistochemical studies confirmed that Cd inhalation reduces the relative amount of OGG1 in lungs of exposed animals without altering its over-all distribution within the lung, which appears to be more prominent within the alveolar epithelium. In agreement with our in vivo studies, we show that OGG1 expression is also attenuated in alveolar epithelial cell cultures exposed to CdCl2 either acutely or by repeated passaging in Cd-containing medium. The effects caused by Cd were observed in cells that show no loss in viability, as assessed by colony forming ability, the MTT assay, and propidium iodide membrane permeability studies. Nuclear extracts prepared from Cd-treated cells also exhibit a reduction in the ability to nick a synthetic oligonucleotide containing 8-oxoG. We conclude from these studies that Cd causes suppression of OGG1 in the lung and that this mechanism may, in part, play a role in the Cd carcinogenic process

  7. Mitochondrial-targeted DNA repair enzyme 8-oxoguanine DNA glycosylase 1 protects against ventilator-induced lung injury in intact mice

    Hashizume, Masahiro; Mouner, Marc; Joshua M. Chouteau; Gorodnya, Olena M.; Ruchko, Mykhaylo V.; Potter, Barry J.; Wilson, Glenn L.; Gillespie, Mark N.; Parker, James C.

    2012-01-01

    This study tested the hypothesis that oxidative mitochondrial-targeted DNA (mtDNA) damage triggered ventilator-induced lung injury (VILI). Control mice and mice infused with a fusion protein targeting the DNA repair enzyme, 8-oxoguanine-DNA glycosylase 1 (OGG1) to mitochondria were mechanically ventilated with a range of peak inflation pressures (PIP) for specified durations. In minimal VILI (1 h at 40 cmH2O PIP), lung total extravascular albumin space increased 2.8-fold even though neither l...

  8. Age-dependent changes in 8-oxoguanine-DNA-glycosylase activity is modulated by adaptive responses to physical exercise in human skeletal muscle

    Radak, Zsolt; Bori, Zoltan; Koltai, Erika; Fatouros, Ioannis G.; JAMURTAS, ATHANASIOS Z.; Douroudos, Ioannis I.; Terzis, Gerasimos; Michalis G. Nikolaidis; Chatzinikolaou, Athanasios; Sovatzidis, Apostolos; Kumagai, Shuzo; Naito, Hisahi; Boldogh, Istvan

    2011-01-01

    8-Oxo-7,8 dihydroguanine (8-oxoG) accumulates in the genome over time and is believed to contribute to the development of aging characteristics of skeletal muscle and various aging-related diseases. Here, we show a significantly increased level of intrahelical 8-oxoG and 8-oxoguanine DNA glycosylase (OGG1) expression in aged human skeletal muscle compared to that of young individuals. In response to exercise, the 8-oxoG level was found to be lastingly elevated in sedentary young and old subje...

  9. "Light-up" Sensing of human 8-oxoguanine DNA glycosylase activity by target-induced autocatalytic DNAzyme-generated rolling circle amplification.

    Kong, Xiang-Juan; Wu, Shuang; Cen, Yao; Yu, Ru-Qin; Chu, Xia

    2016-05-15

    Human 8-oxoguanine DNA glycosylase (hOGG1) plays a crucial role in maintaining the genomic integrity of living organisms for its capability of repairing DNA oxidative damage. The expression level of hOGG1 is closely associated with many diseases including various kinds of cancers. In this study, a novel "light-up" sensor based on target-induced formation of 5' phosphorylated probe and autocatalytic DNAzyme-generated rolling circle amplification has been developed for highly sensitive human 8-oxoguanine DNA glycosylase (hOGG1) activity assay. The approach reaches detection limit as low as 0.001U/mL for hOGG1 via scarcely increased background signal and dual signal amplification strategy. To the best of our knowledge, it is one of the most sensitive methods for the detection of base excision repair enzyme. Moreover, the approach shows excellent specificity over other nonspecific enzymes would interfere with the assay and holds great promise for application in real sample analysis. Hence, the proposed method provides a highly sensitive, selective, and desirable hOGG1 sensing platform. PMID:26765532

  10. The levels of 7,8-dihydrodeoxyguanosine (8-oxoG) and 8-oxoguanine DNA glycosylase 1 (OGG1) - A potential diagnostic biomarkers of Alzheimer's disease.

    Sliwinska, Agnieszka; Kwiatkowski, Dominik; Czarny, Piotr; Toma, Monika; Wigner, Paulina; Drzewoski, Jozef; Fabianowska-Majewska, Krystyna; Szemraj, Janusz; Maes, Michael; Galecki, Piotr; Sliwinski, Tomasz

    2016-09-15

    Evidence indicates that oxidative stress contributes to neuronal cell death in Alzheimer's disease (AD). Increased oxidative DNA damage l, as measured with 8-oxoguanine (8-oxoG), and reduced capacity of proteins responsible for removing of DNA damage, including 8-oxoguanine DNA glycosylase 1 (OGG1), were detected in brains of AD patients. In the present study we assessed peripheral blood biomarkers of oxidative DNA damage, i.e. 8- oxoG and OGG1, in AD diagnosis, by comparing their levels between the patients and the controls. Our study was performed on DNA and serum isolated from peripheral blood taken from 100 AD patients and 110 controls. For 8-oxoG ELISA was employed. The OGG1 level was determined using ELISA and Western blot technique. Levels of 8-oxoG were significantly higher in DNA of AD patients. Both ELISA and Western blot showed decreased levels of OGG1 in serum of AD patients. Our results show that oxidative DNA damage biomarkers detected in peripheral tissue could reflect the changes occurring in the brain of patients with AD. These results also suggest that peripheral blood samples may be useful to measure oxidative stress biomarkers in AD. PMID:27538622

  11. Exercise-Induced Neuroprotection of Hippocampus in APP/PS1 Transgenic Mice via Upregulation of Mitochondrial 8-Oxoguanine DNA Glycosylase

    Hai Bo

    2014-01-01

    Full Text Available Improving mitochondrial function has been proposed as a reasonable therapeutic strategy to reduce amyloid-β (Aβ load and to modify the progression of Alzheimer’s disease (AD. However, the relationship between mitochondrial adaptation and brain neuroprotection caused by physical exercise in AD is poorly understood. This study was undertaken to investigate the effects of long-term treadmill exercise on mitochondrial 8-oxoguanine DNA glycosylase-1 (OGG1 level, mtDNA oxidative damage, and mitochondrial function in the hippocampus of APP/PS1 transgenic mouse model of AD. In the present study, twenty weeks of treadmill training significantly improved the cognitive function and reduced the expression of Aβ-42 in APP/PS1 transgenic (Tg mice. Training also ameliorated mitochondrial respiratory function by increasing the complexes I, and IV and ATP synthase activities, whereas it attenuated ROS generation and mtDNA oxidative damage in Tg mice. Furthermore, the impaired mitochondrial antioxidant enzymes and mitochondrial OGG1 activities seen in Tg mice were restored with training. Acetylation level of mitochondrial OGG1 and MnSOD was markedly suppressed in Tg mice after exercise training, in parallel with increased level of SIRT3. These findings suggest that exercise training could increase mtDNA repair capacity in the mouse hippocampus, which in turn would result in protection against AD-related mitochondrial dysfunction and phenotypic deterioration.

  12. Repair of 8-oxodeoxyguanosine lesions in mitochondrial DNA depends on the oxoguanine DNA glycosylase (OGG1) gene and 8- oxoguanine accumulates in the mitochondrial DNA of OGG1- defective mice

    Souza-Pinto, N.C.; Eide, L.; Hogue, B.A.; Frederiksen, Tanja Thybo; Stevnsner, T.; Seeberg, E.; Klungland, A.; Bohr, V.A.

    2001-01-01

    Mitochondria are not only the major site for generation of reactive oxygen species, but also one of the main targets of oxidative damage. One of the major products of DNA oxidation, 8-oxodeoxyguanosine (8-oxodC), accumulates in mitochondrial DNA (mtDNA) at levels three times higher than in nuclea......DNA isolated from liver from OGG1-null mutant animals contained 20-fold more 8-oxodC than mtDNA From wild-type animals....... DNA, The main pathway for the repair of 8-oxodG is the base excision repair pathway initiated by oxoguanine DNA glycosylase (OGG1), We previously demonstrated that mammalian mitochondria from mice efficiently remove 8-oxodG from their genomes and isolated a protein from rat liver mitochondria with 8......-oxoguanine (8- oxodG) DNA glycosylase/apurinic DNA lyase activity. In the present study, we demonstrated that the mitochondrial 8-oxodG DNA glycosylase/apurinic DNA lyase activity is the mitochondrial isoform of OGG1, Using mouse liver mitochondria isolated from ogg1(-/-) mice, we showed that the OGG1 gene...

  13. 8-Oxoguanine DNA glycosylase 1 (ogg1) maintains the function of cardiac progenitor cells during heart formation in zebrafish

    Yan, Lifeng [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China); Zhou, Yong [Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and Shanghai Jiao Tong University School of Medicine, Shanghai 200025 (China); Yu, Shanhe [Shanghai Institute of Hematology, RuiJin Hospital, Shanghai Jiao Tong University, School of Medicine, Shanghai 200025 (China); Ji, Guixiang [Nanjing Institute of Environmental Sciences/Key Laboratory of Pesticide Environmental Assessment and Pollution Control, Ministry of Environmental Protection, Nanjing 210042 (China); Wang, Lei [Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and Shanghai Jiao Tong University School of Medicine, Shanghai 200025 (China); Liu, Wei [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China); Gu, Aihua, E-mail: aihuagu@njmu.edu.cn [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China)

    2013-11-15

    Genomic damage may devastate the potential of progenitor cells and consequently impair early organogenesis. We found that ogg1, a key enzyme initiating the base-excision repair, was enriched in the embryonic heart in zebrafish. So far, little is known about DNA repair in cardiogenesis. Here, we addressed the critical role of ogg1 in cardiogenesis for the first time. ogg1 mainly expressed in the anterior lateral plate mesoderm (ALPM), the primary heart tube, and subsequently the embryonic myocardium by in situ hybridisation. Loss of ogg1 resulted in severe cardiac morphogenesis and functional abnormalities, including the short heart length, arrhythmia, decreased cardiomyocytes and nkx2.5{sup +} cardiac progenitor cells. Moreover, the increased apoptosis and repressed proliferation of progenitor cells caused by ogg1 deficiency might contribute to the heart phenotype. The microarray analysis showed that the expression of genes involved in embryonic heart tube morphogenesis and heart structure were significantly changed due to the lack of ogg1. Among those, foxh1 is an important partner of ogg1 in the cardiac development in response to DNA damage. Our work demonstrates the requirement of ogg1 in cardiac progenitors and heart development in zebrafish. These findings may be helpful for understanding the aetiology of congenital cardiac deficits. - Highlights: • A key DNA repair enzyme ogg1 is expressed in the embryonic heart in zebrafish. • We found that ogg1 is essential for normal cardiac morphogenesis in zebrafish. • The production of embryonic cardiomyocytes requires appropriate ogg1 expression. • Ogg1 critically regulated proliferation of cardiac progenitor cells in zebrafish. • foxh1 is a partner of ogg1 in the cardiac development in response to DNA damage.

  14. 8-Oxoguanine DNA glycosylase 1 (ogg1) maintains the function of cardiac progenitor cells during heart formation in zebrafish

    Genomic damage may devastate the potential of progenitor cells and consequently impair early organogenesis. We found that ogg1, a key enzyme initiating the base-excision repair, was enriched in the embryonic heart in zebrafish. So far, little is known about DNA repair in cardiogenesis. Here, we addressed the critical role of ogg1 in cardiogenesis for the first time. ogg1 mainly expressed in the anterior lateral plate mesoderm (ALPM), the primary heart tube, and subsequently the embryonic myocardium by in situ hybridisation. Loss of ogg1 resulted in severe cardiac morphogenesis and functional abnormalities, including the short heart length, arrhythmia, decreased cardiomyocytes and nkx2.5+ cardiac progenitor cells. Moreover, the increased apoptosis and repressed proliferation of progenitor cells caused by ogg1 deficiency might contribute to the heart phenotype. The microarray analysis showed that the expression of genes involved in embryonic heart tube morphogenesis and heart structure were significantly changed due to the lack of ogg1. Among those, foxh1 is an important partner of ogg1 in the cardiac development in response to DNA damage. Our work demonstrates the requirement of ogg1 in cardiac progenitors and heart development in zebrafish. These findings may be helpful for understanding the aetiology of congenital cardiac deficits. - Highlights: • A key DNA repair enzyme ogg1 is expressed in the embryonic heart in zebrafish. • We found that ogg1 is essential for normal cardiac morphogenesis in zebrafish. • The production of embryonic cardiomyocytes requires appropriate ogg1 expression. • Ogg1 critically regulated proliferation of cardiac progenitor cells in zebrafish. • foxh1 is a partner of ogg1 in the cardiac development in response to DNA damage

  15. Effect of 8-Oxoguanine on DNA Structure and Deformability

    Dršata, Tomáš; Kara, M.; Zacharias, M.; Lankaš, Filip

    2013-01-01

    Roč. 117, č. 39 (2013), s. 11617-11622. ISSN 1520-6106 Institutional support: RVO:61388963 Keywords : molecular-dynamics simulations * B-DNA * glycosylase MutM Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.377, year: 2013

  16. Molecular dynamics simulation of 8-oxoguanine lesioned DNA complexed with repair enzyme hOGG1

    The molecular dynamics (MD) simulations of DNA mutagenic oxidative lesion - 7,8-dihydro-8-oxoguanine (8-oxoG), single and complexed with the repair enzyme - human oxoguanine glycosylase 1 (hOGG1), were performed for 1 nanosecond (ns) in order to determine structural changes at the DNA molecule and to describe a dynamical process of DNA-enzyme complex formation. The molecule of 8-oxoG was inserted into central part of B-DNA 15-mer d(GCGTCCA'8-oxoG'GTCTACC)2 replacing the native guanine 8. In the case of simulation of single DNA molecule the broken hydrogen bonds resulting in locally collapsed B-DNA structure were observed at the lesion site. In addition the adenine on the complementary strand (separated from 8-oxoG by 1 base pair) was flipped-out of the DNA double helix. In the case of simulation of DNA and repair enzyme hOGG1, the DNA-enzyme complex was formed after 500 picoseconds of MD that lasted stable until the simulation was terminated at 1 ns. Proximity of both molecules in complex satisfied the Van der Waals interactions between the closest atoms. The N-terminus of arginine 313 was located close to the phosphodiester bond of nucleotide with 8-oxoG enabling chemical reactions between amino acid and lesion. Phosphodiester bond at C5' of 8-oxoG was at the position close to the N-terminus of arginine 313. The water mediated hydrogen bonds network was formed in each contact area between DNA and enzyme further enhancing the stability of complex. In the background simulation of the identical molecular system with the native DNA, neither the complex nor the water mediated hydrogen bond network were observed. (author)

  17. Nuclear Magnetic Resonance Solution Structure of DNA Featuring Clustered 2'-Deoxyribonolactone and 8-Oxoguanine Lesions.

    Zálešák, Jan; Constant, Jean-François; Jourdan, Muriel

    2016-07-19

    Ionizing radiation, free radicals, and reactive oxygen species produce hundreds of different DNA lesions. Clustered lesions are typical for ionizing radiation. They compromise the efficiency of the base excision repair (BER) pathway, and as a consequence, they are much more toxic and mutagenic than isolated lesions. Despite their biological relevance, e.g., in cancer radiotherapy and accidental exposure, they are not very well studied from a structural point of view, and while insights provided by structural studies contribute to the understanding of the repair process, only three nuclear magnetic resonance (NMR) studies of DNA containing clusters of lesions were reported. Herein, we report the first NMR solution structure of two DNAs containing a bistranded cluster with the 2'-deoxyribonolactone and 8-oxoguanine lesions. Both DNA duplexes feature a 2'-deoxyribonolactone site in the middle of the sequence of one strand and differ by the relative position of the 8-oxoguanine, staggered 3' or 5' side on the complementary strand at a three-nucleotide distance. Depending on its relative position, the repair of the 8-oxoguanine lesion by the base excision repair protein Fpg is either almost complete or inhibited. We found that the structures of the two DNAs containing a bistranded cluster of two lesions are similar and do not deviate very much from the standard B-form. As no obvious structural deformations were observed between the two duplexes, we concluded that the differences in Fpg activity are not due to differences in their global conformation. PMID:27322640

  18. Efficiency, specificity and DNA polymerase-dependence of translesion replication across the oxidative DNA lesion 8-oxoguanine in human cells

    The oxidation product of guanine, 8-oxoguanine, is a major lesion formed in DNA by intracellular metabolism, ionizing radiation, and tobacco smoke. Using a recently developed method for the quantitative analysis of translesion replication, we have studied the bypass of 8-oxoguanine in vivo by transfecting human cells with a gapped plasmid carrying a site-specific 8-oxoguanine in the ssDNA region. The efficiency of bypass in the human large-cell lung carcinoma cell line H1299 was 80%, and it was similar when assayed in the presence of aphidicolin, an inhibitor of DNA polymerases α, δ and ε. A similar extent of bypass was observed also in XP-V cells, defective in pol η, both in the absence and presence of aphidicolin. DNA sequence analysis indicated that the major nucleotide inserted opposite the 8-oxoguanine was the correct nucleotide C, both in H1299 cells (81%) and in XP-V cells (77%). The major mutagenic event was the insertion of an A, both in H1299 and XP-V cells, and it occurred at a frequency of 16-17%, significantly higher than previously reported. Interestingly, the misinsertion frequency of A opposite 8-oxoguanine was decreased in XP-V cells in the presence of aphidicolin, and misinsertion of G was observed. This modulation of the mutagenic specificity at 8-oxoguanine is consistent with the notion that while not essential for the bypass reaction, pol η and pol δ, when present, are involved in bypass of 8-oxoguanine in vivo

  19. Direct visualization of a DNA glycosylase searching for damage.

    Chen, Liwei; Haushalter, Karl A; Lieber, Charles M; Verdine, Gregory L

    2002-03-01

    DNA glycosylases preserve the integrity of genetic information by recognizing damaged bases in the genome and catalyzing their excision. It is unknown how DNA glycosylases locate covalently modified bases hidden in the DNA helix amongst vast numbers of normal bases. Here we employ atomic-force microscopy (AFM) with carbon nanotube probes to image search intermediates of human 8-oxoguanine DNA glycosylase (hOGG1) scanning DNA. We show that hOGG1 interrogates DNA at undamaged sites by inducing drastic kinks. The sharp DNA bending angle of these non-lesion-specific search intermediates closely matches that observed in the specific complex of 8-oxoguanine-containing DNA bound to hOGG1. These findings indicate that hOGG1 actively distorts DNA while searching for damaged bases. PMID:11927259

  20. Computational study of recognition of DNA damages and their repair. 8-oxoguanine oxidative DNA damage with repair enzyme hOGG1

    The molecular dynamics (MD) simulations of DNA mutagenic oxidative lesion - 7,8-dihydro-8-oxoguanine (8-oxoG), single and complexed with the repair enzyme - human oxoguanine glycosylase 1 (hOGG1) were performed for 1 nanosecond (ns) in order to determine structural changes at the DNA molecule and to describe a dynamical process of DNA-enzyme complex formation. The molecule of 8-oxoG was inserted into central part of B-DNA 15-mer d(GCGTCCA'8-oxoG'GTCTACC)2 replacing the native guanine 8. In the case of simulation of single DNA molecule the broken hydrogen bonds resulting in locally collapsed B-DNA structure were observed at the lesion site. In addition the adenine on the complementary strand (separated from 8-oxoG by 1 base pair) was flipped-out of the DNA double helix. In the case of simulation of DNA and repair enzyme hOGG1, the DNA-enzyme complex was formed after 500 picoseconds of MD that lasted stable until the simulation was terminated at 1 ns. The complex was represented by the overlapping Van der Waals surfaces of DNA and enzyme molecules. The N-terminus of arginine 324 was located close to the phosphodiester bond of nucleotide with 8-oxoG enabling chemical reactions between amino acid and lesion. Phosphodiester bond at C5' of 8-oxoG was at the position close to the N-terminus of arginine 324. The water mediated hydrogen bonds network was formed in each contact area between DNA and enzyme further enhancing the stability of complex. In the background simulation of the identical molecular system with the native DNA, neither the complex nor the water mediated hydrogen bond network were observed. (author)

  1. Deletion of Ogg1 DNA glycosylase results in telomere base damage and length alteration in yeast

    LU, Jian; Liu, Yie

    2009-01-01

    Telomeres consist of short guanine-rich repeats. Guanine can be oxidized to 8-oxo-7,8-dihydroguanine (8-oxoG) and 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyG). 8-oxoguanine DNA glycosylase (Ogg1) repairs these oxidative guanine lesions through the base excision repair (BER) pathway. Here we show that in Saccharomyces cerevisiae ablation of Ogg1p leads to an increase in oxidized guanine level in telomeric DNA. The ogg1 deletion (ogg1Δ) strain shows telomere lengthening that is dependent...

  2. The R46Q, R131Q and R154H Polymorphs of Human DNA Glycosylase/β-Lyase hOgg1 Severely Distort the Active Site and DNA Recognition Site but do not Cause Unfolding†

    Anderson, Peter C.; Daggett, Valerie

    2009-01-01

    Reactive oxygen species can cause widespread cellular damage, including base alterations and strand breaks in DNA. An array of DNA-repair enzymes constitutes an essential part of the line of defense that cells use against oxidative damage to the genome. A DNA glycosylase/β-lyase enzyme, Ogg1, scavenges the genome for 8-oxoguanine, a major mutagenic DNA adduct induced by reactive oxygen species, and catalyzes its excision and subsequent cleavage of the DNA phosphate backbone. Several polymorph...

  3. Active DNA Demethylation Mediated by DNA Glycosylases

    Zhu, Jian-Kang

    2009-01-01

    Active DNA demethylation is involved in many vital developmental and physiological processes of plants and animals. Recent genetic and biochemical studies in Arabidopsis have demonstrated that a subfamily of DNA glycosylases function to promote DNA demethylation through a base excision-repair pathway. These specialized bifunctional DNA glycosylases remove the 5-methylcytosine base and then cleave the DNA backbone at the abasic site, resulting in a gap that is then filled with an unmethylated ...

  4. DNA glycosylases: in DNA repair and beyond

    Jacobs, Angelika L.; Schär, Primo

    2011-01-01

    The base excision repair machinery protects DNA in cells from the damaging effects of oxidation, alkylation, and deamination; it is specialized to fix single-base damage in the form of small chemical modifications. Base modifications can be mutagenic and/or cytotoxic, depending on how they interfere with the template function of the DNA during replication and transcription. DNA glycosylases play a key role in the elimination of such DNA lesions; they recognize and excise damaged bases, thereb...

  5. The Hunt for 8-Oxoguanine Deaminase

    Hall, R.; Fedorov, A; Marti-Arbona, R; Fedorov, E; Kolb, P; Sauder, J; Burley, S; Shoichet, B; Almo, S; et. al.

    2010-01-01

    An enzyme from Pseudomonas aeruginosa, Pa0142 (gi|9945972), that is able to catalyze the deamination of 8-oxoguanine (8-oxoG) to uric acid has been identified for the first time. 8-Oxoguanine is formed by the oxidation of guanine residues within DNA by reactive oxygen species, and this lesion results in G:C to T:A transversions. The value of k{sub cat}/K{sub m} for the deamination of 8-oxoG by Pa0142 at pH 8.0 and 30 C is 2.0 x 10{sup 4} M{sup -1} s{sup -1}. This enzyme can also catalyze the deamination of isocystosine and guanine at rates that are approximately an order of magnitude lower. The three-dimensional structure of a homologous enzyme (gi|44264246) from the Sargasso Sea has been determined by X-ray diffraction methods to a resolution of 2.2 {angstrom} (PDB entry ). The enzyme folds as a ({beta}/{alpha}){sub 8} barrel and is a member of the amidohydrolase superfamily with a single zinc in the active site. This enzyme catalyzes the deamination of 8-oxoG with a k{sub cat}/K{sub m} value of 2.7 x 10{sup 5} M{sup -1} s{sup -1}. Computational docking of potential high-energy intermediates for the deamination reaction to the X-ray crystal structure suggests that active-site binding of 8-oxoG is facilitated by hydrogen-bond interactions from a conserved glutamine that follows {beta}-strand 1 with the carbonyl group at C6, a conserved tyrosine that follows {beta}-strand 2 with N7, and a conserved cysteine residue that follows {beta}-strand 4 with the carbonyl group at C8. A bioinformatic analysis of available protein sequences suggests that {approx}200 other bacteria possess an enzyme capable of catalyzing the deamination of 8-oxoG.

  6. Active destabilization of base pairs by a DNA glycosylase wedge initiates damage recognition

    Kuznetsov, Nikita A.; Bergonzo, Christina; Campbell, Arthur J.; Li, Haoquan; Mechetin, Grigory V.; de los Santos, Carlos; Grollman, Arthur P.; Fedorova, Olga S.; Zharkov, Dmitry O.; Simmerling, Carlos

    2015-01-01

    Formamidopyrimidine-DNA glycosylase (Fpg) excises 8-oxoguanine (oxoG) from DNA but ignores normal guanine. We combined molecular dynamics simulation and stopped-flow kinetics with fluorescence detection to track the events in the recognition of oxoG by Fpg and its mutants with a key phenylalanine residue, which intercalates next to the damaged base, changed to either alanine (F110A) or fluorescent reporter tryptophan (F110W). Guanine was sampled by Fpg, as evident from the F110W stopped-flow traces, but less extensively than oxoG. The wedgeless F110A enzyme could bend DNA but failed to proceed further in oxoG recognition. Modeling of the base eversion with energy decomposition suggested that the wedge destabilizes the intrahelical base primarily through buckling both surrounding base pairs. Replacement of oxoG with abasic (AP) site rescued the activity, and calculations suggested that wedge insertion is not required for AP site destabilization and eversion. Our results suggest that Fpg, and possibly other DNA glycosylases, convert part of the binding energy into active destabilization of their substrates, using the energy differences between normal and damaged bases for fast substrate discrimination. PMID:25520195

  7. Involvement of phylogenetically conserved acidic amino acid residues in catalysis by an oxidative DNA damage enzyme formamidopyrimidine glycosylase.

    Lavrukhin, O V; Lloyd, R S

    2000-12-12

    Formamidopyrimidine glycosylase (Fpg) is an important bacterial base excision repair enzyme, which initiates removal of damaged purines such as the highly mutagenic 8-oxoguanine. Similar to other glycosylase/AP lyases, catalysis by Fpg is known to proceed by a nucleophilic attack by an amino group (the secondary amine of its N-terminal proline) on C1' of the deoxyribose sugar at a damaged base, which results in the departure of the base from the DNA and removal of the sugar ring by beta/delta-elimination. However, in contrast to other enzymes in this class, in which acidic amino acids have been shown to be essential for glycosyl and phosphodiester bond scission, the catalytically essential acidic residues have not been documented for Fpg. Multiple sequence alignments of conserved acidic residues in all known bacterial Fpg-like proteins revealed six conserved glutamic and aspartic acid residues. Site-directed mutagenesis was used to change glutamic and aspartic acid residues to glutamines and asparagines, respectively. While the Asp to Asn mutants had no effect on the incision activity on 8-oxoguanine-containing DNA, several of the substitutions at glutamates reduced Fpg activity on the 8-oxoguanosine DNA, with the E3Q and E174Q mutants being essentially devoid of activity. The AP lyase activity of all of the glutamic acid mutants was slightly reduced as compared to the wild-type enzyme. Sodium borohydride trapping of wild-type Fpg and its E3Q and E174Q mutants on 8-oxoguanosine or AP site containing DNA correlated with the relative activity of the mutants on either of these substrates. PMID:11106507

  8. Oxidized dNTPs and the OGG1 and MUTYH DNA glycosylases combine to induce CAG/CTG repeat instability.

    Cilli, Piera; Ventura, Ilenia; Minoprio, Anna; Meccia, Ettore; Martire, Alberto; Wilson, Samuel H; Bignami, Margherita; Mazzei, Filomena

    2016-06-20

    DNA trinucleotide repeat (TNR) expansion underlies several neurodegenerative disorders including Huntington's disease (HD). Accumulation of oxidized DNA bases and their inefficient processing by base excision repair (BER) are among the factors suggested to contribute to TNR expansion. In this study, we have examined whether oxidation of the purine dNTPs in the dNTP pool provides a source of DNA damage that promotes TNR expansion. We demonstrate that during BER of 8-oxoguanine (8-oxodG) in TNR sequences, DNA polymerase β (POL β) can incorporate 8-oxodGMP with the formation of 8-oxodG:C and 8-oxodG:A mispairs. Their processing by the OGG1 and MUTYH DNA glycosylases generates closely spaced incisions on opposite DNA strands that are permissive for TNR expansion. Evidence in HD model R6/2 mice indicates that these DNA glycosylases are present in brain areas affected by neurodegeneration. Consistent with prevailing oxidative stress, the same brain areas contained increased DNA 8-oxodG levels and expression of the p53-inducible ribonucleotide reductase. Our in vitro and in vivo data support a model where an oxidized dNTPs pool together with aberrant BER processing contribute to TNR expansion in non-replicating cells. PMID:26980281

  9. New Family of Deamination Repair Enzymes in Uracil-DNA Glycosylase Superfamily*

    Lee, Hyun-Wook; Dominy, Brian N.; Cao, Weiguo

    2011-01-01

    DNA glycosylases play a major role in the repair of deaminated DNA damage. Previous investigations identified five families within the uracil-DNA glycosylase (UDG) superfamily. All enzymes within the superfamily studied thus far exhibit uracil-DNA glycosylase activity. Here we identify a new class of DNA glycosylases in the UDG superfamily that lacks UDG activity. Instead, these enzymes act as hypoxanthine-DNA glycosylases in vitro and in vivo. Molecular modeling and structure-guided mutation...

  10. Biosynthesis of the human DNA repair enzyme uracil DNA glycosylase

    Anti-human uracil DNA glycosylase monoclonal antibodies have been used to study the in vitro and in vivo biosynthesis of this human base excision repair enzyme. The in vitro translation of poly(A+)uracil DNA glycosylase mRNA was examined by immunoprecipitation of the [35S]methionine-labeled translation products. As identified by sucrose density analysis, immunoreactive in vitro products of 37,000 daltons and 24,000 daltons were translated from 16S poly(A+)RNA and from 11S poly (A+)RNA, respectively. However, only the 37,000 Mr polypeptide could be detected by immunoblot analysis of crude human placental and fibroblast extracts or by immunoprecipitation of [35S] labeled normal human cell extracts. This relative molecular weight correspond to the molecular weight observed for homogeneous human placental uracil DNA glycosylase. A placental mRNA preparation was used to construct a cDNA library in pUC8. Immunological screening identified two recombinant DNA plasmids each containing a 340 base pair insert. Northern blot analysis demonstrated that the insert hybridized to a 16S poly (A+)mRNA. These results suggest that immunoreactive uracil DNA glycosylase protein was synthesized at its enzymatically active molecular weight as the primary translation product of a 16S poly (A+)mRNA

  11. Age and metabolic risk factors associated with oxidatively damaged DNA in human peripheral blood mononuclear cells

    Løhr, Mille; Jensen, Annie; Eriksen, Louise;

    2015-01-01

    18-93 years. DNA damage was analyzed as strand breaks by the comet assay and levels of formamidopyrimidine (FPG-) and human 8-oxoguanine DNA glycosylase 1 (hOGG1)-sensitive sites There was an association between age and levels of FPG-sensitive sites for women, but not for men. The same tendency was...

  12. Sequence-dependent Structural Variation in DNA Undergoing Intrahelical Inspection by the DNA glycosylase MutM

    Sung, Rou-Jia; Zhang, Michael; Qi, Yan; Verdine, Gregory L. (Harvard-Med); (Harvard)

    2012-08-31

    MutM, a bacterial DNA-glycosylase, plays a critical role in maintaining genome integrity by catalyzing glycosidic bond cleavage of 8-oxoguanine (oxoG) lesions to initiate base excision DNA repair. The task faced by MutM of locating rare oxoG residues embedded in an overwhelming excess of undamaged bases is especially challenging given the close structural similarity between oxoG and its normal progenitor, guanine (G). MutM actively interrogates the DNA to detect the presence of an intrahelical, fully base-paired oxoG, whereupon the enzyme promotes extrusion of the target nucleobase from the DNA duplex and insertion into the extrahelical active site. Recent structural studies have begun to provide the first glimpse into the protein-DNA interactions that enable MutM to distinguish an intrahelical oxoG from G; however, these initial studies left open the important question of how MutM can recognize oxoG residues embedded in 16 different neighboring sequence contexts (considering only the 5'- and 3'-neighboring base pairs). In this study we set out to understand the manner and extent to which intrahelical lesion recognition varies as a function of the 5'-neighbor. Here we report a comprehensive, systematic structural analysis of the effect of the 5'-neighboring base pair on recognition of an intrahelical oxoG lesion. These structures reveal that MutM imposes the same extrusion-prone ('extrudogenic') backbone conformation on the oxoG lesion irrespective of its 5'-neighbor while leaving the rest of the DNA relatively free to adjust to the particular demands of individual sequences.

  13. Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.

    B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1997-01-01

    textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA glyc

  14. Targeted deletion of the genes encoding NTH1 and NEIL1 DNA N-glycosylases reveals the existence of novel carcinogenic oxidative damage to DNA☆

    Chan, Michael K.; Ocampo-Hafalla, Maria T.; Vartanian, Vladimir; Jaruga, Pawel; Kirkali, Güldal; Koenig, Karen L.; Brown, Stuart; Lloyd, R. Stephen; Dizdaroglu, Miral; Teebor, George W.

    2016-01-01

    We have generated a strain of mice lacking two DNA N-glycosylases of base excision repair (BER), NTH1 and NEIL1, homologs of bacterial Nth (endonuclease three) and Nei (endonuclease eight). Although these enzymes remove several oxidized bases from DNA, they do not remove the well-known carcinogenic oxidation product of guanine: 7,8-dihydro-8-oxoguanine (8-OH-Gua), which is removed by another DNA N-glycosylase, OGG1. The Nth1−/−Neil1−/− mice developed pulmonary and hepatocellular tumors in much higher incidence than either of the single knockouts, Nth1−/− and Neil1−/−. The pulmonary tumors contained, exclusively, activating GGT→GAT transitions in codon 12 of K-ras of their DNA. Such transitions contrast sharply with the activating GGT→GTT transversions in codon 12 of K-ras of the pathologically similar pulmonary tumors, which arose in mice lacking OGG1 and a second DNA N-glycosylase, MUTY. To characterize the biochemical phenotype of the knockout mice, the content of oxidative DNA base damage was analyzed from three tissues isolated from control, single and double knockout mice. The content of 8-OH-Gua was indistinguishable among all genotypes. In contrast, the content of 4,6-diamino-5-formamidopyrimidine (FapyAde) and 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua) derived from adenine and guanine, respectively, were increased in some but not all tissues of Neil1−/− and Neil1−/−Nth1−/− mice. The high incidence of tumors in our Nth1−/−Neil1−/− mice together with the nature of the activating mutation in the K-ras gene of their pulmonary tumors, reveal for the first time, the existence of mutagenic and carcinogenic oxidative damage to DNA which is not 8-OH-Gua. PMID:19346169

  15. 5-Methylcytosine-DNA glycosylase activity is present in a cloned G/T mismatch DNA glycosylase associated with the chicken embryo DNA demethylation complex

    Zhu, Bing; Zheng, Yong; Hess, Daniel; Angliker, Herbert; Schwarz, Steffen; Siegmann, Michel; Thiry, Stéphane; Jost, Jean-Pierre

    2000-01-01

    We previously have shown that DNA demethylation by chicken embryo 5-methylcytosine DNA glycosylase (5-MCDG) needs both RNA and proteins. One of these proteins is a RNA helicase. Further peptides were sequenced, and three of them are identical to the mammalian G/T mismatch DNA glycosylase. A 3,233-bp cDNA coding for the chicken homologue of human G/T mismatch DNA glycosylase was isolated and sequenced. The derived amino acid sequence (408 aa) shows 80% identity with the human G/T mismatch DNA ...

  16. Molecular crowding enhances facilitated diffusion of two human DNA glycosylases

    Cravens, Shannen L.; Schonhoft, Joseph D.; Rowland, Meng M.; Rodriguez, Alyssa A.; Anderson, Breeana G.; Stivers, James T.

    2015-01-01

    Intracellular space is at a premium due to the high concentrations of biomolecules and is expected to have a fundamental effect on how large macromolecules move in the cell. Here, we report that crowded solutions promote intramolecular DNA translocation by two human DNA repair glycosylases. The crowding effect increases both the efficiency and average distance of DNA chain translocation by hindering escape of the enzymes to bulk solution. The increased contact time with the DNA chain provides...

  17. Molecular cloning of human uracil-DNA glycosylase, a highly conserved DNA repair enzyme.

    Olsen, L C; Aasland, R; Wittwer, C U; Krokan, H E; Helland, D E

    1989-01-01

    Uracil-DNA glycosylase is the DNA repair enzyme responsible for the removal of uracil from DNA, and it is present in all organisms investigated. Here we report on the cloning and sequencing of a cDNA encoding the human uracil-DNA glycosylase. The sequences of uracil-DNA glycosylases from yeast, Escherichia coli, herpes simplex virus type 1 and 2, and homologous genes from varicella-zoster and Epstein-Barr viruses are known. It is shown in this report that the predicted amino acid sequence of ...

  18. Mitochondrial Targeted Endonuclease III DNA Repair Enzyme Protects against Ventilator Induced Lung Injury in Mice

    Masahiro Hashizume; Marc Mouner; Joshua M. Chouteau; Gorodnya, Olena M.; Ruchko, Mykhaylo V.; Wilson, Glenn L.; Gillespie, Mark N.; Parker, James C.

    2014-01-01

    The mitochondrial targeted DNA repair enzyme, 8-oxoguanine DNA glycosylase 1, was previously reported to protect against mitochondrial DNA (mtDNA) damage and ventilator induced lung injury (VILI). In the present study we determined whether mitochondrial targeted endonuclease III (EndoIII) which cleaves oxidized pyrimidines rather than purines from damaged DNA would also protect the lung. Minimal injury from 1 h ventilation at 40 cmH2O peak inflation pressure (PIP) was reversed by EndoIII pret...

  19. Human polymorphic variants of the NEIL1 DNA glycosylase.

    Roy, Laura M; Jaruga, Pawel; Wood, Thomas G; McCullough, Amanda K; Dizdaroglu, Miral; Lloyd, R Stephen

    2007-05-25

    In mammalian cells, the repair of DNA bases that have been damaged by reactive oxygen species is primarily initiated by a series of DNA glycosylases that include OGG1, NTH1, NEIL1, and NEIL2. To explore the functional significance of NEIL1, we recently reported that neil1 knock-out and heterozygotic mice develop the majority of symptoms of metabolic syndrome (Vartanian, V., Lowell, B., Minko, I. G., Wood, T. G., Ceci, J. D., George, S., Ballinger, S. W., Corless, C. L., McCullough, A. K., and Lloyd, R. S. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 1864-1869). To determine whether this phenotype could be causally related to human disease susceptibility, we have characterized four polymorphic variants of human NEIL1. Although three of the variants (S82C, G83D, and D252N) retained near wild type levels of nicking activity on abasic (AP) site-containing DNA, G83D did not catalyze the wild type beta,delta-elimination reaction but primarily yielded the beta-elimination product. The AP nicking activity of the C136R variant was significantly reduced. Glycosylase nicking activities were measured on both thymine glycol-containing oligonucleotides and gamma-irradiated genomic DNA using gas chromatography/mass spectrometry. Two of the polymorphic variants (S82C and D252N) showed near wild type enzyme specificity and kinetics, whereas G83D was devoid of glycosylase activity. Although insufficient quantities of C136R could be obtained to carry out gas chromatography/mass spectrometry analyses, this variant was also devoid of the ability to incise thymine glycol-containing oligonucleotide, suggesting that it may also be glycosylase-deficient. Extrapolation of these data suggests that individuals who are heterozygous for these inactive variant neil1 alleles may be at increased risk for metabolic syndrome. PMID:17389588

  20. Reactions of the OOH radical with guanine: Mechanisms of formation of 8-oxoguanine and other products

    Kumar, Nagendra; Shukla, P. K.; Mishra, P. C.

    2010-09-01

    The mutagenic product 8-oxoguanine (8-oxoGua) is formed due to intermediacy of peroxyl (OOR) radicals in lipid peroxidation and protein oxidation-induced DNA damage. The mechanisms of these reactions are not yet understood properly. Therefore, in the present study, the mechanisms of formation of 8-oxoGua and other related products due to the reaction of the guanine base of DNA with the hydroperoxyl radical (OOH) were investigated theoretically employing the B3LYP and BHandHLYP hybrid functionals of density functional theory and the polarizable continuum model for solvation. It is found that the reaction of the OOH radical with guanine can occur following seven different mechanisms leading to the formation of various products including 8-oxoGua, its radicals, 5-hydroxy-8-oxoguanine and CO 2. The mechanism that yields 8-oxoGua as an intermediate and 5-hydroxy-8-oxoGua as the final product was found to be energetically most favorable.

  1. Molecular crowding enhances facilitated diffusion of two human DNA glycosylases.

    Cravens, Shannen L; Schonhoft, Joseph D; Rowland, Meng M; Rodriguez, Alyssa A; Anderson, Breeana G; Stivers, James T

    2015-04-30

    Intracellular space is at a premium due to the high concentrations of biomolecules and is expected to have a fundamental effect on how large macromolecules move in the cell. Here, we report that crowded solutions promote intramolecular DNA translocation by two human DNA repair glycosylases. The crowding effect increases both the efficiency and average distance of DNA chain translocation by hindering escape of the enzymes to bulk solution. The increased contact time with the DNA chain provides for redundant damage patrolling within individual DNA chains at the expense of slowing the overall rate of damaged base removal from a population of molecules. The significant biological implication is that a crowded cellular environment could influence the mechanism of damage recognition as much as any property of the enzyme or DNA. PMID:25845592

  2. A DNA glycosylase from human lymphoblasts that releases cis-thymine glycol from oxidized DNA

    An endonuclease (termed the UVX endonuclease) partially purified from cultured human leukemic lymphoblasts (CEM-CCRF line) was previously shown to act specifically on DNA irradiated by ionizing radiation, UV light, or treated with osmium tetroxide. This activity is tightly associated with an endonuclease specific for apurinic /apyrimidinic (AP) sites in DNA, suggesting that the initial attack on the radiation or oxidation induced lesions is by a DNA glycosylase that generates such AP sites. Thymine glycol has been shown to be a product common to γ-irradiated and oxidized DNA and in the present studies the authors have shown that the UVX endonuclease releases free cis-thymine glycol from osmium tetroxide treated DNA. HPLC analysis of the reaction products failed to detect any cis-thymidine glycol or nucleotide material indicating that the activity responsible is truly a DNA glycosylase. This enzyme thus resembles Endonuclease III of E. coli which contains both AP endonuclease and thymine glucol-DNA glycosylase activities

  3. Transcriptional regulation of thymine DNA glycosylase (TDG) by the tumor suppressor protein p53

    da Costa, Nathalia Meireles; Hautefeuille, Agnès; Cros, Marie-Pierre; Melendez, Matias Eliseo; Waters, Timothy; Swann, Peter; Hainaut, Pierre; Pinto, Luis Felipe Ribeiro

    2012-01-01

    Thymine DNA glycosylase (TDG) belongs to the superfamily of uracil DNA glycosylases (UDG) and is the first enzyme in the base-excision repair pathway (BER) that removes thymine from G:T mismatches at CpG sites. This glycosylase activity has also been found to be critical for active demethylation of genes involved in embryonic development. Here we show that wild-type p53 transcriptionally regulates TDG expression. Chromatin immunoprecipitation (ChIP) and luciferase assays indicate that wild-ty...

  4. Linking active DNA demethylation by Thymine DNA Glycosylase with epigenetic regulation of gene expression

    Wirz, Annika

    2014-01-01

    The correct regulation of epigenetic modifications is crucial for cell plasticity and the establishment of cell identity. The underlying molecular mechanisms are not clear, but a role for DNA repair proteins has been implicated in this context, the investigation of which was the overall aim of my PhD thesis. The Thymine DNA Glycosylase (TDG) was described to excise the deamination products of cytosine (C) and 5-methylcytosine (5-mC), thereby initiating base excision repair (BER; Nedderman...

  5. Two DNA glycosylases in Esherichia coli which release primarily 3-methyladenine

    Two enzymes have been partially purified from Escherichia coli and designated 3-methyladenine DNA glycosylases I and II. The apparent molecular weight of glycosylase I is 20,000, and that of II is 27,000. Glycosylase I releases 3-methyladenine (3-MeA) while II releases 3-MeA, 3-methylguanine (3-MeG), 7-methylguanine (7-MeG), and 7-methyladenine (7-MeA). The rate of release of 3-MeA by glycosylase II is 30 times that of 7-MeG. Glycosylase I is missing in mutants tag 1 and tag 2. In crude extracts, the 3-MeA activity of II is approximately 10% of the total 3-MeA activity. A 50% inactivation at 480C required 5 min for I and 65 min for II. The 3-MeA and 7-MeG activities of the glycosylase II preparation could not be separated by isoelectric focusing, by chromatography of DEAE, Sephadex G-100, phosphocellulose, DNA-cellulose, or carboxymethylcellulose, or by heating at 500C

  6. Base excision by thymine DNA glycosylase mediates DNA-directed cytotoxicity of 5-fluorouracil.

    Christophe Kunz

    2009-04-01

    Full Text Available 5-Fluorouracil (5-FU, a chemotherapeutic drug commonly used in cancer treatment, imbalances nucleotide pools, thereby favoring misincorporation of uracil and 5-FU into genomic DNA. The processing of these bases by DNA repair activities was proposed to cause DNA-directed cytotoxicity, but the underlying mechanisms have not been resolved. In this study, we investigated a possible role of thymine DNA glycosylase (TDG, one of four mammalian uracil DNA glycosylases (UDGs, in the cellular response to 5-FU. Using genetic and biochemical tools, we found that inactivation of TDG significantly increases resistance of both mouse and human cancer cells towards 5-FU. We show that excision of DNA-incorporated 5-FU by TDG generates persistent DNA strand breaks, delays S-phase progression, and activates DNA damage signaling, and that the repair of 5-FU-induced DNA strand breaks is more efficient in the absence of TDG. Hence, excision of 5-FU by TDG, but not by other UDGs (UNG2 and SMUG1, prevents efficient downstream processing of the repair intermediate, thereby mediating DNA-directed cytotoxicity. The status of TDG expression in a cancer is therefore likely to determine its response to 5-FU-based chemotherapy.

  7. Microscopic mechanism of DNA damage searching by hOGG1

    Rowland, Meng M.; Schonhoft, Joseph D.; McKibbin, Paige L.; David, Sheila S.; Stivers, James T.

    2014-01-01

    The DNA backbone is often considered a track that allows long-range sliding of DNA repair enzymes in their search for rare damage sites in DNA. A proposed exemplar of DNA sliding is human 8-oxoguanine (oG) DNA glycosylase 1 (hOGG1), which repairs mutagenic oG lesions in DNA. Here we use our high-resolution molecular clock method to show that macroscopic 1D DNA sliding of hOGG1 occurs by microscopic 2D and 3D steps that masquerade as sliding in resolution-limited single-molecule images. Strand...

  8. A novel monofunctional DNA glycosylase activity against thymine glycol in mouse cell nuclei

    Reactive oxygen species continuously oxidize DNA bases and threaten the genetic integrity. Thymine glycol (TG), one of the representative oxidized products, is repaired mainly by base excision repair (BER). In Escherichia coli, endonuclease III (Nth) and endonuclease VIII (Nei) are known to actively remove TG from DNA, and the homologs are well conserved in various organisms. These are bifunctional glycosylases, also associated with apurinic/apyrimidinic (AP) lyase activity. In the present study, a monofunctional TG-DNA glycosylase activity is shown to be one of the predominant nuclear activities present in some mouse tissues. By combining hypertonic extraction and column chromatography, we successfully separated the novel activity from majority of the bifunctional activities. Since it has been reported that mNTH1 may not be a dominant nuclear activity, the monofunctional glycosylase activity, together with mNEIL1, may be the major TG-DNA glycosylases in the mouse nucleus. The optimal reaction conditions for the monofunctional activity were found to be pH 7-8 and 100-150 mM KC1, and the activity was resistant to 20 mM EDTA. High monofunctional activity was detected in the spleen and stomach, while the level was significantly lower in the liver, suggesting that the contribution of the monofunctional activity is variable among organs. (author)

  9. Induction of S.cerevisiae MAG 3-methyladenine DNA glycosylase transcript levels in response to DNA damage.

    J. Chen; Samson, L

    1991-01-01

    We previously showed that the expression of the Saccharomyces cerevisiae MAG 3-methyladenine (3MeA) DNA glycosylase gene, like that of the E. coli alkA 3MeA DNA glycosylase gene, is induced by alkylating agents. Here we show that the MAG induction mechanism differs from that of alkA, at least in part, because MAG mRNA levels are not only induced by alkylating agents but also by UV light and the UV-mimetic agent 4-nitroquinoline-1-oxide. Unlike some other yeast DNA-damage-inducible genes, MAG ...

  10. Trypanosoma cruzi contains a single detectable uracil-DNA glycosylase and repairs uracil exclusively via short patch base excision repair

    Pena Diaz, Javier; Akbari, Mansour; Sundheim, Ottar; Farez-Vidal, M Esther; Andersen, Sonja; Sneve, Ragnhild; Gonzalez-Pacanowska, Dolores; Krokan, Hans E; Slupphaug, Geir

    2004-01-01

    Enzymes involved in genomic maintenance of human parasites are attractive targets for parasite-specific drugs. The parasitic protozoan Trypanosoma cruzi contains at least two enzymes involved in the protection against potentially mutagenic uracil, a deoxyuridine triphosphate nucleotidohydrolase (d......UTPase) and a uracil-DNA glycosylase belonging to the highly conserved UNG-family. Uracil-DNA glycosylase activities excise uracil from DNA and initiate a multistep base-excision repair (BER) pathway to restore the correct nucleotide sequence. Here we report the biochemical characterisation of T.cruzi UNG (Tc......UNG) and its contribution to the total uracil repair activity in T.cruzi. TcUNG is shown to be the major uracil-DNA glycosylase in T.cruzi. The purified recombinant TcUNG exhibits substrate preference for removal of uracil in the order ssU>U:G>U:A, and has no associated thymine-DNA glycosylase activity. T.cruzi...

  11. Cockayne Syndrome group B protein stimulates NEIL2 DNA glycosylase activity

    Aamann, Maria Diget; Hvitby, Christina Poulsen; Popuri, Venkateswarlu;

    2014-01-01

    excision repair and base excision repair. Here, we describe a new interaction partner for CSB, the DNA glycosylase NEIL2. Using both cell extracts and recombinant proteins, CSB and NEIL2 were found to physically interact independently of DNA. We further found that CSB is able to stimulate NEIL2 glycosylase......Cockayne Syndrome is a segmental premature aging syndrome, which can be caused by loss of function of the CSB protein. CSB is essential for genome maintenance and has numerous interaction partners with established roles in different DNA repair pathways including transcription coupled nucleotide...... activity on a 5-hydroxyl uracil lesion in a DNA bubble structure substrate in vitro. A novel 4,6-diamino-5-formamidopyrimidine (FapyA) specific incision activity of NEIL2 was also stimulated by CSB. To further elucidate the biological role of the interaction, immunofluorescence studies were performed...

  12. G-quadruplex DNA structures can interfere with uracil glycosylase activity in vitro.

    Holton, Nate W; Larson, Erik D

    2016-07-01

    Genome sequences that contain tandem repeats of guanine can form stable four-stranded structures known as G-quadruplex, or G4 DNA. While the molecular mechanisms are not fully defined, such guanine-rich loci are prone to mutagenesis and recombination. Various repair pathways function to reduce the potential for genome instability by correcting base damage and replication errors; however, it is not yet fully defined how well these processes function at G4 DNA. One frequent form of base damage occurs from cytidine deamination, resulting in deoxyuracil and UG mismatches. In duplex and single-stranded DNA, uracil bases are recognised and excised by uracil glycosylases. Here, we tested the efficiency of uracil glycosylase activity in vitro on uracil bases located directly adjacent to guanine repeats and G4 DNA. We show that uracil excision by bacterial UDG and human hUNG2 is reduced at uracils positioned directly 5' or 3' of a guanine tetrad. Control reactions using oligonucleotides disrupted for G4 formation or reaction conditions that do not favour G4 formation resulted in full uracil excision activity. Based on these in vitro results, we suggest that folding of guanine-rich DNA into G4 DNA results in a DNA conformation that is resistant to uracil glycosylase-initiated repair and this has the potential to increase the risk of instability at guanine repeats in the genome. PMID:26671821

  13. The oxidative DNA glycosylases of Mycobacterium tuberculosis exhibit different substrate preferences from their Escherichia coli counterparts

    Guo, Yin; Bandaru, Viswanath; Jaruga, Pawel; Zhao, Xiaobei; Burrows, Cynthia J.; Iwai, Shigenori; Dizdaroglu, Miral; Bond, Jeffrey P.; Wallace, Susan S.

    2009-01-01

    The DNA glycosylases that remove oxidized DNA bases fall into two general families: the Fpg/Nei family and the Nth superfamily. Based on protein sequence alignments, we identified four putative Fpg/Nei family members, as well as a putative Nth protein in Mycobacterium tuberculosis H37Rv. All four Fpg/Nei proteins were successfully overexpressed using a bicistronic vector created in our laboratory. The MtuNth protein was also overexpressed in soluble form. The substrate specificities of the pu...

  14. Stimulation of DNA Glycosylase Activities by XPC Protein Complex: Roles of Protein-Protein Interactions

    Yuichiro Shimizu

    2010-01-01

    Full Text Available We showed that XPC complex, which is a DNA damage detector for nucleotide excision repair, stimulates activity of thymine DNA glycosylase (TDG that initiates base excision repair. XPC appeared to facilitate the enzymatic turnover of TDG by promoting displacement from its own product abasic site, although the precise mechanism underlying this stimulation has not been clarified. Here we show that XPC has only marginal effects on the activity of E. coli TDG homolog (EcMUG, which remains bound to the abasic site like human TDG but does not significantly interacts with XPC. On the contrary, XPC significantly stimulates the activities of sumoylated TDG and SMUG1, both of which exhibit quite different enzymatic kinetics from unmodified TDG but interact with XPC. These results point to importance of physical interactions for stimulation of DNA glycosylases by XPC and have implications in the molecular mechanisms underlying mutagenesis and carcinogenesis in XP-C patients.

  15. Uracil-DNA glycosylase-deficient yeast exhibit a mitochondrial mutator phenotype

    Chatterjee, Aditi; Keshav K Singh

    2001-01-01

    Mutations in mitochondrial DNA (mtDNA) have been reported in cancer and are involved in the pathogenesis of many mitochondrial diseases. Uracil-DNA glycosylase, encoded by the UNG1 gene in Saccharomyces cerevisiae, repairs uracil in DNA formed due to deamination of cytosine. Our study demonstrates that inactivation of the UNG1 gene leads to at least a 3-fold increased frequency of mutations in mtDNA compared with the wild-type. Using a Ung1p–green fluorescent protein (GFP) fusion construct, w...

  16. Structure of uracil-DNA glycosylase from Mycobacterium tuberculosis: insights into interactions with ligands

    The molecule of uracil-DNA glycosylase from M. tuberculosis exhibits domain motion on binding to DNA or a proteinaceous inhibitor. The highly conserved DNA-binding region interacts with a citrate ion in the structure. Uracil N-glycosylase (Ung) is the most thoroughly studied of the group of uracil DNA-glycosylase (UDG) enzymes that catalyse the first step in the uracil excision-repair pathway. The overall structure of the enzyme from Mycobacterium tuberculosis is essentially the same as that of the enzyme from other sources. However, differences exist in the N- and C-terminal stretches and some catalytic loops. Comparison with appropriate structures indicate that the two-domain enzyme closes slightly when binding to DNA, while it opens slightly when binding to the proteinaceous inhibitor Ugi. The structural changes in the catalytic loops on complexation reflect the special features of their structure in the mycobacterial protein. A comparative analysis of available sequences of the enzyme from different sources indicates high conservation of amino-acid residues in the catalytic loops. The uracil-binding pocket in the structure is occupied by a citrate ion. The interactions of the citrate ion with the protein mimic those of uracil, in addition to providing insights into other possible interactions that inhibitors could be involved in

  17. EXCISED DAMAGED BASE DETERMINES THE TURNOVER OF HUMAN N-METHYLPURINE-DNA GLYCOSYLASE

    Adhikari, Sanjay; Üren, Aykut; Roy, Rabindra

    2009-01-01

    N-Methylpurine-DNA glycosylase (MPG) initiates base excision repair in DNA by removing a wide variety of alkylated, deaminated, and lipid peroxidation-induced purine adducts. In this study, we tested the role of excised base on MPG’s enzymatic activity. After the reaction, MPG produced two products: free damaged base and AP-site containing DNA. Our results showed that MPG excises 1, N6-ethenoadenine (εA) from εA-containing oligonucleotide (εA-DNA) at a similar or slightly increased efficiency...

  18. Cockayne syndrome group B protein stimulates repair of formamidopyrimidines by NEIL1 DNA glycosylase

    Muftuoglu, Meltem; de Souza-Pinto, Nadja C; Dogan, Arin;

    2009-01-01

    Cockayne syndrome (CS) is a premature aging condition characterized by sensitivity to UV radiation. However, this phenotype does not explain the progressive neurodegeneration in CS patients. It could be due to the hypersensitivity of CSB-deficient cells to oxidative stress. So far most studies on...... for endonuclease VIII-like (NEIL1) DNA glycosylase. Results presented here show that csb(-/-) mice have a higher level of endogenous FapyAde and FapyGua in DNA from brain and kidney than wild type mice as well as higher levels of endogenous FapyAde in genomic DNA and mtDNA from liver. In addition, CSB...

  19. Expression and the Peculiar Enzymatic Behavior of the Trypanosoma cruzi NTH1 DNA Glycosylase

    Ormeño, Fernando; Barrientos, Camila; Ramirez, Santiago; Ponce, Iván; Valenzuela, Lucía; Sepúlveda, Sofía; Bitar, Mainá; Kemmerling, Ulrike; Machado, Carlos Renato; Cabrera, Gonzalo; Galanti, Norbel

    2016-01-01

    Trypanosoma cruzi, the etiological agent of Chagas’ disease, presents three cellular forms (trypomastigotes, epimastigotes and amastigotes), all of which are submitted to oxidative species in its hosts. However, T. cruzi is able to resist oxidative stress suggesting a high efficiency of its DNA repair machinery.The Base Excision Repair (BER) pathway is one of the main DNA repair mechanisms in other eukaryotes and in T. cruzi as well. DNA glycosylases are enzymes involved in the recognition of oxidative DNA damage and in the removal of oxidized bases, constituting the first step of the BER pathway. Here, we describe the presence and activity of TcNTH1, a nuclear T. cruzi DNA glycosylase. Surprisingly, purified recombinant TcNTH1 does not remove the thymine glycol base, but catalyzes the cleavage of a probe showing an AP site. The same activity was found in epimastigote and trypomastigote homogenates suggesting that the BER pathway is not involved in thymine glycol DNA repair. TcNTH1 DNA-binding properties assayed in silico are in agreement with the absence of a thymine glycol removing function of that parasite enzyme. Over expression of TcNTH1 decrease parasite viability when transfected epimastigotes are submitted to a sustained production of H2O2.Therefore, TcNTH1 is the only known NTH1 orthologous unable to eliminate thymine glycol derivatives but that recognizes and cuts an AP site, most probably by a beta-elimination mechanism. We cannot discard that TcNTH1 presents DNA glycosylase activity on other DNA base lesions. Accordingly, a different DNA repair mechanism should be expected leading to eliminate thymine glycol from oxidized parasite DNA. Furthermore, TcNTH1 may play a role in the AP site recognition and processing. PMID:27284968

  20. A 5-methylcytosine DNA glycosylase/lyase demethylates the retrotransposon Tos17 and promotes its transposition in rice

    La, Honggui

    2011-09-06

    DNA 5-methylcytosine (5-meC) is an important epigenetic mark for transcriptional gene silencing in many eukaryotes. In Arabidopsis, 5-meC DNA glycosylase/lyases actively remove 5-meC to counter-act transcriptional gene silencing in a locus-specific manner, and have been suggested to maintain the expression of transposons. However, it is unclear whether plant DNA demethylases can promote the transposition of transposons. Here we report the functional characterization of the DNA glycosylase/lyase DNG701 in rice. DNG701 encodes a large (1,812 amino acid residues) DNA glycosylase domain protein. Recombinant DNG701 protein showed 5-meC DNA glycosylase and lyase activities in vitro. Knockout or knockdown of DNG701 in rice plants led to DNA hypermethylation and reduced expression of the retrotransposon Tos17. Tos17 showed less transposition in calli derived from dng701 knockout mutant seeds compared with that in wild-type calli. Overexpression of DNG701 in both rice calli and transgenic plants substantially reduced DNA methylation levels of Tos17 and enhanced its expression. The overexpression also led to more frequent transposition of Tos17 in calli. Our results demonstrate that rice DNG701 is a 5-meC DNA glycosylase/lyase responsible for the demethylation of Tos17 and this DNA demethylase plays a critical role in promoting Tos17 transposition in rice calli.

  1. Crystal Structure of the Vaccinia Virus Uracil-DNA Glycosylase in Complex with DNA.

    Burmeister, Wim P; Tarbouriech, Nicolas; Fender, Pascal; Contesto-Richefeu, Céline; Peyrefitte, Christophe N; Iseni, Frédéric

    2015-07-17

    Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase catalytic subunit E9 associated with its heterodimeric co-factor A20·D4 required for processive genome synthesis. Although A20 has no known enzymatic activity, D4 is an active uracil-DNA glycosylase (UNG). The presence of a repair enzyme as a component of the viral replication machinery suggests that, for poxviruses, DNA synthesis and base excision repair is coupled. We present the 2.7 Å crystal structure of the complex formed by D4 and the first 50 amino acids of A20 (D4·A201-50) bound to a 10-mer DNA duplex containing an abasic site resulting from the cleavage of a uracil base. Comparison of the viral complex with its human counterpart revealed major divergences in the contacts between protein and DNA and in the enzyme orientation on the DNA. However, the conformation of the dsDNA within both structures is very similar, suggesting a dominant role of the DNA conformation for UNG function. In contrast to human UNG, D4 appears rigid, and we do not observe a conformational change upon DNA binding. We also studied the interaction of D4·A201-50 with different DNA oligomers by surface plasmon resonance. D4 binds weakly to nonspecific DNA and to uracil-containing substrates but binds abasic sites with a Kd of gives new insight into the role of D4 as a co-factor of vaccinia virus DNA polymerase and allows a better understanding of the structural determinants required for UNG action. PMID:26045555

  2. Differential modes of DNA binding by mismatch uracil DNA glycosylase from Escherichia coli: implications for abasic lesion processing and enzyme communication in the base excision repair pathway

    Grippon, Seden; Zhao, Qiyuan; Robinson, Tom; Marshall, Jacqueline J. T.; O’Neill, Rory J.; Manning, Hugh; Kennedy, Gordon; Dunsby, Christopher; Neil, Mark; Halford, Stephen E.; French, Paul M. W.; Baldwin, Geoff S.

    2010-01-01

    Mismatch uracil DNA glycosylase (Mug) from Escherichia coli is an initiating enzyme in the base-excision repair pathway. As with other DNA glycosylases, the abasic product is potentially more harmful than the initial lesion. Since Mug is known to bind its product tightly, inhibiting enzyme turnover, understanding how Mug binds DNA is of significance when considering how Mug interacts with downstream enzymes in the base-excision repair pathway. We have demonstrated differential binding modes o...

  3. Oxidatively damaged DNA in rats exposed by oral gavage to C60 fullerenes and single-walled carbon nanotubes

    Folkmann, Janne K; Risom, Lotte; Jacobsen, Nicklas R;

    2009-01-01

    extent of genotoxicity, whereas corn oil per se generated more genotoxicity than the particles. Although there was increased mRNA expression of 8-oxoguanine DNA glycosylase in the liver of C60 fullerene-treated rats, we found no significant increase in repair activity. CONCLUSIONS: Oral exposure to low...... the initiating event in the development of cancer. OBJECTIVE: In this study we investigated the effect of a single oral administration of C60 fullerenes and SWCNT. METHODS: We measured the level of oxidative damage to DNA as the premutagenic 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) in the colon...

  4. A DNA enzyme with N-glycosylase activity

    Sheppard, Terry L.; Ordoukhanian, Phillip; Joyce, Gerald F.

    2000-01-01

    In vitro evolution was used to develop a DNA enzyme that catalyzes the site-specific depurination of DNA with a catalytic rate enhancement of about 106-fold. The reaction involves hydrolysis of the N-glycosidic bond of a particular deoxyguanosine residue, leading to DNA strand scission at the apurinic site. The DNA enzyme contains 93 nucleotides and is structurally complex. It has an absolute requirement for a divalent metal cation and exhibits optimal activity at about pH 5. The mechanism of...

  5. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [32P]-based oligonucleotide cleavage assay (MPG substrate 5′-CCGCTεAGCGGGTACCGAGCTCGAAT; εA = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 ± 1.67 fmol/μg DNA/h vs 3.47 ± 1.35 fmol/μg DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16–7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  6. Transcriptional regulation of thymine DNA glycosylase (TDG) by the tumor suppressor protein p53.

    da Costa, Nathalia Meireles; Hautefeuille, Agnès; Cros, Marie-Pierre; Melendez, Matias Eliseo; Waters, Timothy; Swann, Peter; Hainaut, Pierre; Pinto, Luis Felipe Ribeiro

    2012-12-15

    Thymine DNA glycosylase (TDG) belongs to the superfamily of uracil DNA glycosylases (UDG) and is the first enzyme in the base-excision repair pathway (BER) that removes thymine from G:T mismatches at CpG sites. This glycosylase activity has also been found to be critical for active demethylation of genes involved in embryonic development. Here we show that wild-type p53 transcriptionally regulates TDG expression. Chromatin immunoprecipitation (ChIP) and luciferase assays indicate that wild-type p53 binds to a domain of TDG promoter containing two p53 consensus response elements (p53RE) and activates its transcription. Next, we have used a panel of cell lines with different p53 status to demonstrate that TDG mRNA and protein expression levels are induced in a p53-dependent manner under different conditions. This panel includes isogenic breast and colorectal cancer cell lines with wild-type or inactive p53, esophageal squamous cell carcinoma cell lines lacking p53 or expressing a temperature-sensitive p53 mutant and normal human bronchial epithelial cells. Induction of TDG mRNA expression is accompanied by accumulation of TDG protein in both nucleus and cytoplasm, with nuclear re-localization occurring upon DNA damage in p53-competent, but not -incompetent, cells. These observations suggest a role for p53 activity in TDG nuclear translocation. Overall, our results show that TDG expression is directly regulated by p53, suggesting that loss of p53 function may affect processes mediated by TDG, thus negatively impacting on genetic and epigenetic stability. PMID:23165212

  7. SPR imaging for label-free multiplexed analyses of DNA N-glycosylase interactions with damaged DNA duplexes

    Base excision repair (BER) is the major mechanism for the correction of damaged nucleobases resulting from the alkylation and oxidation of DNA. The first step in the BER pathway consists of excision of the abnormal base by several specific DNA N-glycosylases. A decrease in BER activity was found to be related to an increased risk of carcinogenesis and aging. To investigate BER activities we set up a new device for DNA repair analysis based on surface plasmon resonance imaging (SPRi). Oligonucleotides bearing an abnormal nucleoside, namely 8-oxo-7,8-dihydro-2'-deoxyguanosine and (5'S)-5',8-cyclo-purine-2'-deoxy-nucleoside, were grafted by a pyrrole electro-copolymerization process on a glass prism coated with a gold layer. The latter label-free DNA sensor chip permits the detection of N-glycosylase/AP-lyase activity as well as the binding of repair proteins to DNA damage without cleavage activity. Thus, the Fapy DNA N-glycosylase (Fpg) protein is shown as expected to bind and then cleave its natural substrate, namely 8-oxo-7,8-dihydro-guanine, together with the resulting abasic site. Using the current SPR imaging-based DNA array we observed an original binding activity of Fpg towards the (5'S)-5',8-cyclod-Adenosine residue. These results altogether show that SPR imaging may be used to simultaneously and specifically detect recognition and excision of several damaged DNA nucleobases, and constitutes an interesting technique to screen inhibitors of DNA repair proteins. (authors)

  8. den V gene of bacteriophage T4 determines a DNA glycosylase specific for pyrimidine dimers in DNA.

    Seawell, P C; Smith, C A; Ganesan, A K

    1980-01-01

    Endonuclease V of bacteriophage T4 has been described as an enzyme, coded for by the denV gene, that incises UV-irradiated DNA. It has recently been proposed that incision of irradiated DNA by this enzyme and the analogous "correndonucleases" I and II of Micrococcus luteus requires the sequential action of a pyrimidine dimer-specific DNA glycosylase and an apyrimidinic/apurinic endonuclease. In support of this two-step mechanism, we found that our preparations of T4 endonuclease V contained a...

  9. Cytosine photoproduct-DNA glycosylase in Escherichia coli and cultured human cells

    Ultraviolet irradiation of DNA produces a variety of pyrimidine base damages. The activities of Escherichia coli endonuclease III and a human lymphoblast endonuclease that incises ultraviolet-irradiated DNA at modified cytosine moieties were compared. Both the bacterial and human enzymes release this cytosine photoproduct as a free base. These glycosylase activities are linear with times of reaction, quantities of enzyme, and irradiation dosages of the substrates. Both enzyme activities are similarly inhibited by the addition of monovalent and divalent cations. Analysis by DNA sequencing identified loci of endonucleolytic incision as cytosines. These are neither cyclobutane pyrimidine dimers, 6-(1,2-dihydro-2-oxo-4-pyrimidinyl)-5-methyl-2,4(1H,3H)-pyrimidinediones, nor apyrimidinic sites. This cytosine photoproduct is separable from unmodified cytosine by high-performance liquid chromatography. This separation should facilitate identification of this modified cytosine and elucidation of its biological significance

  10. Non-productive DNA damage binding by DNA glycosylase-like protein Mag2 from Schizosaccharomyces pombe

    Adhikary, Suraj; Cato, Marilyn C.; McGary, Kris; Rokas, Antonis; Eichman, Brandt F.

    2012-01-01

    Schizosaccharomyces pombe contains two paralogous proteins, Mag1 and Mag2, related to the helix-hairpin-helix (HhH) superfamily of alkylpurine DNA glycosylases from yeast and bacteria. Phylogenetic analysis of related proteins from four Schizosaccharomyces and other fungal species shows that the Mag1/Mag2 duplication is unique to the genus Schizosaccharomyces and most likely occurred in its ancestor. Mag1 excises N3- and N7-alkylguanines and 1,N6-ethenoadenine from DNA, whereas Mag2 has been ...

  11. Repair of Alkylation Damage in Eukaryotic Chromatin Depends on Searching Ability of Alkyladenine DNA Glycosylase.

    Zhang, Yaru; O'Brien, Patrick J

    2015-11-20

    Human alkyladenine DNA glycosylase (AAG) initiates the base excision repair pathway by excising alkylated and deaminated purine lesions. In vitro biochemical experiments demonstrate that AAG uses facilitated diffusion to efficiently search DNA to find rare sites of damage and suggest that electrostatic interactions are critical to the searching process. However, it remains an open question whether DNA searching limits the rate of DNA repair in vivo. We constructed AAG mutants with altered searching ability and measured their ability to protect yeast from alkylation damage in order to address this question. Each of the conserved arginine and lysine residues that are near the DNA binding interface were mutated, and the functional impacts were evaluated using kinetic and thermodynamic analysis. These mutations do not perturb catalysis of N-glycosidic bond cleavage, but they decrease the ability to capture rare lesion sites. Nonspecific and specific DNA binding properties are closely correlated, suggesting that the electrostatic interactions observed in the specific recognition complex are similarly important for DNA searching complexes. The ability of the mutant proteins to complement repair-deficient yeast cells is positively correlated with the ability of the proteins to search DNA in vitro, suggesting that cellular resistance to DNA alkylation is governed by the ability to find and efficiently capture cytotoxic lesions. It appears that chromosomal access is not restricted and toxic sites of alkylation damage are readily accessible to a searching protein. PMID:26317160

  12. Tungsten disulfide nanosheet and exonuclease III co-assisted amplification strategy for highly sensitive fluorescence polarization detection of DNA glycosylase activity

    Herein, we introduced a tungsten disulfide (WS2) nanosheet and exonuclease III (Exo III) co-assisted signal amplification strategy for highly sensitive fluorescent polarization (FP) assay of DNA glycosylase activity. Two DNA glycosylases, uracil-DNA glycosylase (UDG) and human 8-oxoG DNA glycosylase 1 (hOGG1), were tested. A hairpin-structured probe (HP) which contained damaged bases in the stem was used as the substrate. The removal of damaged bases from substrate by DNA glycosylase would lower the melting temperature of HP. The HP was then opened and hybridized with a FAM dye-labeled single strand DNA (DP), generating a duplex with a recessed 3′-terminal of DP. This design facilitated the Exo III-assisted amplification by repeating the hybridization and digestion of DP, liberating numerous FAM fluorophores which could not be adsorbed on WS2 nanosheet. Thus, the final system exhibited a small FP signal. However, in the absence of DNA glycosylases, no hybridization between DP and HP was occurred, hampering the hydrolysis of DP by Exo III. The intact DP was then adsorbed on the surface of WS2 nanosheet that greatly amplified the mass of the labeled-FAM fluorophore, resulting in a large FP value. With the co-assisted amplification strategy, the sensitivity was substantially improved. In addition, this method was applied to detect UDG activity in cell extracts. The study of the inhibition of UDG was also performed. Furthermore, this method is simple in design, easy in implementation, and selective, which holds potential applications in the DNA glycosylase related mechanism research and molecular diagnostics. - Highlights: • A fluorescence polarization strategy for DNA glycosylase activity detection was developed. • The present method was based on WS2 nanosheet and exonuclease III co-assisted signal amplification. • A high sensitivity and desirable selectivity were achieved. • This method provides a promising universal platform for DNA glycosylase activity

  13. Kinetics and binding of the thymine-DNA mismatch glycosylase, Mig-Mth, with mismatch-containing DNA substrates.

    Begley, Thomas J; Haas, Brian J; Morales, Juan C; Kool, Eric T; Cunningham, Richard P

    2003-01-01

    We have examined the removal of thymine residues from T-G mismatches in DNA by the thymine-DNA mismatch glycosylase from Methanobacterium thermoautrophicum (Mig-Mth), within the context of the base excision repair (BER) pathway, to investigate why this glycosylase has such low activity in vitro. Using single-turnover kinetics and steady-state kinetics, we calculated the catalytic and product dissociation rate constants for Mig-Mth, and determined that Mig-Mth is inhibited by product apyrimidinic (AP) sites in DNA. Electrophoretic mobility shift assays (EMSA) provide evidence that the specificity of product binding is dependent upon the base opposite the AP site. The binding of Mig-Mth to DNA containing the non-cleavable substrate analogue difluorotoluene (F) was also analyzed to determine the effect of the opposite base on Mig-Mth binding specificity for substrate-like duplex DNA. The results of these experiments support the idea that opposite strand interactions play roles in determining substrate specificity. Endonuclease IV, which cleaves AP sites in the next step of the BER pathway, was used to analyze the effect of product removal on the overall rate of thymine hydrolysis by Mig-Mth. Our results support the hypothesis that endonuclease IV increases the apparent activity of Mig-Mth significantly under steady-state conditions by preventing reassociation of enzyme to product. PMID:12509271

  14. OGG1 is essential in oxidative stress induced DNA demethylation.

    Zhou, Xiaolong; Zhuang, Ziheng; Wang, Wentao; He, Lingfeng; Wu, Huan; Cao, Yan; Pan, Feiyan; Zhao, Jing; Hu, Zhigang; Sekhar, Chandra; Guo, Zhigang

    2016-09-01

    DNA demethylation is an essential cellular activity to regulate gene expression; however, the mechanism that triggers DNA demethylation remains unknown. Furthermore, DNA demethylation was recently demonstrated to be induced by oxidative stress without a clear molecular mechanism. In this manuscript, we demonstrated that 8-oxoguanine DNA glycosylase-1 (OGG1) is the essential protein involved in oxidative stress-induced DNA demethylation. Oxidative stress induced the formation of 8-oxoguanine (8-oxoG). We found that OGG1, the 8-oxoG binding protein, promotes DNA demethylation by interacting and recruiting TET1 to the 8-oxoG lesion. Downregulation of OGG1 makes cells resistant to oxidative stress-induced DNA demethylation, while over-expression of OGG1 renders cells susceptible to DNA demethylation by oxidative stress. These data not only illustrate the importance of base excision repair (BER) in DNA demethylation but also reveal how the DNA demethylation signal is transferred to downstream DNA demethylation enzymes. PMID:27251462

  15. Oxidative DNA damage and repair in skeletal muscle of humans exposed to high-altitude hypoxia

    Lundby, Carsten; Pilegaard, Henriette; van Hall, Gerrit; Sander, Mikael; Calbet, Jose; Loft, Steffen; Møller, Peter

    Recent research suggests that high-altitude hypoxia may serve as a model for prolonged oxidative stress in healthy humans. In this study, we investigated the consequences of prolonged high-altitude hypoxia on the basal level of oxidative damage to nuclear DNA in muscle cells, a major oxygen...... glycosylase (FPG) protein was unaltered. The expression of 8-oxoguanine DNA glycosylase 1 (OGG1), determined by quantitative RT-PCR of mRNA levels did not significantly change during high-altitude hypoxia, although the data could not exclude a minor upregulation. The expression of heme oxygenase-1 (HO-1) was...... unaltered by prolonged hypoxia, in accordance with the notion that HO-1 is an acute stress response protein. In conclusion, our data indicate high-altitude hypoxia may serve as a good model for oxidative stress and that antioxidant genes are not upregulated in muscle tissue by prolonged hypoxia despite...

  16. The DNA glycosylase AlkD uses a non-base-flipping mechanism to excise bulky lesions

    Mullins, Elwood A.; Shi, Rongxin; Parsons, Zachary D.; Yuen, Philip K.; David, Sheila S.; Igarashi, Yasuhiro; Eichman, Brandt F.

    2015-11-01

    Threats to genomic integrity arising from DNA damage are mitigated by DNA glycosylases, which initiate the base excision repair pathway by locating and excising aberrant nucleobases. How these enzymes find small modifications within the genome is a current area of intensive research. A hallmark of these and other DNA repair enzymes is their use of base flipping to sequester modified nucleotides from the DNA helix and into an active site pocket. Consequently, base flipping is generally regarded as an essential aspect of lesion recognition and a necessary precursor to base excision. Here we present the first, to our knowledge, DNA glycosylase mechanism that does not require base flipping for either binding or catalysis. Using the DNA glycosylase AlkD from Bacillus cereus, we crystallographically monitored excision of an alkylpurine substrate as a function of time, and reconstructed the steps along the reaction coordinate through structures representing substrate, intermediate and product complexes. Instead of directly interacting with the damaged nucleobase, AlkD recognizes aberrant base pairs through interactions with the phosphoribose backbone, while the lesion remains stacked in the DNA duplex. Quantum mechanical calculations revealed that these contacts include catalytic charge-dipole and CH-π interactions that preferentially stabilize the transition state. We show in vitro and in vivo how this unique means of recognition and catalysis enables AlkD to repair large adducts formed by yatakemycin, a member of the duocarmycin family of antimicrobial natural products exploited in bacterial warfare and chemotherapeutic trials. Bulky adducts of this or any type are not excised by DNA glycosylases that use a traditional base-flipping mechanism. Hence, these findings represent a new model for DNA repair and provide insights into catalysis of base excision.

  17. A MATE-family efflux pump rescues the Escherichia coli 8-oxoguanine-repair-deficient mutator phenotype and protects against H(2O(2 killing.

    Javier R Guelfo

    2010-05-01

    Full Text Available Hypermutation may accelerate bacterial evolution in the short-term. In the long-term, however, hypermutators (cells with an increased rate of mutation can be expected to be at a disadvantage due to the accumulation of deleterious mutations. Therefore, in theory, hypermutators are doomed to extinction unless they compensate the elevated mutational burden (deleterious load. Different mechanisms capable of restoring a low mutation rate to hypermutators have been proposed. By choosing an 8-oxoguanine-repair-deficient (GO-deficient Escherichia coli strain as a hypermutator model, we investigated the existence of genes able to rescue the hypermutable phenotype by multicopy suppression. Using an in vivo-generated mini-MudII4042 genomic library and a mutator screen, we obtained chromosomal fragments that decrease the rate of mutation in a mutT-deficient strain. Analysis of a selected clone showed that the expression of NorM is responsible for the decreased mutation rate in 8-oxoguanine-repair-deficient (mutT, mutY, and mutM mutY strains. NorM is a member of the multidrug and toxin extrusion (MATE family of efflux pumps whose role in E. coli cell physiology remains unknown. Our results indicate that NorM may act as a GO-system backup decreasing AT to CG and GC to TA transversions. In addition, the ability of NorM to reduce the level of intracellular reactive oxygen species (ROS in a GO-deficient strain and protect the cell from oxidative stress, including protein carbonylation, suggests that it can extrude specific molecules-byproducts of bacterial metabolism-that oxidize the guanine present in both DNA and nucleotide pools. Altogether, our results indicate that NorM protects the cell from specific ROS when the GO system cannot cope with the damage.

  18. A combinatorial role for MutY and Fpg DNA glycosylases in mutation avoidance in Mycobacterium smegmatis

    Highlights: • We studied the combined role of MutY and Fpg DNA glycosylases in M. smegmatis. • Loss of MutY showed increased sensitivity to oxidative damage. • Loss of MutY together with the Fpg glycosylases showed increased mutation rates. • Our data indicate interplay between these enzymes to control mutagenesis. - Abstract: Hydroxyl radical (·OH) among reactive oxygen species cause damage to nucleobases with thymine being the most susceptible, whilst in contrast, the singlet oxygen (102) targets only guanine bases. The high GC content of mycobacterial genomes predisposes these organisms to oxidative damage of guanine. The exposure of cellular DNA to ·OH and one-electron oxidants results in the formation of two main degradation products, the pro-mutagenic 8-oxo-7,8-dihydroguanine (8-oxoGua) and the cytotoxic 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua). These lesions are repaired through the base excision repair (BER) pathway and we previously, demonstrated a combinatorial role for the mycobacterial Endonuclease III (Nth) and the Nei family of DNA glycosylases in mutagenesis. In addition, the formamidopyrimidine (Fpg/MutM) and MutY DNA glycosylases have also been implicated in mutation avoidance and BER in mycobacteria. In this study, we further investigate the combined role of MutY and the Fpg/Nei DNA glycosylases in Mycobacterium smegmatis and demonstrate that deletion of mutY resulted in enhanced sensitivity to oxidative stress, an effect which was not exacerbated in Δfpg1 Δfpg2 or Δnei1 Δnei2 double mutant backgrounds. However, combinatorial loss of the mutY, fpg1 and fpg2 genes resulted in a significant increase in mutation rates suggesting interplay between these enzymes. Consistent with this, there was a significant increase in C → A mutations with a corresponding change in cell morphology of rifampicin resistant mutants in the Δfpg1 Δfpg2 ΔmutY deletion mutant. In contrast, deletion of mutY together with the nei homologues did

  19. A combinatorial role for MutY and Fpg DNA glycosylases in mutation avoidance in Mycobacterium smegmatis

    Hassim, Farzanah; Papadopoulos, Andrea O.; Kana, Bavesh D.; Gordhan, Bhavna G., E-mail: bhavna.gordhan@nhls.ac.za

    2015-09-15

    Highlights: • We studied the combined role of MutY and Fpg DNA glycosylases in M. smegmatis. • Loss of MutY showed increased sensitivity to oxidative damage. • Loss of MutY together with the Fpg glycosylases showed increased mutation rates. • Our data indicate interplay between these enzymes to control mutagenesis. - Abstract: Hydroxyl radical (·OH) among reactive oxygen species cause damage to nucleobases with thymine being the most susceptible, whilst in contrast, the singlet oxygen ({sup 1}0{sub 2}) targets only guanine bases. The high GC content of mycobacterial genomes predisposes these organisms to oxidative damage of guanine. The exposure of cellular DNA to ·OH and one-electron oxidants results in the formation of two main degradation products, the pro-mutagenic 8-oxo-7,8-dihydroguanine (8-oxoGua) and the cytotoxic 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua). These lesions are repaired through the base excision repair (BER) pathway and we previously, demonstrated a combinatorial role for the mycobacterial Endonuclease III (Nth) and the Nei family of DNA glycosylases in mutagenesis. In addition, the formamidopyrimidine (Fpg/MutM) and MutY DNA glycosylases have also been implicated in mutation avoidance and BER in mycobacteria. In this study, we further investigate the combined role of MutY and the Fpg/Nei DNA glycosylases in Mycobacterium smegmatis and demonstrate that deletion of mutY resulted in enhanced sensitivity to oxidative stress, an effect which was not exacerbated in Δfpg1 Δfpg2 or Δnei1 Δnei2 double mutant backgrounds. However, combinatorial loss of the mutY, fpg1 and fpg2 genes resulted in a significant increase in mutation rates suggesting interplay between these enzymes. Consistent with this, there was a significant increase in C → A mutations with a corresponding change in cell morphology of rifampicin resistant mutants in the Δfpg1 Δfpg2 ΔmutY deletion mutant. In contrast, deletion of mutY together with the nei

  20. Analysis of substrate specificity of Schizosaccharomyces pombe Mag1 alkylpurine DNA glycosylase

    Adhikary, Suraj; Eichman, Brandt F. (Vanderbilt)

    2014-10-02

    DNA glycosylases specialized for the repair of alkylation damage must identify, with fine specificity, a diverse array of subtle modifications within DNA. The current mechanism involves damage sensing through interrogation of the DNA duplex, followed by more specific recognition of the target base inside the active site pocket. To better understand the physical basis for alkylpurine detection, we determined the crystal structure of Schizosaccharomyces pombe Mag1 (spMag1) in complex with DNA and performed a mutational analysis of spMag1 and the close homologue from Saccharomyces cerevisiae (scMag). Despite strong homology, spMag1 and scMag differ in substrate specificity and cellular alkylation sensitivity, although the enzymological basis for their functional differences is unknown. We show that Mag preference for 1,N{sup 6}-ethenoadenine ({var_epsilon}A) is influenced by a minor groove-interrogating residue more than the composition of the nucleobase-binding pocket. Exchanging this residue between Mag proteins swapped their {var_epsilon}A activities, providing evidence that residues outside the extrahelical base-binding pocket have a role in identification of a particular modification in addition to sensing damage.

  1. A germline polymorphism of thymine DNA glycosylase induces genomic instability and cellular transformation.

    Ashley Sjolund

    2014-11-01

    Full Text Available Thymine DNA glycosylase (TDG functions in base excision repair, a DNA repair pathway that acts in a lesion-specific manner to correct individual damaged or altered bases. TDG preferentially catalyzes the removal of thymine and uracil paired with guanine, and is also active on 5-fluorouracil (5-FU paired with adenine or guanine. The rs4135113 single nucleotide polymorphism (SNP of TDG is found in 10% of the global population. This coding SNP results in the alteration of Gly199 to Ser. Gly199 is part of a loop responsible for stabilizing the flipped abasic nucleotide in the active site pocket. Biochemical analyses indicate that G199S exhibits tighter binding to both its substrate and abasic product. The persistent accumulation of abasic sites in cells expressing G199S leads to the induction of double-strand breaks (DSBs. Cells expressing the G199S variant also activate a DNA damage response. When expressed in cells, G199S induces genomic instability and cellular transformation. Together, these results suggest that individuals harboring the G199S variant may have increased risk for developing cancer.

  2. Mutants of the Base Excision Repair Glycosylase, Endonuclease III: DNA Charge Transport as a First Step in Lesion Detection

    Romano, Christine A.; Sontz, Pamela A.; Barton, Jacqueline K.

    2011-01-01

    Endonuclease III (EndoIII) is a base excision repair glycosylase that targets damaged pyrimidines and contains a [4Fe-4S] cluster. We have proposed a model where BER proteins that contain redox-active [4Fe-4S] clusters utilize DNA charge transport (CT) as a first step in the detection of DNA lesions. Here, several mutants of EndoIII were prepared to probe their efficiency of DNA/protein charge transport. Cyclic voltammetry experiments on DNA-modified electrodes show that aromatic residues F30...

  3. 3,N4-ethenocytosine, a highly mutagenic adduct, is a primary substrate for Escherichia coli double-stranded uracil-DNA glycosylase and human mismatch-specific thymine-DNA glycosylase

    Saparbaev, Murat; Laval, Jacques

    1998-01-01

    Exocyclic DNA adducts are generated in cellular DNA by various industrial pollutants such as the carcinogen vinyl chloride and by endogenous products of lipid peroxidation. The etheno derivatives of purine and pyrimidine bases 3,N4-ethenocytosine (ɛC), 1,N6-ethenoadenine (ɛA), N2,3-ethenoguanine, and 1,N2-ethenoguanine cause mutations. The ɛA residues are excised by the human and the Escherichia coli 3-methyladenine-DNA glycosylases (ANPG and AlkA proteins, respectively), but the enzymes repa...

  4. Purification and characterization of a novel UV lesion-specific DNA glycosylase/AP lyase from Bacillus sphaericus.

    Vasquez, D A; Nyaga, S G; Lloyd, R S

    2000-05-31

    The purification and characterization of a pyrimidine dimer-specific glycosylase/AP lyase from Bacillus sphaericus (Bsp-pdg) are reported. Bsp-pdg is highly specific for DNA containing the cis-syn cyclobutane pyrimidine dimer, displaying no detectable activity on oligonucleotides with trans-syn I, trans-syn II, (6-4), or Dewar photoproducts. Like other glycosylase/AP lyases that sequentially cleave the N--glycosyl bond of the 5' pyrimidine of a cyclobutane pyrimidine dimer, and the phosphodiester backbone, this enzyme appears to utilize a primary amine as the attacking nucleophile. The formation of a covalent enzyme-DNA imino intermediate is evidenced by the ability to trap this protein-DNA complex by reduction with sodium borohydride. Also consistent with its AP lyase activity, Bsp-pdg was shown to incise an AP site-containing oligonucleotide, yielding beta- and delta-elimination products. N-terminal amino acid sequence analysis of this 26 kDa protein revealed little amino acid homology to any previously reported protein. This is the first report of a glycosylase/AP lyase enzyme from Bacillus sphaericus that is specific for cis-syn pyrimidine dimers. PMID:10844244

  5. Increase of O6-methylguanine-DNA-methyltransferase and N3-methyladenine glycosylase RNA transcripts in rat hepatoma cells treated with DNA-damaging agents

    A variety of DNA-damaging agents increase the O6-methylguanine-DNA-methyltransferase (transferase) and the N3-methyladenine (3-meAde)-DNA-glycosylase activities in a rat hepatoma cell line (H4 cells). Using two cDNA expressing either the rat 3-meAde-DNA-glycosylase or the transferase, the level of mRNA transcripts was measured by hybridization in H4 cells treated with three different inducing agents, gamma-rays, cis-dichlorodiammine platinum II or N-methyl-9-hydroxy ellipticinium. The two mRNA increased 24 hours after the cell treatments but this enhanced transcription was a transient phenomenon, as it was no longer observed after 96 hours. No significant DNA amplification was detectable in the treated cells

  6. Aag DNA glycosylase promotes alkylation-induced tissue damage mediated by Parp1.

    Jennifer A Calvo

    2013-04-01

    Full Text Available Alkylating agents comprise a major class of front-line cancer chemotherapeutic compounds, and while these agents effectively kill tumor cells, they also damage healthy tissues. Although base excision repair (BER is essential in repairing DNA alkylation damage, under certain conditions, initiation of BER can be detrimental. Here we illustrate that the alkyladenine DNA glycosylase (AAG mediates alkylation-induced tissue damage and whole-animal lethality following exposure to alkylating agents. Aag-dependent tissue damage, as observed in cerebellar granule cells, splenocytes, thymocytes, bone marrow cells, pancreatic β-cells, and retinal photoreceptor cells, was detected in wild-type mice, exacerbated in Aag transgenic mice, and completely suppressed in Aag⁻/⁻ mice. Additional genetic experiments dissected the effects of modulating both BER and Parp1 on alkylation sensitivity in mice and determined that Aag acts upstream of Parp1 in alkylation-induced tissue damage; in fact, cytotoxicity in WT and Aag transgenic mice was abrogated in the absence of Parp1. These results provide in vivo evidence that Aag-initiated BER may play a critical role in determining the side-effects of alkylating agent chemotherapies and that Parp1 plays a crucial role in Aag-mediated tissue damage.

  7. Reaction intermediates in the catalytic mechanism of Escherichia coli MutY DNA glycosylase.

    Manuel, Raymond C; Hitomi, Kenichi; Arvai, Andrew S; House, Paul G; Kurtz, Andrew J; Dodson, M L; McCullough, Amanda K; Tainer, John A; Lloyd, R Stephen

    2004-11-01

    The Escherichia coli adenine DNA glycosylase, MutY, plays an important role in the maintenance of genomic stability by catalyzing the removal of adenine opposite 8-oxo-7,8-dihydroguanine or guanine in duplex DNA. Although the x-ray crystal structure of the catalytic domain of MutY revealed a mechanism for catalysis of the glycosyl bond, it appeared that several opportunistically positioned lysine side chains could participate in a secondary beta-elimination reaction. In this investigation, it is established via site-directed mutagenesis and the determination of a 1.35-A structure of MutY in complex with adenine that the abasic site (apurinic/apyrimidinic) lyase activity is alternatively regulated by two lysines, Lys142 and Lys20. Analyses of the crystallographic structure also suggest a role for Glu161 in the apurinic/apyrimidinic lyase chemistry. The beta-elimination reaction is structurally and chemically uncoupled from the initial glycosyl bond scission, indicating that this reaction occurs as a consequence of active site plasticity and slow dissociation of the product complex. MutY with either the K142A or K20A mutation still catalyzes beta and beta-delta elimination reactions, and both mutants can be trapped as covalent enzyme-DNA intermediates by chemical reduction. The trapping was observed to occur both pre- and post-phosphodiester bond scission, establishing that both of these intermediates have significant half-lives. Thus, the final spectrum of DNA products generated reflects the outcome of a delicate balance of closely related equilibrium constants. PMID:15326180

  8. The DNA glycosylases OGG1 and NEIL3 influence differentiation potential, proliferation, and senescence-associated signs in neural stem cells

    Reis, Amilcar [Linnaeus Center in Developmental Biology for Regenerative Medicine (DBRM), Department of Neuroscience, Karolinska Institutet, SE 17177 Stockholm (Sweden); Hermanson, Ola, E-mail: ola.hermanson@ki.se [Linnaeus Center in Developmental Biology for Regenerative Medicine (DBRM), Department of Neuroscience, Karolinska Institutet, SE 17177 Stockholm (Sweden)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer DNA glycosylases OGG1 and NEIL3 are required for neural stem cell state. Black-Right-Pointing-Pointer No effect on cell viability by OGG1 or NEIL3 knockdown in neural stem cells. Black-Right-Pointing-Pointer OGG1 or NEIL3 RNA knockdown result in decreased proliferation and differentiation. Black-Right-Pointing-Pointer Increased HP1{gamma} immunoreactivity after NEIL3 knockdown suggests premature senescence. -- Abstract: Embryonic neural stem cells (NSCs) exhibit self-renewal and multipotency as intrinsic characteristics that are key parameters for proper brain development. When cells are challenged by oxidative stress agents the resulting DNA lesions are repaired by DNA glycosylases through the base excision repair (BER) pathway as a means to maintain the fidelity of the genome, and thus, proper cellular characteristics. The functional roles for DNA glycosylases in NSCs have however remained largely unexplored. Here we demonstrate that RNA knockdown of the DNA glycosylases OGG1 and NEIL3 decreased NSC differentiation ability and resulted in decreased expression of both neuronal and astrocytic genes after mitogen withdrawal, as well as the stem cell marker Musashi-1. Furthermore, while cell survival remained unaffected, NEIL3 deficient cells displayed decreased cell proliferation rates along with an increase in HP1{gamma} immunoreactivity, a sign of premature senescence. Our results suggest that DNA glycosylases play multiple roles in governing essential neural stem cell characteristics.

  9. Tungsten disulfide nanosheet and exonuclease III co-assisted amplification strategy for highly sensitive fluorescence polarization detection of DNA glycosylase activity

    Zhao, Jingjin; Ma, Yefei [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China); Kong, Rongmei [The Key Laboratory of Life-Organic Analysis, College of Chemistry and Chemical Engineering, Qufu Normal University, Qufu, Shandong 273165 (China); Zhang, Liangliang, E-mail: liangzhang319@163.com [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China); Yang, Wen; Zhao, Shulin [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China)

    2015-08-05

    Herein, we introduced a tungsten disulfide (WS{sub 2}) nanosheet and exonuclease III (Exo III) co-assisted signal amplification strategy for highly sensitive fluorescent polarization (FP) assay of DNA glycosylase activity. Two DNA glycosylases, uracil-DNA glycosylase (UDG) and human 8-oxoG DNA glycosylase 1 (hOGG1), were tested. A hairpin-structured probe (HP) which contained damaged bases in the stem was used as the substrate. The removal of damaged bases from substrate by DNA glycosylase would lower the melting temperature of HP. The HP was then opened and hybridized with a FAM dye-labeled single strand DNA (DP), generating a duplex with a recessed 3′-terminal of DP. This design facilitated the Exo III-assisted amplification by repeating the hybridization and digestion of DP, liberating numerous FAM fluorophores which could not be adsorbed on WS{sub 2} nanosheet. Thus, the final system exhibited a small FP signal. However, in the absence of DNA glycosylases, no hybridization between DP and HP was occurred, hampering the hydrolysis of DP by Exo III. The intact DP was then adsorbed on the surface of WS{sub 2} nanosheet that greatly amplified the mass of the labeled-FAM fluorophore, resulting in a large FP value. With the co-assisted amplification strategy, the sensitivity was substantially improved. In addition, this method was applied to detect UDG activity in cell extracts. The study of the inhibition of UDG was also performed. Furthermore, this method is simple in design, easy in implementation, and selective, which holds potential applications in the DNA glycosylase related mechanism research and molecular diagnostics. - Highlights: • A fluorescence polarization strategy for DNA glycosylase activity detection was developed. • The present method was based on WS{sub 2} nanosheet and exonuclease III co-assisted signal amplification. • A high sensitivity and desirable selectivity were achieved. • This method provides a promising universal platform for DNA

  10. Differential regulation of S-region hypermutation and class-switch recombination by noncanonical functions of uracil DNA glycosylase

    Yousif, Ashraf S.; Stanlie, Andre; Mondal, Samiran; Honjo, Tasuku; Begum, Nasim A.

    2014-01-01

    Uracil DNA glycosylase (UNG) has been known as a critical base excision repair protein required for class switch recombination (CSR) and somatic hypermutation (SHM). On the other hand, its precise function in both CSR and SHM is extremely debatable and elusive. Here, we showed that UNG suppresses S region SHM (s-SHM) by recruiting the faithful DNA repair complex and, in the absence of UNG, the error-prone repair complex that induces s-SHM overrides. Moreover, UNG promotes activation-induced c...

  11. DNA methylation patterns of candidate genes regulated by thymine DNA glycosylase in patients with TP53 germline mutations

    Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results

  12. DNA methylation patterns of candidate genes regulated by thymine DNA glycosylase in patients with TP53 germline mutations

    Fortes, F.P. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Kuasne, H. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Marchi, F.A. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Programa Inter-Institucional em Bioinformtica, Instituto de Matemtica e Estatstica, Universidade So Paulo, So Paulo, SP (Brazil); Miranda, P.M. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Rogatto, S.R. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Achatz, M.I. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Oncogentica, A.C. Camargo Cancer Center, So Paulo, SP (Brazil)

    2015-04-28

    Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results.

  13. DNA methylation patterns of candidate genes regulated by thymine DNA glycosylase in patients with TP53 germline mutations.

    Fortes, F P; Kuasne, H; Marchi, F A; Miranda, P M; Rogatto, S R; Achatz, M I

    2015-07-01

    Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53 mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results. PMID:25945745

  14. DNA methylation patterns of candidate genes regulated by thymine DNA glycosylase in patients with TP53 germline mutations

    F.P. Fortes

    2015-07-01

    Full Text Available Li-Fraumeni syndrome (LFS is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17 in 30 patients with germline TP53 mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results.

  15. Human proteins that specifically bind to 8-oxoguanine-containing RNA and their responses to oxidative stress

    Research highlights: → We performed comprehensive survey for proteins that bind to oxidized RNA. → HNRNPD and HNRNPC proteins were identified as oxidized RNA binding proteins. → Knockdown of HNRNPD/C expression caused increased sensitivity to H2O2. → Amounts of HNRNPD protein rapidly decreased when cells were exposed to H2O2. -- Abstract: Exposure of cells to oxygen radicals damage various biologically important molecules. Among the oxidized bases produced in nucleic acids, 8-oxo-7,8-dihydroguanine (8-oxoguanine) is particularly important since it causes base mispairing. To ensure accurate gene expression, organisms must have a mechanism to discriminate 8-oxoguanine-containing RNA from normal transcripts. We searched for proteins that specifically bind to 8-oxoguanine-containing RNA from human HeLa cell extracts, and the candidate proteins were identified using mass spectrometry. Among the identified candidates, splicing isoform 1 of heterogeneous nuclear ribonucleoprotein D0 (HNRNPD) and splicing isoform C1 of heterogeneous nuclear ribonucleoprotein C1/C2 (HNRNPC) exhibited strong abilities to bind to oxidized RNA. The amount of HNRNPD protein rapidly decreased when cells were exposed to hydrogen peroxide, an agent that enhances oxidative stress. Moreover, the suppression of HNRNPD expression by siRNA caused cells to exhibit an increased sensitivity to hydrogen peroxide. The application of siRNA against HNRNPC also caused an increase in sensitivity to hydrogen peroxide. Since no additive effect was observed with a combined addition of siRNAs for HNRNPD and HNRNPC, we concluded that the two proteins may function in the same mechanism for the accurate gene expression.

  16. Human proteins that specifically bind to 8-oxoguanine-containing RNA and their responses to oxidative stress

    Hayakawa, Hiroshi, E-mail: hiroshi@college.fdcnet.ac.jp [Department of Functional Bioscience and Advanced Science Research Center, Fukuoka Dental College, Fukuoka 814-0193 (Japan); Fujikane, Aya; Ito, Riyoko [Department of Functional Bioscience and Advanced Science Research Center, Fukuoka Dental College, Fukuoka 814-0193 (Japan); Matsumoto, Masaki; Nakayama, Keiichi I. [Department of Molecular and Cellular Biology, Medical Institute of Bioregulation, Kyushu University, Fukuoka 812-8582 (Japan); Sekiguchi, Mutsuo [Department of Functional Bioscience and Advanced Science Research Center, Fukuoka Dental College, Fukuoka 814-0193 (Japan)

    2010-12-10

    Research highlights: {yields} We performed comprehensive survey for proteins that bind to oxidized RNA. {yields} HNRNPD and HNRNPC proteins were identified as oxidized RNA binding proteins. {yields} Knockdown of HNRNPD/C expression caused increased sensitivity to H{sub 2}O{sub 2}. {yields} Amounts of HNRNPD protein rapidly decreased when cells were exposed to H{sub 2}O{sub 2}. -- Abstract: Exposure of cells to oxygen radicals damage various biologically important molecules. Among the oxidized bases produced in nucleic acids, 8-oxo-7,8-dihydroguanine (8-oxoguanine) is particularly important since it causes base mispairing. To ensure accurate gene expression, organisms must have a mechanism to discriminate 8-oxoguanine-containing RNA from normal transcripts. We searched for proteins that specifically bind to 8-oxoguanine-containing RNA from human HeLa cell extracts, and the candidate proteins were identified using mass spectrometry. Among the identified candidates, splicing isoform 1 of heterogeneous nuclear ribonucleoprotein D0 (HNRNPD) and splicing isoform C1 of heterogeneous nuclear ribonucleoprotein C1/C2 (HNRNPC) exhibited strong abilities to bind to oxidized RNA. The amount of HNRNPD protein rapidly decreased when cells were exposed to hydrogen peroxide, an agent that enhances oxidative stress. Moreover, the suppression of HNRNPD expression by siRNA caused cells to exhibit an increased sensitivity to hydrogen peroxide. The application of siRNA against HNRNPC also caused an increase in sensitivity to hydrogen peroxide. Since no additive effect was observed with a combined addition of siRNAs for HNRNPD and HNRNPC, we concluded that the two proteins may function in the same mechanism for the accurate gene expression.

  17. Expansion Mechanisms and Evolutionary History on Genes Encoding DNA Glycosylases and Their Involvement in Stress and Hormone Signaling.

    Jiang, Shu-Ye; Ramachandran, Srinivasan

    2016-01-01

    DNA glycosylases catalyze the release of methylated bases. They play vital roles in the base excision repair pathway and might also function in DNA demethylation. At least three families of DNA glycosylases have been identified, which included 3'-methyladenine DNA glycosylase (MDG) I, MDG II, and HhH-GPD (Helix-hairpin-Helix and Glycine/Proline/aspartate (D)). However, little is known on their genome-wide identification, expansion, and evolutionary history as well as their expression profiling and biological functions. In this study, we have genome-widely identified and evolutionarily characterized these family members. Generally, a genome encodes only one MDG II gene in most of organisms. No MDG I or MDG II gene was detected in green algae. However, HhH-GPD genes were detectable in all available organisms. The ancestor species contain small size of MDG I and HhH-GPD families. These two families were mainly expanded through the whole-genome duplication and segmental duplication. They were evolutionarily conserved and were generally under purifying selection. However, we have detected recent positive selection among the Oryza genus, which might play roles in species divergence. Further investigation showed that expression divergence played important roles in gene survival after expansion. All of these family genes were expressed in most of developmental stages and tissues in rice plants. High ratios of family genes were downregulated by drought and fungus pathogen as well as abscisic acid (ABA) and jasmonic acid (JA) treatments, suggesting a negative regulation in response to drought stress and pathogen infection through ABA- and/or JA-dependent hormone signaling pathway. PMID:27026054

  18. Expansion Mechanisms and Evolutionary History on Genes Encoding DNA Glycosylases and Their Involvement in Stress and Hormone Signaling

    Jiang, Shu-Ye; Ramachandran, Srinivasan

    2016-01-01

    DNA glycosylases catalyze the release of methylated bases. They play vital roles in the base excision repair pathway and might also function in DNA demethylation. At least three families of DNA glycosylases have been identified, which included 3′-methyladenine DNA glycosylase (MDG) I, MDG II, and HhH-GPD (Helix–hairpin–Helix and Glycine/Proline/aspartate (D)). However, little is known on their genome-wide identification, expansion, and evolutionary history as well as their expression profiling and biological functions. In this study, we have genome-widely identified and evolutionarily characterized these family members. Generally, a genome encodes only one MDG II gene in most of organisms. No MDG I or MDG II gene was detected in green algae. However, HhH-GPD genes were detectable in all available organisms. The ancestor species contain small size of MDG I and HhH-GPD families. These two families were mainly expanded through the whole-genome duplication and segmental duplication. They were evolutionarily conserved and were generally under purifying selection. However, we have detected recent positive selection among the Oryza genus, which might play roles in species divergence. Further investigation showed that expression divergence played important roles in gene survival after expansion. All of these family genes were expressed in most of developmental stages and tissues in rice plants. High ratios of family genes were downregulated by drought and fungus pathogen as well as abscisic acid (ABA) and jasmonic acid (JA) treatments, suggesting a negative regulation in response to drought stress and pathogen infection through ABA- and/or JA-dependent hormone signaling pathway. PMID:27026054

  19. DNA oxidation as triggered by H3K9me2 demethylation drives estrogen-induced gene expression.

    Perillo, Bruno; Ombra, Maria Neve; Bertoni, Alessandra; Cuozzo, Concetta; Sacchetti, Silvana; Sasso, Annarita; Chiariotti, Lorenzo; Malorni, Antonio; Abbondanza, Ciro; Avvedimento, Enrico V

    2008-01-11

    Modifications at the N-terminal tails of nucleosomal histones are required for efficient transcription in vivo. We analyzed how H3 histone methylation and demethylation control expression of estrogen-responsive genes and show that a DNA-bound estrogen receptor directs transcription by participating in bending chromatin to contact the RNA polymerase II recruited to the promoter. This process is driven by receptor-targeted demethylation of H3 lysine 9 at both enhancer and promoter sites and is achieved by activation of resident LSD1 demethylase. Localized demethylation produces hydrogen peroxide, which modifies the surrounding DNA and recruits 8-oxoguanine-DNA glycosylase 1 and topoisomeraseIIbeta, triggering chromatin and DNA conformational changes that are essential for estrogen-induced transcription. Our data show a strategy that uses controlled DNA damage and repair to guide productive transcription. PMID:18187655

  20. DNA damage and repair activity after broccoli intake in young healthy smokers

    Riso, Patrizia; Martini, Daniela; Møller, Peter;

    2010-01-01

    compounds, including smokers. The aim of the study was to evaluate the effect of broccoli intake on biomarkers of DNA damage and repair. Twenty-seven young healthy smokers consumed a portion of steamed broccoli (250 g/day) or a control diet for 10 days each within a crossover design with a washout period...... mRNA expression levels of repair and defence enzymes: 8-oxoguanine DNA glycosylase (OGG1), nucleoside diphosphate linked moiety X-type motif 1 (NUDT1) and heme oxygenase 1 (HO-1). After broccoli consumption, the level of oxidised DNA lesions decreased by 41% (95% confidence interval: 10%, 72%) and...... the resistance to H(2)O(2)-induced DNA strand breaks increased by 23% (95% CI: 13%, 34%). Following broccoli intake, a higher protection was observed in subjects with glutathione S-transferase (GST) M1-null genotype. The expression level and activity of repair enzymes was unaltered. In conclusion...

  1. Metal inhibition of human alkylpurine-DNA-N-glycosylase activityin base excision repair

    Wang, Ping; Guliaev, Anton B.; Hang, Bo

    2006-02-28

    Cadmium (Cd{sup 2+}), nickel (Ni{sup 2+}) and cobalt (Co{sup 2+}) are human and/or animal carcinogens. Zinc (Zn{sup 2+}) is not categorized as a carcinogen, and rather an essential element to humans. Metals were recently shown to inhibit DNA repair proteins that use metals for their function and/or structure. Here we report that the divalent ions Cd{sup 2+}, Ni{sup 2+}, and Zn{sup 2+} can inhibit the activity of a recombinant human N-methylpurine-DNA glycosylase (MPG) toward a deoxyoligonucleotide with ethenoadenine (var epsilonA). MPG removes a variety of toxic/mutagenic alkylated bases and does not require metal for its catalytic activity or structural integrity. At concentrations starting from 50 to 1000 {micro}M, both Cd{sup 2+} and Zn{sup 2+} showed metal-dependent inhibition of the MPG catalytic activity. Ni{sup 2+} also inhibited MPG, but to a lesser extent. Such an effect can be reversed with EDTA addition. In contrast, Co{sup 2+} and Mg{sup 2+} did not inhibit the MPG activity in the same dose range. Experiments using HeLa cell-free extracts demonstrated similar patterns of inactivation of the var epsilonA excision activity by the same metals. Binding of MPG to the substrate was not significantly affected by Cd{sup 2+}, Zn{sup 2+}, and Ni{sup 2+} at concentrations that show strong inhibition of the catalytic function, suggesting that the reduced catalytic activity is not due to altered MPG binding affinity to the substrate. Molecular dynamics (MD) simulations with Zn{sup 2+} showed that the MPG active site has a potential binding site for Zn{sup 2+}, formed by several catalytically important and conserved residues. Metal binding to such a site is expected to interfere with the catalytic mechanism of this protein. These data suggest that inhibition of MPG activity may contribute to metal genotoxicity and depressed repair of alkylation damage by metals in vivo.

  2. Sensitive and selective real-time electrochemical monitoring of DNA repair (Presentation Recording)

    Slinker, Jason D.; McWilliams, Marc; Anka, Fadwa; Balkus, Kenneth

    2015-10-01

    Unrepaired DNA damage can lead to mutation, cancer, and death of cells or organisms. However, due to the subtlety of DNA damage, it is difficult to sense the repair of damage products with high selectivity and sensitivity. Here, we show sensitive and selective electrochemical sensing of the repair activity of 8-oxoguanine and uracil glycosylases within DNA monolayers on gold by multiplexed analysis with silicon chips and low-cost electrospun nanofibers. Our approach involves comparing the electrochemical signal of redox probe modified monolayers containing the defect versus the rational control of defect-free monolayers. We find sequence-specific sensitivity thresholds on the order of femtomoles of proteins and dynamic ranges of over two orders of magnitude for each target. For 8-oxoguanine repair, temperature-dependent kinetics are extracted, showing exponential signal loss with time constants of seconds. Electrospun fibers are shown to behave similarly to conventional gold-on-silicon devices, showing the potential of these low-cost devices for sensing applications.

  3. In vivo excision of pyrimidine dimers is mediated by a DNA N-glycosylase in Micrococcus luteus but not in human fibroblasts

    It has been previously shown that Micrococcus luteus possesses a pyrimidine dimer-specific endonuclease which in vitro, functions as both an endonuclease and DNA-glycosylase. To determine if these combined activities function in vivo, the excision products of UV-irradiated M. luteus were isolated and examined. In addition, a procedure was devised to isolate and examine the excision products from UV-irradiated human fibroblasts to determine if an endonuclease/glycosylase activity functions in the excision of UV-induced pyrimidine dimers in human fibroblasts. It was shown that, in vivo, an endonuclease/glycosylase mechanism is utilized extensively in the repair of pyrimidine dimers by M. luteus, but that human fibroblasts do not appear to use this mechanism. (author)

  4. Slow base excision by human alkyladenine DNA glycosylase limits the rate of formation of AP sites and AP endonuclease 1 does not stimulate base excision.

    Maher, Robyn L; Vallur, Aarthy C; Feller, Joyce A; Bloom, Linda B

    2007-01-01

    The base excision repair pathway removes damaged DNA bases and resynthesizes DNA to replace the damage. Human alkyladenine DNA glycosylase (AAG) is one of several damage-specific DNA glycosylases that recognizes and excises damaged DNA bases. AAG removes primarily damaged adenine residues. Human AP endonuclease 1 (APE1) recognizes AP sites produced by DNA glycosylases and incises the phophodiester bond 5' to the damaged site. The repair process is completed by a DNA polymerase and DNA ligase. If not tightly coordinated, base excision repair could generate intermediates that are more deleterious to the cell than the initial DNA damage. The kinetics of AAG-catalyzed excision of two damaged bases, hypoxanthine and 1,N6-ethenoadenine, were measured in the presence and absence of APE1 to investigate the mechanism by which the base excision activity of AAG is coordinated with the AP incision activity of APE1. 1,N6-ethenoadenine is excised significantly slower than hypoxanthine and the rate of excision is not affected by APE1. The excision of hypoxanthine is inhibited to a small degree by accumulated product, and APE1 stimulates multiple turnovers by alleviating product inhibition. These results show that APE1 does not significantly affect the kinetics of base excision by AAG. It is likely that slow excision by AAG limits the rate of AP site formation in vivo such that AP sites are not created faster than can be processed by APE1. PMID:17018265

  5. Opinion: uracil DNA glycosylase (UNG) plays distinct and non-canonical roles in somatic hypermutation and class switch recombination.

    Yousif, Ashraf S; Stanlie, Andre; Begum, Nasim A; Honjo, Tasuku

    2014-10-01

    Activation-induced cytidine deaminase (AID) is essential to class switch recombination (CSR) and somatic hypermutation (SHM). Uracil DNA glycosylase (UNG), a member of the base excision repair complex, is required for CSR. The role of UNG in CSR and SHM is extremely controversial. AID deficiency in mice abolishes both CSR and SHM, while UNG-deficient mice have drastically reduced CSR but augmented SHM raising a possibility of differential functions of UNG in CSR and SHM. Interestingly, UNG has been associated with a CSR-specific repair adapter protein Brd4, which interacts with acetyl histone 4, γH2AX and 53BP1 to promote non-homologous end joining during CSR. A non-canonical scaffold function of UNG, but not the catalytic activity, can be attributed to the recruitment of essential repair proteins associated with the error-free repair during SHM, and the end joining during CSR. PMID:24994819

  6. Novel repair activities of AlkA (3-methyladenine DNA glycosylase II) and endonuclease VIII for xanthine and oxanine, guanine lesions induced by nitric oxide and nitrous acid

    Terato, Hiroaki; Masaoka, Aya; Asagoshi, Kenjiro; Honsho, Akiko; Ohyama, Yoshihiko; Suzuki, Toshinori; Yamada, Masaki; Makino, Keisuke; Yamamoto, Kazuo; Ide, Hiroshi

    2002-01-01

    Nitrosation of guanine in DNA by nitrogen oxides such as nitric oxide (NO) and nitrous acid leads to formation of xanthine (Xan) and oxanine (Oxa), potentially cytotoxic and mutagenic lesions. In the present study, we have examined the repair capacity of DNA N-glycosylases from Escherichia coli for Xan and Oxa. The nicking assay with the defined substrates containing Xan and Oxa revealed that AlkA [in combination with endonuclease (Endo) IV] and Endo VIII recognized Xan in the tested enzymes....

  7. Differential regulation of S-region hypermutation and class-switch recombination by noncanonical functions of uracil DNA glycosylase.

    Yousif, Ashraf S; Stanlie, Andre; Mondal, Samiran; Honjo, Tasuku; Begum, Nasim A

    2014-03-18

    Activation-induced cytidine deaminase (AID) is essential to class-switch recombination (CSR) and somatic hypermutation (SHM) in both V region SHM and S region SHM (s-SHM). Uracil DNA glycosylase (UNG), a member of the base excision repair (BER) complex, is required for CSR. Strikingly, however, UNG deficiency causes augmentation of SHM, suggesting involvement of distinct functions of UNG in SHM and CSR. Here, we show that noncanonical scaffold functions of UNG regulate s-SHM negatively and CSR positively. The s-SHM suppressive function of UNG is attributed to the recruitment of faithful BER components at the cleaved DNA locus, with competition against error-prone polymerases. By contrast, the CSR-promoting function of UNG enhances AID-dependent S-S synapse formation by recruiting p53-binding protein 1 and DNA-dependent protein kinase, catalytic subunit. Several loss-of-catalysis mutants of UNG discriminated CSR-promoting activity from s-SHM suppressive activity. Taken together, the noncanonical function of UNG regulates the steps after AID-induced DNA cleavage: error-prone repair suppression in s-SHM and end-joining promotion in CSR. PMID:24591630

  8. Differential regulation of S-region hypermutation and class-switch recombination by noncanonical functions of uracil DNA glycosylase

    Yousif, Ashraf S.; Stanlie, Andre; Mondal, Samiran; Honjo, Tasuku; Begum, Nasim A.

    2014-01-01

    Activation-induced cytidine deaminase (AID) is essential to class-switch recombination (CSR) and somatic hypermutation (SHM) in both V region SHM and S region SHM (s-SHM). Uracil DNA glycosylase (UNG), a member of the base excision repair (BER) complex, is required for CSR. Strikingly, however, UNG deficiency causes augmentation of SHM, suggesting involvement of distinct functions of UNG in SHM and CSR. Here, we show that noncanonical scaffold functions of UNG regulate s-SHM negatively and CSR positively. The s-SHM suppressive function of UNG is attributed to the recruitment of faithful BER components at the cleaved DNA locus, with competition against error-prone polymerases. By contrast, the CSR-promoting function of UNG enhances AID-dependent S-S synapse formation by recruiting p53-binding protein 1 and DNA-dependent protein kinase, catalytic subunit. Several loss-of-catalysis mutants of UNG discriminated CSR-promoting activity from s-SHM suppressive activity. Taken together, the noncanonical function of UNG regulates the steps after AID-induced DNA cleavage: error-prone repair suppression in s-SHM and end-joining promotion in CSR. PMID:24591630

  9. Sensitive and selective detection of uracil-DNA glycosylase activity with a new pyridinium luminescent switch-on molecular probe.

    Lu, Yu-Jing; Hu, Dong-Ping; Deng, Qiang; Wang, Zheng-Ya; Huang, Bao-Hua; Fang, Yan-Xiong; Zhang, Kun; Wong, Wing-Leung

    2015-09-01

    Uracil-deoxyribonucleic acid glycosylase (UDG) is known to function as an important base-excision repair enzyme and eliminate uracil from DNA molecules to maintain genomic integrity. A new small organic molecule (DID-VP) with interesting structural properties was synthesized as a G-quadruplex selective ligand and was demonstrated to be a sensitive luminescent switch-on probe in a convenient luminescent assay specifically for UDG detection in fetal bovine serum samples under rapid and simple conditions. This newly developed analytical method is based on the UDG enzymatic activity to unwind a duplex DNA substrate, and comprises a G-quadruplex-forming sequence (ON1) and uracil-containing DNA strand (ON2) to generate a remarkable fluorescence signal through the specific interaction of DID-VP with ON1. This luminescent switch-on assay is able to achieve high sensitivity and specificity for UDG over other enzymes. The application range of the present analytical system is found to be 0.05 to 1.00 U mL(-1) UDG with a very low detection limit of 0.005 U mL(-1). The recovery study of UDG in real samples gave a very good performance with 75.05%-102.7% recovery. In addition, an extended application of the assay in screening of UDG inhibitors is demonstrated. A good dose-dependence of the luminescence response with respect to the concentration of UDG inhibitors in samples was observed. PMID:26185800

  10. Accelerated repair and reduced mutagenicity of DNA damage induced by cigarette smoke in human bronchial cells transfected with E.coli formamidopyrimidine DNA glycosylase.

    Mara Foresta

    Full Text Available Cigarette smoke (CS is associated to a number of pathologies including lung cancer. Its mutagenic and carcinogenic effects are partially linked to the presence of reactive oxygen species and polycyclic aromatic hydrocarbons (PAH inducing DNA damage. The bacterial DNA repair enzyme formamidopyrimidine DNA glycosylase (FPG repairs both oxidized bases and different types of bulky DNA adducts. We investigated in vitro whether FPG expression may enhance DNA repair of CS-damaged DNA and counteract the mutagenic effects of CS in human lung cells. NCI-H727 non small cell lung carcinoma cells were transfected with a plasmid vector expressing FPG fused to the Enhanced Green Fluorescent Protein (EGFP. Cells expressing the fusion protein EGFP-FPG displayed accelerated repair of adducts and DNA breaks induced by CS condensate. The mutant frequencies induced by low concentrations of CS condensate to the Na(+K(+-ATPase locus (oua(r were significantly reduced in cells expressing EGFP-FPG. Hence, expression of the bacterial DNA repair protein FPG stably protects human lung cells from the mutagenic effects of CS by improving cells' capacity to repair damaged DNA.

  11. Neil3 DNA Glycosylase in Maintenance and Repair of the Mammalian Brain

    2012-01-01

    The DNA molecule is susceptible to damage induced by cellular metabolites and exogenous DNA damaging agents. Reactive oxygen species (ROS), generated as respiration by-products or arising from inflammatory reactions, are the most abundant endogenous DNA damaging agents and lead to the formation of a number of mutagenic and cytotoxic DNA lesions. To preserve DNA integrity and allow correct transmission of genetic information, several pathways for the repair of such lesions have evolved. Among ...

  12. Pathophysiology of Bronchoconstriction: Role of Oxidatively Damaged DNA Repair

    Bacsi, Attila; Pan, Lang; Ba, Xueqing; Boldogh, Istvan

    2016-01-01

    Purpose of review To provide an overview on the present understanding of roles of oxidative DNA damage repair in cell signaling underlying bronchoconstriction common to, but not restricted to various forms of asthma and chronic obstructive pulmonary disease Recent findings Bronchoconstriction is a tightening of smooth muscle surrounding the bronchi and bronchioles with consequent wheezing and shortness of breath. Key stimuli include air pollutants, viral infections, allergens, thermal and osmotic changes, and shear stress of mucosal epithelium, triggering a wide range of cellular, vascular and neural events. Although activation of nerve fibers, the role of G-proteins, protein kinases and Ca++, and molecular interaction within contracting filaments of muscle are well defined, the overarching mechanisms by which a wide range of stimuli initiate these events are not fully understood. Many, if not all, stimuli increase levels of reactive oxygen species (ROS), which are signaling and oxidatively modifying macromolecules, including DNA. The primary ROS target in DNA is guanine, and 8-oxoguanine is one of the most abundant base lesions. It is repaired by 8-oxoguanine DNA glycosylase1 (OGG1) during base excision repair processes. The product, free 8-oxoG base, is bound by OGG1 with high affinity, and the complex then functions as an activator of small GTPases, triggering pathways for inducing gene expression and contraction of intracellular filaments in mast and smooth muscle cells. Summary Oxidative DNA damage repair-mediated cell activation signaling result in gene expression that “primes” the mucosal epithelium and submucosal tissues to generate mediators of airway smooth muscle contractions. PMID:26694039

  13. Substrate specificity of the Escherichia coli Fpg protein (Formamidopyrimidine - DNA glycosylase): Excision of purine lesions in DNA produced by ionizing radiation or photosensitization

    The authors have investigated the excision of a variety of modified bases from DNA by the Escherichia coli Fpg protein (formamidopyrimidine-DNA glycosylase). DNA used as a substrate was modified either by exposure to ionizing radiation or by photosensitization using visible light in the presence of methylene blue (MB). The technique of gas chromatography/mass spectrometry, which can unambiguously identify and quantitate pyrimidine- and purine-derived lesions in DNA, was used for analysis of hydrolyzed and derivatized DNA samples. Thirteen products resulting from pyrimidines and purines were detected in γ-irradiated DNA, whereas only the formation of 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua) and 8-hydroxyguanine (8-OH-Gua) was observed in visible light/MB-treated DNA. Analysis of γ-irradiated DNA after incubation with the Fpg protein followed by precipitation revealed that the Fpg protein significantly excised 4,6-diamino-5-formamidopyrimidine (FapyAde), FapyGua, and 8-OH-Gua. The excision of a small but detectable amount of 8-hydroxyadenine was also observed. The results suggest that one of the biological roles of the Fpg protein, which is present in bacteria as well as in mammalian cells, is the repair of DNA damage caused by free radicals or by other oxygen-derived species such as singlet oxygen. The Fpg protein appears to be specific for recognition of imidazole ring opened purines and 8-hydroxypurines in DNA and may complement pyrimidine-specific enzymes in repair of DNA damage in vivo

  14. Partial uracil–DNA–glycosylase treatment for screening of ancient DNA

    Rohland, Nadin; Harney, Eadaoin; Mallick, Swapan; Nordenfelt, Susanne; Reich, David

    2015-01-01

    The challenge of sequencing ancient DNA has led to the development of specialized laboratory protocols that have focused on reducing contamination and maximizing the number of molecules that are extracted from ancient remains. Despite the fact that success in ancient DNA studies is typically obtained by screening many samples to identify a promising subset, ancient DNA protocols have not, in general, focused on reducing the time required to screen samples. We present an adaptation of a popula...

  15. DNA glycosylases involved in base excision repair may be associated with cancer risk in BRCA1 and BRCA2 mutation carriers.

    Ana Osorio

    2014-04-01

    Full Text Available Single Nucleotide Polymorphisms (SNPs in genes involved in the DNA Base Excision Repair (BER pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the components of the BER pathway, PARP1 (poly ADP ribose polymerase, and both BRCA1 and BRCA2. In the present study, we have performed a comprehensive analysis of 18 genes involved in BER using a tagging SNP approach in a large series of BRCA1 and BRCA2 mutation carriers. 144 SNPs were analyzed in a two stage study involving 23,463 carriers from the CIMBA consortium (the Consortium of Investigators of Modifiers of BRCA1 and BRCA2. Eleven SNPs showed evidence of association with breast and/or ovarian cancer at p<0.05 in the combined analysis. Four of the five genes for which strongest evidence of association was observed were DNA glycosylases. The strongest evidence was for rs1466785 in the NEIL2 (endonuclease VIII-like 2 gene (HR: 1.09, 95% CI (1.03-1.16, p = 2.7 × 10(-3 for association with breast cancer risk in BRCA2 mutation carriers, and rs2304277 in the OGG1 (8-guanine DNA glycosylase gene, with ovarian cancer risk in BRCA1 mutation carriers (HR: 1.12 95%CI: 1.03-1.21, p = 4.8 × 10(-3. DNA glycosylases involved in the first steps of the BER pathway may be associated with cancer risk in BRCA1/2 mutation carriers and should be more comprehensively studied.

  16. An OGG1 polymorphism is associated with mitochondrial DNA content in pesticide-exposed fruit growers

    Highlights: → Individuals experiencing pesticide exposure had greater mtDNA content. → OGG1 genotype may modulate mtDNA content in pesticide-exposed fruit growers. → No association between MnSOD genotypes and mtDNA content was revealed in this study. -- Abstract: Exposure to pesticides has the capacity to cause mitochondrial dysfunction. An increase mitochondrial DNA (mtDNA) content has also been suggested to relate with DNA damaging agent. In mitochondria, the manganese superoxide dismutase (MnSOD) is a scavenger of reactive oxygen species, and the 8-oxoguanine DNA glycosylase (OGG1) is the major DNA glycosylase for the repair of 8-oxoG lesions. However, the alteration of mtDNA content elicited by pesticide exposure in people with genetic variations in MnSOD or OGG1 has not been investigated. In this study, the mitochondrial to nuclear DNA ratio was quantified in the peripheral blood of 120 fruit growers who experienced pesticide exposure and 106 unexposed controls by real-time quantitative polymerase chain reaction (real-time qPCR). Questionnaires were administered to obtain demographic data and occupational history. The MnSOD and OGG1 genotypes were identified by the PCR based restriction fragment length polymorphism analysis. After adjusting for confounding effects, multiple regression model revealed that subjects experiencing high or low pesticide exposure had a greater mtDNA content than that of controls. The OGG1 Ser-Ser genotype was also associated with an increased mtDNA content. No association between MnSOD genotype and mtDNA content was revealed. Thus, subjects experiencing pesticide exposure had greater mtDNA content and the OGG1 genotype may modulate mtDNA content in pesticide-exposed fruit growers.

  17. Selective inhibition by methoxyamine of the apurinic/apyrimidinic endonuclease activity associated with pyrimidine dimer-DNA glycosylases from Micrococcus luteus and bacteriophage T4

    The UV endonucleases from Micrococcus luteus and bacteriophage T4 possess two catalytic activities specific for the site of cyclobutane pyrimidine dimers in UV-irradiated DNA: a DNA glycosylase that cleaves the 5'-glycosyl bond of the dimerized pyrimidines and an apurinic/apyrimidinic (AP) endonuclease that thereupon incises the phosphodiester bond 3' to the resulting apyrimidinic site. The authors have explored the potential use of methoxyamine, a chemical that reacts at neutral pH with AP sites in DNA, as a selective inhibitor of the AP endonuclease activities residing in the M. luteus and T4 enzymes. The presence of 50 mM methoxyamine during incubation of UV-treated, [3H]thymine-labeled poly(dA) x poly(dT) with either enzyme preparation was found to protect completely the irradiated copolymer from endonucleolytic attack at dimer sites, as assayed by yield of acid-soluble radioactivity. In contrast, the dimer-DNA glycosylase activity of each enzyme remained fully functional, as monitored retrospectively by release of free thymine after either photochemical-(5 kJ/m2, 254 nm) or photoenzymic- (Escherichia coli photolyase plus visible light) induced reversal of pyrimidine dimers in the UV-damaged substrate. The data demonstrate that the inhibition of the strand-incision reaction arises because of chemical modification of the AP sites and is not due to inactivation of the enzyme by methoxyamine. The results, combined with earlier findings for 5'-acting AP endonucleases, strongly suggest that methoxyamine is a highly specific inhibitor of virtually all AP endonucleases, irrespective of their modes of action, and may therefore prove useful in a wide variety of DNA repair studies

  18. Establishment of a non-radioactive cleavage assay to assess the DNA repair capacity towards oxidatively damaged DNA in subcellular and cellular systems and the impact of copper

    Oxidative stress is involved in many diseases, and the search for appropriate biomarkers is one major focus in molecular epidemiology. 8-Oxoguanine (8-oxoG), a potentially mutagenic DNA lesion, is considered to be a sensitive biomarker for oxidative stress. Another approach consists in assessing the repair capacity towards 8-oxoG, mediated predominantly by the human 8-oxoguanine DNA glycosylase 1 (hOGG1). With respect to the latter, during the last few years so-called cleavage assays have been described, investigating the incision of 32P-labelled and 8-oxoG damaged oligonucleotides by cell extracts. Within the present study, a sensitive non-radioactive test system based on a Cy5-labelled oligonucleotide has been established. Sources of incision activity are isolated proteins or extracts prepared from cultured cells and peripheral blood mononuclear cells (PBMC). After comparing different oligonucleotide structures, a hairpin-like structure was selected which was not degraded by cell extracts. Applying this test system the impact of copper on the activity of isolated hOGG1 and on hOGG activity in A549 cells was examined, showing a distinct inhibition of the isolated protein at low copper concentration as compared to a modest inhibition of hOGG activity in cells at beginning cytotoxic concentrations. For investigating PBMC, all reaction conditions, including the amounts of oligonucleotide and cell extract as well as the reaction time have been optimized. The incision activities of PBMC protein extracts obtained from different donors have been investigated, and inter-individual differences have been observed. In summary, the established method is as sensitive and even faster than the radioactive technique, and additionally, offers the advantage of reduced costs and low health risk.

  19. DNA Repair Glycosylases with a [4Fe-4S] Cluster: A Redox Cofactor for DNA-mediated Charge Transport?

    Boal, Amie K.; Yavin, Eylon; Barton, Jacqueline K.

    2007-01-01

    The [4Fe-4S] cluster is ubiquitous to a class of base excision repair enzymes, in organisms ranging from bacteria to man, and was first considered as a structural element, owing to its redox stability under physiological conditions. When studied bound to DNA, two of these repair proteins (MutY and Endonuclease III from Escherichia coli) display DNA-dependent reversible electron transfer with characteristics typical of high potential iron proteins. These results have inspired a reexamination o...

  20. Mechanistic studies of ionizing radiation and oxidative mutagenesis: Genetic effects of a single 8-hydroxyguanine (7-hydro-8-oxoguanine) residue inserted at a unique site in a viral genome

    T4 RNA ligase was used to construct a deoxypentanucleotide containing a single 8-hydroxyguanine (7-hydro-8-oxoguanine; G8-OH) residue, which is one of the putatively mutagenic DNA adducts produced by oxidants and ionizing radiation. The pentamer d(GCTAG8-OH)p was prepared by the ligation of a chemically synthesized acceptor molecule, d(GCTA), to an adducted donor, 8-hydroxy-2'-deoxyguanosine 5',3'-bisphosphate. Following 3'-dephosphorylation, the pentamer was characterized by UV spectroscopy, by high-pressure liquid chromatography, and by gas chromatography-mass spectrometry of the nucleosides released by enzymatic hydrolysis. Both d(GCTAG8-OH) and an unmodified control were 5'-phosphorylated by using [γ-32P]ATP and incorporated covalently by DNA ligase into a five-base gap at a unique NheI restriction site in the otherwise duplex genome of an M13mp19 derivative. The adduct was part of a nonsense codon in a unique restriction site in order to facilitate the identification and selection of mutants generated by the replication of the modified genome in Escherichia coli. Both control and adducted pentamers ligated into the genome at 50% of the maximum theoretical efficiency, and nearly all of the site-specifically adducted products possessed pentanucleotides that were covalently linked at both 5' and 3' termini. Transformation of E. coli strain DL7 with the uniquely modified single-stranded genome resulted in ∼0.5-1.0% of the progeny phase showing the G → T transversion mutation at the original position of G8-OH. The vector containing G8-OH also transformed 50-90% as efficiently as the unmodified control, indicating that the adduct can be both weakly cytotoxic and mutagenic to the phase genome

  1. The Role of Mitochondrial DNA in Mediating Alveolar Epithelial Cell Apoptosis and Pulmonary Fibrosis

    Seok-Jo Kim

    2015-09-01

    Full Text Available Convincing evidence has emerged demonstrating that impairment of mitochondrial function is critically important in regulating alveolar epithelial cell (AEC programmed cell death (apoptosis that may contribute to aging-related lung diseases, such as idiopathic pulmonary fibrosis (IPF and asbestosis (pulmonary fibrosis following asbestos exposure. The mammalian mitochondrial DNA (mtDNA encodes for 13 proteins, including several essential for oxidative phosphorylation. We review the evidence implicating that oxidative stress-induced mtDNA damage promotes AEC apoptosis and pulmonary fibrosis. We focus on the emerging role for AEC mtDNA damage repair by 8-oxoguanine DNA glycosylase (OGG1 and mitochondrial aconitase (ACO-2 in maintaining mtDNA integrity which is important in preventing AEC apoptosis and asbestos-induced pulmonary fibrosis in a murine model. We then review recent studies linking the sirtuin (SIRT family members, especially SIRT3, to mitochondrial integrity and mtDNA damage repair and aging. We present a conceptual model of how SIRTs modulate reactive oxygen species (ROS-driven mitochondrial metabolism that may be important for their tumor suppressor function. The emerging insights into the pathobiology underlying AEC mtDNA damage and apoptosis is suggesting novel therapeutic targets that may prove useful for the management of age-related diseases, including pulmonary fibrosis and lung cancer.

  2. Structural and biophysical analysis of interactions between cod and human uracil-DNA N-glycosylase (UNG) and UNG inhibitor (Ugi)

    Assefa, Netsanet Gizaw [UiT The Arctic University of Norway, 9037 Tromsø (Norway); Niiranen, Laila [UiT The Arctic University of Norway, 9037 Tromsø (Norway); University of Turku, FIN-20014 Turku (Finland); Johnson, Kenneth A.; Leiros, Hanna-Kirsti Schrøder; Smalås, Arne Oskar; Willassen, Nils Peder [UiT The Arctic University of Norway, 9037 Tromsø (Norway); Moe, Elin, E-mail: elin.moe@uit.no [UiT The Arctic University of Norway, 9037 Tromsø (Norway); Universidade Nova de Lisboa, Avenida da Republica (EAN), 2780-157 Oeiras (Portugal)

    2014-08-01

    A structural and biophysical study of the interactions between cod and human uracil-DNA N-glycosylase (UNG) and their inhibitor Ugi is presented. The stronger interaction between cod UNG and Ugi can be explained by a greater positive electrostatic surface potential. Uracil-DNA N-glycosylase from Atlantic cod (cUNG) shows cold-adapted features such as high catalytic efficiency, a low temperature optimum for activity and reduced thermal stability compared with its mesophilic homologue human UNG (hUNG). In order to understand the role of the enzyme–substrate interaction related to the cold-adapted properties, the structure of cUNG in complex with a bacteriophage encoded natural UNG inhibitor (Ugi) has been determined. The interaction has also been analyzed by isothermal titration calorimetry (ITC). The crystal structure of cUNG–Ugi was determined to a resolution of 1.9 Å with eight complexes in the asymmetric unit related through noncrystallographic symmetry. A comparison of the cUNG–Ugi complex with previously determined structures of UNG–Ugi shows that they are very similar, and confirmed the nucleotide-mimicking properties of Ugi. Biophysically, the interaction between cUNG and Ugi is very strong and shows a binding constant (K{sub b}) which is one order of magnitude larger than that for hUNG–Ugi. The binding of both cUNG and hUNG to Ugi was shown to be favoured by both enthalpic and entropic forces; however, the binding of cUNG to Ugi is mainly dominated by enthalpy, while the entropic term is dominant for hUNG. The observed differences in the binding properties may be explained by an overall greater positive electrostatic surface potential in the protein–Ugi interface of cUNG and the slightly more hydrophobic surface of hUNG.

  3. Structural and biophysical analysis of interactions between cod and human uracil-DNA N-glycosylase (UNG) and UNG inhibitor (Ugi)

    A structural and biophysical study of the interactions between cod and human uracil-DNA N-glycosylase (UNG) and their inhibitor Ugi is presented. The stronger interaction between cod UNG and Ugi can be explained by a greater positive electrostatic surface potential. Uracil-DNA N-glycosylase from Atlantic cod (cUNG) shows cold-adapted features such as high catalytic efficiency, a low temperature optimum for activity and reduced thermal stability compared with its mesophilic homologue human UNG (hUNG). In order to understand the role of the enzyme–substrate interaction related to the cold-adapted properties, the structure of cUNG in complex with a bacteriophage encoded natural UNG inhibitor (Ugi) has been determined. The interaction has also been analyzed by isothermal titration calorimetry (ITC). The crystal structure of cUNG–Ugi was determined to a resolution of 1.9 Å with eight complexes in the asymmetric unit related through noncrystallographic symmetry. A comparison of the cUNG–Ugi complex with previously determined structures of UNG–Ugi shows that they are very similar, and confirmed the nucleotide-mimicking properties of Ugi. Biophysically, the interaction between cUNG and Ugi is very strong and shows a binding constant (Kb) which is one order of magnitude larger than that for hUNG–Ugi. The binding of both cUNG and hUNG to Ugi was shown to be favoured by both enthalpic and entropic forces; however, the binding of cUNG to Ugi is mainly dominated by enthalpy, while the entropic term is dominant for hUNG. The observed differences in the binding properties may be explained by an overall greater positive electrostatic surface potential in the protein–Ugi interface of cUNG and the slightly more hydrophobic surface of hUNG

  4. Islet expression of the DNA repair enzyme 8-oxoguanosine DNA glycosylase (Ogg1 in human type 2 diabetes

    Yoon Kun-Ho

    2002-04-01

    Full Text Available Abstract Background It has become increasingly clear that β-cell failure plays a critical role in the pathogenesis of type 2 diabetes. Free-radical mediated β-cell damage has been intensively studied in type 1 diabetes, but not in human type 2 diabetes. Therefore, we studied the protein expression of the DNA repair enzyme Ogg1 in pancreases from type 2 diabetics. Ogg1 was studied because it is the major enzyme involved in repairing 7,8-dihydro-8-oxoguanosine DNA adducts, a lesion previously observed in a rat model of type 2 diabetes. Moreover, in a gene expression screen, Ogg1 was over-expressed in islets from a human type 2 diabetic. Methods Immunofluorescent staining of Ogg1 was performed on pancreatic specimens from healthy controls and patients with diabetes for 2–23 years. The intensity and islet area stained for Ogg1 was evaluated by semi-quantitative scoring. Results Both the intensity and the area of islet Ogg1 staining were significantly increased in islets from the type 2 diabetic subjects compared to the healthy controls. A correlation between increased Ogg1 fluorescent staining intensity and duration of diabetes was also found. Most of the staining observed was cytoplasmic, suggesting that mitochondrial Ogg1 accounts primarily for the increased Ogg1 expression. Conclusion We conclude that oxidative stress related DNA damage may be a novel important factor in the pathogenesis of human type 2 diabetes. An increase of Ogg1 in islet cell mitochondria is consistent with a model in which hyperglycemia and consequent increased β-cell oxidative metabolism lead to DNA damage and the induction of Ogg1 expression.

  5. Mitochondrial Targeted Endonuclease III DNA Repair Enzyme Protects against Ventilator Induced Lung Injury in Mice

    Masahiro Hashizume

    2014-08-01

    Full Text Available The mitochondrial targeted DNA repair enzyme, 8-oxoguanine DNA glycosylase 1, was previously reported to protect against mitochondrial DNA (mtDNA damage and ventilator induced lung injury (VILI. In the present study we determined whether mitochondrial targeted endonuclease III (EndoIII which cleaves oxidized pyrimidines rather than purines from damaged DNA would also protect the lung. Minimal injury from 1 h ventilation at 40 cmH2O peak inflation pressure (PIP was reversed by EndoIII pretreatment. Moderate lung injury due to ventilation for 2 h at 40 cmH2O PIP produced a 25-fold increase in total extravascular albumin space, a 60% increase in W/D weight ratio, and marked increases in MIP-2 and IL-6. Oxidative mtDNA damage and decreases in the total tissue glutathione (GSH and the GSH/GSSH ratio also occurred. All of these indices of injury were attenuated by mitochondrial targeted EndoIII. Massive lung injury caused by 2 h ventilation at 50 cmH2O PIP was not attenuated by EndoIII pretreatment, but all untreated mice died prior to completing the two hour ventilation protocol, whereas all EndoIII-treated mice lived for the duration of ventilation. Thus, mitochondrial targeted DNA repair enzymes were protective against mild and moderate lung damage and they enhanced survival in the most severely injured group.

  6. Mitochondrial Targeted Endonuclease III DNA Repair Enzyme Protects against Ventilator Induced Lung Injury in Mice.

    Hashizume, Masahiro; Mouner, Marc; Chouteau, Joshua M; Gorodnya, Olena M; Ruchko, Mykhaylo V; Wilson, Glenn L; Gillespie, Mark N; Parker, James C

    2014-01-01

    The mitochondrial targeted DNA repair enzyme, 8-oxoguanine DNA glycosylase 1, was previously reported to protect against mitochondrial DNA (mtDNA) damage and ventilator induced lung injury (VILI). In the present study we determined whether mitochondrial targeted endonuclease III (EndoIII) which cleaves oxidized pyrimidines rather than purines from damaged DNA would also protect the lung. Minimal injury from 1 h ventilation at 40 cmH2O peak inflation pressure (PIP) was reversed by EndoIII pretreatment. Moderate lung injury due to ventilation for 2 h at 40 cmH2O PIP produced a 25-fold increase in total extravascular albumin space, a 60% increase in W/D weight ratio, and marked increases in MIP-2 and IL-6. Oxidative mtDNA damage and decreases in the total tissue glutathione (GSH) and the GSH/GSSH ratio also occurred. All of these indices of injury were attenuated by mitochondrial targeted EndoIII. Massive lung injury caused by 2 h ventilation at 50 cmH2O PIP was not attenuated by EndoIII pretreatment, but all untreated mice died prior to completing the two hour ventilation protocol, whereas all EndoIII-treated mice lived for the duration of ventilation. Thus, mitochondrial targeted DNA repair enzymes were protective against mild and moderate lung damage and they enhanced survival in the most severely injured group. PMID:25153040

  7. Research progress of relationship among DNA oxidative damage, its repair enzymes and neoplasms%DNA氧化损伤及其修复酶与肿瘤关系的研究进展

    范国琴

    2015-01-01

    DNA氧化损伤可引起机体功能的改变及疾病的发生.机体可通过多种途径修复DNA氧化损伤,而碱基切除修复(BER)方式是DNA氧化损伤修复最为重要的途径.参与DNA氧化损伤修复的代表酶为8-羟基鸟嘌呤核苷酸酶,即MutT同源酶(MTH)1和8-羟基鸟嘌呤DNA糖苷酶(OGG)1.DNA氧化损伤及其修复酶与肿瘤的发生、肿瘤细胞的生长关系密切.笔者拟就DNA氧化损伤及其修复酶与肿瘤的发生、肿瘤细胞的生长及治疗研究进行综述如下.%DNA oxidative damage can lead to dysfunctions and diseases.There are many pathways to repair DNA oxidative damage and base excision repair (BER) is the most important one.8 oxoguanine nucleotide triphosphatase,also known as MutT homologue (MTH)1,and 8-oxoguanine DNA glycosylase (OGG)I are major repair enzymes,which are closely related with tumorigenesis and growth of tumor cells.This review is about the relationship among tumorigenesis,growth of tumor cells,therapy of neoplasms and DNA oxidative damage and the repair enzymes.

  8. 肿瘤线粒体DNA损伤修复的研究进展%Research progress on mitochondrial DNA damage repair in tumors

    李鹤佳

    2012-01-01

    Mitochondria are organelles in mammalian cells, with the only genetic material outside the nucleus mitochondrial DNA(mtDNA). It supported and participated in many important cellular functions. MtDNA vulnera-bled to a variety of factors and cause damage because of special structures and advancement of genetics. When mtDNA damage happened, some mtDNA repair factors, such as: Mitochondrial transcription factor A, mtDNA poly-merase-γ, 8-oxoguanine DNA glycosylase enzymes take part in the damage repairing. The entire repair process were regulated by related factors.%线粒体是哺乳动物细胞中唯一存在于细胞核外又带有遗传物质线粒体DNA(mtDNA)的细胞器.mtDNA支持和参与诸多重要的细胞功能.mtDNA因其特殊的结构和遗传学地位,易受各种因素的损伤.当损伤发生时,线粒体内的DNA损伤修复因子,诸如线粒体转录因子A、mtDNA聚合酶-γ、8-氧鸟嘌呤DNA糖基化酶等参与修复过程,而整个修复过程受到上游相关因子的调控.

  9. Role of Fapy glycosylase and UvrABC excinuclease in the repair of UVA (320-400 nm)-mediated DNA damage in Escherichia coli

    In contrast to the damage caused by far-UV, the damage caused by UVA (320-400 nm) is largely oxygen dependent, suggesting near-UV-mediated DNA damage involves reactive oxygen species. The DNA repair enzymes that recognize oxidized bases may, therefore, be an important part of the cell's near-UV defense repertoire. To evaluate the relative importance of Fpg (Fapy) glycosy-lase (an enzyme known to remove oxidized bases) and the DNA damage-inducible UvrABC excinuclease in recovery from near-UV-induced stress, we have constructed fpg- and uvrA-derivatives of Escherichia coli and tested the response (survival) of these strains to both UVA and far-UV radiation. Relative to control strains, the fpg- derivatives were found to be consistently more sensitive to the lethal effects of UVA, but not far-UV radiation. In contrast, uvrA- mutants were more sensitive than control strains to both UVA and far-UV radiation. Thymine dimers, known to be produced by far-UV and corrected by UvrABC, were not generated by the UVA fluences used in this study, suggesting that some other UVA-induced lesion(s) is recognized and repaired by this excinuclease. (Author)

  10. Hyperosmotic stress memory in Arabidopsis is mediated by distinct epigenetically labile sites in the genome and is restricted in the male germline by DNA glycosylase activity.

    Wibowo, Anjar; Becker, Claude; Marconi, Gianpiero; Durr, Julius; Price, Jonathan; Hagmann, Jorg; Papareddy, Ranjith; Putra, Hadi; Kageyama, Jorge; Becker, Jorg; Weigel, Detlef; Gutierrez-Marcos, Jose

    2016-01-01

    Inducible epigenetic changes in eukaryotes are believed to enable rapid adaptation to environmental fluctuations. We have found distinct regions of the Arabidopsis genome that are susceptible to DNA (de)methylation in response to hyperosmotic stress. The stress-induced epigenetic changes are associated with conditionally heritable adaptive phenotypic stress responses. However, these stress responses are primarily transmitted to the next generation through the female lineage due to widespread DNA glycosylase activity in the male germline, and extensively reset in the absence of stress. Using the CNI1/ATL31 locus as an example, we demonstrate that epigenetically targeted sequences function as distantly-acting control elements of antisense long non-coding RNAs, which in turn regulate targeted gene expression in response to stress. Collectively, our findings reveal that plants use a highly dynamic maternal 'short-term stress memory' with which to respond to adverse external conditions. This transient memory relies on the DNA methylation machinery and associated transcriptional changes to extend the phenotypic plasticity accessible to the immediate offspring. PMID:27242129

  11. Novel repair activities of AlkA (3-methyladenine DNA glycosylase II) and endonuclease VIII for xanthine and oxanine, guanine lesions induced by nitric oxide and nitrous acid

    Terato, Hiroaki; Masaoka, Aya; Asagoshi, Kenjiro; Honsho, Akiko; Ohyama, Yoshihiko; Suzuki, Toshinori; Yamada, Masaki; Makino, Keisuke; Yamamoto, Kazuo; Ide, Hiroshi

    2002-01-01

    Nitrosation of guanine in DNA by nitrogen oxides such as nitric oxide (NO) and nitrous acid leads to formation of xanthine (Xan) and oxanine (Oxa), potentially cytotoxic and mutagenic lesions. In the present study, we have examined the repair capacity of DNA N-glycosylases from Escherichia coli for Xan and Oxa. The nicking assay with the defined substrates containing Xan and Oxa revealed that AlkA [in combination with endonuclease (Endo) IV] and Endo VIII recognized Xan in the tested enzymes. The activity (Vmax/Km) of AlkA for Xan was 5-fold lower than that for 7-methylguanine, and that of Endo VIII was 50-fold lower than that for thymine glycol. The activity of AlkA and Endo VIII for Xan was further substantiated by the release of [3H]Xan from the substrate. The treatment of E.coli with N-methyl-N′-nitro-N-nitrosoguanidine increased the Xan-excising activity in the cell extract from alkA+ but not alkA– strains. The alkA and nei (the Endo VIII gene) double mutant, but not the single mutants, exhibited increased sensitivity to nitrous acid relative to the wild type strain. AlkA and Endo VIII also exhibited excision activity for Oxa, but the activity was much lower than that for Xan. PMID:12434002

  12. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents

    Shanshan Song; Guichun Xing; Lin Yuan; Jian Wang; Shan Wang; Yuxin Yin; Chunyan Tian; Fuchu He; Lingqiang Zhang

    2012-01-01

    Alkylating agents induce genome-wide base damage,which is repaired mainly by N-methylpurine DNA glycosylase (MPG).An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks.However,the determinant of drug sensitivity or insensitivity still remains unclear.Here,we report that the p53 status coordinates with MPG to play a pivotal role in such process.MPG expression is positive in breast,lung and colon cancers (38.7%,43.4% and 25.3%,respectively) but negative in all adjacent normal tissues.MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells.The overexpression of MPG reduced,whereas depletion of MPG increased,the expression levels of pro-arrest gene downstream of p53 including p21,14-3-3σ and Gadd45 but not pro-apoptotic ones.The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53.Upon DNA alkylation stress,in p53 wild-type tumor cells,p53 dissociated from MPG and induced cell growth arrest.Then,AP sites were repaired efficiently,which led to insensitivity to alkylating agents.By contrast,in p53-mutated cells,the AP sites were repaired with low efficacy.To our knowledge,this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53,and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  13. Ebselen attenuates oxidative DNA damage and enhances its repair activity in the thalamus after focal cortical infarction in hypertensive rats.

    He, Meixia; Xing, Shihui; Yang, Bo; Zhao, Liqun; Hua, Haiying; Liang, Zhijian; Zhou, Wenliang; Zeng, Jinsheng; Pei, Zhong

    2007-11-21

    Oxidative DNA damage has been proposed to be a major contributor to focal cerebral ischemic injury. However, little is known about the role of oxidative DNA damage in remote damage secondary to the primary infarction. In the present study, we investigated oxidative damage within the ventroposterior nucleus (VPN) after distal middle cerebral artery occlusion (MCAO) in hypertensive rats. We also examined the possible protective effect of ebselen, one glutathione peroxidase mimic, on delayed degeneration in the VPN after distal MCAO. Neuronal damage in the ipsilateral VPN was examined by Nissl staining. Oxidative DNA damage and base repair enzyme activity were assessed by analyzing immunoreactivity of 8-hydroxy-2'-deoxyguanosine (8-ohdG) and 8-oxoguanine DNA glycosylase (OGG1), respectively. The number of intact neurons in the ipsilateral VPN decreased by 52% compared to the contralateral side in ischemia group 2 weeks after distal cerebral cortical infarction. The immunoreactivity of 8-ohdG significantly increased while OGG1 immunoreactivity significantly decreased in the ipsilateral VPN 2 weeks after distal cortical infarction (all pVPN (all pVPN region following distal MCAO. Furthermore, ebselen protects against the delayed damage in the VPN when given at 24 h following distal MCAO. PMID:17920569

  14. Dietary elevated sucrose modulation of diesel-induced genotoxicity in the colon and liver of Big Blue rats

    Risom, L.; Moller, P.; Hansen, Max;

    2003-01-01

    liver. The mRNA expression levels of the DNA repair enzymes N-methylpurine DNA glycosylase (MPG), 8-oxoguanine DNA glycosylase (OGG1) and ERCC1 (part of the nucleotide excision repair complex) measured by reverse transcription-polymerase chain reaction were increased in liver by DEP feeding. In colon...

  15. Biomarkers of oxidative damage to DNA and repair.

    Loft, Steffen; Høgh Danielsen, Pernille; Mikkelsen, Lone; Risom, Lotte; Forchhammer, Lykke; Møller, Peter

    2008-10-01

    Oxidative-stress-induced damage to DNA includes a multitude of lesions, many of which are mutagenic and have multiple roles in cancer and aging. Many lesions have been characterized by MS-based methods after extraction and digestion of DNA. These preparation steps may cause spurious base oxidation, which is less likely to occur with methods such as the comet assay, which are based on nicking of the DNA strand at modified bases, but offer less specificity. The European Standards Committee on Oxidative DNA Damage has concluded that the true levels of the most widely studied lesion, 8-oxodG (8-oxo-7,8-dihydro-2'-deoxyguanosine), in cellular DNA is between 0.5 and 5 lesions per 10(6) dG bases. Base excision repair of oxidative damage to DNA can be assessed by nicking assays based on oligonucleotides with lesions or the comet assay, by mRNA expression levels or, in the case of, e.g., OGG1 (8-oxoguanine DNA glycosylase 1), responsible for repair of 8-oxodG, by genotyping. Products of repair in DNA or the nucleotide pool, such as 8-oxodG, excreted into the urine can be assessed by MS-based methods and generally reflects the rate of damage. Experimental and population-based studies indicate that many environmental factors, including particulate air pollution, cause oxidative damage to DNA, whereas diets rich in fruit and vegetables or antioxidant supplements may reduce the levels and enhance repair. Urinary excretion of 8-oxodG, genotype and expression of OGG1 have been associated with risk of cancer in cohort settings, whereas altered levels of damage, repair or urinary excretion in case-control settings may be a consequence rather than the cause of the disease. PMID:18793191

  16. A unique dual recognition hairpin probe mediated fluorescence amplification method for sensitive detection of uracil-DNA glycosylase and endonuclease IV activities.

    Wu, Yushu; Yan, Ping; Xu, Xiaowen; Jiang, Wei

    2016-03-01

    Uracil-DNA glycosylase (UDG) and endonuclease IV (Endo IV) play cooperative roles in uracil base-excision repair (UBER) and inactivity of either will interrupt the UBER to cause disease. Detection of UDG and Endo IV activities is crucial to evaluate the UBER process in fundamental research and diagnostic application. Here, a unique dual recognition hairpin probe mediated fluorescence amplification method was developed for sensitively and selectively detecting UDG and Endo IV activities. For detecting UDG activity, the uracil base in the probe was excised by the target enzyme to generate an apurinic/apyrimidinic (AP) site, achieving the UDG recognition. Then, the AP site was cleaved by a tool enzyme Endo IV, releasing a primer to trigger rolling circle amplification (RCA) reaction. Finally, the RCA reaction produced numerous repeated G-quadruplex sequences, which interacted with N-methyl-mesoporphyrin IX to generate an enhanced fluorescence signal. Alternatively, for detecting Endo IV activity, the uracil base in the probe was first converted into an AP site by a tool enzyme UDG. Next, the AP site was cleaved by the target enzyme, achieving the Endo IV recognition. The signal was then generated and amplified in the same way as those in the UDG activity assay. The detection limits were as low as 0.00017 U mL(-1) for UDG and 0.11 U mL(-1) for Endo IV, respectively. Moreover, UDG and Endo IV can be well distinguished from their analogs. This method is beneficial for properly evaluating the UBER process in function studies and disease prognoses. PMID:26899234

  17. Evidence that OGG1 glycosylase protects neurons against oxidative DNA damage and cell death under ischemic conditions

    Liu, Dong; Croteau, Deborah L; Souza-Pinto, Nadja; Pitta, Michael; Tian, Jingyan; Wu, Christopher; Jiang, Haiyang; Mustafa, Khadija; Keijzers, Guido; Bohr, Vilhelm; Mattson, Mark P

    2011-01-01

    . Cortical neurons isolated from OGG1(-/-) mice were more vulnerable to oxidative insults than were OGG1(+/+) neurons, and OGG1(-/-) mice developed larger cortical infarcts and behavioral deficits after permanent middle cerebral artery occlusion compared with OGG1(+/+) mice. Accumulations of oxidative DNA...

  18. Low-level laser irradiation alters mRNA expression from genes involved in DNA repair and genomic stabilization in myoblasts

    Trajano, L. A. S. N.; Sergio, L. P. S.; Silva, C. L.; Carvalho, L.; Mencalha, A. L.; Stumbo, A. C.; Fonseca, A. S.

    2016-07-01

    Low-level lasers are used for the treatment of diseases in soft and bone tissues, but few data are available regarding their effects on genomic stability. In this study, we investigated mRNA expression from genes involved in DNA repair and genomic stabilization in myoblasts exposed to low-level infrared laser. C2C12 myoblast cultures in different fetal bovine serum concentrations were exposed to low-level infrared laser (10, 35 and 70 J cm‑2), and collected for the evaluation of DNA repair gene expression. Laser exposure increased gene expression related to base excision repair (8-oxoguanine DNA glycosylase and apurinic/apyrimidinic endonuclease 1), nucleotide excision repair (excision repair cross-complementation group 1 and xeroderma pigmentosum C protein) and genomic stabilization (ATM serine/threonine kinase and tumor protein p53) in normal and low fetal bovine serum concentrations. Results suggest that genomic stability could be part of a biostimulation effect of low-level laser therapy in injured muscles.

  19. Regulation of mitochondrial genome replication by hypoxia: The role of DNA oxidation in D-loop region.

    Pastukh, Viktor M; Gorodnya, Olena M; Gillespie, Mark N; Ruchko, Mykhaylo V

    2016-07-01

    Mitochondria of mammalian cells contain multiple copies of mitochondrial (mt) DNA. Although mtDNA copy number can fluctuate dramatically depending on physiological and pathophysiologic conditions, the mechanisms regulating mitochondrial genome replication remain obscure. Hypoxia, like many other physiologic stimuli that promote growth, cell proliferation and mitochondrial biogenesis, uses reactive oxygen species as signaling molecules. Emerging evidence suggests that hypoxia-induced transcription of nuclear genes requires controlled DNA damage and repair in specific sequences in the promoter regions. Whether similar mechanisms are operative in mitochondria is unknown. Here we test the hypothesis that controlled oxidative DNA damage and repair in the D-loop region of the mitochondrial genome are required for mitochondrial DNA replication and transcription in hypoxia. We found that hypoxia had little impact on expression of mitochondrial proteins in pulmonary artery endothelial cells, but elevated mtDNA content. The increase in mtDNA copy number was accompanied by oxidative modifications in the D-loop region of the mitochondrial genome. To investigate the role of this sequence-specific oxidation of mitochondrial genome in mtDNA replication, we overexpressed mitochondria-targeted 8-oxoguanine glycosylase Ogg1 in rat pulmonary artery endothelial cells, enhancing the mtDNA repair capacity of transfected cells. Overexpression of Ogg1 resulted in suppression of hypoxia-induced mtDNA oxidation in the D-loop region and attenuation of hypoxia-induced mtDNA replication. Ogg1 overexpression also reduced binding of mitochondrial transcription factor A (TFAM) to both regulatory and coding regions of the mitochondrial genome without altering total abundance of TFAM in either control or hypoxic cells. These observations suggest that oxidative DNA modifications in the D-loop region during hypoxia are important for increased TFAM binding and ensuing replication of the mitochondrial

  20. Characterization of a novel DNA glycosylase from S. sahachiroi involved in the reduction and repair of azinomycin B induced DNA damage

    Wang, Shan; Liu, Kai; Xiao, Le; Yang, Liyuan; LI Hong; Zhang, Feixue; Lei, Lei; Li, Shengqing; Feng, Xu; Li, Aiying; He, Jing

    2015-01-01

    Azinomycin B is a hybrid polyketide/nonribosomal peptide natural product and possesses antitumor activity by interacting covalently with duplex DNA and inducing interstrand crosslinks. In the biosynthetic study of azinomycin B, a gene (orf1) adjacent to the azinomycin B gene cluster was found to be essential for the survival of the producer, Streptomyces sahachiroi ATCC33158. Sequence analyses revealed that Orf1 belongs to the HTH_42 superfamily of conserved bacterial proteins which are widel...

  1. The basal levels of 8-oxoG and other oxidative modifications in intact mitochondrial DNA are low even in repair-deficient (Ogg1{sup -/-}/Csb{sup -/-}) mice

    Trapp, Christian [Institute of Pharmacy, University of Mainz, D-55099 Mainz (Germany); McCullough, Amanda K. [CROET/Mol. Med. Genetics, Oregon Health and Science University, Portland, OR 97239 (United States); Epe, Bernd [Institute of Pharmacy, University of Mainz, D-55099 Mainz (Germany)], E-mail: epe@uni-mainz.de

    2007-12-01

    Mitochondrial DNA (mtDNA) is assumed to be highly prone to damage by reactive oxygen species (ROS) because of its location in close proximity to the mitochondrial electron transport chain. Accordingly, mitochondrial oxidative DNA damage has been hypothesized to be responsible for various neurological diseases, ageing and cancer. Since 7,8-dihydro-8-oxoguanine (8-oxoG), one of the most frequent oxidative base modifications, is removed from the mitochondrial genome by the glycosylase OGG1, the basal levels of this lesion are expected to be highly elevated in Ogg1{sup -/-} mice. To investigate this hypothesis, we have used a mtDNA relaxation assay in combination with various repair enzymes (Fpg, MutY, endonuclease III, endonuclease IV) to determine the average steady-state number of oxidative DNA modifications within intact (supercoiled) mtDNA from the livers of wild-type mice and those deficient in OGG1 and/or the Cockayne syndrome B (CSB) protein for mice aged up to 23 months. The levels of all types of oxidative modifications were found to be less than 12 per million base pairs, and the difference between wild-type and repair-deficient (Ogg1{sup -/-}/Csb{sup -/-}) mice was not significant. Thus, the increase of 8-oxoG caused by the repair deficiency in intact mtDNA is not much higher than in the nuclear DNA, i.e., not more than a few modifications per million base pairs. Based on these data, it is hypothesized that the load of oxidative base modifications in mtDNA is efficiently reduced during replication even in the absence of excision repair.

  2. [Exercise training in hypoxia prevents hypoxia induced mitochondrial DNA oxidative damage in skeletal muscle].

    Bo, Hai; Li, Ling; Duan, Fu-Qiang; Zhu, Jiang

    2014-10-25

    This study was undertaken to investigate the effect of exercise training on mitochondrial DNA (mtDNA) oxidative damage and 8-oxoguanine DNA glycosylase-1 (OGG1) expression in skeletal muscle of rats under continuous exposure to hypoxia. Male Sprague-Dawley rats were randomly divided into 4 groups (n = 8): normoxia control group (NC), normoxia training group (NT), hypoxia control group (HC), and hypoxia training group (HT). The hypoxia-treated animals were housed in normobaric hypoxic tent containing 11.3% oxygen for consecutive 4 weeks. The exercise-trained animals were exercised on a motor-driven rodent treadmill at a speed of 15 m/min, 5% grade for 60 min/day, 5 days per week for 4 weeks. The results showed that, compared with NC group, hypoxia attenuated complex I, II, IV and ATP synthase activities of the electron transport chain, and the level of mitochondrial membrane potential in HC group (P hypoxia decreased mitochondrial OGG1, MnSOD, and GPx activities (P hypoxia attenuated muscle and mitochondrial [NAD⁺]/ [NADH] ratio, and SIRT3 protein expression (P exercise training in hypoxia elevated complex I, II, IV and ATP synthase activities, and the level of mitochondrial membrane potential in HT group (P exercise training in hypoxia increased MnSOD and GPx activities and mitochondrial OGG1 level (P exercise training in hypoxia increased muscle and mitochondrial [NAD⁺]/[NADH] ratio, as well as SIRT3 protein expression (P exercise training in hypoxia can decrease hypoxia-induced mtDNA oxidative damage in the skeletal muscle through up-regulating exercise-induced mitochondrial OGG1 and antioxidant enzymes. Exercise training in hypoxia may improve hypoxia tolerance in skeletal muscle mitochondria via elevating [NAD⁺]/[NADH] ratio and SIRT3 expression. PMID:25332006

  3. Antioxidant-mediated up-regulation of OGG1 via NRF2 induction is associated with inhibition of oxidative DNA damage in estrogen-induced breast cancer

    Estrogen metabolism-mediated oxidative stress is suggested to play an important role in estrogen-induced breast carcinogenesis. We have earlier demonstrated that antioxidants, vitamin C (Vit C) and butylated hydroxyanisole (BHA) inhibit 17β-estradiol (E2)-mediated oxidative stress and oxidative DNA damage, and breast carcinogenesis in female August Copenhagen Irish (ACI) rats. The objective of the present study was to characterize the mechanism by which above antioxidants prevent DNA damage during breast carcinogenesis. Female ACI rats were treated with E2; Vit C; Vit C + E2; BHA; and BHA + E2 for up to 240 days. mRNA and protein levels of a DNA repair enzyme 8-Oxoguanine DNA glycosylase (OGG1) and a transcription factor NRF2 were quantified in the mammary and mammary tumor tissues of rats after treatment with E2 and compared with that of rats treated with antioxidants either alone or in combination with E2. The expression of OGG1 was suppressed in mammary tissues and in mammary tumors of rats treated with E2. Expression of NRF2 was also significantly suppressed in E2-treated mammary tissues and in mammary tumors. Vitamin C or BHA treatment prevented E2-mediated decrease in OGG1 and NRF2 levels in the mammary tissues. Chromatin immunoprecipitation analysis confirmed that antioxidant-mediated induction of OGG1 was through increased direct binding of NRF2 to the promoter region of OGG1. Studies using silencer RNA confirmed the role of OGG1 in inhibition of oxidative DNA damage. Our studies suggest that antioxidants Vit C and BHA provide protection against oxidative DNA damage and E2-induced mammary carcinogenesis, at least in part, through NRF2-mediated induction of OGG1

  4. Polymorphisms of DNA repair genes OGG1 and XPD and the risk of age-related cataract in Egyptians

    Gharib, Amal F.; Dabour, Sherif A.; Etewa, Rasha L.; Fouad, Rania A.

    2014-01-01

    Purpose To analyze the association of the polymorphisms of xeroderma pigmentosum complementation group D (XPD) and 8-oxoguanine glycosylase-1 (OGG1) genes with the risk of age-related cataract (ARC) in an Egyptian population. Methods This case-control study included 150 patients with ARC and 50 controls. Genotyping of XPD Asp312Asn was performed by amplification refractory mutation system PCR assay and genotyping of OGG1 Ser326Cys was carried out by PCR including confronting two-pair primers....

  5. Use of sequence microdivergence in mycobacterial ortholog to analyze contributions of the water-activating loop histidine of Escherichia coli uracil-DNA glycosylase in reactant binding and catalysis

    Uracil-DNA glycosylase (Ung), a DNA repair enzyme, pioneers uracil excision repair pathway. Structural determinations and mutational analyses of the Ung class of proteins have greatly facilitated our understanding of the mechanism of uracil excision from DNA. More recently, a hybrid quantum-mechanical/molecular mechanical analysis revealed that while the histidine (H67 in EcoUng) of the GQDPYH motif (ω loop) in the active site pocket is important in positioning the reactants, it makes an unfavorable energetic contribution (penalty) in achieving the transition state intermediate. Mutational analysis of this histidine is unavailable from any of the Ung class of proteins. A complication in demonstrating negative role of a residue, especially when located within the active site pocket, is that the mutants with enhanced activity are rarely obtained. Interestingly, unlike the most Ung proteins, the H67 equivalent in the ω loop in mycobacterial Ung is represented by P67. Exploiting this natural diversity to maintain structural integrity of the active site, we transplanted an H67P mutation in EcoUng. Uracil inhibition assays and binding of a proteinaceous inhibitor, Ugi (a transition state substrate mimic), with the mutant (H67P) revealed that its active site pocket was not perturbed. The catalytic efficiency (Vmax/Km) of the mutant was similar to that of the wild type Ung. However, the mutant showed increased Km and Vmax. Together with the data from a double mutation H67P/G68T, these observations provide the first biochemical evidence for the proposed diverse roles of H67 in catalysis by Ung

  6. In vivo repair of alkylating and oxidative DNA damage in the mitochondrial and nuclear genomes of wild-type and glycosylase-deficient Caenorhabditis elegans

    Hunter, Senyene E.; Gustafson, Margaret A; Margillo, Kathleen M; Lee, Sean A; Ryde, Ian T.; Meyer, Joel N.

    2012-01-01

    Base excision repair (BER) is an evolutionarily conserved DNA repair pathway that is critical for repair of many of the most common types of DNA damage generated both by endogenous metabolic pathways and exposure to exogenous stressors such as pollutants. C. elegans is an increasingly important model organism for the study of DNA damage-related processes including DNA repair, genotoxicity, and apoptosis, but BER is not well understood in this organism, and has not previously been measured in ...

  7. Overexpression of transcription factor AP-2 stimulates the PA promoter of the human uracil-DNA glycosylase (UNG) gene through a mechanism involving derepression

    Aas, Per Arne; Pena Diaz, Javier; Liabakk, Nina Beate;

    2009-01-01

    alpha, lacking the activation domain but retaining the DNA binding and dimerization domains, stimulated PA to a level approaching that of full-length AP-2, suggesting that AP-2 overexpression stimulates PA activity by a mechanism involving derepression rather than activation, possibly by neutralizing an...

  8. DNA glycosylases involved in base excision repair may be associated with cancer risk in BRCA1 and BRCA2 mutation carriers

    Osorio, Ana; Milne, Roger L; Kuchenbaecker, Karoline;

    2014-01-01

    Single Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of th...

  9. Alkali-labile lesion and uracil-DNA-glycosylase-sensitive site removal after BrdUrd and UVB treatment of Chinese hamster cells

    A marked cell-cycle dependency for the recovery of cells after BrdUrd UVB treatment has led us to look for similar characteristics in the molecular events associated with DNA repair. Such characteristics are reported for the repair of alkali-labile lesions. When asynchronously growing cells were uniformly substituted with BrdUrd (a condition that results in the greatest cell killing), the repair kinetics followed a simple exponential response with a half-time of approximately 17 min. However, when lesions were restricted to 3-5% of the genome and the repair observed in the mid-S phase (a condition associated with sublethal damage repair), the DNA repair kinetics were complex. The rejoining of the DNA was biphasic with greater than 90% of the lesion with a half-time of less than 6-7 min. Uracil removal followed similar kinetics. Caffeine, a potent inhibitor of cell survival after BrdUrd/UVB treatment, had no measurable effect on either uracil removal or alkali-labile lesion repair. (author)

  10. Molecular dynamics simulation studies of radiation damaged DNA. Molecules and repair enzymes

    Molecular dynamics (MD) studies on several radiation damages to DNA and their recognition by repair enzymes are introduced in order to describe the stepwise description of molecular process observed at radiation lesion sites. MD studies were performed on pyrimidine (thymine dimer, thymine glycol) and purine (8-oxoguanine) lesions using an MD simulation code AMBER 5.0. The force field was modified for each lesion. In all cases the significant structural changes in the DNA double helical structure were observed; a) the breaking of hydrogen bond network between complementary bases and resulting opening of the double helix (8-oxoguanine); b) the sharp bending of the DNA helix centered at the lesion site (thymine dimer, thymine glycol); and c) the flipping-out base on the strand complementary to the lesion (8-oxoguanine). These changes were related to the overall collapsing double helical structure around the lesion and might facilitate the docking of the repair enzyme into the DNA and formation of DNA-enzyme complex. In addition to the structural changes, at lesion sites there were found electrostatic interaction energy values different from those at native sites (thymine dimer -10 kcal/mol, thymine glycol -26 kcal/mol, 8-oxoguanine -48 kcal/mol). These values of electrostatic energy may discriminate lesion from values at native sites (thymine 0 kcal/mol, guanine -37 kcal/mol) and enable a repair enzyme to recognize a lesion during scanning DNA surface. The observed specific structural conformation and energetic properties at the lesions sites are factors that guide a repair enzyme to discriminate lesions from non-damaged native DNA segments. (author)

  11. Assessment of oxidative DNA damage formation by organic complex mixtures from airborne particles PM10

    Gábelová, A.; Valovičová, Z.; Lábaj, J.; Bačová, G.; Binková, Blanka; Farmer, P. B.

    2007-01-01

    Roč. 620, 1-2 (2007), s. 135-144. ISSN 0027-5107 Grant ostatní: EU(EU) 2000-00091 Institutional research plan: CEZ:AV0Z50390512 Source of funding: R - rámcový projekt EK Keywords : airborne particles PM10 * oxidative DNA damage * 8-oxoguanine Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 4.159, year: 2007

  12. Significance of 8-oxoG in the spectrum of DNA damages caused by ionising radiation of different quality

    Štěpán, Václav; Davídková, Marie

    2007-01-01

    Roč. 122, 1-4 (2007), s. 113-115. ISSN 0144-8420. [Symposium on Microdosimetry /14./. Venezia, 13.11.2005-18.11.2005] R&D Projects: GA AV ČR KJB4048401; GA ČR GA202/05/2728 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA damage * 8-oxoguanine * ionizing radiation * theoretical modeling Subject RIV: BO - Biophysics Impact factor: 0.528, year: 2007

  13. hSSB1 (NABP2/OBFC2B) is regulated by oxidative stress.

    Paquet, Nicolas; Adams, Mark N; Ashton, Nicholas W; Touma, Christine; Gamsjaeger, Roland; Cubeddu, Liza; Leong, Vincent; Beard, Sam; Bolderson, Emma; Botting, Catherine H; O'Byrne, Kenneth J; Richard, Derek J

    2016-01-01

    The maintenance of genome stability is an essential cellular process to prevent the development of diseases including cancer. hSSB1 (NABP2/ OBFC2A) is a critical component of the DNA damage response where it participates in the repair of double-strand DNA breaks and in base excision repair of oxidized guanine residues (8-oxoguanine) by aiding the localization of the human 8-oxoguanine glycosylase (hOGG1) to damaged DNA. Here we demonstrate that following oxidative stress, hSSB1 is stabilized as an oligomer which is required for hSSB1 to function in the removal of 8-oxoguanine. Monomeric hSSB1 shows a decreased affinity for oxidized DNA resulting in a cellular 8-oxoguanine-repair defect and in the absence of ATM signaling initiation. While hSSB1 oligomerization is important for the removal of 8-oxoguanine from the genome, it is not required for the repair of double-strand DNA-breaks by homologous recombination. These findings demonstrate a novel hSSB1 regulatory mechanism for the repair of damaged DNA. PMID:27273218

  14. Gas-Phase Studies of Formamidopyrimidine Glycosylase (Fpg) Substrates.

    Kiruba, G S M; Xu, Jiahui; Zelikson, Victoria; Lee, Jeehiun K

    2016-03-01

    Gas-phase thermochemical properties (tautomerism, acidity, and proton affinity) have been measured and calculated for a series of nucleobase derivatives that have not heretofore been examined under vacuum. The studied species are substrates for the enzyme formamidopyrimidine glycosylase (Fpg), which cleaves damaged nucleobases from DNA. The gas-phase results are compared and contrasted to solution-phase data, to afford insight into the Fpg mechanism. Calculations are also used to probe the energetics of various possible mechanisms and to predict isotope effects that could potentially allow for discrimination between different mechanisms. Specifically, (18) O substitution at the ribose O4' is predicted to result in a normal kinetic isotope effect (KIE) for a ring-opening "endocyclic" mechanism and an inverse KIE for a direct base excision "exocyclic" pathway. PMID:26894440

  15. Detection of specific oxidative DNA damage in gill cells and hemocytes of Dreissena polymorpha with the comet assay and OGG1 enzyme

    C.; Michel; Vincent-Hubert, F.

    2009-01-01

    Genotoxicity-end points, such as single strand breaks (SSB) and oxidative DNA damage are highly applicable for monitoring water pollutants effects. In our study, caged zebra mussels are used for monitoring freshwater pollution on urban sites of the Seine basin. After one month of transplantation, an increase amount of SSB was detected with the comet assay. However, mutagenic lesions, especially 8-oxoguanine, are more relevant than SSB for the evaluation of biological effects. Moreover, they h...

  16. Expression of human oxoguanine glycosylase 1 or formamidopyrimidine glycosylase in human embryonic kidney 293 cells exacerbates methylmercury toxicity in vitro

    Ondovcik, Stephanie L.; Preston, Thomas J.; McCallum, Gordon P. [Department of Pharmaceutical Sciences, University of Toronto, Toronto, Ontario M5S 3M2 (Canada); Wells, Peter G., E-mail: pg.wells@utoronto.ca [Department of Pharmaceutical Sciences, University of Toronto, Toronto, Ontario M5S 3M2 (Canada); Department of Pharmacology and Toxicology, University of Toronto, Toronto, Ontario M5S 1A8 (Canada)

    2013-08-15

    Exposure to methylmercury (MeHg) acutely at high levels, or via chronic low-level dietary exposure from daily fish consumption, can lead to adverse neurological effects in both the adult and developing conceptus. To determine the impact of variable DNA repair capacity, and the role of reactive oxygen species (ROS) and oxidatively damaged DNA in the mechanism of toxicity, transgenic human embryonic kidney (HEK) 293 cells that stably express either human oxoguanine glycosylase 1 (hOgg1) or its bacterial homolog, formamidopyrimidine glycosylase (Fpg), which primarily repair the oxidative lesion 8-oxo-2′-deoxyguanosine (8-oxodG), were used to assess the in vitro effects of MeHg. Western blotting confirmed the expression of hOgg1 or Fpg in both the nuclear and mitochondrial compartments of their respective cell lines. Following acute (1–2 h) incubations with 0–10 μM MeHg, concentration-dependent decreases in clonogenic survival and cell growth accompanied concentration-dependent increases in lactate dehydrogenase (LDH) release, ROS formation, 8-oxodG levels and apurinic/apyrimidinic (AP) sites, consistent with the onset of cytotoxicity. Paradoxically, hOgg1- and Fpg-expressing HEK 293 cells were more sensitive than wild-type cells stably transfected with the empty vector control to MeHg across all cellular and biochemical parameters, exhibiting reduced clonogenic survival and cell growth, and increased LDH release and DNA damage. Accordingly, upregulation of specific components of the base excision repair (BER) pathway may prove deleterious potentially due to the absence of compensatory enhancement of downstream processes to repair toxic intermediary abasic sites. Thus, interindividual variability in DNA repair activity may constitute an important risk factor for environmentally-initiated, oxidatively damaged DNA and its pathological consequences. - Highlights: • hOgg1 and Fpg repair oxidatively damaged DNA. • hOgg1- and Fpg-expressing cells are more

  17. Sequence Classification: 891958 [

    Full Text Available ondrial glycosylase/lyase that specifically excises 7,8-dihydro-8-oxoguanine residues located opposite cytosine or thymine residues... in DNA, repairs oxidative damage to mitochondrial DNA; Ogg1p || http://www.ncbi.nlm.nih.gov/protein/6323580 ... ...Non-TMB Non-TMH Non-TMB Non-TMB Non-TMB Non-TMB >gi|6323580|ref|NP_013651.1| Mitoch

  18. Chloroethyinitrosourea-derived ethano cytosine and adenine adducts are substrates for escherichia coli glycosylases excising analogous etheno adducts

    Guliaev, Anton B.; Singer, B.; Hang, Bo

    2004-05-05

    Exocyclic ethano DNA adducts are saturated etheno ring derivatives formed mainly by therapeutic chloroethylnitrosoureas (CNUs), which are also mutagenic and carcinogenic. In this work, we report that two of the ethano adducts, 3,N{sup 4}-ethanocytosine (EC) and 1,N{sup 6}-ethanoadenine (EA), are novel substrates for the Escherichia coli mismatch-specific uracil-DNA glycosylase (Mug) and 3-methyladenine DNA glycosylase II (AlkA), respectively. It has been shown previously that Mug excises 3,N{sup 4}-ethenocytosine ({var_epsilon}C) and AlkA releases 1,N{sup 6}-ethenoadenine ({var_epsilon}A). Using synthetic oligonucleotides containing a single ethano or etheno adduct, we found that both glycosylases had a {approx}20-fold lower excision activity toward EC or EA than that toward their structurally analogous {var_epsilon}C or {var_epsilon}A adduct. Both enzymes were capable of excising the ethano base paired with any of the four natural bases, but with varying efficiencies. The Mug activity toward EC could be stimulated by E. coli endonuclease IV and, more efficiently, by exonuclease III. Molecular dynamics (MD) simulations showed similar structural features of the etheno and ethano derivatives when present in DNA duplexes. However, also as shown by MD, the stacking interaction between the EC base and Phe 30 in the Mug active site is reduced as compared to the {var_epsilon}C base, which could account for the lower EC activity observed in this study.

  19. Overexpression, purification, crystallization and preliminary X-ray analysis of uracil N-glycosylase from Mycobacterium tuberculosis in complex with a proteinaceous inhibitor

    Uracil N-glycosylase from M. tuberculosis has been crystallized in complex with a proteinaceous inhibitor (Ugi) and X-ray diffraction data have been collected. Uracil N-glycosylase is an enzyme which initiates the pathway of uracil-excision repair of DNA. The enzyme from Mycobacterium tuberculosis was co-expressed with a proteinaceous inhibitor from Bacillus subtilis phage and was crystallized in monoclinic space group C2, with unit-cell parameters a = 201.14, b = 64.27, c = 203.68 Å, β = 109.7°. X-ray data from the crystal have been collected for structure analysis

  20. Oxidative DNA damage background estimated by a system model of base excision repair

    Sokhansanj, B A; Wilson, III, D M

    2004-05-13

    Human DNA can be damaged by natural metabolism through free radical production. It has been suggested that the equilibrium between innate damage and cellular DNA repair results in an oxidative DNA damage background that potentially contributes to disease and aging. Efforts to quantitatively characterize the human oxidative DNA damage background level based on measuring 8-oxoguanine lesions as a biomarker have led to estimates varying over 3-4 orders of magnitude, depending on the method of measurement. We applied a previously developed and validated quantitative pathway model of human DNA base excision repair, integrating experimentally determined endogenous damage rates and model parameters from multiple sources. Our estimates of at most 100 8-oxoguanine lesions per cell are consistent with the low end of data from biochemical and cell biology experiments, a result robust to model limitations and parameter variation. Our results show the power of quantitative system modeling to interpret composite experimental data and make biologically and physiologically relevant predictions for complex human DNA repair pathway mechanisms and capacity.

  1. Dispensability of the [4Fe-4S] cluster in novel homologues of adenine glycosylase MutY.

    Trasviña-Arenas, Carlos H; Lopez-Castillo, Laura M; Sanchez-Sandoval, Eugenia; Brieba, Luis G

    2016-02-01

    7,8-Dihydro-8-deoxyguanine (8oG) is one of the most common oxidative lesions in DNA. DNA polymerases misincorporate an adenine across from this lesion. Thus, 8oG is a highly mutagenic lesion responsible for G:C→T:A transversions. MutY is an adenine glycosylase, part of the base excision repair pathway that removes adenines, when mispaired with 8oG or guanine. Its catalytic domain includes a [4Fe-4S] cluster motif coordinated by cysteinyl ligands. When this cluster is absent, MutY activity is depleted and several studies concluded that the [4Fe-4S] cluster motif is an indispensable component for DNA binding, substrate recognition and enzymatic activity. In the present study, we identified 46 MutY homologues that lack the canonical cysteinyl ligands, suggesting an absence of the [4Fe-4S] cluster. A phylogenetic analysis groups these novel MutYs into two different clades. One clade is exclusive of the order Lactobacillales and another clade has a mixed composition of anaerobic and microaerophilic bacteria and species from the protozoan genus Entamoeba. Structural modeling and sequence analysis suggests that the loss of the [4Fe-4S] cluster is compensated by a convergent solution in which bulky amino acids substitute the [4Fe-4S] cluster. We functionally characterized MutYs from Lactobacillus brevis and Entamoeba histolytica as representative members from each clade and found that both enzymes are active adenine glycosylases. Furthermore, chimeric glycosylases, in which the [4Fe-4S] cluster of Escherichia coli MutY is replaced by the corresponding amino acids of LbY and EhY, are also active. Our data indicates that the [4Fe-4S] cluster plays a structural role in MutYs and evidences the existence of alternative functional solutions in nature. PMID:26613369

  2. Repair of DNA treated with γ-irradiation and chemical carcinogens. Progress report, 1980-1983

    We have studied in vitro DNA repair with the isolation and characterization of DNA glycosylases active in the removable of 3-methyladenine and the problem of repair of DNA in chromatin. The second area of focus has been on transposable elements and carcinogen action. The work on DNA adducts with β-propiolactone was done to define potential new substrates useful in a search for new glycosylases

  3. Inactivation by oxidation and recruitment into stress granules of hOGG1 but not APE1 in human cells exposed to sub-lethal concentrations of cadmium

    The induction of mutations in mammalian cells exposed to cadmium has been associated with the oxidative stress triggered by the metal. There is increasing evidence that the mutagenic potential of Cd is not restricted to the induction of DNA lesions. Cd has been shown to inactivate several DNA repair enzymes. Here we show that exposure of human cells to sub-lethal concentrations of Cd leads to a time- and concentration-dependent decrease in hOGG1 activity, the major DNA glycosylase activity responsible for the initiation of the base excision repair (BER) of 8-oxoguanine, an abundant and mutagenic form of oxidized guanine. Although there is a slight effect on the level of hOGG1 transcripts, we show that the inhibition of the 8-oxoguanine DNA glycosylase activity is mainly associated with an oxidation of the hOGG1 protein and its disappearance from the soluble fraction of total cell extracts. Confocal microscopy analyses show that in cells exposed to Cd hOGG1-GFP is recruited to discrete structures in the cytoplasm. These structures were identified as stress granules. Removal of Cd from the medium allows the recovery of the DNA glycosylase activity and the presence of hOGG1 in a soluble form. In contrast to hOGG1, we show here that exposure to Cd does not affect the activity of the second enzyme of the pathway, the major AP endonuclease APE1.

  4. UVA photoactivation of DNA containing halogenated thiopyrimidines induces cytotoxic DNA lesions.

    Brem, Reto; Zhang, Xiaohui; Xu, Yao-Zhong; Karran, Peter

    2015-04-01

    Photochemotherapy, the combination of a photosensitiser and ultraviolet (UV) or visible light, is an effective treatment for skin conditions including cancer. The high mutagenicity and non-selectivity of photochemotherapy regimes warrants the development of alternative approaches. We demonstrate that the thiopyrimidine nucleosides 5-bromo-4-thiodeoxyuridine (SBrdU) and 5-iodo-4-thiodeoxyuridine (SIdU) are incorporated into the DNA of cultured human and mouse cells where they synergistically sensitise killing by low doses of UVA radiation. The DNA halothiopyrimidine/UVA combinations induce DNA interstrand crosslinks, DNA-protein crosslinks, DNA strand breaks, nucleobase damage and lesions that resemble UV-induced pyrimidine(6-4)pyrimidone photoproducts. These are potentially lethal DNA lesions and cells defective in their repair are hypersensitive to killing by SBrdU/UVA and SIdU/UVA. DNA SIdU and SBrdU generate lethal DNA photodamage by partially distinct mechanisms that reflect the different photolabilities of their C-I and C-Br bonds. Although singlet oxygen is involved in photolesion formation, DNA SBrdU and SIdU photoactivation does not detectably increase DNA 8-oxoguanine levels. The absence of significant collateral damage to normal guanine suggests that UVA activation of DNA SIdU or SBrdU might offer a strategy to target hyperproliferative skin conditions that avoids the extensive formation of a known mutagenic DNA lesion. PMID:25747491

  5. Release of 7-methylguanine residues from alkylated DNA by extracts of Micrococcus luteus and Escherichia coli.

    Laval, J; Pierre, J; Laval, F

    1981-01-01

    Cell extracts from Micrococcus luteus release both free 3-methyladenine and free 7-methylguanine from alkylated DNA. The glycosylase activity responsible for the liberation of 7-methylguanine is not 3-methyladenine-DNA glycosylase, which, when purified, does not liberate it. Furthermore, the heat inactivation rates of the two enzymatic activities are different. The release of 7-methylguanine by chemical depurination of ethanol-soluble oligonucleotides has been ruled out. A similar activity re...

  6. In vitro Repair of Oxidative DNA Damage by Human Nucleotide Excision Repair System: Possible Explanation for Neurodegeneration in Xeroderma Pigmentosum Patients

    Reardon, Joyce T.; Bessho, Tadayoshi; Kung, Hsiang Chuan; Bolton, Philip H.; Sancar, Aziz

    1997-08-01

    Xeroderma pigmentosum (XP) patients fail to remove pyrimidine dimers caused by sunlight and, as a consequence, develop multiple cancers in areas exposed to light. The second most common sign, present in 20-30% of XP patients, is a set of neurological abnormalities caused by neuronal death in the central and peripheral nervous systems. Neural tissue is shielded from sunlight-induced DNA damage, so the cause of neurodegeneration in XP patients remains unexplained. In this study, we show that two major oxidative DNA lesions, 8-oxoguanine and thymine glycol, are excised from DNA in vitro by the same enzyme system responsible for removing pyrimidine dimers and other bulky DNA adducts. Our results suggest that XP neurological disease may be caused by defective repair of lesions that are produced in nerve cells by reactive oxygen species generated as by-products of an active oxidative metabolism.

  7. DNA base damage generated in vivo in hepatic chromatin of mice upon whole body γ-irradiation

    DNA base lesions in hepatic chromatin formed upon whole-body irradiation of mice were studied. After γ-irradiating (20-470 Gy) and killing animals, chromatin was isolated from their livers and analysed by GC-MS. Five pyrimidine- and five purine-derived DNA lesions were identified and quantified: 5-hydroxy-5-methylhydantoin, 5-hydroxycytosine, 5-(hydroxymethyl) uracil, 4,6-diamino-5-formamidopyrimidine, 7,8-dihydro-8-oxoadenine, 2-hydroxyadenine, 2,6-diamino-4-hydroxy-5-formamidopyrimidine, 7,8-dihydro-8-oxoguanine, thymine glycol and 5,6-dihydroxy-uracil. Except for the latter two, amounts of these compounds were increased significantly over control levels in the dose range of 100-470 Gy. Above 200 Gy, a deviation from linearity was observed, although yields were increased in most cases up to 470 Gy. (Author)

  8. The hydantoin lesions formed from oxidation of 7,8-dihydro-8-oxoguanine are potnt sources of replication errors in vivo; Henderson, P.T.; Delaney, J.C.; Muller, J. G.; Neeley, W.L.; Tannenbaum, S.R.; Burrows, C.J.; Essigmann, J.M. Biochemistry (accelerate

    Henderson, P; Delaney, J; Muller, J; Neeley, W; Tannenbaum, S; Burrows, C; Essigmann, J

    2003-10-27

    Single-stranded DNA genomes have been constructed that site-specifically contain the 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxoG) oxidation products guanidinohyndantoin (Gh), and the two stable stereoisomers of spiroiminodihydantoin (Sp1 and Sp2). The circular viral genomes were transfected into wild-type AB1157 Escherichia coli and the efficiency of lesion bypass by DNA polymerase(s) was assessed. Viral progeny were analyzed for mutation frequency and type using the recently developed restriction endonuclease and post-labeling (REAP) assay. Gh was bypassed nearly as efficiently as the parent 8-oxoG, but was highly mutagenic, causing almost exclusive G{yields}C transversions. The stereoisomers Sp1 and Sp2 were, in comparison, much stronger blocks to DNA polymerase extension, and caused a mixture of G{yields}T and G{yields}C transversions. The ratio of G{yields}T to G{yields}C mutations for each Sp lesion was dependent on the stereochemical configuration of the base. All observed mutation frequencies were at least an order of magnitude higher than those caused by 8-oxoG. Were these lesions to be formed in vivo, our data show that they are absolutely miscoding, and may be refractory to repair after translesion synthesis.

  9. Reconstitution of DNA base excision-repair with purified human proteins: interaction between DNA polymerase beta and the XRCC1 protein.

    Kubota, Y; Nash, R. A.; Klungland, A; Schär, P; Barnes, D E.; Lindahl, T

    1996-01-01

    Repair of a uracil-guanine base pair in DNA has been reconstituted with the recombinant human proteins uracil-DNA glycosylase, apurinic/apyrimidinic endonuclease, DNA polymerase beta and DNA ligase III. The XRCC1 protein, which is known to bind DNA ligase III, is not absolutely required for the reaction but suppresses strand displacement by DNA polymerase beta, allowing for more efficient ligation after filling of a single nucleotide patch. We show that XRCC1 interacts directly with DNA polym...

  10. Apoptosis and DNA Methylation

    Richard R. Meehan

    2011-04-01

    Full Text Available Epigenetic mechanisms assist in maintaining gene expression patterns and cellular properties in developing and adult tissues. The molecular pathology of disease states frequently includes perturbation of DNA and histone methylation patterns, which can activate apoptotic pathways associated with maintenance of genome integrity. This perspective focuses on the pathways linking DNA methyltransferases and methyl-CpG binding proteins to apoptosis, and includes new bioinformatic analyses to characterize the evolutionary origin of two G/T mismatch-specific thymine DNA glycosylases, MBD4 and TDG.

  11. The Mutyh base excision repair gene influences the inflammatory response in a mouse model of ulcerative colitis.

    Ida Casorelli

    Full Text Available BACKGROUND: The Mutyh DNA glycosylase is involved in the repair of oxidized DNA bases. Mutations in the human MUTYH gene are responsible for colorectal cancer in familial adenomatous polyposis. Since defective DNA repair genes might contribute to the increased cancer risk associated with inflammatory bowel diseases, we compared the inflammatory response of wild-type and Mutyh(-/- mice to oxidative stress. METHODOLOGY/PRINCIPAL FINDINGS: The severity of colitis, changes in expression of genes involved in DNA repair and inflammation, DNA 8-oxoguanine levels and microsatellite instability were analysed in colon of mice treated with dextran sulfate sodium (DSS. The Mutyh(-/- phenotype was associated with a significant accumulation of 8-oxoguanine in colon DNA of treated mice. A single DSS cycle induced severe acute ulcerative colitis in wild-type mice, whereas lesions were modest in Mutyh(-/- mice, and this was associated with moderate variations in the expression of several cytokines. Eight DSS cycles caused chronic colitis in both wild-type and Mutyh(-/- mice. Lymphoid hyperplasia and a significant reduction in Foxp3(+ regulatory T cells were observed only in Mutyh(-/- mice. CONCLUSIONS: The findings indicate that, in this model of ulcerative colitis, Mutyh plays a major role in maintaining intestinal integrity by affecting the inflammatory response.

  12. Catalysts of DNA Strand Cleavage at Apurinic/Apyrimidinic Sites.

    Minko, Irina G; Jacobs, Aaron C; de Leon, Arnie R; Gruppi, Francesca; Donley, Nathan; Harris, Thomas M; Rizzo, Carmelo J; McCullough, Amanda K; Lloyd, R Stephen

    2016-01-01

    Apurinic/apyrimidinic (AP) sites are constantly formed in cellular DNA due to instability of the glycosidic bond, particularly at purines and various oxidized, alkylated, or otherwise damaged nucleobases. AP sites are also generated by DNA glycosylases that initiate DNA base excision repair. These lesions represent a significant block to DNA replication and are extremely mutagenic. Some DNA glycosylases possess AP lyase activities that nick the DNA strand at the deoxyribose moiety via a β- or β,δ-elimination reaction. Various amines can incise AP sites via a similar mechanism, but this non-enzymatic cleavage typically requires high reagent concentrations. Herein, we describe a new class of small molecules that function at low micromolar concentrations as both β- and β,δ-elimination catalysts at AP sites. Structure-activity relationships have established several characteristics that appear to be necessary for the formation of an iminium ion intermediate that self-catalyzes the elimination at the deoxyribose ring. PMID:27363485

  13. Removal of deaminated cytosines and detection of in vivo methylation in ancient DNA

    Briggs, A; Stenzel, U.; Meyer, M; Krause, J.; Kircher, M. (Manfred); Pääbo, S

    2010-01-01

    DNA sequences determined from ancient organisms have high error rates, primarily due to uracil bases created by cytosine deamination. We use synthetic oligonucleotides, as well as DNA extracted from mammoth and Neandertal remains, to show that treatment with uracil–DNA–glycosylase and endonuclease VIII removes uracil residues from ancient DNA and repairs most of the resulting abasic sites, leaving undamaged parts of the DNA fragments intact. Neandertal DNA sequences determined with this proto...

  14. Organisms posses enzymes that function in the repair of DNA damaged by radiations, chemicals and metabolic events

    This report briefly describes the studies on the mechanism of in vivo DNA repairing by the author in Research Reactor Institute, Kyoto Univ. for the past 30 years. First, the ability of UV radiation to induce transformation was investigated with viral DNA. The formation of thymine-thymine dimer was found harmful to organisms and such dimers were removable by UV-radiation at a low frequency. The mutability was determined in three different E.coli strains with mutator gene, mutT, mutS or mutL. The ability to excise 8-oxoguanin developed in primer DNA was deficient in mutT and miss-pairing left after DNA replication could not be recovered in mutL and mutS strains. Further, DNA repairing mechanism was investigated in other microorganisms; single-strand cleavage caused by exposure to BNCB radiation (boron-neutron-captured beam) could not be repaired in E. coli. Whereas for Deinococcus radiodurans, of which survival rate was not decreased by γ-ray radiation at 5 kGy or less, it was found that its single-strand DNA was damaged by γ-radiation to smaller molecules, but it was mended to the similar size to that in the non-irradiated cells during incubation. In addition, the transformation frequency was also recovered in the actinomycetes. Thus, it was demonstrated that de novo protein synthesis is necessary for the repairing system of recombination. (M.N.)

  15. Perturbations of enzymic uracil excision due to purine damage in DNA.

    Duker, N J; Jensen, D E; Hart, D M; Fishbein, D E

    1982-01-01

    Phage PBS-2 DNA, which contains uracil in place of thymine, was selectively damaged and then used as substrate for purified Bacillus subtilis uracil-DNA glycosylase. This enzyme releases uracil from DNA in a limited processive manner. Irradiation by ultraviolet light (greater than 305 nm) in the presence of isopropanol and a free radical photoinitiator introduced covalently bound 8-(2-hydroxy-2-propyl)purines into DNA. Methylation by dimethylsulfate yielded 7-methylguanine. Apurinic sites wer...

  16. Controlled exposure to diesel exhaust and traffic noise - Effects on oxidative stress and activation in mononuclear blood cells

    Hemmingsen, Jette Gjerke; Møller, Peter; Jantzen, Kim;

    2015-01-01

    Particulate air pollution increases risk of cancer and cardiopulmonary disease, partly through oxidative stress. Traffic-related noise increases risk of cardiovascular disease and may cause oxidative stress. In this controlled random sequence study, 18 healthy subjects were exposed for 3h to diesel...... exhaust (DE) at 276μg/m(3) from a passenger car or filtered air, with co-exposure to traffic noise at 48 or 75dB(A). Gene expression markers of inflammation, (interleukin-8 and tumor necrosis factor), oxidative stress (heme oxygenase (decycling-1)) and DNA repair (8-oxoguanine DNA glycosylase (OGG1)) were...... unaltered in peripheral blood mononuclear cells (PBMCs). No significant differences in DNA damage levels, measured by the comet assay, were observed after DE exposure, whereas exposure to high noise levels was associated with significantly increased levels of hOGG1-sensitive sites in PBMCs. Urinary levels...

  17. 3CAPS – a structural AP–site analogue as a tool to investigate DNA base excision repair

    Schuermann, David; Scheidegger, Simon P.; Weber, Alain R.; Bjørås, Magnar; Leumann, Christian J.; Schär, Primo

    2016-01-01

    Abasic sites (AP-sites) are frequent DNA lesions, arising by spontaneous base hydrolysis or as intermediates of base excision repair (BER). The hemiacetal at the anomeric centre renders them chemically reactive, which presents a challenge to biochemical and structural investigation. Chemically more stable AP-site analogues have been used to avoid spontaneous decay, but these do not fully recapitulate the features of natural AP–sites. With its 3′–phosphate replaced by methylene, the abasic site analogue 3CAPS was suggested to circumvent some of these limitations. Here, we evaluated the properties of 3CAPS in biochemical BER assays with mammalian proteins. 3CAPS-containing DNA substrates were processed by APE1, albeit with comparably poor efficiency. APE1-cleaved 3CAPS can be extended by DNA polymerase β but repaired only by strand displacement as the 5′–deoxyribophosphate (dRP) cannot be removed. DNA glycosylases physically and functionally interact with 3CAPS substrates, underlining its structural integrity and biochemical reactivity. The AP lyase activity of bifunctional DNA glycosylases (NTH1, NEIL1, FPG), however, was fully inhibited. Notably, 3CAPS-containing DNA also effectively inhibited the activity of bifunctional glycosylases on authentic substrates. Hence, the chemically stable 3CAPS with its preserved hemiacetal functionality is a potent tool for BER research and a potential inhibitor of bifunctional DNA glycosylases. PMID:26733580

  18. An unprecedented nucleic acid capture mechanism for excision of DNA damage

    Rubinson, Emily H.; Prakasha Gowda, A.S.; Spratt, Thomas E.; Gold, Barry; Eichmanbrand, Brandt F. (Pitt); (Vanderbilt); (Penn)

    2010-11-18

    DNA glycosylases that remove alkylated and deaminated purine nucleobases are essential DNA repair enzymes that protect the genome, and at the same time confound cancer alkylation therapy, by excising cytotoxic N3-methyladenine bases formed by DNA-targeting anticancer compounds. The basis for glycosylase specificity towards N3- and N7-alkylpurines is believed to result from intrinsic instability of the modified bases and not from direct enzyme functional group chemistry. Here we present crystal structures of the recently discovered Bacillus cereus AlkD glycosylase in complex with DNAs containing alkylated, mismatched and abasic nucleotides. Unlike other glycosylases, AlkD captures the extrahelical lesion in a solvent-exposed orientation, providing an illustration for how hydrolysis of N3- and N7-alkylated bases may be facilitated by increased lifetime out of the DNA helix. The structures and supporting biochemical analysis of base flipping and catalysis reveal how the HEAT repeats of AlkD distort the DNA backbone to detect non-Watson-Crick base pairs without duplex intercalation.

  19. Regulation and function of DNA methylation in plants and animals

    He, Xinjian

    2011-02-15

    DNA methylation is an important epigenetic mark involved in diverse biological processes. In plants, DNA methylation can be established through the RNA-directed DNA methylation pathway, an RNA interference pathway for transcriptional gene silencing (TGS), which requires 24-nt small interfering RNAs. In mammals, de novo DNA methylation occurs primarily at two developmental stages: during early embryogenesis and during gametogenesis. While it is not clear whether establishment of DNA methylation patterns in mammals involves RNA interference in general, de novo DNA methylation and suppression of transposons in germ cells require 24-32-nt piwi-interacting small RNAs. DNA methylation status is dynamically regulated by DNA methylation and demethylation reactions. In plants, active DNA demethylation relies on the repressor of silencing 1 family of bifunctional DNA glycosylases, which remove the 5-methylcytosine base and then cleave the DNA backbone at the abasic site, initiating a base excision repair (BER) pathway. In animals, multiple mechanisms of active DNA demethylation have been proposed, including a deaminase- and DNA glycosylase-initiated BER pathway. New information concerning the effects of various histone modifications on the establishment and maintenance of DNA methylation has broadened our understanding of the regulation of DNA methylation. The function of DNA methylation in plants and animals is also discussed in this review. © 2011 IBCB, SIBS, CAS All rights reserved.

  20. The roles of APE1, APE2, DNA polymerase β and mismatch repair in creating S region DNA breaks during antibody class switch

    Schrader, Carol E.; Guikema, Jeroen E.J.; Wu, Xiaoming; Stavnezer, Janet

    2008-01-01

    Immunoglobulin class switch recombination (CSR) occurs by an intrachromosomal deletion requiring generation of double-stranded DNA breaks (DSBs) in immunoglobulin switch region DNA. The initial steps of DSB formation have been elucidated: cytosine deamination by activation-induced cytidine deaminase (AID) and the generation of abasic sites by uracil-DNA glycosylase (UNG). We show that abasic sites are converted into single-strand breaks (SSBs) by apurinic/apyrimidinic endonucleases (APE1 and ...

  1. Non-canonical uracil processing in DNA gives rise to double-strand breaks and deletions

    Bregenhorn, Stephanie; Kallenberger, Lia; Artola-Borán, Mariela;

    2016-01-01

    , repetitive sequences flanking the CHloci, to uracils. Although U/G mispairs arising in this way are generally efficiently repaired to C/Gs by uracil DNA glycosylase (UNG)-initiated base excision repair (BER), uracil processing in S-regions of activated B-cells occasionally gives rise to double strand breaks...

  2. Factors that influence telomeric oxidative base damage and repair by DNA glycosylase OGG1

    Rhee, David B; Ghosh, Avik; Lu, Jian; Bohr, Vilhelm A; Liu, Yie

    2011-01-01

    -telomeric double-stranded substrates. In addition, telomere repeat binding factors TRF1 and TRF2 do not impair OGG1 incision activity. Yet, 8-oxodG in some telomere structures (e.g., fork-opening, 3'-overhang, and D-loop) were less effectively excised by OGG1, depending upon its position in these substrates...

  3. Regulation of MUTYH, a DNA Repair Enzyme, in Renal Proximal Tubular Epithelial Cells

    Jianping Lu

    2015-01-01

    Full Text Available MUTYH is a DNA repair enzyme that initiates a base excision repair (BER by recognizing and removing 8-Oxoguanine (8-oxoG and its paired adenine. We demonstrated that both TGF-β1 and H2O2 treatment led to an increased 8-oxoG in cultured human proximal tubule epithelial (HK-2 cells, while the former induced epithelial-mesenchymal transition and the latter caused cell apoptosis. Without stimulation, HK-2 cells showed MUTYH expression in mitochondria. TGF-β1 triggered a transient upregulation of mitochondrial MUTYH and induced the expression of nuclear isoforms, while H2O2 showed no role on MUTYH expression. Ureteral obstruction (UUO mice exhibited high 8-oxoG reactivity with tubulointerstitial lesions. After obstruction, the MUTYH expression was increased only in tubules at day 3 and decreased with obvious tubular atrophy at day 10. Particularly, MUTYH was primarily located in normal tubular cytoplasm with a dominant mitochondrial form. A few cells with nuclear MUTYH expression were observed in the fibrotic interstitium. We confirmed that increased MUTYH expression was upregulated and positively correlated with the severity of kidney fibrosis. Thus, renal fibrosis caused a cell-type-specific and time-dependent response of oxidative DNA repairs, even within the same tissues. It suggests that intervention of MUTYH might be effective for therapies.

  4. Dicty_cDB: Contig-U08947-1 [Dicty_cDB

    Full Text Available e) Candida dubliniensis CD36 chromo... 98 3e-19 U88620_1( U88620 |pid:none) Human 8-hydroxyguanine glycos...e) Leishmania braziliensis chromoso... 61 3e-08 CP000679_1443( CP000679 |pid:none) Caldicellulosi...as fluorescens SBW25 c... 36 1.1 CU207211_747( CU207211 |pid:none) Herminiimonas arseni.... 35 3.3 CP000644_2306( CP000644 |pid:none) Aeromonas salmonicida subsp. sa... 35 3.3 AE010299_4494( AE010299 |pid:none) Methanos...T46962( T46962 ) 8-oxoguanine DNA-glycosylase [validated] - mouse ... 109 1e-22 Y13479_1( Y13479 |pid:none)

  5. Nitroglycerin induces DNA damage and vascular cell death in the setting of nitrate tolerance.

    Mikhed, Yuliya; Fahrer, Jörg; Oelze, Matthias; Kröller-Schön, Swenja; Steven, Sebastian; Welschof, Philipp; Zinßius, Elena; Stamm, Paul; Kashani, Fatemeh; Roohani, Siyer; Kress, Joana Melanie; Ullmann, Elisabeth; Tran, Lan P; Schulz, Eberhard; Epe, Bernd; Kaina, Bernd; Münzel, Thomas; Daiber, Andreas

    2016-07-01

    Nitroglycerin (GTN) and other organic nitrates are widely used vasodilators. Their side effects are development of nitrate tolerance and endothelial dysfunction. Given the potential of GTN to induce nitro-oxidative stress, we investigated the interaction between nitro-oxidative DNA damage and vascular dysfunction in experimental nitrate tolerance. Cultured endothelial hybridoma cells (EA.hy 926) and Wistar rats were treated with GTN (ex vivo: 10-1000 µM; in vivo: 10, 20 and 50 mg/kg/day for 3 days, s.c.). The level of DNA strand breaks, 8-oxoguanine and O (6)-methylguanine DNA adducts was determined by Comet assay, dot blot and immunohistochemistry. Vascular function was determined by isometric tension recording. DNA adducts and strand breaks were induced by GTN in cells in vitro in a concentration-dependent manner. GTN in vivo administration leads to endothelial dysfunction, nitrate tolerance, aortic and cardiac oxidative stress, formation of DNA adducts, stabilization of p53 and apoptotic death of vascular cells in a dose-dependent fashion. Mice lacking O (6)-methylguanine-DNA methyltransferase displayed more vascular O (6)-methylguanine adducts and oxidative stress under GTN therapy than wild-type mice. Although we were not able to prove a causal role of DNA damage in the etiology of nitrate tolerance, the finding of GTN-induced DNA damage such as the mutagenic and toxic adduct O (6)-methylguanine, and cell death supports the notion that GTN based therapy may provoke adverse side effects, including endothelial function. Further studies are warranted to clarify whether GTN pro-apoptotic effects are related to an impaired recovery of patients upon myocardial infarction. PMID:27357950

  6. Relation between DNA damage measured by comet assay and OGG1 Ser326Cys polymorphism in antineoplastic drugs biomonitoring

    Carina Ladeira; Susana Viegas; Mário Pádua; Elisabete Carolino; Gomes, Manuel C.; Miguel Brito

    2015-01-01

    Antineoplastic drugs are hazardous chemical agents used mostly in the treatment of patients with cancer, however health professionals that handle and administer these drugs can become exposed and develop DNA damage. Comet assay is a standard method for assessing DNA damage in human biomonitoring and, combined with formamidopyrimidine DNA glycosylase (FPG) enzyme, it specifically detects DNA oxidative damage.The aim of this study was to investigate genotoxic effects in workers occupationally e...

  7. FANCJ helicase uniquely senses oxidative base damage in either strand of duplex DNA and is stimulated by replication protein A to unwind the damaged DNA substrate in a strand-specific manner.

    Suhasini, Avvaru N; Sommers, Joshua A; Mason, Aaron C; Voloshin, Oleg N; Camerini-Otero, R Daniel; Wold, Marc S; Brosh, Robert M

    2009-07-01

    FANCJ mutations are genetically linked to the Fanconi anemia complementation group J and predispose individuals to breast cancer. Understanding the role of FANCJ in DNA metabolism and how FANCJ dysfunction leads to tumorigenesis requires mechanistic studies of FANCJ helicase and its protein partners. In this work, we have examined the ability of FANCJ to unwind DNA molecules with specific base damage that can be mutagenic or lethal. FANCJ was inhibited by a single thymine glycol, but not 8-oxoguanine, in either the translocating or nontranslocating strands of the helicase substrate. In contrast, the human RecQ helicases (BLM, RECQ1, and WRN) display strand-specific inhibition of unwinding by the thymine glycol damage, whereas other DNA helicases (DinG, DnaB, and UvrD) are not significantly inhibited by thymine glycol in either strand. In the presence of replication protein A (RPA), but not Escherichia coli single-stranded DNA-binding protein, FANCJ efficiently unwound the DNA substrate harboring the thymine glycol damage in the nontranslocating strand; however, inhibition of FANCJ helicase activity by the translocating strand thymine glycol was not relieved. Strand-specific stimulation of human RECQ1 helicase activity was also observed, and RPA bound with high affinity to single-stranded DNA containing a single thymine glycol. Based on the biochemical studies, we propose a model for the specific functional interaction between RPA and FANCJ on the thymine glycol substrates. These studies are relevant to the roles of RPA, FANCJ, and other DNA helicases in the metabolism of damaged DNA that can interfere with basic cellular processes of DNA metabolism. PMID:19419957

  8. DNA repair in bacterial cultures and plasmid DNA exposed to infrared laser for treatment of pain

    Biostimulation of tissues by low intensity lasers has been described on a photobiological basis and clinical protocols are recommended for treatment of various diseases, but their effects on DNA are controversial. The objective of this work was to evaluate effects of low intensity infrared laser exposure on survival and bacterial filamentation in Escherichia coli cultures, and induction of DNA lesions in bacterial plasmids. In E. coli cultures and plasmids exposed to an infrared laser at fluences used to treat pain, bacterial survival and filamentation and DNA lesions in plasmids were evaluated by electrophoretic profile. Data indicate that the infrared laser (i) increases survival of E. coli wild type in 24 h of stationary growth phase, (ii) induces bacterial filamentation, (iii) does not alter topological forms of plasmids and (iv) does not alter the electrophoretic profile of plasmids incubated with exonuclease III or formamidopyrimidine DNA glycosylase. A low intensity infrared laser at the therapeutic fluences used to treat pain can alter survival of E. coli wild type, induce filamentation in bacterial cells, depending on physiologic conditions and DNA repair, and induce DNA lesions other than single or double DNA strand breaks or alkali-labile sites, which are not targeted by exonuclease III or formamidopyrimidine DNA glycosylase. (letter)

  9. DNA repair in bacterial cultures and plasmid DNA exposed to infrared laser for treatment of pain

    Canuto, K. S.; Sergio, L. P. S.; Marciano, R. S.; Guimarães, O. R.; Polignano, G. A. C.; Geller, M.; Paoli, F.; Fonseca, A. S.

    2013-06-01

    Biostimulation of tissues by low intensity lasers has been described on a photobiological basis and clinical protocols are recommended for treatment of various diseases, but their effects on DNA are controversial. The objective of this work was to evaluate effects of low intensity infrared laser exposure on survival and bacterial filamentation in Escherichia coli cultures, and induction of DNA lesions in bacterial plasmids. In E. coli cultures and plasmids exposed to an infrared laser at fluences used to treat pain, bacterial survival and filamentation and DNA lesions in plasmids were evaluated by electrophoretic profile. Data indicate that the infrared laser (i) increases survival of E. coli wild type in 24 h of stationary growth phase, (ii) induces bacterial filamentation, (iii) does not alter topological forms of plasmids and (iv) does not alter the electrophoretic profile of plasmids incubated with exonuclease III or formamidopyrimidine DNA glycosylase. A low intensity infrared laser at the therapeutic fluences used to treat pain can alter survival of E. coli wild type, induce filamentation in bacterial cells, depending on physiologic conditions and DNA repair, and induce DNA lesions other than single or double DNA strand breaks or alkali-labile sites, which are not targeted by exonuclease III or formamidopyrimidine DNA glycosylase.

  10. Finding and Producing Probiotic Glycosylases for the Biocatalysis of Ginsenosides: A Mini Review.

    Ku, Seockmo

    2016-01-01

    Various microorganisms have been widely applied in nutraceutical industries for the processing of phytochemical conversion. Specifically, in the Asian food industry and academia, notable attention is paid to the biocatalytic process of ginsenosides (ginseng saponins) using probiotic bacteria that produce high levels of glycosyl-hydrolases. Multiple groups have conducted experiments in order to determine the best conditions to produce more active and stable enzymes, which can be applicable to produce diverse types of ginsenosides for commercial applications. In this sense, there are various reviews that cover the biofunctional effects of multiple types of ginsenosides and the pathways of ginsenoside deglycosylation. However, little work has been published on the production methods of probiotic enzymes, which is a critical component of ginsenoside processing. This review aims to investigate current preparation methods, results on the discovery of new glycosylases, the application potential of probiotic enzymes and their use for biocatalysis of ginsenosides in the nutraceutical industry. PMID:27196878

  11. Finding and Producing Probiotic Glycosylases for the Biocatalysis of Ginsenosides: A Mini Review

    Seockmo Ku

    2016-05-01

    Full Text Available Various microorganisms have been widely applied in nutraceutical industries for the processing of phytochemical conversion. Specifically, in the Asian food industry and academia, notable attention is paid to the biocatalytic process of ginsenosides (ginseng saponins using probiotic bacteria that produce high levels of glycosyl-hydrolases. Multiple groups have conducted experiments in order to determine the best conditions to produce more active and stable enzymes, which can be applicable to produce diverse types of ginsenosides for commercial applications. In this sense, there are various reviews that cover the biofunctional effects of multiple types of ginsenosides and the pathways of ginsenoside deglycosylation. However, little work has been published on the production methods of probiotic enzymes, which is a critical component of ginsenoside processing. This review aims to investigate current preparation methods, results on the discovery of new glycosylases, the application potential of probiotic enzymes and their use for biocatalysis of ginsenosides in the nutraceutical industry.

  12. Urinary excretion of 8-oxo-7,8-dihydroguanine as biomarker of oxidative damage to DNA.

    Loft, Steffen; Danielsen, Pernille; Løhr, Mille; Jantzen, Kim; Hemmingsen, Jette G.; Roursgaard, Martin; Karotki, Dorina Gabriela; Møller, Peter

    2012-01-01

    Oxidatively damaged DNA may be important in carcinogenesis. 8-Oxo-7,8-dihydroguanine (8-oxoGua) is an abundant and mutagenic lesion excised by oxoguanine DNA glycosylase 1 (OGG1) and measurable in urine or plasma by chromatographic methods with electrochemical or mass spectrometric detectors, reflecting the rate of damage in steady state. A common genetic OGG1 variant may affect the activity and was associated with increased levels of oxidized purines in leukocytes without apparent effect on ...

  13. The theoretical study of charge transfer through damaged DNA duplexes

    Šebera, Jakub; Humpolíčková, Jana; Hof, Martin; Kratochvílová, Irena; Páv, Ondřej; Rosenberg, Ivan; Nencka, Radim; Tanaka, Y.; Sychrovský, Vladimír

    Nagybörzsöny : -, 2014. [CESTC 2014. Central European Symposium on Theoretical Chemistry. 21.09.2014-25.09.2014, Nagybörzsöny] R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 ; RVO:61388955 ; RVO:68378271 Keywords : charge transfer * 8-oxoguanine * fluorescence spectroscopy Subject RIV: CF - Physical ; Theoretical Chemistry

  14. Association of polymorphisms hOGG1 rs1052133 and hMUTYH rs3219472 with risk of nasopharyngeal carcinoma in a Chinese population

    Xie Y

    2016-02-01

    Full Text Available Ying Xie,2 Yuan Wu,3 Xunzhao Zhou,3 Mengwei Yao,3 Sisi Ning,3 Zhengbo Wei1 1Department of Head and Neck Tumor Surgery, Affiliated Tumor Hospital of Guangxi Medical University, 2Guangxi Key Laboratory for High-Incidence Tumor Prevention and Treatment, Experimental Center of Medical Science of Guangxi Medical University,3Graduate School of Guangxi Medical University, Nanning, People’s Republic of China Abstract: This case–control study investigates the possible relationships between the single-nucleotide polymorphisms rs1052133 in the human 8-oxoguanine DNA glycosylase 1 (hOGG1 gene and rs3219472 in the human MutY glycosylase homologue (hMUTYH gene and the risk of nasopharyngeal carcinoma (NPC. The two polymorphisms were genotyped in 488 unrelated NPC patients and 573 cancer-free controls. Genotype GG at rs1052133 was associated with significantly lower NPC risk than genotypes GC + CC (odds ratio [OR] 0.770, 95% confidence interval [CI] 0.595–0.996, P=0.012. In subgroup analyses, subjects with genotype GG at rs1052133 were at lower risk of NPC than those with GC or CC among individuals older than 40 years (OR 0.706, 95% CI 0.524–0.950, women (OR 0.571, 95% CI 0.337–0.968, and those with no smoking history (OR 0.634, 95% CI 0.463–0.868. No significant association was seen between polymorphisms at hMUTYH rs3219472 and the risk of NPC. However, gene–gene interaction analysis showed that subjects with genotype CC at rs1052133 and genotype AA at rs3219472 (CC/AA were at 2.887-fold higher risk of NPC than those with GG/GG, 3.183-fold higher risk than those with GG/GA, and 3.392-fold higher risk than those with GG/AA. Our results suggest that hOGG1 rs1052133 polymorphism may play an important role in NPC pathogenesis, especially among women, >40 years old, and those with no smoking history. The hMUTYH rs3219472 polymorphism may interact with hOGG1 rs1052133 polymorphism to influence susceptibility to NPC. Keywords: nasopharyngeal

  15. Mutational Analysis of hOGG1 Gene Promoter in Patients with Non-small Cell Lung Cancer

    Xia LIU

    2011-03-01

    Full Text Available Background and objective 8-hydroxygumine DNA glycosylase 1 (OGG1 is a DNA repair enzyme, which can repair damaged DNA by excising 8-dihydro-8-oxoguanine (8-OH-G. Polymorphisms in human OGG1 gene (hOGG1 may alter glycosylase activity, thereby affects its repair to the damaged DNA, resulting in contribution to carcinogenesis. However, an association of genetic variants of hOGG1 promoter with non-small cell lung cancer (NSCLC remains unclear. The present study aims to explore whether there are mutations in the promoter region of hOGG1 and the association of the potential genetic variants with NSCLC. Methods Forty lung cancer patients were enrolled from January, 2003 to December, 2005 in the first affiliated hospital of Soochow University. PCR-SSCP followed by direct sequencing were performed to detect mutations within the promoter region of the hOGG1 gene in NSCLC and corresponding paracancerous lung tissues. Results No abnormal mutation was found in the promoter region of the hOGG1 gene in 40 patients with NSCLC. However, a SNP rs159153 in hOGG1 was significantly associated with higher TNM stage (P=0.008. Moreover, lower frequency of lymph node metastasis was observed in smoker patients with NSCLC (P=0.034. Conclusion The SNP rs159153 in the promoter region of the hOGG1 gene and smoking history may effectively forebode the aggressiveness and metastatic potential of NSCLC.

  16. Acute hypoxia and hypoxic exercise induce DNA strand breaks and oxidative DNA damage in humans

    Møller, P; Loft, S; Lundby, C;

    2001-01-01

    The present study investigated the effect of a single bout of exhaustive exercise on the generation of DNA strand breaks and oxidative DNA damage under normal conditions and at high-altitude hypoxia (4559 meters for 3 days). Twelve healthy subjects performed a maximal bicycle exercise test......; lymphocytes were isolated for analysis of DNA strand breaks and oxidatively altered nucleotides, detected by endonuclease III and formamidipyridine glycosylase (FPG) enzymes. Urine was collected for 24 h periods for analysis of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG), a marker of oxidative DNA damage....... Urinary excretion of 8-oxodG increased during the first day in altitude hypoxia, and there were more endonuclease III-sensitive sites on day 3 at high altitude. The subjects had more DNA strand breaks in altitude hypoxia than at sea level. The level of DNA strand breaks further increased immediately after...

  17. Relationship between the capacity to repair 8-oxoguanine, biomarkers of genotxicity and individual susceptibility in styrene-exposed workers

    Slyšková, Jana; Dušinská, M.; Kuricová, M.; Souček, P.; Vodičková, Ludmila; Susová, S.; Naccarati, Alessio; Tulupová, Elena; Vodička, Pavel

    2007-01-01

    Roč. 634, - (2007), s. 101-111. ISSN 1383-5718 R&D Projects: GA MZd(CZ) NR8563; GA ČR GA310/05/2626 Grant ostatní: EU(SE) 505609 Institutional research plan: CEZ:AV0Z50390512 Source of funding: R - rámcový projekt EK Keywords : Occupational exposure * Styrene * Oxidative damage Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.278, year: 2007

  18. Polymorphisms of DNA repair genes OGG1 and XPD and the risk of age-related cataract in Egyptians

    Gharib, Amal F.; Dabour, Sherif A.; Fouad, Rania A.

    2014-01-01

    Purpose To analyze the association of the polymorphisms of xeroderma pigmentosum complementation group D (XPD) and 8-oxoguanine glycosylase-1 (OGG1) genes with the risk of age-related cataract (ARC) in an Egyptian population. Methods This case-control study included 150 patients with ARC and 50 controls. Genotyping of XPD Asp312Asn was performed by amplification refractory mutation system PCR assay and genotyping of OGG1 Ser326Cys was carried out by PCR including confronting two-pair primers. Results The Asn/Asn genotype of XPD gene was significantly associated with increased risk of ARC (odds ratio [OR] = 2.74, 95% confidence interval [CI] = 1.01–7.43, p = 0.04) and cortical cataract (OR = 5.06, 95% CI = 1.70–15.05, p = 0.002). The Asn312 allele was significantly associated with an increased risk of ARC (OR = 1.75, 95% CI 1.06–2.89, p = 0.03) and cortical cataract (OR = 2.81, 95% CI = 1.56–5.08, p<0.001). The OGG1 Cys/Cys genotype frequency was significantly higher in ARC (OR = 4.13, 95% CI = 0.93–18.21, p = 0.04) and the Cys326 allele (OR = 1.85, 95% CI = 1.07–3.20, p = 0.03). Moreover, the Cys/Cys genotype of the OGG1 gene was significantly higher in cortical cataract (OR = 6.00, 95% CI = 1.24–28.99, p = 0.01) and the Cys326 allele was also significantly associated with cortical cataract (OR = 2.45, 95% CI = 1.30–4.63, p = 0.005). Conclusions The results suggest that the Asn/Asn genotype and Asn312 allele of XPD polymorphism, as well as the Cys/Cys genotype and Cys326 allele of the OGG1 polymorphism, may be associated with increased risk of the development of ARC, particularly the cortical type, in the Egyptian population. PMID:24868140

  19. Error-Prone Translesion DNA Synthesis by Escherichia coli DNA Polymerase IV (DinB on Templates Containing 1,2-dihydro-2-oxoadenine

    Masaki Hori

    2010-01-01

    Full Text Available Escherichia coli DNA polymerase IV (Pol IV is involved in bypass replication of damaged bases in DNA. Reactive oxygen species (ROS are generated continuously during normal metabolism and as a result of exogenous stress such as ionizing radiation. ROS induce various kinds of base damage in DNA. It is important to examine whether Pol IV is able to bypass oxidatively damaged bases. In this study, recombinant Pol IV was incubated with oligonucleotides containing thymine glycol (dTg, 5-formyluracil (5-fodU, 5-hydroxymethyluracil (5-hmdU, 7,8-dihydro-8-oxoguanine (8-oxodG and 1,2-dihydro-2-oxoadenine (2-oxodA. Primer extension assays revealed that Pol IV preferred to insert dATP opposite 5-fodU and 5-hmdU, while it inefficiently inserted nucleotides opposite dTg. Pol IV inserted dCTP and dATP opposite 8-oxodG, while the ability was low. It inserted dCTP more effectively than dTTP opposite 2-oxodA. Pol IV's ability to bypass these lesions decreased in the order: 2-oxodA > 5-fodU~5-hmdU > 8-oxodG > dTg. The fact that Pol IV preferred to insert dCTP opposite 2-oxodA suggests the mutagenic potential of 2-oxodA leading to A:T→G:C transitions. Hydrogen peroxide caused an ~2-fold increase in A:T→G:C mutations in E. coli, while the increase was significantly greater in E. coli overexpressing Pol IV. These results indicate that Pol IV may be involved in ROS-enhanced A:T→G:C mutations.

  20. Association of the hOGG1 Ser326Cys polymorphism with sporadic amyotrophic lateral sclerosis.

    Coppedè, Fabio; Mancuso, Michelangelo; Lo Gerfo, Annalisa; Carlesi, Cecilia; Piazza, Selina; Rocchi, Anna; Petrozzi, Lucia; Nesti, Claudia; Micheli, Dario; Bacci, Andrea; Migliore, Lucia; Murri, Luigi; Siciliano, Gabriele

    2007-06-13

    Amyotropic lateral sclerosis (ALS) is a fatal and progressive neurodegenerative disease causing the loss of motoneurons of the brain and the spinal cord. The etiology of ALS is still uncertain, but males are at increased risk for the disease than females. Several studies have suggested that motoneurons in ALS might be subjected to the double insult of increased DNA oxidative damage and deficiencies in DNA repair systems. Particularly, increased levels of 8-oxoguanine and impairments of the DNA base excision repair system have been observed in neurons of ALS patients. There is evidence that the Ser326Cys polymorphism of the human 8-oxoguanine DNA glycosylase 1 (hOGG1) gene is associated with a reduced DNA repair activity. To evaluate the role of the hOGG1 Ser326Cys polymorphism in sporadic ALS (sALS), we screened 136 patients and 129 matched controls. In the total population, we observed association between both the Cys326 allele (p=0.02) and the combined Ser326Cys+Cys326Cys genotype (OR=1.65, 95% CI=1.06-2.88) and increased risk of disease. After stratification by gender, the Cys326 allele (p=0.01), both the Ser326Cys genotype (OR=2.14, 95% CI=1.09-4.19) and the combined Ser326Cys+Cys326Cys genotype (OR=2.15, 95% CI=1.16-4.01) were associated with sALS risk only in males. No significant association between the Ser326Cys polymorphism and disease phenotype, including age and site of onset and disease progression, was observed. Present results suggest a possible involvement of the hOGG1 Ser326Cys polymorphism in sALS pathogenesis. PMID:17531381

  1. Repair of U/G and U/A in DNA by UNG2-associated repair complexes takes place predominantly by short-patch repair both in proliferating and growth-arrested cells

    Akbari, Mansour; Otterlei, Marit; Pena Diaz, Javier; Aas, Per Arne; Kavli, Bodil; Liabakk, Nina B; Hagen, Lars; Imai, Kohsuke; Durandy, Anne; Slupphaug, Geir; Krokan, Hans E

    2004-01-01

    Nuclear uracil-DNA glycosylase UNG2 has an established role in repair of U/A pairs resulting from misincorporation of dUMP during replication. In antigen-stimulated B-lymphocytes UNG2 removes uracil from U/G mispairs as part of somatic hypermutation and class switch recombination processes. Using...

  2. Oxidatively damaged DNA and its repair after experimental exposure to wood smoke in healthy humans

    Danielsen, Pernille Høgh; Bräuner, Elvira Vaclavik; Barregard, Lars;

    2008-01-01

    exposure, from bedtime until the next morning. We measured the levels of DNA strand breaks (SB), oxidized purines as formamidopyrimidine-DNA-glycosylase (FPG) sites and activity of oxoguanine glycosylase 1 (hOGG1) in PBMC by the comet assay, whereas mRNA levels of hOGG1, nucleoside diphosphate linked...... chromatography with mass spectrometry. The morning following exposure to wood smoke the PBMC levels of SB were significantly decreased and the mRNA levels of hOGG1 significantly increased. FPG sites, hOGG1 activity, expression of hNUDT1 and hHO1, urinary excretion of 8-oxodG and 8-oxoGua did not change...

  3. Characterization of protein interactomes of DNA damages: application to oxidation injuries

    Cyclo-nucleosides are complex DNA damages implying both bases and sugar residues. They are generated by free radicals, in particular by the effect of ionizing radiations, and are not easily covered by cellular mechanisms. Using a protein trapping technique on probes containing these injuries, the negative influence of cyclo-nucleosides on the recognition of its target sequence by a DREF transcription factor and on the interactions of PARP1 with DNA have been identified. Interactions between Fpg bacterial glycosylase and cyclo-nucleosides have been analysed and it has been found that this enzyme has an affinity for them, without excision activity. Finally, a Thermococcus gammatolerans radiation resistant archae has been studied: the formation of simple and complex oxidation injuries at strong radiation doses has been measured and the action mechanism of two new glycosylases has been explained. (author)

  4. Measurement of DNA strand breakage and DNA repair induced with hydrogen peroxide using single cell gel electrophoresis, alkaline DNA unwinding and alkaline elution of DNA

    Three techniques single cell gel electrophoresis (SCGE), alkaline elution of DNA, and alkaline DNA unwinding (ADU) were chosen to compare the sensitivity among these methods in detection of DNA damage and repair in human diploid VH10 cell line after short-term exposure to hydrogen peroxide. Using SCGE technique a dose-dependent increase in DNA migration was found in cell exposed to hydrogen peroxide in concentration range from 10 μmol/l. Alkaline DNA unwinding method detected increased level of single strand breaks (ssb) in concentration range from 25 μmol/l of H2O2, and alkaline elution of DNA estimated increased DNA elution rate from concentration 50 μmol/l of H2O2. In a time course study to evaluate the kinetics of DNA repair, both SCGE and ADU techniques showed that the repair of DNA strand breaks is very rapid; the level of ssb in treated cells has returned to near the background level within two hours. After this time damage remaining in the DNA was in the form of oxidised bases as revealed the incubation of treated cells with specific DNA repair endonuclease, formamidopyridine-DNA glycosylase. (author)

  5. Radiation-induced damage to DNA

    This short survey focuses on the main radiation-induced base lesions that have been identified within cellular DNA. For this purpose, sensitive assays that are aimed at measuring a few modifications per 107 normal bases were set-up. In that respect high performance liquid chromatography - tandem mass spectrometry (CLHP-MS/MS) was found to be able to single out the formation of 9 oxidized nucleosides and two modified nucleo-bases out of the 70 oxidative base lesions that have been identified in model systems. As a striking result, it was found that in the DNA of γ-irradiated human monocytes, the formamide-pyrimidine derivative of guanine is produced in a higher yield than the ubiquitous 8-oxo-7,8-dihydro-guanine damage, both arising from the same radical precursor. However, relatively high doses of ionizing radiation (> 20 Gy) have to be applied in order to detect an increase in the level of the damage. This is due to the low efficiency for both low and high LET radiations to generate oxidative damage to DNA on one hand and the occurrence of artifactual oxidation of the overwhelming normal bases during DNA extraction on the other hand. Interestingly, a modified comet assays that involves the combined use of the alkaline single gel electrophoretic technique and DNA repair N-glycosylases has allowed the detection of three main types of radiation-induced damage within the dose range 0.3 Gy -10 Gy. It appears that the total of frank DNA strand breaks and alkali-labile sites is similar to the sum of oxidized pyrimidine bases and modified purine bases that are recognized by the endonuclease Ill protein and the formamide-pyrimidine DNA N-glycosylase respectively. (author)

  6. Selective enzymatic cleavage and labeling for sensitive capillary electrophoresis laser-induced fluorescence analysis of oxidized DNA bases.

    Li, Cuiping; Wang, Hailin

    2015-08-01

    Oxidatively generated DNA damage is considered to be a significant contributing factor to cancer, aging, and age-related human diseases. It is important to detect oxidatively generated DNA damage to understand and clinically diagnosis diseases caused by oxidative damage. In this study, using selective enzymatic cleavage and quantum dot (QD) labeling, we developed a novel capillary electrophoresis-laser induced fluorescence method for the sensitive detection of oxidized DNA bases. First, oxidized DNA bases are recognized and removed by one DNA base excision repair glycosylase, leaving apurinic and apyrimidinic sites (AP sites) at the oxidized positions. The AP sites are further excised by the AP nicking activity of the chosen glycosylase, generating a nucleotide gap with 5'- and 3'- phosphate groups. After dephosphorylation with one alkaline phosphatase, a biotinylated ddNTP is introduced into the nucleotide space within the DNA strand by DNA polymerase I. The biotin-tagged DNA is further labeled with a QD-streptavidin conjugate via non-covalent interactions. The DNA-bound QD is well-separated from excess DNA-unbound QD by highly efficient capillary electrophoresis and is sensitively detected by online coupled laser-induced fluorescence analysis. Using this method, we can assess the trace levels of oxidized DNA bases induced by the Fenton reaction and UV irradiation. Interestingly, the use of the formamidopyrimidine glycosylase (FPG) protein and endonuclease VIII enables the detection of oxidized purine and pyrimidine bases, respectively. Using the synthesized standard DNA, the approach has low limits of detection of 1.1×10(-19)mol in mass and 2.9pM in concentration. PMID:26105778

  7. Salvia fruticosa reduces intrinsic cellular and H2O2-induced DNA oxidation in HEK 293 cells;assessment using flow cytometry

    Saleem Bani Hani; Mekki Bayachou

    2014-01-01

    Objective:To investigate the role of water-soluble extract of Salvia fruticosa (Greek sage) (S. fruticosa) leaves in reducing both intrinsic cellular and H2O2-induced DNA oxidation in cultured human embryonic kidney 293 cells. S. fruticosa, native to the Eastern-Mediterranean basin, is widely used as a medicinal herb for treatment of various diseases. Methods: Dried leaves of S. fruticosa were extracted in phosphate buffer saline and purified using both vacuum and high pressure filtrations. Each mL of the preparation contained (7.1±1.0) mg of extract. HEK-293 cells were incubated in one set with S. fruticosa extract in the presence of 0.1 mmol/L H2O2, and in the other set with the addition of the extract alone. The DNA oxidation was measured using fluorescence upon fluorescein isothiocyanate derivatization of 8-oxoguanine moieties. The fluorescence was measured using flow cytometry technique. Results:Cells incubated 3 h with 150 µL extract and exposed to 0.1 mmol/L H2O2 showed lower intensity of fluorescence, and thus lower DNA oxidation. Moreover, cells incubated 3 h with 100 µL of the extract showed lower intensity of fluorescence, and thus lower intrinsic cellular DNA oxidation compared to control (without S. fruticosa). Conclusions: The results from this study suggest that the water-soluble extract of S. fruticosa leaves protects against both H2O2-induced and intrinsic cellular DNA oxidation in human embryonic kidney 293 cells.

  8. miR-29 Represses the Activities of DNA Methyltransferases and DNA Demethylases

    Izuho Hatada

    2013-07-01

    Full Text Available Members of the microRNA-29 (miR-29 family directly target the DNA methyltransferases, DNMT3A and DNMT3B. Disturbances in the expression levels of miR-29 have been linked to tumorigenesis and tumor aggressiveness. Members of the miR-29 family are currently thought to repress DNA methylation and suppress tumorigenesis by protecting against de novo methylation. Here, we report that members of the miR-29 family repress the activities of DNA methyltransferases and DNA demethylases, which have opposing roles in control of DNA methylation status. Members of the miR-29 family directly inhibited DNA methyltransferases and two major factors involved in DNA demethylation, namely tet methylcytosine dioxygenase 1 (TET1 and thymine DNA glycosylase (TDG. Overexpression of miR-29 upregulated the global DNA methylation level in some cancer cells and downregulated DNA methylation in other cancer cells, suggesting that miR-29 suppresses tumorigenesis by protecting against changes in the existing DNA methylation status rather than by preventing de novo methylation of DNA.

  9. The tumor suppressor homolog in fission yeast, myh1+, displays a strong interaction with the checkpoint gene rad1+

    The DNA glycosylase MutY is strongly conserved in evolution, and homologs are found in most eukaryotes and prokaryotes examined. This protein is implicated in repair of oxidative DNA damage, in particular adenine mispaired opposite 7,8-dihydro-8-oxoguanine. Previous investigations in Escherichia coli, fission yeast, and mammalian cells show an association of mutations in MutY homologs with a mutator phenotype and carcinogenesis. Eukaryotic MutY homologs physically associate with several proteins with a role in replication, DNA repair, and checkpoint signaling, specifically the trimeric 9-1-1 complex. In a genetic investigation of the fission yeast MutY homolog, myh1+, we show that the myh1 mutation confers a moderately increased UV sensitivity alone and in combination with mutations in several DNA repair genes. The myh1 rad1, and to a lesser degree myh1 rad9, double mutants display a synthetic interaction resulting in enhanced sensitivity to DNA damaging agents and hydroxyurea. UV irradiation of myh1 rad1 double mutants results in severe chromosome segregation defects and visible DNA fragmentation, and a failure to activate the checkpoint. Additionally, myh1 rad1 double mutants exhibit morphological defects in the absence of DNA damaging agents. We also found a moderate suppression of the slow growth and UV sensitivity of rhp51 mutants by the myh1 mutation. Our results implicate fission yeast Myh1 in repair of a wider range of DNA damage than previously thought, and functionally link it to the checkpoint pathway

  10. DNA-dependent protein kinase inhibits AID-induced antibody gene conversion.

    Adam J L Cook

    2007-04-01

    Full Text Available Affinity maturation and class switching of antibodies requires activation-induced cytidine deaminase (AID-dependent hypermutation of Ig V(DJ rearrangements and Ig S regions, respectively, in activated B cells. AID deaminates deoxycytidine bases in Ig genes, converting them into deoxyuridines. In V(DJ regions, subsequent excision of the deaminated bases by uracil-DNA glycosylase, or by mismatch repair, leads to further point mutation or gene conversion, depending on the species. In Ig S regions, nicking at the abasic sites produced by AID and uracil-DNA glycosylases results in staggered double-strand breaks, whose repair by nonhomologous end joining mediates Ig class switching. We have tested whether nonhomologous end joining also plays a role in V(DJ hypermutation using chicken DT40 cells deficient for Ku70 or the DNA-dependent protein kinase catalytic subunit (DNA-PKcs. Inactivation of the Ku70 or DNA-PKcs genes in DT40 cells elevated the rate of AID-induced gene conversion as much as 5-fold. Furthermore, DNA-PKcs-deficiency appeared to reduce point mutation. The data provide strong evidence that double-strand DNA ends capable of recruiting the DNA-dependent protein kinase complex are important intermediates in Ig V gene conversion.

  11. DNA damage by the sulfate radical anion: hydrogen abstraction from the sugar moiety versus one-electron oxidation of guanine.

    Roginskaya, Marina; Mohseni, Reza; Ampadu-Boateng, Derrick; Razskazovskiy, Yuriy

    2016-07-01

    The products of oxidative damage to double-stranded (ds) DNA initiated by photolytically generated sulfate radical anions SO4(•-) were analyzed using reverse-phase (RP) high-performance liquid chromatography (HPLC). Relative efficiencies of two major pathways were compared: production of 8-oxoguanine (8oxoG) and hydrogen abstraction from the DNA 2-deoxyribose moiety (dR) at C1,' C4,' and C5' positions. The formation of 8oxoG was found to account for 87% of all quantified lesions at low illumination doses. The concentration of 8oxoG quickly reaches a steady state at about one 8oxoG per 100 base pairs due to further oxidation of its products. It was found that another guanine oxidation product identified as 2-amino-5-(2'-alkylamino)-4H-imidazol-4-one (X) was released in significant quantities from its tentative precursor 2-amino-5-[(2'-deoxy-β-d-erythro-pentofuranosyl)amino]-4H-imidazol-4-one (dIz) upon treatment with primary amines in neutral solutions. The linear dose dependence of X release points to the formation of dIz directly from guanine and not through oxidation of 8oxoG. The damage to dR was found to account for about 13% of the total damage, with majority of lesions (33%) originating from the C4' oxidation. The contribution of C1' oxidation also turned out to be significant (17% of all dR damages) despite of the steric problems associated with the abstraction of the C1'-hydrogen. However, no evidence of base-to-sugar free valence transfer as a possible alternative to direct hydrogen abstraction at C1' was found. PMID:27043476

  12. SUMO-1 possesses DNA binding activity

    Wieruszeski Jean-Michel

    2010-05-01

    Full Text Available Abstract Background Conjugation of small ubiquitin-related modifiers (SUMOs is a frequent post-translational modification of proteins. SUMOs can also temporally associate with protein-targets via SUMO binding motifs (SBMs. Protein sumoylation has been identified as an important regulatory mechanism especially in the regulation of transcription and the maintenance of genome stability. The precise molecular mechanisms by which SUMO conjugation and association act are, however, not understood. Findings Using NMR spectroscopy and protein-DNA cross-linking experiments, we demonstrate here that SUMO-1 can specifically interact with dsDNA in a sequence-independent fashion. We also show that SUMO-1 binding to DNA can compete with other protein-DNA interactions at the example of the regulatory domain of Thymine-DNA Glycosylase and, based on these competition studies, estimate the DNA binding constant of SUMO1 in the range 1 mM. Conclusion This finding provides an important insight into how SUMO-1 might exert its activity. SUMO-1 might play a general role in destabilizing DNA bound protein complexes thereby operating in a bottle-opener way of fashion, explaining its pivotal role in regulating the activity of many central transcription and DNA repair complexes.

  13. Comet-FISH with strand-specific probes reveals transcription-coupled repair of 8-oxoGuanine in human cells

    Guo, Jia; Hanawalt, Philip C.; Spivak, Graciela

    2013-01-01

    Oxidized bases in DNA have been implicated in cancer, aging and neurodegenerative disease. We have developed an approach combining single-cell gel electrophoresis (comet) with fluorescence in situ hybridization (FISH) that enables the comparative quantification of low, physiologically relevant levels of DNA lesions in the respective strands of defined nucleotide sequences and in the genome overall. We have synthesized single-stranded probes targeting the termini of DNA segments of interest using a polymerase chain reaction-based method. These probes facilitate detection of damage at the single-molecule level, as the lesions are converted to DNA strand breaks by lesion-specific endonucleases or glycosylases. To validate our method, we have documented transcription-coupled repair of cyclobutane pyrimidine dimers in the ataxia telangiectasia-mutated (ATM) gene in human fibroblasts irradiated with 254 nm ultraviolet at 0.1 J/m2, a dose ∼100-fold lower than those typically used. The high specificity and sensitivity of our approach revealed that 7,8-dihydro-8-oxoguanine (8-oxoG) at an incidence of approximately three lesions per megabase is preferentially repaired in the transcribed strand of the ATM gene. We have also demonstrated that the hOGG1, XPA, CSB and UVSSA proteins, as well as actively elongating RNA polymerase II, are required for this process, suggesting cross-talk between DNA repair pathways. PMID:23775797

  14. The role of DNA base damages in the x-ray inactivation of PM2 bacteriophage

    Base and sugar modifications are the predominant class of damages produced in DNA by ionizing radiation. A major radiolysis product of cytosine is uracil. In Escherichia coli misincorporated uracil residues in DNA are removed by the product of the ung gene, uracil-DNA glycosylase. The authors report here that ung/sup -/ mutants of E. coli were about two fold more sensitive to x-rays than ung/sup +/ when irradiated aerobically and about three fold more sensitive under anoxic conditions. Further, ung/sup -/ mutants were not sensitive to ultraviolet light. These results suggest that radiation-induced uracil residues are lethal lesions in E. coli cells. The production of uracil residues in PM2 DNA by ionizing radiation is currently being measured by the appearance of uracil-DNA glycosylase enzyme-sensitive sites and these will be related to the inactivation efficiency of uracil residues in PM2 transfecting DNA. The authors have done similar studies with thymine glycol, the major radiolysis product of thymine, alkali-labile (AP) sites, as well as single and double strand breaks. Thymine glycols accounted for 5.2% of PM2 phage lethal lesions, AP sites 13.8%, single strand breaks 4.2%, and double strand breaks 111.0%

  15. Non-canonical uracil processing in DNA gives rise to double-strand breaks and deletions: relevance to class switch recombination

    Bregenhorn, Stephanie; Kallenberger, Lia; Artola-Borán, Mariela; Peña-Diaz, Javier; Jiricny, Josef

    2016-01-01

    During class switch recombination (CSR), antigen-stimulated B-cells rearrange their immunoglobulin constant heavy chain (CH) loci to generate antibodies with different effector functions. CSR is initiated by activation-induced deaminase (AID), which converts cytosines in switch (S) regions, repetitive sequences flanking the CH loci, to uracils. Although U/G mispairs arising in this way are generally efficiently repaired to C/Gs by uracil DNA glycosylase (UNG)-initiated base excision repair (B...

  16. Infrared laser effects at fluences used for treatment of dentin hypersensitivity on DNA repair in Escherichia coli and plasmids

    Rocha Teixeira, Gleica; da Silva Marciano, Roberta; da Silva Sergio, Luiz Philippe; Castanheira Polignano, Giovanni Augusto; Roberto Guimarães, Oscar; Geller, Mauro; de Paoli, Flavia; de Souza da Fonseca, Adenilson

    2014-12-01

    Low-intensity infrared lasers are proposed in clinical protocols based on biostimulative effects, yet dosimetry is inaccurate and their effects on DNA at therapeutic doses are controversial. The aim of this work was to evaluate the effects of low-intensity infrared laser on survival and induction of filamentation of Escherichia coli cells, and induction of DNA lesions in bacterial plasmids. E. coli cultures were exposed to laser (808 nm, 100 mW, 40 and 60 J/cm2) to study bacterial survival and filamentation. Also, bacterial plasmids were exposed to laser to study DNA lesions by electrophoretic profile and action of DNA repair enzymes. Data indicate low-intensity infrared laser has no effect on survival of E. coli wild type and exonuclease III, but decreases the survival of formamidopyrimidine DNA glycosylase/MutM protein and endonuclease III deficient cells in stationary growth phase, induces bacterial filamentation, does not alter the electrophoretic profile of plasmids in agarose gels and does not alter the electrophoretic profile of plasmids incubated with endonuclease III, formamidopyrimidine DNA glycosylase/MutM protein and exonuclease III. Our findings show that low-intensity laser exposure causes DNA lesions at sub-lethal level and induces cellular mechanisms involved in repair of oxidative lesions in DNA. Studies about laser dosimetry and safety strategies are necessary for professionals and patients exposed to low-intensity lasers at therapeutic doses.

  17. A potential impact of DNA repair on ageing and lifespan in the ageing model organism Podospora anserina

    Soerensen, Mette; Gredilla, Ricardo; Müller-Ohldach, Mathis;

    2009-01-01

    The free radical theory of ageing states that ROS play a key role in age-related decrease in mitochondrial function via the damage of mitochondrial DNA (mtDNA), proteins and lipids. In the sexually reproducing ascomycete Podospora anserina ageing is, as in other eukaryotes, associated with mtDNA...... instability and mitochondrial dysfunction. Part of the mtDNA instabilities may arise due to accumulation of ROS induced mtDNA lesions, which, as previously suggested for mammals, may be caused by an age-related decrease in base excision repair (BER). Alignments of known BER protein sequences with the P....... anserina genome revealed high homology. We report for the first time the presence of BER activities in P. anserina mitochondrial extracts. DNA glycosylase activities decrease with age, suggesting that the increased mtDNA instability with age may be caused by decreased ability to repair mtDNA damage and...

  18. Repair of oxidative DNA base damage in the host genome influences the HIV integration site sequence preference.

    Geoffrey R Bennett

    Full Text Available Host base excision repair (BER proteins that repair oxidative damage enhance HIV infection. These proteins include the oxidative DNA damage glycosylases 8-oxo-guanine DNA glycosylase (OGG1 and mutY homolog (MYH as well as DNA polymerase beta (Polβ. While deletion of oxidative BER genes leads to decreased HIV infection and integration efficiency, the mechanism remains unknown. One hypothesis is that BER proteins repair the DNA gapped integration intermediate. An alternative hypothesis considers that the most common oxidative DNA base damages occur on guanines. The subtle consensus sequence preference at HIV integration sites includes multiple G:C base pairs surrounding the points of joining. These observations suggest a role for oxidative BER during integration targeting at the nucleotide level. We examined the hypothesis that BER repairs a gapped integration intermediate by measuring HIV infection efficiency in Polβ null cell lines complemented with active site point mutants of Polβ. A DNA synthesis defective mutant, but not a 5'dRP lyase mutant, rescued HIV infection efficiency to wild type levels; this suggested Polβ DNA synthesis activity is not necessary while 5'dRP lyase activity is required for efficient HIV infection. An alternate hypothesis that BER events in the host genome influence HIV integration site selection was examined by sequencing integration sites in OGG1 and MYH null cells. In the absence of these 8-oxo-guanine specific glycosylases the chromatin elements of HIV integration site selection remain the same as in wild type cells. However, the HIV integration site sequence preference at G:C base pairs is altered at several positions in OGG1 and MYH null cells. Inefficient HIV infection in the absence of oxidative BER proteins does not appear related to repair of the gapped integration intermediate; instead oxidative damage repair may participate in HIV integration site preference at the sequence level.

  19. Causes and consequences of oxidative stress in spermatozoa.

    Aitken, Robert John; Gibb, Zamira; Baker, Mark A; Drevet, Joel; Gharagozloo, Parviz

    2015-02-01

    Spermatozoa are highly vulnerable to oxidative attack because they lack significant antioxidant protection due to the limited volume and restricted distribution of cytoplasmic space in which to house an appropriate armoury of defensive enzymes. In particular, sperm membrane lipids are susceptible to oxidative stress because they abound in significant amounts of polyunsaturated fatty acids. Susceptibility to oxidative attack is further exacerbated by the fact that these cells actively generate reactive oxygen species (ROS) in order to drive the increase in tyrosine phosphorylation associated with sperm capacitation. However, this positive role for ROS is reversed when spermatozoa are stressed. Under these conditions, they default to an intrinsic apoptotic pathway characterised by mitochondrial ROS generation, loss of mitochondrial membrane potential, caspase activation, phosphatidylserine exposure and oxidative DNA damage. In responding to oxidative stress, spermatozoa only possess the first enzyme in the base excision repair pathway, 8-oxoguanine DNA glycosylase. This enzyme catalyses the formation of abasic sites, thereby destabilising the DNA backbone and generating strand breaks. Because oxidative damage to sperm DNA is associated with both miscarriage and developmental abnormalities in the offspring, strategies for the amelioration of such stress, including the development of effective antioxidant formulations, are becoming increasingly urgent. PMID:27062870

  20. [Ionizing radiation-induced DNA damage and its repair in human cells]. Progress report, [April 1, 1993--February 28, 1994

    1994-07-01

    The excision of radiation-induced lesions in DNA by a DNA repair enzyme complex, namely the UvrABC nuclease complex, has been investigated. Irradiated DNA was treated with the enzyme complex. DNA fractions were analyzed by gas chromatography/isotope-dilution mass spectrometry. The results showed that a number pyrimidine- and purine-derived lesions in DNA were excised by the UvrABC nuclease complex and that the enzyme complex does not act on radiation-induced DNA lesions as a glycosylase. This means that it does not excise individual base products, but it excises oligomers containing these lesions. A number of pyrimidine-derived lesions that were no substrates for other DNA repair enzymes investigated in our laboratory were substrates for the UvrABC nuclease complex.

  1. Epigenetic changes of Arabidopsis genome associated with altered DNA methyltransferase and demethylase expressions after gamma irradiation

    Kim, Ji Eun; Cho, Eun Ju; Kim, Ji Hong; Chung, Byung Yeoup; Kim, Jin Hong [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2012-05-15

    DNA methylation at carbon 5 of cytosines is a hall mark of epigenetic inactivation and heterochromatin in both plants and mammals. In Arabidopsis, DNA methylation has two roles that protect the genome from selfish DNA elements and regulate gene expression. Plant genome has three types of DNA methyltransferase, METHYLTRANSFERASE 1 (MET1), DOMAINREARRANGED METHYLASE (DRM) and CHROMOMETHYLASE 3 (CMT3) that are capable of methylating CG, CHG (where H is A, T, or C) and CHH sites, respectively. MET1 is a maintenance DNA methyltransferase that controls CG methylation. Two members of the DRM family, DRM1 and DRM2, are responsible for de novo methylation of CG, CHG, and CHH sites but show a preference for CHH sites. Finally, CMT3 principally carries out CHG methylation and is involved in both de novo methylation and maintenance. Alternatively, active DNA demethylation may occur through the glycosylase activity by removing the methylcytosines from DNA. It may have essential roles in preventing transcriptional silencing of transgenes and endogenous genes and in activating the expression of imprinted genes. DNA demetylation in Arabidopsis is mediated by the DEMETER (DME) family of bifunctional DNA glycosylase. Three targets of DME are MEA (MEDEA), FWA (FLOWERING WAGENINGEN), and FIS2 (FERTILIZATION INDEPENDENT SEED 2). The DME family contains DEMETER-LIKE 2 (DML2), DML3, and REPRESSOR OF SILENING 1 (ROS1). DNA demetylation by ROS1, DML2, and DML3 protect the hypermethylation of specific genome loci. ROS1 is necessary to suppress the promoter methylation and the silencing of endogenous genes. In contrast, the function of DML2 and DML3 has not been reported. Several recent studies have suggested that epigenetic alterations such as change in DNA methylation and histone modification should be caused in plant genomes upon exposure to ionizing radiation. However, there is a lack of data exploring the underlying mechanisms. Therefore, the present study aims to characterize and

  2. Epigenetic changes of Arabidopsis genome associated with altered DNA methyltransferase and demethylase expressions after gamma irradiation

    DNA methylation at carbon 5 of cytosines is a hall mark of epigenetic inactivation and heterochromatin in both plants and mammals. In Arabidopsis, DNA methylation has two roles that protect the genome from selfish DNA elements and regulate gene expression. Plant genome has three types of DNA methyltransferase, METHYLTRANSFERASE 1 (MET1), DOMAINREARRANGED METHYLASE (DRM) and CHROMOMETHYLASE 3 (CMT3) that are capable of methylating CG, CHG (where H is A, T, or C) and CHH sites, respectively. MET1 is a maintenance DNA methyltransferase that controls CG methylation. Two members of the DRM family, DRM1 and DRM2, are responsible for de novo methylation of CG, CHG, and CHH sites but show a preference for CHH sites. Finally, CMT3 principally carries out CHG methylation and is involved in both de novo methylation and maintenance. Alternatively, active DNA demethylation may occur through the glycosylase activity by removing the methylcytosines from DNA. It may have essential roles in preventing transcriptional silencing of transgenes and endogenous genes and in activating the expression of imprinted genes. DNA demetylation in Arabidopsis is mediated by the DEMETER (DME) family of bifunctional DNA glycosylase. Three targets of DME are MEA (MEDEA), FWA (FLOWERING WAGENINGEN), and FIS2 (FERTILIZATION INDEPENDENT SEED 2). The DME family contains DEMETER-LIKE 2 (DML2), DML3, and REPRESSOR OF SILENING 1 (ROS1). DNA demetylation by ROS1, DML2, and DML3 protect the hypermethylation of specific genome loci. ROS1 is necessary to suppress the promoter methylation and the silencing of endogenous genes. In contrast, the function of DML2 and DML3 has not been reported. Several recent studies have suggested that epigenetic alterations such as change in DNA methylation and histone modification should be caused in plant genomes upon exposure to ionizing radiation. However, there is a lack of data exploring the underlying mechanisms. Therefore, the present study aims to characterize and

  3. Oxidative DNA damage in peripheral leukocytes and its association with expression and polymorphisms of hOGG1: A study of adolescents in a high risk region for hepatocellular carcinoma in China

    Tao Peng; Choon Nam Ong; Han-Ming Shen; Zhi-Ming Liu; Lu-Nan Yan; Min-Hao Peng; Le-Qun Li; Ren-Xiang Liang; Zong-Liang Wei; Barry Halliwell

    2003-01-01

    AIM: To study the oxidative DNA damage to adolescents of hepatocellular carcinoma (HCC) families in Guangxi Zhuang Autonomous Region, China.METHODS: Peripheral leukocytes' DNA 7, 8-dihydro-8-oxoguanine (8-oxoG) and repair enzyme hOGG1 were quantified by flow-cytometry. hOGG1-Cys326Ser single nucleotide polymorphism (SNP) was distinguished by polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP) assay.RESULTS: There was a positive correlation between 8-oxoG and repair enzyme hOGG1 expression (P<0.001). HCC children (n=21) in Fusui county had a higher level of hOGG1(P<0.01) and a lower level of 8-oxoG (P<0.05) than the controls (n=63) in Nanning city. Children in Nanning exposed to passive-smoking had a higher hOGG1 expression (P<0.05)than the non-exposers. 8-oxoG and hOGG1 were negatively correlated with body mass index, while hOGG1 was positively correlated with age. There was a peak of 8-oxoG level nearby the 12 year point. Individuals with the hOGG1 326Ser allele had a significantly marginal higher concentration of leukocyte 8-oxoG level than hOGG1 326Cys allele.CONCLUSION: This is the first report using flow-cytometry to simultaneously quantify both the DNA oxidative damage and its repairing enzyme hOGG1. The results provide new insights towards a better understanding of the mechanisms of oxidative stress in a population highly susceptible to hepatocarcinogenesis.

  4. No effect of 600 grams fruit and vegetables per day on oxidative DNA damage and repair in healthy nonsmokers

    Moller, P.; Vogel, Ulla Birgitte; Pedersen, A.; Dragsted, Lars Ove; Sandstrom, B.; Loft, S.

    2003-01-01

    . Blood and urine samples were collected before, once a week, and 4 weeks after the intervention period. The level of strand breaks, endonuclease III sites, formamidopyrimidine sites, and sensitivity to hydrogen peroxide was assessed in mononuclear blood cells by the comet assay. Excretion of 7-hydro-8...... had no effect on oxidative DNA damage measured in mononuclear cell DNA or urine. Hydrogen peroxide sensitivity, detected by the comet assay, did not differ between the groups. Expression of excision repair cross complementing I and oxoguanine glycosylase I in leukocytes was not related to the diet...

  5. DNA damage in lung after oral exposure to diesel exhaust particles in Big Blue (R) rats

    Müller, Anne Kirstine; Farombi, E.O.; Møller, P.;

    2004-01-01

    . Lung tissue is a target organ for DEP induced cancer following inhalation. Recent studies have provided evidence that the lung is also a target organ for DNA damage and cancer after oral exposure to other complex mixtures of PAHs. The genotoxic effect of oral administration of DEP was investigated, in...... endonuclease III and fapyguanine glycosylase (FPG) sensitive sites increased at the intermediate dose levels. The induction of DNA damage by DEP exposure did not increase the expression of the repair genes OGG1 and ERCC1 at the mRNA level. The present study indicates that the lung is a target organ for primary...... DNA damage following oral exposure to DEP. DNA damage was induced following exposure to relatively low levels of DEP, but under the conditions used in the present experiment DNA damage did not result in an increased mutation rate....

  6. DNA damage in lung after oral exposure to diesel exhaust particles in Big Blue (R) rats

    Müller, Anne Kirstine; Farombi, E.O.; Møller, P.; Autrup, H.N.; Vogel, U.; Wallin, H.; Dragsted, Lars Ove; Loft, S.; Binderup, Mona-Lise

    . Lung tissue is a target organ for DEP induced cancer following inhalation. Recent studies have provided evidence that the lung is also a target organ for DNA damage and cancer after oral exposure to other complex mixtures of PAHs. The genotoxic effect of oral administration of DEP was investigated, in...... endonuclease III and fapyguanine glycosylase (FPG) sensitive sites increased at the intermediate dose levels. The induction of DNA damage by DEP exposure did not increase the expression of the repair genes OGG1 and ERCC1 at the mRNA level. The present study indicates that the lung is a target organ for primary...... DNA damage following oral exposure to DEP. DNA damage was induced following exposure to relatively low levels of DEP, but under the conditions used in the present experiment DNA damage did not result in an increased mutation rate....

  7. Variation of DNA damage levels in peripheral blood mononuclear cells isolated in different laboratories

    Godschalk, Roger W L; Ersson, Clara; Stępnik, Maciej;

    2014-01-01

    This study investigated the levels of DNA strand breaks and formamidopyrimidine DNA glycosylase (FPG) sensitive sites, as assessed by the comet assay, in peripheral blood mononuclear cells (PBMC) from healthy women from five different countries in Europe. The laboratory in each country (referred to...... as 'centre') collected and cryopreserved PBMC samples from three donors, using a standardised cell isolation protocol. The samples were analysed in 13 different laboratories for DNA damage, which is measured by the comet assay. The study aim was to assess variation in DNA damage in PBMC samples that...... were collected in the same way and processed using the same blood isolation procedure. The inter-laboratory variation was the prominent contributor to the overall variation. The inter-laboratory coefficient of variation decreased for both DNA strand breaks (from 68 to 26%) and FPG sensitive sites (from...

  8. Different organization of base excision repair of uracil in DNA in nuclei and mitochondria and selective upregulation of mitochondrial uracil-DNA glycosylase after oxidative stress

    Akbari, M; Otterlei, M; Pena Diaz, Javier; Krokan, H E

    2007-01-01

    proteins also remove the oxidized cytosine derivatives isodialuric acid, alloxan and 5-hydroxyuracil. UNG1 and UNG2 have identical catalytic domain, but different N-terminal regions required for subcellular sorting. We demonstrate that mRNA for UNG1, but not UNG2, is increased after hydrogen peroxide......, indicating regulatory effects of oxidative stress on mitochondrial BER. To examine the overall organization of uracil-BER in nuclei and mitochondria, we constructed cell lines expressing EYFP (enhanced yellow fluorescent protein) fused to UNG1 or UNG2. These were used to investigate the possible presence of...... BER processes are differently organized. Furthermore, the upregulation of mRNA for mitochondrial UNG1 after oxidative stress indicates that it may have an important role in repair of oxidized pyrimidines....

  9. Catalytically impaired hMYH and NEIL1 mutant proteins identified in patients with primary sclerosing cholangitis and cholangiocarcinoma

    Forsbring, Monika; Vik, Erik S.; Dalhus, Bjørn; Karlsen, Tom H.; Bergquist, Annika; Schrumpf, Erik; Bjørås, Magnar; Boberg, Kirsten M.; Alseth, Ingrun

    2009-01-01

    The human hMYH and NEIL1 genes encode DNA glycosylases involved in repair of oxidative base damage and mutations in these genes are associated with certain cancers. Primary sclerosing cholangitis (PSC), a chronic cholestatic liver disease characterized by inflammatory destruction of the biliary tree, is often complicated by the development of cholangiocarcinoma (CCA). Here, we aimed to investigate the influence of genetic variations in the hMYH and NEIL1 genes on risk of CCA in PSC patients. The hMYH and NEIL1 gene loci in addition to the DNA repair genes hOGG1, NTHL1 and NUDT1 were analyzed in 66 PSC patients (37 with CCA and 29 without cancer) by complete genomic sequencing of exons and adjacent intronic regions. Several single-nucleotide polymorphisms and mutations were identified and severe impairment of protein function was observed for three non-synonymous variants. The NEIL1 G83D mutant was dysfunctional for the major oxidation products 7,8-dihydro-8-oxoguanine (8oxoG), thymine glycol and dihydrothymine in duplex DNA, and the ability to perform δ-elimination at abasic sites was significantly reduced. The hMYH R260Q mutant had severe defect in adenine DNA glycosylase activity, whereas hMYH H434D could excise adenines from A:8oxoG pairs but not from A:G mispairs. We found no overall associations between the 18 identified variants and susceptibility to CCA in PSC patients; however, the impaired variants may be of significance for carcinogenesis in general. Our findings demonstrate the importance of complete resequencing of selected candidate genes in order to identify rare genetic variants and their possible contribution to individual susceptibility to cancer development. PMID:19443904

  10. Cu(II) sensitizes pBR322 plasmid DNA to inactivation by UV-B (280-315 nm)

    Copper (II), in the presence of UV-B radiation (280-315 nm), can generate single-strand breaks in the sugar-phosphate backbone of pBr322 plasmid DNA. A low level of single-strand backbone breaks occurs in the presence of Cu(II) alone, but UV-B irradiation increases the rate by the more than 100-fold. Concomitant with the damage to the DNA backbone is a loss of transforming activity. Oxygen is required for generation of the single-strand breaks but not for the loss of transforming activity. A DNA glycosylase (Fpg), which participates in the repair of certain DNA nitrogenous base damage, does not repair plasmid DNA damaged by Cu(II). The hydroxyl radical scavenging compound DMSO is only moderately radioprotective of DNA. (Author)

  11. Characterization of DNA metabolizing enzymes in situ following polyacrylamide gel electrophoresis

    The authors have detected the in situ activities of DNA glycosylase, endonuclease, exonuclease, DNA polymerase, and DNA ligase using a novel polyacrylamide activity gel electrophoresis procedure. DNA metabolizing enzymes were resolved through either native or SDS-polyacrylamide gels containing defined 32P-labeled oligonucleotides annealed to M13 DNA. After electrophoresis, these enzymes catalyzed in situ reactions and their [32P]DNA products were resolved from the gel by a second dimension of electrophoresis through a denaturing DNA sequencing gel. Detection of modified (degraded or elongated) oligonucleotide chains was used to locate various enzyme activities. The catalytic and physical properties of Novikoff hepatoma DNA polymerase β were found to be similar under both in vitro and in situ conditions. With 3'-terminally matched and mismatched [32P]DNA substrates in the same activity gel, DNA polymerase and/or 3' to 5' exonuclease activities of Escherichia coli DNA polymerase I (large fragment), DNA polymerase III (holoenzyme), and exonuclease III were detected and characterized. Several restriction endonucleases and the tripeptide (Lys-Try-Lys), which acts as an apurinic/apyrimidinic endonuclease, were able to diffuse into gels and modify DNA. This ability to create intermediate substrates within activity gels could prove extremely useful in delineating the steps of DNA replication and repair pathways

  12. A functional Ser326Cys polymorphism in hOGG1 is associated with noise-induced hearing loss in a Chinese population.

    Huanxi Shen

    Full Text Available DNA damage to cochlear hair cells caused by 8-oxoguanine (8-oxoG is essential for the development of noise-induced hearing loss (NIHL. Human 8-oxoG DNA glycosylase1 (hOGG1 is a key enzyme in the base excision repair (BER pathway that eliminates 8-oxoG. Many epidemiological and functional studies have suggested that the hOGG1 Ser326Cys polymorphism (rs1052133 is associated with many diseases. The purpose of this investigation was to investigate whether the hOGG1 Ser326Cys polymorphism in the human BER pathway is associated with genetic susceptibility to NIHL in a Chinese population. This polymorphism was genotyped among 612 workers with NIHL and 615 workers with normal hearing. We found that individuals with the hOGG1 Cys/Cys genotype had a statistically significantly increased risk of NIHL compared with those who carried the hOGG1 Ser/Ser genotype (adjusted OR=1.59, 95% CI=1.13-2.25 and this increased risk was more pronounced among the workers in the 15- to 25- and >25-year noise exposure time, 85-92 dB(A noise exposure level, ever smoking, and ever drinking groups, similar effects were also observed in a recessive model. In summary, our data suggested that the hOGG1 Cys/Cys genotype may be a genetic susceptibility marker for NIHL in the Chinese Han population.

  13. Evaluation of genotoxic risk and oxidative DNA damage in mammalian cells exposed to mycotoxins, patulin and citrinin

    Mycotoxins are fungal secondary metabolites with very diversified toxic effects in humans and animals. In the present study, patulin (PAT) and citrinin (CTN), two prevalent mycotoxins, were evaluated for their genotoxic effects and oxidative damage to mammalian cells, including Chinese hamster ovary cells (CHO-K1), human peripheral blood lymphocytes, and human embryonic kidney cells (HEK293). PAT, but not CTN, caused a significant dose-dependent increase in sister chromatid exchange (SCE) frequency in both CHO-K1 and human lymphocytes. PAT also elevated the levels of DNA gap and break in treated CHO-K1. In the single cell gel electrophoresis (SCGE) assay, exposure of HEK293 to concentrations above 15 μM of PAT induced DNA strand breaks; the tail moment values also greatly increased after posttreatment with formamidopyrimidine-DNA glycosylase (Fpg). This suggests that in human cells PAT is a potent clastogen with the ability to cause oxidative damage to DNA. However, no significant change in the tail moment values in CTN-treated cultures was found, suggesting that CTN is not genotoxic to HEK293. Incubation of HEK293 with CTN increased the mRNA level of heat shock protein 70 (HSP70), but not that of human 8-hydroxyguanine DNA glycosylase 1 (hOGG1). PAT treatment did not modulate the expression of either HSP70 or hOGG1 mRNA

  14. Repair of DNA-containing pyrimidine dimers

    Ultraviolet light-induced pyrimidine dimers in DNA are recognized and repaired by a number of unique cellular surveillance systems. The most direct biochemical mechanism responding to this kind of genotoxicity involves direct photoreversal by flavin enzymes that specifically monomerize pyrimidine:pyrimidine dimers monophotonically in the presence of visible light. Incision reactions are catalyzed by a combined pyrimidine dimer DNA-glycosylase:apyrimidinic endonuclease found in some highly UV-resistant organisms. At a higher level of complexity, Escherichia coli has a uvr DNA repair system comprising the UvrA, UvrB, and UvrC proteins responsible for incision. There are several preincision steps governed by this pathway, which includes an ATP-dependent UvrA dimerization reaction required for UvrAB nucleoprotein formation. This complex formation driven by ATP binding is associated with localized topological unwinding of DNA. This same protein complex can catalyze an ATPase-dependent 5'----3'-directed strand displacement of D-loop DNA or short single strands annealed to a single-stranded circular or linear DNA. This putative translocational process is arrested when damaged sites are encountered. The complex is now primed for dual incision catalyzed by UvrC. The remainder of the repair process involves UvrD (helicase II) and DNA polymerase I for a coordinately controlled excision-resynthesis step accompanied by UvrABC turnover. Furthermore, it is proposed that levels of repair proteins can be regulated by proteolysis. UvrB is converted to truncated UvrB* by a stress-induced protease that also acts at similar sites on the E. coli Ada protein. Although UvrB* can bind with UvrA to DNA, it cannot participate in helicase or incision reactions. It is also a DNA-dependent ATPase.21 references

  15. Repair of DNA-containing pyrimidine dimers

    Grossman, L.; Caron, P.R.; Mazur, S.J.; Oh, E.Y.

    1988-08-01

    Ultraviolet light-induced pyrimidine dimers in DNA are recognized and repaired by a number of unique cellular surveillance systems. The most direct biochemical mechanism responding to this kind of genotoxicity involves direct photoreversal by flavin enzymes that specifically monomerize pyrimidine:pyrimidine dimers monophotonically in the presence of visible light. Incision reactions are catalyzed by a combined pyrimidine dimer DNA-glycosylase:apyrimidinic endonuclease found in some highly UV-resistant organisms. At a higher level of complexity, Escherichia coli has a uvr DNA repair system comprising the UvrA, UvrB, and UvrC proteins responsible for incision. There are several preincision steps governed by this pathway, which includes an ATP-dependent UvrA dimerization reaction required for UvrAB nucleoprotein formation. This complex formation driven by ATP binding is associated with localized topological unwinding of DNA. This same protein complex can catalyze an ATPase-dependent 5'----3'-directed strand displacement of D-loop DNA or short single strands annealed to a single-stranded circular or linear DNA. This putative translocational process is arrested when damaged sites are encountered. The complex is now primed for dual incision catalyzed by UvrC. The remainder of the repair process involves UvrD (helicase II) and DNA polymerase I for a coordinately controlled excision-resynthesis step accompanied by UvrABC turnover. Furthermore, it is proposed that levels of repair proteins can be regulated by proteolysis. UvrB is converted to truncated UvrB* by a stress-induced protease that also acts at similar sites on the E. coli Ada protein. Although UvrB* can bind with UvrA to DNA, it cannot participate in helicase or incision reactions. It is also a DNA-dependent ATPase.21 references.

  16. A MATE-Family Efflux Pump Rescues the Escherichia coli 8-Oxoguanine-Repair-Deficient Mutator Phenotype and Protects Against H2O2 Killing

    Guelfo, Javier R.; Alexandro Rodríguez-Rojas; Ivan Matic; Jesús Blázquez

    2010-01-01

    Hypermutation may accelerate bacterial evolution in the short-term. In the long-term, however, hypermutators (cells with an increased rate of mutation) can be expected to be at a disadvantage due to the accumulation of deleterious mutations. Therefore, in theory, hypermutators are doomed to extinction unless they compensate the elevated mutational burden (deleterious load). Different mechanisms capable of restoring a low mutation rate to hypermutators have been proposed. By choosing an 8-oxog...

  17. Oxidative stress, inflammation, and DNA damage in rats after intratracheal instillation or oral exposure to ambient air and wood smoke particulate matter

    Danielsen, Pernille Høgh; Loft, Steffen; Jacobsen, Nicklas Raun;

    2010-01-01

    exposed orally to CB, respectively. Rats orally exposed to PM from the wood stove area and low oxygen combustion WSPM (LOWS) had 35% (95% CI: 0.1-71%) and 45% (95% CI: 10-82%) increased levels of edG in the liver, respectively. No significant differences were observed for bulky DNA adducts. Increased gene...... expression of proinflammatory cytokines, heme oxygenase-1, and oxoguanine DNA glycosylase 1 was observed in the liver following intragastric exposure and in the lung following instillation in particular of LOWS. Exposure to LOWS also increased the proportion of neutrophils in BAL fluid. These results...

  18. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL−1 and 50 μg mL−1 of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair activities

  19. Increased oxidative DNA damage in mononuclear leukocytes in vitiligo

    Giovannelli, Lisa [Department of Preclinical and Clinical Pharmacology, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy)]. E-mail: lisag@pharm.unifi.it; Bellandi, Serena [Department of Dermatological Sciences, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy); Pitozzi, Vanessa [Department of Preclinical and Clinical Pharmacology, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy); Fabbri, Paolo [Department of Dermatological Sciences, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy); Dolara, Piero [Department of Preclinical and Clinical Pharmacology, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy); Moretti, Silvia [Department of Dermatological Sciences, University of Florence, Viale Pieraccini 6, 50139 Florence (Italy)

    2004-11-22

    Vitiligo is an acquired pigmentary disorder of the skin of unknown aetiology. The autocytotoxic hypothesis suggests that melanocyte impairment could be related to increased oxidative stress. Evidences have been reported that in vitiligo oxidative stress might also be present systemically. We used the comet assay (single cell alkaline gel electrophoresis) to evaluate DNA strand breaks and DNA base oxidation, measured as formamidopyrimidine DNA glycosylase (FPG)-sensitive sites, in peripheral blood cells from patients with active vitiligo and healthy controls. The basal level of oxidative DNA damage in mononuclear leukocytes was increased in vitiligo compared to normal subjects, whereas DNA strand breaks (SBs) were not changed. This alteration was not accompanied by a different capability to respond to in vitro oxidative challenge. No differences in the basal levels of DNA damage in polymorphonuclear leukocytes were found between patients and healthy subjects. Thus, this study supports the hypothesis that in vitiligo a systemic oxidative stress exists, and demonstrates for the first time the presence of oxidative alterations at the nuclear level. The increase in oxidative DNA damage shown in the mononuclear component of peripheral blood leukocytes from vitiligo patients was not particularly severe. However, these findings support an adjuvant role of antioxidant treatment in vitiligo.

  20.  Oxidation and deamination of nucleobases as an epigenetic tool

    Jolanta Guz

    2012-05-01

    Full Text Available  Recent discoveries have demonstrated that 5-methylcytosine (5mC may be hydroxymethylated to 5-hydroxymethylcytosine (5hmC in mammals and that genomic DNA may contain about 0.02–0.7�0of 5hmC. The aforementioned modification is the key intermediate of active DNA demethylation and has been named “the sixth base in DNA”.Although active DNA demethylation in mammals is still controversial, the most plausible mechanism/s of active 5mC demethylation include involvement of three families of enzymes; i Tet, which is involved in hydroxylation of 5mC to form 5hmC, which can be further oxidized to 5-formylcytosine (5fC and 5-carboxylcytosine (5caC; ii deamination of 5mC (or 5hmC by AID/APOBEC to form thymine or 5-hydroxymethyluracil (5hmU mispaired with guanine; iii the BER pathway induced by involvement of TDG glycosylase to replace the above described base modification (5fC, 5caC, 5hmU with cytosine to demethylate DNA.A plausible scenario for engagement of TDG glycosylase (or some other G-T glycosylase is through prior deamination of 5-mC to thymine, which generates a G: T substrate for the enzyme. Here cytidine deaminase of the AID/APOBEC family was implicated in the deamination step. It is possible that TDG may act in concert with these deaminases.It seems that mutations are not the only effect of oxidatively modified DNA bases. These, as yet, understudied aspects of the damage suggest a potential for 8-oxoguanine (8-oxoGua to affect gene expression via chromatin relaxation. It is possible that 8-oxoGua presence in specific DNA sequences may be widely used for transcription regulation, which suggests the epigenetic nature of 8-oxoGua presence in DNA.

  1. Effects of Anthocyanins on CAG Repeat Instability and Behaviour in Huntington’s Disease R6/1 Mice

    Møllersen, Linda; Moldestad, Olve; Rowe, Alexander D.; Bjølgerud, Anja; Holm, Ingunn; Tveterås, Linda; Klungland, Arne; Retterstøl, Lars

    2016-01-01

    Background: Huntington’s disease (HD) is a progressive neurodegenerative disorder caused by CAG repeat expansions in the HTT gene. Somatic repeat expansion in the R6/1 mouse model of HD depends on mismatch repair and is worsened by base excision repair initiated by the 7,8-dihydroxy-8-oxoguanine-DNA glycosylase (Ogg1) or Nei-like 1 (Neil1). Ogg1 and Neil1 repairs common oxidative lesions. Methods: We investigated whether anthocyanin antioxidants added daily to the drinking water could affect CAG repeat instability in several organs and behaviour in R6/1 HD mice. In addition, anthocyanin-treated and untreated R6/1 HD mice at 22 weeks of age were tested in the open field test and on the rotarod. Results: Anthocyanin-treated R6/1 HD mice showed reduced instability index in the ears and in the cortex compared to untreated R6/1 mice, and no difference in liver and kidney. There were no significant differences in any of the parameters tested in the behavioural tests among anthocyanin-treated and untreated R6/1 HD mice. Conclusions: Our results indicate that continuous anthocyanin-treatment may have modest effects on CAG repeat instability in the ears and the cortex of R6/1 mice. More studies are required to investigate if anthocyanin-treatment could affect behaviour earlier in the disease course. PMID:27540492

  2. Ancient DNA

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  3. Effects of ionizing radiations on DNA-protein complexes

    The radio-induced destruction of DNA-protein complexes may have serious consequences for systems implicated in important cellular functions. The first system which has been studied is the lactose operon system, that regulates gene expression in Escherichia coli. First of all, the repressor-operator complex is destroyed after irradiation of the complex or of the protein alone. The damaging of the domain of repressor binding to DNA (headpiece) has been demonstrated and studied from the point of view of peptide chain integrity, conformation and amino acids damages. Secondly, dysfunctions of the in vitro induction of an irradiated repressor-unirradiated DNA complex have been observed. These perturbations, due to a decrease of the number of inducer binding sites, are correlated to the damaging of tryptophan residues. Moreover, the inducer protects the repressor when they are irradiated together, both by acting as a scavenger in the bulk, and by the masking of its binding site on the protein. The second studied system is formed by Fpg (for Formamido pyrimidine glycosylase), a DNA repair protein and a DNA with an oxidative lesion. The results show that irradiation disturbs the repair both by decreasing its efficiency of DNA lesion recognition and binding, and by altering its enzymatic activity. (author)

  4. Base Flip in DNA Studied by Molecular Dynamics Simulationsof Differently-Oxidized Forms of Methyl-Cytosine

    Mahdi Bagherpoor Helabad

    2014-07-01

    Full Text Available Distortions in the DNA sequence, such as damage or mispairs, are specifically recognized and processed by DNA repair enzymes. Many repair proteins and, in particular, glycosylases flip the target base out of the DNA helix into the enzyme’s active site. Our molecular dynamics simulations of DNA with intact and damaged (oxidized methyl-cytosine show that the probability of being flipped is similar for damaged and intact methyl-cytosine. However, the accessibility of the different 5-methyl groups allows direct discrimination of the oxidized forms. Hydrogen-bonded patterns that vary between methyl-cytosine forms carrying a carbonyl oxygen atom are likely to be detected by the repair enzymes and may thus help target site recognition.

  5. Modular Nuclease-Responsive DNA Three-Way Junction-Based Dynamic Assembly of a DNA Device and Its Sensing Application.

    Zhu, Jing; Wang, Lei; Xu, Xiaowen; Wei, Haiping; Jiang, Wei

    2016-04-01

    Here, we explored a modular strategy for rational design of nuclease-responsive three-way junctions (TWJs) and fabricated a dynamic DNA device in a "plug-and-play" fashion. First, inactivated TWJs were designed, which contained three functional domains: the inaccessible toehold and branch migration domains, the specific sites of nucleases, and the auxiliary complementary sequence. The actions of different nucleases on their specific sites in TWJs caused the close proximity of the same toehold and branch migration domains, resulting in the activation of the TWJs and the formation of a universal trigger for the subsequent dynamic assembly. Second, two hairpins (H1 and H2) were introduced, which could coexist in a metastable state, initially to act as the components for the dynamic assembly. Once the trigger initiated the opening of H1 via TWJs-driven strand displacement, the cascade hybridization of hairpins immediately switched on, resulting in the formation of the concatemers of H1/H2 complex appending numerous integrated G-quadruplexes, which were used to obtain label-free signal readout. The inherent modularity of this design allowed us to fabricate a flexible DNA dynamic device and detect multiple nucleases through altering the recognition pattern slightly. Taking uracil-DNA glycosylase and CpG methyltransferase M.SssI as models, we successfully realized the butt joint between the uracil-DNA glycosylase and M.SssI recognition events and the dynamic assembly process. Furthermore, we achieved ultrasensitive assay of nuclease activity and the inhibitor screening. The DNA device proposed here will offer an adaptive and flexible tool for clinical diagnosis and anticancer drug discovery. PMID:26943244

  6. Atomic structure of the DNA repair [4Fe-4S] enzyme endonuclease III.

    Kuo, C F; McRee, D E; Fisher, C L; O'Handley, S F; Cunningham, R P; Tainer, J A

    1992-10-16

    The crystal structure of the DNA repair enzyme endonuclease III, which recognizes and cleaves DNA at damaged bases, has been solved to 2.0 angstrom resolution with an R factor of 0.185. This iron-sulfur [4Fe-4S] enzyme is elongated and bilobal with a deep cleft separating two similarly sized domains: a novel, sequence-continuous, six-helix domain (residues 22 to 132) and a Greek-key, four-helix domain formed by the amino-terminal and three carboxyl-terminal helices (residues 1 to 21 and 133 to 211) together with the [4Fe-4S] cluster. The cluster is bound entirely within the carboxyl-terminal loop with a ligation pattern (Cys-X6-Cys-X2-Cys-X5-Cys) distinct from all other known [4Fe-4S] proteins. Sequence conservation and the positive electrostatic potential of conserved regions identify a surface suitable for binding duplex B-DNA across the long axis of the enzyme, matching a 46 angstrom length of protected DNA. The primary role of the [4Fe-4S] cluster appears to involve positioning conserved basic residues for interaction with the DNA phosphate backbone. The crystallographically identified inhibitor binding region, which recognizes the damaged base thymine glycol, is a seven-residue beta-hairpin (residues 113 to 119). Location and side chain orientation at the base of the inhibitor binding site implicate Glu112 in the N-glycosylase mechanism and Lys120 in the beta-elimination mechanism. Overall, the structure reveals an unusual fold and a new biological function for [4Fe-4S] clusters and provides a structural basis for studying recognition of damaged DNA and the N-glycosylase and apurinic/apyrimidinic-lyase mechanisms. PMID:1411536

  7. Macromolecule oxidation and DNA repair in mussel (Mytilus edulis L.) gill following exposure to Cd and Cr(VI)

    The oxidation of DNA and lipid was analysed in the marine mussel (Mytilus edulis) in response to exposure (10 μg/l and 200 μg/l) to cadmium (Cd) and chromium [Cr(VI)]. Concentration dependent uptake of both metals into mussel tissues was established and levels of gill ATP were not depleted at these exposure levels. DNA strand breakage in gill cells (analysed by the comet assay) was elevated by both metals, however, DNA oxidation [measured by DNA strand breakage induced by the DNA repair enzyme formamidopyrimidine glycosylase (FPG)] was not elevated. This was despite a statistically significant increase in both malondialdehyde and 4-hydroxynonenal - indicative of lipid peroxidation - following treatment with Cd. In contrast, both frank DNA stand breaks and FPG-induced DNA strand breaks (indicative of DNA oxidation) were increased following injection of mussels with sodium dichromate (10.4 μg Cr(VI)/mussel). The metals also showed differential inhibitory potential towards DNA repair enzyme activity with Cd exhibiting inhibition of DNA cutting activity towards an oligonucleotide containing 8-oxo-7,8-dihydro-2'-deoxyguanosine and Cr(VI) showing inhibition of such activity towards an oligonucleotide containing ethenoadenosine, both at 200 μg/l. The metals thus show DNA damage activity in mussel gill with distinct mechanisms involving both direct and indirect (oxidative) DNA damage, as well as impairing different DNA repair capacities. A combination of these activities can contribute to adverse effects in these organisms

  8. Macromolecule oxidation and DNA repair in mussel (Mytilus edulis L.) gill following exposure to Cd and Cr(VI)

    Emmanouil, C. [School of Biosciences, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom); Sheehan, T.M.T. [Regional Toxicology Laboratory, City Hospital, Dudley Road, Birmingham B18 7QH (United Kingdom); Chipman, J.K. [School of Biosciences, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom)]. E-mail: J.K.Chipman@bham.ac.uk

    2007-04-20

    The oxidation of DNA and lipid was analysed in the marine mussel (Mytilus edulis) in response to exposure (10 {mu}g/l and 200 {mu}g/l) to cadmium (Cd) and chromium [Cr(VI)]. Concentration dependent uptake of both metals into mussel tissues was established and levels of gill ATP were not depleted at these exposure levels. DNA strand breakage in gill cells (analysed by the comet assay) was elevated by both metals, however, DNA oxidation [measured by DNA strand breakage induced by the DNA repair enzyme formamidopyrimidine glycosylase (FPG)] was not elevated. This was despite a statistically significant increase in both malondialdehyde and 4-hydroxynonenal - indicative of lipid peroxidation - following treatment with Cd. In contrast, both frank DNA stand breaks and FPG-induced DNA strand breaks (indicative of DNA oxidation) were increased following injection of mussels with sodium dichromate (10.4 {mu}g Cr(VI)/mussel). The metals also showed differential inhibitory potential towards DNA repair enzyme activity with Cd exhibiting inhibition of DNA cutting activity towards an oligonucleotide containing 8-oxo-7,8-dihydro-2'-deoxyguanosine and Cr(VI) showing inhibition of such activity towards an oligonucleotide containing ethenoadenosine, both at 200 {mu}g/l. The metals thus show DNA damage activity in mussel gill with distinct mechanisms involving both direct and indirect (oxidative) DNA damage, as well as impairing different DNA repair capacities. A combination of these activities can contribute to adverse effects in these organisms.

  9. Distinct energetics and closing pathways for DNA polymerase β with 8-oxoG template and different incoming nucleotides

    Wang Yanli

    2007-02-01

    Full Text Available Abstract Background 8-Oxoguanine (8-oxoG is a common oxidative lesion frequently encountered by DNA polymerases such as the repair enzyme DNA polymerase β (pol β. To interpret in atomic and energetic detail how pol β processes 8-oxoG, we apply transition path sampling to delineate closing pathways of pol β 8-oxoG complexes with dCTP and dATP incoming nucleotides and compare the results to those of the nonlesioned G:dCTP and G:dATPanalogues. Results Our analyses show that the closing pathways of the 8-oxoG complexes are different from one another and from the nonlesioned analogues in terms of the individual transition states along each pathway, associated energies, and the stability of each pathway's closed state relative to the corresponding open state. In particular, the closed-to-open state stability difference in each system establishes a hierarchy of stability (from high to low as G:C > 8-oxoG:C > 8-oxoG:A > G:A, corresponding to -3, -2, 2, 9 kBT, respectively. This hierarchy of closed state stability parallels the experimentally observed processing efficiencies for the four pairs. Network models based on the calculated rate constants in each pathway indicate that the closed species are more populated than the open species for 8-oxoG:dCTP, whereas the opposite is true for 8-oxoG:dATP. Conclusion These results suggest that the lower insertion efficiency (larger Km for dATP compared to dCTP opposite 8-oxoG is caused by a less stable closed-form of pol β, destabilized by unfavorable interactions between Tyr271 and the mispair. This stability of the closed vs. open form can also explain the higher insertion efficiency for 8-oxoG:dATP compared to the nonlesioned G:dATP pair, which also has a higher overall conformational barrier. Our study offers atomic details of the complexes at different states, in addition to helping interpret the different insertion efficiencies of dATP and dCTP opposite 8-oxoG and G.

  10. DNA damage and repair kinetics of the Alternaria mycotoxins alternariol, altertoxin II and stemphyltoxin III in cultured cells.

    Fleck, Stefanie C; Sauter, Friederike; Pfeiffer, Erika; Metzler, Manfred; Hartwig, Andrea; Köberle, Beate

    2016-03-01

    The Alternaria mycotoxins alternariol (AOH) and altertoxin II (ATX II) have previously been shown to elicit mutagenic and genotoxic effects in bacterial and mammalian cells, although with vastly different activities. For example, ATX II was about 50 times more mutagenic than AOH. We now report that stemphyltoxin III (STTX III) is also highly mutagenic. The more pronounced effects of the perylene quinones ATX II and STTX III at lower concentrations compared to the dibenzo-α-pyrone AOH indicate a marked dependence of the genotoxic potential on the chemical structure and furthermore suggest that the underlying modes of action may be different. We have now further investigated the type of DNA damage induced by AOH, ATX II and STTX III, as well as the repair kinetics and their dependence on the status of nucleotide excision repair (NER). DNA double strand breaks induced by AOH due to poisoning of topoisomerase IIα were completely repaired in less than 2h. Under cell-free conditions, inhibition of topoisomerase IIα could also be measured for ATX II and STTX III at low concentrations, but the perylene quinones were catalytic inhibitors rather than topoisomerase poisons and did not induce DSBs. DNA strand breaks induced by ATX II and STTX III were more persistent and not completely repaired within 24h. A dependence of the repair rate on the NER status could only be demonstrated for STTX III, resulting in an accumulation of DNA damage in NER-deficient cells. Together with the finding that the DNA glycosylase formamidopyrimidine-DNA glycosylase (Fpg), but not T4 endonuclease V, is able to generate additional DNA strand breaks measurable by the alkaline unwinding assay, we conclude that the genotoxicity of the perylene quinones with an epoxide group is probably caused by the formation of DNA adducts which may be converted to Fpg sensitive sites. PMID:26994491

  11. Participation of glutamic acid 23 of T4 endonuclease V in the beta-elimination reaction of an abasic site in a synthetic duplex DNA.

    Hori, N; Doi, T; Karaki, Y.; Kikuchi, M.; Ikehara, M; Ohtsuka, E

    1992-01-01

    T4 endonuclease V catalyzes the hydrolysis of the glycosyl bond of a thymine dimer in a DNA duplex and the cleavage of the 3'-phosphate by beta-elimination. We have previously identified a catalytic site for the first reaction (pyrimidine dimer-glycosylase activity) by systematic mutagenesis (Doi et al. Proc. Natl. Acad. Sci. USA 1992 in press) and by x-ray crystallography (Morikawa et al. Science, 256: 523-526, 1992). The results showed that replacement of Glu23 with either glutamine or aspa...

  12. Oxidative Stress, DNA Damage, and Inflammation Induced by Ambient Air and Wood Smoke Particulate Matter in Human A549 and THP-1 Cell Lines

    Danielsen, Pernille Høgh; Møller, Peter; Jensen, Keld Alstrup;

    2011-01-01

    polycyclic aromatic hydrocarbons (PAH), less soluble metals, and expectedly also had a smaller particle size than PM collected from ambient air. All four types of PM combined increased the levels of 8-oxo-7,8-dihydro-20-deoxyguanosine dose-dependently in A549 cells, whereas there was no change in the levels...... sampled from the wood stove area. Expression of oxoguanine glycosylase 1, lymphocyte function-associated antigen-1, and interleukin-6 did not change. We conclude that WSPM has small particle size, high level of PAH, low level of water-soluble metals, and produces high levels of free radicals, DNA damage...

  13. Monoclonal B-cell hyperplasia and leukocyte imbalance precede development of B-cell malignancies in uracil-DNA glycosylase deficient mice

    Andersen, Sonja; Ericsson, Madelene; Dai, Hong Yan;

    2005-01-01

    Ung-deficient mice have reduced class switch recombination, skewed somatic hypermutation, lymphatic hyperplasia and a 22-fold increased risk of developing B-cell lymphomas. We find that lymphomas are of follicular (FL) and diffuse large B-cell type (DLBCL). All FLs and 75% of the DLBCLs were...... interleukin 2 is clearly different in wild type and in Ung-deficient mice. This suggests that Ung-proteins, directly or indirectly, have important functions in the immune system, not only in the process of antibody maturation, but also for production and functions of immunologically important cell types. The...

  14. Urinary excretion of 8-oxo-7,8-dihydroguanine as biomarker of oxidative damage to DNA

    Loft, Steffen; Danielsen, Pernille Høgh; Løhr, Mille;

    2012-01-01

    Oxidatively damaged DNA may be important in carcinogenesis. 8-Oxo-7,8-dihydroguanine (8-oxoGua) is an abundant and mutagenic lesion excised by oxoguanine DNA glycosylase 1 (OGG1) and measurable in urine or plasma by chromatographic methods with electrochemical or mass spectrometric detectors...... air pollution, toxic metals, tobacco smoke and low plasma antioxidant levels, whereas fruit and vegetable intake or dietary interventions showed no association. In rodent studies some types of feed may be source of 8-oxoGua in collected urine. Of cancer therapies, cisplatin increased 8-oxo......, reflecting the rate of damage in steady state. A common genetic OGG1 variant may affect the activity and was associated with increased levels of oxidized purines in leukocytes without apparent effect on 8-oxoGua excretion or major change in cancer risk. 8-OxoGua excretion has been associated with exposure to...

  15. SUMO-modification and elimination of the active DNA demethylation enzyme TDG in cultured human cells.

    Moriyama, Taishi; Fujimitsu, Yuka; Yoshikai, Yushi; Sasano, Takashi; Yamada, Koji; Murakami, Masataka; Urano, Takeshi; Sugasawa, Kaoru; Saitoh, Hisato

    2014-05-01

    Thymine DNA glycosylase (TDG) is a base excision repair enzyme that interacts with the small ubiquitin-related modifier (SUMO)-targeted ubiquitin E3 ligase RNF4 and functions in the active DNA demethylation pathway. Here we showed that both SUMOylated and non-modified forms of endogenous TDG fluctuated during the cell cycle and in response to drugs that perturbed cell cycle progression, including hydroxyurea and nocodazole. Additionally, we detected a SUMOylation-independent association between TDG and RNF4 in vitro as well as in vivo, and observed that both forms of TDG were efficiently degraded in RNF4-depleted cells when arrested at S phase. Our findings provide insights into the in vivo dynamics of TDG SUMOylation and further clarify the TDG-RNF4 interaction. PMID:24727457

  16. The Base Excision Repair system of Salmonella enterica serovar typhimurium counteracts DNA damage by host nitric oxide.

    Anthony R Richardson

    2009-05-01

    Full Text Available Intracellular pathogens must withstand nitric oxide (NO. generated by host phagocytes. Salmonella enterica serovar Typhimurium interferes with intracellular trafficking of inducible nitric oxide synthase (iNOS and possesses multiple systems to detoxify NO.. Consequently, the level of NO. stress encountered by S. Typhimurium during infection in vivo has been unknown. The Base Excision Repair (BER system recognizes and repairs damaged DNA bases including cytosine and guanine residues modified by reactive nitrogen species. Apurinic/apyrimidinic (AP sites generated by BER glycosylases require subsequent processing by AP endonucleases. S. Typhimurium xth nfo mutants lacking AP endonuclease activity exhibit increased NO. sensitivity resulting from chromosomal fragmentation at unprocessed AP sites. BER mutant strains were thus used to probe the nature and extent of nitrosative damage sustained by intracellular bacteria during infection. Here we show that an xth nfo S. Typhimurium mutant is attenuated for virulence in C3H/HeN mice, and virulence can be completely restored by the iNOS inhibitor L-NIL. Inactivation of the ung or fpg glycosylase genes partially restores virulence to xth nfo mutant S. Typhimurium, demonstrating that NO. fluxes in vivo are sufficient to modify cytosine and guanine bases, respectively. Mutants lacking ung or fpg exhibit NO.-dependent hypermutability during infection, underscoring the importance of BER in protecting Salmonella from the genotoxic effects of host NO.. These observations demonstrate that host-derived NO. damages Salmonella DNA in vivo, and the BER system is required to maintain bacterial genomic integrity.

  17. Use of the comet assay to measure DNA damage in cells exposed to photosensitizers and gamma radiation

    Pouget, J.-P.; Ravanat, J.-L.; Douki, T.; Richard, M.-J.; Cadet, J.

    1999-01-01

    We used the comet assay associated with DNA-glycosylases to estimate DNA damage in cells exposed to gamma irradiation or photosensitized either with methylene blue or orange acridine. A calibration performed using irradiation allowed the measurement of the steady-state level and the yield of 8-oxodGuo as well as strand breaks and alkali-labile sites. Nous avons utilisé la méthode des comètes associée à des ADN-glycosylases, pour estimer les dommages de l'ADN dans des cellules après l'exposition à un rayonnement gamma ou après photosensibilisation par le bleu de méthylène ou l'acridine orange. Une calibration de la méthode des comètes a permis de mesurer le niveau basal et les taux de formation de 8-oxodGuo ainsi que le nombre de cassures de brins et de sites alcali labiles.

  18. Oxidative DNA damage induced by metabolites of chloramphenicol, an antibiotic drug.

    Ohnishi, Shiho; Murata, Mariko; Ida, Naoyuki; Oikawa, Shinji; Kawanishi, Shosuke

    2015-01-01

    Chloramphenicol (CAP) was an old antimicrobial agent. However, the use of CAP is limited because of its harmful side effects, such as leukemia. The molecular mechanism through which CAP has been strongly correlated with leukemogenesis is still unclear. To elucidate the mechanism of genotoxicity, we examined DNA damage by CAP and its metabolites, nitroso-CAP (CAP-NO), N-hydroxy-CAP (CAP-NHOH), using isolated DNA. CAP-NHOH have the ability of DNA damage including 8-oxo-7,8-dihydro-2'-deoxyguanosine formation in the presence of Cu(II), which was greatly enhanced by the addition of an endogenous reductant NADH. CAP-NO caused DNA damage in the presence of Cu(II), only when reduced by NADH. NADH can non-enzymatically reduce the nitroso form to hydronitroxide radicals, resulting in enhanced generation of reactive oxygen species followed by DNA damage through the redox cycle. Furthermore, we also studied the site specificity of base lesions in DNA treated with piperidine or formamidopyrimidine-DNA glycosylase, using (32)P-5'-end-labeled DNA fragments obtained from the human tumor suppressor gene. CAP metabolites preferentially caused double base lesion, the G and C of the ACG sequence complementary to codon 273 of the p53 gene, in the presence of NADH and Cu(II). Therefore, we conclude that oxidative double base lesion may play a role in carcinogenicity of CAP. PMID:25971446

  19. Characterization of oxidative guanine damage and repair in mammalian telomeres.

    Zhilong Wang

    2010-05-01

    Full Text Available 8-oxo-7,8-dihydroguanine (8-oxoG and 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyG are among the most common oxidative DNA lesions and are substrates for 8-oxoguanine DNA glycosylase (OGG1-initiated DNA base excision repair (BER. Mammalian telomeres consist of triple guanine repeats and are subject to oxidative guanine damage. Here, we investigated the impact of oxidative guanine damage and its repair by OGG1 on telomere integrity in mice. The mouse cells were analyzed for telomere integrity by telomere quantitative fluorescence in situ hybridization (telomere-FISH, by chromosome orientation-FISH (CO-FISH, and by indirect immunofluorescence in combination with telomere-FISH and for oxidative base lesions by Fpg-incision/Southern blot assay. In comparison to the wild type, telomere lengthening was observed in Ogg1 null (Ogg1(-/- mouse tissues and primary embryonic fibroblasts (MEFs cultivated in hypoxia condition (3% oxygen, whereas telomere shortening was detected in Ogg1(-/- mouse hematopoietic cells and primary MEFs cultivated in normoxia condition (20% oxygen or in the presence of an oxidant. In addition, telomere length abnormalities were accompanied by altered telomere sister chromatid exchanges, increased telomere single- and double-strand breaks, and preferential telomere lagging- or G-strand losses in Ogg1(-/- mouse cells. Oxidative guanine lesions were increased in telomeres in Ogg1(-/- mice with aging and primary MEFs cultivated in 20% oxygen. Furthermore, oxidative guanine lesions persisted at high level in Ogg1(-/- MEFs after acute exposure to hydrogen peroxide, while they rapidly returned to basal level in wild-type MEFs. These findings indicate that oxidative guanine damage can arise in telomeres where it affects length homeostasis, recombination, DNA replication, and DNA breakage repair. Our studies demonstrate that BER pathway is required in repairing oxidative guanine damage in telomeres and maintaining telomere integrity

  20. DNA damage induced by the direct effect of radiation

    Yokoya, A.; Shikazono, N.; Fujii, K.; Urushibara, A.; Akamatsu, K.; Watanabe, R.

    2008-10-01

    We have studied the nature of DNA damage induced by the direct effect of radiation. The yields of single- (SSB) and double-strand breaks (DSB), base lesions and clustered damage were measured using the agarose gel electrophoresis method after exposing to various kinds of radiations to a simple model DNA molecule, fully hydrated closed-circular plasmid DNA (pUC18). The yield of SSB does not show significant dependence on linear energy transfer (LET) values. On the other hand, the yields of base lesions revealed by enzymatic probes, endonuclease III (Nth) and formamidopyrimidine DNA glycosylase (Fpg), which excise base lesions and leave a nick at the damage site, strongly depend on LET values. Soft X-ray photon (150 kVp) irradiation gives a maximum yield of the base lesions detected by the enzymatic probes as SSB and clustered damage, which is composed of one base lesion and proximate other base lesions or SSBs. The clustered damage is visualized as an enzymatically induced DSB. The yields of the enzymatically additional damages strikingly decrease with increasing levels of LET. These results suggest that in higher LET regions, the repair enzymes used as probes are compromised because of the dense damage clustering. The studies using simple plasmid DNA as a irradiation sample, however, have a technical difficulty to detect multiple SSBs in a plasmid DNA. To detect the additional SSBs induced in opposite strand of the first SSB, we have also developed a novel technique of DNA-denaturation assay. This allows us to detect multiply induced SSBs in both strand of DNA, but not induced DSB.

  1. Mechanism of maltal hydration catalyzed by β-amylase: Role of protein structure in controlling the steric outcome of reactions catalyzed by a glycosylase

    Crystalline (monomeric) soybean and (tetrameric) sweet potato β-amylase were shown to catalyze the cis hydration of maltal (α-D-glucopyranosyl-2-deoxy-D-arabino-hex-1-enitol) to form β-2-deoxymaltose. As reported earlier with the sweet potato enzyme, maltal hydration in D2O by soybean β-amylase was found to exhibit an unusually large solvent deuterium kinetic isotope effect (VH/VD=6.5), a reaction rate linearly dependent on the mole fraction of deuterium, and 2-deoxy-[2(a)-2H]maltose as product. These results indicate (for each β-amylase) that protonation is the rate-limiting step in a reaction involving a nearly symmetric one-proton transition state and that maltal is specifically protonated from above the double bond. That maltal undergoes cis hydration provides evidence in support of a general-acid-catalyzed, carbonium ion mediated reaction. Of fundamental significance is that β-amylase protonates maltal from a direction opposite that assumed for protonating strach, yet creates products of the same anomeric configuration from both. Such stereochemical dichotomy argues for the overriding role of protein structures is dictating the steric outcome of reactions catalyzed by a glycosylase, by limiting the approach and orientation of water or other acceptors to the reaction center

  2. Are glutathione S transferases involved in DNA damage signalling? Interactions with DNA damage and repair revealed from molecular epidemiology studies

    Dusinska, Maria, E-mail: Maria.DUSINSKA@nilu.no [CEE-Health Effects Group, NILU - Norwegian Institute for Air Research, Kjeller (Norway); Staruchova, Marta; Horska, Alexandra [Department of Experimental and Applied Genetics, Slovak Medical University, Bratislava (Slovakia); Smolkova, Bozena [Laboratory of Cancer Genetics, Cancer Research Institute of the Slovak Academy of Sciences, Bratislava (Slovakia); Collins, Andrew [Department of Nutrition, Faculty of Medicine, University of Oslo (Norway); Bonassi, Stefano [Unit of Clinical and Molecular Epidemiology, IRCCS San Raffaele Pisana, Rome (Italy); Volkovova, Katarina [Department of Experimental and Applied Genetics, Slovak Medical University, Bratislava (Slovakia)

    2012-08-01

    Glutathione S-transferases (GSTs) are members of a multigene family of isoenzymes that are important in the control of oxidative stress and in phase II metabolism. Acting non-enzymically, GSTs can modulate signalling pathways of cell proliferation, cell differentiation and apoptosis. Using a molecular epidemiology approach, we have investigated a potential involvement of GSTs in DNA damage processing, specifically the modulation of DNA repair in a group of 388 healthy adult volunteers; 239 with at least 5 years of occupational exposure to asbestos, stone wool or glass fibre, and 149 reference subjects. We measured DNA damage in lymphocytes using the comet assay (alkaline single cell gel electrophoresis): strand breaks (SBs) and alkali-labile sites, oxidised pyrimidines with endonuclease III, and oxidised purines with formamidopyrimidine DNA glycosylase. We also measured GST activity in erythrocytes, and the capacity for base excision repair (BER) in a lymphocyte extract. Polymorphisms in genes encoding three GST isoenzymes were determined, namely deletion of GSTM1 and GSTT1 and single nucleotide polymorphism Ile105Val in GSTP1. Consumption of vegetables and wine correlated negatively with DNA damage and modulated BER. GST activity correlated with oxidised bases and with BER capacity, and differed depending on polymorphisms in GSTP1, GSTT1 and GSTM1. A significantly lower BER rate was associated with the homozygous GSTT1 deletion in all asbestos site subjects and in the corresponding reference group. Multifactorial analysis revealed effects of sex and exposure in GSTP1 Ile/Val heterozygotes but not in Ile/Ile homozygotes. These variants affected also SBs levels, mainly by interactions of GSTP1 genotype with exposure, with sex, and with smoking habit; and by an interaction between sex and smoking. Our results show that GST polymorphisms and GST activity can apparently influence DNA stability and repair of oxidised bases, suggesting a potential new role for these

  3. Are glutathione S transferases involved in DNA damage signalling? Interactions with DNA damage and repair revealed from molecular epidemiology studies

    Glutathione S-transferases (GSTs) are members of a multigene family of isoenzymes that are important in the control of oxidative stress and in phase II metabolism. Acting non-enzymically, GSTs can modulate signalling pathways of cell proliferation, cell differentiation and apoptosis. Using a molecular epidemiology approach, we have investigated a potential involvement of GSTs in DNA damage processing, specifically the modulation of DNA repair in a group of 388 healthy adult volunteers; 239 with at least 5 years of occupational exposure to asbestos, stone wool or glass fibre, and 149 reference subjects. We measured DNA damage in lymphocytes using the comet assay (alkaline single cell gel electrophoresis): strand breaks (SBs) and alkali-labile sites, oxidised pyrimidines with endonuclease III, and oxidised purines with formamidopyrimidine DNA glycosylase. We also measured GST activity in erythrocytes, and the capacity for base excision repair (BER) in a lymphocyte extract. Polymorphisms in genes encoding three GST isoenzymes were determined, namely deletion of GSTM1 and GSTT1 and single nucleotide polymorphism Ile105Val in GSTP1. Consumption of vegetables and wine correlated negatively with DNA damage and modulated BER. GST activity correlated with oxidised bases and with BER capacity, and differed depending on polymorphisms in GSTP1, GSTT1 and GSTM1. A significantly lower BER rate was associated with the homozygous GSTT1 deletion in all asbestos site subjects and in the corresponding reference group. Multifactorial analysis revealed effects of sex and exposure in GSTP1 Ile/Val heterozygotes but not in Ile/Ile homozygotes. These variants affected also SBs levels, mainly by interactions of GSTP1 genotype with exposure, with sex, and with smoking habit; and by an interaction between sex and smoking. Our results show that GST polymorphisms and GST activity can apparently influence DNA stability and repair of oxidised bases, suggesting a potential new role for these

  4. DNA-binding protein from HeLa cells that binds preferentially to supercoiled DNA damaged by ultraviolet light or N-acetoxy-N-acetyl-2-aminofluorene

    A DNA-binding protein was partially purified from extracts of HeLa cells by high-speed centrifugation and chromatography on DEAE-cellulose, phosphocellulose and ultraviolet light-irradiated DNA-cellulose columns. It eluted from the phosphocellulose column with 0.375 M potassium phosphate and from the ultraviolet light-irradiated DNA-cellulose column between 0.5 M and 1 M NaCl. The protein binds preferentially to supercoiled PM2 DNA treated with ultraviolet light or N-acetoxy-N-acetyl-2-aminofluorene, as compared to native supercoiled PM2 DNA. The binding is non-cooperative. Nicked or linear forms of PM2 DNA (damaged or untreated) are not efficient substrates, indicating a requirement of DNA supercoiling for DNA binding. The sedimentation coefficient of the protein estimated by glycerol gradient centrifugation is 2.0-2.5 S, corresponding to a molecular weight of about 20000-25000 if the protein is spherical. The binding to DNA irradiated with ultraviolet light or treated with acetoxyacetylaminofluorene is optimal at around 100-200 mM NaCl and is relatively independent of temperature and pH. MgCl2 and MnCl2 at concentrations between 1 and 5 mM do not markedly affect the binding, but it is inhibited by sucrose, ATP and caffeine. The biological significance of the DNA-binding protein remains to be determined. It does not possess significant glycosylase, endonuclease or exonuclease activities. The dissociation equilibrium constant for the binding reaction of the protein to the ultraviolet light or acetoxyacetylaminofluorene-induced binding sites on DNA is estimated to be 4x10-11 M. There are at least 1x105 DNA-binding protein molecules/HeLa cell. (Auth.)

  5. DNA Book

    Kawai, Jun; Hayashizaki, Yoshihide

    2003-01-01

    We propose herein a new method of DNA distribution, whereby DNA clones or PCR products are printed directly onto the pages of books and delivered to users along with relevant scientific information. DNA sheets, comprising water-soluble paper onto which DNA is spotted, can be bound into books. Readers can easily extract the DNA fragments from DNA sheets and amplify them using PCR. We show that DNA sheets can withstand various conditions that may be experienced during bookbinding and deli...

  6. Cleaving DNA with DNA

    Carmi, Nir; Balkhi, Shameelah R.; Breaker, Ronald R.

    1998-03-01

    A DNA structure is described that can cleave single-stranded DNA oligonucleotides in the presence of ionic copper. This ``deoxyribozyme'' can self-cleave or can operate as a bimolecular complex that simultaneously makes use of duplex and triplex interactions to bind and cleave separate DNA substrates. Bimolecular deoxyribozyme-mediated strand scission proceeds with a kobs of 0.2 min-1, whereas the corresponding uncatalyzed reaction could not be detected. The duplex and triplex recognition domains can be altered, making possible the targeted cleavage of single-stranded DNAs with different nucleotide sequences. Several small synthetic DNAs were made to function as simple ``restriction enzymes'' for the site-specific cleavage of single-stranded DNA.

  7. DNA polymerase X from Deinococcus radiodurans implicated in bacterial tolerance to DNA damage is characterized as a short patch base excision repair polymerase.

    Khairnar, Nivedita P; Misra, Hari S

    2009-09-01

    The Deinococcus radiodurans R1 genome encodes an X-family DNA repair polymerase homologous to eukaryotic DNA polymerase beta. The recombinant deinococcal polymerase X (PolX) purified from transgenic Escherichia coli showed deoxynucleotidyltransferase activity. Unlike the Klenow fragment of E. coli, this enzyme showed short patch DNA synthesis activity on heteropolymeric DNA substrate. The recombinant enzyme showed 5'-deoxyribose phosphate (5'-dRP) lyase activity and base excision repair function in vitro, with the help of externally supplied glycosylase and AP endonuclease functions. A polX disruption mutant of D. radiodurans expressing 5'-dRP lyase and a truncated polymerase domain was comparatively less sensitive to gamma-radiation than a polX deletion mutant. Both mutants showed higher sensitivity to hydrogen peroxide. Excision repair mutants of E. coli expressing this polymerase showed functional complementation of UV sensitivity. These results suggest the involvement of deinococcal polymerase X in DNA-damage tolerance of D. radiodurans, possibly by contributing to DNA double-strand break repair and base excision repair. PMID:19542005

  8. A Meta-Analysis of the Association between the hOGG1 Ser326Cys Polymorphism and the Risk of Esophageal Squamous Cell Carcinoma

    Zhang, Junjie; Zhou, Jingshi; Zhang, Ping; Wang, Weiping; Tao, Shiheng; Wang, Minghua

    2013-01-01

    Background Genetic polymorphism of human 8-oxoguanine glycosylase 1 (hOGG1) Ser326Cys (rs1052133) has been implicated in the risk of Esophageal Squamous Cell Carcinoma (ESCC). However, the published findings are inconsistent. We therefore performed a meta-analysis to derive a more precise estimation of the association between the hOGG1 Ser326Cys polymorphism and ESCC risk. Methodology/Principal Findings A comprehensive search was conducted to identify eligible studies of hOGG1 Ser326Cys polym...

  9. Spectroscopic approaches to study DNA damage induced in genome exposed to ionizing radiation and its enzymatic repair

    Recent progress on spectroscopic study on physicochemical process of DNA damage induction will be reported. It has been predicted by computer track simulation studies that complex DNA damage, so called clustered DNA damage sites, is produced along the tack particularly of high Linear Energy Transfer (LET) ions. The clustered DNA damage, consisting of two or more isolated lesions such as single strand breaks or nucleobase lesions, is thought to compromise DNA repair enzymes. We have revealed that the nucleobase lesions produced by He2+ ion impact to simple model DNA (plasmid) are hardly processed by base excision repair enzymes (E. coli DNA glycosylases). Using the third generation synchrotron radiation facility (SPring-8), we have studied unpaired electron species or desorbed ions as intermediates of DNA damage using an EPR apparatus or mass spectrometer installed in the soft X-ray beamline in SPring-8. These aspects are compared with the yields of final products of single- and double-strand breaks and base lesions revealed biochemical techniques. Models of complex DNA damage induction will be proposed considering various modification factors of the damage induction, ionization of valence and inner-shell electrons, OH radicals, hydration layer and the impact of secondary electrons. (author)

  10. Ionizing radiation-induced DNA damage and its repair in human cells. Final performance report, July 1992 - June 1995

    The studies of DNA damage in living cells in vitro and in vivo were continued. A variety of systems including cultured mammalian cells, animals, and human tissues were used to conduct these studies. In addition, enzymatic repair of DNA base damage was studied using several DNA glycosylases. To this end, substrate specificities of these enzymes were examined in terms of a large number of base lesions in DNA. In the first phase of the studies, the author sought to introduce improvements to his methodologies for measurement of DNA damage using the technique of gas chromatography/mass spectrometry (GC/MS). In particular, the quantitative measurement of DNA base damage and DNA-protein crosslinks was improved by incorporation of isotope-dilution mass spectrometry into the methodologies. This is one of the most accurate techniques for quantification of organic compounds. Having improved the measurement technique, studies of DNA damage in living cells and DNA repair by repair enzymes were pursued. This report provides a summary of these studies with references to the original work

  11. No effect of 600 grams fruit and vegetables per day on oxidative DNA damage and repair in healthy nonsmokers

    Moller, P.; Vogel, Ulla Birgitte; Pedersen, A.;

    2003-01-01

    damage. We set up a parallel 24-day dietary placebo-controlled intervention study in which 43 subjects were randomized into three groups receiving an antioxidant-free basal diet and 600 g of fruits and vegetables, or a supplement containing the corresponding amounts of vitamins and minerals, or placebo......In several epidemiological studies, high intakes of fruits and vegetables have been associated with a lower incidence of cancer. Theoretically, intake of antioxidants by consumption of fruits and vegetables should protect against reactive oxygen species and decrease the formation of oxidative DNA......-oxo-2'-deoxyguanine was measured in urine. The expressions of oxoguanine glycosylase I and excision repair cross complementing I DNA repair genes, determined by real-time reverse transcription-PCR of mRNAs, were investigated in leukocytes. Consumption of fruits and vegetables or vitamins and minerals...

  12. Roles of oxidative stress and the ERK1/2, PTEN and p70S6K signaling pathways in arsenite-induced autophagy.

    Huang, Ya-Chun; Yu, Hsin-Su; Chai, Chee-Yin

    2015-12-15

    Studies show that arsenite induces oxidative stress and modifies cellular function via phosphorylation of proteins and inhibition of DNA repair enzymes. Autophagy, which has multiple physiological and pathological roles in cellular function, is initiated by oxidative stress and is regulated by the signaling pathways of phosphatidylinositol 3-phosphate kinase (PI3K)/mammalian target of rapamycin (mTOR)/p70S6 kinase (p70S6K) and extracellular signaling-regulated protein kinase 1/2 (ERK1/2) that play important roles in oncogenesis. However, the effects of arsenite-induced oxidative stress on autophagy and on expression of related proteins are not fully understood. This study found that cells treated with sodium arsenite had reduced 8-oxoguanine DNA glycosylase 1 (OGG1) and increased 8-hydroxy-2'-deoxyguanosine (8-OHdG) and activating transcription factor (ATF) 3 in SV-40 immortalized human uroepithelial (SV-HUC-1) cells. Arsenite also increased the number of autophagosomes and increased levels of the autophagy markers Beclin-1 and microtubule-associated protein 1 light chain 3B. Reactive oxygen species scavenger decreased arsenite-induced autophagy in SV-HUC-1 cells. Our previous work showed that arsenite induced phosphorylation of the ERK1/2 signaling pathway. The current study further showed that arsenite decreased phosphatase and tensin homologue (PTEN) levels and increased phospho-p70S6 kinase (p-p70S6K) in SV-HUC-1 cells. However, both kinase inhibitor U0126 and the DNA (cytosine-5-)-methyltransferase 1 (DNMT1) inhibitor 5-aza-deoxycytidine abolished the effect of arsenite on expressions of PTEN and p-p70S6K. These results show that autophagy induced by arsenite exposure is mediated by oxidative stress, which regulates activation of the PTEN, p70S6K and ERK1/2 signaling pathways. Thus, this study clarifies the role of autophagy in arsenite-induced urothelial carcinogenesis. PMID:26432159

  13. An enzymatic activity isolated from Brassica oleracea specific for UV-irradiated DNA

    As a consequence of a breakdown in the ozone layer, an increase in the amount of DNA damage caused by ultraviolet irradiation can be expected. Organisms have evolved mechanisms to repair numerous types of DNA damages. While these DNA repair systems have been well characterized in bacteria and to a lesser extent in mammalian cells, surprisingly little is known about repair of potentially harmful DNA lesions in plants. An enzyme that recognizes and incises UV irradiated DNA has been partially purified from the leaf tissue of Brassica oleracea. Glycosylase-produced base loss sites were detected by a nitrocellulose filter-binding assay using UV-irradiated PM2 viral DNA as the substrate. The optimal temperature for maximal enzyme activity is 47C with a pH optimum between 7.0 and 7.5. In addition, the endonuclease is active in both Tris and phosphate buffers, although it is stimulated by phosphate concentrations up to 25 mM. Currently, a number of synthetic polynucleotides as well as DNAs of defined sequence are being employed as substrates to determine the nature of the UV-induced lesion and the precise mechanism of action of the enzyme

  14. Elucidation of the mechanism of X-ray induced DNA duplication observed in human Gorlin cells

    A phenomenon in which DNA synthesis level increases rapidly after x-ray irradiation has found out in the cells which originate in Gorlin patients. A gene, by which an expression level changes after x-ray irradiation, is searched in the human Gorlin cells by the mRNA differential display method. The DNA synthesis level decreases in normal human cell after x-ray irradiation of 2 Gy dose, but increases twice in the Gorlin cell. Expression levels of gene SMT3A, however decrease clearly in the Gorlin cells after the irradiation. The relations between expression levels of gene SMT3M, a protein like ubichitin, and DNA synthesis levels are searched. DNA synthesis activity in normal human cells, which are treated by antisese oligonucleotide and suppressed expression of the genes SMT3A, increases after x-ray irradiation. An increase of the DNA synthesis level after the irradiation is not a phenomenon in particular cells, but indicates the possibility of general phenomena in normal human cells. It is reported that the gene SMT3A combines with a glycosylase which operates in DNA repairing process. The protein modification of gene SMT3A indicates a possibility for controlling of stress protection mechanism in the cells. (M. Suetake)

  15. Evaluation of basal DNA damage and oxidative stress in Wistar rat leukocytes after exposure to microwave radiation

    The aim of this study was to assess whether microwave-induced DNA damage is basal or it is also generated through reactive oxygen species (ROS) formation. After having irradiated Wistar rats with 915 MHz microwave radiation, we assessed different DNA alterations in peripheral leukocytes using standard and formamidopyrimidine DNA-glycosylase (Fpg)-modified comet assay. The first is a sensitive tool for detecting primary DNA damage, and the second is much more specific for detecting oxidative damage. The animals were irradiated for 1 h a day for 2 weeks at a field power density of 2.4 W/m2, and the whole-body average specific absorption rate (SAR) of 0.6 W/kg. Both the standard and the Fpg-modified comet assay detected increased DNA damage in blood leukocytes of the exposed rats. The significant increase in Fpg-detected DNA damage in the exposed rats suggests that oxidative stress is likely to be responsible. DNA damage detected by the standard comet assay indicates that some other mechanisms may also be involved. In addition, both methods served proved sensitive enough to measure basal and oxidative DNA damage after long-term exposure to 915 MHz microwave radiation in vivo.

  16. DNA damage and defence gene expression after oxidative stress induced by x-rays and diesel exhaust particles

    Particulate air pollution is one the most important environmental health factors for people living in cities. Especially the exhaust particles from traffic are possible causes for cancer and cardiopulmonary diseases. The aim of this thesis was to characterize the health effects of diesel exhaust particles (DEP) by inducing oxidative stress and analyse the underlying mechanisms. Methods for determining oxidative stress, DNA damage, and gene expression were validated and calibrated in lung tissue by studying the dose response relations after ionizing radiation. The study showed the feasibility of partial-body x-ray irradiation as an in vivo model for induction and repair of oxidative DNA damage, of DNA repair enzymes expression, and antioxidant defense genes. A 'nose-only' mouse model for inhalation of ultra-fine particles showed that particles induce oxidative DNA damage in lung tissue and in bronchoalveolar lavage cells. The exposure increased the expression of HO-1 mRNA and oxoguanine DNA glycosylase OGG1 mRNA. The levels of 8-oxodG and OGG1 mRNA were mirror images. Colon and liver were analysed after administration of DEP in the diet with or without increasing doses of sucrose. This study indicated that DEP induces DNA adducts and oxidative stress through formation of DNA strand breaks, DNA repair enzyme expression, apoptosis, and protein oxidisation in colon and liver at relatively low exposure doses. The thesis is based on four published journal articles. (ln)

  17. DNA supercoiling inhibits DNA knotting.

    Burnier Y.; Dorier J.; Stasiak A.

    2008-01-01

    Despite the fact that in living cells DNA molecules are long and highly crowded, they are rarely knotted. DNA knotting interferes with the normal functioning of the DNA and, therefore, molecular mechanisms evolved that maintain the knotting and catenation level below that which would be achieved if the DNA segments could pass randomly through each other. Biochemical experiments with torsionally relaxed DNA demonstrated earlier that type II DNA topoisomerases that permit inter- and intramolecu...

  18. Endonucleolytic activity directed towards 8-(2-hydroxy-2-propyl) purines in double-stranded DNA.

    Livneh, Z; Elad, D; Sperling, J

    1979-11-01

    Photoalkylation of circular covalently closed DNA from phage PM2 with isopropyl alcohol by using a free radical photoinitiator and UV light of lambda greater than 305 nm led to the specific 8-substitution of purine moieties in the DNA, yielding 8-(2-hydroxy-2-propyl)adenine and 8-(2-hydroxy-2-propyl)guanine as the only detectable damage in the DNA. Using this specifically photoalkylated DNA as a substrate, we discovered in extracts of Micrococcus luteus an endonucleolytic activity that is directed towards 8-(2-hydroxy-2-propyl) purines in DNA. The activity is not a combination of a DNA-glycosylase and an apurinic site endonuclease. It is not inhibited by single-stranded DNA, by UV- or gamma-irradiated single-stranded DNA, or by normal or depurinated double-stranded DNA. however, gamma- or UV-(254 nm) irradiated double-stranded DNAs to inhibit the activity, hinting at the possibility of a common type of lesion in these damaged DNAs. Divalent cations are not required for the incising activity, and it is fully active in 1 mM EDTA, whereas caffeine and ATP cause inhibition. Extracts of mutant M. luteus lacking pyrimidine-dimer-directed endonucleases were found to contain the endonucleolytic activity in levels comparable to those present in the wild type. After the incision, we could demonstrate the specific excision of the 8-alkylated purines from the damaged DNA. The special conformational consequences of the 8-alkylation of purines, at the nucleotide level, namely their nonregular syn conformation, suggest that it is the distortion in the DNA that is recognized by the endonuclease. PMID:293658

  19. DNA vaccines

    Coban, Cevayir; Kobiyama, Kouji; Jounai, Nao; Tozuka, Miyuki; Ishii, Ken J.

    2013-01-01

    Since the introduction of DNA vaccines two decades ago, this attractive strategy has been hampered by its low immunogenicity in humans. Studies conducted to improve the immunogenicity of DNA vaccines have shown that understanding the mechanism of action of DNA vaccines might be the key to successfully improving their immunogenicity. Our current understanding is that DNA vaccines induce innate and adaptive immune responses in two ways: (1) encoded protein (or polypeptide) antigen(s) by the DNA...

  20. Oxidative stress and male reproductive health

    Robert J Aitken

    2014-02-01

    Full Text Available One of the major causes of defective sperm function is oxidative stress, which not only disrupts the integrity of sperm DNA but also limits the fertilizing potential of these cells as a result of collateral damage to proteins and lipids in the sperm plasma membrane. The origins of such oxidative stress appear to involve the sperm mitochondria, which have a tendency to generate high levels of superoxide anion as a prelude to entering the intrinsic apoptotic cascade. Unfortunately, these cells have very little capacity to respond to such an attack because they only possess the first enzyme in the base excision repair (BER pathway, 8-oxoguanine glycosylase 1 (OGG1. The latter successfully creates an abasic site, but the spermatozoa cannot process the oxidative lesion further because they lack the downstream proteins (APE1, XRCC1 needed to complete the repair process. It is the responsibility of the oocyte to continue the BER pathway prior to initiation of S-phase of the first mitotic division. If a mistake is made by the oocyte at this stage of development, a mutation will be created that will be represented in every cell in the body. Such mechanisms may explain the increase in childhood cancers and other diseases observed in the offspring of males who have suffered oxidative stress in their germ line as a consequence of age, environmental or lifestyle factors. The high prevalence of oxidative DNA damage in the spermatozoa of male infertility patients may have implications for the health of children conceivedin vitro and serves as a driver for current research into the origins of free radical generation in the germ line.

  1. The hOGG1 Ser326Cys Gene Polymorphism and the Risk of Coronary Ectasia in the Chinese Population

    Po-Chao Hsu

    2014-01-01

    Full Text Available Oxidative stress (OS is related to vascular inflammation possibly, contributing to the development of coronary ectasia (CE. Base excision repair (BER and nucleotide excision repair are the main DNA repair pathways that can help to remove 8-hydroxydeoxyguanine (8-OHdG, a marker of OS. Human 8-oxoguanine DNA glycosylase 1 (hOGG1 is a key enzyme of the BER pathway and catalyzes the removal of 8-OHdG. The aim of our study was to investigate the association between hOGG1 Ser326Cys gene polymorphism and CE in a Chinese population. Five-hundred forty-seven patients who underwent diagnostic coronary angiography in a tertiary medical center were recruited. The angiographic definition of CE is the diameter of the ectatic segment being more than 1.5 times larger compared with an adjacent healthy reference segment. The gene polymorphisms were analyzed by polymerase chain reaction. The urine 8OHdG concentration was measured using a commercial ELISA kit. The distribution of hOGG1 Ser326Cys genotypes was significantly different between CE and non-CE groups (p = 0.033. The odds ratio of CE development for the Ser to the Cys variant was 1.55 (95% confidence interval (CI, 1.04–2.31, p = 0.033. Both univariate and logistic regression analysis showed a significant association of hOGG1 Ser326Cys polymorphism in the dominant model with CE development (p = 0.009 and 0.011, respectively. Urine 8-OHdG levels were significantly higher in subjects carrying the hOGG1 Ser variant than in those with the Cys/Cys genotype (p < 0.03. In conclusion, our study suggests that the hOGG1 Ser326Cys gene variant might play a role in susceptibility to the development of CE.

  2. Mechanism of Werner DNA helicase: POT1 and RPA stimulates WRN to unwind beyond gaps in the translocating strand.

    Ahn, Byungchan; Lee, Jae Wan; Jung, Hana; Beck, Gad; Bohr, Vilhelm A

    2009-01-01

    WRN belongs to the RecQ family of DNA helicases and it plays a role in recombination, replication, telomere maintenance and long-patch base excision repair. Here, we demonstrate that WRN efficiently unwinds DNA substrates containing a 1-nucleotide gap in the translocating DNA strand, but when the gap size is increased to 3-nucleotides unwinding activity significantly declines. In contrast, E. coli UvrD (3'-->5' helicase), which recognizes nicks in DNA to initiate unwinding, does not unwind past a 1-nucleotide gap. This unique ability of WRN to bypass gaps supports its involvement in DNA replication and LP-BER where such gaps can be produced by glycosylases and the apurinic/apyrimidinic endonuclease 1 (APE1). Furthermore, we tested telomere repeat binding factor 2 (TRF2), both variants 1 and 2 of protector of telomeres 1 (POT1v1 and POT1v2) and RPA on telomeric DNA substrates containing much bigger gaps than 3-nucleotides in order to determine whether unwinding could be facilitated through WRN-protein interaction. Interestingly, POT1v1 and RPA are capable of stimulating WRN helicase on gapped DNA and 5'-overhang substrates, respectively. PMID:19262689

  3. Mechanism of Werner DNA helicase: POT1 and RPA stimulates WRN to unwind beyond gaps in the translocating strand.

    Byungchan Ahn

    Full Text Available WRN belongs to the RecQ family of DNA helicases and it plays a role in recombination, replication, telomere maintenance and long-patch base excision repair. Here, we demonstrate that WRN efficiently unwinds DNA substrates containing a 1-nucleotide gap in the translocating DNA strand, but when the gap size is increased to 3-nucleotides unwinding activity significantly declines. In contrast, E. coli UvrD (3'-->5' helicase, which recognizes nicks in DNA to initiate unwinding, does not unwind past a 1-nucleotide gap. This unique ability of WRN to bypass gaps supports its involvement in DNA replication and LP-BER where such gaps can be produced by glycosylases and the apurinic/apyrimidinic endonuclease 1 (APE1. Furthermore, we tested telomere repeat binding factor 2 (TRF2, both variants 1 and 2 of protector of telomeres 1 (POT1v1 and POT1v2 and RPA on telomeric DNA substrates containing much bigger gaps than 3-nucleotides in order to determine whether unwinding could be facilitated through WRN-protein interaction. Interestingly, POT1v1 and RPA are capable of stimulating WRN helicase on gapped DNA and 5'-overhang substrates, respectively.

  4. HIV-1 and HIV-2 exhibit divergent interactions with HLTF and UNG2 DNA repair proteins.

    Hrecka, Kasia; Hao, Caili; Shun, Ming-Chieh; Kaur, Sarabpreet; Swanson, Selene K; Florens, Laurence; Washburn, Michael P; Skowronski, Jacek

    2016-07-01

    HIV replication in nondividing host cells occurs in the presence of high concentrations of noncanonical dUTP, apolipoprotein B mRNA-editing, enzyme-catalytic, polypeptide-like 3 (APOBEC3) cytidine deaminases, and SAMHD1 (a cell cycle-regulated dNTP triphosphohydrolase) dNTPase, which maintains low concentrations of canonical dNTPs in these cells. These conditions favor the introduction of marks of DNA damage into viral cDNA, and thereby prime it for processing by DNA repair enzymes. Accessory protein Vpr, found in all primate lentiviruses, and its HIV-2/simian immunodeficiency virus (SIV) SIVsm paralogue Vpx, hijack the CRL4(DCAF1) E3 ubiquitin ligase to alleviate some of these conditions, but the extent of their interactions with DNA repair proteins has not been thoroughly characterized. Here, we identify HLTF, a postreplication DNA repair helicase, as a common target of HIV-1/SIVcpz Vpr proteins. We show that HIV-1 Vpr reprograms CRL4(DCAF1) E3 to direct HLTF for proteasome-dependent degradation independent from previously reported Vpr interactions with base excision repair enzyme uracil DNA glycosylase (UNG2) and crossover junction endonuclease MUS81, which Vpr also directs for degradation via CRL4(DCAF1) E3. Thus, separate functions of HIV-1 Vpr usurp CRL4(DCAF1) E3 to remove key enzymes in three DNA repair pathways. In contrast, we find that HIV-2 Vpr is unable to efficiently program HLTF or UNG2 for degradation. Our findings reveal complex interactions between HIV-1 and the DNA repair machinery, suggesting that DNA repair plays important roles in the HIV-1 life cycle. The divergent interactions of HIV-1 and HIV-2 with DNA repair enzymes and SAMHD1 imply that these viruses use different strategies to guard their genomes and facilitate their replication in the host. PMID:27335459

  5. DNA Methylation

    Alokail, Majed S.; Alenad, Amal M

    2015-01-01

    The DNA of E. coli contains 19,120 6-methyladenines and 12,045 5-methylcytosines in addition to the four regular bases and these are formed by the postreplicative action of three DNA methyltransferases. The majority of the methylated bases are formed by the Dam and Dcm methyltransferases encoded by the dam (DNA adenine methyltransferase) and dcm (DNA cytosine methyltransferase) genes. Although not essential, Dam methylation is important for strand discrimination during repair of replication e...

  6. DNA looping.

    Matthews, K S

    1992-01-01

    DNA-looping mechanisms are part of networks that regulate all aspects of DNA metabolism, including transcription, replication, and recombination. DNA looping is involved in regulation of transcriptional initiation in prokaryotic operons, including ara, gal, lac, and deo, and in phage systems. Similarly, in eukaryotic organisms, the effects of enhancers appear to be mediated at least in part by loop formation, and examples of DNA looping by hormone receptor proteins and developmental regulator...

  7. DNA structure

    Bowater, R

    2003-01-01

    Deoxyribonucleic acid (DNA) is a polymer of nucleotides. In the cell, DNA usually adopts a double-stranded helical form, with complementary base-pairing holding the two strands together. The most stable conformation is called B-form DNA, although other structures can occur under specific conditions.

  8. Biomarkers of radiation or oxidative damage to DNA in cells

    Major efforts have been devoted during the last two decades to the development of chemical and biochemical assays aimed at monitoring oxidized bases within DNA. Until recently, the level of oxidized bases in cellular DNA was overestimated by factors varying from one to three orders of magnitude. The reasons of these inconsistencies are now identified. Thus, artifactual oxidation of nucleobases may occur during the silylation reaction prior to gas chromatography mass spectrometry analysis and to a lesser extent during DNA extraction. The use of the so-called chaotropic DNA extraction method together with chelating agents was found to significantly prevent spurious DNA oxidation to occur. HPLC separations coupled to either electrochemical detection or versatile electrospray ionization tandem-mass spectrometry appear to be appropriate analytical tools when at least 20 μg of DNA is available. Interestingly, up to 11 modified nucleosides and nucleobases including the four cis and trans diastereomers of 5,6- dihydroxy-5,6-dihydrothymidine, 5-formyl-2'-deoxyuridine, 5-(hydroxymethyl)-2'-deoxyuridine, and 5-hydroxy-2'-deoxyuridine, 8-oxo-7,8-dihydro-2'-deoxyguanosine, 8-oxo-7,8-dihydro-2'-deoxyadenosine together with related formamidopyrimidine derivatives were measured in the DNA of neoplastic human monocytes exposed to ionizing radiation using the latter assay. The association of base excision DNA repair enzymes including bacterial formamidopyrimidine glycosylase (Fpg) and endonuclease III (endo III) with the comet assay represents a better alternative for assessing low levels of base damage. The basal level of Fpg- and endo III-sensitive sites was found to be similar, close to 2.1 per 107 bases, within the DNA of human monocytes. The yields of the different classes of damage per Gy and 107 bases are the following: 0.48 Fpg-sensitive sites, 0.53 endo III-sensitive sites and 1.30 strand breaks (direct nicks and alkali-labile sites). Interestingly, the above three classes

  9. Effects of ionizing radiations on DNA-protein complexes; Effets des radiations ionisantes sur des complexes ADN-proteine

    Gillard, N

    2005-11-15

    The radio-induced destruction of DNA-protein complexes may have serious consequences for systems implicated in important cellular functions. The first system which has been studied is the lactose operon system, that regulates gene expression in Escherichia coli. First of all, the repressor-operator complex is destroyed after irradiation of the complex or of the protein alone. The damaging of the domain of repressor binding to DNA (headpiece) has been demonstrated and studied from the point of view of peptide chain integrity, conformation and amino acids damages. Secondly, dysfunctions of the in vitro induction of an irradiated repressor-unirradiated DNA complex have been observed. These perturbations, due to a decrease of the number of inducer binding sites, are correlated to the damaging of tryptophan residues. Moreover, the inducer protects the repressor when they are irradiated together, both by acting as a scavenger in the bulk, and by the masking of its binding site on the protein. The second studied system is formed by Fpg (for Formamido pyrimidine glycosylase), a DNA repair protein and a DNA with an oxidative lesion. The results show that irradiation disturbs the repair both by decreasing its efficiency of DNA lesion recognition and binding, and by altering its enzymatic activity. (author)

  10. Biochemical reconstitution of TET1-TDG-BER-dependent active DNA demethylation reveals a highly coordinated mechanism.

    Weber, Alain R; Krawczyk, Claudia; Robertson, Adam B; Kuśnierczyk, Anna; Vågbø, Cathrine B; Schuermann, David; Klungland, Arne; Schär, Primo

    2016-01-01

    Cytosine methylation in CpG dinucleotides is an epigenetic DNA modification dynamically established and maintained by DNA methyltransferases and demethylases. Molecular mechanisms of active DNA demethylation began to surface only recently with the discovery of the 5-methylcytosine (5mC)-directed hydroxylase and base excision activities of ten-eleven translocation (TET) proteins and thymine DNA glycosylase (TDG). This implicated a pathway operating through oxidation of 5mC by TET proteins, which generates substrates for TDG-dependent base excision repair (BER) that then replaces 5mC with C. Yet, direct evidence for a productive coupling of TET with BER has never been presented. Here we show that TET1 and TDG physically interact to oxidize and excise 5mC, and proof by biochemical reconstitution that the TET-TDG-BER system is capable of productive DNA demethylation. We show that the mechanism assures a sequential demethylation of symmetrically methylated CpGs, thereby avoiding DNA double-strand break formation but contributing to the mutability of methylated CpGs. PMID:26932196

  11. The molecular genetics of the incision step in the DNA excision repair process

    In this historical review one particular aspect of excision repair, DNA incision, and how it is controlled at the genetic level in bacteriophage, bacteria, S. cerevisae, D. melanogaster, rodent cells and humans is examined. In phage T4, DNA is incised by a DNA glycosylase-AP endonuclease coded for by the denV gene. In E. coli, products of three genes, uvrA, uvrB and uvrC, are required to form UVRABC excinuclease that cleaves DNA and releases a fragment 12-13 nucleotides long containing the damage site. In S. cerevisiae, genes complementing five mutants of the RAD3 epistasis group, rad1, rad2, rad3, rad4 and rad10 have been cloned and analyzed. Rodent cells sensitive to a variety of mutagenic agents and deficient in excision repair are being used in molecular studies to identify and clone human repair genes (e.g. ERCC1) capable of complementing mammalian repair defects. Most studies of the human system, have been done with cells isolated from patients xeroderma pigmentosum, and these are now beginning to be characterized at the molecular level. (author)

  12. The aminoglycoside antibiotic kanamycin damages DNA bases in Escherichia coli: caffeine potentiates the DNA-damaging effects of kanamycin while suppressing cell killing by ciprofloxacin in Escherichia coli and Bacillus anthracis.

    Kang, Tina Manzhu; Yuan, Jessica; Nguyen, Angelyn; Becket, Elinne; Yang, Hanjing; Miller, Jeffrey H

    2012-06-01

    The distribution of mutants in the Keio collection of Escherichia coli gene knockout mutants that display increased sensitivity to the aminoglycosides kanamycin and neomycin indicates that damaged bases resulting from antibiotic action can lead to cell death. Strains lacking one of a number of glycosylases (e.g., AlkA, YzaB, Ogt, KsgA) or other specific repair proteins (AlkB, PhrB, SmbC) are more sensitive to these antibiotics. Mutants lacking AlkB display the strongest sensitivity among the glycosylase- or direct lesion removal-deficient strains. This perhaps suggests the involvement of ethenoadenine adducts, resulting from reactive oxygen species and lipid peroxidation, since AlkB removes this lesion. Other sensitivities displayed by mutants lacking UvrA, polymerase V (Pol V), or components of double-strand break repair indicate that kanamycin results in damaged base pairs that need to be removed or replicated past in order to avoid double-strand breaks that saturate the cellular repair capacity. Caffeine enhances the sensitivities of these repair-deficient strains to kanamycin and neomycin. The gene knockout mutants that display increased sensitivity to caffeine (dnaQ, holC, holD, and priA knockout mutants) indicate that caffeine blocks DNA replication, ultimately leading to double-strand breaks that require recombinational repair by functions encoded by recA, recB, and recC, among others. Additionally, caffeine partially protects cells of both Escherichia coli and Bacillus anthracis from killing by the widely used fluoroquinolone antibiotic ciprofloxacin. PMID:22391551

  13. Genome analysis of DNA repair genes in the alpha proteobacterium Caulobacter crescentus

    Menck Carlos FM

    2007-03-01

    Full Text Available Abstract Background The integrity of DNA molecules is fundamental for maintaining life. The DNA repair proteins protect organisms against genetic damage, by removal of DNA lesions or helping to tolerate them. DNA repair genes are best known from the gamma-proteobacterium Escherichia coli, which is the most understood bacterial model. However, genome sequencing raises questions regarding uniformity and ubiquity of these DNA repair genes and pathways, reinforcing the need for identifying genes and proteins, which may respond to DNA damage in other bacteria. Results In this study, we employed a bioinformatic approach, to analyse and describe the open reading frames potentially related to DNA repair from the genome of the alpha-proteobacterium Caulobacter crescentus. This was performed by comparison with known DNA repair related genes found in public databases. As expected, although C. crescentus and E. coli bacteria belong to separate phylogenetic groups, many of their DNA repair genes are very similar. However, some important DNA repair genes are absent in the C. crescentus genome and other interesting functionally related gene duplications are present, which do not occur in E. coli. These include DNA ligases, exonuclease III (xthA, endonuclease III (nth, O6-methylguanine-DNA methyltransferase (ada gene, photolyase-like genes, and uracil-DNA-glycosylases. On the other hand, the genes imuA and imuB, which are involved in DNA damage induced mutagenesis, have recently been described in C. crescentus, but are absent in E. coli. Particularly interesting are the potential atypical phylogeny of one of the photolyase genes in alpha-proteobacteria, indicating an origin by horizontal transfer, and the duplication of the Ada orthologs, which have diverse structural configurations, including one that is still unique for C. crescentus. Conclusion The absence and the presence of certain genes are discussed and predictions are made considering the particular

  14. DNA Immunization

    Wang, Shixia; Lu, Shan

    2013-01-01

    DNA immunization was discovered in early 1990s and its use has been expanded from vaccine studies to a broader range of biomedical research, such as the generation of high quality polyclonal and monoclonal antibodies as research reagents. In this unit, three common DNA immunization methods are described: needle injection, electroporation and gene gun. In addition, several common considerations related to DNA immunization are discussed.

  15. Synthesis of modified oligonucleotides for repair and replication studies of single and double radio-induced DNA lesions

    Several oxidative processes induce the formation of DNA lesions. In order to evaluate the biological and structural significance of such damage, several DNA lesions were inserted into synthetic oligonucleotides at defined sites. The research work aimed at describing the preparation of oligonucleotides t hat contained DNA damage and the evaluation of the biological properties of the lesions. A first part described the incorporation of radiation-induced lesions, namely (5'S,6S)-5',6-cyclo-5,6-dihydro-2'-deoxyuridine and (5'S,5S,6S)-5',6-cyclo-5-hydroxy-5,6-dihydro-2'-desoxyuridine into oligonucleotides. The modified DNA fragments were characterised by several spectroscopic and biochemical analyses including ESI MS, MALDI-TOF MS, CLHP and enzymatic digestions. During in vitro DNA synthesis by Taq DNA polymerase and Klenow exo fragment, the pyrimidine cyclo-nucleosides were found to block the progression of the enzymes. Then, repair studies by ADN N glycosylases, operating in the base excision repair pathway, have shown that the anhydro-nucleoside lesions were not recognised nor excised by Fpg, endo III, endo VIII, yNtg1 yNtg2 and yOgg1. Interestingly, the Latococcus lactis Fpg protein recognises (formation of a non covalent complex) but do not excise the damage. The incorporation into oligonucleotides of the (5R*) and (5S*) diastereoisomers of 1-[2-deoxy-β-D-erythro-pentofuranosyl]-5-hydroxy-hydantoin, generated by several oxidative processes was then described. In vitro DNA replication assays using modified oligonucleotides matrix showed a lethal potential of the latter base damage. Repair studies by ADN N-glycosylases showed that the damage was substrate for Fpg, endo III, endo VIII, Ntg1, Ntg2 and Fpg-L1. The rates of excision as inferred from the determination of the Michaelis kinetics constants were found to be affected by the presence of the damage. MALDI-TOF MS was used in order to gain insights into mechanistic aspects of oligonucleotides cleavage by the

  16. DNA deoxyribophosphodiesterase.

    Franklin, W A; Lindahl, T

    1988-01-01

    A previously unrecognized enzyme acting on damaged termini in DNA is present in Escherichia coli. The enzyme catalyses the hydrolytic release of 2-deoxyribose-5-phosphate from single-strand interruptions in DNA with a base-free residue on the 5' side. The partly purified protein appears to be free from endonuclease activity for apurinic/apyrimidinic sites, exonuclease activity and DNA 5'-phosphatase activity. The enzyme has a mol. wt of approximately 50,000-55,000 and has been termed DNA deox...

  17. Modulating effects of pycnogenol® on oxidative stress and DNA damage induced by sepsis in rats.

    Taner, Gökçe; Aydın, Sevtap; Bacanlı, Merve; Sarıgöl, Zehra; Sahin, Tolga; Başaran, A Ahmet; Başaran, Nurşen

    2014-11-01

    The aim of this study was to evaluate the protective effects of Pycnogenol® (Pyc), a complex plant extract from the bark of French maritime pine, on oxidative stress parameters (superoxide dismutase (SOD), and glutathione peroxidase (GPx) activities and total glutathione (GSH) and malondialdehyde (MDA) levels), an inflammatory cytokine (tumor necrosis factor alpha (TNF-α) level) and also DNA damage in Wistar albino rats. Rats were treated with 100 mg/kg intraperitonally Pyc following the induction of sepsis by cecal ligation and puncture. The decreases in MDA levels and increases in GSH levels, and SOD and GPx activities were observed in the livers and kidneys of Pyc-treated septic rats. Plasma TNF-α level was found to be decreased in the Pyc-treated septic rats. In the lymphocytes, kidney, and liver tissue cells of the sepsis-induced rats, Pyc treatment significantly decreased the DNA damage and oxidative base damage using standard alkaline assay and formamidopyrimidine DNA glycosylase-modified comet assay, respectively. In conclusion, Pyc treatment might have a role in the prevention of sepsis-induced oxidative damage not only by decreasing DNA damage but also increasing the antioxidant status and DNA repair capacity in rats. PMID:24919414

  18. Regulation of Active DNA Demethylation by a Methyl-CpG-Binding Domain Protein in Arabidopsis thaliana.

    Qi Li

    2015-05-01

    Full Text Available Active DNA demethylation plays crucial roles in the regulation of gene expression in both plants and animals. In Arabidopsis thaliana, active DNA demethylation is initiated by the ROS1 subfamily of 5-methylcytosine-specific DNA glycosylases via a base excision repair mechanism. Recently, IDM1 and IDM2 were shown to be required for the recruitment of ROS1 to some of its target loci. However, the mechanism(s by which IDM1 is targeted to specific genomic loci remains to be determined. Affinity purification of IDM1- and IDM2- associating proteins demonstrated that IDM1 and IDM2 copurify together with two novel components, methyl-CpG-binding domain protein 7 (MBD7 and IDM2-like protein 1 (IDL1. IDL1 encodes an α-crystallin domain protein that shows high sequence similarity with IDM2. MBD7 interacts with IDM2 and IDL1 in vitro and in vivo and they form a protein complex associating with IDM1 in vivo. MBD7 directly binds to the target loci and is required for the H3K18 and H3K23 acetylation in planta. MBD7 dysfunction causes DNA hypermethylation and silencing of reporter genes and a subset of endogenous genes. Our results suggest that a histone acetyltransferase complex functions in active DNA demethylation and in suppression of gene silencing at some loci in Arabidopsis.

  19. The source and significance of DNA damage in human spermatozoa; a commentary on diagnostic strategies and straw man fallacies.

    Aitken, R J; Bronson, R; Smith, T B; De Iuliis, G N

    2013-08-01

    This article considers the origins of DNA damage in human spermatozoa, the methods that are available to monitor this aspect of semen quality and the clinical significance of such measurements. DNA damage in spermatozoa appears to be largely oxidative in nature, inversely correlated with levels of nuclear protamination and frequently associated with the activation of a truncated apoptotic pathway. DNA base adducts formed as a result of oxidative attack are released from the spermatozoa into the extracellular space through the action of a glycosylase, OGG1. This creates an abasic site, which is not resolved until fertilization because spermatozoa do not possess the molecular machinery needed to continue the base excision repair pathway. The abasic sites so generated in human spermatozoa are readily detected by SCSA or the Comet assay; however, no signal is detectable with TUNEL. This is because spermatozoa lack the enzyme (APE1) needed to create the free 3' hydroxyl groups required by this detection system. Nevertheless, spermatozoa do eventually become TUNEL positive as they enter the perimortem. The American Society of Reproductive Medicine Practice Committee has suggested that DNA damage in spermatozoa should not be assessed because the correlation with pregnancy is inconsistent across independent studies. However, this is a straw man argument. The reason why such assays should be undertaken is not just that they reflect the underlying quality of spermatogenesis but, more importantly, that the DNA damage they reveal may have detrimental effects on the developmental normality of the embryo and the health of possible future children. PMID:23548339

  20. Cleaving DNA with DNA

    Carmi, Nir; Balkhi, Shameelah R.; Breaker, Ronald R.

    1998-01-01

    A DNA structure is described that can cleave single-stranded DNA oligonucleotides in the presence of ionic copper. This “deoxyribozyme” can self-cleave or can operate as a bimolecular complex that simultaneously makes use of duplex and triplex interactions to bind and cleave separate DNA substrates. Bimolecular deoxyribozyme-mediated strand scission proceeds with a kobs of 0.2 min−1, whereas the corresponding uncatalyzed reaction could not be detected. The duplex and triplex recognition domai...

  1. DNA glue

    Filichev, Vyacheslav V; Astakhova, Irina V.; Malakhov, Andrei D.;

    2008-01-01

    Significant alterations in thermal stability of parallel DNA triplexes and antiparallel duplexes were observed upon changing the attachment of ethynylpyrenes from para to ortho in the structure of phenylmethylglycerol inserted as a bulge into DNA (TINA). Insertions of two ortho-TINAs as a pseudo...

  2. DNA repair by MGMT, but not AAG, causes a threshold in alkylation-induced colorectal carcinogenesis.

    Fahrer, Jörg; Frisch, Janina; Nagel, Georg; Kraus, Alexander; Dörsam, Bastian; Thomas, Adam D; Reißig, Sonja; Waisman, Ari; Kaina, Bernd

    2015-10-01

    Epidemiological studies indicate that N-nitroso compounds (NOC) are causally linked to colorectal cancer (CRC). NOC induce DNA alkylations, including O (6)-methylguanine (O (6)-MeG) and N-methylated purines, which are repaired by O (6)-MeG-DNA methyltransferase (MGMT) and N-alkyladenine-DNA glycosylase (AAG)-initiated base excision repair, respectively. In view of recent evidence of nonlinear mutagenicity for NOC-like compounds, the question arises as to the existence of threshold doses in CRC formation. Here, we set out to determine the impact of DNA repair on the dose-response of alkylation-induced CRC. DNA repair proficient (WT) and deficient (Mgmt (-/-), Aag (-/-) and Mgmt (-/-)/Aag (-/-)) mice were treated with azoxymethane (AOM) and dextran sodium sulfate to trigger CRC. Tumors were quantified by non-invasive mini-endoscopy. A non-linear increase in CRC formation was observed in WT and Aag (-/-) mice. In contrast, a linear dose-dependent increase in tumor frequency was found in Mgmt (-/-) and Mgmt (-/-)/Aag (-/-) mice. The data were corroborated by hockey stick modeling, yielding similar carcinogenic thresholds for WT and Aag (-/-) and no threshold for MGMT lacking mice. O (6)-MeG levels and depletion of MGMT correlated well with the observed dose-response in CRC formation. AOM induced dose-dependently DNA double-strand breaks in colon crypts including Lgr5-positive colon stem cells, which coincided with ATR-Chk1-p53 signaling. Intriguingly, Mgmt (-/-) mice displayed significantly enhanced levels of γ-H2AX, suggesting the usefulness of γ-H2AX as an early genotoxicity marker in the colorectum. This study demonstrates for the first time a non-linear dose-response for alkylation-induced colorectal carcinogenesis and reveals DNA repair by MGMT, but not AAG, as a key node in determining a carcinogenic threshold. PMID:26243310

  3. Dihydropyridines decrease X-ray-induced DNA base damage in mammalian cells

    Wojewodzka, M., E-mail: marylaw@ichtj.waw.pl [Center of Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Warszawa (Poland); Gradzka, I.; Buraczewska, I.; Brzoska, K.; Sochanowicz, B. [Center of Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Warszawa (Poland); Goncharova, R.; Kuzhir, T. [Institute of Genetics and Cytology, Belarussian National Academy of Sciences, Minsk (Belarus); Szumiel, I. [Center of Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Warszawa (Poland)

    2009-12-01

    Compounds with the structural motif of 1,4-dihydropyridine display a broad spectrum of biological activities, often defined as bioprotective. Among them are L-type calcium channel blockers, however, also derivatives which do not block calcium channels exert various effects at the cellular and organismal levels. We examined the effect of sodium 3,5-bis-ethoxycarbonyl-2,6-dimethyl-1,4-dihydropyridine-4-carboxylate (denoted here as DHP and previously also as AV-153) on X-ray-induced DNA damage and mutation frequency at the HGPRT (hypoxanthine-guanine phosphoribosyl transferase) locus in Chinese hamster ovary CHO-K1 cells. Using formamido-pyrimidine glycosylase (FPG) comet assay, we found that 1-h DHP (10 nM) treatment before X-irradiation considerably reduced the initial level of FPG-recognized DNA base damage, which was consistent with decreased 8-oxo-7,8-dihydro-2'-deoxyguanosine content and mutation frequency lowered by about 40%. No effect on single strand break rejoining or on cell survival was observed. Similar base damage-protective effect was observed for two calcium channel blockers: nifedipine (structurally similar to DHP) or verapamil (structurally unrelated). So far, the specificity of the DHP-caused reduction in DNA damage - practically limited to base damage - has no satisfactory explanation.

  4. Aging and defense against generation of 8-oxo-7,8-dihydro-2'-deoxyguanosine in DNA

    Mikkelsen, Lone; Bialkowski, Karol; Risom, Lotte; Løhr, Mille; Loft, Steffen; Møller, Peter

    2009-01-01

    The imbalance between the formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) in DNA and the efficiency of cellular systems of DNA protection and repair is considered an important factor in the age-dependent development of cancer. This study investigated the relationship between oxidatively...... glycosylase sites was unaltered. The enzyme activity toward single oxygen-induced DNA damage and mRNA expression levels of Ercc1, Neil1, and Ogg1 remained unaltered with age. However, the 8-oxodGTPase activity in the liver was 18% (95% CI: 0.2-37%) lower in mice at 25 and 50 weeks than in 10-week-old mice....... The 10- and 100-week-old mice had similar 8-oxodGTPase activity. In contrast, the mRNA expression of Nudt1 was statistically unaltered that likely resulted from higher variation of measurements. The accumulation of 8-oxodG with age is not a direct consequence of decreased enzyme activity toward...

  5. Accumulation of miscoding etheno-DNA adducts and highly expressed DNA repair during liver fluke-induced cholangiocarcinogenesis in hamsters.

    Dechakhamphu, Somkid; Pinlaor, Somchai; Sitthithaworn, Paiboon; Bartsch, Helmut; Yongvanit, Puangrat

    2010-09-10

    Infection by Opisthorchis viverrini, a risk factor for cholangiocarcinoma (CCA) may act through chronic inflammation, oxidative stress and lipid peroxidation (LPO)-related damage and growth stimuli. 1,N6-etheno-2'-deoxyadenosine (epsilondA), and 3,N4-etheno-2'-deoxycytidine (epsilondC), markers for LPO-derived DNA damage were highly increased in white blood cell and urine of O. viverrini-infected Thai patients. In order to investigate tissue specificity etheno adducts were measured in a cholangiocarcinogenesis model, in O. viverrini-infected hamsters that had received N-nitrosodimethylamine (NDMA, 12.5 ppm in dw) for 2 months. epsilondA- and epsilondC-levels were analyzed in paraffin-embedded liver sections by a novel immunohistochemical method, from 21 up to 180 days post-O. viverrini-infection. In inflamed areas of the liver, etheno adducts were localized in the nuclei of inflammatory cells and in the epithelial lining of the bile duct. Semi-quantitative image analysis showed higher adduct levels in the liver of O. viverrini-infected hamsters, treated with or w/o NDMA when compared with untreated controls. Levels were found highest in the liver of O. viverrini-infected plus NDMA-treated hamsters. Adducts increased in an age-dependent manner from O. viverrini-infection until CCA development. Increased adduct formation paralleled histopathological changes in plasma alkaline phosphatase (ALP) activity, bile duct hyperplasia, dysplasia, precancerous lesions, and CCA appearance. Also elevated expression of alkyladenine DNA glycosylase (AAG), which excises 1,N6-ethenoadenine (epsilonA) was linked to higher adduct formation, suggesting imbalanced repair. Our results implicate accumulation of inflammation-related, promutagenic DNA damage in target tissue and possibly imbalanced repair in the onset of cholangiocarcinogenesis. PMID:20541562

  6. DNA probes

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  7. [DNA computing].

    Błasiak, Janusz; Krasiński, Tadeusz; Popławski, Tomasz; Sakowski, Sebastian

    2011-01-01

    Biocomputers can be an alternative for traditional "silicon-based" computers, which continuous development may be limited due to further miniaturization (imposed by the Heisenberg Uncertainty Principle) and increasing the amount of information between the central processing unit and the main memory (von Neuman bottleneck). The idea of DNA computing came true for the first time in 1994, when Adleman solved the Hamiltonian Path Problem using short DNA oligomers and DNA ligase. In the early 2000s a series of biocomputer models was presented with a seminal work of Shapiro and his colleguas who presented molecular 2 state finite automaton, in which the restriction enzyme, FokI, constituted hardware and short DNA oligomers were software as well as input/output signals. DNA molecules provided also energy for this machine. DNA computing can be exploited in many applications, from study on the gene expression pattern to diagnosis and therapy of cancer. The idea of DNA computing is still in progress in research both in vitro and in vivo and at least promising results of these research allow to have a hope for a breakthrough in the computer science. PMID:21735816

  8. Studies on the repair of damaged DNA in bacteriophage, bacterial and mammalian systems. Comprehensive report, 1 February 1981-15 September 1983

    We have explored the molecular mechanism of the repair of DNA at a number of different levels of biological organization, by investigating bacteriophage, bacterial, yeast and mammalian (including human) cells. We have demonstrated that uv endonuclease of phage T4 not only possesses pyrimidine dimer (PD)-DNA glycosylase activity but also apyrimidinic (AP) endonuclease activity. The demonstration of both activities provided an explanation for the specific endonucleosytic cleavage of DNA at sites of pyrimidine dimers catalyzed by this small protein. A new apurinic/apyrimidinic (AP) endonuclease, specific for sites of of base loss in single stranded DNA has been isolated from E. celi and presumably recognizes these lesions in single stranded regions of duplex DNA. We have partially purified this enzyme and have carried out a preliminary characterization of the activity. We treated xeroderma pigmentosum and normal cells with sodium butyrate in the hope of restoring normal levels of excision repair to the former. Although this result was not obtained, we established that all cells treated with sodium butyrate show enhanced levels of repair synthesis, thus providing a means for increasing the sensitivity of this commonly used technique for measuring DNA repair in mammalian cells in culture

  9. DNA cleavage at the AP site via β-elimination mediated by the AP site-binding ligands.

    Abe, Yukiko S; Sasaki, Shigeki

    2016-02-15

    DNA is continuously damaged by endogenous and exogenous factors such as oxidation and alkylation. In the base excision repair pathway, the damaged nucleobases are removed by DNA N-glycosylase to form the abasic sites (AP sites). The alkylating antitumor agent exhibits cytotoxicity through the formation of the AP site. Therefore blockage or modulation of the AP site repair pathway may enhance the antitumor efficacy of DNA alkylating agents. In this study, we have examined the effects of the nucleobase-polyamine conjugated ligands (G-, A-, C- and T-ligands) on the cleavage of the AP site. The G- and A-ligands cleaved DNA at the AP site by promoting β-elimination in a non-selective manner by the G-ligand, and in a selective manner for the opposing dT by the A-ligand. These results suggest that the nucleobase-polyamine conjugate ligands may have the potential for enhancement of the cytotoxicities of the AP site. PMID:26777298

  10. DNA methylation

    Williams, Kristine; Christensen, Jesper; Helin, Kristian

    2012-01-01

    DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...

  11. DNA data

    National Oceanic and Atmospheric Administration, Department of Commerce — Raw DNA chromatogram data produced by the ABI 373, 377, 3130 and 3730 automated sequencing machines in ABI format. These are from fish (primarily Sebastes spp.,...

  12. Potent protection of gallic acid against DNA oxidation: Results of human and animal experiments

    Gallic acid (3,4,5-trihydroxybenzoic acid, GA) is a constituent of plant derived foods, beverages and herbal remedies. We investigated its DNA protective properties in a placebo controlled human intervention trial in single cell gel electrophoresis experiments. Supplementation of drinking water with GA (12.8 mg/person/d) for three days led to a significant reduction of DNA migration attributable to oxidised pyrimidines (endonuclease III sensitive sites) and oxidised purines (formamidopyrimidine glycosylase sensitive sites) in lymphocytes of healthy individuals by 75% and 64% respectively. Also DNA damage caused by treatment of the cells with reactive oxygen species (ROS) was reduced after GA consumption (by 41%). These effects were paralleled by an increase of the activities of antioxidant enzymes (superoxide dismutase, glutathione peroxidase and glutathion-S-transferase-π) and a decrease of intracellular ROS concentrations in lymphocytes, while no alterations of the total antioxidant capacity (TAC), of malondialdehyde levels in serum and of the urinary excretion of isoprostanes were found. Experiments with rats showed that GA reduces oxidatively damaged DNA in lymphocytes, liver, colon and lungs and protects these organs against γ-irradiation-induced strand breaks and formation of oxidatively damaged DNA-bases. Furthermore, the number of radiation-induced preneoplastic hepatic foci was decreased by 43% after oral administration of the phenolic. Since we did not find alterations of the TAC in plasma and lipid peroxidation of cell membranes but intracellular effects it is likely that the antioxidant properties of GA seen in vivo are not due to direct scavenging of radicals but rather to indirect mechanisms (e.g. protection against ROS via activation of transcription factors). As the amount of GA used in the intervention trial is similar to the daily intake in Middle Europe (18 mg/person/day), our findings indicate that it may contribute to prevention of formation

  13. Potent protection of gallic acid against DNA oxidation: Results of human and animal experiments

    Ferk, Franziska; Chakraborty, Asima [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria); Jaeger, Walter [Department of Clinical Pharmacy and Diagnostic, University of Vienna, Vienna (Austria); Kundi, Michael [Institute of Environmental Health, Center for Public Health, Medical University of Vienna, A-1090 Vienna (Austria); Bichler, Julia; Misik, Miroslav [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria); Wagner, Karl-Heinz [Department of Nutritional Sciences, University of Vienna, 1090 Vienna (Austria); Grasl-Kraupp, Bettina; Sagmeister, Sandra [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria); Haidinger, Gerald [Department of Epidemiology, Center for Public Health, Medical University of Vienna, A-1090 Vienna (Austria); Hoelzl, Christine; Nersesyan, Armen [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria); Dusinska, Maria [Health Effect Laboratory, Center for Ecological Economics, Norwegian Institute for Air Research, NO-2027 Kjeller (Norway); Simic, Tatjana [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria); Knasmueller, Siegfried, E-mail: siegfried.knasmueller@meduniwien.ac.at [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria)

    2011-10-01

    Gallic acid (3,4,5-trihydroxybenzoic acid, GA) is a constituent of plant derived foods, beverages and herbal remedies. We investigated its DNA protective properties in a placebo controlled human intervention trial in single cell gel electrophoresis experiments. Supplementation of drinking water with GA (12.8 mg/person/d) for three days led to a significant reduction of DNA migration attributable to oxidised pyrimidines (endonuclease III sensitive sites) and oxidised purines (formamidopyrimidine glycosylase sensitive sites) in lymphocytes of healthy individuals by 75% and 64% respectively. Also DNA damage caused by treatment of the cells with reactive oxygen species (ROS) was reduced after GA consumption (by 41%). These effects were paralleled by an increase of the activities of antioxidant enzymes (superoxide dismutase, glutathione peroxidase and glutathion-S-transferase-{pi}) and a decrease of intracellular ROS concentrations in lymphocytes, while no alterations of the total antioxidant capacity (TAC), of malondialdehyde levels in serum and of the urinary excretion of isoprostanes were found. Experiments with rats showed that GA reduces oxidatively damaged DNA in lymphocytes, liver, colon and lungs and protects these organs against {gamma}-irradiation-induced strand breaks and formation of oxidatively damaged DNA-bases. Furthermore, the number of radiation-induced preneoplastic hepatic foci was decreased by 43% after oral administration of the phenolic. Since we did not find alterations of the TAC in plasma and lipid peroxidation of cell membranes but intracellular effects it is likely that the antioxidant properties of GA seen in vivo are not due to direct scavenging of radicals but rather to indirect mechanisms (e.g. protection against ROS via activation of transcription factors). As the amount of GA used in the intervention trial is similar to the daily intake in Middle Europe (18 mg/person/day), our findings indicate that it may contribute to prevention of

  14. Ancient DNA

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    In the past two decades, ancient DNA research has progressed from the retrieval of small fragments of mitochondrial DNA from a few late Holocene specimens, to large-scale studies of ancient populations, phenotypically important nuclear loci, and even whole mitochondrial genome sequences of extinct species. However, the field is still regularly marred by erroneous reports, which underestimate the extent of contamination within laboratories and samples themselves. An improved understanding of t...

  15. DNA Photolyasen

    Maul, Melanie

    2009-01-01

    Neben der fehlerfreien Weitergabe der genetischen Information während der Zellteilung durch einen intakten Replikationsapparat, ist auch die Aufrechterhaltung der genetischen Integrität der DNA durch Reparaturenzyme entscheidend für das Überleben der Zellen, sowie für einen gesunden Organismus. Um die genomische Integrität zu wahren, entwickelten sich im Laufe der Evolution verschiedene Mechanismen, u.a. die Exzisionreparatur von geschädigter DNA oder die direkte chemische R...

  16. DNA damage

    Kumari, Sunita; Rastogi, Rajesh P.; Singh, Kanchan L.; Singh, Shailendra P; Sinha, Rajeshwar P.

    2008-01-01

    Even under the best of circumstances, DNA is constantly subjected to chemical modifications. Several types of DNA damage such as SSB (single strand break), DSB (double strand break), CPDs (cyclobutane pyrimidine dimers), 6-4PPs (6-4 photoproducts) and their Dewar valence isomers have been identified that result from alkylating agents, hydrolytic deamination, free radicals and reactive oxygen species formed by various photochemical processes including UV radiation. There are a n...

  17. DNA expressions - A formal notation for DNA

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  18. What Is Mitochondrial DNA?

    ... DNA What is mitochondrial DNA? What is mitochondrial DNA? Although most DNA is packaged in chromosomes within ... proteins. For more information about mitochondria and mitochondrial DNA: Molecular Expressions, a web site from the Florida ...

  19. DNA and RNA sensor

    LIU; Tao; LIN; Lin; ZHAO; Hong; JIANG; Long

    2005-01-01

    This review summarizes recent advances in DNA sensor. Major areas of DNA sensor covered in this review include immobilization methods of DNA, general techniques of DNA detection and application of nanoparticles in DNA sensor.

  20. DNA nanotechnology

    Nadrian C Seeman

    2003-01-01

    We are all aware that the DNA found in cells is a double helix consisting of two antiparallel strands held together by specific hydrogen-bonded base pairs; adenine (A always pairs with thymine (T, and guanine (G always pairs with cytosine (C. The specificity of this base pairing and the ability to ensure that it occurs in this fashion (and not some other1 is key to the use of DNA in materials applications. The double helical arrangement of the two molecules leads to a linear helix axis, linear not in the geometrical sense of being a straight line, but in the topological sense of being unbranched. Genetic engineers discovered in the 1970s how to splice together pieces of DNA to add new genes to DNA molecules2, and synthetic chemists worked out convenient syntheses for short pieces of DNA (up to ∼100–150 units in the 1980s3. Regardless of the impact of these technologies on biological systems, hooking together linear molecules leads only to longer linear molecules, with circles, knots, and catenanes perhaps resulting from time to time.

  1. Isolation of development-related genes in somatic embryo radicle of carrot (Daucus carota L.) using modified cDNA RDA

    刁丰秋; 张雷; 黄美娟; 吴乃虎

    2000-01-01

    Using modified cDNA RDA capitalizing on the high affinity of streptavidin for biotin and magnetic-absorption-based separation, we have obtained four bands of specifically expressed cDNA in the carrot somatic embryo deregulated for 12 h, which were designated as NR-1, NR-2, NR-3 and NR-4, respectively. As revealed by homology analysis of their DNA sequences after cloning them into pBS, remarkable homology was demonstrated in NR-2, NR-3 and NR-4 with the genes coding for LEA (late embryogenesis abundant protein), Dna J and xyloglucan endo-trans-glycosylase in plants. On the other hand, NR-1 showing no homology with any known sequence may have come from unknown genes. Using 32P-labeled NR-1 as probe, hybridization with cDNA fragment population has shown that we have actually cloned a new gene fragment related to radicle development. As shown by further Southern hybridization, these genes may be present in carrot genome in the form of single or low copies.

  2. DNA nanotechnology

    Seeman, Nadrian C.

    2003-01-01

    Since Watson and Crick’s determination of its structure nearly 50 years ago, DNA has come to fill our lives in many areas, from genetic counseling to forensics, from genomics to gene therapy. These, and other ways in which DNA affects human activities, are related to its function as genetic material, not just our genetic material, but the genetic material of all living organisms. Here, we will ignore DNA’s biological role; rather, we will discuss how the properties that make it so successful ...

  3. Assessment of DNA nucleo base oxidation and antioxidant defense in postmenopausal women under hormone replacement therapy

    Tülay Akcay

    2010-01-01

    Full Text Available Background and Objective: The aim of the present study was to evaluate oxidative stress byinvesting oxidatively damaged DNA AS Formamidopyrimidine DNA glycosylase (Fpg -sensitive sites, glutathione peroxidase (GPx, superoxide dismutase (SOD activities reduced glutathione (GSH level and nitrite level as satble end product of in women receiving hormone replacement therapy (HRT. Materials and Methods: 127 healthy postmenopausal women receiving HRT and 25 healthy control postmenopausal women were included in this study. Women receiving HRT, comprised surgical menopausal women who underwent surgery for benign conditionsand received conjugated equine estrogen, 0.625 mg/day for 1year (group 1, 5 years (group 2 and more than 10 years (group 3, spontaneous postmenopausal women received conjugated equine estrogen, 0.625 (Premarin mg/day and medroxyprogesterone acetate, 2.5 mg/day (Premelle for 1 year (group 4, 5 years (group 5 and more than 5 years (group 6.We investigated in the present study the effects of HRT on nitrite level and GSH level, activities of SOD and GPx and oxidative damage to DNA by comet assays by measuring levels of Fpg-sensitive sites. Results: Although no significant differences were found in the SOD activities, in total group receiving HRT, increased DNA oxidation (P<0.001 together with an increased GPx activity (P<0.001 and nitrite level (P<0.001 as well as a decreased GSH level (P < 0.05 as compared with controls were observed. Conclusion: Estrogen alone or oestrogen in combination with progesterone and duration of use did not significantly alter the results. We evaluated that caused oxidative stress by investigating oxidative DNA damage as Fp-sensitive sites and GSH.NO levels in women receiving HRT.

  4. Modulation of the DNA scanning activity of the Micrococcus luteus UV endonuclease

    Micrococcus luteus UV endonuclease incises DNA at the sites of ultraviolet (UV) light-induced pyrimidine dimers. The mechanism of incision has been previously shown to be a glycosylic bond cleavage at the 5'-pyrimidine of the dimer followed by an apyrimidine endonuclease activity which cleaves the phosphodiester backbone between the pyrimidines. The process by which M. luteus UV endonuclease locates pyrimidine dimers within a population of UV-irradiated plasmids was shown to occur, in vitro, by a processive or sliding mechanism on non-target DNA as opposed to a distributive or random hit mechanism. Form I plasmid DNA containing 25 dimers per molecule was incubated with M. luteus UV endonuclease in time course reactions. The three topological forms of plasmid DNA generated were analyzed by agarose gel electrophoresis. When the enzyme encounters a pyrimidine dimer, it is significantly more likely to make only the glycosylase cleavage as opposed to making both the glycosylic and phosphodiester bond cleavages. Thus, plasmids are accumulated with many alkaline-labile sites relative to single-stranded breaks. In addition, reactions were performed at both pH 8.0 and pH 6.0, in the absence of NaCl, as well as 25,100, and 250 mM NaCl. The efficiency of the DNA scanning reaction was shown to be dependent on both the ionic strength and pH of the reaction. At low ionic strengths, the reaction was shown to proceed by a processive mechanism and shifted to a distributive mechanism as the ionic strength of the reaction increased. Processivity at pH 8.0 is shown to be more sensitive to increases in ionic strength than reactions performed at pH 6.0

  5. Synthetic DNA

    O’ Driscoll, Aisling; Sleator, Roy D.

    2013-01-01

    With world wide data predicted to exceed 40 trillion gigabytes by 2020, big data storage is a very real and escalating problem. Herein, we discuss the utility of synthetic DNA as a robust and eco-friendly archival data storage solution of the future.

  6. DNA Investigations.

    Mayo, Ellen S.; Bertino, Anthony J.

    1991-01-01

    Presents a simulation activity that allow students to work through the exercise of DNA profiling and to grapple with some analytical and ethical questions involving a couple arranging with a surrogate mother to have a baby. Can be used to teach the principles of restriction enzyme digestion, gel electrophoresis, and probe hybridization. (MDH)

  7. The effect of zinc sulphate and zinc carnosine on genome stability and cytotoxicity in the WIL2-NS human lymphoblastoid cell line.

    Sharif, Razinah; Thomas, Philip; Zalewski, Peter; Graham, Robin D; Fenech, Michael

    2011-02-28

    Zinc (Zn) is an essential cofactor required by numerous enzymes that are essential for cell metabolism and the maintenance of DNA integrity. We investigated the effect of Zn deficiency or excess on genomic instability events and determined the optimal concentration of two Zn compounds that minimize DNA-damage events. The effects of Zn sulphate (ZnSO(4)) and Zn carnosine (ZnC) on cell proliferation were investigated in the WIL2-NS human lymphoblastoid cell line. DNA damage was determined by the use of both the comet assay and the cytokinesis-block micronucleus cytome (CBMN-Cyt) assay. Zn-deficient medium (0μM) was produced using Chelex treatment, and the two Zn compounds (i.e. ZnSO(4) and ZnC) were tested at concentrations of 0.0, 0.4, 4.0, 16.0, 32.0 and 100.0μM. Results from an MTT assay showed that cell growth and viability were decreased in Zn-depleted cells (0μM) as well as at 32μM and 100μM for both Zn compounds (P<0.0001). DNA strand-breaks, as measured by the comet assay, were found to be increased in Zn-depleted cells compared with the other treatment groups (P<0.05). The CBMN-Cyt assay showed a significant increase in the frequency of both apoptotic and necrotic cells under Zn-deficient conditions (P<0.0001). Elevated frequencies of micronuclei (MNi), nucleoplasmic bridges (NPBs) and nuclear buds (NBuds) were induced in Zn-depleted cells (P<0.0001), whereas genome damage was reduced in supplemented cultures for both Zn compounds at 4μM and 16μM, possibly suggesting that these concentrations may be optimal for genome stability. The potential protective effect of ZnSO(4) and ZnC was also investigated following exposure to 1.0Gy γ-radiation. Culture in medium containing these compounds at 4-32μM prior to irradiation displayed significantly reduced frequencies of MNi, NPBs and NBuds compared with cells maintained in 0μM medium (P<0.0001). Expression of γ-H2AX and 8-oxoguanine glycosylase measured by western blotting was increased in Zn

  8. DNA Repair by Reversal of DNA Damage

    Yi, Chengqi; He, Chuan

    2013-01-01

    Endogenous and exogenous factors constantly challenge cellular DNA, generating cytotoxic and/or mutagenic DNA adducts. As a result, organisms have evolved different mechanisms to defend against the deleterious effects of DNA damage. Among these diverse repair pathways, direct DNA-repair systems provide cells with simple yet efficient solutions to reverse covalent DNA adducts. In this review, we focus on recent advances in the field of direct DNA repair, namely, photolyase-, alkyltransferase-,...

  9. DNA Methylation

    İzmirli, Müzeyyen; Tufan, Turan; Alptekin, Davut

    2012-01-01

    Methylation is a chemical reaction in biological systems for normal genome regulation and development. It is a well known type of epigenetic mechanism. Methylation which regulates gene expression via epigenetic events like gene activation, repression, and chromatin remodelling, consists of two methylation systems. One of these systems is DNA methylation whereas the other is protein (histone) methylation. These systems are associated with some fundamental abnormalities and diseases. This revi...

  10. DNA Nanorobotics

    Hamdi M; Ferreira A

    2006-01-01

    This paper presents a molecular mechanics study for new nanorobotic structures using molecular dynamics (MD) simulations coupled to virtual reality (VR) techniques. The operator can design and characterize through molecular dynamics simulation the behavior of bionanorobotic components and structures through 3-D visualization. The main novelty of the proposed simulations is based on the mechanical characterization of passive/active robotic devices based on double stranded DNA molecules. Their ...

  11. DNA Methylation

    Muzeyyen Izmirli; Turan Tufan; Davut Alptekin

    2012-01-01

    Methylation is a chemical reaction in biological systems for normal genome regulation and development. It is a well known type of epigenetic mechanism. Methylation which regulates gene expression via epigenetic events like gene activation, repression, and chromatin remodelling, consists of two methylation systems. One of these systems is DNA methylation whereas the other is protein (histone) methylation. These systems are associated with some fundamental abnormalities and diseases. This revie...

  12. Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance

    Keeney Paula M

    2009-09-01

    Full Text Available Abstract Background Sporadic Parkinson's disease (sPD is a nervous system-wide disease that presents with a bradykinetic movement disorder and is frequently complicated by depression and cognitive impairment. sPD likely has multiple interacting causes that include increased oxidative stress damage to mitochondrial components and reduced mitochondrial bioenergetic capacity. We analyzed mitochondria from postmortem sPD and CTL brains for evidence of oxidative damage to mitochondrial DNA (mtDNA, heteroplasmic mtDNA point mutations and levels of electron transport chain proteins. We sought to determine if sPD brains possess any mtDNA genotype-respiratory phenotype relationships. Results Treatment of sPD brain mtDNA with the mitochondrial base-excision repair enzyme 8-oxyguanosine glycosylase-1 (hOGG1 inhibited, in an age-dependent manner, qPCR amplification of overlapping ~2 kbase products; amplification of CTL brain mtDNA showed moderate sensitivity to hOGG1 not dependent on donor age. hOGG1 mRNA expression was not different between sPD and CTL brains. Heteroplasmy analysis of brain mtDNA using Surveyor nuclease® showed asymmetric distributions and levels of heteroplasmic mutations across mtDNA but no patterns that statistically distinguished sPD from CTL. sPD brain mitochondria displayed reductions of nine respirasome proteins (respiratory complexes I-V. Reduced levels of sPD brain mitochondrial complex II, III and V, but not complex I or IV proteins, correlated closely with rates of NADH-driven electron flow. mtDNA levels and PGC-1α expression did not differ between sPD and CTL brains. Conclusion PD brain mitochondria have reduced mitochondrial respiratory protein levels in complexes I-V, implying a generalized defect in respirasome assembly. These deficiencies do not appear to arise from altered point mutational burden in mtDNA or reduction of nuclear signaling for mitochondrial biogenesis, implying downstream etiologies. The origin of age

  13. Effects of melatonin on DNA damage induced by cyclophosphamide in rats

    The antioxidant and free radical scavenger properties of melatonin have been well described in the literature. In this study, our objective was to determine the protective effect of the pineal gland hormone against the DNA damage induced by cyclophosphamide (CP), an anti-tumor agent that is widely applied in clinical practice. DNA damage was induced in rats by a single intraperitoneal injection of CP (20 or 50 mg/kg). Animals received melatonin during the dark period for 15 days (1 mg/kg in the drinking water). Rat bone marrow cells were used for the determination of chromosomal aberrations and of formamidopyrimidine DNA glycosylase enzyme (Fpg)-sensitive sites by the comet technique and of Xpf mRNA expression by qRT-PCR. The number (mean ± SE) of chromosomal aberrations in pinealectomized (PINX) animals treated with melatonin and CP (2.50 ± 0.50/100 cells) was lower than that obtained for PINX animals injected with CP (12 ± 1.8/100 cells), thus showing a reduction of 85.8% in the number of chromosomal aberrations. This melatonin-mediated protection was also observed when oxidative lesions were analyzed by the Fpg-sensitive assay, both 24 and 48 h after CP administration. The expression of Xpf mRNA, which is involved in the DNA nucleotide excision repair machinery, was up-regulated by melatonin. The results indicate that melatonin is able to protect bone marrow cells by completely blocking CP-induced chromosome aberrations. Therefore, melatonin administration could be an alternative and effective treatment during chemotherapy

  14. Effects of melatonin on DNA damage induced by cyclophosphamide in rats

    S.G. Ferreira

    2013-08-01

    Full Text Available The antioxidant and free radical scavenger properties of melatonin have been well described in the literature. In this study, our objective was to determine the protective effect of the pineal gland hormone against the DNA damage induced by cyclophosphamide (CP, an anti-tumor agent that is widely applied in clinical practice. DNA damage was induced in rats by a single intraperitoneal injection of CP (20 or 50 mg/kg. Animals received melatonin during the dark period for 15 days (1 mg/kg in the drinking water. Rat bone marrow cells were used for the determination of chromosomal aberrations and of formamidopyrimidine DNA glycosylase enzyme (Fpg-sensitive sites by the comet technique and of Xpf mRNA expression by qRT-PCR. The number (mean ± SE of chromosomal aberrations in pinealectomized (PINX animals treated with melatonin and CP (2.50 ± 0.50/100 cells was lower than that obtained for PINX animals injected with CP (12 ± 1.8/100 cells, thus showing a reduction of 85.8% in the number of chromosomal aberrations. This melatonin-mediated protection was also observed when oxidative lesions were analyzed by the Fpg-sensitive assay, both 24 and 48 h after CP administration. The expression of Xpf mRNA, which is involved in the DNA nucleotide excision repair machinery, was up-regulated by melatonin. The results indicate that melatonin is able to protect bone marrow cells by completely blocking CP-induced chromosome aberrations. Therefore, melatonin administration could be an alternative and effective treatment during chemotherapy.

  15. Effects of melatonin on DNA damage induced by cyclophosphamide in rats

    Ferreira, S.G.; Peliciari-Garcia, R.A. [Departamento de Fisiologia e Biofísica, Instituto de Ciências Biomédicas I, Universidade de São Paulo, São Paulo, SP (Brazil); Takahashi-Hyodo, S.A. [Área de Ciências da Saúde, Universidade Braz Cubas, Mogi das Cruzes, SP (Brazil); Rodrigues, A.C. [Departamento de Análises Clínicas e Toxicológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, São Paulo, SP (Brazil); Amaral, F.G. [Departamento de Fisiologia e Biofísica, Instituto de Ciências Biomédicas I, Universidade de São Paulo, São Paulo, SP (Brazil); Berra, C.M. [Departamento de Microbiologia, Instituto de Ciências Biomédicas II, Universidade de São Paulo, São Paulo, SP (Brazil); Bordin, S.; Curi, R.; Cipolla-Neto, J. [Departamento de Fisiologia e Biofísica, Instituto de Ciências Biomédicas I, Universidade de São Paulo, São Paulo, SP (Brazil)

    2013-03-08

    The antioxidant and free radical scavenger properties of melatonin have been well described in the literature. In this study, our objective was to determine the protective effect of the pineal gland hormone against the DNA damage induced by cyclophosphamide (CP), an anti-tumor agent that is widely applied in clinical practice. DNA damage was induced in rats by a single intraperitoneal injection of CP (20 or 50 mg/kg). Animals received melatonin during the dark period for 15 days (1 mg/kg in the drinking water). Rat bone marrow cells were used for the determination of chromosomal aberrations and of formamidopyrimidine DNA glycosylase enzyme (Fpg)-sensitive sites by the comet technique and of Xpf mRNA expression by qRT-PCR. The number (mean ± SE) of chromosomal aberrations in pinealectomized (PINX) animals treated with melatonin and CP (2.50 ± 0.50/100 cells) was lower than that obtained for PINX animals injected with CP (12 ± 1.8/100 cells), thus showing a reduction of 85.8% in the number of chromosomal aberrations. This melatonin-mediated protection was also observed when oxidative lesions were analyzed by the Fpg-sensitive assay, both 24 and 48 h after CP administration. The expression of Xpf mRNA, which is involved in the DNA nucleotide excision repair machinery, was up-regulated by melatonin. The results indicate that melatonin is able to protect bone marrow cells by completely blocking CP-induced chromosome aberrations. Therefore, melatonin administration could be an alternative and effective treatment during chemotherapy.

  16. Relation between DNA damage measured by comet assay and OGG1 Ser326Cys polymorphism in antineoplastic drugs biomonitoring

    Carina Ladeira

    2015-09-01

    Full Text Available Antineoplastic drugs are hazardous chemical agents used mostly in the treatment of patients with cancer, however health professionals that handle and administer these drugs can become exposed and develop DNA damage. Comet assay is a standard method for assessing DNA damage in human biomonitoring and, combined with formamidopyrimidine DNA glycosylase (FPG enzyme, it specifically detects DNA oxidative damage. The aim of this study was to investigate genotoxic effects in workers occupationally exposed to cytostatics (n = 46, as compared to a control group with no exposure (n = 46 at two Portuguese hospitals, by means of the alkaline comet assay. The potential of the OGG1 Ser326Cys polymorphism as a susceptibility biomarker was also investigated. Exposure was evaluated by investigating the contamination of surfaces and genotoxic assessment was done by alkaline comet assay in peripheral blood lymphocytes. OGG1 Ser326Cys (rs1052133 polymorphism was studied by Real Time PCR. As for exposure assessment, there were 121 (37% positive samples out of a total of 327 samples analysed from both hospitals. No statistically significant differences (Mann-Whitney test, p > 0.05 were found between subjects with and without exposure, regarding DNA damage and oxidative DNA damage, nevertheless the exposed group exhibited higher values. Moreover, there was no consistent trend regarding the variation of both biomarkers as assessed by comet assay with OGG1 polymorphism. Our study was not statistically significant regarding occupational exposure to antineoplastic drugs and genetic damage assessed by comet assay. However, health professionals should be monitored for risk behaviour, in order to ensure that safety measures are applied and protection devices are used correctly.

  17. Relation between DNA damage measured by comet assay and OGG1 Ser326Cys polymorphism in antineoplastic drugs biomonitoring

    Carina Ladeira

    2015-09-01

    Full Text Available Antineoplastic drugs are hazardous chemical agents used mostly in the treatment of patients with cancer, however health professionals that handle and administer these drugs can become exposed and develop DNA damage. Comet assay is a standard method for assessing DNA damage in human biomonitoring and, combined with formamidopyrimidine DNA glycosylase (FPG enzyme, it specifically detects DNA oxidative damage.The aim of this study was to investigate genotoxic effects in workers occupationally exposed to cytostatics (n = 46, as compared to a control group with no exposure (n = 46 at two Portuguese hospitals, by means of the alkaline comet assay. The potential of the OGG1 Ser326Cys polymorphism as a susceptibility biomarker was also investigated. Exposure was evaluated by investigating the contamination of surfaces and genotoxic assessment was done by alkaline comet assay in peripheral blood lymphocytes. OGG1 Ser326Cys (rs1052133 polymorphism was studied by Real Time PCR.As for exposure assessment, there were 121 (37% positive samples out of a total of 327 samples analysed from both hospitals. No statistically significant differences (Mann-Whitney test, p > 0.05 were found between subjects with and without exposure, regarding DNA damage and oxidative DNA damage, nevertheless the exposed group exhibited higher values. Moreover, there was no consistent trend regarding the variation of both biomarkers as assessed by comet assay with OGG1 polymorphism.Our study was not statistically significant regarding occupational exposure to antineoplastic drugs and genetic damage assessed by comet assay. However, health professionals should be monitored for risk behaviour, in order to ensure that safety measures are applied and protection devices are used correctly.

  18. Metformin inhibits 7,12-dimethylbenz[a]anthracene-induced breast carcinogenesis and adduct formation in human breast cells by inhibiting the cytochrome P4501A1/aryl hydrocarbon receptor signaling pathway

    Recent studies have established that metformin (MET), an oral anti-diabetic drug, possesses antioxidant activity and is effective against different types of cancer in several carcinogen-induced animal models and cell lines. However, whether MET can protect against breast cancer has not been reported before. Therefore, the overall objectives of the present study are to elucidate the potential chemopreventive effect of MET in non-cancerous human breast MCF10A cells and explore the underlying mechanism involved, specifically the role of cytochrome P4501A1 (CYP1A1)/aryl hydrocarbon receptor (AhR) pathway. Transformation of the MCF10A cells into initiated breast cancer cells with DNA adduct formation was conducted using 7,12-dimethylbenz[a]anthracene (DMBA), an AhR ligand. The chemopreventive effect of MET against DMBA-induced breast carcinogenesis was evidenced by the capability of MET to restore the induction of the mRNA levels of basic excision repair genes, 8-oxoguanine DNA glycosylase (OGG1) and apurinic/apyrimidinic endonuclease1 (APE1), and the level of 8-hydroxy-2-deoxyguanosine (8-OHdG). Interestingly, the inhibition of DMBA-induced DNA adduct formation was associated with proportional decrease in CYP1A1 and in NAD(P)H:quinone oxidoreductase 1 (NQO1) gene expression. Mechanistically, the involvements of AhR and nuclear factor erythroid 2-related factor-2 (Nrf2) in the MET-mediated inhibition of DMBA-induced CYP1A1 and NQO1 gene expression were evidenced by the ability of MET to inhibit DMBA-induced xenobiotic responsive element and antioxidant responsive element luciferase reporter gene expression which suggests an AhR- and Nrf2-dependent transcriptional control. However, the inability of MET to bind to AhR suggests that MET is not an AhR ligand. In conclusion, the present work shows a strong evidence that MET inhibits the DMBA-mediated carcinogenicity and adduct formation by inhibiting the expression of CYP1A1 through an AhR ligand-independent mechanism

  19. Metformin inhibits 7,12-dimethylbenz[a]anthracene-induced breast carcinogenesis and adduct formation in human breast cells by inhibiting the cytochrome P4501A1/aryl hydrocarbon receptor signaling pathway

    Maayah, Zaid H. [Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451 (Saudi Arabia); Ghebeh, Hazem [Stem Cell & Tissue Re-Engineering, King Faisal Specialist Hospital and Research Center, Riyadh 11211 (Saudi Arabia); Alhaider, Abdulqader A. [Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451 (Saudi Arabia); Camel Biomedical Research Unit, College of Pharmacy and Medicine, King Saud University, Riyadh 11451 (Saudi Arabia); El-Kadi, Ayman O.S. [Faculty of Pharmacy & Pharmaceutical Sciences, University of Alberta, Edmonton (Canada); Soshilov, Anatoly A.; Denison, Michael S. [Department of Environmental Toxicology, University of California at Davis, Davis, CA 95616 (United States); Ansari, Mushtaq Ahmad [Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451 (Saudi Arabia); Korashy, Hesham M., E-mail: hkorashy@ksu.edu.sa [Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451 (Saudi Arabia)

    2015-04-15

    Recent studies have established that metformin (MET), an oral anti-diabetic drug, possesses antioxidant activity and is effective against different types of cancer in several carcinogen-induced animal models and cell lines. However, whether MET can protect against breast cancer has not been reported before. Therefore, the overall objectives of the present study are to elucidate the potential chemopreventive effect of MET in non-cancerous human breast MCF10A cells and explore the underlying mechanism involved, specifically the role of cytochrome P4501A1 (CYP1A1)/aryl hydrocarbon receptor (AhR) pathway. Transformation of the MCF10A cells into initiated breast cancer cells with DNA adduct formation was conducted using 7,12-dimethylbenz[a]anthracene (DMBA), an AhR ligand. The chemopreventive effect of MET against DMBA-induced breast carcinogenesis was evidenced by the capability of MET to restore the induction of the mRNA levels of basic excision repair genes, 8-oxoguanine DNA glycosylase (OGG1) and apurinic/apyrimidinic endonuclease1 (APE1), and the level of 8-hydroxy-2-deoxyguanosine (8-OHdG). Interestingly, the inhibition of DMBA-induced DNA adduct formation was associated with proportional decrease in CYP1A1 and in NAD(P)H:quinone oxidoreductase 1 (NQO1) gene expression. Mechanistically, the involvements of AhR and nuclear factor erythroid 2-related factor-2 (Nrf2) in the MET-mediated inhibition of DMBA-induced CYP1A1 and NQO1 gene expression were evidenced by the ability of MET to inhibit DMBA-induced xenobiotic responsive element and antioxidant responsive element luciferase reporter gene expression which suggests an AhR- and Nrf2-dependent transcriptional control. However, the inability of MET to bind to AhR suggests that MET is not an AhR ligand. In conclusion, the present work shows a strong evidence that MET inhibits the DMBA-mediated carcinogenicity and adduct formation by inhibiting the expression of CYP1A1 through an AhR ligand-independent mechanism

  20. Lung Cancer Susceptibility and hOGG1 Ser326Cys Polymorphism: A Meta-Analysis

    Recent lung cancer studies have focused on identifying the effects of single nucleotide polymorphisms (SNPs) in candidate genes, among which DNA repair genes are increasingly being studied. Genetic variations in DNA repair genes are thought to modulate DNA repair capacity and are suggested to be related to lung cancer risk. In this study, we tried to assess reported studies of association between polymorphism of human 8-oxoguanine DNA glycosylase 1 (hOGG1) Ser326Cys and lung cancer. We conducted MEDLINE, Current Contents and Web of Science searches using 'hOGG1', 'lung cancer' and 'polymorphism' as keywords to search for papers published (from January 1995 through August 2010). Data were combined using both a fixed effects (the inverse variance-weighted method) and a random effects (DerSimonian and Laird method) models. The Cochran Q test was used for the assessment of heterogeneity. Publication bias was assessed by both Begg’s and Egger’s tests. We identified 20 case-control studies in 21 different ethnic populations. As two studies were not in the Hardy-Weinberg equilibrium, 18 case-control studies in 19 different ethnic populations (7,792 cases and 9,358 controls) were included in our meta-analysis. Summary frequencies of the Cys allele among Caucasians and Asians based on the random effects model were 20.9% (95% confidence interval (CI) = 18.9–22.9) and 46.1% (95% CI = 40.2–52.0), respectively. The distribution of the Cys allele was significantly different between Asians and Caucasians (P < 0.001). The Cys/Cys genotype was significantly associated with lung cancer risk in Asian populations (odds ratio = 1.27, 95% CI = 1.09–1.48) but not in Caucasian populations. This ethnic difference in lung cancer risk may be due to environmental factors such as cigarette smoking and dietary factors. Although the summary risk for developing lung cancer may not be large, lung cancer is such a common malignancy that even a small increase

  1. Mitochondrial base excision repair assays

    Maynard, Scott; de Souza-Pinto, Nadja C; Scheibye-Knudsen, Morten;

    2010-01-01

    The main source of mitochondrial DNA (mtDNA) damage is reactive oxygen species (ROS) generated during normal cellular metabolism. The main mtDNA lesions generated by ROS are base modifications, such as the ubiquitous 8-oxoguanine (8-oxoG) lesion; however, base loss and strand breaks may also occur....... Many human diseases are associated with mtDNA mutations and thus maintaining mtDNA integrity is critical. All of these lesions are repaired primarily by the base excision repair (BER) pathway. It is now known that mammalian mitochondria have BER, which, similarly to nuclear BER, is catalyzed by DNA...

  2. Selective metal binding to Cys-78 within endonuclease V causes an inhibition of catalytic activities without altering nontarget and target DNA binding

    T4 endonuclease V is a pyrimidine dimer-specific DNA repair enzyme which has been previously shown not to require metal ions for either of its two catalytic activities or its DNA binding function. However, we have investigated whether the single cysteine within the enzyme was able to bind metal salts and influence the various activities of this repair enzyme. A series of metals (Hg2+, Ag+, Cu+) were shown to inactivate both endonuclease Vs pyrimidine dimer-specific DNA glycosylase activity and the subsequent apurinic nicking activity. The binding of metal to endonuclease V did not interfere with nontarget DNA scanning or pyrimidine dimer-specific binding. The Cys-78 codon within the endonuclease V gene was changed by oligonucleotide site-directed mutagenesis to Thr-78 and Ser-78 in order to determine whether the native cysteine was directly involved in the enzyme's DNA catalytic activities and whether the cysteine was primarily responsible for the metal binding. The mutant enzymes were able to confer enhanced ultraviolet light (UV) resistance to DNA repair-deficient Escherichia coli at levels equal to that conferred by the wild type enzyme. The C78T mutant enzyme was purified to homogeneity and shown to be catalytically active on pyrimidine dimer-containing DNA. The catalytic activities of the C78T mutant enzyme were demonstrated to be unaffected by the addition of Hg2+ or Ag+ at concentrations 1000-fold greater than that required to inhibit the wild type enzyme. These data suggest that the cysteine is not required for enzyme activity but that the binding of certain metals to that amino acid block DNA incision by either preventing a conformational change in the enzyme after it has bound to a pyrimidine dimer or sterically interfering with the active site residue's accessibility to the pyrimidine dimer

  3. DNA repair

    In this chapter a series of DNA repair pathways are discussed which are available to the cell to cope with the problem of DNA damaged by chemical or physical agents. In the case of microorganisms our knowledge about the precise mechanism of each DNA repair pathway and the regulation of it has been improved considerably when mutants deficient in these repair mechanisms became available. In the case of mammalian cells in culture, until recently there were very little repair deficient mutants available, because in almost all mammalian cells in culture at least the diploid number of chromosomes is present. Therefore the frequency of repair deficient mutants in such populations is very low. Nevertheless because replica plating techniques are improving some mutants from Chinese hamsters ovary cells and L5178Y mouse lymphoma cells are now available. In the case of human cells, cultures obtained from patients with certain genetic diseases are available. A number of cells appear to be sensitive to some chemical or physical mutagens. These include cells from patients suffering from xeroderma pigmentosum, Ataxia telangiectasia, Fanconi's anemia, Cockayne's syndrome. However, only in the case of xeroderma pigmentosum cells, has the sensitivity to ultraviolet light been clearly correlated with a deficiency in excision repair of pyrimidine dimers. Furthermore the work with strains obtained from biopsies from man is difficult because these cells generally have low cloning efficiencies and also have a limited lifespan in vitro. It is therefore very important that more repair deficient mutants will become available from established cell lines from human or animal origin

  4. Wrinkled DNA.

    Arnott, S.; Chandrasekaran, R.; Puigjaner, L C; Walker, J K; Hall, I H; Birdsall, D L; Ratliff, R L

    1983-01-01

    The B form of poly d(GC):poly d(GC) in orthorhombic microcrystallites in oriented fibers has a secondary structure in which a dinucleotide is the repeated motif rather than a mononucleotide as in standard, smooth B DNA. One set of nucleotides (probably GpC) has the same conformations as the smooth form but the alternate (CpG) nucleotides have a different conformation at C3'-O3'. This leads to a distinctive change in the orientation of the phosphate groups. Similar perturbations can be detecte...

  5. φ29 DNA polymerase

    Blanco, Luis; Bernad, Antonio; Salas, Margarita

    1996-01-01

    An improved method for determining the nucleotide base sequence of a DNA molecule employs a φ-29 type DNA polymerase modified to have reduced or no exonuclease activity. The method includes annealing the DNA molecule with a primer molecule able to hybridize to the DNA molecule; incubating the annealed mixture in a vessel containing four different deoxynucleoside triphosphates, a DNA polymerase, and one or more DNA synthesis terminating agents which terminate DNA synthesis at a specific nucleo...

  6. Isolated and clustered DNA lesions induced by high-energy iron and carbon ions

    Ide, H.; Tanaka, R.; Nakaarai, Y.; Terato, H.; Furusawa, Y.

    and DNA glycosylase-induced DSB.

  7. Spaceflight induces both transient and heritable alterations in DNA methylation and gene expression in rice (Oryza sativa L.)

    Spaceflight represents a complex environmental condition in which several interacting factors such as cosmic radiation, microgravity and space magnetic fields are involved, which may provoke stress responses and jeopardize genome integrity. Given the inherent property of epigenetic modifications to respond to intrinsic as well as external perturbations, it is conceivable that epigenetic markers like DNA methylation may undergo alterations in response to spaceflight. We report here that extensive alteration in both DNA methylation and gene expression occurred in rice plants subjected to a spaceflight, as revealed by a set of characterized sequences including 6 transposable elements (TEs) and 11 cellular genes. We found that several features characterize the alterations: (1) All detected alterations are hypermethylation events; (2) whereas alteration in both CG and CNG methylation occurred in the TEs, only alteration in CNG methylation occurred in the cellular genes; (3) alteration in expression includes both up- and down-regulations, which did not show a general correlation with alteration in methylation; (4) altered methylation patterns in both TEs and cellular genes are heritable to progenies at variable frequencies; however, stochastic reversion to wild-type patterns and further de novo changes in progenies are also apparent; and (5) the altered expression states in both TEs and cellular genes are also heritable to selfed progenies but with markedly lower transmission frequencies than altered DNA methylation states. Furthermore, we found that a set of genes encoding for the various putative DNA methyltransferases, 5-methylcytosine DNA glycosylases, the SWI/SNF chromatin remodeller (DDM1) and siRNA-related proteins are extremely sensitive to perturbation by spaceflight, which might be an underlying cause for the altered methylation patterns in the space-flown plants. We discuss implications of spaceflight-induced epigenetic variations with regard to health safety

  8. Benzene-derived N2-(4-hydroxyphenyl)-deoxyguanosine adduct: UvrABC incision and its conformation in DNA

    Hang, Bo; Rodriguez, Ben; Yang, Yanu; Guliaev, Anton B.; Chenna, Ahmed

    2010-06-14

    Benzene, a ubiquitous human carcinogen, forms DNA adducts through its metabolites such as p-benzoquinone (p-BQ) and hydroquinone (HQ). N(2)-(4-Hydroxyphenyl)-2'-deoxyguanosine (N(2)-4-HOPh-dG) is the principal adduct identified in vivo by (32)P-postlabeling in cells or animals treated with p-BQ or HQ. To study its effect on repair specificity and replication fidelity, we recently synthesized defined oligonucleotides containing a site-specific adduct using phosphoramidite chemistry. We here report the repair of this adduct by Escherichia coli UvrABC complex, which performs the initial damage recognition and incision steps in the nucleotide excision repair (NER) pathway. We first showed that the p-BQ-treated plasmid was efficiently cleaved by the complex, indicating the formation of DNA lesions that are substrates for NER. Using a 40-mer substrate, we found that UvrABC incises the DNA strand containing N(2)-4-HOPh-dG in a dose- and time-dependent manner. The specificity of such repair was also compared with that of DNA glycosylases and damage-specific endonucleases of E. coli, both of which were found to have no detectable activity toward N(2)-4-HOPh-dG. To understand why this adduct is specifically recognized and processed by UvrABC, molecular modeling studies were performed. Analysis of molecular dynamics trajectories showed that stable G:C-like hydrogen bonding patterns of all three Watson-Crick hydrogen bonds are present within the N(2)-4-HOPh-G:C base pair, with the hydroxyphenyl ring at an almost planar position. In addition, N(2)-4-HOPh-dG has a tendency to form more stable stacking interactions than a normal G in B-type DNA. These conformational properties may be critical in differential recognition of this adduct by specific repair enzymes.

  9. DNA ligase I, the replicative DNA ligase

    Howes, Timothy R.L.; Tomkinson, Alan E.

    2012-01-01

    Multiple DNA ligation events are required to join the Okazaki fragments generated during lagging strand DNA synthesis. In eukaryotes, this is primarily carried out by members of the DNA ligase I family. The C-terminal catalytic region of these enzymes is composed of three domains: a DNA binding domain, an adenylation domain and an OB-fold domain. In the absence of DNA, these domains adopt an extended structure but transition into a compact ring structure when they engage a DNA nick, with each...

  10. Chemical repair of base lesions, AP-sites, and strand breaks on plasmid DNA in dilute aqueous solution by ascorbic acid

    Hata, Kuniki [Department of Nuclear Engineering and Management, School of Engineering, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Advanced Science Research Center, Japan Atomic Energy Agency, 2-4 Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Urushibara, Ayumi; Yamashita, Shinichi; Shikazono, Naoya; Yokoya, Akinari [Advanced Science Research Center, Japan Atomic Energy Agency, 2-4 Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Katsumura, Yosuke, E-mail: katsu@n.t.u-tokyo.ac.jp [Department of Nuclear Engineering and Management, School of Engineering, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Nuclear Professional School, School of Engineering, The University of Tokyo, 2-22 Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1188 (Japan)

    2013-05-03

    Highlights: •We report a novel mechanism of radiation protection of DNA by chemical activity of ascorbic acid. •The “chemical repair” of DNA damage was revealed using biochemical assay and chemical kinetics analysis. •We found that ascorbic acid significantly repairs precursors of nucleobase lesions and abasic sites. •However, ascorbic acid seldom repairs precursors of DNA-strand breaks. -- Abstract: We quantified the damage yields produced in plasmid DNA by γ-irradiation in the presence of low concentrations (10–100 μM) of ascorbic acid, which is a major antioxidant in living systems, to clarify whether it chemically repairs radiation damage in DNA. The yield of DNA single strand breaks induced by irradiation was analyzed with agarose gel electrophoresis as conformational changes in closed circular plasmids. Base lesions and abasic sites were also observed as additional conformational changes by treating irradiated samples with glycosylase proteins. By comparing the suppression efficiencies to the induction of each DNA lesion, in addition to scavenging of the OH radicals derived from water radiolysis, it was found that ascorbic acid promotes the chemical repair of precursors of AP-sites and base lesions more effectively than those of single strand breaks. We estimated the efficiency of the chemical repair of each lesion using a kinetic model. Approximately 50–60% of base lesions and AP-sites were repaired by 10 μM ascorbic acid, although strand breaks were largely unrepaired by ascorbic acid at low concentrations. The methods in this study will provide a route to understanding the mechanistic aspects of antioxidant activity in living systems.

  11. Chemical repair of base lesions, AP-sites, and strand breaks on plasmid DNA in dilute aqueous solution by ascorbic acid

    Highlights: •We report a novel mechanism of radiation protection of DNA by chemical activity of ascorbic acid. •The “chemical repair” of DNA damage was revealed using biochemical assay and chemical kinetics analysis. •We found that ascorbic acid significantly repairs precursors of nucleobase lesions and abasic sites. •However, ascorbic acid seldom repairs precursors of DNA-strand breaks. -- Abstract: We quantified the damage yields produced in plasmid DNA by γ-irradiation in the presence of low concentrations (10–100 μM) of ascorbic acid, which is a major antioxidant in living systems, to clarify whether it chemically repairs radiation damage in DNA. The yield of DNA single strand breaks induced by irradiation was analyzed with agarose gel electrophoresis as conformational changes in closed circular plasmids. Base lesions and abasic sites were also observed as additional conformational changes by treating irradiated samples with glycosylase proteins. By comparing the suppression efficiencies to the induction of each DNA lesion, in addition to scavenging of the OH radicals derived from water radiolysis, it was found that ascorbic acid promotes the chemical repair of precursors of AP-sites and base lesions more effectively than those of single strand breaks. We estimated the efficiency of the chemical repair of each lesion using a kinetic model. Approximately 50–60% of base lesions and AP-sites were repaired by 10 μM ascorbic acid, although strand breaks were largely unrepaired by ascorbic acid at low concentrations. The methods in this study will provide a route to understanding the mechanistic aspects of antioxidant activity in living systems

  12. DNA modifications: Another stable base in DNA

    Brazauskas, Pijus; Kriaucionis, Skirmantas

    2014-12-01

    Oxidation of 5-methylcytosine has been proposed to mediate active and passive DNA demethylation. Tracking the history of DNA modifications has now provided the first solid evidence that 5-hydroxymethylcytosine is a stable epigenetic modification.

  13. Synthesis of DNA

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  14. Sperm DNA oxidative damage and DNA adducts.

    Jeng, Hueiwang Anna; Pan, Chih-Hong; Chao, Mu-Rong; Lin, Wen-Yi

    2015-12-01

    The objective of this study was to investigate DNA damage and adducts in sperm from coke oven workers who have been exposed to polycyclic aromatic hydrocarbons. A longitudinal study was conducted with repeated measurements during spermatogenesis. Coke-oven workers (n=112) from a coke-oven plant served the PAH-exposed group, while administrators and security personnel (n=67) served the control. Routine semen parameters (concentration, motility, vitality, and morphology) were analyzed simultaneously; the assessment of sperm DNA integrity endpoints included DNA fragmentation, bulky DNA adducts, and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxo-dGuo). The degree of sperm DNA fragmentation was measured using the terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) assay and sperm chromatin structure assay (SCSA). The PAH-exposed group had a significant increase in bulky DNA adducts and 8-oxo-dGuo compared to the control subjects (Ps=0.002 and 0.045, respectively). Coke oven workers' percentages of DNA fragmentation and denaturation from the PAH-exposed group were not significantly different from those of the control subjects (Ps=0.232 and 0.245, respectively). Routine semen parameters and DNA integrity endpoints were not correlated. Concentrations of 8-oxo-dGuo were positively correlated with percentages of DNA fragmentation measured by both TUNEL and SCSA (Ps=0.045 and 0.034, respectively). However, the concentrations of 8-oxo-dGuo and percentages of DNA fragmentation did not correlate with concentrations of bulky DNA adducts. In summary, coke oven workers with chronic exposure to PAHs experienced decreased sperm DNA integrity. Oxidative stress could contribute to the degree of DNA fragmentation. Bulky DNA adducts may be independent of the formation of DNA fragmentation and oxidative adducts in sperm. Monitoring sperm DNA integrity is recommended as a part of the process of assessing the impact of occupational and environmental toxins on sperm

  15. DNA vaccines and bacterial DNA in immunity

    Bandholtz, Lisa Charlotta

    2002-01-01

    This thesis describes DNA-based vaccination and the importance of bacterial DNA in different immunological perspectives. Intranasal (i.n.) DNA vaccination utilizing a plasmid encoding the chlamydial heat shock protein 60 (p-hsp-60) generated lower bacterial burden and reduced pathology in the lungs of mice after subsequent infection with C. pneumoniae. This DNA vaccine- induced protection was dependent on T cells and induction of IFN-gamma. Co-administration of a plasmid...

  16. DNA damage in wounded, hypoxic and acidotic human skin fibroblast cell cultures after low laser irradiation

    Hawkins Evans, D.; Mbene, A.; Zungu, I.; Houreld, N.; Abrahamse, H.

    2009-02-01

    Phototherapy has become more popular and widely used in the treatment of a variety of medical conditions. To ensure sound results as evidence of its effectiveness, well designed experiments must be conducted when determining the effect of phototherapy. Cell culture models such as hypoxic, acidotic and wounded cell cultures simulating different disease conditions including ischemic heart disease, diabetes and wound healing were used to determine the effect of laser irradiation on the genetic integrity of the cell. Even though phototherapy has been found to be beneficial in a wide spectrum of conditions, it has been shown to induce DNA damage. However, this damage appears to be repairable. The risk lies in the fact that phototherapy may help the medical condition initially but damage DNA at the same time leaving undetected damage that may result in late onset, more severe, induced medical conditions including cancer. Human skin fibroblasts were cultured and used to induce a wound (by the central scratch model), hypoxic (by incubation in an anaerobic jar, 95% N2 and 5% O2) and acidotic (reducing the pH of the media to 6.7) conditions. Different models were irradiated using a Helium-Neon (632.8 nm) laser with a power density of 2.07 mW/cm2 and a fluence of 5 J/cm2 or 16 J/cm2. The effect of the irradiation was determined using the Comet assay 1 and 24 h after irradiation. In addition, the Comet assay was performed with the addition of formamidopyrimidine glycosylase (FPG) obviating strand brakes in oxidized bases at a high fluence of 16 J/cm2. A significant increase in DNA damage was seen in all three injured models at both 1 and 24 h post-irradiation when compared to the normal un-injured cells. However, when compared to non-irradiated controls the acidotic model showed a significant decrease in DNA damage 24 h after irradiation indicating the possible induction of cellular DNA repair mechanisms. When wounded cells were irradiated with higher fluences of 16 J/cm2

  17. Biochemical Characterization of Mycobacterium tuberculosis DNA Repair Enzymes – Nfo, XthA and Nei2

    Sailau Abeldenov

    2014-01-01

    protein mass spectrometry by ion trap tandem MS/MS on nLC-ESI-Ion-Trap platform. Biochemical characterization of DNA repair protein-catalyzed activity was carried out by measuring apurinic/apyrimidinic endonuclease, DNA glycosylase, exonuclease, and 3'-repair diesterase functions. In addition, effect of the opposite base and the influence of metal ion cofactors were measured. Conclusion: Results of the ongoing study will help us define the role of DNA repair enzymes in the emergence of mutations in the mycobacterial genome and, possibly, the origins of multi-drug resistance in mycobacteria.  

  18. DNA encoding a DNA repair protein

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-08-15

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  19. Role of hazelnut consumption on DNA damage and lipid-related markers in children with primary dyslipidemia

    Cristian Del Bo'

    2015-06-01

    Sixty children (11.5 ± 2.5 years have participated in an 8-week controlled, parallel, dietary intervention study with hazelnuts (0.43 g/kg body weight per day. Subjects received dietary guidelines and were randomized in 3 groups: 1- hazelnuts with skin; 2- hazelnut without skin; 3- control (without hazelnuts. Before and after intervention, blood samples were collected and used to evaluate the levels of formamidopyrimidine-DNA glycosylase (FPG-sensitive sites and H2O2-induced DNA damage in peripheral blood mononuclear cells (by comet assay, serum lipid profile (by automatic analyzer and erythrocyte membrane phospholipids composition (by gas chromatography analysis. Preliminary results in a subgroup (5 subjects receiving hazelnut with skin and 5 controls show a reduction in the FPG-sensitive sites (from 13.8 ± 3.16% to 7.88 ± 2.98% and H2O2-induced DNA damage (from 44.4 ± 3.1% to 35.7 ± 7.6% following 8-week hazelnut consumption, while no effect seems to occur in the control group. Hazelnut decreases serum LDL-C level (-11.2%; p= 0.01 and seems to affect erythrocyte membrane phospholipids composition compared to baseline, while no difference in triglycerides, total and HDL-C levels has been documented in the subgroup analyzed. These preliminary results show a tendency towards a decrease in the levels of FPG-sensitive sites, H2O2-induced DNA damage and serum LDL-C after an 8-week hazelnut intervention. Data elaboration on the complete group of subjects will help understanding the effect of hazelnut consumption on lipid profile and markers of oxidative stress in children affected by primary dyslipidemia.

  20. Genetic analysis of repair and damage tolerance mechanisms for DNA-protein cross-links in Escherichia coli.

    Salem, Amir M H; Nakano, Toshiaki; Takuwa, Minako; Matoba, Nagisa; Tsuboi, Tomohiro; Terato, Hiroaki; Yamamoto, Kazuo; Yamada, Masami; Nohmi, Takehiko; Ide, Hiroshi

    2009-09-01

    DNA-protein cross-links (DPCs) are unique among DNA lesions in their unusually bulky nature. We have recently shown that nucleotide excision repair (NER) and RecBCD-dependent homologous recombination (HR) collaboratively alleviate the lethal effect of DPCs in Escherichia coli. In this study, to gain further insight into the damage-processing mechanism for DPCs, we assessed the sensitivities of a panel of repair-deficient E. coli mutants to DPC-inducing agents, including formaldehyde (FA) and 5-azacytidine (azaC). We show here that the damage tolerance mechanism involving HR and subsequent replication restart (RR) provides the most effective means of cell survival against DPCs. Translesion synthesis does not serve as an alternative damage tolerance mechanism for DPCs in cell survival. Elimination of DPCs from the genome relies primarily on NER, which provides a second and moderately effective means of cell survival against DPCs. Interestingly, Cho rather than UvrC seems to be an effective nuclease for the NER of DPCs. Together with the genes responsible for HR, RR, and NER, the mutation of genes involved in several aspects of DNA repair and transactions, such as recQ, xth nfo, dksA, and topA, rendered cells slightly but significantly sensitive to FA but not azaC, possibly reflecting the complexity of DPCs or cryptic lesions induced by FA. UvrD may have an additional role outside NER, since the uvrD mutation conferred a slight azaC sensitivity on cells. Finally, DNA glycosylases mitigate azaC toxicity, independently of the repair of DPCs, presumably by removing 5-azacytosine or its degradation product from the chromosome. PMID:19617358

  1. Characterization of family IV UDG from Aeropyrum pernix and its application in hot-start PCR by family B DNA polymerase.

    Xi-Peng Liu

    Full Text Available Recombinant uracil-DNA glycosylase (UDG from Aeropyrum pernix (A. pernix was expressed in E. coli. The biochemical characteristics of A. pernix UDG (ApeUDG were studied using oligonucleotides carrying a deoxyuracil (dU base. The optimal temperature range and pH value for dU removal by ApeUDG were 55-65°C and pH 9.0, respectively. The removal of dU was inhibited by the divalent ions of Zn, Cu, Co, Ni, and Mn, as well as a high concentration of NaCl. The opposite base in the complementary strand affected the dU removal by ApeUDG as follows: U/C≈U/G>U/T≈U/AP≈U/->U/U≈U/I>U/A. The phosphorothioate around dU strongly inhibited dU removal by ApeUDG. Based on the above biochemical characteristics and the conservation of amino acid residues, ApeUDG was determined to belong to the IV UDG family. ApeUDG increased the yield of PCR by Pfu DNA polymerase via the removal of dU in amplified DNA. Using the dU-carrying oligonucleotide as an inhibitor and ApeUDG as an activator of Pfu DNA polymerase, the yield of undesired DNA fragments, such as primer-dimer, was significantly decreased, and the yield of the PCR target fragment was increased. This strategy, which aims to amplify the target gene with high specificity and yield, can be applied to all family B DNA polymerases.

  2. Human placental DNA methyltransferase: DNA substrate and DNA binding specificity.

    Wang, R.Y.; Huang, L. H.; Ehrlich, M

    1984-01-01

    We have partially purified a DNA methyltransferase from human placenta using a novel substrate for a highly sensitive assay of methylation of hemimethylated DNA. This substrate was prepared by extensive nick translation of bacteriophage XP12 DNA, which normally has virtually all of its cytosine residues replaced by 5-methylcytosine (m5C). Micrococcus luteus DNA was just as good a substrate if it was first similarly nick translated with m5dCTP instead of dCTP in the polymerization mixture. At ...

  3. Determination of apurinic/apyrimidinic lesions in DNA with high-performance liquid chromatography and tandem mass spectrometry.

    Roberts, Kenneth P; Sobrino, Justin A; Payton, Julie; Mason, Lavinnia B; Turesky, Robert J

    2006-02-01

    A new method has been developed to accurately measure apurinic and apyrimidinic (AP) DNA damage sites, which are lesions in DNA formed by loss of a nucleobase from oxidative stress or carcinogen adducts. If AP sites are left unrepaired (or if improperly repaired), these sites can lead to DNA mutations that may ultimately result in the formation of cancer. Hence, detection of AP sites may provide a useful indicator of exposure and susceptibility to chemical carcinogens and oxidative stress. AP detection is currently accomplished by immunodetection methods using an aldehyde reactive probe [Nakamura, J., Walker, V. E., Upton, P. B., Chiang, S.-Y., Kow, Y. W., and Swenberg, J. A. (1998) Cancer Res. 58, 222-225; Atamna, H., Cheung, I., and Ames, B. N. (2000) Proc. Natl. Acad. Sci. U.S.A. 97, 686-691]; however, these approaches lack the specificity required for unequivocal identification of the AP site. Therefore, we have developed an accurate method based on mass spectrometry detection of AP sites from AP DNA that have been prelabeled with O-4-nitrobenzylhydroxylamine (NBHA). Once labeled and once the excess labeling agent has been removed, enzymatic digestion of DNA to monomeric subunits can be accomplished, followed by isolation and detection with high-performance liquid chromatography coupled to electrospray ionization tandem mass spectrometry (HPLC-ESI-MS/MS). Optimization and validation of the experimental procedures and detection limits have been established using a model DNA oligomer (11-mer) containing uracil. Enzymatic removal of uracil with uracil glycosylase generates well-defined AP sites in both single- and double-stranded DNA. The addition of NBHA labels the AP site in the oligomer, creating a labeled 11-mer. HPLC-ESI-MS/MS in the negative ionization mode was used to monitor and confirm binding of NBHA to the AP oligomer. The NBHA-tagged oligomer underwent endo- and exonuclease digestion to the 5'-deoxyribose monophosphate (5'-dRp) level, thereby releasing

  4. DNA extraction by zinc.

    Kejnovský, E; Kypr, J

    1997-01-01

    A fast, very simple and efficient method of DNA extraction is described which takes advantage of DNA sedimentation induced by millimolar concentrations of ZnCl2. The zinc-induced sedimentation is furthermore strongly promoted by submillimolar phosphate anion concentrations. Within 90% of DNA irrespective of whether a plasmid DNA or short oligonucleotides are the extracted material. The method works with plasmid DNA and oligonucleotide concentrations as low as 100 ng/ml and 10 microg/ml, respe...

  5. Wedging out DNA damage

    Schärer, Orlando D.; Campbell, Arthur J

    2009-01-01

    The DNA-repair machinery is faced with the significant challenge of differentiating DNA lesions from unmodified DNA. Two recent publications, one in this issue of Nature Structural & Molecular Biology, uncover a new way of recognizing minimally distorting DNA lesions: insertion of a 3- or 4-amino-acid wedge into DNA to extrude the lesion into a shallow binding pocket that can accommodate various damaged bases.

  6. 3DNA: A Tool for DNA Sculpting

    Gupta, Shikhar Kumar; Joshi, Foram; Limbachiya, Dixita; Gupta, Manish K.

    2014-01-01

    DNA self-assembly is a robust and programmable approach for building structures at nanoscale. Researchers around the world have proposed and implemented different techniques to build two dimensional and three dimensional nano structures. One such technique involves the implementation of DNA Bricks proposed by Ke et al., 2012 to create complex three-dimensional (3D) structures. Modeling these DNA nano structures can prove to be a cumbersome and tedious task. Exploiting the programmability of b...

  7. DNA Polymerase-Catalyzed DNA Network Growth

    Keller, Sascha; Wang, Jie; Chandra, Madhaviah; Berger, Rüdiger; Marx, Andreas

    2008-01-01

    The distinct base pairing property of DNA is an advantageous phenomenon that has been exploited in the usage of DNA as scaffold for directed self-organization to form nanometer-sized objects in a desirable fashion. Herein we report the construction of three-dimensional DNA-based networks that can be generated and amplified by the DNA polymerase chain reaction (PCR). The approach is flexible allowing tuning of the meshes of the network by variation of the size of the template. Additionally, fu...

  8. Investigation of the effects of short-term inhalation of carbon nanoparticles on brains and lungs of c57bl/6j and p47(phox-/-) mice.

    van Berlo, D; Hullmann, M; Wessels, A; Scherbart, A M; Cassee, F R; Gerlofs-Nijland, M E; Albrecht, C; Schins, R P F

    2014-07-01

    Recent studies indicate that the brain is a target for toxic carbonaceous nanoparticles present in ambient air. It has been proposed that the neurotoxic effects of such particles are driven by nicotinamide adenine dinucleotide phosphate (NADPH) oxidase mediated generation of reactive oxygen species (ROS) in activated microglia. In the present study, we have evaluated the effects of short term (4h) nose-only inhalation exposure to carbon NP (CNP) in the brains and lungs of C57BL/6J mice and in p47(phox-/-) mice that lack a functional NADPH oxidase. It was shown that the lungs of the p47(phox-/-) mice are less responsive to CNP inhalation than lungs of the corresponding C57BL/6J control animals. Lung tissue mRNA expression of the oxidative stress/DNA damage response genes 8-oxoguanine glycosylase (OGG1) and apurinic/apyrimidinic endonuclease 1 (APE1) were induced by CNP exposure in C57BL/6J but not in the p47(phox-/-) mice. In contrast, the expression of these genes, as well as Tumor Necrosis Factor-α (TNFα), Cyclooxygenase-2 (COX-2) and Heme Oxygenase-1 (HO-1) was not altered in the olfactory bulb, cerebellum or remaining brain tissue part of either mouse background. This indicates that neuroinflammation was not induced by this exposure. CNP inhalation for 4h or for 4h on three consecutive days also did not affect brain tissue protein expression of interleukin (IL)-1β, while a clear significant difference in constitutive expression level of this pro-inflammatory cytokine was found between C57BL/6J and p47(phox-/-) mice. In conclusion, short-term inhalation exposure to pure carbon nanoparticles can trigger mild p47(phox) dependent oxidative stress responses in the lungs of mice whereas in their brains at the same exposure levels signs of oxidative stress and inflammation remain absent. The possible role of p47(phox) in the neuro-inflammatory effects of nanoparticles in vivo remains to be clarified. PMID:24792328

  9. DNA polymerase δ and DNA repair: DNA repair synthesis in human fibroblasts requires DNA polymerase δ

    When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernate of similarly treated HeLa cells. Monoclonal antibody to KB cell DNA polymerase α, while binding to HeLa DNA polymerase α, did not bind to the HeLa DNA polymerase δ. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGT) and 2(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase α, but did not inhibit the DNA polymerase δ. Neither purified DNA polymerase α nor β could promote repair DNA synthesis in the permeabilized cells. Furthermore, if monoclonal antibodies to DNA polymerase α BuPdGTP, or BuAdATP was added to the reconstituted system, there was no significant inhibition

  10. Non-canonical uracil processing in DNA gives rise to double-strand breaks and deletions: relevance to class switch recombination.

    Bregenhorn, Stephanie; Kallenberger, Lia; Artola-Borán, Mariela; Peña-Diaz, Javier; Jiricny, Josef

    2016-04-01

    During class switch recombination (CSR), antigen-stimulated B-cells rearrange their immunoglobulin constant heavy chain (CH) loci to generate antibodies with different effector functions. CSR is initiated by activation-induced deaminase (AID), which converts cytosines in switch (S) regions, repetitive sequences flanking the CH loci, to uracils. Although U/G mispairs arising in this way are generally efficiently repaired to C/Gs by uracil DNA glycosylase (UNG)-initiated base excision repair (BER), uracil processing in S-regions of activated B-cells occasionally gives rise to double strand breaks (DSBs), which trigger CSR. Surprisingly, genetic experiments revealed that CSR is dependent not only on AID and UNG, but also on mismatch repair (MMR). To elucidate the role of MMR in CSR, we studied the processing of uracil-containing DNA substrates in extracts of MMR-proficient and -deficient human cells, as well as in a system reconstituted from recombinant BER and MMR proteins. Here, we show that the interplay of these repair systems gives rise to DSBs in vitro and to genomic deletions and mutations in vivo, particularly in an S-region sequence. Our findings further suggest that MMR affects pathway choice in DSB repair. Given its amenability to manipulation, our system represents a powerful tool for the molecular dissection of CSR. PMID:26743004

  11. Identification of Escherichia coli ygaQ and rpmG as novel mitomycin C resistance factors implicated in DNA repair.

    Bolt, Edward L; Jenkins, Tabitha; Russo, Valeria Moreira; Ahmed, Sharlene; Cavey, James; Cass, Simon D

    2016-01-01

    Using the ASKA (A Complete Set of Escherichia coli K-12 ORF Archive) library for genome-wide screening of E. coli proteins we identified that expression of ygaQ and rpmG promotes mitomycin C resistance (MMC(R)). YgaQ mediated MMC(R) was independent of homologous recombination involving RecA or RuvABC, but required UvrD. YgaQ is an uncharacterized protein homologous with α-amylases that we identified to have nuclease activity directed to ssDNA of 5' flaps. Nuclease activity was inactivated by mutation of two amino acid motifs, which also abolished MMC(R). RpmG is frequently annotated as a bacterial ribosomal protein, although forms an operon with MutM glycosylase and a putative deubiquitinating (DUB) enzyme, YicR. RpmG associated MMC(R) was dependent on MutM. MMC(R) from RpmG resembles DNA repair phenotypes reported for 'idiosyncratic ribosomal proteins' in eukaryotes. PMID:26704888

  12. An inverse switch in DNA base excision and strand break repair contributes to melphalan resistance in multiple myeloma cells.

    Mirta M L Sousa

    Full Text Available Alterations in checkpoint and DNA repair pathways may provide adaptive mechanisms contributing to acquired drug resistance. Here, we investigated the levels of proteins mediating DNA damage signaling and -repair in RPMI8226 multiple myeloma cells and its Melphalan-resistant derivative 8226-LR5. We observed markedly reduced steady-state levels of DNA glycosylases UNG2, NEIL1 and MPG in the resistant cells and cross-resistance to agents inducing their respective DNA base lesions. Conversely, repair of alkali-labile sites was apparently enhanced in the resistant cells, as substantiated by alkaline comet assay, autoribosylation of PARP-1, and increased sensitivity to PARP-1 inhibition by 4-AN or KU58684. Reduced base-excision and enhanced single-strand break repair would both contribute to the observed reduction in genomic alkali-labile sites, which could jeopardize productive processing of the more cytotoxic Melphalan-induced interstrand DNA crosslinks (ICLs. Furthermore, we found a marked upregulation of proteins in the non-homologous end-joining (NHEJ pathway of double-strand break (DSB repair, likely contributing to the observed increase in DSB repair kinetics in the resistant cells. Finally, we observed apparent upregulation of ATR-signaling and downregulation of ATM-signaling in the resistant cells. This was accompanied by markedly increased sensitivity towards Melphalan in the presence of ATR-, DNA-PK, or CHK1/2 inhibitors whereas no sensitizing effect was observed subsequent to ATM inhibition, suggesting that replication blocking lesions are primary triggers of the DNA damage response in the Melphalan resistant cells. In conclusion, Melphalan resistance is apparently contributed by modulation of the DNA damage response at multiple levels, including downregulation of specific repair pathways to avoid repair intermediates that could impair efficient processing of cytotoxic ICLs and ICL-induced DSBs. This study has revealed several novel

  13. Activity-based assay for ricin-like toxins

    Keener, William K.; Ward, Thomas E.

    2007-02-06

    A method of detecting N-glycosylase activity in a sample involves incubating an oligodeoxyribonucleotide substrate containing a deoxyadenosine or deoxyuridine residue with the sample to be tested such that the N-glycosylase, if present, hydrolyzes the deoxyadenosine or deoxyuridine residue to result in an N-glycosylase product having an abasic site. A primer is annealed to the N-glycosylase product, and the primer is extended with a DNA polymerase, such as Taq DNA polymerase, that pauses at abasic sites. The resulting extension products are melted from the N-glycosylase product, allowed to form hairpins due to self-complementarity, and further extended in the presence of labeled precursors to result in labeled products. Extension products synthesized from undigested substrate as template do not result in labeled products. Thus, detection of labeled products results in detection of N-glycosylase activity. Oligodeoxyribonucleotide substrates, primer, and positive controls and a kit for N-glycosylase assay are also disclosed.

  14. DNA fragmentation in apoptosis

    2000-01-01

    Cleavage of chromosomal DNA into oligonucleosomal size fragments is an integral part of apoptosis. Elegant biochemical work identified the DNA fragmentation factor (DFF) as a major apoptotic endonuclease for DNA fragmentation in vitro. Genetic studies in mice support the importance of DFF in DNA fragmentation and possibly in apoptosis in vivo. Recent work also suggests the existence of additional endonucleases for DNA degradation. Understanding the roles of individual endonucleases in apoptosis, and how they might coordinate to degrade DNA in different tissues during normal development and homeostasis, as well as in various diseased states, will be a major research focus in the near future.

  15. DNA damage and autophagy

    Both exogenous and endogenous agents are a threat to DNA integrity. Exogenous environmental agents such as ultraviolet (UV) and ionizing radiation, genotoxic chemicals and endogenous byproducts of metabolism including reactive oxygen species can cause alterations in DNA structure (DNA damage). Unrepaired DNA damage has been linked to a variety of human disorders including cancer and neurodegenerative disease. Thus, efficient mechanisms to detect DNA lesions, signal their presence and promote their repair have been evolved in cells. If DNA is effectively repaired, DNA damage response is inactivated and normal cell functioning resumes. In contrast, when DNA lesions cannot be removed, chronic DNA damage triggers specific cell responses such as cell death and senescence. Recently, DNA damage has been shown to induce autophagy, a cellular catabolic process that maintains a balance between synthesis, degradation, and recycling of cellular components. But the exact mechanisms by which DNA damage triggers autophagy are unclear. More importantly, the role of autophagy in the DNA damage response and cellular fate is unknown. In this review we analyze evidence that supports a role for autophagy as an integral part of the DNA damage response.

  16. DNA Open states and DNA hydratation

    It is a very well-known fact that an protonic exchange exists among natural DNA filaments and synthetic polynucleotides with the solvent (1--2). The existence of DNA open states, that is to say states for which the interior of the DNA molecule is exposed to the external environment, it has been demonstrated by means of proton-deuterium exchange (3). This work has carried out experiments measuring the dispersion of the traverse relaxation rate (4), as a pulsation rate function in a Carr-Purcell-Meiboom-Gill (CPMG) pulses sequence rate, to determine changes in the moist layer of the DNA molecule. The experiments were carried out under different experimental conditions in order to vary the probability that open states occurs, such as temperature or the exposure to electromagnetic fields. Some theoretical models were supposed to adjust the experimental results including those related to DNA non linear dynamic

  17. HPV DNA test

    The HPV DNA test is used to check for high-risk HPV infection in women. HPV infection around the genitals is ... warts spread when you have sex. The HPV-DNA test is generally not recommended for detecting low- ...

  18. Modeling DNA Replication.

    Bennett, Joan

    1998-01-01

    Recommends the use of a model of DNA made out of Velcro to help students visualize the steps of DNA replication. Includes a materials list, construction directions, and details of the demonstration using the model parts. (DDR)

  19. Recombinant DNA in Medicine

    Cederbaum, Stephen D.; Fareed, George C.; Lovett, Michael A.; Shapiro, Larry J.

    1984-01-01

    Studies in bacteria and bacterial viruses have led to methods to manipulate and recombine DNA in unique and reproducible ways and to amplify these recombined molecules millions of times. Once properly identified, the recombinant DNA molecules can be used in various ways useful in medicine and human biology. There are many applications for recombinant DNA technology. Cloned complementary DNA has been used to produce various human proteins in microorganisms. Insulin and growth hormone have been...

  20. Is DNA a language?

    Tsonis, A A; Elsner, J B; Tsonis, P A

    1997-01-01

    DNA sequences usually involve local construction rules that affect different scales. As such their "dictionary" may not follow Zipf's law (a power law) which is followed in every natural language. Indeed, analysis of many DNA sequences suggests that no linguistics connections to DNA exist and that even though it has structure DNA is not a language. Computer simulations and a biological approach to this problem further support these results. PMID:9039397

  1. DNA Damage Response

    Giglia-Mari, Giuseppina; Zotter, Angelika; Vermeulen, Wim

    2011-01-01

    Structural changes to DNA severely affect its functions, such as replication and transcription, and play a major role in age-related diseases and cancer. A complicated and entangled network of DNA damage response (DDR) mechanisms, including multiple DNA repair pathways, damage tolerance processes, and cell-cycle checkpoints safeguard genomic integrity. Like transcription and replication, DDR is a chromatin-associated process that is generally tightly controlled in time and space. As DNA damag...

  2. DNA-Mediated Electrochemistry

    Gorodetsky, Alon A.; Buzzeo, Marisa C.; Barton, Jacqueline K.

    2008-01-01

    The base pair stack of DNA has been demonstrated as a medium for long-range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here, we discuss the characteristi...

  3. Replicating animal mitochondrial DNA

    Emily A. McKinney

    2013-01-01

    Full Text Available The field of mitochondrial DNA (mtDNA replication has been experiencing incredible progress in recent years, and yet little is certain about the mechanism(s used by animal cells to replicate this plasmid-like genome. The long-standing strand-displacement model of mammalian mtDNA replication (for which single-stranded DNA intermediates are a hallmark has been intensively challenged by a new set of data, which suggests that replication proceeds via coupled leading-and lagging-strand synthesis (resembling bacterial genome replication and/or via long stretches of RNA intermediates laid on the mtDNA lagging-strand (the so called RITOLS. The set of proteins required for mtDNA replication is small and includes the catalytic and accessory subunits of DNA polymerase y, the mtDNA helicase Twinkle, the mitochondrial single-stranded DNA-binding protein, and the mitochondrial RNA polymerase (which most likely functions as the mtDNA primase. Mutations in the genes coding for the first three proteins are associated with human diseases and premature aging, justifying the research interest in the genetic, biochemical and structural properties of the mtDNA replication machinery. Here we summarize these properties and discuss the current models of mtDNA replication in animal cells.

  4. DNA damage response

    G. Giglia-Mari (Giuseppina); A. Zotter (Angelika); W. Vermeulen (Wim)

    2011-01-01

    textabstractStructural changes to DNA severely affect its functions, such as replication and transcription, and play a major role in age-related diseases and cancer. A complicated and entangled network ofDNA damage response (DDR) mechanisms, including multiple DNA repair pathways, damage tolerance p

  5. Protective effects of rosmarinic acid on sepsis-induced DNA damage in the liver of Wistar albino rats

    Hatice Gul Goktas

    2015-06-01

    Full Text Available Sepsis is an imbalance between pro and anti-inflammatory responses. Sepsis induced multiple organ failure that is associated with mortality is characterized by liver, renal, cardiovascular and pulmonary dysfunction and reactive oxygen species (ROS are believed to be involved in the development of sepsis. Plant polyphenols may act as antioxidants by different mechanisms such as free radical scavenging, metal chelation and protein binding. Data indicates possible beneficial effects of plant derived phenolic compounds against sepsis. Rosmarinic acid (RA (α-O-caffeoyl-3,4-dihydroxyphenyllactic acid is a phenolic compound commonly found in various plants such as Rosmarinus officinalis (rosemary, Origanum vulgare (oregano, Thymus vulgaris (thyme, Mentha spicata (spearmint, Perilla frutescens (perilla, Ocimum basilicum (sweet basil and several other medicinal plants. It has been shown that RA has many biological activities including antioxidant, anti-inflammatory, antiallergic, anticancer and actimicrobial and is widely used in cosmetic and food industry. In the present study, we aimed to determine the protective effects of RA against the oxidative DNA damage induced by sepsis in Wistar albino rats. The rats were divided into four groups; sham, sepsis induced, RA-treated, RA treated and sepsis induced groups. Wistar rats were subjected to sepsis by cecal ligation puncture. The liver tissues were carefully dissected from their attachments and totally excised. The concentrations of the hepatic tissue cells were adjusted to approximately 2 x 106 cells/ml. Standard and formamidopyrimidine-DNA glycosylase (Fpg modified comet assay described by Singh et al were used. There were no statistically significant differences in terms of tail length, tail intensity and tail moment between the sham group and the RA-treated groups (p>0.05. The DNA damage was found significantly higher in the sepsis-induced group compared to the sham group (p0.05, and the DNA damage

  6. DNA去甲基化机制的研究进展%Progress in Study on Mechanism of DNA Demethylation

    曹领改; 张旸; 蓝兴国; 李玉花

    2012-01-01

    As a significant epigenetic modification, DNA methylation plays a critical role in regulating gene expression and maintaining genomic stability in mammals and flowering plants. DNA methylation level and pattern of change will lead to abnormal phenotype or even death. The level and pattern of 5-Mc are determined by both DNA methylation and demethylation processes. Demethylation of DNA can be passive and active. The formation of DNA methylation pattern depends on the active demethylation. Five potential mechanisms of DNA active demethylation are reviewed in this paper: base excision repair involved with DNA glycosylases, base excision repair involved with enzymatic deamination, nucleotide excision repair, oxidative demethylation and hydrolysis.%DNA甲基化作为动植物体内一种重要的表观遗传修饰形式,在调控基因表达、维持基因组的稳定性等方面发挥重要的生物学作用.固有DNA甲基化水平和模式的变化会导致生物的表型异常甚至死亡.而5-甲基胞嘧啶的水平和模式是由DNA甲基化和去甲基化共同决定的.DNA去甲基化可以分为主动去甲基化与被动去甲基化,而基因组甲基化模式的形成主要依赖于主动去甲基化.本文综述了生物体内DNA主动去甲基化五种潜在机制:DNA转葡糖基酶参与的碱基切除修复途径、脱氨酶参与的碱基切除修复途径、核苷酸切除修复途径、氧化作用去甲基化与水解作用去甲基化.

  7. DNA loops and semicatenated DNA junctions

    Strauss François; Gaillard Claire

    2000-01-01

    Abstract Background Alternative DNA conformations are of particular interest as potential signals to mark important sites on the genome. The structural variability of CA microsatellites is particularly pronounced; these are repetitive poly(CA) · poly(TG) DNA sequences spread in all eukaryotic genomes as tracts of up to 60 base pairs long. Many in vitro studies have shown that the structure of poly(CA) · poly(TG) can vary markedly from the classical right handed DNA double helix and adopt dive...

  8. Mitochondrial Dna Replacement Versus Nuclear Dna Persistence

    Serva, Maurizio

    2006-01-01

    In this paper we consider two populations whose generations are not overlapping and whose size is large. The number of males and females in both populations is constant. Any generation is replaced by a new one and any individual has two parents for what concerns nuclear DNA and a single one (the mother) for what concerns mtDNA. Moreover, at any generation some individuals migrate from the first population to the second. In a finite random time $T$, the mtDNA of the second population is comple...

  9. Fast phylogenetic DNA barcoding

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Willerslev, Eske;

    2008-01-01

    We present a heuristic approach to the DNA assignment problem based on phylogenetic inferences using constrained neighbour joining and non-parametric bootstrapping. We show that this method performs as well as the more computationally intensive full Bayesian approach in an analysis of 500 insect...... DNA sequences obtained from GenBank. We also analyse a previously published dataset of environmental DNA sequences from soil from New Zealand and Siberia, and use these data to illustrate the fact that statistical approaches to the DNA assignment problem allow for more appropriate criteria...... for determining the taxonomic level at which a particular DNA sequence can be assigned....

  10. Electronic Transport in DNA

    Klotsa, Daphne; Römer, Rudolf A.; Turner, Matthew S.

    2005-01-01

    We study the electronic properties of DNA by way of a tight-binding model applied to four particular DNA sequences. The charge transfer properties are presented in terms of localisation lengths, crudely speaking the length over which electrons travel. Various types of disorder, including random potentials, are employed to account for different real environments. We have performed calculations on poly(dG)-poly(dC), telomeric-DNA, random-ATGC DNA and lambda-DNA. We find that random and lambda-D...

  11. DNA in Nanoscale Electronics

    Slinker, Jason

    2012-10-01

    DNA, the quintessential molecule of life, possesses a number of attractive properties for use in nanoscale circuits. Charge transport (CT) through DNA itself is of both fundamental and practical interest. Fundamentally, DNA has a unique configuration of π-stacked bases in a well ordered, double helical structure. Given its unparalleled importance to life processes and its arrangement of conjugated subunits, DNA has been a compelling target of conductivity studies. In addition, further understanding of DNA CT will elucidate the biological implications of this process and advance its use in sensing technologies. We have investigated the fundamentals of DNA CT by measuring the electrochemistry of DNA monolayers under biologically-relevant conditions. We have uncovered both fundamental kinetic parameters to distinguish between competing models of operation as well as the practical implications of DNA CT for sensing. Furthermore, we are leveraging our studies of DNA conductivity for the manufacture of nanoscale circuits. We are investigating the electrical properties and self-assembly of DNA nanowires containing artificial base pair surrogates, which can be prepared through low cost and high throughput automated DNA synthesis. This unique and economically viable approach will establish a new paradigm for the scalable manufacture of nanoscale semiconductor devices.

  12. DNA: Structure and function

    Sinden, Richard R.; E. Pearson, Christopher; N. Potaman, Vladimir;

    1998-01-01

    This chapter discusses the structure and function of DNA. DNA occupies a critical role in cells, because it is the source of all intrinsic genetic information. Chemically, DNA is a very stable molecule, a characteristic important for a macromolecule that may have to persist in an intact form for a...... long period of time before its information is accessed by the cell. Although DNA plays a critical role as an informational storage molecule, it is by no means as unexciting as a computer tape or disk drive. The structure of the DNA described by Watson and Crick in 1953 is a right handed helix of two...... individual antiparallel DNA strands. Hydrogen bonds provide specificity that allows pairing between the complementary bases (A.T and G.C) in opposite strands. Base stacking occurs near the center of the DNA helix and provides a great deal of stability to the helix (in addition to hydrogen bonding). The sugar...

  13. DNA from keratinous tissue

    Olsen, Maia E.; Bengtsson, Camilla Friis; Bertelsen, Mads Frost;

    2012-01-01

    Although good quality DNA can be recovered from the base of the calamus of freshly sampled feathers, as from other fully keratinized tissues such as nail or hair shaft, the quality and quantity of DNA in the majority of feather structures is much poorer. Little research has been performed...... to characterize the quality of this DNA is, and thus what a researcher might be able to achieve when using feathers as a source of DNA. In this review, we expand on our companion article detailing the quality of DNA in nail and hair, by synthesizing published, and new preliminary genetic data obtained from...... feathers. As with nail and hair, we demonstrate that although DNA can, in general, be recovered from all parts of the feather, the quality of such DNA varies. As such, although one can expect a priori that genetic analyses are possible on the feather, for PCR based analyses, it is extremely difficult...

  14. Biophysics of DNA

    Vologodskii, Alexander

    2015-01-01

    Surveying the last sixty years of research, this book describes the physical properties of DNA in the context of its biological functioning. It is designed to enable both students and researchers of molecular biology, biochemistry and physics to better understand the biophysics of DNA, addressing key questions and facilitating further research. The chapters integrate theoretical and experimental approaches, emphasising throughout the importance of a quantitative knowledge of physical properties in building and analysing models of DNA functioning. For example, the book shows how the relationship between DNA mechanical properties and the sequence specificity of DNA-protein binding can be analyzed quantitatively by using our current knowledge of the physical and structural properties of DNA. Theoretical models and experimental methods in the field are critically considered to enable the reader to engage effectively with the current scientific literature on the physical properties of DNA.

  15. Exposure to runoff from coal-tar-sealed pavement induces genotoxicity and impairment of DNA repair capacity in the RTL-W1 fish liver cell line

    Kienzler, Aude; Mahler, Barbara J.; Van Metre, Peter C.; Schweigert, Nathalie; Devaux, Alain; Bony, Sylvie

    2015-01-01

    Coal-tar-based (CTB) sealcoat, frequently applied to parking lots and driveways in North America, contains elevated concentrations of polycyclic aromatic hydrocarbons (PAHs) and related compounds. The RTL-W1 fish liver cell line was used to investigate two endpoints (genotoxicity and DNA-repair-capacity impairment) associated with exposure to runoff from asphalt pavement with CTB sealcoat or with an asphalt-based sealcoat hypothesized to contain about 7% CTB sealcoat (AS-blend). Genotoxic potential was assessed by the Formamido pyrimidine glycosylase (Fpg)-modified comet assay for 1:10 and 1:100 dilutions of runoff samples collected from 5 h to 36 d following sealcoat application. DNA-repair capacity was assessed by the base excision repair comet assay for 1:10 dilution of samples collected 26 h and 36 d following application. Both assays were run with and without co-exposure to ultraviolet-A radiation (UVA). With co-exposure to UVA, genotoxic effects were significant for both dilutions of CTB runoff for three of four sample times, and for some samples of AS-blend runoff. Base excision repair was significantly impaired for CTB runoff both with and without UVA exposure, and for AS-blend runoff only in the absence of UVA. This study is the first to investigate the effects of exposure to the complex mixture of chemicals in coal tar on DNA repair capacity. The results indicate that co-exposure to runoff from CT-sealcoated pavement and UVA as much as a month after sealcoat application has the potential to cause genotoxicity and impair DNA repair capacity.

  16. Impact of radiotherapy on PBMCs DNA repair capacity - Use of a multiplexed functional repair assay

    Radiation therapy is an essential part of cancer treatment as about 50% of patients will receive radiations at least once. Significant broad variation in radiosensitivity has been demonstrated in patients. About 5-10% of patients develop acute toxicity after radiotherapy. Therefore there is a need for the identification of markers able to predict the occurrence of adverse effects and thus adapt the radiotherapy regimen for radiosensitive patients. As a first step toward this goal, and considering the DNA repair defects associated with hypersensitivity radiation syndromes, we investigated the DNA repair phenotype of patients receiving radiotherapy. More precisely, we used a functional repair assay on support to follow the evolution of the glycosylases/AP endonuclease activities of PBMCs extracts of a series of patients during the time course of radiotherapy. For each patient, we collected one PBMCs sample before the first radiotherapy application (S1) and three samples after (S2 to S4) (one day and one week after application 1, and one at the end of the radiotherapy protocol). These four samples have been analysed for 11 donors. Clustering analyses of the results demonstrated a great heterogeneity of responses among the patients. Interestingly, this heterogeneity decreased between S1 and S4 where only 2 classes of patients remained if we except one patient that exhibited an atypical DNA repair phenotype. Furthermore, we showed that repair of several oxidized bases significantly increased between S1 and S3 or S4 (8oxoG, thymine glycol, A paired with 8oxoG), suggesting an adaptation of patients repair systems to the oxidative stress generated by the ionising radiations. Our preliminary results provided evidence that the DNA repair phenotype was impacted by the radiotherapy regimen. Further characterization of patients with known repair defects are needed to determine if atypical repair phenotypes could be associated with radiotherapy complications. Finally

  17. DNA Hairpins: Fuel for Autonomous DNA Devices

    Green, Simon J.; Lubrich, Daniel; Turberfield, Andrew J.

    2006-01-01

    We present a study of the hybridization of complementary DNA hairpin loops, with particular reference to their use as fuel for autonomous DNA devices. The rate of spontaneous hybridization between complementary hairpins can be reduced by increasing the neck length or decreasing the loop length. Hairpins with larger loops rapidly form long-lived kissed complexes. Hairpin loops may be opened by strand displacement using an opening strand that contains the same sequence as half of the neck and a...

  18. Novel DNA probes for sensitive DNA detection

    Richardson, James Alistair

    2010-01-01

    The ability to detect and interrogate DNA sequences allows further understanding and diagnosis of genetic disease. The ability to perform such analysis of genetic material requires highly selective and reliable technologies. Furthermore techniques which can use simple and cheap equipment allow the use of such technologies for point of care analysis. Described in this thesis are two novel DNA probe systems designed for mutation discrimination and sequence recognition of PCR pro...

  19. Fidelity of DNA polymerases in DNA amplification.

    Keohavong, P; Thilly, W G

    1989-01-01

    Denaturing gradient gel electrophoresis (DGGE) was used to separate and isolate the products of DNA amplification by polymerase chain reaction (PCR). The strategy permitted direct enumeration and identification of point mutations created by T4, modified T7, Klenow fragment of polymerase I, and Thermus aquaticus (Taq) DNA polymerases. Incorrectly synthesized sequences were separated from the wild type by DGGE as mutant/wild-type heteroduplexes and the heteroduplex fraction was used to calculat...

  20. DNA degradation and Apoptosis : DNA degradation

    Torriglia, Alicia; Padron, Laura

    2005-01-01

    Apoptosis, is a form of programmed cell death essential for the development and maintenance of multicellular organisms. DNA degradation is one of the hallmarks of apoptosis. The central component of the apoptotic machinery is a proteolytic system involving caspases and non-caspases proteases. CAD, a caspase-activated DNase, is the endonuclease responsible for DNA degradation during caspase-dependent apoptosis. The relationship between non-caspase proteases and endonucleases is less clear and ...

  1. Forensic DNA analysis.

    McDonald, Jessica; Lehman, Donald C

    2012-01-01

    Before the routine use of DNA profiling, blood typing was an important forensic tool. However, blood typing was not very discriminating. For example, roughly 30% of the United States population has type A-positive blood. Therefore, if A-positive blood were found at a crime scene, it could have come from 30% of the population. DNA profiling has a much better ability for discrimination. Forensic laboratories no longer routinely determine blood type. If blood is found at a crime scene, DNA profiling is performed. From Jeffrey's discovery of DNA fingerprinting to the development of PCR of STRs to the formation of DNA databases, our knowledge of DNA and DNA profiling have expanded greatly. Also, the applications for which we use DNA profiling have increased. DNA profiling is not just used for criminal case work, but it has expanded to encompass paternity testing, disaster victim identification, monitoring bone marrow transplants, detecting fetal cells in a mother's blood, tracing human history, and a multitude of other areas. The future of DNA profiling looks expansive with the development of newer instrumentation and techniques. PMID:22693781

  2. DNA profiles from fingermarks.

    Templeton, Jennifer E L; Linacre, Adrian

    2014-11-01

    Criminal investigations would be considerably improved if DNA profiles could be routinely generated from single fingermarks. Here we report a direct DNA profiling method that was able to generate interpretable profiles from 71% of 170 fingermarks. The data are based on fingermarks from all 5 digits of 34 individuals. DNA was obtained from the fingermarks using a swab moistened with Triton-X, and the fibers were added directly to one of two commercial DNA profiling kits. All profiles were obtained without increasing the number of amplification cycles; therefore, our method is ideally suited for adoption by the forensic science community. We indicate the use of the technique in a criminal case in which a DNA profile was generated from a fingermark on tape that was wrapped around a drug seizure. Our direct DNA profiling approach is rapid and able to generate profiles from touched items when current forensic practices have little chance of success. PMID:25391915

  3. DNA media storage

    Christy M.Bogard; Eric C.Rouchka; Benjamin Arazi

    2008-01-01

    In 1994. University of Southern California computer scientist,Dr.Leonard Adleman solved the Hamiltonian path problem using DNA as a computational mechanism.He proved the principle that DNA computing could be used to solve computationally complex problems.Because of the limitations in discovery time,resource requirements,and sequence mismatches,DNA computing has not yet become a commonly accepted practice.However,advancements are continually being discovered that are evolving the field of DNA computing.Practical applications of DNA are not restricted to computation alone.This research presents a novel approach in which DNA could be used as a means of storing files.Through the use of multiple sequence alignment combined with intelligent heuristics,the most probabilistic file contents can be determined with minimal errors.

  4. Electrocatalysis in DNA Sensors.

    Furst, Ariel; Hill, Michael G; Barton, Jacqueline K

    2014-12-14

    Electrocatalysis is often thought of solely in the inorganic realm, most often applied to energy conversion in fuel cells. However, the ever-growing field of bioelectrocatalysis has made great strides in advancing technology for both biofuel cells as well as biological detection platforms. Within the context of bioelectrocatalytic detection systems, DNA-based platforms are especially prevalent. One subset of these platforms, the one we have developed, takes advantage of the inherent charge transport properties of DNA. Electrocatalysis coupled with DNA-mediated charge transport has enabled specific and sensitive detection of lesions, mismatches and DNA-binding proteins. Even greater signal amplification from these platforms is now being achieved through the incorporation of a secondary electrode to the platform both for patterning DNA arrays and for detection. Here, we describe the evolution of this new DNA sensor technology. PMID:25435647

  5. Innovations. DNA detectives.

    May, M

    1999-01-01

    To understand the many potential causes and resulting consequences of DNA damage, scientists first need methods to detect it. Canadian scientists X. Chris Le and Michael Weinfeld, with help from U.S. molecular biologist Steven Leadon, developed a selective, sensitive technique for measuring DNA damage. The scientists combined a thymine glycol antibody with thymine glycol to selectively tag a specific type of DNA damage. They then added a second antibody with fluorescing properties, and used l...

  6. The Bacillus subtilis DnaD and DnaB Proteins Exhibit Different DNA Remodelling Activities

    Zhang, Wenke; Carneiro, Maria J. V. M.; Turner, Ian J.; ALLEN, Stephanie; Roberts, Clive J.; Soultanas, Panos

    2005-01-01

    Primosomal protein cascades load the replicative helicase onto DNA. In Bacillus subtilis a putative primosomal cascade involving the DnaD-DnaB-DnaI proteins has been suggested to participate in both the DnaA and PriA-dependent loading of the replicative helicase DnaC onto the DNA. Recently we discovered that DnaD has a global remodelling DNA activity suggesting a more widespread role in bacterial nucleoid architecture. Here, we show that DnaB forms a “square-like” tetramer with a hole in the ...

  7. DNA Microarray Technique

    Thakare SP

    2012-11-01

    Full Text Available DNA Microarray is the emerging technique in Biotechnology. The many varieties of DNA microarray or DNA chip devices and systems are described along with their methods for fabrication and their use. It also includes screening and diagnostic applications. The DNA microarray hybridization applications include the important areas of gene expression analysis and genotyping for point mutations, single nucleotide polymorphisms (SNPs, and short tandem repeats (STRs. In addition to the many molecular biological and genomic research uses, this review covers applications of microarray devices and systems for pharmacogenomic research and drug discovery, infectious and genetic disease and cancer diagnostics, and forensic and genetic identification purposes.

  8. DNA ELECTROPHORESIS AT SURFACES

    RAFAILOVICH, MIRIAM; SOKOLOV, JONATHAN; GERSAPPE, DILIP

    2003-09-01

    During this year we performed two major projects: I. We developed a detailed theoretical model which complements our experiments on surface DNA electrophoresis. We found that it was possible to enhance the separation of DNA chains by imposing a chemical nanoscale pattern on the surface. This approach utilized the surface interaction effect of the DNA chains with the substrate and is a refinement to our previous method in which DNA chains were separated on homogeneous flat surfaces. By introducing the nano-patterns on the surface, the conformational changes of DNA chains of different lengths can be amplified, which results in the different friction strengths with the substrate surface. Our results also show that, when compared to the DNA electrophoresis performed on homogeneous flat surfaces, nanopatterned surfaces offer a larger window in choosing different surface interactions to achieve separation. II. In collaboration with a large international manufacturer of skin care products we also embarked on a project involving photo toxicity of titanium dioxide nanoparticles, which are a key ingredient in sunscreen and cosmetic lotions. The results clearly implicated the nanoparticles in catalyzing damage to chromosomal DNA. We then used this knowledge to develop a polymer/anti-oxidant coating which prevented the photocatalytic reaction on DNA while still retaining the UV absorptive properties of the nanoparticles. The standard gel electrophoresis was not sufficient in determining the extent of the DNA damage. The conclusions of this study were based predominantly on analysis obtained with the surface electrophoresis method.

  9. Molecular characterization of a complex site-specific radiation-induced DNA double-strand break

    Full text: Radiation lethality is a function of radiation-induced DNA double-strand breaks (DSB). Current models propose the lethality of a DSB to be a function of its structural complexity. We present here for the first time a map of damage associated with a site-specific double-strand break produced by decay of 125I in a plasmid bound by a 125I-labeled triplex forming oligonucleotide (125 I-TFO). The E. coli DNA repair enzymes, endonuclease IV (endo IV), endonuclease III (endo III), and formamidopyrimidine-DNA glycosylase (Fpg), which recognize AP sites, and pyrimidine and purine base damage respectively, were used as probes in this study. 125I-TFO bound plasmid was incubated with and without DMSO at -80 deg C for 1 month. No significant difference in DSB yield was observed under these conditions. A 32 base pair fragment from the upstream side of the decay site was isolated by restriction digestion and enzymatically probed to identify damage sites. Endo IV treatment of the 5'-end labeled upper strand indicated clustering of AP sites within 3 bases downstream and 7 bases upstream of the targeted base. Also, repeated experiments consistently detected an AP site 4 bases upstream of the 125 I target base. This was further supported by complementary results with the 3'-end labeled upper strand. Endo IV analysis of the lower strand also shows clustering of AP sites near the DSB end. Endo III and Fpg probing demonstrated that base damage is also clustered near the targeted break site. DSBs produced in the absence of DMSO displayed a different pattern of enzyme sensitive damage than those produced in the presence of DMSO. Identification of specific base damage types within the restriction fragment containing the DSB end was achieved with GC/MS. Base damage consisted of 8-hydroguanine, 8-hydroxyadenine, and 5-hydroxycytosine. These lesions were observed at relative yields of 8-hydroguanine and 5-hydroxycytosine to 8-hydroxyadenine of 7.4:1 and 4.7:1, respectively, in the

  10. Molecular characterization of a complex site-specific radiation-induced DNA double-strand break

    Radiation lethality is a function of radiation-induced DNA double-strand breaks (DSB). Current models propose the lethality of a DSB to be a function of its structural complexity. We present here for the first time a map of damage associated with a site-specific double-strand break produced by decay of 125I in a plasmid bound by a 125I-labeled triplex forming oligonucleotide ( 125I-TFO). The E. coli DNA repair enzymes, endonuclease IV (endo IV), endonuclease III (endo III), and formamidopyrimidine-DNA glycosylase (Fpg), which recognize AP sites, and pyrimidine and purine base damage respectively, were used as probes in this study. 125I-TFO bound plasmid was incubated with and without DMSO at -80 deg C for 1 month. No significant difference in DSB yield was observed under these conditions. A 32 base pair fragment from the upstream side of the decay site was isolated by restriction digestion and enzymatically probed to identify damage sites. Endo IV treatment of the 5'-end labeled upper strand indicated clustering of AP sites within 3 bases downstream and 7 bases upstream of the targeted base. Also, repeated experiments consistently detected an AP site 4 bases upstream of the 125Itarget base. This was further supported by complementary results with the 3'-end labeled upper strand. Endo IV analysis of the lower strand also shows clustering of AP sites near the DSB end. Endo III and Fpg probing demonstrated that base damage is also clustered near the targeted break site. DSBs produced in the absence of DMSO displayed a different pattern of enzyme sensitive damage than those produced in the presence of DMSO. Identification of specific base damage types within the restriction fragment containing the DSB end was achieved with GC/MS. Base damage consisted of 8-hydroguanine, 8-hydroxyadenine, and 5-hydroxycytosine. These lesions were observed at relative yields of 8-hydroguanine and 5-hydroxycytosine to 8-hydroxyadenine of 7.4:1 and 4.7:1, respectively, in the absence of

  11. cDNA: 53887 [

    Full Text Available M. musculus + Mm.196480 Mus musculus adult male testis cDNA, RIKEN full-length enriched library, ... uct:DNA Segment, Chr 15 Massachusetts Institute of Technology ... 260, full insert sequence gnl|UG|Mm#S10837764 AK07 ...

  12. cDNA: 53885 [

    Full Text Available M. musculus + Mm.196480 Mus musculus adult male testis cDNA, RIKEN full-length enriched library, ... uct:DNA Segment, Chr 15 Massachusetts Institute of Technology ... 260, full insert sequence gnl|UG|Mm#S10837547 AK07 ...

  13. Recombinant DNA for Teachers.

    Duvall, James G., III

    1992-01-01

    A science teacher describes his experience at a workshop to learn to teach the Cold Spring Harbor DNA Science Laboratory Protocols. These protocols lead students through processes for taking E. coli cells and transforming them into a new antibiotic resistant strain. The workshop featured discussions of the role of DNA recombinant technology in…

  14. Characterization of muntjac DNA

    Sister chromatid exchange (SCE) in muntjac chromosomes is generally proportional to the chromosomal DNA content, but the SCE frequency is reduced in the heterochromatic neck region of the X chromosome. The physical properties of muntjac DNA and the kinetics of repair of UV damage in muntjac heterochromatin and euchromatin were examined and compared with the distribution of sister chromatid exchange

  15. Routine DNA testing

    Routine DNA testing. It’s done once you’ve Marker-Assisted Breeding Pipelined promising Qantitative Trait Loci within your own breeding program and thereby established the performance-predictive power of each DNA test for your germplasm under your conditions. By then you are ready to screen your par...

  16. DNA-cell conjugates

    Hsiao, Shih-Chia; Francis, Matthew B.; Bertozzi, Carolyn; Mathies, Richard; Chandra, Ravi; Douglas, Erik; Twite, Amy; Toriello, Nicholas; Onoe, Hiroaki

    2016-05-03

    The present invention provides conjugates of DNA and cells by linking the DNA to a native functional group on the cell surface. The cells can be without cell walls or can have cell walls. The modified cells can be linked to a substrate surface and used in assay or bioreactors.

  17. Extended DNA Tile Actuators

    Kristiansen, Martin; Kryger, Mille; Zhang, Zhao;

    2012-01-01

    A dynamic linear DNA tile actuator is expanded to three new structures of higher complexity. The original DNA actuator was constructed from a central roller strand which hybridizes with two piston strands by forming two half-crossover junctions. A linear expansion of the actuator is obtained...

  18. Characterization of muntjac DNA

    Davis, R.C.

    1981-05-27

    Sister chromatid exchange (SCE) in muntjac chromosomes is generally proportional to the chromosomal DNA content, but the SCE frequency is reduced in the heterochromatic neck region of the X chromosome. The physical properties of muntjac DNA and the kinetics of repair of UV damage in muntjac heterochromatin and euchromatin were examined and compared with the distribution of sister chromatid exchange.

  19. Workshop on DNA repair.

    A.R. Lehmann (Alan); J.H.J. Hoeijmakers (Jan); A.A. van Zeeland (Albert); C.M.P. Backendorf (Claude); B.A. Bridges; A. Collins; R.P.D. Fuchs; G.P. Margison; R. Montesano; E. Moustacchi; A.T. Natarajan; M. Radman; A. Sarasin; E. Seeberg; C.A. Smith; M. Stefanini (Miria); L.H. Thompson; G.P. van der Schans; C.A. Weber (Christine); M.Z. Zdzienika

    1992-01-01

    textabstractA workshop on DNA repair with emphasis on eukaryotic systems was held, under the auspices of the EC Concerted Action on DNA Repair and Cancer, at Noordwijkerhout (The Netherlands) 14-19 April 1991. The local organization of the meeting was done under the auspices of the Medical Genetic C

  20. Protein–DNA Interactions

    Kovacic, L.; Boelens, R.

    2012-01-01

    The recognition of specific DNA sequences by proteins and the coupling to signaling events are fundamental occurrences that lie at the root of many cellular processes. Many examples of tight control by protein–DNA interactions can be found in such dynamic processes as transcription, replication and

  1. Elevated incidence of polyp formation in APC(Min/⁺Msh2⁻/⁻ mice is independent of nitric oxide-induced DNA mutations.

    Antoaneta Belcheva

    Full Text Available Gut microbiota has been linked to a number of human diseases including colon cancer. However, the mechanism through which gut bacteria influence colon cancer development and progression remains unclear. Perturbation of the homeostasis between the host immune system and microbiota leads to inflammation and activation of macrophages which produce large amounts of nitric oxide that acts as a genotoxic effector molecule to suppress bacterial growth. However, nitric oxide also has genotoxic effects to host cells by producing mutations that can predispose to colon cancer development. The major DNA lesions caused by nitric oxide are 8oxoG and deamination of deoxycytosine bases. Cellular glycosylases that belong to the base excision repair pathway have been demonstrated to repair these mutations. Recent evidence suggests that the mismatch repair pathway (MMR might also repair nitric oxide-induced DNA damage. Since deficiency in MMR predisposes to colon cancer, we hypothesized that MMR-deficient colon epithelial cells are incapable of repairing nitric-oxide induced genetic lesions that can promote colon cancer. Indeed, we found that the MMR pathway repairs nitric oxide-induced DNA mutations in cell lines. To test whether nitric oxide promotes colon cancer, we genetically ablated the inducible nitric oxide synthase (iNOS or inhibited iNOS activity in the APC(Min/+Msh2(-/- mouse model of colon cancer. However, despite the fact that nitric oxide production was strongly reduced in the colon using both approaches, colon cancer incidence was not affected. These data show that nitric oxide and iNOS do not promote colon cancer in APC(Min/+Msh2(-/- mice.

  2. Curcumin protects against cytotoxic and inflammatory effects of quartz particles but causes oxidative DNA damage in a rat lung epithelial cell line

    Chronic inhalation of high concentrations of respirable quartz particles has been implicated in various lung diseases including lung fibrosis and cancer. Generation of reactive oxygen species (ROS) and oxidative stress is considered a major mechanism of quartz toxicity. Curcumin, a yellow pigment from Curcuma longa, has been considered as nutraceutical because of its strong anti-inflammatory, antitumour and antioxidant properties. The aim of our present study was to investigate whether curcumin can protect lung epithelial cells from the cytotoxic, genotoxic and inflammatory effects associated with quartz (DQ12) exposure. Electron paramagnetic resonance (EPR) measurements using the spin-trap DMPO demonstrated that curcumin reduces hydrogen peroxide-dependent hydroxyl-radical formation by quartz. Curcumin was also found to reduce quartz-induced cytotoxicity and cyclooxygenase 2 (COX-2) mRNA expression in RLE-6TN rat lung epithelial cells (RLE). Curcumin also inhibited the release of macrophage inflammatory protein-2 (MIP-2) from RLE cells as observed upon treatment with interleukin-1 beta (IL-1β) and tumour necrosis factor-alpha (TNFα). However, curcumin failed to protect the RLE cells from oxidative DNA damage induced by quartz, as shown by formamidopyrimidine glycosylase (FPG)-modified comet assay and by immunocytochemistry for 8-hydroxydeoxyguanosine. In contrast, curcumin was found to be a strong inducer of oxidative DNA damage itself at non-cytotoxic and anti-inflammatory concentrations. In line with this, curcumin also enhanced the mRNA expression of the oxidative stress response gene heme oxygenase-1 (ho-1). Curcumin also caused oxidative DNA damage in NR8383 rat alveolar macrophages and A549 human lung epithelial cells. Taken together, these observations indicate that one should be cautious in considering the potential use of curcumin in the prevention or treatment of lung diseases associated with quartz exposure

  3. Premeltons in DNA.

    Sobell, Henry M

    2016-03-01

    Premeltons are examples of emergent-structures (i.e., structural-solitons) that arise spontaneously in DNA due to the presence of nonlinear-excitations in its structure. They are of two kinds: B-B (or A-A) premeltons form at specific DNA-regions to nucleate site-specific DNA melting. These are stationary and, being globally-nontopological, undergo breather-motions that allow drugs and dyes to intercalate into DNA. B-A (or A-B) premeltons, on the other hand, are mobile, and being globally-topological, act as phase-boundaries transforming B- into A-DNA during the structural phase-transition. They are not expected to undergo breather motions. A key feature of both types of premeltons is the presence of an intermediate structural-form in their central regions (proposed as being a transition-state intermediate in DNA-melting and in the B- to A-transition), which differs from either A- or B-DNA. Called beta-DNA, this is both metastable and hyperflexible-and contains an alternating sugar-puckering pattern along the polymer backbone combined with the partial unstacking (in its lower energy-forms) of every-other base-pair. Beta-DNA is connected to either B- or to A-DNA on either side by boundaries possessing a gradation of nonlinear structural-change, these being called the kink and the antikink regions. The presence of premeltons in DNA leads to a unifying theory to understand much of DNA physical chemistry and molecular biology. In particular, premeltons are predicted to define the 5' and 3' ends of genes in naked-DNA and DNA in active-chromatin, this having important implications for understanding physical aspects of the initiation, elongation and termination of RNA-synthesis during transcription. For these and other reasons, the model will be of broader interest to the general-audience working in these areas. The model explains a wide variety of data, and carries with it a number of experimental predictions-all readily testable-as will be described in this review. PMID

  4. Whose DNA is this?

    Taroni, Franco; Biedermann, Alex; Vuille, Joëlle;

    2013-01-01

    This communication seeks to draw the attention of researchers and practitioners dealing with forensic DNA profiling analyses to the following question: is a scientist's report, offering support to a hypothesis according to which a particular individual is the source of DNA detected during...... evoked during the international conference "The hidden side of DNA profiles. Artifacts, errors and uncertain evidence" held in Rome (April 27th to 28th, 2012). Indeed, despite the fact that this conference brought together some of the world's leading forensic DNA specialists, it appeared clearly...... talk considerably different languages. It thus is fundamental to address this issue of communication about results of forensic DNA analyses, and open a dialogue with practicing non-scientists at large who need to make meaningful use of scientific results to approach and help solve judicial cases...

  5. DNA repair protocols

    Bjergbæk, Lotte

    In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...

  6. Archaeal DNA replication.

    Kelman, Lori M; Kelman, Zvi

    2014-01-01

    DNA replication is essential for all life forms. Although the process is fundamentally conserved in the three domains of life, bioinformatic, biochemical, structural, and genetic studies have demonstrated that the process and the proteins involved in archaeal DNA replication are more similar to those in eukaryal DNA replication than in bacterial DNA replication, but have some archaeal-specific features. The archaeal replication system, however, is not monolithic, and there are some differences in the replication process between different species. In this review, the current knowledge of the mechanisms governing DNA replication in Archaea is summarized. The general features of the replication process as well as some of the differences are discussed. PMID:25421597

  7. Nanoparticle bridge DNA biosensor

    Huang, Hong-Wen

    A new DNA sensing method is demonstrated in which DNA hybridization events lead to the formation of nanoparticle satellites that bridge two electrodes and are detected electrically. The hybridization events are exclusively carried out only on specific locations, the surfaces of C-ssDNA modified 50 nm GNPs. The uniqueness of this work is that only a small number of T-ccDNA molecules (target DNA and three-base-pair-mismatched DNA in 20nM concentrations. Three single-stranded DNA (ssDNA) system is used in our experiment which includes Capture-ssDNA (C-ssDNA), Target-ssDNA (T-ssDNA) and Probe-ssDNA (P-ssDNA). Both C-ssDNA and P-ssDNA are modified by a thiol group and can hybridize with different portions of T-ssDNA. T-ssDNA requires no modification in three ssDNA system, which is beneficial in many applications. C-ssDNA modified 50nm gold nanoparticle (C-50au) and P-ssDNA modified 30nm gold nanoparticle (P-30au) are prepared through the reaction of thiol-gold chemical bonding between thiolated ssDNA and gold nanoparticle (GNP) (C-ssDNA with 50nm GNP, P-ssDNA with 30nm GNP). We controllably place the C-50au only on the SiO2 band surface (˜ 90nm width) between two gold electrodes (source and drain electrodes) by forming positively- and negatively-charged self-assembled monolayers (SAMs) on SiO2 and gold surface, respectively. DNA modified GNP is negatively charged due to ionization of phosphate group on DNA back bone. C-50au therefore is negatively charged and can only be attracted toward SiO2 area (repelled by negatively charged gold electrode surface). The amine group of positively-charged SAMs on SiO2 surface is then passivated by converting to non-polar methyl functional group after C-50au placement. P-30au is first hybridized with T-ssDNA in the solution phase (T-P- 30au formed) and is introduced into DNA detection device in which C-50au are immobilized on ˜90nm width SiO2 band (between two gold electrodes). The passivation step ensures every TP-30au are attached

  8. DNA Align Editor: DNA Alignment Editor Tool

    The SNPAlignEditor is a DNA sequence alignment editor that runs on Windows platforms. The purpose of the program is to provide an intuitive, user-friendly tool for manual editing of multiple sequence alignments by providing functions for input, editing, and output of nucleotide sequence alignments....

  9. Radiation-induced DNA damage and DNA repair

    Although DNA undergoes various types of damage from radiation, active oxygen, and the like, a living body has a plurality of DNA repair mechanisms responding to the types of DNA damage. On the other hand, there are a system that results in cell death if the repair is impossible and a mechanism to lead to concretization if further repair is not accurately made. This paper explains the following items as the basic researches on these types of DNA damage and the repair mechanisms: (1) biological effects of DNA damage, (2) effect of DNA damage on DNA synthesis, and (3) effects of DNA damage on cells. It also explains the effects of radiation on cells with a focus on specific mechanism for (1) DNA damage caused by direct action due to radiation and by indirect action due mainly to active oxygen, and (2) DNA repair mechanism that works on DNA double-strand break (DSB). (A.O.)

  10. What Controls DNA Looping?

    Pamela J. Perez

    2014-08-01

    Full Text Available The looping of DNA provides a means of communication between sequentially distant genomic sites that operate in tandem to express, copy, and repair the information encoded in the DNA base sequence. The short loops implicated in the expression of bacterial genes suggest that molecular factors other than the naturally stiff double helix are involved in bringing the interacting sites into close spatial proximity. New computational techniques that take direct account of the three-dimensional structures and fluctuations of protein and DNA allow us to examine the likely means of enhancing such communication. Here, we describe the application of these approaches to the looping of a 92 base-pair DNA segment between the headpieces of the tetrameric Escherichia coli Lac repressor protein. The distortions of the double helix induced by a second protein—the nonspecific nucleoid protein HU—increase the computed likelihood of looping by several orders of magnitude over that of DNA alone. Large-scale deformations of the repressor, sequence-dependent features in the DNA loop, and deformability of the DNA operators also enhance looping, although to lesser degrees. The correspondence between the predicted looping propensities and the ease of looping derived from gene-expression and single-molecule measurements lends credence to the derived structural picture.

  11. Quantitive DNA Fiber Mapping

    Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-01-28

    Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

  12. DNA-PK assay

    Anderson, Carl W.; Connelly, Margery A.

    2004-10-12

    The present invention provides a method for detecting DNA-activated protein kinase (DNA-PK) activity in a biological sample. The method includes contacting a biological sample with a detectably-labeled phosphate donor and a synthetic peptide substrate defined by the following features to provide specific recognition and phosphorylation by DNA-PK: (1) a phosphate-accepting amino acid pair which may include serine-glutamine (Ser-Gln) (SQ), threonine-glutamine (Thr-Gln) (TQ), glutamine-serine (Gln-Ser) (QS), or glutamine-threonine (Gln-Thr) (QT); (2) enhancer amino acids which may include glutamic acid or glutamine immediately adjacent at the amino- or carboxyl- side of the amino acid pair and forming an amino acid pair-enhancer unit; (3) a first spacer sequence at the amino terminus of the amino acid pair-enhancer unit; (4) a second spacer sequence at the carboxyl terminus of the amino acid pair-enhancer unit, which spacer sequences may include any combination of amino acids that does not provide a phosphorylation site consensus sequence motif; and, (5) a tag moiety, which may be an amino acid sequence or another chemical entity that permits separating the synthetic peptide from the phosphate donor. A compostion and a kit for the detection of DNA-PK activity are also provided. Methods for detecting DNA, protein phosphatases and substances that alter the activity of DNA-PK are also provided. The present invention also provides a method of monitoring protein kinase and DNA-PK activity in living cells. -A composition and a kit for monitoring protein kinase activity in vitro and a composition and a kit for monitoring DNA-PK activities in living cells are also provided. A method for identifying agents that alter protein kinase activity in vitro and a method for identifying agents that alter DNA-PK activity in living cells are also provided.

  13. "Artifactual" arsenate DNA

    Nielsen, Peter E

    2012-01-01

    The recent claim by Wolfe-Simon et al. that the Halomonas bacterial strain GFAJ-1 when grown in arsenate-containing medium with limiting phosphate is able to substitute phosphate with arsenate in biomolecules including nucleic acids and in particular DNA(1) arose much skepticism, primarily due...... to the very limited chemical stability of arsenate esters (see ref. 2 and references therein). A major part of the criticisms was concerned with the insufficient (bio)chemical evidence in the Wolfe-Simon study for the actual chemical incorporation of arsenate in DNA (and/or RNA). Redfield et al. now present...... evidence that the identification of arsenate DNA was artifactual....

  14. DNA fusion gene vaccines

    Holst, Peter Johannes; Bassi, Maria Rosaria; Thomsen, Allan Randrup;

    2010-01-01

    DNA vaccines are versatile and safe, but limited immunogenicity has prevented their use in the clinical setting. Experimentally, immunogenicity may be enhanced by the use of new delivery technologies, by coadministration of cytokines and pathogen-associated molecular patterns, or by fusion...... with these modifications, it is likely that the primary use of DNA vaccines may be as primers for viral-vectored vaccines, rather than as single agents. This review discusses the approaches used to enhance DNA vaccine immunogenicity, with a primary focus on fusion strategies that enhance antigen presentation....

  15. Improved immobilization of DNA to microwell plates for DNA-DNA hybridization.

    Hirayama, H.; Tamaoka, J; Horikoshi, K

    1996-01-01

    An improved and simplified protocol for DNA immobilization was developed to enhance DNA-DNA hybridization on microwell plates. Target DNA was immobilized by simple dry-adsorption. Efficiencies of DNA immobilization and retention were enhanced 1.4-6.5 times and 4.2-19.6 times, respectively, compared with a conventional method. The overall hybridization efficiency was increased 3.1-5.2 times. This simple new protocol can reduce the consumption of scarce DNA samples.

  16. DNA synthesis on discontinuous templates by human DNA polymerases: implications for non-homologous DNA recombination.

    Islas, L; Fairley, C F; Morgan, W. F.

    1998-01-01

    DNA polymerases catalyze the synthesis of DNA using a continuous uninterrupted template strand. However, it has been shown that a 3'-->5' exonuclease-deficient form of the Klenow fragment of Escherichia coli DNA polymerase I as well as DNA polymerase of Thermus aquaticus can synthesize DNA across two unlinked DNA templates. In this study, we used an oligonucleotide-based assay to show that discontinuous DNA synthesis was present in HeLa cell extracts. DNA synthesis inhibitor studies as well a...

  17. Expansion of the DNA Alphabet beyond Natural DNA Recognition.

    Tateishi-Karimata, Hisae; Sugimoto, Naoki

    2016-07-15

    Simple and inexpensive DNA fibres: New, stable DNA structures are created by the binding of a small molecule to poly(A). Because these DNA fibres are formed from inexpensive materials by using very simple methods, DNA materials suitable for practical use such as information storage should be possible in the near future. PMID:27061868

  18. DNA computing in microreactors

    Wagler, Patrick; van Noort, Danny; McCaskill, John S.

    2001-11-01

    The goal of this research is to improve the modular stability and programmability of DNA-based computers and in a second step towards optical programmable DNA computing. The main focus here is on hydrodynamic stability. Clockable microreactors can be connected in various ways to solve combinatorial optimisation problems, such as Maximum Clique or 3-SAT. This work demonstrates by construction how one micro-reactor design can be programmed to solve any instance of Maximum Clique up to its given maximum size (N). It reports on an implementation of the architecture proposed previously. This contrasts with conventional DNA computing where the individual sequence of biochemical operations depends on the specific problem. In this pilot study we are tackling a graph for the Maximum Clique problem with NDNA solution space will be presented, which is symbolized by a set of bit-strings (words).

  19. Harnessing DNA intercalation.

    Persil, Ozgül; Hud, Nicholas V

    2007-10-01

    Numerous small molecules are known to bind to DNA through base pair intercalation. Fluorescent dyes commonly used for nucleic acid staining, such as ethidium, are familiar examples. Biological and physical studies of DNA intercalation have historically been motivated by mutation and drug discovery research. However, this same mode of binding is now being harnessed for the creation of novel molecular assemblies. Recent studies have used DNA scaffolds and intercalators to construct supramolecular assemblies that function as fluorescent 'nanotags' for cell labeling. Other studies have demonstrated how intercalators can be used to promote the formation of otherwise unstable nucleic acid assemblies. These applications illustrate how intercalators can be used to facilitate and expand DNA-based nanotechnology. PMID:17825446

  20. FBI's DNA analysis program

    Brown, John R.

    1994-03-01

    Forensic DNA profiling technology is a significant law enforcement tool due to its superior discriminating power. Applying the principles of population genetics to the DNA profile obtained in violent crime investigations results in low frequency of occurrence estimates for the DNA profile. These estimates often range from a frequency of occurrence of 1 in 50 unrelated individuals to 1 in a million unrelated individuals or even smaller. It is this power to discriminate among individuals in the population that has propelled forensic DNA technology to the forefront of forensic testing in violent crime cases. Not only is the technology extremely powerful in including or excluding a criminal suspect as the perpetrator, but it also gives rise to the potential of identifying criminal suspects in cases where the investigators of unknown suspect cases have exhausted all other available leads.

  1. cDNA: 34099 [

    Full Text Available H. sapiens + Hs.15282 Homo sapiens cDNA FLJ44214 fis, clone THYMU3003309, moderately similar to ... Homo sapiens sarcoma antigen (SAGE ) gnl|UG|Hs#S16886502 AK126202 23/5622_34099.png ...

  2. cDNA: 43397 [

    Full Text Available M. musculus + Mm.30035 Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length enri ... FOLATE DEHYDROGENASE (EC 1.5.1.6) (10-FTHFDH) (FBP-CI ) homolog [Rattus norvegicus], full insert sequence ...

  3. DNA Sampling Hook

    National Oceanic and Atmospheric Administration, Department of Commerce — The DNA Sampling Hook is a significant improvement on a method of obtaining a tissue sample from a live fish in situ from an aquatic environment. A tissue sample...

  4. DNA sequencing conference, 2

    Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)

    1991-06-19

    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  5. cDNA: 33377 [

    Full Text Available H. sapiens + Hs.181243 Homo sapiens full open reading frame cDNA clone RZPDo834H102D for gene AT ... F4, activating transcription factor 4 (tax -responsive enhancer element B67); complete cds; wi ...

  6. cDNA: 17527 [

    Full Text Available H. sapiens + Hs.134229 Homo sapiens cDNA FLJ44146 fis, clone THYMU2027734, weakly similar to Hom ... o sapiens SA hypertension -associated homolog (rat) (SAH) gnl|UG|Hs#S16886570 ...

  7. cDNA: 47992 [

    Full Text Available M. musculus - Mm.228067 Mus musculus 15 days embryo male testis cDNA, RIKEN full-length enriched ... lone:8030476B22 product:hypothetical Mitochondrial energy ... transfer proteins (carrier protein) containing pro ...

  8. cDNA: 40711 [

    Full Text Available M. musculus + Mm.41523 Mus musculus adult male thymus cDNA, RIKEN full-length enriched library, ... lone:5830492N08 product:hypothetical Mitochondrial energy ... transfer proteins (carrier protein) containing pro ...

  9. cDNA: 47994 [

    Full Text Available M. musculus - Mm.228067 Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched libr ... lone:E130118D21 product:hypothetical Mitochondrial energy ... transfer proteins (carrier protein) containing pro ...

  10. cDNA: 47991 [

    Full Text Available M. musculus - Mm.228067 Mus musculus adult male diencephalon cDNA, RIKEN full-length enriched li ... lone:9330189G22 product:hypothetical Mitochondrial energy ... transfer proteins (carrier protein) containing pro ...

  11. DNA from keratinous tissue

    Bengtsson, Camilla Friis; Olsen, Maia E.; Brandt, Luise Ørsted;

    2012-01-01

    Keratinous tissues such as nail, hair, horn, scales and feather have been used as a source of DNA for over 20 years. Particular benefits of such tissues include the ease with which they can be sampled, the relative stability of DNA in such tissues once sampled, and, in the context of ancient...... genetic analyses, the fact that sampling generally causes minimal visual damage to valuable specimens. Even when freshly sampled, however, the DNA quantity and quality in the fully keratinized parts of such tissues is extremely poor in comparison to other tissues such as blood and muscle - although little...... systematic research has been undertaken to characterize how such degradation may relate to sample source. In this review paper we present the current understanding of the quality and limitations of DNA in two key keratinous tissues, nail and hair. The findings indicate that although some fragments of nuclear...

  12. DNA from keratinous tissue

    Bengtsson, Camilla F.; Olsen, Maja E.; Brandt, Luise Ørsted;

    2011-01-01

    Keratinous tissues such as nail, hair, horn, scales and feather have been used as a source of DNA for over 20 years. Particular benefits of such tissues include the ease with which they can be sampled, the relative stability of DNA in such tissues once sampled, and, in the context of ancient...... genetic analyses, the fact that sampling generally causes minimal visual damage to valuable specimens. Even when freshly sampled, however, the DNA quantity and quality in the fully keratinized parts of such tissues is extremely poor in comparison to other tissues such as blood and muscle – although little...... systematic research has been undertaken to characterize how such degradation may relate to sample source. In this review paper we present the current understanding of the quality and limitations of DNA in two key keratinous tissues, nail and hair. The findings indicate that although some fragments of nuclear...

  13. Making DNA Fingerprints.

    Nunley, Kathie F.

    1996-01-01

    Presents an activity to simulate electrophoresis using everyday items. Uses adding machine paper to construct a set of DNA fingerprints that can be used to solve crime cases designed by students in any biology class. (JRH)

  14. DNA damage tolerance.

    Branzei, Dana; Psakhye, Ivan

    2016-06-01

    Accurate chromosomal DNA replication is fundamental for optimal cellular function and genome integrity. Replication perturbations activate DNA damage tolerance pathways, which are crucial to complete genome duplication as well as to prevent formation of deleterious double strand breaks. Cells use two general strategies to tolerate lesions: recombination to a homologous template, and trans-lesion synthesis with specialized polymerases. While key players of these processes have been outlined, much less is known on their choreography and regulation. Recent advances have uncovered principles by which DNA damage tolerance is regulated locally and temporally - in relation to replication timing and cell cycle stage -, and are beginning to elucidate the DNA dynamics that mediate lesion tolerance and influence chromosome structure during replication. PMID:27060551

  15. cDNA: 36928 [

    Full Text Available M. musculus - Mm.240850 Mus musculus adult male medulla oblongata cDNA, RIKEN full-length enrich ... MA AMPLIFIED SEQUENCE 1 (NOVEL AMPLIFIED IN BREAST CANCER ... 1) (AMPLIFIED AND OVEREXPRESSED IN BREAST CANCER ) ...

  16. cDNA: 36927 [

    Full Text Available M. musculus - Mm.240850 Mus musculus adult male stomach cDNA, RIKEN full-length enriched library ... MA AMPLIFIED SEQUENCE 1 (NOVEL AMPLIFIED IN BREAST CANCER ... 1) (AMPLIFIED AND OVEREXPRESSED IN BREAST CANCER ) ...

  17. cDNA: 40220 [

    Full Text Available M. musculus - Mm.207654 Mus musculus adult male olfactory brain ... cDNA, RIKEN full-length enriched ... library, clone:6430704M03 product:similar to BRAIN ... PROTEIN (FRAGMENT) [Homo sapiens], full insert seq ...

  18. cDNA: 52275 [

    Full Text Available M. musculus - Mm.275648 Mus musculus 11 days embryo head cDNA, RIKEN full-length enriched librar ... y, clone:6230400I01 product:SIMILAR TO ENIGMA ... (LIM DOMAIN PROTEIN) homolog [Homo sapiens], full ...

  19. cDNA: 52278 [

    Full Text Available M. musculus - Mm.275648 Mus musculus adult male tongue cDNA, RIKEN full-length enriched library, ... clone:2310073F10 product:SIMILAR TO ENIGMA ... (LIM DOMAIN PROTEIN) homolog [Homo sapiens], full ...

  20. cDNA: 52277 [

    Full Text Available M. musculus - Mm.275648 Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched l ... ibrary, clone:1110003B01 product:SIMILAR TO ENIGMA ... (LIM DOMAIN PROTEIN) homolog [Homo sapiens], full ...

  1. cDNA: 52276 [

    Full Text Available M. musculus - Mm.275648 Mus musculus adult male brain cDNA, RIKEN full-length enriched library, ... clone:0710007K04 product:SIMILAR TO ENIGMA ... (LIM DOMAIN PROTEIN) homolog [Homo sapiens], full ...

  2. DNA damage and carcinogenesis

    Although cancer may arise as a result of many different types of molecular changes, there is little reason to doubt that changes to DNA are one of the more important ones in cancer initiation. Although DNA repair mechanisms seem able to eliminate a very large fraction of deleterious changes to DNA, we not only have little insight into the molecular mechanisms involved in such repair, but have a negligible amount of information to permit us to estimate the shape of dose response relations at low doses. The case of skin cancer is a special one, in that the average population is exposed to sufficient solar uv so that the effects of small increments in uv dose may be estimated. An approximate 85% reduction in DNA repair increases skin cancer incidence 104 fold

  3. Kink solitons in DNA

    Zdravković, S; Daniel, M

    2012-01-01

    We here examine the nonlinear dynamics of artificial homogeneous DNA chain relying on the plain-base rotator model. It is shown that such dynamics can exhibit kink and antikink solitons of sine-Gordon type. In that respect we propose possible experimental assays based on single molecule micromanipulation techniques. The aim of these experiments is to excite the rotational waves and to determine their speeds along excited DNA. We propose that these experiments should be conducted either for the case of double stranded (DS) or single stranded (SS) DNA. A key question is to compare the corresponding velocities of the rotational waves indicating which one is bigger. The ratio of these velocities appears to be related with the sign of the model parameter representing ratio of the hydrogen-bonding and the covalent-bonding interaction within the considered DNA chain.

  4. Patterning nanocrystals using DNA

    Williams, Shara Carol

    2003-09-01

    One of the goals of nanotechnology is to enable programmed self-assembly of patterns made of various materials with nanometer-sized control. This dissertation describes the results of experiments templating arrangements of gold and semiconductor nanocrystals using 2'-deoxyribonucleic acid (DNA). Previously, simple DNA-templated linear arrangements of two and three nanocrystals structures have been made.[1] Here, we have sought to assemble larger and more complex nanostructures. Gold-DNA conjugates with 50 to 100 bases self-assembled into planned arrangements using strands of DNA containing complementary base sequences. We used two methods to increase the complexity of the arrangements: using branched synthetic doublers within the DNA covalent backbone to create discrete nanocrystal groupings, and incorporating the nanocrystals into a previously developed DNA lattice structure [2][3] that self-assembles from tiles made of DNA double-crossover molecules to create ordered nanoparticle arrays. In the first project, the introduction of a covalently-branched synthetic doubler reagent into the backbone of DNA strands created a branched DNA ''trimer.'' This DNA trimer templated various structures that contained groupings of three and four gold nanoparticles, giving promising, but inconclusive transmission electron microscopy (TEM) results. Due to the presence of a variety of possible structures in the reaction mixtures, and due to the difficulty of isolating the desired structures, the TEM and gel electrophoresis results for larger structures having four particles, and for structures containing both 5 and 10 nm gold nanoparticles were inconclusive. Better results may come from using optical detection methods, or from improved sample preparation. In the second project, we worked toward making two-dimensional ordered arrays of nanocrystals. We replicated and improved upon previous results for making DNA lattices, increasing the size of the lattices

  5. DNA-mediated gene transfer without carrier DNA

    1981-01-01

    DNA-mediated gene transfer is a procedure which uses purified DNA to introduce new genetic elements into cells in culture. The standard DNA- mediated gene transfer procedure involves the use of whole cell DNA as carrier DNA for the transfer. We have modified the standard DNA- mediated gene transfer procedure to transfer the Herpes simplex virus type 1 thymidine kinase gene (TK) into TK- murine recipient cells in the absence of whole cell carrier DNA. The majority (8/10) of carrier- free trans...

  6. Electroeluting DNA Fragments

    Zarzosa-Álvarez, Ana L.; Sandoval-Cabrera, Antonio; Torres-Huerta, Ana L.; Ma. Bermudez-Cruz, Rosa

    2010-01-01

    Purified DNA fragments are used for different purposes in Molecular Biology and they can be prepared by several procedures. Most of them require a previous electrophoresis of the DNA fragments in order to separate the band of interest. Then, this band is excised out from an agarose or acrylamide gel and purified by using either: binding and elution from glass or silica particles, DEAE-cellulose membranes, "crush and soak method", electroelution or very often expensive commercial purification ...

  7. DNA-Origami

    Voigt, Niels Vinther; Tørring, Thomas; Gothelf, Kurt Vesterager

    2010-01-01

    DNA-nanostrukturer giver nye muligheder for studier af individuelle molekyler. Ved at udnytte DNAs unikke selvsamlende egenskaber kan man designe systemer, hvorpå der kan studeres kemiske reaktioner, fluoroforer og biiomolekyler på enkeltmolekyle-niveau.......DNA-nanostrukturer giver nye muligheder for studier af individuelle molekyler. Ved at udnytte DNAs unikke selvsamlende egenskaber kan man designe systemer, hvorpå der kan studeres kemiske reaktioner, fluoroforer og biiomolekyler på enkeltmolekyle-niveau....

  8. An allosteric synthetic DNA.

    Wu, L.; Curran, J F

    1999-01-01

    Allosteric DNA oligonucleotides are potentially useful diagnostic reagents. Here we develop a model system for the study of allosteric interactions in DNAs. A DNA that binds either Cibacron blue or cholic acid was isolated and partially characterized. Isolation was performed using a multi-stage SELEX. First, short oligos that bind either Cibacron blue or cholic acid were enriched from random oligonucleotide pools. Then, members of the two pools were fused to form longer oligos, which were the...

  9. DNA Replication Origins

    Leonard, Alan C.; Méchali, Marcel

    2013-01-01

    The onset of genomic DNA synthesis requires precise interactions of specialized initiator proteins with DNA at sites where the replication machinery can be loaded. These sites, defined as replication origins, are found at a few unique locations in all of the prokaryotic chromosomes examined so far. However, replication origins are dispersed among tens of thousands of loci in metazoan chromosomes, thereby raising questions regarding the role of specific nucleotide sequences and chromatin envir...

  10. Analysis of DNA

    Fiala, Tomáš

    2011-01-01

    Summary This bachelor thesis focuses on the actual use of DNA analysis. The emphasis will be placed mainly on DNA databases of Czech Republic and United Kingdom. Both systems have their own specific characteristics that significantly differ one from the other. Some of those characteristics could be considered to be advantages while other rather as disadvantages mainly with regard to the right for privacy. Therefore, will be introduction of the topic (as well as its historical development)...

  11. Diamondoid-modified DNA

    Wang, Yan; Tkachenko, Boryslav A.; Schreiner, Peter R.; Marx, Andreas

    2011-01-01

    We prepared novel C5-modified triphosphates and phosphoramidites with a diamondoid functionally linked to the nucleobase. Using primer extension experiments with different length templates we investigated whether the modified triphosphates were enzymatically incorporated into DNA and whether they were further extended. We found that all three modified nucleotides can be incorporated into DNA using a single-nucleotide incorporation experiment, but only partially using two templates that demand...

  12. Ejer jeg mit DNA?

    Hoffmeyer, Jesper

    2010-01-01

    Havasupai-indianerne har så lidt som nogen andre mennesker selv frembragt deres DNA. Det repræsenterer en form for biologisk viden opsamlet gennem milliuoner af års forhistorie......Havasupai-indianerne har så lidt som nogen andre mennesker selv frembragt deres DNA. Det repræsenterer en form for biologisk viden opsamlet gennem milliuoner af års forhistorie...

  13. Photofootprinting of DNA triplexes.

    Lyamichev, V I; Voloshin, O N; Frank-Kamenetskii, M D; Soyfer, V N

    1991-01-01

    We have used a photofootprinting assay to study intermolecular and intramolecular DNA triplexes. The assay is based on the fact that the DNA duplex is protected against photodamage (specifically, against the formation of the (6-4) pyrimidine photoproducts) within a triplex structure. We have shown that this is the case for PyPuPu (YRR) as well as PyPuPy (YRY) triplexes. Using the photofootprinting assay, we have studied the triplex formation under a variety of experimentally defined condition...

  14. What Controls DNA Looping?

    Perez, Pamela J.; Nicolas Clauvelin; Grosner, Michael A.; Colasanti, Andrew V.; Olson, Wilma K.

    2014-01-01

    The looping of DNA provides a means of communication between sequentially distant genomic sites that operate in tandem to express, copy, and repair the information encoded in the DNA base sequence. The short loops implicated in the expression of bacterial genes suggest that molecular factors other than the naturally stiff double helix are involved in bringing the interacting sites into close spatial proximity. New computational techniques that take direct account of the three-dimensional stru...

  15. PDA: Pooled DNA analyzer

    Lin Chin-Yu

    2006-04-01

    Full Text Available Abstract Background Association mapping using abundant single nucleotide polymorphisms is a powerful tool for identifying disease susceptibility genes for complex traits and exploring possible genetic diversity. Genotyping large numbers of SNPs individually is performed routinely but is cost prohibitive for large-scale genetic studies. DNA pooling is a reliable and cost-saving alternative genotyping method. However, no software has been developed for complete pooled-DNA analyses, including data standardization, allele frequency estimation, and single/multipoint DNA pooling association tests. This motivated the development of the software, 'PDA' (Pooled DNA Analyzer, to analyze pooled DNA data. Results We develop the software, PDA, for the analysis of pooled-DNA data. PDA is originally implemented with the MATLAB® language, but it can also be executed on a Windows system without installing the MATLAB®. PDA provides estimates of the coefficient of preferential amplification and allele frequency. PDA considers an extended single-point association test, which can compare allele frequencies between two DNA pools constructed under different experimental conditions. Moreover, PDA also provides novel chromosome-wide multipoint association tests based on p-value combinations and a sliding-window concept. This new multipoint testing procedure overcomes a computational bottleneck of conventional haplotype-oriented multipoint methods in DNA pooling analyses and can handle data sets having a large pool size and/or large numbers of polymorphic markers. All of the PDA functions are illustrated in the four bona fide examples. Conclusion PDA is simple to operate and does not require that users have a strong statistical background. The software is available at http://www.ibms.sinica.edu.tw/%7Ecsjfann/first%20flow/pda.htm.

  16. Abeceda struktur DNA

    Vorlíčková, Michaela

    České Budějovice, 2003. s. 57. [Symposium teoretické a aplikované biofyziky. 18.09.2003-20.09.2003, České Budějovice] R&D Projects: GA AV ČR IAA4004201; GA ČR GA204/01/0561 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA structures * microsatellite DNA Subject RIV: BO - Biophysics

  17. Introduction to DNA methods

    The purpose of this session is to discuss the various possibilities for detecting modifications in DNA after irradiation and whether these changes can be utilized as an indicator for the irradiation treatment of foods. The requirement to be fulfilled is that the method be able to distinguish irradiated food without the presence of a control sample, thus the measured response after irradiation must be large enough to supersede background levels from other treatments. Much work has been performed on the effects of radiation on DNA, particularly due to its importance in radiation biology. The main lesions of DNA as a result of irradiation are base damage, damage of the sugar moiety, single strand and double strand breaks. Crosslinking between bases also occurs, e.g. production of thymine dimers, or between DNA and protein. A valuable review on how to utilize these DNA changes for detection purposes has already appeared. Tables 1, 2 and 3 list the proposed methods of detecting changes in irradiated DNA, some identified products as examples for a possible irradiation indicator, in the case of immunoassay the substance used as antigen, and some selected literature references. In this short review, it is not intended to provide a complete literature survey

  18. DNA display I. Sequence-encoded routing of DNA populations.

    Halpin, David R; Pehr B Harbury

    2004-01-01

    Recently reported technologies for DNA-directed organic synthesis and for DNA computing rely on routing DNA populations through complex networks. The reduction of these ideas to practice has been limited by a lack of practical experimental tools. Here we describe a modular design for DNA routing genes, and routing machinery made from oligonucleotides and commercially available chromatography resins. The routing machinery partitions nanomole quantities of DNA into physically distinct subpools ...

  19. DNA-catalyzed sequence-specific hydrolysis of DNA

    Chandra, Madhavaiah; Sachdeva, Amit; Silverman, Scott K.

    2009-01-01

    Deoxyribozymes (DNA catalysts) have been reported for cleavage of RNA phosphodiester linkages, but cleaving peptide or DNA phosphodiester linkages is much more challenging. Using in vitro selection, here we identified deoxyribozymes that sequence-specifically hydrolyze DNA with multiple turnover and rate enhancement of 108 (possibly as high as 1014). The new DNA catalysts require both Mn2+ and Zn2+, which is intriguing because many natural DNA nucleases are bimetallic protein enzymes.

  20. Origin DNA Melting and Unwinding in DNA Replication

    Gai, Dahai; Chang, Y Paul; Chen, Xiaojiang S.

    2010-01-01

    Genomic DNA replication is a necessary step in the life cycles of all organisms. To initiate DNA replication, the double-stranded DNA (dsDNA) at the origin of replication must be separated or melted; this melted region is propagated and a mature replication fork is formed. To accomplish origin recognition, initial DNA melting, and the eventual formation of a replication fork, coordinated activity of initiators, helicases, and other cellular factors are required. In this review, we focus on re...

  1. Accumulation of lipids and oxidatively damaged DNA in hepatocytes exposed to particles

    Vesterdal, Lise K.; Danielsen, Pernille H.; Folkmann, Janne K.; Jespersen, Line F.; Aguilar-Pelaez, Karin; Roursgaard, Martin; Loft, Steffen; Møller, Peter, E-mail: pemo@sund.ku.dk

    2014-01-15

    Exposure to particles has been suggested to generate hepatosteatosis by oxidative stress mechanisms. We investigated lipid accumulation in cultured human hepatocytes (HepG2) and rat liver after exposure to four different carbon-based particles. HepG2 cells were exposed to particles for 3 h and subsequently incubated for another 18 h to manifest lipid accumulation. In an animal model of metabolic syndrome we investigated the association between intake of carbon black (CB, 14 nm) particles and hepatic lipid accumulation, inflammation and gene expression of Srebp-1, Fasn and Scd-1 involved in lipid synthesis. There was a concentration-dependent increase in intracellular lipid content after exposure to CB in HepG2 cells, which was only observed after co-exposure to oleic/palmitic acid. Similar results were observed in HepG2 cells after exposure to diesel exhaust particles, fullerenes C{sub 60} or pristine single-walled carbon nanotubes. All four types of particles also generated oxidatively damaged DNA, assessed as formamidopyrimidine DNA glycosylase (FPG) sensitive sites, in HepG2 cells after 3 h exposure. The animal model of metabolic syndrome showed increased lipid load in the liver after one oral exposure to 6.4 mg/kg of CB in lean Zucker rats. This was not associated with increased iNOS staining in the liver, indicating that the oral CB exposure was associated with hepatic steatosis rather than steatohepatitis. The lipid accumulation did not seem to be related to increased lipogenesis because there were unaltered gene expression levels in both the HepG2 cells and rat livers. Collectively, exposure to particles is associated with oxidative stress and steatosis in hepatocytes. - Highlights: • Oral exposure to nanosized carbon black was associated with hepatosteatosis in rats. • In vitro studies included carbon black, C{sub 60}, diesel exhaust particles and SWCNTs. • Exposure to particles and free fatty acids increased lipid load in HepG2 cells. • Unaltered

  2. Exposure to runoff from coal-tar-sealed pavement induces genotoxicity and impairment of DNA repair capacity in the RTL-W1 fish liver cell line

    Kienzler, Aude, E-mail: aude.kienzler@entpe.fr [Université de Lyon, UMR LEHNA 5023, USC INRA, ENTPE, rue Maurice Audin, Vaulx-en-Velin F-69518 (France); Mahler, Barbara J., E-mail: bjmahler@usgs.gov [U.S. Geological Survey, 1505 Ferguson Lane, Austin, TX 78754 (United States); Van Metre, Peter C., E-mail: pcvanmet@usgs.gov [U.S. Geological Survey, 1505 Ferguson Lane, Austin, TX 78754 (United States); Schweigert, Nathalie [Université de Lyon, UMR LEHNA 5023, USC INRA, ENTPE, rue Maurice Audin, Vaulx-en-Velin F-69518 (France); Devaux, Alain, E-mail: alain.devaux@entpe.fr [Université de Lyon, UMR LEHNA 5023, USC INRA, ENTPE, rue Maurice Audin, Vaulx-en-Velin F-69518 (France); Bony, Sylvie, E-mail: bony@entpe.fr [Université de Lyon, UMR LEHNA 5023, USC INRA, ENTPE, rue Maurice Audin, Vaulx-en-Velin F-69518 (France)

    2015-07-01

    Coal-tar-based (CTB) sealcoat, frequently applied to parking lots and driveways in North America, contains elevated concentrations of polycyclic aromatic hydrocarbons (PAHs) and related compounds. The RTL-W1 fish liver cell line was used to investigate two endpoints (genotoxicity and DNA-repair-capacity impairment) associated with exposure to runoff from asphalt pavement with CTB sealcoat or with an asphalt-based sealcoat hypothesized to contain about 7% CTB sealcoat (AS-blend). Genotoxic potential was assessed by the Formamido pyrimidine glycosylase (Fpg)-modified comet assay for 1:10 and 1:100 dilutions of runoff samples collected from 5 h to 36 d following sealcoat application. DNA-repair capacity was assessed by the base excision repair comet assay for 1:10 dilution of samples collected 26 h and 36 d following application. Both assays were run with and without co-exposure to ultraviolet-A radiation (UVA). With co-exposure to UVA, genotoxic effects were significant for both dilutions of CTB runoff for three of four sample times, and for some samples of AS-blend runoff. Base excision repair was significantly impaired for CTB runoff both with and without UVA exposure, and for AS-blend runoff only in the absence of UVA. This study is the first to investigate the effects of exposure to the complex mixture of chemicals in coal tar on DNA repair capacity. The results indicate that co-exposure to runoff from CT-sealcoated pavement and UVA as much as a month after sealcoat application has the potential to cause genotoxicity and impair DNA repair capacity. - Highlights: • Co-exposure to runoff from coal-tar-sealcoated pavement and UVA caused DNA damage. • Significant genotoxicity occurred with a 1:100 dilution of runoff. • Runoff collected up to 36 d following coal-tar-sealcoat application was genotoxic. • Exposure to runoff from sealed pavement impaired an important DNA repair pathway. • Repair capacity was impaired with a 1:10 dilution of runoff (1:100 not

  3. Exposure to runoff from coal-tar-sealed pavement induces genotoxicity and impairment of DNA repair capacity in the RTL-W1 fish liver cell line

    Coal-tar-based (CTB) sealcoat, frequently applied to parking lots and driveways in North America, contains elevated concentrations of polycyclic aromatic hydrocarbons (PAHs) and related compounds. The RTL-W1 fish liver cell line was used to investigate two endpoints (genotoxicity and DNA-repair-capacity impairment) associated with exposure to runoff from asphalt pavement with CTB sealcoat or with an asphalt-based sealcoat hypothesized to contain about 7% CTB sealcoat (AS-blend). Genotoxic potential was assessed by the Formamido pyrimidine glycosylase (Fpg)-modified comet assay for 1:10 and 1:100 dilutions of runoff samples collected from 5 h to 36 d following sealcoat application. DNA-repair capacity was assessed by the base excision repair comet assay for 1:10 dilution of samples collected 26 h and 36 d following application. Both assays were run with and without co-exposure to ultraviolet-A radiation (UVA). With co-exposure to UVA, genotoxic effects were significant for both dilutions of CTB runoff for three of four sample times, and for some samples of AS-blend runoff. Base excision repair was significantly impaired for CTB runoff both with and without UVA exposure, and for AS-blend runoff only in the absence of UVA. This study is the first to investigate the effects of exposure to the complex mixture of chemicals in coal tar on DNA repair capacity. The results indicate that co-exposure to runoff from CT-sealcoated pavement and UVA as much as a month after sealcoat application has the potential to cause genotoxicity and impair DNA repair capacity. - Highlights: • Co-exposure to runoff from coal-tar-sealcoated pavement and UVA caused DNA damage. • Significant genotoxicity occurred with a 1:100 dilution of runoff. • Runoff collected up to 36 d following coal-tar-sealcoat application was genotoxic. • Exposure to runoff from sealed pavement impaired an important DNA repair pathway. • Repair capacity was impaired with a 1:10 dilution of runoff (1:100 not

  4. DNA Nanotechnology for Cancer Therapy

    Kumar, Vinit; Palazzolo, Stefano; Bayda, Samer; Corona, Giuseppe; Toffoli, Giuseppe; Rizzolio, Flavio

    2016-01-01

    DNA nanotechnology is an emerging and exciting field, and represents a forefront frontier for the biomedical field. The specificity of the interactions between complementary base pairs makes DNA an incredible building material for programmable and very versatile two- and three-dimensional nanostructures called DNA origami. Here, we analyze the DNA origami and DNA-based nanostructures as a drug delivery system. Besides their physical-chemical nature, we dissect the critical factors such as sta...

  5. A Pseudo DNA Cryptography Method

    Ning, Kang

    2009-01-01

    The DNA cryptography is a new and very promising direction in cryptography research. DNA can be used in cryptography for storing and transmitting the information, as well as for computation. Although in its primitive stage, DNA cryptography is shown to be very effective. Currently, several DNA computing algorithms are proposed for quite some cryptography, cryptanalysis and steganography problems, and they are very powerful in these areas. However, the use of the DNA as a means of cryptography...

  6. Forensic DNA Profiling and Database

    Panneerchelvam, S.; Norazmi, M.N.

    2003-01-01

    The incredible power of DNA technology as an identification tool had brought a tremendous change in crimnal justice . DNA data base is an information resource for the forensic DNA typing community with details on commonly used short tandem repeat (STR) DNA markers. This article discusses the essential steps in compilation of COmbined DNA Index System (CODIS) on validated polymerase chain amplified STRs and their use in crime detection.

  7. Local chromatin microenvironment determines DNMT activity : from DNA methyltransferase to DNA demethylase or DNA dehydroxymethylase

    van der Wijst, Monique G. P.; Venkiteswaran, Muralidhar; Chen, Hui; Xu, Guo-Liang; Plosch, Torsten; Rots, Marianne G.

    2015-01-01

    Insights on active DNA demethylation disproved the original assumption that DNA methylation is a stable epigenetic modification. Interestingly, mammalian DNA methyltransferases 3A and 3B (DNMT-3A and -3B) have also been reported to induce active DNA demethylation, in addition to their well-known fun

  8. Human DNA polymerase α in binary complex with a DNA:DNA template-primer

    Javier Coloma; Johnson, Robert E.; Louise Prakash; Satya Prakash; Aggarwal, Aneel K.

    2016-01-01

    The Polα/primase complex assembles the short RNA-DNA fragments for priming of lagging and leading strand DNA replication in eukaryotes. As such, the Polα polymerase subunit encounters two types of substrates during primer synthesis: an RNA:DNA helix and a DNA:DNA helix. The engagement of the polymerase subunit with the DNA:DNA helix has been suggested as the of basis for primer termination in eukaryotes. However, there is no structural information on how the Polα polymerase subunit actually e...

  9. Electroeluting DNA fragments.

    Zarzosa-Alvarez, Ana L; Sandoval-Cabrera, Antonio; Torres-Huerta, Ana L; Bermudez-Cruz, Rosa M

    2010-01-01

    Purified DNA fragments are used for different purposes in Molecular Biology and they can be prepared by several procedures. Most of them require a previous electrophoresis of the DNA fragments in order to separate the band of interest. Then, this band is excised out from an agarose or acrylamide gel and purified by using either: binding and elution from glass or silica particles, DEAE-cellulose membranes, "crush and soak method", electroelution or very often expensive commercial purification kits. Thus, selecting a method will depend mostly of what is available in the laboratory. The electroelution procedure allows one to purify very clean DNA to be used in a large number of applications (sequencing, radiolabeling, enzymatic restriction, enzymatic modification, cloning etc). This procedure consists in placing DNA band-containing agarose or acrylamide slices into sample wells of the electroeluter, then applying current will make the DNA fragment to leave the agarose and thus be trapped in a cushion salt to be recovered later by ethanol precipitation. PMID:20834225

  10. Programmable Quantitative DNA Nanothermometers.

    Gareau, David; Desrosiers, Arnaud; Vallée-Bélisle, Alexis

    2016-07-13

    Developing molecules, switches, probes or nanomaterials that are able to respond to specific temperature changes should prove of utility for several applications in nanotechnology. Here, we describe bioinspired strategies to design DNA thermoswitches with programmable linear response ranges that can provide either a precise ultrasensitive response over a desired, small temperature interval (±0.05 °C) or an extended linear response over a wide temperature range (e.g., from 25 to 90 °C). Using structural modifications or inexpensive DNA stabilizers, we show that we can tune the transition midpoints of DNA thermometers from 30 to 85 °C. Using multimeric switch architectures, we are able to create ultrasensitive thermometers that display large quantitative fluorescence gains within small temperature variation (e.g., > 700% over 10 °C). Using a combination of thermoswitches of different stabilities or a mix of stabilizers of various strengths, we can create extended thermometers that respond linearly up to 50 °C in temperature range. Here, we demonstrate the reversibility, robustness, and efficiency of these programmable DNA thermometers by monitoring temperature change inside individual wells during polymerase chain reactions. We discuss the potential applications of these programmable DNA thermoswitches in various nanotechnology fields including cell imaging, nanofluidics, nanomedecine, nanoelectronics, nanomaterial, and synthetic biology. PMID:27058370

  11. Structural insight into negative DNA supercoiling by DNA gyrase, a bacterial type 2A DNA topoisomerase

    Papillon, Julie; Ménétret, Jean-François; Batisse, Claire; Hélye, Reynald; Schultz, Patrick; Potier, Noëlle; Lamour, Valérie

    2013-01-01

    Type 2A DNA topoisomerases (Topo2A) remodel DNA topology during replication, transcription and chromosome segregation. These multisubunit enzymes catalyze the transport of a double-stranded DNA through a transient break formed in another duplex. The bacterial DNA gyrase, a target for broad-spectrum antibiotics, is the sole Topo2A enzyme able to introduce negative supercoils. We reveal here for the first time the architecture of the full-length Thermus thermophilus DNA gyrase alone and in a cl...

  12. Synapsis of DNA ends by DNA-dependent protein kinase

    DeFazio, Lisa G.; Stansel, Rachel M.; Griffith, Jack D.; Chu, Gilbert

    2002-01-01

    The catalytic subunit of DNA-dependent protein kinase (DNA-PKCS) is required for a non-homologous end-joining pathway that repairs DNA double-strand breaks produced by ionizing radiation or V(D)J recombination; however, its role in this pathway has remained obscure. Using a neutravidin pull-down assay, we found that DNA-PKCS mediates formation of a synaptic complex containing two DNA molecules. Furthermore, kinase activity was cooperative with respect to DNA concentration, suggesting that act...

  13. DNA display I. Sequence-encoded routing of DNA populations.

    David R Halpin

    2004-07-01

    Full Text Available Recently reported technologies for DNA-directed organic synthesis and for DNA computing rely on routing DNA populations through complex networks. The reduction of these ideas to practice has been limited by a lack of practical experimental tools. Here we describe a modular design for DNA routing genes, and routing machinery made from oligonucleotides and commercially available chromatography resins. The routing machinery partitions nanomole quantities of DNA into physically distinct subpools based on sequence. Partitioning steps can be iterated indefinitely, with worst-case yields of 85% per step. These techniques facilitate DNA-programmed chemical synthesis, and thus enable a materials biology that could revolutionize drug discovery.

  14. DNA repair and DNA antibodies during experimental mycoplasma arthritis

    To clarify the pathogenesis of a mycoplasma induced arthritis in rats, investigations were carried out on the influence of mycoplasma infection on DNA repair and the occurrence of DNA antibodies. During acute and subacute stage of the experimentally induced arthritis an inhibition of DNA repair could be observed. Besides the results indicated a correlation between reduced or inhibited DNA repair and the appearance of DNA antibodies could be found. The DNA-repair behaviour after the mycoplasma infection was compared with the influence of γ-irradiation

  15. DNA-mediated charge transport for DNA repair

    Boon, Elizabeth M; Livingston, Alison L.; Chmiel, Nikolas H.; David, Sheila S.; Barton, Jacqueline K.

    2003-01-01

    MutY, like many DNA base excision repair enzymes, contains a [4Fe4S](2+) cluster of undetermined function. Electrochemical studies of MutY bound to a DNA-modified gold electrode demonstrate that the [4Fe4S] cluster of MutY can be accessed in a DNA-mediated redox reaction. Although not detectable without DNA, the redox potential of DNA-bound MutY is approximate to275 mV versus NHE, which is characteristic of HiPiP iron proteins. Binding to DNA is thus associated with a change in [4Fe4S](3+/2+)...

  16. [DNA methylation in obesity].

    Pokrywka, Małgorzata; Kieć-Wilk, Beata; Polus, Anna; Wybrańska, Iwona

    2014-01-01

    The number of overweight and obese people is increasing at an alarming rate, especially in the developed and developing countries. Obesity is a major risk factor for diabetes, cardiovascular disease, and cancer, and in consequence for premature death. The development of obesity results from the interplay of both genetic and environmental factors, which include sedentary life style and abnormal eating habits. In the past few years a number of events accompanying obesity, affecting expression of genes which are not directly connected with the DNA base sequence (e.g. epigenetic changes), have been described. Epigenetic processes include DNA methylation, histone modifications such as acetylation, methylation, phosphorylation, ubiquitination, and sumoylation, as well as non-coding micro-RNA (miRNA) synthesis. In this review, the known changes in the profile of DNA methylation as a factor affecting obesity and its complications are described. PMID:25531701

  17. DNA sequencing: chemical methods

    Limited base-specific or base-selective cleavage of a defined DNA fragment yields polynucleotide products, the length of which correlates with the positions of the particular base (or bases) in the original fragment. Sverdlov and co-workers recognized the possibility of using this principle for the determination of DNA sequences. In 1977 a fully elaborated method was introduced based on this principle, which allowed routine analysis of DNA sequences over distances greater than 100 nucleotide unite from a defined, radiolabeled terminus. Six procedures for partial cleavage were described. Simultaneous parallel resolution of an appropriate set of partial cleavage mixtures by polyacrylamide gel electrophoresis, followed by visualization of the radioactive bands by autoradiography, allows the deduction of nucleotide sequence

  18. DNA Topoisomerases in Transcription

    Rødgaard, Morten Terpager

    2015-01-01

    This Ph.D. thesis summarizes the main results of my studies on the interplay between DNA topoisomerases and transcription. The work was performed from 2011 to 2015 at Aarhus University in the Laboratory of Genome Research, and was supervised by associate professor Anni H. Andersen. Most of the ex......This Ph.D. thesis summarizes the main results of my studies on the interplay between DNA topoisomerases and transcription. The work was performed from 2011 to 2015 at Aarhus University in the Laboratory of Genome Research, and was supervised by associate professor Anni H. Andersen. Most...... topoisomerase-DNA cleavage complex. The second study is an investigation of how topoisomerases influence gene regulation by keeping the genome in an optimal topological state....

  19. Tunnelling microscopy of DNA

    Selci, Stefano; Cricenti, Antonio

    1991-01-01

    Uncoated DNA molecules marked with an activated tris (1-aziridinyl) phosphine oxide (TAPO) solution were deposited on gold substrates and imaged in air with a high resolution Scanning Tunnelling Microscope (STM). The STM operated simultaneously in the constant-current and gap-modulated mode. Highly reproducible STM images have been obtained and interpreted in terms of expected DNA structure. The main periodicity, regularly presented in molecules several hundred Ångstrom long, ranges from 25 Å to 35 Å with an average diameter of 22 Å. Higher resolution images of the minor groove have revealed the phosphate groups along the DNA backbones. Constant-current images of TAPO deposited on gold show a crystalline structure of rows of molecules with a side-by-side spacing of 3 Å.

  20. Rigidity of melting DNA

    Pal, Tanmoy; Bhattacharjee, Somendra M.

    2016-05-01

    The temperature dependence of DNA flexibility is studied in the presence of stretching and unzipping forces. Two classes of models are considered. In one case the origin of elasticity is entropic due to the polymeric correlations, and in the other the double-stranded DNA is taken to have an intrinsic rigidity for bending. In both cases single strands are completely flexible. The change in the elastic constant for the flexible case due to thermally generated bubbles is obtained exactly. For the case of intrinsic rigidity, the elastic constant is found to be proportional to the square root of the bubble number fluctuation.