WorldWideScience

Sample records for 6-phosphate synthase gene

  1. Isolation and characterization of the trehalose-6-phosphate synthase gene from Locusta migratoria manflensis

    Shu-Yan Cui; Yu-Xian Xia

    2009-01-01

    Trehalose plays an important role in protecting organisms from various stresses.Trehalose-6-phosphate synthase (TPS) is the key enzyme in trehalose synthesis, but in in-sects only a few TPS genes have been identified and their function has not been well characterized. To better understand the function of TPS in insects, a complete TPS com-plementary DNA (eDNA) clone was obtained from the fat body of the locust Locusta migratoria manilensis (GenBank accession number: EU 131894). The full-length cDNA is 2 806 bp, including an open reading frame of 2 442 bp, which encodes an 813 amino acids protein with a calculated molecular weight of 91 976 Daltons and an isoelectric point of 6.14. The deduced amino acid sequence is highly similar to other published insect TPS and its C-terminal also has a region homologous to trehalose phosphate phsophatase (TPP).Semi-quantitative analysis indicated that the TPS transcript was expressed not only in fat body, but also in gut, hemolymph and leg muscle. These data may facilitate studies of TPS function in insects and improve our understanding of trehalose metabolism.

  2. Cloning and Characterization of a Salt Tolerance-Associated Gene Encoding Trehalose-6-Phosphate Synthase in Sweetpotato

    JIANG Tao; ZHAI Hong; WANG Fei-bing; ZHOU Hua-nan; SI Zeng-zhi; HE Shao-zhen; LIU Qing-chang

    2014-01-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in a variety of organisms. In plants, its biosynthesis is catalyzed by two key enzymes:trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP). In the present study, a TPS gene, named IbTPS, was ifrst isolated from sweetpotato (Ipomoea batatas (L.) Lam.) cv. Lushu 3 by rapid ampliifcation of cDNA ends (RACE). The open reading frame (ORF) contained 2 580 nucleotides encoding 859 amino acids with a molecular weight of 97.433 kDa and an isoelectric point (pI) of 5.7. The deduced amino acid sequence showed high identities with TPS of other plants. Real-time quantitative PCR analysis revealed that the expression level of IbTPS gene was signiifcantly higher in stems of Lushu 3 than in its leaves and roots. Subcellular localization analysis in onion epidermal cells indicated that IbTPS gene was located in the nucleus. Transgenic tobacco (cv. Wisconsin 38) plants over-expressing IbTPS gene exhibited signiifcantly higher salt tolerance compared with the control plant. Trehalose and proline content was found to be signiifcantly more accumulated in transgenic tobacco plants than in the wild-type and several stress tolerance related genes were up-regulated. These results suggest that IbTPS gene may enhance salt tolerance of plants by increasing the amount of treahalose and proline and regulating the expression of stress tolerance related genes.

  3. Identification of the trehalose-6-phosphate synthase gene family in winter wheat and expression analysis under conditions of freezing stress

    D. W. Xie; X. N. Wang; L. S. Fu; J. Sun; W. Zheng; Z. F. Li

    2015-03-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are potentially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag sequence information from NCBI and two wheat genome databases, we identified 12 wheat TPS genes and performed a comprehensive study on their structural, evolutionary and functional properties. The estimated divergence time of wheat TPS gene pairs and wheat–rice orthologues suggested that wheat and rice have a common ancestor. The number of TPS genes in the wheat genome was estimated to be at least 12, which is close to the number found in rice, Arabidopsis and soybean. Moreover, it has been reported earlier in other plants that TPS genes respond to abiotic stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat, and determined that most of the TPS gene expression in winter wheat was induced by freezing conditions, which further suggested that wheat TPS genes were involved in winter wheat freeze-resistance signal transduction pathways. Taken together, the current study represents the first comprehensive study of TPS genes in winter wheat and provides a foundation for future functional studies of this important gene family in Triticeae.

  4. Virus-Induced Gene Silencing-Based Functional Analyses Revealed the Involvement of Several Putative Trehalose-6-Phosphate Synthase/Phosphatase Genes in Disease Resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000 in Tomato

    Zhang, Huijuan; Hong, Yongbo; Huang, Lei; Liu, Shixia; Tian, Limei; Dai, Yi; Cao, Zhongye; Huang, Lihong; Li, Dayong; Song, Fengming

    2016-01-01

    Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development, and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs, and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs, and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst) DC3000 as well as to defense signaling hormones (e.g., salicylic acid, jasmonic acid, and a precursor of ethylene). Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4, or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7, or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7, and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato. PMID:27540389

  5. Molecular cloning and characterization of a trehalose-6-phosphate synthase/phosphatase from Dunaliella viridis.

    Zhang, Nan; Wang, Fei; Meng, Xiangzong; Luo, Saifan; Li, Qiyun; Dong, Hongyun; Xu, Zhengkai; Song, Rentao

    2011-04-01

    Dunaliella is a group of green algae with exceptional stress tolerance capability, and is considered as an important model organism for stress tolerance study. Here we cloned a TPS (trehalose-6-phosphate synthase) gene from Dunaliella viridis and designated it as DvTPS (D. viridis trehalose-6-phosphate synthase/phosphatase).The DvTPS cDNA contained an ORF of 2793 bp encoding 930 aa. DvTPS had both TPS and TPP domain and belonged to the Group II TPS/TPP fusion gene family. Southern blots showed it has a single copy in the genome. Genome sequence analysis revealed that it has 18 exons and 17 introns. DvTPS had a constitutive high expression level under various NaCl culture conditions, however, could be induced by salt shock. Promoter analysis indicated there were ten STREs (stress response element) in its promoter region, giving a possible explanation of its inducible expression pattern upon salt shock. Yeast functional complementation analysis showed that DvTPS had neither TPS nor TPP activity. However, DvTPS could improve the salt tolerance of yeast salt sensitive mutant G19. Our results indicated that despite DvTPS showed significant similarity with TPS/TPP, its real biological function is still remained to be revealed. PMID:20878239

  6. Silencing trehalose-6-phosphate synthase incapacitates adult mosquitoes by interfering with the biosynthetic pathway for flight fuel

    Trehalose is a disaccharide comprised of two glucose molecules. It is the main blood sugar of insects and is essential for flight. Trehalose is synthesized by two enzymes: trehalose-6-phosphate synthase (T6PS) converts glucose-6-phosphate to trehalose-6-phosphate, and trehalose-6-phosphate phosphata...

  7. Synthesis and modifications of heterocyclic derivatives of D-arabinose: potential inhibitors of glucose-6-phosphate isomerase and glucosamine-6-phosphate synthase

    The synthesis of -5-(D-arabino-1,2,3,4-tetrahydroxybutyl)tetrazole and -2-(d-arabino-1,2,3,4-tetra-acetoxybutyl)-5-methyl-1,3,4-oxadiazole from d-arabinose is described. Attempts at removing the protecting groups of the oxadiazole derivative were unsuccessful, leading to products resulting from the opening of the oxadiazole ring. The unprotected tetrazole derivative was selectively phosphorylated at the primary hydroxyl group with diethyl phosphoryl chloride. The resulting 5-[d-arabino-4-(diethylphosphoryloxy)-1,2,3-trihydroxybutyl]tetrazole is a protected form of a potential inhibitor of the enzymes glucose-6-phosphate isomerase and glucosamine synthase. (author)

  8. Crystallization and preliminary X-ray analysis of the isomerase domain of glucosamine-6-phosphate synthase from Candida albicans

    The isomerase domain of glucosamine-6-phosphate synthase from C. albicans has been crystallized and X-ray diffraction data have been collected. Preliminary analysis of the data reveals the oligomeric structure of the eukaryotic synthase to be a ‘dimer’ of prokaryotic-like dimers. Glucosamine-6-phosphate synthase (EC 2.6.1.16) catalyses the first and practically irreversible step in the hexosamine metabolism pathway, the end product of which, uridine 5′-diphospho-N-acetyl d-glucosamine, is an essential substrate for assembly of the cell wall. The isomerase domain, consisting of residues 346–712 (42 kDa), of glucosamine-6-phosphate synthase from Candida albicans has been crystallized. X-ray analysis revealed that the crystals belonged to space group I4, with unit-cell parameters a = b = 149, c = 103 Å. Diffraction data were collected to 3.8 Å. Preliminary results from molecular replacement using the homologous bacterial monomer reveal that the asymmetric unit contains two monomers that resemble a bacterial dimer. The crystal lattice consists of pairs of such symmetry-related dimers forming elongated tetramers

  9. Cloning and Expression Analysis of Trehalose-6-phosphate Synthase Gene(CsTPS)from Tea Plant(Camellia sinensis(L.)O.Kuntz)%茶树海藻糖-6-磷酸合成酶基因(CsTPS)的克隆及表达分析

    丁菲; 庞磊; 李叶云; 葛菁; 江昌俊

    2012-01-01

    海藻糖-6-磷酸合成酶(trehalose-6-phosphate synthase,TPS)是海藻糖合成途径中的一个关键酶.目前,TPS基因的研究多数集中于细菌和真菌等,而对植物的研究较少.本实验通过对茶树(Camellia sinensis(L.)O.Kuntze)全器官转录组文库序列比对,获得一条与其他物种同源性较高的编码TPS基因的EST序列,通过RACE扩增后获得茶树TPS基因cDNA全长序列,命名为Cs TPS(GenBank登录号JQ742017).该基因cDNA全长3 125 bp,包含一个2799 bp的开放阅读框,编码932个氨基酸.多序列比对分析结果表明,Cs TPS基因编码的蛋白具有明显的TPS和TPP两个结构域.系统进化分析表明,其编码的氨基酸序列与拟南芥(Arabidopsis thaliana)、烟草(Nicotiana tabacum)和番茄(Solanum lycopersicum)等植物的TPS同源性较高,且CsTPS与拟南芥TPS1(AtTPS1)的同源性高于TPS2(AtTPS2)和TPS3(AtTPS3).qPCR分析显示,CsTPS基因在茶树不同组织器官中呈现差异性表达.低温诱导促使老叶和嫩叶中的CsTPS基因上调程度明显大于根系,表明CsTPS基因可能参与了茶树抗寒机制.%Trehalose-6-phosphate Synthase (TPS) is a key enzyme in the synthesis of trehalose in plants. At present, researches about TPS have mainly focused on bacteria and fungi but little about plants. An EST, having high homology with TPS gene from other organisms, was screened from the whole organic transcriptomic library of tea {Camellia sinensis (L.) O. Kuntz) and amplified through RACE technology to obtain the cDNA full-length of trehalose-6-phosphate synthase gene, named CsTPS (GenBank accession number: JQ742017). The cDNA full-length of CsTPS was 3 125 bp with a single 2 799 bp opening reading frame that predicted to encoded a 932 animo acid, which contained two obvious structure domains, TPS and TPP, through multiple sequences alignment. Phylogenetic tree indicated that the deduced animo acid sequence of CsTPS gene had a very high identity with TPS genes from other

  10. Monitoring the Dynamics of Monomer Exchange Using Electrospray Mass Spectrometry: The Case of the Dimeric Glucosamine-6-Phosphate Synthase

    Chevreux, Guillaume; Atmanene, Cédric; Lopez, Philippe; Ouazzani, Jamal; Van Dorsselaer, Alain; Badet, Bernard; Badet-Denisot, Marie-Ange; Sanglier-Cianférani, Sarah

    2011-03-01

    Escherichia coli glucosamine-6-phosphate synthase (GlmS) is a dimeric enzyme from the glutamine-dependent amidotransferases family, which catalyses the conversion of D-fructose-6-phosphate (Fru6P) and glutamine (Gln) into D-glucosamine-6-phosphate (GlcN6P) and glutamate, respectively. Extensive X-ray crystallography investigations have been reported, highlighting the importance of the dimeric association to form the sugar active site as well as significant conformational changes of the protein upon substrate and product binding. In the present work, an approach based on time-resolved noncovalent mass spectrometry has been developed to study the dynamics of GlmS subunit exchange. Using 14N versus 15N labeled proteins, the kinetics of GlmS subunit exchange was monitored with the wild-type enzyme in the presence of different substrates and products as well as with the protein bearing a key amino acid mutation specially designed to weaken the dimer interface. Determination of rate constants of subunit exchange revealed important modifications of the protein dynamics: while glutamine, glutamate, and K603A mutation accelerates subunit exchange, Fru6P and GlcN6P totally prevent it. These results are described in light of the available structural information, providing additional useful data for both the characterization of GlmS catalytic process and the design of new GlmS inhibitors. Finally, time-resolved noncovalent MS can be proposed as an additional biophysical technique for real-time monitoring of protein dynamics.

  11. Molecular Docking Studies of Catechin and Its Derivatives as Anti-bacterial Inhibitor for Glucosamine-6-Phosphate Synthase

    Fikrika, H.; Ambarsari, L.; Sumaryada, T.

    2016-01-01

    Molecular docking simulation of catechin and its derivatives on Glucosamine-6- Phosphate Synthase (GlmS) has been performed in this research. GlmS inhibition by a particular ligand will suppress the production of bacterial cell wall and significantly reduce the population of invading bacteria. In this study, catechin derivatives i.e epicatechin, galloatechin and epigalloatechin were found to have stronger binding affinities as compared to natural ligand of GlmS, Fructose-6-Phosphate (F6P). Those three ligands were docked on the same pocket in GlmS target as F6P, with 70% binding sites similarity. Based on the docking results, gallocatechin turns out to be the most potent ligand for anti-bacterial agent with ΔG= -8.00 kcal/mol. The docking between GlmS and catechin derivatives are characterized by a constant present of a strong hydrogen bond between functional group O3 and Ser-349. This hydrogen bond most likely plays a significant role in the docking mechanism and binding modes selection. The surprising result is catechin itself exhibited a quite strong binding with GlmS (ΔG= -7.80 kcal.mol), but docked on a completely different pocket compared to other ligands. This results suggest that catechin might still have a curing effect but with a completely different pathway and mechanism as compared to its derivatives.

  12. Cloning, expression and characterization of glucokinase gene involved in the glucose-6- phosphate formation in Staphylococcus aureus

    Lakshmi, Hanumanthu Prasanna; Yeswanth, Sthanikam; Prasad, Uppu Venkateswara; Vasu, Dudipeta; Swarupa, Vimjam; Kumar, Pasupuleti Santhosh; Narasu, Mangamoori Lakshmi; Krishna Sarma, Potukuchi Venkata Gurunadha

    2013-01-01

    Glucose-6-phosphate (G-6-P) formation in Staphylococcus aureus is catalysed by glucokinase (glkA) gene under high glucose concentration leading to upregulation of various pathogenic factors; therefore the present study is aimed in the cloning and characterization of glk A gene from S. aureus ATCC12600. The glk A gene was cloned in the Sma I site of pQE 30, sequenced (Accession number: JN645812) and expressed in E. coli DH5α. The recombinant glk A expressed from the resultant glk A 1 clone was...

  13. Lactose metabolism by Staphylococcus aureus: characterization of lacABCD, the structural genes of the tagatose 6-phosphate pathway.

    Rosey, E L; Oskouian, B; Stewart, G. C.

    1991-01-01

    The nucleotide and deduced amino acid sequences of the lacA and lacB genes of the Staphylococcus aureus lactose operon (lacABCDFEG) are presented. The primary translation products are polypeptides of 142 (Mr = 15,425) and 171 (Mr = 18,953) amino acids, respectively. The lacABCD loci were shown to encode enzymes of the tagatose 6-phosphate pathway through both in vitro studies and complementation analysis in Escherichia coli. A serum aldolase assay, modified to allow detection of the tagatose ...

  14. Impact of temperature stress and validamycin A on compatible solutes and fumonisin production in F. verticillioides: role of trehalose-6-phosphate synthase.

    Boudreau, Beth A; Larson, Troy M; Brown, Daren W; Busman, Mark; Roberts, Ethan S; Kendra, David F; McQuade, Kristi L

    2013-08-01

    Fusarium verticillioides is a pathogen of maize that causes root, stalk and ear rot and produces fumonisins, toxic secondary metabolites associated with disease in livestock and humans. Environmental stresses such as heat and drought influence disease severity and toxin production, but the effects of abiotic stress on compatible solute production by F. verticillioides have not been fully characterized. We found that decreasing the growth temperature leads to a long-term reduction in polyol levels, whereas increasing the temperature leads to a transient increase in polyols. The effects of temperature shifts on trehalose levels are opposite the effects on polyols and more dramatic. Treatment with validamycin A, a trehalose analog with antifungal activity, leads to a rapid reduction in trehalose levels, despite its known role as a trehalase inhibitor. Mutant strains lacking TPS1, which encodes a putative trehalose-6-phosphate synthase, have altered growth characteristics, do not produce detectable amounts of trehalose under any condition tested, and accumulate glycogen at levels significantly higher than wild-type F. verticillioides. TPS1 mutants also produce significantly less fumonisin than wild type and are also less pathogenic than wild type on maize. These data link trehalose biosynthesis, secondary metabolism, and disease, and suggest that trehalose metabolic pathways may be a viable target for the control of Fusarium diseases and fumonisin contamination of maize. PMID:23751979

  15. Glucosamine-6-phosphate synthase from Escherichia coli: Determination of the mechanism of inactivation by N3-fumaroyl-L-2,3-diaminopropionic derivatives

    A mechanistic investigation of the inactivation of Escherichia coli glucosamine-6-phosphate synthase by N3-(4-methoxyfumaroyl)-L-2,3-diaminopropionate (FMDP) was undertaken. On the basis of the known participation of the N-terminal cysteine residue in this process, the model reactions between FMDP and L-cysteine and between FMDP and the synthetic decapeptide Cys-Gly-Ile-Val-Gly-Ala-Ile-Ala-Ile-Ala-Gln-Arg, corresponding to the amino-terminal protein sequence, were studied. The results allowed us to propose a pathway that is in perfect agreement with the biochemical results: enzyme inactivation arose from Michael addition of glutamine binding site cysteine-1 on the fumaroyl double bond at the β-position of the ester group. Upon denaturation under slightly alkaline conditions, this adduct underwent cyclization to a transient succinimide adduct, which rearranged into the stable 2-substituted 1,4-thiazin-3-one-5-carboxylate involving participation of the cysteine amino group. The tryptic radiolabeled peptides purified from [3H]FMDP-treated enzyme and resistant to Edman degradation coeluted with the products resulting from the model reaction between the synthetic decapeptide and the inhibitor

  16. Glucose-6-phosphate dehydrogenase

    ... this page: //medlineplus.gov/ency/article/003671.htm Glucose-6-phosphate dehydrogenase test To use the sharing features on this page, please enable JavaScript. Glucose-6-phosphate dehydrogenase (G6PD) is a type of ...

  17. Identification of point mutations in Glucose-6-Phosphate Dehydrogenase gene in Timor Island people : A preliminary report

    Widanto Hardjowasito

    2001-12-01

    Full Text Available Glucose 6 phosphate dehydrogenase (G6PD deficiency is common in malaria endemic region, however no molecular study has been performed on G6PD deficiency in Timor Island, Indonesia a malarial hyperendemic area which Proto Malay is the majority of the people in that island. To observe the frequency and molecular type of mutations in G6PD deficient Proto Malay people, 118 native people were screened using formazan ring test. Mutation in the G6PD gene were determined by MPTP (Multiple PCR using Multiple Tandem Forward Primers and a common Reserve Pimer method and confirmed by automatic sequencer. This study shows that three males have lower G6PD activity. Using MPTP method, a point mutation could be indicated in the two cases. Sequencing of the amplified products in 2 G6PD patients disclosed mutations of T383C in exon 5 and C 592 T in exon 6 in respective case. Our result documents point mutations in exon 5 and exon 6 in the G6PD gene of two Proto Malay people in Timor. These mutations are common in Asia region. (Med J Indones 2001; 10: 210-3Keywords: mutations, G6PD, Proto Malay.

  18. Identification and Characterization of the Glucose-6-Phosphate Dehydrogenase Gene Family in the Para Rubber Tree, Hevea brasiliensis.

    Long, Xiangyu; He, Bin; Fang, Yongjun; Tang, Chaorong

    2016-01-01

    As a key enzyme in the pentose phosphate pathway (PPP), glucose-6-phosphate dehydrogenase (G6PDH) provides nicotinamide adenine dinucleotide phosphate (NADPH) and intermediary metabolites for rubber biosynthesis, and plays an important role in plant development and stress responses. In this study, four Hevea brasiliensis (Para rubber tree) G6PDH genes (HbG6PDH1 to 4) were identified and cloned using a genome-wide scanning approach. All four HbG6PDH genes encode functional G6PDH enzymes as shown by heterologous expression in E. coli. Phylogeny analysis and subcellular localization prediction show that HbG6PDH3 is a cytosolic isoform, while the other three genes (HbG6PDH1, 2 and 4) are plastidic isoforms. The subcellular locations of HbG6PDH3 and 4, two latex-abundant isoforms were further verified by transient expression in rice protoplasts. Enzyme activity assay and expression analysis showed HbG6PDH3 and 4 were implicated in PPP during latex regeneration, and to influence rubber production positively in rubber tree. The cytosolic HbG6PDH3 is a predominant isoform in latex, implying a principal role for this isoform in controlling carbon flow and NADPH production in the PPP during latex regeneration. The expression pattern of plastidic HbG6PDH4 correlates well with the degree of tapping panel dryness, a physiological disorder that stops the flow of latex from affected rubber trees. In addition, the four HbG6PDHs responded to temperature and drought stresses in root, bark, and leaves, implicating their roles in maintaining redox balance and defending against oxidative stress. PMID:26941770

  19. Synthesis and modifications of heterocyclic derivatives of D-arabinose: potential inhibitors of glucose-6-phosphate isomerase and glucosamine-6-phosphate synthase; Sintese e modificacoes de derivados heterociclicos de d-arabinose: potenciais inibidores de glicose-6-fosfato isomerase e de glicosamina-6-fosfato sintase

    Viana, Renato Marcio Ribeiro; Prado, Maria Auxiliadora Fontes; Alves, Ricardo Jose [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Fac. de Farmacia. Dept. de Produtos Farmaceuticos]. E-mail: ricardodylan@farmacia.ufmg.br

    2008-07-01

    The synthesis of -5-(D-arabino-1,2,3,4-tetrahydroxybutyl)tetrazole and -2-(d-arabino-1,2,3,4-tetra-acetoxybutyl)-5-methyl-1,3,4-oxadiazole from d-arabinose is described. Attempts at removing the protecting groups of the oxadiazole derivative were unsuccessful, leading to products resulting from the opening of the oxadiazole ring. The unprotected tetrazole derivative was selectively phosphorylated at the primary hydroxyl group with diethyl phosphoryl chloride. The resulting 5-[d-arabino-4-(diethylphosphoryloxy)-1,2,3-trihydroxybutyl]tetrazole is a protected form of a potential inhibitor of the enzymes glucose-6-phosphate isomerase and glucosamine synthase. (author)

  20. Diverse point mutations in the human glucose-6-phosphate dehydrogenase gene cause enzyme deficiency and mild or severe hemolytic anemia.

    Vulliamy, T J; D'Urso, M; Battistuzzi, G; Estrada, M.; Foulkes, N S; Martini, G; Calabro, V; Poggi, V; Giordano, R.; Town, M

    1988-01-01

    Glucose-6-phosphate dehydrogenase (G6PD; EC 1.1.1.49) deficiency is a common genetic abnormality affecting an estimated 400 million people worldwide. Clinical and biochemical analyses have identified many variants exhibiting a range of phenotypes, which have been well characterized from the hematological point of view. However, until now, their precise molecular basis has remained unknown. We have cloned and sequenced seven mutant G6PD alleles. In the nondeficient polymorphic African variant ...

  1. Targeted disruption of the M(r) 46,000 mannose 6-phosphate receptor gene in mice results in misrouting of lysosomal proteins.

    Köster, A; Saftig, P; Matzner, U; von Figura, K; Peters, C; Pohlmann, R

    1993-01-01

    Lysosomal enzymes containing mannose 6-phosphate recognition markers are sorted to lysosomes by mannose 6-phosphate receptors (MPRs). The physiological importance of this targeting mechanism is illustrated by I-cell disease, a fatal lysosomal storage disorder caused by the absence of mannose 6-phosphate residues in lysosomal enzymes. Most mammalian cells express two MPRs. Although the binding specificities, subcellular distribution and expression pattern of the two receptors can be differentiated, their coexpression is not understood. The larger of the two receptors with an M(r) of approximately 300,000 (MPR300), which also binds IGFII, appears to have a dominant role in lysosomal enzyme targeting, while the function of the smaller receptor with an M(r) of 46,000 (MPR46) is less clear. To investigate the in vivo function of the MPR46, we generated MPR46-deficient mice using gene targeting in embryonic stem cells. Reduced intracellular retention of newly synthesized lysosomal proteins in cells from MPR46 -/- mice demonstrated an essential sorting function of MPR46. The phenotype of MPR46 -/- mice was normal, indicating mechanisms that compensate the MPR46 deficiency in vivo. Images PMID:8262064

  2. Diverse point mutations in the human glucose-6-phosphate dehydrogenase gene cause enzyme deficiency and mild or severe hemolytic anemia

    Vulliamy, T.J.; D' Urso, M.; Battistuzzi, G.; Estrada, M.; Foulkes, N.S.; Martini, G.; Calabro, V.; Poggi, V.; Giordano, R.; Town, M.; Luzzatto, L.; Persico, M.G. (Royal Postgraduate Medical School, London (England))

    1988-07-01

    Glucose-6-phosphate dehydrogenase deficiency is a common genetic abnormality affecting an estimated 400 million people worldwide. Clinical and biochemical analyses have identified many variants exhibiting a range of phenotypes, which have been well characterized from the hematological point of view. However, until now, their precise molecular basis has remained unknown. The authors have cloned and sequenced seven mutant G6PD alleles. In the nondeficient polymorphic African variant G6PD A they have found a single point mutation. The other six mutants investigated were all associated with enzyme deficiency. The mutations observed show a striking predominance of C {yields} T transitions, with CG doublets involved in four of seven cases. Thus, diverse point mutations may account largely for the phenotypic heterogeneity of G6PD deficiency.

  3. Diverse point mutations in the human glucose-6-phosphate dehydrogenase gene cause enzyme deficiency and mild or severe hemolytic anemia

    Glucose-6-phosphate dehydrogenase deficiency is a common genetic abnormality affecting an estimated 400 million people worldwide. Clinical and biochemical analyses have identified many variants exhibiting a range of phenotypes, which have been well characterized from the hematological point of view. However, until now, their precise molecular basis has remained unknown. The authors have cloned and sequenced seven mutant G6PD alleles. In the nondeficient polymorphic African variant G6PD A they have found a single point mutation. The other six mutants investigated were all associated with enzyme deficiency. The mutations observed show a striking predominance of C → T transitions, with CG doublets involved in four of seven cases. Thus, diverse point mutations may account largely for the phenotypic heterogeneity of G6PD deficiency

  4. Glucose-6-phosphate dehydrogenase deficiency

    ... this page: //medlineplus.gov/ency/article/000528.htm Glucose-6-phosphate dehydrogenase deficiency To use the sharing features on this page, please enable JavaScript. Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a condition ...

  5. A Novel de novo Mutation in the G6PD Gene in a Korean Boy with Glucose-6-phosphate Dehydrogenase Deficiency: Case Report.

    Jang, Mi-Ae; Kim, Ji-Yoon; Lee, Ki-O; Kim, Sun-Hee; Koo, Hong Hoe; Kim, Hee-Jin

    2015-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked recessive hemolytic anemia caused by a mutation in the G6PD gene on Xq28. Herein, we describe a Korean boy with G6PD deficiency resulting from a novel mutation in G6PD. A 20-month-old boy with hemolytic anemia was referred for molecular diagnosis. He had no relevant family history. The G6PD activity was severely decreased at 0.2 U/g Hb (severe deficiency). Direct sequencing analyses on the G6PD gene revealed that he was hemizygous for a novel missense variant, c.1187C>G (p.Pro396Arg), in exon 10 of G6PD. Family study involving his parents revealed the de novo occurrence of the mutation. This is the first report of genetically confirmed G6PD deficiency in Korea. PMID:26275698

  6. Cloning and Sequence Analysis of a Glucose-6-Phosphate Dehydrogenase Gene PsG6PDH from Freezing-tolerant Populus suaveolens

    Lin Yuan-zhen; Lin Shan-zhi; Zhang Wei; Zhang Qian; Zhang Zhi-yi; Guo Huan

    2005-01-01

    A 1207 hp cDNA fragment (PsG6PDH) was amplified by PT-PCR from cold-induced total Pna of the freexing-tolerant P. Suaveolens, using primers based on the highly comserved region of published plant glucose-6-phosphate dehydrogenase (G6PDH)genes. The sepuence analysis showed that PsG6PDH coding region had 1 101 bp and encoded 367 predicted aminoacid residues. Moreover, the nucleotide sequence of psG6PDH showed 83%,82%,79%,79% and 78% identity, and the derived amino acid sequence shared 44.2%,44.7%,42.0%,40.5% and 43.9% identity with those of the Solanum tuberosum, Nicotiana tabacum, Triticum aestivum, Oryxa sativa and Arabidopsis thaliana, respectively. The results show that PsG6PDH is a new member of G6PDH gene family and belongs to cytosolic G6PDH gene. This is the first report on clonign of the G6PDH gene from woody plants.

  7. High Level Expression of Glucose-6-phosphate Dehydrogenase Gene PsG6PDH from Populus suaveolens in E. coli

    2005-01-01

    In order to investigate the functions of the gene PsG6PDH and the mechanisms underlying freezing tolerance of Populus suaveolens, the recombinant expression vector pET-G (pET30a-G6PDH), which contained full encoding region of PsG6PDH gene, was established. The recombinant was identified by lawn-PCR and double enzyme digestion and then transformed into expression host XA90 and induced by isopropyl-a-D-thiogalactoside (IPTG) to express 100 kD polypeptide of G6PDH fusion protein. The results showed that the expressed amount of the fusion protein culminated after 1 mmol·L-1 IPTG treatment for 4 h and that pET-G product was predominately soluble and not extra-cellular secreting.

  8. Two new mutations of the glucose-6-phosphate dehydrogenase (G6PD) gene associated with haemolytic anaemia: clinical, biochemical and molecular relationships.

    Zarza, R; Pujades, A; Rovira, A; Saavedra, R; Fernandez, J; Aymerich, M; Vives Corrons, J L

    1997-09-01

    In two unrelated Spanish males with glucose-6-phosphate dehydrogenase (G6PD) deficiency and haemolytic anaemia, and two different novel point mutations in the G6PD gene, have been identified. A C to T transition at nucleotide 406 resulting in a (136) Arg to Cys substitution and a C to G transition at nucleotide 1155 resulting in a (385) Cys to Trp substitution. These two molecular defects have not been described before and are designated G6PD Valladolid 406 C-->T and G6PD Madrid 1155 C-->G. In vitro biochemical characterization of both mutant enzymes showed important differences in their molecular properties according to their different clinical behaviour. In G6PD Valladolid, the mutation of which is located in exon 5, the normal in vitro heat stability may explain its mild clinical expression (low-grade haemolysis interrupted by an acute haemolytic crisis at age 70). In G6PD Madrid, the mutation, located in exon 10, results in a deficient variant associated with neonatal jaundice and life-long chronic nonspherocytic haemolytic anaemia (CNSHA). This finding further emphasizes the importance of this specific region of the G6PD gene in the stabilization of the G6PD molecule. Putative relationships between these single point mutations and the molecular properties of the mutant enzymes are also discussed. PMID:9332310

  9. The tomato terpene synthase gene family

    V. Falara; T.A. Akhtar; T.T.H. Nguyen; E.A. Spyropoulou; P.M. Bleeker; I. Schauvinhold; Y. Matsuba; M.E. Bonini; A.L. Schilmiller; R.L. Last; R.C. Schuurink; E. Pichersky

    2011-01-01

    Compounds of the terpenoid class play many roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of Solanum lycopersicum (cultivated tomato) contains 40 terpene synthase (TPS) genes, including 28

  10. The tomato terpene synthase gene family

    Falara, V.; Akhtar, T.A.; NGUYEN, T. T. H.; Spyropoulou, E.A.; Bleeker, P.M.; Schauvinhold, I.; Matsuba, Y.; Bonini, M.E.; Schilmiller, A.L.; Last, R.L.; Schuurink, R. C.; Pichersky, E

    2011-01-01

    Compounds of the terpenoid class play many roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of Solanum lycopersicum (cultivated tomato) contains 40 terpene synthase (TPS) genes, including 28 which are functional or potentially functional. Of these 28 TPS genes, 25 were expressed in at least some parts of the plant. The enzymatic functions of eight of the TPS proteins were previously r...

  11. Glucose 6 phosphate dehydrogenase deficiency Review

    Şaşmaz, İlgen

    2009-01-01

    Glucose 6 phosphate dehydrogenase G6PD is the first enzyme of the pentose phosphate pathway providing reducing power to all cells in the form of reduced form of nicotinamide adenine dinucleotide phosphate G6PD deficiency is the most common human enzyme defect being present in more than 400 million people worldwide G6PD deficiency is an X linked hereditary genetic defect caused by mutations in the G6PD gene Clinical presentations include acute hemolytic anemia chronic hemolytic anemia neonatal...

  12. Evaluation on the effectiveness of 2-deoxyglucose-6-phosphate phosphatase (DOGR1) gene as a selectable marker for oil palm (Elaeis guineensis Jacq.) embryogenic calli transformation mediated by Agrobacterium tumefaciens

    Izawati, Abang Masli Dayang; Masani, Mat Yunus Abdul; Ismanizan, Ismail; Parveez, Ghulam Kadir Ahmad

    2015-01-01

    DOGR1, which encodes 2-deoxyglucose-6-phosphate phosphatase, has been used as a selectable marker gene to produce transgenic plants. In this study, a transformation vector, pBIDOG, which contains the DOGR1 gene, was transformed into oil palm embryogenic calli (EC) mediated by Agrobacterium tumefaciens strain LBA4404. Transformed EC were exposed to 400 mg l-1 2-deoxyglucose (2-DOG) as the selection agent. 2-DOG resistant tissues were regenerated into whole plantlets on various regeneration med...

  13. Mutational Analyses of Glucose Dehydrogenase and Glucose-6-Phosphate Dehydrogenase Genes in Pseudomonas fluorescens Reveal Their Effects on Growth and Alginate Production

    Maleki, Susan; Mærk, Mali; Valla, Svein

    2015-01-01

    The biosynthesis of alginate has been studied extensively due to the importance of this polymer in medicine and industry. Alginate is synthesized from fructose-6-phosphate and thus competes with the central carbon metabolism for this metabolite. The alginate-producing bacterium Pseudomonas fluorescens relies on the Entner-Doudoroff and pentose phosphate pathways for glucose metabolism, and these pathways are also important for the metabolism of fructose and glycerol. In the present study, the impact of key carbohydrate metabolism enzymes on growth and alginate synthesis was investigated in P. fluorescens. Mutants defective in glucose-6-phosphate dehydrogenase isoenzymes (Zwf-1 and Zwf-2) or glucose dehydrogenase (Gcd) were evaluated using media containing glucose, fructose, or glycerol. Zwf-1 was shown to be the most important glucose-6-phosphate dehydrogenase for catabolism. Both Zwf enzymes preferred NADP as a coenzyme, although NAD was also accepted. Only Zwf-2 was active in the presence of 3 mM ATP, and then only with NADP as a coenzyme, indicating an anabolic role for this isoenzyme. Disruption of zwf-1 resulted in increased alginate production when glycerol was used as the carbon source, possibly due to decreased flux through the Entner-Doudoroff pathway rendering more fructose-6-phosphate available for alginate biosynthesis. In alginate-producing cells grown on glucose, disruption of gcd increased both cell numbers and alginate production levels, while this mutation had no positive effect on growth in a non-alginate-producing strain. A possible explanation is that alginate synthesis might function as a sink for surplus hexose phosphates that could otherwise be detrimental to the cell. PMID:25746989

  14. Trichinella pseudospiralis vs. T. spiralis thymidylate synthase gene structure and T. pseudospiralis thymidylate synthase retrogene sequence

    Jagielska, Elżbieta; Płucienniczak, Andrzej; Dąbrowska, Magdalena; Dowierciał, Anna; Rode, Wojciech

    2014-01-01

    Background Thymidylate synthase is a housekeeping gene, designated ancient due to its role in DNA synthesis and ubiquitous phyletic distribution. The genomic sequences were characterized coding for thymidylate synthase in two species of the genus Trichinella, an encapsulating T. spiralis and a non-encapsulating T. pseudospiralis. Methods Based on the sequence of parasitic nematode Trichinella spiralis thymidylate synthase cDNA, PCR techniques were employed. Results Each of the respective gene...

  15. Glucose-6-Phosphate Dehydrogenase Deficiency Overview

    ... Drugs GARD Information Navigator FAQs About Rare Diseases Glucose-6-phosphate dehydrogenase deficiency Title Other Names: G6PD ... G6PD deficiency Categories: Newborn Screening Summary Summary Listen Glucose 6 phosphate dehydrogenase (G6PD) deficiency is a hereditary ...

  16. Glucose-6-Phosphate Dehydrogenase Deficiency Overview

    ... Information Center (GARD) Print friendly version Glucose-6-phosphate dehydrogenase deficiency Table of Contents Overview Symptoms Cause ... National Institutes of Health. Overview Listen Glucose 6 phosphate dehydrogenase (G6PD) deficiency is a hereditary condition in ...

  17. Evaluation on the effectiveness of 2-deoxyglucose-6-phosphate phosphatase (DOGR1) gene as a selectable marker for oil palm (Elaeis guineensis Jacq.) embryogenic calli transformation mediated by Agrobacterium tumefaciens

    Izawati, Abang Masli Dayang; Masani, Mat Yunus Abdul; Ismanizan, Ismail; Parveez, Ghulam Kadir Ahmad

    2015-01-01

    DOGR1, which encodes 2-deoxyglucose-6-phosphate phosphatase, has been used as a selectable marker gene to produce transgenic plants. In this study, a transformation vector, pBIDOG, which contains the DOGR1 gene, was transformed into oil palm embryogenic calli (EC) mediated by Agrobacterium tumefaciens strain LBA4404. Transformed EC were exposed to 400 mg l-1 2-deoxyglucose (2-DOG) as the selection agent. 2-DOG resistant tissues were regenerated into whole plantlets on various regeneration media containing the same concentration of 2-DOG. The plantlets were later transferred into soil and grown in a biosafety screenhouse. PCR and subsequently Southern blot analyses were carried out to confirm the integration of the transgene in the plantlets. A transformation efficiency of about 1.0% was obtained using DOGR1 gene into the genome of oil palm. This result demonstrates the potential of using combination of DOGR1 gene and 2-DOG for regenerating transgenic oil palm. PMID:26442041

  18. Population study of 1311 C/T polymorphism of Glucose 6 Phosphate Dehydrogenase gene in Pakistan – an analysis of 715 X-chromosomes

    Naqvi Zulfiqar

    2009-07-01

    Full Text Available Abstract Background Nucleotide 1311 polymorphism at exon 11 of G6PD gene is widely prevalent in various populations of the world. The aim of the study was to evaluate 1311 polymorphism in subjects carrying G6PD Mediterranean gene and in general population living in Pakistan. Results Patients already known to be G6PD deficient were tested for 563C-T (G6PD Mediterranean and 1311 C-T mutation through RFLP based PCR and gene sequencing. A control group not known to be G6PD deficient was tested for 1311C/T only. C-T transition at nt 1311 was detected in 60/234 X-chromosomes with 563 C-T mutation (gene frequency of 0.26 while in 130 of normal 402 X-chromosomes (gene frequency of 0.32. Conclusion We conclude that 1311 T is a frequent polymorphism both in general populations and in subjects with G6PD Mediterranean gene in Pakistan. The prevalence is higher compared to most of the populations of the world. The present study will help in understanding genetic basis of G6PD deficiency in Pakistani population and in developing ancestral links of its various ethnic groups.

  19. Evaluation on the Effectiveness of 2-Deoxyglucose-6-phosphate phosphatase (DOGR1 Gene as a Selectable Marker for Oil Palm (Elaeis guineensis Jacq. Embryogenic Calli Transformation Mediated by Agrobacterium tumefaciens.

    Abang Masli eDayang Izawati

    2015-09-01

    Full Text Available DOGR1, which encodes for 2-deoxyglucose-6-phosphate phosphatase, has been used as a selectable marker gene to produce transgenic plants. In this study, a transformation vector, pBIDOG, which contains the DOGR1 gene, was transformed into oil palm embryogenic calli mediated by Agrobacterium tumefaciens strain LBA4404. Transformed embryogenic calli were exposed to 400 mg l–1 2-deoxyglucose (2-DOG as the selection agent. 2-DOG resistant tissues were regenerated into whole plantlets on various regeneration media containing the same concentration of 2-DOG. The plantlets were later transferred into soil and grown in a biosafety screenhouse. PCR and subsequently Southern blot analyses were carried out to confirm the integration of the transgene in the plantlets. A transformation efficiency of about 1.0% was obtained using DOGR1 gene into the genome of oil palm. This result demonstrates the potential of using combination of DOGR1 gene and 2-DOG for regenerating transgenic oil palm.

  20. Evaluation on the effectiveness of 2-deoxyglucose-6-phosphate phosphatase (DOG(R)1) gene as a selectable marker for oil palm (Elaeis guineensis Jacq.) embryogenic calli transformation mediated by Agrobacterium tumefaciens.

    Izawati, Abang Masli Dayang; Masani, Mat Yunus Abdul; Ismanizan, Ismail; Parveez, Ghulam Kadir Ahmad

    2015-01-01

    DOG(R)1, which encodes 2-deoxyglucose-6-phosphate phosphatase, has been used as a selectable marker gene to produce transgenic plants. In this study, a transformation vector, pBIDOG, which contains the DOG(R)1 gene, was transformed into oil palm embryogenic calli (EC) mediated by Agrobacterium tumefaciens strain LBA4404. Transformed EC were exposed to 400 mg l(-1) 2-deoxyglucose (2-DOG) as the selection agent. 2-DOG resistant tissues were regenerated into whole plantlets on various regeneration media containing the same concentration of 2-DOG. The plantlets were later transferred into soil and grown in a biosafety screenhouse. PCR and subsequently Southern blot analyses were carried out to confirm the integration of the transgene in the plantlets. A transformation efficiency of about 1.0% was obtained using DOG(R)1 gene into the genome of oil palm. This result demonstrates the potential of using combination of DOG(R)1 gene and 2-DOG for regenerating transgenic oil palm. PMID:26442041

  1. An autosomal glucose-6-phosphate dehydrogenase (hexose-6-phosphate dehydrogenase) polymorphism in human saliva.

    Tan, S G; Ashton, G C

    1976-01-01

    Glucose-6-phosphate dehydrogenase (hexose-6-phosphate dehydrogenase) from human saliva has been demonstrated by the zymogram technique. Three phenotypes were found. Family and population studies suggested that these phenotypes are the products of an autosomal locus with two alleles Sgd-1 and Sgd-2. PMID:950237

  2. Glycogen Metabolic Genes Are Involved in Trehalose-6-Phosphate Synthase-Mediated Regulation of Pathogenicity by the Rice Blast Fungus Magnaporthe oryzae

    Badaruddin, Muhammad; Holcombe, Lucy J.; Richard A. Wilson; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.

    2013-01-01

    Author Summary The fungus Magnaporthe oryzae causes a devastating disease of rice called blast. Each year, rice blast disease destroys almost a quarter of the potential global rice harvest. The fungus infects rice plants by elaborating a special infection structure called an appressorium, which physically breaks the tough outer cuticle of a rice leaf. Magnaporthe can develop appressoria in the absence of a nutrient source. We are therefore studying how the fungus utilizes energy stores in its...

  3. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    Edman, U; Edman, J C; Lundgren, B;

    1989-01-01

    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar t...... into plasmid vectors under control of the lac and tac promoters. These constructs direct the synthesis of catalytically active enzyme to the extent of 2% of total soluble protein....

  4. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  5. Expression of the Grifola frondosa Trehalose Synthase Gene and Improvement of Drought-Tolerance in Sugarcane (Saccharum officinarum L.)

    2006-01-01

    Trehalose is a nonreducing disaccharide of glucose that functions as a protectant in the stabilization of biological structures and enhances stress tolerance to abiotic stresses in organisms. We report here the expression of a Grifola frondosa trehalose synthase (TSase) gene for improving drought tolerance in sugarcane (Saccharum officinarum L.). The expression of the transgene was under the control of two tandem copies of the CaMV35S promoter and transferred into sugarcane by Agrobacterium tumefaciens EHA105. The transgenic plants accumulated high levels of trehalose, up to 8.805-12.863 mg/g fresh weight, whereas it was present at undetectable level in nontransgenic plants. It has been reported that transgenic plants transformed with Escherichia coli TPS (trehalose-6-phosphatesynthase) and/or TPP (trehalose-6-phosphate phosphatase) are severely stunted and have root morphologic alterations. Interestingly, our transgenic sugarcane plants had no obvious morphological changes and no growth inhibition in the field. Trehalose accumulation in 35S-35S: TSase plants resulted in increased drought tolerance, as shown by the drought and the drought physiological indexes, such as the rate of bound water/free water, plasma membrane permeability, malondialdehyde content, chlorophyll a and b contents,and activity of SOD and POD of the excised leaves. These results suggest that transgenic plants transformed with the TSase gene can accumulate high levels of trehalose and have enhanced tolerance to drought.

  6. Trehalose 6-phosphate coordinates organic and amino acid metabolism with carbon availability.

    Figueroa, Carlos M; Feil, Regina; Ishihara, Hirofumi; Watanabe, Mutsumi; Kölling, Katharina; Krause, Ursula; Höhne, Melanie; Encke, Beatrice; Plaxton, William C; Zeeman, Samuel C; Li, Zhi; Schulze, Waltraud X; Hoefgen, Rainer; Stitt, Mark; Lunn, John E

    2016-02-01

    Trehalose 6-phosphate (Tre6P) is an essential signal metabolite in plants, linking growth and development to carbon metabolism. The sucrose-Tre6P nexus model postulates that Tre6P acts as both a signal and negative feedback regulator of sucrose levels. To test this model, short-term metabolic responses to induced increases in Tre6P levels were investigated in Arabidopsis thaliana plants expressing the Escherichia coli Tre6P synthase gene (otsA) under the control of an ethanol-inducible promoter. Increased Tre6P levels led to a transient decrease in sucrose content, post-translational activation of nitrate reductase and phosphoenolpyruvate carboxylase, and increased levels of organic and amino acids. Radio-isotope ((14)CO2) and stable isotope ((13)CO2) labelling experiments showed no change in the rates of photoassimilate export in plants with elevated Tre6P, but increased labelling of organic acids. We conclude that high Tre6P levels decrease sucrose levels by stimulating nitrate assimilation and anaplerotic synthesis of organic acids, thereby diverting photoassimilates away from sucrose to generate carbon skeletons and fixed nitrogen for amino acid synthesis. These results are consistent with the sucrose-Tre6P nexus model, and implicate Tre6P in coordinating carbon and nitrogen metabolism in plants. PMID:26714615

  7. Novel terpenes generated by heterologous expression of bacterial terpene synthase genes in an engineered Streptomyces host

    YAMADA, YUUKI; Arima, Shiho; Nagamitsu, Tohru; Johmoto, Kohei; Uekusa, Hidehiro; Eguchi, Tadashi; Shin’ya, Kazuo; Cane, David E.; Ikeda, Haruo

    2015-01-01

    Mining of bacterial genome data has revealed numerous presumptive terpene synthases. Heterologous expression of several putative terpene synthase genes in an engineered Streptomyces host has revealed 13 newly discovered terpenes whose GC-MS and NMR data did not match any known compounds in the spectroscopic databases. Each of the genes encoding the corresponding terpene synthases were silent in their parent microorganisms. Heterologous expression and detailed NMR spectroscopic analysis allowe...

  8. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode polyketides important in pathogenicity. PMID:27388157

  9. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  10. Over-expression of BvMTSH, a fusion gene for maltooligosyltrehalose synthase and maltooligosyltrehalose trehalohydrolase, enhances drought tolerance in transgenic rice.

    Joo, Joungsu; Choi, Hae Jong; Lee, Youn Hab; Lee, Sarah; Lee, Choong Hwan; Kim, Chung Ho; Cheong, Jong-Joo; Choi, Yang Do; Song, Sang Ik

    2014-01-01

    Plant abiotic stress tolerance has been modulated by engineering the trehalose synthesis pathway. However, many stress-tolerant plants that have been genetically engineered for the trehalose synthesis pathway also show abnormal development. The metabolic intermediate trehalose 6-phosphate has the potential to cause aberrations in growth. To avoid growth inhibition by trehalose 6-phosphate, we used a gene that encodes a bifunctional in-frame fusion (BvMTSH) of maltooligosyltrehalose synthase (BvMTS) and maltooligosyltrehalose trehalohydrolase (BvMTH) from the nonpathogenic bacterium Brevibacterium helvolum. BvMTS converts maltooligosaccharides into maltooligosyltrehalose and BvMTH releases trehalose. Transgenic rice plants that over-express BvMTSH under the control of the constitutive rice cytochrome c promoter (101MTSH) or the ABA-inducible Ai promoter (105MTSH) show enhanced drought tolerance without growth inhibition. Moreover, 101MTSH and 105MTSH showed an ABA-hyposensitive phenotype in the roots. Our results suggest that over-expression of BvMTSH enhances drought-stress tolerance without any abnormal growth and showes ABA hyposensitive phenotype in the roots. PMID:24209631

  11. Glucose 6 phosphate dehydrogenase deficiency in adults

    Objective: To determine the frequency of glucose-6-phosphate dehydrogenase (G6PD) deficiency in adults presented with anemia. Subjects and Methods: Eighteen months admission data was reviewed for G6PD deficiency as a cause of anemia. Anemia was defined by world health organization (WHO) criteria as haemoglobin less than 11.3 gm%. G6PD activity was measured by Sigma dye decolorisation method. All patients were screened for complications of hemolysis and its possible cause. Patients with more than 13 years of age were included in the study. Results: Out of 3600 patients admitted, 1440 were found anaemic and 49 as G6PD deficient. So the frequency of G6PD deficiency in anaemic patients was 3.4% and the overall frequency is 1.36%. G6PD deficiency among males and females was three and six percent respectively. Antimalarials and antibiotics containing sulphonamide group were the most common precipitating factors for hemolysis. Anemia and jaundice were the most common presentations while malaria was the most common associated disease. Acute renal failure was the most severe complication occurring in five patients with two deaths. Conclusion: G6PD deficiency is a fairly common cause of anemia with medicine as common precipitating factor for hemolysis. Such complications can be avoided with early recognition of the disease and avoiding indiscriminate use of medicine. (author)

  12. Cloning and characterization of a glucose 6-phosphate/phosphate translocator from Oryza sativa

    姜华武; 佃蔚敏; 刘非燕; 吴平

    2003-01-01

    Plastids of nongreen tissues import carbon as a source of biosynthetic pathways and energy, and glucose 6-phosphate is the preferred hexose phosphate taken up by nongreen plastids. A cDNA clone encoding glucose 6-phosphate/phosphate translocator (GPT) was isolated from a cDNA library of immature seeds of rice and named as OsGPT. The cDNA has one uninterrupted open reading frame encoding a 42 kDa polypeptide possessing transit peptide consisting of 70 amino acid residues. The OsGPT gene maps on chromosome 8 of rice and is linked to the quantitative trait locus for 1000-grain weight. The expression of OsGPT is mainly restricted to heterotrophic tissues. These results suggest that glucose 6-phosphate imported via GPT can be used for starch biosynthesis in rice nongreen plastids.

  13. Trehalose 6-phosphate is required for the onset of leaf senescence associated with high carbon availability.

    Wingler, A.; Delatte, T. L.; O Hara, L. E.; Primavesi, L. F.; Jhurreea, D.; Paul, M. J.; Schluepmann, H.

    2012-01-01

    Trehalose 6-phosphate (T6P) is an important regulator of plant metabolism and development. T6P content increases when carbon availability is high, and in young growing tissue, T6P inhibits the activity of Snf1-related protein kinase (SnRK1). Here, strong accumulation of T6P was found in senescing leaves of Arabidopsis (Arabidopsis thaliana), in parallel with a rise in sugar contents. To determine the role of T6P in senescence, T6P content was altered by expressing the bacterial T6P synthase g...

  14. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    Vestergaard, H; Lund, S; Bjørbaek, C; Pedersen, O

    1995-01-01

    treatment. Ten obese patients with NIDDM were studied before and after 8 weeks of treatment with a weight-maintaining diet in combination with the sulphonylurea gliclazide. Gliclazide treatment was associated with significant reductions in HbA1C (p=0.001) and fasting plasma glucose (p=0.005) as well as...... metabolism (p=0.02) was demonstrated in teh gliclazide-treated patients when compared to pre-treatment values. In biopsies obtained from vastus lateralis muscle during insulin infusion, the half-maximal activation of glycogen synthase was achieved at a significantly lower concentration of the allosteric...... activator glucose 6-phosphate (p=0.01). However, despite significant increases in both insulin-stimulated non-oxidative glucose metabolism and muscle glycogen synthase activation in gliclazide-treated patients no changes were found in levels of glycogen synthase mRNA or immunoreactive protein in muscle. In...

  15. All members in the sphingomyelin synthase gene family have ceramide phosphoethanolamine synthase activity[S

    Ding, Tingbo; Kabir, Inamul; Li, Yue; Lou, Caixia; Yazdanyar, Amirfarbod; Xu, Jiachen; Dong, Jibin; Zhou, Hongwen; Park, Taesik; Boutjdir, Mohamed; Li, Zhiqiang; Jiang, Xian-Cheng

    2015-01-01

    Sphingomyelin synthase-related protein (SMSr) synthesizes the sphingomyelin analog ceramide phosphoethanolamine (CPE) in cells. Previous cell studies indicated that SMSr is involved in ceramide homeostasis and is crucial for cell function. To further examine SMSr function in vivo, we generated Smsr KO mice that were fertile and had no obvious phenotypic alterations. Quantitative MS analyses of plasma, liver, and macrophages from the KO mice revealed only marginal changes in CPE and ceramide a...

  16. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Bechard Matthew E.

    2003-01-01

    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  17. Mannose 6-, fructose 1-, and fructose 6-phosphates inhibit human natural cell-mediated cytotoxicity.

    Forbes, J T; Bretthauer, R. K.; Oeltmann, T N

    1981-01-01

    In vitro human natural cell-mediated cytotoxicity (NCMC) to K-562, Molt-4, and F-265 cells is inhibited in a dose-dependent manner by mannose 6-phosphate, fructose 1-phosphate and fructose 6-phosphate. This inhibition is not observed with mannose, glucose, fucose, glucose 6-phosphate, mannose 1-phosphate, galactose 1-phosphate, or galactose 6-phosphate. Preincubation of the effector cells, obtained from fresh whole blood, with mannose-6-phosphate, fructose-1-phosphate, or fructose-6-phosphate...

  18. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Somerville, Chris R.; Scheible, Wolf

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  19. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  20. Chemical analysis of a genome wide polyketide synthase gene deletion library in Aspergillus nidulans

    Larsen, Thomas Ostenfeld; Klejnstrup, Marie Louise; Nielsen, Jakob Blæsbjerg;

    predicted to encode polyketide synthases have been individually been deleted. This presentation will highlight our recent linking of secondary metabolites in A. nidulans to genes, and in particular describe some recent work on characterization of ANID_6448 and associated genes responsible for biosynthesis...

  1. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    Krath, Britta N.; Hove-Jensen, Bjarne

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca...

  2. Dihydropteroate Synthase and Novel Dihydrofolate Reductase Gene Mutations in Strains of Pneumocystis jirovecii from South Africa

    Robberts, F. J. L.; Chalkley, L J; Weyer, K.; Goussard, P.; Liebowitz, L. D.

    2005-01-01

    Dihydropteroate synthase (DHPS) gene mutations have raised concerns about emerging sulfonamide resistance in Pneumocystis jirovecii. DHPS and dihydrofolate reductase (DHFR) gene products were amplified in clinical specimens from South African patients. One of 53 DHPS genes sequenced contained the double mutation Thr55Ala Pro57Ser. DHFR gene mutations detected were Ala67Val and the new mutations Arg59Gly and C278T.

  3. Isolation and partial characterization of the gene for goose fatty acid synthase.

    Kameda, K; Goodridge, A G

    1991-01-01

    Fatty acid synthase is regulated by diet and hormones, with regulation being primarily transcriptional. In chick embryo hepatocytes in culture, triiodothyronine stimulates accumulation of enzyme and transcription of the gene. Since the 5'-flanking region of this gene is likely involved in hormonal regulation of its expression, we have isolated and partially characterized an avian fatty acid synthase gene. A genomic DNA library was constructed in a cosmid vector and screened with cDNA clones that contained sequence complementary to the 3' end of goose fatty acid synthase mRNA. A genomic clone (approximately 35 kilobase pairs (kb] was isolated, and a 6.5-kb EcoRI fragment thereof contained DNA complementary to the 3' noncoding region of fatty acid synthase mRNA. Additional cosmid libraries were screened with 5' fragments of previously isolated genomic clones, resulting in the isolation of five overlapping cosmid DNAs. The entire region of cloned DNA spans approximately 105 kb. Exon-containing fragments were identified by hybridization with end-labeled poly(A)+ RNA and by hybridization of labeled exon-containing genomic DNA fragments to fatty acid synthase mRNA. A new set of cDNA clones spanning approximately 3.2 kb was isolated from a lambda-ZAP goose liver cDNA library using the 5'-most exon-containing fragment of the 5'-most genomic DNA clone. This region of mRNA contains a 5'-untranslated sequence and a continuous open reading frame which includes a region that codes for the essential cysteine of the beta-ketoacyl synthase domain. The entire fatty acid synthase gene spans about 50 kb. The 5' 15 kb of the gene contain 7 exons. S1 nuclease and primer extension analyses were used to identify a single site for initiation of transcription, 174 nucleotides upstream from the putative translation initiation codon. Putative "TATA" and "CCAAT" boxes are located 28 and 60 base pairs (bp), respectively, upstream of the site of initiation of transcription. The 5'-flanking 597

  4. The chsA gene, encoding a class-I chitin synthase from Ampelomyces quisqualis.

    Weiss, N; Sztejnberg, A; Yarden, O

    1996-02-01

    Degenerate oligodeoxyribonucleotide primers, designed on the basis of conserved regions of the chitin synthase gene family, were used to amplify a fragment of the Ampelomyces quisqualis (Aq) chsA gene. Subsequently, the PCR product was used as a probe in order to identify and isolate genomic clones harboring the entire chsA gene. Aq chsA is 2786-nt long, has one intron and encodes a 910-amino-acid polypeptide belonging to the class-I chitin synthases. Low-stringency Southern hybridizations to Aq genomic DNA provided evidence for the presence of additional DNA fragments resembling chsA in the fungal genome, suggesting the presence of a multigene family of chitin synthases in Aq. PMID:8626074

  5. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. PMID:25688574

  6. Phylogenetic analysis of uroporphyrinogen III synthase (UROS) gene

    Shaik, Abjal Pasha; Alsaeed, Abbas H; Sultana, Asma

    2012-01-01

    The uroporphyrinogen III synthase (UROS) enzyme (also known as hydroxymethylbilane hydrolyase) catalyzes the cyclization of hydroxymethylbilane to uroporphyrinogen III during heme biosynthesis. A deficiency of this enzyme is associated with the very rare Gunther's disease or congenital erythropoietic porphyria, an autosomal recessive inborn error of metabolism. The current study investigated the possible role of UROS (Homo sapiens [EC: 4.2.1.75; 265 aa; 1371 bp mRNA; Entrez Pubmed ref NP_0003...

  7. A cryptic type I polyketide synthase (cpk) gene cluster in Streptomyces coelicolor A3(2)

    Pawlik, Krzysztof; Kotowska, Magdalena; Chater, Keith F.; Kuczek, Katarzyna; Takano, Eriko

    2007-01-01

    The chromosome of Streptomyces coelicolor A3(2), a model organism for the genus Streptomyces, contains a cryptic type I polyketide synthase (PKS) gene cluster which was revealed when the genome was sequenced. The ca. 54-kb cluster contains three large genes, cpkA, cpkB and cpkC, encoding the PKS subunits. In silico analysis showed that the synthase consists of a loading module, five extension modules and a unique reductase as a terminal domain instead of a typical thioesterase. All acyltransf...

  8. Prevalence and Molecular Identification of Mediterranean Glucose-6-Phosphate Dehydrogenase Deficiency in Khuzestan Province, Iran

    SR Kazemi Nezhad; Mashayekhi, A.; SR Khatami; Daneshmand, S; Fahmi, F.; M Ghaderigandmani; MA Jalali-Far

    2009-01-01

    "nBackground: Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most frequent genetic enzymatic disorder in hu­man, which is inherited as an X-linked gene. It encodes a housekeeping enzyme, which is vital for cell survival. Accord­ing to previous investigations, Mediterranean mutation (C563T) of g6pd gene is the most prevalent mutation in some prov­inces of Iran and neighboring countries. We aimed to study the Mediterranean mutation of g6pd gene in Khuzes...

  9. Crystal structure and substrate specificity of D-galactose-6-phosphate isomerase complexed with substrates.

    Woo-Suk Jung

    Full Text Available D-Galactose-6-phosphate isomerase from Lactobacillus rhamnosus (LacAB; EC 5.3.1.26, which is encoded by the tagatose-6-phosphate pathway gene cluster (lacABCD, catalyzes the isomerization of D-galactose-6-phosphate to D-tagatose-6-phosphate during lactose catabolism and is used to produce rare sugars as low-calorie natural sweeteners. The crystal structures of LacAB and its complex with D-tagatose-6-phosphate revealed that LacAB is a homotetramer of LacA and LacB subunits, with a structure similar to that of ribose-5-phosphate isomerase (Rpi. Structurally, LacAB belongs to the RpiB/LacAB superfamily, having a Rossmann-like αβα sandwich fold as has been identified in pentose phosphate isomerase and hexose phosphate isomerase. In contrast to other family members, the LacB subunit also has a unique α7 helix in its C-terminus. One active site is distinctly located at the interface between LacA and LacB, whereas two active sites are present in RpiB. In the structure of the product complex, the phosphate group of D-tagatose-6-phosphate is bound to three arginine residues, including Arg-39, producing a different substrate orientation than that in RpiB, where the substrate binds at Asp-43. Due to the proximity of the Arg-134 residue and backbone Cα of the α6 helix in LacA to the last Asp-172 residue of LacB with a hydrogen bond, a six-carbon sugar-phosphate can bind in the larger pocket of LacAB, compared with RpiB. His-96 in the active site is important for ring opening and substrate orientation, and Cys-65 is essential for the isomerization activity of the enzyme. Two rare sugar substrates, D-psicose and D-ribulose, show optimal binding in the LacAB-substrate complex. These findings were supported by the results of LacA activity assays.

  10. Isoflavone synthase genes in legumes and non-leguminous plants

    Pičmanová, Martina; Koblovská, R.; Lapčík, O.; Honys, David

    Washington, D.C: IEEE Computer Society, 2012 - (Sloan, K.), s. 344-347 ISBN 978-0-7695-4706-0. [International Conference on Biomedical Engineering and Biotechnology /2012/. Macau (CN), 28.05.2012-30.05.2012] R&D Projects: GA ČR GA525/09/0994; GA ČR(CZ) GAP501/11/1462; GA MŠk(CZ) OC10054 Institutional support: RVO:61389030 Keywords : legumes * non-leguminous plants * isoflavone synthase Subject RIV: EF - Botanics

  11. Molecular characterization of glucose-6-phosphate dehydrogenase deficiency in Jeddah, Kingdom of Saudi Arabia

    Azhar Essam

    2011-10-01

    Full Text Available Abstract Background The development of polymerase chain reaction (PCR-based methods for the detection of known mutations has facilitated detecting specific red blood cell (RBC enzyme deficiencies. We carried out a study on glucose-6-phosphate dehydrogenase (G6PD deficient subjects in Jeddah to evaluate the molecular characteristics of this enzyme deficiency and the frequency of nucleotide1311 and IVS-XI-93 polymorphisms in the glucose-6-phosphate dehydrogenase gene. Results A total of 1584 unrelated Saudis (984 neonates and 600 adults were screened for glucose-6-phosphate dehydrogenase deficiency. The prevalence of glucose-6-phosphate dehydrogenase deficiency was 6.9% (n = 110. G6PD Mediterranean mutation was observed in 98 (89.1% cases, G6PD Aures in 11 (10.0% cases, and G6PD Chatham in 1 (0.9% case. None of the samples showed G6PD A‾ mutation. Samples from 29 deficient subjects (25 males and 4 females were examined for polymorphism. The association of two polymorphisms of exon/intron 11 (c.1311T/IVS-XI-93C was observed in 14 (42.4% of 33 chromosomes studied. This association was found in 9 (31.0% carriers of G6PD Mediterranean and in 4 (13.8% carriers of G6PD Aures. Conclusions The majority of mutations were G6PD Mediterranean, followed by G6PD Aures and G6PD Chatham. We conclude that 1311T is a frequent polymorphism in subjects with G6PD Mediterranean and Aures variants in Jeddah.

  12. Allotopic Expression of a Gene Encoding FLAG Tagged-subunit 8 of Yeast Mitochondrial ATP Synthase

    I MADE ARTIKA

    2006-03-01

    Full Text Available Subunit 8 of yeast mitochondrial ATP synthase is a polypeptide of 48 amino acids encoded by the mitochondrial ATP8 gene. A nuclear version of subunit 8 gene has been designed to encode FLAG tagged-subunit 8 fused with a mitochondrial signal peptide. The gene has been cloned into a yeast expression vector and then expressed in a yeast strain lacking endogenous subunit 8. Results showed that the gene was successfully expressed and the synthesized FLAG tagged-subunit 8 protein was imported into mitochondria. Following import, the FLAG tagged-subunit 8 protein assembled into functional mitochondrial ATP synthase complex. Furthermore, the subunit 8 protein could be detected using anti-FLAG tag monoclonal antibody.

  13. PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

    Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

  14. Chromosome mapping of the GD3 synthase gene (SIAT8) in human and mouse

    Matsuda, Yoichi; Saito, Toshiyuki [National Inst. of Radiological Sciences, Chiba (Japan); Nara, Kiyomitsu [Tokyo Metropolitan Inst. of Medical Science (Japan)] [and others

    1996-02-15

    This article reports on the genetic mapping of the human and mouse GD3 synthase gene (SIAT8) using fluorescence in situ hybridization and interspecific backcross analysis. The human gene was localized to human chromosome 12p12.1-p11.2; the mouse homologue was localized to mouse chromosome 6, which has been shown to be syntenic with the short arm of human chromosome 12, suggesting a common evolution. 16 refs., 1 fig.

  15. Gold Nanoparticles Decorated with Mannose-6-phosphate Analogues

    Stéphanie Combemale

    2014-01-01

    Full Text Available Herein, the preparation of neoglycoconjugates bearing mannose-6-phosphate analogues is described by: (a synthesis of a cyclic sulfate precursor to access the carbohydrate head-group by nucleophilic displacement with an appropriate nucleophile; (b introduction of spacers on the mannose-6-phosphate analogues via Huisgen’s cycloaddition, the Julia reaction, or the thiol-ene reaction under ultrasound activation. With the resulting compounds in hand, gold nanoparticles could be functionalized with various carbohydrate derivatives (glycoconjugates and then tested for angiogenic activity. It was observed that the length and flexibility of the spacer separating the sugar analogue from the nanoparticle have little influence on the biological response. One particular nanoparticle system substantially inhibits blood vessel growth in contrast to activation by the corresponding monomeric glycoconjugate, thereby demonstrating the importance of multivalency in angiogenic activity.

  16. Glucose-6-Phosphate Dehydrogenase Deficiency in Nigerian Children

    Olatundun Williams; Daniel Gbadero; Grace Edowhorhu; Ann Brearley; Tina Slusher; Lund, Troy C.

    2013-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzymopathy and in Sub-Saharan Africa, is a significant cause of infection- and drug-induced hemolysis and neonatal jaundice. Our goals were to determine the prevalence of G6PD deficiency among Nigerian children of different ethnic backgrounds and to identify predictors of G6PD deficiency by analyzing vital signs and hematocrit and by asking screening questions about symptoms of hemolysis. We studied 1,122 children (...

  17. Glucose-6-phosphate dehydrogenase deficiency. WHO Working Group.

    1989-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the commonest enzyme disorder of human beings and a globally important cause of neonatal jaundice, which can lead to kernicterus and death or spastic cerebral palsy. It can also lead to life-threatening haemolytic crises in childhood and at later ages, by interacting with specific drugs and with fava beans in the diet. The complications of G6PD deficiency can largely be prevented by education and information, and neonatal jaundice can be ...

  18. Neonatal screening for glucose-6-phosphate dehydrogenase deficiency: sex distribution.

    Kaplan, M.; Hammerman, C; Kvit, R; Rudensky, B; Abramov, A.

    1994-01-01

    Eight hundred and six newborn infants at high risk for glucose-6-phosphate dehydrogenase (G-6-PD) deficiency were screened; 30.2% of the boys and 10.4% of the girls had severe G-6-PD deficiency. Surprisingly, 14% of the enzyme deficient girls had a father from a low risk ethnic group. Girls of high risk mothers should be screened for G-6-PD deficiency regardless of paternal origin.

  19. Cloning and verification of the Lactococcus lactis pyrG gene and characterization of the gene product, CTP synthase

    Wadskov-Hansen, Steen Lyders Lerche; Willemoës, M.; Martinussen, Jan;

    2001-01-01

    The pyrG gene of Lactococcus lactis subsp. cremoris, encoding CTP synthase, has been cloned and sequenced. It is flanked upstream by an open reading frame showing homology to several aminotransferases and downstream by an open reading frame of unknown function. L. lactis strains harboring disrupted...

  20. Glucose and fructose 6-phosphate cycle in humans

    We have determined the rate of glucose cycling by comparing turnovers of [2-3H]- and [6-3H]glucose under basal conditions and during a glucose infusion. Moreover, the activity of the fructose 6-phosphate cycle was assessed by comparing [3-3H]- and [6-3H]glucose. The study included eight lean subjects with normal glucose tolerance. They participated in two randomly performed investigations. In one experiment [2-3H]- and [6-3H]glucose were given simultaneously, while in the other only [3-3H]glucose was given. The basal rate of glucose cycling was 0.32 +/- 0.08 mg X kg-1 X min-1 or 17% of basal glucose production (P less than 0.005). During glucose infusion the activity of endogenous glucose cycling did not change but since glucose production was suppressed it amounted to 130% of glucose production. The basal fructose 6-phosphate cycle could be detected only in three subjects and was suppressed during glucose infusion. In conclusion, the glucose cycle is active in healthy humans both in basal conditions and during moderate hyperglycemia. In some subjects, the fructose 6-phosphate cycle also appears to be active. Thus it is preferable to use [6-3H]glucose rather than [3-3H]glucose when measuring glucose production and particularly when assessing glucose cycle

  1. Maternally transmitted severe glucose 6-phosphate dehydrogenase deficiency is an embryonic lethal

    Longo, Letizia; Vanegas, Olga Camacho; Patel, Meghavi; Rosti, Vittorio; Li, Haiqing; Waka, John; Merghoub, Taha; Pandolfi, Pier Paolo; Notaro, Rosario; Manova, Katia; Luzzatto, Lucio

    2002-01-01

    Mouse chimeras from embryonic stem cells in which the X-linked glucose 6-phosphate dehydrogenase (G6PD) gene had been targeted were crossed with normal females. First-generation (F1) G6PD(+/–) heterozygotes born from this cross were essentially normal; analysis of their tissues demonstrated strong selection for cells with the targeted G6PD allele on the inactive X chromosome. When these F1 G6PD(+/–) females were bred to normal males, only normal G6PD mice were born, because: (i) hemizygous G6...

  2. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  3. Isolation and Molecular Characterization of 1-Aminocyclopropane-1-carboxylic Acid Synthase Genes in Hevea brasiliensis

    Jia-Hong Zhu

    2015-02-01

    Full Text Available Ethylene is an important factor that stimulates Hevea brasiliensis to produce natural rubber. 1-Aminocyclopropane-1-carboxylic acid synthase (ACS is a rate-limiting enzyme in ethylene biosynthesis. However, knowledge of the ACS gene family of H. brasiliensis is limited. In this study, nine ACS-like genes were identified in H. brasiliensis. Sequence and phylogenetic analysis results confirmed that seven isozymes (HbACS1–7 of these nine ACS-like genes were similar to ACS isozymes with ACS activity in other plants. Expression analysis results showed that seven ACS genes were differentially expressed in roots, barks, flowers, and leaves of H. brasiliensis. However, no or low ACS gene expression was detected in the latex of H. brasiliensis. Moreover, seven genes were differentially up-regulated by ethylene treatment. These results provided relevant information to help determine the functions of the ACS gene in H. brasiliensis, particularly the functions in regulating ethylene stimulation of latex production.

  4. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina; Antunes, F; Matos, O

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  5. Transcriptional Modulation of Squalene Synthase Genes in Barley Treated with PGPR

    Anam eYousaf

    2015-09-01

    Full Text Available Phytosterol contents and food quality of plant produce is directly associated with transcription of gene Squalene Synthase (SS. In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27±3°C greenhouse conditions in order to modulate expression of SS gene. Plant samples were analysed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of squalene synthase. Results revealed that among four SS genes (i.e. SSA, SS1, SS2 and SS3, the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43% and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes.

  6. Genetic Transformation of Tobacco with the Trehalose Synthase Gene from Grifola frondosa Fr. Enhances the Resistance to Drought and Salt in Tobacco

    Shu-Zhen ZHANG; Ben-Peng YANG; Cui-Lian FENG; Huo-Long TANG

    2005-01-01

    Trehalose is a non-reducing disaccharide of glucose that functions as a protectant in the stabilization of biological structures and enhances the tolerance of organisms to abiotic stress. In the present study, we report on the expression of the Grifolafrondosa Fr. trehalose synthase (TSase) gene for manipulating abiotic stress tolerance in tobacco (Nicotiana tabaccum L.). The expression of the transgene was under the control of two tandem copies of the CaMV35S promoter and was transferred into tobacco by Agrobacterium tumefaciens EHA105. Compared with non-transgenic plants, transgenic plants were able to accumulate high levels of products of trehalose, which were increased up to 2.126-2.556 mg/g FW, although levels were undetectable in non-transgenic plants. This level of trehalose in transgenic plants was 400-fold higher than that of transgenic tobacco plants cotransformed with Escherichia coli TPS and TPP on independent expression cassettes, twofold higher than that of transgenic rice plants transformed with a bifunctional fusion gene (TPSP) of the trehalose-6-phosphate (T-6-P) synthase (TPS) and T-6-P phosphatase (TPP) of E. coli, and 12-fold higher than that of transgenic tobacco plants transformed the yeast TPS1 gene.It has been reported that transgenic plants with E. coli TPS and/or TPP were severely stunted and had morphological alterations of their roots. Interestingly, our transgenic plants have obvious morphological changes, including thick and deep-coloured leaves, but show no growth inhibition; moreover, these morphological changes can restore to normal type in T2 progenies. Trehalose accumulation in 35S-35S:TSase plants resulted in increased tolerance to drought and salt, as shown by the results of tests on drought, salt tolerance, and drought physiological indices, such as water content in excised leaves, malondialdehyde content, chlorophyll a and b contents, and the activity of superoxide dismutase and peroxidase in excised leaves. These results

  7. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  8. Mannose-6-phosphate regulates destruction of lipid-linked oligosaccharides

    Gao, Ningguo; Shang, Jie; Huynh, Dang; Manthati, Vijaya L.; Arias, Carolina; Harding, Heather P.; Kaufman, Randal J.; Mohr, Ian; Ron, David; Falck, John R.; Lehrman, Mark A.

    2011-01-01

    Mannose-6-phosphate (M6P) is an essential precursor for mannosyl glycoconjugates, including lipid-linked oligosaccharides (LLO; glucose3mannose9GlcNAc2-P-P-dolichol) used for protein N-glycosylation. In permeabilized mammalian cells, M6P also causes specific LLO cleavage. However, the context and purpose of this paradoxical reaction are unknown. In this study, we used intact mouse embryonic fibroblasts to show that endoplasmic reticulum (ER) stress elevates M6P concentrations, leading to clea...

  9. Glucose-6-phosphate dehydrogenase (G6PD) Deficiency

    DD Farhud"; L Yazdanpanah

    2008-01-01

    "nGlucose-6-phosphate dehydrogenase (G6PD) Deficiency is the most prevalent enzymopathy in mankind. It has sex-linked in­heritance. This enzyme exists in all cells.  G6PD deficiency increases the sensitivity of red blood cells to oxidative dam­age. G6PD deficiency was discovered in 1950 when some people suffered hemolytic anemia as a result of taking antimalar­ial drugs (primaquin). Most people with G6PD deficiency do not have any symptoms, till they are ...

  10. Coexpression of glutamine synthetase and carbamoylphosphate synthase I genes in pancreatic hepatocytes of rat.

    Yeldandi, A. V.; X. D. Tan; Dwivedi, R S; Subbarao, V; Smith, D. D.; Scarpelli, D. G.; Rao, M S; Reddy, J K

    1990-01-01

    In the mammalian liver the distribution of ammonia-detoxifying enzymes, glutamine synthetase (GS) and carbamoylphosphate synthase I (ammonia) (CPS-I), is mutually exclusive in that these enzymes are expressed in two distinct populations of hepatocytes that are zonally demarcated in the liver acinus. In the present study we examined the distribution of GS and CPS-I in pancreatic hepatocytes to ascertain if the expression of these two genes in these hepatocytes is also mutually exclusive. Multi...

  11. Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea

    Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A.; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby

    2013-01-01

    Background Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. Methods A pediatric ...

  12. The Polyketide Synthase Gene pks4 of Trichoderma reesei Provides Pigmentation and Stress Resistance

    Atanasova, Lea; Knox, Benjamin P.; Kubicek, Christian P.; Druzhinina, Irina S.; Baker, Scott E.

    2013-01-01

    Species of the fungal genus Trichoderma (Hypocreales, Ascomycota) are well-known for their production of various secondary metabolites. Nonribosomal peptides and polyketides represent a major portion of these products. In a recent phylogenomic investigation of Trichoderma polyketide synthase (PKS)-encoding genes, the pks4 from T. reesei was shown to be an orthologue of pigment-forming PKSs involved in synthesis of aurofusarin and bikaverin in Fusarium spp. In this study, we show that deletion...

  13. Diversifying Selection on Flavanone 3-Hydroxylase and Isoflavone Synthase Genes in Cultivated Soybean and Its Wild Progenitors

    Hao Cheng; Jiao Wang; Shanshan Chu; Hong-Lang Yan; Deyue Yu

    2013-01-01

    Soybean isoflavone synthase (IFS) and flavanone 3-hydroxylase (F3H) are two key enzymes catalyzing the biosynthesis of isoflavonoids and flavonoids, both of which play diverse roles in stress responses. However, little is known about the evolutionary pattern of these genes in cultivated soybean and its wild progenitors. Herein, we investigated the nucleotide polymorphisms in Isoflavone synthase (IFS1, IFS2) and Flavanone 3-hydroxylase (F3H2) genes from 33 soybean accessions, including 17 cult...

  14. Hydroxymethylbilane synthase: Complete genomic sequence and amplifiable polymorphisms in the human gene

    Yoo, Hanwook; Warner, C.A.; Chen, Chiahsiang; Desnick, R.J. (Mount Sinai School of Medicine, New York, NY (United States))

    1993-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error of heme biosynthesis, results from the half-normal activity of the heme biosynthetic enzyme hydroxymethylbilane synthase (HMB-synthase). Heterozygous individuals are prone to life-threatening acute neurologic attacks, which are precipitated by certain drugs and other metabolic, hormonal, and nutritional factors. Since the biochemical diagnosis of heterozygous individuals has been problematic, recent efforts have focused on the identification of mutations and diagnostically useful restriction fragment length polymorphisms (RFLPS) in the HMB-synthase gene. To facilitate these endeavors, the human HMB-synthase gene, including 1.1 kb of the 5[prime] flanking region, was isolated and completely sequenced in both orientations. The 10,024-bp gene contained 15 exons ranging in size from 39 to 438 bp and 14 introns ranging from 87 to 2913 bp. All intron/exon boundaries conformed to the GT/AG consensus rule. There were six Alu repetitive elements, one of the J and five of the Sa subfamilies. Analysis of the 1. I -kb 5[prime]flanking region revealed putative regulatory elements for the housekeeping promoter including AP1, AP4, SP1, TRE, ENH, and CAC. This region contained 10 HpaII sites and had an overall GC content of 54%. Three new polymorphic sites were identified by the single-strand conformation polymorphism (SSCP) technique, a common BsmAI site in intron 3 (3581 A/G), a common HinfI RFLP in intron 10 (7064 C/A), and a rare MnlI site in intron 14 (7998G/A). The allele frequencies of five previously known and the new polymorphic sites in a normal Caucasian population indicated that the intron 1 and intron 3 RFLPs were in linkage disequilibrium; however, the Hint I site segregated independently. 54 refs., 6 figs., 3 tabs.

  15. Cloning and transformation analysis of isoflavone synthase gene into Minshan Trifolium pratense.

    Hu, H H; Jing, C Q; Liu, R; Li, W D; Feng, H G

    2015-01-01

    The aim of this study was to clone the isoflavone synthase (IFS) gene and establish the recombinant Minshan Trifolium pratense. The IFS gene was cloned from the callus of Minshan T. pratense using reverse transcription-polymerase chain reaction. The plant expression vector pRI101-AN-IFS was constructed and introduced into Agrobacterium tumefaciens strain LBA4404, and then screened under cephalosporin. IFS expression was detected by reverse transcription-polymerase chain reaction. The IFS gene was cloned successfully. Sequence analysis indicated that IFS gene had high homology with similar genes from other plants. The IFS-overexpressing callus was obtained by introducing the LBA4404-harboring IFS-pRI101-AN-IFS vector into T. pratense calluses. PMID:26345862

  16. Adaptive evolution of the chrysanthemyl diphosphate synthase gene involved in irregular monoterpene metabolism

    Liu Ping-Li

    2012-11-01

    Full Text Available Abstract Background Chrysanthemyl diphosphate synthase (CDS is a key enzyme in biosynthetic pathways producing pyrethrins and irregular monoterpenes. These compounds are confined to plants of the tribe Anthemideae of the Asteraceae, and play an important role in defending the plants against herbivorous insects. It has been proposed that the CDS genes arose from duplication of the farnesyl diphosphate synthase (FDS gene and have different function from FDSs. However, the duplication time toward the origin of CDS and the evolutionary force behind the functional divergence of the CDS gene are still unknown. Results Two duplication events were detected in the evolutionary history of the FDS gene family in the Asteraceae, and the second duplication led to the origin of CDS. CDS occurred after the divergence of the tribe Mutisieae from other tribes of Asteraceae but before the birth of the Anthemideae tribe. After its origin, CDS accumulated four mutations in sites homologous to the substrate-binding and catalysis sites of FDS. Of these, two sites were involved in the binding of the nucleophilic substrate isopentenyl diphosphate in FDS. Maximum likelihood analyses showed that some sites in CDS were under positive selection and were scattered throughout primary sequences, whereas in the three-dimensional structure model they clustered in the large central cavity. Conclusion Positive selection associated with gene duplication played a major role in the evolution of CDS.

  17. Differential expression of biphenyl synthase gene family members in fire-blight-infected apple 'Holsteiner Cox'.

    Chizzali, Cornelia; Gaid, Mariam M; Belkheir, Asma K; Hänsch, Robert; Richter, Klaus; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola; Liu, Benye; Beerhues, Ludger

    2012-02-01

    Fire blight, caused by the bacterium Erwinia amylovora, is a devastating disease of apple (Malus × domestica). The phytoalexins of apple are biphenyls and dibenzofurans, whose carbon skeleton is formed by biphenyl synthase (BIS), a type III polyketide synthase. In the recently published genome sequence of apple 'Golden Delicious', nine BIS genes and four BIS gene fragments were detected. The nine genes fall into four subfamilies, referred to as MdBIS1 to MdBIS4. In a phylogenetic tree, the BIS amino acid sequences from apple and Sorbus aucuparia formed an individual cluster within the clade of the functionally diverse type III polyketide synthases. cDNAs encoding MdBIS1 to MdBIS4 were cloned from fire-blight-infected shoots of apple 'Holsteiner Cox,' heterologously expressed in Escherichia coli, and functionally analyzed. Benzoyl-coenzyme A and salicoyl-coenzyme A were the preferred starter substrates. In response to inoculation with E. amylovora, the BIS3 gene was expressed in stems of cv Holsteiner Cox, with highest transcript levels in the transition zone between necrotic and healthy tissues. The transition zone was the accumulation site of biphenyl and dibenzofuran phytoalexins. Leaves contained transcripts for BIS2 but failed to form immunodetectable amounts of BIS protein. In cell cultures of apple 'Cox Orange,' expression of the BIS1 to BIS3 genes was observed after the addition of an autoclaved E. amylovora suspension. Using immunofluorescence localization under a confocal laser-scanning microscope, the BIS3 protein in the transition zone of stems was detected in the parenchyma of the bark. Dot-shaped immunofluorescence was confined to the junctions between neighboring cortical parenchyma cells. PMID:22158676

  18. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  19. Glucose-6 phosphate dehydrogenase deficiency and psychotic illness

    Vijender Singh

    2012-01-01

    Full Text Available Mr. T, a 28-year-old unmarried male, a diagnosed case of Glucose-6 Phosphate Dehydrogenase (G6PD deficiency since childhood, presented with 13 years of psychotic illness and disturbed biological functions. He showed poor response to antipsychotics and mood stabilizers and had three prior admissions to Psychiatry. There was a family history of psychotic illness. The General Physical Examination and Systemic Examination were unremarkable. Mental Status Examination revealed increased psychomotor activity, pressure of speech, euphoric affect, prolixity, delusion of persecution, delusion of grandiosity, delusion of control, thought withdrawal and thought insertion, and second and third person auditory hallucinations, with impaired judgment and insight. A diagnosis of schizophrenia paranoid type, with a differential diagnosis of schizoaffective disorder manic subtype, was made. This case is being reported for its rarity and atypicality of clinical presentation, as well as a course of psychotic illness in the G6PD Deficiency state,with its implications on management.

  20. Frostbite: A Novel Presentation of Glucose-6-Phosphate Dehydrogenase Deficiency?

    Bowles, Justin M; Joas, Chris; Head, Steven

    2015-01-01

    Acute hemolytic anemia (AHA) due to glucose 6-phosphate dehydrogenase (G6PD) deficiency has rarely been recognized as a contributor to the development of frostbite. We discuss a case of frostbite in a 32-year-old male Marine with G6PD deficiency during military training on Mount McKinley in Alaska, which eventually led to a permanent disability. In this report, the pathophysiology of G6PD deficiency, the effects of hemolytic anemia, and factors that contribute to frostbite will be discussed, as well as the clinical findings, treatment course, and the outcome of this case. The patient was evacuated and admitted to Alaska Regional Hospital. He was treated for fourth-degree frostbite, ultimately resulting in the complete or partial amputation of all toes. Although it cannot be proved that AHA occurred in this patient, this case potentially adds frostbite to the list of rare but possible clinical presentations of G6PD deficiency. PMID:26360347

  1. Kawasaki disease with Glucose-6-Phosphate Dehydrogenase deficiency, case report.

    Obeidat, Hesham Radi; Al-Dossary, Sahar; Asseri, Abdulsalam

    2015-09-01

    Kawasaki disease (KD) is an acute, self-limited vasculitis of unknown etiology that occurs predominantly in infants and children younger than 5 years of age. Coronary artery abnormalities are the most serious complication. Based on the literatures infusion of Intravenous Immunoglobulin of 2 g/kg and a high dose of oral aspirin up to 100 mg/kg/day are the standard treatment for Kawasaki disease in the acute stage, and should be followed by antiplatelet dose of aspirin for thrombocytosis. Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency is an inherited X-linked hereditary disorder, and aspirin can induce hemolysis in patients with G6PD deficiency. We report a case of a 5 year and 8 month old male with KD and G6PD deficiency. PMID:27134550

  2. Erythrocyte glucose-6-phosphate dehydrogenase from Brazilian opossum Didelphis marsupialis

    Barretto O.C. de O.

    2006-01-01

    Full Text Available In a comparative study of erythrocyte metabolism of vertebrates, the specific activity of glucose-6-phosphate dehydrogenase (G6PD of the Brazilian opossum Didelphis marsupialis in a hemolysate was shown to be high, 207 ± 38 IU g-1 Hb-1 min-1 at 37ºC, compared to the human erythrocyte activity of 12 ± 2 IU g-1 Hb-1 min-1 at 37ºC. The apparent high specific activity of the mixture led us to investigate the physicochemical properties of the opossum enzyme. We report that reduced glutathione (GSH in the erythrocytes was only 50% higher than in human erythrocytes, a value lower than expected from the high G6PD activity since GSH is maintained in a reduced state by G6PD activity. The molecular mass, determined by G-200 Sephadex column chromatography at pH 8.0, was 265 kDa, which is essentially the same as that of human G6PD (260 kDa. The Michaelis-Menten constants (Km: 55 µM for glucose-6-phosphate and nicotinamide adenine dinucleotide phosphate (Km: 3.3 µM were similar to those of the human enzyme (Km: 50-70 and Km: 2.9-4.4, respectively. A 450-fold purification of the opossum enzyme was achieved and the specific activity of the purified enzyme, 90 IU/mg protein, was actually lower than the 150 IU/mg protein observed for human G6PD. We conclude that G6PD after purification from the hemolysate of D. marsupialis does not have a high specific activity. Thus, it is quite probable that the red cell hyperactivity reported may be explained by increased synthesis of G6PD molecules per unit of hemoglobin or to reduced inactivation in the RBC hemolysate.

  3. Erythrocyte glucose-6-phosphate dehydrogenase from Brazilian opossum Didelphis marsupialis.

    Barretto, O C de O; Oshiro, M; Oliveira, R A G; Fedullo, J D L; Nonoyama, K

    2006-05-01

    In a comparative study of erythrocyte metabolism of vertebrates, the specific activity of glucose-6-phosphate dehydrogenase (G6PD) of the Brazilian opossum Didelphis marsupialis in a hemolysate was shown to be high, 207 +/- 38 IU g-1 Hb-1 min-1 at 37 degrees C, compared to the human erythrocyte activity of 12 +/- 2 IU g-1 Hb-1 min-1 at 37 degrees C. The apparent high specific activity of the mixture led us to investigate the physicochemical properties of the opossum enzyme. We report that reduced glutathione (GSH) in the erythrocytes was only 50% higher than in human erythrocytes, a value lower than expected from the high G6PD activity since GSH is maintained in a reduced state by G6PD activity. The molecular mass, determined by G-200 Sephadex column chromatography at pH 8.0, was 265 kDa, which is essentially the same as that of human G6PD (260 kDa). The Michaelis-Menten constants (Km: 55 microM) for glucose-6-phosphate and nicotinamide adenine dinucleotide phosphate (Km: 3.3 microM) were similar to those of the human enzyme (Km: 50-70 and Km: 2.9-4.4, respectively). A 450-fold purification of the opossum enzyme was achieved and the specific activity of the purified enzyme, 90 IU/mg protein, was actually lower than the 150 IU/mg protein observed for human G6PD. We conclude that G6PD after purification from the hemolysate of D. marsupialis does not have a high specific activity. Thus, it is quite probable that the red cell hyperactivity reported may be explained by increased synthesis of G6PD molecules per unit of hemoglobin or to reduced inactivation in the RBC hemolysate. PMID:16648898

  4. Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.

    Meng-Jun Li; Ai-Qin Li; Han Xia; Chuan-Zhi Zhao; Chang-Sheng Li; Shu-Bo Wan; Yu-Ping Bi; Xing-Jun Wang

    2009-06-01

    The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, -ketoacyl-ACP synthase (I, II, III), -ketoacyl-ACP reductase, -hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

  5. Promoter regulatory domain identification of cassava starch synthase IIb gene in transgenic tobacco.

    Guan, Zhihui; Chen, Xin; Xie, Hairong; Wang, Wenquan

    2016-05-01

    Soluble starch synthase is a key enzyme in the starch biosynthesis pathway, and its enzyme activity significantly influences starch components in cassava storage root. However, studies on the regulation mechanism of soluble starch synthase gene are rare. In this study, we cloned the 5' flanking sequence of the MeSSIIb gene and predicted the distribution of cis-elements. The region from -453 to -1 was considered the primary core promoter by the quantitative detection of GUS activity in transgenic tobacco plants containing 5' truncated promoters fused with the GUS gene. Analysis results clarified that the region from -531 to -454 significantly repressed promoter activity. The region from -453 to -388 was a repressive domain of ethylene, and some unknown drought responsive cis-elements were located in the region from -387 to -1. These findings will provide useful information on the functional assay and transcriptional regulation mechanisms of the MeSSIIb gene. PMID:26919397

  6. Diversity of benzyl- and alkylsuccinate synthase genes in hydrocarbon-impacted environments and enrichment cultures.

    Callaghan, Amy V; Davidova, Irene A; Savage-Ashlock, Kristen; Parisi, Victoria A; Gieg, Lisa M; Suflita, Joseph M; Kukor, Jerome J; Wawrik, Boris

    2010-10-01

    Hydrocarbon-degrading microorganisms play an important role in the natural attenuation of spilled petroleum in a variety of anoxic environments. The role of benzylsuccinate synthase (BSS) in aromatic hydrocarbon degradation and its use as a biomarker for field investigations are well documented. The recent discovery of alkylsuccinate synthase (ASS) allows the opportunity to test whether its encoding gene, assA, can serve as a comparable biomarker of anaerobic alkane degradation. Degenerate assA- and bssA-targeted PCR primers were designed in order to survey the diversity of genes associated with aromatic and aliphatic hydrocarbon biodegradation in petroleum-impacted environments and enrichment cultures. DNA was extracted from an anaerobic alkane-degrading isolate (Desulfoglaeba alkenexedens ALDC), hydrocarbon-contaminated river and aquifer sediments, a paraffin-degrading enrichment, and a propane-utilizing mixed culture. Partial assA and bssA genes were PCR amplified, cloned, and sequenced, yielding several novel clades of assA genes. These data expand the range of alkane-degrading conditions for which relevant gene sequences are available and indicate that considerable diversity of assA genes can be found in hydrocarbon-impacted environments. The detection of genes associated with anaerobic alkane degradation in conjunction with the in situ detection of alkylsuccinate metabolites was also demonstrated. Comparable molecular signals of assA/bssA were not found when environmental metagenome databases of uncontaminated sites were searched. These data confirm that the assA gene is a useful biomarker for anaerobic alkane metabolism. PMID:20504044

  7. A trehalose-6-phosphate phosphatase enhances anaerobic germination tolerance in rice.

    Kretzschmar, Tobias; Pelayo, Margaret Anne F; Trijatmiko, Kurniawan R; Gabunada, Lourd Franz M; Alam, Rejbana; Jimenez, Rosario; Mendioro, Merlyn S; Slamet-Loedin, Inez H; Sreenivasulu, Nese; Bailey-Serres, Julia; Ismail, Abdelbagi M; Mackill, David J; Septiningsih, Endang M

    2015-01-01

    Global socioeconomic developments create strong incentives for farmers to shift from transplanted to direct-seeded rice (DSR) as a means of intensification and economization(1). Rice production must increase to ensure food security(2) and the bulk of this increase will have to be achieved through intensification of cultivation, because expansion of cultivated areas is reaching sustainable limits(3). Anaerobic germination tolerance, which enables uniform germination and seedling establishment under submergence(4), is a key trait for the development of tropical DSR varieties(5,6). Here, we identify a trehalose-6-phosphate phosphatase gene, OsTPP7, as the genetic determinant in qAG-9-2, a major quantitative trait locus (QTL) for anaerobic germination tolerance(7). OsTPP7 is involved in trehalose-6-phosphate (T6P) metabolism, central to an energy sensor that determines anabolism or catabolism depending on local sucrose availability(8,9). OsTPP7 activity may increase sink strength in proliferating heterotrophic tissues by indicating low sugar availability through increased T6P turnover, thus enhancing starch mobilization to drive growth kinetics of the germinating embryo and elongating coleoptile, which consequently enhances anaerobic germination tolerance. PMID:27250677

  8. Functional and Biochemical Characterization of Three Recombinant Human Glucose-6-Phosphate Dehydrogenase Mutants: Zacatecas, Vanua-Lava and Viangchan

    Saúl Gómez-Manzo; Jaime Marcial-Quino; America Vanoye-Carlo; Hugo Serrano-Posada; Abigail González-Valdez; Víctor Martínez-Rosas; Beatriz Hernández-Ochoa; Edgar Sierra-Palacios; Rosa Angélica Castillo-Rodríguez; Miguel Cuevas-Cruz; Eduardo Rodríguez-Bustamante; Roberto Arreguin-Espinosa

    2016-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency in humans causes severe disease, varying from mostly asymptomatic individuals to patients showing neonatal jaundice, acute hemolysis episodes or chronic nonspherocytic hemolytic anemia. In order to understand the effect of the mutations in G6PD gene function and its relation with G6PD deficiency severity, we report the construction, cloning and expression as well as the detailed kinetic and stability characterization of three purified clinic...

  9. ATP synthase of yeast mitochondria. Isolation of subunit j and disruption of the ATP18 gene.

    Arnold, I; Pfeiffer, K; Neupert, W; Stuart, R A; Schägger, H

    1999-01-01

    The subunit composition of the mitochondrial ATP synthase from Saccharomyces cerevisiae was analyzed using blue native gel electrophoresis and high resolution SDS-polyacrylamide gel electrophoresis. We report here the identification of a novel subunit of molecular mass of 6,687 Da, termed subunit j (Su j). An open reading frame of 127 base pairs (ATP18), which encodes for Su j, was identified on chromosome XIII. Su j does not display sequence similarity to ATP synthase subunits from other organisms. Data base searches, however, identified a potential homolog from Schizosaccharomyces pombe with 51% identity to Su j of S. cerevisiae. Su j, a small protein of 59 amino acid residues, has the characteristics of an integral inner membrane protein with a single transmembrane segment. Deletion of the ATP18 gene encoding Su j led to a strain (Deltasu j) completely deficient in oligomycin-sensitive ATPase activity and unable to grow on nonfermentable carbon sources. The presence of Su j is required for the stable expression of subunits 6 and f of the F0 membrane sector. In the absence of Su j, spontaneously arising rho- cells were observed that lacked also ubiquinol-cytochrome c reductase and cytochrome c oxidase activities. We conclude that Su j is a novel and essential subunit of yeast ATP synthase. PMID:9867807

  10. Molecular cloning and seasonal expression of oyster glycogen phosphorylase and glycogen synthase genes

    Bacca, Helene; Huvet, Arnaud; Fabioux, Caroline; Daniel, Jean-yves; Delaporte, Maryse; Pouvreau, Stephane; van Wormhoudt, A.; Moal, Jeanne

    2005-01-01

    To investigate the control at the mRNA level of glycogen metabolism in the cupped oyster Crassostrea gigas, we report in the present paper the cloning and characterization of glycogen phosphorylase and synthase cDNAs (Cg-GPH and Cg-GYS, respectively, transcripts of main enzymes for glycogen use and storage), and their first expression profiles depending on oyster tissues and seasons. A strong expression of both genes was observed in the labial palps and the gonad in accordance with specific c...

  11. A transgenic wheat with a stilbene synthase gene resistant to powdery mildew obtained by biolistic method

    2000-01-01

    Stilbene, a kind of phytoalexin, plays an important role in resistance to fungal and bacterial infection in plants. It strongly inhibits the growth of fungi and sprout of spore. Stilbene synthase gene (Vst1) obtained from grapevine has been transferred into common spring wheat Jinghong 5 by using the biolistic transformation method. Five transgenic plants (T0) were obtained from the bombarded 2014 immature embryos. One immune plantlet and 3 plantlets with mid-resistance to powdery mildew were identified from the transgenic plants of T3 generation which came from 2 T0 transgenic plants.

  12. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice

    Zheng, Shigang; Zhao, Shanchang; Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 ...

  13. Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

    Good, Laura Lee

    2001-01-01

    The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

  14. An anther-specific chalcone synthase-like gene D5 related to rice pollen development

    2000-01-01

    It was shown in a previous analysis that D5 gene from rice (Oryza sativa L.) was an anther-specific gene encoding a chalcone synthase-related protein. In this study, D5 gene was found specifically expressed in tapetum cells as well as in the peripheral cells of the vascular bundle of rice anthers by RNA in situ hybridization. In order to study its function, D5 was transformed into rice in both sense and antisense directions driven by a rice Actin 1 promoter. It has been observed that the pollen grains from the antisense D5 transgenic rice plants are abnormal, indicating that D5 plays a critical role in rice pollen development.

  15. Cloning,Characterization,and Gene Annotation of Cellulose Synthase Genes from Arabidopsis thaliana

    BALASUBRAMANI G; AMUDHA J; KATEGERI I S; KHADI B M

    2008-01-01

    @@ The mechanistic basis of cellulose biosynthesis in plants has gained ground during last decade or so.The isolation of plant eDNA clones encoding cotton homologs of the bacterial cellulose synthase catalytic subunit was a significant achievement,which promises the elucidation of cellulose biosynthesis.

  16. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.)

    Fupeng Li; Chaoyun Hao; Lin Yan; Baoduo Wu; Xiaowei Qin; Jianxiong Lai; Yinghui Song

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  17. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family. PMID:26440085

  18. Protein preparation and preliminary X-ray crystallographic analysis of a putative glucosamine 6-phosphate deaminase from Streptococcus mutants

    A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P212121, with unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å

  19. Overexpression, crystallization and preliminary X-ray analysis of xylulose-5-phosphate/fructose-6-phosphate phosphoketolase from Bifidobacterium breve

    Xylulose-5-phosphate/fructose-6-phosphate phosphoketolase from B. breve was overexpressed and crystallized. The crystals belonged to the tetragonal space group I422 and diffracted to beyond 1.7 Å resolution. The xylulose-5-phosphate/fructose-6-phosphate phosphoketolase gene from Bifidobacterium breve was cloned and overexpressed in Escherichia coli. The enzyme was purified to homogeneity and crystallized by the sitting-drop vapour-diffusion method. Crystals were obtained at 293 K using 0.05 mM thiamine diphosphate, 0.25 mM MgCl2, 24%(w/v) PEG 6000 and 0.1 M Bicine pH 9.0. The crystals belonged to the tetragonal space group I422, with unit-cell parameters a = b = 174.8, c = 163.8 Å, and diffracted to beyond 1.7 Å resolution

  20. The gene controlling marijuana psychoactivity: molecular cloning and heterologous expression of Delta1-tetrahydrocannabinolic acid synthase from Cannabis sativa L.

    Sirikantaramas, Supaart; Morimoto, Satoshi; Shoyama, Yoshinari; Ishikawa, Yu; Wada, Yoshiko; Shoyama, Yukihiro; Taura, Futoshi

    2004-09-17

    Delta(1)-tetrahydrocannabinolic acid (THCA) synthase is the enzyme that catalyzes oxidative cyclization of cannabigerolic acid into THCA, the precursor of Delta(1)-tetrahydrocannabinol. We cloned a novel cDNA (GenBank trade mark accession number AB057805) encoding THCA synthase by reverse transcription and polymerase chain reactions from rapidly expanding leaves of Cannabis sativa. This gene consists of a 1635-nucleotide open reading frame, encoding a 545-amino acid polypeptide of which the first 28 amino acid residues constitute the signal peptide. The predicted molecular weight of the 517-amino acid mature polypeptide is 58,597 Da. Interestingly, the deduced amino acid sequence exhibited high homology to berberine bridge enzyme from Eschscholtzia californica, which is involved in alkaloid biosynthesis. The liquid culture of transgenic tobacco hairy roots harboring the cDNA produced THCA upon feeding of cannabigerolic acid, demonstrating unequivocally that this gene encodes an active THCA synthase. Overexpression of the recombinant THCA synthase was achieved using a baculovirus-insect expression system. The purified recombinant enzyme contained covalently attached FAD cofactor at a molar ratio of FAD to protein of 1:1. The mutant enzyme constructed by changing His-114 of the wild-type enzyme to Ala-114 exhibited neither absorption characteristics of flavoproteins nor THCA synthase activity. Thus, we concluded that the FAD binding residue is His-114 and that the THCA synthase reaction is FAD-dependent. This is the first report on molecular characterization of an enzyme specific to cannabinoid biosynthesis. PMID:15190053

  1. Endothelial nitric oxide synthase gene polymorphisms (G894T in diabetes mellitus in Egypt

    El-baz1 ; Farouk2; Tag Eldin2; Ezat2

    2010-06-01

    Full Text Available Objective: Diabetic nephropathy (DN is one of the major microvascular complications of diabetes. Genetic predisposition has been implicated in DN. The eNOS protein synthesizes nitric oxide constitutively via a reaction including the conversion of L-arginine to L-citrulline, which involves the transfer of five electrons provided by nicotinamide adenine dinucleotide phosphate The aim of this study is to evaluate the association of G894T polymorphisms of endothelial nitric oxide synthase(eNOS gene with the development of diabetic nephropathy (DN among Egyptian patients with type 1,2 diabetes mellitus in Egypt. Methods: Study subjects comprised 86 patients of type 2 diabetes with nephropathy,23 patients of type 1 diabetes with nephropathy and 46 patients of type 2 diabetes without nephropathy. G894T genotypes was determined by SSP- PCR analysis. Results: Mutant T allele, GT and TT genotypes of G894TSNP had no significant frequencies in type 1,2 diabetic patients with nephropathy compared to those without nephropathy.. Conclusion: These findings indicate that G894T polymorphism of eNOS gene may be not considered as genetic risk factors for DN among Egyptian type1, 2 diabetic patients. Abbreviations: T2DM: type 2 diabetes mellitus ­ DN: diabetic nephropathy eNOS : Endothelial nitric oxide synthase:­ SNP: single nucleotide polymorphism- SSP-PCR: sequence specific primer- polymerase chain reaction

  2. Molecular analysis of glucose-6-phosphate dehydrogenase variants in the Solomon Islands

    Hirono, A.; Ishii, A.; Hirono, K.; Miwa, S. [National Institute of Health, Tokyo (Japan); Kere, N. [Medical Research and Training Institute, Honiara (Japan); Fujii, H. [Tokyo Women`s Medical College, Tokyo (Japan)

    1995-05-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is one of the most prevalent genetic disorders, and >100 million people are considered to have mutant genes. G6PD deficiency is frequent in the area where plasmodium falciparum infection is endemic, probably because the G6PD-deficient subjects are resistant to the parasite. Falciparum and vivax malarias have been highly endemic in the Solomon Islands, and a high frequency of G6PD deficiency has also been expected. A recent investigation showed that the frequency of G6PD deficiency in the Solomon Islands was 8.4%-14.4%. Although >80 G6PD variants from various populations have been molecularly analyzed, little is known about those in Melanesians. G6PD Maewo, which was originally found in Vanuatu, has so far been the only Melanesian variant whose structural abnormality was determined. 14 refs., 1 fig.

  3. A New Farnesyl Diphosphate Synthase Gene from Taxus media Rehder: Cloning, Characterization and Functional Complementation

    Zhi-Hua Liao; Min Chen; Yi-Fu Gong; Zhu-Gang Li; Kai-Jing Zuo; Peng Wang; Feng Tan; Xiao-Fen Sun; Ke-Xuan Tang

    2006-01-01

    Farnesyl diphosphate synthase (FPS; EC 2.5.1.10) catalyzes the production of 15-carbon farnesyl diphosphate which is a branch-point intermediate for many terpenoids. This reaction is considered to be a ratelimiting step in terpenoid biosynthesis. Here we report for the first time the cloning of a new full-length cDNA encoding farnesyl diphosphate synthase from a gymnosperm plant species, Taxus media Rehder,designated as TmFPS1. The full-length cDNA of TmFPS1 (GenBank accession number: AY461811) was 1 464bp with a 1 056-bp open reading frame encoding a 351-amino acid polypeptide with a calculated molecular weight of 40.3 kDa and a theoretical pl of 5.07. Bioinformatic analysis revealed that TmFPS1 contained all five conserved domains of prenyltransferases, and showed homology to other FPSs of plant origin. Phylogenetic analysis showed that farnesyl diphosphate synthases can be divided into two groups: one of prokaryotic origin and the other of eukaryotic origin. TmFPS1 was grouped with FPSs of plant origin. Homologybased structural modeling showed that TmFPS1 had the typical spatial structure of FPS, whose most prominent structural feature is the arrangement of 13 core helices around a large central cavity in which the catalytic reaction takes place. Our bioinformatic analysis strongly suggests that TmFPS1 is a functional gene. Southern blot analysis revealed that TmFPS1 belongs to a small FPS gene family in T. media. Northern blot analysis indicated that TmFPS1 is expressed in all tested tissues, including the needles, stems and roots of T. media. Subsequently, functional complementation with TmFPS1 in a FPS-deficient mutant yeast demonstrated that TmFPS1 did encode farnesyl diphosphate synthase, which rescued the yeast mutant.This study will be helpful in future investigations aiming at understanding the detailed role of FPS in terpenoid biosynthesis flux control at the molecular genetic level.

  4. Lanosterol Synthase Gene Polymorphisms and Changes in Endogenous Ouabain in the Response to Low Sodium Intake.

    Lanzani, Chiara; Gatti, Guido; Citterio, Lorena; Messaggio, Elisabetta; Delli Carpini, Simona; Simonini, Marco; Casamassima, Nunzia; Zagato, Laura; Brioni, Elena; Hamlyn, John M; Manunta, Paolo

    2016-02-01

    Circulating levels of endogenous ouabain (EO), a vasopressor hormone of adrenocortical origin, are increased by sodium depletion. Furthermore, lanosterol synthase, an enzyme involved in cholesterol biosynthesis, has a missense polymorphism (rs2254524 V642L) that affects EO biosynthesis in adrenocortical cells. Here, we investigated the hypothesis that lanosterol synthase rs2254524 alleles in vivo impact the blood pressure (BP) and EO responses evoked by a low dietary Na intake (mEq/d, 2 weeks) among patients with mild essential hypertension. During the low salt diet, the declines in both systolic BP (SBP: -8.7±1.7 versus -3.0±1.5; P=0.013) and diastolic BP (DBP: -5.1±0.98 versus -1.4±0.94 mm Hg; PmEq/mm Hg/24 h; P=0.028). In addition, BP rose in ≈25% of the patients in response to the low salt diet and this was associated with increased circulating EO. Lanosterol synthase gene polymorphisms influence both the salt sensitivity of BP and changes in circulating EO in response to a low salt diet. The response of BP and EO to the low salt diet is markedly heterogeneous. Approximately 25% of patients experienced adverse effects, that is, increased BP and EO when salt intake was reduced and may be at increased long-term risk. The augmented response of EO to the low salt diet further supports the view that adrenocortical function is abnormal in some essential hypertensives. PMID:26667413

  5. Associations between nitric oxide synthase genes and exhaled NO-related phenotypes according to asthma status.

    Emmanuelle Bouzigon

    Full Text Available BACKGROUND: The nitric oxide (NO pathway is involved in asthma, and eosinophils participate in the regulation of the NO pool in pulmonary tissues. We investigated associations between single nucleotide polymorphisms (SNPs of NO synthase genes (NOS and biological NO-related phenotypes measured in two compartments (exhaled breath condensate and plasma and blood eosinophil counts. METHODOLOGY: SNPs (N = 121 belonging to NOS1, NOS2 and NOS3 genes were genotyped in 1277 adults from the French Epidemiological study on the Genetics and Environment of Asthma (EGEA. Association analyses were conducted on four quantitative phenotypes: the exhaled fraction of NO (Fe(NO, plasma and exhaled breath condensate (EBC nitrite-nitrate levels (NO2-NO3 and blood eosinophils in asthmatics and non-asthmatics separately. Genetic heterogeneity of these phenotypes between asthmatics and non-asthmatics was also investigated. PRINCIPAL FINDINGS: In non-asthmatics, after correction for multiple comparisons, we found significant associations of Fe(NO levels with three SNPs in NOS3 and NOS2 (P ≤ 0.002, and of EBC NO2-NO3 level with NOS2 (P = 0.002. In asthmatics, a single significant association was detected between Fe(NO levels and one SNP in NOS3 (P = 0.004. Moreover, there was significant heterogeneity of NOS3 SNP effect on Fe(NO between asthmatics and non-asthmatics (P = 0.0002 to 0.005. No significant association was found between any SNP and NO2-NO3 plasma levels or blood eosinophil counts. CONCLUSIONS: Variants in NO synthase genes influence Fe(NO and EBC NO2-NO3 levels in adults. These genetic determinants differ according to asthma status. Significant associations were only detected for exhaled phenotypes, highlighting the critical relevance to have access to specific phenotypes measured in relevant biological fluid.

  6. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice

    Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C) or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering. PMID:26302213

  7. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice.

    Shigang Zheng

    Full Text Available Resveratrol (Res is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS, existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering.

  8. Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2

    Bhubalan, K.

    2010-01-01

    Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.

  9. 21 CFR 864.7360 - Erythrocytic glucose-6-phosphate dehydrogenase assay.

    2010-04-01

    ... assay. 864.7360 Section 864.7360 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND... § 864.7360 Erythrocytic glucose-6-phosphate dehydrogenase assay. (a) Identification. An erythrocytic glucose-6-phosphate dehydrogenase assay is a device used to measure the activity of the enzyme...

  10. Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

    The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

  11. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

    Yue Ming

    2009-06-01

    Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

  12. Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis.

    Sanjari, Sepideh; Shobbar, Zahra Sadat; Ebrahimi, Mohsen; Hasanloo, Tahereh; Sadat-Noori, Seyed-Ahmad; Tirnaz, Soodeh

    2015-12-01

    Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of CHS encoding genes in milk thistle plant can be of great importance. In the current research, fragments of CHS genes were amplified using degenerate primers based on the conserved parts of Asteraceae CHS genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of CHS gene family,SmCHS1 and SmCHS2. Third member, full-length cDNA (SmCHS3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants.Real-time PCR analysis indicated that SmCHS1 and SmCHS3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis. PMID:26690515

  13. Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis

    Sepideh Sanjari; Zahra Sadat Shobbar; Mohsen Ebrahimi; Tahereh Hasanloo; Seyed-Ahmad Sadat-Noor; Soodeh Tirnaz

    2015-12-01

    Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of gene family, 1 and 2. Third member, full-length cDNA (3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants. Real-time PCR analysis indicated that 1 and 3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis.

  14. Molecular cloning and expression profiling of a chalcone synthase gene from Lamiophlomis rotata

    Qiao Feng; Geng Gui-Gong; Zeng Yang; Xie Hui-Chun; Jin Lan; Shang Jun; Chen Zhi

    2015-06-01

    Lamiophlomis rotata is a renowned Chinese medicinal plant. Chalcone synthase (CHS) is important in flavonoid and isoflavonoid biosynthesis, catalysing the formation of naringenin chalcone in plants. A full-length cDNA encoding the CHS gene was cloned from L. rotata based on the highly conserved CHS gene sequences of Labiatae plants. A blast search showed its homology (named LrCHS) with other CHS genes of Labiate plants. The full-length genomic DNA of LrCHS was 2026 bp with one intron of 651 bp, two exons of 178 bp and 998 bp, flanked by a 73 bp $5'$-UTR and a 126 bp $3'$-UTR. The cDNA sequence of the LrCHS gene had an 1176 bp open reading frame encoding a 391 amino acid protein of 42,798 Da. The CHS protein predicted from L. rotata showed 79–86% identity with CHS of other plant species. We conducted a phylogenetic analysis of nine families containing 48 plants and L. rotata based on the full amino acid sequences of CHS proteins. Consequently, LrCHS was located in the Labiatae branch. Additionally, we examined LrCHS gene expression patterns in different tissues by quantitative real-time PCR with specific primers. The expression analysis showed preferential expression of LrCHS in flowers and leaves during the flowering stage. Total flavonoid content and CHS gene expression exhibited similar patterns during L. rotata organ development. In agreement with its function as an elicitor-responsive gene, LrCHS expression was coordinated by methyl jasmonate and UV light, and induced between 6 and 18 h. These results provide a molecular basis for additional functional studies of LrCHS in L. rotata.

  15. Phylogenetic diversification of glycogen synthase kinase 3/SHAGGY-like kinase genes in plants

    Soltis Pamela S

    2006-02-01

    Full Text Available Abstract Background The glycogen synthase kinase 3 (GSK3/SHAGGY-like kinases (GSKs are non-receptor serine/threonine protein kinases that are involved in a variety of biological processes. In contrast to the two members of the GSK3 family in mammals, plants appear to have a much larger set of divergent GSK genes. Plant GSKs are encoded by a multigene family; analysis of the Arabidopsis genome revealed the existence of 10 GSK genes that fall into four major groups. Here we characterized the structure of Arabidopsis and rice GSK genes and conducted the first broad phylogenetic analysis of the plant GSK gene family, covering a taxonomically diverse array of algal and land plant sequences. Results We found that the structure of GSK genes is generally conserved in Arabidopsis and rice, although we documented examples of exon expansion and intron loss. Our phylogenetic analyses of 139 sequences revealed four major clades of GSK genes that correspond to the four subgroups initially recognized in Arabidopsis. ESTs from basal angiosperms were represented in all four major clades; GSK homologs from the basal angiosperm Persea americana (avocado appeared in all four clades. Gymnosperm sequences occurred in clades I, III, and IV, and a sequence of the red alga Porphyra was sister to all green plant sequences. Conclusion Our results indicate that (1 the plant-specific GSK gene lineage was established early in the history of green plants, (2 plant GSKs began to diversify prior to the origin of extant seed plants, (3 three of the four major clades of GSKs present in Arabidopsis and rice were established early in the evolutionary history of extant seed plants, and (4 diversification into four major clades (as initially reported in Arabidopsis occurred either just prior to the origin of the angiosperms or very early in angiosperm history.

  16. Glucose-6-phosphate dehydrogenase deficiency in Nigerian children.

    Olatundun Williams

    Full Text Available Glucose-6-phosphate dehydrogenase (G6PD deficiency is the most common human enzymopathy and in Sub-Saharan Africa, is a significant cause of infection- and drug-induced hemolysis and neonatal jaundice. Our goals were to determine the prevalence of G6PD deficiency among Nigerian children of different ethnic backgrounds and to identify predictors of G6PD deficiency by analyzing vital signs and hematocrit and by asking screening questions about symptoms of hemolysis. We studied 1,122 children (561 males and 561 females aged 1 month to 15 years. The mean age was 7.4 ± 3.2 years. Children of Yoruba ethnicity made up the largest group (77.5% followed by those Igbo descent (10.6% and those of Igede (10.2% and Tiv (1.8% ethnicity. G6PD status was determined using the fluorescent spot method. We found that the overall prevalence of G6PD deficiency was 15.3% (24.1% in males, 6.6% in females. Yoruba children had a higher prevalence (16.9% than Igede (10.5%, Igbo (10.1% and Tiv (5.0% children. The odds of G6PD deficiency were 0.38 times as high in Igbo children compared to Yoruba children (p=0.0500. The odds for Igede and Tiv children were not significantly different from Yoruba children (p=0.7528 and 0.9789 respectively. Mean oxygen saturation, heart rate and hematocrit were not significantly different in G6PD deficient and G6PD sufficient children. The odds of being G6PD deficient were 2.1 times higher in children with scleral icterus than those without (p=0.0351. In conclusion, we determined the prevalence of G6PD deficiency in Nigerian sub-populations. The odds of G6PD deficiency were decreased in Igbo children compared to Yoruba children. There was no association between vital parameters or hematocrit and G6PD deficiency. We found that a history of scleral icterus may increase the odds of G6PD deficiency, but we did not exclude other common causes of icterus such as sickle cell disease or malarial infection.

  17. Glucose-6-phosphate dehydrogenase deficiency in Nigerian children.

    Williams, Olatundun; Gbadero, Daniel; Edowhorhu, Grace; Brearley, Ann; Slusher, Tina; Lund, Troy C

    2013-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzymopathy and in Sub-Saharan Africa, is a significant cause of infection- and drug-induced hemolysis and neonatal jaundice. Our goals were to determine the prevalence of G6PD deficiency among Nigerian children of different ethnic backgrounds and to identify predictors of G6PD deficiency by analyzing vital signs and hematocrit and by asking screening questions about symptoms of hemolysis. We studied 1,122 children (561 males and 561 females) aged 1 month to 15 years. The mean age was 7.4 ± 3.2 years. Children of Yoruba ethnicity made up the largest group (77.5%) followed by those Igbo descent (10.6%) and those of Igede (10.2%) and Tiv (1.8%) ethnicity. G6PD status was determined using the fluorescent spot method. We found that the overall prevalence of G6PD deficiency was 15.3% (24.1% in males, 6.6% in females). Yoruba children had a higher prevalence (16.9%) than Igede (10.5%), Igbo (10.1%) and Tiv (5.0%) children. The odds of G6PD deficiency were 0.38 times as high in Igbo children compared to Yoruba children (p=0.0500). The odds for Igede and Tiv children were not significantly different from Yoruba children (p=0.7528 and 0.9789 respectively). Mean oxygen saturation, heart rate and hematocrit were not significantly different in G6PD deficient and G6PD sufficient children. The odds of being G6PD deficient were 2.1 times higher in children with scleral icterus than those without (p=0.0351). In conclusion, we determined the prevalence of G6PD deficiency in Nigerian sub-populations. The odds of G6PD deficiency were decreased in Igbo children compared to Yoruba children. There was no association between vital parameters or hematocrit and G6PD deficiency. We found that a history of scleral icterus may increase the odds of G6PD deficiency, but we did not exclude other common causes of icterus such as sickle cell disease or malarial infection. PMID:23874768

  18. Purification and Characteristics of Sorbitol-6-phosphate Dehydrogenase from Loquat Leaves.

    Hirai, M

    1981-02-01

    To study the role of sorbitol-6-phosphate dehydrogenase in sorbitol synthesis in leaves of Rosaceous plants, properties of the enzyme and its presence in several plants in the family was investigated. The activity of the enzyme, which catalyzes an NADP-dependent oxidation of the substrate to glucose-6-phosphate, was detected in leaves of Prunus mume, Prunus persica, Rhaphiolepsis indica, Sorbus aucuparia, Cydonia oblonga, Photinia glabra, Sorbaria kirilowii, and Spiraea thunbergii.The enzyme was purified about 60-fold from leaves of loquat (Eriobotrya japonica) using affinity chromatography with Blue Sepharose. Neither mannitol-1-phosphate nor fructose-6-phosphate served as substrate. Molecular weight of the enzyme was calculated to be 65,000 at pH 8.0 by gel filtration. Since sodium dodecyl sulfate-polyacrylamide gel electrophoresis showed a peptide of 33,000 daltons, the enzyme was assumed to be a dimer at pH 8.0 K(m) values for sorbitol-6-phosphate, glucose-6-phosphate, NADP, and NADPH were 2.22 millimolar, 11.6 millimolar, 13.5 micromolar, and 1.61 micromolar, respectively. Equilibrium constant for sorbitol-6-phosphate oxidation was 5.12 x 10(-10). Optimal pH for sorbitol-6-phosphate oxidation was 9.8. The enzyme showed its maximum activity within a broad pH range between 7 and 9 for glucose-6-phosphate reduction. The enzyme was more effective in the direction of glucose-6-phosphate reduction than in the reverse direction at neutral pH. Thus, it is suggested that the enzyme catalyzes sorbitol synthesis from glucose-6-phosphate during photosynthesis in leaves of Rosaceous plants. PMID:16661650

  19. Molecular Cloning and Characterization of Citrate Synthase Gene in Rice( Oryza sativa)

    ZHANG Shan-shan; MING Feng; LU Qun; GUO Bin; SHEN Da-leng

    2005-01-01

    The full-length OsCS encoding citrate synthase was isolated from rice (Oryza sativa L. subsp. japonica). OsCS is 1477-bp long and encodes a 474 amino acid polypeptide. Its putative protein sequence is highly identical to Daucus carota, Nicotiana tabacum,Beta vulgaris subsp., Arabidopsis thaliana, and Citrus junos (>70%). The deduced amino-terminal sequence of OsCS showes characteristics of mitochondrial targeting signal. Southern blot analysis using ORF of the OsCS as the probe indicated that this gene exists in multiple copies in rice genome. The band with predicated size of 82 kD was detected by Western blot after being induced by 0.4 mmol/L IPTG.

  20. Mutational Analysis of Pneumocystis jirovecii Dihydropteroate Synthase and Dihydrofolate Reductase Genes in HIV-Infected Patients in China

    Deng, Xilong; Zhuo, Li; Lan, Yun; Dai, Zhaoxia; Chen, Wan-shan; Cai, Weiping; Kovacs, Joseph A.; Ma, Liang; Tang, Xiaoping

    2014-01-01

    We investigated Pneumocystis jirovecii dihydropteroate synthase (DHPS) and dihydrofolate reductase (DHFR) genes for mutations in 25 Chinese HIV-infected patients with P. jirovecii pneumonia. We identified DHPS mutations in 3 (12%) patients and DHFR mutations in 1 (4%) patient. The prevalence of DHPS and DHFR mutations in China remains low, as it does in other developing countries.

  1. Effect of estrogen on gene expression of fatty acid synthase in periosteum

    ZHENG Rui-min; LIN Shou-qing; LIU Yong; HUANG Man-ting; GONG Wei-yan; WU Zhi-hong

    2009-01-01

    Background Estrogen deficiency contributes to postmenopausal osteoporosis.Periosteum might be a potential target of estrogen,but the underlying mechanism at gene level is far from being elucidated.The objective of this study was to investigate the correlation between estrogen and fatty acid synthase(FAS)expression in periosteum.Methods Human periosteum cells were cultured in vitro.Expressed genes in the substrated cDNA library were verified using semi-quantitative PCR and real-time PCR.The expression of FAS in periosteum of ovarectomized(OVX)SD rats was investigated.Results FAS gene was most significantly expressed in the subtracted cDNA library of periosteal cells screened by semi-quantitative PCR.Low FAS expression was verified by real-time PCR in the estrogen exposed human periosteum rather than in the control.The estradiol levels were(20.81±12.62)pg/ml,(19.64±4.35)pg/ml and(13.47+1.84)pg/ml in the sham group,the control,and the OVX group,respectively.The estradiol levels in the OVX group was significantly lower(P=0.0386).The FAS gene expression in periosteum in the OVX group,sham group,and control group was 3.09±1.97,1.33±0.47 and 1.51±1.32,respectively.The gene expression in the OVX group was significantly higher (P=0.0372).Conclusion Estrogen modulates FAS gene expression in in vitro human perisoteum as well as in in vivo rat periosteum.

  2. Expression of an (E)-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Xiudao Yu; Yongjun Zhang; Youzhi Ma; Zhaoshi Xu; Genping Wang; Lanqin Xia

    2013-01-01

    Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E)-β-farnesene (EβF) is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piper...

  3. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  4. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Jianrong Wang

    2014-12-01

    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  5. Callose Synthase Family Genes Involved in the Grapevine Defense Response to Downy Mildew Disease.

    Yu, Ying; Jiao, Li; Fu, Shufang; Yin, Ling; Zhang, Yali; Lu, Jiang

    2016-01-01

    The deposition of callose is a common plant defense response to intruding pathogens and part of the plant's innate immunity. In this study, eight grapevine callose synthase (CalS) genes were identified and characterized. To investigate biological function of CalS in grapevine against the infection of Plasmopara viticola, expression patterns of grapevine CalS family genes were analyzed among resistant/susceptible cultivars. After P. viticola infection, expression of CalS1, 3, 7, 8, 9, 10, and 11 were significantly modified among the grapevine cultivars. For example, the expression of CalS1 and CalS10 were greatly increased in downy mildew (DM)-immune Muscadinia rotundifolia 'Carlos' and 'Noble'. Transient expression assay with promoters of the CalS1 and CalS10 genes confirmed that they were regulated by the oomycete pathogen P. viticola. CalS1 promoter activity was also significantly up-regulated by ABA in DM-immune M. rotundifolia 'Noble', but down-regulated in DM-susceptible Vitis vinifera 'Chardonnay'. The CalS1 promoter, however, was also down-regulated by GA in 'Chardonnay', but not affected in 'Noble'. The promoter activity of CalS10 was significantly up-regulated by GA in 'Chardonnay', but not regulated by ABA at all. It is proposed that CalS1 and CalS10 were involved in grapevine defense against DM disease. PMID:26474330

  6. Relationship Between Polymorphism of Cystathionine beta Synthase Gene and Congenital Heart Disease in Chinese Nuclear Families

    XIAO-MING SONG; XIAO-YING ZHENG; WEN-LI ZHU; LEI HUANG; YONG LI

    2006-01-01

    Objective To study the relationship between polymorphism of cystathionine beta synthase (CBS) gene and development of congenital heart disease (CHD). Methods One hundred and twenty-seven CHD case-parent triads were recruited from Liaoning Province as patient group, and 129 healthy subjects without family history of birth defect were simultaneously recruited as control group together with their biological parents. For all subjects the polymorphism of CBS gene G919A locus was examined by PCR-ARMS method. Results The frequencies of three genotypes (w/w, w/m, and m/m) in control group were 27.2%, 58.4%, and 14.4%, respectively, with no significant difference in gender. A significant difference in the allele frequency was found between CHD patients and controls, the wild allele frequency was 67.9% in patients and 55.7% in controls.CHD parents' genotype distribution was significantly different from that in controls. Further comparison of each type of CHD showed that genotype frequencies in several CHD subtypes were significantly different from those in their corresponding controls. The results of TDT analysis showed that no allele transmission disequilibrium existed in CHD nuclear families.Conclusions CBS gene G919A mutation is associated with the development of CHD, and the mutated allele may decrease the risk of CHD.

  7. Molecular identity and gene expression of aldosterone synthase cytochrome P450

    11β-Hydroxylase (CYP11B1) of bovine adrenal cortex produced corticosterone as well as aldosterone from 11-deoxycorticosterone in the presence of the mitochondrial P450 electron transport system. CYP11B1s of pig, sheep, and bullfrog, when expressed in COS-7 cells, also performed corticosterone and aldosterone production. Since these CYP11B1s are present in the zonae fasciculata and reticularis as well as in the zona glomerulosa, the zonal differentiation of steroid production may occur by the action of still-unidentified factor(s) on the enzyme-catalyzed successive oxygenations at C11- and C18-positions of steroid. In contrast, two cDNAs, one encoding 11β-hydroxylase and the other encoding aldosterone synthase (CYP11B2), were isolated from rat, mouse, hamster, guinea pig, and human adrenals. The expression of CYP11B1 gene was regulated by cyclic AMP (cAMP)-dependent signaling, whereas that of CYP11B2 gene by calcium ion-signaling as well as cAMP-signaling. Salt-inducible protein kinase, a cAMP-induced novel protein kinase, was one of the regulators of CYP11B2 gene expression

  8. Genomic Distance between Thymidylate Synthase and Dihydrofolate Reductase Genes Does Not Correlate With Phylogenetic Evolution in Bacteria

    Vitor Hugo Moreau

    2010-01-01

    Problem statement: Dihydrofolate Reductase (DHFR) and Thymidylate Synthase (TS) exist as bifunctional enzymes coded into unique polypeptide chain in protozoans. Bifunctional DHFR-TS is associated with an increase in the enzymatic activity by channeling the substrate between the active sites. In some bacteria, DHFR and TS genes are neighbors in the genome, whereas in others, they are located millions of base pairs apart. Gene neighboring gained importance in evolution because it was found to p...

  9. Acid sphingomyelinase gene knockout ameliorates hyperhomocysteinemic glomerular injury in mice lacking cystathionine-β-synthase.

    Krishna M Boini

    Full Text Available Acid sphingomyelinase (ASM has been implicated in the development of hyperhomocysteinemia (hHcys-induced glomerular oxidative stress and injury. However, it remains unknown whether genetically engineering of ASM gene produces beneficial or detrimental action on hHcys-induced glomerular injury. The present study generated and characterized the mice lacking cystathionine β-synthase (Cbs and Asm mouse gene by cross breeding Cbs(+/- and Asm(+/- mice. Given that the homozygotes of Cbs(-/-/Asm(-/- mice could not survive for 3 weeks. Cbs(+/-/Asm(+/+, Cbs(+/-/Asm(+/- and Cbs(+/-/Asm(-/- as well as their Cbs wild type littermates were used to study the role of Asm(-/- under a background of Cbs(+/- with hHcys. HPLC analysis revealed that plasma Hcys level was significantly elevated in Cbs heterozygous (Cbs(+/- mice with different copies of Asm gene compared to Cbs(+/+ mice with different Asm gene copies. Cbs(+/-/Asm(+/+ mice had significantly increased renal Asm activity, ceramide production and O(2.(- level compared to Cbs(+/+/Asm(+/+, while Cbs(+/-/Asm(-/- mice showed significantly reduced renal Asm activity, ceramide production and O(2.(- level due to increased plasma Hcys levels. Confocal microscopy demonstrated that colocalization of podocin with ceramide was much lower in Cbs(+/-/Asm(-/- mice compared to Cbs(+/-/Asm(+/+ mice, which was accompanied by a reduced glomerular damage index, albuminuria and proteinuria in Cbs(+/-/Asm(-/- mice. Immunofluorescent analyses of the podocin, nephrin and desmin expression also illustrated less podocyte damages in the glomeruli from Cbs(+/-/Asm(-/- mice compared to Cbs(+/-/Asm(+/+ mice. In in vitro studies of podocytes, hHcys-enhanced O(2.(- production, desmin expression, and ceramide production as well as decreases in VEGF level and podocin expression in podocytes were substantially attenuated by prior treatment with amitriptyline, an Asm inhibitor. In conclusion, Asm gene knockout or corresponding enzyme

  10. Endothelial nitric oxide synthase gene polymorphism is associated with sickle cell disease patients in India.

    Nishank, Sudhansu Sekhar; Singh, Mendi Prema Shyam Sunder; Yadav, Rajiv; Gupta, Rasik Bihari; Gadge, Vijay Sadashiv; Gwal, Anil

    2013-12-01

    Patients with sickle cell disease (SCD) produce significantly low levels of plasma nitric oxide (NO) during acute vaso-occlusive crisis. In transgenic sickle cell mice, NO synthesized by endothelial nitric oxide synthase (eNOS) enzyme of vascular endothelial cells has been found to protect the mice from vaso-occlusive events. Therefore, the present study aims to explore possible association of eNOS gene polymorphism as a potential genetic modifier in SCD patients. A case control study involving 150 SCD patients and age- and ethnicity-matched 150 healthy controls were genotyped by PCR-restriction fragment length polymorphism techniques for three important eNOS gene polymorphisms-eNOS 4a/b, eNOS 894G>T and eNOS -786T>C. It was observed that SCD patients had significantly higher frequencies of mutant alleles besides heterozygous and homozygous mutant genotypes of these three eNOS gene polymorphisms and low levels of plasma nitrite (NO2) as compared with control groups. The SCD severe group had significantly lower levels of plasma NO2 and higher frequencies of mutant alleles of these three SNPs of eNOS gene in contrast to the SCD mild group of patients. Haplotype analysis revealed that frequencies of one mutant haplotype '4a-T-C' (alleles in order of eNOS 4a/b, eNOS 894G>T and eNOS -786T>C) were significantly high in the severe SCD patients (Phaplotype '4b-G-T' was found to be significantly high (P<0.0001) in the SCD mild patients, which indicates that eNOS gene polymorphisms are associated with SCD patients in India and may act as a genetic modifier of the phenotypic variation of SCD patients. PMID:24088668

  11. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

  12. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  13. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

    Dullat Harpreet K

    2011-03-01

    Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

  14. NMR studies on mechanism of isomerisation of fructose 6-phosphate to glucose 6-phosphate catalysed by phosphoglucose isomerase from Thermococcus kodakarensis.

    Abbas, Shahzada Nadeem; Mok, Kenneth Hun; Rashid, Naeem; Xie, Yongjing; Ruether, Manuel; O'Brien, John; Akhtar, Muhammad

    2016-06-01

    The fate of hydrogen atoms at C-2 of glucose 6-phosphate (G6P) and C-1 of fructose 6-phosphate (F6P) was studied in the reaction catalysed by phosphoglucose isomerase from Thermococcus kodakarensis (TkPGI) through 1D and 2D NMR methods. When the reaction was performed in (2)H2O the hydrogen atoms in the aforementioned positions were exchanged with deuterons indicating that the isomerization occurred by a cis-enediol intermediate involving C-1 pro-R hydrogen of F6P. These features are similar to those described for phosphoglucose isomerases from rabbit muscle and Pyrococcus furiosus. PMID:27014866

  15. Insertional mutagenesis and characterization of a polyketide synthase gene (PKS1) required for melanin biosynthesis in Bipolaris oryzae.

    Moriwaki, Akihiro; Kihara, Junichi; Kobayashi, Tsutomu; Tokunaga, Toshiko; Arase, Sakae; Honda, Yuichi

    2004-09-01

    A polyketide synthase gene named PKS1, involved in the melanin biosynthesis pathway of the phytopathogenic fungus Bipolaris oryzae, was isolated using restriction enzyme-mediated integration. Sequence analysis showed that the PKS1 encodes a putative protein that has 2155 amino acids and significant similarity to other fungal polyketide synthases. Targeted disruption of the PKS1 gene showed that it is necessary for melanin biosynthesis in B. oryzae. Northern blot analysis showed that PKS1 transcripts were specifically enhanced by near-ultraviolet radiation (300-400 nm) and that its temporal transcriptional patterns were similar to those of THR1 and SCD1 genes involved in the melanin biosynthesis pathway of B. oryzae. PMID:15336395

  16. Multiple independent fusions of glucose-6-phosphate dehydrogenase with enzymes in the pentose phosphate pathway.

    Nicholas A Stover

    Full Text Available Fusions of the first two enzymes in the pentose phosphate pathway, glucose-6-phosphate dehydrogenase (G6PD and 6-phosphogluconolactonase (6PGL, have been previously described in two distant clades, chordates and species of the malarial parasite Plasmodium. We have analyzed genome and expressed sequence data from a variety of organisms to identify the origins of these gene fusion events. Based on the orientation of the domains and range of species in which homologs can be found, the fusions appear to have occurred independently, near the base of the metazoan and apicomplexan lineages. Only one of the two metazoan paralogs of G6PD is fused, showing that the fusion occurred after a duplication event, which we have traced back to an ancestor of choanoflagellates and metazoans. The Plasmodium genes are known to contain a functionally important insertion that is not seen in the other apicomplexan fusions, highlighting this as a unique characteristic of this group. Surprisingly, our search revealed two additional fusion events, one that combined 6PGL and G6PD in an ancestor of the protozoan parasites Trichomonas and Giardia, and another fusing G6PD with phosphogluconate dehydrogenase (6PGD in a species of diatoms. This study extends the range of species known to contain fusions in the pentose phosphate pathway to many new medically and economically important organisms.

  17. Genes encoding the alpha, gamma, delta, and four F0 subunits of ATP synthase constitute an operon in the cyanobacterium Anabaena sp. strain PCC 7120.

    McCarn, D F; R A Whitaker; Alam, J; Vrba, J M; Curtis, S E

    1988-01-01

    A cluster of genes encoding subunits of ATP synthase of Anabaena sp. strain PCC 7120 was cloned, and the nucleotide sequences of the genes were determined. This cluster, denoted atp1, consists of four F0 genes and three F1 genes encoding the subunits a (atpI), c (atpH), b' (atpG), b (atpF), delta (atpD), alpha (aptA), and gamma (atpC) in that order. Closely linked upstream of the ATP synthase subunit genes is an open reading frame denoted gene 1, which is equivalent to the uncI gene of Escher...

  18. Nonribosomal peptide synthase gene clusters for lipopeptide biosynthesis in Bacillus subtilis 916 and their phenotypic functions.

    Luo, Chuping; Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu; Chen, Zhiyi

    2015-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way. PMID:25362061

  19. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-01-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems (P mercury exposure significantly enhanced the mRNA expression of SsPCS (P metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  20. Evolution of mustard (Brassica juncea Coss) subspecies in China: evidence from the chalcone synthase gene.

    Chen, F B; Liu, H F; Yao, Q L; Fang, P

    2016-01-01

    To explore the phylogenetic relationship, genome donor, and evolutionary history of the polyploid mustard (Brassica juncea) from China, eighty-one sequences of the chalcone synthase gene (Chs) were analyzed in 43 individuals, including 34 B. juncea, 2 B. rapa, 1 B. nigra, 2 B. oleracea, 1 B. napus, 1 B. carinata, and 2 Raphanus sativus. A maximum likelihood analysis showed that sequences from B. juncea were separated into two well-supported groups in accordance with the A and B genomes, whereas the traditional phenotypic classification of B. juncea was not wholly supported by the molecular results. The SplitsTree analysis recognized four distinct groups of Brassicaceae, and the median-joining network analysis recognized four distinct haplotypes of Chs. The estimates of Tajima's D, Fu and Li's D, and Fu and Li's F statistic for the Chs gene in the B genome were negative, while those in the A genome were significant. The results indicated that 1) the Chs sequences revealed a high level of sequence variation in Chinese mustard, 2) both tree and reticulate evolutions existed, and artificial selection played an important role in the evolution of Chinese mustard, 3) the original parental species of Chinese mustard are B. rapa var. sinapis arvensis and B. nigra (derived from China), 4) nucleotide variation in the B genome was higher than that in the A genome, and 5) cultivated mustard evolved from wild mustard, and China is one of the primary origins of B. juncea. PMID:27173323

  1. Nitric Oxide Synthase Type III Overexpression By Gene Therapy Exerts Antitumoral Activity In Mouse Hepatocellular Carcinoma

    Raúl González

    2015-08-01

    Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.

  2. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-01-01

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots. PMID:26782459

  3. Polymorphism of thymidylate synthase gene associated with its protein expression in human colon cancer

    Kai-Huan Yu; Wei-Xing Wang; You-Ming Ding; Hui Li; Ze-Sheng Wang

    2008-01-01

    AIM: To correlate the polymorphisms in the 5'-untranslated region with thymidylate synthase (TS) protein expression in Han Chinese colonic neoplasms.METHODS: Adenocarcinoma samples were from 68 patients who received no treatment before surgery. Tandem repeat length of TS gene was determined by PCR amplification of genomic DNA. Intratumoral TS protein expression was studied immunohistochemically in corresponding sections from paraffin-embedded primary foci. Immunoreactivity was semiquantitatively evaluated by immunoreactivity score (IRS).RESULTS: Double-(2R) and triple-repeated (3R) sequences of the TS gene were found in the cancer tissues. Three genotypes of TS were found: 2R/2R (n = 6), 2R/3R (n = 22) and 3R/3R (n = 40). Patients who were homozygous for triple-repeated (3R/3R) sequences showed significantly higher IRS of TS than patients who were homozygous for double-repeated (2R/2R) sequences or heterozygous patients (2R/3R): 5.73 ± 3.25 vs 2.17 ± 1.47 or 3.77 ± 2.64, P = 0.008 or P = 0.015. But no statistical significance of IRS in cancer tissues was observed between 2R/3R genotype and 2R/2R genotype.CONCLUSION: There is a relationship between TS genotype and TS protein expression in clinical specimens. The data might offer an advantage for selection of Chinese cancer patients to receive fluoropyrimidines treatment.

  4. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

    2007-11-01

    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat. PMID:17721773

  5. Presence of two transcribed malate synthase genes in an n-alkane-utilizing yeast, Candida tropicalis.

    Hikida, M; Atomi, H; Fukuda, Y; Aoki, A; Hishida, T; Teranishi, Y; Ueda, M; Tanaka, A

    1991-12-01

    The presence of two genomic DNA regions encoding malate synthase (MS) was shown by Southern blot analysis of the genomic DNA from an n-alkane-assimilating yeast, Candida tropicalis, using a partial MS cDNA probe, in accordance with the fact that two types of partial MS cDNAs have previously been isolated. This was also confirmed by the restriction mapping of the two genes screened from the yeast lambda EMBL library. Nucleotide sequence analysis of the respective genomic DNAs, named MS-1 gene and MS-2 gene, revealed that both regions encoding MS had the same length of 1,653 base pairs, corresponding to 551 amino acids (molecular mass of MS-1, 62,448 Da; MS-2, 62,421 Da). Although 29 nucleotide pairs differed in the sequences of the coding regions, the number of amino acid replacements was only one: 159Asn (MS-1)----159Ser (MS-2). In the 5'-flanking regions, there were replacements of four nucleotide pairs, deletion of one pair, and insertion of four pairs. In spite of the fact that two genomic genes were present and transcribed, RNA blot analysis demonstrated that only one band (about 2 kb) was observable even when the carbon sources in the cultivation medium were changed. A comparison of the amino acid sequences was made with MSs of rape (Brassica napus L.), cucumber seed, pumpkin seed, Escherichia coli, and Hansenula polymorpha. A high homology was observed among these enzymes, the results indicating that the protein structure was relatively well conserved through the evolution of the molecule.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1794980

  6. IDENTIFICATION AND HORMONE INDUCTION OF PUTATIVE CHITIN SYNTHASE GENES AND SPLICE VARIANTS IN Leptinotarsa decemlineata (SAY).

    Shi, Ji-Feng; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing

    2016-08-01

    Chitin synthase (ChS) plays a critical role in chitin synthesis and excretion. In this study, two ChS genes (LdChSA and LdChSB) were identified in Leptinotarsa decemlineata. LdChSA contains two splicing variants, LdChSAa and LdChSAb. Within the first, second, and third larval instars, the mRNA levels of LdChSAa, LdChSAb, and LdChSB coincide with the peaks of circulating 20-hydroxyecdysone (20E) and juvenile hormone (JH). In vitro culture of midguts and an in vivo bioassay revealed that 20E and an ecdysteroid agonist halofenozide stimulated the expression of the three LdChSs. Conversely, a reduction of 20E by RNA interference (RNAi) of an ecdysteroidogenesis gene LdSHD repressed the expression of these LdChSs, and ingestion of halofenozide by LdSHD RNAi larvae rescued the repression. Moreover, disruption of 20E signaling by RNAi of LdEcR, LdE75, LdHR3, and LdFTZ-F1 reduced the expression levels of these genes. Similarly, in vitro culture and an in vivo bioassay showed that exogenous JH and a JH analog methoprene activated the expression of the three LdChSs, whereas a decrease in JH by RNAi of a JH biosynthesis gene LdJHAMT downregulated these LdChSs. It seems that JH upregulates LdChSs at the early stage of each instar, whereas a 20E pulse triggers the transcription of LdChSs during molting in L. decemlineata. PMID:27030662

  7. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  8. Characterization of two trpE genes encoding anthranilate synthase α-subunit in Azospirillum brasilense

    The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1(G) while these sequence features did not exist in front of trpE 2. The β-galactosidase activity of an A. brasilense strain carrying a trpE 2-lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1(G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1(G)- and trpE 2- mutants demonstrated that TrpE1(G) fusion protein is feedback inhibited by tryptophan while TrpE2 protein is not. We also found that both trpE 1(G) and trpE 2 gene products were involved in IAA synthesis

  9. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Lydia J R Hunter

    Full Text Available BACKGROUND: RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail. METHODOLOGY/PRINCIPAL FINDINGS: In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought. CONCLUSIONS/SIGNIFICANCE: RDR1 is regulated by a much broader range of phytohormones than previously thought

  10. Kernicterus by glucose-6-phosphate dehydrogenase deficiency: a case report and review of the literature

    Cossio de Gurrola Gladys

    2008-05-01

    Full Text Available Abstract Introduction Glucose-6-phosphate dehydrogenase deficiency is an X-linked recessive disease that causes acute or chronic hemolytic anemia and potentially leads to severe jaundice in response to oxidative agents. This deficiency is the most common human innate error of metabolism, affecting more than 400 million people worldwide. Case presentation Here, we present the first documented case of kernicterus in Panama, in a glucose-6-phosphate dehydrogenase-deficient newborn clothed in naphthalene-impregnated garments, resulting in reduced psychomotor development, neurosensory hypoacousia, absence of speech and poor reflex of the pupil to light. Conclusion Mutational analysis revealed the glucose-6-phosphate dehydrogenase Mediterranean polymorphic variant, which explained the development of kernicterus after exposition of naphthalene. As the use of naphthalene in stored clothes is a common practice, glucose-6-phosphate dehydrogenase testing in neonatal screening could prevent severe clinical consequences.

  11. Glucose-6-Phosphate Dehydrogenase deficiency presented with convulsion: a rare case

    Alparslan Merdin

    2014-03-01

    Full Text Available Red blood cells carry oxygen in the body and Glucose-6-Phosphate Dehydrogenase protects these cells from oxidative chemicals. If there is a lack of Glucose-6-Phosphate Dehydrogenase, red blood cells can go acute hemolysis. Convulsion is a rare presentation for acute hemolysis due to Glucose-6-Phosphate Dehydrogenase deficiency. Herein, we report a case report of a Glucose-6-Phosphate Dehydrogenase deficiency diagnosed patient after presentation with convulsion. A 70 year-old woman patient had been hospitalized because of convulsion and fatigue. She has not had similar symptoms before. She had ingested fava beans in the last two days. Her hypophyseal and brain magnetic resonance imaging were normal. Blood transfusion was performed and the patient recovered.

  12. Phosphorylation and 14-3-3 binding of Arabidopsis trehalose-phosphate synthase 5 in response to 2-deoxyglucose

    Harthill, Jean E; Meek, Sarah E M; Morrice, Nick;

    2006-01-01

    Trehalose-6-phosphate is a 'sugar signal' that regulates plant metabolism and development. The Arabidopsis genome encodes trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphatase (TPP) enzymes. It also encodes class II proteins (TPS isoforms 5-11) that contain both TPS-like and TPP...

  13. High glucose concentrations partially release hexokinase from inhibition by glucose 6-phosphate.

    Fujii, S; Beutler, E

    1985-01-01

    The phosphorylation of glucose by human erythrocyte hexokinase follows classical Michaelis-Menten kinetics; hexokinase manifests maximum activity at 5 mM glucose, and no further increase in activity can be measured at higher glucose concentrations. However, the erythrocytes of diabetics and normal erythrocytes incubated with high concentrations of glucose contain increased concentrations of glucose 6-phosphate. To elucidate the mechanism of accumulation of glucose 6-phosphate when erythrocyte...

  14. Kernicterus by glucose-6-phosphate dehydrogenase deficiency: a case report and review of the literature

    Cossio de Gurrola Gladys; Araúz Juan; Durán Elfilda; Aguilar-Medina Maribel; Ramos-Payán Rosalío; García-Magallanes Noemí; Pacheco Gerardo; Arámbula Meraz Eliakym

    2008-01-01

    Abstract Introduction Glucose-6-phosphate dehydrogenase deficiency is an X-linked recessive disease that causes acute or chronic hemolytic anemia and potentially leads to severe jaundice in response to oxidative agents. This deficiency is the most common human innate error of metabolism, affecting more than 400 million people worldwide. Case presentation Here, we present the first documented case of kernicterus in Panama, in a glucose-6-phosphate dehydrogenase-deficient newborn clothed in nap...

  15. Amperometric Biosensor for estimation of Glucose-6-phosphate Using Prussian Blue Nanoparticles.

    Banerjee, S.; Sarkar, Priya; Turner, Anthony

    2013-01-01

    Glucose-6-phosphateplays an important role in carbohydrate metabolism of all living organisms.Compared to the conventional analytical methods available for estimation of glucose-6-phosphate,the biosensors having relative simplicity, specificity, low-cost and fastresponse time are a promising alternative. We have reported a glucose-6-phosphatesensor based on screen-printed electrode utilizing Prussian blue nanoparticlesand enzymes, glucose-6-phosphate dehydrogenase and glutathione reductase. T...

  16. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  17. Thymidylate synthase gene amplification in human colon cancer cell lines resistant to 5-fluorouracil.

    Copur, S; Aiba, K; Drake, J C; Allegra, C J; Chu, E

    1995-05-17

    A series of 5-fluorouracil (5-FU)-resistant human colon H630 cancer cell lines were established by continuous exposure of cells to 5-FU. The concentration of 5-FU required to inhibit cell proliferation by 50% (IC50) in the parent colon line (H630) was 5.5 microM. The 5-FU IC50 values for the resistant H630-R1, H630-R10, and H630-R cell lines were 11-, 29-, and 27-fold higher than that for the parent H630 cell line. Using both the radioenzymatic 5-fluoro-2'-deoxyuridine-5'-monophosphate (FdUMP) binding and catalytic assays for measurement of thymidylate synthase (TS) enzyme activity, there was significantly increased TS activity in resistant H630-R1 (13- and 23-fold), H630-R10 (37- and 40-fold), and H630-R (24- and 34-fold) lines, for binding and catalytic assays, respectively, compared with the parent H630 line. The level of TS protein, as determined by western immunoblot analysis, was increased markedly in resistant H630-R1 (23-fold), H630-R10 (33-fold), and H630-R (26-fold) cells. Northern analysis revealed elevations in TS mRNA levels in H630-R1 (18-fold), H630-R10 (39-fold), and H630-R (36-fold) cells relative to parent H630 cells. Although no major rearrangements of the TS gene were noted by Southern analysis, there was significant amplification of the TS gene in 5-FU-resistant cells, which was confirmed by DNA slot blot analysis. These studies demonstrate that continuous exposure of human colon cancer cells to 5-FU leads to TS gene amplification and overexpression of TS protein with resultant development of fluoropyrimidine resistance. PMID:7763285

  18. Polymorphism of Methionine Synthase Gene in Nuclear Families of Congenital Heart Disease

    WEN-LI ZHU; JUN CHENG; JING-JING DAO; RU-BING ZHAO; LI-YING YAN; SHU-QING LI; AND YONG LI

    2004-01-01

    Objective To investgate the relation of methionine synthase (MS) gene variation with congenital heart disease (CHD) phenotype. Methods One hundred and ninety three CHD patients (94 males and 99 females) and their biological parents (nuclear families) in Liaoning Province were selected as the case group, and another 104 normal persons (60 males and 44 females) and their parents without family history of birth defects as the control group. For all subjects the polymorphism of MS gene A2756G locus was examined by PCR-RFLP method. Results In offspring of the control group the frequencies of MS genotype (+/-) and allele (+) were 10.7% and 5.3%, without existence of homozygote. The MS genotype distribution and allele frequencies of CHD patients and their mothers were not significantly different from the control (P > 0.05). The frequency of allele (+)in case fathers (5.0 %) was apparently lower than that in the control (9.1%, P=0.060), and the odds ratio (OR) was 0.53 (95% CI: 0.25-1.09). There was no difference in parents' genotype combination between the two groups, and in genotype distribution among different types of CHD. Analysis of genetic transmission indicated that mutation allele (+) existed transmission disequilibrium in CHD nuclear families. The percentage of allele (+) transmitted from parents was lower than that allele (-)with OR 0.26 (95% CI: 0.11-0.60). Conclusion MS gene variation in parents is associated with occurrence of CHD in offspring, and mutation allele (+) in parents may be related with the decrease of CHD risk in offspring.

  19. Epidemiology and clinical relevanceof Pneumocystis jirovecii Frenkel, 1976 dihydropteroate synthase gene mutations*

    Matos O.

    2010-09-01

    Full Text Available A review was conducted to examine the published works that studied the prevalence of Pneumocystis jirovecii dihydropteroate synthase (DHPS mutations in patients with P. jirovecii pneumonia (PcP, in develop and developing countries, and that focused the problem of the possible association of these mutations with exposure to sulpha or sulphone drugs and their influence in the PcP outcome. Studies conducted in United States of America presented higher P. jirovecii mutations rates, in comparison with European countries, and in developing countries, lower rates of DHPS mutations were reported, due to limited use of sulpha drugs. A significant association was reported between the use of sulpha or sulphone agents for PcP prophylaxis in HIV-infected patients and the presence of DHPS mutations. However these mutations were also detected in PcP patients who were not currently receiving sulpha or sulphone agents. The outcome and mortality of HIV-infected patients with PcP harbouring DHPS gene mutations were related primarily to the underlying severity of illness and the initial severity of PcP, more than to the presence of mutations.

  20. Molecular characterization and expression analyses of an anthocyanin synthase gene from Magnolia sprengeri Pamp.

    Shi, Shou-Guo; Li, Shan-Ju; Kang, Yong-Xiang; Liu, Jian-Jun

    2015-01-01

    Anthocyanin synthase (ANS), which catalyzes the conversion of colorless leucoanthocyanins into colored anthocyanins, is a key enzyme in the anthocyanin biosynthetic pathway. It plays important roles in plant development and defense. An ANS gene designated as MsANS was cloned from Magnolia sprengeri using rapid amplification of complementary DNA (cDNA) ends technology. The full-length MsANS is 1171-bp long and contains a 1080-bp open reading frame encoding a 360 amino acid polypeptide. In a sequence alignment analysis, the deduced MsANS protein showed high identity to ANS proteins from other plants: Prunus salicina var. cordata (74 % identity), Ampelopsis grossedentata (74 % identity), Pyrus communis (73 % identity), and Prunus avium (73 % identity). A structural analysis showed that MsANS belongs to 2-oxoglutarate (2OG)- and ferrous iron-dependent oxygenase family because it contains three binding sites for 2OG. Real-time quantitative polymerase chain reaction analyses showed that the transcript level of MsANS was 26-fold higher in red petals than in white petals. The accumulation of anthocyanins in petals of white, pink, and red M. sprengeri flowers was analyzed by HPLC. The main anthocyanin was cyanidin-3-o-glucoside chloride, and the red petals contained the highest concentration of this pigment. PMID:25315387

  1. Borna disease virus P protein inhibits nitric oxide synthase gene expression in astrocytes

    Borna disease virus (BDV) is one of the potential infectious agents involved in the development of central nervous system (CNS) diseases. Neurons and astrocytes are the main targets of BDV infection, but little is known about the roles of BDV infection in the biological effects of astrocytes. Here we reported that BDV inhibits the activation of inducible nitric oxide synthase (iNOS) in murine astrocytes induced by bacterial LPS and PMA. To determine which protein of BDV is responsible for the regulation of iNOS expression, we co-transfected murine astrocytes with reporter plasmid iNOS-luciferase and plasmid expressing individual BDV proteins. Results from analyses of reporter activities revealed that only the phosphoprotein (P) of BDV had an inhibitory effect on the activation of iNOS. In addition, P protein inhibits nitric oxide production through regulating iNOS expression. We also reported that the nuclear factor kappa B (NF-κB) binding element, AP-1 recognition site, and interferon-stimulated response element (ISRE) on the iNOS promoter were involved in the repression of iNOS gene expression regulated by the P protein. Functional analysis indicated that sequences from amino acids 134 to 174 of the P protein are necessary for the regulation of iNOS. These data suggested that BDV may suppress signal transduction pathways, which resulted in the inhibition of iNOS activation in astrocytes

  2. RNA Interference-mediated Silencing of Phytochelatin Synthase Gene Reduce Cadmium Accumulation in Rice Seeds

    2007-01-01

    Phytochelatins (PCs) play an important role in heavy metal resistance and accumulation. To reduce the accumulation of cadmium (Cd) in rice seeds, the expression of phytochelatin synthase (PCS) gene OsPCS1 was suppressed by RNA interference (RNAi). A hairpin construct of a PCS fragment was designed in the pRNAi-OsPCS1 under the control of ZMM1, a seed-specific promoter from maize. The construct was introduced into rice (japonica) through Agrobacterium tumefaciens. The RNAi rice plantlets were selected and cultivated in pots exposured to 10 mg/kg Cd. The transcriptional level of OsPCS1 declined in seeds of some RNAi rice compared to the wild type. As a result Cd accumulation was reduced by about half in the seeds of RNAi rice. As expected, no apparent difference of growth appeared between RNAi and wild-type plants. The results suggest that this new approach can be used to control heavy metal accumulation in crops.

  3. The Phytoene synthase gene family of apple (Malus x domestica) and its role in controlling fruit carotenoid content

    Ampomah-Dwamena, C.; Driedonks, N.J.W.; Lewis, D; Shumskaya, M.; Chen, X Y; Wurtzel, E.T.; Espley, R.V.; Allan, A.C.

    2015-01-01

    Background Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genom...

  4. Nucleotide Variability in the 5-Enolpyruvylshikimate-3-Phosphate Synthase Gene from Eleusine indica (L.) Gaertn

    J.L. Chong; R. Wickneswari; Ismail, B. S.; S. Salmijah

    2008-01-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to pr...

  5. Molecular Cloning, Expression, and Characterization of the Genes Encoding the Two Essential Protein Components of Micrococcus luteus B-P 26 Hexaprenyl Diphosphate Synthase

    Shimizu, Naoto; Koyama, Tanetoshi; Ogura, Kyozo

    1998-01-01

    The structural genes encoding the two essential components A and B of hexaprenyl diphosphate synthase, which produce the precursor of the prenyl side chain of menaquinone-6, were cloned from Micrococcus luteus B-P 26.

  6. Expression of an(E)-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Xiudao; Yu; Yongjun; Zhang; Youzhi; Ma; Zhaoshi; Xu; Genping; Wang; Lanqin; Xia

    2013-01-01

    Aphids are major agricultural pests that cause significant yield losses in crop plants each year.(E)-β-farnesene(EβF) is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint(Mentha × piperita), two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint(Mentha asiatica). Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d-1g-1of fresh tissue. Tritrophic interactions involving peach aphids(Myzus persicae), and predatory lacewing(Chrysopa septempunctata) larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  7. Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Xiudao Yu

    2013-10-01

    Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  8. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  9. Molecular cloning and characterization of three isoprenyl diphosphate synthase genes from alfalfa.

    Sun, Yan; Long, Ruicai; Kang, Junmei; Zhang, Tiejun; Zhang, Ze; Zhou, He; Yang, Qingchuan

    2013-02-01

    Isoprenoid is the precursor for the biosynthesis of saponins, abscisic acid, gibberellins, chlorophylls and many other products in plants. Saponins are an important group of bioactive plant natural products. The alfalfa (Medicago sativa L.) saponins are glycosides of different triterpene aglycones and possess many biological activities. We isolated three genes (MsFPPS, MsGPPS and MsGGPPS) encoding isoprenyl diphosphate synthases (IDS) from alfalfa via a homology-based PCR approach. The enzyme activity assay of purified recombined MsFPPS and MsGGPPS expressed in Escherichia coli indicated that they all had IDS activity. Expression analysis of the three genes in different alfalfa tissues using real time PCR displayed that they were expressed in all tissues although they had a different expression patterns. MsFPPS and MsGPS displayed a significant increase in transcript level in response to methyl jasmonate, but the transcript level of MsGGPPS decreased obviously. To elucidate the functions of the three IDSs, their overexpression driven by a constitutive cauliflower mosaic virus-35S promoter in tobacco plants was applied and analyzed. The T(0) transgenic plants of MsFPPS showed high levels of squalene content when compared with control. However, no differences were detected in T(0) transgenic plants of MsGPPS and MsGGPPS. In addition, the overexpression of MsFPPS induced senescence response in transgenic plant leaves. This result may indicate that MsFPPS performs a role not only in phytosterol and triterpene biosynthesis, but also in growth regulation. PMID:23238915

  10. Sequence of the bchG gene from Chloroflexus aurantiacus: relationship between chlorophyll synthase and other polyprenyltransferases

    Lopez, J. C.; Ryan, S.; Blankenship, R. E.

    1996-01-01

    The sequence of the Chloroflexus aurantiacus open reading frame thought to be the C. aurantiacus homolog of the Rhodobacter capsulatus bchG gene is reported. The BchG gene product catalyzes esterification of bacteriochlorophyllide a by geranylgeraniol-PPi during bacteriochlorophyll a biosynthesis. Homologs from Arabidopsis thaliana, Synechocystis sp. strain PCC6803, and C. aurantiacus were identified in database searches. Profile analysis identified three related polyprenyltransferase enzymes which attach an aliphatic alcohol PPi to an aromatic substrate. This suggests a broader relationship between chlorophyll synthases and other polyprenyltransferases.

  11. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Emilia Wilmowicz

    2016-03-01

    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  12. Multiple resistance to sulfonylureas and imidazolinones conferred by an acetohydroxyacid synthase gene with separate mutations for selective resistance.

    Hattori, J; Rutledge, R; Labbé, H; Brown, D; Sunohara, G; Miki, B

    1992-03-01

    The acetohydroxyacid synthase (AHAS) gene from the Arabidopsis thaliana mutant line GH90 carrying the imidazolinone resistance allele imr1 was cloned. Expression of the AHAS gene under the control of the CaMV 35S promoter in transgenic tobacco resulted in selective imidazolinone resistance, confirming that the single base-pair change found near the 3' end of the coding region of this gene is responsible for imidazolinone resistance. A chimeric AHAS gene containing both the imr1 mutation and the csr1 mutation, responsible for selective resistance to sulfonylurea herbicides, was constructed. It conferred on transgenic tobacco plants resistance to both sulfonylurea and imidazolinone herbicides. The data illustrate that a multiple-resistance phenotype can be achieved in an AHAS gene through combinations of separate mutations, each of which individually confers resistance to only one class of herbicides. PMID:1557022

  13. Five novel glucose-6-phosphate dehydrogenase deficiency haplotypes correlating with disease severity

    Dallol Ashraf

    2012-09-01

    Full Text Available Abstract Background Glucose-6-phosphate dehydrogenase (G6PD, EC 1.1.1.49 deficiency is caused by one or more mutations in the G6PD gene on chromosome X. An association between enzyme levels and gene haplotypes remains to be established. Methods In this study, we determined G6PD enzyme levels and sequenced the coding region, including the intron-exon boundaries, in a group of individuals (163 males and 86 females who were referred to the clinic with suspected G6PD deficiency. The sequence data were analysed by physical linkage analysis and PHASE haplotype reconstruction. Results All previously reported G6PD missense changes, including the AURES, MEDITERRANEAN, A-, SIBARI, VIANGCHAN and ANANT, were identified in our cohort. The AURES mutation (p.Ile48Thr was the most common variant in the cohort (30% in males patients followed by the Mediterranean variant (p.Ser188Phe detectable in 17.79% in male patients. Variant forms of the A- mutation (p.Val68Met, p.Asn126Asp or a combination of both were detectable in 15.33% of the male patients. However, unique to this study, several of such mutations co-existed in the same patient as shown by physical linkage in males or PHASE haplotype reconstruction in females. Based on 6 non-synonymous variants of G6PD, 13 different haplotypes (13 in males, 8 in females were identified. Five of these were previously unreported (Jeddah A, B, C, D and E and were defined by previously unreported combinations of extant mutations where patients harbouring these haplotypes exhibited severe G6PD deficiency. Conclusions Our findings will help design a focused population screening approach and provide better management for G6PD deficiency patients.

  14. Glucose-6-Phosphate Dehydrogenase Deficiency Improves Insulin Resistance With Reduced Adipose Tissue Inflammation in Obesity.

    Ham, Mira; Choe, Sung Sik; Shin, Kyung Cheul; Choi, Goun; Kim, Ji-Won; Noh, Jung-Ran; Kim, Yong-Hoon; Ryu, Je-Won; Yoon, Kun-Ho; Lee, Chul-Ho; Kim, Jae Bum

    2016-09-01

    Glucose-6-phosphate dehydrogenase (G6PD), a rate-limiting enzyme of the pentose phosphate pathway, plays important roles in redox regulation and de novo lipogenesis. It was recently demonstrated that aberrant upregulation of G6PD in obese adipose tissue mediates insulin resistance as a result of imbalanced energy metabolism and oxidative stress. It remains elusive, however, whether inhibition of G6PD in vivo may relieve obesity-induced insulin resistance. In this study we showed that a hematopoietic G6PD defect alleviates insulin resistance in obesity, accompanied by reduced adipose tissue inflammation. Compared with wild-type littermates, G6PD-deficient mutant (G6PD(mut)) mice were glucose tolerant upon high-fat-diet (HFD) feeding. Intriguingly, the expression of NADPH oxidase genes to produce reactive oxygen species was alleviated, whereas that of antioxidant genes was enhanced in the adipose tissue of HFD-fed G6PD(mut) mice. In diet-induced obesity (DIO), the adipose tissue of G6PD(mut) mice decreased the expression of inflammatory cytokines, accompanied by downregulated proinflammatory macrophages. Accordingly, macrophages from G6PD(mut) mice greatly suppressed lipopolysaccharide-induced proinflammatory signaling cascades, leading to enhanced insulin sensitivity in adipocytes and hepatocytes. Furthermore, adoptive transfer of G6PD(mut) bone marrow to wild-type mice attenuated adipose tissue inflammation and improved glucose tolerance in DIO. Collectively, these data suggest that inhibition of macrophage G6PD would ameliorate insulin resistance in obesity through suppression of proinflammatory responses. PMID:27284106

  15. Transcripts for genes encoding soluble acid invertase and sucrose synthase accumulate in root tip and cortical cells containing mycorrhizal arbuscules.

    Blee, Kristopher A; Anderson, Anne J

    2002-09-01

    Arbuscule formation by the arbuscular mycorrhizal fungus Glomus intraradices (Schenck & Smith) was limited to cortical cells immediately adjacent to the endodermis. Because these cortical cells are the first to intercept photosynthate exiting the vascular cylinder, transcript levels for sucrose metabolizing-enzymes were compared between mycorrhizal and non-mycorrhizal roots. The probes corresponded to genes encoding a soluble acid invertase with potential vacuolar targeting, which we generated from Phaseolus vulgaris roots, a Rhizobium-responsive sucrose synthase of soybean and a cell wall acid invertase of carrot. Transcripts in non-mycorrhizal roots were developmentally regulated and abundant in the root tips for all three probes but in differentiated roots of P. vulgaris they were predominantly located in phloem tissues for sucrose synthase or the endodermis and phloem for soluble acid invertase. In mycorrhizal roots increased accumulations of transcripts for sucrose synthase and vacuolar invertase were both observed in the same cortical cells bearing arbuscules that fluoresce. There was no effect on the expression of the cell wall invertase gene in fluorescent carrot cells containing arbuscules. Thus, it appears that presence of the fungal hyphae in the fluorescent arbusculated cell stimulates discrete alterations in expression of sucrose metabolizing enzymes to increase the sink potential of the cell. PMID:12175013

  16. Isolation of developing secondary xylem specific cellulose synthase genes and their expression profiles during hormone signalling in Eucalyptus tereticornis

    Balachandran Karpaga Raja Sundari; Modhumita Ghosh Dasgupta

    2014-08-01

    Cellulose synthases (CesA) represent a group of -1, 4 glycosyl transferases involved in cellulose biosynthesis. Recent reports in higher plants have revealed that two groups of CesA gene families exist, which are associated with either primary or secondary cell wall deposition. The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from Eucalyptus tereticornis, a species predominantly used in paper and pulp industries in the tropics. The differential expression analysis of the three EtCesA genes using qRT-PCR revealed 49 to 87 fold relative expression in developing secondary xylem tissues. Three full length gene sequences of EtCesA1, EtCesA2 and EtCesA3 were isolated with the size of 2940, 3114 and 3123 bp, respectively. Phytohormone regulation of all three EtCesA genes were studied by exogenous application of gibberellic acid, naphthalene acetic acid, indole acetic acid and 2, 4-epibrassinolide in internode tissues derived from three-month-old rooted cuttings. All three EtCesA transcripts were upregulated by indole acetic acid and gibberellic acid. This study demonstrates that the increased cellulose deposition in the secondary wood induced by hormones can be attributed to the upregulation of xylem specific CesAs.

  17. Pneumocystis jiroveci dihydropteroate synthase gene mutations among colonized individuals and Pneumocystis pneumonia patients from Spain.

    Friaza, Vicente; Morilla, Rubén; Respaldiza, Nieves; de la Horra, Carmen; Calderón, Enrique J

    2010-11-01

    Cotrimoxazole, an association of trimethoprim and sulfamethoxazole, and dapsone, are mainstays for the prophylaxis and treatment of Pneumocystis pneumonia (PcP). The inability to culture Pneumocystis prevents routine susceptibility testing and detection of drug resistance. Instead, molecular techniques have been used to detect Pneumocystis jiroveci dihydropteroate synthase (DHPS) mutations that cause sulfa resistance in other microorganisms. The most frequent DHPS mutations occur at nucleotide positions 165 and 171, which lead to an amino acid change at positions 55 and 57. Several studies suggest that these mutations are associated with the failure of chemoprophylaxis for PcP. The aim was to establish the frequency and characteristics of P jiroveci DHPS mutations among colonized individuals and PcP patients from Spain. A total of 50 colonized individuals and 25 PcP patients were studied. DHPS polymorphisms were identified by restriction fragment length polymorphism assay. The analysis provided a rate of 28% of DHPS gene mutations in our population, with the presence of all possible polymorphisms described. The presence of mutations was higher in PcP patients than in colonized subjects (40% vs 22%), probably because of the chemoprophylaxis used in PcP patients. The comparison between patients with and without DHPS mutations did not show statistical differences due to age, sex, steroid use, sulfa drug exposure, or smoking. A high rate of DHPS mutations in our area of Spain, not only confined to patients previously exposed to sulfa drugs, is shown in this study. As well as PcP patients, colonized individuals who harbor P jiroveci strains with DHPS mutations could play a major role in the transmission cycle of these mutations, representing a reservoir and source of infection for susceptible individuals. Further research is thus warranted to assess the true scope of the problem and to design rational preventive strategies. PMID:21084778

  18. Polymorphisms in the endothelial nitric oxide synthase gene in thalidomide embryopathy.

    Vianna, Fernanda Sales Luiz; Fraga, Lucas Rosa; Tovo-Rodrigues, Luciana; Tagliani-Ribeiro, Alice; Biondi, Flavia; Maximino, Claudia Marques; Sanseverino, Maria Teresa Vieira; Hutz, Mara Helena; Schuler-Faccini, Lavínia

    2013-11-30

    Thalidomide is one of the most potent teratogens known to humans. It is currently used for many clinical situations such as treatment of leprosy reactions and multiple myeloma. However, the teratogenic mechanisms by which it produces morphological defects still remain unclear. One of the hypotheses is the blockage of angiogenesis by reduction of nitric oxide (NO). In this study, we evaluated two functional polymorphisms of the endothelial nitric oxide synthase (eNOS) gene which is a constitutively expressed enzyme responsible for production of NO. The promoter -786T>C exon 7 (896G>T) polymorphisms were genotyped using real-time PCR for 28 individuals with thalidomide embryopathy (TE), 27 first-degree relatives of these individuals, and 68 individuals from the general population. Their allele, genotypic, and haplotypic frequencies were compared. A significant difference was observed in the -786T>C polymorphism genotypes (p=0.03) between the groups affected by TE and those unaffected (non-relatives). The TT genotype of the 896G>T polymorphism was observed in 10.7% of those affected and 2.9% of those unaffected, but the difference was not statistically significant (p=0.09). The haplotypic analysis indicated that the wild haplotype -786T/896G was distributed differently in the affected and unaffected groups (p=0.004). These results indicate that the individuals with TE have a higher frequency of alleles associated with lower expression of eNOS, indicating that this may be a genotype susceptible to TE. PMID:24055736

  19. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases

  20. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: nishizaw@sk.ritsumei.ac.jp [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  1. Non-thermal effect of a ceramics radiation on a yeast glucose-6-phosphate dehydrogenase

    Non-thermal effect of a ceramics radiation on glucose-6-phosphate dehydrogenase has been investigated using the enzyme, glucose-6-phosphate and NADP+ separately irradiated at 10 degrees C by a ceracompo R plate and a ceramics un-sewed cloth (sheet). The Km for glucose-6-phosphate was increased 20% after 6 h of irradiation by the plate, but the Vmax/Km was decreased 24. After 3 h of irradiation by the sheet, the Km was increased 17%, but after 6 h of irradiation it was decreased 11%. The 3 h of irradiation by the sheet slightly increased both enthalpy and entropy changes of the reaction, but the 6 h of irradiation significantly decreased them. Both thermodynamic parameters in the activated state were increased by the sheet irradiation. The promotion energy for both formations of the enzyme-substrate and their activated complex depended on enthalpy. The different effects of two ceramics radiators on G6PDH activity were discussed

  2. Heterologous expression and product identification of Colletotrichum lagenarium polyketide synthase encoded by the PKS1 gene involved in melanin biosynthesis.

    Fujii, I; Mori, Y; Watanabe, A; Kubo, Y; Tsuji, G; Ebizuka, Y

    1999-08-01

    The Colletotrichum lagenarium PKS1 gene was expressed in the heterologous fungal host, Aspergillus oryzae, under the starch-inducible alpha-amylase promoter to identify the direct product of polyketide synthase (PKS) encoded by the PKS1 gene. The main compound produced by an A. oryzae transformant was isolated and characterized to be 1,3,6,8-tetrahydroxynaphthalene (T4HN) as its tetraacetate. Since the PKS1 gene was cloned from C. lagenarium to complement the nonmelanizing albino mutant, T4HN was assumed to be an initial biosynthetic intermediate, and thus the product of the PKS reaction, but had not been isolated from the fungus. The production of T4HN by the PKS1 transformant unambiguously identified the gene to encode a PKS of pentaketide T4HN. In addition, tetraketide orsellinic acid and pentaketide isocoumarin were isolated, the latter being derived from a pentaketide monocyclic carboxylic acid, as by-products of the PKS1 PKS reaction. Production of the pentaketide carboxylic acid provided insights into the mechanism for the PKS1 polyketide synthase reaction to form T4HN. PMID:10501004

  3. pks63787, a Polyketide Synthase Gene Responsible for the Biosynthesis of Benzenoids in the Medicinal Mushroom Antrodia cinnamomea.

    Yu, Po-Wei; Chang, Ya-Chih; Liou, Ruey-Fen; Lee, Tzong-Huei; Tzean, Shean-Shong

    2016-06-24

    Antrodia cinnamomea, a unique resupinate basidiomycete endemic to Taiwan, has potent medicinal activities. The reddish basidiocarps and mycelia generally exhibit abundant metabolites and higher biological activity. To investigate the pigments of A. cinnamomea, polyketide synthase (PKS) genes were characterized based on its partially deciphered genome and the construction of a fosmid library. Furthermore, a gene disruption platform was established via protoplast transformation and homologous recombination. Of four putative polyketide synthase genes, pks63787 was selected and disrupted in the monokaryotic wild-type (wt) strain f101. Transformant Δpks63787 was deficient in the synthesis of several aromatic metabolites, including five benzenoids and two benzoquinone derivatives. Based on these results, a biosynthetic pathway for benzenoid derivatives was proposed. The pks63787 deletion mutant not only displayed a reduced red phenotype compared to the wt strain but also displayed less 1,1-biphenyl-2-picrylhydrazyl free radical scavenging activity. This finding suggests that PKS63787 is responsible for the biosynthesis of pigments and metabolites related to the antioxidant activity of A. cinnamomea. The present study focuses on the functional characterization of the PKS gene, the fluctuations of its profile of secondary metabolites, and interpretation of the biosynthesis of benzenoids. PMID:27227778

  4. Fluorometric determination of free glucose and glucose 6-phosphate in cows' milk and other opaque matrices

    Larsen, Torben

    2015-01-01

    fluorometric detection. Standards and control materials were based on milk that was stripped of intrinsic glucose and glucose 6-phosphate in order to obtain standards and samples based on the same matrix. The analysis works without pre-treatment of the samples, e.g. without centrifugation and precipitation of......Analyses of free glucose and glucose 6-phosphate in milk have until now been dependent upon several time consuming and troublesome procedures. This has limited investigations in the area. The present article presents a new, reliable, analytical procedure, based on enzymatic degradation and...

  5. The Prevalence of Mediterranean Mutation of Glucose-6-Phosphate Dehydrogenase (G6PD in Zahedan

    Alireza Nakhaee

    2012-03-01

    Full Text Available Background: glucose-6-phosphate dehydrogenase (G6PD deficiency is the most common genetic defects in the world, so that more than 400 million people in worldwide are affected with it, but its prevalence varies from 1-65% in different populations. Clinical manifestation of this defect is acute hemolytic anemia, neonatal hyperbilirubinemia and chronic nonspherocytic haemolytic anaemia. So far, almost 140 mutations have been identified in the gene of G6PD enzyme. Mediterranean is the most common mutation. The purpose of this study is to determine the prevalence of G6PD Mediterranean mutation in the deficient people in the city of Zahedan.Materials and Methods: In this descriptive cross-sectional study, blood samples of 1440 male individuals, who were referred to Zahedan Reference Laboratory for premarital testing, were examined for G6PD deficiency using fluorescent spot test. Genomic DNA from blood of people with G6PD deficiency was extracted by DNA extraction kit. Mediterranean mutation was identified using PCR-RFLP method.Results: 101 out of 1440 subjects had G6PD deficiency. Therefore prevalence of G6PD deficiency in Zahedan city was estimated about 7%. Mediterranean mutation frequency in patients with defect of G6PD was estimated 84.2% (85 out of 101 patients and 15.8% (16 out of 101 patients did not have mutation Mediterranean. The frequency of G6PD deficiency was expressed as a percentage of total cases and Mediterranean mutation prevalence was expressed as a percentage of total impaired individuals.Conclusion: The result of this study showed that the frequency of G6PD deficiency in Zahedan city is lower than other cities of sistan and baluchestan province. Dominant mutation in present study was Mediterranean type and its frequency was very similar with prevalence of this mutation in other parts of Iran.

  6. Control of Enzyme IIscr and Sucrose-6-Phosphate Hydrolase Activities in Streptococcus mutans by Transcriptional Repressor ScrR Binding to the cis-Active Determinants of the scr Regulon

    Wang, Bing; Kuramitsu, Howard K.

    2003-01-01

    In Streptococcus mutans, enzyme IIscr and sucrose-6-phosphate hydrolase are two important enzymes in the transport and metabolism of dietary sucrose. The scr regulon of S. mutans is composed of three genes, scrA and scrB, which code for enzyme IIscr and sucrose-6-phosphate hydrolase, respectively, and scrR, which codes for a GalR-LacI-type transcription regulator. It was previously shown that expression of both scrA and scrB is similarly induced by sucrose. Mutation in the scrR gene resulted ...

  7. Polyketide genes in the marine sponge Plakortis simplex: a new group of mono-modular type I polyketide synthases from sponge symbionts

    Della Sala, Gerardo; Hochmuth, Thomas; Costantino, Valeria; Teta, Roberta; Gerwick, William; Gerwick, Lena; Piel, Jörn; Mangoni, Alfonso

    2013-01-01

    Summary Sponge symbionts are a largely unexplored source of new and unusual metabolic pathways. Insights into the distribution and function of metabolic genes of sponge symbionts are crucial to dissect and exploit their biotechnological potential. Screening of the metagenome of the marine sponge Plakortis simplex led to the discovery of the swf family, a new group of mono-modular type I polyketide synthase/fatty acid synthase (PKS/FAS) specifically associated with sponge symbionts. Two differ...

  8. Ethylene Production and 1-Aminocyclopropane-1-Carboxylate (ACC) Synthase Gene Expression in Tomato(Lycopsicon esculentum Mill.) Leaves Under Enhanced UV-B Radiation

    Lizhe An; Xunling Wang; Xiaofeng Xu; Hongguan Tang; Manxiao Zhang; Zongdong Hou; Yanhong Liu; Zhiguang Zhao; Huyuan Feng; Shijian Xu

    2006-01-01

    Tomato (Lycopsicon esculentum Mill.) plants grown in a greenhouse were irradiated with two different levels of UV-B, namely 8.82 (T1) and 12.6 kJ/m2 per day (T2). Ethylene production, 1-aminocyclopropane-1carboxylate (ACC) content, 1-(malonylamino) cyclopvopane-1-carboxylic acid (MACC) content, gene expression of ACC synthase (EC 4.4.1.14), and ACC oxidase activity in tomato leaves were determined. The results indicated that ACC content, the activity of ACC synthase and ACC oxidase, and ethylene production increased continuously under low doses of UV-B radiation, whereas at high doses of radiation these parameters increased during the first 12 d and then started to decrease. The MACC content increased continuously over 18 d under both doses of UV-B irradiation. The changes in ACC content, ACC synthase activity,ACC oxidase activity, the transcriptional level of the ACC synthase gene, and ethylene production were consistent with each other, suggesting that ACC synthase was the key enzyme in ethylene biosynthesis and that ethylene production in tomato leaf tissues under UV-B radiation could be regulated by the expression of the ACC synthase gene. The results also indicate that the change in ethylene metabolism may be an adaptive mechanism to enhanced UV-B radiation.

  9. Association of Polymorphism of Neuronal Nitric Oxide Synthase Gene with Risk to Parkinson's Disease.

    Gupta, Satya Prakash; Kamal, Ritul; Mishra, Sarad Kumar; Singh, Maneesh Kumar; Shukla, Rakesh; Singh, Mahendra Pratap

    2016-07-01

    Environmental factors are implicated in aging as well as genetic predisposition-induced Parkinson's disease (PD) pathogenesis. Wrongdoers increase oxidative stress and nitrosative burden, which eventually degenerate the nigrostriatal dopaminergic neurons. Inhibition of the expression of nitric oxide synthase (NOS), an enzyme responsible for nitric oxide (NO) biosynthesis, prevents the demise of the nigrostriatal dopaminergic neurons. Polymorphism of NOS is thus expected to alter PD susceptibility. The study therefore aimed to examine an association of neuronal NOS (nNOS) gene polymorphism with nitrite, an indicator of nitrosative load; lipid peroxidation, an index of oxidative stress and PD susceptibility. An age-matched case-control study was performed in the north Indian residents enrolled at the Neurology Department of the King George's Medical University, Lucknow, India. While nNOS exon 29 TT variant genotype [odds ratio (OR) = 2.20, 95 % CI = 1.08-5.34, P = 0.040], combined TT and CT variants [OR = 1.68, 95 % CI = 1.05-2.69, P = 0.031] and T allele [OR = 1.58, 95 % CI = 1.10-2.28, P = 0.014] were found to be significantly associated with PD susceptibility, no association between nNOS exon 18 [OR for TT carriers = 1.97, 95 % CI = 0.89-4.20, P = 0.09 and OR for T allele = 1.35, 95 % CI = 0.94-1.93, P = 0.098] and PD risk was observed. Lipid peroxidation was augmented in all patients irrespective of their genotype. While genotype independent increase in nitrite content was observed in PD patients of exon 29 polymorphic groups, only heterozygous variant genotype of exon 18 was associated with augmentation in nitrite level as compared with respective control. The results obtained thus demonstrate that selected nNOS polymorphisms do not significantly contribute to PD risk in north Indian population. PMID:26081147

  10. Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

    Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

  11. Relationships between endothelial nitric oxide synthase gene polymorphisms and osteoporosis in postmenopausal women

    Shun-zhi LIU; Hong YAN; Wei-kun HOU; Peng XU; Juan TUN; Li-fang TIAN; Bo-feng ZHU; Jie MA; She-min LU

    2009-01-01

    Objective: To investigate the relationships between endothelial nitric oxide synthases (eNOS) G894T and 27 bp-variable number tandem repeat (VNTR) gene polymorphisms and osteoporosis in the postmenopausal women of Chinese Han nationality. Methods: In the present study, 281 postmenopausal women from Xi'an urban area in West China were recruited, and divided into osteoporosis, osteopenia, and normal groups according to the diagnostic criteria of osteoporosis proposed by World Health Organization (WHO). The bone mineral density (BMD) values of lumbar vertebrae and left hips were determined by QDR-2000 dual energy X-ray absorptiometry. Blood samples were tested for plasma biochemical indicators including testosterone, estradiol, calcitonin, osteocalcin, and procollagen type I amino-terminal propeptide by enzyme-linked immunosorbent assay (ELISA), tartrate-resistant acid phosphatase by spectrophotometric method, and the content of nitric oxide by Griess method. Genome DNA was extracted from whole blood, and G894T polymorphism of eNOS gene was analyzed by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method and 27 bp-VNTR polymorphism of eNOS gene was genotyped by PCR method. Then the relationships between genotypes and biochemical indicators, genotypes and osteoporosis, and haplotypes and osteoporosis were analyzed. Results: The average BMD values of the femoral neck, ward's triangle and lumbar vertebrae 1~4 (L1~L4) in the subjects with T/T genotype in eNOS G894T locus were significantly higher than those in the subjects with G/T and G/G genotypes (P<0.05). The average BMD of the femoral neck in the subjects with a/a genotype of eNOS 27 bp-VNTR locus was evidently higher than that in the subjects with b/b genotype (P<0.05). The plasma testosterone and osteocalcin concentrations in the subjects of eNOS G894T G/T genotype were evidently higher than those in the subjects of other genotypes (P<0.05); the plasma estradiol

  12. Agrobacterium mediated transfer of a mutant Arabidopsis acetolactate synthase gene confers resistance to chlorsulfuron in chicory (Cichorium intybus L.).

    Vermeulen, A; Vaucheret, H; Pautot, V; Chupeau, Y

    1992-06-01

    Leaf discs of C. intybus were inoculated with an Agrobacterium tumefaciens strain harboring a neomycin phosphotransferase (neo) gene for kanamycin resistance and a mutant acetolactate synthase gene (csr1-1) from Arabidopsis thaliana conferring resistance to sulfonylurea herbicides. A regeneration medium was optimized which permitted an efficient shoot regeneration from leaf discs. Transgenic shoots were selected on rooting medium containing 100 mg/l kanamycin sulfate. Integration of the csr1-1 gene into genomic DNA of kanamycin resistant chicory plants was confirmed by Southern blot hybridizations. Analysis of the selfed progenies (S1 and S2) of two independent transformed clones showed that kanamycin and chlorsulfuron resistances were inherited as dominant Mendelian traits. The method described here for producing transformed plants will allow new opportunities for chicory breeding. PMID:24203132

  13. Correlation of viral RNA biosynthesis with glucose-6-phosphate dehydrogenase activity and host resistance

    Šindelář, Luděk; Šindelářová, Milada

    2002-01-01

    Roč. 215, - (2002), s. 862-869. ISSN 0032-0935 R&D Projects: GA ČR GA522/99/1264 Institutional research plan: CEZ:AV0Z5038910 Keywords : Glucose 6 phosphate dehydrogenase * Nicotiana (viral infection) * Plant viruses Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.960, year: 2002

  14. Cryopreservation of glucose-6-phosphate dehydrogenase activity inside red blood cells: developing a specimen repository in support of development and evaluation of glucose-6-phosphate dehydrogenase deficiency tests

    Kahn, Maria; LaRue, Nicole; Bansil, Pooja; Kalnoky, Michael; McGray, Sarah; Domingo, Gonzalo J

    2013-01-01

    Background Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common human enzyme deficiency. It is characterized by abnormally low levels of G6PD activity. Individuals with G6PD deficiency are at risk of undergoing acute haemolysis when exposed to 8‒aminoquinoline-based drugs, such as primaquine. For this reason it is imperative to identify individuals with G6PD deficiency prior to administering these anti-malarial drugs. There is a need for the development and evaluation of point-of-c...

  15. Glucose-6-phosphate-dehydrogenase deficiency and its correlation with other risk factors in jaundiced newborns in Southern Brazil

    Clarissa Gutirrez Carvalho; Simone Martins Castro; Ana Paula Santin; Carina Zaleski; Felipe Gutirrez Carvalho; Roberto Giugliani

    2011-01-01

    Objective:To evaluate the correlation between glucose-6-phosphate-dehydrogenase (G6PD) deficiency and neonatal jaundice.Methods: Prospective, observational case-control study was conducted on490 newborns admitted to Hospital de Clínicas de Porto Alegre for phototherapy, who all experienced35 or more weeks of gestation, from March to December2007. Enzymatic screening ofG6PD activity was performed, followed byPCR.Results:There was prevalence of4.6% and a boy-girl ratio of3:1 in jaundiced newborns. No jaundiced neonate withABO incompatibility presented G6PD deficiency, and no Mediterranean mutation was found. A higher proportion of deficiency was observed in Afro-descendants. There was no association withUGT1A1 variants. Conclusions:G6PD deficiency is not related to severe hyperbilirubinemia and considering the high miscegenation in this area of Brazil, other gene interactions should be investigated.

  16. The level of glucose-6-phosphate dehydrogenase activity strongly influences xylose fermentation and inhibitor sensitivity in recombinant Saccharomyces cerevisiae strains

    Jeppsson, M.; Johansson, B.; Jensen, Peter Ruhdal;

    2003-01-01

    Disruption of the ZWF1 gene encoding glucose-6-phosphate dehydrogenase (G6PDH) has been shown to reduce the xylitol yield and the xylose consumption in the xylose-utilizing recombinant Saccharomyces cerevisiae strain TMB3255. In the present investigation we have studied the influence of different...... consumption, respectively, compared with the ZWF1-disrupted strain. Both strains exhibited decreased xylitol yields (0.13 and 0.19 g/g xylose) and enhanced ethanol yields (0.36 and 0.34 g/g xylose) compared with the control strain TMB3001 (0.29 g xylitol/g xylose, 0.31 g ethanol/g xylose). Cytoplasmic...... transhydrogenase (TH) from Azotobacter vinelandii has previously been shown to transfer NADPH and NAD(+) into NADP(+) and NADH, and TH-overproduction resulted in lower xylitol yield and enhanced glycerol yield during xylose utilization. Strains with low G6PDH-activity grew slower in a lignocellulose hydrolysate...

  17. Cloning and Expression of Poly(hydroxyalkanoate) Synthase Genes from Photosynthetic bacterium Allochromatium vinosum ATCC 35206

    Poly(hydroxyalkanoate) (PHA) synthases catalyze the polymerization of beta-hydroxy fatty acids to form PHA biopolyesters. These enzymes are grouped into four classes (classes I to IV) based on their subunit composition and substrate specificity. Since PHA biopolymers are naturally synthesized by b...

  18. Genetic Diversity of Polyketide Synthase/Nonribosomal Peptide Synthetase Genes in Isolates of the Barley Net Blotch Fungus Pyrenophora teres f. teres

    Polyketide synthases (PKSs) and nonribosomal peptide synthetases (NRPSs) are multifunctional enzymes responsible for biosynthesis of diverse small molecules (e.g., mycotoxins and phytotoxins) in filamentous ascomycetes. Both PKS and NRPS genes are present in fungal genomes as large gene families but...

  19. COMPLEMENTATION OF THE AMYLOSE-FREE STARCH MUTANT OF POTATO (SOLANUM-TUBEROSUM) BY THE GENE ENCODING GRANULE-BOUND STARCH SYNTHASE

    VANDERLEIJ, FR; VISSER, RGF; OOSTERHAVEN, K; VANDERKOP, DAM; JACOBSEN, E; FEENSTRA, WJ

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  20. N-acetylglucosamine 6-phosphate deacetylase (nagA is required for N-acetyl glucosamine assimilation in Gluconacetobacter xylinus.

    Vikas Yadav

    Full Text Available Metabolic pathways for amino sugars (N-acetylglucosamine; GlcNAc and glucosamine; Gln are essential and remain largely conserved in all three kingdoms of life, i.e., microbes, plants and animals. Upon uptake, in the cytoplasm these amino sugars undergo phosphorylation by phosphokinases and subsequently deacetylation by the enzyme N-acetylglucosamine 6-phosphate deacetylase (nagA to yield glucosamine-6-phosphate and acetate, the first committed step for both GlcNAc assimilation and amino-sugar-nucleotides biosynthesis. Here we report the cloning of a DNA fragment encoding a partial nagA gene and its implications with regard to amino sugar metabolism in the cellulose producing bacterium Glucoacetobacter xylinus (formally known as Acetobacter xylinum. For this purpose, nagA was disrupted by inserting tetracycline resistant gene (nagA::tet(r; named as ΔnagA via homologous recombination. When compared to glucose fed conditions, the UDP-GlcNAc synthesis and bacterial growth (due to lack of GlcNAc utilization was completely inhibited in nagA mutants. Interestingly, that inhibition occured without compromising cellulose production efficiency and its molecular composition under GlcNAc fed conditions. We conclude that nagA plays an essential role for GlcNAc assimilation by G. xylinus thus is required for the growth and survival for the bacterium in presence of GlcNAc as carbon source. Additionally, G. xylinus appears to possess the same molecular machinery for UDP-GlcNAc biosynthesis from GlcNAc precursors as other related bacterial species.

  1. Characterization of the Saccharomyces cerevisiae ARG7 gene encoding ornithine acetyltransferase, an enzyme also endowed with acetylglutamate synthase activity.

    Crabeel, M; Abadjieva, A; Hilven, P; Desimpelaere, J; Soetens, O

    1997-12-01

    We have cloned by functional complementation and characterized the yeast ARG7 gene encoding mitochondrial ornithine acetyltransferase, the enzyme catalyzing the fifth step in arginine biosynthesis. While forming ornithine, this enzyme regenerates acetylglutamate, also produced in the first step by the ARG2-encoded acetylglutamate synthase. Interestingly, total deletion of the genomic ARG7 ORF resulted in an arginine-leaky phenotype, indicating that yeast cells possess an alternative route for generating ornithine from acetylornithine. Yeast ornithine acetyltransferase has been purified and characterized previously as a heterodimer of two subunits proposed to derive from a single precursor protein [Liu, Y-S., Van Heeswijck R., Hoj, P. & Hoogenraad, N. (1995) Eur. J. Biochem. 228, 291-296]; those authors further suggested that the internal processing of Arg7p, which is a mitochondrial enzyme, might occur in the matrix, while the leader peptide would be of the non-cleavable-type. The characterization of the gene (a) establishes that Arg7p is indeed encoded by a single gene, (b) demonstrates the existence of a cleaved mitochondrial prepeptide of eight residues, and (c) shows that the predicted internal processing site is unlike the mitochondrial proteolytic peptidase target sequence. Yeast Arg7p shares between 32-43% identity in pairwise comparisons with the ten analogous bacterial ArgJ enzymes characterized. Among these evolutionarily related enzymes, some but not all appear bifunctional, being able to produce acetylglutamate not only from acetylornithine but also from acetyl-CoA, thus catalyzing the same reaction as the apparently unrelated acetylglutamate synthase. We have addressed the question of the bifunctionality of the eucaryotic enzyme, showing that overexpressed ARG7 can complement yeast arg2 and Escherichia coli argA mutations (affecting acetylglutamate synthase). Furthermore, Arg7p-linked acetylglutamate synthase activity was measurable in an assay. The

  2. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Hausman, Jean-Francois; Strauss, Joseph; Ezcurra, Inés

    2016-01-01

    WD40 repeat (WDR) proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD). FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina) comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed. PMID:27367684

  3. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal

  4. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

    2014-07-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  5. Functional genomics reveals that a compact terpene synthase gene family can account for terpene volatile production in apple.

    Nieuwenhuizen, Niels J; Green, Sol A; Chen, Xiuyin; Bailleul, Estelle J D; Matich, Adam J; Wang, Mindy Y; Atkinson, Ross G

    2013-02-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple 'Royal Gala' expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  6. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  7. Expression in Arabidopsis of a Strawberry Linalool Synthase Gene Under the Control of the Inducible Potato P12 Promoter

    YANG Li-mei; Per Mercke; Joop J A van Loon; FANG Zhi-yuan; Marcel Dicke; Maarten A Jongsma

    2008-01-01

    To investigate the role of inducible linalool in Arabidopsis-insect interactions, the FANESl linalool synthase (LIS) cDNA from strawberry with plastid targeting and a synthetic intron (LIS') was placed under the control of the wound inducible proteinase inhibitor 2 (PI2) promoter from potato. The construct pBin-PP12-LIS' was transformed to Arabidopsis thaliana ecotype Columbia O. Kanamycin resistant T0 seedlings were confirmed for the presence and transcription of the LIS' gene by PCR analysis on genomic DNA and by RT-PCR analysis on RNA. Genomic and RT-PCR products were sequenced to confirm correct splicing of the synthetic intron. The expression of active linalool synthase by the PP12-LIS' gene construct in the transgenic lines was assessed by measuring linalool emission using solid phase micro-extraction (SPME) GC-MS measurements after induction with methyl jasmonate. Among 30 tested independent T2 transgenic lines, 10 exhibited linalool production.Linalool expression could be induced by methyl jasmonate treatment, but not by diamondback moth larvae.

  8. T-786c Polymorphism in nitric oxide synthase 3 gene and Nitrit Oxide Level of Diabetic Retinopathy in Javanese Population

    Putri Widelia Welkriana

    2015-11-01

    Full Text Available AbstractComplication of retinopathy in type 2 DM is caused of lower level of NO. Nitric oxide level is synthesizedfrom L-arginin in reaction that catalyze Nitric oxide synthase (NOS 3. The T-786C mutation in NOS 3 genedecreases the expression of nitric oxide synthase (NOS 3 so decreases NO synthesis. To investigate theassociation between T-786C polymorphism in NOS 3 gene with NO level of diabetic retinopathy patients. Thisstudy was a case control study, consist of 40 patient of type 2 diabetic with DR (case group and 40 patient oftype 2 diabetic without DR (control group of Javanese ethnic. The genotyping of T-786C polymorphism wasperformed by PCR-RLFP. Level of NO was measured by spectrophotometry. Chi square test and odd ratiowere used to analyze the association of the T-786C polymorphism in NOS 3 gene with DR. Differences ofNO level between TT and TC genotypes were analyzed using independent t test. The distribution of T-786Cpolymorphism in NOS 3 gene of DR subjects showed that frequency of TT genotype was 22.5% and TC genotypewas 77.5%. Non DR subjects showed the frequency of TT genotype was 50% and TC genotype was 50%, (p=0.011. Frequency of T allele in DR group was 61.25% and C allele was 38.75%, and frequency of T allele in nonDR group was 75% and C allele was 25%, (p= 0.62. Odd ratio of TC genotype was 3.444(CI; 95% : 0.964-3.735and C allele was 1.898 (CI; 95% : 1.310-9.058. The NO level of TC genotype was 1.43+0.126 and TT genotypewas 11.27+5.87 (p=0.000. Level of NO between RD and non RD showed not different significantly (p=0.160for retinopathy. The T-786C polymorphism of NOS 3 gene is risk factor for retinopathy in type 2 DiabetesMellitus. Individual with TC genotype of NOS 3 gene has lower level of NO than TT genotype.Keywords : Diabetic Retinopathy, Polymorphism, Nitric Oxide, Nitric Oxide Synthase.

  9. Normal Responses to Restraint Stress in Mice Lacking the Gene for Neuronal Nitric Oxide Synthase

    WEISSMAN, BEN A.; Sottas, Chantal M.; HOLMES, MICHAEL; Zhou, Ping; Iadecola, Costantino; HARDY, DIANNE O.; Ge, Ren-Shan; Hardy, Matthew P

    2009-01-01

    The hormonal changes associated with immobilization stress (IMO) include a swift increase in corticosterone (CORT) concentration and a decrease in circulating testosterone (T) levels. There is evidence that the production of the short-lived neuromodulator nitric oxide (NO) is increased during stress in various tissues, including the brain. NO also suppresses the biosynthesis of T. Both the inducible and the neuronal isoforms of NO synthase (iNOS and nNOS, respectively) have been implicated in...

  10. Association of Thymidylate Synthase Gene Polymorphisms with Stavudine Triphosphate Intracellular Levels and Lipodystrophy▿

    Domingo, Pere (Domingo Pedrol); Cabeza, M. Carmen; Pruvost, Alain; Torres, Ferran; Salazar, Juliana; del Mar Gutierrez, M.; Mateo, M. Gracia; Fontanet, Angels; Fernandez, Irene; Domingo, Joan C.; Villarroya, Francesc; Vidal, Francesc; Baiget, Montserrat

    2011-01-01

    The antiviral activity and toxicity of stavudine (d4T) depend on its triphosphate metabolite, stavudine triphosphate (d4T-TP). Therefore, modifications in intracellular levels of d4T-TP may change the toxicity profile of stavudine. d4T-TP intracellular levels in peripheral blood mononuclear cells were determined with a prominence liquid chromatograph connected to a triple-quadruple mass spectrometer. Polymorphisms in the thymidylate synthase (TS), methylenetetrahydrofolate reductase (MTHFR), ...

  11. Factors influencing gene silencing of granule-bound starch synthase in potato

    Heilersig, H.J.B.

    2005-01-01

    In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI has been achieved by transformation with antisense and sense GBSSI constructs. However, the percentages of transformants showing strong silencing were relatively low which implicated that large num...

  12. Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea).

    Yang, Ji; Gu, Hongya; Yang, Ziheng

    2004-01-01

    Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication. PMID:14743314

  13. [Full-length cDNA cloning of flavonol synthase genes of Carthamus tinctorius and construction plant expression vector].

    Yang, Wen-ting; Liu, Xiu-ming; Wan, Qiu; Yao, Na; Wang, Nan; Zhang, Xue-meng; Jiao, Zhong-da; Li, Hai-yan; Li, Xiao-kun

    2015-02-01

    Flavonol synthase (FLS) is one of the key enzymes in flavonoids metabolic pathways. In this study, middle sequence was obtained from Carthamus tinctorius transcriptome sequencing results. Full-length cDNAs of FLS was cloned from petals of C. tinctorius to FLS by using RT-PCR and RACE technology. Its full-length cDNA was 1,201 bp, with an open reading frame of 1,101 bp and 336 encoded amino acids. The phylogenetic analysis showed that, FLS gene encoded amino acids in C. tinctorius were highly homologous with amino acids in congeneric Compositae species, especially Rudbeckia laciniata. The pBASTA-FLS plant expression vector was successfully built by the molecular biology method, which lays a foundation for further studying biology functions of the gene and biosynthesis mechanism of flavonoids. PMID:26137682

  14. Congenital erythropoietic porphyria with two mutations of the uroporphyrinogen III synthase gene (Cys73Arg, Thr228Met

    Zoran Gucev

    2011-01-01

    Full Text Available Congenital erythropoietic porphyria (CEP is an autosomal recessive inborn error of metabolism that results from the markedly deficient activity of uroporphyrinogen III synthase (UROS. We describe a 14-year-old girl with red urine since infancy, progressive blistering and scarring of the skin, and moderate hemolytic anemia. After years of skin damage, her face is mutilated; she has a bald patch on the scalp, hypertrichosis of the neck, areas of skin darkening, and limited joint movements of the hands. Total urine excretion and fecal total porphyrin were both markedly raised above normal levels. Sequencing of the UROS gene identified two mutations causing CEP (Cys73Arg, Thr228Met. The patient lesions are progressing. Bone marrow transplantation and/or gene therapy are proposed as the next steps in her treatment. In brief, we describe a CEP with confirmed two pathogenic mutations, severe phenotype and discuss the various treatment options available.

  15. Sequence analysis of the chitin synthase A gene of the Dutch elm pathogen Ophiostoma novo-ulmi indicates a close association with the human pathogen Sporothrix schenckii.

    Hintz, W E

    1999-09-01

    Degenerate oligonucleotide primers were designed according to conserved regions of the chitin synthase gene family and used to amplify a 621 basepair (bp) fragment from genomic DNA of Ophiostoma novo-ulmi, the causal agent of Dutch elm disease. The amplification product was used as a hybridization probe to screen a library of genomic DNA sequences and to retrieve a full-length chitin synthase gene (chsA). The putative coding region of the gene was 2619 bp long, lacked introns, and encoded a polypeptide of 873 amino acids. Based on the similarity of the predicted amino acid sequence to the full-length chsC gene of Aspergillus nidulans and chsA gene of Ampelomyces quisqualis, the O. novo-ulmi chsA was classified as a Class I chitin synthase. The phylogenies constructed, according to a subregion of all available chitin synthases, showed that O. novo-ulmi consistently clustered most closely with the human pathogen Sporothrix schenckii, recently classified as a member of the mitosporic Ophiostomataceae. Disruption of the chsA gene locus had no obvious effects on the growth or morphology of the fungus. PMID:10524253

  16. Hexose-6-phosphate dehydrogenase contributes to skeletal muscle homeostasis independent of 11β-hydroxysteroid dehydrogenase type 1.

    Semjonous, Nina M

    2011-01-01

    Glucose-6-phosphate (G6P) metabolism by the enzyme hexose-6-phosphate dehydrogenase (H6PDH) within the sarcoplasmic reticulum lumen generates nicotinamide adenine dinucleotide phosphate (reduced) to provide the redox potential for the enzyme 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) to activate glucocorticoid (GC). H6PDH knockout (KO) mice have a switch in 11β-HSD1 activity, resulting in GC inactivation and hypothalamic-pituitary-adrenal axis activation. Importantly, H6PDHKO mice develop a type II fiber myopathy with abnormalities in glucose metabolism and activation of the unfolded protein response (UPR). GCs play important roles in muscle physiology, and therefore, we have examined the importance of 11β-HSD1 and GC metabolism in mediating aspects of the H6PDHKO myopathy. To achieve this, we examined 11β-HSD1\\/H6PDH double-KO (DKO) mice, in which 11β-HSD1 mediated GC inactivation is negated. In contrast to H6PDHKO mice, DKO mice GC metabolism and hypothalamic-pituitary-adrenal axis set point is similar to that observed in 11β-HSD1KO mice. Critically, in contrast to 11β-HSD1KO mice, DKO mice phenocopy the salient features of the H6PDHKO, displaying reduced body mass, muscle atrophy, and vacuolation of type II fiber-rich muscle, fasting hypoglycemia, increased muscle glycogen deposition, and elevated expression of UPR genes. We propose that muscle G6P metabolism through H6PDH may be as important as changes in the redox environment when considering the mechanism underlying the activation of the UPR and the ensuing myopathy in H6PDHKO and DKO mice. These data are consistent with an 11β-HSD1-independent function for H6PDH in which sarcoplasmic reticulum G6P metabolism and nicotinamide adenine dinucleotide phosphate-(oxidized)\\/nicotinamide adenine dinucleotide phosphate (reduced) redox status are important for maintaining muscle homeostasis.

  17. Medications and glucose-6-phosphate dehydrogenase deficiency: an evidence-based review.

    Youngster, Ilan; Arcavi, Lidia; Schechmaster, Renata; Akayzen, Yulia; Popliski, Hen; Shimonov, Janna; Beig, Svetlana; Berkovitch, Matitiahu

    2010-09-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect and one of the most common genetic disorders worldwide, with an estimated 400 million people worldwide carrying a mutation in the G6PD gene that causes deficiency of the enzyme. Although drug-induced haemolysis is considered the most common adverse clinical consequence of G6PD deficiency, significant confusion exists regarding which drugs can cause haemolytic anaemia in patients with G6PD deficiency. In the absence of consensus among physicians, patients are subject to conflicting advice, causing uncertainty and distress. In the current review we aimed, by thorough search of the medical literature, to collect evidence on which to base decisions either to prohibit or allow the use of various medications in patients with G6PD deficiency. A literature search was conducted during May 2009 for studies and case reports on medication use and G6PD deficiency using the following sources: MEDLINE (1966-May 2009), PubMed (1950-May 2009), the Cochrane database of systematic reviews (2009), and major pharmacology, internal medicine, haematology and paediatric textbooks. After assessing the literature, we divided medications into one of three groups: medications that should be avoided in individuals with G6PD deficiency, medications that were considered unsafe by at least one source, but according to our review can probably be given safely in normal therapeutic dosages to individuals with G6PD deficiency as evidence does not contravene their use, and medications where no evidence at all was found to contravene their use in G6PD-deficient patients. It is reasonable to conclude that, over time, many compounds have been wrongly cited as causing haemolysis because they were administered to patients experiencing an infection-related haemolytic episode. We found solid evidence to prohibit only seven currently used medications: dapsone, methylthioninium chloride (methylene blue), nitrofurantoin

  18. Post-irradiation repairing processes of glucose-6-phosphate dehydrogenase and catalase from Hansenula Polymorpha yeast

    The post-irradiation repairing mechanisms of two Hansenula Polymorpha yeast enzymes, glucose-6-phosphate dehydrogenase and catalase, were studied. The kinetic parameters of the selected enzymes were investigated over one month since the moment of γ-irradiation with different doses in the presence of oxygen. Dose dependent decrease of initial reaction rates was noticed for both enzymes. Small variation of initial reaction rate was recorded for glucose-6-phosphate dehydrogenase over one month, with a decreasing tendency. No significant electrophoretic changes of molecular forms of this enzyme were observed after irradiation. Continuous strong decrease of catalase activity was evident for the first 20 days after irradiation. Partial recovery process of the catalytic activity was revealed by this study. (authors)

  19. Kinetics of exogenous induction of the hexose-6-phosphate transport system of Escherichia coli.

    Winkler, H H

    1971-07-01

    The kinetics of the exogenous induction of the hexose-phosphate transport system by glucose-6-phosphate (G6P) was investigated. The induction of this system by extracellular but not intracellular G6P was confirmed. The differential rate of synthesis was linear, a function of the extracellular concentration of G6P and independent of the previous induction history of the culture. Neither maintenance nor autocatalysis, phenomena described in the induction of the lac operon, were observed in the exogenous induction of hexose-phosphate transport. Fructose-6-phosphate, a potent competitive inhibitor of G6P influx, had no effect on the induction of the system by G6P, indicating that the transport of inducer was not involved in the induction process. PMID:4935331

  20. Mannose-6-phosphate receptor: a target for theranostics of prostate cancer.

    Vaillant, Ophélie; El Cheikh, Khaled; Warther, David; Brevet, David; Maynadier, Marie; Bouffard, Elise; Salgues, Frédéric; Jeanjean, Audrey; Puche, Pierre; Mazerolles, Catherine; Maillard, Philippe; Mongin, Olivier; Blanchard-Desce, Mireille; Raehm, Laurence; Rébillard, Xavier; Durand, Jean-Olivier; Gary-Bobo, Magali; Morère, Alain; Garcia, Marcel

    2015-05-11

    The development of personalized and non-invasive cancer therapies based on new targets combined with nanodevices is a major challenge in nanomedicine. In this work, the over-expression of a membrane lectin, the cation-independent mannose 6-phosphate receptor (M6PR), was specifically demonstrated in prostate cancer cell lines and tissues. To efficiently target this lectin a mannose-6-phosphate analogue was synthesized in six steps and grafted onto the surface of functionalized mesoporous silica nanoparticles (MSNs). These MSNs were used for in vitro and ex vivo photodynamic therapy to treat prostate cancer cell lines and primary cell cultures prepared from patient biopsies. The results demonstrated the efficiency of M6PR targeting for prostate cancer theranostic. PMID:25802144

  1. Fructose-6-phosphate aldolase is a novel class I aldolase from Escherichia coli and is related to a novel group of bacterial transaldolases.

    Schurmann, M; Sprenger, G A

    2001-04-01

    We have cloned an open reading frame from the Escherichia coli K-12 chromosome that had been assumed earlier to be a transaldolase or a transaldolase-related protein, termed MipB. Here we show that instead a novel enzyme activity, fructose-6-phosphate aldolase, is encoded by this open reading frame, which is the first report of an enzyme that catalyzes an aldol cleavage of fructose 6-phosphate from any organism. We propose the name FSA (for fructose-six phosphate aldolase; gene name fsa). The recombinant protein was purified to apparent homogeneity by anion exchange and gel permeation chromatography with a yield of 40 mg of protein from 1 liter of culture. By using electrospray tandem mass spectroscopy, a molecular weight of 22,998 per subunit was determined. From gel filtration a size of 257,000 (+/- 20,000) was calculated. The enzyme most likely forms either a decamer or dodecamer of identical subunits. The purified enzyme displayed a V(max) of 7 units mg(-)1 of protein for fructose 6-phosphate cleavage (at 30 degrees C, pH 8.5 in 50 mm glycylglycine buffer). For the aldolization reaction a V(max) of 45 units mg(-)1 of protein was found; K(m) values for the substrates were 9 mm for fructose 6-phosphate, 35 mm for dihydroxyacetone, and 0.8 mm for glyceraldehyde 3-phosphate. FSA did not utilize fructose, fructose 1-phosphate, fructose 1,6-bisphosphate, or dihydroxyacetone phosphate. FSA is not inhibited by EDTA which points to a metal-independent mode of action. The lysine 85 residue is essential for its action as its exchange to arginine (K85R) resulted in complete loss of activity in line with the assumption that the reaction mechanism involves a Schiff base formation through this lysine residue (class I aldolase). Another fsa-related gene, talC of Escherichia coli, was shown to also encode fructose-6-phosphate aldolase activity and not a transaldolase as proposed earlier. PMID:11120740

  2. Frequency of glucose-6-phosphate dehydrogenase deficiency in relation to altitude: a malaria hypothesis

    Tzoneva, M.; Bulanov, A. G.; Mavrudieva, M.; Lalchev, S.; Toncheva, D; Tanev, D.

    1980-01-01

    Genetic markers have recently been found to be much more polymorphic than expected. Such extensive human polymorphisms may be partly explained by a number of genetic and environmental factors, including infectious diseases. Malaria, which was very widespread in the past and still poses a problem in many countries today, is a good candidate for research. The association between malaria and glucose-6-phosphate dehydrogenase (G6PD) deficiency is well-known, but more should be done to determine t...

  3. Evaluation of Glucose-6-Phosphate Dehydrogenase Deficiency without Hemolysis in Icteric Newborns

    Farzaneh Eghbalian; Ali Reza Monsef

    2007-01-01

    Objective: Glucose-6- phosphate dehydrogenase (G6PD) deficiency is an inherited deficiency that may be the cause of neonatal jaundice. Our aim was to study the prevalence of G6PD deficiency without hemolysis in relation to neonatal jaundice. Material & Methods: This prospective descriptive study has been conducted on 272 icteric newborns admitted to the Ekbatan Hospital from October 2002 to September 2004. The dataset included: age, sex, total and direct bilirubin, hemoglobin, reticulocyte co...

  4. Subtle adjustments of the glucose-6-phosphate dehydrogenase (G6PD) mutation database and reference sequence.

    Mazières, Stéphane; Petit, Florence; Dugoujon, Jean-Michel; Iriart, Xavier; Berry, Antoine; Carme, Bernard; Nacher, Mathieu; Bailly, Pascal; Chiaroni, Jacques

    2014-01-01

    Reference sequences and mutation databases are essential for the development of molecular-based methods in human genetics. Lately, Minucci et al. [1] revised the glucose-6-phosphate dehydrogenase (G6PD) reference material from 131 bibliographic references, three previous databases, and the genomic reference sequence (GenBank accession number X55448.1). Deficiency in G6PD is the most common enzymatic insufficiency in human populations and clinical manifestations range from mild to severe: neon...

  5. A model of glucose-6-phosphate dehydrogenase deficiency in the zebrafish

    Patrinostro, Xiaobai; Carter, Michelle L.; Kramer, Ashley C.; Lund, Troy C

    2013-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common genetic defect and enzymopathy worldwide, affecting approximately 400 million people and causing acute hemolysis in persons exposed to prooxidant compounds such as menthol, naphthalene, anti-malarial drugs, and fava beans. Mouse models have not been useful because of a lack of significant response to oxidative challenge. We turned to zebrafish (Danrio rerio) embryos, which develop ex utero and are transparent, allowing vis...

  6. Prevalence of Glucose-6-Phosphate Dehydrogenase (G6PD) Deficiency in Newborns

    Zamani, A.; Z Oloumi; E. Amini; M Ghasemi

    2006-01-01

    Background: Glucose-6-phosphate dehydrogenase (G6PD) deficiency can cause hemolytic anemia and neonatal jaundice. Screening of newborns by examining the cord blood for enzyme activity has been proposed for prevention of its complications. The aim of the present study was to determine the incidence of G6PD deficiency in newborns in Vali-e-Asr hospital, Tehran. The relation between G6PD deficiency and the variables of sex, gestational age, jaundice, hemolysis, and anemia was also examined. Meth...

  7. Impact of glucose-6-phosphate dehydrogenase deficiency on the pathophysiology of cardiovascular disease

    Hecker, Peter A.; Leopold, Jane A.; Gupte, Sachin A.; Recchia, Fabio A; Stanley, William C.

    2012-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) catalyzes the rate-determining step in the pentose phosphate pathway and produces NADPH to fuel glutathione recycling. G6PD deficiency is the most common enzyme deficiency in humans and affects over 400 million people worldwide; however, its impact on cardiovascular disease is poorly understood. The glutathione pathway is paramount to antioxidant defense, and G6PD-deficient cells do not cope well with oxidative damage. Limited clinical evidence indicat...

  8. Glucose-6-Phosphate Dehydrogenase-Deficiency in Transfusion Medicine: The Unknown Risks

    Francis, Richard O.; Jhang, Jeffrey S.; Pham, Huy P.; Hod, Eldad A.; Zimring, James C; Spitalnik, Steven L.

    2013-01-01

    The hallmark of glucose-6-phosphate dehydrogenase (G6PD) deficiency is red blood cell (RBC) destruction in response to oxidative stress. Patients requiring RBC transfusions may simultaneously receive oxidative medications or have concurrent infections, both of which can induce hemolysis in G6PD-deficient RBCs. Although it is not routine practice to screen healthy blood donors for G6PD deficiency, case reports identified transfusion of G6PD-deficient RBCs as causing hemolysis and other adverse...

  9. Trehalose 6-phosphate regulates starch synthesis via posttranslational redox activation of ADP-glucose pyrophosphorylase

    Kolbe, A.; Tiessen, A.; Schluepmann, H.; Paul, M; Ulrich, S; Geigenberger, P.

    2005-01-01

    Trehalose is the most widespread disaccharide in nature, occurring in bacteria, fungi, insects, and plants. Its precursor, trehalose 6-phosphate (T6P), is also indispensable for the regulation of sugar utilization and growth, but the sites of action are largely unresolved. Here we use genetic and biochemical approaches to investigate whether T6P acts to regulate starch synthesis in plastids of higher plants. Feeding of trehalose to Arabidopsis leaves led to stimulation of starch synthesis wit...

  10. Hydrocellular foam dressing promotes wound healing along with increases in hyaluronan synthase 3 and PPARα gene expression in epidermis.

    Takumi Yamane

    Full Text Available BACKGROUND: Hydrocellular foam dressing, modern wound dressing, induces moist wound environment and promotes wound healing: however, the regulatory mechanisms responsible for these effects are poorly understood. This study was aimed to reveal the effect of hydrocellular foam dressing on hyaluronan, which has been shown to have positive effects on wound healing, and examined its regulatory mechanisms in rat skin. METHODOLOGY/PRINCIPAL FINDINGS: We created two full-thickness wounds on the dorsolateral skin of rats. Each wound was covered with either a hydrocellular foam dressing or a film dressing and hyaluronan levels in the periwound skin was measured. We also investigated the mechanism by which the hydrocellular foam dressing regulates hyaluronan production by measuring the gene expression of hyaluronan synthase 3 (Has3, peroxisome proliferator-activated receptor α (PPARα, and CD44. Hydrocellular foam dressing promoted wound healing and upregulated hyaluronan synthesis, along with an increase in the mRNA levels of Has3, which plays a primary role in hyaluronan synthesis in epidermis. In addition, hydrocellular foam dressing enhanced the mRNA levels of PPARα, which upregulates Has3 gene expression, and the major hyaluronan receptor CD44. CONCLUSIONS/SIGNIFICANCE: These findings suggests that hydrocellular foam dressing may be beneficial for wound healing along with increases in hyaluronan synthase 3 and PPARα gene expression in epidermis. We believe that the present study would contribute to the elucidation of the mechanisms underlying the effects of hydrocellular foam dressing-induced moist environment on wound healing and practice evidence-based wound care.