WorldWideScience

Sample records for 6-phosphate synthase gene

  1. Isolation and characterization of the trehalose-6-phosphate synthase gene from Locusta migratoria manflensis

    Shu-Yan Cui; Yu-Xian Xia

    2009-01-01

    Trehalose plays an important role in protecting organisms from various stresses.Trehalose-6-phosphate synthase (TPS) is the key enzyme in trehalose synthesis, but in in-sects only a few TPS genes have been identified and their function has not been well characterized. To better understand the function of TPS in insects, a complete TPS com-plementary DNA (eDNA) clone was obtained from the fat body of the locust Locusta migratoria manilensis (GenBank accession number: EU 131894). The full-length cDNA is 2 806 bp, including an open reading frame of 2 442 bp, which encodes an 813 amino acids protein with a calculated molecular weight of 91 976 Daltons and an isoelectric point of 6.14. The deduced amino acid sequence is highly similar to other published insect TPS and its C-terminal also has a region homologous to trehalose phosphate phsophatase (TPP).Semi-quantitative analysis indicated that the TPS transcript was expressed not only in fat body, but also in gut, hemolymph and leg muscle. These data may facilitate studies of TPS function in insects and improve our understanding of trehalose metabolism.

  2. Cloning and Characterization of a Salt Tolerance-Associated Gene Encoding Trehalose-6-Phosphate Synthase in Sweetpotato

    JIANG Tao; ZHAI Hong; WANG Fei-bing; ZHOU Hua-nan; SI Zeng-zhi; HE Shao-zhen; LIU Qing-chang

    2014-01-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in a variety of organisms. In plants, its biosynthesis is catalyzed by two key enzymes:trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP). In the present study, a TPS gene, named IbTPS, was ifrst isolated from sweetpotato (Ipomoea batatas (L.) Lam.) cv. Lushu 3 by rapid ampliifcation of cDNA ends (RACE). The open reading frame (ORF) contained 2 580 nucleotides encoding 859 amino acids with a molecular weight of 97.433 kDa and an isoelectric point (pI) of 5.7. The deduced amino acid sequence showed high identities with TPS of other plants. Real-time quantitative PCR analysis revealed that the expression level of IbTPS gene was signiifcantly higher in stems of Lushu 3 than in its leaves and roots. Subcellular localization analysis in onion epidermal cells indicated that IbTPS gene was located in the nucleus. Transgenic tobacco (cv. Wisconsin 38) plants over-expressing IbTPS gene exhibited signiifcantly higher salt tolerance compared with the control plant. Trehalose and proline content was found to be signiifcantly more accumulated in transgenic tobacco plants than in the wild-type and several stress tolerance related genes were up-regulated. These results suggest that IbTPS gene may enhance salt tolerance of plants by increasing the amount of treahalose and proline and regulating the expression of stress tolerance related genes.

  3. Identification of the trehalose-6-phosphate synthase gene family in winter wheat and expression analysis under conditions of freezing stress

    D. W. Xie; X. N. Wang; L. S. Fu; J. Sun; W. Zheng; Z. F. Li

    2015-03-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are potentially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag sequence information from NCBI and two wheat genome databases, we identified 12 wheat TPS genes and performed a comprehensive study on their structural, evolutionary and functional properties. The estimated divergence time of wheat TPS gene pairs and wheat–rice orthologues suggested that wheat and rice have a common ancestor. The number of TPS genes in the wheat genome was estimated to be at least 12, which is close to the number found in rice, Arabidopsis and soybean. Moreover, it has been reported earlier in other plants that TPS genes respond to abiotic stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat, and determined that most of the TPS gene expression in winter wheat was induced by freezing conditions, which further suggested that wheat TPS genes were involved in winter wheat freeze-resistance signal transduction pathways. Taken together, the current study represents the first comprehensive study of TPS genes in winter wheat and provides a foundation for future functional studies of this important gene family in Triticeae.

  4. Virus-Induced Gene Silencing-Based Functional Analyses Revealed the Involvement of Several Putative Trehalose-6-Phosphate Synthase/Phosphatase Genes in Disease Resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000 in Tomato

    Zhang, Huijuan; Hong, Yongbo; Huang, Lei; Liu, Shixia; Tian, Limei; Dai, Yi; Cao, Zhongye; Huang, Lihong; Li, Dayong; Song, Fengming

    2016-01-01

    Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development, and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs, and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs, and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst) DC3000 as well as to defense signaling hormones (e.g., salicylic acid, jasmonic acid, and a precursor of ethylene). Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4, or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7, or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7, and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato. PMID:27540389

  5. Molecular cloning and characterization of a trehalose-6-phosphate synthase/phosphatase from Dunaliella viridis.

    Zhang, Nan; Wang, Fei; Meng, Xiangzong; Luo, Saifan; Li, Qiyun; Dong, Hongyun; Xu, Zhengkai; Song, Rentao

    2011-04-01

    Dunaliella is a group of green algae with exceptional stress tolerance capability, and is considered as an important model organism for stress tolerance study. Here we cloned a TPS (trehalose-6-phosphate synthase) gene from Dunaliella viridis and designated it as DvTPS (D. viridis trehalose-6-phosphate synthase/phosphatase).The DvTPS cDNA contained an ORF of 2793 bp encoding 930 aa. DvTPS had both TPS and TPP domain and belonged to the Group II TPS/TPP fusion gene family. Southern blots showed it has a single copy in the genome. Genome sequence analysis revealed that it has 18 exons and 17 introns. DvTPS had a constitutive high expression level under various NaCl culture conditions, however, could be induced by salt shock. Promoter analysis indicated there were ten STREs (stress response element) in its promoter region, giving a possible explanation of its inducible expression pattern upon salt shock. Yeast functional complementation analysis showed that DvTPS had neither TPS nor TPP activity. However, DvTPS could improve the salt tolerance of yeast salt sensitive mutant G19. Our results indicated that despite DvTPS showed significant similarity with TPS/TPP, its real biological function is still remained to be revealed. PMID:20878239

  6. Silencing trehalose-6-phosphate synthase incapacitates adult mosquitoes by interfering with the biosynthetic pathway for flight fuel

    Trehalose is a disaccharide comprised of two glucose molecules. It is the main blood sugar of insects and is essential for flight. Trehalose is synthesized by two enzymes: trehalose-6-phosphate synthase (T6PS) converts glucose-6-phosphate to trehalose-6-phosphate, and trehalose-6-phosphate phosphata...

  7. Synthesis and modifications of heterocyclic derivatives of D-arabinose: potential inhibitors of glucose-6-phosphate isomerase and glucosamine-6-phosphate synthase

    The synthesis of -5-(D-arabino-1,2,3,4-tetrahydroxybutyl)tetrazole and -2-(d-arabino-1,2,3,4-tetra-acetoxybutyl)-5-methyl-1,3,4-oxadiazole from d-arabinose is described. Attempts at removing the protecting groups of the oxadiazole derivative were unsuccessful, leading to products resulting from the opening of the oxadiazole ring. The unprotected tetrazole derivative was selectively phosphorylated at the primary hydroxyl group with diethyl phosphoryl chloride. The resulting 5-[d-arabino-4-(diethylphosphoryloxy)-1,2,3-trihydroxybutyl]tetrazole is a protected form of a potential inhibitor of the enzymes glucose-6-phosphate isomerase and glucosamine synthase. (author)

  8. Crystallization and preliminary X-ray analysis of the isomerase domain of glucosamine-6-phosphate synthase from Candida albicans

    The isomerase domain of glucosamine-6-phosphate synthase from C. albicans has been crystallized and X-ray diffraction data have been collected. Preliminary analysis of the data reveals the oligomeric structure of the eukaryotic synthase to be a ‘dimer’ of prokaryotic-like dimers. Glucosamine-6-phosphate synthase (EC 2.6.1.16) catalyses the first and practically irreversible step in the hexosamine metabolism pathway, the end product of which, uridine 5′-diphospho-N-acetyl d-glucosamine, is an essential substrate for assembly of the cell wall. The isomerase domain, consisting of residues 346–712 (42 kDa), of glucosamine-6-phosphate synthase from Candida albicans has been crystallized. X-ray analysis revealed that the crystals belonged to space group I4, with unit-cell parameters a = b = 149, c = 103 Å. Diffraction data were collected to 3.8 Å. Preliminary results from molecular replacement using the homologous bacterial monomer reveal that the asymmetric unit contains two monomers that resemble a bacterial dimer. The crystal lattice consists of pairs of such symmetry-related dimers forming elongated tetramers

  9. Cloning and Expression Analysis of Trehalose-6-phosphate Synthase Gene(CsTPS)from Tea Plant(Camellia sinensis(L.)O.Kuntz)%茶树海藻糖-6-磷酸合成酶基因(CsTPS)的克隆及表达分析

    丁菲; 庞磊; 李叶云; 葛菁; 江昌俊

    2012-01-01

    海藻糖-6-磷酸合成酶(trehalose-6-phosphate synthase,TPS)是海藻糖合成途径中的一个关键酶.目前,TPS基因的研究多数集中于细菌和真菌等,而对植物的研究较少.本实验通过对茶树(Camellia sinensis(L.)O.Kuntze)全器官转录组文库序列比对,获得一条与其他物种同源性较高的编码TPS基因的EST序列,通过RACE扩增后获得茶树TPS基因cDNA全长序列,命名为Cs TPS(GenBank登录号JQ742017).该基因cDNA全长3 125 bp,包含一个2799 bp的开放阅读框,编码932个氨基酸.多序列比对分析结果表明,Cs TPS基因编码的蛋白具有明显的TPS和TPP两个结构域.系统进化分析表明,其编码的氨基酸序列与拟南芥(Arabidopsis thaliana)、烟草(Nicotiana tabacum)和番茄(Solanum lycopersicum)等植物的TPS同源性较高,且CsTPS与拟南芥TPS1(AtTPS1)的同源性高于TPS2(AtTPS2)和TPS3(AtTPS3).qPCR分析显示,CsTPS基因在茶树不同组织器官中呈现差异性表达.低温诱导促使老叶和嫩叶中的CsTPS基因上调程度明显大于根系,表明CsTPS基因可能参与了茶树抗寒机制.%Trehalose-6-phosphate Synthase (TPS) is a key enzyme in the synthesis of trehalose in plants. At present, researches about TPS have mainly focused on bacteria and fungi but little about plants. An EST, having high homology with TPS gene from other organisms, was screened from the whole organic transcriptomic library of tea {Camellia sinensis (L.) O. Kuntz) and amplified through RACE technology to obtain the cDNA full-length of trehalose-6-phosphate synthase gene, named CsTPS (GenBank accession number: JQ742017). The cDNA full-length of CsTPS was 3 125 bp with a single 2 799 bp opening reading frame that predicted to encoded a 932 animo acid, which contained two obvious structure domains, TPS and TPP, through multiple sequences alignment. Phylogenetic tree indicated that the deduced animo acid sequence of CsTPS gene had a very high identity with TPS genes from other

  10. Monitoring the Dynamics of Monomer Exchange Using Electrospray Mass Spectrometry: The Case of the Dimeric Glucosamine-6-Phosphate Synthase

    Chevreux, Guillaume; Atmanene, Cédric; Lopez, Philippe; Ouazzani, Jamal; Van Dorsselaer, Alain; Badet, Bernard; Badet-Denisot, Marie-Ange; Sanglier-Cianférani, Sarah

    2011-03-01

    Escherichia coli glucosamine-6-phosphate synthase (GlmS) is a dimeric enzyme from the glutamine-dependent amidotransferases family, which catalyses the conversion of D-fructose-6-phosphate (Fru6P) and glutamine (Gln) into D-glucosamine-6-phosphate (GlcN6P) and glutamate, respectively. Extensive X-ray crystallography investigations have been reported, highlighting the importance of the dimeric association to form the sugar active site as well as significant conformational changes of the protein upon substrate and product binding. In the present work, an approach based on time-resolved noncovalent mass spectrometry has been developed to study the dynamics of GlmS subunit exchange. Using 14N versus 15N labeled proteins, the kinetics of GlmS subunit exchange was monitored with the wild-type enzyme in the presence of different substrates and products as well as with the protein bearing a key amino acid mutation specially designed to weaken the dimer interface. Determination of rate constants of subunit exchange revealed important modifications of the protein dynamics: while glutamine, glutamate, and K603A mutation accelerates subunit exchange, Fru6P and GlcN6P totally prevent it. These results are described in light of the available structural information, providing additional useful data for both the characterization of GlmS catalytic process and the design of new GlmS inhibitors. Finally, time-resolved noncovalent MS can be proposed as an additional biophysical technique for real-time monitoring of protein dynamics.

  11. Molecular Docking Studies of Catechin and Its Derivatives as Anti-bacterial Inhibitor for Glucosamine-6-Phosphate Synthase

    Fikrika, H.; Ambarsari, L.; Sumaryada, T.

    2016-01-01

    Molecular docking simulation of catechin and its derivatives on Glucosamine-6- Phosphate Synthase (GlmS) has been performed in this research. GlmS inhibition by a particular ligand will suppress the production of bacterial cell wall and significantly reduce the population of invading bacteria. In this study, catechin derivatives i.e epicatechin, galloatechin and epigalloatechin were found to have stronger binding affinities as compared to natural ligand of GlmS, Fructose-6-Phosphate (F6P). Those three ligands were docked on the same pocket in GlmS target as F6P, with 70% binding sites similarity. Based on the docking results, gallocatechin turns out to be the most potent ligand for anti-bacterial agent with ΔG= -8.00 kcal/mol. The docking between GlmS and catechin derivatives are characterized by a constant present of a strong hydrogen bond between functional group O3 and Ser-349. This hydrogen bond most likely plays a significant role in the docking mechanism and binding modes selection. The surprising result is catechin itself exhibited a quite strong binding with GlmS (ΔG= -7.80 kcal.mol), but docked on a completely different pocket compared to other ligands. This results suggest that catechin might still have a curing effect but with a completely different pathway and mechanism as compared to its derivatives.

  12. Cloning, expression and characterization of glucokinase gene involved in the glucose-6- phosphate formation in Staphylococcus aureus

    Lakshmi, Hanumanthu Prasanna; Yeswanth, Sthanikam; Prasad, Uppu Venkateswara; Vasu, Dudipeta; Swarupa, Vimjam; Kumar, Pasupuleti Santhosh; Narasu, Mangamoori Lakshmi; Krishna Sarma, Potukuchi Venkata Gurunadha

    2013-01-01

    Glucose-6-phosphate (G-6-P) formation in Staphylococcus aureus is catalysed by glucokinase (glkA) gene under high glucose concentration leading to upregulation of various pathogenic factors; therefore the present study is aimed in the cloning and characterization of glk A gene from S. aureus ATCC12600. The glk A gene was cloned in the Sma I site of pQE 30, sequenced (Accession number: JN645812) and expressed in E. coli DH5α. The recombinant glk A expressed from the resultant glk A 1 clone was...

  13. Lactose metabolism by Staphylococcus aureus: characterization of lacABCD, the structural genes of the tagatose 6-phosphate pathway.

    Rosey, E L; Oskouian, B; Stewart, G. C.

    1991-01-01

    The nucleotide and deduced amino acid sequences of the lacA and lacB genes of the Staphylococcus aureus lactose operon (lacABCDFEG) are presented. The primary translation products are polypeptides of 142 (Mr = 15,425) and 171 (Mr = 18,953) amino acids, respectively. The lacABCD loci were shown to encode enzymes of the tagatose 6-phosphate pathway through both in vitro studies and complementation analysis in Escherichia coli. A serum aldolase assay, modified to allow detection of the tagatose ...

  14. Impact of temperature stress and validamycin A on compatible solutes and fumonisin production in F. verticillioides: role of trehalose-6-phosphate synthase.

    Boudreau, Beth A; Larson, Troy M; Brown, Daren W; Busman, Mark; Roberts, Ethan S; Kendra, David F; McQuade, Kristi L

    2013-08-01

    Fusarium verticillioides is a pathogen of maize that causes root, stalk and ear rot and produces fumonisins, toxic secondary metabolites associated with disease in livestock and humans. Environmental stresses such as heat and drought influence disease severity and toxin production, but the effects of abiotic stress on compatible solute production by F. verticillioides have not been fully characterized. We found that decreasing the growth temperature leads to a long-term reduction in polyol levels, whereas increasing the temperature leads to a transient increase in polyols. The effects of temperature shifts on trehalose levels are opposite the effects on polyols and more dramatic. Treatment with validamycin A, a trehalose analog with antifungal activity, leads to a rapid reduction in trehalose levels, despite its known role as a trehalase inhibitor. Mutant strains lacking TPS1, which encodes a putative trehalose-6-phosphate synthase, have altered growth characteristics, do not produce detectable amounts of trehalose under any condition tested, and accumulate glycogen at levels significantly higher than wild-type F. verticillioides. TPS1 mutants also produce significantly less fumonisin than wild type and are also less pathogenic than wild type on maize. These data link trehalose biosynthesis, secondary metabolism, and disease, and suggest that trehalose metabolic pathways may be a viable target for the control of Fusarium diseases and fumonisin contamination of maize. PMID:23751979

  15. Glucosamine-6-phosphate synthase from Escherichia coli: Determination of the mechanism of inactivation by N3-fumaroyl-L-2,3-diaminopropionic derivatives

    A mechanistic investigation of the inactivation of Escherichia coli glucosamine-6-phosphate synthase by N3-(4-methoxyfumaroyl)-L-2,3-diaminopropionate (FMDP) was undertaken. On the basis of the known participation of the N-terminal cysteine residue in this process, the model reactions between FMDP and L-cysteine and between FMDP and the synthetic decapeptide Cys-Gly-Ile-Val-Gly-Ala-Ile-Ala-Ile-Ala-Gln-Arg, corresponding to the amino-terminal protein sequence, were studied. The results allowed us to propose a pathway that is in perfect agreement with the biochemical results: enzyme inactivation arose from Michael addition of glutamine binding site cysteine-1 on the fumaroyl double bond at the β-position of the ester group. Upon denaturation under slightly alkaline conditions, this adduct underwent cyclization to a transient succinimide adduct, which rearranged into the stable 2-substituted 1,4-thiazin-3-one-5-carboxylate involving participation of the cysteine amino group. The tryptic radiolabeled peptides purified from [3H]FMDP-treated enzyme and resistant to Edman degradation coeluted with the products resulting from the model reaction between the synthetic decapeptide and the inhibitor

  16. Glucose-6-phosphate dehydrogenase

    ... this page: //medlineplus.gov/ency/article/003671.htm Glucose-6-phosphate dehydrogenase test To use the sharing features on this page, please enable JavaScript. Glucose-6-phosphate dehydrogenase (G6PD) is a type of ...

  17. Identification of point mutations in Glucose-6-Phosphate Dehydrogenase gene in Timor Island people : A preliminary report

    Widanto Hardjowasito

    2001-12-01

    Full Text Available Glucose 6 phosphate dehydrogenase (G6PD deficiency is common in malaria endemic region, however no molecular study has been performed on G6PD deficiency in Timor Island, Indonesia a malarial hyperendemic area which Proto Malay is the majority of the people in that island. To observe the frequency and molecular type of mutations in G6PD deficient Proto Malay people, 118 native people were screened using formazan ring test. Mutation in the G6PD gene were determined by MPTP (Multiple PCR using Multiple Tandem Forward Primers and a common Reserve Pimer method and confirmed by automatic sequencer. This study shows that three males have lower G6PD activity. Using MPTP method, a point mutation could be indicated in the two cases. Sequencing of the amplified products in 2 G6PD patients disclosed mutations of T383C in exon 5 and C 592 T in exon 6 in respective case. Our result documents point mutations in exon 5 and exon 6 in the G6PD gene of two Proto Malay people in Timor. These mutations are common in Asia region. (Med J Indones 2001; 10: 210-3Keywords: mutations, G6PD, Proto Malay.

  18. Identification and Characterization of the Glucose-6-Phosphate Dehydrogenase Gene Family in the Para Rubber Tree, Hevea brasiliensis.

    Long, Xiangyu; He, Bin; Fang, Yongjun; Tang, Chaorong

    2016-01-01

    As a key enzyme in the pentose phosphate pathway (PPP), glucose-6-phosphate dehydrogenase (G6PDH) provides nicotinamide adenine dinucleotide phosphate (NADPH) and intermediary metabolites for rubber biosynthesis, and plays an important role in plant development and stress responses. In this study, four Hevea brasiliensis (Para rubber tree) G6PDH genes (HbG6PDH1 to 4) were identified and cloned using a genome-wide scanning approach. All four HbG6PDH genes encode functional G6PDH enzymes as shown by heterologous expression in E. coli. Phylogeny analysis and subcellular localization prediction show that HbG6PDH3 is a cytosolic isoform, while the other three genes (HbG6PDH1, 2 and 4) are plastidic isoforms. The subcellular locations of HbG6PDH3 and 4, two latex-abundant isoforms were further verified by transient expression in rice protoplasts. Enzyme activity assay and expression analysis showed HbG6PDH3 and 4 were implicated in PPP during latex regeneration, and to influence rubber production positively in rubber tree. The cytosolic HbG6PDH3 is a predominant isoform in latex, implying a principal role for this isoform in controlling carbon flow and NADPH production in the PPP during latex regeneration. The expression pattern of plastidic HbG6PDH4 correlates well with the degree of tapping panel dryness, a physiological disorder that stops the flow of latex from affected rubber trees. In addition, the four HbG6PDHs responded to temperature and drought stresses in root, bark, and leaves, implicating their roles in maintaining redox balance and defending against oxidative stress. PMID:26941770

  19. Synthesis and modifications of heterocyclic derivatives of D-arabinose: potential inhibitors of glucose-6-phosphate isomerase and glucosamine-6-phosphate synthase; Sintese e modificacoes de derivados heterociclicos de d-arabinose: potenciais inibidores de glicose-6-fosfato isomerase e de glicosamina-6-fosfato sintase

    Viana, Renato Marcio Ribeiro; Prado, Maria Auxiliadora Fontes; Alves, Ricardo Jose [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Fac. de Farmacia. Dept. de Produtos Farmaceuticos]. E-mail: ricardodylan@farmacia.ufmg.br

    2008-07-01

    The synthesis of -5-(D-arabino-1,2,3,4-tetrahydroxybutyl)tetrazole and -2-(d-arabino-1,2,3,4-tetra-acetoxybutyl)-5-methyl-1,3,4-oxadiazole from d-arabinose is described. Attempts at removing the protecting groups of the oxadiazole derivative were unsuccessful, leading to products resulting from the opening of the oxadiazole ring. The unprotected tetrazole derivative was selectively phosphorylated at the primary hydroxyl group with diethyl phosphoryl chloride. The resulting 5-[d-arabino-4-(diethylphosphoryloxy)-1,2,3-trihydroxybutyl]tetrazole is a protected form of a potential inhibitor of the enzymes glucose-6-phosphate isomerase and glucosamine synthase. (author)

  20. Diverse point mutations in the human glucose-6-phosphate dehydrogenase gene cause enzyme deficiency and mild or severe hemolytic anemia.

    Vulliamy, T J; D'Urso, M; Battistuzzi, G; Estrada, M.; Foulkes, N S; Martini, G; Calabro, V; Poggi, V; Giordano, R.; Town, M

    1988-01-01

    Glucose-6-phosphate dehydrogenase (G6PD; EC 1.1.1.49) deficiency is a common genetic abnormality affecting an estimated 400 million people worldwide. Clinical and biochemical analyses have identified many variants exhibiting a range of phenotypes, which have been well characterized from the hematological point of view. However, until now, their precise molecular basis has remained unknown. We have cloned and sequenced seven mutant G6PD alleles. In the nondeficient polymorphic African variant ...

  1. Targeted disruption of the M(r) 46,000 mannose 6-phosphate receptor gene in mice results in misrouting of lysosomal proteins.

    Köster, A; Saftig, P; Matzner, U; von Figura, K; Peters, C; Pohlmann, R

    1993-01-01

    Lysosomal enzymes containing mannose 6-phosphate recognition markers are sorted to lysosomes by mannose 6-phosphate receptors (MPRs). The physiological importance of this targeting mechanism is illustrated by I-cell disease, a fatal lysosomal storage disorder caused by the absence of mannose 6-phosphate residues in lysosomal enzymes. Most mammalian cells express two MPRs. Although the binding specificities, subcellular distribution and expression pattern of the two receptors can be differentiated, their coexpression is not understood. The larger of the two receptors with an M(r) of approximately 300,000 (MPR300), which also binds IGFII, appears to have a dominant role in lysosomal enzyme targeting, while the function of the smaller receptor with an M(r) of 46,000 (MPR46) is less clear. To investigate the in vivo function of the MPR46, we generated MPR46-deficient mice using gene targeting in embryonic stem cells. Reduced intracellular retention of newly synthesized lysosomal proteins in cells from MPR46 -/- mice demonstrated an essential sorting function of MPR46. The phenotype of MPR46 -/- mice was normal, indicating mechanisms that compensate the MPR46 deficiency in vivo. Images PMID:8262064

  2. Diverse point mutations in the human glucose-6-phosphate dehydrogenase gene cause enzyme deficiency and mild or severe hemolytic anemia

    Vulliamy, T.J.; D' Urso, M.; Battistuzzi, G.; Estrada, M.; Foulkes, N.S.; Martini, G.; Calabro, V.; Poggi, V.; Giordano, R.; Town, M.; Luzzatto, L.; Persico, M.G. (Royal Postgraduate Medical School, London (England))

    1988-07-01

    Glucose-6-phosphate dehydrogenase deficiency is a common genetic abnormality affecting an estimated 400 million people worldwide. Clinical and biochemical analyses have identified many variants exhibiting a range of phenotypes, which have been well characterized from the hematological point of view. However, until now, their precise molecular basis has remained unknown. The authors have cloned and sequenced seven mutant G6PD alleles. In the nondeficient polymorphic African variant G6PD A they have found a single point mutation. The other six mutants investigated were all associated with enzyme deficiency. The mutations observed show a striking predominance of C {yields} T transitions, with CG doublets involved in four of seven cases. Thus, diverse point mutations may account largely for the phenotypic heterogeneity of G6PD deficiency.

  3. Diverse point mutations in the human glucose-6-phosphate dehydrogenase gene cause enzyme deficiency and mild or severe hemolytic anemia

    Glucose-6-phosphate dehydrogenase deficiency is a common genetic abnormality affecting an estimated 400 million people worldwide. Clinical and biochemical analyses have identified many variants exhibiting a range of phenotypes, which have been well characterized from the hematological point of view. However, until now, their precise molecular basis has remained unknown. The authors have cloned and sequenced seven mutant G6PD alleles. In the nondeficient polymorphic African variant G6PD A they have found a single point mutation. The other six mutants investigated were all associated with enzyme deficiency. The mutations observed show a striking predominance of C → T transitions, with CG doublets involved in four of seven cases. Thus, diverse point mutations may account largely for the phenotypic heterogeneity of G6PD deficiency

  4. Glucose-6-phosphate dehydrogenase deficiency

    ... this page: //medlineplus.gov/ency/article/000528.htm Glucose-6-phosphate dehydrogenase deficiency To use the sharing features on this page, please enable JavaScript. Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a condition ...

  5. A Novel de novo Mutation in the G6PD Gene in a Korean Boy with Glucose-6-phosphate Dehydrogenase Deficiency: Case Report.

    Jang, Mi-Ae; Kim, Ji-Yoon; Lee, Ki-O; Kim, Sun-Hee; Koo, Hong Hoe; Kim, Hee-Jin

    2015-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked recessive hemolytic anemia caused by a mutation in the G6PD gene on Xq28. Herein, we describe a Korean boy with G6PD deficiency resulting from a novel mutation in G6PD. A 20-month-old boy with hemolytic anemia was referred for molecular diagnosis. He had no relevant family history. The G6PD activity was severely decreased at 0.2 U/g Hb (severe deficiency). Direct sequencing analyses on the G6PD gene revealed that he was hemizygous for a novel missense variant, c.1187C>G (p.Pro396Arg), in exon 10 of G6PD. Family study involving his parents revealed the de novo occurrence of the mutation. This is the first report of genetically confirmed G6PD deficiency in Korea. PMID:26275698

  6. Cloning and Sequence Analysis of a Glucose-6-Phosphate Dehydrogenase Gene PsG6PDH from Freezing-tolerant Populus suaveolens

    Lin Yuan-zhen; Lin Shan-zhi; Zhang Wei; Zhang Qian; Zhang Zhi-yi; Guo Huan

    2005-01-01

    A 1207 hp cDNA fragment (PsG6PDH) was amplified by PT-PCR from cold-induced total Pna of the freexing-tolerant P. Suaveolens, using primers based on the highly comserved region of published plant glucose-6-phosphate dehydrogenase (G6PDH)genes. The sepuence analysis showed that PsG6PDH coding region had 1 101 bp and encoded 367 predicted aminoacid residues. Moreover, the nucleotide sequence of psG6PDH showed 83%,82%,79%,79% and 78% identity, and the derived amino acid sequence shared 44.2%,44.7%,42.0%,40.5% and 43.9% identity with those of the Solanum tuberosum, Nicotiana tabacum, Triticum aestivum, Oryxa sativa and Arabidopsis thaliana, respectively. The results show that PsG6PDH is a new member of G6PDH gene family and belongs to cytosolic G6PDH gene. This is the first report on clonign of the G6PDH gene from woody plants.

  7. High Level Expression of Glucose-6-phosphate Dehydrogenase Gene PsG6PDH from Populus suaveolens in E. coli

    2005-01-01

    In order to investigate the functions of the gene PsG6PDH and the mechanisms underlying freezing tolerance of Populus suaveolens, the recombinant expression vector pET-G (pET30a-G6PDH), which contained full encoding region of PsG6PDH gene, was established. The recombinant was identified by lawn-PCR and double enzyme digestion and then transformed into expression host XA90 and induced by isopropyl-a-D-thiogalactoside (IPTG) to express 100 kD polypeptide of G6PDH fusion protein. The results showed that the expressed amount of the fusion protein culminated after 1 mmol·L-1 IPTG treatment for 4 h and that pET-G product was predominately soluble and not extra-cellular secreting.

  8. Two new mutations of the glucose-6-phosphate dehydrogenase (G6PD) gene associated with haemolytic anaemia: clinical, biochemical and molecular relationships.

    Zarza, R; Pujades, A; Rovira, A; Saavedra, R; Fernandez, J; Aymerich, M; Vives Corrons, J L

    1997-09-01

    In two unrelated Spanish males with glucose-6-phosphate dehydrogenase (G6PD) deficiency and haemolytic anaemia, and two different novel point mutations in the G6PD gene, have been identified. A C to T transition at nucleotide 406 resulting in a (136) Arg to Cys substitution and a C to G transition at nucleotide 1155 resulting in a (385) Cys to Trp substitution. These two molecular defects have not been described before and are designated G6PD Valladolid 406 C-->T and G6PD Madrid 1155 C-->G. In vitro biochemical characterization of both mutant enzymes showed important differences in their molecular properties according to their different clinical behaviour. In G6PD Valladolid, the mutation of which is located in exon 5, the normal in vitro heat stability may explain its mild clinical expression (low-grade haemolysis interrupted by an acute haemolytic crisis at age 70). In G6PD Madrid, the mutation, located in exon 10, results in a deficient variant associated with neonatal jaundice and life-long chronic nonspherocytic haemolytic anaemia (CNSHA). This finding further emphasizes the importance of this specific region of the G6PD gene in the stabilization of the G6PD molecule. Putative relationships between these single point mutations and the molecular properties of the mutant enzymes are also discussed. PMID:9332310

  9. The tomato terpene synthase gene family

    V. Falara; T.A. Akhtar; T.T.H. Nguyen; E.A. Spyropoulou; P.M. Bleeker; I. Schauvinhold; Y. Matsuba; M.E. Bonini; A.L. Schilmiller; R.L. Last; R.C. Schuurink; E. Pichersky

    2011-01-01

    Compounds of the terpenoid class play many roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of Solanum lycopersicum (cultivated tomato) contains 40 terpene synthase (TPS) genes, including 28

  10. The tomato terpene synthase gene family

    Falara, V.; Akhtar, T.A.; NGUYEN, T. T. H.; Spyropoulou, E.A.; Bleeker, P.M.; Schauvinhold, I.; Matsuba, Y.; Bonini, M.E.; Schilmiller, A.L.; Last, R.L.; Schuurink, R. C.; Pichersky, E

    2011-01-01

    Compounds of the terpenoid class play many roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of Solanum lycopersicum (cultivated tomato) contains 40 terpene synthase (TPS) genes, including 28 which are functional or potentially functional. Of these 28 TPS genes, 25 were expressed in at least some parts of the plant. The enzymatic functions of eight of the TPS proteins were previously r...

  11. Glucose 6 phosphate dehydrogenase deficiency Review

    Şaşmaz, İlgen

    2009-01-01

    Glucose 6 phosphate dehydrogenase G6PD is the first enzyme of the pentose phosphate pathway providing reducing power to all cells in the form of reduced form of nicotinamide adenine dinucleotide phosphate G6PD deficiency is the most common human enzyme defect being present in more than 400 million people worldwide G6PD deficiency is an X linked hereditary genetic defect caused by mutations in the G6PD gene Clinical presentations include acute hemolytic anemia chronic hemolytic anemia neonatal...

  12. Evaluation on the effectiveness of 2-deoxyglucose-6-phosphate phosphatase (DOGR1) gene as a selectable marker for oil palm (Elaeis guineensis Jacq.) embryogenic calli transformation mediated by Agrobacterium tumefaciens

    Izawati, Abang Masli Dayang; Masani, Mat Yunus Abdul; Ismanizan, Ismail; Parveez, Ghulam Kadir Ahmad

    2015-01-01

    DOGR1, which encodes 2-deoxyglucose-6-phosphate phosphatase, has been used as a selectable marker gene to produce transgenic plants. In this study, a transformation vector, pBIDOG, which contains the DOGR1 gene, was transformed into oil palm embryogenic calli (EC) mediated by Agrobacterium tumefaciens strain LBA4404. Transformed EC were exposed to 400 mg l-1 2-deoxyglucose (2-DOG) as the selection agent. 2-DOG resistant tissues were regenerated into whole plantlets on various regeneration med...

  13. Mutational Analyses of Glucose Dehydrogenase and Glucose-6-Phosphate Dehydrogenase Genes in Pseudomonas fluorescens Reveal Their Effects on Growth and Alginate Production

    Maleki, Susan; Mærk, Mali; Valla, Svein

    2015-01-01

    The biosynthesis of alginate has been studied extensively due to the importance of this polymer in medicine and industry. Alginate is synthesized from fructose-6-phosphate and thus competes with the central carbon metabolism for this metabolite. The alginate-producing bacterium Pseudomonas fluorescens relies on the Entner-Doudoroff and pentose phosphate pathways for glucose metabolism, and these pathways are also important for the metabolism of fructose and glycerol. In the present study, the impact of key carbohydrate metabolism enzymes on growth and alginate synthesis was investigated in P. fluorescens. Mutants defective in glucose-6-phosphate dehydrogenase isoenzymes (Zwf-1 and Zwf-2) or glucose dehydrogenase (Gcd) were evaluated using media containing glucose, fructose, or glycerol. Zwf-1 was shown to be the most important glucose-6-phosphate dehydrogenase for catabolism. Both Zwf enzymes preferred NADP as a coenzyme, although NAD was also accepted. Only Zwf-2 was active in the presence of 3 mM ATP, and then only with NADP as a coenzyme, indicating an anabolic role for this isoenzyme. Disruption of zwf-1 resulted in increased alginate production when glycerol was used as the carbon source, possibly due to decreased flux through the Entner-Doudoroff pathway rendering more fructose-6-phosphate available for alginate biosynthesis. In alginate-producing cells grown on glucose, disruption of gcd increased both cell numbers and alginate production levels, while this mutation had no positive effect on growth in a non-alginate-producing strain. A possible explanation is that alginate synthesis might function as a sink for surplus hexose phosphates that could otherwise be detrimental to the cell. PMID:25746989

  14. Trichinella pseudospiralis vs. T. spiralis thymidylate synthase gene structure and T. pseudospiralis thymidylate synthase retrogene sequence

    Jagielska, Elżbieta; Płucienniczak, Andrzej; Dąbrowska, Magdalena; Dowierciał, Anna; Rode, Wojciech

    2014-01-01

    Background Thymidylate synthase is a housekeeping gene, designated ancient due to its role in DNA synthesis and ubiquitous phyletic distribution. The genomic sequences were characterized coding for thymidylate synthase in two species of the genus Trichinella, an encapsulating T. spiralis and a non-encapsulating T. pseudospiralis. Methods Based on the sequence of parasitic nematode Trichinella spiralis thymidylate synthase cDNA, PCR techniques were employed. Results Each of the respective gene...

  15. Glucose-6-Phosphate Dehydrogenase Deficiency Overview

    ... Drugs GARD Information Navigator FAQs About Rare Diseases Glucose-6-phosphate dehydrogenase deficiency Title Other Names: G6PD ... G6PD deficiency Categories: Newborn Screening Summary Summary Listen Glucose 6 phosphate dehydrogenase (G6PD) deficiency is a hereditary ...

  16. Glucose-6-Phosphate Dehydrogenase Deficiency Overview

    ... Information Center (GARD) Print friendly version Glucose-6-phosphate dehydrogenase deficiency Table of Contents Overview Symptoms Cause ... National Institutes of Health. Overview Listen Glucose 6 phosphate dehydrogenase (G6PD) deficiency is a hereditary condition in ...

  17. Evaluation on the effectiveness of 2-deoxyglucose-6-phosphate phosphatase (DOGR1) gene as a selectable marker for oil palm (Elaeis guineensis Jacq.) embryogenic calli transformation mediated by Agrobacterium tumefaciens

    Izawati, Abang Masli Dayang; Masani, Mat Yunus Abdul; Ismanizan, Ismail; Parveez, Ghulam Kadir Ahmad

    2015-01-01

    DOGR1, which encodes 2-deoxyglucose-6-phosphate phosphatase, has been used as a selectable marker gene to produce transgenic plants. In this study, a transformation vector, pBIDOG, which contains the DOGR1 gene, was transformed into oil palm embryogenic calli (EC) mediated by Agrobacterium tumefaciens strain LBA4404. Transformed EC were exposed to 400 mg l-1 2-deoxyglucose (2-DOG) as the selection agent. 2-DOG resistant tissues were regenerated into whole plantlets on various regeneration media containing the same concentration of 2-DOG. The plantlets were later transferred into soil and grown in a biosafety screenhouse. PCR and subsequently Southern blot analyses were carried out to confirm the integration of the transgene in the plantlets. A transformation efficiency of about 1.0% was obtained using DOGR1 gene into the genome of oil palm. This result demonstrates the potential of using combination of DOGR1 gene and 2-DOG for regenerating transgenic oil palm. PMID:26442041

  18. Population study of 1311 C/T polymorphism of Glucose 6 Phosphate Dehydrogenase gene in Pakistan – an analysis of 715 X-chromosomes

    Naqvi Zulfiqar

    2009-07-01

    Full Text Available Abstract Background Nucleotide 1311 polymorphism at exon 11 of G6PD gene is widely prevalent in various populations of the world. The aim of the study was to evaluate 1311 polymorphism in subjects carrying G6PD Mediterranean gene and in general population living in Pakistan. Results Patients already known to be G6PD deficient were tested for 563C-T (G6PD Mediterranean and 1311 C-T mutation through RFLP based PCR and gene sequencing. A control group not known to be G6PD deficient was tested for 1311C/T only. C-T transition at nt 1311 was detected in 60/234 X-chromosomes with 563 C-T mutation (gene frequency of 0.26 while in 130 of normal 402 X-chromosomes (gene frequency of 0.32. Conclusion We conclude that 1311 T is a frequent polymorphism both in general populations and in subjects with G6PD Mediterranean gene in Pakistan. The prevalence is higher compared to most of the populations of the world. The present study will help in understanding genetic basis of G6PD deficiency in Pakistani population and in developing ancestral links of its various ethnic groups.

  19. Evaluation on the Effectiveness of 2-Deoxyglucose-6-phosphate phosphatase (DOGR1 Gene as a Selectable Marker for Oil Palm (Elaeis guineensis Jacq. Embryogenic Calli Transformation Mediated by Agrobacterium tumefaciens.

    Abang Masli eDayang Izawati

    2015-09-01

    Full Text Available DOGR1, which encodes for 2-deoxyglucose-6-phosphate phosphatase, has been used as a selectable marker gene to produce transgenic plants. In this study, a transformation vector, pBIDOG, which contains the DOGR1 gene, was transformed into oil palm embryogenic calli mediated by Agrobacterium tumefaciens strain LBA4404. Transformed embryogenic calli were exposed to 400 mg l–1 2-deoxyglucose (2-DOG as the selection agent. 2-DOG resistant tissues were regenerated into whole plantlets on various regeneration media containing the same concentration of 2-DOG. The plantlets were later transferred into soil and grown in a biosafety screenhouse. PCR and subsequently Southern blot analyses were carried out to confirm the integration of the transgene in the plantlets. A transformation efficiency of about 1.0% was obtained using DOGR1 gene into the genome of oil palm. This result demonstrates the potential of using combination of DOGR1 gene and 2-DOG for regenerating transgenic oil palm.

  20. Evaluation on the effectiveness of 2-deoxyglucose-6-phosphate phosphatase (DOG(R)1) gene as a selectable marker for oil palm (Elaeis guineensis Jacq.) embryogenic calli transformation mediated by Agrobacterium tumefaciens.

    Izawati, Abang Masli Dayang; Masani, Mat Yunus Abdul; Ismanizan, Ismail; Parveez, Ghulam Kadir Ahmad

    2015-01-01

    DOG(R)1, which encodes 2-deoxyglucose-6-phosphate phosphatase, has been used as a selectable marker gene to produce transgenic plants. In this study, a transformation vector, pBIDOG, which contains the DOG(R)1 gene, was transformed into oil palm embryogenic calli (EC) mediated by Agrobacterium tumefaciens strain LBA4404. Transformed EC were exposed to 400 mg l(-1) 2-deoxyglucose (2-DOG) as the selection agent. 2-DOG resistant tissues were regenerated into whole plantlets on various regeneration media containing the same concentration of 2-DOG. The plantlets were later transferred into soil and grown in a biosafety screenhouse. PCR and subsequently Southern blot analyses were carried out to confirm the integration of the transgene in the plantlets. A transformation efficiency of about 1.0% was obtained using DOG(R)1 gene into the genome of oil palm. This result demonstrates the potential of using combination of DOG(R)1 gene and 2-DOG for regenerating transgenic oil palm. PMID:26442041

  1. An autosomal glucose-6-phosphate dehydrogenase (hexose-6-phosphate dehydrogenase) polymorphism in human saliva.

    Tan, S G; Ashton, G C

    1976-01-01

    Glucose-6-phosphate dehydrogenase (hexose-6-phosphate dehydrogenase) from human saliva has been demonstrated by the zymogram technique. Three phenotypes were found. Family and population studies suggested that these phenotypes are the products of an autosomal locus with two alleles Sgd-1 and Sgd-2. PMID:950237

  2. Glycogen Metabolic Genes Are Involved in Trehalose-6-Phosphate Synthase-Mediated Regulation of Pathogenicity by the Rice Blast Fungus Magnaporthe oryzae

    Badaruddin, Muhammad; Holcombe, Lucy J.; Richard A. Wilson; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.

    2013-01-01

    Author Summary The fungus Magnaporthe oryzae causes a devastating disease of rice called blast. Each year, rice blast disease destroys almost a quarter of the potential global rice harvest. The fungus infects rice plants by elaborating a special infection structure called an appressorium, which physically breaks the tough outer cuticle of a rice leaf. Magnaporthe can develop appressoria in the absence of a nutrient source. We are therefore studying how the fungus utilizes energy stores in its...

  3. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    Edman, U; Edman, J C; Lundgren, B;

    1989-01-01

    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar t...... into plasmid vectors under control of the lac and tac promoters. These constructs direct the synthesis of catalytically active enzyme to the extent of 2% of total soluble protein....

  4. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  5. Expression of the Grifola frondosa Trehalose Synthase Gene and Improvement of Drought-Tolerance in Sugarcane (Saccharum officinarum L.)

    2006-01-01

    Trehalose is a nonreducing disaccharide of glucose that functions as a protectant in the stabilization of biological structures and enhances stress tolerance to abiotic stresses in organisms. We report here the expression of a Grifola frondosa trehalose synthase (TSase) gene for improving drought tolerance in sugarcane (Saccharum officinarum L.). The expression of the transgene was under the control of two tandem copies of the CaMV35S promoter and transferred into sugarcane by Agrobacterium tumefaciens EHA105. The transgenic plants accumulated high levels of trehalose, up to 8.805-12.863 mg/g fresh weight, whereas it was present at undetectable level in nontransgenic plants. It has been reported that transgenic plants transformed with Escherichia coli TPS (trehalose-6-phosphatesynthase) and/or TPP (trehalose-6-phosphate phosphatase) are severely stunted and have root morphologic alterations. Interestingly, our transgenic sugarcane plants had no obvious morphological changes and no growth inhibition in the field. Trehalose accumulation in 35S-35S: TSase plants resulted in increased drought tolerance, as shown by the drought and the drought physiological indexes, such as the rate of bound water/free water, plasma membrane permeability, malondialdehyde content, chlorophyll a and b contents,and activity of SOD and POD of the excised leaves. These results suggest that transgenic plants transformed with the TSase gene can accumulate high levels of trehalose and have enhanced tolerance to drought.

  6. Trehalose 6-phosphate coordinates organic and amino acid metabolism with carbon availability.

    Figueroa, Carlos M; Feil, Regina; Ishihara, Hirofumi; Watanabe, Mutsumi; Kölling, Katharina; Krause, Ursula; Höhne, Melanie; Encke, Beatrice; Plaxton, William C; Zeeman, Samuel C; Li, Zhi; Schulze, Waltraud X; Hoefgen, Rainer; Stitt, Mark; Lunn, John E

    2016-02-01

    Trehalose 6-phosphate (Tre6P) is an essential signal metabolite in plants, linking growth and development to carbon metabolism. The sucrose-Tre6P nexus model postulates that Tre6P acts as both a signal and negative feedback regulator of sucrose levels. To test this model, short-term metabolic responses to induced increases in Tre6P levels were investigated in Arabidopsis thaliana plants expressing the Escherichia coli Tre6P synthase gene (otsA) under the control of an ethanol-inducible promoter. Increased Tre6P levels led to a transient decrease in sucrose content, post-translational activation of nitrate reductase and phosphoenolpyruvate carboxylase, and increased levels of organic and amino acids. Radio-isotope ((14)CO2) and stable isotope ((13)CO2) labelling experiments showed no change in the rates of photoassimilate export in plants with elevated Tre6P, but increased labelling of organic acids. We conclude that high Tre6P levels decrease sucrose levels by stimulating nitrate assimilation and anaplerotic synthesis of organic acids, thereby diverting photoassimilates away from sucrose to generate carbon skeletons and fixed nitrogen for amino acid synthesis. These results are consistent with the sucrose-Tre6P nexus model, and implicate Tre6P in coordinating carbon and nitrogen metabolism in plants. PMID:26714615

  7. Novel terpenes generated by heterologous expression of bacterial terpene synthase genes in an engineered Streptomyces host

    YAMADA, YUUKI; Arima, Shiho; Nagamitsu, Tohru; Johmoto, Kohei; Uekusa, Hidehiro; Eguchi, Tadashi; Shin’ya, Kazuo; Cane, David E.; Ikeda, Haruo

    2015-01-01

    Mining of bacterial genome data has revealed numerous presumptive terpene synthases. Heterologous expression of several putative terpene synthase genes in an engineered Streptomyces host has revealed 13 newly discovered terpenes whose GC-MS and NMR data did not match any known compounds in the spectroscopic databases. Each of the genes encoding the corresponding terpene synthases were silent in their parent microorganisms. Heterologous expression and detailed NMR spectroscopic analysis allowe...

  8. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode polyketides important in pathogenicity. PMID:27388157

  9. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  10. Over-expression of BvMTSH, a fusion gene for maltooligosyltrehalose synthase and maltooligosyltrehalose trehalohydrolase, enhances drought tolerance in transgenic rice.

    Joo, Joungsu; Choi, Hae Jong; Lee, Youn Hab; Lee, Sarah; Lee, Choong Hwan; Kim, Chung Ho; Cheong, Jong-Joo; Choi, Yang Do; Song, Sang Ik

    2014-01-01

    Plant abiotic stress tolerance has been modulated by engineering the trehalose synthesis pathway. However, many stress-tolerant plants that have been genetically engineered for the trehalose synthesis pathway also show abnormal development. The metabolic intermediate trehalose 6-phosphate has the potential to cause aberrations in growth. To avoid growth inhibition by trehalose 6-phosphate, we used a gene that encodes a bifunctional in-frame fusion (BvMTSH) of maltooligosyltrehalose synthase (BvMTS) and maltooligosyltrehalose trehalohydrolase (BvMTH) from the nonpathogenic bacterium Brevibacterium helvolum. BvMTS converts maltooligosaccharides into maltooligosyltrehalose and BvMTH releases trehalose. Transgenic rice plants that over-express BvMTSH under the control of the constitutive rice cytochrome c promoter (101MTSH) or the ABA-inducible Ai promoter (105MTSH) show enhanced drought tolerance without growth inhibition. Moreover, 101MTSH and 105MTSH showed an ABA-hyposensitive phenotype in the roots. Our results suggest that over-expression of BvMTSH enhances drought-stress tolerance without any abnormal growth and showes ABA hyposensitive phenotype in the roots. PMID:24209631

  11. Glucose 6 phosphate dehydrogenase deficiency in adults

    Objective: To determine the frequency of glucose-6-phosphate dehydrogenase (G6PD) deficiency in adults presented with anemia. Subjects and Methods: Eighteen months admission data was reviewed for G6PD deficiency as a cause of anemia. Anemia was defined by world health organization (WHO) criteria as haemoglobin less than 11.3 gm%. G6PD activity was measured by Sigma dye decolorisation method. All patients were screened for complications of hemolysis and its possible cause. Patients with more than 13 years of age were included in the study. Results: Out of 3600 patients admitted, 1440 were found anaemic and 49 as G6PD deficient. So the frequency of G6PD deficiency in anaemic patients was 3.4% and the overall frequency is 1.36%. G6PD deficiency among males and females was three and six percent respectively. Antimalarials and antibiotics containing sulphonamide group were the most common precipitating factors for hemolysis. Anemia and jaundice were the most common presentations while malaria was the most common associated disease. Acute renal failure was the most severe complication occurring in five patients with two deaths. Conclusion: G6PD deficiency is a fairly common cause of anemia with medicine as common precipitating factor for hemolysis. Such complications can be avoided with early recognition of the disease and avoiding indiscriminate use of medicine. (author)

  12. Cloning and characterization of a glucose 6-phosphate/phosphate translocator from Oryza sativa

    姜华武; 佃蔚敏; 刘非燕; 吴平

    2003-01-01

    Plastids of nongreen tissues import carbon as a source of biosynthetic pathways and energy, and glucose 6-phosphate is the preferred hexose phosphate taken up by nongreen plastids. A cDNA clone encoding glucose 6-phosphate/phosphate translocator (GPT) was isolated from a cDNA library of immature seeds of rice and named as OsGPT. The cDNA has one uninterrupted open reading frame encoding a 42 kDa polypeptide possessing transit peptide consisting of 70 amino acid residues. The OsGPT gene maps on chromosome 8 of rice and is linked to the quantitative trait locus for 1000-grain weight. The expression of OsGPT is mainly restricted to heterotrophic tissues. These results suggest that glucose 6-phosphate imported via GPT can be used for starch biosynthesis in rice nongreen plastids.

  13. Trehalose 6-phosphate is required for the onset of leaf senescence associated with high carbon availability.

    Wingler, A.; Delatte, T. L.; O Hara, L. E.; Primavesi, L. F.; Jhurreea, D.; Paul, M. J.; Schluepmann, H.

    2012-01-01

    Trehalose 6-phosphate (T6P) is an important regulator of plant metabolism and development. T6P content increases when carbon availability is high, and in young growing tissue, T6P inhibits the activity of Snf1-related protein kinase (SnRK1). Here, strong accumulation of T6P was found in senescing leaves of Arabidopsis (Arabidopsis thaliana), in parallel with a rise in sugar contents. To determine the role of T6P in senescence, T6P content was altered by expressing the bacterial T6P synthase g...

  14. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    Vestergaard, H; Lund, S; Bjørbaek, C; Pedersen, O

    1995-01-01

    treatment. Ten obese patients with NIDDM were studied before and after 8 weeks of treatment with a weight-maintaining diet in combination with the sulphonylurea gliclazide. Gliclazide treatment was associated with significant reductions in HbA1C (p=0.001) and fasting plasma glucose (p=0.005) as well as...... metabolism (p=0.02) was demonstrated in teh gliclazide-treated patients when compared to pre-treatment values. In biopsies obtained from vastus lateralis muscle during insulin infusion, the half-maximal activation of glycogen synthase was achieved at a significantly lower concentration of the allosteric...... activator glucose 6-phosphate (p=0.01). However, despite significant increases in both insulin-stimulated non-oxidative glucose metabolism and muscle glycogen synthase activation in gliclazide-treated patients no changes were found in levels of glycogen synthase mRNA or immunoreactive protein in muscle. In...

  15. All members in the sphingomyelin synthase gene family have ceramide phosphoethanolamine synthase activity[S

    Ding, Tingbo; Kabir, Inamul; Li, Yue; Lou, Caixia; Yazdanyar, Amirfarbod; Xu, Jiachen; Dong, Jibin; Zhou, Hongwen; Park, Taesik; Boutjdir, Mohamed; Li, Zhiqiang; Jiang, Xian-Cheng

    2015-01-01

    Sphingomyelin synthase-related protein (SMSr) synthesizes the sphingomyelin analog ceramide phosphoethanolamine (CPE) in cells. Previous cell studies indicated that SMSr is involved in ceramide homeostasis and is crucial for cell function. To further examine SMSr function in vivo, we generated Smsr KO mice that were fertile and had no obvious phenotypic alterations. Quantitative MS analyses of plasma, liver, and macrophages from the KO mice revealed only marginal changes in CPE and ceramide a...

  16. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Bechard Matthew E.

    2003-01-01

    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  17. Mannose 6-, fructose 1-, and fructose 6-phosphates inhibit human natural cell-mediated cytotoxicity.

    Forbes, J T; Bretthauer, R. K.; Oeltmann, T N

    1981-01-01

    In vitro human natural cell-mediated cytotoxicity (NCMC) to K-562, Molt-4, and F-265 cells is inhibited in a dose-dependent manner by mannose 6-phosphate, fructose 1-phosphate and fructose 6-phosphate. This inhibition is not observed with mannose, glucose, fucose, glucose 6-phosphate, mannose 1-phosphate, galactose 1-phosphate, or galactose 6-phosphate. Preincubation of the effector cells, obtained from fresh whole blood, with mannose-6-phosphate, fructose-1-phosphate, or fructose-6-phosphate...

  18. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Somerville, Chris R.; Scheible, Wolf

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  19. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  20. Chemical analysis of a genome wide polyketide synthase gene deletion library in Aspergillus nidulans

    Larsen, Thomas Ostenfeld; Klejnstrup, Marie Louise; Nielsen, Jakob Blæsbjerg;

    predicted to encode polyketide synthases have been individually been deleted. This presentation will highlight our recent linking of secondary metabolites in A. nidulans to genes, and in particular describe some recent work on characterization of ANID_6448 and associated genes responsible for biosynthesis...

  1. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    Krath, Britta N.; Hove-Jensen, Bjarne

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca...

  2. Dihydropteroate Synthase and Novel Dihydrofolate Reductase Gene Mutations in Strains of Pneumocystis jirovecii from South Africa

    Robberts, F. J. L.; Chalkley, L J; Weyer, K.; Goussard, P.; Liebowitz, L. D.

    2005-01-01

    Dihydropteroate synthase (DHPS) gene mutations have raised concerns about emerging sulfonamide resistance in Pneumocystis jirovecii. DHPS and dihydrofolate reductase (DHFR) gene products were amplified in clinical specimens from South African patients. One of 53 DHPS genes sequenced contained the double mutation Thr55Ala Pro57Ser. DHFR gene mutations detected were Ala67Val and the new mutations Arg59Gly and C278T.

  3. Isolation and partial characterization of the gene for goose fatty acid synthase.

    Kameda, K; Goodridge, A G

    1991-01-01

    Fatty acid synthase is regulated by diet and hormones, with regulation being primarily transcriptional. In chick embryo hepatocytes in culture, triiodothyronine stimulates accumulation of enzyme and transcription of the gene. Since the 5'-flanking region of this gene is likely involved in hormonal regulation of its expression, we have isolated and partially characterized an avian fatty acid synthase gene. A genomic DNA library was constructed in a cosmid vector and screened with cDNA clones that contained sequence complementary to the 3' end of goose fatty acid synthase mRNA. A genomic clone (approximately 35 kilobase pairs (kb] was isolated, and a 6.5-kb EcoRI fragment thereof contained DNA complementary to the 3' noncoding region of fatty acid synthase mRNA. Additional cosmid libraries were screened with 5' fragments of previously isolated genomic clones, resulting in the isolation of five overlapping cosmid DNAs. The entire region of cloned DNA spans approximately 105 kb. Exon-containing fragments were identified by hybridization with end-labeled poly(A)+ RNA and by hybridization of labeled exon-containing genomic DNA fragments to fatty acid synthase mRNA. A new set of cDNA clones spanning approximately 3.2 kb was isolated from a lambda-ZAP goose liver cDNA library using the 5'-most exon-containing fragment of the 5'-most genomic DNA clone. This region of mRNA contains a 5'-untranslated sequence and a continuous open reading frame which includes a region that codes for the essential cysteine of the beta-ketoacyl synthase domain. The entire fatty acid synthase gene spans about 50 kb. The 5' 15 kb of the gene contain 7 exons. S1 nuclease and primer extension analyses were used to identify a single site for initiation of transcription, 174 nucleotides upstream from the putative translation initiation codon. Putative "TATA" and "CCAAT" boxes are located 28 and 60 base pairs (bp), respectively, upstream of the site of initiation of transcription. The 5'-flanking 597

  4. The chsA gene, encoding a class-I chitin synthase from Ampelomyces quisqualis.

    Weiss, N; Sztejnberg, A; Yarden, O

    1996-02-01

    Degenerate oligodeoxyribonucleotide primers, designed on the basis of conserved regions of the chitin synthase gene family, were used to amplify a fragment of the Ampelomyces quisqualis (Aq) chsA gene. Subsequently, the PCR product was used as a probe in order to identify and isolate genomic clones harboring the entire chsA gene. Aq chsA is 2786-nt long, has one intron and encodes a 910-amino-acid polypeptide belonging to the class-I chitin synthases. Low-stringency Southern hybridizations to Aq genomic DNA provided evidence for the presence of additional DNA fragments resembling chsA in the fungal genome, suggesting the presence of a multigene family of chitin synthases in Aq. PMID:8626074

  5. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. PMID:25688574

  6. Phylogenetic analysis of uroporphyrinogen III synthase (UROS) gene

    Shaik, Abjal Pasha; Alsaeed, Abbas H; Sultana, Asma

    2012-01-01

    The uroporphyrinogen III synthase (UROS) enzyme (also known as hydroxymethylbilane hydrolyase) catalyzes the cyclization of hydroxymethylbilane to uroporphyrinogen III during heme biosynthesis. A deficiency of this enzyme is associated with the very rare Gunther's disease or congenital erythropoietic porphyria, an autosomal recessive inborn error of metabolism. The current study investigated the possible role of UROS (Homo sapiens [EC: 4.2.1.75; 265 aa; 1371 bp mRNA; Entrez Pubmed ref NP_0003...

  7. A cryptic type I polyketide synthase (cpk) gene cluster in Streptomyces coelicolor A3(2)

    Pawlik, Krzysztof; Kotowska, Magdalena; Chater, Keith F.; Kuczek, Katarzyna; Takano, Eriko

    2007-01-01

    The chromosome of Streptomyces coelicolor A3(2), a model organism for the genus Streptomyces, contains a cryptic type I polyketide synthase (PKS) gene cluster which was revealed when the genome was sequenced. The ca. 54-kb cluster contains three large genes, cpkA, cpkB and cpkC, encoding the PKS subunits. In silico analysis showed that the synthase consists of a loading module, five extension modules and a unique reductase as a terminal domain instead of a typical thioesterase. All acyltransf...

  8. Prevalence and Molecular Identification of Mediterranean Glucose-6-Phosphate Dehydrogenase Deficiency in Khuzestan Province, Iran

    SR Kazemi Nezhad; Mashayekhi, A.; SR Khatami; Daneshmand, S; Fahmi, F.; M Ghaderigandmani; MA Jalali-Far

    2009-01-01

    "nBackground: Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most frequent genetic enzymatic disorder in hu­man, which is inherited as an X-linked gene. It encodes a housekeeping enzyme, which is vital for cell survival. Accord­ing to previous investigations, Mediterranean mutation (C563T) of g6pd gene is the most prevalent mutation in some prov­inces of Iran and neighboring countries. We aimed to study the Mediterranean mutation of g6pd gene in Khuzes...

  9. Crystal structure and substrate specificity of D-galactose-6-phosphate isomerase complexed with substrates.

    Woo-Suk Jung

    Full Text Available D-Galactose-6-phosphate isomerase from Lactobacillus rhamnosus (LacAB; EC 5.3.1.26, which is encoded by the tagatose-6-phosphate pathway gene cluster (lacABCD, catalyzes the isomerization of D-galactose-6-phosphate to D-tagatose-6-phosphate during lactose catabolism and is used to produce rare sugars as low-calorie natural sweeteners. The crystal structures of LacAB and its complex with D-tagatose-6-phosphate revealed that LacAB is a homotetramer of LacA and LacB subunits, with a structure similar to that of ribose-5-phosphate isomerase (Rpi. Structurally, LacAB belongs to the RpiB/LacAB superfamily, having a Rossmann-like αβα sandwich fold as has been identified in pentose phosphate isomerase and hexose phosphate isomerase. In contrast to other family members, the LacB subunit also has a unique α7 helix in its C-terminus. One active site is distinctly located at the interface between LacA and LacB, whereas two active sites are present in RpiB. In the structure of the product complex, the phosphate group of D-tagatose-6-phosphate is bound to three arginine residues, including Arg-39, producing a different substrate orientation than that in RpiB, where the substrate binds at Asp-43. Due to the proximity of the Arg-134 residue and backbone Cα of the α6 helix in LacA to the last Asp-172 residue of LacB with a hydrogen bond, a six-carbon sugar-phosphate can bind in the larger pocket of LacAB, compared with RpiB. His-96 in the active site is important for ring opening and substrate orientation, and Cys-65 is essential for the isomerization activity of the enzyme. Two rare sugar substrates, D-psicose and D-ribulose, show optimal binding in the LacAB-substrate complex. These findings were supported by the results of LacA activity assays.

  10. Isoflavone synthase genes in legumes and non-leguminous plants

    Pičmanová, Martina; Koblovská, R.; Lapčík, O.; Honys, David

    Washington, D.C: IEEE Computer Society, 2012 - (Sloan, K.), s. 344-347 ISBN 978-0-7695-4706-0. [International Conference on Biomedical Engineering and Biotechnology /2012/. Macau (CN), 28.05.2012-30.05.2012] R&D Projects: GA ČR GA525/09/0994; GA ČR(CZ) GAP501/11/1462; GA MŠk(CZ) OC10054 Institutional support: RVO:61389030 Keywords : legumes * non-leguminous plants * isoflavone synthase Subject RIV: EF - Botanics

  11. Molecular characterization of glucose-6-phosphate dehydrogenase deficiency in Jeddah, Kingdom of Saudi Arabia

    Azhar Essam

    2011-10-01

    Full Text Available Abstract Background The development of polymerase chain reaction (PCR-based methods for the detection of known mutations has facilitated detecting specific red blood cell (RBC enzyme deficiencies. We carried out a study on glucose-6-phosphate dehydrogenase (G6PD deficient subjects in Jeddah to evaluate the molecular characteristics of this enzyme deficiency and the frequency of nucleotide1311 and IVS-XI-93 polymorphisms in the glucose-6-phosphate dehydrogenase gene. Results A total of 1584 unrelated Saudis (984 neonates and 600 adults were screened for glucose-6-phosphate dehydrogenase deficiency. The prevalence of glucose-6-phosphate dehydrogenase deficiency was 6.9% (n = 110. G6PD Mediterranean mutation was observed in 98 (89.1% cases, G6PD Aures in 11 (10.0% cases, and G6PD Chatham in 1 (0.9% case. None of the samples showed G6PD A‾ mutation. Samples from 29 deficient subjects (25 males and 4 females were examined for polymorphism. The association of two polymorphisms of exon/intron 11 (c.1311T/IVS-XI-93C was observed in 14 (42.4% of 33 chromosomes studied. This association was found in 9 (31.0% carriers of G6PD Mediterranean and in 4 (13.8% carriers of G6PD Aures. Conclusions The majority of mutations were G6PD Mediterranean, followed by G6PD Aures and G6PD Chatham. We conclude that 1311T is a frequent polymorphism in subjects with G6PD Mediterranean and Aures variants in Jeddah.

  12. PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

    Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

  13. Allotopic Expression of a Gene Encoding FLAG Tagged-subunit 8 of Yeast Mitochondrial ATP Synthase

    I MADE ARTIKA

    2006-03-01

    Full Text Available Subunit 8 of yeast mitochondrial ATP synthase is a polypeptide of 48 amino acids encoded by the mitochondrial ATP8 gene. A nuclear version of subunit 8 gene has been designed to encode FLAG tagged-subunit 8 fused with a mitochondrial signal peptide. The gene has been cloned into a yeast expression vector and then expressed in a yeast strain lacking endogenous subunit 8. Results showed that the gene was successfully expressed and the synthesized FLAG tagged-subunit 8 protein was imported into mitochondria. Following import, the FLAG tagged-subunit 8 protein assembled into functional mitochondrial ATP synthase complex. Furthermore, the subunit 8 protein could be detected using anti-FLAG tag monoclonal antibody.

  14. Gold Nanoparticles Decorated with Mannose-6-phosphate Analogues

    Stéphanie Combemale

    2014-01-01

    Full Text Available Herein, the preparation of neoglycoconjugates bearing mannose-6-phosphate analogues is described by: (a synthesis of a cyclic sulfate precursor to access the carbohydrate head-group by nucleophilic displacement with an appropriate nucleophile; (b introduction of spacers on the mannose-6-phosphate analogues via Huisgen’s cycloaddition, the Julia reaction, or the thiol-ene reaction under ultrasound activation. With the resulting compounds in hand, gold nanoparticles could be functionalized with various carbohydrate derivatives (glycoconjugates and then tested for angiogenic activity. It was observed that the length and flexibility of the spacer separating the sugar analogue from the nanoparticle have little influence on the biological response. One particular nanoparticle system substantially inhibits blood vessel growth in contrast to activation by the corresponding monomeric glycoconjugate, thereby demonstrating the importance of multivalency in angiogenic activity.

  15. Chromosome mapping of the GD3 synthase gene (SIAT8) in human and mouse

    Matsuda, Yoichi; Saito, Toshiyuki [National Inst. of Radiological Sciences, Chiba (Japan); Nara, Kiyomitsu [Tokyo Metropolitan Inst. of Medical Science (Japan)] [and others

    1996-02-15

    This article reports on the genetic mapping of the human and mouse GD3 synthase gene (SIAT8) using fluorescence in situ hybridization and interspecific backcross analysis. The human gene was localized to human chromosome 12p12.1-p11.2; the mouse homologue was localized to mouse chromosome 6, which has been shown to be syntenic with the short arm of human chromosome 12, suggesting a common evolution. 16 refs., 1 fig.

  16. Neonatal screening for glucose-6-phosphate dehydrogenase deficiency: sex distribution.

    Kaplan, M.; Hammerman, C; Kvit, R; Rudensky, B; Abramov, A.

    1994-01-01

    Eight hundred and six newborn infants at high risk for glucose-6-phosphate dehydrogenase (G-6-PD) deficiency were screened; 30.2% of the boys and 10.4% of the girls had severe G-6-PD deficiency. Surprisingly, 14% of the enzyme deficient girls had a father from a low risk ethnic group. Girls of high risk mothers should be screened for G-6-PD deficiency regardless of paternal origin.

  17. Glucose-6-phosphate dehydrogenase deficiency. WHO Working Group.

    1989-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the commonest enzyme disorder of human beings and a globally important cause of neonatal jaundice, which can lead to kernicterus and death or spastic cerebral palsy. It can also lead to life-threatening haemolytic crises in childhood and at later ages, by interacting with specific drugs and with fava beans in the diet. The complications of G6PD deficiency can largely be prevented by education and information, and neonatal jaundice can be ...

  18. Glucose-6-Phosphate Dehydrogenase Deficiency in Nigerian Children

    Olatundun Williams; Daniel Gbadero; Grace Edowhorhu; Ann Brearley; Tina Slusher; Lund, Troy C.

    2013-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzymopathy and in Sub-Saharan Africa, is a significant cause of infection- and drug-induced hemolysis and neonatal jaundice. Our goals were to determine the prevalence of G6PD deficiency among Nigerian children of different ethnic backgrounds and to identify predictors of G6PD deficiency by analyzing vital signs and hematocrit and by asking screening questions about symptoms of hemolysis. We studied 1,122 children (...

  19. Glucose and fructose 6-phosphate cycle in humans

    We have determined the rate of glucose cycling by comparing turnovers of [2-3H]- and [6-3H]glucose under basal conditions and during a glucose infusion. Moreover, the activity of the fructose 6-phosphate cycle was assessed by comparing [3-3H]- and [6-3H]glucose. The study included eight lean subjects with normal glucose tolerance. They participated in two randomly performed investigations. In one experiment [2-3H]- and [6-3H]glucose were given simultaneously, while in the other only [3-3H]glucose was given. The basal rate of glucose cycling was 0.32 +/- 0.08 mg X kg-1 X min-1 or 17% of basal glucose production (P less than 0.005). During glucose infusion the activity of endogenous glucose cycling did not change but since glucose production was suppressed it amounted to 130% of glucose production. The basal fructose 6-phosphate cycle could be detected only in three subjects and was suppressed during glucose infusion. In conclusion, the glucose cycle is active in healthy humans both in basal conditions and during moderate hyperglycemia. In some subjects, the fructose 6-phosphate cycle also appears to be active. Thus it is preferable to use [6-3H]glucose rather than [3-3H]glucose when measuring glucose production and particularly when assessing glucose cycle

  20. Cloning and verification of the Lactococcus lactis pyrG gene and characterization of the gene product, CTP synthase

    Wadskov-Hansen, Steen Lyders Lerche; Willemoës, M.; Martinussen, Jan;

    2001-01-01

    The pyrG gene of Lactococcus lactis subsp. cremoris, encoding CTP synthase, has been cloned and sequenced. It is flanked upstream by an open reading frame showing homology to several aminotransferases and downstream by an open reading frame of unknown function. L. lactis strains harboring disrupted...

  1. Maternally transmitted severe glucose 6-phosphate dehydrogenase deficiency is an embryonic lethal

    Longo, Letizia; Vanegas, Olga Camacho; Patel, Meghavi; Rosti, Vittorio; Li, Haiqing; Waka, John; Merghoub, Taha; Pandolfi, Pier Paolo; Notaro, Rosario; Manova, Katia; Luzzatto, Lucio

    2002-01-01

    Mouse chimeras from embryonic stem cells in which the X-linked glucose 6-phosphate dehydrogenase (G6PD) gene had been targeted were crossed with normal females. First-generation (F1) G6PD(+/–) heterozygotes born from this cross were essentially normal; analysis of their tissues demonstrated strong selection for cells with the targeted G6PD allele on the inactive X chromosome. When these F1 G6PD(+/–) females were bred to normal males, only normal G6PD mice were born, because: (i) hemizygous G6...

  2. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  3. Isolation and Molecular Characterization of 1-Aminocyclopropane-1-carboxylic Acid Synthase Genes in Hevea brasiliensis

    Jia-Hong Zhu

    2015-02-01

    Full Text Available Ethylene is an important factor that stimulates Hevea brasiliensis to produce natural rubber. 1-Aminocyclopropane-1-carboxylic acid synthase (ACS is a rate-limiting enzyme in ethylene biosynthesis. However, knowledge of the ACS gene family of H. brasiliensis is limited. In this study, nine ACS-like genes were identified in H. brasiliensis. Sequence and phylogenetic analysis results confirmed that seven isozymes (HbACS1–7 of these nine ACS-like genes were similar to ACS isozymes with ACS activity in other plants. Expression analysis results showed that seven ACS genes were differentially expressed in roots, barks, flowers, and leaves of H. brasiliensis. However, no or low ACS gene expression was detected in the latex of H. brasiliensis. Moreover, seven genes were differentially up-regulated by ethylene treatment. These results provided relevant information to help determine the functions of the ACS gene in H. brasiliensis, particularly the functions in regulating ethylene stimulation of latex production.

  4. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina; Antunes, F; Matos, O

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  5. Transcriptional Modulation of Squalene Synthase Genes in Barley Treated with PGPR

    Anam eYousaf

    2015-09-01

    Full Text Available Phytosterol contents and food quality of plant produce is directly associated with transcription of gene Squalene Synthase (SS. In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27±3°C greenhouse conditions in order to modulate expression of SS gene. Plant samples were analysed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of squalene synthase. Results revealed that among four SS genes (i.e. SSA, SS1, SS2 and SS3, the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43% and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes.

  6. Genetic Transformation of Tobacco with the Trehalose Synthase Gene from Grifola frondosa Fr. Enhances the Resistance to Drought and Salt in Tobacco

    Shu-Zhen ZHANG; Ben-Peng YANG; Cui-Lian FENG; Huo-Long TANG

    2005-01-01

    Trehalose is a non-reducing disaccharide of glucose that functions as a protectant in the stabilization of biological structures and enhances the tolerance of organisms to abiotic stress. In the present study, we report on the expression of the Grifolafrondosa Fr. trehalose synthase (TSase) gene for manipulating abiotic stress tolerance in tobacco (Nicotiana tabaccum L.). The expression of the transgene was under the control of two tandem copies of the CaMV35S promoter and was transferred into tobacco by Agrobacterium tumefaciens EHA105. Compared with non-transgenic plants, transgenic plants were able to accumulate high levels of products of trehalose, which were increased up to 2.126-2.556 mg/g FW, although levels were undetectable in non-transgenic plants. This level of trehalose in transgenic plants was 400-fold higher than that of transgenic tobacco plants cotransformed with Escherichia coli TPS and TPP on independent expression cassettes, twofold higher than that of transgenic rice plants transformed with a bifunctional fusion gene (TPSP) of the trehalose-6-phosphate (T-6-P) synthase (TPS) and T-6-P phosphatase (TPP) of E. coli, and 12-fold higher than that of transgenic tobacco plants transformed the yeast TPS1 gene.It has been reported that transgenic plants with E. coli TPS and/or TPP were severely stunted and had morphological alterations of their roots. Interestingly, our transgenic plants have obvious morphological changes, including thick and deep-coloured leaves, but show no growth inhibition; moreover, these morphological changes can restore to normal type in T2 progenies. Trehalose accumulation in 35S-35S:TSase plants resulted in increased tolerance to drought and salt, as shown by the results of tests on drought, salt tolerance, and drought physiological indices, such as water content in excised leaves, malondialdehyde content, chlorophyll a and b contents, and the activity of superoxide dismutase and peroxidase in excised leaves. These results

  7. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  8. Glucose-6-phosphate dehydrogenase (G6PD) Deficiency

    DD Farhud"; L Yazdanpanah

    2008-01-01

    "nGlucose-6-phosphate dehydrogenase (G6PD) Deficiency is the most prevalent enzymopathy in mankind. It has sex-linked in­heritance. This enzyme exists in all cells.  G6PD deficiency increases the sensitivity of red blood cells to oxidative dam­age. G6PD deficiency was discovered in 1950 when some people suffered hemolytic anemia as a result of taking antimalar­ial drugs (primaquin). Most people with G6PD deficiency do not have any symptoms, till they are ...

  9. Mannose-6-phosphate regulates destruction of lipid-linked oligosaccharides

    Gao, Ningguo; Shang, Jie; Huynh, Dang; Manthati, Vijaya L.; Arias, Carolina; Harding, Heather P.; Kaufman, Randal J.; Mohr, Ian; Ron, David; Falck, John R.; Lehrman, Mark A.

    2011-01-01

    Mannose-6-phosphate (M6P) is an essential precursor for mannosyl glycoconjugates, including lipid-linked oligosaccharides (LLO; glucose3mannose9GlcNAc2-P-P-dolichol) used for protein N-glycosylation. In permeabilized mammalian cells, M6P also causes specific LLO cleavage. However, the context and purpose of this paradoxical reaction are unknown. In this study, we used intact mouse embryonic fibroblasts to show that endoplasmic reticulum (ER) stress elevates M6P concentrations, leading to clea...

  10. Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea

    Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A.; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby

    2013-01-01

    Background Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. Methods A pediatric ...

  11. Coexpression of glutamine synthetase and carbamoylphosphate synthase I genes in pancreatic hepatocytes of rat.

    Yeldandi, A. V.; X. D. Tan; Dwivedi, R S; Subbarao, V; Smith, D. D.; Scarpelli, D. G.; Rao, M S; Reddy, J K

    1990-01-01

    In the mammalian liver the distribution of ammonia-detoxifying enzymes, glutamine synthetase (GS) and carbamoylphosphate synthase I (ammonia) (CPS-I), is mutually exclusive in that these enzymes are expressed in two distinct populations of hepatocytes that are zonally demarcated in the liver acinus. In the present study we examined the distribution of GS and CPS-I in pancreatic hepatocytes to ascertain if the expression of these two genes in these hepatocytes is also mutually exclusive. Multi...

  12. The Polyketide Synthase Gene pks4 of Trichoderma reesei Provides Pigmentation and Stress Resistance

    Atanasova, Lea; Knox, Benjamin P.; Kubicek, Christian P.; Druzhinina, Irina S.; Baker, Scott E.

    2013-01-01

    Species of the fungal genus Trichoderma (Hypocreales, Ascomycota) are well-known for their production of various secondary metabolites. Nonribosomal peptides and polyketides represent a major portion of these products. In a recent phylogenomic investigation of Trichoderma polyketide synthase (PKS)-encoding genes, the pks4 from T. reesei was shown to be an orthologue of pigment-forming PKSs involved in synthesis of aurofusarin and bikaverin in Fusarium spp. In this study, we show that deletion...

  13. Diversifying Selection on Flavanone 3-Hydroxylase and Isoflavone Synthase Genes in Cultivated Soybean and Its Wild Progenitors

    Hao Cheng; Jiao Wang; Shanshan Chu; Hong-Lang Yan; Deyue Yu

    2013-01-01

    Soybean isoflavone synthase (IFS) and flavanone 3-hydroxylase (F3H) are two key enzymes catalyzing the biosynthesis of isoflavonoids and flavonoids, both of which play diverse roles in stress responses. However, little is known about the evolutionary pattern of these genes in cultivated soybean and its wild progenitors. Herein, we investigated the nucleotide polymorphisms in Isoflavone synthase (IFS1, IFS2) and Flavanone 3-hydroxylase (F3H2) genes from 33 soybean accessions, including 17 cult...

  14. Hydroxymethylbilane synthase: Complete genomic sequence and amplifiable polymorphisms in the human gene

    Yoo, Hanwook; Warner, C.A.; Chen, Chiahsiang; Desnick, R.J. (Mount Sinai School of Medicine, New York, NY (United States))

    1993-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error of heme biosynthesis, results from the half-normal activity of the heme biosynthetic enzyme hydroxymethylbilane synthase (HMB-synthase). Heterozygous individuals are prone to life-threatening acute neurologic attacks, which are precipitated by certain drugs and other metabolic, hormonal, and nutritional factors. Since the biochemical diagnosis of heterozygous individuals has been problematic, recent efforts have focused on the identification of mutations and diagnostically useful restriction fragment length polymorphisms (RFLPS) in the HMB-synthase gene. To facilitate these endeavors, the human HMB-synthase gene, including 1.1 kb of the 5[prime] flanking region, was isolated and completely sequenced in both orientations. The 10,024-bp gene contained 15 exons ranging in size from 39 to 438 bp and 14 introns ranging from 87 to 2913 bp. All intron/exon boundaries conformed to the GT/AG consensus rule. There were six Alu repetitive elements, one of the J and five of the Sa subfamilies. Analysis of the 1. I -kb 5[prime]flanking region revealed putative regulatory elements for the housekeeping promoter including AP1, AP4, SP1, TRE, ENH, and CAC. This region contained 10 HpaII sites and had an overall GC content of 54%. Three new polymorphic sites were identified by the single-strand conformation polymorphism (SSCP) technique, a common BsmAI site in intron 3 (3581 A/G), a common HinfI RFLP in intron 10 (7064 C/A), and a rare MnlI site in intron 14 (7998G/A). The allele frequencies of five previously known and the new polymorphic sites in a normal Caucasian population indicated that the intron 1 and intron 3 RFLPs were in linkage disequilibrium; however, the Hint I site segregated independently. 54 refs., 6 figs., 3 tabs.

  15. Cloning and transformation analysis of isoflavone synthase gene into Minshan Trifolium pratense.

    Hu, H H; Jing, C Q; Liu, R; Li, W D; Feng, H G

    2015-01-01

    The aim of this study was to clone the isoflavone synthase (IFS) gene and establish the recombinant Minshan Trifolium pratense. The IFS gene was cloned from the callus of Minshan T. pratense using reverse transcription-polymerase chain reaction. The plant expression vector pRI101-AN-IFS was constructed and introduced into Agrobacterium tumefaciens strain LBA4404, and then screened under cephalosporin. IFS expression was detected by reverse transcription-polymerase chain reaction. The IFS gene was cloned successfully. Sequence analysis indicated that IFS gene had high homology with similar genes from other plants. The IFS-overexpressing callus was obtained by introducing the LBA4404-harboring IFS-pRI101-AN-IFS vector into T. pratense calluses. PMID:26345862

  16. Adaptive evolution of the chrysanthemyl diphosphate synthase gene involved in irregular monoterpene metabolism

    Liu Ping-Li

    2012-11-01

    Full Text Available Abstract Background Chrysanthemyl diphosphate synthase (CDS is a key enzyme in biosynthetic pathways producing pyrethrins and irregular monoterpenes. These compounds are confined to plants of the tribe Anthemideae of the Asteraceae, and play an important role in defending the plants against herbivorous insects. It has been proposed that the CDS genes arose from duplication of the farnesyl diphosphate synthase (FDS gene and have different function from FDSs. However, the duplication time toward the origin of CDS and the evolutionary force behind the functional divergence of the CDS gene are still unknown. Results Two duplication events were detected in the evolutionary history of the FDS gene family in the Asteraceae, and the second duplication led to the origin of CDS. CDS occurred after the divergence of the tribe Mutisieae from other tribes of Asteraceae but before the birth of the Anthemideae tribe. After its origin, CDS accumulated four mutations in sites homologous to the substrate-binding and catalysis sites of FDS. Of these, two sites were involved in the binding of the nucleophilic substrate isopentenyl diphosphate in FDS. Maximum likelihood analyses showed that some sites in CDS were under positive selection and were scattered throughout primary sequences, whereas in the three-dimensional structure model they clustered in the large central cavity. Conclusion Positive selection associated with gene duplication played a major role in the evolution of CDS.

  17. Differential expression of biphenyl synthase gene family members in fire-blight-infected apple 'Holsteiner Cox'.

    Chizzali, Cornelia; Gaid, Mariam M; Belkheir, Asma K; Hänsch, Robert; Richter, Klaus; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola; Liu, Benye; Beerhues, Ludger

    2012-02-01

    Fire blight, caused by the bacterium Erwinia amylovora, is a devastating disease of apple (Malus × domestica). The phytoalexins of apple are biphenyls and dibenzofurans, whose carbon skeleton is formed by biphenyl synthase (BIS), a type III polyketide synthase. In the recently published genome sequence of apple 'Golden Delicious', nine BIS genes and four BIS gene fragments were detected. The nine genes fall into four subfamilies, referred to as MdBIS1 to MdBIS4. In a phylogenetic tree, the BIS amino acid sequences from apple and Sorbus aucuparia formed an individual cluster within the clade of the functionally diverse type III polyketide synthases. cDNAs encoding MdBIS1 to MdBIS4 were cloned from fire-blight-infected shoots of apple 'Holsteiner Cox,' heterologously expressed in Escherichia coli, and functionally analyzed. Benzoyl-coenzyme A and salicoyl-coenzyme A were the preferred starter substrates. In response to inoculation with E. amylovora, the BIS3 gene was expressed in stems of cv Holsteiner Cox, with highest transcript levels in the transition zone between necrotic and healthy tissues. The transition zone was the accumulation site of biphenyl and dibenzofuran phytoalexins. Leaves contained transcripts for BIS2 but failed to form immunodetectable amounts of BIS protein. In cell cultures of apple 'Cox Orange,' expression of the BIS1 to BIS3 genes was observed after the addition of an autoclaved E. amylovora suspension. Using immunofluorescence localization under a confocal laser-scanning microscope, the BIS3 protein in the transition zone of stems was detected in the parenchyma of the bark. Dot-shaped immunofluorescence was confined to the junctions between neighboring cortical parenchyma cells. PMID:22158676

  18. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  19. Frostbite: A Novel Presentation of Glucose-6-Phosphate Dehydrogenase Deficiency?

    Bowles, Justin M; Joas, Chris; Head, Steven

    2015-01-01

    Acute hemolytic anemia (AHA) due to glucose 6-phosphate dehydrogenase (G6PD) deficiency has rarely been recognized as a contributor to the development of frostbite. We discuss a case of frostbite in a 32-year-old male Marine with G6PD deficiency during military training on Mount McKinley in Alaska, which eventually led to a permanent disability. In this report, the pathophysiology of G6PD deficiency, the effects of hemolytic anemia, and factors that contribute to frostbite will be discussed, as well as the clinical findings, treatment course, and the outcome of this case. The patient was evacuated and admitted to Alaska Regional Hospital. He was treated for fourth-degree frostbite, ultimately resulting in the complete or partial amputation of all toes. Although it cannot be proved that AHA occurred in this patient, this case potentially adds frostbite to the list of rare but possible clinical presentations of G6PD deficiency. PMID:26360347

  20. Kawasaki disease with Glucose-6-Phosphate Dehydrogenase deficiency, case report.

    Obeidat, Hesham Radi; Al-Dossary, Sahar; Asseri, Abdulsalam

    2015-09-01

    Kawasaki disease (KD) is an acute, self-limited vasculitis of unknown etiology that occurs predominantly in infants and children younger than 5 years of age. Coronary artery abnormalities are the most serious complication. Based on the literatures infusion of Intravenous Immunoglobulin of 2 g/kg and a high dose of oral aspirin up to 100 mg/kg/day are the standard treatment for Kawasaki disease in the acute stage, and should be followed by antiplatelet dose of aspirin for thrombocytosis. Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency is an inherited X-linked hereditary disorder, and aspirin can induce hemolysis in patients with G6PD deficiency. We report a case of a 5 year and 8 month old male with KD and G6PD deficiency. PMID:27134550

  1. Glucose-6 phosphate dehydrogenase deficiency and psychotic illness

    Vijender Singh

    2012-01-01

    Full Text Available Mr. T, a 28-year-old unmarried male, a diagnosed case of Glucose-6 Phosphate Dehydrogenase (G6PD deficiency since childhood, presented with 13 years of psychotic illness and disturbed biological functions. He showed poor response to antipsychotics and mood stabilizers and had three prior admissions to Psychiatry. There was a family history of psychotic illness. The General Physical Examination and Systemic Examination were unremarkable. Mental Status Examination revealed increased psychomotor activity, pressure of speech, euphoric affect, prolixity, delusion of persecution, delusion of grandiosity, delusion of control, thought withdrawal and thought insertion, and second and third person auditory hallucinations, with impaired judgment and insight. A diagnosis of schizophrenia paranoid type, with a differential diagnosis of schizoaffective disorder manic subtype, was made. This case is being reported for its rarity and atypicality of clinical presentation, as well as a course of psychotic illness in the G6PD Deficiency state,with its implications on management.

  2. Erythrocyte glucose-6-phosphate dehydrogenase from Brazilian opossum Didelphis marsupialis

    Barretto O.C. de O.

    2006-01-01

    Full Text Available In a comparative study of erythrocyte metabolism of vertebrates, the specific activity of glucose-6-phosphate dehydrogenase (G6PD of the Brazilian opossum Didelphis marsupialis in a hemolysate was shown to be high, 207 ± 38 IU g-1 Hb-1 min-1 at 37ºC, compared to the human erythrocyte activity of 12 ± 2 IU g-1 Hb-1 min-1 at 37ºC. The apparent high specific activity of the mixture led us to investigate the physicochemical properties of the opossum enzyme. We report that reduced glutathione (GSH in the erythrocytes was only 50% higher than in human erythrocytes, a value lower than expected from the high G6PD activity since GSH is maintained in a reduced state by G6PD activity. The molecular mass, determined by G-200 Sephadex column chromatography at pH 8.0, was 265 kDa, which is essentially the same as that of human G6PD (260 kDa. The Michaelis-Menten constants (Km: 55 µM for glucose-6-phosphate and nicotinamide adenine dinucleotide phosphate (Km: 3.3 µM were similar to those of the human enzyme (Km: 50-70 and Km: 2.9-4.4, respectively. A 450-fold purification of the opossum enzyme was achieved and the specific activity of the purified enzyme, 90 IU/mg protein, was actually lower than the 150 IU/mg protein observed for human G6PD. We conclude that G6PD after purification from the hemolysate of D. marsupialis does not have a high specific activity. Thus, it is quite probable that the red cell hyperactivity reported may be explained by increased synthesis of G6PD molecules per unit of hemoglobin or to reduced inactivation in the RBC hemolysate.

  3. Erythrocyte glucose-6-phosphate dehydrogenase from Brazilian opossum Didelphis marsupialis.

    Barretto, O C de O; Oshiro, M; Oliveira, R A G; Fedullo, J D L; Nonoyama, K

    2006-05-01

    In a comparative study of erythrocyte metabolism of vertebrates, the specific activity of glucose-6-phosphate dehydrogenase (G6PD) of the Brazilian opossum Didelphis marsupialis in a hemolysate was shown to be high, 207 +/- 38 IU g-1 Hb-1 min-1 at 37 degrees C, compared to the human erythrocyte activity of 12 +/- 2 IU g-1 Hb-1 min-1 at 37 degrees C. The apparent high specific activity of the mixture led us to investigate the physicochemical properties of the opossum enzyme. We report that reduced glutathione (GSH) in the erythrocytes was only 50% higher than in human erythrocytes, a value lower than expected from the high G6PD activity since GSH is maintained in a reduced state by G6PD activity. The molecular mass, determined by G-200 Sephadex column chromatography at pH 8.0, was 265 kDa, which is essentially the same as that of human G6PD (260 kDa). The Michaelis-Menten constants (Km: 55 microM) for glucose-6-phosphate and nicotinamide adenine dinucleotide phosphate (Km: 3.3 microM) were similar to those of the human enzyme (Km: 50-70 and Km: 2.9-4.4, respectively). A 450-fold purification of the opossum enzyme was achieved and the specific activity of the purified enzyme, 90 IU/mg protein, was actually lower than the 150 IU/mg protein observed for human G6PD. We conclude that G6PD after purification from the hemolysate of D. marsupialis does not have a high specific activity. Thus, it is quite probable that the red cell hyperactivity reported may be explained by increased synthesis of G6PD molecules per unit of hemoglobin or to reduced inactivation in the RBC hemolysate. PMID:16648898

  4. Promoter regulatory domain identification of cassava starch synthase IIb gene in transgenic tobacco.

    Guan, Zhihui; Chen, Xin; Xie, Hairong; Wang, Wenquan

    2016-05-01

    Soluble starch synthase is a key enzyme in the starch biosynthesis pathway, and its enzyme activity significantly influences starch components in cassava storage root. However, studies on the regulation mechanism of soluble starch synthase gene are rare. In this study, we cloned the 5' flanking sequence of the MeSSIIb gene and predicted the distribution of cis-elements. The region from -453 to -1 was considered the primary core promoter by the quantitative detection of GUS activity in transgenic tobacco plants containing 5' truncated promoters fused with the GUS gene. Analysis results clarified that the region from -531 to -454 significantly repressed promoter activity. The region from -453 to -388 was a repressive domain of ethylene, and some unknown drought responsive cis-elements were located in the region from -387 to -1. These findings will provide useful information on the functional assay and transcriptional regulation mechanisms of the MeSSIIb gene. PMID:26919397

  5. Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.

    Meng-Jun Li; Ai-Qin Li; Han Xia; Chuan-Zhi Zhao; Chang-Sheng Li; Shu-Bo Wan; Yu-Ping Bi; Xing-Jun Wang

    2009-06-01

    The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, -ketoacyl-ACP synthase (I, II, III), -ketoacyl-ACP reductase, -hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

  6. Diversity of benzyl- and alkylsuccinate synthase genes in hydrocarbon-impacted environments and enrichment cultures.

    Callaghan, Amy V; Davidova, Irene A; Savage-Ashlock, Kristen; Parisi, Victoria A; Gieg, Lisa M; Suflita, Joseph M; Kukor, Jerome J; Wawrik, Boris

    2010-10-01

    Hydrocarbon-degrading microorganisms play an important role in the natural attenuation of spilled petroleum in a variety of anoxic environments. The role of benzylsuccinate synthase (BSS) in aromatic hydrocarbon degradation and its use as a biomarker for field investigations are well documented. The recent discovery of alkylsuccinate synthase (ASS) allows the opportunity to test whether its encoding gene, assA, can serve as a comparable biomarker of anaerobic alkane degradation. Degenerate assA- and bssA-targeted PCR primers were designed in order to survey the diversity of genes associated with aromatic and aliphatic hydrocarbon biodegradation in petroleum-impacted environments and enrichment cultures. DNA was extracted from an anaerobic alkane-degrading isolate (Desulfoglaeba alkenexedens ALDC), hydrocarbon-contaminated river and aquifer sediments, a paraffin-degrading enrichment, and a propane-utilizing mixed culture. Partial assA and bssA genes were PCR amplified, cloned, and sequenced, yielding several novel clades of assA genes. These data expand the range of alkane-degrading conditions for which relevant gene sequences are available and indicate that considerable diversity of assA genes can be found in hydrocarbon-impacted environments. The detection of genes associated with anaerobic alkane degradation in conjunction with the in situ detection of alkylsuccinate metabolites was also demonstrated. Comparable molecular signals of assA/bssA were not found when environmental metagenome databases of uncontaminated sites were searched. These data confirm that the assA gene is a useful biomarker for anaerobic alkane metabolism. PMID:20504044

  7. A trehalose-6-phosphate phosphatase enhances anaerobic germination tolerance in rice.

    Kretzschmar, Tobias; Pelayo, Margaret Anne F; Trijatmiko, Kurniawan R; Gabunada, Lourd Franz M; Alam, Rejbana; Jimenez, Rosario; Mendioro, Merlyn S; Slamet-Loedin, Inez H; Sreenivasulu, Nese; Bailey-Serres, Julia; Ismail, Abdelbagi M; Mackill, David J; Septiningsih, Endang M

    2015-01-01

    Global socioeconomic developments create strong incentives for farmers to shift from transplanted to direct-seeded rice (DSR) as a means of intensification and economization(1). Rice production must increase to ensure food security(2) and the bulk of this increase will have to be achieved through intensification of cultivation, because expansion of cultivated areas is reaching sustainable limits(3). Anaerobic germination tolerance, which enables uniform germination and seedling establishment under submergence(4), is a key trait for the development of tropical DSR varieties(5,6). Here, we identify a trehalose-6-phosphate phosphatase gene, OsTPP7, as the genetic determinant in qAG-9-2, a major quantitative trait locus (QTL) for anaerobic germination tolerance(7). OsTPP7 is involved in trehalose-6-phosphate (T6P) metabolism, central to an energy sensor that determines anabolism or catabolism depending on local sucrose availability(8,9). OsTPP7 activity may increase sink strength in proliferating heterotrophic tissues by indicating low sugar availability through increased T6P turnover, thus enhancing starch mobilization to drive growth kinetics of the germinating embryo and elongating coleoptile, which consequently enhances anaerobic germination tolerance. PMID:27250677

  8. Functional and Biochemical Characterization of Three Recombinant Human Glucose-6-Phosphate Dehydrogenase Mutants: Zacatecas, Vanua-Lava and Viangchan

    Saúl Gómez-Manzo; Jaime Marcial-Quino; America Vanoye-Carlo; Hugo Serrano-Posada; Abigail González-Valdez; Víctor Martínez-Rosas; Beatriz Hernández-Ochoa; Edgar Sierra-Palacios; Rosa Angélica Castillo-Rodríguez; Miguel Cuevas-Cruz; Eduardo Rodríguez-Bustamante; Roberto Arreguin-Espinosa

    2016-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency in humans causes severe disease, varying from mostly asymptomatic individuals to patients showing neonatal jaundice, acute hemolysis episodes or chronic nonspherocytic hemolytic anemia. In order to understand the effect of the mutations in G6PD gene function and its relation with G6PD deficiency severity, we report the construction, cloning and expression as well as the detailed kinetic and stability characterization of three purified clinic...

  9. ATP synthase of yeast mitochondria. Isolation of subunit j and disruption of the ATP18 gene.

    Arnold, I; Pfeiffer, K; Neupert, W; Stuart, R A; Schägger, H

    1999-01-01

    The subunit composition of the mitochondrial ATP synthase from Saccharomyces cerevisiae was analyzed using blue native gel electrophoresis and high resolution SDS-polyacrylamide gel electrophoresis. We report here the identification of a novel subunit of molecular mass of 6,687 Da, termed subunit j (Su j). An open reading frame of 127 base pairs (ATP18), which encodes for Su j, was identified on chromosome XIII. Su j does not display sequence similarity to ATP synthase subunits from other organisms. Data base searches, however, identified a potential homolog from Schizosaccharomyces pombe with 51% identity to Su j of S. cerevisiae. Su j, a small protein of 59 amino acid residues, has the characteristics of an integral inner membrane protein with a single transmembrane segment. Deletion of the ATP18 gene encoding Su j led to a strain (Deltasu j) completely deficient in oligomycin-sensitive ATPase activity and unable to grow on nonfermentable carbon sources. The presence of Su j is required for the stable expression of subunits 6 and f of the F0 membrane sector. In the absence of Su j, spontaneously arising rho- cells were observed that lacked also ubiquinol-cytochrome c reductase and cytochrome c oxidase activities. We conclude that Su j is a novel and essential subunit of yeast ATP synthase. PMID:9867807

  10. A transgenic wheat with a stilbene synthase gene resistant to powdery mildew obtained by biolistic method

    2000-01-01

    Stilbene, a kind of phytoalexin, plays an important role in resistance to fungal and bacterial infection in plants. It strongly inhibits the growth of fungi and sprout of spore. Stilbene synthase gene (Vst1) obtained from grapevine has been transferred into common spring wheat Jinghong 5 by using the biolistic transformation method. Five transgenic plants (T0) were obtained from the bombarded 2014 immature embryos. One immune plantlet and 3 plantlets with mid-resistance to powdery mildew were identified from the transgenic plants of T3 generation which came from 2 T0 transgenic plants.

  11. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice

    Zheng, Shigang; Zhao, Shanchang; Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 ...

  12. Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

    Good, Laura Lee

    2001-01-01

    The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

  13. Molecular cloning and seasonal expression of oyster glycogen phosphorylase and glycogen synthase genes

    Bacca, Helene; Huvet, Arnaud; Fabioux, Caroline; Daniel, Jean-yves; Delaporte, Maryse; Pouvreau, Stephane; van Wormhoudt, A.; Moal, Jeanne

    2005-01-01

    To investigate the control at the mRNA level of glycogen metabolism in the cupped oyster Crassostrea gigas, we report in the present paper the cloning and characterization of glycogen phosphorylase and synthase cDNAs (Cg-GPH and Cg-GYS, respectively, transcripts of main enzymes for glycogen use and storage), and their first expression profiles depending on oyster tissues and seasons. A strong expression of both genes was observed in the labial palps and the gonad in accordance with specific c...

  14. An anther-specific chalcone synthase-like gene D5 related to rice pollen development

    2000-01-01

    It was shown in a previous analysis that D5 gene from rice (Oryza sativa L.) was an anther-specific gene encoding a chalcone synthase-related protein. In this study, D5 gene was found specifically expressed in tapetum cells as well as in the peripheral cells of the vascular bundle of rice anthers by RNA in situ hybridization. In order to study its function, D5 was transformed into rice in both sense and antisense directions driven by a rice Actin 1 promoter. It has been observed that the pollen grains from the antisense D5 transgenic rice plants are abnormal, indicating that D5 plays a critical role in rice pollen development.

  15. Cloning,Characterization,and Gene Annotation of Cellulose Synthase Genes from Arabidopsis thaliana

    BALASUBRAMANI G; AMUDHA J; KATEGERI I S; KHADI B M

    2008-01-01

    @@ The mechanistic basis of cellulose biosynthesis in plants has gained ground during last decade or so.The isolation of plant eDNA clones encoding cotton homologs of the bacterial cellulose synthase catalytic subunit was a significant achievement,which promises the elucidation of cellulose biosynthesis.

  16. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family. PMID:26440085

  17. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.)

    Fupeng Li; Chaoyun Hao; Lin Yan; Baoduo Wu; Xiaowei Qin; Jianxiong Lai; Yinghui Song

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  18. Protein preparation and preliminary X-ray crystallographic analysis of a putative glucosamine 6-phosphate deaminase from Streptococcus mutants

    A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P212121, with unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å

  19. Overexpression, crystallization and preliminary X-ray analysis of xylulose-5-phosphate/fructose-6-phosphate phosphoketolase from Bifidobacterium breve

    Xylulose-5-phosphate/fructose-6-phosphate phosphoketolase from B. breve was overexpressed and crystallized. The crystals belonged to the tetragonal space group I422 and diffracted to beyond 1.7 Å resolution. The xylulose-5-phosphate/fructose-6-phosphate phosphoketolase gene from Bifidobacterium breve was cloned and overexpressed in Escherichia coli. The enzyme was purified to homogeneity and crystallized by the sitting-drop vapour-diffusion method. Crystals were obtained at 293 K using 0.05 mM thiamine diphosphate, 0.25 mM MgCl2, 24%(w/v) PEG 6000 and 0.1 M Bicine pH 9.0. The crystals belonged to the tetragonal space group I422, with unit-cell parameters a = b = 174.8, c = 163.8 Å, and diffracted to beyond 1.7 Å resolution

  20. The gene controlling marijuana psychoactivity: molecular cloning and heterologous expression of Delta1-tetrahydrocannabinolic acid synthase from Cannabis sativa L.

    Sirikantaramas, Supaart; Morimoto, Satoshi; Shoyama, Yoshinari; Ishikawa, Yu; Wada, Yoshiko; Shoyama, Yukihiro; Taura, Futoshi

    2004-09-17

    Delta(1)-tetrahydrocannabinolic acid (THCA) synthase is the enzyme that catalyzes oxidative cyclization of cannabigerolic acid into THCA, the precursor of Delta(1)-tetrahydrocannabinol. We cloned a novel cDNA (GenBank trade mark accession number AB057805) encoding THCA synthase by reverse transcription and polymerase chain reactions from rapidly expanding leaves of Cannabis sativa. This gene consists of a 1635-nucleotide open reading frame, encoding a 545-amino acid polypeptide of which the first 28 amino acid residues constitute the signal peptide. The predicted molecular weight of the 517-amino acid mature polypeptide is 58,597 Da. Interestingly, the deduced amino acid sequence exhibited high homology to berberine bridge enzyme from Eschscholtzia californica, which is involved in alkaloid biosynthesis. The liquid culture of transgenic tobacco hairy roots harboring the cDNA produced THCA upon feeding of cannabigerolic acid, demonstrating unequivocally that this gene encodes an active THCA synthase. Overexpression of the recombinant THCA synthase was achieved using a baculovirus-insect expression system. The purified recombinant enzyme contained covalently attached FAD cofactor at a molar ratio of FAD to protein of 1:1. The mutant enzyme constructed by changing His-114 of the wild-type enzyme to Ala-114 exhibited neither absorption characteristics of flavoproteins nor THCA synthase activity. Thus, we concluded that the FAD binding residue is His-114 and that the THCA synthase reaction is FAD-dependent. This is the first report on molecular characterization of an enzyme specific to cannabinoid biosynthesis. PMID:15190053

  1. Molecular analysis of glucose-6-phosphate dehydrogenase variants in the Solomon Islands

    Hirono, A.; Ishii, A.; Hirono, K.; Miwa, S. [National Institute of Health, Tokyo (Japan); Kere, N. [Medical Research and Training Institute, Honiara (Japan); Fujii, H. [Tokyo Women`s Medical College, Tokyo (Japan)

    1995-05-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is one of the most prevalent genetic disorders, and >100 million people are considered to have mutant genes. G6PD deficiency is frequent in the area where plasmodium falciparum infection is endemic, probably because the G6PD-deficient subjects are resistant to the parasite. Falciparum and vivax malarias have been highly endemic in the Solomon Islands, and a high frequency of G6PD deficiency has also been expected. A recent investigation showed that the frequency of G6PD deficiency in the Solomon Islands was 8.4%-14.4%. Although >80 G6PD variants from various populations have been molecularly analyzed, little is known about those in Melanesians. G6PD Maewo, which was originally found in Vanuatu, has so far been the only Melanesian variant whose structural abnormality was determined. 14 refs., 1 fig.

  2. Endothelial nitric oxide synthase gene polymorphisms (G894T in diabetes mellitus in Egypt

    El-baz1 ; Farouk2; Tag Eldin2; Ezat2

    2010-06-01

    Full Text Available Objective: Diabetic nephropathy (DN is one of the major microvascular complications of diabetes. Genetic predisposition has been implicated in DN. The eNOS protein synthesizes nitric oxide constitutively via a reaction including the conversion of L-arginine to L-citrulline, which involves the transfer of five electrons provided by nicotinamide adenine dinucleotide phosphate The aim of this study is to evaluate the association of G894T polymorphisms of endothelial nitric oxide synthase(eNOS gene with the development of diabetic nephropathy (DN among Egyptian patients with type 1,2 diabetes mellitus in Egypt. Methods: Study subjects comprised 86 patients of type 2 diabetes with nephropathy,23 patients of type 1 diabetes with nephropathy and 46 patients of type 2 diabetes without nephropathy. G894T genotypes was determined by SSP- PCR analysis. Results: Mutant T allele, GT and TT genotypes of G894TSNP had no significant frequencies in type 1,2 diabetic patients with nephropathy compared to those without nephropathy.. Conclusion: These findings indicate that G894T polymorphism of eNOS gene may be not considered as genetic risk factors for DN among Egyptian type1, 2 diabetic patients. Abbreviations: T2DM: type 2 diabetes mellitus ­ DN: diabetic nephropathy eNOS : Endothelial nitric oxide synthase:­ SNP: single nucleotide polymorphism- SSP-PCR: sequence specific primer- polymerase chain reaction

  3. A New Farnesyl Diphosphate Synthase Gene from Taxus media Rehder: Cloning, Characterization and Functional Complementation

    Zhi-Hua Liao; Min Chen; Yi-Fu Gong; Zhu-Gang Li; Kai-Jing Zuo; Peng Wang; Feng Tan; Xiao-Fen Sun; Ke-Xuan Tang

    2006-01-01

    Farnesyl diphosphate synthase (FPS; EC 2.5.1.10) catalyzes the production of 15-carbon farnesyl diphosphate which is a branch-point intermediate for many terpenoids. This reaction is considered to be a ratelimiting step in terpenoid biosynthesis. Here we report for the first time the cloning of a new full-length cDNA encoding farnesyl diphosphate synthase from a gymnosperm plant species, Taxus media Rehder,designated as TmFPS1. The full-length cDNA of TmFPS1 (GenBank accession number: AY461811) was 1 464bp with a 1 056-bp open reading frame encoding a 351-amino acid polypeptide with a calculated molecular weight of 40.3 kDa and a theoretical pl of 5.07. Bioinformatic analysis revealed that TmFPS1 contained all five conserved domains of prenyltransferases, and showed homology to other FPSs of plant origin. Phylogenetic analysis showed that farnesyl diphosphate synthases can be divided into two groups: one of prokaryotic origin and the other of eukaryotic origin. TmFPS1 was grouped with FPSs of plant origin. Homologybased structural modeling showed that TmFPS1 had the typical spatial structure of FPS, whose most prominent structural feature is the arrangement of 13 core helices around a large central cavity in which the catalytic reaction takes place. Our bioinformatic analysis strongly suggests that TmFPS1 is a functional gene. Southern blot analysis revealed that TmFPS1 belongs to a small FPS gene family in T. media. Northern blot analysis indicated that TmFPS1 is expressed in all tested tissues, including the needles, stems and roots of T. media. Subsequently, functional complementation with TmFPS1 in a FPS-deficient mutant yeast demonstrated that TmFPS1 did encode farnesyl diphosphate synthase, which rescued the yeast mutant.This study will be helpful in future investigations aiming at understanding the detailed role of FPS in terpenoid biosynthesis flux control at the molecular genetic level.

  4. Lanosterol Synthase Gene Polymorphisms and Changes in Endogenous Ouabain in the Response to Low Sodium Intake.

    Lanzani, Chiara; Gatti, Guido; Citterio, Lorena; Messaggio, Elisabetta; Delli Carpini, Simona; Simonini, Marco; Casamassima, Nunzia; Zagato, Laura; Brioni, Elena; Hamlyn, John M; Manunta, Paolo

    2016-02-01

    Circulating levels of endogenous ouabain (EO), a vasopressor hormone of adrenocortical origin, are increased by sodium depletion. Furthermore, lanosterol synthase, an enzyme involved in cholesterol biosynthesis, has a missense polymorphism (rs2254524 V642L) that affects EO biosynthesis in adrenocortical cells. Here, we investigated the hypothesis that lanosterol synthase rs2254524 alleles in vivo impact the blood pressure (BP) and EO responses evoked by a low dietary Na intake (mEq/d, 2 weeks) among patients with mild essential hypertension. During the low salt diet, the declines in both systolic BP (SBP: -8.7±1.7 versus -3.0±1.5; P=0.013) and diastolic BP (DBP: -5.1±0.98 versus -1.4±0.94 mm Hg; PmEq/mm Hg/24 h; P=0.028). In addition, BP rose in ≈25% of the patients in response to the low salt diet and this was associated with increased circulating EO. Lanosterol synthase gene polymorphisms influence both the salt sensitivity of BP and changes in circulating EO in response to a low salt diet. The response of BP and EO to the low salt diet is markedly heterogeneous. Approximately 25% of patients experienced adverse effects, that is, increased BP and EO when salt intake was reduced and may be at increased long-term risk. The augmented response of EO to the low salt diet further supports the view that adrenocortical function is abnormal in some essential hypertensives. PMID:26667413

  5. Associations between nitric oxide synthase genes and exhaled NO-related phenotypes according to asthma status.

    Emmanuelle Bouzigon

    Full Text Available BACKGROUND: The nitric oxide (NO pathway is involved in asthma, and eosinophils participate in the regulation of the NO pool in pulmonary tissues. We investigated associations between single nucleotide polymorphisms (SNPs of NO synthase genes (NOS and biological NO-related phenotypes measured in two compartments (exhaled breath condensate and plasma and blood eosinophil counts. METHODOLOGY: SNPs (N = 121 belonging to NOS1, NOS2 and NOS3 genes were genotyped in 1277 adults from the French Epidemiological study on the Genetics and Environment of Asthma (EGEA. Association analyses were conducted on four quantitative phenotypes: the exhaled fraction of NO (Fe(NO, plasma and exhaled breath condensate (EBC nitrite-nitrate levels (NO2-NO3 and blood eosinophils in asthmatics and non-asthmatics separately. Genetic heterogeneity of these phenotypes between asthmatics and non-asthmatics was also investigated. PRINCIPAL FINDINGS: In non-asthmatics, after correction for multiple comparisons, we found significant associations of Fe(NO levels with three SNPs in NOS3 and NOS2 (P ≤ 0.002, and of EBC NO2-NO3 level with NOS2 (P = 0.002. In asthmatics, a single significant association was detected between Fe(NO levels and one SNP in NOS3 (P = 0.004. Moreover, there was significant heterogeneity of NOS3 SNP effect on Fe(NO between asthmatics and non-asthmatics (P = 0.0002 to 0.005. No significant association was found between any SNP and NO2-NO3 plasma levels or blood eosinophil counts. CONCLUSIONS: Variants in NO synthase genes influence Fe(NO and EBC NO2-NO3 levels in adults. These genetic determinants differ according to asthma status. Significant associations were only detected for exhaled phenotypes, highlighting the critical relevance to have access to specific phenotypes measured in relevant biological fluid.

  6. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice

    Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C) or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering. PMID:26302213

  7. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice.

    Shigang Zheng

    Full Text Available Resveratrol (Res is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS, existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering.

  8. Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2

    Bhubalan, K.

    2010-01-01

    Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.

  9. 21 CFR 864.7360 - Erythrocytic glucose-6-phosphate dehydrogenase assay.

    2010-04-01

    ... assay. 864.7360 Section 864.7360 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND... § 864.7360 Erythrocytic glucose-6-phosphate dehydrogenase assay. (a) Identification. An erythrocytic glucose-6-phosphate dehydrogenase assay is a device used to measure the activity of the enzyme...

  10. Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

    The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

  11. Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis.

    Sanjari, Sepideh; Shobbar, Zahra Sadat; Ebrahimi, Mohsen; Hasanloo, Tahereh; Sadat-Noori, Seyed-Ahmad; Tirnaz, Soodeh

    2015-12-01

    Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of CHS encoding genes in milk thistle plant can be of great importance. In the current research, fragments of CHS genes were amplified using degenerate primers based on the conserved parts of Asteraceae CHS genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of CHS gene family,SmCHS1 and SmCHS2. Third member, full-length cDNA (SmCHS3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants.Real-time PCR analysis indicated that SmCHS1 and SmCHS3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis. PMID:26690515

  12. Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis

    Sepideh Sanjari; Zahra Sadat Shobbar; Mohsen Ebrahimi; Tahereh Hasanloo; Seyed-Ahmad Sadat-Noor; Soodeh Tirnaz

    2015-12-01

    Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of gene family, 1 and 2. Third member, full-length cDNA (3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants. Real-time PCR analysis indicated that 1 and 3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis.

  13. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

    Yue Ming

    2009-06-01

    Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

  14. Glucose-6-phosphate dehydrogenase deficiency in Nigerian children.

    Olatundun Williams

    Full Text Available Glucose-6-phosphate dehydrogenase (G6PD deficiency is the most common human enzymopathy and in Sub-Saharan Africa, is a significant cause of infection- and drug-induced hemolysis and neonatal jaundice. Our goals were to determine the prevalence of G6PD deficiency among Nigerian children of different ethnic backgrounds and to identify predictors of G6PD deficiency by analyzing vital signs and hematocrit and by asking screening questions about symptoms of hemolysis. We studied 1,122 children (561 males and 561 females aged 1 month to 15 years. The mean age was 7.4 ± 3.2 years. Children of Yoruba ethnicity made up the largest group (77.5% followed by those Igbo descent (10.6% and those of Igede (10.2% and Tiv (1.8% ethnicity. G6PD status was determined using the fluorescent spot method. We found that the overall prevalence of G6PD deficiency was 15.3% (24.1% in males, 6.6% in females. Yoruba children had a higher prevalence (16.9% than Igede (10.5%, Igbo (10.1% and Tiv (5.0% children. The odds of G6PD deficiency were 0.38 times as high in Igbo children compared to Yoruba children (p=0.0500. The odds for Igede and Tiv children were not significantly different from Yoruba children (p=0.7528 and 0.9789 respectively. Mean oxygen saturation, heart rate and hematocrit were not significantly different in G6PD deficient and G6PD sufficient children. The odds of being G6PD deficient were 2.1 times higher in children with scleral icterus than those without (p=0.0351. In conclusion, we determined the prevalence of G6PD deficiency in Nigerian sub-populations. The odds of G6PD deficiency were decreased in Igbo children compared to Yoruba children. There was no association between vital parameters or hematocrit and G6PD deficiency. We found that a history of scleral icterus may increase the odds of G6PD deficiency, but we did not exclude other common causes of icterus such as sickle cell disease or malarial infection.

  15. Glucose-6-phosphate dehydrogenase deficiency in Nigerian children.

    Williams, Olatundun; Gbadero, Daniel; Edowhorhu, Grace; Brearley, Ann; Slusher, Tina; Lund, Troy C

    2013-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzymopathy and in Sub-Saharan Africa, is a significant cause of infection- and drug-induced hemolysis and neonatal jaundice. Our goals were to determine the prevalence of G6PD deficiency among Nigerian children of different ethnic backgrounds and to identify predictors of G6PD deficiency by analyzing vital signs and hematocrit and by asking screening questions about symptoms of hemolysis. We studied 1,122 children (561 males and 561 females) aged 1 month to 15 years. The mean age was 7.4 ± 3.2 years. Children of Yoruba ethnicity made up the largest group (77.5%) followed by those Igbo descent (10.6%) and those of Igede (10.2%) and Tiv (1.8%) ethnicity. G6PD status was determined using the fluorescent spot method. We found that the overall prevalence of G6PD deficiency was 15.3% (24.1% in males, 6.6% in females). Yoruba children had a higher prevalence (16.9%) than Igede (10.5%), Igbo (10.1%) and Tiv (5.0%) children. The odds of G6PD deficiency were 0.38 times as high in Igbo children compared to Yoruba children (p=0.0500). The odds for Igede and Tiv children were not significantly different from Yoruba children (p=0.7528 and 0.9789 respectively). Mean oxygen saturation, heart rate and hematocrit were not significantly different in G6PD deficient and G6PD sufficient children. The odds of being G6PD deficient were 2.1 times higher in children with scleral icterus than those without (p=0.0351). In conclusion, we determined the prevalence of G6PD deficiency in Nigerian sub-populations. The odds of G6PD deficiency were decreased in Igbo children compared to Yoruba children. There was no association between vital parameters or hematocrit and G6PD deficiency. We found that a history of scleral icterus may increase the odds of G6PD deficiency, but we did not exclude other common causes of icterus such as sickle cell disease or malarial infection. PMID:23874768

  16. Molecular cloning and expression profiling of a chalcone synthase gene from Lamiophlomis rotata

    Qiao Feng; Geng Gui-Gong; Zeng Yang; Xie Hui-Chun; Jin Lan; Shang Jun; Chen Zhi

    2015-06-01

    Lamiophlomis rotata is a renowned Chinese medicinal plant. Chalcone synthase (CHS) is important in flavonoid and isoflavonoid biosynthesis, catalysing the formation of naringenin chalcone in plants. A full-length cDNA encoding the CHS gene was cloned from L. rotata based on the highly conserved CHS gene sequences of Labiatae plants. A blast search showed its homology (named LrCHS) with other CHS genes of Labiate plants. The full-length genomic DNA of LrCHS was 2026 bp with one intron of 651 bp, two exons of 178 bp and 998 bp, flanked by a 73 bp $5'$-UTR and a 126 bp $3'$-UTR. The cDNA sequence of the LrCHS gene had an 1176 bp open reading frame encoding a 391 amino acid protein of 42,798 Da. The CHS protein predicted from L. rotata showed 79–86% identity with CHS of other plant species. We conducted a phylogenetic analysis of nine families containing 48 plants and L. rotata based on the full amino acid sequences of CHS proteins. Consequently, LrCHS was located in the Labiatae branch. Additionally, we examined LrCHS gene expression patterns in different tissues by quantitative real-time PCR with specific primers. The expression analysis showed preferential expression of LrCHS in flowers and leaves during the flowering stage. Total flavonoid content and CHS gene expression exhibited similar patterns during L. rotata organ development. In agreement with its function as an elicitor-responsive gene, LrCHS expression was coordinated by methyl jasmonate and UV light, and induced between 6 and 18 h. These results provide a molecular basis for additional functional studies of LrCHS in L. rotata.

  17. Phylogenetic diversification of glycogen synthase kinase 3/SHAGGY-like kinase genes in plants

    Soltis Pamela S

    2006-02-01

    Full Text Available Abstract Background The glycogen synthase kinase 3 (GSK3/SHAGGY-like kinases (GSKs are non-receptor serine/threonine protein kinases that are involved in a variety of biological processes. In contrast to the two members of the GSK3 family in mammals, plants appear to have a much larger set of divergent GSK genes. Plant GSKs are encoded by a multigene family; analysis of the Arabidopsis genome revealed the existence of 10 GSK genes that fall into four major groups. Here we characterized the structure of Arabidopsis and rice GSK genes and conducted the first broad phylogenetic analysis of the plant GSK gene family, covering a taxonomically diverse array of algal and land plant sequences. Results We found that the structure of GSK genes is generally conserved in Arabidopsis and rice, although we documented examples of exon expansion and intron loss. Our phylogenetic analyses of 139 sequences revealed four major clades of GSK genes that correspond to the four subgroups initially recognized in Arabidopsis. ESTs from basal angiosperms were represented in all four major clades; GSK homologs from the basal angiosperm Persea americana (avocado appeared in all four clades. Gymnosperm sequences occurred in clades I, III, and IV, and a sequence of the red alga Porphyra was sister to all green plant sequences. Conclusion Our results indicate that (1 the plant-specific GSK gene lineage was established early in the history of green plants, (2 plant GSKs began to diversify prior to the origin of extant seed plants, (3 three of the four major clades of GSKs present in Arabidopsis and rice were established early in the evolutionary history of extant seed plants, and (4 diversification into four major clades (as initially reported in Arabidopsis occurred either just prior to the origin of the angiosperms or very early in angiosperm history.

  18. Purification and Characteristics of Sorbitol-6-phosphate Dehydrogenase from Loquat Leaves.

    Hirai, M

    1981-02-01

    To study the role of sorbitol-6-phosphate dehydrogenase in sorbitol synthesis in leaves of Rosaceous plants, properties of the enzyme and its presence in several plants in the family was investigated. The activity of the enzyme, which catalyzes an NADP-dependent oxidation of the substrate to glucose-6-phosphate, was detected in leaves of Prunus mume, Prunus persica, Rhaphiolepsis indica, Sorbus aucuparia, Cydonia oblonga, Photinia glabra, Sorbaria kirilowii, and Spiraea thunbergii.The enzyme was purified about 60-fold from leaves of loquat (Eriobotrya japonica) using affinity chromatography with Blue Sepharose. Neither mannitol-1-phosphate nor fructose-6-phosphate served as substrate. Molecular weight of the enzyme was calculated to be 65,000 at pH 8.0 by gel filtration. Since sodium dodecyl sulfate-polyacrylamide gel electrophoresis showed a peptide of 33,000 daltons, the enzyme was assumed to be a dimer at pH 8.0 K(m) values for sorbitol-6-phosphate, glucose-6-phosphate, NADP, and NADPH were 2.22 millimolar, 11.6 millimolar, 13.5 micromolar, and 1.61 micromolar, respectively. Equilibrium constant for sorbitol-6-phosphate oxidation was 5.12 x 10(-10). Optimal pH for sorbitol-6-phosphate oxidation was 9.8. The enzyme showed its maximum activity within a broad pH range between 7 and 9 for glucose-6-phosphate reduction. The enzyme was more effective in the direction of glucose-6-phosphate reduction than in the reverse direction at neutral pH. Thus, it is suggested that the enzyme catalyzes sorbitol synthesis from glucose-6-phosphate during photosynthesis in leaves of Rosaceous plants. PMID:16661650

  19. Molecular Cloning and Characterization of Citrate Synthase Gene in Rice( Oryza sativa)

    ZHANG Shan-shan; MING Feng; LU Qun; GUO Bin; SHEN Da-leng

    2005-01-01

    The full-length OsCS encoding citrate synthase was isolated from rice (Oryza sativa L. subsp. japonica). OsCS is 1477-bp long and encodes a 474 amino acid polypeptide. Its putative protein sequence is highly identical to Daucus carota, Nicotiana tabacum,Beta vulgaris subsp., Arabidopsis thaliana, and Citrus junos (>70%). The deduced amino-terminal sequence of OsCS showes characteristics of mitochondrial targeting signal. Southern blot analysis using ORF of the OsCS as the probe indicated that this gene exists in multiple copies in rice genome. The band with predicated size of 82 kD was detected by Western blot after being induced by 0.4 mmol/L IPTG.

  20. Mutational Analysis of Pneumocystis jirovecii Dihydropteroate Synthase and Dihydrofolate Reductase Genes in HIV-Infected Patients in China

    Deng, Xilong; Zhuo, Li; Lan, Yun; Dai, Zhaoxia; Chen, Wan-shan; Cai, Weiping; Kovacs, Joseph A.; Ma, Liang; Tang, Xiaoping

    2014-01-01

    We investigated Pneumocystis jirovecii dihydropteroate synthase (DHPS) and dihydrofolate reductase (DHFR) genes for mutations in 25 Chinese HIV-infected patients with P. jirovecii pneumonia. We identified DHPS mutations in 3 (12%) patients and DHFR mutations in 1 (4%) patient. The prevalence of DHPS and DHFR mutations in China remains low, as it does in other developing countries.

  1. Effect of estrogen on gene expression of fatty acid synthase in periosteum

    ZHENG Rui-min; LIN Shou-qing; LIU Yong; HUANG Man-ting; GONG Wei-yan; WU Zhi-hong

    2009-01-01

    Background Estrogen deficiency contributes to postmenopausal osteoporosis.Periosteum might be a potential target of estrogen,but the underlying mechanism at gene level is far from being elucidated.The objective of this study was to investigate the correlation between estrogen and fatty acid synthase(FAS)expression in periosteum.Methods Human periosteum cells were cultured in vitro.Expressed genes in the substrated cDNA library were verified using semi-quantitative PCR and real-time PCR.The expression of FAS in periosteum of ovarectomized(OVX)SD rats was investigated.Results FAS gene was most significantly expressed in the subtracted cDNA library of periosteal cells screened by semi-quantitative PCR.Low FAS expression was verified by real-time PCR in the estrogen exposed human periosteum rather than in the control.The estradiol levels were(20.81±12.62)pg/ml,(19.64±4.35)pg/ml and(13.47+1.84)pg/ml in the sham group,the control,and the OVX group,respectively.The estradiol levels in the OVX group was significantly lower(P=0.0386).The FAS gene expression in periosteum in the OVX group,sham group,and control group was 3.09±1.97,1.33±0.47 and 1.51±1.32,respectively.The gene expression in the OVX group was significantly higher (P=0.0372).Conclusion Estrogen modulates FAS gene expression in in vitro human perisoteum as well as in in vivo rat periosteum.

  2. Expression of an (E)-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Xiudao Yu; Yongjun Zhang; Youzhi Ma; Zhaoshi Xu; Genping Wang; Lanqin Xia

    2013-01-01

    Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E)-β-farnesene (EβF) is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piper...

  3. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Jianrong Wang

    2014-12-01

    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  4. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  5. Relationship Between Polymorphism of Cystathionine beta Synthase Gene and Congenital Heart Disease in Chinese Nuclear Families

    XIAO-MING SONG; XIAO-YING ZHENG; WEN-LI ZHU; LEI HUANG; YONG LI

    2006-01-01

    Objective To study the relationship between polymorphism of cystathionine beta synthase (CBS) gene and development of congenital heart disease (CHD). Methods One hundred and twenty-seven CHD case-parent triads were recruited from Liaoning Province as patient group, and 129 healthy subjects without family history of birth defect were simultaneously recruited as control group together with their biological parents. For all subjects the polymorphism of CBS gene G919A locus was examined by PCR-ARMS method. Results The frequencies of three genotypes (w/w, w/m, and m/m) in control group were 27.2%, 58.4%, and 14.4%, respectively, with no significant difference in gender. A significant difference in the allele frequency was found between CHD patients and controls, the wild allele frequency was 67.9% in patients and 55.7% in controls.CHD parents' genotype distribution was significantly different from that in controls. Further comparison of each type of CHD showed that genotype frequencies in several CHD subtypes were significantly different from those in their corresponding controls. The results of TDT analysis showed that no allele transmission disequilibrium existed in CHD nuclear families.Conclusions CBS gene G919A mutation is associated with the development of CHD, and the mutated allele may decrease the risk of CHD.

  6. Molecular identity and gene expression of aldosterone synthase cytochrome P450

    11β-Hydroxylase (CYP11B1) of bovine adrenal cortex produced corticosterone as well as aldosterone from 11-deoxycorticosterone in the presence of the mitochondrial P450 electron transport system. CYP11B1s of pig, sheep, and bullfrog, when expressed in COS-7 cells, also performed corticosterone and aldosterone production. Since these CYP11B1s are present in the zonae fasciculata and reticularis as well as in the zona glomerulosa, the zonal differentiation of steroid production may occur by the action of still-unidentified factor(s) on the enzyme-catalyzed successive oxygenations at C11- and C18-positions of steroid. In contrast, two cDNAs, one encoding 11β-hydroxylase and the other encoding aldosterone synthase (CYP11B2), were isolated from rat, mouse, hamster, guinea pig, and human adrenals. The expression of CYP11B1 gene was regulated by cyclic AMP (cAMP)-dependent signaling, whereas that of CYP11B2 gene by calcium ion-signaling as well as cAMP-signaling. Salt-inducible protein kinase, a cAMP-induced novel protein kinase, was one of the regulators of CYP11B2 gene expression

  7. Callose Synthase Family Genes Involved in the Grapevine Defense Response to Downy Mildew Disease.

    Yu, Ying; Jiao, Li; Fu, Shufang; Yin, Ling; Zhang, Yali; Lu, Jiang

    2016-01-01

    The deposition of callose is a common plant defense response to intruding pathogens and part of the plant's innate immunity. In this study, eight grapevine callose synthase (CalS) genes were identified and characterized. To investigate biological function of CalS in grapevine against the infection of Plasmopara viticola, expression patterns of grapevine CalS family genes were analyzed among resistant/susceptible cultivars. After P. viticola infection, expression of CalS1, 3, 7, 8, 9, 10, and 11 were significantly modified among the grapevine cultivars. For example, the expression of CalS1 and CalS10 were greatly increased in downy mildew (DM)-immune Muscadinia rotundifolia 'Carlos' and 'Noble'. Transient expression assay with promoters of the CalS1 and CalS10 genes confirmed that they were regulated by the oomycete pathogen P. viticola. CalS1 promoter activity was also significantly up-regulated by ABA in DM-immune M. rotundifolia 'Noble', but down-regulated in DM-susceptible Vitis vinifera 'Chardonnay'. The CalS1 promoter, however, was also down-regulated by GA in 'Chardonnay', but not affected in 'Noble'. The promoter activity of CalS10 was significantly up-regulated by GA in 'Chardonnay', but not regulated by ABA at all. It is proposed that CalS1 and CalS10 were involved in grapevine defense against DM disease. PMID:26474330

  8. Genomic Distance between Thymidylate Synthase and Dihydrofolate Reductase Genes Does Not Correlate With Phylogenetic Evolution in Bacteria

    Vitor Hugo Moreau

    2010-01-01

    Problem statement: Dihydrofolate Reductase (DHFR) and Thymidylate Synthase (TS) exist as bifunctional enzymes coded into unique polypeptide chain in protozoans. Bifunctional DHFR-TS is associated with an increase in the enzymatic activity by channeling the substrate between the active sites. In some bacteria, DHFR and TS genes are neighbors in the genome, whereas in others, they are located millions of base pairs apart. Gene neighboring gained importance in evolution because it was found to p...

  9. Acid sphingomyelinase gene knockout ameliorates hyperhomocysteinemic glomerular injury in mice lacking cystathionine-β-synthase.

    Krishna M Boini

    Full Text Available Acid sphingomyelinase (ASM has been implicated in the development of hyperhomocysteinemia (hHcys-induced glomerular oxidative stress and injury. However, it remains unknown whether genetically engineering of ASM gene produces beneficial or detrimental action on hHcys-induced glomerular injury. The present study generated and characterized the mice lacking cystathionine β-synthase (Cbs and Asm mouse gene by cross breeding Cbs(+/- and Asm(+/- mice. Given that the homozygotes of Cbs(-/-/Asm(-/- mice could not survive for 3 weeks. Cbs(+/-/Asm(+/+, Cbs(+/-/Asm(+/- and Cbs(+/-/Asm(-/- as well as their Cbs wild type littermates were used to study the role of Asm(-/- under a background of Cbs(+/- with hHcys. HPLC analysis revealed that plasma Hcys level was significantly elevated in Cbs heterozygous (Cbs(+/- mice with different copies of Asm gene compared to Cbs(+/+ mice with different Asm gene copies. Cbs(+/-/Asm(+/+ mice had significantly increased renal Asm activity, ceramide production and O(2.(- level compared to Cbs(+/+/Asm(+/+, while Cbs(+/-/Asm(-/- mice showed significantly reduced renal Asm activity, ceramide production and O(2.(- level due to increased plasma Hcys levels. Confocal microscopy demonstrated that colocalization of podocin with ceramide was much lower in Cbs(+/-/Asm(-/- mice compared to Cbs(+/-/Asm(+/+ mice, which was accompanied by a reduced glomerular damage index, albuminuria and proteinuria in Cbs(+/-/Asm(-/- mice. Immunofluorescent analyses of the podocin, nephrin and desmin expression also illustrated less podocyte damages in the glomeruli from Cbs(+/-/Asm(-/- mice compared to Cbs(+/-/Asm(+/+ mice. In in vitro studies of podocytes, hHcys-enhanced O(2.(- production, desmin expression, and ceramide production as well as decreases in VEGF level and podocin expression in podocytes were substantially attenuated by prior treatment with amitriptyline, an Asm inhibitor. In conclusion, Asm gene knockout or corresponding enzyme

  10. Endothelial nitric oxide synthase gene polymorphism is associated with sickle cell disease patients in India.

    Nishank, Sudhansu Sekhar; Singh, Mendi Prema Shyam Sunder; Yadav, Rajiv; Gupta, Rasik Bihari; Gadge, Vijay Sadashiv; Gwal, Anil

    2013-12-01

    Patients with sickle cell disease (SCD) produce significantly low levels of plasma nitric oxide (NO) during acute vaso-occlusive crisis. In transgenic sickle cell mice, NO synthesized by endothelial nitric oxide synthase (eNOS) enzyme of vascular endothelial cells has been found to protect the mice from vaso-occlusive events. Therefore, the present study aims to explore possible association of eNOS gene polymorphism as a potential genetic modifier in SCD patients. A case control study involving 150 SCD patients and age- and ethnicity-matched 150 healthy controls were genotyped by PCR-restriction fragment length polymorphism techniques for three important eNOS gene polymorphisms-eNOS 4a/b, eNOS 894G>T and eNOS -786T>C. It was observed that SCD patients had significantly higher frequencies of mutant alleles besides heterozygous and homozygous mutant genotypes of these three eNOS gene polymorphisms and low levels of plasma nitrite (NO2) as compared with control groups. The SCD severe group had significantly lower levels of plasma NO2 and higher frequencies of mutant alleles of these three SNPs of eNOS gene in contrast to the SCD mild group of patients. Haplotype analysis revealed that frequencies of one mutant haplotype '4a-T-C' (alleles in order of eNOS 4a/b, eNOS 894G>T and eNOS -786T>C) were significantly high in the severe SCD patients (Phaplotype '4b-G-T' was found to be significantly high (P<0.0001) in the SCD mild patients, which indicates that eNOS gene polymorphisms are associated with SCD patients in India and may act as a genetic modifier of the phenotypic variation of SCD patients. PMID:24088668

  11. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

  12. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  13. NMR studies on mechanism of isomerisation of fructose 6-phosphate to glucose 6-phosphate catalysed by phosphoglucose isomerase from Thermococcus kodakarensis.

    Abbas, Shahzada Nadeem; Mok, Kenneth Hun; Rashid, Naeem; Xie, Yongjing; Ruether, Manuel; O'Brien, John; Akhtar, Muhammad

    2016-06-01

    The fate of hydrogen atoms at C-2 of glucose 6-phosphate (G6P) and C-1 of fructose 6-phosphate (F6P) was studied in the reaction catalysed by phosphoglucose isomerase from Thermococcus kodakarensis (TkPGI) through 1D and 2D NMR methods. When the reaction was performed in (2)H2O the hydrogen atoms in the aforementioned positions were exchanged with deuterons indicating that the isomerization occurred by a cis-enediol intermediate involving C-1 pro-R hydrogen of F6P. These features are similar to those described for phosphoglucose isomerases from rabbit muscle and Pyrococcus furiosus. PMID:27014866

  14. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

    Dullat Harpreet K

    2011-03-01

    Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

  15. Multiple independent fusions of glucose-6-phosphate dehydrogenase with enzymes in the pentose phosphate pathway.

    Nicholas A Stover

    Full Text Available Fusions of the first two enzymes in the pentose phosphate pathway, glucose-6-phosphate dehydrogenase (G6PD and 6-phosphogluconolactonase (6PGL, have been previously described in two distant clades, chordates and species of the malarial parasite Plasmodium. We have analyzed genome and expressed sequence data from a variety of organisms to identify the origins of these gene fusion events. Based on the orientation of the domains and range of species in which homologs can be found, the fusions appear to have occurred independently, near the base of the metazoan and apicomplexan lineages. Only one of the two metazoan paralogs of G6PD is fused, showing that the fusion occurred after a duplication event, which we have traced back to an ancestor of choanoflagellates and metazoans. The Plasmodium genes are known to contain a functionally important insertion that is not seen in the other apicomplexan fusions, highlighting this as a unique characteristic of this group. Surprisingly, our search revealed two additional fusion events, one that combined 6PGL and G6PD in an ancestor of the protozoan parasites Trichomonas and Giardia, and another fusing G6PD with phosphogluconate dehydrogenase (6PGD in a species of diatoms. This study extends the range of species known to contain fusions in the pentose phosphate pathway to many new medically and economically important organisms.

  16. Insertional mutagenesis and characterization of a polyketide synthase gene (PKS1) required for melanin biosynthesis in Bipolaris oryzae.

    Moriwaki, Akihiro; Kihara, Junichi; Kobayashi, Tsutomu; Tokunaga, Toshiko; Arase, Sakae; Honda, Yuichi

    2004-09-01

    A polyketide synthase gene named PKS1, involved in the melanin biosynthesis pathway of the phytopathogenic fungus Bipolaris oryzae, was isolated using restriction enzyme-mediated integration. Sequence analysis showed that the PKS1 encodes a putative protein that has 2155 amino acids and significant similarity to other fungal polyketide synthases. Targeted disruption of the PKS1 gene showed that it is necessary for melanin biosynthesis in B. oryzae. Northern blot analysis showed that PKS1 transcripts were specifically enhanced by near-ultraviolet radiation (300-400 nm) and that its temporal transcriptional patterns were similar to those of THR1 and SCD1 genes involved in the melanin biosynthesis pathway of B. oryzae. PMID:15336395

  17. Genes encoding the alpha, gamma, delta, and four F0 subunits of ATP synthase constitute an operon in the cyanobacterium Anabaena sp. strain PCC 7120.

    McCarn, D F; R A Whitaker; Alam, J; Vrba, J M; Curtis, S E

    1988-01-01

    A cluster of genes encoding subunits of ATP synthase of Anabaena sp. strain PCC 7120 was cloned, and the nucleotide sequences of the genes were determined. This cluster, denoted atp1, consists of four F0 genes and three F1 genes encoding the subunits a (atpI), c (atpH), b' (atpG), b (atpF), delta (atpD), alpha (aptA), and gamma (atpC) in that order. Closely linked upstream of the ATP synthase subunit genes is an open reading frame denoted gene 1, which is equivalent to the uncI gene of Escher...

  18. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-01-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems (P mercury exposure significantly enhanced the mRNA expression of SsPCS (P metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  19. Evolution of mustard (Brassica juncea Coss) subspecies in China: evidence from the chalcone synthase gene.

    Chen, F B; Liu, H F; Yao, Q L; Fang, P

    2016-01-01

    To explore the phylogenetic relationship, genome donor, and evolutionary history of the polyploid mustard (Brassica juncea) from China, eighty-one sequences of the chalcone synthase gene (Chs) were analyzed in 43 individuals, including 34 B. juncea, 2 B. rapa, 1 B. nigra, 2 B. oleracea, 1 B. napus, 1 B. carinata, and 2 Raphanus sativus. A maximum likelihood analysis showed that sequences from B. juncea were separated into two well-supported groups in accordance with the A and B genomes, whereas the traditional phenotypic classification of B. juncea was not wholly supported by the molecular results. The SplitsTree analysis recognized four distinct groups of Brassicaceae, and the median-joining network analysis recognized four distinct haplotypes of Chs. The estimates of Tajima's D, Fu and Li's D, and Fu and Li's F statistic for the Chs gene in the B genome were negative, while those in the A genome were significant. The results indicated that 1) the Chs sequences revealed a high level of sequence variation in Chinese mustard, 2) both tree and reticulate evolutions existed, and artificial selection played an important role in the evolution of Chinese mustard, 3) the original parental species of Chinese mustard are B. rapa var. sinapis arvensis and B. nigra (derived from China), 4) nucleotide variation in the B genome was higher than that in the A genome, and 5) cultivated mustard evolved from wild mustard, and China is one of the primary origins of B. juncea. PMID:27173323

  20. Nitric Oxide Synthase Type III Overexpression By Gene Therapy Exerts Antitumoral Activity In Mouse Hepatocellular Carcinoma

    Raúl González

    2015-08-01

    Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.

  1. Nonribosomal peptide synthase gene clusters for lipopeptide biosynthesis in Bacillus subtilis 916 and their phenotypic functions.

    Luo, Chuping; Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu; Chen, Zhiyi

    2015-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way. PMID:25362061

  2. Polymorphism of thymidylate synthase gene associated with its protein expression in human colon cancer

    Kai-Huan Yu; Wei-Xing Wang; You-Ming Ding; Hui Li; Ze-Sheng Wang

    2008-01-01

    AIM: To correlate the polymorphisms in the 5'-untranslated region with thymidylate synthase (TS) protein expression in Han Chinese colonic neoplasms.METHODS: Adenocarcinoma samples were from 68 patients who received no treatment before surgery. Tandem repeat length of TS gene was determined by PCR amplification of genomic DNA. Intratumoral TS protein expression was studied immunohistochemically in corresponding sections from paraffin-embedded primary foci. Immunoreactivity was semiquantitatively evaluated by immunoreactivity score (IRS).RESULTS: Double-(2R) and triple-repeated (3R) sequences of the TS gene were found in the cancer tissues. Three genotypes of TS were found: 2R/2R (n = 6), 2R/3R (n = 22) and 3R/3R (n = 40). Patients who were homozygous for triple-repeated (3R/3R) sequences showed significantly higher IRS of TS than patients who were homozygous for double-repeated (2R/2R) sequences or heterozygous patients (2R/3R): 5.73 ± 3.25 vs 2.17 ± 1.47 or 3.77 ± 2.64, P = 0.008 or P = 0.015. But no statistical significance of IRS in cancer tissues was observed between 2R/3R genotype and 2R/2R genotype.CONCLUSION: There is a relationship between TS genotype and TS protein expression in clinical specimens. The data might offer an advantage for selection of Chinese cancer patients to receive fluoropyrimidines treatment.

  3. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-01-01

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots. PMID:26782459

  4. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

    2007-11-01

    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat. PMID:17721773

  5. Presence of two transcribed malate synthase genes in an n-alkane-utilizing yeast, Candida tropicalis.

    Hikida, M; Atomi, H; Fukuda, Y; Aoki, A; Hishida, T; Teranishi, Y; Ueda, M; Tanaka, A

    1991-12-01

    The presence of two genomic DNA regions encoding malate synthase (MS) was shown by Southern blot analysis of the genomic DNA from an n-alkane-assimilating yeast, Candida tropicalis, using a partial MS cDNA probe, in accordance with the fact that two types of partial MS cDNAs have previously been isolated. This was also confirmed by the restriction mapping of the two genes screened from the yeast lambda EMBL library. Nucleotide sequence analysis of the respective genomic DNAs, named MS-1 gene and MS-2 gene, revealed that both regions encoding MS had the same length of 1,653 base pairs, corresponding to 551 amino acids (molecular mass of MS-1, 62,448 Da; MS-2, 62,421 Da). Although 29 nucleotide pairs differed in the sequences of the coding regions, the number of amino acid replacements was only one: 159Asn (MS-1)----159Ser (MS-2). In the 5'-flanking regions, there were replacements of four nucleotide pairs, deletion of one pair, and insertion of four pairs. In spite of the fact that two genomic genes were present and transcribed, RNA blot analysis demonstrated that only one band (about 2 kb) was observable even when the carbon sources in the cultivation medium were changed. A comparison of the amino acid sequences was made with MSs of rape (Brassica napus L.), cucumber seed, pumpkin seed, Escherichia coli, and Hansenula polymorpha. A high homology was observed among these enzymes, the results indicating that the protein structure was relatively well conserved through the evolution of the molecule.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1794980

  6. IDENTIFICATION AND HORMONE INDUCTION OF PUTATIVE CHITIN SYNTHASE GENES AND SPLICE VARIANTS IN Leptinotarsa decemlineata (SAY).

    Shi, Ji-Feng; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing

    2016-08-01

    Chitin synthase (ChS) plays a critical role in chitin synthesis and excretion. In this study, two ChS genes (LdChSA and LdChSB) were identified in Leptinotarsa decemlineata. LdChSA contains two splicing variants, LdChSAa and LdChSAb. Within the first, second, and third larval instars, the mRNA levels of LdChSAa, LdChSAb, and LdChSB coincide with the peaks of circulating 20-hydroxyecdysone (20E) and juvenile hormone (JH). In vitro culture of midguts and an in vivo bioassay revealed that 20E and an ecdysteroid agonist halofenozide stimulated the expression of the three LdChSs. Conversely, a reduction of 20E by RNA interference (RNAi) of an ecdysteroidogenesis gene LdSHD repressed the expression of these LdChSs, and ingestion of halofenozide by LdSHD RNAi larvae rescued the repression. Moreover, disruption of 20E signaling by RNAi of LdEcR, LdE75, LdHR3, and LdFTZ-F1 reduced the expression levels of these genes. Similarly, in vitro culture and an in vivo bioassay showed that exogenous JH and a JH analog methoprene activated the expression of the three LdChSs, whereas a decrease in JH by RNAi of a JH biosynthesis gene LdJHAMT downregulated these LdChSs. It seems that JH upregulates LdChSs at the early stage of each instar, whereas a 20E pulse triggers the transcription of LdChSs during molting in L. decemlineata. PMID:27030662

  7. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  8. Characterization of two trpE genes encoding anthranilate synthase α-subunit in Azospirillum brasilense

    The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1(G) while these sequence features did not exist in front of trpE 2. The β-galactosidase activity of an A. brasilense strain carrying a trpE 2-lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1(G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1(G)- and trpE 2- mutants demonstrated that TrpE1(G) fusion protein is feedback inhibited by tryptophan while TrpE2 protein is not. We also found that both trpE 1(G) and trpE 2 gene products were involved in IAA synthesis

  9. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Lydia J R Hunter

    Full Text Available BACKGROUND: RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail. METHODOLOGY/PRINCIPAL FINDINGS: In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought. CONCLUSIONS/SIGNIFICANCE: RDR1 is regulated by a much broader range of phytohormones than previously thought

  10. Glucose-6-Phosphate Dehydrogenase deficiency presented with convulsion: a rare case

    Alparslan Merdin

    2014-03-01

    Full Text Available Red blood cells carry oxygen in the body and Glucose-6-Phosphate Dehydrogenase protects these cells from oxidative chemicals. If there is a lack of Glucose-6-Phosphate Dehydrogenase, red blood cells can go acute hemolysis. Convulsion is a rare presentation for acute hemolysis due to Glucose-6-Phosphate Dehydrogenase deficiency. Herein, we report a case report of a Glucose-6-Phosphate Dehydrogenase deficiency diagnosed patient after presentation with convulsion. A 70 year-old woman patient had been hospitalized because of convulsion and fatigue. She has not had similar symptoms before. She had ingested fava beans in the last two days. Her hypophyseal and brain magnetic resonance imaging were normal. Blood transfusion was performed and the patient recovered.

  11. Kernicterus by glucose-6-phosphate dehydrogenase deficiency: a case report and review of the literature

    Cossio de Gurrola Gladys

    2008-05-01

    Full Text Available Abstract Introduction Glucose-6-phosphate dehydrogenase deficiency is an X-linked recessive disease that causes acute or chronic hemolytic anemia and potentially leads to severe jaundice in response to oxidative agents. This deficiency is the most common human innate error of metabolism, affecting more than 400 million people worldwide. Case presentation Here, we present the first documented case of kernicterus in Panama, in a glucose-6-phosphate dehydrogenase-deficient newborn clothed in naphthalene-impregnated garments, resulting in reduced psychomotor development, neurosensory hypoacousia, absence of speech and poor reflex of the pupil to light. Conclusion Mutational analysis revealed the glucose-6-phosphate dehydrogenase Mediterranean polymorphic variant, which explained the development of kernicterus after exposition of naphthalene. As the use of naphthalene in stored clothes is a common practice, glucose-6-phosphate dehydrogenase testing in neonatal screening could prevent severe clinical consequences.

  12. Phosphorylation and 14-3-3 binding of Arabidopsis trehalose-phosphate synthase 5 in response to 2-deoxyglucose

    Harthill, Jean E; Meek, Sarah E M; Morrice, Nick;

    2006-01-01

    Trehalose-6-phosphate is a 'sugar signal' that regulates plant metabolism and development. The Arabidopsis genome encodes trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphatase (TPP) enzymes. It also encodes class II proteins (TPS isoforms 5-11) that contain both TPS-like and TPP...

  13. High glucose concentrations partially release hexokinase from inhibition by glucose 6-phosphate.

    Fujii, S; Beutler, E

    1985-01-01

    The phosphorylation of glucose by human erythrocyte hexokinase follows classical Michaelis-Menten kinetics; hexokinase manifests maximum activity at 5 mM glucose, and no further increase in activity can be measured at higher glucose concentrations. However, the erythrocytes of diabetics and normal erythrocytes incubated with high concentrations of glucose contain increased concentrations of glucose 6-phosphate. To elucidate the mechanism of accumulation of glucose 6-phosphate when erythrocyte...

  14. Kernicterus by glucose-6-phosphate dehydrogenase deficiency: a case report and review of the literature

    Cossio de Gurrola Gladys; Araúz Juan; Durán Elfilda; Aguilar-Medina Maribel; Ramos-Payán Rosalío; García-Magallanes Noemí; Pacheco Gerardo; Arámbula Meraz Eliakym

    2008-01-01

    Abstract Introduction Glucose-6-phosphate dehydrogenase deficiency is an X-linked recessive disease that causes acute or chronic hemolytic anemia and potentially leads to severe jaundice in response to oxidative agents. This deficiency is the most common human innate error of metabolism, affecting more than 400 million people worldwide. Case presentation Here, we present the first documented case of kernicterus in Panama, in a glucose-6-phosphate dehydrogenase-deficient newborn clothed in nap...

  15. Amperometric Biosensor for estimation of Glucose-6-phosphate Using Prussian Blue Nanoparticles.

    Banerjee, S.; Sarkar, Priya; Turner, Anthony

    2013-01-01

    Glucose-6-phosphateplays an important role in carbohydrate metabolism of all living organisms.Compared to the conventional analytical methods available for estimation of glucose-6-phosphate,the biosensors having relative simplicity, specificity, low-cost and fastresponse time are a promising alternative. We have reported a glucose-6-phosphatesensor based on screen-printed electrode utilizing Prussian blue nanoparticlesand enzymes, glucose-6-phosphate dehydrogenase and glutathione reductase. T...

  16. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  17. Polymorphism of Methionine Synthase Gene in Nuclear Families of Congenital Heart Disease

    WEN-LI ZHU; JUN CHENG; JING-JING DAO; RU-BING ZHAO; LI-YING YAN; SHU-QING LI; AND YONG LI

    2004-01-01

    Objective To investgate the relation of methionine synthase (MS) gene variation with congenital heart disease (CHD) phenotype. Methods One hundred and ninety three CHD patients (94 males and 99 females) and their biological parents (nuclear families) in Liaoning Province were selected as the case group, and another 104 normal persons (60 males and 44 females) and their parents without family history of birth defects as the control group. For all subjects the polymorphism of MS gene A2756G locus was examined by PCR-RFLP method. Results In offspring of the control group the frequencies of MS genotype (+/-) and allele (+) were 10.7% and 5.3%, without existence of homozygote. The MS genotype distribution and allele frequencies of CHD patients and their mothers were not significantly different from the control (P > 0.05). The frequency of allele (+)in case fathers (5.0 %) was apparently lower than that in the control (9.1%, P=0.060), and the odds ratio (OR) was 0.53 (95% CI: 0.25-1.09). There was no difference in parents' genotype combination between the two groups, and in genotype distribution among different types of CHD. Analysis of genetic transmission indicated that mutation allele (+) existed transmission disequilibrium in CHD nuclear families. The percentage of allele (+) transmitted from parents was lower than that allele (-)with OR 0.26 (95% CI: 0.11-0.60). Conclusion MS gene variation in parents is associated with occurrence of CHD in offspring, and mutation allele (+) in parents may be related with the decrease of CHD risk in offspring.

  18. Thymidylate synthase gene amplification in human colon cancer cell lines resistant to 5-fluorouracil.

    Copur, S; Aiba, K; Drake, J C; Allegra, C J; Chu, E

    1995-05-17

    A series of 5-fluorouracil (5-FU)-resistant human colon H630 cancer cell lines were established by continuous exposure of cells to 5-FU. The concentration of 5-FU required to inhibit cell proliferation by 50% (IC50) in the parent colon line (H630) was 5.5 microM. The 5-FU IC50 values for the resistant H630-R1, H630-R10, and H630-R cell lines were 11-, 29-, and 27-fold higher than that for the parent H630 cell line. Using both the radioenzymatic 5-fluoro-2'-deoxyuridine-5'-monophosphate (FdUMP) binding and catalytic assays for measurement of thymidylate synthase (TS) enzyme activity, there was significantly increased TS activity in resistant H630-R1 (13- and 23-fold), H630-R10 (37- and 40-fold), and H630-R (24- and 34-fold) lines, for binding and catalytic assays, respectively, compared with the parent H630 line. The level of TS protein, as determined by western immunoblot analysis, was increased markedly in resistant H630-R1 (23-fold), H630-R10 (33-fold), and H630-R (26-fold) cells. Northern analysis revealed elevations in TS mRNA levels in H630-R1 (18-fold), H630-R10 (39-fold), and H630-R (36-fold) cells relative to parent H630 cells. Although no major rearrangements of the TS gene were noted by Southern analysis, there was significant amplification of the TS gene in 5-FU-resistant cells, which was confirmed by DNA slot blot analysis. These studies demonstrate that continuous exposure of human colon cancer cells to 5-FU leads to TS gene amplification and overexpression of TS protein with resultant development of fluoropyrimidine resistance. PMID:7763285

  19. Epidemiology and clinical relevanceof Pneumocystis jirovecii Frenkel, 1976 dihydropteroate synthase gene mutations*

    Matos O.

    2010-09-01

    Full Text Available A review was conducted to examine the published works that studied the prevalence of Pneumocystis jirovecii dihydropteroate synthase (DHPS mutations in patients with P. jirovecii pneumonia (PcP, in develop and developing countries, and that focused the problem of the possible association of these mutations with exposure to sulpha or sulphone drugs and their influence in the PcP outcome. Studies conducted in United States of America presented higher P. jirovecii mutations rates, in comparison with European countries, and in developing countries, lower rates of DHPS mutations were reported, due to limited use of sulpha drugs. A significant association was reported between the use of sulpha or sulphone agents for PcP prophylaxis in HIV-infected patients and the presence of DHPS mutations. However these mutations were also detected in PcP patients who were not currently receiving sulpha or sulphone agents. The outcome and mortality of HIV-infected patients with PcP harbouring DHPS gene mutations were related primarily to the underlying severity of illness and the initial severity of PcP, more than to the presence of mutations.

  20. Molecular characterization and expression analyses of an anthocyanin synthase gene from Magnolia sprengeri Pamp.

    Shi, Shou-Guo; Li, Shan-Ju; Kang, Yong-Xiang; Liu, Jian-Jun

    2015-01-01

    Anthocyanin synthase (ANS), which catalyzes the conversion of colorless leucoanthocyanins into colored anthocyanins, is a key enzyme in the anthocyanin biosynthetic pathway. It plays important roles in plant development and defense. An ANS gene designated as MsANS was cloned from Magnolia sprengeri using rapid amplification of complementary DNA (cDNA) ends technology. The full-length MsANS is 1171-bp long and contains a 1080-bp open reading frame encoding a 360 amino acid polypeptide. In a sequence alignment analysis, the deduced MsANS protein showed high identity to ANS proteins from other plants: Prunus salicina var. cordata (74 % identity), Ampelopsis grossedentata (74 % identity), Pyrus communis (73 % identity), and Prunus avium (73 % identity). A structural analysis showed that MsANS belongs to 2-oxoglutarate (2OG)- and ferrous iron-dependent oxygenase family because it contains three binding sites for 2OG. Real-time quantitative polymerase chain reaction analyses showed that the transcript level of MsANS was 26-fold higher in red petals than in white petals. The accumulation of anthocyanins in petals of white, pink, and red M. sprengeri flowers was analyzed by HPLC. The main anthocyanin was cyanidin-3-o-glucoside chloride, and the red petals contained the highest concentration of this pigment. PMID:25315387

  1. RNA Interference-mediated Silencing of Phytochelatin Synthase Gene Reduce Cadmium Accumulation in Rice Seeds

    2007-01-01

    Phytochelatins (PCs) play an important role in heavy metal resistance and accumulation. To reduce the accumulation of cadmium (Cd) in rice seeds, the expression of phytochelatin synthase (PCS) gene OsPCS1 was suppressed by RNA interference (RNAi). A hairpin construct of a PCS fragment was designed in the pRNAi-OsPCS1 under the control of ZMM1, a seed-specific promoter from maize. The construct was introduced into rice (japonica) through Agrobacterium tumefaciens. The RNAi rice plantlets were selected and cultivated in pots exposured to 10 mg/kg Cd. The transcriptional level of OsPCS1 declined in seeds of some RNAi rice compared to the wild type. As a result Cd accumulation was reduced by about half in the seeds of RNAi rice. As expected, no apparent difference of growth appeared between RNAi and wild-type plants. The results suggest that this new approach can be used to control heavy metal accumulation in crops.

  2. Borna disease virus P protein inhibits nitric oxide synthase gene expression in astrocytes

    Borna disease virus (BDV) is one of the potential infectious agents involved in the development of central nervous system (CNS) diseases. Neurons and astrocytes are the main targets of BDV infection, but little is known about the roles of BDV infection in the biological effects of astrocytes. Here we reported that BDV inhibits the activation of inducible nitric oxide synthase (iNOS) in murine astrocytes induced by bacterial LPS and PMA. To determine which protein of BDV is responsible for the regulation of iNOS expression, we co-transfected murine astrocytes with reporter plasmid iNOS-luciferase and plasmid expressing individual BDV proteins. Results from analyses of reporter activities revealed that only the phosphoprotein (P) of BDV had an inhibitory effect on the activation of iNOS. In addition, P protein inhibits nitric oxide production through regulating iNOS expression. We also reported that the nuclear factor kappa B (NF-κB) binding element, AP-1 recognition site, and interferon-stimulated response element (ISRE) on the iNOS promoter were involved in the repression of iNOS gene expression regulated by the P protein. Functional analysis indicated that sequences from amino acids 134 to 174 of the P protein are necessary for the regulation of iNOS. These data suggested that BDV may suppress signal transduction pathways, which resulted in the inhibition of iNOS activation in astrocytes

  3. The Phytoene synthase gene family of apple (Malus x domestica) and its role in controlling fruit carotenoid content

    Ampomah-Dwamena, C.; Driedonks, N.J.W.; Lewis, D; Shumskaya, M.; Chen, X Y; Wurtzel, E.T.; Espley, R.V.; Allan, A.C.

    2015-01-01

    Background Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genom...

  4. Nucleotide Variability in the 5-Enolpyruvylshikimate-3-Phosphate Synthase Gene from Eleusine indica (L.) Gaertn

    J.L. Chong; R. Wickneswari; Ismail, B. S.; S. Salmijah

    2008-01-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to pr...

  5. Molecular Cloning, Expression, and Characterization of the Genes Encoding the Two Essential Protein Components of Micrococcus luteus B-P 26 Hexaprenyl Diphosphate Synthase

    Shimizu, Naoto; Koyama, Tanetoshi; Ogura, Kyozo

    1998-01-01

    The structural genes encoding the two essential components A and B of hexaprenyl diphosphate synthase, which produce the precursor of the prenyl side chain of menaquinone-6, were cloned from Micrococcus luteus B-P 26.

  6. Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Xiudao Yu

    2013-10-01

    Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  7. Expression of an(E)-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Xiudao; Yu; Yongjun; Zhang; Youzhi; Ma; Zhaoshi; Xu; Genping; Wang; Lanqin; Xia

    2013-01-01

    Aphids are major agricultural pests that cause significant yield losses in crop plants each year.(E)-β-farnesene(EβF) is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint(Mentha × piperita), two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint(Mentha asiatica). Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d-1g-1of fresh tissue. Tritrophic interactions involving peach aphids(Myzus persicae), and predatory lacewing(Chrysopa septempunctata) larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  8. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  9. Molecular cloning and characterization of three isoprenyl diphosphate synthase genes from alfalfa.

    Sun, Yan; Long, Ruicai; Kang, Junmei; Zhang, Tiejun; Zhang, Ze; Zhou, He; Yang, Qingchuan

    2013-02-01

    Isoprenoid is the precursor for the biosynthesis of saponins, abscisic acid, gibberellins, chlorophylls and many other products in plants. Saponins are an important group of bioactive plant natural products. The alfalfa (Medicago sativa L.) saponins are glycosides of different triterpene aglycones and possess many biological activities. We isolated three genes (MsFPPS, MsGPPS and MsGGPPS) encoding isoprenyl diphosphate synthases (IDS) from alfalfa via a homology-based PCR approach. The enzyme activity assay of purified recombined MsFPPS and MsGGPPS expressed in Escherichia coli indicated that they all had IDS activity. Expression analysis of the three genes in different alfalfa tissues using real time PCR displayed that they were expressed in all tissues although they had a different expression patterns. MsFPPS and MsGPS displayed a significant increase in transcript level in response to methyl jasmonate, but the transcript level of MsGGPPS decreased obviously. To elucidate the functions of the three IDSs, their overexpression driven by a constitutive cauliflower mosaic virus-35S promoter in tobacco plants was applied and analyzed. The T(0) transgenic plants of MsFPPS showed high levels of squalene content when compared with control. However, no differences were detected in T(0) transgenic plants of MsGPPS and MsGGPPS. In addition, the overexpression of MsFPPS induced senescence response in transgenic plant leaves. This result may indicate that MsFPPS performs a role not only in phytosterol and triterpene biosynthesis, but also in growth regulation. PMID:23238915

  10. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Emilia Wilmowicz

    2016-03-01

    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  11. Sequence of the bchG gene from Chloroflexus aurantiacus: relationship between chlorophyll synthase and other polyprenyltransferases

    Lopez, J. C.; Ryan, S.; Blankenship, R. E.

    1996-01-01

    The sequence of the Chloroflexus aurantiacus open reading frame thought to be the C. aurantiacus homolog of the Rhodobacter capsulatus bchG gene is reported. The BchG gene product catalyzes esterification of bacteriochlorophyllide a by geranylgeraniol-PPi during bacteriochlorophyll a biosynthesis. Homologs from Arabidopsis thaliana, Synechocystis sp. strain PCC6803, and C. aurantiacus were identified in database searches. Profile analysis identified three related polyprenyltransferase enzymes which attach an aliphatic alcohol PPi to an aromatic substrate. This suggests a broader relationship between chlorophyll synthases and other polyprenyltransferases.

  12. Multiple resistance to sulfonylureas and imidazolinones conferred by an acetohydroxyacid synthase gene with separate mutations for selective resistance.

    Hattori, J; Rutledge, R; Labbé, H; Brown, D; Sunohara, G; Miki, B

    1992-03-01

    The acetohydroxyacid synthase (AHAS) gene from the Arabidopsis thaliana mutant line GH90 carrying the imidazolinone resistance allele imr1 was cloned. Expression of the AHAS gene under the control of the CaMV 35S promoter in transgenic tobacco resulted in selective imidazolinone resistance, confirming that the single base-pair change found near the 3' end of the coding region of this gene is responsible for imidazolinone resistance. A chimeric AHAS gene containing both the imr1 mutation and the csr1 mutation, responsible for selective resistance to sulfonylurea herbicides, was constructed. It conferred on transgenic tobacco plants resistance to both sulfonylurea and imidazolinone herbicides. The data illustrate that a multiple-resistance phenotype can be achieved in an AHAS gene through combinations of separate mutations, each of which individually confers resistance to only one class of herbicides. PMID:1557022

  13. Glucose-6-Phosphate Dehydrogenase Deficiency Improves Insulin Resistance With Reduced Adipose Tissue Inflammation in Obesity.

    Ham, Mira; Choe, Sung Sik; Shin, Kyung Cheul; Choi, Goun; Kim, Ji-Won; Noh, Jung-Ran; Kim, Yong-Hoon; Ryu, Je-Won; Yoon, Kun-Ho; Lee, Chul-Ho; Kim, Jae Bum

    2016-09-01

    Glucose-6-phosphate dehydrogenase (G6PD), a rate-limiting enzyme of the pentose phosphate pathway, plays important roles in redox regulation and de novo lipogenesis. It was recently demonstrated that aberrant upregulation of G6PD in obese adipose tissue mediates insulin resistance as a result of imbalanced energy metabolism and oxidative stress. It remains elusive, however, whether inhibition of G6PD in vivo may relieve obesity-induced insulin resistance. In this study we showed that a hematopoietic G6PD defect alleviates insulin resistance in obesity, accompanied by reduced adipose tissue inflammation. Compared with wild-type littermates, G6PD-deficient mutant (G6PD(mut)) mice were glucose tolerant upon high-fat-diet (HFD) feeding. Intriguingly, the expression of NADPH oxidase genes to produce reactive oxygen species was alleviated, whereas that of antioxidant genes was enhanced in the adipose tissue of HFD-fed G6PD(mut) mice. In diet-induced obesity (DIO), the adipose tissue of G6PD(mut) mice decreased the expression of inflammatory cytokines, accompanied by downregulated proinflammatory macrophages. Accordingly, macrophages from G6PD(mut) mice greatly suppressed lipopolysaccharide-induced proinflammatory signaling cascades, leading to enhanced insulin sensitivity in adipocytes and hepatocytes. Furthermore, adoptive transfer of G6PD(mut) bone marrow to wild-type mice attenuated adipose tissue inflammation and improved glucose tolerance in DIO. Collectively, these data suggest that inhibition of macrophage G6PD would ameliorate insulin resistance in obesity through suppression of proinflammatory responses. PMID:27284106

  14. Five novel glucose-6-phosphate dehydrogenase deficiency haplotypes correlating with disease severity

    Dallol Ashraf

    2012-09-01

    Full Text Available Abstract Background Glucose-6-phosphate dehydrogenase (G6PD, EC 1.1.1.49 deficiency is caused by one or more mutations in the G6PD gene on chromosome X. An association between enzyme levels and gene haplotypes remains to be established. Methods In this study, we determined G6PD enzyme levels and sequenced the coding region, including the intron-exon boundaries, in a group of individuals (163 males and 86 females who were referred to the clinic with suspected G6PD deficiency. The sequence data were analysed by physical linkage analysis and PHASE haplotype reconstruction. Results All previously reported G6PD missense changes, including the AURES, MEDITERRANEAN, A-, SIBARI, VIANGCHAN and ANANT, were identified in our cohort. The AURES mutation (p.Ile48Thr was the most common variant in the cohort (30% in males patients followed by the Mediterranean variant (p.Ser188Phe detectable in 17.79% in male patients. Variant forms of the A- mutation (p.Val68Met, p.Asn126Asp or a combination of both were detectable in 15.33% of the male patients. However, unique to this study, several of such mutations co-existed in the same patient as shown by physical linkage in males or PHASE haplotype reconstruction in females. Based on 6 non-synonymous variants of G6PD, 13 different haplotypes (13 in males, 8 in females were identified. Five of these were previously unreported (Jeddah A, B, C, D and E and were defined by previously unreported combinations of extant mutations where patients harbouring these haplotypes exhibited severe G6PD deficiency. Conclusions Our findings will help design a focused population screening approach and provide better management for G6PD deficiency patients.

  15. Transcripts for genes encoding soluble acid invertase and sucrose synthase accumulate in root tip and cortical cells containing mycorrhizal arbuscules.

    Blee, Kristopher A; Anderson, Anne J

    2002-09-01

    Arbuscule formation by the arbuscular mycorrhizal fungus Glomus intraradices (Schenck & Smith) was limited to cortical cells immediately adjacent to the endodermis. Because these cortical cells are the first to intercept photosynthate exiting the vascular cylinder, transcript levels for sucrose metabolizing-enzymes were compared between mycorrhizal and non-mycorrhizal roots. The probes corresponded to genes encoding a soluble acid invertase with potential vacuolar targeting, which we generated from Phaseolus vulgaris roots, a Rhizobium-responsive sucrose synthase of soybean and a cell wall acid invertase of carrot. Transcripts in non-mycorrhizal roots were developmentally regulated and abundant in the root tips for all three probes but in differentiated roots of P. vulgaris they were predominantly located in phloem tissues for sucrose synthase or the endodermis and phloem for soluble acid invertase. In mycorrhizal roots increased accumulations of transcripts for sucrose synthase and vacuolar invertase were both observed in the same cortical cells bearing arbuscules that fluoresce. There was no effect on the expression of the cell wall invertase gene in fluorescent carrot cells containing arbuscules. Thus, it appears that presence of the fungal hyphae in the fluorescent arbusculated cell stimulates discrete alterations in expression of sucrose metabolizing enzymes to increase the sink potential of the cell. PMID:12175013

  16. Isolation of developing secondary xylem specific cellulose synthase genes and their expression profiles during hormone signalling in Eucalyptus tereticornis

    Balachandran Karpaga Raja Sundari; Modhumita Ghosh Dasgupta

    2014-08-01

    Cellulose synthases (CesA) represent a group of -1, 4 glycosyl transferases involved in cellulose biosynthesis. Recent reports in higher plants have revealed that two groups of CesA gene families exist, which are associated with either primary or secondary cell wall deposition. The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from Eucalyptus tereticornis, a species predominantly used in paper and pulp industries in the tropics. The differential expression analysis of the three EtCesA genes using qRT-PCR revealed 49 to 87 fold relative expression in developing secondary xylem tissues. Three full length gene sequences of EtCesA1, EtCesA2 and EtCesA3 were isolated with the size of 2940, 3114 and 3123 bp, respectively. Phytohormone regulation of all three EtCesA genes were studied by exogenous application of gibberellic acid, naphthalene acetic acid, indole acetic acid and 2, 4-epibrassinolide in internode tissues derived from three-month-old rooted cuttings. All three EtCesA transcripts were upregulated by indole acetic acid and gibberellic acid. This study demonstrates that the increased cellulose deposition in the secondary wood induced by hormones can be attributed to the upregulation of xylem specific CesAs.

  17. Polymorphisms in the endothelial nitric oxide synthase gene in thalidomide embryopathy.

    Vianna, Fernanda Sales Luiz; Fraga, Lucas Rosa; Tovo-Rodrigues, Luciana; Tagliani-Ribeiro, Alice; Biondi, Flavia; Maximino, Claudia Marques; Sanseverino, Maria Teresa Vieira; Hutz, Mara Helena; Schuler-Faccini, Lavínia

    2013-11-30

    Thalidomide is one of the most potent teratogens known to humans. It is currently used for many clinical situations such as treatment of leprosy reactions and multiple myeloma. However, the teratogenic mechanisms by which it produces morphological defects still remain unclear. One of the hypotheses is the blockage of angiogenesis by reduction of nitric oxide (NO). In this study, we evaluated two functional polymorphisms of the endothelial nitric oxide synthase (eNOS) gene which is a constitutively expressed enzyme responsible for production of NO. The promoter -786T>C exon 7 (896G>T) polymorphisms were genotyped using real-time PCR for 28 individuals with thalidomide embryopathy (TE), 27 first-degree relatives of these individuals, and 68 individuals from the general population. Their allele, genotypic, and haplotypic frequencies were compared. A significant difference was observed in the -786T>C polymorphism genotypes (p=0.03) between the groups affected by TE and those unaffected (non-relatives). The TT genotype of the 896G>T polymorphism was observed in 10.7% of those affected and 2.9% of those unaffected, but the difference was not statistically significant (p=0.09). The haplotypic analysis indicated that the wild haplotype -786T/896G was distributed differently in the affected and unaffected groups (p=0.004). These results indicate that the individuals with TE have a higher frequency of alleles associated with lower expression of eNOS, indicating that this may be a genotype susceptible to TE. PMID:24055736

  18. Pneumocystis jiroveci dihydropteroate synthase gene mutations among colonized individuals and Pneumocystis pneumonia patients from Spain.

    Friaza, Vicente; Morilla, Rubén; Respaldiza, Nieves; de la Horra, Carmen; Calderón, Enrique J

    2010-11-01

    Cotrimoxazole, an association of trimethoprim and sulfamethoxazole, and dapsone, are mainstays for the prophylaxis and treatment of Pneumocystis pneumonia (PcP). The inability to culture Pneumocystis prevents routine susceptibility testing and detection of drug resistance. Instead, molecular techniques have been used to detect Pneumocystis jiroveci dihydropteroate synthase (DHPS) mutations that cause sulfa resistance in other microorganisms. The most frequent DHPS mutations occur at nucleotide positions 165 and 171, which lead to an amino acid change at positions 55 and 57. Several studies suggest that these mutations are associated with the failure of chemoprophylaxis for PcP. The aim was to establish the frequency and characteristics of P jiroveci DHPS mutations among colonized individuals and PcP patients from Spain. A total of 50 colonized individuals and 25 PcP patients were studied. DHPS polymorphisms were identified by restriction fragment length polymorphism assay. The analysis provided a rate of 28% of DHPS gene mutations in our population, with the presence of all possible polymorphisms described. The presence of mutations was higher in PcP patients than in colonized subjects (40% vs 22%), probably because of the chemoprophylaxis used in PcP patients. The comparison between patients with and without DHPS mutations did not show statistical differences due to age, sex, steroid use, sulfa drug exposure, or smoking. A high rate of DHPS mutations in our area of Spain, not only confined to patients previously exposed to sulfa drugs, is shown in this study. As well as PcP patients, colonized individuals who harbor P jiroveci strains with DHPS mutations could play a major role in the transmission cycle of these mutations, representing a reservoir and source of infection for susceptible individuals. Further research is thus warranted to assess the true scope of the problem and to design rational preventive strategies. PMID:21084778

  19. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases

  20. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: nishizaw@sk.ritsumei.ac.jp [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  1. Non-thermal effect of a ceramics radiation on a yeast glucose-6-phosphate dehydrogenase

    Non-thermal effect of a ceramics radiation on glucose-6-phosphate dehydrogenase has been investigated using the enzyme, glucose-6-phosphate and NADP+ separately irradiated at 10 degrees C by a ceracompo R plate and a ceramics un-sewed cloth (sheet). The Km for glucose-6-phosphate was increased 20% after 6 h of irradiation by the plate, but the Vmax/Km was decreased 24. After 3 h of irradiation by the sheet, the Km was increased 17%, but after 6 h of irradiation it was decreased 11%. The 3 h of irradiation by the sheet slightly increased both enthalpy and entropy changes of the reaction, but the 6 h of irradiation significantly decreased them. Both thermodynamic parameters in the activated state were increased by the sheet irradiation. The promotion energy for both formations of the enzyme-substrate and their activated complex depended on enthalpy. The different effects of two ceramics radiators on G6PDH activity were discussed

  2. Fluorometric determination of free glucose and glucose 6-phosphate in cows' milk and other opaque matrices

    Larsen, Torben

    2015-01-01

    fluorometric detection. Standards and control materials were based on milk that was stripped of intrinsic glucose and glucose 6-phosphate in order to obtain standards and samples based on the same matrix. The analysis works without pre-treatment of the samples, e.g. without centrifugation and precipitation of......Analyses of free glucose and glucose 6-phosphate in milk have until now been dependent upon several time consuming and troublesome procedures. This has limited investigations in the area. The present article presents a new, reliable, analytical procedure, based on enzymatic degradation and...

  3. Heterologous expression and product identification of Colletotrichum lagenarium polyketide synthase encoded by the PKS1 gene involved in melanin biosynthesis.

    Fujii, I; Mori, Y; Watanabe, A; Kubo, Y; Tsuji, G; Ebizuka, Y

    1999-08-01

    The Colletotrichum lagenarium PKS1 gene was expressed in the heterologous fungal host, Aspergillus oryzae, under the starch-inducible alpha-amylase promoter to identify the direct product of polyketide synthase (PKS) encoded by the PKS1 gene. The main compound produced by an A. oryzae transformant was isolated and characterized to be 1,3,6,8-tetrahydroxynaphthalene (T4HN) as its tetraacetate. Since the PKS1 gene was cloned from C. lagenarium to complement the nonmelanizing albino mutant, T4HN was assumed to be an initial biosynthetic intermediate, and thus the product of the PKS reaction, but had not been isolated from the fungus. The production of T4HN by the PKS1 transformant unambiguously identified the gene to encode a PKS of pentaketide T4HN. In addition, tetraketide orsellinic acid and pentaketide isocoumarin were isolated, the latter being derived from a pentaketide monocyclic carboxylic acid, as by-products of the PKS1 PKS reaction. Production of the pentaketide carboxylic acid provided insights into the mechanism for the PKS1 polyketide synthase reaction to form T4HN. PMID:10501004

  4. pks63787, a Polyketide Synthase Gene Responsible for the Biosynthesis of Benzenoids in the Medicinal Mushroom Antrodia cinnamomea.

    Yu, Po-Wei; Chang, Ya-Chih; Liou, Ruey-Fen; Lee, Tzong-Huei; Tzean, Shean-Shong

    2016-06-24

    Antrodia cinnamomea, a unique resupinate basidiomycete endemic to Taiwan, has potent medicinal activities. The reddish basidiocarps and mycelia generally exhibit abundant metabolites and higher biological activity. To investigate the pigments of A. cinnamomea, polyketide synthase (PKS) genes were characterized based on its partially deciphered genome and the construction of a fosmid library. Furthermore, a gene disruption platform was established via protoplast transformation and homologous recombination. Of four putative polyketide synthase genes, pks63787 was selected and disrupted in the monokaryotic wild-type (wt) strain f101. Transformant Δpks63787 was deficient in the synthesis of several aromatic metabolites, including five benzenoids and two benzoquinone derivatives. Based on these results, a biosynthetic pathway for benzenoid derivatives was proposed. The pks63787 deletion mutant not only displayed a reduced red phenotype compared to the wt strain but also displayed less 1,1-biphenyl-2-picrylhydrazyl free radical scavenging activity. This finding suggests that PKS63787 is responsible for the biosynthesis of pigments and metabolites related to the antioxidant activity of A. cinnamomea. The present study focuses on the functional characterization of the PKS gene, the fluctuations of its profile of secondary metabolites, and interpretation of the biosynthesis of benzenoids. PMID:27227778

  5. The Prevalence of Mediterranean Mutation of Glucose-6-Phosphate Dehydrogenase (G6PD in Zahedan

    Alireza Nakhaee

    2012-03-01

    Full Text Available Background: glucose-6-phosphate dehydrogenase (G6PD deficiency is the most common genetic defects in the world, so that more than 400 million people in worldwide are affected with it, but its prevalence varies from 1-65% in different populations. Clinical manifestation of this defect is acute hemolytic anemia, neonatal hyperbilirubinemia and chronic nonspherocytic haemolytic anaemia. So far, almost 140 mutations have been identified in the gene of G6PD enzyme. Mediterranean is the most common mutation. The purpose of this study is to determine the prevalence of G6PD Mediterranean mutation in the deficient people in the city of Zahedan.Materials and Methods: In this descriptive cross-sectional study, blood samples of 1440 male individuals, who were referred to Zahedan Reference Laboratory for premarital testing, were examined for G6PD deficiency using fluorescent spot test. Genomic DNA from blood of people with G6PD deficiency was extracted by DNA extraction kit. Mediterranean mutation was identified using PCR-RFLP method.Results: 101 out of 1440 subjects had G6PD deficiency. Therefore prevalence of G6PD deficiency in Zahedan city was estimated about 7%. Mediterranean mutation frequency in patients with defect of G6PD was estimated 84.2% (85 out of 101 patients and 15.8% (16 out of 101 patients did not have mutation Mediterranean. The frequency of G6PD deficiency was expressed as a percentage of total cases and Mediterranean mutation prevalence was expressed as a percentage of total impaired individuals.Conclusion: The result of this study showed that the frequency of G6PD deficiency in Zahedan city is lower than other cities of sistan and baluchestan province. Dominant mutation in present study was Mediterranean type and its frequency was very similar with prevalence of this mutation in other parts of Iran.

  6. Control of Enzyme IIscr and Sucrose-6-Phosphate Hydrolase Activities in Streptococcus mutans by Transcriptional Repressor ScrR Binding to the cis-Active Determinants of the scr Regulon

    Wang, Bing; Kuramitsu, Howard K.

    2003-01-01

    In Streptococcus mutans, enzyme IIscr and sucrose-6-phosphate hydrolase are two important enzymes in the transport and metabolism of dietary sucrose. The scr regulon of S. mutans is composed of three genes, scrA and scrB, which code for enzyme IIscr and sucrose-6-phosphate hydrolase, respectively, and scrR, which codes for a GalR-LacI-type transcription regulator. It was previously shown that expression of both scrA and scrB is similarly induced by sucrose. Mutation in the scrR gene resulted ...

  7. Polyketide genes in the marine sponge Plakortis simplex: a new group of mono-modular type I polyketide synthases from sponge symbionts

    Della Sala, Gerardo; Hochmuth, Thomas; Costantino, Valeria; Teta, Roberta; Gerwick, William; Gerwick, Lena; Piel, Jörn; Mangoni, Alfonso

    2013-01-01

    Summary Sponge symbionts are a largely unexplored source of new and unusual metabolic pathways. Insights into the distribution and function of metabolic genes of sponge symbionts are crucial to dissect and exploit their biotechnological potential. Screening of the metagenome of the marine sponge Plakortis simplex led to the discovery of the swf family, a new group of mono-modular type I polyketide synthase/fatty acid synthase (PKS/FAS) specifically associated with sponge symbionts. Two differ...

  8. Ethylene Production and 1-Aminocyclopropane-1-Carboxylate (ACC) Synthase Gene Expression in Tomato(Lycopsicon esculentum Mill.) Leaves Under Enhanced UV-B Radiation

    Lizhe An; Xunling Wang; Xiaofeng Xu; Hongguan Tang; Manxiao Zhang; Zongdong Hou; Yanhong Liu; Zhiguang Zhao; Huyuan Feng; Shijian Xu

    2006-01-01

    Tomato (Lycopsicon esculentum Mill.) plants grown in a greenhouse were irradiated with two different levels of UV-B, namely 8.82 (T1) and 12.6 kJ/m2 per day (T2). Ethylene production, 1-aminocyclopropane-1carboxylate (ACC) content, 1-(malonylamino) cyclopvopane-1-carboxylic acid (MACC) content, gene expression of ACC synthase (EC 4.4.1.14), and ACC oxidase activity in tomato leaves were determined. The results indicated that ACC content, the activity of ACC synthase and ACC oxidase, and ethylene production increased continuously under low doses of UV-B radiation, whereas at high doses of radiation these parameters increased during the first 12 d and then started to decrease. The MACC content increased continuously over 18 d under both doses of UV-B irradiation. The changes in ACC content, ACC synthase activity,ACC oxidase activity, the transcriptional level of the ACC synthase gene, and ethylene production were consistent with each other, suggesting that ACC synthase was the key enzyme in ethylene biosynthesis and that ethylene production in tomato leaf tissues under UV-B radiation could be regulated by the expression of the ACC synthase gene. The results also indicate that the change in ethylene metabolism may be an adaptive mechanism to enhanced UV-B radiation.

  9. Association of Polymorphism of Neuronal Nitric Oxide Synthase Gene with Risk to Parkinson's Disease.

    Gupta, Satya Prakash; Kamal, Ritul; Mishra, Sarad Kumar; Singh, Maneesh Kumar; Shukla, Rakesh; Singh, Mahendra Pratap

    2016-07-01

    Environmental factors are implicated in aging as well as genetic predisposition-induced Parkinson's disease (PD) pathogenesis. Wrongdoers increase oxidative stress and nitrosative burden, which eventually degenerate the nigrostriatal dopaminergic neurons. Inhibition of the expression of nitric oxide synthase (NOS), an enzyme responsible for nitric oxide (NO) biosynthesis, prevents the demise of the nigrostriatal dopaminergic neurons. Polymorphism of NOS is thus expected to alter PD susceptibility. The study therefore aimed to examine an association of neuronal NOS (nNOS) gene polymorphism with nitrite, an indicator of nitrosative load; lipid peroxidation, an index of oxidative stress and PD susceptibility. An age-matched case-control study was performed in the north Indian residents enrolled at the Neurology Department of the King George's Medical University, Lucknow, India. While nNOS exon 29 TT variant genotype [odds ratio (OR) = 2.20, 95 % CI = 1.08-5.34, P = 0.040], combined TT and CT variants [OR = 1.68, 95 % CI = 1.05-2.69, P = 0.031] and T allele [OR = 1.58, 95 % CI = 1.10-2.28, P = 0.014] were found to be significantly associated with PD susceptibility, no association between nNOS exon 18 [OR for TT carriers = 1.97, 95 % CI = 0.89-4.20, P = 0.09 and OR for T allele = 1.35, 95 % CI = 0.94-1.93, P = 0.098] and PD risk was observed. Lipid peroxidation was augmented in all patients irrespective of their genotype. While genotype independent increase in nitrite content was observed in PD patients of exon 29 polymorphic groups, only heterozygous variant genotype of exon 18 was associated with augmentation in nitrite level as compared with respective control. The results obtained thus demonstrate that selected nNOS polymorphisms do not significantly contribute to PD risk in north Indian population. PMID:26081147

  10. Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

    Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

  11. Relationships between endothelial nitric oxide synthase gene polymorphisms and osteoporosis in postmenopausal women

    Shun-zhi LIU; Hong YAN; Wei-kun HOU; Peng XU; Juan TUN; Li-fang TIAN; Bo-feng ZHU; Jie MA; She-min LU

    2009-01-01

    Objective: To investigate the relationships between endothelial nitric oxide synthases (eNOS) G894T and 27 bp-variable number tandem repeat (VNTR) gene polymorphisms and osteoporosis in the postmenopausal women of Chinese Han nationality. Methods: In the present study, 281 postmenopausal women from Xi'an urban area in West China were recruited, and divided into osteoporosis, osteopenia, and normal groups according to the diagnostic criteria of osteoporosis proposed by World Health Organization (WHO). The bone mineral density (BMD) values of lumbar vertebrae and left hips were determined by QDR-2000 dual energy X-ray absorptiometry. Blood samples were tested for plasma biochemical indicators including testosterone, estradiol, calcitonin, osteocalcin, and procollagen type I amino-terminal propeptide by enzyme-linked immunosorbent assay (ELISA), tartrate-resistant acid phosphatase by spectrophotometric method, and the content of nitric oxide by Griess method. Genome DNA was extracted from whole blood, and G894T polymorphism of eNOS gene was analyzed by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method and 27 bp-VNTR polymorphism of eNOS gene was genotyped by PCR method. Then the relationships between genotypes and biochemical indicators, genotypes and osteoporosis, and haplotypes and osteoporosis were analyzed. Results: The average BMD values of the femoral neck, ward's triangle and lumbar vertebrae 1~4 (L1~L4) in the subjects with T/T genotype in eNOS G894T locus were significantly higher than those in the subjects with G/T and G/G genotypes (P<0.05). The average BMD of the femoral neck in the subjects with a/a genotype of eNOS 27 bp-VNTR locus was evidently higher than that in the subjects with b/b genotype (P<0.05). The plasma testosterone and osteocalcin concentrations in the subjects of eNOS G894T G/T genotype were evidently higher than those in the subjects of other genotypes (P<0.05); the plasma estradiol

  12. Correlation of viral RNA biosynthesis with glucose-6-phosphate dehydrogenase activity and host resistance

    Šindelář, Luděk; Šindelářová, Milada

    2002-01-01

    Roč. 215, - (2002), s. 862-869. ISSN 0032-0935 R&D Projects: GA ČR GA522/99/1264 Institutional research plan: CEZ:AV0Z5038910 Keywords : Glucose 6 phosphate dehydrogenase * Nicotiana (viral infection) * Plant viruses Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.960, year: 2002

  13. Agrobacterium mediated transfer of a mutant Arabidopsis acetolactate synthase gene confers resistance to chlorsulfuron in chicory (Cichorium intybus L.).

    Vermeulen, A; Vaucheret, H; Pautot, V; Chupeau, Y

    1992-06-01

    Leaf discs of C. intybus were inoculated with an Agrobacterium tumefaciens strain harboring a neomycin phosphotransferase (neo) gene for kanamycin resistance and a mutant acetolactate synthase gene (csr1-1) from Arabidopsis thaliana conferring resistance to sulfonylurea herbicides. A regeneration medium was optimized which permitted an efficient shoot regeneration from leaf discs. Transgenic shoots were selected on rooting medium containing 100 mg/l kanamycin sulfate. Integration of the csr1-1 gene into genomic DNA of kanamycin resistant chicory plants was confirmed by Southern blot hybridizations. Analysis of the selfed progenies (S1 and S2) of two independent transformed clones showed that kanamycin and chlorsulfuron resistances were inherited as dominant Mendelian traits. The method described here for producing transformed plants will allow new opportunities for chicory breeding. PMID:24203132

  14. Cryopreservation of glucose-6-phosphate dehydrogenase activity inside red blood cells: developing a specimen repository in support of development and evaluation of glucose-6-phosphate dehydrogenase deficiency tests

    Kahn, Maria; LaRue, Nicole; Bansil, Pooja; Kalnoky, Michael; McGray, Sarah; Domingo, Gonzalo J

    2013-01-01

    Background Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common human enzyme deficiency. It is characterized by abnormally low levels of G6PD activity. Individuals with G6PD deficiency are at risk of undergoing acute haemolysis when exposed to 8‒aminoquinoline-based drugs, such as primaquine. For this reason it is imperative to identify individuals with G6PD deficiency prior to administering these anti-malarial drugs. There is a need for the development and evaluation of point-of-c...

  15. Glucose-6-phosphate-dehydrogenase deficiency and its correlation with other risk factors in jaundiced newborns in Southern Brazil

    Clarissa Gutirrez Carvalho; Simone Martins Castro; Ana Paula Santin; Carina Zaleski; Felipe Gutirrez Carvalho; Roberto Giugliani

    2011-01-01

    Objective:To evaluate the correlation between glucose-6-phosphate-dehydrogenase (G6PD) deficiency and neonatal jaundice.Methods: Prospective, observational case-control study was conducted on490 newborns admitted to Hospital de Clínicas de Porto Alegre for phototherapy, who all experienced35 or more weeks of gestation, from March to December2007. Enzymatic screening ofG6PD activity was performed, followed byPCR.Results:There was prevalence of4.6% and a boy-girl ratio of3:1 in jaundiced newborns. No jaundiced neonate withABO incompatibility presented G6PD deficiency, and no Mediterranean mutation was found. A higher proportion of deficiency was observed in Afro-descendants. There was no association withUGT1A1 variants. Conclusions:G6PD deficiency is not related to severe hyperbilirubinemia and considering the high miscegenation in this area of Brazil, other gene interactions should be investigated.

  16. The level of glucose-6-phosphate dehydrogenase activity strongly influences xylose fermentation and inhibitor sensitivity in recombinant Saccharomyces cerevisiae strains

    Jeppsson, M.; Johansson, B.; Jensen, Peter Ruhdal;

    2003-01-01

    Disruption of the ZWF1 gene encoding glucose-6-phosphate dehydrogenase (G6PDH) has been shown to reduce the xylitol yield and the xylose consumption in the xylose-utilizing recombinant Saccharomyces cerevisiae strain TMB3255. In the present investigation we have studied the influence of different...... consumption, respectively, compared with the ZWF1-disrupted strain. Both strains exhibited decreased xylitol yields (0.13 and 0.19 g/g xylose) and enhanced ethanol yields (0.36 and 0.34 g/g xylose) compared with the control strain TMB3001 (0.29 g xylitol/g xylose, 0.31 g ethanol/g xylose). Cytoplasmic...... transhydrogenase (TH) from Azotobacter vinelandii has previously been shown to transfer NADPH and NAD(+) into NADP(+) and NADH, and TH-overproduction resulted in lower xylitol yield and enhanced glycerol yield during xylose utilization. Strains with low G6PDH-activity grew slower in a lignocellulose hydrolysate...

  17. Cloning and Expression of Poly(hydroxyalkanoate) Synthase Genes from Photosynthetic bacterium Allochromatium vinosum ATCC 35206

    Poly(hydroxyalkanoate) (PHA) synthases catalyze the polymerization of beta-hydroxy fatty acids to form PHA biopolyesters. These enzymes are grouped into four classes (classes I to IV) based on their subunit composition and substrate specificity. Since PHA biopolymers are naturally synthesized by b...

  18. COMPLEMENTATION OF THE AMYLOSE-FREE STARCH MUTANT OF POTATO (SOLANUM-TUBEROSUM) BY THE GENE ENCODING GRANULE-BOUND STARCH SYNTHASE

    VANDERLEIJ, FR; VISSER, RGF; OOSTERHAVEN, K; VANDERKOP, DAM; JACOBSEN, E; FEENSTRA, WJ

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  19. Genetic Diversity of Polyketide Synthase/Nonribosomal Peptide Synthetase Genes in Isolates of the Barley Net Blotch Fungus Pyrenophora teres f. teres

    Polyketide synthases (PKSs) and nonribosomal peptide synthetases (NRPSs) are multifunctional enzymes responsible for biosynthesis of diverse small molecules (e.g., mycotoxins and phytotoxins) in filamentous ascomycetes. Both PKS and NRPS genes are present in fungal genomes as large gene families but...

  20. N-acetylglucosamine 6-phosphate deacetylase (nagA is required for N-acetyl glucosamine assimilation in Gluconacetobacter xylinus.

    Vikas Yadav

    Full Text Available Metabolic pathways for amino sugars (N-acetylglucosamine; GlcNAc and glucosamine; Gln are essential and remain largely conserved in all three kingdoms of life, i.e., microbes, plants and animals. Upon uptake, in the cytoplasm these amino sugars undergo phosphorylation by phosphokinases and subsequently deacetylation by the enzyme N-acetylglucosamine 6-phosphate deacetylase (nagA to yield glucosamine-6-phosphate and acetate, the first committed step for both GlcNAc assimilation and amino-sugar-nucleotides biosynthesis. Here we report the cloning of a DNA fragment encoding a partial nagA gene and its implications with regard to amino sugar metabolism in the cellulose producing bacterium Glucoacetobacter xylinus (formally known as Acetobacter xylinum. For this purpose, nagA was disrupted by inserting tetracycline resistant gene (nagA::tet(r; named as ΔnagA via homologous recombination. When compared to glucose fed conditions, the UDP-GlcNAc synthesis and bacterial growth (due to lack of GlcNAc utilization was completely inhibited in nagA mutants. Interestingly, that inhibition occured without compromising cellulose production efficiency and its molecular composition under GlcNAc fed conditions. We conclude that nagA plays an essential role for GlcNAc assimilation by G. xylinus thus is required for the growth and survival for the bacterium in presence of GlcNAc as carbon source. Additionally, G. xylinus appears to possess the same molecular machinery for UDP-GlcNAc biosynthesis from GlcNAc precursors as other related bacterial species.

  1. Characterization of the Saccharomyces cerevisiae ARG7 gene encoding ornithine acetyltransferase, an enzyme also endowed with acetylglutamate synthase activity.

    Crabeel, M; Abadjieva, A; Hilven, P; Desimpelaere, J; Soetens, O

    1997-12-01

    We have cloned by functional complementation and characterized the yeast ARG7 gene encoding mitochondrial ornithine acetyltransferase, the enzyme catalyzing the fifth step in arginine biosynthesis. While forming ornithine, this enzyme regenerates acetylglutamate, also produced in the first step by the ARG2-encoded acetylglutamate synthase. Interestingly, total deletion of the genomic ARG7 ORF resulted in an arginine-leaky phenotype, indicating that yeast cells possess an alternative route for generating ornithine from acetylornithine. Yeast ornithine acetyltransferase has been purified and characterized previously as a heterodimer of two subunits proposed to derive from a single precursor protein [Liu, Y-S., Van Heeswijck R., Hoj, P. & Hoogenraad, N. (1995) Eur. J. Biochem. 228, 291-296]; those authors further suggested that the internal processing of Arg7p, which is a mitochondrial enzyme, might occur in the matrix, while the leader peptide would be of the non-cleavable-type. The characterization of the gene (a) establishes that Arg7p is indeed encoded by a single gene, (b) demonstrates the existence of a cleaved mitochondrial prepeptide of eight residues, and (c) shows that the predicted internal processing site is unlike the mitochondrial proteolytic peptidase target sequence. Yeast Arg7p shares between 32-43% identity in pairwise comparisons with the ten analogous bacterial ArgJ enzymes characterized. Among these evolutionarily related enzymes, some but not all appear bifunctional, being able to produce acetylglutamate not only from acetylornithine but also from acetyl-CoA, thus catalyzing the same reaction as the apparently unrelated acetylglutamate synthase. We have addressed the question of the bifunctionality of the eucaryotic enzyme, showing that overexpressed ARG7 can complement yeast arg2 and Escherichia coli argA mutations (affecting acetylglutamate synthase). Furthermore, Arg7p-linked acetylglutamate synthase activity was measurable in an assay. The

  2. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Hausman, Jean-Francois; Strauss, Joseph; Ezcurra, Inés

    2016-01-01

    WD40 repeat (WDR) proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD). FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina) comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed. PMID:27367684

  3. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

    2014-07-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  4. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal

  5. Functional genomics reveals that a compact terpene synthase gene family can account for terpene volatile production in apple.

    Nieuwenhuizen, Niels J; Green, Sol A; Chen, Xiuyin; Bailleul, Estelle J D; Matich, Adam J; Wang, Mindy Y; Atkinson, Ross G

    2013-02-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple 'Royal Gala' expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  6. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  7. Expression in Arabidopsis of a Strawberry Linalool Synthase Gene Under the Control of the Inducible Potato P12 Promoter

    YANG Li-mei; Per Mercke; Joop J A van Loon; FANG Zhi-yuan; Marcel Dicke; Maarten A Jongsma

    2008-01-01

    To investigate the role of inducible linalool in Arabidopsis-insect interactions, the FANESl linalool synthase (LIS) cDNA from strawberry with plastid targeting and a synthetic intron (LIS') was placed under the control of the wound inducible proteinase inhibitor 2 (PI2) promoter from potato. The construct pBin-PP12-LIS' was transformed to Arabidopsis thaliana ecotype Columbia O. Kanamycin resistant T0 seedlings were confirmed for the presence and transcription of the LIS' gene by PCR analysis on genomic DNA and by RT-PCR analysis on RNA. Genomic and RT-PCR products were sequenced to confirm correct splicing of the synthetic intron. The expression of active linalool synthase by the PP12-LIS' gene construct in the transgenic lines was assessed by measuring linalool emission using solid phase micro-extraction (SPME) GC-MS measurements after induction with methyl jasmonate. Among 30 tested independent T2 transgenic lines, 10 exhibited linalool production.Linalool expression could be induced by methyl jasmonate treatment, but not by diamondback moth larvae.

  8. T-786c Polymorphism in nitric oxide synthase 3 gene and Nitrit Oxide Level of Diabetic Retinopathy in Javanese Population

    Putri Widelia Welkriana

    2015-11-01

    Full Text Available AbstractComplication of retinopathy in type 2 DM is caused of lower level of NO. Nitric oxide level is synthesizedfrom L-arginin in reaction that catalyze Nitric oxide synthase (NOS 3. The T-786C mutation in NOS 3 genedecreases the expression of nitric oxide synthase (NOS 3 so decreases NO synthesis. To investigate theassociation between T-786C polymorphism in NOS 3 gene with NO level of diabetic retinopathy patients. Thisstudy was a case control study, consist of 40 patient of type 2 diabetic with DR (case group and 40 patient oftype 2 diabetic without DR (control group of Javanese ethnic. The genotyping of T-786C polymorphism wasperformed by PCR-RLFP. Level of NO was measured by spectrophotometry. Chi square test and odd ratiowere used to analyze the association of the T-786C polymorphism in NOS 3 gene with DR. Differences ofNO level between TT and TC genotypes were analyzed using independent t test. The distribution of T-786Cpolymorphism in NOS 3 gene of DR subjects showed that frequency of TT genotype was 22.5% and TC genotypewas 77.5%. Non DR subjects showed the frequency of TT genotype was 50% and TC genotype was 50%, (p=0.011. Frequency of T allele in DR group was 61.25% and C allele was 38.75%, and frequency of T allele in nonDR group was 75% and C allele was 25%, (p= 0.62. Odd ratio of TC genotype was 3.444(CI; 95% : 0.964-3.735and C allele was 1.898 (CI; 95% : 1.310-9.058. The NO level of TC genotype was 1.43+0.126 and TT genotypewas 11.27+5.87 (p=0.000. Level of NO between RD and non RD showed not different significantly (p=0.160for retinopathy. The T-786C polymorphism of NOS 3 gene is risk factor for retinopathy in type 2 DiabetesMellitus. Individual with TC genotype of NOS 3 gene has lower level of NO than TT genotype.Keywords : Diabetic Retinopathy, Polymorphism, Nitric Oxide, Nitric Oxide Synthase.

  9. Association of Thymidylate Synthase Gene Polymorphisms with Stavudine Triphosphate Intracellular Levels and Lipodystrophy▿

    Domingo, Pere (Domingo Pedrol); Cabeza, M. Carmen; Pruvost, Alain; Torres, Ferran; Salazar, Juliana; del Mar Gutierrez, M.; Mateo, M. Gracia; Fontanet, Angels; Fernandez, Irene; Domingo, Joan C.; Villarroya, Francesc; Vidal, Francesc; Baiget, Montserrat

    2011-01-01

    The antiviral activity and toxicity of stavudine (d4T) depend on its triphosphate metabolite, stavudine triphosphate (d4T-TP). Therefore, modifications in intracellular levels of d4T-TP may change the toxicity profile of stavudine. d4T-TP intracellular levels in peripheral blood mononuclear cells were determined with a prominence liquid chromatograph connected to a triple-quadruple mass spectrometer. Polymorphisms in the thymidylate synthase (TS), methylenetetrahydrofolate reductase (MTHFR), ...

  10. Normal Responses to Restraint Stress in Mice Lacking the Gene for Neuronal Nitric Oxide Synthase

    WEISSMAN, BEN A.; Sottas, Chantal M.; HOLMES, MICHAEL; Zhou, Ping; Iadecola, Costantino; HARDY, DIANNE O.; Ge, Ren-Shan; Hardy, Matthew P

    2009-01-01

    The hormonal changes associated with immobilization stress (IMO) include a swift increase in corticosterone (CORT) concentration and a decrease in circulating testosterone (T) levels. There is evidence that the production of the short-lived neuromodulator nitric oxide (NO) is increased during stress in various tissues, including the brain. NO also suppresses the biosynthesis of T. Both the inducible and the neuronal isoforms of NO synthase (iNOS and nNOS, respectively) have been implicated in...

  11. Factors influencing gene silencing of granule-bound starch synthase in potato

    Heilersig, H.J.B.

    2005-01-01

    In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI has been achieved by transformation with antisense and sense GBSSI constructs. However, the percentages of transformants showing strong silencing were relatively low which implicated that large num...

  12. [Full-length cDNA cloning of flavonol synthase genes of Carthamus tinctorius and construction plant expression vector].

    Yang, Wen-ting; Liu, Xiu-ming; Wan, Qiu; Yao, Na; Wang, Nan; Zhang, Xue-meng; Jiao, Zhong-da; Li, Hai-yan; Li, Xiao-kun

    2015-02-01

    Flavonol synthase (FLS) is one of the key enzymes in flavonoids metabolic pathways. In this study, middle sequence was obtained from Carthamus tinctorius transcriptome sequencing results. Full-length cDNAs of FLS was cloned from petals of C. tinctorius to FLS by using RT-PCR and RACE technology. Its full-length cDNA was 1,201 bp, with an open reading frame of 1,101 bp and 336 encoded amino acids. The phylogenetic analysis showed that, FLS gene encoded amino acids in C. tinctorius were highly homologous with amino acids in congeneric Compositae species, especially Rudbeckia laciniata. The pBASTA-FLS plant expression vector was successfully built by the molecular biology method, which lays a foundation for further studying biology functions of the gene and biosynthesis mechanism of flavonoids. PMID:26137682

  13. Congenital erythropoietic porphyria with two mutations of the uroporphyrinogen III synthase gene (Cys73Arg, Thr228Met

    Zoran Gucev

    2011-01-01

    Full Text Available Congenital erythropoietic porphyria (CEP is an autosomal recessive inborn error of metabolism that results from the markedly deficient activity of uroporphyrinogen III synthase (UROS. We describe a 14-year-old girl with red urine since infancy, progressive blistering and scarring of the skin, and moderate hemolytic anemia. After years of skin damage, her face is mutilated; she has a bald patch on the scalp, hypertrichosis of the neck, areas of skin darkening, and limited joint movements of the hands. Total urine excretion and fecal total porphyrin were both markedly raised above normal levels. Sequencing of the UROS gene identified two mutations causing CEP (Cys73Arg, Thr228Met. The patient lesions are progressing. Bone marrow transplantation and/or gene therapy are proposed as the next steps in her treatment. In brief, we describe a CEP with confirmed two pathogenic mutations, severe phenotype and discuss the various treatment options available.

  14. Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea).

    Yang, Ji; Gu, Hongya; Yang, Ziheng

    2004-01-01

    Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication. PMID:14743314

  15. Hexose-6-phosphate dehydrogenase contributes to skeletal muscle homeostasis independent of 11β-hydroxysteroid dehydrogenase type 1.

    Semjonous, Nina M

    2011-01-01

    Glucose-6-phosphate (G6P) metabolism by the enzyme hexose-6-phosphate dehydrogenase (H6PDH) within the sarcoplasmic reticulum lumen generates nicotinamide adenine dinucleotide phosphate (reduced) to provide the redox potential for the enzyme 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) to activate glucocorticoid (GC). H6PDH knockout (KO) mice have a switch in 11β-HSD1 activity, resulting in GC inactivation and hypothalamic-pituitary-adrenal axis activation. Importantly, H6PDHKO mice develop a type II fiber myopathy with abnormalities in glucose metabolism and activation of the unfolded protein response (UPR). GCs play important roles in muscle physiology, and therefore, we have examined the importance of 11β-HSD1 and GC metabolism in mediating aspects of the H6PDHKO myopathy. To achieve this, we examined 11β-HSD1\\/H6PDH double-KO (DKO) mice, in which 11β-HSD1 mediated GC inactivation is negated. In contrast to H6PDHKO mice, DKO mice GC metabolism and hypothalamic-pituitary-adrenal axis set point is similar to that observed in 11β-HSD1KO mice. Critically, in contrast to 11β-HSD1KO mice, DKO mice phenocopy the salient features of the H6PDHKO, displaying reduced body mass, muscle atrophy, and vacuolation of type II fiber-rich muscle, fasting hypoglycemia, increased muscle glycogen deposition, and elevated expression of UPR genes. We propose that muscle G6P metabolism through H6PDH may be as important as changes in the redox environment when considering the mechanism underlying the activation of the UPR and the ensuing myopathy in H6PDHKO and DKO mice. These data are consistent with an 11β-HSD1-independent function for H6PDH in which sarcoplasmic reticulum G6P metabolism and nicotinamide adenine dinucleotide phosphate-(oxidized)\\/nicotinamide adenine dinucleotide phosphate (reduced) redox status are important for maintaining muscle homeostasis.

  16. Sequence analysis of the chitin synthase A gene of the Dutch elm pathogen Ophiostoma novo-ulmi indicates a close association with the human pathogen Sporothrix schenckii.

    Hintz, W E

    1999-09-01

    Degenerate oligonucleotide primers were designed according to conserved regions of the chitin synthase gene family and used to amplify a 621 basepair (bp) fragment from genomic DNA of Ophiostoma novo-ulmi, the causal agent of Dutch elm disease. The amplification product was used as a hybridization probe to screen a library of genomic DNA sequences and to retrieve a full-length chitin synthase gene (chsA). The putative coding region of the gene was 2619 bp long, lacked introns, and encoded a polypeptide of 873 amino acids. Based on the similarity of the predicted amino acid sequence to the full-length chsC gene of Aspergillus nidulans and chsA gene of Ampelomyces quisqualis, the O. novo-ulmi chsA was classified as a Class I chitin synthase. The phylogenies constructed, according to a subregion of all available chitin synthases, showed that O. novo-ulmi consistently clustered most closely with the human pathogen Sporothrix schenckii, recently classified as a member of the mitosporic Ophiostomataceae. Disruption of the chsA gene locus had no obvious effects on the growth or morphology of the fungus. PMID:10524253

  17. Medications and glucose-6-phosphate dehydrogenase deficiency: an evidence-based review.

    Youngster, Ilan; Arcavi, Lidia; Schechmaster, Renata; Akayzen, Yulia; Popliski, Hen; Shimonov, Janna; Beig, Svetlana; Berkovitch, Matitiahu

    2010-09-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect and one of the most common genetic disorders worldwide, with an estimated 400 million people worldwide carrying a mutation in the G6PD gene that causes deficiency of the enzyme. Although drug-induced haemolysis is considered the most common adverse clinical consequence of G6PD deficiency, significant confusion exists regarding which drugs can cause haemolytic anaemia in patients with G6PD deficiency. In the absence of consensus among physicians, patients are subject to conflicting advice, causing uncertainty and distress. In the current review we aimed, by thorough search of the medical literature, to collect evidence on which to base decisions either to prohibit or allow the use of various medications in patients with G6PD deficiency. A literature search was conducted during May 2009 for studies and case reports on medication use and G6PD deficiency using the following sources: MEDLINE (1966-May 2009), PubMed (1950-May 2009), the Cochrane database of systematic reviews (2009), and major pharmacology, internal medicine, haematology and paediatric textbooks. After assessing the literature, we divided medications into one of three groups: medications that should be avoided in individuals with G6PD deficiency, medications that were considered unsafe by at least one source, but according to our review can probably be given safely in normal therapeutic dosages to individuals with G6PD deficiency as evidence does not contravene their use, and medications where no evidence at all was found to contravene their use in G6PD-deficient patients. It is reasonable to conclude that, over time, many compounds have been wrongly cited as causing haemolysis because they were administered to patients experiencing an infection-related haemolytic episode. We found solid evidence to prohibit only seven currently used medications: dapsone, methylthioninium chloride (methylene blue), nitrofurantoin

  18. Kinetics of exogenous induction of the hexose-6-phosphate transport system of Escherichia coli.

    Winkler, H H

    1971-07-01

    The kinetics of the exogenous induction of the hexose-phosphate transport system by glucose-6-phosphate (G6P) was investigated. The induction of this system by extracellular but not intracellular G6P was confirmed. The differential rate of synthesis was linear, a function of the extracellular concentration of G6P and independent of the previous induction history of the culture. Neither maintenance nor autocatalysis, phenomena described in the induction of the lac operon, were observed in the exogenous induction of hexose-phosphate transport. Fructose-6-phosphate, a potent competitive inhibitor of G6P influx, had no effect on the induction of the system by G6P, indicating that the transport of inducer was not involved in the induction process. PMID:4935331

  19. Post-irradiation repairing processes of glucose-6-phosphate dehydrogenase and catalase from Hansenula Polymorpha yeast

    The post-irradiation repairing mechanisms of two Hansenula Polymorpha yeast enzymes, glucose-6-phosphate dehydrogenase and catalase, were studied. The kinetic parameters of the selected enzymes were investigated over one month since the moment of γ-irradiation with different doses in the presence of oxygen. Dose dependent decrease of initial reaction rates was noticed for both enzymes. Small variation of initial reaction rate was recorded for glucose-6-phosphate dehydrogenase over one month, with a decreasing tendency. No significant electrophoretic changes of molecular forms of this enzyme were observed after irradiation. Continuous strong decrease of catalase activity was evident for the first 20 days after irradiation. Partial recovery process of the catalytic activity was revealed by this study. (authors)

  20. Mannose-6-phosphate receptor: a target for theranostics of prostate cancer.

    Vaillant, Ophélie; El Cheikh, Khaled; Warther, David; Brevet, David; Maynadier, Marie; Bouffard, Elise; Salgues, Frédéric; Jeanjean, Audrey; Puche, Pierre; Mazerolles, Catherine; Maillard, Philippe; Mongin, Olivier; Blanchard-Desce, Mireille; Raehm, Laurence; Rébillard, Xavier; Durand, Jean-Olivier; Gary-Bobo, Magali; Morère, Alain; Garcia, Marcel

    2015-05-11

    The development of personalized and non-invasive cancer therapies based on new targets combined with nanodevices is a major challenge in nanomedicine. In this work, the over-expression of a membrane lectin, the cation-independent mannose 6-phosphate receptor (M6PR), was specifically demonstrated in prostate cancer cell lines and tissues. To efficiently target this lectin a mannose-6-phosphate analogue was synthesized in six steps and grafted onto the surface of functionalized mesoporous silica nanoparticles (MSNs). These MSNs were used for in vitro and ex vivo photodynamic therapy to treat prostate cancer cell lines and primary cell cultures prepared from patient biopsies. The results demonstrated the efficiency of M6PR targeting for prostate cancer theranostic. PMID:25802144

  1. Fructose-6-phosphate aldolase is a novel class I aldolase from Escherichia coli and is related to a novel group of bacterial transaldolases.

    Schurmann, M; Sprenger, G A

    2001-04-01

    We have cloned an open reading frame from the Escherichia coli K-12 chromosome that had been assumed earlier to be a transaldolase or a transaldolase-related protein, termed MipB. Here we show that instead a novel enzyme activity, fructose-6-phosphate aldolase, is encoded by this open reading frame, which is the first report of an enzyme that catalyzes an aldol cleavage of fructose 6-phosphate from any organism. We propose the name FSA (for fructose-six phosphate aldolase; gene name fsa). The recombinant protein was purified to apparent homogeneity by anion exchange and gel permeation chromatography with a yield of 40 mg of protein from 1 liter of culture. By using electrospray tandem mass spectroscopy, a molecular weight of 22,998 per subunit was determined. From gel filtration a size of 257,000 (+/- 20,000) was calculated. The enzyme most likely forms either a decamer or dodecamer of identical subunits. The purified enzyme displayed a V(max) of 7 units mg(-)1 of protein for fructose 6-phosphate cleavage (at 30 degrees C, pH 8.5 in 50 mm glycylglycine buffer). For the aldolization reaction a V(max) of 45 units mg(-)1 of protein was found; K(m) values for the substrates were 9 mm for fructose 6-phosphate, 35 mm for dihydroxyacetone, and 0.8 mm for glyceraldehyde 3-phosphate. FSA did not utilize fructose, fructose 1-phosphate, fructose 1,6-bisphosphate, or dihydroxyacetone phosphate. FSA is not inhibited by EDTA which points to a metal-independent mode of action. The lysine 85 residue is essential for its action as its exchange to arginine (K85R) resulted in complete loss of activity in line with the assumption that the reaction mechanism involves a Schiff base formation through this lysine residue (class I aldolase). Another fsa-related gene, talC of Escherichia coli, was shown to also encode fructose-6-phosphate aldolase activity and not a transaldolase as proposed earlier. PMID:11120740

  2. Frequency of glucose-6-phosphate dehydrogenase deficiency in relation to altitude: a malaria hypothesis

    Tzoneva, M.; Bulanov, A. G.; Mavrudieva, M.; Lalchev, S.; Toncheva, D; Tanev, D.

    1980-01-01

    Genetic markers have recently been found to be much more polymorphic than expected. Such extensive human polymorphisms may be partly explained by a number of genetic and environmental factors, including infectious diseases. Malaria, which was very widespread in the past and still poses a problem in many countries today, is a good candidate for research. The association between malaria and glucose-6-phosphate dehydrogenase (G6PD) deficiency is well-known, but more should be done to determine t...

  3. Evaluation of Glucose-6-Phosphate Dehydrogenase Deficiency without Hemolysis in Icteric Newborns

    Farzaneh Eghbalian; Ali Reza Monsef

    2007-01-01

    Objective: Glucose-6- phosphate dehydrogenase (G6PD) deficiency is an inherited deficiency that may be the cause of neonatal jaundice. Our aim was to study the prevalence of G6PD deficiency without hemolysis in relation to neonatal jaundice. Material & Methods: This prospective descriptive study has been conducted on 272 icteric newborns admitted to the Ekbatan Hospital from October 2002 to September 2004. The dataset included: age, sex, total and direct bilirubin, hemoglobin, reticulocyte co...

  4. Subtle adjustments of the glucose-6-phosphate dehydrogenase (G6PD) mutation database and reference sequence.

    Mazières, Stéphane; Petit, Florence; Dugoujon, Jean-Michel; Iriart, Xavier; Berry, Antoine; Carme, Bernard; Nacher, Mathieu; Bailly, Pascal; Chiaroni, Jacques

    2014-01-01

    Reference sequences and mutation databases are essential for the development of molecular-based methods in human genetics. Lately, Minucci et al. [1] revised the glucose-6-phosphate dehydrogenase (G6PD) reference material from 131 bibliographic references, three previous databases, and the genomic reference sequence (GenBank accession number X55448.1). Deficiency in G6PD is the most common enzymatic insufficiency in human populations and clinical manifestations range from mild to severe: neon...

  5. A model of glucose-6-phosphate dehydrogenase deficiency in the zebrafish

    Patrinostro, Xiaobai; Carter, Michelle L.; Kramer, Ashley C.; Lund, Troy C

    2013-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common genetic defect and enzymopathy worldwide, affecting approximately 400 million people and causing acute hemolysis in persons exposed to prooxidant compounds such as menthol, naphthalene, anti-malarial drugs, and fava beans. Mouse models have not been useful because of a lack of significant response to oxidative challenge. We turned to zebrafish (Danrio rerio) embryos, which develop ex utero and are transparent, allowing vis...

  6. Prevalence of Glucose-6-Phosphate Dehydrogenase (G6PD) Deficiency in Newborns

    Zamani, A.; Z Oloumi; E. Amini; M Ghasemi

    2006-01-01

    Background: Glucose-6-phosphate dehydrogenase (G6PD) deficiency can cause hemolytic anemia and neonatal jaundice. Screening of newborns by examining the cord blood for enzyme activity has been proposed for prevention of its complications. The aim of the present study was to determine the incidence of G6PD deficiency in newborns in Vali-e-Asr hospital, Tehran. The relation between G6PD deficiency and the variables of sex, gestational age, jaundice, hemolysis, and anemia was also examined. Meth...

  7. Impact of glucose-6-phosphate dehydrogenase deficiency on the pathophysiology of cardiovascular disease

    Hecker, Peter A.; Leopold, Jane A.; Gupte, Sachin A.; Recchia, Fabio A; Stanley, William C.

    2012-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) catalyzes the rate-determining step in the pentose phosphate pathway and produces NADPH to fuel glutathione recycling. G6PD deficiency is the most common enzyme deficiency in humans and affects over 400 million people worldwide; however, its impact on cardiovascular disease is poorly understood. The glutathione pathway is paramount to antioxidant defense, and G6PD-deficient cells do not cope well with oxidative damage. Limited clinical evidence indicat...

  8. Glucose-6-Phosphate Dehydrogenase-Deficiency in Transfusion Medicine: The Unknown Risks

    Francis, Richard O.; Jhang, Jeffrey S.; Pham, Huy P.; Hod, Eldad A.; Zimring, James C; Spitalnik, Steven L.

    2013-01-01

    The hallmark of glucose-6-phosphate dehydrogenase (G6PD) deficiency is red blood cell (RBC) destruction in response to oxidative stress. Patients requiring RBC transfusions may simultaneously receive oxidative medications or have concurrent infections, both of which can induce hemolysis in G6PD-deficient RBCs. Although it is not routine practice to screen healthy blood donors for G6PD deficiency, case reports identified transfusion of G6PD-deficient RBCs as causing hemolysis and other adverse...

  9. Trehalose 6-phosphate regulates starch synthesis via posttranslational redox activation of ADP-glucose pyrophosphorylase

    Kolbe, A.; Tiessen, A.; Schluepmann, H.; Paul, M; Ulrich, S; Geigenberger, P.

    2005-01-01

    Trehalose is the most widespread disaccharide in nature, occurring in bacteria, fungi, insects, and plants. Its precursor, trehalose 6-phosphate (T6P), is also indispensable for the regulation of sugar utilization and growth, but the sites of action are largely unresolved. Here we use genetic and biochemical approaches to investigate whether T6P acts to regulate starch synthesis in plastids of higher plants. Feeding of trehalose to Arabidopsis leaves led to stimulation of starch synthesis wit...

  10. The suitability of saliva for detection of glucose-6-phosphate dehydrogenase deficiency.

    Beamont, A H; Miguel, A; Goos, C M; Vermeesch-Markslag, A M; Hermans, A; Vermorken, A J

    1988-01-01

    Saliva was investigated for its suitability as a biopsy tissue for the determination of glucose-6-phosphate dehydrogenase deficiency. It appears that there is a significant difference between the activity of the enzyme in patients and controls. However, some controls have very low values making discrimination between patients and controls using a qualitative method impossible. Glucose-6-phosphate dehydrogenase deficiency is a relevant clinical problem in many rural areas in developing countries. Existing methods for determination of the deficiency in blood and hair follicles do not meet the criteria necessary for their large scale introduction in the areas of the world that are concerned by the problem. The present study shows that saliva is not a suitable alternative. Between the three biopsy tissues compared: blood, hair follicles and saliva, hair follicles remain most attractive since their isolation hardly involves the risk of infection. A simplified method for the detection of glucose-6-phosphate dehydrogenase activity in hair follicles that would allow health service workers in the field to determine the carrier status of pregnant women might form the basis for a future kernicterus prevention programme. PMID:3221843

  11. Association of Variable Number of Tandem Repeats in Endothelial Nitric Oxide Synthase Gene with Coronary Artery Disease

    S Salimi

    2006-08-01

    Full Text Available Endo-derived nitric oxide (NO is synthesized from L-arginine by endothelium nitric oxide synthase (eNOS. Since reduced NO synthesis has been implicated in the development of coronary atherosclerosis; we hypothesized that polymorphisms of NOS gene might be associated with increased susceptibility to this disorder and coronary artery disease (CAD. We studied the 27 base pair tandem repeat polymorphism in intron4 of the endothelial nitric oxide synthase (eNOS gene in 141 unrelated CAD patients with positive coronary angiograms in Shahid Rajaee Heart Hospital and 159 age matched control subjects without a history of symptomatic CAD. The study protocol was approved by the Iran University of Medical Sciences Ethics Committee. The eNOS gene intron4a/b VNTR polymorphism was analyzed by polymerase chain reaction. The plasma lipids levels and other risk factors were also determined. The genotype frequencies for eNOS4b/b, eNOS4a/b and eNOS4a/a were 68.8, 29.1 and 2.1% in CAD subjects, and 81, 18.4 and 0.6 % in control subjects, respectively. The genotype frequencies differed significantly between the two groups (χ²= 6.38 P= 0.041. The frequency of the allele was 16.7% in CAD subjects and 9.8% in control subjects and was significantly higher in the patients (χ²= 6.18 P= 0.013, odds ratio=1.84. Plasma lipids, except HDL-C were also remarkablely increased in CAD group.

  12. Hydrocellular foam dressing promotes wound healing along with increases in hyaluronan synthase 3 and PPARα gene expression in epidermis.

    Takumi Yamane

    Full Text Available BACKGROUND: Hydrocellular foam dressing, modern wound dressing, induces moist wound environment and promotes wound healing: however, the regulatory mechanisms responsible for these effects are poorly understood. This study was aimed to reveal the effect of hydrocellular foam dressing on hyaluronan, which has been shown to have positive effects on wound healing, and examined its regulatory mechanisms in rat skin. METHODOLOGY/PRINCIPAL FINDINGS: We created two full-thickness wounds on the dorsolateral skin of rats. Each wound was covered with either a hydrocellular foam dressing or a film dressing and hyaluronan levels in the periwound skin was measured. We also investigated the mechanism by which the hydrocellular foam dressing regulates hyaluronan production by measuring the gene expression of hyaluronan synthase 3 (Has3, peroxisome proliferator-activated receptor α (PPARα, and CD44. Hydrocellular foam dressing promoted wound healing and upregulated hyaluronan synthesis, along with an increase in the mRNA levels of Has3, which plays a primary role in hyaluronan synthesis in epidermis. In addition, hydrocellular foam dressing enhanced the mRNA levels of PPARα, which upregulates Has3 gene expression, and the major hyaluronan receptor CD44. CONCLUSIONS/SIGNIFICANCE: These findings suggests that hydrocellular foam dressing may be beneficial for wound healing along with increases in hyaluronan synthase 3 and PPARα gene expression in epidermis. We believe that the present study would contribute to the elucidation of the mechanisms underlying the effects of hydrocellular foam dressing-induced moist environment on wound healing and practice evidence-based wound care.

  13. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection. PMID:25001420

  14. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

    Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo;

    2016-01-01

    identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...... affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes....

  15. Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

    Liepman, Aaron H; Nairn, C Joseph; Willats, William G T;

    2007-01-01

    Mannan polysaccharides are widespread among plants, where they serve as structural elements in cell walls, as carbohydrate reserves, and potentially perform other important functions. Previous work has demonstrated that members of the cellulose synthase-like A (CslA) family of glycosyltransferases...... from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced in...

  16. Alfalfa Cellulose synthase gene expression under abiotic stress: a Hitchhiker's guide to RT-qPCR normalization.

    Gea Guerriero

    Full Text Available Abiotic stress represents a serious threat affecting both plant fitness and productivity. One of the promptest responses that plants trigger following abiotic stress is the differential expression of key genes, which enable to face the adverse conditions. It is accepted and shown that the cell wall senses and broadcasts the stress signal to the interior of the cell, by triggering a cascade of reactions leading to resistance. Therefore the study of wall-related genes is particularly relevant to understand the metabolic remodeling triggered by plants in response to exogenous stresses. Despite the agricultural and economical relevance of alfalfa (Medicago sativa L., no study, to our knowledge, has addressed specifically the wall-related gene expression changes in response to exogenous stresses in this important crop, by monitoring the dynamics of wall biosynthetic gene expression. We here identify and analyze the expression profiles of nine cellulose synthases, together with other wall-related genes, in stems of alfalfa plants subjected to different abiotic stresses (cold, heat, salt stress at various time points (e.g. 0, 24, 72 and 96 h. We identify 2 main responses for specific groups of genes, i.e. a salt/heat-induced and a cold/heat-repressed group of genes. Prior to this analysis we identified appropriate reference genes for expression analyses in alfalfa, by evaluating the stability of 10 candidates across different tissues (namely leaves, stems, roots, under the different abiotic stresses and time points chosen. The results obtained confirm an active role played by the cell wall in response to exogenous stimuli and constitute a step forward in delineating the complex pathways regulating the response of plants to abiotic stresses.

  17. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  18. Botrytis cinerea virulence is drastically reduced after disruption of chitin synthase class III gene (Bcchs3a).

    Soulié, Marie-Christine; Perino, Claude; Piffeteau, Annie; Choquer, Mathias; Malfatti, Pierrette; Cimerman, Agnès; Kunz, Caroline; Boccara, Martine; Vidal-Cros, Anne

    2006-08-01

    Botrytis cinerea is an important phytopathogenic fungus requiring new methods of control. Chitin biosynthesis, which involves seven classes of chitin synthases, could be an attractive target. A fragment encoding one of the class III enzymes was used to disrupt the corresponding Bcchs3a gene in the B. cinerea genome. The resulting mutant exhibited a 39% reduction in its chitin content and an 89% reduction in its in vitro chitin synthase activity, compared with the wild-type strain. Bcchs3a mutant was not affected in its growth in liquid medium, neither in its production of sclerotia, micro- and macroconidia. In contrast, the mutant Bcchs3a was severely impaired in its growth on solid medium. Counterbalancing this defect in radial growth, Bcchs3a mutant presented a large increase in hyphal ramification, resulting in an enhanced aerial growth. Observations by different techniques of microscopy revealed a thick extracellular matrix around the hyphal tips. Moreover, Bcchs3a mutant had a largely reduced virulence on Vitis vinifera and Arabidopsis thaliana leaves. PMID:16882034

  19. Molecular cloning and sequence analysis of the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase gene.

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1987-01-01

    Genomic DNA clones that coded for the bifunctional dihydrofolate reductase (DHFR) and thymidylate synthase (TS) (DHFR-TS) activities from a pyrimethamine-sensitive strain of Plasmodium falciparum were isolated and sequenced. The deduced DHFR-TS protein contained 608 amino acids (71,682 Da). The coding region for DHFR-TS contained no intervening sequences and had a high A + T content (75%). The DHFR domain, in the amino-terminal portion of the protein, was joined by a 94-amino acid junction se...

  20. Fructose 6-phosphate phosphoketolase activity in wild-type strains of Lactobacillus, isolated from the intestinal tract of pigs.

    Bolado-Martínez, E; Acedo-Félix, E; Peregrino-Uriarte, A B; Yepiz-Plascencia, G

    2012-01-01

    Phosphoketolases are key enzymes of the phosphoketolase pathway of heterofermentative lactic acid bacteria, which include lactobacilli. In heterofermentative lactobacilli xylulose 5-phosphate phosphoketolase (X5PPK) is the main enzyme of the phosphoketolase pathway. However, activity of fructose 6-phosphate phosphoketolase (F6PPK) has always been considered absent in lactic acid bacteria. In this study, the F6PPK activity was detected in 24 porcine wild-type strains of Lactobacillus reuteri and Lactobacillus mucosae, but not in the Lactobacillus salivarius or in L. reuteri ATCC strains. The activity of F6PPK increased after treatment of the culture at low-pH and diminished after porcine bile-salts stress conditions in wild-type strains of L. reuteri. Colorimetric quantification at 505 nm allowed to differentiate between microbial strains with low activity and without the activity of F6PPK. Additionally, activity of F6PPK and the X5PPK gene expression levels were evaluated by real time PCR, under stress and nonstress conditions, in 3 L. reuteri strains. Although an exact correlation, between enzyme activity and gene expression was not obtained, it remains possible that the xpk gene codes for a phosphoketolase with dual substrate, at least in the analyzed strains of L. reuteri. PMID:23101386

  1. Inducible nitric oxide synthase gene methylation and parkinsonism in manganese-exposed welders

    Nielsen, Susan Searles; Checkoway, Harvey; Criswell, Susan R.; Farin, Federico M.; Stapleton, Patricia L.; Sheppard, Lianne; Racette, Brad A.

    2015-01-01

    Introduction Neurologist-assessed parkinsonism signs are prevalent among workers exposed to manganese (Mn)-containing welding fume. Neuroinflammation may possibly play a role. Inducible nitric oxide synthase, coded by NOS2, is involved in inflammation, and particulate exposure increases the gene’s expression through methylation of CpG sites in the 5′ region. Methods We assessed DNA methylation at three CpG sites in the NOS2 exon 1 from blood from 201 welders. All were non-Hispanic Caucasian men 25–65 years old who were examined by a neurologist specializing in movement disorders. We categorized the workers according to their Unified Parkinson Disease Rating Scale motor subsection 3 (UPDRS3) scores as parkinsonism cases (UPDRS3 ≥ 15; n = 49), controls (UPDRS3 < 6; n = 103), or intermediate (UPDRS3 ≥6 to <15; n = 49). Results While accounting for age, examiner and experimental plate, parkinsonism cases had lower mean NOS2 methylation than controls (p-value for trend = 0.04), specifically at CpG site 8329 located in an exonic splicing enhancer of NOS2 (p-value for trend = 0.07). These associations were not observed for the intermediate UPDRS3 group (both p-value for trend ≥ 0.59). Conclusions Inflammation mediated by inducible nitric oxide synthase may possibly contribute to the association between welding fume and parkinsonism, but requires verification in a longitudinal study. PMID:25634431

  2. Widespread occurrence and genomic context of unusually small polyketide synthase genes in microbial consortia associated with marine sponges.

    Fieseler, Lars; Hentschel, Ute; Grozdanov, Lubomir; Schirmer, Andreas; Wen, Gaiping; Platzer, Matthias; Hrvatin, Sinisa; Butzke, Daniel; Zimmermann, Katrin; Piel, Jörn

    2007-04-01

    Numerous marine sponges harbor enormous amounts of as-yet-uncultivated bacteria in their tissues. There is increasing evidence that these symbionts play an important role in the synthesis of protective metabolites, many of which are of great pharmacological interest. In this study, genes for the biosynthesis of polyketides, one of the most important classes of bioactive natural products, were systematically investigated in 20 demosponge species from different oceans. Unexpectedly, the sponge metagenomes were dominated by a ubiquitously present, evolutionarily distinct, and highly sponge-specific group of polyketide synthases (PKSs). Open reading frames resembling animal fatty acid genes were found on three corresponding DNA regions isolated from the metagenomes of Theonella swinhoei and Aplysina aerophoba. Their architecture suggests that methyl-branched fatty acids are the metabolic product. According to a phylogenetic analysis of housekeeping genes, at least one of the PKSs belongs to a bacterium of the Deinococcus-Thermus phylum. The results provide new insights into the chemistry of sponge symbionts and allow inference of a detailed phylogeny of the diverse functional PKS types present in sponge metagenomes. Based on these qualitative and quantitative data, we propose a significantly simplified strategy for the targeted isolation of biomedically relevant PKS genes from complex sponge-symbiont associations. PMID:17293531

  3. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

    Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.

  4. The glycogen synthase 2 gene (Gys2) displays parallel evolution between Old World and New World fruit bats.

    Qian, Yamin; Fang, Tao; Shen, Bin; Zhang, Shuyi

    2014-01-01

    Frugivorous and nectarivorous bats rely largely on hepatic glycogenesis and glycogenolysis for postprandial blood glucose disposal and maintenance of glucose homeostasis during short time starvation, respectively. The glycogen synthase 2 encoded by the Gys2 gene plays a critical role in liver glycogen synthesis. To test whether the Gys2 gene has undergone adaptive evolution in bats with carbohydrate-rich diets in relation to their insect-eating sister taxa, we sequenced the coding region of the Gys2 gene in a number of bat species, including three Old World fruit bats (OWFBs) (Pteropodidae) and two New World fruit bats (NWFBs) (Phyllostomidae). Our results showed that the Gys2 coding sequences are highly conserved across all bat species we examined, and no evidence of positive selection was detected in the ancestral branches leading to OWFBs and NWFBs. Our explicit convergence test showed that posterior probabilities of convergence between several branches of OWFBs, and the NWFBs were markedly higher than that of divergence. Three parallel amino acid substitutions (Q72H, K371Q, and E666D) were detected among branches of OWFBs and NWFBs. Tests for parallel evolution showed that two parallel substitutions (Q72H and E666D) were driven by natural selection, while the K371Q was more likely to be fixed randomly. Thus, our results suggested that the Gys2 gene has undergone parallel evolution on amino acid level between OWFBs and NWFBs in relation to their carbohydrate metabolism. PMID:24258790

  5. Transformation of Brassica napus canola cultivars with Arabidopsis thaliana acetohydroxyacid synthase genes and analysis of herbicide resistance.

    Miki, B L; Labbé, H; Hattori, J; Ouellet, T; Gabard, J; Sunohara, G; Charest, P J; Iyer, V N

    1990-10-01

    A survey of selected crop species and weeds was conducted to evaluate the inhibition of the enzyme acetohydroxyacid synthase (AHAS) and seedling growth in vitro by the sulfonylurea herbicides chlorsulfuron, DPX A7881, DPX L5300, DPX M6316 and the imidazolinone herbicides AC243,997, AC263,499, AC252,214. Particular attention was given to the Brassica species including canola cultivars and cruciferous weeds such as B. kaber (wild mustard) and Thlaspi arvense (stinkweed). Transgenic lines of B. napus cultivars Westar and Profit, which express the Arabidopsis thaliana wild-type AHAS gene or the mutant gene csr1-1 at levels similar to the resident AHAS genes, were generated and compared. The mutant gene was essential for resistance to the sulfonylurea chlorsulfuron but not to DPX A7881, which appeared to be tolerated by certain Brassica species. Cross-resistance to the imidazolinones did not occur. The level of resistance to chlorsulfuron in transgenic canola greatly exceeded the levels that were toxic to the Brassica species or cruciferous weeds. Direct selection of transgenic lines with chlorsulfuron sprayed at field levels under greenhouse conditions was achieved. PMID:24221001

  6. Glycosylation defects and virulence phenotypes of Leishmania mexicana phosphomannomutase and dolicholphosphate-mannose synthase gene deletion mutants.

    Garami, A; Mehlert, A; Ilg, T

    2001-12-01

    Leishmania parasites synthesize an abundance of mannose (Man)-containing glycoconjugates thought to be essential for virulence to the mammalian host and for viability. These glycoconjugates include lipophosphoglycan (LPG), proteophosphoglycans (PPGs), glycosylphosphatidylinositol (GPI)-anchored proteins, glycoinositolphospholipids (GIPLs), and N-glycans. A prerequisite for their biosynthesis is an ample supply of the Man donors GDP-Man and dolicholphosphate-Man. We have cloned from Leishmania mexicana the gene encoding the enzyme phosphomannomutase (PMM) and the previously described dolicholphosphate-Man synthase gene (DPMS) that are involved in Man activation. Surprisingly, gene deletion experiments resulted in viable parasite lines lacking the respective open reading frames (DeltaPMM and DeltaDPMS), a result against expectation and in contrast to the lethal phenotype observed in gene deletion experiments with fungi. L. mexicana DeltaDPMS exhibits a selective defect in LPG, protein GPI anchor, and GIPL biosynthesis, but despite the absence of these structures, which have been implicated in parasite virulence and viability, the mutant remains infectious to macrophages and mice. By contrast, L. mexicana DeltaPMM are largely devoid of all known Man-containing glycoconjugates and are unable to establish an infection in mouse macrophages or the living animal. Our results define Man activation leading to GDP-Man as a virulence pathway in Leishmania. PMID:11689705

  7. β-Glucan synthase gene overexpression and β-glucans overproduction in Pleurotus ostreatus using promoter swapping.

    Ran Chai

    Full Text Available Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR, and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi.

  8. Hypoxia-induced endothelial NO synthase gene transcriptional activation is mediated through the tax-responsive element in endothelial cells.

    Min, Jiho; Jin, Yoon-Mi; Moon, Je-Sung; Sung, Min-Sun; Jo, Sangmee Ahn; Jo, Inho

    2006-06-01

    Although hypoxia is known to induce upregulation of endothelial NO synthase (eNOS) gene expression, the underlying mechanism is largely unclear. In this study, we show that hypoxia increases eNOS gene expression through the binding of phosphorylated cAMP-responsive element binding (CREB) protein (pCREB) to the eNOS gene promoter. Hypoxia (1% O2) increased both eNOS expression and NO production, peaking at 24 hours, in bovine aortic endothelial cells, and these increases were accompanied by increases in pCREB. Treatment with the protein kinase A inhibitor H-89 or transfection with dominant-negative inhibitor of CREB reversed the hypoxia-induced increases in eNOS expression and NO production, with concomitant inhibition of the phosphorylation of CREB induced by hypoxia, suggesting an involvement of protein kinase A/pCREB-mediated pathway. To map the regulatory elements of the eNOS gene responsible for pCREB binding under hypoxia, we constructed an eNOS gene promoter (-1600 to +22 nucleotides) fused with a luciferase reporter gene [pGL2-eNOS(-1600)]. Hypoxia (for 24-hour incubation) increased the promoter activity by 2.36+/-0.18-fold in the bovine aortic endothelial cells transfected with pGL2-eNOS(-1600). However, progressive 5'-deletion from -1600 to -873 completely attenuated the hypoxia-induced increase in promoter activity. Electrophoretic mobility shift, anti-pCREB antibody supershift, and site-specific mutation analyses showed that pCREB is bound to the Tax-responsive element (TRE) site, a cAMP-responsive element-like site, located at -924 to -921 of the eNOS promoter. Our data demonstrate that the interaction between pCREB and the Tax-responsive element site within the eNOS promoter may represent a novel mechanism for the mediation of hypoxia-stimulated eNOS gene expression. PMID:16651461

  9. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

    Bua-In Saowaluck

    2014-01-01

    Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

  10. Structural and functional changes of mitochondrial ATP synthase caused by mtDNA 9205delTA mutation in ATP6 gene

    Ješina, Pavel; Tesařová, M.; Fornůsková, D.; Vojtíšková, Alena; Pecina, Petr; Kaplanová, Vilma; Hansíková, H.; Zeman, J.; Houštěk, Josef

    2006-01-01

    Roč. 29, S1 (2006), s. 117-117. ISSN 0141-8955. [International Congress of Inborn Errors of Metabolism /10./. 12.09.2006-16.09.2006, Chiba] R&D Projects: GA MZd NR7790 Institutional research plan: CEZ:AV0Z50110509 Keywords : ATP synthase * ATP6 gene * mitochondria Subject RIV: CE - Biochemistry

  11. Nitric oxide synthase, calcitonin gene-related peptide and NK-1 receptor mechanisms are involved in GTN-induced neuronal activation

    Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri; Hay-Schmidt, Anders; Jansen-Olesen, Inger; Gupta, Saurabh; Olesen, Jes

    2014-01-01

    BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene...

  12. Development of genome-specific primers for homoeologous genes in allopolyploid species: the waxy and starch synthase II genes in allohexaploid wheat (Triticum aestivum L. as examples

    Brûlé-Babel Anita

    2010-05-01

    Full Text Available Abstract Background In allopolypoid crops, homoeologous genes in different genomes exhibit a very high sequence similarity, especially in the coding regions of genes. This makes it difficult to design genome-specific primers to amplify individual genes from different genomes. Development of genome-specific primers for agronomically important genes in allopolypoid crops is very important and useful not only for the study of sequence diversity and association mapping of genes in natural populations, but also for the development of gene-based functional markers for marker-assisted breeding. Here we report on a useful approach for the development of genome-specific primers in allohexaploid wheat. Findings In the present study, three genome-specific primer sets for the waxy (Wx genes and four genome-specific primer sets for the starch synthase II (SSII genes were developed mainly from single nucleotide polymorphisms (SNPs and/or insertions or deletions (Indels in introns and intron-exon junctions. The size of a single PCR product ranged from 750 bp to 1657 bp. The total length of amplified PCR products by these genome-specific primer sets accounted for 72.6%-87.0% of the Wx genes and 59.5%-61.6% of the SSII genes. Five genome-specific primer sets for the Wx genes (one for Wx-7A, three for Wx-4A and one for Wx-7D could distinguish the wild type wheat and partial waxy wheat lines. These genome-specific primer sets for the Wx and SSII genes produced amplifications in hexaploid wheat, cultivated durum wheat, and Aegilops tauschii accessions, but failed to generate amplification in the majority of wild diploid and tetraploid accessions. Conclusions For the first time, we report on the development of genome-specific primers from three homoeologous Wx and SSII genes covering the majority of the genes in allohexaploid wheat. These genome-specific primers are being used for the study of sequence diversity and association mapping of the three homoeologous Wx

  13. The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils

    Irmisch Sandra

    2012-06-01

    Full Text Available Abstract Background The essential oil of chamomile, one of the oldest and agronomically most important medicinal plant species in Europe, has significant antiphlogistic, spasmolytic and antimicrobial activities. It is rich in chamazulene, a pharmaceutically active compound spontaneously formed during steam distillation from the sesquiterpene lactone matricine. Chamomile oil also contains sesquiterpene alcohols and hydrocarbons which are produced by the action of terpene synthases (TPS, the key enzymes in constructing terpene carbon skeletons. Results Here, we present the identification and characterization of five TPS enzymes contributing to terpene biosynthesis in chamomile (Matricaria recutita. Four of these enzymes were exclusively expressed in above-ground organs and produced the common terpene hydrocarbons (−-(E-β-caryophyllene (MrTPS1, (+-germacrene A (MrTPS3, (E-β-ocimene (MrTPS4 and (−-germacrene D (MrTPS5. A fifth TPS, the multiproduct enzyme MrTPS2, was mainly expressed in roots and formed several Asteraceae-specific tricyclic sesquiterpenes with (−-α-isocomene being the major product. The TPS transcript accumulation patterns in different organs of chamomile were consistent with the abundance of the corresponding TPS products isolated from these organs suggesting that the spatial regulation of TPS gene expression qualitatively contribute to terpene composition. Conclusions The terpene synthases characterized in this study are involved in the organ-specific formation of essential oils in chamomile. While the products of MrTPS1, MrTPS2, MrTPS4 and MrTPS5 accumulate in the oils without further chemical alterations, (+-germacrene A produced by MrTPS3 accumulates only in trace amounts, indicating that it is converted into another compound like matricine. Thus, MrTPS3, but also the other TPS genes, are good markers for further breeding of chamomile cultivars rich in pharmaceutically active essential oils.

  14. Design, synthesis and in vitro evaluation on glucosamine-6P synthase of aromatic analogs of 2-Aminohexitols-6P

    Dias, Danielle F.; Alves, Ricardo J., E-mail: ricardodylan@farmacia.ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Faculdade de Farmacia; Roux, Celine; Durand, Philippe; Iorga, Bogdan; Badet-Denisot, Marie A.; Badet, Bernard [Centre National de la Recherche Scientifique (CNRS), Gif-sur-Yvette (France). Inst. de Chimie des Substances Naturelles

    2010-07-01

    The aminosugars are very important structural components of bacterial and fungi cell walls. Glucosamine-6-phosphate synthase (GlmS), which catalyses the first step of the aminosugar biosynthetic pathway i.e. the formation of D-glucosamine-6-phosphate from D-fructose-6-phosphate, is therefore an interesting target in the fight against microorganisms. In this work is described the synthesis of aromatic analogs of 2-amino-2-deoxy-D-glucitol-6-phosphate (ADGP) and its epimer 2-amino-2-deoxy-D-manitol-6-phosphate (ADMP), two important inhibitors of GlmS. The aromatic analogs displayed modest inhibitory activity against GlmS, with IC{sub 50} in the mmol L{sup -1} range. (author)

  15. Design, synthesis and in vitro evaluation on glucosamine-6P synthase of aromatic analogs of 2-Aminohexitols-6P

    The aminosugars are very important structural components of bacterial and fungi cell walls. Glucosamine-6-phosphate synthase (GlmS), which catalyses the first step of the aminosugar biosynthetic pathway i.e. the formation of D-glucosamine-6-phosphate from D-fructose-6-phosphate, is therefore an interesting target in the fight against microorganisms. In this work is described the synthesis of aromatic analogs of 2-amino-2-deoxy-D-glucitol-6-phosphate (ADGP) and its epimer 2-amino-2-deoxy-D-manitol-6-phosphate (ADMP), two important inhibitors of GlmS. The aromatic analogs displayed modest inhibitory activity against GlmS, with IC50 in the mmol L-1 range. (author)

  16. The binding of 2-deoxy-D-glucose 6-phosphate to glycogen phosphorylase b: kinetic and crystallographic studies.

    Oikonomakos, N G; Zographos, S E; Johnson, L N; Papageorgiou, A C; Acharya, K R

    1995-12-15

    Kinetic and crystallographic studies have characterized the effect of 2-deoxy-glucose 6-phosphate on the catalytic and structural properties of glycogen phosphorylase b. Previous work on the binding of glucose 6-phosphate, a potent physiological inhibitor of the enzyme, to T state phosphorylase b in the crystal showed that the inhibitor binds at the allosteric site and induces substantial conformational changes that affect the subunit-subunit interface. The hydrogen-bond from the O-2 hydroxyl of glucose 6-phosphate to the main-chain oxygen of Val40' represents the only hydrogen bond from the sugar to the other subunit, and this interaction appears important for promoting a more "tensed" structure than native T state phosphorylase b. 2-Deoxy-glucose 6-phosphate acts competitively with both the activator AMP and the substrate glucose 1-phosphate, with Ki values of 0.53 mM and 1.23 mM, respectively. The binding of 2-deoxy-glucose 6-phosphate to T state glycogen phosphorylase b in the crystal, has been investigated and the complex phosphorylase b: 2-deoxy-glucose 6-phosphate has been refined to give a crystallographic R factor of 17.3%, for data between 8 A and 2.3 A. 2-Deoxy-glucose 6-phosphate binds at the allosteric site as the a anomer and adopts a different conformation compared to glucose 6-phosphate. The two conformations differ by 160 degrees in the torsion angle about the C-5-C-6 bond. The contacts from the phosphate group are essentially identical to those made by the phosphate of glucose 6-phosphate but the 2-deoxy glucosyl moiety binds in a quite different orientation compared to the glucosyl of glucose 6-phosphate. 2-Deoxy-glucose 6-phosphate can be accommodated in the allosteric site with very little change in the protein, while structural comparisons show that the phosphorylase b: 2-deoxy-glucose 6-phosphate complex structure is overall more similar to a glucose-like complex than to the Glc-6-P complex structure. PMID:7500360

  17. An Arabidopsis callose synthase

    Ostergaard, Lars; Petersen, Morten; Mattsson, Ole;

    2002-01-01

    unclear whether callose synthases can also produce cellulose and whether plant cellulose synthases may also produce beta-1,3-glucans. We describe here an Arabidopsis gene, AtGsl5, encoding a plasma membrane-localized protein homologous to yeast beta-1,3-glucan synthase whose expression partially......Beta-1,3-glucan polymers are major structural components of fungal cell walls, while cellulosic beta-1,4-glucan is the predominant polysaccharide in plant cell walls. Plant beta-1,3-glucan, called callose, is produced in pollen and in response to pathogen attack and wounding, but it has been...

  18. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook

    2008-10-24

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  19. Effect of deletion of chitin synthase genes on mycelial morphology and culture viscosity in Aspergillus oryzae.

    Müller, Christian; Hansen, Kim; Szabo, Peter; Nielsen, Jens

    2003-03-01

    The objective of this study was to quantify the effect of disrupting two chitin synthases, chsB and csmA, on the morphology and rheology during batch cultivation of Aspergillus oryzae. The rheological properties were characterized in batch cultivations at different biomass concentrations (from 3.4-22.5 g kg(-1) biomass) and the power-law model adequately described the rheological properties. In the cultivations there were pellets, clumps, and freely dispersed hyphal elements. The different morphological fractions were quantified using image analysis. The apparent viscosity of the fermentation broth was significantly affected by the biomass concentration, the morphology, and also by pH. The chsB disruption strain had lower consistency index K values for all biomass concentrations investigated, which is a desirable trait for industrial Aspergillus fermentations. PMID:12514801

  20. Molecular cloning and sequence analysis of the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase gene.

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1987-12-01

    Genomic DNA clones that coded for the bifunctional dihydrofolate reductase (DHFR) and thymidylate synthase (TS) (DHFR-TS) activities from a pyrimethamine-sensitive strain of Plasmodium falciparum were isolated and sequenced. The deduced DHFR-TS protein contained 608 amino acids (71,682 Da). The coding region for DHFR-TS contained no intervening sequences and had a high A + T content (75%). The DHFR domain, in the amino-terminal portion of the protein, was joined by a 94-amino acid junction sequence to the TS domain in the carboxyl-terminal portion of the protein. The TS domain was more conserved than the DHFR domain and both P. falciparum domains were more homologous to eukaryotic than to prokaryotic forms of the enzymes. Predicted secondary structures of the DHFR and TS domains were nearly identical to the structures identified in other DHFR and TS enzymes. PMID:2825189

  1. Exposure to Diflubenzuron Results in an Up-Regulation of a Chitin Synthase 1 Gene in Citrus Red Mite, Panonychus citri (Acari: Tetranychidae)

    Wen-Kai Xia; Tian-Bo Ding; Jin-Zhi Niu; Chong-Yu Liao; Rui Zhong; Wen-Jia Yang; Bin Liu; Wei Dou; Jin-Jun Wang

    2014-01-01

    Chitin synthase synthesizes chitin, which is critical for the arthropod exoskeleton. In this study, we cloned the cDNA sequences of a chitin synthase 1 gene, PcCHS1, in the citrus red mite, Panonychus citri (McGregor), which is one of the most economically important pests of citrus worldwide. The full-length cDNA of PcCHS1 contains an open reading frame of 4605 bp of nucleotides, which encodes a protein of 1535 amino acid residues with a predicted molecular mass of 175.0 kDa. A phylogenetic ...

  2. Citrate-release-mediated aluminum resistance is coupled to the inducible expression of mitochondrial citrate synthase gene in Paraserianthes falcataria.

    Osawa, Hiroki; Kojima, Katsumi

    2006-05-01

    Aluminum (Al) resistance in some leguminous plants is achieved by enhanced citrate release from roots. Enhancement requires several hours for complete activation and is postulated to involve Al-responsive genes or components. We examined the mechanism of Al-induced citrate release by studying the relationship between citrate release and expression of the mitochondrial citrate synthase (mCS) gene in three leguminous trees. Root elongation in Leucaena leucocephala (Lam.) de Wit was arrested within 24 h by 30 microM Al, whereas root elongation in Paraserianthes falcataria (L.) Neilson and Acacia mangium Willd. was inhibited mangium maintained enhanced release and accumulation of citrate for at least 28 days in response to Al treatment. Aluminum increased the accumulation of mCS transcripts in P. falcataria roots, but not in L. leucocephala roots, and thus up-regulation decreased following removal of Al. Lanthanum did not alter the expression level of mCS. Aluminum increased mCS activity concomitantly with enhanced mCS gene expression in P. falcataria, whereas it did not affect mCS activity in L. leucocephala. Aluminum content in root apices of P. falcataria was increased by cycloheximide, supporting the idea that de novo synthesis of proteins is a prerequisite for Al resistance. Our findings suggest that Al-inducible expression of mCS coupled with enhanced citrate release mediates Al resistance in P. falcataria. PMID:16452070

  3. Role of Plant Fatty acid Elongase (3 keto acyl-CoA Synthase gene in Cuticular Wax Biosynthesis

    Uppala Lokesh

    2013-12-01

    Full Text Available Plant surfaces are ensheathed by cuticular wax, amorphous intra-cuticular embedded in cutin polymer and crystalloid epi-cuticular that imparts a whitish appearance, confers drought resistance by reducing stomatal transpiration and also protects from U.V Radiation, phytophagous insects etc. Very long chain fatty acids acts as precursors for cuticular wax bio-synthesis. Wax bio-synthesis begins with fatty acid synthesis in the plastid (de novo synthesis of C16 and C18 and elongation of fatty acids in endoplasmic reticulum (C20 – C34 by four distinct enzymes 3-ketoacyl-CoA synthase, 3-ketoacyl-CoA reductase, 3-hydroxacyl-CoA dehydratase, trans-2,3-enoyl-CoA reductase (KCS, KCR, HCD, ECR. The KCS, a fatty acid elongase, determines the chain length and substrate specificity of the condensation reaction, a rate limiting step and the subsequent elongated products alkanes, aldehydes, primary alcohols, secondary alcohols, ketones and wax esters. 21 KCS genes were annotated in Arabidopsis thaliana Genome of which some KCSs were identified involved in cuticle formation (CER6 (CUT1, KCS1, KCS2, (DAISY, KCS20 and FDH.The current review will focus on the bio-chemical, genetic and molecular approaches on KCSs genes, predominantly KCS1 in plants particularly useful in identifying and characterizing gene products involved in wax bio-synthesis, secretion and function for developing transgenic crops that combat various stresses. INTRODUCTION

  4. Rhizobacteria activates (+)-δ-cadinene synthase genes and induces systemic resistance in cotton against beet armyworm (Spodoptera exigua).

    Zebelo, Simon; Song, Yuanyuan; Kloepper, Joseph W; Fadamiro, Henry

    2016-04-01

    Gossypol is an important allelochemical produced by the subepidermal glands of some cotton varieties and important for their ability to respond to changing biotic stress by exhibiting antibiosis against some cotton pests. Plant growth-promoting rhizobacteria (PGPR) are root-colonizing bacteria that increase plant growth and often elicit defence against plant pathogens and insect pests. Little is known about the effect of PGPR on cotton plant-insect interactions and the potential biochemical and molecular mechanisms by which PGPR enhance cotton plant defence. Here, we report that PGPR (Bacillus spp.) treated cotton plants showed significantly higher levels of gossypol compared with untreated plants. Similarly, the transcript levels of the genes (i.e. (+)-δ-cadinene synthase gene family) involved in the biosynthesis of gossypol were higher in PGPR-treated plants than in untreated plants. Furthermore, the levels of jasmonic acid, an octadecanoid-derived defence-related phytohormone and the transcript level of jasmonic acid responsive genes were higher in PGPR-treated plants than in untreated plants. Most intriguingly, Spodoptera exigua showed reduced larval feeding and development on PGPR-treated plants. These findings demonstrate that treatment of plants with rhizobacteria may induce significant biochemical and molecular changes with potential ramifications for plant-insect interactions. PMID:26715260

  5. Cloning and characterization of the gene encoding β-amyrin synthase in the glycyrrhizic acid biosynthetic pathway in Glycyrrhiza uralensis

    Honghao Chen

    2013-12-01

    Full Text Available Glycyrrhiza uralensis is considered to be one of the most important herbs in traditional Chinese medicine due to its numerous pharmacological effects particularly its ability to relieve cough and act as a mucolytic. Based on previous research, these effects are mediated by a number of active ingredients, especially glycyrrhizic acid (GA. In the present study, a gene encoding β-amyrin synthase (β-AS involved in GA biosynthesis in G. uralensis has been cloned and expressed in Saccharomyces cerevisiae. The cloned enzyme showed similar activity to native enzymes isolated from other Glycyrrhiza species to catalyze the conversion of 2,3-oxidosqualene into β-amyrin. In fact the β-AS gene is particularly important in the GA biosynthetic pathway in G. uralensis. The complete sequence of the enzyme was determined and a phylogenetic tree based on the β-AS gene of G. uralensis and 20 other species was created. This showed that Glycyrrhiza glabra had the closest kinship with G. uralensis. The results of this work will be useful in determining how to improve the efficacy of G. uralensis by improving its GA content and in exploring the biosynthesis of GA in vitro.

  6. Geranyl diphosphate synthase from mint

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  7. Geranyl diphosphate synthase from mint

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  8. Tobacco streak virus (strain dahlia) suppresses post-transcriptional gene silencing of flavone synthase II in black dahlia cultivars and causes a drastic flower color change.

    Deguchi, Ayumi; Tatsuzawa, Fumi; Hosokawa, Munetaka; Doi, Motoaki; Ohno, Sho

    2015-01-01

    Tobacco streak virus suppressed post-transcriptional gene silencing and caused a flower color change in black dahlias, which supported the role of cyanidin-based anthocyanins for black flower appearance. Black flower color of dahlia (Dahlia variabilis) has been attributed, in part, to the high accumulation of cyanidin-based anthocyanins that occurs when flavone synthesis is reduced because of post-transcriptional gene silencing (PTGS) of flavone synthase II (DvFNS). There are also purple-flow...

  9. The Gene CBO0515 from Clostridium botulinum Strain Hall A Encodes the Rare Enzyme N5-(Carboxyethyl) Ornithine Synthase, EC 1.5.1.24▿

    Thompson, John; Hill, Karen K.; Smith, Theresa J.; Pikis, Andreas

    2010-01-01

    Sequencing of the genome of Clostridium botulinum strain Hall A revealed a gene (CBO0515), whose putative amino acid sequence was suggestive of the rare enzyme N5-(1-carboxyethyl) ornithine synthase. To test this hypothesis, CBO0515 has been cloned, and the encoded polypeptide was purified and characterized. This unusual gene appears to be confined to proteolytic strains assigned to group 1 of C. botulinum. PMID:19933367

  10. Enhanced expression and differential inducibility of soybean chalcone synthase genes by supplemental UV-B in dark-grown seedlings

    By developing gene-specific RT-PCR and using filters to allow transmission down to 290 nm (UV-B+) or blocking all radiation below 320 nm (UV-B(-)), the effect of UV-B+ and UV-B- light on expression of each of the presently known seven members of soybean chalcone synthase (CHS) gene family in dark-grown seedlings was analyzed. Dark expression was detectable already in 18 h dark-germinating embryos, with progressive increases on successive days, suggesting that chs belongs to a class of genes expressed very early during germination, and that the expression at this stage is either constitutive or induced by non-light-dependent factors present in the seed or made available following imbibition. Exposure of 18 h dark-germinating embryos to UV-B- or to UV-B+ light did not lead to an increase in chs signal. However, the 24 h dark-germinating embryos showed a distinct effect of UV-B+, interestingly coinciding with the stage when the head of seedlings was in the process of being pushed up above ground by stem elongation, suggesting the possibility of a developmental switch modulating the appearance of UV-B response. The response to UV-B- was most prominent in chs1 and almost silent in chs2, while the up-regulation by UV-B+ was most prominent in chs5 and chs6 and much less so in chs2. Interestingly, chs2 was noted to be the only member of the Gmchs gene family devoid of H-box, raising the possibility that the H-box may be a good indicator of the photo-inducibility of a chs gene. (author)

  11. Evaluation of Glucose-6-Phosphate Dehydrogenase stability in stored blood samples

    Jalil, Norunaluwar; Azma, Raja Zahratul; Mohamed, Emida; Ithnin, Azlin; Alauddin, Hafiza; Baya, Siti Noor; Othman, Ainoon

    2016-01-01

    Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency is the commonest cause of neonatal jaundice in Malaysia. Recently, OSMMR2000-D G6PD Assay Kit has been introduced to quantitate the level of G6PD activity in newborns delivered in Universiti Kebangsaan Malaysia Medical Centre (UKMMC). As duration of sample storage prior to analysis is one of the matters of concern, this study was conducted to identify the stability of G6PD enzyme during storage. A total of 188 cord blood samples from normal ...

  12. Glucose-6-phosphate dehydrogenase-deficient mice have increased renal oxidative stress and increased albuminuria

    Xu, Yizhen; Zhang, Zhaoyun; Hu, Ji; Stillman, Isaac E.; Leopold, Jane A.; Handy, Diane E.; Loscalzo, Joseph; Stanton, Robert C.

    2010-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) is the rate-limiting enzyme of the pentose phosphate pathway and the principal source of NADPH, a major cellular reductant, and is central to cell survival. Our previous work showed that diabetes and increased aldosterone are acquired forms of G6PD deficiency, leading to decreased G6PD activity and NADPH levels and damage to kidney tissue and endothelial cells. In this study, G6PD-deficient mice were studied to test the hypothesis that decreased G6PD a...

  13. Evaluation of a Rapid Qualitative Enzyme Chromatographic Test for Glucose-6-Phosphate Dehydrogenase Deficiency

    Tinley, Kathleen E.; LOUGHLIN, ANITA M.; Jepson, Anne; Barnett, Elizabeth D

    2010-01-01

    Rapid determination of glucose-6-phosphate dehydrogenase (G6PD) status is desirable when it is necessary to use a drug contraindicated in G6PD-deficient persons, such as use of primaquine for malaria prevention or treatment. The purpose of this study was to compare a new, rapid, qualitative enzyme chromatographic test for deficiency of G6PD to a standard reference method. Samples from 196 G6PD-normal persons and 50 G6PD-deficient persons were evaluated. The sensitivity of the experimental rap...

  14. Glucose 6-phosphate dehydrogenase deficiency enhances germ cell apoptosis and causes defective embryogenesis in Caenorhabditis elegans

    Yang, H-C; Chen, T-L; Wu, Y-H; Cheng, K-P; Lin, Y-H; Cheng, M-L; Ho, H-Y; Lo, S J; Chiu, D T-Y

    2013-01-01

    Glucose 6-phosphate dehydrogenase (G6PD) deficiency, known as favism, is classically manifested by hemolytic anemia in human. More recently, it has been shown that mild G6PD deficiency moderately affects cardiac function, whereas severe G6PD deficiency leads to embryonic lethality in mice. How G6PD deficiency affects organisms has not been fully elucidated due to the lack of a suitable animal model. In this study, G6PD-deficient Caenorhabditis elegans was established by RNA interference (RNAi...

  15. Incidence and mutation analysis of glucose-6-phosphate dehydrogenase deficiency in eastern indonesian populations

    Tantular,Indah S.; Matsuoka, Hiroyuki; Kasahara, Yuichi; Pusarawati,Suhintam; Kanbe,Toshio; Tuda,Josef S. B.; Kido, Yasutoshi; Dachlan, Yoes P.; Kawamoto, Fumihiko

    2010-01-01

    We conducted a field survey of glucose-6-phosphate dehydrogenese (G6PD) deficiency in the eastern Indonesian islands, and analyzed G6PD variants molecularly. The incidence of G6PD deficiency in 5 ethnic groups (Manggarai, Bajawa, Nage-Keo, Larantuka, and Palue) on the Flores and Palue Islands was lower than that of another native group, Sikka, or a nonnative group, Riung. Molecular analysis of G6PD variants indicated that 19 cases in Sikka had a frequency distribution of G6PD variants similar...

  16. Hemolysis Induced by Glucose-6-Phosphate Dehydrogenase Deficiency and Its Association with Sex in Children

    Esmaeel Sadeghi; Perikala Vijayananda Kumar; Mansour Haghshenas; Hamed Jalaeian

    2010-01-01

    Background: Glucose-6-phosphate dehydrogenase (G6PD)deficiency is the most common enzyme disorder in human.The aim of this study was to determine the prevalence ofG6PD deficiency among children and evaluate its associationwith ABO/Rh blood groups.Method: Blood samples of 3401 asymptomatic children wereanalyzed and compared with 317 children who were admitted tohospital because of hemolysis resulted fromG6PD deficiency.Results: Among asymptomatic children 375 (11%) were G6PDdeficient. Male to ...

  17. Is glucose-6-phosphate dehydrogenase deficiency more prevalent in Carrion's disease endemic areas in Latin America?

    Mazulis, Fernando; Weilg, Claudia; Alva-Urcia, Carlos; Pons, Maria J; Del Valle Mendoza, Juana

    2015-12-01

    Glucose-6-phosphate dehydrogenase (G6PD) is a cytoplasmic enzyme with an important function in cell oxidative damage prevention. Erythrocytes have a predisposition towards oxidized environments due to their lack of mitochondria, giving G6PD a major role in its stability. G6PD deficiency (G6PDd) is the most common enzyme deficiency in humans; it affects approximately 400 million individuals worldwide. The overall G6PDd allele frequency across malaria endemic countries is estimated to be 8%, corresponding to approximately 220 million males and 133 million females. However, there are no reports on the prevalence of G6PDd in Andean communities where bartonellosis is prevalent. PMID:26706684

  18. Glucose-6-Phosphate Dehydrogenase Deficiency and Adrenal Hemorrhage in a Filipino Neonate with Hyperbilirubinemia

    Akira Ohishi

    2013-05-01

    Full Text Available We report on a Filipino neonate with early onset and prolonged hyperbilirubinemia who was delivered by a vacuum extraction due to a prolonged labor. Subsequent studies revealed adrenal hemorrhage and glucose-6-phosphate dehydrogenase (G6PD deficiency. It is likely that asphyxia and resultant hypoxia underlie the occurrence of adrenal hemorrhage and the clinical manifestation of G6PD deficiency and that the presence of the two events explains the early onset and prolonged hyperbilirubinemia of this neonate. Our results represent the importance of examining possible underlying factors for the development of severe, early onset, or prolonged hyperbilirubinemia.

  19. Glucose-6-Phosphate Dehydrogenase Deficiency and the Need for a Novel Treatment to Prevent Kernicterus.

    Cunningham, Anna D; Hwang, Sunhee; Mochly-Rosen, Daria

    2016-06-01

    Hyperbilirubinemia occurs frequently in newborns, and in severe cases can progress to kernicterus and permanent developmental disorders. Glucose-6-phosphate dehydrogenase (G6PD) deficiency, one of the most common human enzymopathies, is a major risk factor for hyperbilirubinemia and greatly increases the risk of kernicterus even in the developed world. Therefore, a novel treatment for kernicterus is needed, especially for G6PD-deficient newborns. Oxidative stress is a hallmark of bilirubin toxicity in the brain. We propose that the activation of G6PD via a small molecule chaperone is a potential strategy to increase endogenous defense against bilirubin-induced oxidative stress and prevent kernicterus. PMID:27235212

  20. Mechanism of glucose-6-phosphate dehydrogenase-mediated regulation of coronary artery contractility

    Ata, Hirotaka; Rawat, Dhwajbhadur K.; Lincoln, Thomas; Gupte, Sachin A.

    2011-01-01

    We previously identified glucose-6-phosphate dehydrogenase (G6PD) as a regulator of vascular smooth muscle contraction. In this study, we tested our hypothesis that G6PD activated by KCl via a phosphatase and tensin homologue deleted on chromosome 10 (PTEN)-protein kinase C (PKC) pathway increases vascular smooth muscle contraction and that inhibition of G6PD relaxes smooth muscle by decreasing intracellular Ca2+ ([Ca2+]i) and Ca2+ sensitivity to the myofilament. Here we show that G6PD is act...

  1. The crtE gene in Erwinia herbicola encodes geranylgeranyl diphosphate synthase.

    Math, S K; Hearst, J E; Poulter, C. D.

    1992-01-01

    A cluster of genes essential for the biosynthesis of carotenoids in Erwinia herbicola has been isolated and characterized [Armstrong, G.A., Alberti, M. & Hearst, J. E. (1990) Proc. Natl. Acad. Sci. USA 87, 9975-9979]. Related gene clusters are found in other carotenoid-producing bacteria. Two of these genes, crtB and crtE, have been assigned to enzymes responsible for conversion of geranylgeranyl diphosphate (GGPP) to prephytoene diphosphate and prephytoene diphosphate to phytoene, respective...

  2. Purification, crystallization and preliminary X-ray analysis of the glucosamine-6-phosphate N-acetyltransferase from human liver

    Glucosamine-6-phosphate N-acetyltransferase from human liver was expressed, purified and crystallized. Diffraction data have been collected to 2.6 Å resolution. Glucosamine-6-phosphate N-acetyltransferase from human liver, which catalyzes the transfer of an acetyl group from acetyl coenzyme A (AcCoA) to the primary amine of d-glucosamine 6-phosphate to form N-acetyl-d-glucosamine 6-phosphate, was expressed in a soluble form from Escherichia coli strain BL21 (DE3). The protein was purified to homogeneity using Ni2+-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.6 Å resolution. The crystals belonged to space group P41212 or P43212, with unit-cell parameters a = b = 50.08, c = 142.88 Å

  3. Characterization and functional analysis of a chitin synthase gene (HcCS1) identified from the freshwater pearlmussel Hyriopsis cumingii.

    Zheng, H F; Bai, Z Y; Lin, J Y; Wang, G L; Li, J L

    2015-01-01

    The triangle sail mussel, Hyriopsis cumingii, is the most important freshwater pearl mussel in China. However, the mechanisms underlying its chitin-mediated shell and nacre formation remain largely unknown. Here, we characterized a chitin synthase (CS) gene (HcCS1) in H. cumingii, and analyzed its possible physiological function. The complete ORF sequence of HcCS1 contained 6903 bp, encoding a 2300-amino acid protein (theoretical molecular mass = 264 kDa; isoelectric point = 6.22), and no putative signal peptide was predicted. A myosin motor head domain, a CS domain, and 12 transmembrane domains were found. The predicted spatial structures of the myosin head and CS domains were similar to the electron microscopic structure of the heavy meromyosin subfragment of chicken smooth muscle myosin and the crystal structure of bacterial cellulose synthase, respectively. This structural similarity indicates that the functions of these two domains might be conserved. Quantitative reverse transcription PCR results showed that HcCS1 was present in all detected tissues, with the highest expression levels detected in the mantle. The HcCS1 transcripts in the mantle were upregulated following shell damage from 12 to 24 h post-damage, and they peaked (approximately 1.5-fold increase) at 12 h after shell damage. These findings suggest that HcCS1 was involved in shell regeneration, and that it might participate in shell and nacre formation in this species via chitin synthesis. HcCS1 might also dynamically regulate chitin deposition during the process of shell and nacre formation with the help of its conserved myosin head domain. PMID:26782579

  4. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Pejcha, Robert; Ludwig, Martha L. (Michigan)

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  5. Cobalamin-independent methionine synthase (MetE: a face-to-face double barrel that evolved by gene duplication.

    Robert Pejchal

    2005-02-01

    Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  6. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα)8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys)3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E · Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  7. Relationship between gene expression of nitric oxide synthase and androgens in rat corpus cavernosum

    2000-01-01

    Objective To cladfy the dependence of neural nitric oxide synthase mRNA (nNOSmRNA) and endothelial nitric oxide synthase mRNA (eNOSmRNA) on androgens (testosterone [T] and dihydrotestosterone [DHT]). Methods 160 male Sprague Dawley (SD) rats were divided into Groups A (56 rats, 5 weeks old), B (50 rets,10 weeks old) and C (54 rats, 58 weeks old). Groups A, B and C were all subdivided respectively into five Subgroups. Subgroup 1: intact osntrels; Subgroup 2: castrated; Subgroup 3: castrated with testosterone ubdecanoate 25 mg/kg·mon-1, intramuscular injection, Subgroup 4: castrated with testosterone undecanoate 50 mg/kg·mon-1, intramuscular injection and Subgroup 5: treated with finaeteride 4.5 mg/kg·day-1, orally. Four and ten weeks after treatments described above, one half of the rats were killed. Serum samples were token for measurements of T, free testosterone (FT) and DHT by raclioimmunoassay. Penile samples were treated with liquid nitrogen and then stored at-80℃. nNOSmRNA and eNOSmRNA were detected by semiquantitative reveres-transcription polymerase chain reaction (RT-PCR) and Dot blot. Resulte There was no significant difference between Subgroup 1 and Subgroup 2 or Subgroup 5 in all Groups A, B and C. The expression of penile eNOSmRNA of Group A was significantly increased (4 weeks model) (P<0.05) or increased (10 weeks model) (P>0.05) in Subgroup 2 or 5 compared with those in Subgroup 1.There wes no significant difference between Subgroup 1 and Subgroup 2 or Subgroup 5 of Group B in 4 weeks model (P>0.05). There was an elevation when animals were castrated or treated with finasteride in the 10 weeks model.The expreseion of penile eNOSmRNA of Group C was significantly increased (10 weeks model) (P<0.05) or increased (4 weeks model) in Subgroup 2 compared with those in Subgroup 1.The production of eNOSmRNA in Subgroup 5 was also increased (including 4- and 10-week models). When T was supplied for castration, the penile eNOSmRNA was desreased to

  8. Dynamic modulation of thymidylate synthase gene expression and fluorouracil sensitivity in human colorectal cancer cells.

    Kentaro Wakasa

    Full Text Available Biomarkers have revolutionized cancer chemotherapy. However, many biomarker candidates are still in debate. In addition to clinical studies, a priori experimental approaches are needed. Thymidylate synthase (TS expression is a long-standing candidate as a biomarker for 5-fluorouracil (5-FU treatment of cancer patients. Using the Tet-OFF system and a human colorectal cancer cell line, DLD-1, we first constructed an in vitro system in which TS expression is dynamically controllable. Quantitative assays have elucidated that TS expression in the transformant was widely modulated, and that the dynamic range covered 15-fold of the basal level. 5-FU sensitivity of the transformant cells significantly increased in response to downregulated TS expression, although being not examined in the full dynamic range because of the doxycycline toxicity. Intriguingly, our in vitro data suggest that there is a linear relationship between TS expression and the 5-FU sensitivity in cells. Data obtained in a mouse model using transformant xenografts were highly parallel to those obtained in vitro. Thus, our in vitro and in vivo observations suggest that TS expression is a determinant of 5-FU sensitivity in cells, at least in this specific genetic background, and, therefore, support the possibility of TS expression as a biomarker for 5-FU-based cancer chemotherapy.

  9. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  10. Relationship of endothelial nitric oxide synthase gene polymorphism with blood pressure,lipid profile and blood glucose level

    2008-01-01

    To study the relationship of the polymorphism of endothelial nitric oxide synthase(eNOS)gene and blood pressure,lipid profiles and blood glucose level.By using PCR-RFLP,the eNOS Glu298Asp gene polymorphism was detected in 184 patients with essential hypertension and 196 matched healthy individuals with normal blood pressure.Taking into account eNOS Glu298Asp polymorphisms,the relationship of blood pressure with triglycerides(TG),total cholesterol(TC),high density lipoprotein(HDL),low density lipoprotein(LDL)and blood glucose level was analyzed.The distribution of eNOS Glu298Asp polymorphism had no significant difference between different blood pressure groups and gender groups,but there was a significant difference between different age groups,diastolic blood pressure groups or BMI groups(P<0.05).Asp/Asp genotype significantly increased the risk of hypertension in individuals with serum TC above 5.4 mmol/L(P=0.03,OR=2.65).eNOSGlu298Asp polymorphism and serum lipid could synergistically modulate the blood pressure,eNOS Asp/Asp genotype could significantly increase the risk of hypertension in individuals with serum TC over 5.4 mmol/L,eNOS Glu298Asp in combination with serum TC could be used to predict the risk of hypertension.

  11. Structural analysis of the promoter of tomato 1-aminocyclopropane-1-carboxylate synthase 6 gene(Le-ACS6)

    LIN JingYu; FAN Rong; WAN XiaoRong; CHARNG Yeeyung; WANG NingNing

    2007-01-01

    Ethylene plays an important role in the regulation of many growth and developmental processes of higher plants. In tomato, Le-ACS6, a member of the ACC synthase multigene family involved in system 1 ethylene biosynthesis during fruit ripening, is subject to negative feedback regulation by ethylene. To identify the cis-elements that are responsible for the negative feedback control, we established an in vitro transient assay system employing particle bombardment on mature-green tomato fruit pericarp to examine the expression of a luciferase (LUC) reporter gene driven by a 5'-serially deleted Le-ACS6 promoter. The results localized putative cis-elements required for negative ethylene-response between -347 and -266 upstream from the translational start site ATG. Several lines of stable transformation of the Le-ACS6 promoter and GUS reporter fusion gene containing internal deletion from -347 to -266 were generated. The expression pattern of the GUS reporter showed that removal of the nucleotides from -347 to -266 completely eliminated the response of the Le-ACS6 promoter to exogenous ethylene.

  12. Data for analysis of mannose-6-phosphate glycans labeled with fluorescent tags.

    Kang, Ji-Yeon; Kwon, Ohsuk; Gil, Jin Young; Oh, Doo-Byoung

    2016-06-01

    Mannose-6-phosphate (M-6-P) glycan plays an important role in lysosomal targeting of most therapeutic enzymes for treatment of lysosomal storage diseases. This article provides data for the analysis of M-6-P glycans by high-performance liquid chromatography (HPLC) and matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. The identities of M-6-P glycan peaks in HPLC profile were confirmed by measuring the masses of the collected peak eluates. The performances of three fluorescent tags (2-aminobenzoic acid [2-AA], 2-aminobenzamide [2-AB], and 3-(acetyl-amino)-6-aminoacridine [AA-Ac]) were compared focusing on the analysis of bi-phosphorylated glycan (containing two M-6-Ps). The bi-phosphorylated glycan analysis is highly affected by the attached fluorescent tag and the hydrophilicity of elution solvent used in HPLC. The data in this article is associated with the research article published in "Comparison of fluorescent tags for analysis of mannose-6-phosphate glycans" (Kang et al., 2016 [1]). PMID:27222848

  13. Purification and properties of the cytoplasmic glucose-6-phosphate dehydrogenase from pea leaves.

    Fickenscher, K; Scheibe, R

    1986-06-01

    A method involving affinity chromatography on the yellow dye Remazol Brilliant Gelb GL to highly purify the cytoplasmic isoenzyme of glucose-6-phosphate dehydrogenase from pea shoots is described. Purification is at least 6000-fold. The specific activity of the purified enzyme is 185 mumol NADP reduced/min per mg protein. The preparation was free from any contamination of chloroplastic isoenzyme. The purified enzyme retains its activity in the presence of reducing agents which, in contrast, inactivate the chloroplast enzyme. The state of activity of the cytoplasmic and the chloroplastic isoenzyme in illuminated or darkened pea leaves was investigated using specific antibodies. While upon illumination the chloroplastic isoenzyme was inactivated by 80 to 90%, we could not find any change in activity of the cytoplasmic glucose-6-phosphate dehydrogenase. ATP, ADP, NAD, NADH, and various sugar phosphates do not inhibit the enzyme activity. Only NADPH is a strong competitive inhibitor with respect to NADP, suggesting that the enzyme is regulated by feedback inhibition by one of its products. Mg2+ ions have no influence on the activity of the enzyme. The molecular weight has found to be 240,000 for the native enzyme and 60,000 for the subunit. Throughout the purification procedure the enzyme was very unstable unless NADP was present in the buffer. PMID:3717951

  14. Beta glucosidase from Bacillus polymyxa is activated by glucose-6-phosphate.

    Weiss, Paulo H E; Álvares, Alice C M; Gomes, Anderson A; Miletti, Luiz C; Skoronski, Everton; da Silva, Gustavo F; de Freitas, Sonia M; Magalhães, Maria L B

    2015-08-15

    Optimization of cellulose enzymatic hydrolysis is crucial for cost effective bioethanol production from lignocellulosic biomass. Enzymes involved in cellulose hydrolysis are often inhibited by their end-products, cellobiose and glucose. Efforts have been made to produce more efficient enzyme variants that are highly tolerant to product accumulation; however, further improvements are still necessary. Based on an alternative approach we initially investigated whether recently formed glucose could be phosphorylated into glucose-6-phosphate to circumvent glucose accumulation and avoid inhibition of beta-glucosidase from Bacillus polymyxa (BGLA). The kinetic properties and structural analysis of BGLA in the presence of glucose-6-phosphate (G6P) were investigated. Kinetic studies demonstrated that enzyme was not inhibited by G6P. In contrast, the presence of G6P activated the enzyme, prevented beta glucosidase feedback inhibition by glucose accumulation and improved protein stability. G6P binding was investigated by fluorescence quenching experiments and the respective association constant indicated high affinity binding of G6P to BGLA. Data reported here are of great impact for future design strategies for second-generation bioethanol production. PMID:26116788

  15. Exclusion of the neuronal nitric oxide synthase gene and the human achaete-scute homologue 1 gene as candidate loci for spinal cerebellar ataxia 2 (SCA2)

    Twells, R.; Xu, W. [Imperial College, London (United Kingdom)]|[Institute of Animal Physiology and Genetics Research, Babraham, Cambridge (United Kingdom); Ball, D. [Johns Hopkins Univ. School of Medicine, Baltimore, MD (United States)] [and others

    1994-09-01

    The autosomal dominant ataxias are a heterogeneous group of disorders, characterized by progressive degeneration of the cerebellum, pons and inferior olives, as well as the spinal cord. We previously mapped the spinal cerebellar ataxia 2 locus (SCA2) to chromosome 12q23-24.1 in a large Cuban founder population, flanked by the markers D12S58 and PLA2. Anticipation is a common feature of this disorder and therefore we have examined genes in this region which contain trinucleotide repeat motifs as candidate loci for SCA2. The neuronal nitric oxide synthase gene (NOS) has recently been assigned to chromosome 12q24.2-24.3 by fluorescent in situ hybridization. Neuronal NOS is responsible for the production of nitric oxide, a neurotransmitter expressed in high levels in the cerebellum as well as other regions of the nervous system. We report here the identification and analysis of an (AAT){sub n} repeat motif in an intronic region of the neuronal NOS gene, genetic mapping data and its exclusion from being involved in SCA2. We also report the exclusion of the human achaete-scute homologue 1 gene (HASH1), instrumental in neurosensory development in mouse, from being involved in SCA2 by the analysis of a proximal (CAG){sub n} repeat motif in the Cuban pedigrees, and its genetic location on chromosome 12q.

  16. Functional and Biochemical Characterization of Three Recombinant Human Glucose-6-Phosphate Dehydrogenase Mutants: Zacatecas, Vanua-Lava and Viangchan

    Gómez-Manzo, Saúl; Marcial-Quino, Jaime; Vanoye-Carlo, America; Serrano-Posada, Hugo; González-Valdez, Abigail; Martínez-Rosas, Víctor; Hernández-Ochoa, Beatriz; Sierra-Palacios, Edgar; Castillo-Rodríguez, Rosa Angélica; Cuevas-Cruz, Miguel; Rodríguez-Bustamante, Eduardo; Arreguin-Espinosa, Roberto

    2016-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency in humans causes severe disease, varying from mostly asymptomatic individuals to patients showing neonatal jaundice, acute hemolysis episodes or chronic nonspherocytic hemolytic anemia. In order to understand the effect of the mutations in G6PD gene function and its relation with G6PD deficiency severity, we report the construction, cloning and expression as well as the detailed kinetic and stability characterization of three purified clinical variants of G6PD that present in the Mexican population: G6PD Zacatecas (Class I), Vanua-Lava (Class II) and Viangchan (Class II). For all the G6PD mutants, we obtained low purification yield and altered kinetic parameters compared with Wild Type (WT). Our results show that the mutations, regardless of the distance from the active site where they are located, affect the catalytic properties and structural parameters and that these changes could be associated with the clinical presentation of the deficiency. Specifically, the structural characterization of the G6PD Zacatecas mutant suggests that the R257L mutation have a strong effect on the global stability of G6PD favoring an unstable active site. Using computational analysis, we offer a molecular explanation of the effects of these mutations on the active site. PMID:27213370

  17. Molecular Characterization of Cosenza Mutation among Patients with Glucose-6-Phosphate Dehydrogenase Deficiency in Khuzestan Province, Southwest Iran

    Seyed Reza Kazemi Nezhad

    2011-03-01

    Full Text Available Glucose-6-phosphate dehydrogenase (G6PD deficiency is one of the most common hereditary enzymatic disorders in human, increases the vulnerability of erythrocytes to oxidative stress. It is also characterized by remarkable molecular and biochemical heterogeneity. According to previous investigations, G6PD Cosenza (G1376C is a common G6PD mutation in some parts of Iran. Therefore in the present study we have characterized Cosenza mutation among G6PD deficient individuals in Khuzestan province. In order to identify G6PD Cosenza, we analyzed the G6PD gene in 64 samples out of 231 deficient individuals who had not G6PD Mediterranean mutation, using PCR- restriction fragment length polymorphism (RFLP method. G6PD Cosenza mutation was found in 6 males of 231 samples, resulting in the relative rate of 2.6% and allele frequency of 0.023 among Khuzestanian G6PD deficient subjects. A comparison of these results with previous findings in some parts of Iran suggests that G6PD Cosenza is a common mutation in Khuzestanian G6PD deficient individuals

  18. Functional and Biochemical Characterization of Three Recombinant Human Glucose-6-Phosphate Dehydrogenase Mutants: Zacatecas, Vanua-Lava and Viangchan.

    Gómez-Manzo, Saúl; Marcial-Quino, Jaime; Vanoye-Carlo, America; Serrano-Posada, Hugo; González-Valdez, Abigail; Martínez-Rosas, Víctor; Hernández-Ochoa, Beatriz; Sierra-Palacios, Edgar; Castillo-Rodríguez, Rosa Angélica; Cuevas-Cruz, Miguel; Rodríguez-Bustamante, Eduardo; Arreguin-Espinosa, Roberto

    2016-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency in humans causes severe disease, varying from mostly asymptomatic individuals to patients showing neonatal jaundice, acute hemolysis episodes or chronic nonspherocytic hemolytic anemia. In order to understand the effect of the mutations in G6PD gene function and its relation with G6PD deficiency severity, we report the construction, cloning and expression as well as the detailed kinetic and stability characterization of three purified clinical variants of G6PD that present in the Mexican population: G6PD Zacatecas (Class I), Vanua-Lava (Class II) and Viangchan (Class II). For all the G6PD mutants, we obtained low purification yield and altered kinetic parameters compared with Wild Type (WT). Our results show that the mutations, regardless of the distance from the active site where they are located, affect the catalytic properties and structural parameters and that these changes could be associated with the clinical presentation of the deficiency. Specifically, the structural characterization of the G6PD Zacatecas mutant suggests that the R257L mutation have a strong effect on the global stability of G6PD favoring an unstable active site. Using computational analysis, we offer a molecular explanation of the effects of these mutations on the active site. PMID:27213370

  19. Functional and Biochemical Characterization of Three Recombinant Human Glucose-6-Phosphate Dehydrogenase Mutants: Zacatecas, Vanua-Lava and Viangchan

    Saúl Gómez-Manzo

    2016-05-01

    Full Text Available Glucose-6-phosphate dehydrogenase (G6PD deficiency in humans causes severe disease, varying from mostly asymptomatic individuals to patients showing neonatal jaundice, acute hemolysis episodes or chronic nonspherocytic hemolytic anemia. In order to understand the effect of the mutations in G6PD gene function and its relation with G6PD deficiency severity, we report the construction, cloning and expression as well as the detailed kinetic and stability characterization of three purified clinical variants of G6PD that present in the Mexican population: G6PD Zacatecas (Class I, Vanua-Lava (Class II and Viangchan (Class II. For all the G6PD mutants, we obtained low purification yield and altered kinetic parameters compared with Wild Type (WT. Our results show that the mutations, regardless of the distance from the active site where they are located, affect the catalytic properties and structural parameters and that these changes could be associated with the clinical presentation of the deficiency. Specifically, the structural characterization of the G6PD Zacatecas mutant suggests that the R257L mutation have a strong effect on the global stability of G6PD favoring an unstable active site. Using computational analysis, we offer a molecular explanation of the effects of these mutations on the active site.

  20. The role of sugars and sugar metabolism genes (sucrose synthase) in arabidopsis thaliana seed development

    Odunlami, Benjamin Oladipo

    2009-01-01

    Seed development in Arabidopsis thaliana, has been studied at several levels. However, little has been done to study the role of sugar metabolism genes in seed pod development in this species. As the fertilized egg progresses to a mature seed, the sugars composition during different stages of the developing changes. These changes are related to metabolic processes in the developing seeds, but also to the activity of sucrose- converting and transporting genes, active at the interphase between ...

  1. Overproduction, crystallization and preliminary X-ray analysis of the putative l-ascorbate-6-phosphate lactonase UlaG from Escherichia coli

    UlaG, the putative l-ascorbate-6-phosphate lactonase encoded by the ulaG gene from the utilization of l-ascorbate regulon in E. coli, has been cloned, overexpressed, purified using standard chromatographic techniques and crystallized in a monoclinic space group. Crystals were obtained by the sitting-drop vapour-diffusion method at 293 K. A data set diffracting to 3 Å resolution was collected from a single crystal at 100 K. UlaG, the putative l-ascorbate-6-phosphate lactonase encoded by the ulaG gene from the utilization of l-ascorbate regulon in Escherichia coli, has been cloned, overexpressed, purified using standard chromatographic techniques and crystallized. Crystals were obtained by sitting-drop vapour diffusion at 293 K. Preliminary X-ray diffraction analysis revealed that the UlaG crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 104.52, b = 180.69, c = 112.88 Å, β = 103.26°. The asymmetric unit is expected to contain six copies of UlaG, with a corresponding volume per protein weight of 2.16 Å3 Da−1 and a solvent content of 43%

  2. Normal responses to restraint stress in mice lacking the gene for neuronal nitric oxide synthase.

    Weissman, Ben A; Sottas, Chantal M; Holmes, Michael; Zhou, Ping; Iadecola, Costantino; Hardy, Dianne O; Ge, Ren-Shan; Hardy, Matthew P

    2009-01-01

    The hormonal changes associated with immobilization stress (IMO) include a swift increase in corticosterone (CORT) concentration and a decrease in circulating testosterone (T) levels. There is evidence that the production of the short-lived neuromodulator nitric oxide (NO) is increased during stress in various tissues, including the brain. NO also suppresses the biosynthesis of T. Both the inducible and the neuronal isoforms of NO synthase (iNOS and nNOS, respectively) have been implicated in this suppression, but the evidence has not been conclusive. We used adult wild-type (WT) and nNOS knockout male mice (nNOS-/-) to assess the respective roles of CORT and nNOS-derived NO in stress mediated inhibition of T production. Animals were assigned to either basal control or 3-hour IMO groups. No difference in basal plasma and testicular T levels were observed between WT and nNOS-/-, although testicular weights of mutant mice were slightly lower compared to WT animals. The plasma contents of luteinizing hormone (LH) and CORT in unstressed mice of both genotypes were similar. Exposure to 3 hours of IMO increased plasma CORT and decreased T concentrations in mice of both genotypes. However, comparable levels of plasma LH and testicular nitrite and nitrate (NOx), NO stable metabolites, were detected in control and stressed WT and nNOS-/- mice. Adrenal concentrations of NOx declined after IMO, but the reduction was not statistically significant. These findings implicate CORT rather than NO generated by nNOS in the rapid stress-induced suppression of circulating T. PMID:19304728

  3. Study of exon 12 polymorphism of the human thromboxane synthase (CYP5A1) gene in Egyptian stroke patients

    Thromboxane synthase (CYP5A1) catalyzes the conversion of prostaglandin H2 to thromboxane A2, a potent mediator of platelet aggregation, vasoconstriction and bronchoconstriction. It has been implicated in the patho-physiological process of a variety of diseases, such as atherosclerosis, myocardial infarction, stroke and asthma. On the basis of the hypothesis that variations of the CYP5A1 gene may play an important role in human diseases, we performed screening for the prevalence of exon12 polymorphism of the human Thromboxane synthase (CYP5A1) gene among Egyptian normal and stroke patients. Using sequence-specific PCR, we examined the allelic prevalence in 70 Egyptian patients with ischemic strokes and in 70 controls. In addition, we compared the CYP5A1 allelic prevalence in 30 patients with stroke recurrence despite Aspirin use, in comparison with patients who have not experienced recurrent stroke while taking Aspirin. The frequencies of the CYP5A1*9 mutant (substitution of guanine by adenine near the heme-binding catalytic domain) and of the wild-type allele were 0.197(19.7%) and 0.803 (80.3%) respectively; they did not differ significantly between stroke patients and controls. The CYP5A1*9 mutant was significantly more prevalent among stroke patients with history of previous cerebrovascular attacks; even after adjusting for the common risk factors for cardiovascular disease (odds ratio (OR)1.73, 95%, confidence interval ( CI) 1.10-2.73; p=0.017). Among stroke patients, the presence of the CYP5A1 wild type allele was more frequent among the hypertensives (OR 1.68, 95% CI, 1.01-2.79; p=0.045), and less frequent among the diabetics (OR 0.55, 95%, CI 0.36-0.84; p=0.006). Also among stroke patients, the CYP5A1*9 mutant was significantly more prevalent among those, who failed secondary Aspirin prophylaxis compared to those with successful secondary Aspirin prophylaxis (OR 1.49, 95%, CI 1.06-2.11). This study provides evidence for high prevalence of the CYP5A1*9 mutant

  4. Polymorphisms in thymidylate synthase gene and susceptibility to breast cancer in a Chinese population: a case-control analysis

    Liu Jiyong

    2006-05-01

    Full Text Available Abstract Background Accumulative evidence suggests that low folate intake is associated with increased risk of breast cancer. Polymorphisms in genes involved in folate metabolism may influence DNA methylation, nucleotide synthesis, and thus individual susceptibility to cancer. Thymidylate synthase (TYMS is a key enzyme that participates in folate metabolism and catalyzes the conversion of dUMP to dTMP in the process of DNA synthesis. Two potentially functional polymorphisms [a 28-bp tandem repeat in the TYMS 5'-untranslated enhanced region (TSER and a 6-bp deletion/insertion in the TYMS 3'-untranslated region (TS 3'-UTR] were suggested to be correlated with alteration of thymidylate synthase expression and associated with cancer risk. Methods To test the hypothesis that polymorphisms of the TYMS gene are associated with risk of breast cancer, we genotyped these two polymorphisms in a case-control study of 432 incident cases with invasive breast cancer and 473 cancer-free controls in a Chinese population. Results We found that the distribution of TS3'-UTR (1494del6 genotype frequencies were significantly different between the cases and controls (P = 0.026. Compared with the TS3'-UTR del6/del6 wild-type genotype, a significantly reduced risk was associated with the ins6/ins6 homozygous variant genotype (adjusted OR = 0.58, 95% CI = 0.35–0.97 but not the del6/ins6 genotype (OR = 1.09, 95% CI = 0.82–1.46. Furthermore, breast cancer risks associated with the TS3'-UTR del6/del6 genotype were more evident in older women, postmenopausal subjects, individuals with a younger age at first-live birth and individuals with an older age at menarche. However, there was no evidence for an association between the TSER polymorphism and breast cancer risks. Conclusion These findings suggest that the TS3'-UTR del6 polymorphism may play a role in the etiology of breast cancer. Further larger population-based studies as well as functional evaluation of the

  5. Phylogeny reconstruction in the Caesalpinieae grade (Leguminosae) based on duplicated copies of the sucrose synthase gene and plastid markers.

    Manzanilla, Vincent; Bruneau, Anne

    2012-10-01

    The Caesalpinieae grade (Leguminosae) forms a morphologically and ecologically diverse group of mostly tropical tree species with a complex evolutionary history. This grade comprises several distinct lineages, but the exact delimitation of the group relative to subfamily Mimosoideae and other members of subfamily Caesalpinioideae, as well as phylogenetic relationships among the lineages are uncertain. With the aim of better resolving phylogenetic relationships within the Caesalpinieae grade, we investigated the utility of several nuclear markers developed from genomic studies in the Papilionoideae. We cloned and sequenced the low copy nuclear gene sucrose synthase (SUSY) and combined the data with plastid trnL and matK sequences. SUSY has two paralogs in the Caesalpinieae grade and in the Mimosoideae, but occurs as a single copy in all other legumes tested. Bayesian and maximum likelihood phylogenetic analyses suggest the two nuclear markers are congruent with plastid DNA data. The Caesalpinieae grade is divided into four well-supported clades (Cassia, Caesalpinia, Tachigali and Peltophorum clades), a poorly supported clade of Dimorphandra Group genera, and two paraphyletic groups, one with other Dimorphandra Group genera and the other comprising genera previously recognized as the Umtiza clade. A selection analysis of the paralogs, using selection models from PAML, suggests that SUSY genes are subjected to a purifying selection. One of the SUSY paralogs, under slightly stronger positive selection, may be undergoing subfunctionalization. The low copy SUSY gene is useful for phylogeny reconstruction in the Caesalpinieae despite the presence of duplicate copies. This study confirms that the Caesalpinieae grade is an artificial group, and highlights the need for further analyses of lineages at the base of the Mimosoideae. PMID:22699157

  6. Association study of the endothelial nitric oxide synthase gene polymorphisms with essential hypertension in northern Han Chinese

    ZHAO Qi; SU Shao-yong; CHEN Shu-feng; LI Biao; GU Dong-feng

    2006-01-01

    Background Nitric oxide (NO) synthesized by endothelial nitric oxide synthase (eNOS) plays an important role in both the regulation of endothelial function and the control of blood pressure. Up to now, there has been conflicting data regarding the association between three clinically relevant polymorphisms (T-786C, intron4b/a and G894T) of the eNOS gene and essential hypertension.Methods To examine the contribution of the three eNOS gene polymorphisms to the development of hypertension in the northern Han Chinese, a case-control study including 503 hypertensive cases and 490 age-,gender-, and area-matched controls recruited from the International Collaborative Study of Cardiovascular Disease in Asia (InterASIA) was conducted. Genotyping was performed by polymerase chain reaction (PCR) or PCR-restriction fragment length polymorphism (RFLP).Results The T-786C and intron4b/a polymorphisms were observed in significant linkage disequilibrium (D'=0.87, P<0.001). The minor allele frequencies of these three polymorphisms in healthy controls were much lower than those of Caucasians (9.3% vs 39.6%-42.0%, 8.9% vs 15.0%- 16.0% and 10.9% vs 34.5%-34.9%for -786C, intron4a and 894T, respectively). Genotype distributions and allele frequencies of the three polymorphisms did not differ between cases and controls (all P > 0.05). In addition, none of the eight estimated haplotypes significantly increased or decreased the risk of hypertension before or after adjustment for several known risk factors.Conclusion The study results suggest that the three eNOS gene polymorphisms are unlikely to be major genetic susceptibility factors for essential hypertension in the northern Han Chinese population.

  7. Enrichment of carotenoids in flaxseed (Linum usitatissimum) by metabolic engineering with introduction of bacterial phytoene synthase gene crtB.

    Fujisawa, Masaki; Watanabe, Mio; Choi, Song-Kang; Teramoto, Maki; Ohyama, Kanji; Misawa, Norihiko

    2008-06-01

    Linseed flax (Linum usitatissimum L.) is an industrially important oil crop, which includes large amounts of alpha-linolenic acid (18:3) and lignan in its seed oil. We report here the metabolic engineering of flax plants to increase carotenoid amount in seeds. Agrobacterium-mediated transformation of flax was performed to express the phytoene synthase gene (crtB) derived from the soil bacterium Pantoea ananatis (formerly called Erwinia uredovora 20D3) under the control of the cauliflower mosaic virus (CaMV) 35S constitutive promoter or the Arabidopsis thaliana fatty acid elongase 1 gene (FAE1) seed-specific promoter. As a result, eight transgenic flax plants were generated. They formed orange seeds (embryos), in which phytoene, alpha-carotene, and beta-carotene were newly accumulated in addition to increased amounts of lutein, while untransformed flax plants formed light-yellow seeds, in which only lutein was detected. Interestingly, despite the control of the CaMV 35S promoter, the expression of crtB was not observed in the leaves but in the seeds in the transgenic flax plants. Total carotenoid amounts in these seeds were 65.4-156.3 microg/g fresh weight, which corresponded to 7.8- to 18.6-fold increase, compared with those of untransformed controls. These results suggest that the flux of phytoene synthesis from geranylgeranyl diphosphate was first promoted by the expressed crtB gene product (CrtB), and then phytoene was consecutively decomposed to the downstream metabolites alpha-carotene, beta-carotene, and lutein, as catalyzed by endogenous carotenoid biosynthetic enzymes in seeds. The transgenic flaxseeds enriched with the carotenoids could be valuable as nutritional sources for human health. PMID:18640603

  8. Endothelial Nitric Oxide Synthase (eNOS) Gene Polymorphism is Associated with Age Onset of Menarche in Sickle Cell Disease Females of India

    Nishank, Sudhansu Sekhar

    2013-01-01

    Background and Objective Females with sickle cell disease (SCD) often show late onset of menarche. In transgenic sickle cell mouse, deficiency of gene encoding endothelial nitric oxide synthase (eNOS) has been reported to be associated with late onset of menarche. Thus to explore the possible association of eNOS gene polymorphism with age of onset of menarche in SCD females, 3 important eNOS gene polymorphisms- eNOS 4a/b, eNOS 894G>T (rs1799983) and eNOS-786 T>C (rs2070744) and plasma nitrite...

  9. ENDOTHELIAL NITRIC OXIDE SYNTHASE (ENOS) GENE POLYMORPHISM IS ASSOCIATED WITH AGE ONSET OF MENARCHE IN SICKLE CELL DISEASE FEMALES OF INDIA

    Sudhansu Sekhar Nishank

    2013-01-01

    ABSTRACT   Background and Objective :  Females with sickle cell disease (SCD) often show late onset of menarche. In transgenic sickle cell mouse, deficiency of gene encoding endothelial nitric oxide synthase (eNOS) has been reported to be associated with late onset of menarche. Thus to explore the possible association of eNOS gene polymorphism with age of onset of menarche in SCD females, 3 important eNOS gene polymorphism- eNOS 4a/b, eNOS 894G>T and eNOS-786 T>C  and  plasma ...

  10. Production of copolyesters of 3-hydroxybutyrate and medium-chain-length 3-hydroxyalkanoates by E. coli containing an optimized PHA synthase gene

    Gao Xue

    2012-09-01

    Full Text Available Abstract Background Microbial polyhydroxyalkanoates (PHA are biopolyesters consisting of diverse monomers. PHA synthase PhaC2Ps cloned from Pseudomonas stutzeri 1317 is able to polymerize short-chain-length (scl 3-hydroxybutyrate (3HB monomers and medium-chain-length (mcl 3-hydroxyalkanoates (3HA with carbon chain lengths ranging from C6 to C12. However, the scl and mcl PHA production in Escherichia coli expressing PhaC2Ps is limited with very low PHA yield. Results To improve the production of PHA with a wide range of monomer compositions in E. coli, a series of optimization strategies were applied on the PHA synthase PhaC2Ps. Codon optimization of the gene and mRNA stabilization with a hairpin structure were conducted and the function of the optimized PHA synthase was tested in E. coli. The transcript was more stable after the hairpin structure was introduced, and western blot analysis showed that both codon optimization and hairpin introduction increased the protein expression level. Compared with the wild type PhaC2Ps, the optimized PhaC2Ps increased poly-3-hydroxybutyrate (PHB production by approximately 16-fold to 30% of the cell dry weight. When grown on dodecanoate, the recombinant E. coli harboring the optimized gene phaC2PsO with a hairpin structure in the 5’ untranslated region was able to synthesize 4-fold more PHA consisting of 3HB and medium-chain-length 3HA compared to the recombinant harboring the wild type phaC2Ps. Conclusions The levels of both PHB and scl-mcl PHA in E. coli were significantly increased by series of optimization strategies applied on PHA synthase PhaC2Ps. These results indicate that strategies including codon optimization and mRNA stabilization are useful for heterologous PHA synthase expression and therefore enhance PHA production.

  11. Cloning and Characterisation of the Gene Encoding 3-Hydroxy-3-Methylglutaryl-CoA Synthase in Tripterygium wilfordii

    Yu-Jia Liu

    2014-11-01

    Full Text Available Tripterygium wilfordii is a traditional Chinese medical plant used to treat rheumatoid arthritis and cancer. The main bioactive compounds of the plant are diterpenoids and triterpenoids. 3-Hydroxy-3-methylglutaryl-CoA synthase (HMGS catalyses the reaction of acetoacetyl-CoA to 3-hydroxy-3-methylglutaryl-CoA, which is the first committed enzyme in the mevalonate (MVA pathway. The sequence information of HMGS in Tripterygium wilfordii is a basic resource necessary for studying the terpenoids in the plant. In this paper, full-length cDNA encoding HMGS was isolated from Tripterygium wilfordii (abbreviated TwHMGS, GenBank accession number: KM978213. The full length of TwHMGS is 1814 bp, and the gene encodes a protein with 465 amino acids. Sequence comparison revealed that TwHMGS exhibits high similarity to HMGSs of other plants. The tissue expression patterns revealed that the expression level of TwHMGS is highest in the stems and lowest in the roots. Induced expression of TwHMGS can be induced by MeJA, and the expression level is highest 4 h after induction. The functional complement assays in the YML126C knockout yeast demonstrated that TwHMGS participates in yeast terpenoid biosynthesis.

  12. A Sweetpotato Geranylgeranyl Pyrophosphate Synthase Gene, IbGGPS, Increases Carotenoid Content and Enhances Osmotic Stress Tolerance in Arabidopsis thaliana.

    Wei Chen

    Full Text Available Sweetpotato highly produces carotenoids in storage roots. In this study, a cDNA encoding geranylgeranyl phyrophosphate synthase (GGPS, named IbGGPS, was isolated from sweetpotato storage roots. Green fluorescent protein (GFP was fused to the C-terminus of IbGGPS to obtain an IbGGPS-GFP fusion protein that was transiently expressed in both epidermal cells of onion and leaves of tobacco. Confocal microscopic analysis determined that the IbGGPS-GFP protein was localized to specific areas of the plasma membrane of onion and chloroplasts in tobacco leaves. The coding region of IbGGPS was cloned into a binary vector under the control of 35S promoter and then transformed into Arabidopsis thaliana to obtain transgenic plants. High performance liquid chromatography (HPLC analysis showed a significant increase of total carotenoids in transgenic plants. The seeds of transgenic and wild-type plants were germinated on an agar medium supplemented with polyethylene glycol (PEG. Transgenic seedlings grew significantly longer roots than wild-type ones did. Further enzymatic analysis showed an increased activity of superoxide dismutase (SOD in transgenic seedlings. In addition, the level of malondialdehyde (MDA was reduced in transgenics. qRT-PCR analysis showed altered expressions of several genes involved in the carotenoid biosynthesis in transgenic plants. These data results indicate that IbGGPS is involved in the biosynthesis of carotenoids in sweetpotato storage roots and likely associated with tolerance to osmotic stress.

  13. Identification of genes coding for putative wax ester synthase/diacylglycerol acyltransferase enzymes in terrestrial and marine environments.

    Lanfranconi, Mariana P; Alvarez, Adrián F; Alvarez, Héctor M

    2015-12-01

    Synthesis of neutral lipids such as triacylglycerols (TAG) and wax esters (WE) is catalyzed in bacteria by wax ester synthase/diacylglycerol acyltransferase enzymes (WS/DGAT). We investigated the diversity of genes encoding this enzyme in contrasting natural environments from Patagonia (Argentina). The content of petroleum hydrocarbons in samples collected from oil-producing areas was measured. PCR-based analysis covered WS/DGAT occurrence in marine sediments and soil. No product was obtained in seawater samples. All clones retrieved from marine sediments affiliated with gammaproteobacterial sequences and within them, most phylotypes formed a unique cluster related to putative WS/DGAT belonging to marine OM60 clade. In contrast, soils samples contained phylotypes only related to actinomycetes. Among them, phylotypes affiliated with representatives largely or recently reported as oleaginous bacteria, as well as with others considered as possible lipid-accumulating bacteria based on the analysis of their annotated genomes. Our study shows for the first time that the environment could contain a higher variety of ws/dgat than that reported from bacterial isolates. The results of this study highlight the relevance of the environment in a natural process such as the synthesis and accumulation of neutral lipids. Particularly, both marine sediments and soil may serve as a useful source for novel WS/DGAT with biotechnological interest. PMID:26228353

  14. Functional analyses of a flavonol synthase - like gene from Camellia nitidissima reveal its roles in flavonoid metabolism during floral pigmentation

    Xing-Wen Zhou; Zheng-Qi Fan; Yue Chen; Yu-Lin Zhu; Ji-Yuan Li; Heng-Fu Yin

    2013-09-01

    The flavonoids metabolic pathway plays central roles in floral coloration, in which anthocyanins and flavonols are derived from common precursors, dihydroflavonols. Flavonol synthase (FLS) catalyses dihydroflavonols into flavonols, which presents a key branch of anthocyanins biosynthesis. The yellow flower of Camellia nitidissima Chi. is a unique feature within the genus Camellia, which makes it a precious resource for breeding yellow camellia varieties. In this work, we characterized the secondary metabolites of pigments during floral development of C. nitidissima and revealed that accumulation of flavonols correlates with floral coloration. We first isolated CnFLS1 and showed that it is a FLS of C. nitidissima by gene family analysis. Second, expression analysis during floral development and different floral organs indicated that the expression level of CnFLS1 was regulated by developmental cues, which was in agreement with the accumulating pattern of flavonols. Furthermore, over-expression of CnFLS1 in Nicotiana tabacum altered floral colour into white or light yellow, and metabolic analysis showed significant increasing of flavonols and reducing of anthocyanins in transgenic plants. Our work suggested CnFLS1 plays critical roles in yellow colour pigmentation and is potentially a key point of genetic engineering toward colour modification in Camellia.

  15. Tumor necrosis factor alpha augments nitric oxide-dependent macrophage cytotoxicity against Entamoeba histolytica by enhanced expression of the nitric oxide synthase gene.

    Lin, J. Y.; Seguin, R; K. Keller; Chadee, K

    1994-01-01

    Nitric oxide (NO measured as nitrite, NO2-) is the major effector molecule produced by activated macrophages for in vitro cytotoxicity against Entamoeba histolytica trophozoites. In this study, we determine whether tumor necrosis factor alpha (TNF-alpha) produced by activated bone marrow-derived macrophages (BMM) is involved in the induction of the inducible NO synthase gene (mac-NOS) for NO-dependent amebicidal activity. TNF-alpha alone did not directly induce macrophage NO2- production to k...

  16. Molecular characterization of a cellulose synthase gene (AaxmCesA1) isolated from an Acacia auriculiformis x Acacia mangium hybrid

    Yong, Seok Yien Christina; Wickneswari, Ratnam

    2012-01-01

    Cellulose is the major component of plant cell walls, providing mechanical strength to the structural framework of plants. In association with lignin, hemicellulose, protein and pectin, cellulose forms the strong yet flexible bio-composite tissue of wood. Wood formation is an essential biological process and is of significant importance to the cellulosic private sector industry. Cellulose synthase genes encode the catalytic subunits of a large protein complex responsible for the biogenesis of...

  17. Cloning, Sequencing, and Functional Analysis of an Iterative Type I Polyketide Synthase Gene Cluster for Biosynthesis of the Antitumor Chlorinated Polyenone Neocarzilin in “Streptomyces carzinostaticus”

    OTSUKA, Miyuki; Ichinose, Koji; Fujii, Isao; Ebizuka, Yutaka

    2004-01-01

    Neocarzilins (NCZs) are antitumor chlorinated polyenones produced by “Streptomyces carzinostaticus” var. F-41. The gene cluster responsible for the biosynthesis of NCZs was cloned and characterized. DNA sequence analysis of a 33-kb region revealed a cluster of 14 open reading frames (ORFs), three of which (ORF4, ORF5, and ORF6) encode type I polyketide synthase (PKS), which consists of four modules. Unusual features of the modular organization is the lack of an obvious acyltransferase domain ...

  18. Identification of Select Fumonisin Forming Fusarium Species Using PCR Applications of the Polyketide Synthase Gene and its Relationship to Fumonisin Production in vitro

    Mary Scruggs; Leigh Hawkins; Rowena Kelley; Peter Ma; Sonya Baird; Paul Williams; Gary Windham; Hamed K. Abbas; Richard Baird

    2008-01-01

    A polymerase chain reaction (PCR) based diagnostic assay was used to develop markers for detection of Fusarium verticillioides (=F. moniliforme), a fumonisin producing fungus in maize tissues. Species-specific primers were designed based on sequence data from the polyketide synthase (PKS) gene (FUM1- previously FUM5) responsible for fumonisin production in fungi. Four sets of oligonucleotide primers were tested for their specificity using 24 strains of F. verticillioides, 10 F. proliferatum, ...

  19. Irradiation shortens the survival time of red cells deficient in glucose-6-phosphate dehydrogenasee

    Westerman, M.P. (Rush Medical College, Chicago, IL); Wald, N.; Diloy-Puray, M.

    1980-03-01

    X radiation of glucose-6-phosphate dehydrogenase (G6PD)-deficient red cells causes distinct shortening of their survival time. This is accompanied by significant lowering of reduced glutathione content and is not observed in similarly prepared and treated normal cells. The damage is most likely related to irradiation-induced formation of activated oxygen products and to their subsequent effects on the cells. Neither methemoglobin increases nor Heinz body formation were observed, suggesting that hemolysis occurred prior to these changes. The study provides a model for examining the effects of irradiation and activated oxygen on red cells and suggests that patients with G6PD deficiency who receive irradiation could develop severe hemolysis in certain clinical settings.

  20. Irradiation shortens the survival time of red cells deficient in glucose-6-phosphate dehydrogenasee

    X radiation of glucose-6-phosphate dehydrogenase (G6PD)-deficient red cells causes distinct shortening of their survival time. This is accompanied by significant lowering of reduced glutathione content and is not observed in similarly prepared and treated normal cells. The damage is most likely related to irradiation-induced formation of activated oxygen products and to their subsequent effects on the cells. Neither methemoglobin increases nor Heinz body formation were observed, suggesting that hemolysis occurred prior to these changes. The study provides a model for examining the effects of irradiation and activated oxygen on red cells and suggests that patients with G6PD deficiency who receive irradiation could develop severe hemolysis in certain clinical settings

  1. Glucose-6-Phosphate Dehydrogenase of Trypanosomatids: Characterization, Target Validation, and Drug Discovery

    Gupta, Shreedhara; Igoillo-Esteve, Mariana; Michels, Paul A. M.; Cordeiro, Artur T.

    2011-01-01

    In trypanosomatids, glucose-6-phosphate dehydrogenase (G6PDH), the first enzyme of the pentosephosphate pathway, is essential for the defense of the parasite against oxidative stress. Trypanosoma brucei, Trypanosoma cruzi, and Leishmania mexicana G6PDHs have been characterized. The parasites' G6PDHs contain a unique 37 amino acid long N-terminal extension that in T. cruzi seems to regulate the enzyme activity in a redox-state-dependent manner. T. brucei and T. cruzi G6PDHs, but not their Leishmania spp. counterpart, are inhibited, in an uncompetitive way, by steroids such as dehydroepiandrosterone and derivatives. The Trypanosoma enzymes are more susceptible to inhibition by these compounds than the human G6PDH. The steroids also effectively kill cultured trypanosomes but not Leishmania and are presently considered as promising leads for the development of new parasite-selective chemotherapeutic agents. PMID:22091394

  2. Comparison of fluorescent tags for analysis of mannose-6-phosphate glycans.

    Kang, Ji-Yeon; Kwon, Ohsuk; Gil, Jin Young; Oh, Doo-Byoung

    2016-05-15

    Mannose-6-phosphate (M-6-P) glycan analysis is important for quality control of therapeutic enzymes for lysosomal storage diseases. Here, we found that the analysis of glycans containing two M-6-Ps was highly affected by the hydrophilicity of the elution solvent used in high-performance liquid chromatography (HPLC). In addition, the performances of three fluorescent tags--2-aminobenzoic acid (2-AA), 2-aminobenzamide (2-AB), and 3-(acetyl-amino)-6-aminoacridine (AA-Ac)--were compared with each other for M-6-P glycan analysis using HPLC and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. The best performance for analyzing M-6-P glycans was shown by 2-AA labeling in both analyses. PMID:26876105

  3. Mutations in Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase genes in Senegal

    D. Ndiaye; Daily, J. P.; Sarr, O.; Ndir, O.; Gaye, O.; Mboup, S.; Wirth, D F

    2005-01-01

    Senegal recently (2004) switched to sulfadoxine-pyrimethamine (SP) with amodiaquine as first line therapy for malaria in response to increasing chloroquine resistance. In anticipation of emerging resistance to SP as a result of this change in drug pressure, we set out to define the baseline prevalence of SP-associated mutations in the dhfr and dhps genes in P. falciparum using geographically diverse and longitudinally collected samples. A total of 153 blood samples were analyzed from patients...

  4. Molecular Epidemiological Survey of Glucose-6-Phosphate Dehydrogenase Deficiency and Thalassemia in Uygur and Kazak Ethnic Groups in Xinjiang, Northwest China.

    Han, Luhao; Su, Hai; Wu, Hao; Jiang, Weiying; Chen, Suqin

    2016-06-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency and thalassemia occur frequently in tropical and subtropical regions, while the prevalence of relationship between the two diseases in Xinjiang has not been reported. We aimed to determine the prevalence of these diseases and clarify the relationship between genotypes and phenotypes of the two diseases in the Uygur and Kazak ethnic groups in Xinjiang. We measured G6PD activity by G6PD:6PGD (glucose acid-6-phosphate dehydrogenase) ratio, identified the gene variants of G6PD and α- and β-globin genes by polymerase chain reaction (PCR)-DNA sequencing and gap-PCR and compared these variants in different ethnic groups in Xinjiang with those adjacent to it. Of the 149 subjects with molecular analysis of G6PD deficiency conducted, a higher prevalence of the combined mutations c.1311C > T/IVSXI + 93T > C and IVSXI + 93T > C, both with normal enzymatic activities, were observed in the Uygur and Kazak subjects. A case of rare mutation HBB: c.135delC [codon 44 (-C) in the heterozygous state], a heterozygous case of HBB: c.68A > G [Hb G-Taipei or β22(B4)Glu→Gly] and several common single nucleotide polymorphisms (SNPs) were found on the β-globin gene. In conclusion, G6PD deficiency with pathogenic mutations and three common α-thalassemia (α-thal) [- -(SEA), -α(3.7) (rightward), -α(4.2) (leftward)] deletions and point mutations of the α-globin gene were not detected in the present study. The average incidence of β-thalassemia (β-thal) in Uygurs was 1.45% (2/138) in Xinjiang. The polymorphisms of G6PD and β-globin genes might be useful genetic markers to trace the origin and migration of the Uygur and Kazak in Xinjiang. PMID:26950205

  5. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers.

    Aros, Danilo; Gonzalez, Veronica; Allemann, Rudolf K; Müller, Carsten T; Rosati, Carlo; Rogers, Hilary J

    2012-04-01

    Native to South America, Alstroemeria flowers are known for their colourful tepals, and Alstroemeria hybrids are an important cut flower. However, in common with many commercial cut flowers, virtually all the commercial Alstroemeria hybrids are not scented. The cultivar 'Sweet Laura' is one of very few scented commercial Alstroemeria hybrids. Characterization of the volatile emission profile of these cut flowers revealed three major terpene compounds: (E)-caryophyllene, humulene (also known as α-caryophyllene), an ocimene-like compound, and several minor peaks, one of which was identified as myrcene. The profile is completely different from that of the parental scented species A. caryophyllaea. Volatile emission peaked at anthesis in both scented genotypes, coincident in cv. 'Sweet Laura' with the maximal expression of a putative terpene synthase gene AlstroTPS. This gene was preferentially expressed in floral tissues of both cv. 'Sweet Laura' and A. caryophyllaea. Characterization of the AlstroTPS gene structure from cv. 'Sweet Laura' placed it as a member of the class III terpene synthases, and the predicted 567 amino acid sequence placed it into the subfamily TPS-b. The conserved sequences R(28)(R)X(8)W and D(321)DXXD are the putative Mg(2+)-binding sites, and in vitro assay of AlstroTPS expressed in Escherichia coli revealed that the encoded enzyme possesses myrcene synthase activity, consistent with a role for AlstroTPS in scent production in Alstroemeria cv. 'Sweet Laura' flowers. PMID:22268153

  6. Small RNA Derived from the Virulence Modulating Region of the Potato spindle tuber viroid Silences callose synthase Genes of Tomato Plants.

    Adkar-Purushothama, Charith Raj; Brosseau, Chantal; Giguère, Tamara; Sano, Teruo; Moffett, Peter; Perreault, Jean-Pierre

    2015-08-01

    The tomato (Solanum lycopersicum) callose synthase genes CalS11-like and CalS12-like encode proteins that are essential for the formation of callose, a major component of pollen mother cell walls; these enzymes also function in callose formation during pathogen infection. This article describes the targeting of these callose synthase mRNAs by a small RNA derived from the virulence modulating region of two Potato spindle tuber viroid variants. More specifically, viroid infection of tomato plants resulted in the suppression of the target mRNAs up to 1.5-fold, depending on the viroid variant used and the gene targeted. The targeting of these mRNAs by RNA silencing was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Viroid mutants incapable of targeting callose synthase mRNAs failed to induce typical infection phenotypes, whereas a chimeric viroid obtained by swapping the virulence modulating regions of a mild and a severe variant of Potato spindle tuber viroid greatly affected the accumulation of viroids and the severity of disease symptoms. These data provide evidence of the silencing of multiple genes by a single small RNA derived from a viroid. PMID:26290537

  7. Small RNA Derived from the Virulence Modulating Region of the Potato spindle tuber viroid Silences callose synthase Genes of Tomato Plants[OPEN

    Adkar-Purushothama, Charith Raj; Brosseau, Chantal; Giguère, Tamara; Sano, Teruo; Moffett, Peter; Perreault, Jean-Pierre

    2015-01-01

    The tomato (Solanum lycopersicum) callose synthase genes CalS11-like and CalS12-like encode proteins that are essential for the formation of callose, a major component of pollen mother cell walls; these enzymes also function in callose formation during pathogen infection. This article describes the targeting of these callose synthase mRNAs by a small RNA derived from the virulence modulating region of two Potato spindle tuber viroid variants. More specifically, viroid infection of tomato plants resulted in the suppression of the target mRNAs up to 1.5-fold, depending on the viroid variant used and the gene targeted. The targeting of these mRNAs by RNA silencing was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Viroid mutants incapable of targeting callose synthase mRNAs failed to induce typical infection phenotypes, whereas a chimeric viroid obtained by swapping the virulence modulating regions of a mild and a severe variant of Potato spindle tuber viroid greatly affected the accumulation of viroids and the severity of disease symptoms. These data provide evidence of the silencing of multiple genes by a single small RNA derived from a viroid. PMID:26290537

  8. Cloning, characterisation and comparative analysis of a starch synthase IV gene in wheat: functional and evolutionary implications

    Broglie Karen E

    2008-09-01

    Full Text Available Abstract Background Starch is of great importance to humans as a food and biomaterial, and the amount and structure of starch made in plants is determined in part by starch synthase (SS activity. Five SS isoforms, SSI, II, III, IV and Granule Bound SSI, have been identified, each with a unique catalytic role in starch synthesis. The basic mode of action of SSs is known; however our knowledge of several aspects of SS enzymology at the structural and mechanistic level is incomplete. To gain a better understanding of the differences in SS sequences that underscore their specificity, the previously uncharacterised SSIVb from wheat was cloned and extensive bioinformatics analyses of this and other SSs sequences were done. Results The wheat SSIV cDNA is most similar to rice SSIVb with which it shows synteny and shares a similar exon-intron arrangement. The wheat SSIVb gene was preferentially expressed in leaf and was not regulated by a circadian clock. Phylogenetic analysis showed that in plants, SSIV is closely related to SSIII, while SSI, SSII and Granule Bound SSI clustered together and distinctions between the two groups can be made at the genetic level and included chromosomal location and intron conservation. Further, identified differences at the amino acid level in their glycosyltransferase domains, predicted secondary structures, global conformations and conserved residues might be indicative of intragroup functional associations. Conclusion Based on bioinformatics analysis of the catalytic region of 36 SSs and 3 glycogen synthases (GSs, it is suggested that the valine residue in the highly conserved K-X-G-G-L motif in SSIII and SSIV may be a determining feature of primer specificity of these SSs as compared to GBSSI, SSI and SSII. In GBSSI, the Ile485 residue may partially explain that enzyme's unique catalytic features. The flexible 380s Loop in the starch catalytic domain may be important in defining the specificity of action for each

  9. Developmental evolution of flowering plant pollen tube cell walls: callose synthase (CalS gene expression patterns

    Abercrombie Jason M

    2011-07-01

    Full Text Available Abstract Background A number of innovations underlie the origin of rapid reproductive cycles in angiosperms. A critical early step involved the modification of an ancestrally short and slow-growing pollen tube for faster and longer distance transport of sperm to egg. Associated with this shift are the predominantly callose (1,3-β-glucan walls and septae (callose plugs of angiosperm pollen tubes. Callose synthesis is mediated by callose synthase (CalS. Of 12 CalS gene family members in Arabidopsis, only one (CalS5 has been directly linked to pollen tube callose. CalS5 orthologues are present in several monocot and eudicot genomes, but little is known about the evolutionary origin of CalS5 or what its ancestral function may have been. Results We investigated expression of CalS in pollen and pollen tubes of selected non-flowering seed plants (gymnosperms and angiosperms within lineages that diverged below the monocot/eudicot node. First, we determined the nearly full length coding sequence of a CalS5 orthologue from Cabomba caroliniana (CcCalS5 (Nymphaeales. Semi-quantitative RT-PCR demonstrated low CcCalS5 expression within several vegetative tissues, but strong expression in mature pollen. CalS transcripts were detected in pollen tubes of several species within Nymphaeales and Austrobaileyales, and comparative analyses with a phylogenetically diverse group of sequenced genomes indicated homology to CalS5. We also report in silico evidence of a putative CalS5 orthologue from Amborella. Among gymnosperms, CalS5 transcripts were recovered from germinating pollen of Gnetum and Ginkgo, but a novel CalS paralog was instead amplified from germinating pollen of Pinus taeda. Conclusion The finding that CalS5 is the predominant callose synthase in pollen tubes of both early-diverging and model system angiosperms is an indicator of the homology of their novel callosic pollen tube walls and callose plugs. The data suggest that CalS5 had transient expression

  10. Coincidence of cleavage sites of intron endonuclease I-TevI and critical sequences of the host thymidylate synthase gene.

    Edgell, David R; Stanger, Matthew J; Belfort, Marlene

    2004-11-01

    To maximize spread of their host intron or intein, many homing endonucleases recognize nucleotides that code for important and conserved amino acid residues of the target gene. Here, we examine the cleavage requirements for I-TevI, which binds a stretch of thymidylate synthase (TS) DNA that codes for functionally critical residues in the TS active site. Using an in vitro selection scheme, we identified two base-pairs in the I-TevI cleavage site region as important for cleavage efficiency. These were confirmed by comparison of I-TevI cleavage efficiencies on mutant and on wild-type substrates. We also showed that nicking of the bottom strand by I-TevI is not affected by mutation of residues surrounding the bottom-strand cleavage site, unlike other homing endonucleases. One of these two base-pairs is universally conserved in all TS sequences, and is identical with a previously identified cleavage determinant of I-BmoI, a related GIY-YIG endonuclease that binds a homologous stretch of TS-encoding DNA. The other base-pair is conserved only in a subset of TS genes that includes the I-TevI, but not the I-BmoI, target sequence. Both the I-TevI and I-BmoI cleavage site requirements correspond to functionally critical residues involved in an extensive hydrogen bond network within the TS active site. Remarkably, these cleavage requirements correlate with TS phylogeny in bacteria, suggesting that each endonuclease has individually adapted to efficiently cleave distinct TS substrates. PMID:15491609

  11. Association of endothelial nitric oxide synthase gene polymorphisms with coronary artery disease: an updated meta-analysis and systematic review.

    Himanshu Rai

    Full Text Available Several association studies of endothelial nitric oxide synthase (NOS3 gene polymorphisms with respect to coronary artery disease (CAD have been published in the past two decades. However, their association with the disease, especially among different ethnic subgroups, still remains controversial. This prompted us to conduct a systematic review and an updated structured meta-analysis, which is the largest so far (89 articles, 132 separate studies, and a sample size of 69,235, examining association of three polymorphic forms of the NOS3 gene (i.e. Glu298Asp, T786-C and 27 bp VNTR b/a with CAD. In a subgroup analysis, we tested their association separately among published studies originating predominantly from European, Middle Eastern, Asian, Asian-Indian and African ancestries. The pooled analysis confirmed the association of all the three selected SNP with CAD in three different genetic models transcending all ancestries worldwide. The Glu298Asp polymorphism showed strongest association (OR range = 1.28-1.52, and P<0.00001 for all comparisons, followed by T786-C (OR range = 1.34-1.42, and P<0.00001 for all comparisons and 4b/a, (OR range = 1.19-1.41, and P ≤ 0.002 for all comparisons in our pooled analysis. Subgroup analysis revealed that Glu298Asp (OR range = 1.54-1.87, and P<0.004 for all comparisons and 4b/a (OR range = 1.71-3.02, and P<0.00001 for all comparisons have highest degree of association amongst the Middle Easterners. On the other hand, T786-C and its minor allele seem to carry a highest risk for CAD among subjects of Asian ancestry (OR range = 1.61-1.90, and P ≤ 0.01 for all comparisons.

  12. The role of the erythroid-specific delta-aminolevulinate synthase gene expression in erythroid heme synthesis.

    Meguro, K; Igarashi, K; Yamamoto, M; Fujita, H; Sassa, S

    1995-08-01

    Using antisense technology, the effects of suppressed gene expression of the erythroid-specific delta-aminolevulinate (ALA) synthase (ALAS-E) on heme synthesis, expression of mRNAs encoding an erythroid-specific transcription factor NF-E2, other heme pathway enzymes, and beta-globin were examined in murine erythroleukemia (MEL) cells. In MEL cells in which an antisense ALAS-E RNA was expressed (AS clone), sense ALAS-E mRNA levels in both untreated and dimethylsulfoxide (DMSO)-treated cells were decreased compared with their respective controls. Heme synthesis in AS clones was decreased in proportion to the suppressed levels of ALAS-E mRNA. In addition, mRNAs for ALA dehydratase, porphobilinogen deaminase, ferrochelatase (FeC), and beta-globin were also decreased in AS clones. There was a strong correlation between the level of ALAS-E mRNA and most of the mRNAs of the heme pathway enzymes and beta-globin. There was a decrease in the mRNA level of p45, but not of mafK, which are the large and the small subunits of NF-E2, respectively, in AS clones. Treatment of AS cells with hemin and ALA in the presence of DMSO partially restored the suppressed mRNA levels for beta-globin and FeC and heme content, respectively. These findings thus indicate that heme formation, which is determined by the level of ALAS-E, plays an essential role on gene expression of many proteins necessary for erythroid development. PMID:7620186

  13. Genomic structure and sequence polymorphism of E,E-alphafarnesene synthase gene in apples (Malus domestica Borkh.)

    2008-01-01

    Primer pairs were designed to amplify the genomic DNA sequence of the alpha-farnesene synthase (AFS) gene by PCR.The PCR products were sequenced,spliced and compared to Cdna sequences in the GenBank (accession No.AY182241).The genomic sequence and intron-exon organization of the AFS gene were thus obtained.The AFS genomic sequence has been registered in the GenBank (accession No.DQ901739).It has 6 introns and 7 exons,encoding a protein of 576 amino acids.The sizes of the 6 introns were 108 bp,113 bp,>1000 bp,125 bp,220 bp and 88 bp,and their phases were 0,1,2,2,0,0,respectively.The sizes of the deduced amino acids of the 7 exons were 57,89,127,73,48,83 and 99,respectively.The AFS protein contained three motifs:the RR(X8)W motif encoded by a sequence in exon 1,and the RxR motif and DDxxD motif encoded by two sequences in exon 4.After comparing the AFS genomic sequence (accession No.DQ901739) to the Cdna sequence (accession No.AY523409) in the GenBank,it was found that there were 6 single-nucleotide polymorphisms between the two sequences,four of which caused mutations at the amino acid level.Interestingly,one amino acid mutation (291R→G) was found in the RxR motif,and further investigation is needed to determine whether the alpha-farnesene synthesis ability and superficial scald susceptibility of apples are influenced by this amino acid mutation and other mutations.

  14. Overexpression of a Potato Sucrose Synthase Gene in Cotton Accelerates Leaf Expansion,Reduces Seed Abortion, and Enhances Fiber Production

    Shou-Min Xu; Elizabeth Brill; Danny J.Llewellyn; Robert T.Furbank; Yong-Ling Ruan

    2012-01-01

    Sucrose synthase (Sus) is a key enzyme in the breakdown of sucrose and is considered a biochemical marker for sink strength,especially in crop species,based on mutational and gene suppression studies.It remains elusive,however,whether,or to what extent,increase in Sus activity may enhance sink development.We aimed to address this question by expressing a potato Sus gene in cotton where Sus expression has been previously shown to be critical for normal seed and fiber development.Segregation analyses at T1 generation followed by studies in homozygous progeny lines revealed that increased Sus activity in cotton (1) enhanced leaf expansion with the effect evident from young leaves emerging from shoot apex; (2) improved early seed development,which reduced seed abortion,hence enhanced seed set,and (3) promoted fiber elongation.In young leaves of Sus overexpressing lines,fructose concentrations were significantly increased whereas,in elongating fibers,both fructose and glucose levels were increased.Since hexoses contribute little to osmolality in leaves,in contrast to developing fibers,it is concluded that high Sus activity promotes leaf development independently of osmotic regulation,probably through sugar signaling.The analyses also showed that doubling the Sus activity in 0-d cotton seeds increased their fresh weight by about 30%.However,further increase in Sus activity did not lead to any further increase in seed weight,indicating an upper limit for the Sus overexpression effect.Finally,based on the observed additive effect on fiber yield from increased fiber length and seed number,a new strategy is proposed to increase cotton fiber yield by improving seed development as a whole,rather than solely focusing on manipulating fiber growth.

  15. Effect of Dexamethasone on Nitric Oxide Synthase and Caspase-3 Gene Expressions in Endotoxemia in Neonate Rat Brain

    HUA WANG; YU-BIN WU; XIU-HUA DU

    2005-01-01

    Objective To investigate the gene and protein expressions of three isoforms of nitric oxide synthase (NOS) and gene expression of Caspase-3, and effect of dexamethasone on them in neonatal rats with lipopolysaccharide (LPS)-induced endotoxemic brain damage. Methods Expressions of the three isoforms of NOS and caspase-3 mRNA in the brain were investigated by RT-PCR in postnatal 7-day wistar rats with acute endotoxemia by intraperitoneal administration of LPS. Regional distributions of NOSs were examined by immunohistochemical technique. Results nNOS and Caspase-3 mRNA were obviously detected. eNOS mRNA was faintly expressed, but iNOS mRNA was undetectable in the control rat brain. The expressions of NOS mRNA of three isoforms were weak 2 h after LPS (5 mg/mg) delivery, peaked at 6 h, and thereafter, reduced gradually up to 24 h. The expression intensity was in the order of nNOS> iNOS> eNOS. Widespread nNOS, scattered eNOS distribution and negative iNOS were identified in the control rat brain and all isoforms of NOS could be induced by LPS which reached the apex at 24 h in the order of nNOS> iNOS> eNOS as detected by immunostaining. Although Caspase-3 mRNA could be found in all groups, DNA fragmentation was only seen at 6 h and 24 h. The expressions of NOS and Caspase-3 mRNA were inhibited in the rat brain when dexamethasone was administrated. Conclusion LPS-induced NO production induces apoptosis of neurons through mechanism involving the Caspase-3 activation, which may play an important role in the pathogenesis of brain damage during endotoxemia, and neuro-protective effects of dexamethasone may be partially realized by inhibiting the expression of NOS mRNA.

  16. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters.

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  17. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  18. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook

    2008-01-01

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of...

  19. A novel 3-base deletion (IVS3+2_4delTGG of the hydroxymethylbilane synthase gene in a Brazilian patient with acute intermittent porphyria

    Georgina Severo Ribeiro

    2007-01-01

    Full Text Available Acute intermittent porphyria (AIP, OMIM 176000 is an autosomal dominant metabolic disease caused by mutations in the gene encoding hydroxymethylbilane synthase (HMBS; EC 4.3.1.8; formely named porphobilinogen deaminase, PBGD, mapped to chromosome 11q23.3. We describe a novel mutation of the HMBS gene, a de novo 3-base deletion in the splicing donor site of intron 3 (IVS3+2_4delTGG in a woman affected by AIP. RT-PCR analysis revealed an abnormal HMBS mRNA, compatible with exon 3 skipping.

  20. An intron in the thymidylate synthase gene of Bacillus bacteriophage beta 22: evidence for independent evolution of a gene, its group I intron, and the intron open reading frame.

    Bechhofer, D H; Hue, K K; Shub, D A

    1994-11-22

    The thymidylate synthase gene (thy) (EC 2.1.1.45) of Bacillus subtilis bacteriophage beta 22 has a self-splicing, group I intron inserted into a highly conserved region of the coding sequence. The intron is very similar to one that is inserted 21 bp further downstream in the homologous thymidylate synthase gene (td) of Escherichia coli bacteriophage T4. In contrast, the amino acid sequences of the bacteriophage thymidylate synthases are highly divergent. The beta 22 intron has a fragmentary open reading frame (ORF) that encodes a putative helix-turn-helix DNA-binding motif, similar to one at the carboxyl terminus of the homing endonuclease (I-TevI) encoded by the T4 td intron. The td ORF and the thy ORF fragments are inserted into different regions of their respective intron structures. These results suggest that the thymidylate synthase genes, their introns, and their respective intron-ORFs all have separate evolutionary histories and that the acquisition of the intron could not have occurred by a simple homing event. PMID:7972121

  1. Molecular characterization of glutathione S-transferase, endothelial nitric oxide synthase and Vitamin D receptor genes in breast cancer cases

    Rizk El-Baz(1; Azza Ismail(2 ; Maher Amer(2; Mai Elshahat(3; Amira Kazamel(2; Ahmad Settin

    2012-10-01

    Full Text Available Background: Enzymes of the Glutathione S-transferase system (GST modulate the effects of exposure to several cytotoxic and genotoxic agents. Nitric oxide (NO is constitutively synthesized in the endothelium by endothelial nitric oxide synthase (eNOS and acts as a pleiotropic regulator involved in carcinogenesis. Vitamin D levels may influence breast cancer development. The vitamin D receptor (VDR is a crucial mediator for the cellular effects of vitamin D and additionally interacts with other cell-signaling pathways that influence cancer development. Objectives: To check for the association of polymorphisms of GST, eNOS3 and VDR genes with the susceptibility and severity of breast cancer in Egyptian cases. Subjects: This work included 100 cases with breast cancer and 100 healthy individuals. The mean age of cases was 48.31±11.40 years. They included 100 females.Methods: DNA was amplified using PCR-RFLP for detection of polymorphisms related to eNOS3 and VDR , also DNA was amplified using PCR-SSP for detection of polymorphisms related to GST and calculating the odds ratios and their 95% confidence intervals.Results: Total cases showed high significant frequency of eNOS3-786 CC (P<0.05, OR=18.58 genotypes, GSTT1(null (OR = 2.68; CI 95%=1.51-4.75; p=0.001. These were considered risk genotypes for disease susceptibility. On the other hand, total cases showed low significant frequency with homozygosity for eNOS3-786 TT (P=0.01 and the GSTT1 gene was present in 42.0% of the cancers and in 66.0% of controls (OR = 0.37; CI 95%= 0.21-0.66; p=0.001. These may be considered low risk genotypes. No significant difference in frequencies of null and present genotypes of GSTM1 and VDR FOKI in total cases compared to controls. Conclusions: Polymorphisms related to eNOS3-786, GSTT1 and VDR FOKI genes may be considered genetic markers for BC among Egyptian cases. This may have potential impact on family counselling as well as future management plans.

  2. Down regulation of ethylene biosynthesis in apples. Cloning and sequencing of the partial ACC synthase gene in the McIntosh cultivar

    Ethylene is a plant hormone that regulates many aspects of plant growth, development and senescence. 1-aminocyclopropane-1-carboxylate (ACC) synthase has been identified as the key enzyme in the biosynthesis of ethylene. Down regulation of ethylene biosynthesis via transformation with the antisense ACC synthase gene (as has already been proved with tomato) might lengthen the storability of apple. To produce the antisense gene of the apple, RNA was isolated from the McIntosh cultivar and the cDNA synthesized. The cDNA template was amplified by polymerase chain reaction (PCR) using ACC specific primers that have been found to be highly conserved in several plant species. PCR resulted in a 1.1 kb DNA band, which was cloned and sequenced. Sequenced analysis of the McIntosh clones (K1, G1, G2, G3, G4) showed a similarity of 63.5-71.6% with the apple ACC synthase known so far and found comparable homology with the ACC syntheses of other plant species in the databank. 8 refs, 2 tabs

  3. Prevalence of glucose-6-phosphate dehydrogenase deficiency and diagnostic challenges in 1500 immigrants in Denmark examined for haemoglobinopathies.

    Warny, Marie; Klausen, Tobias Wirenfeldt; Petersen, Jesper; Birgens, Henrik

    2015-09-01

    Similar to the thalassaemia syndromes, glucose-6-phosphate dehydrogenase (G6PD) deficiency is highly prevalent in areas historically exposed to malaria. In the present study, we used quantitative and molecular methods to determine the prevalence of G6PD deficiency in a population of 1508 immigrants in Denmark. We found the allele frequency to be between 2.4 and 2.9% in the female immigrants. Furthermore, the mutation pattern in the studied population showed a high prevalence of the G6PD A-(202A) variant in African and African-American immigrants, a high prevalence of the G6PD Mediterranean variant in Mediterranean European and Western Asian immigrants, and substantial heterogeneity in the variants found in the Eastern Asian/Pacific immigrants. Inasmuch as many of the patients included in this investigation had various thalassaemic syndromes, we were able to evaluate the effects of the interaction between a low mean corpuscular haemoglobin (MCH) value and G6PD activity, particularly in heterozygous females. The activity level was markedly influenced by the MCH value in females with normal G6PD activity, but not in heterozygous and homozygous females. Comparison of patients with normal G6PD activity and heterozygous females indicated considerable overlap in activity levels. To help separating heterozygous females from females with wild-type genes, a DNA analysis is necessary when the female activity level is between 4.0 and 4.9 U/g hgb corresponding to 50-60% of the median activity of unaffected males. PMID:25925739

  4. Jinggangmycin increases fecundity of the brown planthopper, Nilaparvata lugens (Stål) via fatty acid synthase gene expression.

    Li, Lei; Jiang, Yiping; Liu, Zongyu; You, Linlin; Wu, You; Xu, Bing; Ge, Linquan; Stanley, David; Song, Qisheng; Wu, Jincai

    2016-01-01

    The antibiotic jinggangmycin (JGM) is mainly used in controlling the rice sheath blight, Rhizoctonia solani, in China. JGM also enhances reproduction of the brown planthopper (BPH), Nilaparvata lugens (Stål). To date, however, molecular mechanisms of the enhancement are unclear. Our related report documented the influence of foliar JGM sprays on ovarian protein content. Here, we used isobaric tags for relative and absolute quantitation (iTRAQ) protocols to analyze ovarian proteins of BPH females following JGM spray (JGM-S) and topical application (JGM-T). We recorded changes in expression of 284 proteins (142↑ and 142↓) in JGM-S compared to the JGM-S control group (S-control); 267 proteins were differentially expressed (130↑ and 137↓) in JGM-T compared to the JGM-T control group (T-control), of which, 22 proteins were up-regulated in both groups. Comparing the JGM-S to the JGM-T group, 114 proteins were differentially expressed (62↑ and 52↓). Based on the biological significance of fatty acids, pathway annotation and enrichment analysis, we designed a dsRNA construct to silence a gene encoding fatty acid synthase (FAS). FAS was more highly expressed in JGM-S vs S-control and JGM-S vs JGM-T groups. The dsFAS treatment reduced fecundity by about 46% and reduced ovarian and fat body fatty acid concentrations in JGM-S-treated females relative to controls. We infer FAS provides critically needed fatty acids to support JGM-enhanced fecundity in BPH. PMID:26388431

  5. Nitric oxide synthase inhibitors can antagonize neurogenic and calcitonin gene-related peptide induced dilation of dural meningeal vessels

    Akerman, S; Williamson, D J; Kaube, H; Goadsby, P J

    2002-01-01

    The detailed pathophysiology of migraine is beginning to be understood and is likely to involve activation of trigeminovascular afferents. Clinically effective anti-migraine compounds are believed to have actions that include peripheral inhibition of calcitonin gene-related peptide (CGRP) release from trigeminal neurones, or preventing dural vessel dilation, or both. CGRP antagonists can block both neurogenic and CGRP-induced dural vessel dilation. Nitric oxide (NO) can induce headache in migraine patients and often triggers a delayed migraine. The initial headache is thought to be caused via a direct action of the NO–cGMP pathway that causes vasodilation by vascular smooth muscle relaxation, while the delayed headache is likely to be a result of triggering trigeminovascular activation. Nitric oxide synthase (NOS) inhibitors are effective in the treatment of acute migraine. The present studies used intravital microscopy to examine the effects of specific NOS inhibitors on neurogenic dural vasodilation (NDV) and CGRP-induced dilation. The non-specific and neuronal NOS (nNOS) inhibitors were able to partially inhibit NDV, while the non-specific and endothelial NOS (eNOS) inhibitors were able to partially inhibit the CGRP induced dilation. There was no effect of the inducible NOS (iNOS) inhibitor. The data suggest that the delayed headache response triggered by NO donors in humans may be due, in part, to increased nNOS activity in the trigeminal system that causes CGRP release and dural vessel dilation. Further, eNOS activity in the endothelium causes NO production and smooth muscle relaxation by direct activation of the NO–cGMP pathway, and may be involved in the initial headache response. PMID:12183331

  6. In vivo gene transfer of endothelial nitric oxide synthase decreases portal pressure in anaesthetised carbon tetrachloride cirrhotic rats

    Van de Casteele, M; Omasta, A; Janssens, S; Roskams, T; Desmet, V; Nevens, F; Fevery, J

    2002-01-01

    Background: Portal hypertension in cirrhosis results from enhanced intrahepatic resistance to an augmented inflow. The former is partly due to an imbalance between intrahepatic vasoconstriction and vasodilatation. Enhanced endothelin-1 and decreased activity of hepatic constitutive endothelial nitric oxide synthase (NOS 3) was reported in carbon tetrachloride (CCl4) cirrhotic rat liver. Aims: To study whether an increase in hepatic NOS 3 could be obtained in the CCl4 cirrhotic rat liver by in vivo cDNA transfer and to investigate a possible effect on portal pressure. Methods: Hepatic NOS 3 immunohistochemistry and western blotting were used to measure the amount of NOS 3 protein. Recombinant adenovirus, carrying cDNA encoding human NOS 3, was injected into the portal vein of CCl4 cirrhotic rats. Cirrhotic controls received carrier buffer, naked adenovirus, or adenovirus carrying the lac Z gene. Results: NOS 3 immunoreactivity and amount of protein (western blotting) were significantly decreased in CCl4 cirrhotic livers. Following cDNA transfer, NOS 3 expression and the amount of protein were partially restored. Portal pressure was 11.4 (1.6) mm Hg in untreated cirrhotic (n=9) and 11.8 (0.6) in lac Z transfected (n=4) cirrhotic rats but was reduced to 7.8 (1.0) mm Hg (n=9) five days after NOS 3 cDNA transfer. No changes were observed in systemic haemodynamics, in liver tests or urinary nitrates, or in NOS 3 expression in lung or kidney, indicating a highly selective transfer. Conclusions: NOS 3 cDNA transfer to cirrhotic rat liver is feasible and the increase in hepatic NOS 3 leads to a marked decrease in portal hypertension without systemic effects. These data indicate a major haemodynamic role of intrahepatic NOS 3 in the pathogenesis of portal hypertension in CCl4 cirrhosis. PMID:12171971

  7. Novel alleles of 31-bp VNTR polymorphism in the human cystathionine -synthase (CBS) gene were detected in healthy Asians

    Yik-Yuen Gan; Chuan-Fei Chen

    2010-12-01

    A 31-bp variable number of tandem repeats (VNTR) polymorphism of the cystathionine -synthase (CBS) gene was earlier reported in Caucasians of predominantly European descent and Indo–Caucasoid populations.We report here for the first time, the detection of allele 20, which was absent in Caucasian and Indo–Caucasoid populations, as a common allele present in Singaporean Chinese (6.25%), Indians (11.7%), and Malays (11.5%). Hence, allele 20 might be a specific allele for Asian populations. A relatively common allele 19 found in the Caucasian and Indo–Caucasoid populations (10.4%–10.6%) was absent in the Asian samples of this study. Therefore, allele 19 might be a specific allele for the Caucasian populations. A novel and rare allele 13, which was not reported before in the Caucasian and Indo–Caucasoid populations, was found in 0.5% of Singaporean Chinese as genotype 13/17 heterozygotes. The presence of alleles 13 and 20 were verified by DNA sequencing. There were five new genotypes (13/17, 16/20, 17/20, 18/20 and 20/20) not reported before in the Caucasian and Indo–Caucasoid populations, detected in this study. Nine genotypes (15/18, 16/18, 16/21, 17/19, 18/19, 18/21, 19/19, 19/21 and 21/21) which were present in the Caucasian and/or Indo–Caucasoid populations were absent in this study. Our results showed that CBS 31-bp VNTR polymorphism has a distinct genetic difference in allele and genotype frequencies between the European Caucasians, Indo–Caucasoid and Asian populations.

  8. Expression of Biphenyl Synthase Genes and Formation of Phytoalexin Compounds in Three Fire Blight-Infected Pyrus communis Cultivars

    Chizzali, Cornelia; Swiddan, Asya K.; Abdelaziz, Sahar; Gaid, Mariam; Richter, Klaus; Fischer, Thilo C.; Liu, Benye; Beerhues, Ludger

    2016-01-01

    Pear (Pyrus communis) is an economically important fruit crop. Drops in yield and even losses of whole plantations are caused by diseases, most importantly fire blight which is triggered by the bacterial pathogen Erwinia amylovora. In response to the infection, biphenyls and dibenzofurans are formed as phytoalexins, biosynthesis of which is initiated by biphenyl synthase (BIS). Two PcBIS transcripts were cloned from fire blight-infected leaves and the encoded enzymes were characterized regarding substrate specificities and kinetic parameters. Expression of PcBIS1 and PcBIS2 was studied in three pear cultivars after inoculation with E. amylovora. Both PcBIS1 and PcBIS2 were expressed in ‘Harrow Sweet’, while only PcBIS2 transcripts were detected in ‘Alexander Lucas’ and ‘Conference’. Expression of the PcBIS genes was observed in both leaves and the transition zone of the stem; however, biphenyls and dibenzofurans were only detected in stems. The maximum phytoalexin level (~110 μg/g dry weight) was observed in the transition zone of ‘Harrow Sweet’, whereas the concentrations were ten times lower in ‘Conference’ and not even detectable in ‘Alexander Lucas’. In ‘Harrow Sweet’, the accumulation of the maximum phytoalexin level correlated with the halt of migration of the transition zone, whereby the residual part of the shoot survived. In contrast, the transition zones of ‘Alexander Lucas’ and ‘Conference’ advanced down to the rootstock, resulting in necrosis of the entire shoots. PMID:27410389

  9. Characterization and Role of Glucose-6-phosphate Dehydrogenase of Populus suaveolens in Induction of Freezing Resistance

    Lin Yuanzhen; Guo Huan; Liu Wenfeng; Lin Shanzhi; Zhang Qian; Hu Dongmei; Zhu Baoqing; Zhang Zhiyi

    2004-01-01

    Glucose-6-phosphate dehydrogenase (G6PDH, EC 1.1.1.49) was purified from the leaves of 8-week-old Populus suaveolens cuttings. The enzyme activity in the absence and presence of reduced dithiothreitol (DTTred) was determined. The results show that the G6PDH activity is not inactivated by pre-incubation with DTTred, indicating that the purified enzyme probably presented in cytosol of P. suaveolens. The catalytic characteristics and kinetic parameters of cytosolic G6PDH purified from P. suaveolens cuttings were also studied. The results show that G6PDH is characterized by Km value of 360 (mol·L-1 for G6P and 16 (mol·L-1 for NADP, a pH range of 7.3-8.9, and the maximum activity around pH 8.2. The enzyme activity is inhibited by various metabolites such as NADPH, NADH, GTP, UTP, ATP, AMP, ADP, CoA, acetyl CoA, fructose-6-phosphate (F6P), erythrose-4-phosphate (E4P), ribose-5-phosphate (R5P) and 3-phosphoglycerate (3-PG) (all at 1 mmol·L-1 except for NADPH and NADH) to different extents. NADPH is the most effective inhibitor of enzyme activity, with an inhibition of 72.0%. The addition of metal ions such as MgCl2, CaCl2 and KCl (all 1.0 mmol·L-1) to the standard reaction mixture has no remarkable influence on the cytosolic G6PDH activity. However, CdCl2 (1.0 mmol·L-1) causes high inhibitory effect on the enzyme activity. To explore the role of G6PDH on the enhancement of freezing resistance induced by freezing acclimation, the changes in the cytosolic G6PDH activity and freezing resistance (expressed as LT50) of P. suaveolens cuttings during freezing acclimation at -20 °C were investigated. The results reveal that freezing acclimation decreases LT50 of cuttings, and increases the activity of cytosolic G6PDH compared with control ones, while 2 d of de-acclimation at 25 °C result in a decrease in cytosolic G6PDH activity, and caused an increase in LT50. Furthermore, the change in cytosolic G6PDH activity is found to be closely correlated to the degree of freezing

  10. Tetrahydrodipicolinate N-succinyltransferase and dihydrodipicolinate synthase from Pseudomonas aeruginosa: structure analysis and gene deletion.

    Robert Schnell

    Full Text Available The diaminopimelic acid pathway of lysine biosynthesis has been suggested to provide attractive targets for the development of novel antibacterial drugs. Here we report the characterization of two enzymes from this pathway in the human pathogen Pseudomonas aeruginosa, utilizing structural biology, biochemistry and genetics. We show that tetrahydrodipicolinate N-succinyltransferase (DapD from P. aeruginosa is specific for the L-stereoisomer of the amino substrate L-2-aminopimelate, and its D-enantiomer acts as a weak inhibitor. The crystal structures of this enzyme with L-2-aminopimelate and D-2-aminopimelate, respectively, reveal that both compounds bind at the same site of the enzyme. Comparison of the binding interactions of these ligands in the enzyme active site suggests misalignment of the amino group of D-2-aminopimelate for nucleophilic attack on the succinate moiety of the co-substrate succinyl-CoA as the structural basis of specificity and inhibition. P. aeruginosa mutants where the dapA gene had been deleted were viable and able to grow in a mouse lung infection model, suggesting that DapA is not an optimal target for drug development against this organism. Structure-based sequence alignments, based on the DapA crystal structure determined to 1.6 Å resolution revealed the presence of two homologues, PA0223 and PA4188, in P. aeruginosa that could substitute for DapA in the P. aeruginosa PAO1ΔdapA mutant. In vitro experiments using recombinant PA0223 protein could however not detect any DapA activity.

  11. Neonatal screening for sickle cell disease, Glucose-6-PhosphateDehydrogenase deficiency and Alpha-Thalassemia in Qatif and Al-Hasa

    Screening programs to determine the frequency of sickle cell,glucose-6-phosphate dehydrogenase deficiency and alpha-thalassemia gene areavailable in Saudi Arabia, although not used frequently. Greater use of theseprograms will decrease the morbidity and mortality of Saudi children affectedby these disorders. Neonatal hemoglobin electrophoresis andglucose-6-dehydrogenase fluorescent spot tests were performed on new bornbabies delivered between December 1992 and December 1993 at the Qatif CentralHospital and at the King Fahd Hospital in Al-Hasa. Cord blood samples werecollected from babies born in these two hospitals. Babies born in otherhospitals had blood collected in their first visit to Qatif primary carecenters at the time of vaccination. All specimens were sent to Dammam CentralLaboratory. The diagnosis of sickle cell and alpha-thalassemia was based oncellulose acetate electrophoresis and confirmed by agar gel electrophoresisand glucose-6-phosphate dehydrgenase was confirmed by fluorescent spot test.A total of 12,220 infants, including 11,313 Saudis (92.6%), were screenedover a 12-month period. The common phenotype detected in these infantsincluded AF, SFA, SFA Bart's, FS and FS Bart's. In Saudi infants, homozygoussickle cell disease was detected in 2.35% and 1.08% in Qatif and Al-Hasa,respectively. The frequencies of sickle cell gene were 0.1545% and 0.1109% inQatif and Al-Hasa. Alpha-thalassemia genes based on an elevated level of HbBart's were 28% and 16.3% in Qatif and Al-Hasa. The screening for G6PDdeficiency revealed a high prevalence of 30.6% and 14.7% in Qatif andAl-Hasa. In the non-Saudi infants the frequencies were low. The outcome ofthis study indicates that the Saudi populations in Qatif and Al-Hasa are atrisk for hemoglobinopathies and G6PD. Neonatal screening programs areessential and cost effective and should be maintained as a routine practice.(author)

  12. Biosynthesis of Akaeolide and Lorneic Acids and Annotation of Type I Polyketide Synthase Gene Clusters in the Genome of Streptomyces sp. NPS554

    Tao Zhou

    2015-01-01

    Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.

  13. Antioxidant vitamins and glucose-6-phosphate dehydrogenase deficiency in full-term neonates

    Obediat, Ahmad D.

    2008-09-01

    Full Text Available Objective: The mechanism by which glucose-6-phosphate dehydrogenase (G6PD deficiency causes neonatal hyperbilirubinemia is not completely understood. However, the genetic disorder G6PD deficiency predisposes red blood cells to oxidative stress. The aim of this study was to establish the relationship between plasma antioxidant vitamin (E and C levels and the development of hyperbilirubinemia in full-term neonates with deficient G6PD. Methods: A total of 196 live birth neonates of healthy mothers were included in this study. Twelve of them were deficient in G6PD. In addition to demographic data, serum total bilirubin, hemoglobin, hematocrit, and vitamin E and C levels were measured on the first day after birth.Results: Neonates with G6PD deficiency (n=7 who did not develop hyperbilirubinemia (mean serum bilirubin level of 70.8±23 µmol/l, median 71.8 and neonates with G6PD deficiency (n=4 who developed hyperbilirubinemia (mean serum bilirubin level of 226.7±79 µmol/l, median 233.4 on the first day of life had similar gestational weights and age. The second group, however, had lower hemoglobin and hematocrit as well as plasma vitamin C and E levels. None of these results showed significant difference. Conclusion: The results of the present study indicate that red blood cell hemolysis as a result of inadequate antioxidants system in G6PD-deficient neonates is not the only contributing factor for hyperbilirubinemia.

  14. Glucose-6-phosphate dehydrogenase screening of babies born in a tertiary care hospital in West Bengal

    Sukamal Bisoi

    2012-01-01

    Full Text Available About 400 million individuals worldwide have been affected by the inherited disorder of glucose-6-phosphate dehydrogenase (G6PD deficiency that predisposes individuals to neonatal jaundice or hemolytic crisis due to drugs or infections. A descriptive observational study with longitudinal design was undertaken among 109 live newborns, delivered in labor room of IPGME and R, Kolkata during the period from June to August 2009. An objective of the study was to estimate the occurrence of G6PD deficiency among newborns and its association with different socio-demographic, clinical and gestational characteristics. 14.68% newborns were found G6PD deficient. This occurrence was not significantly related to gender, religion and ethnicity, consanguineous marriage of the parents, gestational age and birth weight of the baby. Development of severe jaundice (total serum bilirubin >15 mg/dl was found 23.8% among G6PD deficient babies and 12.5% among non-G6PD deficient. This difference was statistically not significant.

  15. Mechanism of glucose-6-phosphate dehydrogenase-mediated regulation of coronary artery contractility.

    Ata, Hirotaka; Rawat, Dhwajbhadur K; Lincoln, Thomas; Gupte, Sachin A

    2011-06-01

    We previously identified glucose-6-phosphate dehydrogenase (G6PD) as a regulator of vascular smooth muscle contraction. In this study, we tested our hypothesis that G6PD activated by KCl via a phosphatase and tensin homologue deleted on chromosome 10 (PTEN)-protein kinase C (PKC) pathway increases vascular smooth muscle contraction and that inhibition of G6PD relaxes smooth muscle by decreasing intracellular Ca(2+) ([Ca(2+)](i)) and Ca(2+) sensitivity to the myofilament. Here we show that G6PD is activated by membrane depolarization via PKC and PTEN pathway and that G6PD inhibition decreases intracellular free calcium ([Ca(2+)](i)) in vascular smooth muscle cells and thus arterial contractility. In bovine coronary artery (CA), KCl (30 mmol/l) increased PKC activity and doubled G6PD V(max) without affecting K(m). KCl-induced PKC and G6PD activation was inhibited by bisperoxo(pyridine-2-carboxyl)oxovanadate (Bpv; 10 μmol/l), a PTEN inhibitor, which also inhibited (P PET-cGMPs (100 nmol/l) diminished 6AN-evoked VASP phosphorylation (P PET-cGMPs increased 6AN-induced relaxation. These findings suggest G6PD inhibition relaxes CA by decreasing Ca(2+) influx, increasing Ca(2+) sequestration, and inhibiting Rho kinase but not by increasing Ca(2+) extrusion or activating PKG. PMID:21398595

  16. D-Fructose-6-phosphate aldolase-catalyzed one-pot synthesis of iminocyclitols.

    Sugiyama, Masakazu; Hong, Zhangyong; Liang, Pi-Hui; Dean, Stephen M; Whalen, Lisa J; Greenberg, William A; Wong, Chi-Huey

    2007-11-28

    A one-pot chemoenzymatic method for the synthesis of a variety of new iminocyclitols from readily available, non-phosphorylated donor substrates has been developed. The method utilizes the recently discovered fructose-6-phosphate aldolase (FSA), which is functionally distinct from known aldolases in its tolerance of different donor substrates as well as acceptor substrates. Kinetic studies were performed with dihydroxyacetone (DHA), the presumed endogenous substrate for FSA, as well as hydroxy acetone (HA) and 1-hydroxy-2-butanone (HB) as donor substrates, in each case using glyceraldehyde-3-phosphate as acceptor substrate. Remarkably, FSA used the three donor substrates with equal efficiency, with kcat/KMvalues of 33, 75, and 20 M-1 s-1, respectively. This level of donor substrate tolerance is unprecedented for an aldolase. Furthermore, DHA, HA, and HB were accepted as donors in FSA-catalyzed aldol reactions with a variety of azido- and Cbz-amino aldehyde acceptors. The broad substrate tolerance of FSA and the ability to circumvent the need for phosphorylated substrates allowed for one-pot synthesis of a number of known and novel iminocyclitols in good yields, and in a very concise fashion. New iminocyclitols were assayed as inhibitors against a panel of glycosidases. Compounds 15 and 16 were specific alpha-mannosidase inhibitors, and 24 and 26 were potent and selective inhibitors of beta-N-acetylglucosaminidases in the submicromolar range. Facile access to these compounds makes them attractive core structures for further inhibitor optimization. PMID:17985886

  17. Nitrogen Assimilation, Abiotic Stress and Glucose 6-Phosphate Dehydrogenase: The Full Circle of Reductants.

    Esposito, Sergio

    2016-01-01

    Glucose 6 phosphate dehydrogenase (G6PDH; EC 1.1.1.49) is well-known as the main regulatory enzyme of the oxidative pentose phosphate pathway (OPPP) in living organisms. Namely, in Planta, different G6PDH isoforms may occur, generally localized in cytosol and plastids/chloroplasts. These enzymes are differently regulated by distinct mechanisms, still far from being defined in detail. In the last decades, a pivotal function for plant G6PDHs during the assimilation of nitrogen, providing reductants for enzymes involved in nitrate reduction and ammonium assimilation, has been described. More recently, several studies have suggested a main role of G6PDH to counteract different stress conditions, among these salinity and drought, with the involvement of an ABA depending signal. In the last few years, this recognized vision has been greatly widened, due to studies clearly showing the non-conventional subcellular localization of the different G6PDHs, and the peculiar regulation of the different isoforms. The whole body of these considerations suggests a central question: how do the plant cells distribute the reductants coming from G6PDH and balance their equilibrium? This review explores the present knowledge about these mechanisms, in order to propose a scheme of distribution of reductants produced by G6PDH during nitrogen assimilation and stress. PMID:27187489

  18. Glucose-6-phosphate dehydrogenase deficiency in northern Mexico and description of a novel mutation

    N. García-Magallanes; F. Luque-Ortega; E. M. Aguilar-Medina; R. Ramos-Payán; C. Galaviz-Hernández; J. G. Romero-Quintana; L. Del Pozo-Yauner; H. Rangel-Villalobos; E. Arámbula-Meraz

    2014-08-01

    Glucose-6-phosphate dehydrogenase deficiency (G6PD) is the most common enzyme pathology in humans; it is X-linked inherited and causes neonatal hyperbilirubinaemia, chronic nonspherocytic haemolytic anaemia and drug-induced acute haemolytic anaemia. G6PD deficiency has scarcely been studied in the northern region of Mexico, which is important because of the genetic heterogeneity described in Mexican population. Therefore, samples from the northern Mexico were biochemically screened for G6PD deficiency, and PCR-RFLPs, and DNA sequencing used to identify mutations in positive samples. The frequency of G6PD deficiency in the population was 0.95% ($n = 1993$); the mutations in 86% of these samples were G6PD A-202A/376G, G6PD A-376G/968C and G6PD Santamaria376G/542T. Contrary to previous reports, we demonstrated that G6PD deficiency distribution is relatively homogenous throughout the country $(P = 0.48336)$, and the unique exception with high frequency of G6PD deficiency does not involve a coastal population (Chihuahua: 2.4%). Analysis of eight polymorphic sites showed only 10 haplotypes. In one individual we identified a new G6PD mutation named Mexico DF193A>G (rs199474830), which probably results in a damaging functional effect, according to PolyPhen analysis. Proteomic impact of the mutation is also described.

  19. [Glucose-6-phosphate dehydrogenase (G6PD) deficiency--a cause of anaemia in pregnant women].

    Kuliszkiewicz-Janus, Małgorzata; Zimny, Anna

    2003-11-01

    Glucose-6-phosphate dehydrogenase (G6PD) is one of the most important cytoprotective enzymes for oxidative stress. The WHO classification of G6PD deficiency, based on enzyme activity and clinical significance, distinguishes five variants. Chronic haemolytic process is rare and the main factors causing haemolysis are: infections, substances derived from plants, drugs with high oxidation-reduction potential, stress, ketoacidosis in diabetes and surgery operations. We report two cases of women belonging to the class 3 of the WHO classification in whom haemolysis occured during pregnancy. One of the patients developed two incidents of haemolytic anaemia. The cause of the first episode, nine months before pregnancy, was probably infection of the urinary tract caused by Escherichia coli, but the influence of the drugs also cannot be excluded. Because of the genetic background of this enzymopathy we also examined members of the patients, families but did not find any evidence of G6PD deficiency among them. The reported cases indicate that haemolytic anaemia caused by G6PD deficiency may occur during pregnancy what can lead to many not only haematological but also serious obstetrical complications such as infertility, fetus malformations and even its death. We also draw attention to several difficulties in diagnosing G6PD deficiency especially during haemolysis. PMID:16737003

  20. Glucose-6-phosphate dehydrogenase in rat lung alveolar epithelial cells. An ultrastructural enzyme-cytochemical study

    S Matsubara

    2010-01-01

    Full Text Available Glucose-6-phosphate dehydrogenase (G6PD is the key enzyme of the pentose phosphate pathway in carbohydrate metabolism, and it plays an important role in cell proliferation and antioxidant regulation within cells in various organs. Although marked cell proliferation and oxidant/antioxidant metabolism occur in lung alveolar epithelial cells, definite data has been lacking as to whether cytochemically detectable G6PD is present in alveolar epithelial cells. The distribution pattern of G6PD within these cells, if it is present, is also unknown. The purpose of the present study was to investigate the subcellular localization of G6PD in alveolar cells in the rat lung using a newly- developed enzyme-cytochemistry (copper-ferrocyanide method. Type I cells and stromal endothelia and fibroblasts showed no activities. Electron-dense precipitates indicating G6PD activity were clearly visible in the cytoplasm and on the cytosolic side of the endoplasmic reticulum of type II alveolar epithelial cells. The cytochemical controls ensured specific detection of enzyme activity. This enzyme may play a role in airway defense by delivering substances for cell proliferation and antioxidant forces, thus maintaining the airway architecture.

  1. Regulation of Aerobic Energy Metabolism in Podospora anserina by Two Paralogous Genes Encoding Structurally Different c-Subunits of ATP Synthase

    Sellem, Carole H.; di Rago, Jean-Paul; Lasserre, Jean-Paul; Ackerman, Sharon H.; Sainsard-Chanet, Annie

    2016-01-01

    Most of the ATP in living cells is produced by an F-type ATP synthase. This enzyme uses the energy of a transmembrane electrochemical proton gradient to synthesize ATP from ADP and inorganic phosphate. Proton movements across the membrane domain (FO) of the ATP synthase drive the rotation of a ring of 8–15 c-subunits, which induces conformational changes in the catalytic part (F1) of the enzyme that ultimately promote ATP synthesis. Two paralogous nuclear genes, called Atp9-5 and Atp9-7, encode structurally different c-subunits in the filamentous fungus Podospora anserina. We have in this study identified differences in the expression pattern for the two genes that correlate with the mitotic activity of cells in vegetative mycelia: Atp9-7 is transcriptionally active in non-proliferating (stationary) cells while Atp9-5 is expressed in the cells at the extremity (apex) of filaments that divide and are responsible for mycelium growth. When active, the Atp9-5 gene sustains a much higher rate of c-subunit synthesis than Atp9-7. We further show that the ATP9-7 and ATP9-5 proteins have antagonist effects on the longevity of P. anserina. Finally, we provide evidence that the ATP9-5 protein sustains a higher rate of mitochondrial ATP synthesis and yield in ATP molecules per electron transferred to oxygen than the c-subunit encoded by Atp9-7. These findings reveal that the c-subunit genes play a key role in the modulation of ATP synthase production and activity along the life cycle of P. anserina. Such a degree of sophistication for regulating aerobic energy metabolism has not been described before. PMID:27442014

  2. Stable transformation of Toxoplasma gondii based on a pyrimethamine resistant trifunctional dihydrofolate reductase-cytosine deaminase-thymidylate synthase gene that confers sensitivity to 5-fluorocytosine.

    Fox, B A; Belperron, A A; Bzik, D J

    1999-01-01

    To improve genetic models available for the analysis of apicomplexan protozoan parasites, bacterial sequences encoding the 427 amino acid cytosine deaminase (CD) gene were fused, in-frame, to an engineered linker domain of the high level pyrimethamine resistant form of the parasite bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene. Toxoplasma gondii was transformed with the plasmid containing the fused pyrimethamine resistant dihydrofolate reductase-cytosine deaminase-thymidylate synthase (DHFRm2m3-CD-TS) gene and parasites were selected in a high level of pyrimethamine. Transfected parasites that acquired resistance to pyrimethamine were cloned and evaluated for expression of the CD genetic marker. CD transgenic parasites acquired a high sensitivity to 5-fluorocytosine due to the intraparasitic conversion of this non-toxic prodrug to the cytotoxic compound 5-fluorouracil. Exogenously supplied cytosine or uracil rescued the growth of CD transgenic T. gondii parasites that were cultured in the presence of cytotoxic concentrations of 5-fluorouracil or 5-fluorocytosine. Bacterial CD fused to the pyrimethamine resistant DHFR-TS marker provides a novel genetic tool for new positive and negative genetic selection strategies in several protozoan parasites. An advantage of the CD genetic marker is that it is derived from a bacterial gene and can therefore be used in nearly any parasite genetic background for negative selection. This novel system should facilitate new approaches for the development of improved model genetic systems for the biological investigation of apicomplexan parasites. PMID:10029312

  3. Prevalence of glucose-6-phosphate dehydrogenase deficiency and diagnostic challenges in 1500 immigrants in Denmark examined for haemoglobinopathies

    Warny, Marie; Klausen, Tobias Wirenfeldt; Petersen, Jesper;

    2015-01-01

    Similar to the thalassaemia syndromes, glucose-6-phosphate dehydrogenase (G6PD) deficiency is highly prevalent in areas historically exposed to malaria. In the present study, we used quantitative and molecular methods to determine the prevalence of G6PD deficiency in a population of 1508 immigrants...

  4. Cloning, expression, purification, crystallization and preliminary X-ray crystallographic analysis of the mannose 6-phosphate isomerase from Salmonella typhimurium

    The cloning, expression, purification, crystallization and preliminary X-ray crystallographic studies of mannose 6-phosphate isomerase from S. typhimurium are reported. Mannose 6-phosphate isomerase (MPI; EC 5.3.1.8) catalyzes the reversible isomerization of d-mannose 6-phosphate (M6P) and d-fructose 6-phosphate (F6P). In the eukaryotes and prokaryotes investigated to date, the enzyme has been reported to play a crucial role in d-mannose metabolism and supply of the activated mannose donor guanosine diphosphate d-mannose (GDP-d-mannose). In the present study, MPI was cloned from Salmonella typhimurium, overexpressed in Escherichia coli and purified using Ni–NTA affinity column chromatography. Purified MPI crystallized in space group P212121, with unit-cell parameters a = 36.03, b = 92.2, c = 111.01 Å. A data set extending to 1.66 Å resolution was collected with 98.8% completeness using an image-plate detector system mounted on a rotating-anode X-ray generator. The asymmetric unit of the crystal cell was compatible with the presence of a monomer of MPI. A preliminary structure solution of the enzyme has been obtained by molecular replacement using Candida albicans MPI as the phasing model and the program Phaser. Further refinement and model building are in progress

  5. Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

    Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)

    1995-08-28

    Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

  6. Plasmodium falciparum clearance with artemisinin-based combination therapy (ACT in patients with glucose-6-phosphate dehydrogenase deficiency in Mali

    Djimde Abdoulaye

    2010-11-01

    Full Text Available Abstract Background Artemisinin-based combination therapy (ACT is currently the most effective medicine for the treatment of uncomplicated malaria. Artemisinin has previously been shown to increase the clearance of Plasmodium falciparum in malaria patients with haemoglobin E trait, but it did not increase parasite inhibition in an in vitro study using haemoglobin AS erythrocytes. The current study describes the efficacy of artemisinin derivatives on P. falciparum clearance in patients with glucose-6-phosphate dehydrogenase deficiency (G6PD, a haemoglobin enzyme deficiency, not yet studied in the same context, but nonetheless is a common in malaria endemic areas, associated with host protection against uncomplicated and severe malaria. The impact of G6PD deficiency on parasite clearance with ACT treatment was compared between G6PD-deficient patients and G6PD-normal group. Methods Blood samples from children and adults participants (1 to 70 years old with uncomplicated P. falciparum malaria residing in Kambila, Mali were analysed. Study participants were randomly assigned to receive either artemether-lumefantrine (Coartem® or artesunate plus mefloquine (Artequin™. A restriction-fragment length polymorphism analysis of PCR-amplified DNA samples was used to identify the (A- allele of the gene mutation responsible for G6PD deficiency (G6PD*A-. 470 blood samples were thus analysed and of these, DNA was extracted from 315 samples using the QIAamp kit for PCR to identify the G6PD*A- gene. Results The DNA amplified from 315 samples using PCR showed that G6PD*A- deficiency was present in 56 participants (17.8%. The distribution of the specific deficiency was 1%, 7% and, 9.8% respectively for homozygous, hemizygous, and heterozygous genotypes. Before treatment, the median parasitaemia and other baseline characteristics (mean haemoglobin, sex and age groups between G6PD deficiency (hemizygous, heterozygous, and homozygous and G6PD-normal participants

  7. Nitric Oxide Synthase Gene Transfer Overcomes the Inhibition of Wound Healing by Sulfur Mustard in a Human Keratinocyte In Vitro Model

    Hiroshi Ishida; Radharaman Ray; Jack Amnuaysirikul; Keiko Ishida; Prabhati Ray

    2012-01-01

    Sulfur mustard (SM) is a chemical warfare agent that causes extensive skin injury. Previously we reported that SM exposure resulted in suppression of inducible nitric oxide synthase (iNOS) expression to inhibit the healing of scratch wounds in a cultured normal human epidermal keratinocyte (NHEK) model. Based on this finding, the present study was to use adenovirus-mediated gene transfer of iNOS to restore the nitric oxide (NO) supply depleted by exposure to SM and to evaluate the effect of N...

  8. Frequency of malaria and glucose-6-phosphate dehydrogenase deficiency in Tajikistan

    Saipphudin Karimov

    2006-06-01

    Full Text Available Abstract Background During the Soviet era, malaria was close to eradication in Tajikistan. Since the early 1990s, the disease has been on the rise and has become endemic in large areas of southern and western Tajikistan. The standard national treatment for Plasmodium vivax is based on primaquine. This entails the risk of severe haemolysis for patients with glucose-6-phosphate dehydrogenase (G6PD deficiency. Seasonal and geographical distribution patterns as well as G6PD deficiency frequency were analysed with a view to improve understanding of the current malaria situation in Tajikistan. Methods Spatial and seasonal distribution was analysed, applying a risk model that included key environmental factors such as temperature and the availability of mosquito breeding sites. The frequency of G6PD deficiency was studied at the health service level, including a cross-sectional sample of 382 adult men. Results Analysis revealed high rates of malaria transmission in most districts of the southern province of Khatlon, as well as in some zones in the northern province of Sughd. Three categories of risk areas were identified: (i zones at relatively high malaria risk with high current incidence rates, where malaria control and prevention measures should be taken at all stages of the transmission cycle; (ii zones at relatively high malaria risk with low current incidence rates, where malaria prevention measures are recommended; and (iii zones at intermediate or low malaria risk with low current incidence rates where no particular measures appear necessary. The average prevalence of G6PD deficiency was 2.1% with apparent differences between ethnic groups and geographical regions. Conclusion The study clearly indicates that malaria is a serious health issue in specific regions of Tajikistan. Transmission is mainly determined by temperature. Consequently, locations at lower altitude are more malaria-prone. G6PD deficiency frequency is too moderate to require

  9. Correlation between Hemolysis and Jaundice in Glucose 6-Phosphate Dehydrogenase Deficient Neonates

    Marzban Asghar

    2009-10-01

    Full Text Available Glucose 6-phosphate dehydrogenase (G6PD deficiency is an enzyme deficiency of the red blood cells and the most important disease of hexose monophosphate pathway. The role of hemolysis in the pathophysiology of neonatal jaundice due to G6PD deficiency is in contencious. Our aim is to study the role of hemolysis in neonatal jaundice associated with G6PD deficiency. This prospective descriptive study has been done on 244 neonates who were admitted with the symptoms and signs of icter to the Ali-Asghar Children Hospital, affiliated to Iran University of Medical Sciences, Tehran, Iran, during April 2006 to April 2007. Two groups of the babies, G6PD-defcient with neonatal jaundice and G6PD-normal with neonatal jaundice, were compared based on the parameters related to hemolysis such as hemoglobin, reticulocyte count and bilirubin level. The criteria of hemolysis in our study were reticulocyte count more than >5% and hemoglobin less than <14 mg/dl. Our data have shown that 14 (5.7% of 244 neonates with the chief complain of icter suffered G6PD-deficiency with high male to female ratio (3.6 to 1. The mean hemoglobin levels and reticulocyte counts (16.72 vs. 16.97 and %2.48 vs. %2.79 respectively did not differ significantly between both groups (P>0.05. The present study indicate, G6PD- deficiency as a major cause of neonatal jaundice "nand hemolysis is not a main determinant of neonatal jaundice in G6PD-deficient babies and most of them have non hemolytic jaundice.

  10. Glucose 6-phosphate dehydrogenase deficient subjects may be better "storers" than donors of red blood cells.

    Tzounakas, Vassilis L; Kriebardis, Anastasios G; Georgatzakou, Hara T; Foudoulaki-Paparizos, Leontini E; Dzieciatkowska, Monika; Wither, Matthew J; Nemkov, Travis; Hansen, Kirk C; Papassideri, Issidora S; D'Alessandro, Angelo; Antonelou, Marianna H

    2016-07-01

    Storage of packed red blood cells (RBCs) is associated with progressive accumulation of lesions, mostly triggered by energy and oxidative stresses, which potentially compromise the effectiveness of the transfusion therapy. Concerns arise as to whether glucose 6-phosphate dehydrogenase deficient subjects (G6PD(-)), ~5% of the population in the Mediterranean area, should be accepted as routine donors in the light of the increased oxidative stress their RBCs suffer from. To address this question, we first performed morphology (scanning electron microscopy), physiology and omics (proteomics and metabolomics) analyses on stored RBCs from healthy or G6PD(-) donors. We then used an in vitro model of transfusion to simulate transfusion outcomes involving G6PD(-) donors or recipients, by reconstituting G6PD(-) stored or fresh blood with fresh or stored blood from healthy volunteers, respectively, at body temperature. We found that G6PD(-) cells store well in relation to energy, calcium and morphology related parameters, though at the expenses of a compromised anti-oxidant system. Additional stimuli, mimicking post-transfusion conditions (37°C, reconstitution with fresh healthy blood, incubation with oxidants) promoted hemolysis and oxidative lesions in stored G6PD(-) cells in comparison to controls. On the other hand, stored healthy RBC units showed better oxidative parameters and lower removal signaling when reconstituted with G6PD(-) fresh blood compared to control. Although the measured parameters of stored RBCs from the G6PD deficient donors appeared to be acceptable, the results from the in vitro model of transfusion suggest that G6PD(-) RBCs could be more susceptible to hemolysis and oxidative stresses post-transfusion. On the other hand, their chronic exposure to oxidative stress might make them good recipients, as they better tolerate exposure to oxidatively damaged long stored healthy RBCs. PMID:27094493

  11. Prevalence of glucose-6-phosphate dehydrogenase deficiency and sickle cell trait among blood donors in Riyadh

    Alabdulaali Mohammed

    2010-01-01

    Full Text Available Background and Aims: Blood donation from glucose-6-phosphate dehydrogenase (G6PD-deficient and sickle cell trait (SCT donors might alter the quality of the donated blood during processing, storage or in the recipient′s circulatory system. The aim of this study was to determine the prevalence of G6PD deficiency and SCT among blood donors coming to King Khalid University Hospital (KKUH in Riyadh. It was also reviewed the benefits and risks of transfusing blood from these blood donors. Materials and Methods: This cross-sectional study was conducted on 1150 blood samples obtained from blood donors that presented to KKUH blood bank during the period April 2006 to May 2006. All samples were tested for Hb-S by solubility test, alkaline gel electrophoresis; and for G6PD deficiency, by fluorescent spot test. Results: Out of the 1150 donors, 23 (2% were diagnosed for SCT, 9 (0.78% for G6PD deficiency and 4 (0.35% for both conditions. Our prevalence of SCT and G6PD deficiency is higher than that of the general population of Riyadh. Conclusion: We recommend to screen all units for G6PD deficiency and sickle cell trait and to defer donations from donors with either of these conditions, unless if needed for special blood group compatibility, platelet apheresis or if these are likely to affect the blood bank inventory. If such blood is to be used, special precautions need to be undertaken to avoid complications in high-risk recipients.

  12. Evaluation of the blue formazan spot test for screening glucose 6 phosphate dehydrogenase deficiency.

    Pujades, A; Lewis, M; Salvati, A M; Miwa, S; Fujii, H; Zarza, R; Alvarez, R; Rull, E; Corrons, J L

    1999-06-01

    Several screening tests for glucose 6 phosphate dehydrogenase (G6PD) deficiency have been reported thus far, and a standardized method of testing was proposed by the International Council for Standardization in Hematology (ICSH). The screening test used in any particular laboratory depends upon a number of factors such as cost, time required, temperature, humidity, and availability of reagents. In this study, a direct comparison between three different G6PD screening methods has been undertaken. In 71 cases (50 hematologically normal volunteers, 9 hemizygous G6PD-deficient males, and 12 heterozygous deficient females), the blue formazan spot test (BFST) was compared with the conventional methemoglobin reduction test (HiRT) and the ICSH-recommended fluorescent spot test (FST-ICSH). In all cases, the results obtained with the three screening tests were correlated with the enzyme activity assayed spectrophotometrically. In hemizygous G6PD-deficient males, all cases were equally detected with the three methods: BFST (4.7-6.64, controls: 11.1-13.4), BMRT (score +3 in all 9 cases), and FST (no fluorescence in 9 cases). In heterozygous G6PD-deficient females, two methods detected 7 out of 12 cases (BFST: 8.71-11.75, controls: 11.1-13.4; and BMRT: score +3 in 7 cases), whereas the FST-ICSH missed all 12 cases that presented a variable degree of fluorescence. Although the sensitivity for G6PD-deficient carrier detection is the same for the BMRT and the BFST, the latter has the advantage of being semiquantitative and not merely qualitative. Unfortunately, none of the three screening tests compared here allowed the detection of the 100% heterozygote carrier state of G6PD deficiency. PMID:10407579

  13. Evaluation of Glucose-6-Phosphate Dehydrogenase Deficiency without Hemolysis in Icteric Newborns

    Farzaneh Eghbalian

    2007-04-01

    Full Text Available Objective: Glucose-6- phosphate dehydrogenase (G6PD deficiency is an inherited deficiency that may be the cause of neonatal jaundice. Our aim was to study the prevalence of G6PD deficiency without hemolysis in relation to neonatal jaundice. Material & Methods: This prospective descriptive study has been conducted on 272 icteric newborns admitted to the Ekbatan Hospital from October 2002 to September 2004. The dataset included: age, sex, total and direct bilirubin, hemoglobin, reticulocyte count, blood group and Rh of mother and newborn, direct Coombs, G6PD level and the type of treatment. All data was analyzed by using statistical method. Findings: From 272 neonates, 12 neonates (4.4% were found to have G6PD deficiency. The male to female ratio was 5 to 1 (10 male and 2 female neonates. From 12 neonates with G6PD deficiency, hemolysis was seen in 5 neonates (41.7% and the rate of G6PD deficiency without hemolysis was 2.6%. There was no difference in the mean bilirubin level, hemoglobin level and also reticulocyte count between patients with G6PD deficiency and those without G6PD deficiency (p>0.05. Out of 12 patients with G6PD deficiency, 2 patients (16.7% had blood exchange transfusion. Rh and ABO incompatibility were not seen in any of the12 patients with G6PD deficiency. Conclusion: In this study the prevalence of G6PD deficiency in icteric newborns was considerably high and most of them were non hemolytic, so we recommend G6PD test as a screening program for every newborn at the time of delivery.

  14. Glucose-6-Phosphate Dehydrogenase Regulation in Anoxia Tolerance of the Freshwater Crayfish Orconectes virilis

    Benjamin Lant

    2011-01-01

    Full Text Available Glucose-6-phosphate dehydrogenase (G6PDH, the enzyme which catalyzes the rate determining step of the pentose phosphate pathway (PPP, controls the production of nucleotide precursor molecules (R5P and powerful reducing molecules (NADPH that support multiple biosynthetic functions, including antioxidant defense. G6PDH from hepatopancreas of the freshwater crayfish (Orconectes virilis showed distinct kinetic changes in response to 20 h anoxic exposure. Km values for both substrates decreased significantly in anoxic crayfish; Km NADP+ dropped from 0.015±0.008 mM to 0.012±0.008 mM, and Km G6P decreased from 0.13±0.02 mM to 0.08±0.007 mM. Two lines of evidence indicate that the mechanism involved is reversible phosphorylation. In vitro incubations that stimulated protein kinase or protein phosphatase action mimicked the effects on anoxia on Km values, whereas DEAE-Sephadex chromatography showed the presence of two enzyme forms (low- and high-phosphate whose proportions changed during anoxia. Incubation studies implicated protein kinase A and G in mediating the anoxia-responsive changes in G6PDH kinetic properties. In addition, the amount of G6PDH protein (measured by immunoblotting increased by ∼60% in anoxic hepatopancreas. Anoxia-induced phosphorylation of G6PDH could contribute to modifying carbon flow through the PPP under anoxic conditions, potentially maintaining NADPH supply for antioxidant defense during prolonged anoxia-induced hypometabolism.

  15. Glutathione metabolism and glucose 6-phosphate dehydrogenase activity in experimental liver injury.

    Watanabe,Akiharu

    1983-12-01

    Full Text Available Increased activities of liver glucose-6-phosphate dehydrogenase (G6PD, EC 1.1.1.49 and 6-phosphogluconate dehydrogenase (6PGD, EC 1.1.1.44 in the pentose phosphate cycle were accompanied with a depletion of reduced glutathione (GSH following an intragastric administration of carbon tetrachloride (CCl4 to rats. Oxidized glutathione (GSSG also decreased remarkably, keeping the GSSG: GSH ratio constant. No significant alteration of glutathione reductase (EC 1.6.4.2., glutathione peroxidase (EC 1.11.1.9 and malic enzyme (EC 1.1.1.40 activities in the supernatant and gamma-glutamyl transpeptidase (gamma-GTP, EC 2.3.2.2 activity in the homogenate of the injured liver were observed. Furthermore, no marked difference in the GSH-synthesizing activity was found between control and CCl4-intoxicated liver. An intraperitoneal injection of GSH produced a significant increase in liver GSH content in control rats but not in CCl4-treated rats; G6PD activity was not affected. Intraperitoneal injections of diethylmaleate resulted in continuously diminished levels of liver GSH without any alteration of liver G6PD activity. In vitro disappearance of GSH added to the liver homogenate from CCl4-treated rats occurred enzymatically and could not be prevented by the addition of a NADPH-generating system. The results suggest that increased G6PD activity in CCl4-injured liver does not play an important role in the maintenance of glutathione in the reduced form and that the decreased GSH content in the injured liver might be caused by enhanced GSH catabolism not due to gamma-GTP.

  16. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  17. Increased mannosylphosphorylation of N-glycans by heterologous expression of YlMPO1 in glyco-engineered Saccharomyces cerevisiae for mannose-6-phosphate modification.

    Gil, Jin Young; Park, Jeong-Nam; Lee, Kyung Jin; Kang, Ji-Yeon; Kim, Yeong Hun; Kim, Seonghun; Kim, Sang-Yoon; Kwon, Ohsuk; Lim, Yong Taik; Kang, Hyun Ah; Oh, Doo-Byoung

    2015-07-20

    Mannosylphosphorylated N-glycans found in yeasts can be converted to those containing mannose-6-phosphate, which is a key factor for lysosomal targeting. In the traditional yeast Saccharomyces cerevisiae, both ScMNN4 and ScMNN6 genes are required for efficient mannosylphosphorylation. ScMnn4 protein has been known to be a positive regulator of ScMnn6p, a real enzyme for mannosylphosphorylation. On the other hand, YlMpo1p, a ScMnn4p homologue, mediates mannosylphosphorylation in Yarrowia lypolytica without the involvement of ScMnn6p homologues. In this study, we show that heterologous expression of YlMpo1p can perform and enhance mannosylphosphorylation in S. cerevisiae in the absence of ScMnn4p and ScMnn6p. Moreover, the level of mannosylphosphorylation of N-glycans enhanced by YlMpo1p overexpression is much higher than that with ScMnn4p overexpression, and this is highlighted further in Scmnn4- and Scmnn6-disrupted mutants. When YlMpo1p overexpression is applied to glyco-engineered S. cerevisiae in which the synthesis of immunogenic glycans is abolished, a great increase of bi-mannosylphosphorylated glycan is observed. Through an in vitro process involving the uncapping of the outer mannose residue, this bi-mannosylphosphorylated structure is changed to a bi-phosphorylated structure with high affinity for mannose-6-phosphate receptor. The superior ability of YlMpo1p to increase bi-mannosylphosphorylated glycan in yeast shows promise for the production of therapeutic enzymes with improved lysosomal targeting capability. PMID:25907834

  18. Molecular characterization of a cellulose synthase gene (AaxmCesA1) isolated from an Acacia auriculiformis x Acacia mangium hybrid.

    Yong, Seok Yien Christina; Wickneswari, Ratnam

    2013-01-01

    Cellulose is the major component of plant cell walls, providing mechanical strength to the structural framework of plants. In association with lignin, hemicellulose, protein and pectin, cellulose forms the strong yet flexible bio-composite tissue of wood. Wood formation is an essential biological process and is of significant importance to the cellulosic private sector industry. Cellulose synthase genes encode the catalytic subunits of a large protein complex responsible for the biogenesis of cellulose in higher plants. The hybrid Acacia auriculiformis x Acacia mangium represents an important source of tree cellulose for forest-based product manufacturing, with enormous economic potential. In this work, we isolate the first cellulose synthase gene, designated AaxmCesA1, from this species. The isolated full-length AaxmCesA1 cDNA encodes a polypeptide of 1,064 amino acids. Sequence analyses revealed that AaxmCesA1 cDNA possesses the key motif characteristics of a CesA protein. AaxmCesA1 shares more than 75 % amino acid sequence identity with CesA proteins from other plant species. Subsequently, the full-length AaxmCesA1 gene of 7,389 bp with partial regulatory and 13 intron regions was also isolated. Relative gene expression analysis by quantitative PCR in different tissues of the Acacia hybrid, suggests the involvement of the AaxmCesA1 gene in primary cell wall synthesis of rapidly dividing young root cells. Similarity analyses using Blast algorithms also suggests a role in primary cell wall deposition in the Acacia hybrid. Southern analysis predicts that AaxmCesA1 is a member of a multigene family with at least two isoforms in the genome of the Acacia hybrid. PMID:24415841

  19. In vitro silencing of Brugia malayi trehalose-6-phosphate phosphatase impairs embryogenesis and in vivo development of infective larvae in jirds.

    Susheela Kushwaha

    Full Text Available BACKGROUND: The trehalose metabolic enzymes have been considered as potential targets for drug or vaccine in several organisms such as Mycobacterium, plant nematodes, insects and fungi due to crucial role of sugar trehalose in embryogenesis, glucose uptake and protection from stress. Trehalose-6-phosphate phosphatase (TPP is one of the enzymes of trehalose biosynthesis that has not been reported in mammals. Silencing of tpp gene in Caenorhabditis elegans revealed an indispensable functional role of TPP in nematodes. METHODOLOGY AND PRINCIPAL FINDINGS: In the present study, functional role of B. malayi tpp gene was investigated by siRNA mediated silencing which further validated this enzyme to be a putative antifilarial drug target. The silencing of tpp gene in adult female B. malayi brought about severe phenotypic deformities in the intrauterine stages such as distortion and embryonic development arrest. The motility of the parasites was significantly reduced and the microfilarial production as well as their in vitro release from the female worms was also drastically abridged. A majority of the microfilariae released in to the culture medium were found dead. B. malayi infective larvae which underwent tpp gene silencing showed 84.9% reduced adult worm establishment after inoculation into the peritoneal cavity of naïve jirds. CONCLUSIONS/SIGNIFICANCE: The present findings suggest that B. malayi TPP plays an important role in the female worm embryogenesis, infectivity of the larvae and parasite viability. TPP enzyme of B. malayi therefore has the potential to be exploited as an antifilarial drug target.

  20. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    Paez, David, E-mail: dpaez@santpau.cat [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Salazar, Juliana; Pare, Laia [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Pertriz, Lourdes [Department of Radiotherapy, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Targarona, Eduardo [Department of Surgery, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Rio, Elisabeth del [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Barnadas, Agusti; Marcuello, Eugenio [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Baiget, Montserrat [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain)

    2011-12-01

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk

  1. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate

  2. Diversification of genes encoding granule-bound starch synthase in monocots and dicots is marked by multiple genome-wide duplication events.

    Cheng, Jun; Khan, Muhammad Awais; Qiu, Wen-Ming; Li, Jing; Zhou, Hui; Zhang, Qiong; Guo, Wenwu; Zhu, Tingting; Peng, Junhua; Sun, Fengjie; Li, Shaohua; Korban, Schuyler S; Han, Yuepeng

    2012-01-01

    Starch is one of the major components of cereals, tubers, and fruits. Genes encoding granule-bound starch synthase (GBSS), which is responsible for amylose synthesis, have been extensively studied in cereals but little is known about them in fruits. Due to their low copy gene number, GBSS genes have been used to study plant phylogenetic and evolutionary relationships. In this study, GBSS genes have been isolated and characterized in three fruit trees, including apple, peach, and orange. Moreover, a comprehensive evolutionary study of GBSS genes has also been conducted between both monocots and eudicots. Results have revealed that genomic structures of GBSS genes in plants are conserved, suggesting they all have evolved from a common ancestor. In addition, the GBSS gene in an ancestral angiosperm must have undergone genome duplication ∼251 million years ago (MYA) to generate two families, GBSSI and GBSSII. Both GBSSI and GBSSII are found in monocots; however, GBSSI is absent in eudicots. The ancestral GBSSII must have undergone further divergence when monocots and eudicots split ∼165 MYA. This is consistent with expression profiles of GBSS genes, wherein these profiles are more similar to those of GBSSII in eudicots than to those of GBSSI genes in monocots. In dicots, GBSSII must have undergone further divergence when rosids and asterids split from each other ∼126 MYA. Taken together, these findings suggest that it is GBSSII rather than GBSSI of monocots that have orthologous relationships with GBSS genes of eudicots. Moreover, diversification of GBSS genes is mainly associated with genome-wide duplication events throughout the evolutionary course of history of monocots and eudicots. PMID:22291904

  3. Polyketide genes in the marine sponge Plakortis simplex: a new group of mono-modular type I polyketide synthases from sponge symbionts.

    Della Sala, Gerardo; Hochmuth, Thomas; Costantino, Valeria; Teta, Roberta; Gerwick, William; Gerwick, Lena; Piel, Jörn; Mangoni, Alfonso

    2013-12-01

    Sponge symbionts are a largely unexplored source of new and unusual metabolic pathways. Insights into the distribution and function of metabolic genes of sponge symbionts are crucial to dissect and exploit their biotechnological potential. Screening of the metagenome of the marine sponge Plakortis simplex led to the discovery of the swf family, a new group of mono-modular type I polyketide synthase/fatty acid synthase (PKS/FAS) specifically associated with sponge symbionts. Two different examples of the swf cluster were present in the metagenome of P. simplex. A third example of the cluster is present in the previously sequenced genome of a poribacterium from the sponge Aplysina aerophoba but was formerly considered orthologous to the wcb/rkp cluster. The swf cluster was also found in six additional species of sponges. Therefore, the swf cluster represents the second group of mono-modular PKS, after the supA family, to be widespread in marine sponges. The putative swf operon consists of swfA (type I PKS/FAS), swfB (reductase and sulphotransferase domains) and swfC (radical S-adenosylmethionine, or radical SAM). Activation of the acyl carrier protein (ACP) domain of the SwfA protein to its holo-form by co-expression with Svp is the first functional proof of swf type genes in marine sponges. However, the precise biosynthetic role of the swf clusters remains unknown. PMID:24249289

  4. Evaluation of Glucose-6-Phosphate Dehydrogenase stability in stored blood samples.

    Jalil, Norunaluwar; Azma, Raja Zahratul; Mohamed, Emida; Ithnin, Azlin; Alauddin, Hafiza; Baya, Siti Noor; Othman, Ainoon

    2016-01-01

    Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency is the commonest cause of neonatal jaundice in Malaysia. Recently, OSMMR2000-D G6PD Assay Kit has been introduced to quantitate the level of G6PD activity in newborns delivered in Universiti Kebangsaan Malaysia Medical Centre (UKMMC). As duration of sample storage prior to analysis is one of the matters of concern, this study was conducted to identify the stability of G6PD enzyme during storage. A total of 188 cord blood samples from normal term newborns delivered at UKMMC were selected for this study. The cord bloods samples were collected in ethylene-diamine-tetra-acetic acid (EDTA) tubes and refrigerated at 2-8 °C. In addition, 32 out of 188 cord blood samples were spotted on chromatography paper, air-dried and stored at room temperature. G6PD enzyme activities were measured daily for 7 days using the OSMMR2000-D G6PD Assay Kit on both the EDTA blood and dried blood samples. The mean value for G6PD activity was compared between days of analysis using Student Paired T-Test. In this study, 172 out of 188 cord blood samples showed normal enzyme levels while 16 had levels corresponding to severe enzyme deficiency. The daily mean G6PD activity for EDTA blood samples of newborns with normal G6PD activity showed a significant drop on the fourth day of storage (p deficient G6PD activity, significant drop was seen on third day of storage (p = 0.002). Analysis of dried cord blood showed a significant reduction in enzyme activity as early as the second day of storage (p = 0.001). It was also noted that mean G6PD activity for spotted blood samples were lower compared to those in EDTA tubes for all days (p = 0.001). Thus, EDTA blood samples stored at 2-8 °C appeared to have better stability in terms of their G6PD enzyme level as compared to dried blood samples on filter paper, giving a storage time of up to 3 days. PMID:27103895

  5. An optimised system for refolding of human glucose 6-phosphate dehydrogenase

    Engel Paul C

    2009-03-01

    Full Text Available Abstract Background Human glucose 6-phosphate dehydrogenase (G6PD, active in both dimer and tetramer forms, is the key entry enzyme in the pentose phosphate pathway (PPP, providing NADPH for biosynthesis and various other purposes, including protection against oxidative stress in erythrocytes. Accordingly haemolytic disease is a major consequence of G6PD deficiency mutations in man, and many severe disease phenotypes are attributed to G6PD folding problems. Therefore, a robust refolding method with high recovery yield and reproducibility is of particular importance to study those clinical mutant enzymes as well as to shed light generally on the refolding process of large multi-domain proteins. Results The effects of different chemical and physical variables on the refolding of human recombinant G6PD have been extensively investigated. L-Arg, NADP+ and DTT are all major positive influences on refolding, and temperature, protein concentration, salt types and other additives also have significant impacts. With the method described here, ~70% enzyme activity could be regained, with good reproducibility, after denaturation with Gdn-HCl, by rapid dilution of the protein, and the refolded enzyme displays kinetic and CD properties indistinguishable from those of the native protein. Refolding under these conditions is relatively slow, taking about 7 days to complete at room temperature even in the presence of cyclophilin A, a peptidylprolyl isomerase reported to increase refolding rates. The refolded protein intermediates shift from dominant monomer to dimer during this process, the gradual emergence of dimer correlating well with the regain of enzyme activity. Conclusion L-Arg is the key player in the refolding of human G6PD, preventing the aggregation of folding intermediate, and NADP+ is essential for the folding intermediate to adopt native structure. The refolding protocol can be applied to produce high recovery yield of folded protein with

  6. Evaluation of the phenotypic test and genetic analysis in the detection of glucose-6-phosphate dehydrogenase deficiency

    Nantakomol, D; Paul, R; A Palasuwan; Day, NP; White, NJ; Imwong, M

    2013-01-01

    BACKGROUND: Glucose-6-phosphate dehydrogenase (G6PD) deficiency is particularly prevalent in historically malaria-endemic countries. Although most individuals with G6PD deficiency are asymptomatic, deficiency can result in acute haemolytic anaemia after exposure to oxidative agents. A reliable test is necessary for diagnosing the deficiency to prevent an acute haemolytic crisis following, for example, anti-malarial treatment. The aim of this study was to investigate which method was the best ...

  7. Prevalence of glucose-6- phosphate dehydrogenase (G6PD) deficency in neonates in Bunda Women's and Childre's Hospital, Jakarta, Indonesia

    Risma Kerina Kaban; Veronica Wijaya

    2011-01-01

    Background Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common ennme deficiency in the world. It is a risk factor for hyperbilirubinemia in neonates, which can cause serious complica¬tions such as bilirubin-induced encephalopathy or kernicterus. WHO recommends universal neonatal screening for G6PD deficiency when the frequency exceeds 3-5% of male newborns. Objective To assess the prevalence of G6PD deficiency among neonates in Bunda Women and Children Hospital (Bunda WC...

  8. Prevalence and molecular characterization of Glucose-6-Phosphate dehydrogenase deficient variants among the Kurdish population of Northern Iraq

    Jamal Shakir AR; Jubrael Jaladet MS; Eissa Adil A; Al-Allawi Nasir; Hamamy Hanan

    2010-01-01

    Abstract Background Glucose-6-Phosphate dehydrogenase (G6PD) is a key enzyme of the pentose monophosphate pathway, and its deficiency is the most common inherited enzymopathy worldwide. G6PD deficiency is common among Iraqis, including those of the Kurdish ethnic group, however no study of significance has ever addressed the molecular basis of this disorder in this population. The aim of this study is to determine the prevalence of this enzymopathy and its molecular basis among Iraqi Kurds. M...

  9. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis.

    CALABRÒ, V; Mason, P J; Filosa, S.; Civitelli, D; Cittadella, R; Tagarelli, A.; Martini, G; Brancati, C; Luzzatto, L.

    1993-01-01

    We have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Our sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then verified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) O...

  10. High glucose inhibits glucose-6-phosphate dehydrogenase, leading to increased oxidative stress and β-cell apoptosis

    Zhang, Zhaoyun; Liew, Chong Wee; Handy, Diane E.; Zhang, Yingyi; Leopold, Jane A.; Hu, Ji; Guo, Lili; Kulkarni, Rohit N.; Loscalzo, Joseph; Stanton, Robert C.

    2010-01-01

    Patients with type 2 diabetes lose β cells, but the underlying mechanisms are incompletely understood. Glucose-6-phosphate dehydrogenase (G6PD) is the principal source of the major intracellular reductant, NADPH, which is required by many enzymes, including enzymes of the antioxidant pathway. Previous work from our laboratory has shown that high glucose impairs G6PD activity in endothelial and kidney cells, which leads to decreased cell survival. Pancreatic β cells are highly sensitive to inc...

  11. Molecular Characterization of Cosenza Mutation among Patients with Glucose-6-Phosphate Dehydrogenase Deficiency in huzestan Province, Southwest Iran

    Seyed Reza Kazemi Nezhad; Fatemeh Fahmi; Saeid Reza Khatami; Mohsen Musaviun

    2011-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is one of the most common hereditary enzymatic disorders in human, increases the vulnerability of erythrocytes to oxidative stress. It is also characterized by remarkable molecular and biochemical heterogeneity. According to previous investigations, G6PD Cosenza (G1376C) is a common G6PD mutation in some parts of Iran. Therefore in the present study we have characterized Cosenza mutation among G6PD deficient individuals in Khuzestan province...

  12. Prevalence and molecular basis of glucose-6-phosphate dehydrogenase deficiency in Afghan populations: implications for treatment policy in the region.

    Leslie, T.; Moiz, B; N. Mohammad; Amanzai, O; Ur Rasheed, H; Jan, S.; Siddiqi, AM; Nasir, A; Beg, MA; Vink, M.

    2013-01-01

    BACKGROUND Glucose-6-phosphate dehydrogenase deficiency (G6PD), an x-linked inherited enzymopathy, is a barrier to malaria control because primaquine cannot be readily applied for radical cure in individuals with the condition. In endemic areas, including in Afghanistan, the G6PD status of vivax patients is not routinely determined so the drug is rarely, if ever, prescribed even though it is included as a recommended treatment in local, regional and global guidelines. This study assessed the ...

  13. Glucose-6-phosphate Dehydrogenase Deficiency and Malaria: Cytochemical Detection of Heterozygous G6PD Deficiency in Women

    Peters, Anna L.; Van Noorden, Cornelis J. F.

    2009-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a X-chromosomally transmitted disorder of the erythrocyte that affects 400 million people worldwide. Diagnosis of heterozygously-deficient women is complicated: as a result of lyonization, these women have a normal and a G6PD-deficient population of erythrocytes. The cytochemical assay is the only reliable assay to discriminate between heterozygously-deficient women and non-deficient women or homozygously-deficient women. G6PD deficiency ...

  14. Glucose-6-Phosphate Dehydrogenase Deficiency and Diabetes Mellitus with Severe Retinal Complications in a Sardinian Population, Italy

    Pinna, Antonio; Contini, Emma Luigia; Carru, Ciriaco; Solinas, Giuliana

    2013-01-01

    Background: Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency is one of the most common human genetic abnormalities, with a high prevalence in Sardinia, Italy. Evidence indicates that G6PD-deficient patients are protected against vascular disease. Little is known about the relationship between G6PD deficiency and diabetes mellitus. The purpose of this study was to compare G6PD deficiency prevalence in Sardinian diabetic men with severe retinal vascular complications and in age-matched non-d...

  15. Ultrasound-Guided Regional Anesthesia in a Glucose-6-Phosphate Dehydrogenase (G6PD)-Deficient Geriatric Trauma Patient

    Födinger, Agnes M.; Kammerlander, Christian; Luger, Thomas J.

    2012-01-01

    Objective: Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a genetic enzymatic disorder causing hemolytic anemia. Exposure to drugs is considered to be the most common cause of acute hemolysis in patients with G6PD deficiency. Experience with regional anesthesia, in particular peripheral nerve blocks, is rarely described in patients with G6PD deficiency, but is of great clinical interest. For this reason, we now report on the successful management of ultrasound-guided axillary brachial...

  16. Beneficial Effect of Sugar Osmolytes on the Refolding of Guanidine Hydrochloride-Denatured Trehalose-6-phosphate Hydrolase from Bacillus licheniformis

    Jiau-Hua Chen; Meng-Chun Chi; Min-Guan Lin; Long-Liu Lin; Tzu-Fan Wang

    2015-01-01

    The influence of three sugar osmolytes on the refolding of guanidine hydrochloride- (GdnHCl-) denatured trehalose-6-phosphate hydrolase of Bacillus licheniformis (BlTreA) was studied by circular dichroism (CD) spectra, fluorescence emission spectra, and the recovery of enzymatic activity. These experimental results clearly indicated that sorbitol, sucrose, and trehalose at a concentration of 0.75 M improved the refolding yields of GdnHCl-denatured  BlTreA, probably due to the fact that these ...

  17. Structure of the trehalose-6-phosphate phosphatase from Brugia malayi reveals key design principles for anthelmintic drugs.

    Jeremiah D Farelli

    2014-07-01

    Full Text Available Parasitic nematodes are responsible for devastating illnesses that plague many of the world's poorest populations indigenous to the tropical areas of developing nations. Among these diseases is lymphatic filariasis, a major cause of permanent and long-term disability. Proteins essential to nematodes that do not have mammalian counterparts represent targets for therapeutic inhibitor discovery. One promising target is trehalose-6-phosphate phosphatase (T6PP from Brugia malayi. In the model nematode Caenorhabditis elegans, T6PP is essential for survival due to the toxic effect(s of the accumulation of trehalose 6-phosphate. T6PP has also been shown to be essential in Mycobacterium tuberculosis. We determined the X-ray crystal structure of T6PP from B. malayi. The protein structure revealed a stabilizing N-terminal MIT-like domain and a catalytic C-terminal C2B-type HAD phosphatase fold. Structure-guided mutagenesis, combined with kinetic analyses using a designed competitive inhibitor, trehalose 6-sulfate, identified five residues important for binding and catalysis. This structure-function analysis along with computational mapping provided the basis for the proposed model of the T6PP-trehalose 6-phosphate complex. The model indicates a substrate-binding mode wherein shape complementarity and van der Waals interactions drive recognition. The mode of binding is in sharp contrast to the homolog sucrose-6-phosphate phosphatase where extensive hydrogen-bond interactions are made to the substrate. Together these results suggest that high-affinity inhibitors will be bi-dentate, taking advantage of substrate-like binding to the phosphoryl-binding pocket while simultaneously utilizing non-native binding to the trehalose pocket. The conservation of the key residues that enforce the shape of the substrate pocket in T6PP enzymes suggest that development of broad-range anthelmintic and antibacterial therapeutics employing this platform may be possible.

  18. Cloning and enzymology analysis of farnesyl pyrophosphate synthase gene from a superior strain of Artemisia annua L

    2003-01-01

    A cDNA(af1) encoding farnesyl pyrophosphate synthase AaFPS1 (FPS, EC2.5.1.1/EC2.5.1.10) from a high yield Artemisia annua strain 025 has been cloned from its cDNA library. Sequence analysis showed that the cDNA encoded a protein of 343 amino acid (aa) residues with molecular weight of 39 kD. Deduced aa sequence of the cDNA was similar to FPS from other plants, yeast and mammals, containing 5 conserved domains found in both prenyl transferase and polyprenyl synthase. The expression of the cDNA in Escherichia coli showed measurable specific activity of FPS in vitro. The enzyme was purified by ion exchange chromatography and its kinetics was measured. These results would further promote the molecular regulation of artemisinin biosynthesis.

  19. The overexpressed human 46-kDa mannose 6-phosphate receptor mediates endocytosis and sorting of β-glucuronidase

    The authors studied the function of the human small (46-kDa) mannose 6-phosphate receptor (SMPR) in transfected mouse L cells that do not express the larger insulin-like growth factor II/mannose 6-phosphate receptor. Cells overexpressing human SMPR were studied for enzyme binding to cell surface receptors, for binding to intracellular receptors in permeabilized cells, and for receptor-mediated endocytosis of recombinant human β-glucuronidase. Specific binding to human SMPR in permeabilized cells showed a pH optimum between pH 6.0 and pH 6.5. Binding was significant in the present of EDTA but was enhanced by added divalent cations. Up to 2.3% of the total functional receptor could be detected on the cell surface by enzyme binding. They present experiments showing that at very high levels of overexpression, and at pH 6.5, human SMPR mediated the endocytosis of β-glucuronidase. At pH 7.5, the rate of endocytosis was only 14% the rate seen at pH 6.5. Cells overexpressing human SMPR also showed reduced secretion of newly synthesized β-glucuronidase when compared to cells transfected with vector only, suggesting that overexpressed human SMPR can participate in sorting of newly synthesized β-glucuronidase and partially correct the sorting defect in mouse L cells that do not express the insulin-like growth factor II/mannose 6-phosphate receptor

  20. Structural and Chemical Basis for Glucosamine 6-Phosphate Binding and Activation of the glmS Ribozyme

    Cochrane, J.; Lipchock, S; Smith, K; Strobel, S

    2009-01-01

    The glmS ribozyme is the first naturally occurring catalytic RNA that relies on an exogenous, nonnucleotide cofactor for reactivity. From a biochemical perspective, the glmS ribozyme derived from Bacillus anthracis is the best characterized. However, much of the structural work to date has been done on a variant glmS ribozyme, derived from Thermoanaerobacter tengcongensis. Here we present structures of the B. anthracis glmS ribozyme in states before the activating sugar, glucosamine 6-phosphate (GlcN6P), has bound and after the reaction has occurred. These structures show an active site preorganized to bind GlcN6P that retains some affinity for the sugar even after cleavage of the RNA backbone. A structure of an inactive glmS ribozyme with a mutation distal from the ligand-binding pocket highlights a nucleotide critical to the reaction that does not affect GlcN6P binding. Structures of the glmS ribozyme bound to a naturally occurring inhibitor, glucose 6-phosphate (Glc6P), and a nonnatural activating sugar, mannosamine 6-phosphate (MaN6P), reveal a binding mode similar to that of GlcN6P. Kinetic analyses show a pH dependence of ligand binding that is consistent with titration of the cofactor's phosphate group and support a model in which the major determinant of activity is the sugar amine independent of its stereochemical presentation.

  1. Mitochondrial ATP synthase deficiency due to a mutation in the ATP5E gene for the F1 e subunit

    Mayr, J. A.; Havlíčková, Vendula; Zimmermann, F.; Magler, I.; Kaplanová, Vilma; Ješina, Pavel; Pecinová, Alena; Nůsková, Hana; Koch, J.; Sperl, W.; Houštěk, Josef

    2010-01-01

    Roč. 19, č. 17 (2010), s. 3430-3439. ISSN 0964-6906 R&D Projects: GA MZd(CZ) NS9759; GA MŠk(CZ) 1M0520 Grant ostatní: Univerzita Karlova(CZ) 97807 Institutional research plan: CEZ:AV0Z50110509 Keywords : ATP-synthase * ATP5E * disease Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.058, year: 2010

  2. Molecular characterization of glutathione S-transferase, endothelial nitric oxide synthase and Vitamin D receptor genes in breast cancer cases

    Rizk El-Baz(1); Azza Ismail(2) ; Maher Amer(2); Mai Elshahat(3); Amira Kazamel(2); Ahmad Settin

    2012-01-01

    Background: Enzymes of the Glutathione S-transferase system (GST) modulate the effects of exposure to several cytotoxic and genotoxic agents. Nitric oxide (NO) is constitutively synthesized in the endothelium by endothelial nitric oxide synthase (eNOS) and acts as a pleiotropic regulator involved in carcinogenesis. Vitamin D levels may influence breast cancer development. The vitamin D receptor (VDR) is a crucial mediator for the cellular effects of vitamin D and additionally interacts with o...

  3. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.)

    Dullat Harpreet K; Hamberger Britta; Jancsik Sharon; Ralph Steven G; Weisshaar Sabrina; Keeling Christopher I; Bohlmann Jörg

    2011-01-01

    Abstract Background In conifers, terpene synthases (TPSs) of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs) and full-length cDNAs in sev...

  4. Multiple phenotypic changes in mice after knockout of the B3gnt5 gene, encoding Lc3 synthase--a key enzyme in lacto-neolacto ganglioside synthesis

    McLendon Roger E

    2010-11-01

    Full Text Available Abstract Background Ganglioside biosynthesis occurs through a multi-enzymatic pathway which at the lactosylceramide step is branched into several biosynthetic series. Lc3 synthase utilizes a variety of galactose-terminated glycolipids as acceptors by establishing a glycosidic bond in the beta-1,3-linkage to GlcNaAc to extend the lacto- and neolacto-series gangliosides. In order to examine the lacto-series ganglioside functions in mice, we used gene knockout technology to generate Lc3 synthase gene B3gnt5-deficient mice by two different strategies and compared the phenotypes of the two null mouse groups with each other and with their wild-type counterparts. Results B3gnt5 gene knockout mutant mice appeared normal in the embryonic stage and, if they survived delivery, remained normal during early life. However, about 9% developed early-stage growth retardation, 11% died postnatally in less than 2 months, and adults tended to die in 5-15 months, demonstrating splenomegaly and notably enlarged lymph nodes. Without lacto-neolacto series gangliosides, both homozygous and heterozygous mice gradually displayed fur loss or obesity, and breeding mice demonstrated reproductive defects. Furthermore, B3gnt5 gene knockout disrupted the functional integrity of B cells, as manifested by a decrease in B-cell numbers in the spleen, germinal center disappearance, and less efficiency to proliferate in hybridoma fusion. Conclusions These novel results demonstrate unequivocally that lacto-neolacto series gangliosides are essential to multiple physiological functions, especially the control of reproductive output, and spleen B-cell abnormality. We also report the generation of anti-IgG response against the lacto-series gangliosides 3'-isoLM1 and 3',6'-isoLD1.

  5. Application of GFAT as a novel selection marker to mediate gene expression.

    Guogan Wu

    Full Text Available The enzyme glutamine: fructose-6-phosphate aminotransferase (GFAT, also known as glucosamine synthase (GlmS, catalyzes the formation of glucosamine-6-phosphate from fructose-6-phosphate and is the first and rate-limiting enzyme of the hexosamine biosynthetic pathway. For the first time, the GFAT gene was proven to possess a function as an effective selection marker for genetically modified (GM microorganisms. This was shown by construction and analysis of two GFAT deficient strains, E. coli ΔglmS and S. pombe Δgfa1, and the ability of the GFAT encoding gene to mediate plasmid selection. The gfa1 gene of the fission yeast Schizosaccharomyces pombe was deleted by KanMX6-mediated gene disruption and the Cre-loxP marker removal system, and the glmS gene of Escherichia coli was deleted by using λ-Red mediated recombinase system. Both E. coli ΔglmS and S. pombe Δgfa1 could not grow normally in the media without addition of glucosamine. However, the deficiency was complemented by transforming the plasmids that expressed GFAT genes. The xylanase encoding gene, xynA2 from Thermomyces lanuginosus was successfully expressed and secreted by using GFAT as selection marker in S. pombe. Optimal glucosamine concentration for E. coli ΔglmS and S. pombe Δgfa1 growth was determined respectively. These findings provide an effective technique for the construction of GM bacteria without an antibiotic resistant marker, and the construction of GM yeasts to be applied to complex media.

  6. The barley genome sequence assembly reveals three additional members of the CslF (1,3;1,4-β-glucan synthase gene family.

    Miriam Schreiber

    Full Text Available An important component of barley cell walls, particularly in the endosperm, is (1,3;1,4-β-glucan, a polymer that has proven health benefits in humans and that influences processability in the brewing industry. Genes of the cellulose synthase-like (Csl F gene family have been shown to be involved in (1,3;1,4-β-glucan synthesis but many aspects of the biosynthesis are still unclear. Examination of the sequence assembly of the barley genome has revealed the presence of an additional three HvCslF genes (HvCslF11, HvCslF12 and HvCslF13 which may be involved in (1,3;1,4-β-glucan synthesis. Transcripts of HvCslF11 and HvCslF12 mRNA were found in roots and young leaves, respectively. Transient expression of these genes in Nicotiana benthamiana resulted in phenotypic changes in the infiltrated leaves, although no authentic (1,3;1,4-β-glucan was detected. Comparisons of the CslF gene families in cereals revealed evidence of intergenic recombination, gene duplications and translocation events. This significant divergence within the gene family might be related to multiple functions of (1,3;1,4-β-glucans in the Poaceae. Emerging genomic and global expression data for barley and other cereals is a powerful resource for characterising the evolution and dynamics of complete gene families. In the case of the CslF gene family, the results will contribute to a more thorough understanding of carbohydrate metabolism in grass cell walls.

  7. Benzalacetone Synthase

    Ikuro eAbe

    2012-03-01

    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  8. Effects of a subconvulsive dose of kainic acid on the gene expressions of the arginine vasopressin, oxytocin and neuronal nitric oxide synthase in the rat hypothalamus.

    Yoshimura, Mitsuhiro; Ohkubo, Jun-ichi; Hashimoto, Hirofumi; Matsuura, Takanori; Maruyama, Takashi; Onaka, Tatsushi; Suzuki, Hideaki; Ueta, Yoichi

    2015-10-01

    Arginine vasopressin (AVP) synthesis in the hypothalamo-neurohypophysial system (HNS) is up-regulated by kainic acid (KA)-induced seizure in rats. However, it remains unknown whether a subconvulsive dose of KA affects the HNS. Here we examined the effects of subcutaneous (s.c.) administration of a low dose of KA (4 mg/kg) on the gene expressions of the AVP, oxytocin (OXT) and neuronal nitric oxide synthase (nNOS) in the supraoptic (SON) and paraventricular nuclei (PVN) of the rat hypothalamus, using in situ hybridization histochemistry. The expression of the AVP gene in the SON and PVN was judged to be up-regulated in KA-treated rats in comparison with saline-treated rats as controls. Next, the expression of the OXT gene was significantly increased in the SON at 6-24h and in the PVN at 6 and 12h after s.c. administration of KA. Finally, the expression of the nNOS gene was significantly increased in the SON and PVN at 3 and 6h after s.c. administration of KA. These results suggest that up-regulation of the gene expressions of the AVP, OXT and nNOS in the rat hypothalamus may be differentially affected by peripheral administration of a subconvulsive dose of KA. PMID:26003742

  9. Immune Thrombocytopenia Resolved by Eltrombopag in a Carrier of Glucose-6-Phosphate Dehydrogenase Deficiency

    Laura Scaramucci

    2016-03-01

    Full Text Available Eltrombopag, a thrombopoietin mimetic peptide, may provide excellent clinical efficacy in steroid-refractory patients with immune thrombocytopenic purpura (ITP [1,2]. Eltrombopag is generally well tolerated. However, its use in the particular setting of glucose-6-phosphate dehydrogenase (G6PD and history of acute hemolytic anemia (AHA has not been reported so far. A 51-year-old female was diagnosed as having ITP in September 2014. She was not taking any medication and her past history was negative, apart from having been diagnosed a carrier (heterozygous of G6PD deficiency (Mediterranean variant after a familial screening by molecular and biochemical methods. She presented with only slightly reduced (about 50% enzyme level, belonging to World Health Organization-defined class 3 [3,4]. In the following years, the patient experienced some episodes of AHA, which were managed at outside institutions; in particular, a severe episode of AHA, probably triggered by urinary infection and antibiotics [5], had complicated her second and last delivery. The hemolytic episodes were selflimiting and resolved without sequelae. No other causes of hemolysis were documented. When the case came to our attention, a diagnosis of ITP was made; hemolytic parameters were normal, although the G6PD enzyme concentration was not measured. Oral prednisone (1 mg/kg was given with only a transient benefit. The patient was then a candidate for elective splenectomy. However, given her extremely low platelet count, she was started in October 2014 on eltrombopag at 50 mg/day as a bridge to splenectomy. Given that, to the best of our knowledge, the use of this drug has never been reported in the particular setting of G6PD deficiency, the patient was constantly monitored. A prompt platelet increase (178x109/L was observed 1 week after the start of treatment. After she achieved the target platelet count, the dose of eltrombopag was tapered to the lowest effective dose. The patient

  10. Starch phosphorylation in potato tubers is influenced by allelic variation in the genes encoding glucan water dikinase, starch branching enzymes I and II, and starch synthase III

    Margaret Ann Carpenter

    2015-03-01

    Full Text Available Starch phosphorylation is an important aspect of plant metabolism due to its role in starch degradation. Moreover, the degree of phosphorylation of starch determines its physicochemical properties and is therefore relevant for industrial uses of starch. Currently, starch is chemically phosphorylated to increase viscosity and paste stability. Potato cultivars with elevated starch phosphorylation would make this process unnecessary, thereby bestowing economic and environmental benefits. Starch phosphorylation is a complex trait which has been previously shown by antisense gene repression to be influenced by a number of genes including those involved in starch synthesis and degradation. We have used an association mapping approach to discover genetic markers associated with the degree of starch phosphorylation. A diverse collection of 193 potato lines was grown in replicated field trials, and the levels of starch phosphorylation at the C6 and C3 positions of the glucosyl residues were determined by mass spectrometry of hydrolyzed starch from tubers. In addition, the potato lines were genotyped by amplicon sequencing and microsatellite analysis, focusing on candidate genes known to be involved in starch synthesis. As potato is an autotetraploid, genotyping included determination of allele dosage. Significant associations (p<0.001 were found with SNPs in the glucan water dikinase (GWD, starch branching enzyme I (SBEI and the starch synthase III (SSIII genes, and with a SSR allele in the SBEII gene. SNPs in the GWD gene were associated with C6 phosphorylation, whereas polymorphisms in the SBEI and SBEII genes were associated with both C6 and C3 phosphorylation and the SNP in the SSIII gene was associated with C3 phosphorylation. These allelic variants have potential as genetic markers for starch phosphorylation in potato.

  11. Exposure to Diflubenzuron Results in an Up-Regulation of a Chitin Synthase 1 Gene in Citrus Red Mite, Panonychus citri (Acari: Tetranychidae

    Wen-Kai Xia

    2014-02-01

    Full Text Available Chitin synthase synthesizes chitin, which is critical for the arthropod exoskeleton. In this study, we cloned the cDNA sequences of a chitin synthase 1 gene, PcCHS1, in the citrus red mite, Panonychus citri (McGregor, which is one of the most economically important pests of citrus worldwide. The full-length cDNA of PcCHS1 contains an open reading frame of 4605 bp of nucleotides, which encodes a protein of 1535 amino acid residues with a predicted molecular mass of 175.0 kDa. A phylogenetic analysis showed that PcCHS1 was most closely related to CHS1 from Tetranychus urticae. During P. citri development, PcCHS1 was constantly expressed in all stages but highly expressed in the egg stage (114.8-fold higher than in the adult. When larvae were exposed to diflubenzuron (DFB for 6 h, the mite had a significantly high mortality rate, and the mRNA expression levels of PcCHS1 were significantly enhanced. These results indicate a promising use of DFB to control P. citri, by possibly acting as an inhibitor in chitin synthesis as indicated by the up-regulation of PcCHS1 after exposure to DFB.

  12. Exposure to diflubenzuron results in an up-regulation of a chitin synthase 1 gene in citrus red mite, Panonychus citri (Acari: Tetranychidae).

    Xia, Wen-Kai; Ding, Tian-Bo; Niu, Jin-Zhi; Liao, Chong-Yu; Zhong, Rui; Yang, Wen-Jia; Liu, Bin; Dou, Wei; Wang, Jin-Jun

    2014-01-01

    Chitin synthase synthesizes chitin, which is critical for the arthropod exoskeleton. In this study, we cloned the cDNA sequences of a chitin synthase 1 gene, PcCHS1, in the citrus red mite, Panonychus citri (McGregor), which is one of the most economically important pests of citrus worldwide. The full-length cDNA of PcCHS1 contains an open reading frame of 4605 bp of nucleotides, which encodes a protein of 1535 amino acid residues with a predicted molecular mass of 175.0 kDa. A phylogenetic analysis showed that PcCHS1 was most closely related to CHS1 from Tetranychus urticae. During P. citri development, PcCHS1 was constantly expressed in all stages but highly expressed in the egg stage (114.8-fold higher than in the adult). When larvae were exposed to diflubenzuron (DFB) for 6 h, the mite had a significantly high mortality rate, and the mRNA expression levels of PcCHS1 were significantly enhanced. These results indicate a promising use of DFB to control P. citri, by possibly acting as an inhibitor in chitin synthesis as indicated by the up-regulation of PcCHS1 after exposure to DFB. PMID:24590130

  13. Metabolic Engineering of Plant-derived (E)-β-farnesene Synthase Genes for a Novel Type of Aphid-resistant Genetically Modified Crop Plants

    Xiu-Dao Yu; John Pickett; You-Zhi Ma; Toby Bruce; Johnathan Napier; Huw D.Jones; Lan-Qin Xia

    2012-01-01

    Aphids are major agricultural pests that cause significant yield losses of crop plants each year.Excessive dependence on insecticides for long-term aphid control is undesirable because of the development of insecticide resistance,the potential negative effects on non-target organisms and environmental pollution.Transgenic crops engineered for resistance to aphids via a non-toxic mode of action could be an efficient alternative strategy.(E)-β-Farnesene (EβF) synthases catalyze the formation of EβF,which for many pest aphids is the main component of the alarm pheromone involved in the chemical communication within these species.EβF can also be synthesized by certain plants but is then normally contaminated with inhibitory compounds.Engineering of crop plants capable of synthesizing and emitting EβF could cause repulsion of aphids and also the attraction of natural enemies that use EβF as a foraging cue,thus minimizing aphid infestation.In this review,the effects of aphids on host plants,plants' defenses against aphid herbivory and the recruitment of natural enemies for aphid control in an agricultural setting are briefly introduced.Furthermore,the plant-derived EβF synthase genes cloned to date along with their potential roles in generating novel aphid resistance via genetically modified approaches are discussed.

  14. Molecular Cloning, Characterization and mRNA Expression of a Chitin Synthase 2 Gene from the Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae

    Kang-Kang Xu

    2013-08-01

    Full Text Available Chitin synthase (CHS, a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2 was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis.

  15. Modulation of inducible nitric oxide synthase gene expression in RAW 264.7 murine macrophages by Pacific ciguatoxin

    Kumar-Roine, Shilpa; Matsui, Mariko; Chinain, M. (Mireille); Laurent, Dominique; Pauillac, S

    2008-01-01

    To investigate the possible involvement of the nitric oxide radical (NO) in ciguatera fish poisoning (CFP), the in vitro effects of the main Pacific ciguatoxin (P-CTX-1B) and bacterial lipopolysaccharide (LPS) were comparatively studied on neuroblastoma Neuro-2a and on macrophage RAW 264.7 cell lines. NO accumulation was quantified by measuring nitrite levels in cellular supernatant using Griess reagent while the up-regulation of inducible nitric oxide synthase (iNOS) at the mRNA level was qu...

  16. Knowledge and misconceptions about sickle cell anemia and glucose-6-phosphate dehydrogenase deficiency among adult sickle cell anemia patients in al Qatif Area (eastern KSA

    Hussain A Al-Suwaid

    2015-01-01

    Full Text Available Introduction and Background: Sickle cell disease (SCD is an extremely challenging disease of global concern. The highest prevalence of SCD in Saudi Arabia is in the Eastern province. Compared to all other areas of Saudi Arabia, Al-Qatif area has the highest gene frequencies for HbS and glucose-6-phosphate dehydrogenase (G-6-PD deficiency genes. Objective: The objective of this study was to assess the knowledge and misconceptions about SCD of adults (≥18 years with sickle cell anemia in Al-Qatif area, Eastern Province, Saudi Arabia, and study factors that may affect them. Materials and Methods: A cross-sectional study using a self-administered questionnaire was distributed to 320 patients aged ≥18 years with sickle cell anemia, who attend the medical outpatient clinics in Qatif central hospital and primary care centers in the Qatif area, Eastern Province, Saudi Arabia. Result: A total of 300 participants completed their questionnaire. In general, 56.3% had poor knowledge of the disease. About 58.3% had good knowledge of the genetic transmission. The knowledge of 46.7% about the precipitating factors was poor. Moreover, 59.3% had poor knowledge of the diet of people with SCD and 81.3% had poor knowledge of the diet of people with G-6-PD deficiency. Conclusion: Our study revealed significant widespread misconceptions of patients with sickle cell anemia especially relating to their diet.

  17. Endothelial Nitric Oxide Synthase (−786T>C) and Endothelin-1 (5665G>T) Gene Polymorphisms as Vascular Dysfunction Risk Factors in Sickle Cell Anemia

    Vilas-Boas, Wendell; Figueiredo, Camylla V. B.; Pitanga, Thassila N.; Carvalho, Magda O. S.; Santiago, Rayra P.; Santana, Sânzio S.; Guarda, Caroline C.; Zanette, Angela M. D.; Cerqueira, Bruno A. V.; Gonçalves, Marilda S.

    2016-01-01

    Sickle cell anemia (SCA) patients have vascular complications, and polymorphisms in endothelin-1 (ET-1) and endothelial nitric oxide synthase (eNOS) genes were associated with ET-1 and nitric oxide disturbance. We investigate the association of ET-1 5665G>T and eNOS −786T>C polymorphisms with soluble adhesion molecules (sVCAM-1 and sICAM-1), biochemical markers, and medical history. We studied 101 SCA patients; carriers of eNOS minor allele (C) had the highest levels of sVCAM-1, and carriers of ET-1 minor allele had more occurrence of acute chest syndrome (ACS). The multivariate analysis suggested the influence of the ET-1 gene on ACS outcome and an association of the eNOS gene with upper respiratory tract infection. We suggest that eNOS and ET-1 gene polymorphisms can influence SCA pathophysiology and that eNOS variant in SCA patients might be important to nitric oxide activity and vascular alteration. We found an association of the ET-1 minor allele in ACS, showing the importance of genetic screening in SCA. PMID:27486304

  18. Loss of cation-independent mannose 6-phosphate receptor expression promotes the accumulation of lysobisphosphatidic acid in multilamellar bodies.

    Reaves, B J; Row, P E; Bright, N A; Luzio, J P; Davidson, H W

    2000-11-01

    A number of recent studies have highlighted the importance of lipid domains within endocytic organelles in the sorting and movement of integral membrane proteins. In particular, considerable attention has become focussed upon the role of the unusual phospholipid lysobisphosphatidic acid (LBPA). This lipid appears to be directly involved in the trafficking of cholesterol and glycosphingolipids, and accumulates in a number of lysosomal storage disorders. Antibody-mediated disruption of LBPA function also leads to mis-sorting of cation-independent mannose 6-phosphate receptors. We now report that the converse is also true, and that spontaneous loss of cation-independent mannose 6-phosphate receptors from a rat fibroblast cell line led to the formation of aberrant late endocytic structures enriched in LBPA. Accumulation of LBPA was directly dependent upon the loss of the receptors, and could be reversed by expression of bovine cation-independent mannose 6-phosphate receptors in the mutant cell line. Ultrastructural analysis indicated that the abnormal organelles were electron-dense, had a multi-lamellar structure, accumulated endocytosed probes, and were distinct from dense-core lysosomes present within the same cells. The late endocytic structures present at steady state within any particular cell likely reflect the balance of membrane traffic through the endocytic pathway of that cell, and the rate of maturation of individual endocytic organelles. Moreover, there is considerable evidence which suggests that cargo receptors also play a direct mechanistic role in membrane trafficking events. Therefore, loss of such a protein may disturb the overall equilibrium of the pathway, and hence cause the accumulation of aberrant organelles. We propose that this mechanism underlies the phenotype of the mutant cell line, and that the formation of inclusion bodies in many lysosomal storage diseases is also due to an imbalance in membrane trafficking within the endocytic pathway

  19. The Preterm Infant: A High-Risk Situation for Neonatal Hyperbilirubinemia Due to Glucose-6-Phosphate Dehydrogenase Deficiency.

    Kaplan, Michael; Hammerman, Cathy; Bhutani, Vinod K

    2016-06-01

    Prematurity and glucose-6-phosphate dehydrogenase (G6PD) deficiency are risk factors for neonatal hyperbilirubinemia. The 2 conditions may interact additively or synergistically, contributing to extreme hyperbilirubinemia, with the potential for bilirubin neurotoxicity. This hyperbilirubinemia is the result of sudden, unpredictable, and acute episodes of hemolysis in combination with immaturity of bilirubin elimination, primarily of conjugation. Avoidance of contact with known triggers of hemolysis in G6PD-deficient individuals will prevent some, but not all, episodes of hemolysis. All preterm infants with G6PD deficiency should be vigilantly observed for the development of jaundice both in hospital and after discharge home. PMID:27235211

  20. Glucose-6-phosphate dehydrogenase (G6PD) deficiency is associated with asymptomatic malaria in a rural community in Burkina Faso

    Abdoul Karim Ouattara; Cyrille Bisseye; Bapio Valery Jean Télesphore Elvira Bazie; Birama Diarra; Tegwindé Rebeca Compaore; Florencia Djigma; Virginio Pietra; Remy Moret; Jacques Simpore

    2014-01-01

    Objective: To investigate 4 combinations of mutations responsible for glucose-6-phosphate dehydrogenase (G6PD) deficiency in a rural community of Burkina Faso, a malaria endemic country. Methods: Two hundred individuals in a rural community were genotyped for the mutations A376G, G202A, A542T, G680T and T968C using TaqMan single nucleotide polymorphism assays and polymerase chain reaction followed by restriction fragment length polymorphism. Results: The prevalence of the G6PD deficienc...

  1. Dental Considerations in Children with Glucose-6-phosphate Dehydrogenase Deficiency (Favism: A Review of the Literature and Case Report

    Daniela Hernández-Pérez

    2015-01-01

    Full Text Available Glucose-6-phosphate dehydrogenase (G6PD deficiency is an uncommon inherited enzyme deficiency characterized by hemolytic anemia, caused by the inability of erythrocytes to detoxify oxidizing agents such as drugs, infectious diseases, or fava bean ingestion. In this later case, the disorder is known as favism. The aim of the present report was to present a review of the literature in this disease, to describe a case report concerning an affected 9-year-old male, and to review the main implications and precautions in pediatric dental management.

  2. Seven Different Glucose-6-phosphate Dehydrogenase Variants Including a New Variant Distributed in Lam Dong Province in Southern Vietnam.

    ARAI, Meiji; Hirai, Makoto; Jalloh, Amadu; Kanbe,Toshio; Van Thien, Huynh; Thuan,Dang Thi Vinh; Matsuoka, Hiroyuki; Dung,Nguyen The; Kawamoto, Fumihiko

    2007-01-01

    We conducted a survey for glucose-6-phosphate dehydrogenase (G6PD) deficiency using blood samples from male outpatients of a local hospital in southern Vietnam. Most of the samples were from the Kinh (88.9%), the largest ethnic group in Vietnam, with a small number (11.1%) coming from the K'Ho, Chauma, Nung, and Tay minorities. We detected 25 G6PD-deficient cases among 1,104 samples (2.3%), and read the open reading frame of G6PD. A novel mutation (352T>C) predicting an aminoacid change o...

  3. PCR-based allelic discrimination for glucose-6-phosphate dehydrogenase (G6PD) deficiency in Ugandan umbilical cord blood

    Hsu, Jennifer; Fink, Deanna; Langer, Erica; Carter, Michelle L.; Bengo, Derrik; Ndidde, Susan; Slusher, Tina; Ross, Julie A.; Lund, Troy C

    2013-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common X-linked disorder in the world. G6PD deficiency puts children at risk for hyperbilirubinemia and kernicterus during the newborn period and an increased risk of severe hemolysis after exposure to many anti-malarial medications. A laboratory diagnosis of G6PD deficiency is rare in the developing world due to limited resources. We developed a Taqman-based allele specific assay to rapidly determine rates of G6PD deficiency con...

  4. Origin and spread of the glucose-6-phosphate dehydrogenase variant (G6PD-Mediterranean) in the Middle East.

    Kurdi-Haidar, B; Mason, P J; Berrebi, A.; Ankra-Badu, G; Al-Ali, A; Oppenheim, A.; Luzzatto, L.

    1990-01-01

    A common glucose-6-phosphate dehydrogenase (G6PD) variant characterized by severe enzyme deficiency and B-like electrophoretic mobility is called "G6PD-Mediterranean" because it is found in different populations around the Mediterranean Sea. Sequence analysis of Italian subjects has revealed that the molecular basis of G6PD-Mediterranean is a single C-T transition at nucleotide position 563, causing a serine phenylalanine replacement at amino acid position 188. Most G6PD-Mediterranean subject...

  5. Fructose-6-phosphate aldolase in organic synthesis: preparation of D-fagomine, N-alkylated derivatives, and preliminary biological assays.

    Castillo, José A; Calveras, Jordi; Casas, Josefina; Mitjans, Montserrat; Vinardell, M Pilar; Parella, Teodor; Inoue, Tomoyuki; Sprenger, Georg A; Joglar, Jesús; Clapés, Pere

    2006-12-21

    [Structure: see text] D-fructose-6-phosphate aldolase (FSA) mediates a novel straightforward two-step chemo-enzymatic synthesis of D-fagomine and some of its N-alkylated derivatives in 51% isolated yield and 99% de. The key step is the FSA-catalyzed aldol addition of simple dihydroxyacetone (DHA) to N-Cbz-3-aminopropanal. The use of FSA greatly simplifies the enzymatic procedures that used dihydroxyacetonephosphate or DHA/esters. Some N-alkyl derivatives synthesized elicited antifungal and antibacterial activity as well as enhanced inhibitory activity, and selectivity against beta-galactosidase and alpha-glucosidase. PMID:17165931

  6. Prevalence of glucose-6-phosphate dehydrogenase deficiency and its association with Plasmodium falciparum infection among children in Iganga distric in Uganda

    Bwayo, Denis; Kaddumukasa, Mark; Ddungu, Henry; Kironde, Fred

    2014-01-01

    Background Glucose-6-phosphate dehydrogenase (G6PD) is a metabolic enzyme involved in the pentose phosphate pathway, its especially important in red blood cell metabolism. Glucose-6-phosphate dehydrogenase deficiency is an X-linked recessive hereditary disease characterised by abnormally low levels of G6PD. About 400 million people worldwide have a deficiency of this enzyme. The remarkable geographic correlation of G6PD deficiency distribution with historical endemicity patterns of malaria ha...

  7. Isoniazid acetylating phenotype in patients with paracoccidioidomycosis and its relationship with serum sulfadoxin levels, glucose-6-phosphate dehydrogenase and glutathione reductase activities

    Benedito Barraviera; Paulo Câmara Marques Pereira; Jussara Marcondes Machado; Maria Julia de Souza; Carlos Roberto G. Lima; Paulo Roberto Curi; Rinaldo Poncio Mendes; Domingos Alves Meira

    1991-01-01

    The authors evaluated the isoniazid acetylating phenotype and measured hematocrit, hemoglobin, glucose-6-phosphate dehydrogenase and glutathione reductase activities plus serum sulfadoxin levels in 39 patients with paracoccidioidomycosis (33 males and 6 females) aged 17 to 58 years. Twenty one (53.84%) of the patients presented a slow acetylatingphenotype and 18(46.16%) a fast acetylating phenotype. Glucose-6-phosphate- dehydrogenase (G6PD) acti vity was decreased in 5(23.80%) slow acetylator...

  8. High Trap Formation and Low Metabolite Production by Disruption of the Polyketide Synthase Gene Involved in the Biosynthesis of Arthrosporols from Nematode-Trapping Fungus Arthrobotrys oligospora.

    Xu, Zi-Fei; Wang, Bai-Le; Sun, Hong-Kai; Yan, Ni; Zeng, Zhi-Jun; Zhang, Ke-Qin; Niu, Xue-Mei

    2015-10-21

    A group of morphology regulatory arthrosporol metabolites have been recently characterized from carnivorous fungus Arthrobotrys oligospora that can develop trapping networks to capture their prey. A combination of genetic manipulation and chemical analyses was applied to characterize the function of one polyketide synthase (PKS) gene AOL_s00215g283 in A. oligospora, which was putatively involved in the production of 6-methylsalicylic acid. High-performance liquid chromatography analysis showed that the disruption of the PKS gene not only led to the total loss of the arthrosporol A but also resulted in significant reduction in the production of secondary metabolites in the cultural broth of the mutant ΔAOL_s00215g283 strain. Interestingly, the mutant strain displayed significant increases in the trap formation and the nematicidal activity by 10 and 2 times, respectively, higher than the wild-type strain. These findings revealed a pathogenicity-related biosynthetic gene of this agriculturally important biological agent and have implications for establishment of efficient fungal biocontrol agents. PMID:26422178

  9. Construction of eukaryotic expression vector encoding ATP synthase lipid-binding protein-like protein gene of Sj and its expression in HeLa cells

    Ouyang Danming; Hu Yongxuan; Li Mulan; Zeng Xiaojun; He Zhixiong; Yuan Caijia

    2008-01-01

    Objective: To clone and construct the recombinant plasmid containing ATP synthase lipid-binding protein-like protein gene of Schistosoma japonicum,(SjAslp) and transfer it into mammalian cells to express the objective protein. Methods: By polymerase chain reaction (PCR) technique, SjAslp was amplified from the constructed recombinant plasmid pBCSK+/SjAslp, and inserted into cloning vector pUCm-T. Then, SjAslp was subcloned into an eukaryotic expression vector pcDNA3.1(+). After identifying it by PCR, restrictive enzymes digestion and DNA sequencing, the recombinant plasmid was transfected into HeLa cells using electroporation, and the expression of the recombinant protein was analyzed by immunocytochemical assay. Resnlts: The specific gene fragment of 558 bp was successfully amplified. The DNA vaccine of SjAslp was successfully constructed. Immunocytochemical assay showed that SjAslp was expressed in the cytoplasm of HeLa cells. Conclusion: SjAslp gene can be expressed in eukaryotic system, which lays the foundation for development of the SjAslp DNA vaccine against schitosomiasis.

  10. Genome mining of the sordarin biosynthetic gene cluster from Sordaria araneosa Cain ATCC 36386: characterization of cycloaraneosene synthase and GDP-6-deoxyaltrose transferase.

    Kudo, Fumitaka; Matsuura, Yasunori; Hayashi, Takaaki; Fukushima, Masayuki; Eguchi, Tadashi

    2016-07-01

    Sordarin is a glycoside antibiotic with a unique tetracyclic diterpene aglycone structure called sordaricin. To understand its intriguing biosynthetic pathway that may include a Diels-Alder-type [4+2]cycloaddition, genome mining of the gene cluster from the draft genome sequence of the producer strain, Sordaria araneosa Cain ATCC 36386, was carried out. A contiguous 67 kb gene cluster consisting of 20 open reading frames encoding a putative diterpene cyclase, a glycosyltransferase, a type I polyketide synthase, and six cytochrome P450 monooxygenases were identified. In vitro enzymatic analysis of the putative diterpene cyclase SdnA showed that it catalyzes the transformation of geranylgeranyl diphosphate to cycloaraneosene, a known biosynthetic intermediate of sordarin. Furthermore, a putative glycosyltransferase SdnJ was found to catalyze the glycosylation of sordaricin in the presence of GDP-6-deoxy-d-altrose to give 4'-O-demethylsordarin. These results suggest that the identified sdn gene cluster is responsible for the biosynthesis of sordarin. Based on the isolated potential biosynthetic intermediates and bioinformatics analysis, a plausible biosynthetic pathway for sordarin is proposed. PMID:27072286

  11. Expression of agsA, one of five 1,3-α-d-glucan synthase-encoding genes in Aspergillus niger, is induced in response to cell wall stress

    Damveld, R.A.; Kuyk, P.A. van; Arentshorst, M.; Klis, F.M.; Hondel, C.A.M.J.J. van den; Ram, A.F.J.

    2005-01-01

    1,3-α-d-Glucan is an important component of the cell wall of filamentous fungi. We have identified a family of five 1,3-α-d-glucan synthase-encoding genes in Aspergillus niger. The agsA gene was sequenced and the predicted protein sequence indicated that the overall domain structure of 1,3-α-d-gluca

  12. Fructose-1,6-Bisphosphate Is an Allosteric Activator of Pyrophosphate:Fructose-6-Phosphate 1-Phosphotransferase.

    Nielsen, T. H.

    1995-05-01

    The activity of highly purified pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP) from barley (Hordeum vulgare) leaves was studied under conditions where the catalyzed reaction was allowed to approach equilibrium. The activity of PFP was monitored by determining the changes in the levels of fructose-6-phosphate, orthophosphate, and fructose-1,6-bisphosphate (Fru-1,6-bisP). Under these conditions PFP activity was not dependent on activation by fructose-2,6-bisphosphate (Fru-2,6-bisP). Inclusion of aldolase in the reaction mixture temporarily restored the dependence of PFP on Fru-2,6-bisP. Alternatively, PFP was activated by Fru-1,6-bisP in the presence of aldolase. It is concluded that Fru-1,6-bisP is an allosteric activator of barley PFP, which can substitute for Fru-2,6-bisP as an activator. A significant activation was observed at a concentration of 5 to 25 [mu]M Fru-1,6-bisP, which demonstrates that the allosteric site of barley PFP has a very high affinity for Fru-1,6-bisP. The high affinity for Fru-1,6-bisP at the allosteric site suggests that the observed activation of PFP by Fru-1,6-bisP constitutes a previously unrecognized in vivo regulation mechanism. PMID:12228454

  13. Identification of the binding domain for NADP+ of human glucose-6-phosphate dehydrogenase by sequence analysis of mutants

    Human erythrocyte glucose-6-phosphate is normally quite stable in the presence of 10 μM NADP+. Certain glucose-6-phosphate dehydrogenase variants lose virtually all their activity at this concentration of NADP+ but are reactivated by 200 μM NADP+. Such variants presumably have a defect in their NADP+-binding site. The authors analyzed the sequence of cDNA or genomic DNA from seven unrelated patients with hemolytic anemia due to the inheritance of variants that are reactivated by NADP+. Six patients had substitutions of one of three adjacent amino acids, and the seventh patient had another amino acid substitution 23 residues downstream. These amino acids are highly conserved, all being present in rat and all but one being found also in Drosophila. The anomalous electrophoretic behavior of some of the variants can be explained by their loss of ability to bind NADP+. The conclude that the region in which these mutations occur defines the binding domain for NADP+ and that binding NADP+ that has been designated as structural and as catalytic probably occurs at the same site

  14. Characterization of phosphorylation sites in the cytoplasmic domain of the 300 kDa mannose-6-phosphate receptor

    Rosorius, O; Mieskes, G; Issinger, O G;

    1993-01-01

    The human 300 kDa mannose-6-phosphate receptor (MPR 300) is phosphorylated in vivo at serine residues of its cytoplasmic domain. Two-dimensional separation can resolve tryptic phosphopeptides into four major species. To identify the kinases involved in MPR 300 phosphorylation and the phosphorylat......The human 300 kDa mannose-6-phosphate receptor (MPR 300) is phosphorylated in vivo at serine residues of its cytoplasmic domain. Two-dimensional separation can resolve tryptic phosphopeptides into four major species. To identify the kinases involved in MPR 300 phosphorylation and the...... phosphorylation sites the entire coding sequence of the cytoplasmic tail was expressed in Escherichia coli. The isolated cytoplasmic domain was used as a substrate for four purified serine/threonine kinases [casein kinase II (CK II), protein kinase A (PKA), protein kinase C and Ca2+/calmodulin kinase]. All...... kinases phosphorylate the cytoplasmic tail exclusively on serine residues. Inhibition studies using synthetic peptides, partial sequencing of isolated tryptic phosphopeptides and co-migration with tryptic phosphopeptides from MPR 300 labelled in vivo showed that (i) PKA phosphorylates the cytoplasmic MPR...

  15. Biosynthesis of P(3HB-co-3HV-co-3HHp terpolymer by Cupriavidus necator PHB-4 transformant harboring the highly active PHA synthase gene of Chromobacterium sp. USM2

    Rathi, D-N.

    2013-01-01

    Full Text Available Aims: This study evaluates potentials of Cupriavidus necator PHB4 transformant harboring the highly activepolyhydroxyalkanoate synthase gene (phaC of a locally isolated Chromobacterium sp. USM2 for its ability toincorporate 3-hydroxyheptanoate (3HHp monomer.Methodology and results: A mixture of fructose and sodium heptanoate fed to the culture gave rise to poly(3-hydroxybutyrate-co-3-hydroxyvalerate-co-3-hydroxyheptanoate, [P(3HB-co-3HV-co-3HHp] terpolymer synthesis, withtraces of 3HHp monomers confirmed through gas chromatography (GC, proton (1H and carbon (13C NMR spectra.Conclusion, significance and impact of study: This study has revealed that the PHA synthase of Chromobacteriumsp. USM2 has a broad range of substrate specificity. The synthase is able to polymerize 3-hydroxyalkanoate monomershaving 4–7 carbon atoms.

  16. Interrupted thymidylate synthase gene of bacteriophages T2 and T6 and other potential self-splicing introns in the T-even bacteriophages

    Southern hybridization analyses of procaryotic DNA from Escherchia coli, λ bacteriophage, and T1 to T7 phages were carried out. The hybridization probes used consisted of DNA restriction fragments derived from the T4 phage intron-containing thymidylate synthase gene (td) and short synthetic oligodeoxynucleotides defining specific exon and intron regions of the gene. It was shown that intact as well as restricted DNA from the T-even phages hybridized not only to both T4 phage td intron- and exon-specific probes but also to probes defining the td 5' (exon I-intron) and 3' (intron-exon II) presplice junctions. These data strongly suggest that, analogous to the T4 phage, only the T2 and T6 phages among the procaryotes tested contain interrupted td genes. The td intervening sequence in each phage is roughly 1 kilobase pair (kb) in size and interrupts the td gene at a site analogous to that in the T4 phage. This was confirmed by data from Northern (RNA) hybridization analysis of td-specific in vitro transcripts of these phage DNAs. [α-32P]GTP in vitro labeling of total RNA from T4 phage-infected cells produced five species of labeled RNAs that were 1, 0.9, 0.83, 0.75, and 0.6 kb in size. Only the 1-, 0.9-, and 0.75-kb species were labeled in RNA from T2- or T6-infected cells. The commonly present 1-kb RNA is the excised td intron, which exists in both linear and circular forms in the respective T-even-phage-infected cells, while the 0.6-kb RNA unique to T4 may be the excised intron derived from the ribonucleotide reductase small subunit gene (nrdB) of the phage. The remaining labeled RNA species are likely candidates for other self-splicing introns

  17. Hereditary nonspherocytic hemolytic anemia caused by red cell glucose-6-phosphate isomerase (GPI) deficiency in two Portuguese patients: Clinical features and molecular study.

    Manco, Licínio; Bento, Celeste; Victor, Bruno L; Pereira, Janet; Relvas, Luís; Brito, Rui M; Seabra, Carlos; Maia, Tabita M; Ribeiro, M Letícia

    2016-09-01

    Glucose-6-phosphate isomerase (GPI) deficiency cause hereditary nonspherocytic hemolytic anemia (HNSHA) of variable severity in individuals homozygous or compound heterozygous for mutations in GPI gene. This work presents clinical features and genotypic results of two patients of Portuguese origin with GPI deficiency. The patients suffer from a mild hemolytic anemia (Hb levels ranging from 10 to 12.7g/mL) associated with macrocytosis, reticulocytosis, hyperbilirubinemia, hyperferritinemia and slight splenomegaly. Genomic DNA sequencing revealed in one patient homozygosity for a new missense mutation in exon 3, c.260G>C (p.Gly87Ala), and in the second patient compound heterozygosity for the same missense mutation (p.Gly87Ala), along with a frameshift mutation resulting from a single nucleotide deletion in exon 14, c.1238delA (p.Gln413Arg fs*24). Mutation p.Gln413Arg fs*24 is the first frameshift null mutation to be described in GPI deficiency. Molecular modeling suggests that the structural change induced by the p.Gly87Ala pathogenic variant has direct impact in the structural arrangement of the region close to the active site of the enzyme. PMID:27519939

  18. In vitro tolerance to Botrytis cinerea of grapevine 41B rootstock in transgenic plants expressing the stilbene synthase Vst1 gene under the control of a pathogen‐inducible PR 10 promoterIn vitro tolerance to Botrytis cinerea of grapevine 41B rootstock in transgenic plants expressing the stilbene synthase Vst1 gene under the control of a pathogen‐inducible PR 10 promoter

    Coutos-Thévenot, Pierre; Poinssot, Benoît; Bonomelli, A.; Yean, H.; Breda, C; Buffard, D; Esnault, R.; Hain, R; Boulay, M.

    2001-01-01

    Resveratrol is a major phytoalexin in grapevine but its synthesis in response to phytopathogen attack decreases with grape berry ripening, A chimeric gene combining an alfalfa PR 10 promoter and Vst1 (Vitis stilbene synthase 1) gene was introduced into the genome of 41B rootstock, Transgenic plants were analysed for resveratrol production in leaves infected with Botrytis using an in vitro test. Among the 50 transgenic lines analysed, some exhibited a production lower than the non-transgenic c...

  19. The T -786C, G894T, and Intron 4 VNTR (4a/b) Polymorphisms of the Endothelial Nitric Oxide Synthase Gene in Prostate Cancer Cases.

    Diler, S B; Öden, A

    2016-02-01

    In previously conducted some studies it has been revealed that nitric oxide (NO) and nitric oxide synthase (NOS) system play a significant role in carcinogenesis. Nitric oxide (NO) is regulated by endothelial nitric oxide synthase (eNOS) enzyme which is one of the isoenzymes of NO synthase (NOS). In this study we have tried to come to a conclusion about whether eNOS gene T -786C, G894T and Intron 4 VNTR (4a/b) polymorphisms might be considered as a risk factor causing prostate cancer (PCa) or not. A total of 200 subjects were included in this research. 84 patients with PCa (mean age 70.0 ± 6.4) and 116 healthy controls (mean age 69.9 ± 7.5) were recruited in this case-control study. Genomic DNA was extracted using the QIAamp DNA Blood Mini Kit (QIAGEN GmbH, Maryland, USA), according to the manufacturer's guidelines. The T-786C, G894T and Intron 4 VNTR (4a/b) polymorphisms were amplified using polymerase chain reation (PCR), detected by restriction fragment length polymorphism (RFLP). For T -786C polymorphism CC genotype [odds ratio (OR): 0.34, 95% confidence interval (CI): 0.15-0.78, P = 0.009)] and allele frequency (OR: 0.631, CI: 0.421-0.946, P = 0.026) is significant for control. In patients with PCa eNOS G894T polymorphism, both GT (OR: 0.069, CI: 0.027-0.174; P = 0.0001) and TT (OR: 0.040, CI: 0.013-0.123; P = = 0.0001) genotype distribution, and also T allele frequency (OR: 0.237, CI: 0.155-0.362, P = 0.0001) were considered significant statistically. While genotype distribution for the other polymorphism eNOS, intron 4 VNTR (4a/b), is insignificant statistically, "a" allele frequency was found out to be significant (OR: 2.223, CI: 1.311-3.769, P = 0.003). In this study we indicated that genotype and allele frequencies of eNOS T -786C and G894T polymorphisms are statistically significant in patients with PCa. eNOS T -786C and G894T polymorphisms may be associated with PCa susceptibility in the Turkish population. In contrast, intron 4 VNTR (4a

  20. Cloning and Sequence Analyzing of Chalcone Synthase Gene in Loropetalum chinense var.Rubrum%红花檵木CHS基因的克隆与序列分析

    许威; 于晓英; 陈己任; 符红艳; 胡博文; 陈彦斌; 李达

    2013-01-01

    查尔酮合酶(chalcone synthase,CHS)是进入类黄酮和花色素苷次生代谢的第1个关键酶.根据植物查尔酮合成酶保守区序列设计引物,以红花檵木Loropetalurn chinense var.Rubrum)大叶红的嫩叶为材料,用RT-PCR方法,分离得到了一个查尔酮合成酶基因的eDNA(GenBank登录号为JQ609678),将该基因命名为Lc vrCHS1.该序列长927 bp,编码232个氨基酸残基.其核苷酸序列与GenBank已登录的同样来源的核桃、山茶属植物CHS序列同源性达83%,与其他科植物(绣球花、葡萄、桃、马铃薯、甘草、领春木属)CHS序列同源性也达到80%以上;其编码的氨基酸序列与山茶属、葡萄、鳄梨、洋梨、沙梨、映山红CHS基因编码的氨基酸序列同样具有高度同源性,同源性高达98%.%Chalcone synthase (chalcone synthase, CHS) is the key enzyme that catalyzes the first step in flavonoids biosynthesis and anthocyanins secondary metabolites. A full-length cDNA encoding CHS was cloned from the young leaves of Loropetalurn chinense var. rubrum by RT-PCR using specific primers based on the highly conserved sequences of plant CHS that had already known. Blast search revealed that it was a new gene, and was named as LcvrCHSl (GenBank accession: JQ609678). The sequence was 927 bp, encoding 232 amino acid residues. It had 83% sequence homology with walnut and camellia that had been logged in GenBank; with other genus plants (hydrangea, grapes, peaches, potatoes, licorice, Euptelea genus), CHS sequence homology was also more than 80%; with other plants (camellia, grapes, avocados, bartlett pear, sand pear, azalea), CHS sequence also had high homology, up to 98% homology.

  1. Examining Ancient Inter-domain Horizontal Gene Transfer

    Francisca C. Almeida

    2008-01-01

    Full Text Available Details of the genomic changes that occurred in the ancestors of Eukarya, Archaea and Bacteria are elusive. Ancient interdomain horizontal gene transfer (IDHGT amongst the ancestors of these three domains has been difficult to detect and analyze because of the extreme degree of divergence of genes in these three domains and because most evidence for such events are poorly supported. In addition, many researchers have suggested that the prevalence of IDHGT events early in the evolution of life would most likely obscure the patterns of divergence of major groups of organisms let alone allow the tracking of horizontal transfer at this level. In order to approach this problem, we mined the E. coli genome for genes with distinct paralogs. Using the 1,268 E. coli K-12 genes with 40% or higher similarity level to a paralog elsewhere in the E. coli genome we detected 95 genes found exclusively in Bacteria and Archaea and 86 genes found in Bacteria and Eukarya. These genes form the basis for our analysis of IDHGT. We also applied a newly developed statistical test (the node height test, to examine the robustness of these inferences and to corroborate the phylogenetically identifi ed cases of ancient IDHGT. Our results suggest that ancient inter domain HGT is restricted to special cases, mostly involving symbiosis in eukaryotes and specific adaptations in prokaryotes. Only three genes in the Bacteria + Eukarya class (Deoxyxylulose-5-phosphate synthase (DXPS, fructose 1,6-phosphate aldolase class II protein and glucosamine-6-phosphate deaminase and three genes–in the Bacteria + Archaea class (ABC-type FE3+ -siderophore transport system, ferrous iron transport protein B, and dipeptide transport protein showed evidence of ancient IDHGT. However, we conclude that robust estimates of IDHGT will be very difficult to obtain due to the methodological limitations and the extreme sequence saturation of the genes suspected of being involved in IDHGT.

  2. Rapid screening for glucose-6-phosphate dehydrogenase deficiency and haemoglobin polymorphisms in Africa by a simple high-throughput SSOP-ELISA method

    Theander Thor G

    2005-12-01

    Full Text Available Abstract Background Mutations in the haemoglobin beta-globin (HbB and glucose-6-phosphate dehydrogenase (G6PD genes cause widespread human genetic disorders such as sickle cell diseases and G6PD deficiency. In sub-Saharan Africa, a few predominant polymorphic variants of each gene account for a majority of these deficiencies. Examining at a larger scale the clinical importance of these independent genetic disorders, their possible association with malaria pathogenesis and innate resistance, and their relevance for antimalarial drug treatment, would be easier if an accurate screening method with limited costs was available. Methods A simple and rapid technique was developed to detect the most prominent single nucleotide polymorphisms (SNPs in the HbB and G6PD genes. The method is able to detect the different haemoglobin polymorphisms A, S, C and E, as well as G6PD polymorphisms B, A and A- based on PCR-amplification followed by a hybridization step using sequence-specific oligonucleotide probes (SSOPs specific for the SNP variants and quantified by ELISA. Results The SSOP-ELISA method was found to be specific, and compared well to the commonly used PCR-RFLP technique. Identical results were obtained in 98% (haemoglobin and 95% (G6PD of the tested 90 field samples from a high-transmission area in Tanzania, which were used to validate the new technique. Conclusion The simplicity and accuracy of the new methodology makes it suitable for application in settings where resources are limited. It would serve as a valuable tool for research purposes by monitoring genotype frequencies in relation to disease epidemiology.

  3. Molecular characterization of glucose-6-phosphate dehydrogenase deficiency in the Han and Li nationalities in Hainan, China and identification of a new mutation in human G6PD gene%海南汉族、黎族人葡萄糖-6-磷酸脱氢酶缺乏症 的基因突变型分析及一种新的G6PD 基因突变型的鉴定

    2001-01-01

    .7%), three with 871G→A(5.1%), one with 835A→T(1.7%), one with 517T→C(1.7%), three with 392G→T(5.1%), and four with 95A→G(6.8%) were found. Of the thirty-two Li cases with G6PD deficiency, six with 1388G→A(18.8%), three with 871G→A(9.4%), and two with 95A→G(6.3%) were found. A new mutation 835A→G which causes the substitution of Ala for Thr at 279 in a Han case was identified and named as G6PD-Haikou. The enzyme activity of the variant is about 10% of the normal and lower than the activity of the variant 835A→T with about 40% of the normal. Analysis of the 3D model of human G6PD has revealed that the hydroxyl group of Thr at 279 is a group in maintaining the interaction of the G6PD subunits. Conclusion  The most common mutations of G6PD deficiency in Han and Li nationalities in Hainan are similar. Compared with the mutation spectrum of G6PD gene in the populations in other regions of China, the results indicate that some G6PD gene mutations are widespread in the populations of different regions in the southern part of China. The hydroxyl group of the Thr at 279 of human G6PD may be a necessary group for maintaining the interaction of the G6PD subunits and the enzyme activity.

  4. Targeting a polyketide synthase gene for Aspergillus carbonarius quantification and ochratoxin A assessment in grapes using real-time PCR

    Aspergillus carbonarius is an ochratoxin producing fungus that has been considered to be responsible of the ochratoxin A (OTA) contamination in grapes and wine. In order to monitor and quantify A. carbonarius, a specific primer pair Ac12RLOTAF/Ac12RLOTAR has been designed from the acyltransferase (AT) domain of the polyketide synthase sequence Ac12RL3 to amplify 141 bp PCR product. Among the mycotoxigenic fungi tested, only A. carbonarius gave a positive result. This specific primer pair was also successfully employed in real-time PCR conjugated with SYBR Green I dye for the direct quantification of this fungus in grape samples. A positive correlation (R2 = 0.81) was found between A. carbonarius DNA content and OTA concentration in 72 grape samples, allowing for the estimation of the potential risk from OTA contamination. Consequently, this work offers a quick alternative to conventional methods of OTA quantification and mycological detection and quantification of A. carbonarius in grapes. (author)

  5. Expression characteristics of CS-ACS1, CS-ACS2 and CS-ACS3, three members of the 1-aminocyclopropane-1-carboxylate synthase gene family in cucumber (Cucumis sativus L.) fruit under carbon dioxide stress.

    Mathooko, F M; Mwaniki, M W; Nakatsuka, A; Shiomi, S; Kubo, Y; Inaba, A; Nakamura, R

    1999-02-01

    We investigated the expression pattern of three 1-aminocyclopropane-1-carboxylate (ACC) synthase genes, CS-ACS1, CS-ACS2 and CS-ACS3 in cucumber (Cucumis sativus L.) fruit under CO2 stress. CO2 stress-induced ethylene production paralleled the accumulation of only CS-ACS1 transcripts which disappeared upon withdrawal of CO2. Cycloheximide inhibited the CO2 stress-induced ethylene production but superinduced the accumulation of CS-ACS1 transcript. At higher concentrations, cycloheximide also induced the accumulation of CS-ACS2 and CS-ACS3 transcripts. In the presence of CO2 and cycloheximide, the accumulation of CS-ACS2 transcript occurred within 1 h, disappeared after 3 h and increased greatly upon withdrawal of CO2. Inhibitors of protein kinase and types 1 and 2A protein phosphatases which inhibited and stimulated, respectively, CO2 stress-induced ethylene production had little effect on the expression of these genes. The results presented here identify CS-ACS1 as the main ACC synthase gene responsible for the increased ethylene biosynthesis in cucumber fruit under CO2 stress and suggest that this gene is a primary response gene and its expression is under negative control since it is expressed by treatment with cycloheximide. The results further suggest that the regulation of CO2 stress-induced ethylene biosynthesis by reversible protein phosphorylation does not result from enhanced ACC synthase transcription. PMID:10202812

  6. Identification and function of a polyketide synthase gene responsible for 1,8-dihydroxynaphthalene-melanin pigment biosynthesis in Ascochyta rabiei.

    Akamatsu, Hajime O; Chilvers, Martin I; Stewart, Jane E; Peever, Tobin L

    2010-08-01

    Ascochyta rabiei produces and accumulates one of the well-known fungal polyketides, 1,8-dihydroxynaphthalene-melanin pigment (DHN-melanin), in asexual and sexual fruiting bodies. Degenerate PCR primers were used to isolate an ArPKS1 of A. rabiei encoding a polypeptide with high similarity to polyketide synthase (PKS) involved in biosynthesis of DHN-melanin in other ascomycetous fungi. Site-directed mutagenesis of ArPKS1 in A. rabiei generated melanin-deficient pycnidial mutants but caused no significant reduction of pathogenicity to chickpea. Pycnidiospores in ArPKS1-mutant pycnidia showed higher sensitivity to UV light exposure compared to pycnidiospores in melanized pycnidia of the wild-type progenitor isolate. Integration of an orthologous PKS1 gene from Bipolaris oryzae into the genome of the mutants complemented the dysfunctional ArPKS1 gene. This study demonstrated that A. rabiei uses a DHN-melanin pathway for pigmentation of pycnidia and this molecule may protect pycnidiospores from UV irradiation. PMID:20473673

  7. Increased enzyme production under liquid culture conditions in the industrial fungus Aspergillus oryzae by disruption of the genes encoding cell wall α-1,3-glucan synthase.

    Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu

    2016-09-01

    Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions. PMID:27442340

  8. Phylogenetic diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff), detection of polyketide synthase gene and their antagonistic activity analysis.

    Wang, Ya; Gao, Bo Liang; Li, Xi Xi; Zhang, Zhi Bin; Yan, Ri Ming; Yang, Hui Lin; Zhu, Du

    2015-11-01

    The biodiversity of plant endophytic fungi is enormous, numerous competent endophytic fungi are capable of providing different forms of fitness benefits to host plants and also could produce a wide array of bioactive natural products, which make them a largely unexplored source of novel compounds with potential bioactivity. In this study, we provided a first insights into revealing the diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff.) from China using rDNA-ITS phylogenetic analysis. Here, the potential of fungi in producing bioactive natural products was estimated based on the beta-ketosynthase detected in the polyketide synthase (PKS) gene cluster and on the bioassay of antagonistic activity against two rice phytopathogens Thanatephorus cucumeris and Xanthomonas oryzae. A total of 229 endophytic fungal strains were validated in 19 genera. Among the 24 representative strains, 13 strains displayedantagonistic activity against the phytopathogens. Furthermore, PKS genes were detected in 9 strains, indicating their potential for synthesising PKS compounds. Our study confirms the phylogenetic diversity of endophytic fungi in O. rufipogon G. and highlights that endophytic fungi are not only promising resources of biocontrol agents against phytopathogens of rice plants, but also of bioactive natural products and defensive secondary metabolites. PMID:26466878

  9. Genetic variants in inducible nitric oxide synthase gene are associated with the risk of radiation-induced lung injury in lung cancer patients receiving definitive thoracic radiation

    Background and purpose: Nitric oxide (NO), mainly synthesized by inducible nitric oxide synthase (NOS2) in pathological conditions, plays an important role in cytotoxicity, inflammation and fibrosis. Elevations in exhaled NO after thoracic radiation have been reported to predict radiation-induced lung injury (RILI). This study examined whether genetic variations in NOS2 gene is associated with the risk of RILI. Material and methods: A cohort of 301 patients between 2009 and 2011 were genotyped for 21 single nucleotide polymorphisms (SNPs) in the NOS2 gene by the Sequenom MassArray system. Kaplan–Meier cumulative probability was used to assess RILI risk and Cox proportional hazards analyses were performed to evaluate the effect of NOS2 genotypes on RILI. Results: Multivariate analysis found that three SNPs (rs2297518, rs1137933 and rs16949) in NOS2 were significantly associated with risk of RILI ⩾ 2 (P value = 0.001, 0.000092, 0.001, respectively) after adjusting for other covariates. Their associations were independent of radiation dose and mean lung dose. Further haplotype analysis indicated that the ATC haplotype of three SNPs is associated with reducing the risk of developing RILI. Conclusion: Our results demonstrate that genetic variants of NOS2 may serve as a reliable predictor of RILI in lung cancer patients treated with thoracic radiation

  10. Adenoviral gene transfer of endothelial nitric-oxide synthase (eNOS) partially restores normal pulmonary arterial pressure in eNOS-deficient mice

    Champion, Hunter C.; Bivalacqua, Trinity J.; Greenberg, Stanley S.; Giles, Thomas D.; Hyman, Albert L.; Kadowitz, Philip J.

    2002-01-01

    It has been shown that mice deficient in the gene coding for endothelial nitric-oxide synthase (eNOS) have increased pulmonary arterial pressure and pulmonary vascular resistance. In the present study, the effect of transfer to the lung of an adenoviral vector encoding the eNOS gene (AdCMVeNOS) on pulmonary arterial pressure and pulmonary vascular resistance was investigated in eNOS-deficient mice. One day after intratracheal administration of AdCMVeNOS to eNOS−/− mice, there was an increase in eNOS protein, cGMP levels, and calcium-dependent conversion of l-arginine to l-citrulline in the lung. The increase in eNOS protein and activity in eNOS−/− mice was associated with a reduction in mean pulmonary arterial pressure and pulmonary vascular resistance when compared with values in eNOS-deficient mice treated with vehicle or a control adenoviral vector coding for β-galactosidase, AdCMVβgal. These data suggest that in vivo gene transfer of eNOS to the lung in eNOS−/− mice can increase eNOS staining, eNOS protein, calcium-dependent NOS activity, and cGMP levels and partially restore pulmonary arterial pressure and pulmonary vascular resistance to near levels measured in eNOS+/+ mice. Thus, the major finding in this study is that in vivo gene transfer of eNOS to the lung in large part corrects a genetic deficiency resulting from eNOS deletion and may be a useful therapeutic intervention for the treatment of pulmonary hypertensive disorders in which eNOS activity is reduced. PMID:12237402

  11. A myo-inositol-1-phosphate synthase gene, IbMIPS1, enhances salt and drought tolerance and stem nematode resistance in transgenic sweet potato.

    Zhai, Hong; Wang, Feibing; Si, Zengzhi; Huo, Jinxi; Xing, Lei; An, Yanyan; He, Shaozhen; Liu, Qingchang

    2016-02-01

    Myo-inositol-1-phosphate synthase (MIPS) is a key rate limiting enzyme in myo-inositol biosynthesis. The MIPS gene has been shown to improve tolerance to abiotic stresses in several plant species. However, its role in resistance to biotic stresses has not been reported. In this study, we found that expression of the sweet potato IbMIPS1 gene was induced by NaCl, polyethylene glycol (PEG), abscisic acid (ABA) and stem nematodes. Its overexpression significantly enhanced stem nematode resistance as well as salt and drought tolerance in transgenic sweet potato under field conditions. Transcriptome and real-time quantitative PCR analyses showed that overexpression of IbMIPS1 up-regulated the genes involved in inositol biosynthesis, phosphatidylinositol (PI) and ABA signalling pathways, stress responses, photosynthesis and ROS-scavenging system under salt, drought and stem nematode stresses. Inositol, inositol-1,4,5-trisphosphate (IP3 ), phosphatidic acid (PA), Ca(2+) , ABA, K(+) , proline and trehalose content was significantly increased, whereas malonaldehyde (MDA), Na(+) and H2 O2 content was significantly decreased in the transgenic plants under salt and drought stresses. After stem nematode infection, the significant increase of inositol, IP3 , PA, Ca(2+) , ABA, callose and lignin content and significant reduction of MDA content were found, and a rapid increase of H2 O2 levels was observed, peaked at 1 to 2 days and thereafter declined in the transgenic plants. This study indicates that the IbMIPS1 gene has the potential to be used to improve the resistance to biotic and abiotic stresses in plants. PMID:26011089

  12. Over-expression of Catharanthus roseus tryptophan decarboxylase and strictosidine synthase in rol gene integrated transgenic cell suspensions of Vinca minor.

    Verma, Priyanka; Sharma, Abhishek; Khan, Shamshad Ahmad; Shanker, Karuna; Mathur, Ajay K

    2015-01-01

    Tryptophan decarboxylase (TDC) and strictosidine synthase (STR) genes from Catharanthus roseus have been successfully over-expressed in the rol gene integrated cell suspensions of V. minor. Thirty seconds SAAT (sonication-assisted Agrobacterium transformation) treatment of plant cell suspension with LBA1119 having construct () generated three stable TDC + STR over-expressing cell lines--PVG1, PVG2, and PVG3. The transgenes were confirmed by β-glucuronidase GUS histochemical assay and PCR amplification of rol genes/GUS gene. All the three cell suspension lines were found to be slow growing. In comparison to the control cell suspensions (GI = 241.0 ± 5.8), PVG3 cell line registered a growth index (GI) of 208.0 ± 10.0 followed by PVG1 (GI = 140.0 ± 14.2) and PVG2 (GI = 85.0 ± 9.6). The PVG3 cell line was also up-scaled in the 5-l stirred tank bioreactor with GI of 745.6 ± 35.3 under optimized parameters. Only PVG3 line registered a twofold increase in total alkaloid content (2.1 ± 0.1% dry wt.) and showed vincamine presence (0.003 ± 0.001% dry wt.) which was further enhanced at the bioreactor level (2.7 ± 0.3 and 0.005 ± 0.001% dry wt., respectively). Real-time (RT) qPCR analysis of PVG3 showed more than sevenfold to eightfold increase in TDC and STR expression [relative quantity value (RQ) = 7.6 ± 0.8 (TDC); RQ = 8.5 ± 0.9 (STR)]. PMID:25106473

  13. Dermal exposure of Eisenia andrei earthworms: Effects of heavy metals on metallothionein and phytochelatin synthase gene expressions in coelomocytes.

    Homa, Joanna; Rorat, Agnieszka; Kruk, Jerzy; Cocquerelle, Claude; Plytycz, Barbara; Vandenbulcke, Franck

    2015-06-01

    Parameters such as total number of coelomocytes, riboflavin content in coelomocytes, expression of genes implied in metal homeostasis, and detoxification mechanisms can be used as biomarkers to assess the impact of metals on annelids. Defense biomarkers (detoxification gene expressions and coelomocyte parameters) were investigated in the ecotoxicologically important species Eisenia andrei following in vivo exposure to 5 different metals (zinc, copper, nickel, lead, and cadmium) at known concentrations. Coelomocyte numbers and riboflavin content were not affected by metallic exposure, but metal-specific gene expression variations were evidenced. PMID:25693738

  14. Novel Structural and Functional Motifs in cellulose synthase (CesA) Genes of Bread Wheat (Triticum aestivum, L.)

    Kaur, Simerjeet; Dhugga, Kanwarpal S; Gill, Kulvinder; Singh, Jaswinder

    2016-01-01

    Cellulose is the primary determinant of mechanical strength in plant tissues. Late-season lodging is inversely related to the amount of cellulose in a unit length of the stem. Wheat is the most widely grown of all the crops globally, yet information on its CesA gene family is limited. We have identified 22 CesA genes from bread wheat, which include homoeologs from each of the three genomes, and named them as TaCesAXA, TaCesAXB or TaCesAXD, where X denotes the gene number and the last suffix s...

  15. Effect of thoracic x-irradiation on glucose-6-phosphate dehydrogenase activity of the pectoral muscle of guinea pig

    The histochemical distribution of glucose-6-phosphate dehydrogenase (G6PD) was observed in the major pectoral muscle of a guinea pig that had received 240 R thoracic X-irradiation. The irradiation effects were studied at 24, 48 and 72 hrs after X-irradiation. Type I fibres of the pectoral muscle were deeply stained showing high activity whereas type II fibres demonstrated minimum enzyme activity. The intermediate fibres had medium levels of G6PD activity. Type II fibres showed more staining at 24 and 48 hrs as compared with control muscle. However, at 72 hrs all three fibre types showed a marked inhibition of G6PD activity. The significance of these changes suggests that muscle G6PD metabolism generally altered after irradiation, but the specific nature of these changes and their causes still remain unclear. (author)

  16. Incorporation of 14C glucose into glycogen and glucose-6-phosphate dehydrogenase activity in rat brain following carbon monoxide intoxication

    Incorporation of 14C glucose into glycogen and glucose-6-phosphate dehydrogenase activity in rat brain following carbon monoxide intoxication was studied. In brains of rats tested on the 20, 30 and 60th minute of exposure to CO and immediately after removal from the chamber the enzyme activity showed no essential deviation from the control level. In the group of rats tested 1 hour after taking them out from the chamber increase of the enzyme activity was noticed, amounting to about 33% of the control value. The brains tested 24 hours after exposure showed the largest increase of the enzyme activity by about 94%. In the next time periods, 48 and 72 hours after intoxication, the enzyme activity was decreasing. The glycogen content in brains of control animals increased 3 hours after CO intoxication by about 69%. The increase of glycogen synthesis was expressed by increase of the total radioactivity, which amounted to 160% of the control value. (Z.M.)

  17. Identification of Mutation of Glucose-6-Phosphate Dehy-drogenase (G6PD in Iran: Meta- analysis Study

    Mahmood Moosazadeh

    2013-09-01

    Full Text Available Background: Glucose-6-phosphate dehydrogenase is one of the most common genetic deficiencies, which approximately 400 million people in the world suffer from. According to authors' initial search, numerous studies have been carried out in Iran regarding molecular variants of this enzyme. Thus, this meta-analysis presented a reliable estimation about prevalence of different types of molecular mutations of G6PD Enzyme in Iran.Methods: Keywords "glucose 6 phosphate dehydrogenase or G6PD, Mediterranean or Chatham or Cosenza and mutation, Iran or Iranian and their Persian equivalents" were searched in different databases. Moreover, reference list of the published studies were examined to increase sensitivity and to select more studies. After studying titles and abstracts of retrieved articles, excluding the repeated and unrelated ones, and evaluating quality of articles, documents were selected. Data was analyzed using STATA.Results: After performing systematic review, 22 papers were entered this meta-analysis and 1698 subjects were examined concerning G6PD molecular mutation. In this meta-analysis, prevalence of Mediterranean mutation, Chatham mutation and Cosenza mutation in Iran was estimated 78.2%, 9.1% and 0.5% respectively.Conclusions: This meta-analysis showed that in spite of prevalence of different types of G6PD molecular mutations in center, north, north-west and west of Iran, the most common molecular mutations in people with G6PD deficiency in Iran, like other Mediterranean countries and countries around Persian Gulf, were Mediterranean mutation, Chatham mutation and Cosenza mutation. It is also recommended that future studies may focus on races and regions which haven't been taken into consideration up to now.

  18. Mannose 6-phosphate-dependent targeting of lysosomal enzymes is required for normal craniofacial and dental development.

    Koehne, Till; Markmann, Sandra; Schweizer, Michaela; Muschol, Nicole; Friedrich, Reinhard E; Hagel, Christian; Glatzel, Markus; Kahl-Nieke, Bärbel; Amling, Michael; Schinke, Thorsten; Braulke, Thomas

    2016-09-01

    Mucolipidosis II (MLII) is a severe systemic genetic disorder caused by defects in mannose 6-phosphate-dependent targeting of multiple lysosomal hydrolases and subsequent lysosomal accumulation of non-degraded material. MLII patients exhibit marked facial coarseness and gingival overgrowth soon after birth, accompanied with delayed tooth eruption and dental infections. To examine the pathomechanisms of early craniofacial and dental abnormalities, we analyzed mice with an MLII patient mutation that mimic the clinical and biochemical symptoms of MLII patients. The mouse data were compared with clinical and histological data of gingiva and teeth from MLII patients. Here, we report that progressive thickening and porosity of calvarial and mandibular bones, accompanied by elevated bone loss due to 2-fold higher number of osteoclasts cause the characteristic craniofacial phenotype in MLII. The analysis of postnatal tooth development by microcomputed tomography imaging and histology revealed normal dentin and enamel formation, and increased cementum thickness accompanied with accumulation of storage material in cementoblasts of MLII mice. Massive accumulation of storage material in subepithelial cells as well as disorganization of collagen fibrils led to gingival hypertrophy. Electron and immunofluorescence microscopy, together with (35)S-sulfate incorporation experiments revealed the accumulation of non-degraded material, non-esterified cholesterol and glycosaminoglycans in gingival fibroblasts, which was accompanied by missorting of various lysosomal proteins (α-fucosidase 1, cathepsin L and Z, Npc2, α-l-iduronidase). Our study shows that MLII mice closely mimic the craniofacial and dental phenotype of MLII patients and reveals the critical role of mannose 6-phosphate-dependent targeting of lysosomal proteins for alveolar bone, cementum and gingiva homeostasis. PMID:27239697

  19. Glucose-6-Phosphate Dehydrogenase Enhances Antiviral Response through Downregulation of NADPH Sensor HSCARG and Upregulation of NF-κB Signaling

    Yi-Hsuan Wu

    2015-12-01

    Full Text Available Glucose-6-phosphate dehydrogenase (G6PD-deficient cells are highly susceptible to viral infection. This study examined the mechanism underlying this phenomenon by measuring the expression of antiviral genes—tumor necrosis factor alpha (TNF-α and GTPase myxovirus resistance 1 (MX1—in G6PD-knockdown cells upon human coronavirus 229E (HCoV-229E and enterovirus 71 (EV71 infection. Molecular analysis revealed that the promoter activities of TNF-α and MX1 were downregulated in G6PD-knockdown cells, and that the IκB degradation and DNA binding activity of NF-κB were decreased. The HSCARG protein, a nicotinamide adenine dinucleotide phosphate (NADPH sensor and negative regulator of NF-κB, was upregulated in G6PD-knockdown cells with decreased NADPH/NADP+ ratio. Treatment of G6PD-knockdown cells with siRNA against HSCARG enhanced the DNA binding activity of NF-κB and the expression of TNF-α and MX1, but suppressed the expression of viral genes; however, the overexpression of HSCARG inhibited the antiviral response. Exogenous G6PD or IDH1 expression inhibited the expression of HSCARG, resulting in increased expression of TNF-α and MX1 and reduced viral gene expression upon virus infection. Our findings suggest that the increased susceptibility of the G6PD-knockdown cells to viral infection was due to impaired NF-κB signaling and antiviral response mediated by HSCARG.

  20. Disruption of Yarrowia lipolytica TPS1 gene encoding trehalose-6-P synthase does not affect growth in glucose but impairs growth at high temperature.

    Carmen-Lisset Flores

    Full Text Available We have cloned the Yarrowia lipolytica TPS1 gene encoding trehalose-6-P synthase by complementation of the lack of growth in glucose of a Saccharomyces cerevisiae tps1 mutant. Disruption of YlTPS1 could only be achieved with a cassette placed in the 3' half of its coding region due to the overlap of its sequence with the promoter of the essential gene YlTFC1. The Yltps1 mutant grew in glucose although the Y. lipolytica hexokinase is extremely sensitive to inhibition by trehalose-6-P. The presence of a glucokinase, insensitive to trehalose-6-P, that constitutes about 80% of the glucose phosphorylating capacity during growth in glucose may account for the growth phenotype. Trehalose content was below 1 nmol/mg dry weight in Y. lipolytica, but it increased in strains expressing YlTPS1 under the control of the YlTEF1 promoter or with a disruption of YALI0D15598 encoding a putative trehalase. mRNA levels of YlTPS1 were low and did not respond to thermal stresses, but that of YlTPS2 (YALI0D14476 and YlTPS3 (YALI0E31086 increased 4 and 6 times, repectively, by heat treatment. Disruption of YlTPS1 drastically slowed growth at 35°C. Homozygous Yltps1 diploids showed a decreased sporulation frequency that was ascribed to the low level of YALI0D20966 mRNA an homolog of the S. cerevisiae MCK1 which encodes a protein kinase that activates early meiotic gene expression.

  1. Glucose-6-phosphate dehydrogenase (G6PD mutations and haemoglobinuria syndrome in the Vietnamese population

    Day Nick

    2009-07-01

    Full Text Available Abstract Background In Vietnam the blackwater fever syndrome (BWF has been associated with malaria infection, quinine ingestion and G6PD deficiency. The G6PD variants within the Vietnamese Kinh contributing to the disease risk in this population, and more generally to haemoglobinuria, are currently unknown. Method Eighty-two haemoglobinuria patients and 524 healthy controls were screened for G6PD deficiency using either the methylene blue reduction test, the G-6-PDH kit or the micro-methaemoglobin reduction test. The G6PD gene variants were screened using SSCP combined with DNA sequencing in 82 patients with haemoglobinuria, and in 59 healthy controls found to be G6PD deficient. Results This study confirmed that G6PD deficiency is strongly associated with haemoglobinuria (OR = 15, 95% CI [7.7 to 28.9], P G6PD variants were identified in the Vietnamese population, of which two are novel (Vietnam1 [Glu3Lys] and Vietnam2 [Phe66Cys]. G6PD Viangchan [Val291Met], common throughout south-east Asia, accounted for 77% of the variants detected and was significantly associated with haemoglobinuria within G6PD-deficient ethnic Kinh Vietnamese (OR = 5.8 95% CI [114-55.4], P = 0.022. Conclusion The primary frequency of several G6PD mutations, including novel mutations, in the Vietnamese Kinh population are reported and the contribution of G6PD mutations to the development of haemoglobinuria are investigated.

  2. Construction and characterization of a double deletion mutant of Fusarium verticillioides lacking two putative trehalose-6-phosphate phosphatase genes

    Fusarium verticillioides is a fungal pathogen that commonly infects the stalk, ear, and kernels of corn and can produce fumonisins, a family of mycotoxins linked to disease in livestock and humans. Our goal is to characterize the role of the disaccharide trehalose in growth and stress response in F....

  3. Glucose-6-phosphate dehydrogenase and glutathione reductase activity in methemoglobin reduction by methylene blue and cyst amine: study on glucose-6-phosphate dehydrogenase-deficient individuals, on normal subjects and on riboflavin-treated subjects

    Benedito Barraviera

    1988-10-01

    Full Text Available The authors have standardized methods for evaluation of the activity of the glucose-6-phosphate dehydrogenase and of glutathione reductase. The general principle of the first method was based on methemoglobin formation by sodium nitrite followed by stimulation of the glucose-6-phosphate dehydrogenase with methylene blue. Forty six adults (23 males and 23 females were studied. Subjects were not G6PD deficient and were aged 20 to 30 years. The results showed that methemoglobin reduction by methylene blue was 154.40 and 139.90 mg/min (p<0.05 for males and females, respectively, in whole blood, and 221.10 and 207.85 mg/min (n.s., respectively, in washed red cells. These data showed that using washed red cells and 0.7g% sodium nitrite concentration produced no differences between sexes and also shortened reading time for the residual amount of methemoglobin to 90 minutes. Glutathione reductase activity was evaluated on the basis of the fact that cystamine (a thiol agent binds to the SH groups of hemoglobin, forming complexes. These complexes are reversed by the action of glutathione reductase, with methemoglobin reduction occurring simultaneously with this reaction. Thirty two adults (16 males and 16 females were studied. Subjects were not G6PD deficient and were aged 20 to 30 years. Methemoglobin reduction by cystamine was 81.27 and 91.13 mg/min (p<0.01 for males and females, respectively. These data showed that using washed red cells and 0.1 M cystamine concentration permits a reading of the residual amount of methemoglobin at 180 minutes of incubation. Glutathione reductase activity was evaluated by methemoglobin reduction by cystamine in 14 females before and after treatment with 10 mg riboflavin per day for 8 days. The results were 73.69 and 94.26 jug/min (p<0.01 before and after treatment, showing that riboflavin treatment increase glutathione reductase activity even in normal individuals. Three Black G6PD-deficient individuals (2 males and 1

  4. Provitamin A Accumulation in Cassava (Manihot esculenta) Roots Driven by a Single Nucleotide Polymorphism in a Phytoene Synthase Gene[W

    Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

    2010-01-01

    Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification. PMID:20889914

  5. cDNA cloning and expression analyses of phytoene synthase 1, phytoene desaturase and ζ-carotene desaturase genes from Solanum lycopersicum KKU-T34003

    Krittaya Supathaweewat

    2013-10-01

    Full Text Available We report on the cloning of Psy1, Pds and Zds cDNAs encoding the enzymes responsible for lycopene biosynthesis,namely phytoene synthase 1 (PSY1, phytoene desaturase (PDS and -carotene desaturase (ZDS, respectively, from high-lycopene tomato cultivar, Solanum lycopersicum KKU-T34003. DNA sequence analyses showed that the complete openreading frames of Psy1, Pds and Zds cDNAs were 1,239, 1,752 and 1,767 base pairs in length and encoded proteins of 412,583 and 588 amino acids, respectively. Phylogenetic and the conserved domain analyses suggest that PSY1, PDS and ZDSfrom S. lycopersicum KKU-T34003 potentially have similar structures and biological functions to the corresponding proteinsfrom other plants. Gene expression studies showed that Psy1 was expressed only in the petal and the breaker fruit, whereasthe expressions of Pds and Zds were observed in the petal, the breaker fruit and the leaf. The highest expression level for allgenes was detected in the breaker-stage fruit, suggesting that carotenoid accumulation was developmentally regulated inthe chromoplast-containing tissues.

  6. Genome-wide identification and expression profile analysis of citrus sucrose synthase genes: investigation of possible roles in the regulation of sugar accumulation.

    Mohammad Zahidul Islam

    Full Text Available Sucrose synthase (Sus (EC 2.4.1.13 is a key enzyme for the sugar accumulation that is critical to form fruit quality. In this study, extensive data-mining and PCR amplification confirmed that there are at least six Sus genes (CitSus1-6 in the citrus genome. Gene structure and phylogeny analysis showed an evolutionary consistency with other plant species. The six Sus genes contain 12-15 exons and 11-14 introns and were evenly distributed into the three plant Sus groups (CitSus1 and CitSus2 in the Sus I group, CitSus3 and CitSus6 in the Sus II group, and CitSus4 and CitSus5 in the Sus III group. Transcripts of these six CitSus genes were subsequently examined. For tissues and organs, CitSus1 and 2 were predominantly expressed in fruit juice sacs (JS whereas CitSus3 and 4 were predominantly expressed in early leaves (immature leaves, and CitSus5 and 6 were predominantly expressed in fruit JS and in mature leaves. During fruit development, CitSus5 transcript increased significantly and CitSus6 transcript decreased significantly in fruit JS. In the fruit segment membrane (SM, the transcript levels of CitSus2 and 5 were markedly higher and the abundant levels of CitSus3 and 6 gradually decreased. Moreover, transcript levels of CitSus1-4 examined were higher and the CitSus5 transcript level was lower in the fruit SM than in fruit JS, while CitSus6 had a similar transcript level in fruit JS and SM. In addition, transcripts of CitSus1-6 responded differently to dehydration in mature leaves or to mild drought stress in fruit JS and SM. Finally, the possible roles of Sus genes in the regulation of sugar accumulation are discussed; however, further study is required.

  7. Widespread Occurrence and Genomic Context of Unusually Small Polyketide Synthase Genes in Microbial Consortia Associated with Marine Sponges

    Fieseler, L.; Hentschel, Ute; Grozdanov, L.; Schirmer, A; Wen, G; Platzer, M; Hrvatin, S.; Butzke, D.; Zimmermann, K.; Piel, J.

    2007-01-01

    Numerous marine sponges harbor enormous amounts of as-yet-uncultivated bacteria in their tissues. There is increasing evidence that these symbionts play an important role in the synthesis of protective metabolites, many of which are of great pharmacological interest. In this study, genes for the biosynthesis of polyketides, one of the most important classes of bioactive natural products, were systematically investigated in 20 demosponge species from different oceans. Unexpectedly, the sponge ...

  8. Attenuation of Mycobacterium tuberculosis by Disruption of a mas-Like Gene or a Chalcone Synthase-Like Gene, Which Causes Deficiency in Dimycocerosyl Phthiocerol Synthesis

    Sirakova, Tatiana D.; Dubey, Vinod S.; Cynamon, Michael H.; Kolattukudy, Pappachan E.

    2003-01-01

    Tuberculosis is one of the leading preventable causes of death. Emergence of drug-resistant tuberculosis makes the discovery of new targets for antimycobacterial drugs critical. The unique mycobacterial cell wall lipids are known to play an important role in pathogenesis, and therefore the genes responsible for their biosynthesis offer potential new targets. To assess the possible role of some of the genes potentially involved in cell wall lipid synthesis, we disrupted a mas-like gene, msl7, ...

  9. N-acetylglucosamine-6-phosphate deacetylase (NagA) of Listeria monocytogenes EGD, an essential enzyme for the metabolism and recycling of amino sugars

    Popowska, Magdalena; Osińska, Magdalena; Rzeczkowska, Magdalena

    2011-01-01

    The main aim of our study was to determine the physiological function of NagA enzyme in the Listeria monocytogenes cell. The primary structure of the murein of L. monocytogenes is very similar to that of Escherichia coli, the main differences being amidation of diaminopimelic acid and partial de-N-acetylation of glucosamine residues. NagA is needed for the deacetylation of N-acetyl-glucosamine-6 phosphate to glucosamine-6 phosphate and acetate. Analysis of the L. monocytogenes genome reveals ...

  10. Global gene expression during stringent response in Corynebacterium glutamicum in presence and absence of the rel gene encoding (pppGpp synthase

    Kalinowski Jörn

    2006-09-01

    Full Text Available Background The stringent response is the initial reaction of microorganisms to nutritional stress. During stringent response the small nucleotides (pppGpp act as global regulators and reprogram bacterial transcription. In this work, the genetic network controlled by the stringent response was characterized in the amino acid-producing Corynebacterium glutamicum. Results The transcriptome of a C. glutamicum rel gene deletion mutant, unable to synthesize (pppGpp and to induce the stringent response, was compared with that of its rel-proficient parent strain by microarray analysis. A total of 357 genes were found to be transcribed differentially in the rel-deficient mutant strain. In a second experiment, the stringent response was induced by addition of DL-serine hydroxamate (SHX in early exponential growth phase. The time point of the maximal effect on transcription was determined by real-time RT-PCR using the histidine and serine biosynthetic genes. Transcription of all of these genes reached a maximum at 10 minutes after SHX addition. Microarray experiments were performed comparing the transcriptomes of SHX-induced cultures of the rel-proficient strain and the rel mutant. The differentially expressed genes were grouped into three classes. Class A comprises genes which are differentially regulated only in the presence of an intact rel gene. This class includes the non-essential sigma factor gene sigB which was upregulated and a large number of genes involved in nitrogen metabolism which were downregulated. Class B comprises genes which were differentially regulated in response to SHX in both strains, independent of the rel gene. A large number of genes encoding ribosomal proteins fall into this class, all being downregulated. Class C comprises genes which were differentially regulated in response to SHX only in the rel mutant. This class includes genes encoding putative stress proteins and global transcriptional regulators that might be

  11. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile

    Shuiyuan Cheng

    2016-03-01

    Full Text Available Roman chamomile (Chamaemelum nobile L. is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969 was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  12. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...... gene product had no PRPP synthase activity. In contrast, expression of five pairwise combinations of PRS genes resulted in the formation of active PRPP synthase. These combinations were PRS1 PRS2, PRS1 PRS3, and PRS1 PRS4, as well as PRS5 PRS2 and PRS5 PRS4. None of the remaining five possible pairwise...... combinations of PRS genes appeared to produce active enzyme. Extract of an E. coli strain containing a plasmid-borne PRS1 gene and a chromosome-borne PRS3 gene contained detectable PRPP synthase activity, whereas extracts of strains containing PRS1 PRS2, PRS1 PRS4, PRS5 PRS2, or PRS5 PRS4 contained no...

  13. A critical update on endothelial nitric oxide synthase gene variations in women with idiopathic recurrent spontaneous abortion: genetic association study, systematic review and meta-analyses.

    Pereza, N; Peterlin, B; Volk, M; Kapović, M; Ostojić, S

    2015-05-01

    A number of case-control studies investigated the association between idiopathic recurrent spontaneous abortion (IRSA) and variations in the gene encoding endothelial nitric oxide synthase (NOS3), but yielded contradictory results. Our aim was to test the association of the NOS3 variable number of tandem repeats (VNTR) in intron 4 and +894 G/T single-nucleotide polymorphism (SNP) with IRSA in Slovenian women (148 IRSA and 149 control women), conduct a systematic review of literature on the association between NOS3 gene variations and IRSA, and perform meta-analyses of studies that met the inclusion criteria, defined by virtue of the European Society for Human Reproduction and Embryology evidence-based guidelines for recurrent spontaneous abortion. Genotyping was performed using PCR and restriction fragment length polymorphism methods. The systematic review of literature (English language) was conducted using PubMed and Scopus databases, to 1 November 2014. We determined no association of IRSA with the VNTR in intron 4 and +894 G/T SNP in Slovenian women. Furthermore, 16 case-control studies were identified on the association between 15 NOS3 gene variations and IRSA. However, significant inconsistencies exist in the selection criteria of patients and controls between studies. The meta-analysis of VNTR in intron 4 was performed on five studies (894 patients, 944 controls), whereas the meta-analysis of +894 G/T SNP included six studies (1111 patients, 1121 controls). The association with IRSA was significant for the +894 G/T SNP under the dominant genetic model (GT+TT versus GG) based on fixed (odds ratio (OR) = 1.54, 95% confidence interval (CI) = 1.28-1.86, P = <0.01) and random effects models (OR = 1.54, 95% CI = 1.03-2.31, P = 0.03). In conclusion, the GT and TT genotypes of the +894 G/T SNP in women might contribute to a predisposition to IRSA. Additional genetic association and functional studies in different populations with larger numbers of participants and a

  14. Gene cloning, structural gene and promoter identification, and active assay of the phosphatidylcholine synthase of Pseudomonas sp. strain 593.

    He, Huoguang; Wu, Bin; Xiong, Min; Li, Yang; Wu, Wenhua; Wang, Xingguo

    2011-10-01

    Pseudomonas sp. strain 593, a soil bacterium, is able to use exogenous choline to synthesize phosphatidylcholine via phosphatidylcholine synthase (Pcs). A 2020 bp DNA fragment that hybridized to a Pcs probe was cloned. This fragment contained a large open reading frame (ORF) with two potential ATG start sites that would encode for 293 and 231 amino acid proteins. Fragments containing the two ORFs encoded Pcs when they were inserted into the expression vector pET23a and expressed under the control of the T7 promoter in Escherichia coli BL21(DE3) pLysS. However, when the two ORFs were inserted into the cloning vector pMD18-T and expressed without control of the plasmid promoter in E. coli DH5α, only the larger clone exhibited Pcs activity. This suggested that the larger fragment contained a native promoter driving expression of the smaller ORF. A promoter activity assay, in which DNA fragments were inserted into the promoter-probe plasmid pCB182 and β-galactosidase activity of E. coli transformants was tested, demonstrated that a promoter is indeed present in the DNA region. All results together indicate that the 696 bp ORF, not the larger 897 bp ORF, encodes the Pcs in Pseudomonas sp. strain 593 and carries a promoter in front of its 5' terminus. PMID:21939372

  15. Mutant dihydrofolate reductase-thymidylate synthase genes in pyrimethamine-resistant Plasmodium falciparum with polymorphic chromosome duplications.

    Tanaka, M; Gu, H M; Bzik, D J; Li, W B; Inselburg, J

    1990-08-01

    We have identified dihydrofolate reductase (DHFR) gene point mutations and chromosomal changes in pyrimethamine-resistant mutants selected in vitro of Plasmodium falciparum strain FCR3. A pyrimethamine-resistant derivative of the pyrimethamine-sensitive strain FCR3, FCR3-D8, that had been grown in the absence of pyrimethamine for an extended time, was grown in two concentrations of pyrimethamine, and surviving drug-resistant parasites were subcloned. One selected mutant, FCR3-D81, that grew at 1 X 10(-6) M pyrimethamine, contained a single point mutation in the DHFR domain which caused an amino acid change (Phe to Ser) at amino acid 223, whereas another mutant, FCR3-D85, that grew at 5 X 10(-6) M pyrimethamine had that same mutation and an additional point mutation that changed amino acid 54 (Asp to Asn). The selection of FCR3-D85, whose nucleotide sequence was identical to that previously reported for FCR3-D8, confirmed that the original FCR3-D8 parasite population had changed during extended growth in vitro in the absence of drug pressure. FCR3-D81 and FCR3-D85 cells contained different pairs of polymorphic chromosomes that hybridized to a DHFR-TS probe as well as to three other chromosome 4 specific DNAs, indicating that at least part of chromosome 4 had been duplicated and that these parasites were aneuploid with 15 rather than 14 chromosomes. The mutant DHFR-TS genes were diploid. We consider the roles of the polymorphic chromosome duplications and DHFR point mutation(s) as causes of pyrimethamine resistance. PMID:2233901

  16. A cluster of three genes (dapA, orf2, and dapB) of Brevibacterium lactofermentum encodes dihydrodipicolinate synthase, dihydrodipicolinate reductase, and a third polypeptide of unknown function.

    Pisabarro, A; Malumbres, M; Mateos, L M; Oguiza, J A; Martín, J F

    1993-01-01

    The dapA and dapB genes, encoding, respectively, dihydrodipicolinate synthase and dihydrodipicolinate reductase, the two first enzymes of the lysine branch of the aspartic amino acid family, were cloned from the DNA of the amino acid-producing bacterium Brevibacterium lactofermentum. The two genes were clustered in a 3.5-kb Sau3AI-BamHI fragment but were separated by an open reading frame of 750 nucleotides. The protein encoded by this open reading frame had little similarity to any protein i...

  17. Are free glucose and glucose-6-phosphate in milk indicators of specific physiological states in the cow?

    Larsen, Torben; Moyes, Kasey M

    2015-01-01

    ’s correlations were generated between milk variables. P<0.05 was considered significant. Concentration of free glucose and G6P were on average 331 and 81 μM, respectively. Time from last milking (stay in the gland cistern) did not increase the concentration of these monosaccharides, indicating that they are not......A total of 3200 milk samples from Holstein and Jersey cows were analysed for free glucose and glucose-6-phosphate (G6P) by an enzymatic-fluorometric method that requires no pre-treatment. The cows were primiparous as well as multiparous, and samples were taken throughout the entire lactation period...... hydrolysis product from lactose post secretion, but rather reflecting the energy status of the mammary epithelial cells pre-secretion. Wide variation in range of these metabolites, that is, from 90 to 630 μM and 5 to 324 μM, for glucose and G6P, respectively, was observed. During the first 21 weeks in milk...

  18. Kinetic and thermodynamic study of the reaction catalyzed by glucose-6-phosphate dehydrogenase with nicotinamide adenine dinucleotide

    Martin del Campo, Julia S. [Departamento de Fisica Aplicada, Centro de Investigacion y de Estudios Avanzados - Unidad Merida, Carretera antigua a Progreso Km. 6, A.P. 73 Cordemex, 97310, Merida, Yucatan (Mexico); Patino, Rodrigo, E-mail: rtarkus@mda.cinvestav.mx [Departamento de Fisica Aplicada, Centro de Investigacion y de Estudios Avanzados - Unidad Merida, Carretera antigua a Progreso Km. 6, A.P. 73 Cordemex, 97310, Merida, Yucatan (Mexico)

    2011-04-20

    Research highlights: {yields} The reaction catalyzed by one enzyme of the pentose phosphate pathway was studied. {yields} A spectrophotometric method is proposed for kinetic and thermodynamic analysis. {yields} The pH and the temperature influences are reported on physical chemical properties. {yields} Relative concentrations of substrates are also important in the catalytic process. - Abstract: The enzyme glucose-6-phosphate dehydrogenase (G6PD, EC 1.1.1.49) from Leuconostoc mesenteroides has a dual coenzyme specificity with oxidized nicotinamide adenine dinucleotide (NAD{sub ox}) and oxidized nicotinamide adenine dinucleotide phosphate as electron acceptors. The G6PD coenzyme selection is determined by the metabolic cellular prevailing conditions. In this study a kinetic and thermodynamic analysis is presented for the reaction catalyzed by G6PD from L. mesenteroides with NAD{sub ox} as coenzyme in phosphate buffer. For this work, an in situ spectrophotometric technique was employed based on the detection of one product of the reaction. Substrate and coenzyme concentrations as well as temperature and pH effects were evaluated. The apparent equilibrium constant, the Michaelis constant, and the turnover number were determined as a function of each experimental condition. The standard transformed Gibbs energy of reaction was determined from equilibrium constants at different initial conditions. For the product 6-phospho-D-glucono-1,5-lactone, a value of the standard Gibbs energy of formation is proposed, {Delta}{sub f}G{sup o} = -1784 {+-} 5 kJ mol{sup -1}.

  19. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  20. Estimation of risk of glucose 6-phosphate dehydrogenase-deficient red cells to ozone and nitrogen dioxide

    Amoruso, M.A.; Ryer, J.; Easton, D.; Witz, G.; Goldstein, B.D.

    1986-07-01

    It has been suggested that the more than 1 million black Americans with the A- variant of glucose-6-phosphate dehydrogenase deficiency (G6PD) are at risk for adverse hematologic effects due to inhalation of ambient levels of oxidant gases. To evaluate this hypothesis studies were performed that included direct exposure of human G6PD-deficient red cells, and of mouse strains with different G6PD levels, to the oxidant gases ozone and nitrogen dioxide. Using the oxidant drug phenylhydrazine in part as a point of comparison, conservative extrapolation of the data indicates that exposure to levels of ozone or nitrogen dioxide at least one and probably two orders of magnitude above the LD50 would be required for any hematologic effect to be observed of pertinence to G6PD deficiency. It is concluded that there is no reason to remove or preclude from the workplace black employees with the common A- variant of red cell G6PD deficiency who potentially are exposed to oxidant gases.