WorldWideScience

Sample records for 50s ribosomal subunit

  1. A new low resolution model for the 50S subunit of Escherichia coli ribosomes

    Neutron low angle scattering studies of the 50S subunit of Escherichia coli ribosomes using the contrast variation method reveals large fluctuations in the scattering density. A region of relatively low scattering density, rich in proteins, surrounds an RNA-rich core of higher scattering density. The centres of mass of the RNA and protein parts of the 50S subunit are separated by a distance that is considerably smaller than that reported in previous studies. (orig.)

  2. Structural model of the 50S subunit of E.Coli ribosomes from solution scattering

    The application of new methods of small-angle scattering data interpretation to a contrast variation study of the 50S ribosomal subunit of Escherichia coli in solution is described. The X-ray data from contrast variation with sucrose are analyzed in terms of the basic scattering curves from the volume inaccessible to sucrose and from the regions inside this volume occupied mainly by RNA and by proteins. From these curves models of the shape of the 50S and its RNA-rich core are evaluated and positioned so that their difference produces a scattering curve which is in good agreement with the scattering from the protein moiety. Basing on this preliminary model, the X-ray and neutron contrast variation data of the 50S subunit in aqueous solutions are interpreted in the frame of the advanced two-phase model described by the shapes of the 50S subunit and its RNA-rich core taking into account density fluctuations inside the RNA and the protein moiety. The shape of the envelope of the 50S subunit and of the RNA-rich core are evaluated with a resolution of about 40A. The shape of the envelope is in good agreement with the models of the 50S subunit obtained from electron microscopy on isolated particles. The shape of the RNA-rich core correlates well with the model of the entire particle determined by the image reconstruction from ordered sheets indicating that the latter model which is based on the subjective contouring of density maps is heavily biased towards the RNA

  3. Structural model of the 50S subunit of E.Coli ribosomes from solution scattering

    Svergun, D.I.; Koch, M.H.J. [Hamburg Outstation (Germany); Pedersen, J.S. [Riso National Laboratory, Roskilde (Denmark); Serdyuk, I.N. [Inst. of Protein Research, Moscow (Russian Federation)

    1994-12-31

    The application of new methods of small-angle scattering data interpretation to a contrast variation study of the 50S ribosomal subunit of Escherichia coli in solution is described. The X-ray data from contrast variation with sucrose are analyzed in terms of the basic scattering curves from the volume inaccessible to sucrose and from the regions inside this volume occupied mainly by RNA and by proteins. From these curves models of the shape of the 50S and its RNA-rich core are evaluated and positioned so that their difference produces a scattering curve which is in good agreement with the scattering from the protein moiety. Basing on this preliminary model, the X-ray and neutron contrast variation data of the 50S subunit in aqueous solutions are interpreted in the frame of the advanced two-phase model described by the shapes of the 50S subunit and its RNA-rich core taking into account density fluctuations inside the RNA and the protein moiety. The shape of the envelope of the 50S subunit and of the RNA-rich core are evaluated with a resolution of about 40A. The shape of the envelope is in good agreement with the models of the 50S subunit obtained from electron microscopy on isolated particles. The shape of the RNA-rich core correlates well with the model of the entire particle determined by the image reconstruction from ordered sheets indicating that the latter model which is based on the subjective contouring of density maps is heavily biased towards the RNA.

  4. Morphological variation of individual Escherichia coli 50S ribosomal subunits in situ, as revealed by cryo-electron tomography

    Electron tomography (ET) has been used to reconstruct in situ individual 50S ribosomal subunits in Escherichia coli rifampicin-treated cells. Rifampicin inhibits transcription initiation. As a result, rapid degradation of preformed mRNA and dissociation of 70S ribosomes give accumulation of free subunits. In the 50S subunit, the L1 stalk, the L7/L12 stalk, the central protuberance (CP), and the peptidyl transferase center (PTC) cleft are the most dynamic and flexible parts in the reconstructed structures with clear movements indicated. Different locations of the tunnel in the central cross-sections through the in situ 50S subunits indicate the flexible nature of the pathway inside the large ribosomal subunit. In addition, gross morphological heterogeneity was observed in the reconstructions. Our results demonstrate a considerable structural variability among individual 50S subunits in the intracellular environment

  5. The Vibrio harveyi GTPase CgtAV Is Essential and Is Associated with the 50S Ribosomal Subunit

    Sikora, A. E.; Zielke, R.; Datta, K.; Maddock, J. R.

    2006-01-01

    It was previously reported that unlike the other obg/cgtA GTPases, the Vibrio harveyi cgtAV is not essential. Here we show that cgtAV was not disrupted in these studies and is, in fact, essential for viability. Depletion of CgtAV did not result in cell elongation. CgtAV is associated with the large ribosomal particle. In light of our results, we predict that the V. harveyi CgtAV protein plays a similar essential role to that seen for Obg/CgtA proteins in other bacteria. PMID:16428430

  6. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka;

    2012-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several...

  7. A protein residing at the subunit interface of the bacterial ribosome.

    Agafonov, D E; Kolb, V A; Nazimov, I V; Spirin, A S

    1999-10-26

    Surface labeling of Escherichia coli ribosomes with the use of the tritium bombardment technique has revealed a minor unidentified ribosome-bound protein (spot Y) that is hidden in the 70S ribosome and becomes highly labeled on dissociation of the 70S ribosome into subunits. In the present work, the N-terminal sequence of the protein Y was determined and its gene was identified as yfia, an ORF located upstream the phe operon of E. coli. This 12.7-kDa protein was isolated and characterized. An affinity of the purified protein Y for the 30S subunit, but not for the 50S ribosomal subunit, was shown. The protein proved to be exposed on the surface of the 30S subunit. The attachment of the 50S subunit resulted in hiding the protein Y, thus suggesting the protein location at the subunit interface in the 70S ribosome. The protein was shown to stabilize ribosomes against dissociation. The possible role of the protein Y as ribosome association factor in translation is discussed. PMID:10535924

  8. Proteopedia Entry: The Large Ribosomal Subunit of "Haloarcula Marismortui"

    Decatur, Wayne A.

    2010-01-01

    This article presents a "Proteopedia" page that shows the refined version of the structure of the "Haloarcula" large ribosomal subunit as solved by the laboratories of Thomas Steitz and Peter Moore. The landmark structure is of great impact as it is the first atomic-resolution structure of the highly conserved ribosomal subunit which harbors…

  9. Ribosomal small subunit domains radiate from a central core

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O'Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

    2016-02-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2‧OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit.

  10. Disassembly of yeast 80S ribosomes into subunits is a concerted action of ribosome-assisted folding of denatured protein.

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-22

    It has been shown by several groups that ribosome can assist folding of denatured protein in vitro and the process is conserved across the species. Domain V of large ribosomal rRNA which occupies the intersubunit side of the large subunit was identified as the key player responsible for chaperoning the folding process. Thus, it is conceivable that denatured protein needs to access the intersubunit space of the ribosome in order to get folded. In this study, we have investigated the mechanism of release of the protein from the eukaryotic ribosome following reactivation. We have observed significant splitting of yeast 80S ribosome when incubated with the denatured BCAII protein. Energy-free disassembly mechanism functions in low Mg(+2) ion concentration for prokaryotic ribosomes. Eukaryotic ribosomes do not show significant splitting even at low Mg(+2) ion concentration. In this respect, denatured protein-induced disassembly of eukaryotic ribosome without the involvement of any external energy source is intriguing. For prokaryotic ribosomes, it was reported that the denatured protein induces ribosome splitting into subunits in order to access domain V-rRNA. In contrast, our results suggest an alternative mechanism for eukaryotic ribosomal rRNA-mediated protein folding and subsequent separation of the subunits by which release of the activated-protein occurs. PMID:26723252

  11. Nascent 60S ribosomal subunits enter the free pool bound by Nmd3p.

    Ho, J. H.; Kallstrom, G; Johnson, A. W.

    2000-01-01

    Nmd3p from yeast is required for the export of the large (60S) ribosomal subunit from the nucleus (Ho et al., 2000). Here, we show that Nmd3p forms a stable complex with free 60S subunits. Using an epitope-tagged Nmd3p, we show that free 60S subunits can be coimmunoprecipitated with Nmd3p. The interaction was specific for 60S subunits; 40S subunits were not coimmunoprecipitated. Using this coprecipitation technique and pulse-chase labeling of ribosomal subunit proteins we showed that Nmd3p bo...

  12. Effect of ultraviolet irradiation on 30-S ribosomal subunits. Identification of the RNA region crosslinked to protein S7

    The effects of ultraviolet irradiation on Escherichia coli 30-S ribosomal subunits were studied. At the doses of radiation used in this work (0-4.5 x 105 quanta/30-S subunit), only protein S7 was found to be significantly crosslinked to the 16-S RNA. In conditions where 25% of the protein was covalently crosslinked, the ability of the irradiated 30-S subunits to reassociate with 50-S subunits and their activity in polyphenylalanine synthesis decreased strongly. Similar results were obtained by irradiation with a germicide lamp (254 nm) or with a monochromatic ultraviolet light at 248 nm. No additional proteins were crosslinked to the 16-S RNA by irradiating 30-S subunits depleted in protein S1 or 70-S ribosomes. The covalent complex of 16-S RNA and protein S7 was isolated and digested by T1 ribonuclease. The oligonucleotide remaining attached to the crosslinked protein was characterised as A-C-C-U-C-G (position 1261-1266, see the sequence published by Carbon et al. (1979) Eur. J. Biochem. 160, 399-410). Analysis of this fragment suggests that protein S7 was linked to the cytosine at position 1265 in the RNA sequence. (orig.)

  13. Mammalian mitochondrial ribosomal small subunit (MRPS) genes: A putative role in human disease.

    Gopisetty, Gopal; Thangarajan, Rajkumar

    2016-09-01

    Mitochondria are prominently understood as power houses producing ATP the primary energy currency of the cell. However, mitochondria are also known to play an important role in apoptosis and autophagy, and mitochondrial dysregulation can lead to pathological outcomes. Mitochondria are known to contain 1500 proteins of which only 13 are coded by mitochondrial DNA and the rest are coded by nuclear genes. Protein synthesis in mitochondria involves mitochondrial ribosomes which are 55-60S particles and are composed of small 28S and large 39S subunits. A feature of mammalian mitoribosome which differentiate it from bacterial ribosomes is the increased protein content. The human mitochondrial ribosomal protein (MRP) gene family comprises of 30 genes which code for mitochondrial ribosomal small subunit and 50 genes for the large subunit. The present review focuses on the mitochondrial ribosomal small subunit genes (MRPS), presents an overview of the literature and data gleaned from publicly available gene and protein expression databases. The survey revealed aberrations in MRPS gene expression patterns in varied human diseases indicating a putative role in their etiology. PMID:27170550

  14. Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals.

    Dao, E Han; Sierra, Raymond G; Laksmono, Hartawan; Lemke, Henrik T; Alonso-Mori, Roberto; Coey, Aaron; Larsen, Kevin; Baxter, Elizabeth L; Cohen, Aina E; Soltis, S Michael; DeMirci, Hasan

    2015-07-01

    In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecond X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser. PMID:26798805

  15. Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals

    E. Han Dao

    2015-07-01

    Full Text Available In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecond X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.

  16. Neutron scattering and the 30 S ribosomal subunit of E. coli

    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today. 30 references, 5 figures

  17. Neutron Scattering and the 30 S Ribosomal Subunit of E. Coli

    Moore, P. B.; Engelman, D. M.; Langer, J. A.; Ramakrishnan, V. R.; Schindler, D. G.; Schoenborn, B. P.; Sillers, I. Y.; Yabuki, S.

    1982-06-01

    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today.

  18. Surface topography of the Bacillus stearothermophilus ribosome

    The surface topography of the intact 70S ribosome and free 30S and 50S subunits from Bacillus stearothermophilus strain 2,184 was investigated by lactoperoxidase-catalyzed iodination. Two-dimensional polyacrylamide gel electrophoresis was employed to separate ribosomal proteins for analysis of their reactivity. Free 50S subunits incorporated about 18% more 125I than did 50S subunits derived from 70S ribosomes, whereas free 30S subunits and 30S subunits derived from 70S ribosomes incorporated similar amounts of 125I. Iodinated 70S ribosomes and subunits retained 62-78% of the protein synthesis activity of untreated particles and sedimentation profiles showed no gross conformational changes due to iodination. The proteins most reactive to enzymatic iodination were S4, S7, S10 and Sa of the small subunit and L2, L4, L5/9, L6 and L36 of the large subunit. Proteins S2, S3, S7, S13, Sa, L5/9, L10, L11 and L24/25 were labeled substantially more in the free subunits than in the 70S ribosome. Other proteins, including S5, S9, S12, S15/16, S18 and L36 were more extensively iodinated in the 70S ribosome than in the free subunits. The locations of tyrosine residues in some homologus ribosomal proteins from B. stearothermophilus and E. coli are compared. (orig.)

  19. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors.

    Uli Ohmayer

    Full Text Available Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins and ribosomal RNAs (rRNAs. Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs.

  20. Heterologous complementation reveals that mutant alleles of QSR1 render 60S ribosomal subunits unstable and translationally inactive.

    Dick, F A; Trumpower, B L

    1998-01-01

    QSR1 is a highly conserved gene which encodes a 60S ribosomal subunit protein that is required for joining of large and small ribosomal subunits. In this report we demonstrate heterologous complementation of a yeast QSR1 deletion strain with both the human and corn homologs and show that the human and corn proteins are assembled into hybrid yeast/human and yeast/corn ribosomes. While the homologous genes complement lethality of the QSR1 deletion, they also result in a diminished growth rate. ...

  1. The A1 Subunit of Shiga Toxin 2 Has Higher Affinity for Ribosomes and Higher Catalytic Activity than the A1 Subunit of Shiga Toxin 1.

    Basu, Debaleena; Li, Xiao-Ping; Kahn, Jennifer N; May, Kerrie L; Kahn, Peter C; Tumer, Nilgun E

    2016-01-01

    Shiga toxin (Stx)-producing Escherichia coli (STEC) infections can lead to life-threatening complications, including hemorrhagic colitis (HC) and hemolytic-uremic syndrome (HUS), which is the most common cause of acute renal failure in children in the United States. Stx1 and Stx2 are AB5 toxins consisting of an enzymatically active A subunit associated with a pentamer of receptor binding B subunits. Epidemiological evidence suggests that Stx2-producing E. coli strains are more frequently associated with HUS than Stx1-producing strains. Several studies suggest that the B subunit plays a role in mediating toxicity. However, the role of the A subunits in the increased potency of Stx2 has not been fully investigated. Here, using purified A1 subunits, we show that Stx2A1 has a higher affinity for yeast and mammalian ribosomes than Stx1A1. Biacore analysis indicated that Stx2A1 has faster association and dissociation with ribosomes than Stx1A1. Analysis of ribosome depurination kinetics demonstrated that Stx2A1 depurinates yeast and mammalian ribosomes and an RNA stem-loop mimic of the sarcin/ricin loop (SRL) at a higher catalytic rate and is a more efficient enzyme than Stx1A1. Stx2A1 depurinated ribosomes at a higher level in vivo and was more cytotoxic than Stx1A1 in Saccharomyces cerevisiae. Stx2A1 depurinated ribosomes and inhibited translation at a significantly higher level than Stx1A1 in human cells. These results provide the first direct evidence that the higher affinity for ribosomes in combination with higher catalytic activity toward the SRL allows Stx2A1 to depurinate ribosomes, inhibit translation, and exhibit cytotoxicity at a significantly higher level than Stx1A1. PMID:26483409

  2. Extremophilic 50S Ribosomal RNA-Binding Protein L35Ae as a Basis for Engineering of an Alternative Protein Scaffold.

    Anna V Lomonosova

    Full Text Available Due to their remarkably high structural stability, proteins from extremophiles are particularly useful in numerous biological applications. Their utility as alternative protein scaffolds could be especially valuable in small antibody mimetic engineering. These artificial binding proteins occupy a specific niche between antibodies and low molecular weight substances, paving the way for development of innovative approaches in therapeutics, diagnostics, and reagent use. Here, the 50S ribosomal RNA-binding protein L35Ae from the extremophilic archaea Pyrococcus horikoshii has been probed for its potential to serve as a backbone in alternative scaffold engineering. The recombinant wild type L35Ae has a native-like secondary structure, extreme thermal stability (mid-transition temperature of 90°C and a moderate resistance to the denaturation by guanidine hydrochloride (half-transition at 2.6 M. Chemical crosslinking and dynamic light scattering data revealed that the wild type L35Ae protein has a propensity for multimerization and aggregation correlating with its non-specific binding to a model cell surface of HEK293 cells, as evidenced by flow cytometry. To suppress these negative features, a 10-amino acid mutant (called L35Ae 10X was designed, which lacks the interaction with HEK293 cells, is less susceptible to aggregation, and maintains native-like secondary structure and thermal stability. However, L35Ae 10X also shows lowered resistance to guanidine hydrochloride (half-transition at 2.0M and is more prone to oligomerization. This investigation of an extremophile protein's scaffolding potential demonstrates that lowered resistance to charged chemical denaturants and increased propensity to multimerization may limit the utility of extremophile proteins as alternative scaffolds.

  3. Chaperone binding at the ribosomal exit tunnel

    Kristensen, Ole; Gajhede, Michael

    2003-01-01

    The exit tunnel region of the ribosome is well established as a focal point for interaction between the components that guide the fate of nascent polypeptides. One of these, the chaperone trigger factor (TF), associates with the 50S ribosomal subunit through its N-terminal domain. Targeting of TF...

  4. Rice Ribosomal Protein Large Subunit Genes and Their Spatio-temporal and Stress Regulation.

    Moin, Mazahar; Bakshi, Achala; Saha, Anusree; Dutta, Mouboni; Madhav, Sheshu M; Kirti, P B

    2016-01-01

    Ribosomal proteins (RPs) are well-known for their role in mediating protein synthesis and maintaining the stability of the ribosomal complex, which includes small and large subunits. In the present investigation, in a genome-wide survey, we predicted that the large subunit of rice ribosomes is encoded by at least 123 genes including individual gene copies, distributed throughout the 12 chromosomes. We selected 34 candidate genes, each having 2-3 identical copies, for a detailed characterization of their gene structures, protein properties, cis-regulatory elements and comprehensive expression analysis. RPL proteins appear to be involved in interactions with other RP and non-RP proteins and their encoded RNAs have a higher content of alpha-helices in their predicted secondary structures. The majority of RPs have binding sites for metal and non-metal ligands. Native expression profiling of 34 ribosomal protein large (RPL) subunit genes in tissues covering the major stages of rice growth shows that they are predominantly expressed in vegetative tissues and seedlings followed by meiotically active tissues like flowers. The putative promoter regions of these genes also carry cis-elements that respond specifically to stress and signaling molecules. All the 34 genes responded differentially to the abiotic stress treatments. Phytohormone and cold treatments induced significant up-regulation of several RPL genes, while heat and H2O2 treatments down-regulated a majority of them. Furthermore, infection with a bacterial pathogen, Xanthomonas oryzae, which causes leaf blight also induced the expression of 80% of the RPL genes in leaves. Although the expression of RPL genes was detected in all the tissues studied, they are highly responsive to stress and signaling molecules indicating that their encoded proteins appear to have roles in stress amelioration besides house-keeping. This shows that the RPL gene family is a valuable resource for manipulation of stress tolerance in rice

  5. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  6. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20NLS mutant gene and examined polysome profile of cells that had been transfected with the S20NLS gene. As a result, we observed the formation of recombinant 40S carried S20NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20NLS. • Cytoplasm-retained S20NLS is crucial for creating a functional small subunit

  7. Phylogenetic relationships of the green alga Volvox carteri deduced from small-subunit ribosomal RNA comparisons.

    Rausch, H; Larsen, N; Schmitt, R

    1989-09-01

    The 1788-nucleotide sequence of the small-subunit ribosomal RNA (srRNA) coding region from the chlorophyte Volvox carteri was determined. The secondary structure bears features typical of the universal model of srRNA, including about 40 helices and a division into four domains. Phylogenetic relationships to 17 other eukaryotes, including two other chlorophytes, were explored by comparing srRNA sequences. Similarity values and the inspection of phylogenetic trees derived by distance matrix methods revealed a close relationship between V. carteri and Chlamydomonas reinhardtii. The results are consistent with the view that these Volvocales, and the third green alga, Nanochlorum eucaryotum, are more closely related to higher plants than to any other major eukaryotic group, but constitute a distinct lineage that has long been separated from the line leading to the higher plants. PMID:2506359

  8. A new fungal large subunit ribosomal RNA primer for high-throughput sequencing surveys.

    Mueller, Rebecca C; Gallegos-Graves, La Verne; Kuske, Cheryl R

    2016-02-01

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300-400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R-LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Together, these findings show that the LR22R-LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods. PMID:26656064

  9. Unexpected Diagnosis of Cerebral Toxoplasmosis by 16S and D2 Large-Subunit Ribosomal DNA PCR and Sequencing

    Kruse, Alexandra Yasmin Collin; Kvich, Lasse Andersson; Eickhardt-Dalbøge, Steffen Robert;

    2015-01-01

    The protozoan parasite Toxoplasma gondii causes severe opportunistic infections. Here, we report an unexpected diagnosis of cerebral toxoplasmosis. T. gondii was diagnosed by 16S and D2 large-subunit (LSU) ribosomal DNA (rDNA) sequencing of a cerebral biopsy specimen and confirmed by T. gondii...

  10. Serial femtosecond X-ray diffraction of 30S ribosomal subunit microcrystals in liquid suspension at ambient temperature using an X-ray free-electron laser

    Serial femtosecond X-ray (SFX) diffraction extending beyond 6 Å resolution using T. thermophilus 30S ribosomal subunit crystals is reported. High-resolution ribosome structures determined by X-ray crystallography have provided important insights into the mechanism of translation. Such studies have thus far relied on large ribosome crystals kept at cryogenic temperatures to reduce radiation damage. Here, the application of serial femtosecond X-ray crystallography (SFX) using an X-ray free-electron laser (XFEL) to obtain diffraction data from ribosome microcrystals in liquid suspension at ambient temperature is described. 30S ribosomal subunit microcrystals diffracted to beyond 6 Å resolution, demonstrating the feasibility of using SFX for ribosome structural studies. The ability to collect diffraction data at near-physiological temperatures promises to provide fundamental insights into the structural dynamics of the ribosome and its functional complexes

  11. One step engineering of the small-subunit ribosomal RNA using CRISPR/Cas9.

    Kannan, Krishna; Tsvetanova, Billyana; Chuang, Ray-Yuan; Noskov, Vladimir N; Assad-Garcia, Nacyra; Ma, Li; Hutchison Iii, Clyde A; Smith, Hamilton O; Glass, John I; Merryman, Chuck; Venter, J Craig; Gibson, Daniel G

    2016-01-01

    Bacteria are indispensable for the study of fundamental molecular biology processes due to their relatively simple gene and genome architecture. The ability to engineer bacterial chromosomes is quintessential for understanding gene functions. Here we demonstrate the engineering of the small-ribosomal subunit (16S) RNA of Mycoplasma mycoides, by combining the CRISPR/Cas9 system and the yeast recombination machinery. We cloned the entire genome of M. mycoides in yeast and used constitutively expressed Cas9 together with in vitro transcribed guide-RNAs to introduce engineered 16S rRNA genes. By testing the function of the engineered 16S rRNA genes through genome transplantation, we observed surprising resilience of this gene to addition of genetic elements or helix substitutions with phylogenetically-distant bacteria. While this system could be further used to study the function of the 16S rRNA, one could envision the "simple" M. mycoides genome being used in this setting to study other genetic structures and functions to answer fundamental questions of life. PMID:27489041

  12. One step engineering of the small-subunit ribosomal RNA using CRISPR/Cas9

    Kannan, Krishna; Tsvetanova, Billyana; Chuang, Ray-Yuan; Noskov, Vladimir N.; Assad-Garcia, Nacyra; Ma, Li; Hutchison III, Clyde A.; Smith, Hamilton O.; Glass, John I.; Merryman, Chuck; Venter, J. Craig; Gibson, Daniel G.

    2016-01-01

    Bacteria are indispensable for the study of fundamental molecular biology processes due to their relatively simple gene and genome architecture. The ability to engineer bacterial chromosomes is quintessential for understanding gene functions. Here we demonstrate the engineering of the small-ribosomal subunit (16S) RNA of Mycoplasma mycoides, by combining the CRISPR/Cas9 system and the yeast recombination machinery. We cloned the entire genome of M. mycoides in yeast and used constitutively expressed Cas9 together with in vitro transcribed guide-RNAs to introduce engineered 16S rRNA genes. By testing the function of the engineered 16S rRNA genes through genome transplantation, we observed surprising resilience of this gene to addition of genetic elements or helix substitutions with phylogenetically-distant bacteria. While this system could be further used to study the function of the 16S rRNA, one could envision the “simple” M. mycoides genome being used in this setting to study other genetic structures and functions to answer fundamental questions of life. PMID:27489041

  13. 2.8-Å Cryo-EM Structure of the Large Ribosomal Subunit from the Eukaryotic Parasite Leishmania.

    Shalev-Benami, Moran; Zhang, Yan; Matzov, Donna; Halfon, Yehuda; Zackay, Arie; Rozenberg, Haim; Zimmerman, Ella; Bashan, Anat; Jaffe, Charles L; Yonath, Ada; Skiniotis, Georgios

    2016-07-12

    Leishmania is a single-cell eukaryotic parasite of the Trypanosomatidae family, whose members cause an array of tropical diseases. The often fatal outcome of infections, lack of effective vaccines, limited selection of therapeutic drugs, and emerging resistant strains, underline the need to develop strategies to combat these pathogens. The Trypanosomatid ribosome has recently been highlighted as a promising therapeutic target due to structural features that are distinct from other eukaryotes. Here, we present the 2.8-Å resolution structure of the Leishmania donovani large ribosomal subunit (LSU) derived from a cryo-EM map, further enabling the structural observation of eukaryotic rRNA modifications that play a significant role in ribosome assembly and function. The structure illustrates the unique fragmented nature of leishmanial LSU rRNA and highlights the irregular distribution of rRNA modifications in Leishmania, a characteristic with implications for anti-parasitic drug development. PMID:27373148

  14. Similarity between the association factor of ribosomal subunits and the protein Stm1p from Saccharomyces cerevisiae

    Heriberto Correia

    2004-11-01

    Full Text Available A ribosome association factor (AF was isolated from the yeast Sacchharomyces cerevisiae. Partial amino acid sequence of AF was determined from its fragment of 25 kDa isolated by treating AF with 2-(2-nitrophenylsulfenyl-3-methyl-3'-Bromoindolenine (BNPS-skatole. This sequence has a 86% identity to the product of the single-copy S. cerevisiae STM1 gene that is apparently involved in several events like binding to quadruplex and triplex nucleic acids and participating in apoptosis, stability of telomere structures, cell cycle, and ribosomal function. Here we show that AF and Stm1p share some characteristics: both bind to quadruplex and Pu triplex DNA, associates ribosomal subunits, and are thermostable. These observations suggest that these polypeptides belong to a family of proteins that may have roles in the translation process.

  15. The essential nucleolar yeast protein Nop8p controls the exosome function during 60S ribosomal subunit maturation.

    Marcia C T Santos

    Full Text Available The yeast nucleolar protein Nop8p has previously been shown to interact with Nip7p and to be required for 60S ribosomal subunit formation. Although depletion of Nop8p in yeast cells leads to premature degradation of rRNAs, the biochemical mechanism responsible for this phenotype is still not known. In this work, we show that the Nop8p amino-terminal region mediates interaction with the 5.8S rRNA, while its carboxyl-terminal portion interacts with Nip7p and can partially complement the growth defect of the conditional mutant strain Δnop8/GAL::NOP8. Interestingly, Nop8p mediates association of Nip7p to pre-ribosomal particles. Nop8p also interacts with the exosome subunit Rrp6p and inhibits the complex activity in vitro, suggesting that the decrease in 60S ribosomal subunit levels detected upon depletion of Nop8p may result from degradation of pre-rRNAs by the exosome. These results strongly indicate that Nop8p may control the exosome function during pre-rRNA processing.

  16. Capreomycin susceptibility is increased by TlyA-directed 2'-O-methylation on both ribosomal subunits

    Monshupanee, Tanakarn; Johansen, Shanna K; Dahlberg, Albert E; Douthwaite, Stephen Roger

    2012-01-01

    The binding site of the cyclic peptide antibiotics capreomycin and viomycin is located on the ribosomal subunit interface close to nucleotides C1409 in 16S rRNA and C1920 in 23S rRNA. In Mycobacterium tuberculosis, the 2'-hydroxyls of both nucleotides are methylated by the enzyme TlyA. Loss of...... these methylations through inactivation of TlyA confers resistance to capreomycin and viomycin. We report here that TlyA orthologues occur in diverse bacteria and fall into two distinct groups. One group, now termed TlyA(I) , has shorter N- and C-termini and methylates only C1920; the second group (now...

  17. DNAJC21 Mutations Link a Cancer-Prone Bone Marrow Failure Syndrome to Corruption in 60S Ribosome Subunit Maturation.

    Tummala, Hemanth; Walne, Amanda J; Williams, Mike; Bockett, Nicholas; Collopy, Laura; Cardoso, Shirleny; Ellison, Alicia; Wynn, Rob; Leblanc, Thierry; Fitzgibbon, Jude; Kelsell, David P; van Heel, David A; Payne, Elspeth; Plagnol, Vincent; Dokal, Inderjeet; Vulliamy, Tom

    2016-07-01

    A substantial number of individuals with bone marrow failure (BMF) present with one or more extra-hematopoietic abnormality. This suggests a constitutional or inherited basis, and yet many of them do not fit the diagnostic criteria of the known BMF syndromes. Through exome sequencing, we have now identified a subgroup of these individuals, defined by germline biallelic mutations in DNAJC21 (DNAJ homolog subfamily C member 21). They present with global BMF, and one individual developed a hematological cancer (acute myeloid leukemia) in childhood. We show that the encoded protein associates with rRNA and plays a highly conserved role in the maturation of the 60S ribosomal subunit. Lymphoblastoid cells obtained from an affected individual exhibit increased sensitivity to the transcriptional inhibitor actinomycin D and reduced amounts of rRNA. Characterization of mutations revealed impairment in interactions with cofactors (PA2G4, HSPA8, and ZNF622) involved in 60S maturation. DNAJC21 deficiency resulted in cytoplasmic accumulation of the 60S nuclear export factor PA2G4, aberrant ribosome profiles, and increased cell death. Collectively, these findings demonstrate that mutations in DNAJC21 cause a cancer-prone BMF syndrome due to corruption of early nuclear rRNA biogenesis and late cytoplasmic maturation of the 60S subunit. PMID:27346687

  18. A new genus of athecate interstitial dinoflagellates, Togula gen. nov., previously encompassed within Amphidinium sensu lato: Inferred from light and electron microscopy and phylogenetic analyses of partial large subunit ribosomal DNA sequences

    Jørgensen, Mårten Flø; Murray, Shauna; Daugbjerg, Niels

    2004-01-01

    subunit ribosomal DNA as well as in size and shape. Based on morphological similarity and partial large subunit ribosomal DNA evidence, we erect the new genus, Togula gen. nov. with the emended type species Togula britannica (Herdman) comb. nov. Based on differences in division pattern and partial large...

  19. Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3

    Anuradha Seshadri; Umesh Varshney

    2006-06-01

    Ribosome recycling is a process which dissociates the post-termination complexes (post-TC) consisting of mRNA-bound ribosomes harbouring deacylated tRNA(s). Ribosome recycling factor (RRF), and elongation factor G (EFG) participate in this crucial process to free the ribosomal subunits for a new round of translation. We discuss the overall pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor 3 (IF3) in this process. Depending on the step(s) at which IF3 function is implicated, three models have been proposed. In model 1, RRF and EFG dissociate the post-TCs into the 50S and 30S subunits, mRNA and tRNA(s). In this model, IF3, which binds to the 30S subunit, merely keeps the dissociated subunits apart by its anti-association activity. In model 2, RRF and EFG separate the 50S subunit from the post-TC. IF3 then dissociates the remaining complex of mRNA, tRNA and the 30S subunit, and keeps the ribosomal subunits apart from each other. However, in model 3, both the genetic and biochemical evidence support a more active role for IF3 even at the step of dissociation of the post-TC by RRF and EFG into the 50S and 30S subunits.

  20. Molecular phylogeny of silk-producing insects based on 16S ribosomal RNA and cytochrome oxidase subunit I genes

    B. Mahendran; S. K. Ghosh; S. C. Kundu

    2006-04-01

    We have examined the molecular-phylogenetic relationships between nonmulberry and mulberry silkwormspecies that belong to the families Saturniidae, Bombycidae and Lasiocampidae using 16S ribosomal RNA (16S rRNA) and cytochrome oxidase subunit I (coxI) gene sequences. Aligned nucleotide sequences of 16S rRNA and coxI from 14 silk-producing species were used for construction of phylogenetic trees by maximum likelihood and maximum parsimony methods. The tree topology on the basis of 16S rRNA supports monophyly for members of Saturniidae and Bombycidae. Weighted parsimony analysis weighted towards transversions relative to transitions (ts, tv4) for coxI resulted in more robust bootstrap support over unweighted parsimony and favours the 16S rRNA tree topology. Combined analysis reflected clear biogeographic pattern, and agrees with morphological and cytological data.

  1. Physical and biochemical nature of the bacterial cytoplasm: movement and localization of mRNA and the 30S subunits of ribosomes.

    Trevors, J T

    2012-05-01

    There is a paucity of knowledge on how mRNA transcripts in the spatially crowded, but molecularly organized bacterial cytoplasm contact the 30S ribosomal subunits. Does simple diffusion in the cytoplasm account for transcript-ribosome interactions given that a large number of ribosomes (e.g., about 72,000 in Escherichia coli during exponential growth) can be present in the cytoplasm? Or are undiscovered mechanisms present where specific transcripts are directed to specific ribosomes at specific cytoplasmic locations, while others are mobilized in a random manner? Moreover, is it possible that cytoplasmic mobilization occurs in bacteria, driven possibly by thermal infrared (IR) radiation and the generation of exclusion zone (EZ) water? These aspects will be discussed in this article and hypotheses presented. PMID:22710107

  2. Architecture of the E.coli 70S ribosome

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.; Meerwinck, W.; Stuhrmann, H.B.; Pedersen, J.S.; Koch, M.H.J.; Volkov, V.V.; Kozin, M.B.; Svergun, D.I.

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast-vari...

  3. Architecture of the E.coli 70S ribosome

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.;

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  4. Incorporation of single dinitrophenyl-modified proteins in to the 30S subunit of Escherichia coli ribosomes by total reconstitution for localization by immune electron microscopy

    The ribosome is a structurally defined organelle whose function is central to the existence of all organisms. It is the unique site of protein biosynthesis in all cells. A detailed understanding of ribosome structure is essential in understanding the process of translation. This thesis represents a new approach to the systematic localization of individual proteins contained in the small subunit of Escherichia coli ribosomes using immunoelectron microscopy. All 30S proteins were purified using high performance liquid chromatography (HPLC) and eight isolated proteins (S12,S21,S14,S19,S18,S17,S16 and S13) were derivatized with 2,4-[3,5-3H]dinitrofluorobenzene (DNFB). The extent of modification of these proteins was estimated by both radioactivity and integrated peak areas, using dual wavelength monitoring at 214nm to detect protein and 360nm (to detect dinitrophenyl groups). Each dinitrophenylated protein was introduced in place of the corresponding unmodified protein into totally reconstituted 30S subunits. Antibodies raised against the DNP-hapten bound effectively to such reconstituted subunits and did not cause dissociation of the modified protein from the subunit. Electron microscopy of the immune complexes was used to localize the modified protein on the subunit surface. Incorporation of any of the DNP-modified proteins, with the exception of DNP-S18, does not interfere with the functionality of the ribosome as measure by the binding of Phe-tRNAPhe or the synthesis of poly(Phe) in a poly(U)-dependent manner. Results show that unmodified protein competes with DNP-protein and that DNP-protein can function, as its native counterpart, in stimulating uptake of specific proteins during reconstitution. This data provides evidence that each DNP-protein occupies the same position in 30S subunits as does the corresponding unmodified protein

  5. Phylogenetic position of the genus Perkinsus (Protista, Apicomplexa) based on small subunit ribosomal RNA.

    Goggin, C L; Barker, S C

    1993-07-01

    Parasites of the genus Perkinsus destroy marine molluscs worldwide. Their phylogenetic position within the kingdom Protista is controversial. Nucleotide sequence data (1792 bp) from the small subunit rRNA gene of Perkinsus sp. from Anadara trapezia (Mollusca: Bivalvia) from Moreton Bay, Queensland, was used to examine the phylogenetic affinities of this enigmatic genus. These data were aligned with nucleotide sequences from 6 apicomplexans, 3 ciliates, 3 flagellates, a dinoflagellate, 3 fungi, maize and human. Phylogenetic trees were constructed after analysis with maximum parsimony and distance matrix methods. Our analyses indicate that Perkinsus is phylogenetically closer to dinoflagellates and to coccidean and piroplasm apicomplexans than to fungi or flagellates. PMID:8366895

  6. Non-FG mediated transport of the large pre-ribosomal subunit through the nuclear pore complex by the mRNA export factor Gle2

    Occhipinti, L.; Chang, Y.; Altvater, M.; Menet, A. M.; Kemmler, S.; Panse, V. G.

    2013-01-01

    Multiple export receptors passage bound pre-ribosomes through nuclear pore complexes (NPCs) by transiently interacting with the Phe-Gly (FG) meshwork of their transport channels. Here, we reveal how the non-FG interacting yeast mRNA export factor Gly-Leu-FG lethal 2 (Gle2) functions in the export of the large pre-ribosomal subunit (pre-60S). Structure-guided studies uncovered conserved platforms used by Gle2 to export pre-60S: an uncharacterized basic patch required to bind pre-60S, and a sec...

  7. Single protein omission reconstitution studies of tetracycline binding to the 30S subunit of Escherichia coli ribosomes

    In previous work the authors showed that on photolysis of Escherichia coli ribosomes in the presence of [3H]tetracycline (TC) the major protein labeled is S7, and they presented strong evidence that such labeling takes place from a high-affinity site related to the inhibitory action of TC. In this work they use single protein omission reconstitution (SPORE) experiments to identify those proteins that are important for high-affinity TC binding to the 30S subunit, as measured by both cosedimentation and filter binding assays. With respect to both sedimentation coefficients and relative Phe-tRNAPhe binding, the properties of the SPORE particles they obtain parallel very closely those measured earlier, with the exception of the SPORE particle lacking S13. A total of five proteins, S3, S7, S8, S14, and S19, are shown to be important for TC binding, with the largest effects seen on omission of proteins S7 and S14. Determination of the protein compositions of the corresponding SPORE particles demonstrates that the observed effects are, for the most part, directly attributable to the omission of the given protein rather than reflecting an indirect effect of omitting one protein on the uptake of another. A large body of evidence supports the notion that four of these proteins, S3, S7, S14, and S19, are included, along with 16S rRNA bases 920-1,396, in one of the major domains of the 30S subunit. The results support the conclusion that the structure of this domain is important for the binding of TC and that, within this domain, TC binds directly to S7

  8. Hepatitis-C-virus-like internal ribosome entry sites displace eIF3 to gain access to the 40S subunit

    Hashem, Yaser; Des Georges, Amedee; Dhote, Vidya; Langlois, Robert; Liao, Hstau Y.; Grassucci, Robert A.; Pestova, Tatyana V.; Hellen, Christopher U. T.; Frank, Joachim

    2013-11-01

    Hepatitis C virus (HCV) and classical swine fever virus (CSFV) messenger RNAs contain related (HCV-like) internal ribosome entry sites (IRESs) that promote 5'-end independent initiation of translation, requiring only a subset of the eukaryotic initiation factors (eIFs) needed for canonical initiation on cellular mRNAs. Initiation on HCV-like IRESs relies on their specific interaction with the 40S subunit, which places the initiation codon into the P site, where it directly base-pairs with eIF2-bound initiator methionyl transfer RNA to form a 48S initiation complex. However, all HCV-like IRESs also specifically interact with eIF3 (refs 2, 5, 6, 7, 9, 10, 11, 12), but the role of this interaction in IRES-mediated initiation has remained unknown. During canonical initiation, eIF3 binds to the 40S subunit as a component of the 43S pre-initiation complex, and comparison of the ribosomal positions of eIF3 and the HCV IRES revealed that they overlap, so that their rearrangement would be required for formation of ribosomal complexes containing both components. Here we present a cryo-electron microscopy reconstruction of a 40S ribosomal complex containing eIF3 and the CSFV IRES. Remarkably, although the position and interactions of the CSFV IRES with the 40S subunit in this complex are similar to those of the HCV IRES in the 40S-IRES binary complex, eIF3 is completely displaced from its ribosomal position in the 43S complex, and instead interacts through its ribosome-binding surface exclusively with the apical region of domain III of the IRES. Our results suggest a role for the specific interaction of HCV-like IRESs with eIF3 in preventing ribosomal association of eIF3, which could serve two purposes: relieving the competition between the IRES and eIF3 for a common binding site on the 40S subunit, and reducing formation of 43S complexes, thereby favouring translation of viral mRNAs.

  9. Interconversion of active and inactive 30 S ribosomal subunits is accompanied by a conformational change in the decoding region of 16 S rRNA

    Moazed, D; Van Stolk, B J; Douthwaite, S;

    1986-01-01

    Zamir, Elson and their co-workers have shown that 30 S ribosomal subunits are reversibly inactivated by depletion of monovalent or divalent cations. We have re-investigated the conformation of 16 S rRNA in the active and inactive forms of the 30 S subunit, using a strategy that is designed......' regions of 16 S rRNA. The inactive form also shows significantly decreased reactivity at positions 1533 to 1538 (the Shine-Dalgarno region), in agreement with earlier findings. The principal changes in reactivity involve the universally conserved nucleotides G926, C1395, A1398 and G1401. The three purines...

  10. A local role for the small ribosomal subunit primary binder rpS5 in final 18S rRNA processing in yeast.

    Andreas Neueder

    Full Text Available In vivo depletion of the yeast small ribosomal subunit (SSU protein S5 (rpS5 leads to nuclear degradation of nascent SSUs and to a perturbed global assembly state of the SSU head domain. Here, we report that rpS5 plays an additional local role at the head/platform interface in efficient SSU maturation. We find that yeast small ribosomal subunits which incorporated an rpS5 variant lacking the seven C-terminal amino acids have a largely assembled head domain and are exported to the cytoplasm. On the other hand, 3' processing of 18S rRNA precursors is inhibited in these ribosomal particles, although they associate with the putative endonuclease Nob1p and other late acting 40S biogenesis factors. We suggest that the SSU head component rpS5 and platform components as rpS14 are crucial constituents of a highly defined spatial arrangement in the head-platform interface of nascent SSUs, which is required for efficient processing of the therein predicted SSU rRNA 3' end. Positioning of rpS5 in nascent SSUs, including its relative orientation towards platform components in the head-platform cleft, will depend on the general assembly and folding state of the head domain. Therefore, the suggested model can explain 18S precursor rRNA 3' processing phenotypes observed in many eukaryotic SSU head assembly mutants.

  11. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution...

  12. Crystal Structures of EF-G-Ribosome Complexes Trapped in Intermediate States of Translocation

    Zhou, Jie; Lancaster, Laura; Donohue, John Paul; Noller, Harry F. [UCSC

    2013-11-12

    Translocation of messenger and transfer RNA (mRNA and tRNA) through the ribosome is a crucial step in protein synthesis, whose mechanism is not yet understood. The crystal structures of three Thermus ribosome-tRNA-mRNA–EF-G complexes trapped with β,γ-imidoguanosine 5'-triphosphate (GDPNP) or fusidic acid reveal conformational changes occurring during intermediate states of translocation, including large-scale rotation of the 30S subunit head and body. In all complexes, the tRNA acceptor ends occupy the 50S subunit E site, while their anticodon stem loops move with the head of the 30S subunit to positions between the P and E sites, forming chimeric intermediate states. Two universally conserved bases of 16S ribosomal RNA that intercalate between bases of the mRNA may act as “pawls” of a translocational ratchet. These findings provide new insights into the molecular mechanism of ribosomal translocation.

  13. Localisation of the ribosomal proteins L2, L14 and L24 of the E. coli ribosome by means of nuclear spin contrast variation

    Ribosomes are ribonucleo-protein complexes, which are the site of the protein synthesis, one of the most important steps during the translation of the genetic code from the DNA to the proteins. The proteins L2, L14 and L24 in the 50S subunit and the protein L2 in the 70S ribosome of the E. coli bacterium were localised by means of nuclear spin contrast variation. The contrast created by isotopic substitution is increased by almost a factor of three provided that polarised neutrons are scattered by polarised hydrogen spins of the sample. To get additional information about the in situ structure of the proteins the shapes were described by a two or three sphere model. Within the project of mapping the 50S subunit of the E. coli ribosome the protein L24 is localised for the first time. L24 is one of the initiator protein for the assembly of the 50S subunit therefore the knowledge of the position is of great interest for the understanding of this process. With the localisation of the protein L14, which is one of the most conserved protein in the ribosome, new hints are given in respect of the protein function which was until now unknown. The localisation of the protein L2, which is one of the candidates of the area of the central step in protein synthesis was done both in the 50S subunit and in the whole 70S ribosome. This allows to investigate conformational changes during the association of the subunits. (orig.)

  14. Higher order structure in the 3'-minor domain of small subunit ribosomal RNAs from a gram negative bacterium, a gram positive bacterium and a eukaryote

    Douthwaite, S; Christensen, A; Garrett, R A

    1983-01-01

    , T2 and S1. The data enabled the various minimal secondary structural models, proposed for the 3'-regions of the E. coli and S. cerevisiae RNAs, to be critically examined, and to demonstrate that the main common features of these models are correct. The results also reveal the presence and position...... "unstructured" regions. Several unusual structural features were detected. Multiple G X A pairings in two of the putative helices, which are compatible with phylogenetic sequence comparisons, are strongly supported by the occurrence of cobra venom ribonuclease cuts adjacent to, and in one case between, these......An experimental approach was used to determine and compare the highest order structure within the 150 to 200 nucleotides at the 3'-ends of the RNAs from the small ribosomal subunits of Escherichia coli, Bacillus stearothermophilus and Saccharomyces cerevisiae. Chemical reagents were employed to...

  15. The antibiotic Furvina® targets the P-site of 30S ribosomal subunits and inhibits translation initiation displaying start codon bias.

    Fabbretti, Attilio; Brandi, Letizia; Petrelli, Dezemona; Pon, Cynthia L; Castañedo, Nilo R; Medina, Ricardo; Gualerzi, Claudio O

    2012-11-01

    Furvina®, also denominated G1 (MW 297), is a synthetic nitrovinylfuran [2-bromo-5-(2-bromo-2-nitrovinyl)-furan] antibiotic with a broad antimicrobial spectrum. An ointment (Dermofural®) containing G1 as the only active principle is currently marketed in Cuba and successfully used to treat dermatological infections. Here we describe the molecular target and mechanism of action of G1 in bacteria and demonstrate that in vivo G1 preferentially inhibits protein synthesis over RNA, DNA and cell wall synthesis. Furthermore, we demonstrate that G1 targets the small ribosomal subunit, binds at or near the P-decoding site and inhibits its function interfering with the ribosomal binding of fMet-tRNA during 30S initiation complex (IC) formation ultimately inhibiting translation. Notably, this G1 inhibition displays a bias for the nature (purine vs. pyrimidine) of the 3'-base of the codon, occurring efficiently only when the mRNA directing 30S IC formation and translation contains the canonical AUG initiation triplet or the rarely found AUA triplet, but hardly occurs when the mRNA start codon is either one of the non-canonical triplets AUU or AUC. This codon discrimination by G1 is reminiscent, though of opposite type of that displayed by IF3 in its fidelity function, and remarkably does not occur in the absence of this factor. PMID:22941660

  16. Non-FG mediated transport of the large pre-ribosomal subunit through the nuclear pore complex by the mRNA export factor Gle2.

    Occhipinti, Laura; Chang, Yiming; Altvater, Martin; Menet, Anna M; Kemmler, Stefan; Panse, Vikram G

    2013-09-01

    Multiple export receptors passage bound pre-ribosomes through nuclear pore complexes (NPCs) by transiently interacting with the Phe-Gly (FG) meshwork of their transport channels. Here, we reveal how the non-FG interacting yeast mRNA export factor Gly-Leu-FG lethal 2 (Gle2) functions in the export of the large pre-ribosomal subunit (pre-60S). Structure-guided studies uncovered conserved platforms used by Gle2 to export pre-60S: an uncharacterized basic patch required to bind pre-60S, and a second surface that makes non-FG contacts with the nucleoporin Nup116. A basic patch mutant of Gle2 is able to function in mRNA export, but not pre-60S export. Thus, Gle2 provides a distinct interaction platform to transport pre-60S to the cytoplasm. Notably, Gle2's interaction platforms become crucial for pre-60S export when FG-interacting receptors are either not recruited to pre-60S or are impaired. We propose that large complex cargos rely on non-FG as well as FG-interactions for their efficient translocation through the nuclear pore complex channel. PMID:23907389

  17. De novo Synthesis and Assembly of rRNA into Ribosomal Subunits during Cold Acclimation in Escherichia coli.

    Piersimoni, Lolita; Giangrossi, Mara; Marchi, Paolo; Brandi, Anna; Gualerzi, Claudio O; Pon, Cynthia L

    2016-04-24

    During the cold adaptation that follows a cold stress, bacterial cells undergo many physiological changes and extensive reprogramming of their gene expression pattern. Bulk gene expression is drastically reduced, while a set of cold shock genes is selectively and transiently expressed. The initial stage of cold acclimation is characterized by the establishment of a stoichiometric imbalance of the translation initiation factors (IFs)/ribosomes ratio that contributes to the preferential translation of cold shock transcripts. Whereas de novo synthesis of the IFs following cold stress has been documented, nothing was known concerning the activity of the rrn operons during the cold acclimation period. In this work, we focus on the expression of the rrn operons and the fate of rRNA after temperature downshift. We demonstrate that in Escherichia coli, rRNA synthesis does not stop during the cold acclimation phase, but continues with greater contribution of the P2 compared to the P1 promoter and all seven rrn operons are active, although their expression levels change with respect to pre-stress conditions. Eight hours after the 37°→10°C temperature downshift, the newly transcribed rRNA represents up to 20% of total rRNA and is preferentially found in the polysomes. However, with respect to the de novo synthesis of the IFs, both rRNA transcription and maturation are slowed down drastically by cold stress, thereby accounting in part for the stoichiometric imbalance of the IFs/ribosomes. Overall, our data indicate that new ribosomes, which are possibly suitable to function at low temperature, are slowly assembled during cold acclimation. PMID:26953262

  18. Immunogenicity Analysis of a Novel Subunit Vaccine Candidate Molecule-Recombinant L7/L12 Ribosomal Protein of Brucella suis.

    Du, Zhi-Qiang; Li, Xin; Wang, Jian-Ying

    2016-08-01

    Brucella was an intracellular parasite, which could infect special livestock and humans. After infected by Brucella, livestock's reproductive system could be affected and destroyed resulting in huge economic losses. More seriously, it could be contagious from livestock to humans. So far, there is no available vaccine which is safe enough for humans. On this point, subunit vaccine has become the new breakthrough of conquering brucellosis. In this study, Brucella rL7/L12-BLS fusion protein was used as an antigen to immunize rabbits to detect the immunogenicity. The results of antibody level testing assay of rabbit antiserum indicated rL7/L12-BLS fusion protein could elicit rabbits to produce high-level IgG. And gamma interferon (IFN-γ) concentrations in rabbit antiserum were obviously up-regulated in both the rL7/L12 group and rL7/L12-BLS group. Besides, the results of quantitative real-time PCR (qRT-PCR) showed the IFN-γ gene's expression levels of both the rL7/L12 group and rL7/L12-BLS group were obviously up-regulated. All these results suggested Brucella L7/L12 protein was an ideal subunit vaccine candidate and possessed good immunogenicity. And Brucella lumazine synthase (BLS) molecule was a favorable transport vector for antigenic protein. PMID:27075455

  19. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    Zhao, Huayan

    2015-08-13

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  20. Identification of the oligonucleotide and oligopeptide involved in an RNA-protein crosslink induced by ultraviolet irradiation of Escherichia coli 30 S ribosomal subunits

    When 30 S ribosomal subunits are irradiated with ultraviolet light, it has been found that an RNA-protein crosslinking reaction occurs whose primary target is protein S7. This paper describes the identification of the oligopeptide and oligonucleotide at the crosslinking point, by direct analysis (a) of the peptide remaining attached to an oligonucleotide (after total digestion of the RNA in the crosslinked complex with ribonucleases A and Tperpendicular, followed by digestion with trypsin), and (b) of the nucleotides remaining attached to the crosslinked protein (after digestion of the RNA in the complex with ribonuclease Tperpendicular alone). The crosslinking site was found to lie within a single short peptide, Ser-Met-Ala-Leu-Arg (positions 113 to 117 in the S7 sequence), with methionine as the probable amino acid concerned. The principal RNA site was found to lie within an oligonucleotide three to six bases long, the bracketed portion of the partially ordered sequence C-U-A-C-[A-A-U-G.G.C]-G in section P of the 16 S RNA. The methodology involved has been designed with a view to being generally applicable in future RNA-protein crosslinking studies, where several proteins are simultaneously attached to the RNA. (author)

  1. Differential Effects of Replacing Escherichia coli Ribosomal Protein L27 with Its Homologue from Aquifex aeolicus

    Maguire, Bruce A.; Manuilov, Anton V; Zimmermann, Robert A.

    2001-01-01

    The rpmA gene, which encodes 50S ribosomal subunit protein L27, was cloned from the extreme thermophile Aquifex aeolicus, and the protein was overexpressed and purified. Comparison of the A. aeolicus protein with its homologue from Escherichia coli by circular dichroism analysis and proton nuclear magnetic resonance spectroscopy showed that it readily adopts some structure in solution that is very stable, whereas the E. coli protein is unstructured under the same conditions. A mutant of E. co...

  2. YsxC, an essential protein in Staphylococcus aureus crucial for ribosome assembly/stability

    García-Lara Jorge

    2009-12-01

    Full Text Available Abstract Background Bacterial growth and division requires a core set of essential proteins, several of which are still of unknown function. They are also attractive targets for the development of new antibiotics. YsxC is a member of a family of GTPases highly conserved across eubacteria with a possible ribosome associated function. Results Here, we demonstrate by the creation of a conditional lethal mutant that ysxC is apparently essential for growth in S. aureus. To begin to elucidate YsxC function, a translational fusion of YsxC to the CBP-ProteinA tag in the staphylococcal chromosome was made, enabling Tandem Affinity Purification (TAP of YsxC-interacting partners. These included the ribosomal proteins S2, S10 and L17, as well as the β' subunit of the RNA polymerase. YsxC was then shown to copurify with ribosomes as an accessory protein specifically localizing to the 50 S subunit. YsxC depletion led to a decrease in the presence of mature ribosomes, indicating a role in ribosome assembly and/or stability in S. aureus. Conclusions In this study we demonstrate that YsxC of S. aureus localizes to the ribosomes, is crucial for ribosomal stability and is apparently essential for the life of S. aureus.

  3. Structural insights into ribosome translocation.

    Ling, Clarence; Ermolenko, Dmitri N

    2016-09-01

    During protein synthesis, tRNA and mRNA are translocated from the A to P to E sites of the ribosome thus enabling the ribosome to translate one codon of mRNA after the other. Ribosome translocation along mRNA is induced by the universally conserved ribosome GTPase, elongation factor G (EF-G) in bacteria and elongation factor 2 (EF-2) in eukaryotes. Recent structural and single-molecule studies revealed that tRNA and mRNA translocation within the ribosome is accompanied by cyclic forward and reverse rotations between the large and small ribosomal subunits parallel to the plane of the intersubunit interface. In addition, during ribosome translocation, the 'head' domain of small ribosomal subunit undergoes forward- and back-swiveling motions relative to the rest of the small ribosomal subunit around the axis that is orthogonal to the axis of intersubunit rotation. tRNA/mRNA translocation is also coupled to the docking of domain IV of EF-G into the A site of the small ribosomal subunit that converts the thermally driven motions of the ribosome and tRNA into the forward translocation of tRNA/mRNA inside the ribosome. Despite recent and enormous progress made in the understanding of the molecular mechanism of ribosome translocation, the sequence of structural rearrangements of the ribosome, EF-G and tRNA during translocation is still not fully established and awaits further investigation. WIREs RNA 2016, 7:620-636. doi: 10.1002/wrna.1354 For further resources related to this article, please visit the WIREs website. PMID:27117863

  4. Ribosome-inactivating proteins

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M.

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with oth...

  5. Cloning a cDNA Encoding Ribosomal Protein S25 from Amaranthus cruentus L.%籽粒苋(Amaranthus cruentus L.)核糖体蛋白S25基因(cDNA)的克隆及其表达分析

    徐芳秀; 江树业; 等

    2001-01-01

    @@ Ribosomes, the agents of protein synthesis, consist of roughly equal amounts of RNA (rRNA) and protein (r-protein). Knowledge of the ribosome and its function mainly comes from the extensive work on 70S bacterial ribosomes. There are 21 proteins in the small (30S) subunit and 30 in the large (50S) subunit in E. coil ri bosomes. The 80S eukaryotic ribosomes are more com plex than the bacterial ones and contain at least 30 pro teins in the small (40S) subunit and 40 in the large (60 S) subunit. These r-proteins are named S1 to S30 and L1 to L40 according to whether they arise from the small or large subunit, and to their mobility in gels. In plants, several ribosomal protein genes and/or cDNAs have been isolated, such as the small subunit proteins S 11, S13, S14, S16, and S19 and the large subunit proteins L2, L7, L17, and L27. Here we report the r-protein S25 cDNA, Arps25, from Amaranthus cruentus L.

  6. Structure determination of archaea-specific ribosomal protein L46a reveals a novel protein fold

    Feng, Yingang, E-mail: fengyg@qibebt.ac.cn [Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, Shandong 266101 (China); Song, Xiaxia [Department of Biological Science and Engineering, School of Chemical and Biological Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Lin, Jinzhong [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Xuan, Jinsong [Department of Biological Science and Engineering, School of Chemical and Biological Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Cui, Qiu [Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, Shandong 266101 (China); Wang, Jinfeng [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China)

    2014-07-18

    Highlights: • The archaea-specific ribosomal protein L46a has no homology to known proteins. • Three dimensional structure and backbone dynamics of L46a were determined by NMR. • The structure of L46a represents a novel protein fold. • A potential rRNA-binding surface on L46a was identified. • The potential position of L46a on the ribosome was proposed. - Abstract: Three archaea-specific ribosomal proteins recently identified show no sequence homology with other known proteins. Here we determined the structure of L46a, the most conserved one among the three proteins, from Sulfolobus solfataricus P2 using NMR spectroscopy. The structure presents a twisted β-sheet formed by the N-terminal part and two helices at the C-terminus. The L46a structure has a positively charged surface which is conserved in the L46a protein family and is the potential rRNA-binding site. Searching homologous structures in Protein Data Bank revealed that the structure of L46a represents a novel protein fold. The backbone dynamics identified by NMR relaxation experiments reveal significant flexibility at the rRNA binding surface. The potential position of L46a on the ribosome was proposed by fitting the structure into a previous electron microscopy map of the ribosomal 50S subunit, which indicated that L46a contacts to domain I of 23S rRNA near a multifunctional ribosomal protein L7ae.

  7. Structure determination of archaea-specific ribosomal protein L46a reveals a novel protein fold

    Highlights: • The archaea-specific ribosomal protein L46a has no homology to known proteins. • Three dimensional structure and backbone dynamics of L46a were determined by NMR. • The structure of L46a represents a novel protein fold. • A potential rRNA-binding surface on L46a was identified. • The potential position of L46a on the ribosome was proposed. - Abstract: Three archaea-specific ribosomal proteins recently identified show no sequence homology with other known proteins. Here we determined the structure of L46a, the most conserved one among the three proteins, from Sulfolobus solfataricus P2 using NMR spectroscopy. The structure presents a twisted β-sheet formed by the N-terminal part and two helices at the C-terminus. The L46a structure has a positively charged surface which is conserved in the L46a protein family and is the potential rRNA-binding site. Searching homologous structures in Protein Data Bank revealed that the structure of L46a represents a novel protein fold. The backbone dynamics identified by NMR relaxation experiments reveal significant flexibility at the rRNA binding surface. The potential position of L46a on the ribosome was proposed by fitting the structure into a previous electron microscopy map of the ribosomal 50S subunit, which indicated that L46a contacts to domain I of 23S rRNA near a multifunctional ribosomal protein L7ae

  8. Ribosomal crystallography: from crystal growth to initial phasing

    Thygesen, J.; Krumbholz, S.; Levin, I.; Zaytzev-Bashan, A.; Harms, J.; Bartels, H.; Schlünzen, F.; Hansen, H. A. S.; Bennett, W. S.; Volkmann, N.; Agmon, I.; Eisenstein, M.; Dribin, A.; Maltz, E.; Sagi, I.; Morlang, S.; Fua, M.; Franceschi, F.; Weinstein, S.; Böddeker, N.; Sharon, R.; Anagnostopoulos, K.; Peretz, M.; Geva, M.; Berkovitch-Yellin, Z.; Yonath, A.

    1996-10-01

    Preliminary phases were determined by the application of the isomorphous replacement method at low and intermediate resolution for structure factor amplitudes collected from crystals of large and small ribosomal subunits from halophilic and thermophilic bacteria. Derivatization was performed with dense heavy atom clusters, either by soaking or by specific covalent binding prior to the crystallization. The resulting initial electron density maps contain features comparable in size to those expected for the corresponding particles. The packing arrangements of these maps have been compared with motifs observed by electron microscopy in positively stained thin sections of embedded three-dimensional crystals, as well as with phase sets obtained by ab-initio computations. Aimed at higher resolution phasing, procedures are being developed for multi-site binding of relatively small dense metal clusters at selected locations. Potential sites are being inserted either by mutagenesis or by chemical modifications to facilitate cluster binding to the large halophilic and the small thermophilic ribosomal subunits which yield crystals diffracting to the highest resolution obtained so far for ribosomes, 2.9 and 7.3 Å, respectively. For this purpose the surfaces of these ribosomal particles have been characterized and conditions for quantitative reversible detachment of selected ribosomal proteins have been found. The corresponding genes are being cloned, sequenced, mutated to introduce the reactive side-groups (mainly cysteines) and overexpressed. To assist the interpretation of the anticipated electron density maps, sub-ribosomal stable complexes were isolated from H50S. One of these complexes is composed of two proteins and the other is made of a stretch of the rRNA and a protein. For exploiting the exposed parts of the surface of these complexes for heavy atom binding and for attempting the determination of their three-dimensional structure, their components are being produced

  9. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    Long, Katherine S.; Vester, Birte

    2012-01-01

    linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design...

  10. Discovery of a Katablepharis sp. in the Columbia River estuary that is abundant during the spring and bears a unique large ribosomal subunit sequence element

    Kahn, Peter; Herfort, Lydie; Peterson, Tawnya D; Zuber, Peter

    2014-01-01

    Heterotrophic protists play significant roles in pelagic food webs as bacterivorous and herbivorous consumers. However, heterotrophic protists—unlike autotrophic ones—are often difficult to track since they tend to lack features such as photosynthetic pigments that allow for remote sensing or for bulk characterization. Difficulty in the identification of heterotrophic protists has often resulted in lumping them into broad groups, but there is a strong need to develop methods that increase the spatial and temporal resolution of observations applied to particular organisms in order to discover the drivers of population structure and ecological function. In surveys of small subunit rRNA, gene (SSU) sequences of microbial eukaryotes from the Columbia River to the Pacific Ocean, the heterotrophic flagellate Katablepharis sp. were found to dominate protist assemblages (including autotrophic and heterotrophic fractions) in the spring, prior to the freshet. We discovered a 332 base pair unique sequence element (USE) insertion in the large subunit rRNA gene (28S) that is not present in other katablepharids or in any other eukaryote. Using this USE, we were able to detect Katablepharis within mixed assemblages in river, estuarine, and oceanic samples and determine spatial and temporal patterns in absolute abundance through quantitative PCR and fluorescence in situ hybridization. Given their high abundance and repeatable temporal patterns of occurrence, we hypothesize that the Columbia River Estuary Katablepharis (Katablepharis CRE) plays an important role in estuarine biogeochemical and ecosystem function. PMID:25168204

  11. Ribosome engineering to promote new crystal forms

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors

  12. An overview of pre-ribosomal RNA processing in eukaryotes

    Henras, Anthony K.; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel

    2014-01-01

    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. ...

  13. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    Poulsen, S M; Karlsson, M; Johansson, L B;

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are...... strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...

  14. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  15. Interrelationships between yeast ribosomal protein assembly events and transient ribosome biogenesis factors interactions in early pre-ribosomes.

    Steffen Jakob

    Full Text Available Early steps of eukaryotic ribosome biogenesis require a large set of ribosome biogenesis factors which transiently interact with nascent rRNA precursors (pre-rRNA. Most likely, concomitant with that initial contacts between ribosomal proteins (r-proteins and ribosome precursors (pre-ribosomes are established which are converted into robust interactions between pre-rRNA and r-proteins during the course of ribosome maturation. Here we analysed the interrelationship between r-protein assembly events and the transient interactions of ribosome biogenesis factors with early pre-ribosomal intermediates termed 90S pre-ribosomes or small ribosomal subunit (SSU processome in yeast cells. We observed that components of the SSU processome UTP-A and UTP-B sub-modules were recruited to early pre-ribosomes independently of all tested r-proteins. On the other hand, groups of SSU processome components were identified whose association with early pre-ribosomes was affected by specific r-protein assembly events in the head-platform interface of the SSU. One of these components, Noc4p, appeared to be itself required for robust incorporation of r-proteins into the SSU head domain. Altogether, the data reveal an emerging network of specific interrelationships between local r-protein assembly events and the functional interactions of SSU processome components with early pre-ribosomes. They point towards some of these components being transient primary pre-rRNA in vivo binders and towards a role for others in coordinating the assembly of major SSU domains.

  16. Nucleocytoplasmic transport of ribosomes in a eukaryotic system: Is there a facilitated transport process?

    The authors have examined the kinetics of the process by which ribosomes are exported from the nucleus to the cytoplasm using Xenopus laevis oocytes microinjected into the germinal vesicle with radiolabeled ribosomes or ribosomal subunits from X. laevis, Tetrahymena thermophila, or Escherichia coli. Microinjected eukaryotic mature ribosomes are redistributed into the oocyte cytoplasm by an apparent carrier-mediated transport process that exhibits saturation kinetics as increasing amounts of ribosomes are injected. T. thermophila ribosomes are competent to traverse the Xenopus nuclear envelope, suggesting that the basic mechanism underlying ribosome transport is evolutionarily conserved. Microinjected E. coli ribosomes are not transported in this system, indicating that prokaryotic ribosomes lack the signals required for transport. Surprisingly, coinjected small (40S) and large (60S) subunits from T. thermophila are transported significantly faster than individual subunits. These observations support a facilitated transport model for the translocation of ribosomal subunits as separate units across the nuclear envelope whereby the transport rate of 60S or 40S subunits is enhanced by the presence of the partner subunit. Although the basic features of the transport mechanism have been preserved through evolution, other aspects of the process may be mediated through species-specific interactions. They hypothesize that a species-specific nuclear 40S-60S subunit association may expedite the transport of individual subunits across the nuclear envelope

  17. Eukaryotic Ribosome Assembly and Nuclear Export.

    Nerurkar, Purnima; Altvater, Martin; Gerhardy, Stefan; Schütz, Sabina; Fischer, Ute; Weirich, Christine; Panse, Vikram Govind

    2015-01-01

    Accurate translation of the genetic code into functional polypeptides is key to cellular growth and proliferation. This essential process is carried out by the ribosome, a ribonucleoprotein complex of remarkable size and intricacy. Although the structure of the mature ribosome has provided insight into the mechanism of translation, our knowledge regarding the assembly, quality control, and intracellular targeting of this molecular machine is still emerging. Assembly of the eukaryotic ribosome begins in the nucleolus and requires more than 350 conserved assembly factors, which transiently associate with the preribosome at specific maturation stages. After accomplishing their tasks, early-acting assembly factors are released, preparing preribosomes for nuclear export. Export competent preribosomal subunits are transported through nuclear pore complexes into the cytoplasm, where they undergo final maturation steps, which are closely connected to quality control, before engaging in translation. In this chapter, we focus on the final events that commit correctly assembled ribosomal subunits for translation. PMID:26404467

  18. Ribosome dynamics and the evolutionary history of ribosomes

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.

    2015-09-01

    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  19. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  20. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  1. Initiation factor 2 stabilizes the ribosome in a semirotated conformation.

    Ling, Clarence; Ermolenko, Dmitri N

    2015-12-29

    Intersubunit rotation and movement of the L1 stalk, a mobile domain of the large ribosomal subunit, have been shown to accompany the elongation cycle of translation. The initiation phase of protein synthesis is crucial for translational control of gene expression; however, in contrast to elongation, little is known about the conformational rearrangements of the ribosome during initiation. Bacterial initiation factors (IFs) 1, 2, and 3 mediate the binding of initiator tRNA and mRNA to the small ribosomal subunit to form the initiation complex, which subsequently associates with the large subunit by a poorly understood mechanism. Here, we use single-molecule FRET to monitor intersubunit rotation and the inward/outward movement of the L1 stalk of the large ribosomal subunit during the subunit-joining step of translation initiation. We show that, on subunit association, the ribosome adopts a distinct conformation in which the ribosomal subunits are in a semirotated orientation and the L1 stalk is positioned in a half-closed state. The formation of the semirotated intermediate requires the presence of an aminoacylated initiator, fMet-tRNA(fMet), and IF2 in the GTP-bound state. GTP hydrolysis by IF2 induces opening of the L1 stalk and the transition to the nonrotated conformation of the ribosome. Our results suggest that positioning subunits in a semirotated orientation facilitates subunit association and support a model in which L1 stalk movement is coupled to intersubunit rotation and/or IF2 binding. PMID:26668356

  2. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen (1H) for deuterium (2H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.)

  3. Ribosomal crystallography: peptide bond formation and its inhibition.

    Bashan, Anat; Zarivach, Raz; Schluenzen, Frank; Agmon, Ilana; Harms, Joerg; Auerbach, Tamar; Baram, David; Berisio, Rita; Bartels, Heike; Hansen, Harly A S; Fucini, Paola; Wilson, Daniel; Peretz, Moshe; Kessler, Maggie; Yonath, Ada

    2003-09-01

    Ribosomes, the universal cellular organelles catalyzing the translation of genetic code into proteins, are protein/RNA assemblies, of a molecular weight 2.5 mega Daltons or higher. They are built of two subunits that associate for performing protein biosynthesis. The large subunit creates the peptide bond and provides the path for emerging proteins. The small has key roles in initiating the process and controlling its fidelity. Crystallographic studies on complexes of the small and the large eubacterial ribosomal subunits with substrate analogs, antibiotics, and inhibitors confirmed that the ribosomal RNA governs most of its activities, and indicated that the main catalytic contribution of the ribosome is the precise positioning and alignment of its substrates, the tRNA molecules. A symmetry-related region of a significant size, containing about two hundred nucleotides, was revealed in all known structures of the large ribosomal subunit, despite the asymmetric nature of the ribosome. The symmetry rotation axis, identified in the middle of the peptide-bond formation site, coincides with the bond connecting the tRNA double-helical features with its single-stranded 3' end, which is the moiety carrying the amino acids. This thus implies sovereign movements of tRNA features and suggests that tRNA translocation involves a rotatory motion within the ribosomal active site. This motion is guided and anchored by ribosomal nucleotides belonging to the active site walls, and results in geometry suitable for peptide-bond formation with no significant rearrangements. The sole geometrical requirement for this proposed mechanism is that the initial P-site tRNA adopts the flipped orientation. The rotatory motion is the major component of unified machinery for peptide-bond formation, translocation, and nascent protein progression, since its spiral nature ensures the entrance of the nascent peptide into the ribosomal exit tunnel. This tunnel, assumed to be a passive path for the

  4. HCV IRES manipulates the ribosome to promote the switch from translation initiation to elongation.

    Filbin, Megan E; Vollmar, Breanna S; Shi, Dan; Gonen, Tamir; Kieft, Jeffrey S

    2013-02-01

    The internal ribosome entry site (IRES) of the hepatitis C virus (HCV) drives noncanonical initiation of protein synthesis necessary for viral replication. Functional studies of the HCV IRES have focused on 80S ribosome formation but have not explored its role after the 80S ribosome is poised at the start codon. Here, we report that mutations of an IRES domain that docks in the 40S subunit's decoding groove cause only a local perturbation in IRES structure and result in conformational changes in the IRES-rabbit 40S subunit complex. Functionally, the mutations decrease IRES activity by inhibiting the first ribosomal translocation event, and modeling results suggest that this effect occurs through an interaction with a single ribosomal protein. The ability of the HCV IRES to manipulate the ribosome provides insight into how the ribosome's structure and function can be altered by bound RNAs, including those derived from cellular invaders. PMID:23262488

  5. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  6. Eukaryotic ribosomes that lack a 5.8S RNA

    Vossbrinck, C. R.; Woese, C. R.

    1986-01-01

    The 5.8S ribosomal RNA is believed to be a universal eukaryotic characteristic. It has no (size) counterpart among the prokaryotes, although its sequence is homologous with the first 150 or so nucleotides of the prokaryotic large subunit (23S) ribosomal RNA. An exception to this rule is reported here. The microsporidian Vairimorpha necatrix is a eukaryote that has no 5.8S rRNA. As in the prokaryotes, it has a single large subunit rRNA, whose 5-prime region corresponds to the 5.8S rRNA.

  7. Confident Computing for the Over 50s Teach Yourself

    Reeves, Bob

    2010-01-01

    This best-selling book on computing for the over 50s, now available in this Windows 7 edition, provides instruction and advice on a wide range of computer uses and is written with practical good humour for the late beginner or the technologically terrified!

  8. Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

    The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C1400 was preserved. Changing C1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

  9. Photochemical cross-linking of tRNA/sup Phe/ modified at A76 and A73 to the Escherichia coli ribosome

    [5'-32P]-8-azidoadenosine 3',5'-bisphosphate ([5'-32P]p(N3)Ap) has been prepared using a simple two-step procedure: alkaline hydrolysis of 8-azidoadenosine 3',5'-cyclic monophosphate followed by labeling of the resulting 3'-mononucleotide with 32P at the 5' position using [γ-32P]ATP and T4 polynucleotide kinase. [5'-32P]p(N3)Ap has proven to be an excellent substrate for T4 RNA ligase. To study the environment of the 3' end of tRNA on bacterial ribosomes, nucleosides A76 and A73 in yeast tRNA/sup Phe/ were replaced with their 8-azido derivatives. This was achieved by stepwise removal of 3'-terminal nucleosides from the tRNA using the Whitfield procedure, incorporation of [5'-32P]p(N3)Ap into appropriately degraded tRNA with T4 RNA ligase, and restoration of the CCA/sub OH/ terminus with yeast nucleotidyl transferase. The modified tRNAs were bound to the A or P site of Escherichia coli ribosomes programmed with poly(U). UV irradiation produced covalent, zero-length cross-links between the tRNA and neighboring ribosomal components. The tRNA derivative containing (N3)A73 became attached exclusively to proteins of the 50S subunit whose identity is currently under investigation

  10. Disruption of ribosome assembly in yeast blocks cotranscriptional pre-rRNA processing and affects the global hierarchy of ribosome biogenesis.

    Talkish, Jason; Biedka, Stephanie; Jakovljevic, Jelena; Zhang, Jingyu; Tang, Lan; Strahler, John R; Andrews, Philip C; Maddock, Janine R; Woolford, John L

    2016-06-01

    In higher eukaryotes, pre-rRNA processing occurs almost exclusively post-transcriptionally. This is not the case in rapidly dividing yeast, as the majority of nascent pre-rRNAs are processed cotranscriptionally, with cleavage at the A2 site first releasing a pre-40S ribosomal subunit followed by release of a pre-60S ribosomal subunit upon transcription termination. Ribosome assembly is driven in part by hierarchical association of assembly factors and r-proteins. Groups of proteins are thought to associate with pre-ribosomes cotranscriptionally during early assembly steps, whereas others associate later, after transcription is completed. Here we describe a previously uncharacterized phenotype observed upon disruption of ribosome assembly, in which normally late-binding proteins associate earlier, with pre-ribosomes containing 35S pre-rRNA. As previously observed by many other groups, we show that disruption of 60S subunit biogenesis results in increased amounts of 35S pre-rRNA, suggesting that a greater fraction of pre-rRNAs are processed post-transcriptionally. Surprisingly, we found that early pre-ribosomes containing 35S pre-rRNA also contain proteins previously thought to only associate with pre-ribosomes after early pre-rRNA processing steps have separated maturation of the two subunits. We believe the shift to post-transcriptional processing is ultimately due to decreased cellular division upon disruption of ribosome assembly. When cells are grown under stress or to high density, a greater fraction of pre-rRNAs are processed post-transcriptionally and follow an alternative processing pathway. Together, these results affirm the principle that ribosome assembly occurs through different, parallel assembly pathways and suggest that there is a kinetic foot-race between the formation of protein binding sites and pre-rRNA processing events. PMID:27036125

  11. Immunomodulation by microbial ribosomes

    W. Domzig

    1987-01-01

    Full Text Available Over the past twenty years, many authors have reported evidence of the immunoprotective capacity of ribosomes isolated from bacteria, fungi and parasites. Since 1971 we have explored the protective capacity of ribosomes isolated from a large variety of microorganisms responsible for human and animal diseases. More recently, using monoclonal antibodies raised against ribosomes and then selected for their ability to confer passive immunity to mice, we have studied the mechanism of the protection induced by ribosomes. These studies, in parallel with the development of a technology for the large scale production of ribosomes, have allowed us to achieve a new regard for ribosomal vaccines for use in human. The general concept of ribosomal vaccines in presented and examples of two such vaccines are described with data on the specific protection that they induce in mice against experimental infections with Klebsiella peneumoniae, Streptococcus pneumoniae, S. pyogenes and Haemophilus influenzae for the first one, and against Candida albicans type A and type B for the second one. Because of their high immunogenicity and their innocuity these vaccines represent a decisive improvement over classical microbial vaccines.

  12. Characterisation of ribosomal proteins from HeLa and Krebs II mouse ascites tumor cells by different two-dimensional polyacrylamide gel electrophoresis techniques

    Issinger, O G; Beier, H

    1978-01-01

    Electrophoresis of ribosomal proteins according to Kaltschmidt and Wittmann, 1970a, b (pH 8.6/pH 4.5 urea system) yielded 29 proteins for the small subunits and 35 and 37 proteins for the large subunits of Krebs II ascites and HeLa ribosomes, respectively. Analysis of the proteins according to a ...

  13. Identical ribosomal DNA sequence data from Pfiesteria piscicida (Dinophyceae) isolates with different toxicity phenotypes

    Complete small subunit ribosomal RNA, internal transcribed spacer 1 and 2, 5.8S, and partial large subunit ribosomal RNA gene sequences were generated from multiple isolates of Pfiesteria piscicida. Sequences were derived from isolates that have been shown to be ichthyotoxic as well as isolates that have no history of toxic behavior. All of the sequences generated were identical for the different cultures, and we therefore conclude that differences in toxicity seen between isolates of P. piscicida are linked to factors other than genetic strain variation detectable by ribosomal gene sequence analyses

  14. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function.

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  15. Auxin-induced changes in the incorporation of /sup 3/H-amino acids into soybean ribosomal proteins

    Travis, R.L.; Key, J.L.

    1976-06-01

    Auxin-induced activation of 80S ribosomes and polyribosome formation in mature soybean (Glycine max var. Hawkeye) hypocotyl (R. L. Travis, J. M. Anderson, and J. L. Key. 1973. Plant Physiol. 52: 608-612) in the presence of a mixture of radioactive amino acids correlates with an increased specific radioactivity of at least three ribosomal proteins; the labeling of one of these increased severalfold above the control level. Results of experiments with 5-fluorouracil and cycloheximide indicated that the proteins in question were synthesized in response to auxin and became associated with pre-existing ribosomes. Ribosome dissociation experiments indicated that these proteins were associated with the 60S ribosome subunit.

  16. GTPases and the origin of the ribosome

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  17. Tennessee Williams in the 50s: A Mirror Competing Discourses

    Anushiravani A.

    2012-01-01

    Full Text Available This article was a study of different but synchronized discourses mirrored in Tennessee Williams’s Hollywood adaptations in the 50s. It discussed the effect of artistic agencies of censorship on the hows and whys of Willaims’s adaptations. Most notably, PCA and HUAC were in charge of cultural and political regulations that no Hollywood film was immune from. Until the early 60, HUAC and PCA imposed religious values to supplant Communism, happy ending to replace the intellectual fad of pessimism and strict dressing code to restore the innocence of the Freud-conscious moviegoers. However, these agencies were not omnipotent. The voice of those discourses that the agencies were fighting against were heard in Hollywood. Hollywood achieved the subversion with the help of William’s controversial plots albeit tamed by some reinforcing discourses of optimism and diluted religious values.

  18. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [14C]CH3-methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  19. The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins

    Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech;

    2003-01-01

    The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached to the ribos......The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...... to the ribosome through the P0 protein. The "stalk" is essential for the ribosome activity, taking part in the interaction with elongation factors.In this report, we have shown that the subcellular distribution of the human P proteins does not fall into standard behavior of regular ribosomal proteins. We have...... used two approaches to assess the distribution of the P proteins, in vivo experiments with GFP fusion proteins and in vitro one with anti-P protein antibodies. In contrast to standard r-proteins, the P1 and P2 proteins are not actively transported into the nucleus compartment, remaining predominantly...

  20. Structures of the Bacterial Ribosome in Classical and Hybrid States of tRNA Binding

    Dunkle, Jack A.; Wang, Leyi; Feldman, Michael B.; Pulk, Arto; Chen, Vincent B.; Kapral, Gary J.; Noeske, Jonas; Richardson, Jane S.; Blanchard, Scott C.; Cate, Jamie H. Doudna (Cornell); (UCB); (Duke)

    2011-09-06

    During protein synthesis, the ribosome controls the movement of tRNA and mRNA by means of large-scale structural rearrangements. We describe structures of the intact bacterial ribosome from Escherichia coli that reveal how the ribosome binds tRNA in two functionally distinct states, determined to a resolution of {approx}3.2 angstroms by means of x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit site. The structures help to explain how the ratchet-like motion of the two ribosomal subunits contributes to the mechanisms of translocation, termination, and ribosome recycling.

  1. The Ribosome Comes Alive

    Frank, Joachim

    2010-01-01

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample (“story in a sample”), providing snapshots of an entire subprocess of translation, such as t...

  2. The Ribosome Comes Alive.

    Frank, Joachim

    2010-06-18

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample ("story in a sample"), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  3. Chaperoning ribosome assembly

    Karbstein, Katrin

    2010-01-01

    Chaperones help proteins fold in all cellular compartments, and many associate directly with ribosomes, capturing nascent chains to assist their folding and prevent aggregation. In this issue, new data from Koplin et al. (2010. J. Cell Biol. doi: 10.1083/jcb.200910074) and Albanèse et al. (2010. J. Cell Biol. doi: 10.1083/jcb.201001054) suggest that in addition to promoting protein folding, the chaperones ribosome-associated complex (RAC), nascent chain–associated complex (NAC), and Jjj1 also...

  4. Structural, biophysical and functional characterization of Nop7-Erb1-Ytm1 complex and its implications in eukaryotic ribosome biogenesis

    Wegrecki, Marcin

    2015-01-01

    [EN] Ribosome biogenesis is one of the most important and energy-consuming processes in the cell. However, the vast majority of the events and factors that are involved in the synthesis of ribosomal subunits are not well understood. Ribosome maturation comprises multiple steps of rRNA processing that require sequential association and dissociation of numerous assembly factors. These proteins establish a complex network of interactions that are essential for the pathway to continue. Extensive ...

  5. Ribosome recycling induces optimal translation rate at low ribosomal availability

    Marshall, E.; Stansfield, I; Romano, M. C.

    2014-01-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces ...

  6. Phosphorylation in vivo of non-ribosomal proteins from native 40 S ribosomal particles of Krebs II mouse ascites-tumour cells

    Schuck, J; Reichert, G; Issinger, O G

    1981-01-01

    Four non-ribosomal proteins from native 40 S ribosomal subunits with mol.wts. of 110 000, 84 000, 68 000 and 26 000 were phosphorylated in vivo when ascites cells were incubated in the presence of [32P]Pi. The 110 000-, 84 000- and 26 000-dalton proteins are identical with phosphorylated products...... from native 40 S subunits after phosphorylation in vitro by a cyclic nucleotide-independent protein kinase. Phosphoserine was the major phosphorylated amino acid of the proteins phosphorylated in vivo and in vitro....

  7. Preparation of ribosomes for smFRET studies: A simplified approach.

    Shebl, Bassem; Menke, Drew E; Pennella, Min; Poudyal, Raghav R; Burke, Donald H; Cornish, Peter V

    2016-08-01

    During the past decade, single-molecule studies of the ribosome have significantly advanced our understanding of protein synthesis. The broadest application of these methods has been towards the investigation of ribosome conformational dynamics using single-molecule Förster resonance energy transfer (smFRET). The recent advances in fluorescently labeled ribosomes and translation components have resulted in success of smFRET experiments. Various methods have been employed to target fluorescent dyes to specific locations within the ribosome. Primarily, these methods have involved additional steps including subunit dissociation and/or full reconstitution, which could result in ribosomes of reduced activity and translation efficiency. In addition, substantial time and effort are required to produce limited quantities of material. To enable rapid and large-scale production of highly active, fluorescently labeled ribosomes, we have developed a procedure that combines partial reconstitution with His-tag purification. This allows for a homogeneous single-step purification of mutant ribosomes and subsequent integration of labeled proteins. Ribosomes produced with this method are shown to be as active as ribosomes purified using classical methods. While we have focused on two labeling sites in this report, the method is generalizable and can in principle be extended to any non-essential ribosomal protein. PMID:27208427

  8. Dissecting ribosome assembly and transport in budding yeast.

    Altvater, Martin; Schütz, Sabina; Chang, Yiming; Panse, Vikram Govind

    2014-01-01

    Construction of the eukaryotic ribosome begins in the nucleolus and requires >300 evolutionarily conserved nonribosomal trans-acting factors, which transiently associate with preribosomal subunits at distinct assembly stages. A subset of trans-acting and transport factors passage assembled preribosomal subunits in a functionally inactive state through the nuclear pore complexes (NPC) into the cytoplasm, where they undergo final maturation before initiating translation. Here, we summarize the repertoire of tools developed in the model organism budding yeast that are spearheading the functional analyses of trans-acting factors involved in the assembly and intracellular transport of preribosomal subunits. We elaborate on different GFP-tagged ribosomal protein reporters and a pre-rRNA reporter that reliably monitors the movement of preribosomal particles from the nucleolus to cytoplasm. We discuss the powerful yeast heterokaryon assay, which can be employed to uncover shuttling trans-acting factors that need to accompany preribosomal subunits to the cytoplasm to be released prior to initiating translation. Moreover, we present two biochemical approaches, namely sucrose gradient analyses and tandem affinity purification, that are rapidly facilitating the uncovering of regulatory processes that control the compositional dynamics of trans-acting factors on maturing preribosomal particles. Altogether, these approaches when combined with traditional analytical biochemistry, targeted proteomics and structural methodologies, will contribute to the dissection of the assembly and intracellular transport of preribosomal subunits, as well as other macromolecular assemblies that influence diverse biological pathways. PMID:24857742

  9. Ribosome Assembly as Antimicrobial Target.

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  10. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position. PMID:26926435

  11. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    Recht, M I; Douthwaite, S; Dahlquist, K D;

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  12. Ribosome-associated pentatricopeptide repeat proteins function as translational activators in mitochondria of trypanosomes.

    Aphasizheva, Inna; Maslov, Dmitri A; Qian, Yu; Huang, Lan; Wang, Qi; Costello, Catherine E; Aphasizhev, Ruslan

    2016-03-01

    Mitochondrial ribosomes of Trypanosoma brucei are composed of 9S and 12S rRNAs, eubacterial-type ribosomal proteins, polypeptides lacking discernible motifs and approximately 20 pentatricopeptide repeat (PPR) RNA binding proteins. Several PPRs also populate the polyadenylation complex; among these, KPAF1 and KPAF2 function as general mRNA 3' adenylation/uridylation factors. The A/U-tail enables mRNA binding to the small ribosomal subunit and is essential for translation. The presence of A/U-tail also correlates with requirement for translation of certain mRNAs in mammalian and insect parasite stages. Here, we inquired whether additional PPRs activate translation of individual mRNAs. Proteomic analysis identified KRIPP1 and KRIPP8 as components of the small ribosomal subunit in mammalian and insect forms, but also revealed their association with the polyadenylation complex in the latter. RNAi knockdowns demonstrated essential functions of KRIPP1 and KRIPP8 in the actively respiring insect stage, but not in the mammalian stage. In the KRIPP1 knockdown, A/U-tailed mRNA encoding cytochrome c oxidase subunit 1 declined concomitantly with the de novo synthesis of this subunit whereas polyadenylation and translation of cyb mRNA were unaffected. In contrast, the KRIPP8 knockdown inhibited A/U-tailing and translation of both CO1 and cyb mRNAs. Our findings indicate that ribosome-associated PPRs may selectively activate mRNAs for translation. PMID:26713541

  13. Ribosome recycling induces optimal translation rate at low ribosomal availability.

    Marshall, E; Stansfield, I; Romano, M C

    2014-09-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3' end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called 'closed-loop' model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  14. Transcription-independent role for human mitochondrial RNA polymerase in mitochondrial ribosome biogenesis

    Surovtseva, Yulia V; Shadel, Gerald S.

    2013-01-01

    Human mitochondrial RNA polymerase, POLRMT, is required for mitochondrial DNA (mtDNA) transcription and forms initiation complexes with human mitochondrial transcription factor B2 (h-mtTFB2). However, POLRMT also interacts with the paralogue of h-mtTFB2, h-mtTFB1, which is a 12S ribosomal RNA methyltransferase required for small (28S) mitochondrial ribosome subunit assembly. Herein, we show that POLRMT associates with h-mtTFB1 in 28S mitochondrial ribosome complexes that are stable in the abs...

  15. Hyperaccurate and error-prone ribosomes exploit distinct mechanisms during tRNA selection

    Zaher, Hani S.; Green, Rachel

    2010-01-01

    Escherichia coli strains displaying hyper-accurate (restrictive) and ribosomal ambiguity (ram) phenotypes have long been associated with alterations in rpsL and rpsD/rpsE, respectively. Crystallographic evidence shows the ribosomal proteins S12 and S4/S5 (corresponding to these genes) to be located in separate regions of the small ribosomal subunit that are important for domain-closure thought to take place during tRNA selection. Mechanistically, the process of tRNA selection is separated int...

  16. Horizontal gene transfer of zinc and non-zinc forms of bacterial ribosomal protein S4

    Luthey-Schulten Zaida; Roberts Elijah; Chen Ke

    2009-01-01

    Abstract Background The universal ribosomal protein S4 is essential for the initiation of small subunit ribosomal assembly and translational accuracy. Being part of the information processing machinery of the cell, the gene for S4 is generally thought of as being inherited vertically and has been used in concatenated gene phylogenies. Here we report the evolution of ribosomal protein S4 in relation to a broad sharing of zinc/non-zinc forms of the gene and study the scope of horizontal gene tr...

  17. Nucleolus: The ribosome factory

    Cmarko, Dušan; Šmigová, J.; Minichová, L.; Popov, Alexey

    2008-01-01

    Roč. 23, č. 10 (2008), s. 1291-1298. ISSN 0213-3911 R&D Projects: GA ČR(CZ) GA304/06/1691 Grant ostatní: Wellcome Trust(XE) 075834/04/Z; GA MŠk(CZ) LC535; GA ČR(CZ) GA304/06/1662 Institutional research plan: CEZ:AV0Z50110509 Keywords : nucleolus * nucleolar architecture * ribosome biogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.194, year: 2008

  18. 云南保山和普洱地区带绦虫线粒体DNA基因编码核糖体RNA小亚基基因序列分析%Analysis of the mitochondrial DNA-gene encoding ribosomal RNA small subunit gene sequence of Taenia cestode from Baoshan and Puer areas in Yunnan Province

    刘爱波; 杨毅梅

    2011-01-01

    Objective To identify Taenia cestodes specimens collected from Baoshan and Puer regions of Yunnan Province by analyzing mitochondrial DNA gene encoding ribosomal RNA small subunit (mtDNA-12S rRNA) gene sequence. Methods The adult Taenia cestode samples were collected from Baoshan and Puer regions of Yunnan Province. The genomic DNA was extracted and mtDNA-12S rRAN gene was amplified by polymerase chain reaction (PCR), then sequenced.Combined with the known mtDNA-12S rRNA gene sequence of Taenia solium, Taenia saginata,Taenia asiatica in GenBank, homology tree and phylogenetic tree were constructed by DNA MAN software. Results Taenia cestode homology tree and phylogenetic tree showed that gene sequences of BS1, BS2, BS4 and BS5 were most close to YZ with identity of 99% and those of BS3, BS6, BST,PE1 and PE2 were most close to ND with identity of 99%. Conclusions Taenia saginata and Taenia asiatica can be found in Baoshan area, while Taenia saginata can be found in Puer area. The gene sequence of mtDNA-12S rRNA can be used for clarifying the three types of Taenia cestode.%目的 利用线粒体DNA基因编码核糖体RNA小亚基(mtDNA-12S rRNA)基因序列分析对采自云南保山、普洱地区的带绦虫标本进行鉴定.方法 选取保山(7条,BS1-BS7)、普洱(2条,PE1~PE2)带绦虫成虫节片,抽提基因组DNA,PCR扩增mtDNA-12S rRNA基因序列,并测序;结合GenBank中已知的猪带绦虫(ZD)、牛带绦虫(ND)、亚洲带绦虫(YZ)mtDNA-12S rRNA基因序列,经DNA MAN软件处理后构建同源树状图与系统发育树状图.结果 带绦虫同源树与系统发育树状图显示,BS1、BS2、BS4、BS5与YZ的同源性最近(99%).BS3、BS6、BS7、PE1、PE2与ND的同源性最近(99%).结论 云南保山存在牛带绦虫与亚洲带绦虫,普洱存在牛带绦虫,mtDNA-12S rRNA基因序列可用于三种带绦虫的分类研究.

  19. HCV IRES domain IIb affects the configuration of coding RNA in the 40S subunit's decoding groove

    Filbin, Megan E.; Kieft, Jeffrey S.

    2011-01-01

    Hepatitis C virus (HCV) uses a structured internal ribosome entry site (IRES) RNA to recruit the translation machinery to the viral RNA and begin protein synthesis without the ribosomal scanning process required for canonical translation initiation. Different IRES structural domains are used in this process, which begins with direct binding of the 40S ribosomal subunit to the IRES RNA and involves specific manipulation of the translational machinery. We have found that upon initial 40S subuni...

  20. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J L; Levesque, C.A.; W. Chen; Crous, P.W.; Boekhout, T.; Damm, U.; Hoog, de, R.; Eberhardt, U.; Groenewald, J.Z.; Groenewald, M.; Hagen, F.

    2012-01-01

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of thre...

  1. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    Schoch, Conrad L.; Seifert, Keith A.; Huhndorf, Sabine; Robert, Vincent; Spouge, John L.; Levesque, C. André; Chen, Wen; Bolchacova, Elena; Voigt, Kerstin; Crous, Pedro W.; Miller, Andrew N.; Wingfield, Michael J.; Aime, M. Catherine; An, Kwang-Deuk; Bai, Feng-Yan; Barreto, Robert W.; Begerow, Dominik; Bergeron, Marie-Josée; Blackwell, Meredith; Boekhout, Teun; Bogale, Mesfin; Boonyuen, Nattawut; Burgaz, Ana R.; Buyck, Bart; Cai, Lei; Cai, Qing; Cardinali, G.; Chaverri, Priscila; Coppins, Brian J.; Crespo, Ana; Cubas, Paloma; Cummings, Craig; Damm, Ulrike; de Beer, Z. Wilhelm; de Hoog, G. Sybren; Del-Prado, Ruth; Dentinger, Bryn; Diéguez-Uribeondo, Javier; Divakar, Pradeep K.; Douglas, Brian; Dueñas, Margarita; Duong, Tuan A.; Eberhardt, Ursula; Edwards, Joan E.; Elshahed, Mostafa S.; Fliegerova, Katerina; Furtado, Manohar; García, Miguel A.; Ge, Zai-Wei; Griffith, Gareth W.; Griffiths, K.; Groenewald, Johannes Z.; Groenewald, Marizeth; Grube, Martin; Gryzenhout, Marieka; Guo, Liang-Dong; Hagen, Ferry; Hambleton, Sarah; Hamelin, Richard C.; Hansen, Karen; Harrold, Paul; Heller, Gregory; Herrera, Cesar; Hirayama, Kazuyuki; Hirooka, Yuuri; Ho, Hsiao-Man; Hoffmann, Kerstin; Hofstetter, Valérie; Högnabba, Filip; Hollingsworth, Peter M.; Hong, Seung-Beom; Hosaka, Kentaro; Houbraken, Jos; Hughes, Karen; Huhtinen, Seppo; Hyde, Kevin D.; James, Timothy; Johnson, Eric M.; Johnson, Joan E.; Johnston, Peter R.; Jones, E.B. Gareth; Kelly, Laura J.; Kirk, Paul M.; Knapp, Dániel G.; Kõljalg, Urmas; Kovács, Gábor M.; Kurtzman, Cletus P.; Landvik, Sara; Leavitt, Steven D.; Liggenstoffer, Audra S.; Liimatainen, Kare; Lombard, Lorenzo; Luangsa-ard, J. Jennifer; Lumbsch, H. Thorsten; Maganti, Harinad; Maharachchikumbura, Sajeewa S. N.; Martin, María P.; May, Tom W.; McTaggart, Alistair R.; Methven, Andrew S.; Meyer, Wieland; Moncalvo, Jean-Marc; Mongkolsamrit, Suchada; Nagy, László G.; Nilsson, R. Henrik; Niskanen, Tuula; Nyilasi, Ildikó; Okada, Gen; Okane, Izumi; Olariaga, Ibai; Otte, Jürgen; Papp, Tamás; Park, Duckchul; Petkovits, Tamás; Pino-Bodas, Raquel; Quaedvlieg, William; Raja, Huzefa A.; Redecker, Dirk; Rintoul, Tara L.; Ruibal, Constantino; Sarmiento-Ramírez, Jullie M.; Schmitt, Imke; Schüßler, Arthur; Shearer, Carol; Sotome, Kozue; Stefani, Franck O.P.; Stenroos, Soili; Stielow, Benjamin; Stockinger, Herbert; Suetrong, Satinee; Suh, Sung-Oui; Sung, Gi-Ho; Suzuki, Motofumi; Tanaka, Kazuaki; Tedersoo, Leho; Telleria, M. Teresa; Tretter, Eric; Untereiner, Wendy A.; Urbina, Hector; Vágvölgyi, Csaba; Vialle, Agathe; Vu, Thuy Duong; Walther, Grit; Wang, Qi-Ming; Wang, Yan; Weir, Bevan S.; Weiß, Michael; White, Merlin M.; Xu, Jianping; Yahr, Rebecca; Yang, Zhu L.; Yurkov, Andrey; Zamora, Juan-Carlos; Zhang, Ning; Zhuang, Wen-Ying; Schindel, David

    2012-01-01

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494

  2. GenBank blastx search result: AK104146 [KOME

    Full Text Available AK104146 006-207-D01 AY548459.1 Fremyella diplosiphon clone 3098E8 30S ribosomal su... L17, and putative RNA polymerase alpha subunit genes, complete cds.|BCT BCT 6e-41 +3 ... ...bunit S9, 50S ribosomal subunit L13, putative t-RNA pseudouridine synthase I, putative 50S ribosomal subunit

  3. GenBank blastx search result: AK104434 [KOME

    Full Text Available AK104434 006-208-D02 AY548459.1 Fremyella diplosiphon clone 3098E8 30S ribosomal su... L17, and putative RNA polymerase alpha subunit genes, complete cds.|BCT BCT 3e-23 +3 ... ...bunit S9, 50S ribosomal subunit L13, putative t-RNA pseudouridine synthase I, putative 50S ribosomal subunit

  4. GenBank blastx search result: AK119189 [KOME

    Full Text Available AK119189 001-039-H01 AY548459.1 Fremyella diplosiphon clone 3098E8 30S ribosomal su... L17, and putative RNA polymerase alpha subunit genes, complete cds.|BCT BCT 6e-41 +3 ... ...bunit S9, 50S ribosomal subunit L13, putative t-RNA pseudouridine synthase I, putative 50S ribosomal subunit

  5. GenBank blastx search result: AK104198 [KOME

    Full Text Available AK104198 006-304-A06 AY548459.1 Fremyella diplosiphon clone 3098E8 30S ribosomal su... L17, and putative RNA polymerase alpha subunit genes, complete cds.|BCT BCT 1e-26 +1 ... ...bunit S9, 50S ribosomal subunit L13, putative t-RNA pseudouridine synthase I, putative 50S ribosomal subunit

  6. The Functional Role of eL19 and eB12 Intersubunit Bridge in the Eukaryotic Ribosome.

    Kisly, Ivan; Gulay, Suna P; Mäeorg, Uno; Dinman, Jonathan D; Remme, Jaanus; Tamm, Tiina

    2016-05-22

    During translation, the two eukaryotic ribosomal subunits remain associated through 17 intersubunit bridges, five of which are eukaryote specific. These are mainly localized to the peripheral regions and are believed to stabilize the structure of the ribosome. The functional importance of these bridges remains largely unknown. Here, the essentiality of the eukaryote-specific bridge eB12 has been investigated. The main component of this bridge is ribosomal protein eL19 that is composed of an N-terminal globular domain, a middle region, and a long C-terminal α-helix. The analysis of deletion mutants demonstrated that the globular domain and middle region of eL19 are essential for cell viability, most likely functioning in ribosome assembly. The eB12 bridge, formed by contacts between the C-terminal α-helix of eL19 and 18S rRNA in concert with additional stabilizing interactions involving either eS7 or uS17, is dispensable for viability. Nevertheless, eL19 mutants impaired in eB12 bridge formation displayed slow growth phenotypes, altered sensitivity/resistance to translational inhibitors, and enhanced hyperosmotic stress tolerance. Biochemical analyses determined that the eB12 bridge contributes to the stability of ribosome subunit interactions in vitro. 60S subunits containing eL19 variants defective in eB12 bridge formation failed to form 80S ribosomes regardless of Mg(2+) concentration. The reassociation of 40S and mutant 60S subunits was markedly improved in the presence of deacetylated tRNA, emphasizing the importance of tRNAs during the subunit association. We propose that the eB12 bridge plays an important role in subunit joining and in optimizing ribosome functionality. PMID:27038511

  7. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [35S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [32P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  8. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes. PMID:6121796

  9. Structural characterization of ribosome recruitment and translocation by type IV IRES.

    Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S

    2016-01-01

    Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts tvhe otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation. PMID:27159451

  10. Mutations in the leader region of ribosomal RNA operons cause structurally defective 30 S ribosomes as revealed by in vivo structural probing.

    Balzer, M; Wagner, R

    1998-02-27

    The biogenesis of functional ribosomes is regulated in a very complex manner, involving different proteins and RNA molecules. RNAs are not only essential components of both ribosomal subunits but also transiently interacting factors during particle formation. In eukaryotes snoRNAs act as molecular chaperones to assist maturation, modification and assembly. In a very similar way highly conserved leader sequences of bacterial rRNA operons are involved in the correct formation of 30 S ribosomal subunits. Certain mutations in the rRNA leader region cause severe growth defects due to malfunction of ribosomes which are assembled from such transcription units. To understand how the leader sequences act to facilitate the formation of the correct 30 S subunits we performed in vivo chemical probing to assess structural differences between ribosomes assembled either from rRNA transcribed from wild-type operons or from operons which contain mutations in the rRNA leader region. Cells transformed with plasmids containing the respective rRNA operons were reacted with dimethylsulphate (DMS). Ribosomes were isolated by sucrose gradient centrifugation and modified nucleotides within the 16 S rRNA were identified by primer extension reaction. Structural differences between ribosomes from wild-type and mutant rRNA operons occur in several clusters within the 16 S rRNA secondary structure. The most prominent differences are located in the central domain including the universally conserved pseudoknot structure which connects the 5', the central and the 3' domain of 16 S rRNA. Two other clusters with structural differences fall in the 5' domain where the leader had been shown to interact with mature 16 S rRNA and within the ribosomal protein S4 binding site. The other differences in structure are located in sites which are also known as sites for the action of several antibiotics. The data explain the functional defects of ribosomes from rRNA operons with leader mutations and help to

  11. Metabolism of ribosomal proteins microinjected into the oocytes of Xenopus laevis

    When the total proteins from Xenopus laevis 60 S ribosomal subunits (TP60) were 3H-labeled in vitro and injected back into X. laevis oocytes, most 3H-TP60 are integrated into the cytoplasmic 60 S subunits via the nucleus during 16 h of incubation. In the oocytes whose rRNA synthesis is inhibited, 3H-TP60 are rapidly degraded with a half-life of 2-3 h. This degradation ceased as soon as rRNA synthesis was resumed, suggesting that ribosomal proteins unassociated with nascent rRNA are unstable in the oocytes. The degradation of 3H-TP60 in the absence of RNA synthesis was inhibited by iodoacetamide, a cysteine protease inhibitor, resulting in the accumulation of 3H-TP60 in the nucleus reaching about a threefold concentration in the cytoplasm. Considering the results with enucleated oocytes, we suggest that the X. laevis nucleus has a limited capacity to accumulate ribosomal proteins in an active manner but that those ribosomal proteins accumulated in excess over rRNA synthesis are degraded by a cysteine protease in the nucleus. By contrast, ribosomal proteins from Escherichia coli only equilibrate between the nucleus and the cytoplasm and are degraded by serine protease(s) in the cytoplasm without being integrated in the form of ribosomes in the nucleus

  12. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  13. Hierarchical RNA Processing Is Required for Mitochondrial Ribosome Assembly.

    Rackham, Oliver; Busch, Jakob D; Matic, Stanka; Siira, Stefan J; Kuznetsova, Irina; Atanassov, Ilian; Ermer, Judith A; Shearwood, Anne-Marie J; Richman, Tara R; Stewart, James B; Mourier, Arnaud; Milenkovic, Dusanka; Larsson, Nils-Göran; Filipovska, Aleksandra

    2016-08-16

    The regulation of mitochondrial RNA processing and its importance for ribosome biogenesis and energy metabolism are not clear. We generated conditional knockout mice of the endoribonuclease component of the RNase P complex, MRPP3, and report that it is essential for life and that heart and skeletal-muscle-specific knockout leads to severe cardiomyopathy, indicating that its activity is non-redundant. Transcriptome-wide parallel analyses of RNA ends (PARE) and RNA-seq enabled us to identify that in vivo 5' tRNA cleavage precedes 3' tRNA processing, and this is required for the correct biogenesis of the mitochondrial ribosomal subunits. We identify that mitoribosomal biogenesis proceeds co-transcriptionally because large mitoribosomal proteins can form a subcomplex on an unprocessed RNA containing the 16S rRNA. Taken together, our data show that RNA processing links transcription to translation via assembly of the mitoribosome. PMID:27498866

  14. Chloroplast ribosomes and protein synthesis.

    Harris, E. H.; Boynton, J E; Gillham, N W

    1994-01-01

    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles i...

  15. VISUALIZATION OF THE HYBRID STATE OF tRNA BINDING PROMOTED BY SPONTANEOUS RATCHETING OF THE RIBOSOME

    Agirrezabala, Xabier; Lei, Jianlin; Brunelle, Julie L; Ortiz-Meoz, Rodrigo F.; Green, Rachel; Frank, Joachim

    2008-01-01

    A crucial step in protein translation is the translocation of tRNAs through the ribosome. In the transition from one canonical site to the other, the tRNAs acquire intermediate configurations, so-called hybrid states. At this stage, the small subunits is rotated with respect to the large subunit, and the anticodon stem loops reside in the A and P sites of the small subunit, while the acceptor ends interact with the P and E sites of the large subunit. In this work, by means of cryo-EM and part...

  16. Phylogenetic evidence for the acquisition of ribosomal RNA introns subsequent to the divergence of some of the major Tetrahymena groups

    Sogin, M L; Ingold, A; Karlok, M;

    1986-01-01

    Previous work has demonstrated the presence of a self-splicing intron in the large subunit ribosomal RNA coding region in some strains of the ciliate protozoan Tetrahymena. Sequence comparisons of the intron regions from six Tetrahymena species showed these to fall into three homology groups. In an...... attempt to evaluate the evolutionary origins of the intervening sequences, we have now determined complete small subunit ribosomal RNA gene sequences from 13 species of Tetrahymena and the absolute number of nucleotide differences between the sequences was used to construct a phylogenetic tree. This...

  17. The kissing-loop T-shaped structure translational enhancer of Pea enation mosaic virus can bind simultaneously to ribosomes and a 5' proximal hairpin.

    Gao, Feng; Gulay, Suna P; Kasprzak, Wojciech; Dinman, Jonathan D; Shapiro, Bruce A; Simon, Anne E

    2013-11-01

    The Pea enation mosaic virus (PEMV) 3' translational enhancer, known as the kissing-loop T-shaped structure (kl-TSS), binds to 40S subunits, 60S subunits, and 80S ribosomes, whereas the Turnip crinkle virus (TCV) TSS binds only to 60S subunits and 80S ribosomes. Using electrophoretic mobility gel shift assay (EMSA)-based competition assays, the kl-TSS was found to occupy a different site in the ribosome than the P-site-binding TCV TSS, suggesting that these two TSS employ different mechanisms for enhancing translation. The kl-TSS also engages in a stable, long-distance RNA-RNA kissing-loop interaction with a 12-bp 5'-coding-region hairpin that does not alter the structure of the kl-TSS as revealed by molecular dynamics simulations. Addition of the kl-TSS in trans to a luciferase reporter construct containing either wild-type or mutant 5' and 3' PEMV sequences suppressed translation, suggesting that the kl-TSS is required in cis to function, and both ribosome-binding and RNA interaction activities of the kl-TSS contributed to translational inhibition. Addition of the kl-TSS was more detrimental for translation than an adjacent eIF4E-binding 3' translational enhancer known as the PTE, suggesting that the PTE may support the ribosome-binding function of the kl-TSS. Results of in-line RNA structure probing, ribosome filter binding, and high-throughput selective 2'-hydroxyl acylation analyzed by primer extension (hSHAPE) of rRNAs within bound ribosomes suggest that kl-TSS binding to ribosomes and binding to the 5' hairpin are compatible activities. These results suggest a model whereby posttermination ribosomes/ribosomal subunits bind to the kl-TSS and are delivered to the 5' end of the genome via the associated RNA-RNA interaction, which enhances the rate of translation reinitiation. PMID:23986599

  18. Ribosome-Inactivating Proteins: From Plant Defense to Tumor Attack

    Maria Serena Fabbrini

    2010-11-01

    Full Text Available Ribosome-inactivating proteins (RIPs are EC3.2.32.22 N-glycosidases that recognize a universally conserved stem-loop structure in 23S/25S/28S rRNA, depurinating a single adenine (A4324 in rat and irreversibly blocking protein translation, leading finally to cell death of intoxicated mammalian cells. Ricin, the plant RIP prototype that comprises a catalytic A subunit linked to a galactose-binding lectin B subunit to allow cell surface binding and toxin entry in most mammalian cells, shows a potency in the picomolar range. The most promising way to exploit plant RIPs as weapons against cancer cells is either by designing molecules in which the toxic domains are linked to selective tumor targeting domains or directly delivered as suicide genes for cancer gene therapy. Here, we will provide a comprehensive picture of plant RIPs and discuss successful designs and features of chimeric molecules having therapeutic potential.

  19. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    James M. Love

    2015-08-01

    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  20. Analysis of the protein-protein interactions between the human acidic ribosomal P-proteins: evaluation by the two hybrid system

    Tchórzewski, M; Boldyreff, B; Issinger, O;

    2000-01-01

    function of these proteins, we are the first to have precisely analyzed mutual interactions among human P-proteins, employing the two hybrid system. The human acidic ribosomal P-proteins, (P1 or P2,) were fused to the GAL4 binding domain (BD) as well as the activation domain (AD), and analyzed in yeast...... forms the 60 S ribosomal stalk: P0-(P1/P2)(2). Additionally, mutual interactions among human and yeast P-proteins were analyzed. Heterodimer formation could be observed between human P2 and yeast P1 proteins.......The surface acidic ribosomal proteins (P-proteins), together with ribosomal core protein P0 form a multimeric lateral protuberance on the 60 S ribosomal subunit. This structure, also called stalk, is important for efficient translational activity of the ribosome. In order to shed more light on the...

  1. Mutations in the bacterial ribosomal protein l3 and their association with antibiotic resistance

    Klitgaard, Rasmus N; Ntokou, Eleni; Nørgaard, Katrine;

    2015-01-01

    Different groups of antibiotics bind to the peptidyl transferase center (PTC) in the large subunit of the bacterial ribosome. Resistance to these groups of antibiotics has often been linked with mutations or methylations of the 23S rRNA. In recent years, there has been a rise in the number of...... studies where mutations have been found in the ribosomal protein L3 in bacterial strains resistant to PTC-targeting antibiotics but there is often no evidence that these mutations actually confer antibiotic resistance. In this study, a plasmid exchange system was used to replace plasmid-carried wild...

  2. Molecular mechanisms of ribosomal protein gene coregulation.

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B Franklin

    2015-09-15

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20-50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1-TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

  3. Preferential translation of chloroplast ribosomal proteins in Chlamydomonas reinhardtti

    The nuclear cr-1 mutant of C. reinhardtii is deficient in the 30S subunit of the chloroplast (cp) ribosome and in cp protein synthesis. The cp spectinomycin resistant mutant, spr-u-1-27-3, has a normal level of 70S ribosomes but only a low rate of cp protein synthesis with spectinomycin present. In both mutants there is little accumulation of the large subunit of ribulose 1,5-bisphosphate carboxylase (Rubisco LSU), but near wild-type levels of cp synthesized r-proteins. In cells pulse-labelled with 35SO4 and immunoprecipitated with specific antisera, the ratio of the rate of synthesis of cp r-proteins to that of Rubisco LSU is 7 times greater in both mutants than in wild-type. No difference in the rate of turnover between r-proteins and Rubisco LSU in mutant and wild-type cells was observed during a one hour chase. The mRNA levels for r-protein L1 and Rubisco LSU actually increase slightly in the mutants. These data suggest that C. reinhardtii has a translation mechanism for preferential synthesis of cp r-proteins that operates under conditions of reduced total cp protein synthesis

  4. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  5. Plastid-Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae.

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

    2016-01-01

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid-nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

  6. The Internet and Email For The Over 50s Teach Yourself

    Reeves, Bob

    2010-01-01

    The Internet and Email for the Over 50s provides instruction and advice on how to get the best out of email and the Internet and is written with practical good humour for the the late beginner or the technicologically terrified!

  7. A Philosophical Perspective on Leading Music Activities for the Over 50s

    McQueen, Hilary; Hallam, Susan; Creech, Andrea; Varvarigou, Maria

    2013-01-01

    The basis of this article is findings from the Music for Life Project which investigated the benefits and challenges of music activity participation for the over 50s in three case study sites in the United Kingdom. The paper uses a philosophical lens to explore the leaders' and participants' views on the purpose of the activities, how…

  8. 核糖体小亚基RNA和细胞色素氧化酶亚单位Ⅱ基因在中国利什曼原虫系统发育学分析中应用的比较%Comparison on the difference between the analysis of phylogenetic relationships of Leishmania isolates from China with small subunit ribosomal RNA and cytochrome oxidase Ⅱ gene

    曹得萍; 廖琳; 陈达丽; 陈建平

    2014-01-01

    目的 比较核糖体小亚基RNA(small subunit ribosomal RNA,SSUrRNA)和细胞色素氧化酶亚单位Ⅱ(cytochrome oxidaseⅡ,COXⅡ)这2种分子标志在中国利什曼原虫系统发育学分析中的不同. 方法 提取利什曼原虫各虫株核基因组和线粒体基因组,PCR方法扩增中国不同地区利什曼原虫SSUrRNA和COXⅡ基因,扩增产物送上海生工生物工程技术服务有限公司测序,序列碱基通过Clustal X软件比对,用DAMBE软件进行单倍型分析、Mega4软件计算遗传距离,Mrbayes3.1.2软件构建贝叶斯进化树. 结果 COXⅡ分析结果表明,流行于中国的利什曼原虫虫株未形成一个单系群;GS7和XJ771属于杜氏利什曼原虫复合体;10株利什曼原虫形成的6个单倍型(MHOM/CN/93/GS7,IPHUCN/77/XJ771,MHOM/CN/84/JS1和MGER/CN/60/GS-GER20除外)形成1个单系群;而SSUrRNA分析结果表明:11株利什曼原虫(IPHL/CN/77/XJ771,MH OM/CN/93/GS7,MRHO/CN/88/KXG-2,MHOM/CN/84/JS1,MGER/CN/60/GS-GER20除外)形成一个独立枝;江苏株JS1和热带利什曼原虫聚在一起,不与杜氏利什曼原虫聚在一起. 结论 SSUrRNA和COXⅡ得出的结果较一致,但COXⅡ基因在分析利仟曼原虫的系统发育关系时,可能是一个更可靠的遗传标志.%Objective To compare the difference between the analysis on the phylogenetic relationships of Leishmania isolates from different foci in China with partial fragment of small subunit ribosomal RNA (SSUrRNA) gene sequences or kinetoplast cytochrome oxidase Ⅱ (COX Ⅱ) gene sequences.Methods Genomic DNA and kinetoplast DNA were extracted from the promastigotes.The CO Ⅱ and SSUrRNA genes were amplified using respective primers.Products of PCR were sent to a commercial company for sequencing using the same PCR primer.Combined sequences matrix was aligned using Clustal X (1.8) with default settings and refined manually.Bayesian tree was constructed using Mrbayes-3.1.2.Results Leishmania isolates from different foci in China

  9. Developmentally regulated phosphorylation-dephosphorylation of ribosomal proteins from maize embryonic axes

    Previous work in our lab suggests translational control during maize germination. To test this possibility the present research focuses on the phosphorylated status of the ribosomal proteins of maize axes during germination. Ribosomes from embryonic axes incubated for different periods were in vitro or in vivo labeled by 1h-pulse for 32P orthophosphate. Electrophoretic analysis of the ribosomal proteins and autoradiographs revealed: (a) in vitro, several 32P bands and very similar patterns for all stages tested (0 to 24h); in vivo, less number of labeled bands and a changing pattern from 3 to 24h of incubation. A protein of 30,900 MW did not appear phosphorylated until 8h of incubation, while a 17,000 MW protein was strongly labeled at 3h and fastly dephosphorylated toward 24h. Phosphorylated proteins belong to both the small and the large subunits. The implication of this process will be discussed

  10. Structural characterization of ribosome recruitment and translocation by type IV IRES

    Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S

    2016-01-01

    Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts tvhe otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation. DOI: http://dx.doi.org/10.7554/eLife.13567.001 PMID:27159451

  11. Recovery of crenarchaeotal ribosomal DNA sequences from freshwater-lake sediments.

    Schleper, C; Holben, W; Klenk, H.P.

    1997-01-01

    We report several novel environmental sequences of archaea from the kingdom Crenarchaeota, recovered from anaerobic freshwater-lake sediments in Michigan. A nested PCR approach with Archaea- and Crenar-chaeota-specific primers was used to amplify partial Small-subunit ribosomal DNAs. Phylogenetic analysis of seven sequences shows that these DNAs represent a monophyletic lineage diverging prior to all recently identified crenarchaeotal phylotypes isolated from temperate environments. Including...

  12. An evaluation of the monophyly of Massarina based on ribosomal DNA sequences

    Liew, ECY; Aptroot, A.; Hyde, KD

    2002-01-01

    The monophyletic status of the genus Massarina was evaluated on the basis of phylogenetic analysis of the partial small subunit gene (SSU), internal transcribed spacers (ITS 1 & 2), and 5.8S gene sequences of the ribosomal DNA. Species of Massarina used in the study clustered into two distinct clades with high bootstrap support in trees generated from maximum parsimony, weighted parsimony, maximum likelihood, and neighbor-joining analyses. The hypothesis that Massarina species belong to a phy...

  13. Phylogenetic relationship of ribosomal ITS2 and mitochondrial COI among diploid and triploid Paragonimus westermani isolates

    Park, Gab-Man; Im, Kyung-Il; Yong, Tai-Soon

    2003-01-01

    We compared patterns of intraspecific polymorphism of two markers with contrasting modes of evolution, nuclear ribosomal DNA (rDNA) and mitochondrial DNA (mtDNA), in the lung fluke, diploid and triploid Paragonimus westermani from three geographical regions of Korea. The genetic distances between three populations of Korean diploid and triploid P. westermani showed no significant difference in the nucleotide sequences of the mitochondrial cytochrome c oxidase subunit I (mtCOI) and ribosomaal ...

  14. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  15. HrpA, a new ribosome-associated protein which appears in heat-stressed Mycobacterium bovis bacillus Calmette-Guérin.

    Ohara, N; Naito, M.; Miyazaki, C.; Matsumoto, S.; Tabira, Y; Yamada, T.

    1997-01-01

    A novel 18-kDa heat shock protein, HrpA, has been identified from Mycobacterium bovis BCG. HrpA was rapidly synthesized in membrane and ribosome fractions but not in the cytoplasmic fraction under heat shock stress. HrpA bound tightly to 70S ribosomes, mainly in 30S subunits. HrpA might be involved in the initiation step of translation at high temperature.

  16. Mutant connexin 50 (S276F) inhibits channel and hemichannel functions inducing cataract

    Yuanyuan Liu; Chen Qiao; Tanwei Wei; Fang Zheng; Shuren Guo; Qiang Chen; Ming Yan; Xin Zhou

    2015-06-01

    This study was designed to detect the expression, detergent resistance, subcellular localization, and channel and hemichannel functions of mutant Cx50 to understand the forming mechanism for inducing congenital cataract by a novel mutation p.S276F in connexin 50 (Cx50) reported previously by us. HeLa and human lens epithelial (HLE) cells were transfected with wild-type Cx50 and mutant Cx50 (S276F). We examined the functional characteristics of mutant Cx50 (S276F) in comparison with those of wild-type Cx50 using immunoblot, confocal fluorescence microscopy, dye transfer analysis and dye uptake assay. The mutant and wild-type Cx50 were expressed in equal levels and could efficiently localize to the plasma membrane without transportation and assembly problems. Scrape loading dye transfer was significantly evident in cells transfected with wild-type Cx50 compared to those in cells transfected with mutant Cx50 and cotransfected with wild-type and mutant Cx50. The dye uptake was found to be significantly lower in cells transfected with mutant Cx50 than in cells transfected with wild-type Cx50 and cells cotransfected with wild-type and mutant Cx50. The transfected HeLa and HLE cell lines showed similar performance in all the experiments. These results indicated that the mutant Cx50 (S276F) might inhibit the function of gap junction channel in a dominant negative manner, but inhibit the hemichannel function in a recessive negative manner.

  17. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  18. Ribosome Mechanics Informs about Mechanism.

    Zimmermann, Michael T; Jia, Kejue; Jernigan, Robert L

    2016-02-27

    The essential aspects of the ribosome's mechanism can be extracted from coarse-grained simulations, including the ratchet motion, the movement together of critical bases at the decoding center, and movements of the peptide tunnel lining that assist in the expulsion of the synthesized peptide. Because of its large size, coarse graining helps to simplify and to aid in the understanding of its mechanism. Results presented here utilize coarse-grained elastic network modeling to extract the dynamics, and both RNAs and proteins are coarse grained. We review our previous results, showing the well-known ratchet motions and the motions in the peptide tunnel and in the mRNA tunnel. The motions of the lining of the peptide tunnel appear to assist in the expulsion of the growing peptide chain, and clamps at the ends of the mRNA tunnel with three proteins ensure that the mRNA is held tightly during decoding and essential for the helicase activity at the entrance. The entry clamp may also assist in base recognition to ensure proper selection of the incoming tRNA. The overall precision of the ribosome machine-like motions is remarkable. PMID:26687034

  19. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  20. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G.

    2014-01-01

    eLife digest The production of a protein in a cell starts with a region of DNA being transcribed to produce a molecule of messenger RNA. A large molecular machine called ribosome then reads the information in the messenger RNA molecule to produce a protein. Ribosomes themselves are made of RNA and several different proteins called r-proteins. The construction of a ribosome starts with the assembly of a pre-ribosome inside the cell nucleus, and the ribosome is completed in the cytosol of the c...

  1. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  2. Biochemical characterization of three mycobacterial ribosomal fractions.

    Portelance, V; Beaudet, R

    1983-02-01

    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  3. Viral IRES RNA structures and ribosome interactions.

    Kieft, Jeffrey S

    2008-06-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  4. Quantitative studies of mRNA recruitment to the eukaryotic ribosome.

    Fraser, Christopher S

    2015-07-01

    The process of peptide bond synthesis by ribosomes is conserved between species, but the initiation step differs greatly between the three kingdoms of life. This is illustrated by the evolution of roughly an order of magnitude more initiation factor mass found in humans compared with bacteria. Eukaryotic initiation of translation is comprised of a number of sub-steps: (i) recruitment of an mRNA and initiator methionyl-tRNA to the 40S ribosomal subunit; (ii) migration of the 40S subunit along the 5' UTR to locate the initiation codon; and (iii) recruitment of the 60S subunit to form the 80S initiation complex. Although the mechanism and regulation of initiation has been studied for decades, many aspects of the pathway remain unclear. In this review, I will focus discussion on what is known about the mechanism of mRNA selection and its recruitment to the 40S subunit. I will summarize how the 43S preinitiation complex (PIC) is formed and stabilized by interactions between its components. I will discuss what is known about the mechanism of mRNA selection by the eukaryotic initiation factor 4F (eIF4F) complex and how the selected mRNA is recruited to the 43S PIC. The regulation of this process by secondary structure located in the 5' UTR of an mRNA will also be discussed. Finally, I present a possible kinetic model with which to explain the process of mRNA selection and recruitment to the eukaryotic ribosome. PMID:25742741

  5. Accommodation of tmRNA-SmpB into stalled ribosomes: a cryo-EM study.

    Weis, Felix; Bron, Patrick; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald

    2010-02-01

    In eubacteria, translation of defective messenger RNAs (mRNAs) produces truncated polypeptides that stall on the ribosome. A quality control mechanism referred to as trans-translation is performed by transfer-messenger RNA (tmRNA), a specialized RNA acting as both a tRNA and an mRNA, associated with small protein B (SmpB). So far, a clear view of the structural movements of both the protein and RNA necessary to perform accommodation is still lacking. By using a construct containing the tRNA-like domain as well as the extended helix H2 of tmRNA, we present a cryo-electron microscopy study of the process of accommodation. The structure suggests how tmRNA and SmpB move into the ribosome decoding site after the release of EF-Tu.GDP. While two SmpB molecules are bound per ribosome in a preaccommodated state, our results show that during accommodation the SmpB protein interacting with the small subunit decoding site stays in place while the one interacting with the large subunit moves away. Relative to canonical translation, an additional movement is observed due to the rotation of H2. This suggests that the larger movement required to resume translation on a tmRNA internal open reading frame starts during accommodation. PMID:20038631

  6. Systematics of Chaetognatha under the light of molecular data, using duplicated ribosomal 18S DNA sequences.

    Papillon, Daniel; Perez, Yvan; Caubit, Xavier; Le Parco, Yannick

    2006-03-01

    While the phylogenetic position of Chaetognatha has became central to the question of early bilaterian evolution, the internal systematics of the phylum are still not clear. The phylogenetic relationships of the chaetognaths were investigated using newly obtained small subunit ribosomal RNA nuclear 18S (SSU rRNA) sequences from 16 species together with 3 sequences available in GenBank. As previously shown with the large subunit ribosomal RNA 28S gene, two classes of Chaetognatha SSU rRNA gene can be identified, suggesting a duplication of the whole ribosomal cluster; allowing the rooting of one class of genes by another in phylogenetic analyses. Maximum Parsimony, Maximum Likelihood and Bayesian analyses of the molecular data, and statistical tests showed (1) that there are three main monophyletic groups: Sagittidae/Krohnittidae, Spadellidae/Pterosagittidae, and Eukrohniidae/Heterokrohniidae, (2) that the group of Aphragmophora without Pterosagittidae (Sagittidae/Krohnittidae) is monophyletic, (3) the Spadellidae/Pterosagittidae and Eukrohniidae/Heterokrohniidae families are very likely clustered, (4) the Krohnittidae and Pterosagittidae groups should no longer be considered as families as they are included in other groups designated as families, (5) suborder Ctenodontina is not monophyletic and the Flabellodontina should no longer be considered as a suborder, and (6) the Syngonata/Chorismogonata and the Monophragmophora/Biphragmophora hypotheses are rejected. Such conclusions are considered in the light of morphological characters, several of which are shown to be prone to homoplasy. PMID:16434216

  7. The Kissing-Loop T-Shaped Structure Translational Enhancer of Pea Enation Mosaic Virus Can Bind Simultaneously to Ribosomes and a 5′ Proximal Hairpin

    Gao, Feng; Gulay, Suna P.; Kasprzak, Wojciech; Dinman, Jonathan D.

    2013-01-01

    The Pea Enation Mosaic Virus (PEMV) 3′ translational enhancer, known as the kissing-loop T-shaped structure (kl-TSS), binds to 40S subunits, 60S subunits, and 80S ribosomes, whereas the Turnip crinkle virus (TCV) TSS binds only to 60S subunits and 80S ribosomes. Using electrophoretic mobility gel shift assay (EMSA)-based competition assays, the kl-TSS was found to occupy a different site in the ribosome than the P-site-binding TCV TSS, suggesting that these two TSS employ different mechanisms for enhancing translation. The kl-TSS also engages in a stable, long-distance RNA-RNA kissing-loop interaction with a 12-bp 5′-coding-region hairpin that does not alter the structure of the kl-TSS as revealed by molecular dynamics simulations. Addition of the kl-TSS in trans to a luciferase reporter construct containing either wild-type or mutant 5′ and 3′ PEMV sequences suppressed translation, suggesting that the kl-TSS is required in cis to function, and both ribosome-binding and RNA interaction activities of the kl-TSS contributed to translational inhibition. Addition of the kl-TSS was more detrimental for translation than an adjacent eIF4E-binding 3′ translational enhancer known as the PTE, suggesting that the PTE may support the ribosome-binding function of the kl-TSS. Results of in-line RNA structure probing, ribosome filter binding, and high-throughput selective 2′-hydroxyl acylation analyzed by primer extension (hSHAPE) of rRNAs within bound ribosomes suggest that kl-TSS binding to ribosomes and binding to the 5′ hairpin are compatible activities. These results suggest a model whereby posttermination ribosomes/ribosomal subunits bind to the kl-TSS and are delivered to the 5′ end of the genome via the associated RNA-RNA interaction, which enhances the rate of translation reinitiation. PMID:23986599

  8. Viral IRES RNA structures and ribosome interactions

    Kieft, Jeffrey S.

    2008-01-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IR...

  9. The economics of ribosome biosynthesis in yeast.

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  10. Visualization of the hybrid state of tRNA binding promoted by spontaneous ratcheting of the ribosome.

    Agirrezabala, Xabier; Lei, Jianlin; Brunelle, Julie L; Ortiz-Meoz, Rodrigo F; Green, Rachel; Frank, Joachim

    2008-10-24

    A crucial step in translation is the translocation of tRNAs through the ribosome. In the transition from one canonical site to the other, the tRNAs acquire intermediate configurations, so-called hybrid states. At this stage, the small subunit is rotated with respect to the large subunit, and the anticodon stem loops reside in the A and P sites of the small subunit, while the acceptor ends interact with the P and E sites of the large subunit. In this work, by means of cryo-EM and particle classification procedures, we visualize the hybrid state of both A/P and P/E tRNAs in an authentic factor-free ribosome complex during translocation. In addition, we show how the repositioning of the tRNAs goes hand in hand with the change in the interplay between S13, L1 stalk, L5, H68, H69, and H38 that is caused by the ratcheting of the small subunit. PMID:18951087

  11. Protein Folding Activity of the Ribosome (PFAR –– A Target for Antiprion Compounds

    Debapriya Banerjee

    2014-10-01

    Full Text Available Prion diseases are fatal neurodegenerative diseases affecting mammals. Prions are misfolded amyloid aggregates of the prion protein (PrP, which form when the alpha helical, soluble form of PrP converts to an aggregation-prone, beta sheet form. Thus, prions originate as protein folding problems. The discovery of yeast prion(s and the development of a red-/white-colony based assay facilitated safe and high-throughput screening of antiprion compounds. With this assay three antiprion compounds; 6-aminophenanthridine (6AP, guanabenz acetate (GA, and imiquimod (IQ have been identified. Biochemical and genetic studies reveal that these compounds target ribosomal RNA (rRNA and inhibit specifically the protein folding activity of the ribosome (PFAR. The domain V of the 23S/25S/28S rRNA of the large ribosomal subunit constitutes the active site for PFAR. 6AP and GA inhibit PFAR by competition with the protein substrates for the common binding sites on the domain V rRNA. PFAR inhibition by these antiprion compounds opens up new possibilities for understanding prion formation, propagation and the role of the ribosome therein. In this review, we summarize and analyze the correlation between PFAR and prion processes using the antiprion compounds as tools.

  12. NCBI nr-aa BLAST: CBRC-PHAM-01-1519 [SEVENS

    Full Text Available The Structure Of Rf2 Bound To The Ribosome (Part 2 Of 4). This File Contains The 50s Subunit. pdb|2JL8|J Cha...in J, Insights Into Translational Termination From The Structure Of Rf2 Bound To The Ribosome (Part 4 Of 4). This File Contains The 50s Subunit 2JL6 3e-08 36% ...

  13. NCBI nr-aa BLAST: CBRC-TTRU-01-0296 [SEVENS

    Full Text Available The Structure Of Rf2 Bound To The Ribosome (Part 2 Of 4). This File Contains The 50s Subunit. pdb|2JL8|J Cha...in J, Insights Into Translational Termination From The Structure Of Rf2 Bound To The Ribosome (Part 4 Of 4). This File Contains The 50s Subunit 2JL6 7e-05 48% ...

  14. Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

    Kirsten Kehrein

    2015-02-01

    Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.

  15. X-ray Analyses of the Ribosomal A-Site Molecular Switches

    Kondo, Jiro

    The aminoacyl-tRNA decoding site (A-site) on the small ribosomal subunit is an RNA molecular switch guaranteeing high translation fidelity. Due to the similarity of the secondary structure of the A-site, it has long been believed that the functional characteristics and tertiary structure of the A-site molecular switch are basically conserved in three main cell types, bacteria, mitochondria and eukaryotic cytoplasm. However, these three cell types are noticeably different in their biological properties such as life cycle, genome size, structural component of ribosome and number of tRNA species. In our structural studies, we have shown how a small difference of nucleotide sequences affects the dynamics of the A-site molecular switches underlying the decoding mechanism adapted to their biological properties and environments. The observed structural insights into the decoding process allowed us to understand molecular mechanisms of non-syndromic hearing loss and toxicity mechanism of aminoglycoside antibiotics.

  16. A Ribosomal Protein AgRPS3aE from Halophilic Aspergillus glaucus Confers Salt Tolerance in Heterologous Organisms

    Xilong Liang; Yiling Liu; Lixia Xie; Xiaodan Liu; Yi Wei; Xiaoyang Zhou; Shihong Zhang

    2015-01-01

    High salt in soils is one of the abiotic stresses that significantly reduces crop yield, although saline lands are considered potential resources arable for agriculture. Currently, genetic engineering for enhancing salt tolerance is being tested as an efficient and viable strategy for crop improvement. We previously characterized a large subunit of the ribosomal protein RPL44, which is involved in osmotic stress in the extremely halophilic fungus Aspergillus glaucus. Here, we screened another...

  17. The circadian clock coordinates ribosome biogenesis.

    Céline Jouffe

    Full Text Available Biological rhythms play a fundamental role in the physiology and behavior of most living organisms. Rhythmic circadian expression of clock-controlled genes is orchestrated by a molecular clock that relies on interconnected negative feedback loops of transcription regulators. Here we show that the circadian clock exerts its function also through the regulation of mRNA translation. Namely, the circadian clock influences the temporal translation of a subset of mRNAs involved in ribosome biogenesis by controlling the transcription of translation initiation factors as well as the clock-dependent rhythmic activation of signaling pathways involved in their regulation. Moreover, the circadian oscillator directly regulates the transcription of ribosomal protein mRNAs and ribosomal RNAs. Thus the circadian clock exerts a major role in coordinating transcription and translation steps underlying ribosome biogenesis.

  18. The immunological properties of Brucella ribosomal preparations.

    Corbel, M J

    1976-01-01

    Ribosomes were isolated from Brucella abortus strains 19 and 45/20 by disruption of the cells followed by differential ultracentrifugation. The ribosome preparations contained 2-3 components reacting in immunodiffusion tests but were free of detectable lipopolysaccharide-protein agglutinogen. They crossreacted with antisera to Br. abortus, Br. melitensis, Br. suis and Br. ovis and elicited intradermal delayed hypersensitivity reactions in animals infected with Br. abortus, Br. melitensis or Br. suis. The ribosomes were antigenic in rabbits, guinea pigs and mice. Those from Br. abortus S19 induced agglutinins reaction with smooth brucella strains whereas those from Br. abortus 45/20 induced agglutinins reacting with rough brucella strains. Cattle vaccinated with S19 or 45/20 vaccines or infected with Br. abortus developed pricipitins to ribosomal components at an early stage in the immune response. PMID:816681

  19. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  20. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-01

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  1. A Ribosomal Protein AgRPS3aE from Halophilic Aspergillus glaucus Confers Salt Tolerance in Heterologous Organisms

    Xilong Liang

    2015-01-01

    Full Text Available High salt in soils is one of the abiotic stresses that significantly reduces crop yield, although saline lands are considered potential resources arable for agriculture. Currently, genetic engineering for enhancing salt tolerance is being tested as an efficient and viable strategy for crop improvement. We previously characterized a large subunit of the ribosomal protein RPL44, which is involved in osmotic stress in the extremely halophilic fungus Aspergillus glaucus. Here, we screened another ribosomal protein (AgRPS3aE that also produced high-salt tolerance in yeast. Bioinformatics analysis indicated that AgRPS3aE encodes a 29.2 kDa small subunit of a ribosomal protein belonging to the RPS3Ae family in eukaryotes. To further confirm its protective function against salinity, we expressed AgRPS3aE in three heterologous systems, the filamentous fungus Magnaporthe oryzae and two model plants Arabidopsis and tobacco. Overexpression of AgRPS3aE in all tested transformants significantly alleviated stress symptoms compared with controls, suggesting that AgRPS3aE functions not only in fungi but also in plants. Considering that ribosomal proteins are housekeeping components in organisms from prokaryotes to eukaryotes, we propose that AgRPS3aE is one of the optimal genes for improving high-salt tolerance in crops.

  2. RPG: the Ribosomal Protein Gene database

    Nakao, Akihiro; Yoshihama, Maki; Kenmochi, Naoya

    2004-01-01

    RPG (http://ribosome.miyazaki-med.ac.jp/) is a new database that provides detailed information about ribosomal protein (RP) genes. It contains data from humans and other organisms, including Drosophila melanogaster, Caenorhabditis elegans, Saccharo myces cerevisiae, Methanococcus jannaschii and Escherichia coli. Users can search the database by gene name and organism. Each record includes sequences (genomic, cDNA and amino acid sequences), intron/exon structures, genomic locations and informa...

  3. Ribosome biogenesis during skeletal muscle hypertrophy

    von Walden, Ferdinand

    2014-01-01

    Muscle adaptation to chronic resistance exercise (RE) is the result of a cumulative effect on gene expression and protein content. Following a bout of RE, muscle protein synthesis increases and, if followed by consecutive bouts (training), protein accretion and muscle hypertrophy develops. The protein synthetic capacity of the muscle is dictated by ribosome content. Therefore, the general aim of this thesis is to investigate the regulation of ribosome biogenesis during skeletal muscle hypertr...

  4. Flexural Properties of E Glass and TR50S Carbon Fiber Reinforced Epoxy Hybrid Composites

    Dong, Chensong; Sudarisman; Davies, Ian J.

    2013-01-01

    A study on the flexural properties of E glass and TR50S carbon fiber reinforced hybrid composites is presented in this paper. Specimens were made by the hand lay-up process in an intra-ply configuration with varying degrees of glass fibers added to the surface of a carbon laminate. These specimens were then tested in the three-point bend configuration in accordance with ASTM D790-07 at three span-to-depth ratios: 16, 32, and 64. The failure modes were examined under an optical microscope. The flexural behavior was also simulated by finite element analysis, and the flexural modulus, flexural strength, and strain to failure were calculated. It is shown that although span-to-depth ratio shows an influence on the stress-strain relationship, it has no effect on the failure mode. The majority of specimens failed by either in-plane or out-of-plane local buckling followed by kinking and splitting at the compressive GFRP side and matrix cracking combined with fiber breakage at the CFRP tensile face. It is shown that positive hybrid effects exist for the flexural strengths of most of the hybrid configurations. The hybrid effect is noted to be more obvious when the hybrid ratio is small, which may be attributed to the relative position of the GFRP layer(s) with respect to the neutral plane. In contrast to this, flexural modulus seems to obey the rule of mixtures equation.

  5. Factor requirements for translation initiation on the Simian picornavirus internal ribosomal entry site

    de Breyne, Sylvain; Yu, Yingpu; Pestova, Tatyana V.; Hellen, Christopher U. T.

    2008-01-01

    The Simian picornavirus type 9 (SPV9) 5′-untranslated region (5′ UTR) has been predicted to contain an internal ribosomal entry site (IRES) with structural elements that resemble domains of hepacivirus/pestivirus (HP) IRESs. In vitro reconstitution of initiation confirmed that this 5′ UTR contains an IRES and revealed that it has both functional similarities and differences compared to HP IRESs. Like HP IRESs, the SPV9 IRES bound directly to 40S subunits and eukaryotic initiation factor (eIF)...

  6. Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

    Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne; Støttrup, Josianne; Buchmann, Kurt

    2010-01-01

    An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested to be...... related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

  7. Structural and Functional Studies of Ribosome-inactivating Proteins and Ribosomal RNA

    LIU Wangyi; ZHANG Jinsong; LIU Renshui; HE Wenjun; LING Jun

    2007-01-01

    @@ A plant's ribosome-inactivating proteins (RIPs) are a group of toxic proteins. Theoretically, they can be employed as a tool enzyme in the exploration of the structure and function of the ribosomal RNA; in practical application, they can be used as an insecticide in agriculture, for preparation of immuno-toxic protein to kill cancer cells or against viral infection in medicine.

  8. Canonical Initiation Factor Requirements of the Myc Family of Internal Ribosome Entry Segments▿ †

    Spriggs, Keith A.; Cobbold, Laura C.; Jopling, Catherine L.; Cooper, Rebecca E.; Wilson, Lindsay A.; Stoneley, Mark; Coldwell, Mark J.; Poncet, Didier; Shen, Ya-Ching; Morley, Simon J.; Bushell, Martin; Willis, Anne E.

    2009-01-01

    Initiation of protein synthesis in eukaryotes requires recruitment of the ribosome to the mRNA and its translocation to the start codon. There are at least two distinct mechanisms by which this process can be achieved; the ribosome can be recruited either to the cap structure at the 5′ end of the message or to an internal ribosome entry segment (IRES), a complex RNA structural element located in the 5′ untranslated region (5′-UTR) of the mRNA. However, it is not well understood how cellular IRESs function to recruit the ribosome or how the 40S ribosomal subunits translocate from the initial recruitment site on the mRNA to the AUG initiation codon. We have investigated the canonical factors that are required by the IRESs found in the 5′-UTRs of c-, L-, and N-myc, using specific inhibitors and a tissue culture-based assay system, and have shown that they differ considerably in their requirements. The L-myc IRES requires the eIF4F complex and the association of PABP and eIF3 with eIF4G for activity. The minimum requirements of the N- and c-myc IRESs are the C-terminal domain of eIF4G to which eIF4A is bound and eIF3, although interestingly this protein does not appear to be recruited to the IRES RNA via eIF4G. Finally, our data show that all three IRESs require a ternary complex, although in contrast to c- and L-myc IRESs, the N-myc IRES has a lesser requirement for a ternary complex. PMID:19124605

  9. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  10. TAXONOMIC STATUS OF CAR BACILLUS BASED ON THE SMALL SUBUNIT RIBOSOMAL RNA SEQUENCES

    魏强; TsujiM; TakahashiT; IshiharaC; ItohT

    1995-01-01

    In an attempt to identify the taxonomic relationship between CAR bacillus and other bacteria, the SSU rRNA gene sequences of two CAR bacillus strains, CBM and CBR isolated from mice and rats respectively were used in the present studies. The SSU rRNA gene sequences, approximately 1.5 kb in size amplified from genomic DNAs from both strains, were determined and 96. 8% homologies were found to exist be-tween them. Those sequences were aligned to most euhacteria with a computer search showing high homol-ogy with those of Flavobacter/Flexibacter species especially closed to Fx. sanai and Ft. ferrugineum. Phylogenetic analysts indicated that CAR bacillus belongs to a species close to Fx. sancti and Ft. ferrug-imum subdivision.

  11. Notes on coccidian phylogeny, based on the apicoplast small subunit ribosomal DNA

    Oborník, Miroslav; Jirků, Milan; Šlapeta, Jan Roger; Modrý, David; Koudela, Břetislav; Lukeš, Julius

    2002-01-01

    Roč. 88, č. 4 (2002), s. 360-363. ISSN 0932-0113 R&D Projects: GA AV ČR IAB5022904 Institutional research plan: CEZ:AV0Z6022909 Keywords : coccidia * apicoplast * SSU rRNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.046, year: 2002

  12. Plasmids containing small subunit ribosomal RNA gene fragments from Babesia bovis and Babesia bigemina

    BEI Resources was developed by NIAID as a centralized biological resource center for research reagents to the scientific community (http://www.beiresources.org/). They have a considerable amount of reagents and isolates for parasitologists working with Entamoeba histolytica, Giardia, Toxoplasma, and...

  13. HCV IRES domain IIb affects the configuration of coding RNA in the 40S subunit's decoding groove.

    Filbin, Megan E; Kieft, Jeffrey S

    2011-07-01

    Hepatitis C virus (HCV) uses a structured internal ribosome entry site (IRES) RNA to recruit the translation machinery to the viral RNA and begin protein synthesis without the ribosomal scanning process required for canonical translation initiation. Different IRES structural domains are used in this process, which begins with direct binding of the 40S ribosomal subunit to the IRES RNA and involves specific manipulation of the translational machinery. We have found that upon initial 40S subunit binding, the stem-loop domain of the IRES that contains the start codon unwinds and adopts a stable configuration within the subunit's decoding groove. This configuration depends on the sequence and structure of a different stem-loop domain (domain IIb) located far from the start codon in sequence, but spatially proximal in the IRES•40S complex. Mutation of domain IIb results in misconfiguration of the HCV RNA in the decoding groove that includes changes in the placement of the AUG start codon, and a substantial decrease in the ability of the IRES to initiate translation. Our results show that two distal regions of the IRES are structurally communicating at the initial step of 40S subunit binding and suggest that this is an important step in driving protein synthesis. PMID:21606179

  14. Structure of a mitochondrial ribosome with minimal RNA

    Sharma, Manjuli R.; Booth, Timothy M.; Simpson, Larry; Maslov, Dmitri A.; Agrawal, Rajendra K.

    2009-01-01

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show th...

  15. Single-particle cryoEM analysis at near-atomic resolution from several thousand asymmetric subunits.

    Passos, Dario Oliveira; Lyumkis, Dmitry

    2015-11-01

    A single-particle cryoEM reconstruction of the large ribosomal subunit from Saccharomyces cerevisiae was obtained from a dataset of ∼75,000 particles. The gold-standard and frequency-limited approaches to single-particle refinement were each independently used to determine orientation parameters for the final reconstruction. Both approaches showed similar resolution curves and nominal resolution values for the 60S dataset, estimated at 2.9 Å. The amount of over-fitting present during frequency-limited refinement was quantitatively analyzed using the high-resolution phase-randomization test, and the results showed no apparent over-fitting. The number of asymmetric subunits required to reach specific resolutions was subsequently analyzed by refining subsets of the data in an ab initio manner. With our data collection and processing strategies, sub-nanometer resolution was obtained with ∼200 asymmetric subunits (or, equivalently for the ribosomal subunit, particles). Resolutions of 5.6 Å, 4.5 Å, and 3.8 Å were reached with ∼1000, ∼1600, and ∼5000 asymmetric subunits, respectively. At these resolutions, one would expect to detect alpha-helical pitch, separation of beta-strands, and separation of Cα atoms, respectively. Using this map, together with strategies for ab initio model building and model refinement, we built a region of the ribosomal protein eL6, which was missing in previous models of the yeast ribosome. The relevance for more routine high-resolution structure determination is discussed. PMID:26470814

  16. A-Raf kinase is a new interacting partner of protein kinase CK2 beta subunit

    Boldyreff, B; Issinger, O G

    1997-01-01

    In a search for protein kinase CK2 beta subunit binding proteins using the two-hybrid system, more than 1000 positive clones were isolated. Beside clones for the alpha' and beta subunit of CK2, there were clones coding for a so far unknown protein, whose partial cDNA sequence was already deposited...... in the EMBL database under the accession numbers R08806 and Z17360, for the ribosomal protein L5 and for A-Raf kinase. All isolated clones except the one for CK2 beta showed no interaction with the catalytic alpha subunit of CK2. A-Raf kinase is a new interesting partner of CK2 beta. The isolated A...

  17. Ribosome-dependent activation of stringent control.

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V

    2016-06-01

    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  18. Nucleolar dominance and ribosomal RNA gene silencing

    Tucker, Sarah; Vitins, Alexa; Pikaard, Craig S.

    2010-01-01

    Nucleolar dominance is an epigenetic phenomenon that occurs in genetic hybrids and describes the expression of 45S rRNA genes inherited from one progenitor due to the silencing of the other progenitor’s rRNA genes. Nucleolar dominance is a manifestation of rRNA gene dosage control, which also occurs in non-hybrids, regulating the number of active rRNA genes according to the cellular demand for ribosomes and protein synthesis. Ribosomal RNA gene silencing involves changes in DNA methylation an...

  19. Control of Ribosome Synthesis in Escherichia coli

    Molin, Søren; Meyenburg, K. von; Måløe, O.;

    1977-01-01

    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha}-methylgluc......The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...

  20. The role of human ribosomal proteins in the maturation of rRNA and ribosome production

    Robledo, Sara; Rachel A Idol; Crimmins, Dan L.; Ladenson, Jack H.; Mason, Philip J.; Bessler, Monica

    2008-01-01

    Production of ribosomes is a fundamental process that occurs in all dividing cells. It is a complex process consisting of the coordinated synthesis and assembly of four ribosomal RNAs (rRNA) with about 80 ribosomal proteins (r-proteins) involving more than 150 nonribosomal proteins and other factors. Diamond Blackfan anemia (DBA) is an inherited red cell aplasia caused by mutations in one of several r-proteins. How defects in r-proteins, essential for proliferation in all cells, lead to a hum...

  1. Interaction of factor XIII subunits.

    Katona, Eva; Pénzes, Krisztina; Csapó, Andrea; Fazakas, Ferenc; Udvardy, Miklós L; Bagoly, Zsuzsa; Orosz, Zsuzsanna Z; Muszbek, László

    2014-03-13

    Coagulation factor XIII (FXIII) is a heterotetramer consisting of 2 catalytic A subunits (FXIII-A2) and 2 protective/inhibitory B subunits (FXIII-B2). FXIII-B, a mosaic protein consisting of 10 sushi domains, significantly prolongs the lifespan of catalytic subunits in the circulation and prevents their slow progressive activation in plasmatic conditions. In this study, the biochemistry of the interaction between the 2 FXIII subunits was investigated. Using a surface plasmon resonance technique and an enzyme-linked immunosorbent assay-type binding assay, the equilibrium dissociation constant (Kd) for the interaction was established in the range of 10(-10) M. Based on the measured Kd, it was calculated that in plasma approximately 1% of FXIII-A2 should be in free form. This value was confirmed experimentally by measuring FXIII-A2 in plasma samples immunodepleted of FXIII-A2B2. Free plasma FXIII-A2 is functionally active, and when activated by thrombin and Ca(2+), it can cross-link fibrin. In cerebrospinal fluid and tears with much lower FXIII subunit concentrations, >80% of FXIII-A2 existed in free form. A monoclonal anti-FXIII-B antibody that prevented the interaction between the 2 subunits reacted with the recombinant combined first and second sushi domains of FXIII-B, and its epitope was localized to the peptide spanning positions 96 to 103 in the second sushi domain. PMID:24408323

  2. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress.

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L J

    2016-01-01

    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucleolar morphology. Remarkably, we find that uL5 (formerly RPL11) and uL18 (RPL5) are the strongest contributors to nucleolar integrity. Together with the 5S rRNA, they form the late-assembling central protuberance on mature 60S subunits, and act as an Hdm2 trap and p53 stabilizer. Other major contributors to p53 homeostasis are also strictly late-assembling large subunit r-proteins essential to nucleolar structure. The identification of the r-proteins that specifically contribute to maintaining nucleolar structure and p53 steady-state level provides insights into fundamental aspects of cell and cancer biology. PMID:27265389

  3. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L. J.

    2016-01-01

    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucleolar morphology. Remarkably, we find that uL5 (formerly RPL11) and uL18 (RPL5) are the strongest contributors to nucleolar integrity. Together with the 5S rRNA, they form the late-assembling central protuberance on mature 60S subunits, and act as an Hdm2 trap and p53 stabilizer. Other major contributors to p53 homeostasis are also strictly late-assembling large subunit r-proteins essential to nucleolar structure. The identification of the r-proteins that specifically contribute to maintaining nucleolar structure and p53 steady-state level provides insights into fundamental aspects of cell and cancer biology. PMID:27265389

  4. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  5. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-01-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  6. Variability in ribosomal DNA genic and spacer regions in Verticillium dahliae isolates from different hosts

    Otero Laura

    2004-01-01

    Full Text Available Using PCR-based assays with specific primers for amplification of the ribosomal DNA intergenic spacer region (IGS and a portion of the mitochondrial DNA small subunit ribosomal RNA gene (mtDNA SSU rRNA, the genetic variability among Verticillium dahliae isolates from olive (Olea europaea and other host species from Argentina and Brazil was estimated. The derived UPGMA-generated phenograms based upon the restriction fingerprinting data of rDNA IGS products revealed genetic differences, correlating with the host of origin. Isolates infecting olive genetically distinct from those from cocoa (Theobroma cacao and sunflower (Helianthus annuus. Digestion of mitochondrial DNA SSU rRNA PCR products revealed less variability, distinguishing only one isolate from sunflower. Ribosomal DNA ITS restriction patterns were identical for all isolates of V. dahliae, irrespective of host of origin. These preliminary results may have relevance for Verticillium wilt control practices, possibly reflecting a different evolutionary origin, or reproductive isolation of the pathogen in olive, distinct from populations of other hosts.

  7. Dynamics of ribosome scanning and recycling revealed by translation complex profiling.

    Archer, Stuart K; Shirokikh, Nikolay E; Beilharz, Traude H; Preiss, Thomas

    2016-07-28

    Regulation of messenger RNA translation is central to eukaryotic gene expression control. Regulatory inputs are specified by them RNA untranslated regions (UTRs) and often target translation initiation. Initiation involves binding of the 40S ribosomal small subunit (SSU) and associated eukaryotic initiation factors (eIFs)near the mRNA 5′ cap; the SSU then scans in the 3′ direction until it detects the start codon and is joined by the 60S ribosomal large subunit (LSU) to form the 80S ribosome. Scanning and other dynamic aspects of the initiation model have remained as conjectures because methods to trap early intermediates were lacking. Here we uncover the dynamics of the complete translation cycle in live yeast cells using translation complex profile sequencing (TCP-seq), a method developed from the ribosome profiling approach. We document scanning by observing SSU footprints along 5′ UTRs. Scanning SSU have 5′-extended footprints (up to~75 nucleotides), indicative of additional interactions with mRNA emerging from the exit channel, promoting forward movement. We visualized changes in initiation complex conformation as SSU footprints coalesced into three major sizes at start codons (19, 29 and 37 nucleotides). These share the same 5′ start site but differ at the 3′ end, reflecting successive changes at the entry channel from an open to a closed state following start codon recognition. We also observe SSU 'lingering' at stop codons after LSU departure. Our results underpin mechanistic models of translation initiation and termination, built on decades of biochemical and structural investigation, with direct genome-wide in vivo evidence. Our approach captures ribosomal complexes at all phases of translation and will aid in studying translation dynamics in diverse cellular contexts. Dysregulation of translation is common in disease and, for example, SSU scanning is a target of anti-cancer drug development. TCP-seq will prove useful in discerning differences

  8. Function and structure in phage Qbeta RNA replicase. Association of EF-Tu-Ts with the other enzyme subunits

    Blumenthal, T; Young, R A; Brown, S

    1976-01-01

    Qbeta replicase is a complex of four nonidentical subunits readily dissociable into two subcomplexes: 30 S ribosomal protein S1 and the phage-coded polypeptide (Subunits I + II) and protein synthesis elongation factors EF-Tu and EF-Ts (Subunits III + IV). The affinity of the two subcomplexes for...... of EF-Tu-Ts from the other enzyme subunits: whereas free EF-Tu-Ts binds GDP independently of salt concentration, this binding by Qbeta replicase is sensitive to high ionic strength and remains so in the presence of Qbeta RNA. Furthermore, RNA does not allow the release of EF-Ts from EF-Tu by GTP as...... measured by sensitivity of EF-Ts activity to N-ethylmaleimide....

  9. Molecular paleontology: a biochemical model of the ancestral ribosome

    Hsiao, Chiaolong; Lenz, Timothy K.; Peters, Jessica K; Fang, Po-Yu; Schneider, Dana M.; Anderson, Eric J.; Preeprem, Thanawadee; Bowman, Jessica C.; O'Neill, Eric B.; Lie, Lively; Athavale, Shreyas S.; Gossett, J. Jared; Trippe, Catherine; Murray, Jason; Anton S. Petrov

    2013-01-01

    Ancient components of the ribosome, inferred from a consensus of previous work, were constructed in silico, in vitro and in vivo. The resulting model of the ancestral ribosome presented here incorporates ∼20% of the extant 23S rRNA and fragments of five ribosomal proteins. We test hypotheses that ancestral rRNA can: (i) assume canonical 23S rRNA-like secondary structure, (ii) assume canonical tertiary structure and (iii) form native complexes with ribosomal protein fragments. Footprinting exp...

  10. Control of Ribosome Synthesis in Escherichia coli

    Molin, Søren; Meyenburg, K. von; Måløe, O.; Trier Hansen, M.; Pato, M. L.

    1977-01-01

    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...

  11. Ribosome evolution: Emergence of peptide synthesis machinery

    Koji Tamura

    2011-12-01

    Proteins, the main players in current biological systems, are produced on ribosomes by sequential amide bond (peptide bond) formations between amino-acid-bearing tRNAs. The ribosome is an exquisite super-complex of RNA-proteins, containing more than 50 proteins and at least 3 kinds of RNAs. The combination of a variety of side chains of amino acids (typically 20 kinds with some exceptions) confers proteins with extraordinary structure and functions. The origin of peptide bond formation and the ribosome is crucial to the understanding of life itself. In this article, a possible evolutionary pathway to peptide bond formation machinery (proto-ribosome) will be discussed, with a special focus on the RNA minihelix (primordial form of modern tRNA) as a starting molecule. Combining the present data with recent experimental data, we can infer that the peptidyl transferase center (PTC) evolved from a primitive system in the RNA world comprising tRNA-like molecules formed by duplication of minihelix-like small RNA.

  12. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Background Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role...

  13. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly.

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers-termed here escortins-to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. PMID:25144938

  14. Thermodynamic analysis reveals that GTP binding affects the interaction between the α- and γ-subunits of translation initiation factor 2

    Eukaryotic and archaeal translation initiation factors 2, heterotrimers that consist of α-, β-, and γ-subunits, deliver methionylated initiator tRNA to a small ribosomal subunit in a manner that depends on GTP. To evaluate correlation of the function and association of the subunits, we used isothermal titration calorimetry to analyze the thermodynamics of the interactions between the α- and γ-subunits in the presence or absence of a nonhydrolyzable GTP analog or GDP. The α-subunits bound to the γ-subunit with large heat capacity change (ΔCp) values. The ΔH and ΔCp values for the interaction between the α- and γ-subunits varied in the presence of the GTP analog but not in the presence of GDP. These results suggest that the binding of both the α-subunit and GTP changes the conformation of the switch region of the γ-subunit and increases the affinity of the γ-subunit for tRNA

  15. Comparison of phosphorylation of ribosomal proteins from HeLa and Krebs II ascites-tumour cells by cyclic AMP-dependent and cyclic GMP-dependent protein kinases

    Issinger, O G; Beier, H; Speichermann, N; Flokerzi, V; Hofmann, F

    1980-01-01

    Phosphorylation of eukaryotic ribosomal proteins in vitro by essentially homogeneous preparations of cyclic AMP-dependent protein kinase catalytic subunit and cyclic GMP-dependent protein kinase was compared. Each protein kinase was added at a concentration of 30nM. Ribosomal proteins were...... cyclic AMP-dependent enzyme. Between 0.1 and 0.2 mol of phosphate was incorporated/mol of these phosphorylated proteins. With the exception of protein S7, the same proteins were also major substrates for the cyclic GMP-dependent protein kinase. Time courses of the phosphorylation of individual proteins...... from the small and large ribosomal subunits in the presence of either protein kinase suggested four types of phosphorylation reactions: (1) proteins S2, S10 and L5 were preferably phosphorylated by the cyclic GMP-dependent protein kinase; (2) proteins S3 and L6 were phosphorylated at very similar rates...

  16. Requirement for SAPK-JNK signaling in the induction of apoptosis by ribosomal stress in REH lymphoid leukemia cells.

    Johnson, C R; Jiffar, T; Fischer, U M; Ruvolo, P P; Jarvis, W D

    2003-11-01

    The present studies examined performance of SAPK cascades and apoptotic commitment following ribosomal trauma in REH lymphoid leukemia cells. Ribostatic insults included disruption of ribosomal activity by mechanistically dissimilar agents such as blasticidin-S (BCS) (which binds 28S-rRNA to block peptidyl bond formation), kasugamycin (KSM) (which binds 18S-rRNA to prevent translational initiation), and cycloheximide (CHX) (which blocks A-site to P-site translocation of peptidyl-tRNA). Exposure of REH cells to BCS elicited DNA degradation and apoptotic cytolysis. BCS stimulated JNK1/JNK2 and p38, and their shared targets c-Jun and ATF2. Inhibition of JNK1/JNK2 (but not of p38) antagonized blasticidin-induced apoptosis, whereas targeting alternative ribosomal sites with KSM or CHX limited translation, but failed to activate the SAPK cascade or initiate apoptosis. Our findings indicate that interference with 28S-rRNA by BCS initiates apoptosis in REH cells through recruitment of SAPK-JNK signaling. Disparities between the lethal actions of BCS, KSM, and CHX appear to reflect established differences in the subribosomal targets of these agents. We propose that the SAPK cascade comprises an essential mechanism for the transduction of specific lethal stress signals emanating from active ribosomes, and that interference with the 28S-rRNA, rather than the peptidyl transfer center of the large subunit, is critical to apoptotic commitment. PMID:12970763

  17. Differential phosphorylation of ribosomal acidic proteins from yeast cell by two endogenous protein kinases: casein kinase-2 and 60S kinase

    The native 80S ribosomes isolated from ''Saccharomyces cerevisiae'' (strain W303) cells was phosphorylated by two endogenous protein kinases: multifunctional casein kinase-2 (CK-2) and specific 60S kinase. Three acidic proteins within the 60S ribosomal subunit: YP1β, YP1β' and YP2α are phosphorylated by both kinases. The other two proteins: YP1α and YP2β are predominantly phosphorylated by CK-2 but not by 60S kinase. This was confirmed in the experiment with the recombinant protein, YP2β, as a substrate, which is practically not phosphorylated by specific 60S kinase. These results together with the previous data based on the target amino-acid sequences suggest that, in addition to the multifunctional casein kinase-2 and specific 60S kinase, there exist probably other protein kinase(s) which phosphorylate the ribosomal acidic proteins in the cell. (author). 23 refs, 3 figs, 1 tab

  18. Identification of Trichosporon spp. Strains by Sequencing D1/D2 Region and Sub-typing by Sequencing Ribosomal Intergenic Spacer Region of Ribosomal DNA

    Jingsi ZENG; Cristina Maria de Souza Motta; Kazutaka Fukushima; Kayoko Takizawa; Oliane Maria Correia Magalhes; Rejane Pereira Neves; Kazuko Nishimura

    2009-01-01

    To re-identify and further group 25 isolates of Trichosporon spp. identified morphologically previously, sequences of D1/D2 region of large subunit (LSU) of ribosomal DNA (rDNA) of 25 tested strains for identification and those of ribosomal intergenic space 1 (IGS1) region of 11 strains for sub-grouping were detected. The identifications of tested strains were changed except 6 strains. According to the alignment of the IGS1 region, 6 T. asahii isolates tested fell into 4 groups and 5 T. faecale isolates into 3 groups. Polymorphism of 2 T.japonicum isolates was found in 10 positions. With the alignments obtained in this research compared with the relative GenBank entries, it was found that T. asahii, T.faecale and T.japonicum species were divided into 7, 3 and 2 subtypes respectively. Morphological and biophysical methods are not sufficient for Trichosporon spp. identification. Sequencing becomes neces-sary for Trichosporon diagnosis. There is obvious diversity within a species.

  19. Neurodegeneration-associated instability of ribosomal DNA

    Hallgren, Justin; Pietrzak, Maciej; Rempala, Grzegorz; Nelson, Peter T.; Hetman, Michal

    2014-01-01

    Homologous recombination (HR)-mediated instability of the repetitively organized ribosomal DNA (rDNA) has been proposed as a mediator of cell senescence in yeast triggering the DNA damage response. High individual variability in the content of human rDNA suggests that this genomic region remained relatively unstable throughout evolution. Therefore, quantitative real time PCR was used to determine the genomic content of rDNA in post mortem samples of parietal cortex from 14 young- and 9 elderl...

  20. Ribosome Inactivating Proteins from Plants Inhibiting Viruses

    Inderdeep Kaur; R C Gupta; Munish Puri

    2011-01-01

    Many plants contain ribosome inactivating proteins (RIPs) with N-glycosidase activity,which depurinate large ribosomal RNA and arrest protein synthesis.RIPs so far tested inhibit replication of mRNA as well as DNA viruses and these proteins,isolated from plants,are found to be effective against a broad range of viruses such as human immunodeficiency virus (HIV),hepatitis B virus (HBV) and herpes simplex virus (HSV).Most of the research work related to RIPs has been focused on antiviral activity against HIV; however,the exact mechanism of antiviral activity is still not clear.The mechanism of antiviral activity was thought to follow inactivation of the host cell ribosome,leading to inhibition of viral protein translation and host cell death.Enzymatic activity of RIPs is not hmited to depurination of the large rRNA,in addition they can depurinate viral DNA as well as RNA.Recently,Phase Ⅰ/Ⅱ clinical trials have demonstrated the potential use of RIPs for treating patients with HIV disease.The aim of this review is to focus on various RIPs from plants associated with anti-HIV activity.

  1. Nomenclature for Ion channel Subunits

    Bradley, Jonathan; Frings, Stephan; Yau, King-Wai; Reed, Randall

    2001-01-01

    Presents the nomenclature for ion channel subunits. Role of ion channels in the mediation of visual and olfactory signal transduction; Expression of ion channels in cell types and tissues; Assessment on the nucleotide sensitivity, ion conductance and calcium modulation in heteromers.

  2. Structure of a mitochondrial ribosome with minimal RNA.

    Sharma, Manjuli R; Booth, Timothy M; Simpson, Larry; Maslov, Dmitri A; Agrawal, Rajendra K

    2009-06-16

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show that (i) the overall structure of the Lmr is considerably more porous, (ii) the topology of the intersubunit space is significantly different, with fewer intersubunit bridges, but more tunnels, and (iii) several of the functionally-important rRNA regions, including the alpha-sarcin-ricin loop, have different relative positions within the structure. Furthermore, the major portions of the mRNA channel, the tRNA passage, and the nascent polypeptide exit tunnel contain Lmr-specific proteins, suggesting that the mechanisms for mRNA recruitment, tRNA interaction, and exiting of the nascent polypeptide in Lmr must differ markedly from the mechanisms deduced for ribosomes in other organisms. Our study identifies certain structural features that are characteristic solely of mitochondrial ribosomes and other features that are characteristic of both mitochondrial and chloroplast ribosomes (i.e., organellar ribosomes). PMID:19497863

  3. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis

    Cole, J. R.; Chai, B.; Farris, R. J.; Wang, Q; Kulam, S. A.; McGarrell, D. M.; Garrity, G M; Tiedje, J M

    2004-01-01

    The Ribosomal Database Project (RDP-II) provides the research community with aligned and annotated rRNA gene sequences, along with analysis services and a phylogenetically consistent taxonomic framework for these data. Updated monthly, these services are made available through the RDP-II website (http://rdp.cme.msu.edu/). RDP-II release 9.21 (August 2004) contains 101 632 bacterial small subunit rRNA gene sequences in aligned and annotated format. High-throughput tools for initial taxonomic p...

  4. Cloning and expression of a cDNA encoding ribosomal protein S4 from Rice (Oryza sativa)

    2000-01-01

    A cDNA clone, pS4, has been isolated from a cDNA library prepared from rice anthers of about 1.0 mm in length. DNA sequence analysis and database search show that the cDNA encodes a protein which is highly homologous to eukaryotic 80S ribosomal protein subunit 4 (S4). Northern hybridization indicates that this gene expresses in all tissues analyzed although the expression level varies and it cannot be induced by mechanical wounding in leaves. Southern blot analysis demonstrates that this rice S4 gene is from a multigene family.

  5. Interference with phage lambda development by the small subunit of the phage 21 terminase, gp1.

    Johnson, G.,; Widner, W; Xin, W N; Feiss, M

    1991-01-01

    Bacteriophage lambda development is blocked in cells carrying a plasmid that expresses the terminase genes of phage 21. The interference is caused by the small subunit of phage 21 terminase, gp1. Mutants of lambda able to form plaques in the presence of gp1 include sti mutants. One such mutation, sti30, is an A. T-to-G.C transition mutation at base pair 184 on the lambda chromosome. The sti30 mutation extends the length of the ribosome-binding sequence of the Nul gene that is complementary to...

  6. Characterization of fimbrial subunits from Bordetella species

    Mooi, F.R.; Heide, H.G.J. van der; Avest, A.R. ter; Welinder, K.G.; Livey, I.; Zeijst, B.A.M. van der; Gaastra, W.

    1987-01-01

    Using antisera raised against serotype 2 and 3 fimbrial subunits from Bordetella pertussis, serologically related polypeptides were detected in Bordetella bronchiseptica, Bordetella parapertussis and Bordetella avium strains. The two B. pertussis fimbrial subunits, and three of the serologically rel

  7. The beta subunit of casein kinase II

    Boldyreff, B; Piontek, K; Schmidt-Spaniol, I; Issinger, O G

    1991-01-01

    cDNAs encoding the beta subunit of pig and mouse CKII were isolated. The porcine cDNA was expressed as a fusion protein in Escherichia coli and used for the production of anti-CKII-beta subunit specific antibodies.......cDNAs encoding the beta subunit of pig and mouse CKII were isolated. The porcine cDNA was expressed as a fusion protein in Escherichia coli and used for the production of anti-CKII-beta subunit specific antibodies....

  8. Nanometer scale pores similar in size to the entrance of the ribosomal exit cavity are a common feature of large RNAs

    Rivas, Mario; Tran, Quyen; Fox, George E.

    2013-01-01

    The highly conserved peptidyl transferase center (PTC) of the ribosome contains an RNA pore that serves as the entrance to the exit tunnel. Analysis of available ribosome crystal structures has revealed the presence of multiple additional well-defined pores of comparable size in the ribosomal (rRNA) RNAs. These typically have dimensions of 1–2 nm, with a total area of ∼100 Å2 or more, and most are associated with one or more ribosomal proteins. The PTC example and the other rRNA pores result from the packing of helices. However, in the non-PTC cases the nitrogenous bases do not protrude into the pore, thereby limiting the potential for hydrogen bonding within the pore. Instead, it is the RNA backbone that largely defines the pore likely resulting in a negatively charged environment. In many but not all cases, ribosomal proteins are associated with the pores to a greater or lesser extent. With the exception of the PTC case, the large subunit pores are not found in what are thought to be the evolutionarily oldest regions of the 23S rRNA. The unusual nature of the PTC pore may reflect a history of being created by hybridization between two or more RNAs early in evolution rather than simple folding of a single RNA. An initial survey of nonribosomal RNA crystal structures revealed additional pores, thereby showing that they are likely a general feature of RNA tertiary structure. PMID:23940386

  9. eIF3 Peripheral Subunits Rearrangement after mRNA Binding and Start-Codon Recognition.

    Simonetti, Angelita; Brito Querido, Jailson; Myasnikov, Alexander G; Mancera-Martinez, Eder; Renaud, Adeline; Kuhn, Lauriane; Hashem, Yaser

    2016-07-21

    mRNA translation initiation in eukaryotes requires the cooperation of a dozen eukaryotic initiation factors (eIFs) forming several complexes, which leads to mRNA attachment to the small ribosomal 40S subunit, mRNA scanning for start codon, and accommodation of initiator tRNA at the 40S P site. eIF3, composed of 13 subunits, 8 core (a, c, e, f, h, l, k, and m) and 5 peripheral (b, d, g, i, and j), plays a central role during this process. Here we report a cryo-electron microscopy structure of a mammalian 48S initiation complex at 5.8 Å resolution. It shows the relocation of subunits eIF3i and eIF3g to the 40S intersubunit face on the GTPase binding site, at a late stage in initiation. On the basis of a previous study, we demonstrate the relocation of eIF3b to the 40S intersubunit face, binding below the eIF2-Met-tRNAi(Met) ternary complex upon mRNA attachment. Our analysis reveals the deep rearrangement of eIF3 and unravels the molecular mechanism underlying eIF3 function in mRNA scanning and timing of ribosomal subunit joining. PMID:27373335

  10. Horizontal gene transfer of zinc and non-zinc forms of bacterial ribosomal protein S4

    Luthey-Schulten Zaida

    2009-07-01

    Full Text Available Abstract Background The universal ribosomal protein S4 is essential for the initiation of small subunit ribosomal assembly and translational accuracy. Being part of the information processing machinery of the cell, the gene for S4 is generally thought of as being inherited vertically and has been used in concatenated gene phylogenies. Here we report the evolution of ribosomal protein S4 in relation to a broad sharing of zinc/non-zinc forms of the gene and study the scope of horizontal gene transfer (HGT of S4 during bacterial evolution. Results In this study we present the complex evolutionary history of ribosomal protein S4 using 660 bacterial genomes from 16 major bacterial phyla. According to conserved characteristics in the sequences, S4 can be classified into C+ (zinc-binding and C- (zinc-free variants, with 26 genomes (mainly from the class Clostridia containing genes for both. A maximum likelihood phylogenetic tree of the S4 sequences was incongruent with the standard bacterial phylogeny, indicating a departure from strict vertical inheritance. Further analysis using the genome content near the S4 genes, which are usually located in a conserved gene cluster, showed not only that HGT of the C- gene had occurred at various stages of bacterial evolution, but also that both the C- and C+ genes were present before the individual phyla diverged. To explain the latter, we theorize that a gene pool existed early in bacterial evolution from which bacteria could sample S4 gene variants, according to environmental conditions. The distribution of the C+/- variants for seven other zinc-binding ribosomal proteins in these 660 bacterial genomes is consistent with that seen for S4 and may shed light on the evolutionary pressures involved. Conclusion The complex history presented for "core" protein S4 suggests the existence of a gene pool before the emergence of bacterial lineages and reflects the pervasive nature of HGT in subsequent bacterial evolution

  11. Molecular Profiling of Activated Neurons by Phosphorylated Ribosome Capture

    Knight, Zachary A.; Tan, Keith; Birsoy, Kivanc; Schmidt, Sarah; Garrison, Jennifer L.; Wysocki, Robert W.; Emiliano, Ana; Ekstrand, Mats I.; Friedman, Jeffrey M.

    2012-01-01

    The mammalian brain is composed of thousands of interacting neural cell types. Systematic approaches to establish the molecular identity of functional populations of neurons would advance our understanding of neural mechanisms controlling behavior. Here, we show that ribosomal protein S6, a structural component of the ribosome, becomes phosphorylated in neurons activated by a wide range of stimuli. We show that these phosphorylated ribosomes can be captured from mouse brain homogenates, there...

  12. Structural and functional topography of the human ribosome

    Dmitri Graifer; Galina Karpova

    2012-01-01

    This review covers data on the structural organization of functional sites in the human ribosome,namely,the messenger RNA binding center,the binding site of the hepatitis C virus RNA internal ribosome entry site,and the peptidyl transferase center.The data summarized here have been obtained primarily by means of a site-directed crosslinking approach with application of the analogs of the respective ribosomal ligands bearing cross-linkers at the designed positions.These data are discussed taking into consideration available structural data on ribosomes from various kingdoms obtained with the use of cryo-electron microscopy,X-ray crystallography,and other approaches.

  13. The architecture of mammalian ribosomal protein promoters

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  14. Ribosome-Inactivating and Related Proteins

    Joachim Schrot; Alexander Weng; Matthias F. Melzig

    2015-01-01

    Ribosome-inactivating proteins (RIPs) are toxins that act as N-glycosidases (EC 3.2.2.22). They are mainly produced by plants and classified as type 1 RIPs and type 2 RIPs. There are also RIPs and RIP related proteins that cannot be grouped into the classical type 1 and type 2 RIPs because of their different sizes, structures or functions. In addition, there is still not a uniform nomenclature or classification existing for RIPs. In this review, we give the current status of all known plant ...

  15. Molecular dynamics simulation of ribosome jam

    Matsumoto, Shigenori

    2011-09-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.

  16. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  17. Functional Characterization of the Role of the N-terminal Domain of the c/Nip1 Subunit of Eukaryotic Initiation Factor 3 (eIF3) in AUG Recognition

    Karásková, Martina; Gunišová, Stanislava; Herrmannová, Anna; Wagner, Susan; Munzarová, Vanda; Valášek, Leoš

    2012-01-01

    Roč. 287, č. 34 (2012), s. 28420-28434. ISSN 0021-9258 R&D Projects: GA ČR GAP305/10/0335 Institutional support: RVO:61388971 Keywords : START CODON SELECTION * 40S RIBOSOMAL-SUBUNIT * GCN4 TRANSLATIONAL CONTROL Subject RIV: CE - Biochemistry Impact factor: 4.651, year: 2012

  18. The effect of trichloroethylene and acrylonitrile on RNA and ribosome synthesis and ribosome content in Saccharomyces cells.

    Lochmann, E R; Ehrlich, W; Mangir, M

    1984-04-01

    The effects of trichloroethylene (TCE) and acrylonitrile (ACN) on growth, RNA synthesis, ribosome synthesis, and ribosome content were tested in yeast cells. TCE causes a delay of the growth of a cell culture (prolongation of the lag phase), but does not cause inhibition. Cells exposed to increasing concentrations of ACN show increasing damage, so that, at a certain point of the growth curve, cell division stops altogether. Similar results were obtained when RNA synthesis was investigated: After treatment with TCE, the maximum RNA synthesis of the cell culture was retarded, but subsequently reached the same level as the untreated control cells. In the presence of ACN, however, the rate of RNA synthesis was lowered with increasing ACN concentrations. The same effect was observed upon investigation of ribosome synthesis: Whereas TCE produces only a slight effect, treatment with increasing concentrations of ACN leads to a substantial decrease in ribosome synthesis, and finally to total inhibition. Parallel to this, the content of free and membrane-bound ribosomes is diminished. Obviously, the decrease in ribosome content is caused not only by an inhibition of ribosome synthesis, but also by a degradation of existing ribosomes, as well as by induction of a ribosome-associated RNase. PMID:6714140

  19. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs

  20. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    Nichols, C. E. [Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom); Johnson, C.; Lamb, H. K. [Institute of Cell and Molecular Biosciences, Catherine Cookson Building, Medical School, Framlington Place, Newcastle University, Newcastle-upon-Tyne NE2 4HH (United Kingdom); Lockyer, M. [Arrow Therapeutics Ltd, Britannia House, Trinity Street, Borough, London SE1 1DA (United Kingdom); Charles, I. G. [The Wolfson Institute for Biomedical Research, The Cruciform Building, University College London, Gower Street, London WC1E 6BT (United Kingdom); Hawkins, A. R. [Institute of Cell and Molecular Biosciences, Catherine Cookson Building, Medical School, Framlington Place, Newcastle University, Newcastle-upon-Tyne NE2 4HH (United Kingdom); Stammers, D. K., E-mail: daves@strubi.ox.ac.uk [Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom)

    2007-11-01

    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs.

  1. IRESPred: Web Server for Prediction of Cellular and Viral Internal Ribosome Entry Site (IRES).

    Kolekar, Pandurang; Pataskar, Abhijeet; Kulkarni-Kale, Urmila; Pal, Jayanta; Kulkarni, Abhijeet

    2016-01-01

    Cellular mRNAs are predominantly translated in a cap-dependent manner. However, some viral and a subset of cellular mRNAs initiate their translation in a cap-independent manner. This requires presence of a structured RNA element, known as, Internal Ribosome Entry Site (IRES) in their 5' untranslated regions (UTRs). Experimental demonstration of IRES in UTR remains a challenging task. Computational prediction of IRES merely based on sequence and structure conservation is also difficult, particularly for cellular IRES. A web server, IRESPred is developed for prediction of both viral and cellular IRES using Support Vector Machine (SVM). The predictive model was built using 35 features that are based on sequence and structural properties of UTRs and the probabilities of interactions between UTR and small subunit ribosomal proteins (SSRPs). The model was found to have 75.51% accuracy, 75.75% sensitivity, 75.25% specificity, 75.75% precision and Matthews Correlation Coefficient (MCC) of 0.51 in blind testing. IRESPred was found to perform better than the only available viral IRES prediction server, VIPS. The IRESPred server is freely available at http://bioinfo.net.in/IRESPred/. PMID:27264539

  2. Dynamic evolution process of multilayer core-shell microstructures within containerlessly solidifying F e50S n50 immiscible alloy

    Wang, W. L.; Wu, Y. H.; Li, L. H.; Geng, D. L.; Wei, B.

    2016-03-01

    Multilayer core-shell structures are frequently formed in polymers and alloys when temperature and concentration fields are well symmetrical spatially. Here we report that two- to five-layer core-shell microstructures were the dominant structural morphology of a binary F e50S n50 immiscible alloy solidified under the containerless and microgravity states within a drop tube. Three dimensional phase field simulation reveals that both the uniformly dispersive structure and the multilayer core-shells are the various metastable and transitional states of the liquid phase separation process. Only the two-layer core-shell is the most stable microstructure with the lowest chemical potential. Because of the suppression of Stokes motion, solutal Marangoni migration becomes important to drive the evolution of core-shell structures.

  3. Regulating the Ribosome: A Spotlight on RNA Dark Matter

    Lintner, Nathanael G.; Cate, Jamie H. D.

    2014-01-01

    In this issue Pircher et al.(2014) show that an abundant ribosome-associated 18-nt noncoding RNA (ncRNA),derived from the open reading frame of an mRNA,acts directly on the ribosome and regulates global translation levels in response to hypertonic shock.

  4. Translation with frameshifting of ribosome along mRNA transcript

    Li, Jingwei

    2015-01-01

    Translation is an important process for prokaryotic and eukaryotic cells to produce necessary proteins for cell growth. Numerious experiments have been performed to explore the translational properties. Diverse models have also been developed to determine the biochemical mechanism of translation. However, to simplify the majority of the existing models, the frameshifting of ribosome along the mRNA transcript is neglected, which actually occurs in real cells and has been extensively experimentally studied. The frameshifting of ribosome evidently influences the efficiency and speed of translation, considering that the peptide chains synthesized by shifted ribosomes will not fold into functional proteins and will degrade rapidly. In this study, a theoretical model is presented to describe the translational process based on the model for totally asymmetric simple exclusion process. In this model, the frameshifting of the ribosome along the mRNA transcript and the attachment/detachment of the ribosome to/from the ...

  5. Regulation of ribosome biogenesis in maize embryonic axes during germination.

    Villa-Hernández, J M; Dinkova, T D; Aguilar-Caballero, R; Rivera-Cabrera, F; Sánchez de Jiménez, E; Pérez-Flores, L J

    2013-10-01

    Ribosome biogenesis is a pre-requisite for cell growth and proliferation; it is however, a highly regulated process that consumes a great quantity of energy. It requires the coordinated production of rRNA, ribosomal proteins and non-ribosomal factors which participate in the processing and mobilization of the new ribosomes. Ribosome biogenesis has been studied in yeast and animals; however, there is little information about this process in plants. The objective of the present work was to study ribosome biogenesis in maize seeds during germination, a stage characterized for its fast growth, and the effect of insulin in this process. Insulin has been reported to accelerate germination and to induce seedling growth. It was observed that among the first events reactivated just after 3 h of imbibition are the rDNA transcription and the pre-rRNA processing and that insulin stimulates both of them (40-230%). The transcript of nucleolin, a protein which regulates rDNA transcription and pre-rRNA processing, is among the messages stored in quiescent dry seeds and it is mobilized into the polysomal fraction during the first hours of imbibition (6 h). In contrast, de novo ribosomal protein synthesis was low during the first hours of imbibition (3 and 6 h) increasing by 60 times in later stages (24 h). Insulin increased this synthesis (75%) at 24 h of imbibition; however, not all ribosomal proteins were similarly regulated. In this regard, an increase in RPS6 and RPL7 protein levels was observed, whereas RPL3 protein levels did not change even though its transcription was induced. Results show that ribosome biogenesis in the first stages of imbibition is carried out with newly synthesized rRNA and ribosomal proteins translated from stored mRNA. PMID:23806421

  6. Cloning, periplasmic expression, purification and structural characterization of human ribosomal protein L10

    The ribosomal protein L10 (RP L10) is a strong candidate to be included in the class of tumor suppressor proteins. This protein, also denominated as QM, is known to participate in the binding of ribosomal subunits 60S and 40S and the translation of mRNAs. It has a molecular weight that varies between 24 and 26 kDa and an isoelectric point of (pI) 10.5. The sequence of the protein QM is highly conserved in mammals, plants, invertebrates, insects and yeast which indicates its critical functions in a cell. As a tumor suppressor, RP L10 has been studied in strains of Wilm's tumor (WT-1) and tumor cells in the stomach, where was observed a decrease in the amount of its mRNA. More recently, the RP L10 was found in low amounts in the early stages of prostate adenoma and showed some mutation in ovarian cancer, what indicates its role as a suppressor protein in the development of these diseases. It has also been described that this protein interacts with c-Jun and c-Yes inhibiting growth factors and consequently, cell division. This work has an important role on the establishment of soluble expression of QM to give base information for further studies on expression that aim to evaluate the specific regions where it acts binding the 60S and 40S ribosomal subunits and translation, as well as its binding to proto-oncogenes. The cDNA for QM protein was amplified by PCR and cloned into periplasmic expression vector p3SN8. The QM protein was expressed in E. coli BL21 (DE3) in the region of cytoplasm and periplasm, the best condition was obtained from the expression of the recombinant plasmid QM p1813QM at 25 degree C or 30 degree C, the soluble protein was obtained with small amounts of contaminants. The assays of secondary structure showed that the QM protein is predominantly alpha-helix, but when it loses the folding, this condition changes and the protein is replaced by β- sheet feature. (author)

  7. Ribosome-Inactivating and Related Proteins

    Joachim Schrot

    2015-05-01

    Full Text Available Ribosome-inactivating proteins (RIPs are toxins that act as N-glycosidases (EC 3.2.2.22. They are mainly produced by plants and classified as type 1 RIPs and type 2 RIPs. There are also RIPs and RIP related proteins that cannot be grouped into the classical type 1 and type 2 RIPs because of their different sizes, structures or functions. In addition, there is still not a uniform nomenclature or classification existing for RIPs. In this review, we give the current status of all known plant RIPs and we make a suggestion about how to unify those RIPs and RIP related proteins that cannot be classified as type 1 or type 2 RIPs.

  8. Inter-Protein Sequence Co-Evolution Predicts Known Physical Interactions in Bacterial Ribosomes and the Trp Operon.

    Feinauer, Christoph; Szurmant, Hendrik; Weigt, Martin; Pagnani, Andrea

    2016-01-01

    Interaction between proteins is a fundamental mechanism that underlies virtually all biological processes. Many important interactions are conserved across a large variety of species. The need to maintain interaction leads to a high degree of co-evolution between residues in the interface between partner proteins. The inference of protein-protein interaction networks from the rapidly growing sequence databases is one of the most formidable tasks in systems biology today. We propose here a novel approach based on the Direct-Coupling Analysis of the co-evolution between inter-protein residue pairs. We use ribosomal and trp operon proteins as test cases: For the small resp. large ribosomal subunit our approach predicts protein-interaction partners at a true-positive rate of 70% resp. 90% within the first 10 predictions, with areas of 0.69 resp. 0.81 under the ROC curves for all predictions. In the trp operon, it assigns the two largest interaction scores to the only two interactions experimentally known. On the level of residue interactions we show that for both the small and the large ribosomal subunit our approach predicts interacting residues in the system with a true positive rate of 60% and 85% in the first 20 predictions. We use artificial data to show that the performance of our approach depends crucially on the size of the joint multiple sequence alignments and analyze how many sequences would be necessary for a perfect prediction if the sequences were sampled from the same model that we use for prediction. Given the performance of our approach on the test data we speculate that it can be used to detect new interactions, especially in the light of the rapid growth of available sequence data. PMID:26882169

  9. Inter-Protein Sequence Co-Evolution Predicts Known Physical Interactions in Bacterial Ribosomes and the Trp Operon.

    Christoph Feinauer

    Full Text Available Interaction between proteins is a fundamental mechanism that underlies virtually all biological processes. Many important interactions are conserved across a large variety of species. The need to maintain interaction leads to a high degree of co-evolution between residues in the interface between partner proteins. The inference of protein-protein interaction networks from the rapidly growing sequence databases is one of the most formidable tasks in systems biology today. We propose here a novel approach based on the Direct-Coupling Analysis of the co-evolution between inter-protein residue pairs. We use ribosomal and trp operon proteins as test cases: For the small resp. large ribosomal subunit our approach predicts protein-interaction partners at a true-positive rate of 70% resp. 90% within the first 10 predictions, with areas of 0.69 resp. 0.81 under the ROC curves for all predictions. In the trp operon, it assigns the two largest interaction scores to the only two interactions experimentally known. On the level of residue interactions we show that for both the small and the large ribosomal subunit our approach predicts interacting residues in the system with a true positive rate of 60% and 85% in the first 20 predictions. We use artificial data to show that the performance of our approach depends crucially on the size of the joint multiple sequence alignments and analyze how many sequences would be necessary for a perfect prediction if the sequences were sampled from the same model that we use for prediction. Given the performance of our approach on the test data we speculate that it can be used to detect new interactions, especially in the light of the rapid growth of available sequence data.

  10. Drug: D04194 [KEGG MEDICUS

    Full Text Available 4194.gif Antibacterial [veterinary] Veterinary medicine Antiinfectives [BR:br08307] Antibacterials Protein b...iosynthesis inhibitor 23S rRNA of 50S ribosomal subunit inhibitor [KO:K01980] Amphenicols Florfenicol; Veterinary

  11. Drug: D10034 [KEGG MEDICUS

    Full Text Available sed by Brachyspira hyodysenteriae, and porcine proliferative enteropathy caused by Lawsonia intracellularis Tylosin [DR:D02490] deriv...ertive 23S rRNA of 50S ribosomal subunit, protein synthe

  12. Ribosomal Initiation Complex Assembly within the Wild-Strain of Coxsackievirus B3 and Live-Attenuated Sabin3-like IRESes during the Initiation of Translation

    Nathalie Chamond

    2013-02-01

    Full Text Available Coxsackievirus B3 (CVB3 is an enterovirus of the family of Picornaviridae. The Group B coxsackieviruses include six serotypes (B1 to B6 that cause a variety of human diseases, including myocarditis, meningitis, and diabetes. Among the group B, the B3 strain is mostly studied for its cardiovirulence and its ability to cause acute and persistent infections. Translation initiation of CVB3 RNA has been shown to be mediated by a highly ordered structure of the 5’-untranslated region (5’UTR, which harbors an internal ribosome entry site (IRES. Translation initiation is a complex process in which initiator tRNA, 40S and 60S ribosomal subunits are assembled by eukaryotic initiation factors (eIFs into an 80S ribosome at the initiation codon of the mRNA. We have previously addressed the question of whether the attenuating mutations of domain V of the poliovirus IRES were specific for a given genomic context or whether they could be transposed and extrapolated to a genomic related virus, i.e., CVB3 wild-type strain. In this context, we have described that Sabin3-like mutation (U473→C introduced in CVB3 genome led to a defective mutant with a serious reduction in translation efficiency. In this study, we analyzed the efficiency of formation of ribosomal initiation complexes 48S and 80S through 10%–30% and 10%–50% sucrose gradients using rabbit reticulocyte lysates (RRLs and stage-specific translation inhibitors: 5'-Guanylyl-imidodiphosphate (GMP-PNP and Cycloheximide (CHX, respectively. We demonstrated that the interaction of 48S and 80S ribosomal complexes within the mutant CVB3 RNA was abolished compared with the wild-type RNA by ribosome assembly analysis. Taken together, it is possible that the mutant RNA was unable to interact with some trans-acting factors critical for enhanced IRES function.

  13. Conservation of ribosomal protein gene ordering in 16 complete genomes

    2000-01-01

    The organization of ribosomal proteins in 16 prokaryotic genomes was studied as an example of comparative genome analyses of gene systems. Hypothetical ribosomal protein-containing operons were constructed. These operons also contained putative genes and other non-ribosomal genes. The correspondences among these genes across different organisms were clarified by sequence homology computations. In this way a cross tabulation of 70 ribosomal proteins genes was constructed. On average, these were organized into 9-14 operons in each genome. There were also 25 non-ribosomal or putative genes in these mainly ribosomal protein operons. Hence the table contains 95 genes in total. It was found that: (i) the conservation of the block of about 20 r-proteins in the L3 and L4 operons across almost the entire eubacteria and archaebacteria is remarkable; (ii) some operons only belong to eubacteria or archaebacteria; (iii) although the ribosomal protein operons are highly conserved within domain, there are fine variations in some operons across different organisms within each domain, and these variations are informative on the evolutionary relations among the organisms. This method provides a new potential for studying the origin and evolution of old species.

  14. Conservation of ribosomal protein gene ordering in 16 complete genomes

    王宁; 陈润生; 王永雄

    2000-01-01

    The organization of ribosomal proteins in 16 prokaryotic genomes was studied as an example of comparative genome analyses of gene systems. Hypothetical ribosomal protein-containing operons were constructed. These operons also contained putative genes and other non-ribosomal genes. The correspondences among these genes across different organisms were clarified by sequence homology computations. In this way a cross tabulation of 70 ribosomal proteins genes was constructed. On average, these were organized into 9-14 operons in each genome. There were also 25 non-ribosomal or putative genes in these mainly ribosomal protein operons. Hence the table contains 95 genes in total. It was found that: (i) the conservation of the block of about 20 r-proteins in the L3 and L4 operons across almost the entire eubacteria and ar-chaebacteria is remarkable; (ii) some operons only belong to eubacteria or archaebacte-ria; (iii) although the ribosomal protein operons are highly conserved within domain, there are fine variat

  15. Energy Retrofit Strategies for Residential Building Envelopes: An Italian Case Study of an Early-50s Building

    Luca Evangelisti

    2015-08-01

    Full Text Available During the last few years, the issues of energy efficiency and energy saving have dominated the buildings research field. New constructions are based on efficient design and, because of this, the real challenge is to retrofit existing buildings. Italian standards impose thermal transmittance limits for opaque and transparent surfaces, according to the climatic area. In order to understand buildings’ energy behavior, an accurate analysis, carried out by employing advanced calculation codes and instrumental diagnosis—provided by the use of heat flow meter, surface temperature probes and thermal imaging camera—is needed. In this paper, a structure built in the 50 s has been analyzed, by means of a measurement campaign, to investigate the building’s characteristics and its vulnerability. Finally, some retrofit hypotheses have been evaluated by means of a well-known dynamic code. All investments have to be analyzed under a financial point of view, considering materials and installation costs. For this reason, the payback time has been calculated in order to understand how quickly the energy upgrading can be repaid.

  16. Do the A subunits contribute to the differences in the toxicity of Shiga toxin 1 and Shiga toxin 2?

    Basu, Debaleena; Tumer, Nilgun E

    2015-05-01

    Shiga toxin producing Escherichia coli O157:H7 (STEC) is one of the leading causes of food-poisoning around the world. Some STEC strains produce Shiga toxin 1 (Stx1) and/or Shiga toxin 2 (Stx2) or variants of either toxin, which are critical for the development of hemorrhagic colitis (HC) or hemolytic uremic syndrome (HUS). Currently, there are no therapeutic treatments for HC or HUS. E. coli O157:H7 strains carrying Stx2 are more virulent and are more frequently associated with HUS, which is the most common cause of renal failure in children in the US. The basis for the increased potency of Stx2 is not fully understood. Shiga toxins belong to the AB5 family of protein toxins with an A subunit, which depurinates a universally conserved adenine residue in the α-sarcin/ricin loop (SRL) of the 28S rRNA and five copies of the B subunit responsible for binding to cellular receptors. Recent studies showed differences in the structure, receptor binding, dependence on ribosomal proteins and pathogenicity of Stx1 and Stx2 and supported a role for the B subunit in differential toxicity. However, the current data do not rule out a potential role for the A1 subunits in the differential toxicity of Stx1 and Stx2. This review highlights the recent progress in understanding the differences in the A1 subunits of Stx1 and Stx2 and their role in defining toxicity. PMID:25938272

  17. Production and delivery of recombinant subunit vaccines

    Andersson, Christin

    2000-01-01

    Recombinant strategies are today dominating in thedevelopment of modern subunit vaccines. This thesis describesstrategies for the production and recovery of protein subunitimmunogens, and how genetic design of the expression vectorscan be used to adapt the immunogens for incorporation intoadjuvant systems. In addition, different strategies fordelivery of subunit vaccines by RNA or DNA immunization havebeen investigated. Attempts to create general production strategies forrecombinant protein i...

  18. Ribosomes containing mutants of L4 ribosomal protein from Thermus thermophilus display multiple defects in ribosomal functions and sensitivity against erythromycin

    TSAGKALIA, AIKATERINI; LEONTIADOU, FOTINI; XAPLANTERI, MARIA A.; PAPADOPOULOS, GEORGIOS; KALPAXIS, DIMITRIOS L.; CHOLI-PAPADOPOULOU, THEODORA

    2005-01-01

    Protein L4 from Thermus thermophilus (TthL4) was heterologously overproduced in Escherichia coli cells. To study the implication of the extended loop of TthL4 in the exit-tunnel and peptidyltransferase functions, the highly conserved E56 was replaced by D or Q, while the semiconserved G55 was changed to E or S. Moreover, the sequence -G55E56- was inverted to -E55G56-. When we incorporated these mutants into E. coli ribosomes and investigated their impact on poly(Phe) synthesis, high variations in the synthetic activity and response to erythromycin of the resulting ribosomes were observed. In the absence of erythromycin, ribosomes harboring mutations G55E and E56D in TthL4 protein were characterized by low activity in synthesizing poly(Phe) and decreased capability in binding tRNA at the A site. On the other hand, ribosomes possessing mutations G55E, G55S, G55E-E56G, or E56Q in TthL4 protein were unexpectedly more sensitive to erythromycin. Evidence in support of these findings was drawn by in vivo experiments, assessing the erythromycin sensitivity of E. coli cells expressing wild-type or mutant TthL4 proteins. Our results emphasize the role of the extended loop of L4 ribosomal protein in the exit-tunnel and peptidyltransferase center functions. PMID:16244130

  19. The aminoglycoside resistance methyltransferase Sgm impedes RsmF methylation at an adjacent rRNA nucleotide in the ribosomal A site

    Cubrilo, Sonja; Babić, Fedora; Douthwaite, Stephen;

    2009-01-01

    methylated nucleotides including m(4)Cm1402 and m(5)C1407. Modification at m(5)C1407 by the methyltransferase RsmF is impeded as Sgm gains access to its adjacent G1405 target on the 30S ribosomal subunit. An Sgm mutant (G135A), which is impaired in S-adenosylmethionine binding and confers lower resistance......Ribosome-targeting antibiotics block protein synthesis by binding at functionally important regions of the bacterial rRNA. Resistance is often conferred by addition of a methyl group at the antibiotic binding site within an rRNA region that is already highly modified with several nucleotide...... methylations. In bacterial rRNA, each methylation requires its own specific methyltransferase enzyme, and this raises the question as to how an extra methyltransferase conferring antibiotic resistance can be accommodated and how it can gain access to its nucleotide target within a short and functionally...

  20. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  1. Nonenzymatic microorganism identification based on ribosomal RNA

    Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.

    1999-11-01

    Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

  2. On peptide bond formation, translocation, nascent protein progression and the regulatory properties of ribosomes. Derived on 20 October 2002 at the 28th FEBS Meeting in Istanbul.

    Agmon, Ilana; Auerbach, Tamar; Baram, David; Bartels, Heike; Bashan, Anat; Berisio, Rita; Fucini, Paola; Hansen, Harly A S; Harms, Joerg; Kessler, Maggie; Peretz, Moshe; Schluenzen, Frank; Yonath, Ada; Zarivach, Raz

    2003-06-01

    High-resolution crystal structures of large ribosomal subunits from Deinococcus radiodurans complexed with tRNA-mimics indicate that precise substrate positioning, mandatory for efficient protein biosynthesis with no further conformational rearrangements, is governed by remote interactions of the tRNA helical features. Based on the peptidyl transferase center (PTC) architecture, on the placement of tRNA mimics, and on the existence of a two-fold related region consisting of about 180 nucleotides of the 23S RNA, we proposed a unified mechanism integrating peptide bond formation, A-to-P site translocation, and the entrance of the nascent protein into its exit tunnel. This mechanism implies sovereign, albeit correlated, motions of the tRNA termini and includes a spiral rotation of the A-site tRNA-3' end around a local two-fold rotation axis, identified within the PTC. PTC features, ensuring the precise orientation required for the A-site nucleophilic attack on the P-site carbonyl-carbon, guide these motions. Solvent mediated hydrogen transfer appears to facilitate peptide bond formation in conjunction with the spiral rotation. The detection of similar two-fold symmetry-related regions in all known structures of the large ribosomal subunit, indicate the universality of this mechanism, and emphasizes the significance of the ribosomal template for the precise alignment of the substrates as well as for accurate and efficient translocation. The symmetry-related region may also be involved in regulatory tasks, such as signal transmission between the ribosomal features facilitating the entrance and the release of the tRNA molecules. The protein exit tunnel is an additional feature that has a role in cellular regulation. We showed by crystallographic methods that this tunnel is capable of undergoing conformational oscillations and correlated the tunnel mobility with sequence discrimination, gating and intracellular regulation. PMID:12787020

  3. Identification, isolation, and characterization of the structural gene encoding the delta' subunit of Escherichia coli DNA polymerase III holoenzyme.

    J.R. Carter; Franden, M A; Aebersold, R.; McHenry, C S

    1993-01-01

    The gene encoding the delta' subunit of DNA polymerase III holoenzyme, designated holB, was cloned by a strategy in which peptide sequence was used to derive a DNA hybridization probe. The gene maps to 24.95 centisomes of the chromosome. Sequencing of holB revealed a 1,002-bp open reading frame predicted to produce a 36,936-Da protein. The gene has a ribosome-binding site and promoter that are highly similar to the consensus sequences and is flanked by two potential open reading frames. Prote...

  4. Sequence homology between the subunits of two immunologically and functionally distinct types of fimbriae of Actinomyces spp.

    Yeung, M K; Cisar, J O

    1990-01-01

    Nucleotide sequencing of the type 1 fimbrial subunit gene of Actinomyces viscosus T14V revealed a consensus ribosome-binding site followed by an open reading frame of 1,599 nucleotides. The encoded protein of 533 amino acids (Mr = 56,899) was predominantly hydrophilic except for an amino-terminal signal peptide and a carboxy-terminal region identified as a potential membrane-spanning segment. Edman degradation of the cloned protein expressed in Escherichia coli and the type 1 fimbriae of A. v...

  5. Subunit architecture of general transcription factor TFIIH

    Gibbons, Brian J.; Brignole, Edward J; Azubel, Maia; Murakami, Kenji; Voss, Neil R; Bushnell, David A.; Asturias, Francisco J; Kornberg, Roger D.

    2012-01-01

    Structures of complete 10-subunit yeast TFIIH and of a nested set of subcomplexes, containing 5, 6, and 7 subunits, have been determined by electron microscopy (EM) and 3D reconstruction. Consistency among all the structures establishes the location of the “minimal core” subunits (Ssl1, Tfb1, Tfb2, Tfb4, and Tfb5), and additional densities can be specifically attributed to Rad3, Ssl2, and the TFIIK trimer. These results can be further interpreted by placement of previous X-ray structures into...

  6. The p90 ribosomal S6 kinase (RSK is a mediator of smooth muscle contractility.

    Mykhaylo Artamonov

    Full Text Available In the canonical model of smooth muscle (SM contraction, the contractile force is generated by phosphorylation of the myosin regulatory light chain (RLC20 by the myosin light chain kinase (MLCK. Moreover, phosphorylation of the myosin targeting subunit (MYPT1 of the RLC20 phosphatase (MLCP by the RhoA-dependent ROCK kinase, inhibits the phosphatase activity and consequently inhibits dephosphorylation of RLC20 with concomitant increase in contractile force, at constant intracellular [Ca(2+]. This pathway is referred to as Ca(2+-sensitization. There is, however, emerging evidence suggesting that additional Ser/Thr kinases may contribute to the regulatory pathways in SM. Here, we report data implicating the p90 ribosomal S6 kinase (RSK in SM contractility. During both Ca(2+- and agonist (U46619 induced SM contraction, RSK inhibition by the highly selective compound BI-D1870 (which has no effect on MLCK or ROCK resulted in significant suppression of contractile force. Furthermore, phosphorylation levels of RLC20 and MYPT1 were both significantly decreased. Experiments involving the irreversible MLCP inhibitor microcystin-LR, in the absence of Ca(2+, revealed that the decrease in phosphorylation levels of RLC20 upon RSK inhibition are not due solely to the increase in the phosphatase activity, but reflect direct or indirect phosphorylation of RLC20 by RSK. Finally, we show that agonist (U46619 stimulation of SM leads to activation of extracellular signal-regulated kinases ERK1/2 and PDK1, consistent with a canonical activation cascade for RSK. Thus, we demonstrate a novel and important physiological function of the p90 ribosomal S6 kinase, which to date has been typically associated with the regulation of gene expression.

  7. Generic concepts in the Crepidotaceae as inferred from nuclear large subunit ribosomal DNA sequences, morphology, and basidiospore dormancy patterns

    Aime, Mary Catherine

    1998-01-01

    The Crepidotaceae (Imai) Singer (Basidiomycetes: Agaricales) represents a proposed family of saprophytic fungi containing five agaricoid (Crepidotus, Tubaria, Melanomphalia, Simocybe, Pleurotellus) and four cyphelloid (Episphaeria, Phaeosolenia, Pellidiscus, Chromocyphella) genera. Several contemporary classification systems exist that delegate some or all of these genera to other agaric families. Phylogenetic relationships for the most prevalent genera in the Crepidotaceae were investigated ...

  8. Genetic Characterization of Clinical Acanthamoeba Isolates Using Gene Loci of Nuclear and Mitochondrial Small Subunit Ribosomal RNA

    ラフマン, モハメド, モシウル

    2013-01-01

    以下に掲載:The Korean Journal of Parasitology 51(4) pp.401-411 2013. Korean Society for Parasitology and Tropical Medicine. 共著者:Md Moshiur Rahman, Kenji Yagita, Akira Kobayashi, Yosaburo Oikawa, Amjad I.A. Hussein, Takahiro Matsumura and Masaharu Tokoro

  9. Genetic Characterization of Clinical Acanthamoeba Isolates Using Gene Loci of Nuclear and Mitochondrial Small Subunit Ribosomal RNA

    ラフマン, モハメド, モシウル

    2013-01-01

    要旨Abstract 以下に掲載:The Korean Journal of Parasitology. 51(4) pp.401-411 2013. Korean Society for Parasitology and Tropical Medicine. 共著者:Md Moshiur Rahman, Kenji Yagita, Akira Kobayashi, Yosaburo Oikawa, Amjad I.A. Hussein, Takahiro Matsumura and Masaharu Tokoro

  10. Risk capital allocation with autonomous subunits

    Hougaard, Jens Leth; Smilgins, Aleksandrs

    2016-01-01

    Risk capital allocation problems have been widely discussed in the academic literature. We consider a set of independent subunits collaborating in order to reduce risk: that is, when subunit portfolios are merged a diversification benefit arises and the risk of the group as a whole is smaller tha...... fairness tests related directly to the problem of risk capital allocation and show that the Lorenz set satisfies all three tests in contrast to other well-known coherent methods. Finally, we discuss how to deal with non-uniqueness of the Lorenz set.......Risk capital allocation problems have been widely discussed in the academic literature. We consider a set of independent subunits collaborating in order to reduce risk: that is, when subunit portfolios are merged a diversification benefit arises and the risk of the group as a whole is smaller than...... the sum of the risks of the individual subunits. The question is how to allocate the risk capital of the group among the subunits in a fair way. In this paper we propose to use the Lorenz set as an allocation method. We show that the Lorenz set is operational and coherent. Moreover, we propose three...

  11. Molecular characterization of the largest subunit of Plasmodium falciparum RNA polymerase I.

    Fox, B A; Li, W B; Tanaka, M; Inselburg, J; Bzik, D J

    1993-09-01

    Plasmodium species possess developmentally regulated ribosomal RNA (rRNA) genes. This report describes the expression and gene structure of the largest subunit of P. falciparum RNA polymerase I (RNAPI), which is responsible for the synthesis of rRNA. The RNAPI largest subunit gene was present as a single copy gene on chromosome 9. Three exons encode the 2910-amino acid RNAPI polypeptide (340 140 Da). A comparison of Plasmodium, Trypanosoma, and Saccharomyces cerevisiae nuclear RNAP largest subunits identified conserved amino acid positions and class-specific amino acid positions. Novel amino acid insertions were found between RNAPI conserved regions A and B (region A'), D and DE1 (region D'), DE2 and E (region DE2'), and F and G (region F'). Leucine zipper domains were found within regions D', DE2, and DE2'. A novel serine-rich repeat domain, a domain with homology to the C-terminal domain of eukaryotic upstream binding factor (UBF), and 4 highly conserved casein kinase II (CKII) Ser/Thr phosphorylation motifs were found within a 127-amino acid sub-region of enlarged region F'. The novel RNAPI serine-rich repeat contained a conserved motif, Ser-X3-Ser, which was also identified in the serine-rich repeat domains of the P. falciparum RNAPII and RNAPIII largest subunits, as well as within a highly homologous serine-rich repeat from trophozoite antigen R45. The results of this molecular analysis indicate that phosphorylation and dephosphorylation mechanisms regulate the activity of P. falciparum RNAPI. PMID:8259131

  12. Stochastic kinetics of ribosomes: single motor properties and collective behavior

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Synthesis of protein molecules in a cell are carried out by ribosomes. A ribosome can be regarded as a molecular motor which utilizes the input chemical energy to move on a messenger RNA (mRNA) track that also serves as a template for the polymerization of the corresponding protein. The forward movement, however, is characterized by an alternating sequence of translocation and pause. Using a quantitative model, which captures the mechanochemical cycle of an individual ribosome, we derive an {\\it exact} analytical expression for the distribution of its dwell times at the successive positions on the mRNA track. Inverse of the average dwell time satisfies a ``Michaelis-Menten-like'' equation and is consistent with the general formula for the average velocity of a molecular motor with an unbranched mechano-chemical cycle. Extending this formula appropriately, we also derive the exact force-velocity relation for a ribosome. Often many ribosomes simultaneously move on the same mRNA track, while each synthesizes a c...

  13. An internal ribosome entry site (IRES mutant library for tuning expression level of multiple genes in mammalian cells.

    Esther Y C Koh

    Full Text Available A set of mutated Encephalomyocarditis virus (EMCV internal ribosome entry site (IRES elements with varying strengths is generated by mutating the translation initiation codons of 10(th, 11(th, and 12(th AUG to non-AUG triplets. They are able to control the relative expression of multiple genes over a wide range in mammalian cells in both transient and stable transfections. The relative strength of each IRES mutant remains similar in different mammalian cell lines and is not gene specific. The expressed proteins have correct molecular weights. Optimization of light chain over heavy chain expression by these IRES mutants enhances monoclonal antibody expression level and quality in stable transfections. Uses of this set of IRES mutants can be extended to other applications such as synthetic biology, investigating interactions between proteins and its complexes, cell engineering, multi-subunit protein production, gene therapy, and reprogramming of somatic cells into stem cells.

  14. The bacterial translocon SecYEG opens upon ribosome binding.

    Knyazev, Denis G; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-06-21

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which has the conductivity of the plug deletion mutant. The number of ion-conducting channels inserted into the planar bilayer per fusion event roughly equals the number of SecYEG channels counted by fluorescence correlation spectroscopy in a single proteoliposome. Thus, the open probability of the channel must be close to unity. To prevent the otherwise lethal proton leak, a closed post-translational conformation of the SecYEG complex bound to a ribosome must exist. PMID:23645666

  15. The Bacterial Translocon SecYEG Opens upon Ribosome Binding*

    Knyazev, Denis G.; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-01-01

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which has the conductivity of the plug deletion mutant. The number of ion-conducting channels inserted into the planar bilayer per fusion event roughly equals the number of SecYEG channels counted by fluorescence correlation spectroscopy in a single proteoliposome. Thus, the open probability of the channel must be close to unity. To prevent the otherwise lethal proton leak, a closed post-translational conformation of the SecYEG complex bound to a ribosome must exist. PMID:23645666

  16. Effects of ribosomal exit tunnel on protein's cotranslational folding

    In vivo, folding of many proteins occurs during their synthesis in the ribosome and continues after they have escaped from the ribosomal exit tunnel. In this research, we investigate the confinement effects of the ribosome on the cotranslational folding of three proteins, of PDB codes 1PGA, 1CRN and 2RJX, by using a coarse-grained model and molecular dynamics simulation. The exit tunnel is modeled as a hollow cylinder attached to a flat wall, whereas a Go-like model is adopted for the proteins. Our results show that the exit tunnel has a strong effect on the folding mechanism by setting an order by which the secondary and tertiary structures are formed. For protein 1PGA, the folding follows two different folding routes. The presence of the tunnel also improves the foldability of protein. (author)

  17. Molecular profiling of activated neurons by phosphorylated ribosome capture.

    Knight, Zachary A; Tan, Keith; Birsoy, Kivanc; Schmidt, Sarah; Garrison, Jennifer L; Wysocki, Robert W; Emiliano, Ana; Ekstrand, Mats I; Friedman, Jeffrey M

    2012-11-21

    The mammalian brain is composed of thousands of interacting neural cell types. Systematic approaches to establish the molecular identity of functional populations of neurons would advance our understanding of neural mechanisms controlling behavior. Here, we show that ribosomal protein S6, a structural component of the ribosome, becomes phosphorylated in neurons activated by a wide range of stimuli. We show that these phosphorylated ribosomes can be captured from mouse brain homogenates, thereby enriching directly for the mRNAs expressed in discrete subpopulations of activated cells. We use this approach to identify neurons in the hypothalamus regulated by changes in salt balance or food availability. We show that galanin neurons are activated by fasting and that prodynorphin neurons restrain food intake during scheduled feeding. These studies identify elements of the neural circuit that controls food intake and illustrate how the activity-dependent capture of cell-type-specific transcripts can elucidate the functional organization of a complex tissue. PMID:23178128

  18. Interaction of tRNA with Eukaryotic Ribosome

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  19. Spontaneous clearance of chronic hepatitis C infection is associated with an internal ribosomal entry site IIId stem loop structure variant

    N G Bader El Din

    2015-01-01

    Full Text Available Aim: To investigate if any mutations in hepatitis C virus (HCV internal ribosome entry site (IRES can inhibit the translation of viral polyprotein. Materials and Methods: A 26-year-old male patient infected with HCV 10 years ago was followed up. After 9 years of chronic infection. The patient had managed to resolve the infection for a period of 9 months, after which the patient experienced a viral recurrence characterized by high viral load and diverse HCV quasispecies. The IRES structures of the viral strains that disappeared were comparable with those that are currently active using structural mutational analysis. Results: A novo mutational position 254 combined with a rarely observed mutation at position 253 in the stem of the IIId subdomain were observed and the new conformation had an octa-apical loop (AGUGUUGG and a shift in the 3 ` GU from the loop to the stem. Conclusions: These mutations were found to be highly deleterious, and they affected the direct binding of the IIId loop to the 40S ribosomal subunit with a subsequent inhibition of translation of viral polyprotein and clearance of the virus.

  20. TORC1 and TORC2 work together to regulate ribosomal protein S6 phosphorylation in Saccharomyces cerevisiae.

    Yerlikaya, Seda; Meusburger, Madeleine; Kumari, Romika; Huber, Alexandre; Anrather, Dorothea; Costanzo, Michael; Boone, Charles; Ammerer, Gustav; Baranov, Pavel V; Loewith, Robbie

    2016-01-15

    Nutrient-sensitive phosphorylation of the S6 protein of the 40S subunit of the eukaryote ribosome is highly conserved. However, despite four decades of research, the functional consequences of this modification remain unknown. Revisiting this enigma in Saccharomyces cerevisiae, we found that the regulation of Rps6 phosphorylation on Ser-232 and Ser-233 is mediated by both TOR complex 1 (TORC1) and TORC2. TORC1 regulates phosphorylation of both sites via the poorly characterized AGC-family kinase Ypk3 and the PP1 phosphatase Glc7, whereas TORC2 regulates phosphorylation of only the N-terminal phosphosite via Ypk1. Cells expressing a nonphosphorylatable variant of Rps6 display a reduced growth rate and a 40S biogenesis defect, but these phenotypes are not observed in cells in which Rps6 kinase activity is compromised. Furthermore, using polysome profiling and ribosome profiling, we failed to uncover a role of Rps6 phosphorylation in either global translation or translation of individual mRNAs. Taking the results together, this work depicts the signaling cascades orchestrating Rps6 phosphorylation in budding yeast, challenges the notion that Rps6 phosphorylation plays a role in translation, and demonstrates that observations made with Rps6 knock-ins must be interpreted cautiously. PMID:26582391

  1. Role of adenosine 5'-monophosphate-activated protein kinase subunits in skeletal muscle mammalian target of rapamycin signaling

    Deshmukh, Atul S.; Treebak, Jonas Thue; Long, Yun Chau;

    2008-01-01

    AMP-activated protein kinase (AMPK) is an important energy-sensing protein in skeletal muscle. Mammalian target of rapamycin (mTOR) mediates translation initiation and protein synthesis through ribosomal S6 kinase 1 (S6K1) and eukaryotic initiation factor 4E-binding protein 1 (4E-BP1). AMPK...... activation reduces muscle protein synthesis by down-regulating mTOR signaling, whereas insulin mediates mTOR signaling via Akt activation. We hypothesized that AMPK-mediated inhibitory effects on mTOR signaling depend on catalytic alpha2 and regulatory gamma3 subunits. Extensor digitorum longus muscle from...... extensor digitorum longus muscle from either alpha2 or gamma3 AMPK KO mice, indicating functional alpha2 and gamma3 subunits of AMPK are required for the reduction in mTOR signaling. AICAR alone was without effect on basal phosphorylation of S6K1 (Thr389), ribosomal protein S6 (Ser235/236), and 4E-BP1 (Thr...

  2. Protein-protein interactions within late pre-40S ribosomes.

    Melody G Campbell

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  3. The Bacterial Translocon SecYEG Opens upon Ribosome Binding*

    Knyazev, Denis G.; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-01-01

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which ha...

  4. Single Molecule Fluorescence Measurements of Ribosomal Translocation Dynamics

    Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskarin; Cabral, Diana; Liu, Hanqing; Wang, Yuhong; Zhang, Haibo; Rosenblum, Gabriel; Smilansky, Zeev; Goldman, Yale E.; Cooperman, Barry S.

    2011-01-01

    We employ single-molecule fluorescence resonance energy transfer (smFRET) to study structural dynamics over the first two elongation cycles of protein synthesis, using ribosomes containing either Cy3-labeled ribosomal protein L11 and A- or P-site Cy5-labeled tRNA or Cy3 and Cy5 labeled tRNAs. Pre-translocation (PRE) complexes demonstrate fluctuations between classical and hybrid forms, with concerted motions of tRNAs away from L11 and from each other when classical complex converts to hybrid ...

  5. Investigation of molluscan phylogeny using large-subunit and small-subunit nuclear rRNA sequences.

    Passamaneck, Yale J; Schander, Christoffer; Halanych, Kenneth M

    2004-07-01

    The Mollusca represent one of the most morphologically diverse animal phyla, prompting a variety of hypotheses on relationships between the major lineages within the phylum based upon morphological, developmental, and paleontological data. Analyses of small-ribosomal RNA (SSU rRNA) gene sequence have provided limited resolution of higher-level relationships within the Mollusca. Recent analyses suggest large-subunit (LSU) rRNA gene sequences are useful in resolving deep-level metazoan relationships, particularly when combined with SSU sequence. To this end, LSU (approximately 3.5 kb in length) and SSU (approximately 2 kb) sequences were collected for 33 taxa representing the major lineages within the Mollusca to improve resolution of intraphyletic relationships. Although the LSU and combined LSU+SSU datasets appear to hold potential for resolving branching order within the recognized molluscan classes, low bootstrap support was found for relationships between the major lineages within the Mollusca. LSU+SSU sequences also showed significant levels of rate heterogeneity between molluscan lineages. The Polyplacophora, Gastropoda, and Cephalopoda were each recovered as monophyletic clades with the LSU+SSU dataset. While the Bivalvia were not recovered as monophyletic clade in analyses of the SSU, LSU, or LSU+SSU, the Shimodaira-Hasegawa test showed that likelihood scores for these results did not differ significantly from topologies where the Bivalvia were monophyletic. Analyses of LSU sequences strongly contradict the widely accepted Diasoma hypotheses that bivalves and scaphopods are closely related to one another. The data are consistent with recent morphological and SSU analyses suggesting scaphopods are more closely related to gastropods and cephalopods than to bivalves. The dataset also presents the first published DNA sequences from a neomeniomorph aplacophoran, a group considered critical to our understanding of the origin and early radiation of the Mollusca

  6. Direct TFIIA-TFIID protein contacts drive budding yeast ribosomal protein gene transcription.

    Layer, Justin H; Weil, P Anthony

    2013-08-01

    We have previously shown that yeast TFIID provides coactivator function on the promoters of ribosomal protein-encoding genes (RPGs) by making direct contact with the transactivator repressor activator protein 1 (Rap1). Further, our structural studies of assemblies generated with purified Rap1, TFIID, and TFIIA on RPG enhancer-promoter DNA indicate that Rap1-TFIID interaction induces dramatic conformational rearrangements of enhancer-promoter DNA and TFIID-bound TFIIA. These data indicate a previously unknown yet critical role for yeast TFIIA in the integration of activator-TFIID contacts with promoter conformation and downstream preinitiation complex formation and/or function. Here we describe the use of systematic mutagenesis to define how specific TFIIA contacts contribute to these processes. We have verified that TFIIA is required for RPG transcription in vivo and in vitro, consistent with the existence of a critical Rap1-TFIIA-TFIID interaction network. We also identified essential points of contact for TFIIA and Rap1 within the Rap1 binding domain of the Taf4 subunit of TFIID. These data suggest a mechanism for how interactions between TFIID, TFIIA, and Rap1 contribute to the high rate of transcription initiation seen on RPGs in vivo. PMID:23814059

  7. RNA-DNA differences in human mitochondria restore ancestral form of 16S ribosomal RNA.

    Bar-Yaacov, Dan; Avital, Gal; Levin, Liron; Richards, Allison L; Hachen, Naomi; Rebolledo Jaramillo, Boris; Nekrutenko, Anton; Zarivach, Raz; Mishmar, Dan

    2013-11-01

    RNA transcripts are generally identical to the underlying DNA sequences. Nevertheless, RNA-DNA differences (RDDs) were found in the nuclear human genome and in plants and animals but not in human mitochondria. Here, by deep sequencing of human mitochondrial DNA (mtDNA) and RNA, we identified three RDD sites at mtDNA positions 295 (C-to-U), 13710 (A-to-U, A-to-G), and 2617 (A-to-U, A-to-G). Position 2617, within the 16S rRNA, harbored the most prevalent RDDs (>30% A-to-U and ∼15% A-to-G of the reads in all tested samples). The 2617 RDDs appeared already at the precursor polycistrone mitochondrial transcript. By using traditional Sanger sequencing, we identified the A-to-U RDD in six different cell lines and representative primates (Gorilla gorilla, Pongo pigmaeus, and Macaca mulatta), suggesting conservation of the mechanism generating such RDD. Phylogenetic analysis of more than 1700 vertebrate mtDNA sequences supported a thymine as the primate ancestral allele at position 2617, suggesting that the 2617 RDD recapitulates the ancestral 16S rRNA. Modeling U or G (the RDDs) at position 2617 stabilized the large ribosomal subunit structure in contrast to destabilization by an A (the pre-RDDs). Hence, these mitochondrial RDDs are likely functional. PMID:23913925

  8. Shigella toxin inhibition of binding and translation of polyuridylic acid by Escherichia coli ribosomes.

    Olenick, J G; Wolfe, A D

    1980-01-01

    Shigella toxin inhibits polyuridylic acid-directed polymerization of phenylalanine in ribosome-enzyme systems obtained from Escherichia coli or from Shigella dysenteriae. The inhibition is the result of toxin acting on ribosomes to prevent polyuridylic acid attachment.

  9. Heteromeric assembly of P2X subunits

    Ralf Hausmann

    2013-12-01

    Full Text Available Transcripts and/or proteins of P2X receptor (P2XR subunits have been found in virtually all mammalian tissues. Generally more than one of the seven known P2X subunits have been identified in a given cell type. Six of the seven cloned P2X subunits can efficiently form functional homotrimeric ion channels in recombinant expression systems. This is in contrast to other ligand-gated ion channel families, such as the Cys-loop or glutamate receptors, where homomeric assemblies seem to represent the exception rather than the rule. P2XR mediated responses recorded from native tissues rarely match exactly the biophysical and pharmacological properties of heterologously expressed homomeric P2XRs. Heterotrimerization of P2X subunits is likely to account for this observed diversity. While the existence of heterotrimeric P2X2/3Rs and their role in physiological processes is well established, the composition of most other P2XR heteromers and/or the interplay between distinct trimeric receptor complexes in native tissues is not clear. After a description of P2XR assembly and the structure of the intersubunit ATP-binding site, this review summarizes the distribution of P2XR subunits in selected mammalian cell types and the biochemically and/or functionally characterized heteromeric P2XRs that have been observed upon heterologous co-expression of P2XR subunits. We further provide examples where the postulated heteromeric P2XRs have been suggested to occur in native tissues and an overview of the currently available pharmacological tools that have been used to discriminate between homo- and heteromeric P2XRs

  10. Ligation-free ribosome profiling of cell type-specific translation in the brain

    Hornstein, Nicholas; Torres, Daniela; Das Sharma, Sohani; Tang, Guomei; Canoll, Peter; Sims, Peter A

    2016-01-01

    Ribosome profiling has emerged as a powerful tool for genome-wide measurements of translation, but library construction requires multiple ligation steps and remains cumbersome relative to more conventional deep-sequencing experiments. We report a new, ligation-free approach to ribosome profiling that does not require ligation. Library construction for ligation-free ribosome profiling can be completed in one day with as little as 1 ng of purified RNA footprints. We apply ligation-free ribosome...

  11. The Database of Ribosomal Cross-links: an update.

    Baranov, P. V.; Kubarenko, A V; Gurvich, O L; Shamolina, T A; Brimacombe, R

    1999-01-01

    The Database of Ribosomal Cross-links (DRC) was created in 1997. Here we describe new data incorporated into this database and several new features of the DRC. The DRC is freely available via World Wide Web at http://visitweb.com/database/ or http://www. mpimg-berlin-dahlem.mpg.de/ approximately ag_ribo/ag_brimacombe/drc/

  12. The ribosome and the mechanism of protein synthesis

    In virtually all forms of life on earth, proteins in each cell are made according to a genetic blueprint, in the form of DNA. The translation of copies of this genetic blueprint (in the form of messenger RNA) into polypeptides is performed on the ribosome, a highly complex molecular machine composed of RNAs and proteins. To this end, special adaptor molecules called transfer RNAs are lined up by the ribosome in the sequence dictated by the genetic code, such that the amino acids carried by these molecules can be linked into a polypeptide. Several cofactors are involved in these processes, some of which require energy freed up by GTP hydrolysis. Although the ribosome was discovered more than 50 years ago, its structure has only been solved recently by X-ray crystallography. Another technique, cryo-electron microscopy, is starting to contribute toward our understanding of the ribosome's function, by portraying its conformational changes and binding interactions with the cofactors and tRNA

  13. The ABC of Ribosome-Related Antibiotic Resistance

    Wilson, Daniel N.

    2016-01-01

    ABSTRACT The increase in multidrug-resistant pathogenic bacteria is limiting the utility of our current arsenal of antimicrobial agents. Mechanistically understanding how bacteria obtain antibiotic resistance is a critical first step to the development of improved inhibitors. One common mechanism for bacteria to obtain antibiotic resistance is by employing ATP-binding cassette (ABC) transporters to actively pump the drug from the cell. The ABC-F family includes proteins conferring resistance to a variety of clinically important ribosome-targeting antibiotics; however, controversy remains as to whether resistance is conferred via efflux like other ABC transporters or whether another mechanism, such as ribosome protection, is at play. A recent study by Sharkey and coworkers (L. K. Sharkey, T. A. Edwards, and A. J. O’Neill, mBio 7:e01975-15, 2016, http://dx.doi.org/10.1128/mBio.01975-15) provides strong evidence that ABC-F proteins conferring antibiotic resistance utilize ribosome protection mechanisms, namely, by interacting with the ribosome and displacing the drug from its binding site, thus revealing a novel role for ABC-F proteins in antibiotic resistance. PMID:27143393

  14. A streamlined ribosome profiling protocol for the characterization of microorganisms

    Latif, Haythem; Szubin, Richard; Tan, Justin; Brunk, Elizabeth; Lechner, Anna; Zengler, Karsten; Palsson, Bernhard O.

    2015-01-01

    the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time...... a high fraction of informative reads, all while retaining the high quality standards of the existing protocol....

  15. Characterization of a Novel Class I Transcription Factor A (CITFA) Subunit That Is Indispensable for Transcription by the Multifunctional RNA Polymerase I of Trypanosoma brucei

    Nguyen, T. N.

    2012-10-26

    Trypanosoma brucei is the only organism known to have evolved a multifunctional RNA polymerase I (pol I) system that is used to express the parasite\\'s ribosomal RNAs, as well as its major cell surface antigens, namely, the variant surface glycoprotein (VSG) and procyclin, which are vital for establishing successful infections in the mammalian host and the tsetse vector, respectively. Thus far, biochemical analyses of the T. brucei RNA pol I transcription machinery have elucidated the subunit structure of the enzyme and identified the class I transcription factor A (CITFA). CITFA binds to RNA pol I promoters, and its CITFA-2 subunit was shown to be absolutely essential for RNA pol I transcription in the parasite. Tandem affinity purification (TAP) of CITFA revealed the subunits CITFA-1 to -6, which are conserved only among kinetoplastid organisms, plus the dynein light chain DYNLL1. Here, by tagging CITFA-6 instead of CITFA-2, a complex was purified that contained all known CITFA subunits, as well as a novel proline-rich protein. Functional studies carried out in vivo and in vitro, as well as a colocalization study, unequivocally demonstrated that this protein is a bona fide CITFA subunit, essential for parasite viability and indispensable for RNA pol I transcription of ribosomal gene units and the active VSG expression site in the mammalian-infective life cycle stage of the parasite. Interestingly, CITFA-7 function appears to be species specific, because expression of an RNA interference (RNAi)-resistant CITFA-7 transgene from Trypanosoma cruzi could not rescue the lethal phenotype of silencing endogenous CITFA-7.

  16. Purification and properties of a ribosomal casein kinase from rabbit reticulocytes

    Issinger, O G

    1977-01-01

    A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...

  17. Lactococcus lactis YfiA is necessary and sufficient for ribosome dimerization

    Puri, Pranav; Eckhardt, Thomas H; Franken, Linda E; Fusetti, Fabrizia; Stuart, Marc C A; Boekema, Egbert J; Kuipers, Oscar P; Kok, Jan; Poolman, Berend

    2014-01-01

    Dimerization and inactivation of ribosomes in Escherichia coli is a two-step process that involves the binding of ribosome modulation factor (RMF) and hibernation promotion factor (HPF). Lactococcus lactisMG1363 expresses a protein, YfiA(Ll), which associates with ribosomes in the stationary phase o

  18. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  19. Structure of the JmjC domain-containing protein NO66 complexed with ribosomal protein Rpl8

    Wang, Chengliang [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Chinese Academy of Sciences, Hefei, Anhui 230026, People’s Republic of (China); Zhang, Qiongdi [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Hang, Tianrong [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Chinese Academy of Sciences, Hefei, Anhui 230026, People’s Republic of (China); Tao, Yue [Shanghai Children’s Medical Center, 1678 Dongfang Road, Pudong, Shanghai 200120, People’s Republic of (China); Ma, Xukai [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Wu, Minhao; Zhang, Xuan, E-mail: xuanzbin@ustc.edu.cn; Zang, Jianye, E-mail: xuanzbin@ustc.edu.cn [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Chinese Academy of Sciences, Hefei, Anhui 230026, People’s Republic of (China)

    2015-08-28

    The structure of the complex of NO66 and Rpl8 was solved in the native state and NO66 recognizes the consensus motif NHXH . Tetramerization is required for efficient substrate binding and catalysis by NO66. The JmjC domain-containing proteins belong to a large family of oxygenases possessing distinct substrate specificities which are involved in the regulation of different biological processes, such as gene transcription, RNA processing and translation. Nucleolar protein 66 (NO66) is a JmjC domain-containing protein which has been reported to be a histone demethylase and a ribosome protein 8 (Rpl8) hydroxylase. The present biochemical study confirmed the hydroxylase activity of NO66 and showed that oligomerization is required for NO66 to efficiently catalyze the hydroxylation of Rpl8. The structures of NO66{sup 176–C} complexed with Rpl8{sup 204–224} in a tetrameric form and of the mutant protein M2 in a dimeric form were solved. Based on the results of structural and biochemical analyses, the consensus sequence motif NHXH recognized by NO66 was confirmed. Several potential substrates of NO66 were found by a BLAST search according to the consensus sequence motif. When binding to substrate, the relative positions of each subunit in the NO66 tetramer shift. Oligomerization may facilitate the motion of each subunit in the NO66 tetramer and affect the catalytic activity.

  20. Ribosomal DNA and Plastid Markers Used to Sample Fungal and Plant Communities from Wetland Soils Reveals Complementary Biotas

    Porter, Teresita M.; Shokralla, Shadi; Baird, Donald; Golding, G. Brian; Hajibabaei, Mehrdad

    2016-01-01

    Though the use of metagenomic methods to sample below-ground fungal communities is common, the use of similar methods to sample plants from their underground structures is not. In this study we use high throughput sequencing of the ribulose-bisphosphate carboxylase large subunit (rbcL) plastid marker to study the plant community as well as the internal transcribed spacer and large subunit ribosomal DNA (rDNA) markers to investigate the fungal community from two wetland sites. Observed community richness and composition varied by marker. The two rDNA markers detected complementary sets of fungal taxa and total fungal composition clustered according to primer rather than by site. The composition of the most abundant plants, however, clustered according to sites as expected. We suggest that future studies consider using multiple genetic markers, ideally generated from different primer sets, to detect a more taxonomically diverse suite of taxa compared with what can be detected by any single marker alone. Conclusions drawn from the presence of even the most frequently observed taxa should be made with caution without corroborating lines of evidence. PMID:26731732

  1. Structure of the JmjC domain-containing protein NO66 complexed with ribosomal protein Rpl8

    The structure of the complex of NO66 and Rpl8 was solved in the native state and NO66 recognizes the consensus motif NHXH . Tetramerization is required for efficient substrate binding and catalysis by NO66. The JmjC domain-containing proteins belong to a large family of oxygenases possessing distinct substrate specificities which are involved in the regulation of different biological processes, such as gene transcription, RNA processing and translation. Nucleolar protein 66 (NO66) is a JmjC domain-containing protein which has been reported to be a histone demethylase and a ribosome protein 8 (Rpl8) hydroxylase. The present biochemical study confirmed the hydroxylase activity of NO66 and showed that oligomerization is required for NO66 to efficiently catalyze the hydroxylation of Rpl8. The structures of NO66176–C complexed with Rpl8204–224 in a tetrameric form and of the mutant protein M2 in a dimeric form were solved. Based on the results of structural and biochemical analyses, the consensus sequence motif NHXH recognized by NO66 was confirmed. Several potential substrates of NO66 were found by a BLAST search according to the consensus sequence motif. When binding to substrate, the relative positions of each subunit in the NO66 tetramer shift. Oligomerization may facilitate the motion of each subunit in the NO66 tetramer and affect the catalytic activity

  2. Virus-induced gene silencing of the RPC5-like subunit of RNA polymerase III caused pleiotropic effects in Nicotiana benthamiana.

    Nemchinov, Lev G; Boutanaev, Alexander M; Postnikova, Olga A

    2016-01-01

    In eukaryotic cells, RNA polymerase III is highly conserved and transcribes housekeeping genes such as ribosomal 5S rRNA, tRNA and other small RNAs. The RPC5-like subunit is one of the 17 subunits forming RNAPIII and its exact functional roles in the transcription are poorly understood. In this work, we report that virus-induced gene silencing of transcripts encoding a putative RPC5-like subunit of the RNA Polymerase III in a model species Nicotiana benthamiana had pleiotropic effects, including but not limited to severe dwarfing appearance, chlorosis, nearly complete reduction of internodes and abnormal leaf shape. Using transcriptomic analysis, we identified genes and pathways affected by RPC5 silencing and thus presumably related to the cellular roles of the subunit as well as to the downstream cascade of reactions in response to partial loss of RNA Polymerase III function. Our results suggest that silencing of the RPC5L in N. benthamiana disrupted not only functions commonly associated with the core RNA Polymerase III transcripts, but also more diverse cellular processes, including responses to stress. We believe this is the first demonstration that activity of the RPC5 subunit is critical for proper functionality of RNA Polymerase III and normal plant development. PMID:27282827

  3. Domain Modeling: NP_663781.1 [SAHG[Archive

    Full Text Available NP_663781.1 chr1 Crystal structure of five 70s ribosomes from Escherichia Coli in c...omplex with protein Y. This file contains the 50s subunit of one 70s ribosome. The entire crystal structure

  4. Domain Modeling: NP_078816.2 [SAHG[Archive

    Full Text Available NP_078816.2 chr1 Crystal structure of five 70s ribosomes from Escherichia Coli in c...omplex with protein Y. This file contains the 50s subunit of one 70s ribosome. The entire crystal structure

  5. Differential effects of ribosomal proteins and Mg2+ ions on a conformational switch during 30S ribosome 5'-domain assembly.

    Abeysirigunawardena, Sanjaya C; Woodson, Sarah A

    2015-11-01

    Ribosomal protein S4 nucleates assembly of the 30S ribosome 5' and central domains, which is crucial for the survival of cells. Protein S4 changes the structure of its 16S rRNA binding site, passing through a non-native intermediate complex before forming native S4-rRNA contacts. Ensemble FRET was used to measure the thermodynamic stability of non-native and native S4 complexes in the presence of Mg(2+) ions and other 5'-domain proteins. Equilibrium titrations of Cy3-labeled 5'-domain RNA with Cy5-labeled protein S4 showed that Mg(2+) ions preferentially stabilize the native S4-rRNA complex. In contrast, ribosomal proteins S20 and S16 act by destabilizing the non-native S4-rRNA complex. The full cooperative switch to the native complex requires S4, S16, and S20 and is achieved to a lesser degree by S4 and S16. The resulting thermodynamic model for assembly of the 30S body illustrates how ribosomal proteins selectively bias the equilibrium between alternative rRNA conformations, increasing the cooperativity of rRNA folding beyond what can be achieved by Mg(2+) ions alone. PMID:26354770

  6. Immunochemical aspects of crotoxim and its subunits

    Crotamine and crotoxin with the subunits - phospholipase A and crotapotin - were obtained by purification from Crotalus durissus terrificus venom. Interaction studies of the subunits using crotalic antiserum, indicated that: crotoxin is formed of crotapotin and phospholipase A with the molar ratio of 1 to 1; using crotapotin 125I the presence of a soluble complex was shown with the same antiserum. Immunological precipitation reactions demonstrated that crotapotin is antigenic: crotapotin and phospholipase A presented similar antigenic determinants; crotoxin antiserum reacted with each one of the submits; when the subunits are mixed to form synthetic crotoxin some antigenic determinants are masked in the process of interaction. Crotamine, interacted with crotapotin 1:1, without hidden antigenic determinants crotapotin antigenic site seems to be formed by, at least, one lysine. Enzimatical activity of phospholipase A apreared to be dependent on some reaction conditions when its arginine residues are blocked. Tyrosines of phospholipase A are more susceptible to labelling with 131I than crotapotin. Gama irradiation of aqueous solutions of the subunits produced modifications in the ultraviolet spectra. A decrease of the enzymatic activity occured as a function of radiation dosis. Immunological activities of crotapotin and phospholipase A were not altered

  7. The structure of Aquifex aeolicus ribosomal protein S8 reveals a unique subdomain that contributes to an extremely tight association with 16S rRNA.

    Menichelli, Elena; Edgcomb, Stephen P; Recht, Michael I; Williamson, James R

    2012-01-20

    The assembly of ribonucleoprotein complexes occurs under a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from Aquifex aeolicus (AS8) is unique in that there is a 41-residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually high affinity for the 16S ribosomal RNA, characterized by a picomolar dissociation constant that is approximately 26,000-fold tighter than the equivalent interaction from Escherichia coli. Deletion analysis demonstrated that binding to the minimal site on helix 21 occurred at the same nanomolar affinity found for other bacterial species. The additional affinity required the presence of a three-helix junction between helices 20, 21, and 22. The crystal structure of AS8 was solved, revealing the helix-loop-helix geometry of the unique AS8 insertion region, while the core of the molecule is conserved with known S8 structures. The AS8 structure was modeled onto the structure of the 30S ribosomal subunit from E. coli, suggesting the possibility that the unique subdomain provides additional backbone and side-chain contacts between the protein and an unpaired base within the three-way junction of helices 20, 21, and 22. Point mutations in the protein insertion subdomain resulted in a significantly reduced RNA binding affinity with respect to wild-type AS8. These results indicate that the AS8-specific subdomain provides additional interactions with the three-way junction that contribute to the extremely tight binding to ribosomal RNA. PMID:22079365

  8. Influence of composition on optical and dispersion parameters of thermally evaporated non-crystalline Cd50S50−xSex thin films

    Non-crystalline thin films of chalcogenide Cd50S50−xSex system (30 ≤ x ≤ 50) were obtained by thermal evaporation technique onto a pre-cleaned glass substrate at a vacuum of 8.2 × 10−4 Pa. The deposition rate and film thickness were kept constant at about 8 nm/s and 200 nm, respectively. Amorphous/crystalline nature and chemical composition of films have been checked using X-ray diffraction and energy dispersive X-ray spectroscopy (EDX). Optical properties of thin films were investigated and studied using the corrected transmittance, T(λ) and corrected reflectance, R(λ) measurements. Obtained data reveal that, the indirect optical energy gap (Eg) was decreased from 2.21 to 1.57 eV. On the contrary, Urbach energy (band tail width), EU was found to be increased from 0.29 to 0.45 eV. This behavior is believed to be associated with the increase of Se-content instead of S-content in the thin films of Cd50S50−xSex system. Chemical bond approach model, CBA was used to analyze the obtained values of Eg and EU. Optical density, skin depth, extinction coefficient, refractive index and optical conductivity of chalcogenide CdSSe thin films were discussed as functions of Se-content. Using Wemple-DiDomenico single oscillator model, the refractive index dispersion and energy parameters and their dependence on Se content were studied. - Highlights: • Amorphous thin films of thickness 200 nm of Cd50S50−xSex (30 ≤ x ≤ 50) have prepared. • Optical properties, indirect optical energy gap and band tail width were studied. • Chemical bond approach, CBA was used to analyze the obtained values of Eg and EU. • New data of dispersion refractive index parameters were investigated and discussed

  9. Dynamic regulation of β1 subunit trafficking controls vascular contractility

    Leo, M. Dennis; Bannister, John P.; Narayanan, Damodaran; Nair, Anitha; Grubbs, Jordan E.; Gabrick, Kyle S.; Boop, Frederick A.; Jaggar, Jonathan H.

    2014-01-01

    Plasma membrane ion channels composed of pore-forming and auxiliary subunits regulate physiological functions in virtually all cell types. A conventional view is that ion channels assemble with their auxiliary subunits prior to surface trafficking of the multiprotein complex. Arterial myocytes express large-conductance Ca2+-activated potassium (BK) channel α and auxiliary β1 subunits that modulate contractility and blood pressure and flow. The data here show that although most BKα subunits ar...

  10. Evolution of Drosophila ribosomal protein gene core promoters

    Ma, Xiaotu; Zhang, Kangyu; Li, Xiaoman

    2008-01-01

    The coordinated expression of ribosomal protein genes (RPGs) has been well documented in many species. Previous analyses of RPG promoters focus only on Fungi and mammals. Recognizing this gap and using a comparative genomics approach, we utilize a motif-finding algorithm that incorporates cross-species conservation to identify several significant motifs in Drosophila RPG promoters. As a result, significant differences of the enriched motifs in RPG promoter are found among Drosophila, Fungi, a...

  11. Revised phylogeny of whales suggested by mitochondrial ribosomal DNA sequences

    Milinkovitch, M.C.; Orti, G.; Meyer, A.

    1993-01-01

    Living cetaceans are subdivided into two highly distinct suborders, Odontoceti (the echolocating toothed whales) and Mysticeti (the filter-feeding baleen whales), which are believed to have had a long independent history. Here we report the determination of DNA sequences from two mitochondrial ribosomal gene segments (930 base pairs per species) for 16 species of cetaceans, a perissodactyl and a sloth, and construct the first phylogeny for whales and dolphins based on explicit cladistic metho...

  12. Structural Insights into tRNA Dynamics on the Ribosome

    Xabier Agirrezabala

    2015-04-01

    Full Text Available High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation.

  13. Structural Insights into tRNA Dynamics on the Ribosome.

    Agirrezabala, Xabier; Valle, Mikel

    2015-01-01

    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation. PMID:25941930

  14. Structural Insights into tRNA Dynamics on the Ribosome

    Xabier Agirrezabala; Mikel Valle

    2015-01-01

    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation.

  15. Visualization of ribosomal RNA operon copy number distribution

    DasGupta Indrani; Wu Martin; Rastogi Rajat; Fox George E

    2009-01-01

    Abstract Background Results of microbial ecology studies using 16S rRNA sequence information can be deceiving due to differences in rRNA operon copy number and genome size of the detected organisms. It therefore will be useful for investigators to have a better understanding of how these two parameters differ in various organism types. In this study, the number of ribosomal operons and genome size were separately mapped onto a Bacterial phylogenetic tree. Results A representative Bacterial tr...

  16. Poliovirus tropism and attenuation are determined after internal ribosome entry

    Kauder, Steven E.; Racaniello, Vincent R

    2004-01-01

    Poliovirus replication is limited to a few organs, including the brain and spinal cord. This restricted tropism may be a consequence of organ-specific differences in translation initiation by the poliovirus internal ribosome entry site (IRES). A C-to-U mutation at base 472 in the IRES of the Sabin type 3 poliovirus vaccine strain, known to attenuate neurovirulence, may further restrict tropism by eliminating viral replication in the CNS. To determine the relationship between IRES-mediated tra...

  17. Ribosomal biosynthesis of α-amanitin in Galerina marginata

    Luo, Hong; Hallen-Adams, Heather E.; Scott-Craig, John S.; Walton, Jonathan D

    2011-01-01

    Amatoxins, including α-amanitin, are bicyclic octapeptides found in mushrooms (Agaricomycetes, Agaricales) of certain species in the genera Amanita, Galerina, Lepiota, and Conocybe. Amatoxins and the chemically similar phallotoxins are synthesized on ribosomes in Amanita bisporigera, Amanita phalloides, and Amanita ocreata. In order to determine if amatoxins are synthesized by a similar mechanism in another, distantly related mushroom, we obtained genome survey sequence data from a monokaryot...

  18. Ribosome biogenesis in replicating cells: Integration of experiment and theory.

    Earnest, Tyler M; Cole, John A; Peterson, Joseph R; Hallock, Michael J; Kuhlman, Thomas E; Luthey-Schulten, Zaida

    2016-10-01

    Ribosomes-the primary macromolecular machines responsible for translating the genetic code into proteins-are complexes of precisely folded RNA and proteins. The ways in which their production and assembly are managed by the living cell is of deep biological importance. Here we extend a recent spatially resolved whole-cell model of ribosome biogenesis in a fixed volume [Earnest et al., Biophys J 2015, 109, 1117-1135] to include the effects of growth, DNA replication, and cell division. All biological processes are described in terms of reaction-diffusion master equations and solved stochastically using the Lattice Microbes simulation software. In order to determine the replication parameters, we construct and analyze a series of Escherichia coli strains with fluorescently labeled genes distributed evenly throughout their chromosomes. By measuring these cells' lengths and number of gene copies at the single-cell level, we could fit a statistical model of the initiation and duration of chromosome replication. We found that for our slow-growing (120 min doubling time) E. coli cells, replication was initiated 42 min into the cell cycle and completed after an additional 42 min. While simulations of the biogenesis model produce the correct ribosome and mRNA counts over the cell cycle, the kinetic parameters for transcription and degradation are lower than anticipated from a recent analytical time dependent model of in vivo mRNA production. Describing expression in terms of a simple chemical master equation, we show that the discrepancies are due to the lack of nonribosomal genes in the extended biogenesis model which effects the competition of mRNA for ribosome binding, and suggest corrections to parameters to be used in the whole-cell model when modeling expression of the entire transcriptome. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 735-751, 2016. PMID:27294303

  19. Recent Advances in Subunit Vaccine Carriers.

    Vartak, Abhishek; Sucheck, Steven J

    2016-01-01

    The lower immunogenicity of synthetic subunit antigens, compared to live attenuated vaccines, is being addressed with improved vaccine carriers. Recent reports indicate that the physio-chemical properties of these carriers can be altered to achieve optimal antigen presentation, endosomal escape, particle bio-distribution, and cellular trafficking. The carriers can be modified with various antigens and ligands for dendritic cells targeting. They can also be modified with adjuvants, either covalently or entrapped in the matrix, to improve cellular and humoral immune responses against the antigen. As a result, these multi-functional carrier systems are being explored for use in active immunotherapy against cancer and infectious diseases. Advancing technology, improved analytical methods, and use of computational methodology have also contributed to the development of subunit vaccine carriers. This review details recent breakthroughs in the design of nano-particulate vaccine carriers, including liposomes, polymeric nanoparticles, and inorganic nanoparticles. PMID:27104575

  20. Epigeneitc silencing of ribosomal RNA genes by Mybbp1a

    Tan Bertrand

    2012-06-01

    Full Text Available Abstract Background Transcription of the ribosomal RNA gene repeats by Pol I occurs in the nucleolus and is a fundamental step in ribosome biogenesis and protein translation. Due to tight coordination between ribosome biogenesis and cell proliferation, transcription of rRNA and stable maintenance of rDNA clusters are thought to be under intricate control by intercalated mechanisms, particularly at the epigenetic level. Methods and Results Here we identify the nucleolar protein Myb-binding protein 1a (Mybbp1a as a novel negative regulator of rRNA expression. Suppression of rDNA transcription by Mybbp1a was linked to promoter regulation as illustrated by its binding to the chromatin around the hypermethylated, inactive rDNA gene promoters. Our data further showed that downregulation of Mybbp1a abrogated the local DNA methylation levels and histone marks associated with gene silencing, and altered the promoter occupancy of various factors such UBF and HDACs, consequently leading to elevated rRNA expression. Mechanistically, we propose that Mybbp1a maintains rDNA repeats in a silenced state while in association with the negative epigenetic modifiers HDAC1/2. Conclusions Results from our present work reveal a previously unrecognized co-repressor role of Mybbp1a in rRNA expression. They are further consistent with the scenario that Mybbp1a is an integral constituent of the rDNA epigenetic regulation that underlies the balanced state of rDNA clusters.

  1. Further characterization of ribosome binding to thylakoid membranes

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [3H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  2. Simulation and analysis of single-ribosome translation

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  3. Structure of Vibrio cholerae ribosome hibernation promoting factor

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  4. Single Molecule Fluorescence Measurements of Ribosomal Translocation Dynamics

    Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskarin; Cabral, Diana; Liu, Hanqing; Wang, Yuhong; Zhang, Haibo; Rosenblum, Gabriel; Smilansky, Zeev; Goldman, Yale E.; Cooperman, Barry S.

    2011-01-01

    We employ single-molecule fluorescence resonance energy transfer (smFRET) to study structural dynamics over the first two elongation cycles of protein synthesis, using ribosomes containing either Cy3-labeled ribosomal protein L11 and A- or P-site Cy5-labeled tRNA or Cy3 and Cy5 labeled tRNAs. Pre-translocation (PRE) complexes demonstrate fluctuations between classical and hybrid forms, with concerted motions of tRNAs away from L11 and from each other when classical complex converts to hybrid complex. EF-G·GTP binding to both hybrid and classical PRE complexes halts these fluctuations prior to catalyzing translocation to form the post-translocation (POST) complex. EF-G dependent translocation from the classical PRE complex proceeds via transient formation of a short-lived hybrid intermediate. A-site binding of either EF-G to the PRE complex or of aminoacyl-tRNA·EF-Tu ternary complex to the POST complex markedly suppresses ribosome conformational lability. PMID:21549313

  5. Single-molecule fluorescence measurements of ribosomal translocation dynamics.

    Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskarin; Cabral, Diana; Liu, Hanqing; Wang, Yuhong; Zhang, Haibo; Rosenblum, Gabriel; Smilansky, Zeev; Goldman, Yale E; Cooperman, Barry S

    2011-05-01

    We employ single-molecule fluorescence resonance energy transfer (smFRET) to study structural dynamics over the first two elongation cycles of protein synthesis, using ribosomes containing either Cy3-labeled ribosomal protein L11 and A- or P-site Cy5-labeled tRNA or Cy3- and Cy5-labeled tRNAs. Pretranslocation (PRE) complexes demonstrate fluctuations between classical and hybrid forms, with concerted motions of tRNAs away from L11 and from each other when classical complex converts to hybrid complex. EF-G⋅GTP binding to both hybrid and classical PRE complexes halts these fluctuations prior to catalyzing translocation to form the posttranslocation (POST) complex. EF-G dependent translocation from the classical PRE complex proceeds via transient formation of a short-lived hybrid intermediate. A-site binding of either EF-G to the PRE complex or of aminoacyl-tRNA⋅EF-Tu ternary complex to the POST complex markedly suppresses ribosome conformational lability. PMID:21549313

  6. Detecting actively translated open reading frames in ribosome profiling data.

    Calviello, Lorenzo; Mukherjee, Neelanjan; Wyler, Emanuel; Zauber, Henrik; Hirsekorn, Antje; Selbach, Matthias; Landthaler, Markus; Obermayer, Benedikt; Ohler, Uwe

    2016-02-01

    RNA-sequencing protocols can quantify gene expression regulation from transcription to protein synthesis. Ribosome profiling (Ribo-seq) maps the positions of translating ribosomes over the entire transcriptome. We have developed RiboTaper (available at https://ohlerlab.mdc-berlin.de/software/), a rigorous statistical approach that identifies translated regions on the basis of the characteristic three-nucleotide periodicity of Ribo-seq data. We used RiboTaper with deep Ribo-seq data from HEK293 cells to derive an extensive map of translation that covered open reading frame (ORF) annotations for more than 11,000 protein-coding genes. We also found distinct ribosomal signatures for several hundred upstream ORFs and ORFs in annotated noncoding genes (ncORFs). Mass spectrometry data confirmed that RiboTaper achieved excellent coverage of the cellular proteome. Although dozens of novel peptide products were validated in this manner, few of the currently annotated long noncoding RNAs appeared to encode stable polypeptides. RiboTaper is a powerful method for comprehensive de novo identification of actively used ORFs from Ribo-seq data. PMID:26657557

  7. MspA Nanopores from Subunit Dimers

    Pavlenok, Mikhail; Derrington, Ian M.; Gundlach, Jens H.; Niederweis, Michael

    2012-01-01

    Mycobacterium smegmatis porin A (MspA) forms an octameric channel and represents the founding member of a new family of pore proteins. Control of subunit stoichiometry is important to tailor MspA for nanotechnological applications. In this study, two MspA monomers were connected by linkers ranging from 17 to 62 amino acids in length. The oligomeric pore proteins were purified from M. smegmatis and were shown to form functional channels in lipid bilayer experiments. These results indicated tha...

  8. Expression of Telomerase Subunits in Gastric Cancer

    CHEN Fenghua; HU Lihua; LI Yirong; WANG Lin

    2005-01-01

    To detect the expression of telomerase subunits human telomerase reverse transcriptase, human telomerase associated protein 1 and human telomerase RNA) in gastric cancer and to examine the role that different telomerase subunits play in the gastric carcinogenesis, reverse transcription-polymerase chain reaction (RT-PCR) was used to detect telomerase subunits messenger RNA in 24 samples of gastric cancer and corresponding non-cancerous tissue. The results showed that the positive rate of hTERT mRNA from gastric cancer and corresponding non-cancerous tissues was 100 % and 25 %, respectively. The former was significantly higher than the latter (χ2 =26.4, P<0.01). The positive rate of hTEP1 mRNA from gastric cancer and corresponding non-cancerous tissues was 100 % and 91.7 %, respectively and no significant difference was found between them (χ2 =2.1, P>0.05). The positive rates of hTR for gastric cancer and corresponding non-cancerous tissues were both 100 % and no significant difference existed between them. It is concluded that in contrast to hTEP1 and hTR, the up-regulation of hTERT mRNA expression may play a more important role in the development of gastric cancer.

  9. Mass spectrometric and bioinformatics approaches to characterizing of cyclic non-ribosomal peptides and ribosomally encoded peptide antibiotic

    Liu, Wei-Ting

    2009-01-01

    Natural products are a crucial component in drug discovery because of their considerable pharmaceutical properties. Cyclic non-ribosomally peptides are one category of natural products featured by containing non-standard amino acids and lactam or lactone structures, thus increasing the complexity of the resulting tandem mass spectrometry data. Cyclosporin, microcystins and nodularins all are well-known examples and have notable pharmacologically importance. In this current work, by collaborat...

  10. Na+ channel β subunits: Overachievers of the ion channel family

    LoriLIsom; WilliamJBrackenbury

    2011-01-01

    Voltage gated Na+ channels (VGSCs) in mammals contain a pore-forming α subunit and one or more β subunits. There are five mammalian β subunits in total: β1, β1B, β2, β3, and β4, encoded by four genes: SCN1B-SCN4B. With the exception of the SCN1B splice variant, β1B, the β subunits are type I topology transmembrane proteins. In contrast, β1B lacks a transmembrane domain and is a secreted protein. A growing body of work shows that VGSC β subunits are multifunctional. While they do not form the...

  11. Drug: D09809 [KEGG MEDICUS

    Full Text Available D09809 Drug Tylosin acetate isovalerte (JAN) Antibacterial 23S rRNA of 50S ribosomal subunit, pr ... subunit inhibitor [KO:K01980] Macrolides Tylosin; Veterinary ... D09809 Tylosin acetate isovalerte (JAN) PubChem: 1 ...

  12. Cyanobacterial ribosomal RNA genes with multiple, endonuclease-encoding group I introns

    Turner Seán

    2007-09-01

    Full Text Available Abstract Background Group I introns are one of the four major classes of introns as defined by their distinct splicing mechanisms. Because they catalyze their own removal from precursor transcripts, group I introns are referred to as autocatalytic introns. Group I introns are common in fungal and protist nuclear ribosomal RNA genes and in organellar genomes. In contrast, they are rare in all other organisms and genomes, including bacteria. Results Here we report five group I introns, each containing a LAGLIDADG homing endonuclease gene (HEG, in large subunit (LSU rRNA genes of cyanobacteria. Three of the introns are located in the LSU gene of Synechococcus sp. C9, and the other two are in the LSU gene of Synechococcus lividus strain C1. Phylogenetic analyses show that these introns and their HEGs are closely related to introns and HEGs located at homologous insertion sites in organellar and bacterial rDNA genes. We also present a compilation of group I introns with homing endonuclease genes in bacteria. Conclusion We have discovered multiple HEG-containing group I introns in a single bacterial gene. To our knowledge, these are the first cases of multiple group I introns in the same bacterial gene (multiple group I introns have been reported in at least one phage gene and one prophage gene. The HEGs each contain one copy of the LAGLIDADG motif and presumably function as homodimers. Phylogenetic analysis, in conjunction with their patchy taxonomic distribution, suggests that these intron-HEG elements have been transferred horizontally among organelles and bacteria. However, the mode of transfer and the nature of the biological connections among the intron-containing organisms are unknown.

  13. RPL41, a Small Ribosomal Peptide Deregulated in Tumors, Is Essential for Mitosis and Centrosome Integrity

    Shan Wang

    2010-03-01

    Full Text Available Ribosomal large subunit protein RPL41 is a basic (positively charged peptide consisting of only 25 amino acids. An antisense-based functional screening revealed that the down-regulation of RPL41 led to an anchorage-independent growth of NIH3T3 cells in soft agar plates. RPL41 depletion with gene-specific small interfering RNA also resulted in malignant transformation of NIH3T3 cells including increased tumor growth in mice. RPL41 deletion was detected in 59% of tumor cell lines by fluorescence in situ hybridization analyses and RPL41 down-regulation in 75% of primary breast cancers by real-time quantitative reverse transcription-polymerase chain reaction. These studies suggest a tumor suppression role for RPL41. By mass spectrometry, RPL41 was associated with several cytoskeleton components including tubulin β, γ, and myosin IIA, which was confirmed by Western blot analysis on both cellular lysis and individually in vitro-expressed proteins. RPL41 also bound directly to polymerized tubulins. Cells overexpressing a GFP-RPL41 were resistant to nocodazole-induced microtubule depolymerization. A synthetic RPL41 induced cellular α-tubulin acetylation and G2/M cell cycle arrest. These results indicate a stabilizing role of RPL41 on microtubule. Microtubule spindles are essential for chromosome segregation during mitosis. Cells with RPL41 knock-down showed abnormal spindles, frequent failure of cytokinesis, and formation of polynuclear cells. In interphase cells, RPL41-depleted cells had premature splitting of centrosome. Our results provide evidence that RPL41 is a microtubule-associated protein essential for functional spindles and for the integrity of centrosome and that the abnormal mitosis and disrupted centrosome associated with the RPL41 down-regulation may be related to malignant transformation.

  14. IDENTIFICATION OF THREE FRUIT-ROT FUNGI OF BANANA BY 28S RIBOSOMAL DNA SEQUENCING

    Supriya Sarkar*, S Girisham and SM Reddy

    2013-01-01

    Full Text Available The aim of present investigation was to identify three fruit-rot fungi-Macrophomina phaseolina (Tassi Goid, Fusarium oxysporum (Schlechtend and Nigrospora oryzae (Berk and Br. Petch isolated from banana fruits [Rasthali (Silk AAB and Cavendish (AAA varieties]. Out of different fungal genera isolated, the above fungi were responsible for maximum loss of banana fruits as they spread rapidly into the fruit pulp and deteriorated the fruits. The amplification studies of fragment of D2 region of LSU (Large subunit 28S rDNA gene of three fungi understudy was carried out using PCR technique. Based on the nucleotide homology and phylogenetic analysis, the fungus M. phaseolina was identified as M. phaseolina strain R-4242 sp. (Genbank accession number: FJ415068.1, F. oxysporum as Fusarium sp.QJC-1403 5.8S ribosomal RNA gene sp. (Genbank accession number: EU193176.1 and N. oryzae as N. oryzae NRRL: 54030 sp. (Genbank accession number: GQ328855.1. Nucleic acid sequencing provides more objective separation of genera and species than that provided by the conventional techniques. This technique can best be used for the identification of organisms that could not be identified satisfactorily by their microscopic morphological features. Genetic characterization of plant pathogens prevalent in an area is necessary for efficient management and increased crop productivity. The data presented may help researchers to understand the host-pathogen interactions indetail in banana, to design effective strategies for deployment of resistant genes in banana (Musa paradisiaca L. growing regions in the country and worldwide.

  15. Rapid identification of Helicoverpa armigera and Helicoverpa zea (Lepidoptera: Noctuidae) using ribosomal RNA internal transcribed spacer 1.

    Perera, Omaththage P; Allen, Kerry C; Jain, Devendra; Purcell, Matthew; Little, Nathan S; Luttrell, Randall G

    2015-01-01

    Rapid identification of invasive species is crucial for deploying management strategies to prevent establishment. Recent Helicoverpa armigera (Hübner) invasions and subsequent establishment in South America has increased the risk of this species invading North America. Morphological similarities make differentiation of H. armigera from the native Helicoverpa zea (Boddie) difficult. Characteristics of adult male genitalia and nucleotide sequence differences in mitochondrial DNA are two of the currently available methods to differentiate these two species. However, current methods are likely too slow to be employed as rapid detection methods. In this study, conserved differences in the internal transcribed spacer 1 (ITS1) of the ribosomal RNA genes were used to develop species-specific oligonucleotide primers that amplified ITS1 fragments of 147 and 334 bp from H. armigera and H. zea, respectively. An amplicon (83 bp) from a conserved region of 18S ribosomal RNA subunit served as a positive control. Melting temperature differences in ITS1 amplicons yielded species-specific dissociation curves that could be used in high resolution melt analysis to differentiate the two Helicoverpa species. In addition, a rapid and inexpensive procedure for obtaining amplifiable genomic DNA from a small amount of tissue was identified. Under optimal conditions, the process was able to detect DNA from one H. armigera leg in a pool of 25 legs. The high resolution melt analysis combined with rapid DNA extraction could be used as an inexpensive method to genetically differentiate large numbers of H. armigera and H. zea using readily available reagents. PMID:26516166

  16. Mammalian sperm translate nuclear-encoded proteins by mitochondrial-type ribosomes

    Gur, Yael; Breitbart, Haim

    2006-01-01

    It is widely accepted that spermatozoa are translationally silent. The present study demonstrates, for the first time, incorporation of labeled amino acids into polypeptides during sperm capacitation, which was completely inhibited by mitochondrial translation inhibitors but not by the cytoplasmic translation inhibitor. Unlike 80S cytoplasmic ribosomes, 55S mitochondrial ribosomes were present in polysomal fractions, indicating that these ribosomes are actively involved in protein translation...

  17. Amicoumacin A induces cancer cell death by targeting the eukaryotic ribosome

    Prokhorova, Irina V.; Akulich, Kseniya A.; Desislava S. Makeeva; Osterman, Ilya A.; Skvortsov, Dmitry A.; Sergiev, Petr V.; Dontsova, Olga A.; Gulnara Yusupova; Yusupov, Marat M; Dmitriev, Sergey E

    2016-01-01

    Amicoumacin A is an antibiotic that was recently shown to target bacterial ribosomes. It affects translocation and provides an additional contact interface between the ribosomal RNA and mRNA. The binding site of amicoumacin A is formed by universally conserved nucleotides of rRNA. In this work, we showed that amicoumacin A inhibits translation in yeast and mammalian systems by affecting translation elongation. We determined the structure of the amicoumacin A complex with yeast ribosomes at a ...

  18. Structural Basis for Ribosome Recruitment and Manipulation by a Viral IRES RNA

    Pfingsten, Jennifer S; Costantino, David A.; Kieft, Jeffrey S.

    2006-01-01

    Canonical cap-dependent translation initiation requires a large number of protein factors that act in a stepwise assembly process. In contrast, internal ribosomal entry sites (IRESs) are cis-acting RNAs that in some cases completely supplant these factors by recruiting and activating the ribosome using a single structured RNA. Here we present the crystal structures of the ribosome-binding domain from a Dicistroviridae intergenic region IRES at 3.1 angstrom resolution, providing a view of the ...

  19. Engineering the rRNA decoding site of eukaryotic cytosolic ribosomes in bacteria

    Hobbie, S N; Kalapala, S K; Akshay, S.; Bruell, C M; S. Schmidt; Dabow, S; Vasella, A; Sander, P; Böttger, E C

    2007-01-01

    Structural and genetic studies on prokaryotic ribosomes have provided important insights into fundamental aspects of protein synthesis and translational control and its interaction with ribosomal drugs. Comparable mechanistic studies in eukaryotes are mainly hampered by the absence of both high-resolution crystal structures and efficient genetic models. To study the interaction of aminoglycoside antibiotics with selected eukaryotic ribosomes, we replaced the bacterial drug binding site in 16S...

  20. Targeted proteomics reveals compositional dynamics of 60S pre-ribosomes after nuclear export

    Altvater, Martin; Chang, Yiming; Melnik, Andre; Occhipinti, Laura; Schütz, Sabina; Rothenbusch, Ute; Picotti, Paola; Panse, Vikram Govind

    2012-01-01

    Construction and intracellular targeting of eukaryotic pre-ribosomal particles involve a multitude of diverse transiently associating trans-acting assembly factors, energy-consuming enzymes, and transport factors. The ability to rapidly and reliably measure co-enrichment of multiple factors with maturing pre-ribosomal particles presents a major biochemical bottleneck towards revealing their function and the precise contribution of >50 energy-consuming steps that drive ribosome assembly. Here,...

  1. Detecting Ricin: A Sensitive Luminescent Assay for Ricin A-chain Ribosome Depurination Kinetics+

    Sturm, Matthew B.; Schramm, Vern L.

    2009-01-01

    Ricin is a family member of the lethal ribosome-inactivating proteins (RIP) found in plants. Ricin toxin A-chain (RTA) from castor beans catalyzes the hydrolytic depurination of a single base from a GAGA tetraloop of eukaryotic ribosomal RNA to release a single adenine from the sarcin-ricin loop (SRL). Protein synthesis is inhibited by loss of elongation factor binding resulting in cell death. We report a sensitive coupled assay for the measurement of adenine released from ribosomes or small ...

  2. Visualising ribosome profiling and using it for reading frame detection and exploration of eukaryotic translation initiation

    Mannion Michel, Audrey

    2013-01-01

    Ribosome profiling (ribo-seq) is a recently developed technique that provides genomewide information on protein synthesis (GWIPS) in vivo. The high resolution of ribo-seq is one of the exciting properties of this technique. In Chapter 2, I present a computational method that utilises the sub-codon precision and triplet periodicity of ribosome profiling data to detect transitions in the translated reading frame. Application of this method to ribosome profiling data generated for human HeLa cel...

  3. Ribosome Profiling Provides Evidence that Large Noncoding RNAs Do Not Encode Proteins

    Guttman, Mitchell; Russell, Pamela; Ingolia, Nicholas T.; Weissman, Jonathan S.; Lander, Eric S.; Lander, Eric S.

    2013-01-01

    Large noncoding RNAs are emerging as an important component in cellular regulation. Considerable evidence indicates that these transcripts act directly as functional RNAs rather than through an encoded protein product. However, a recent study of ribosome occupancy reported that many large intergenic ncRNAs (lincRNAs) are bound by ribosomes, raising the possibility that they are translated into proteins. Here, we show that classical noncoding RNAs and 5′ UTRs show the same ribosome occupancy a...

  4. Implications of macromolecular crowding and reducing conditions for in vitro ribosome construction

    Fritz, Brian R; Jamil, Osman K.; Jewett, Michael C

    2015-01-01

    In vitro construction of Escherichia coli ribosomes could elucidate a deeper understanding of these complex molecular machines and make possible the production of synthetic variants with new functions. Toward this goal, we recently developed an integrated synthesis, assembly and translation (iSAT) system that allows for co-activation of ribosomal RNA (rRNA) transcription and ribosome assembly, mRNA transcription and protein translation without intact cells. Here, we discovered that macromolec...

  5. MspA nanopores from subunit dimers.

    Mikhail Pavlenok

    Full Text Available Mycobacterium smegmatis porin A (MspA forms an octameric channel and represents the founding member of a new family of pore proteins. Control of subunit stoichiometry is important to tailor MspA for nanotechnological applications. In this study, two MspA monomers were connected by linkers ranging from 17 to 62 amino acids in length. The oligomeric pore proteins were purified from M. smegmatis and were shown to form functional channels in lipid bilayer experiments. These results indicated that the peptide linkers did not prohibit correct folding and localization of MspA. However, expression levels were reduced by 10-fold compared to wild-type MspA. MspA is ideal for nanopore sequencing due to its unique pore geometry and its robustness. To assess the usefulness of MspA made from dimeric subunits for DNA sequencing, we linked two M1-MspA monomers, whose constriction zones were modified to enable DNA translocation. Lipid bilayer experiments demonstrated that this construct also formed functional channels. Voltage gating of MspA pores made from M1 monomers and M1-M1 dimers was identical indicating similar structural and dynamic channel properties. Glucose uptake in M. smegmatis cells lacking porins was restored by expressing the dimeric mspA M1 gene indicating correct folding and localization of M1-M1 pores in their native membrane. Single-stranded DNA hairpins produced identical ionic current blockades in pores made from monomers and subunit dimers demonstrating that M1-M1 pores are suitable for DNA sequencing. This study provides the proof of principle that production of single-chain MspA pores in M. smegmatis is feasible and paves the way for generating MspA pores with altered stoichiometries. Subunit dimers enable better control of the chemical and physical properties of the constriction zone of MspA. This approach will be valuable both in understanding transport across the outer membrane in mycobacteria and in tailoring MspA for nanopore

  6. MspA nanopores from subunit dimers.

    Pavlenok, Mikhail; Derrington, Ian M; Gundlach, Jens H; Niederweis, Michael

    2012-01-01

    Mycobacterium smegmatis porin A (MspA) forms an octameric channel and represents the founding member of a new family of pore proteins. Control of subunit stoichiometry is important to tailor MspA for nanotechnological applications. In this study, two MspA monomers were connected by linkers ranging from 17 to 62 amino acids in length. The oligomeric pore proteins were purified from M. smegmatis and were shown to form functional channels in lipid bilayer experiments. These results indicated that the peptide linkers did not prohibit correct folding and localization of MspA. However, expression levels were reduced by 10-fold compared to wild-type MspA. MspA is ideal for nanopore sequencing due to its unique pore geometry and its robustness. To assess the usefulness of MspA made from dimeric subunits for DNA sequencing, we linked two M1-MspA monomers, whose constriction zones were modified to enable DNA translocation. Lipid bilayer experiments demonstrated that this construct also formed functional channels. Voltage gating of MspA pores made from M1 monomers and M1-M1 dimers was identical indicating similar structural and dynamic channel properties. Glucose uptake in M. smegmatis cells lacking porins was restored by expressing the dimeric mspA M1 gene indicating correct folding and localization of M1-M1 pores in their native membrane. Single-stranded DNA hairpins produced identical ionic current blockades in pores made from monomers and subunit dimers demonstrating that M1-M1 pores are suitable for DNA sequencing. This study provides the proof of principle that production of single-chain MspA pores in M. smegmatis is feasible and paves the way for generating MspA pores with altered stoichiometries. Subunit dimers enable better control of the chemical and physical properties of the constriction zone of MspA. This approach will be valuable both in understanding transport across the outer membrane in mycobacteria and in tailoring MspA for nanopore sequencing of DNA. PMID

  7. Hypersecretion of the alpha-subunit in clinically non-functioning pituitary adenomas: Diagnostic accuracy is improved by adding alpha-subunit/gonadotropin ratio to levels of alpha-subunit

    Andersen, Marianne; Ganc-Petersen, Joanna; Jørgensen, Jens O L;

    2010-01-01

    In vitro, the majority of clinically non-functioning pituitary adenomas (NFPAs) produce gonadotropins or their alpha-subunit; however, in vivo, measurements of alpha-subunit levels may not accurately detect the hypersecretion of the alpha-subunit.......In vitro, the majority of clinically non-functioning pituitary adenomas (NFPAs) produce gonadotropins or their alpha-subunit; however, in vivo, measurements of alpha-subunit levels may not accurately detect the hypersecretion of the alpha-subunit....

  8. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  9. Various mechanisms in cyclopeptide production from precursors synthesized independently of non-ribosomal peptide synthetases

    Wenyan Xu; Liling Li; Liangcheng Du; Ninghua Tan

    2011-01-01

    An increasing number of cyclopeptides have been discovered as products of ribosomal synthetic pathway.The biosynthetic study of these cyclopeptides has revealed interesting new mechanisms for cyclization.This review highlighted the recent discoveries in cyclization mechanisms for cyclopeptides synthesized independently of non-ribosomal peptide synthetases,including endopeptidase-catalyzed cyclization,intein-mediated cyclization,and peptide synthetase-catalyzed cyclization.This information may help to design hybrid ribosomal and non-ribosomal biosynthetic systems to produce novel cyclopeptides with various bioactivities.

  10. γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

    γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg2+-content and γ-resistance is discussed. (orig.)

  11. Modeling of ribosome dynamics on a ds-mRNA under an external load

    Shakiba, Bahareh; Dayeri, Maryam; Mohammad-Rafiee, Farshid

    2016-07-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to the recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force and the translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  12. Modeling of Ribosome Dynamics on a ds-mRNA under an External Load

    Shakiba, Bahareh; Mohammad-Rafiee, Farshid

    2016-01-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force, and translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  13. Heritability and Variability in Ribosomal RNA Genes of Vicia faba

    Rogers, Scott O; Bendich, Arnold J.

    1987-01-01

    We have compared the restriction patterns and copy numbers of ribosomal RNA genes (rDNA) between and within individuals of Vicia faba . While the EcoRI blot-hybridization patterns changed only after one to two generations, copy number changes were found among different tissues of the same plant. Copy number differences among individuals in the population were as great as 95-fold, whereas as much as a 12-fold variation was seen among tissues of the same plant. Among individual F1 progeny from ...

  14. Advances in the Research of AMPK and its Subunit Genes

    R.S. Jiang

    2013-01-01

    Full Text Available AMP-activated kinase (AMPK is a heterotrimeric complex composed of three subunits and is the core energy sensor of the cell. The AMPK activity is important for survival during periods of stress and starvation and also has implications in type II diabetes, obesity, metabolic syndrome, longevity and cancer, etc. The activation of AMPK is triggered through binding of Adenosine Monophosphate Activated Proteins (AMP to the Bateman domains of the gamma subunit, leading to increased phosphorylation of the threonine 172 on the alpha subunit by inducing allosteric activation and inhibiting dephosphorylation. AMPK and its subunits have been the focuses of many researchers dealing with genetic and metabolic issues. The study makes a comprehensive review on the structure, function, distribution, enzyme activity, the genetic mutation and other aspects of AMPK and its subunit genes, with the aim to outline main aspects of present researches on AMPK and its subunits in animal genetics.

  15. Comparative Analysis of Eubacterial DNA Polymerase Ⅲ Alpha Subunits

    Xiao-Qian Zhao; Jian-Fei Hu; Jun Yu

    2006-01-01

    DNA polymerase Ⅲ is one of the five eubacterial DNA polymerases that is responsible for the replication of DNA duplex. Among the ten subunits of the DNA polymerase Ⅲ core enzyme, the alpha subunit catalyzes the reaction for polymerizing both DNA strands. In this study, we extracted genomic sequences of the alpha subunit from 159 sequenced eubacterial genomes, and carried out sequencebased phylogenetic and structural analyses. We found that all eubacterial genomes have one or more alpha subunits, which form either homodimers or heterodimers.Phylogenetic and domain structural analyses as well as copy number variations of the alpha subunit in each bacterium indicate the classification of alpha subunit into four basic groups: polC, dnaE1, dnaE2, and dnaE3. This classification is of essence in genome composition analysis. We also consolidated the naming convention to avoid further confusion in gene annotations.

  16. Exploring accessibility of structural elements of the mammalian 40S ribosomal mRNA entry channel at various steps of translation initiation.

    Sharifulin, Dmitri E; Bartuli, Yulia S; Meschaninova, Maria I; Ven'yaminova, Aliya G; Graifer, Dmitri M; Karpova, Galina G

    2016-10-01

    In this work, we studied how the accessibility of structural elements of the mammalian 40S ribosomal mRNA entry channel, ribosomal protein (rp) uS3 and helix (h) 16 of the 18S rRNA, changes upon the translation initiation. In particular, we examined the accessibility of rp uS3 for binding of unstructured RNAs and of riboses in h16 towards attack with benzoyl cyanide (BzCN) in complexes assembled in rabbit reticulocyte lysate utilizing synthetic oligoribonucleotides as well as full-length and truncated up to the initiation AUG codon hepatitis C virus IRES as model mRNAs. With both mRNA types, the rp uS3 peptide recognizing single-stranded RNAs was shown to become shielded only in those 48S preinitiation complexes (PICs) that contained eIF3j bound to 40S subunit in the area between the decoding site and the mRNA entry channel. Chemical probing with BzCN revealed that h16 in the 48S PICs containing eIF3j or scanning factor DHX29 is strongly shielded; the effect was observed with all the mRNAs used, and h16 remained protected as well in 80S post-initiation complexes lacking these factors. Altogether, the obtained results allowed us to suggest that eIF3j bound at the 48S PICs makes the rp uS3 inaccessible for binding of RNAs and this factor subunit is responsible for the decrease of h16 conformational flexibility; the latter is manifested as reduced accessibility of h16 to BzCN. Thus, our findings provide new insights into how eIF3j is implicated in ensuring the proper conformation of the mRNA entry channel, thereby facilitating mRNA loading. PMID:27346718

  17. The trp RNA-binding attenuation protein of Bacillus subtilis regulates translation of the tryptophan transport gene trpP (yhaG) by blocking ribosome binding.

    Yakhnin, Helen; Zhang, Hong; Yakhnin, Alexander V; Babitzke, Paul

    2004-01-01

    Expression of the Bacillus subtilis tryptophan biosynthetic genes (trpEDCFBA and pabA [trpG]) is regulated in response to tryptophan by TRAP, the trp RNA-binding attenuation protein. TRAP-mediated regulation of the tryptophan biosynthetic genes includes a transcription attenuation and two distinct translation control mechanisms. TRAP also regulates translation of trpP (yhaG), a single-gene operon that encodes a putative tryptophan transporter. Its translation initiation region contains triplet repeats typical of TRAP-regulated mRNAs. We found that regulation of trpP and pabA is unaltered in a rho mutant strain. Results from filter binding and gel mobility shift assays demonstrated that TRAP binds specifically to a segment of the trpP transcript that includes the untranslated leader and translation initiation region. While the affinities of TRAP for the trpP and pabA transcripts are similar, TRAP-mediated translation control of trpP is much more extensive than for pabA. RNA footprinting revealed that the trpP TRAP binding site consists of nine triplet repeats (five GAG, three UAG, and one AAG) that surround and overlap the trpP Shine-Dalgarno (S-D) sequence and translation start codon. Results from toeprint and RNA-directed cell-free translation experiments indicated that tryptophan-activated TRAP inhibits TrpP synthesis by preventing binding of a 30S ribosomal subunit. Taken together, our results establish that TRAP regulates translation of trpP by blocking ribosome binding. Thus, TRAP coordinately regulates tryptophan synthesis and transport by three distinct mechanisms: attenuation transcription of the trpEDCFBA operon, promoting formation of the trpE S-D blocking hairpin, and blocking ribosome binding to the pabA and trpP transcripts. PMID:14702295

  18. Autocatalytic Processing of m-AAA Protease Subunits in Mitochondria

    Koppen, Mirko; Bonn, Florian; Ehses, Sarah; Langer, Thomas

    2009-01-01

    m-AAA proteases are ATP-dependent proteolytic machines in the inner membrane of mitochondria which are crucial for the maintenance of mitochondrial activities. Conserved nuclear-encoded subunits, termed paraplegin, Afg3l1, and Afg3l2, form various isoenzymes differing in their subunit composition in mammalian mitochondria. Mutations in different m-AAA protease subunits are associated with distinct neuronal disorders in human. However, the biogenesis of m-AAA protease complexes or of individua...

  19. Antibodies against ribosomal protein S29 (RPS29) fused with glutathione's transferase specially react with native RPS29 in mouse and human cells

    Liu Jia; Zhang Junlei; Han Junfeng; Li Dongying; Jian Rui; Rao XianCai; Chen Wei; Wang Jiali; Xu Xiaofeng; Hu Zhen

    2011-01-01

    The ribosomal protein S29 also known as RPS29,is not only a component of the 40S subunit of ribosome,but also involved in embryonic development,oncogenesis and other pathologic conditions. However,rare commercial antibody against RPS29 restricts the discovery of precise physiological and pathological function of this protein. In this study,the whole RPS29 gene was inserted into plasmid pGEX-6p-1 to express glutathione's transferase (GST) fusion proteins in Escherichia coli (E. coli) strain BL21. High yields of soluble recombinant proteins were obtained. Mice were immunized with the recombinant RPS29 protein. The serum from the immunized mice could specially react with purified recombinant RPS29 proteins and native RPS29 proteins in CCE cells by western blotting,immunofluorescence staining and flow cytometric analysis. Further more the polyclonal antibodies also reacted specifically with human cell strain ECV304,which showed typical cytoplasmatic fluorescence. The polyclonal antibodies we prepared would be an available tool for studying the roles of RPS29 in embryonic development and human diseases.

  20. PKA-dependent phosphorylation of ribosomal protein S6 does not correlate with translation efficiency in striatonigral and striatopallidal medium-sized spiny neurons.

    Biever, Anne; Puighermanal, Emma; Nishi, Akinori; David, Alexandre; Panciatici, Claire; Longueville, Sophie; Xirodimas, Dimitris; Gangarossa, Giuseppe; Meyuhas, Oded; Hervé, Denis; Girault, Jean-Antoine; Valjent, Emmanuel

    2015-03-11

    Ribosomal protein S6 (rpS6), a component of the 40S ribosomal subunit, is phosphorylated on several residues in response to numerous stimuli. Although commonly used as a marker for neuronal activity, its upstream mechanisms of regulation are poorly studied and its role in protein synthesis remains largely debated. Here, we demonstrate that the psychostimulant d-amphetamine (d-amph) markedly increases rpS6 phosphorylation at Ser235/236 sites in both crude and synaptoneurosomal preparations of the mouse striatum. This effect occurs selectively in D1R-expressing medium-sized spiny neurons (MSNs) and requires the cAMP/PKA/DARPP-32/PP-1 cascade, whereas it is independent of mTORC1/p70S6K, PKC, and ERK signaling. By developing a novel assay to label nascent peptidic chains, we show that the rpS6 phosphorylation induced in striatonigral MSNs by d-amph, as well as in striatopallidal MSNs by the antipsychotic haloperidol or in both subtypes by papaverine, is not correlated with the translation of global or 5' terminal oligopyrimidine tract mRNAs. Together, these results provide novel mechanistic insights into the in vivo regulation of the post-translational modification of rpS6 in the striatum and point out the lack of a relationship between PKA-dependent rpS6 phosphorylation and translation efficiency. PMID:25762659

  1. Analysis of ribosomal protein gene structures: implications for intron evolution.

    2006-03-01

    Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

  2. August-September 2003 small vulcanian eruption at the Nevados de Chillán Volcanic Complex (36°50'S, Southern Andes (Chile

    José A. Naranjo

    2004-12-01

    Full Text Available During the winter months of August-September 2003 a small (VEI=0-1 eruption took place at the 9 km long fissure-like Nevados de Chillán Volcanic Complex (36°50'S, that includes Nuevo (formed between 1906 and 1945 and Arrau (formed in the 1973-1986 period volcanoes. Only the local inhabitants and tourists of the ski resort located at the foothills noted the eruption. From August 29 to September 4, 2003, low-magnitude explosive events occurred and brown-greyish to white gas and ash columns reached up to 400 to 500 m above the crater, rising at periods that lasted for 20 to 25 minutes. After the first week, explosions became more sporadic and occurred at two-three day intervals. Strong prevailing winds from the north dispersed the low-altitude plume to the SSE until the eruption finally stopped by the middle of September. A new compound crater is now present in the saddle between Nuevo and Arrau volcanoes. This 64 m fissure-like double crater is surrounded by an area of intense fumaroles near to Nuevo volcano suggesting the renewal of activity in the complexPequeña erupción vulcaniana de agosto-septiembre en el Complejo Volcánco Nevados de Chillán (36°50'S, Andes del sur (Chile. Durante los meses invernales de agosto y septiembre de 2003 ocurrió una pequeña erupción (IEV=0-1 en la fisura de 9 km de largo del Complejo Volcánico Nevados de Chillán (36°50'S, que incluye a los volcanes Nuevo (formado entre 1906 y 1945 y Arrau (formado entre 1973 y 1986. La erupción fue advertida únicamente por los lugareños y los visitantes del centro invernal situado a los pies del volcán. La semana del 20 al 27 de agosto 2003 se produjeron eventos explosivos de baja magnitud con columnas de gas y ceniza de color pardo-grisáceo y blanco que alcanzaron alturas de 400 a 500 m con períodos de 20 a 25 minutos. Después de la primera semana las explosiones se hicieron más esporádicas ocurriendo a intervalos de 2 a 3 días. Los fuertes vientos

  3. Effects of electroacupuncture on the expression of p70 ribosomal protein S6 kinase and ribosomal protein S6 in the hippocampus of rats with vascular dementia

    Yanzhen Zhu; Xuan Wang; Xiaobao Ye; Changhua Gao; Wei Wang

    2012-01-01

    This study investigated the mechanism underlying electroacupuncture therapy for vascular dementia through electroacupuncture at the acupoints of Baihui (DU20), Dazhui (DU14), and bilateral Shenshu (BL23) in a rat model of vascular dementia produced by bilateral middle cerebral artery occlusion. Morris water maze test showed that electroacupuncture improved the learning ability of vascular dementia rats. Western blot assay revealed that the expression of p70 ribosomal protein S6 kinase and ribosomal protein S6 in vascular dementia rats was significantly increased after electroacupuncture, compared with the model group that was not treated with acupuncture. The average escape latency was also shortened after electroacupuncture, and escape strategies in the spatial probe test improved from edge and random searches, to linear and trending swim pathways. The experimental findings indicate that electroacupuncture improves learning and memory ability by up-regulating expression of p70 ribosomal protein S6 kinase and ribosomal protein S6 in the hippocampus of vascular dementia rats.

  4. Ribosome-associated Asc1/RACK1 is required for endonucleolytic cleavage induced by stalled ribosome at the 3′ end of nonstop mRNA

    Ikeuchi, Ken; Inada, Toshifumi

    2016-01-01

    Dom34-Hbs1 stimulates degradation of aberrant mRNAs lacking termination codons by dissociating ribosomes stalled at the 3′ ends, and plays crucial roles in Nonstop Decay (NSD) and No-Go Decay (NGD). In the dom34Δ mutant, nonstop mRNA is degraded by sequential endonucleolytic cleavages induced by a stalled ribosome at the 3′ end. Here, we report that ribosome-associated Asc1/RACK1 is required for the endonucleolytic cleavage of nonstop mRNA by stalled ribosome at the 3′ end of mRNA in dom34Δ mutant cells. Asc1/RACK1 facilitates degradation of truncated GFP-Rz mRNA in the absence of Dom34 and exosome-dependent decay. Asc1/RACK1 is required for the sequential endonucleolytic cleavages by the stalled ribosome in the dom34Δ mutant, depending on its ribosome-binding activity. The levels of peptidyl-tRNA derived from nonstop mRNA were elevated in dom34Δasc1Δ mutant cells, and overproduction of nonstop mRNA inhibited growth of mutant cells. E3 ubiquitin ligase Ltn1 degrades the arrest products from truncated GFP-Rz mRNA in dom34Δ and dom34Δasc1Δ mutant cells, and Asc1/RACK1 represses the levels of substrates for Ltn1-dependent degradation. These indicate that ribosome-associated Asc1/RACK1 facilitates endonucleolytic cleavage of nonstop mRNA by stalled ribosomes and represses the levels of aberrant products even in the absence of Dom34. We propose that Asc1/RACK1 acts as a fail-safe in quality control for nonstop mRNA. PMID:27312062

  5. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-01-01

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S ...

  6. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  7. Participation of deoxyribonucleic acid polymerase alpha in amplification of ribosomal deoxyribonucleic acid in Xenopus laevis.

    Zimmermann, W.; Weissbach, A

    1981-01-01

    Aphidicolin, a known inhibitor of eucaryotic deoxyribonucleic acid (DNA) polymerase alpha, efficiently inhibited amplification of ribosomal DNA during oogenesis in Xenopus laevis. DNA polymerase alpha, but not DNA polymerase gamma, as isolated from ovaries, was sensitive to aphidicolin. DNA polymerase beta was not detectable in Xenopus ovary extracts. Therefore, DNA polymerase alpha plays a major role in ribosomal ribonucleic acid gene amplification.

  8. Control of ribosome traffic by position-dependent choice of synonymous codons

    Mitarai, Namiko; Pedersen, Steen

    2013-10-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species.

  9. Autogenous Regulation of Splicing of the Transcript of a Yeast Ribosomal Protein Gene

    Dabeva, Mariana D.; Post-Beittenmiller, Martha A.; Warner, Jonathan R.

    1986-08-01

    The gene for a yeast ribosomal protein, RPL32, contains a single intron. The product of this gene appears to participate in feedback control of the splicing of the intron from the transcript. This autogenous regulation of splicing provides a striking analogy to the autogenous regulation of translation of ribosomal proteins in Escherichia coli.

  10. Autogenous regulation of splicing of the transcript of a yeast ribosomal protein gene.

    Dabeva, M. D.; Post-Beittenmiller, M A; Warner, J R

    1986-01-01

    The gene for a yeast ribosomal protein, RPL32, contains a single intron. The product of this gene appears to participate in feedback control of the splicing of the intron from the transcript. This autogenous regulation of splicing provides a striking analogy to the autogenous regulation of translation of ribosomal proteins in Escherichia coli.

  11. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    Essers, Paul B; Nonnekens, Julie; Goos, Yvonne J; Betist, Marco C; Viester, Marjon D; Mossink, Britt; Lansu, Nico; Korswagen, Hendrik C; Jelier, Rob; Brenkman, Arjan B; MacInnes, Alyson W

    2015-01-01

    The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs

  12. Designability of protein subunits on a lattice

    Dmitry, Green; Wingreen, Ned; Tang, Chao; Miller, Jonathan

    2001-03-01

    Native protein folds are often made up of distinct sub folds. We use a two-dimensional lattice protein model based on hydrophobicity to study this feature. The "designability" of a structure is defined as the number of sequences with that structure as their unique, lowest energy configuration. A "highly designable" structure is one that is encoded by a disproportionate share of sequences. The designability of a structure encapsulates the insensitivity to mutation of the sequences that fold into it. We consider structures on a 6x6 and an 8x8 lattice that are composed of two loops, and find that their designability is correlated with the designability of the component loops. This result points to a more general principle asserting that some proteins may be built up from highly designable subunits.

  13. The Schizosaccharomyces pombe casein kinase II alpha and beta subunits: evolutionary conservation and positive role of the beta subunit.

    Roussou, I; Draetta, G

    1994-01-01

    Casein kinase II is a key regulatory enzyme involved in many cellular processes, including the control of growth and cell division. We report the molecular cloning and sequencing of cDNAs encoding the alpha and the beta subunits of casein kinase II of Schizosaccharomyces pombe. The deduced amino acid sequence of Cka1, the alpha catalytic subunit, shows high sequence similarity to alpha subunits identified in other species. The amino acid sequence of Ckb1, the S. pombe beta subunit, is 57% ide...

  14. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese`s group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  15. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese's group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  16. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei.

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit

    2016-01-01

    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts. PMID:27142987

  17. Fusion of Escherichia coli heat-stable enterotoxin and heat-labile enterotoxin B subunit

    The 3' terminus of the DNA coding for the extracellular Escherichia coli heat-stable enterotoxin (ST) devoid of transcription and translation stop signals was fused to the 5' terminus of the DNA coding for the periplasmic B subunit of the heat-labile enterotoxin (LT/sub B/) deleted of ribosomal binding sites and leader peptide. By RNA-DNA hybridization analysis, it was shown that the fused DNA was transcribed in vivo into an RNA species in close agreement with the expected molecular weight inferred from the nucleotide sequence. The translation products of the fused DNA resulted in a hybrid molecule recognized in Western blots (immunoblots) with antibodies directed against the heat-labile moiety. Anti-LT/sub B/ antibodies coupled to a solid support bound ST and LT/sub B/ simultaneously when incubated with ST-LT/sub B/ cellular extracts. By [35S] cysteine pulse-chase experiments, it was shown that the fused ST-LT/sub B/ polypeptide was converted from a precursor with an equivalent electrophoretic mobility of 20,800 daltons to an approximately 18,500-dalton species, which accumulated within the cell. The data suggest that wild-type ST undergoes at least two processing steps during its export to the culture supernatant. Blocking the natural carboxy terminus of ST inhibited the second proteolytic step and extracellular delivery of the hybrid molecule

  18. Evaluation of a Subunit Vaccine to Infectious Hematopoietic Necrosis (IHN) Virus, 1984 FY Annual Report.

    Leong, JoAnn Ching

    1985-07-01

    A prototype subunit vaccine to IHN virus is being developed by recombinant DNA techniques. The techniques involve the isolation and characterization of the glycoprotein gene, which encodes the viral protein responsible for inducing a protective immune response in fish. The viral glycoprotein gene has been cloned and a restriction map of the cloned gene has been prepared. Preliminary DNA sequence analysis of the cloned gene has been initiated so that manipulation of the gene for maximum expression in appropriate plasmid vectors is possible. A recombinant plasmid containing the viral gene inserted in the proper orientation adjacent to a very strong lambda promoter and ribosome binding site has been constructed. Evaluation of this recombinant plasmid for gene expression is being conducted. Immunization trials with purified viral glycoprotein indicate that fish are protected against lethal doses of IHNV after immersion and intraperitoneal methods of immunization. In addition, cross protection immunization trials indicate that Type 2 and Type 1 IHN virus produce glycoproteins that are cross-protective.

  19. Subunit structure of the follitropin receptor

    Both of the α and β subunits of intact human follitropin (FSH) were radioiodinated with 125I-FSH-sodium iodide and chloramine-T, and could be resolved on polyacrylamide gels (SDS-PAGE). The electrophoretic mobility of radioiodinated FSH α and β subunits as well as the αβ dimer changed markedly depending on the concentration of reducing agents. 125I-FSH (Ka = 1.4 x 1010 M-1), complexes to the receptor on procine granulosa cells or in Triton X-100 extracts, was affinity-crosslinked with a cleavable (nondisulfide) homobifunctional reagent, bis[2-(succinimidooxycarbonyloxy)ethyl]sulfone, solubilized in sodium dodecyl sulfate with or without reducing agents, and electrophoresed. Crosslinked samples revealed three additional bands of slower electrophoretic mobility, corresponding to 65 (unreduced 62), 83 (unreduced 76) and 117 (unreduced 110)kDa, in addition to hormone bands. Formation of the three bands requires the 125I-FSH hormone to bind specifically to the receptor with subsequent cross-linking. The rate of formation and cleavage of the cross-linked complexes indicated a sequential and incremental addition of 22, 18, and 34 kDa components to the FSH αβ dimer. The results of reduction of cross-linked complexes demonstrated the existence of disulfide linkage between the three components. FSH was photoactively derivatized with N-hydroxysuccinimide ester of 4-azidobenzolyl-glycine and radioiodinated for photoaffinity labeling. When derivatized 125I-FSH (Ka = 1.12 1010 M-1) bound to the cell was photolyzed for cross-linking and resolved on the SDS-PAGE, two new bands (106 and 61 kDa) under reducing condition appeared in addition to the hormone bands. Upon reduction with dithiotheitol and second-dimensional electrophoresis, the unreduced 104 kDa (reduced 106 kDa) band released two small components 31 and 14 kDa

  20. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA

    Medina, Monica; Collins, Allen G.; Silberman, Jeffrey; Sogin, Mitchell L.

    2001-06-21

    We studied the evolutionary relationships among basal metazoan lineages by using complete large subunit (LSU) and small subunit (SSU) ribosomal RNA sequences for 23 taxa. After identifying competing hypotheses, we performed maximum likelihood searches for trees conforming to each hypothesis. Kishino-Hasegawa tests were used to determine whether the data (LSU, SSU, and combined) reject any of the competing hypotheses. We also conducted unconstrained tree searches, compared the resulting topologies, and calculated bootstrap indices. Shimodaira-Hasegawa tests were applied to determine whether the data reject any of the topologies resulting from the constrained and unconstrained tree searches. LSU, SSU, and the combined data strongly contradict two assertions pertaining to sponge phylogeny. Hexactinellid sponges are not likely to be the basal lineage of amonophyletic Porifera or the sister group to all other animals. Instead, Hexactinellida and Demospongia form a well-supported clade of siliceous sponges, Silicea. It remains unclear, on the basis of these data alone, whether the calcarean sponges are more closely related to Silicea or to nonsponge animals. The SSU and combined data reject the hypothesis that Bilateria is more closely related to Ctenophora than it is to Cnidaria, whereas LSU data alone do not refute either hypothesis. LSU and SSU data agree in supporting the monophyly of Bilateria, Cnidaria, Ctenophora, and Metazoa. LSU sequence data reveal phylogenetic structure in a data set with limited taxon sampling. Continued accumulation of LSU sequences should increase our understanding of animal phylogeny.

  1. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA

    We studied the evolutionary relationships among basal metazoan lineages by using complete large subunit (LSU) and small subunit (SSU) ribosomal RNA sequences for 23 taxa. After identifying competing hypotheses, we performed maximum likelihood searches for trees conforming to each hypothesis. Kishino-Hasegawa tests were used to determine whether the data (LSU, SSU, and combined) reject any of the competing hypotheses. We also conducted unconstrained tree searches, compared the resulting topologies, and calculated bootstrap indices. Shimodaira-Hasegawa tests were applied to determine whether the data reject any of the topologies resulting from the constrained and unconstrained tree searches. LSU, SSU, and the combined data strongly contradict two assertions pertaining to sponge phylogeny. Hexactinellid sponges are not likely to be the basal lineage of amonophyletic Porifera or the sister group to all other animals. Instead, Hexactinellida and Demospongia form a well-supported clade of siliceous sponges, Silicea. It remains unclear, on the basis of these data alone, whether the calcarean sponges are more closely related to Silicea or to nonsponge animals. The SSU and combined data reject the hypothesis that Bilateria is more closely related to Ctenophora than it is to Cnidaria, whereas LSU data alone do not refute either hypothesis. LSU and SSU data agree in supporting the monophyly of Bilateria, Cnidaria, Ctenophora, and Metazoa. LSU sequence data reveal phylogenetic structure in a data set with limited taxon sampling. Continued accumulation of LSU sequences should increase our understanding of animal phylogeny

  2. Novel Accurate Bacterial Discrimination by MALDI-Time-of-Flight MS Based on Ribosomal Proteins Coding in S10-spc-alpha Operon at Strain Level S10-GERMS

    Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki

    2013-08-01

    Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.

  3. Dynamic regulation of β1 subunit trafficking controls vascular contractility

    Leo, M. Dennis; Bannister, John P.; Narayanan, Damodaran; Nair, Anitha; Grubbs, Jordan E.; Gabrick, Kyle S.; Boop, Frederick A.; Jaggar, Jonathan H.

    2014-01-01

    Ion channels composed of pore-forming and auxiliary subunits control physiological functions in virtually all cell types. A conventional view is that channels assemble with their auxiliary subunits before anterograde plasma membrane trafficking of the protein complex. Whether the multisubunit composition of surface channels is fixed following protein synthesis or flexible and open to acute and, potentially, rapid modulation to control activity and cellular excitability is unclear. Arterial smooth muscle cells (myocytes) express large-conductance Ca2+-activated potassium (BK) channel α and auxiliary β1 subunits that are functionally significant modulators of arterial contractility. Here, we show that native BKα subunits are primarily (∼95%) plasma membrane-localized in human and rat arterial myocytes. In contrast, only a small fraction (∼10%) of total β1 subunits are located at the cell surface. Immunofluorescence resonance energy transfer microscopy demonstrated that intracellular β1 subunits are stored within Rab11A-postive recycling endosomes. Nitric oxide (NO), acting via cGMP-dependent protein kinase, and cAMP-dependent pathways stimulated rapid (≤1 min) anterograde trafficking of β1 subunit-containing recycling endosomes, which increased surface β1 almost threefold. These β1 subunits associated with surface-resident BKα proteins, elevating channel Ca2+ sensitivity and activity. Our data also show that rapid β1 subunit anterograde trafficking is the primary mechanism by which NO activates myocyte BK channels and induces vasodilation. In summary, we show that rapid β1 subunit surface trafficking controls functional BK channel activity in arterial myocytes and vascular contractility. Conceivably, regulated auxiliary subunit trafficking may control ion channel activity in a wide variety of cell types. PMID:24464482

  4. Traffic of interacting ribosomes: effects of single-machine mechano-chemistry on protein synthesis

    Basu, A; Basu, Aakash; Chowdhury, Debashish

    2006-01-01

    Many ribosomes simultaneously move on the same messenger RNA (mRNA), each synthesizing a protein. Earlier models of ribosome traffic represent each ribosome by a ``self-propelled particle'' and capture the dynamics by an extension of the totally asymmetric simple exclusion process. In contrast, here we develope a ``unified'' theoretical model that not only incorporates the mutual exclusions of the interacting ribosomes, but also describes explicitly the mechano-chemistry of each of these individual cyclic machines during protein synthesis. Using a combination of analytical and numerical techniques of non-equilibrium statistical mechanics, we analyze this model and illustrate its power by making experimentally testable predictions on the rate of protein synthesis and the density profile of the ribosomes on some mRNAs in E-Coli.

  5. Ribosome collisions and Translation efficiency: Optimization by codon usage and mRNA destabilization

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen

    2008-01-01

    collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of m......Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation...... process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome...

  6. Structure of the GTP Form of Elongation Factor 4 (EF4) Bound to the Ribosome.

    Kumar, Veerendra; Ero, Rya; Ahmed, Tofayel; Goh, Kwok Jian; Zhan, Yin; Bhushan, Shashi; Gao, Yong-Gui

    2016-06-17

    Elongation factor 4 (EF4) is a member of the family of ribosome-dependent translational GTPase factors, along with elongation factor G and BPI-inducible protein A. Although EF4 is highly conserved in bacterial, mitochondrial, and chloroplast genomes, its exact biological function remains controversial. Here we present the cryo-EM reconstitution of the GTP form of EF4 bound to the ribosome with P and E site tRNAs at 3.8-Å resolution. Interestingly, our structure reveals an unrotated ribosome rather than a clockwise-rotated ribosome, as observed in the presence of EF4-GDP and P site tRNA. In addition, we also observed a counterclockwise-rotated form of the above complex at 5.7-Å resolution. Taken together, our results shed light on the interactions formed between EF4, the ribosome, and the P site tRNA and illuminate the GTPase activation mechanism at previously unresolved detail. PMID:27137929

  7. Abundant intergenic TAACTGA direct repeats and putative alternate RNA polymerase β´ subunits in marine Beggiatoaceae genomes: possible regulatory roles and origins

    Barbara J. MacGregor

    2015-12-01

    Full Text Available The genome sequences of several giant marine sulfur-oxidizing bacteria present evidence of a possible post-transcriptional regulatory network that may have been transmitted to or from two distantly related bacteria lineages. The draft genome of a Cand. Maribeggiatoa filament from the Guaymas Basin (Gulf of California, Mexico seafloor contains 169 sets of TAACTGA direct repeats and one indirect repeat, with two to six copies per set. Related heptamers are rarely or never found as direct repeats. TAACTGA direct repeats are also found in some other Beggiatoaceae, Thiocystis violascens, a range of Cyanobacteria, and five Bacteroidetes. This phylogenetic distribution suggests they may have been transmitted horizontally, but no mechanism is evident. There is no correlation between total TAACTGA occurrences and repeats per genome. In most species the repeat units are relatively short, but longer arrays of up to 43 copies are found in several Bacteroidetes and Cyanobacteria. The majority of TAACTGA repeats in the Cand. Maribeggiatoa Orange Guaymas (BOGUAY genome are within several nucleotides upstream of a putative start codon, suggesting they may be binding sites for a post-transcriptional regulator. Candidates include members of the ribosomal protein S1, Csp (cold shock protein, and Csr (carbon storage regulator families. No pattern was evident in the predicted functions of the open reading frames (ORFs downstream of repeats, but some encode presumably essential products such as ribosomal proteins. Among these is an ORF encoding a possible alternate or modified RNA polymerase beta prime subunit, predicted to have the expected subunit interaction domains but lacking most catalytic residues. A similar ORF was found in the Thioploca ingrica draft genome, but in no others. In both species they are immediately upstream of putative sensor kinase genes with nearly identical domain structures. In the marine Beggiatoaceae, a role for the TAACTGA repeats in

  8. Abundant Intergenic TAACTGA Direct Repeats and Putative Alternate RNA Polymerase β' Subunits in Marine Beggiatoaceae Genomes: Possible Regulatory Roles and Origins.

    MacGregor, Barbara J

    2015-01-01

    The genome sequences of several giant marine sulfur-oxidizing bacteria present evidence of a possible post-transcriptional regulatory network that may have been transmitted to or from two distantly related bacteria lineages. The draft genome of a Cand. "Maribeggiatoa" filament from the Guaymas Basin (Gulf of California, Mexico) seafloor contains 169 sets of TAACTGA direct repeats and one indirect repeat, with two to six copies per set. Related heptamers are rarely or never found as direct repeats. TAACTGA direct repeats are also found in some other Beggiatoaceae, Thiocystis violascens, a range of Cyanobacteria, and five Bacteroidetes. This phylogenetic distribution suggests they may have been transmitted horizontally, but no mechanism is evident. There is no correlation between total TAACTGA occurrences and repeats per genome. In most species the repeat units are relatively short, but longer arrays of up to 43 copies are found in several Bacteroidetes and Cyanobacteria. The majority of TAACTGA repeats in the Cand. "Maribeggiatoa" Orange Guaymas (BOGUAY) genome are within several nucleotides upstream of a putative start codon, suggesting they may be binding sites for a post-transcriptional regulator. Candidates include members of the ribosomal protein S1, Csp (cold shock protein), and Csr (carbon storage regulator) families. No pattern was evident in the predicted functions of the open reading frames (ORFs) downstream of repeats, but some encode presumably essential products such as ribosomal proteins. Among these is an ORF encoding a possible alternate or modified RNA polymerase beta prime subunit, predicted to have the expected subunit interaction domains but lacking most catalytic residues. A similar ORF was found in the Thioploca ingrica draft genome, but in no others. In both species they are immediately upstream of putative sensor kinase genes with nearly identical domain structures. In the marine Beggiatoaceae, a role for the TAACTGA repeats in translational

  9. The Listeria monocytogenes Hibernation-Promoting Factor Is Required for the Formation of 100S Ribosomes, Optimal Fitness, and Pathogenesis

    Kline, Benjamin C.; McKay, Susannah L.; Tang, William W.; Portnoy, Daniel A.

    2014-01-01

    During exposure to certain stresses, bacteria dimerize pairs of 70S ribosomes into translationally silent 100S particles in a process called ribosome hibernation. Although the biological roles of ribosome hibernation are not completely understood, this process appears to represent a conserved and adaptive response that contributes to optimal survival during stress and post-exponential-phase growth. Hibernating ribosomes are formed by the activity of one or more highly conserved proteins; gamm...

  10. Mechanism of fusidic acid inhibition of RRF- and EF-G-dependent splitting of the bacterial post-termination ribosome

    Borg, Anneli; Pavlov, Michael; Ehrenberg, Måns

    2016-01-01

    The antibiotic drug fusidic acid (FA) is commonly used in the clinic against gram-positive bacterial infections. FA targets ribosome-bound elongation factor G (EF-G), a translational GTPase that accelerates both messenger RNA (mRNA) translocation and ribosome recycling. How FA inhibits translocation was recently clarified, but FA inhibition of ribosome recycling by EF-G and ribosome recycling factor (RRF) has remained obscure. Here we use fast kinetics techniques to estimate mean times of rib...

  11. “Silencing the ribosomal locus of Saccharomyces cerevisiae: role of RNA polymerase I transcription and chromatin acetylation”

    Cesarini, Elisa

    2011-01-01

    During my PhD I investigated the transcriptional silencing occurring at the ribosomal DNA of Saccharomyces cerevisiae. In yeast the ribosomal locus (rDNA) is transcribed with high efficiency by RNA polymerase I (Pol I) and III to synthetize ribosomal RNAs. It has been discovered that RNA polymerase Pol II (Pol II) can also transcribe the ribosomal locus, at low level, starting from cryptic promoters and generating non coding RNAs (ncRNAs). ncRNA transcription leads to genome...

  12. Cloning, periplasmic expression, purification and structural characterization of human ribosomal protein L10; Clonagem, expressao, purificacao e caracterizacao estrutural da proteina ribossomal L10 humana recombinante

    Pereira, Larissa Miranda

    2009-07-01

    The ribosomal protein L10 (RP L10) is a strong candidate to be included in the class of tumor suppressor proteins. This protein, also denominated as QM, is known to participate in the binding of ribosomal subunits 60S and 40S and the translation of mRNAs. It has a molecular weight that varies between 24 and 26 kDa and an isoelectric point of (pI) 10.5. The sequence of the protein QM is highly conserved in mammals, plants, invertebrates, insects and yeast which indicates its critical functions in a cell. As a tumor suppressor, RP L10 has been studied in strains of Wilm's tumor (WT-1) and tumor cells in the stomach, where was observed a decrease in the amount of its mRNA. More recently, the RP L10 was found in low amounts in the early stages of prostate adenoma and showed some mutation in ovarian cancer, what indicates its role as a suppressor protein in the development of these diseases. It has also been described that this protein interacts with c-Jun and c-Yes inhibiting growth factors and consequently, cell division. This work has an important role on the establishment of soluble expression of QM to give base information for further studies on expression that aim to evaluate the specific regions where it acts binding the 60S and 40S ribosomal subunits and translation, as well as its binding to proto-oncogenes. The cDNA for QM protein was amplified by PCR and cloned into periplasmic expression vector p3SN8. The QM protein was expressed in E. coli BL21 (DE3) in the region of cytoplasm and periplasm, the best condition was obtained from the expression of the recombinant plasmid QM p1813{sub Q}M at 25 degree C or 30 degree C, the soluble protein was obtained with small amounts of contaminants. The assays of secondary structure showed that the QM protein is predominantly alpha-helix, but when it loses the folding, this condition changes and the protein is replaced by {beta}- sheet feature. (author)

  13. Liposome-Based Adjuvants for Subunit Vaccines: Formulation Strategies for Subunit Antigens and Immunostimulators

    Signe Tandrup Schmidt

    2016-03-01

    Full Text Available The development of subunit vaccines has become very attractive in recent years due to their superior safety profiles as compared to traditional vaccines based on live attenuated or whole inactivated pathogens, and there is an unmet medical need for improved vaccines and vaccines against pathogens for which no effective vaccines exist. The subunit vaccine technology exploits pathogen subunits as antigens, e.g., recombinant proteins or synthetic peptides, allowing for highly specific immune responses against the pathogens. However, such antigens are usually not sufficiently immunogenic to induce protective immunity, and they are often combined with adjuvants to ensure robust immune responses. Adjuvants are capable of enhancing and/or modulating immune responses by exposing antigens to antigen-presenting cells (APCs concomitantly with conferring immune activation signals. Few adjuvant systems have been licensed for use in human vaccines, and they mainly stimulate humoral immunity. Thus, there is an unmet demand for the development of safe and efficient adjuvant systems that can also stimulate cell-mediated immunity (CMI. Adjuvants constitute a heterogeneous group of compounds, which can broadly be classified into delivery systems or immunostimulators. Liposomes are versatile delivery systems for antigens, and they can carefully be customized towards desired immune profiles by combining them with immunostimulators and optimizing their composition, physicochemical properties and antigen-loading mode. Immunostimulators represent highly diverse classes of molecules, e.g., lipids, nucleic acids, proteins and peptides, and they are ligands for pattern-recognition receptors (PRRs, which are differentially expressed on APC subsets. Different formulation strategies might thus be required for incorporation of immunostimulators and antigens, respectively, into liposomes, and the choice of immunostimulator should ideally be based on knowledge regarding the

  14. Regulation of Glutamate Receptors by Their Auxiliary Subunits

    Tomita, Susumu

    2010-01-01

    Glutamate receptors are major excitatory receptors in the brain. Recent findings have established auxiliary subunits of glutamate receptors as critical modulators of synaptic transmission, synaptic plasticity and neurological disorder. The elucidation of the molecular rules governing glutamate receptors and subunits will improve our understanding of synapses and of neural-circuit regulation in the brain.

  15. A ribosome-inactivating protein in a Drosophila defensive symbiont.

    Hamilton, Phineas T; Peng, Fangni; Boulanger, Martin J; Perlman, Steve J

    2016-01-12

    Vertically transmitted symbionts that protect their hosts against parasites and pathogens are well known from insects, yet the underlying mechanisms of symbiont-mediated defense are largely unclear. A striking example of an ecologically important defensive symbiosis involves the woodland fly Drosophila neotestacea, which is protected by the bacterial endosymbiont Spiroplasma when parasitized by the nematode Howardula aoronymphium. The benefit of this defense strategy has led to the rapid spread of Spiroplasma throughout the range of D. neotestacea, although the molecular basis for this protection has been unresolved. Here, we show that Spiroplasma encodes a ribosome-inactivating protein (RIP) related to Shiga-like toxins from enterohemorrhagic Escherichia coli and that Howardula ribosomal RNA (rRNA) is depurinated during Spiroplasma-mediated protection of D. neotestacea. First, we show that recombinant Spiroplasma RIP catalyzes depurination of 28S rRNAs in a cell-free assay, as well as Howardula rRNA in vitro at the canonical RIP target site within the α-sarcin/ricin loop (SRL) of 28S rRNA. We then show that Howardula parasites in Spiroplasma-infected flies show a strong signal of rRNA depurination consistent with RIP-dependent modification and large decreases in the proportion of 28S rRNA intact at the α-sarcin/ricin loop. Notably, host 28S rRNA is largely unaffected, suggesting targeted specificity. Collectively, our study identifies a novel RIP in an insect defensive symbiont and suggests an underlying RIP-dependent mechanism in Spiroplasma-mediated defense. PMID:26712000

  16. Identification of a novel HMW glutenin subunit and comparison of its amino acid sequence with those of homologous subunits

    2002-01-01

    Aegilops tauschii is the donor of the D genome of common wheat (Triticum aestivum). Genetic variation of HMW glutenin subunits encoded by the Glu-1Dt locus of Ae. tauschii has been found to be higher than that specified by the Glu-1D locus in common wheat. In the present note, we report the identification of a novel HMW glutenin subunit, Dy13t, from Ae. tauschii. The newly identified subunit possessed an electrophoretic mobility that was faster than that of the Dy12 subunit of common wheat. The complete ORF of encoding the Dy13t subunit contained 624 codons (excluding the stop codons). The amino acid sequence deduced from the Dy13t gene ORF was the shortest among those of the previously reported subunits derived by the D genome. A further comparison of Dy13t amino acid sequence with those of the subunits characterized from the A, B, D, R genomes of Triticeae showed that the smaller size of the Dy13t subunit was associated with a reduction in the size of its repetitive domain.

  17. A rapid and simple pipeline for synthesis of mRNA-ribosome-V(H)H complexes used in single-domain antibody ribosome display.

    Bencurova, Elena; Pulzova, Lucia; Flachbartova, Zuzana; Bhide, Mangesh

    2015-06-01

    The single-domain antibody (VHH) is a promising building block for a number of antibody-based applications. Ribosome display can successfully be used in the production of VHH. However, the construction of the expression cassette, confirmation of the translation and proper folding of the nascent chain, and the purification of the ribosome complexes, remain cumbersome tasks. Additionally, selection of the most suitable expression system can be challenging. We have designed primers that will amplify virtually all Camelidae VHH. With the help of a double-overlap extension (OE) polymerase chain reaction (PCR) we have fused VHH with the F1 fragment (T7 promoter and species-independent translation sequence) and the F2 fragment (mCherry, Myc-tag, tether, SecM arrest sequence and 3' stem loop) to generate a full-length DNA cassette. OE-PCR generated fragments were incubated directly with cell-free lysates (Leishmania torentolae, rabbit reticulocyte or E. coli) for the synthesis of mRNA-VHH-mCherry-ribosome complexes in vitro. Alternatively, the cassette was ligated in pQE-30 vector and transformed into E. coli to produce ribosome complexes in vivo. The results showed that the same expression cassette could be used to synthesize ribosome complexes with different expression systems. mCherry reporter served to confirm the synthesis and proper folding of the nascent chain, Myc-tag was useful in the rapid purification of ribosome complexes, and combination of the SecM sequence and 3' stem loop made the cassette universal, both for cells-free and E. coli in vivo. This rapid and universal pipeline can effectively be used in antibody ribosome display and VHH production. PMID:25902394

  18. Abanico East Formation: petrology and geochemistry of volcanic rocks behind the Cenozoic arc front in the Andean Cordillera, central Chile (33°50'S

    Marcia Muñoz

    2006-01-01

    Full Text Available The stratigraphy, chemistry and age of rocks assigned to the eastern portion of the Abanico Formation exposed along the El Volcán river valley, Principal Cordillera east of Santiago (30º50'S/70º12'-70º5'W, are reported and discussed. This ca. 3,300 m thick succession is mainly composed of basalts, basaltic andesites and volcaniclastic rocks. 40Ar/39Ar radiometric dates on plagioclase from the lava flows yield Oligocene-lower Miocene ages with a maximum age of 34.3 ±0.4 Ma for the lower part and a plateau age of 21.4±1.0 Ma for the upper part of the succession. The lava flows show calc-alkaline affinities and have chemical characteristics that are typical of arc volcanic rocks erupted in an active continental margin. A temporal chemical evolution in the sequence is indicated by upward increases in concentrations of LILE and LREE elements and LaN/YbN ratios. This pattern can be attributed to increasing contributions of fluids derived from the subducted lithosphere with time. A chemical comparison of these rocks with Oligocene-lower Miocene volcanic rocks from the Cerro Abanico and Chacabuco areas on the western border of the Principal Cordillera, east of Santiago, and at the northern end of the Central Depression reveals west to east compositional variations. From west to east these variations include: (1 increasing LILE and LREE concentrations, LaN/YbN ratios and Sr and Nd initial isotopic ratios, and (2 decreasing LILE/HFSE and LREE/HFSE ratios. These pattern can be attributed to a west to east decrease in the contribution of slab derived fluids and increase in the influence of crustal contamination processesLa formación Abanico Este: petrología y geoquímica de las rocas volcánicas detrás del arco Cenozoico en la Cordillera Andina, Chile central (33º50'S. Se presentan los resultados del estudio de la estratigrafía, química y edades de rocas asignadas a la franja oriental de la Formación Abanico expuestas en la ladera sur del R

  19. 16S/18S ribosomal DNA clone library analysis of rumen microbial diversity

    The rumen contains a complex ecosystem where billions of bacteria, archaea, protozoa and fungi reside. This diverse microbiota is well adapted to live in the rumen and play an important role in the digestion of feed and nutrient supply to the host in the form of microbial protein and volatile fatty acids. It is estimated that the rumen microbial population consists of about 106 protozoa/ml, 103-107 fungi/ml, 1010 bacteria/ml, and 109 methanogens/ml. To better understand the complex relationships in the rumen, it is necessary to gain an insight into the diversity of the rumen microbes and how the quantity and composition of rumen micro-organisms are altered by a number of different host factors such as age, genetics and diet. In the past, the diversity of micro-organisms from the digestive tracts of domesticated ruminants has been identified by classical microbiological techniques. However, given the fastidious growth requirements of rumen micro-organisms, it is reasonable to concede that the culture-dependent methods may select against some species, or taxonomic groups, leading researchers to underestimate the microbial diversity that is actually present in the rumen. In fact, it has been speculated that 90% of micro-organisms in nature have escaped traditional cultivation methods. Therefore, a major challenge in microbial ecology has been to assess the diversity and structure of natural microbial communities. The field of molecular biology has advanced with many innovative technological breakthroughs. The ability to extract and to isolate high-molecular weight DNA from rumen digesta, PCR amplify genes from specific microbial groups and obtain gene sequence data is now a routine event. The small subunit ribosomal RNA (SSU-rRNA) gene, called 16S in prokaryotes and 18S in eukaryotes, is the most widely used molecular marker to presumptively identify morphologically indistinguishable species, to infer their phylogenetic relationships, and to elucidate microbial

  20. Hydrogen bonding and packing density are factors most strongly connected to limiting sites of high flexibility in the 16S rRNA in the 30S ribosome

    Ghosh Sujit K

    2009-07-01

    Full Text Available Abstract Background Conformational flexibility in structured RNA frequently is critical to function. The 30S ribosomal subunit exists in different conformations in different functional states due to changes in the central part of the 16S rRNA. We are interested in evaluating the factors that might be responsible for restricting flexibility to specific parts of the 16S rRNA using biochemical data obtained from the 30S subunit in solution. This problem was approached taking advantage of the observation that there must be a high degree of conformational flexibility at sites where UV photocrosslinking occurs and a lack of flexibility inhibits photoreactivity at many other sites that are otherwise suitable for reaction. Results We used 30S x-ray structures to quantify the properties of the nucleotide pairs at UV- and UVA-s4U-induced photocrosslinking sites in 16S rRNA and compared these to the properties of many hundreds of additional sites that have suitable geometry but do not undergo photocrosslinking. Five factors that might affect RNA flexibility were investigated – RNA interactions with ribosomal proteins, interactions with Mg2+ ions, the presence of long-range A minor motif interactions, hydrogen bonding and the count of neighboring heavy atoms around the center of each nucleobase to estimate the neighbor packing density. The two factors that are very different in the unreactive inflexible pairs compared to the reactive ones are the average number of hydrogen bonds and the average value for the number of neighboring atoms. In both cases, these factors are greater for the unreactive nucleotide pairs at a statistically very significant level. Conclusion The greater extent of hydrogen bonding and neighbor atom density in the unreactive nucleotide pairs is consistent with reduced flexibility at a majority of the unreactive sites. The reactive photocrosslinking sites are clustered in the 30S subunit and this indicates nonuniform patterns of

  1. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Jeffrey A Hussmann

    2015-12-01

    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  2. Translation by polysome: theory of ribosome profile on a single mRNA transcript

    Sharma, Ajeet K

    2011-01-01

    The process of polymerizing a protein by a ribosome, using a messenger RNA (mRNA) as the corresponding template, is called {\\it translation}. Ribosome may be regarded as a molecular motor for which the mRNA template serves also as the track. Often several ribosomes may translate the same (mRNA) simultaneously. The ribosomes bound simultaneously to a single mRNA transcript are the members of a polyribosome (or, simply, {\\it polysome}). Experimentally measured {\\it polysome profile} gives the distribution of polysome {\\it sizes}. Recently a breakthrough in determining the instantaneous {\\it positions} of the ribosomes on a given mRNA track has been achieved and the technique is called {\\it ribosome profiling} \\cite{ingolia10,guo10}. Motivated by the success of these techniques, we have studied the spatio-temporal organization of ribosomes by extending a theoretical model that we have reported elsewhere \\cite{sharma11}. This extended version of our model incorporates not only (i) mechano-chemical cycle of indivi...

  3. Gel-based chemical cross-linking analysis of 20S proteasome subunit-subunit interactions in breast cancer.

    Song, Hai; Xiong, Hua; Che, Jing; Xi, Qing-Song; Huang, Liu; Xiong, Hui-Hua; Zhang, Peng

    2016-08-01

    The ubiquitin-proteasome system plays a pivotal role in breast tumorigenesis by controlling transcription factors, thus promoting cell cycle growth, and degradation of tumor suppressor proteins. However, breast cancer patients have failed to benefit from proteasome inhibitor treatment partially due to proteasome heterogeneity, which is poorly understood in malignant breast neoplasm. Chemical crosslinking is an increasingly important tool for mapping protein three-dimensional structures and proteinprotein interactions. In the present study, two cross-linkers, bis (sulfosuccinimidyl) suberate (BS(3)) and its water-insoluble analog disuccinimidyl suberate (DSS), were used to map the subunit-subunit interactions in 20S proteasome core particle (CP) from MDA-MB-231 cells. Different types of gel electrophoresis technologies were used. In combination with chemical cross-linking and mass spectrometry, we applied these gel electrophoresis technologies to the study of the noncovalent interactions among 20S proteasome subunits. Firstly, the CP subunit isoforms were profiled. Subsequently, using native/SDSPAGE, it was observed that 0.5 mmol/L BS(3) was a relatively optimal cross-linking concentration for CP subunit-subunit interaction study. 2-DE analysis of the cross-linked CP revealed that α1 might preinteract with α2, and α3 might pre-interact with α4. Moreover, there were different subtypes of α1α2 and α3α4 due to proteasome heterogeneity. There was no significant difference in cross-linking pattern for CP subunits between BS(3) and DSS. Taken together, the gel-based characterization in combination with chemical cross-linking could serve as a tool for the study of subunit interactions within a multi-subunit protein complex. The heterogeneity of 20S proteasome subunit observed in breast cancer cells may provide some key information for proteasome inhibition strategy. PMID:27465334

  4. β-Puromycin selection of modified ribosomes for in vitro incorporation of β-amino acids.

    Dedkova, Larisa M; Fahmi, Nour Eddine; Paul, Rakesh; del Rosario, Melissa; Zhang, Liqiang; Chen, Shengxi; Feder, Glen; Hecht, Sidney M

    2012-01-10

    Ribosomally mediated protein biosynthesis is limited to α-L-amino acids. A strong bias against β-L-amino acids precludes their incorporation into proteins in vivo and also in vitro in the presence of misacylated β-aminoacyl-tRNAs. Nonetheless, earlier studies provide some evidence that analogues of aminoacyl-tRNAs bearing β-amino acids can be accommodated in the ribosomal A-site. Both functional and X-ray crystallographic data make it clear that the exclusion of β-L-amino acids as participants in protein synthesis is a consequence of the architecture of the ribosomal peptidyltransferase center (PTC). To enable the reorganization of ribosomal PTC architecture through mutagenesis of 23S rRNA, a library of modified ribosomes having modifications in two regions of the 23S rRNA (2057-2063 and 2496-2507 or 2582-2588) was prepared. A dual selection procedure was used to obtain a set of modified ribosomes able to carry out protein synthesis in the presence β-L-amino acids and to provide evidence for the utilization of such amino acids, in addition to α-L-amino acids. β-Puromycin, a putative mimetic for β-aminoacyl-tRNAs, was used to select modified ribosome variants having altered PTC architectures, thus potentially enabling incorporation of β-L-amino acids. Eight types of modified ribosomes altered within the PTC have been selected by monitoring improved sensitivity to β-puromycin in vivo. Two of the modified ribosomes, having 2057AGCGUGA2063 and 2502UGGCAG2507 or 2502AGCCAG2507, were able to suppress UAG codons in E. coli dihydrofolate reductase (DHFR) and scorpion Opisthorcanthus madagascariensis peptide IsCT mRNAs in the presence of β-alanyl-tRNA(CUA). PMID:22145951

  5. Nonfouling hydrogels formed from charged monomer subunits.

    Dobbins, Sean C; McGrath, Daniel E; Bernards, Matthew T

    2012-12-13

    A critical challenge in the field of biomaterials is the often undesirable, but immediate, coating of implants with nonspecifically adsorbed proteins upon contact with bodily fluids. Prior research has shown that overall neutral materials containing a homologous arrangement of mixed charges exhibit nonfouling properties. This has been widely demonstrated for zwitterionic materials and more recently for coatings containing an equimolar mixture of positively and negatively charged monomer subunits. In this investigation it is demonstrated that nonfouling hydrogels can be formed through this approach, and the physical properties of the resulting materials are thoroughly characterized. In particular, hydrogels were formed from mixtures of [2-(methacryloyloxy)ethyl]trimethylammonium chloride (TM) and 3-sulfopropyl methacrylate potassium salt (SA) monomers with varying concentrations of a triethylene glycol dimethacrylate (TEGDMA) cross-linker. The swelling, weight percentage water, surface zeta potential, and compressional properties of the gels were characterized, and the nonfouling properties were demonstrated using enzyme-linked immunosorbant assays for both negatively charged fibrinogen and positively charged lysozyme. The results confirm that the TM:SA hydrogel systems have nonfouling properties that are equivalent to established nonfouling controls. Additionally, even though the gels were resistant to nonspecific protein adsorption, a composition analysis suggests that there is room to further improve the nonfouling performance because there is a slight enrichment of the SA monomer relative to the TM monomer. PMID:23189949

  6. Bacterial effector binding to ribosomal protein s3 subverts NF-kappaB function.

    Xiaofei Gao

    2009-12-01

    Full Text Available Enteric bacterial pathogens cause food borne disease, which constitutes an enormous economic and health burden. Enterohemorrhagic Escherichia coli (EHEC causes a severe bloody diarrhea following transmission to humans through various means, including contaminated beef and vegetable products, water, or through contact with animals. EHEC also causes a potentially fatal kidney disease (hemolytic uremic syndrome for which there is no effective treatment or prophylaxis. EHEC and other enteric pathogens (e.g., enteropathogenic E. coli (EPEC, Salmonella, Shigella, Yersinia utilize a type III secretion system (T3SS to inject virulence proteins (effectors into host cells. While it is known that T3SS effectors subvert host cell function to promote diarrheal disease and bacterial transmission, in many cases, the mechanisms by which these effectors bind to host proteins and disrupt the normal function of intestinal epithelial cells have not been completely characterized. In this study, we present evidence that the E. coli O157:H7 nleH1 and nleH2 genes encode T3SS effectors that bind to the human ribosomal protein S3 (RPS3, a subunit of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kappaB transcriptional complexes. NleH1 and NleH2 co-localized with RPS3 in the cytoplasm, but not in cell nuclei. The N-terminal region of both NleH1 and NleH2 was required for binding to the N-terminus of RPS3. NleH1 and NleH2 are autophosphorylated Ser/Thr protein kinases, but their binding to RPS3 is independent of kinase activity. NleH1, but not NleH2, reduced the nuclear abundance of RPS3 without altering the p50 or p65 NF-kappaB subunits or affecting the phosphorylation state or abundance of the inhibitory NF-kappaB chaperone IkappaBalpha NleH1 repressed the transcription of a RPS3/NF-kappaB-dependent reporter plasmid, but did not inhibit the transcription of RPS3-independent reporters. In contrast, NleH2 stimulated RPS3-dependent transcription, as well

  7. New ribosome-inactivating proteins with polynucleotide:adenosine glycosidase and antiviral activities from Basella rubra L. and bougainvillea spectabilis Willd.

    Bolognesi, A; Polito, L; Olivieri, F; Valbonesi, P; Barbieri, L; Battelli, M G; Carusi, M V; Benvenuto, E; Del Vecchio Blanco, F; Di Maro, A; Parente, A; Di Loreto, M; Stirpe, F

    1997-12-01

    New single-chain (type 1) ribosome-inactivating proteins (RIPs) were isolated from the seeds of Basella rubra L. (two proteins) and from the leaves of Bougainvillea spectabilis Willd. (one protein). These RIPs inhibit protein synthesis both in a cell-free system, with an IC50 (concentration causing 50% inhibition) in the 10(-10) M range, and by various cell lines, with IC50S in the 10(-8)-10(-6) M range. All three RIPs released adenine not only from rat liver ribosomes but also from Escherichia coli rRNA, polyadenylic acid, herring sperm DNA, and artichoke mottled crinkle virus (AMCV) genomic RNA, thus being polynucleotide:adenosine glycosidases. The proteins from Basella rubra had toxicity to mice similar to that of most type 1 RIPs (Barbieri et al., 1993, Biochim Biophys Acta 1154: 237-282) with an LD50 (concentration that is 50% lethal) 32 mg.kg-1. The N-terminal sequence of the two RIPs from Basella rubra had 80-93% identity, whereas it differed from the sequence of the RIP from Bougainvillea spectabilis. When tested with antibodies against various RIPs, the RIPs from Basella gave some cross-reactivity with sera against dianthin 32, and weak cross-reactivity with momordin I and momorcochin-S, whilst the RIP from Bougainvillea did not cross-react with any antiserum tested. An RIP from Basella rubra and one from Bougainvillea spectabilis were tested for antiviral activity, and both inhibited infection of Nicotiana benthamiana by AMCV. PMID:9421927

  8. Impact of P-Site tRNA and antibiotics on ribosome mediated protein folding: studies using the Escherichia coli ribosome.

    Surojit Mondal

    Full Text Available BACKGROUND: The ribosome, which acts as a platform for mRNA encoded polypeptide synthesis, is also capable of assisting in folding of polypeptide chains. The peptidyl transferase center (PTC that catalyzes peptide bond formation resides in the domain V of the 23S rRNA of the bacterial ribosome. Proper positioning of the 3' -CCA ends of the A- and P-site tRNAs via specific interactions with the nucleotides of the PTC are crucial for peptidyl transferase activity. This RNA domain is also the center for ribosomal chaperoning activity. The unfolded polypeptide chains interact with the specific nucleotides of the PTC and are released in a folding competent form. In vitro transcribed RNA corresponding to this domain (bDV RNA also displays chaperoning activity. RESULTS: The present study explores the effects of tRNAs, antibiotics that are A- and P-site PTC substrate analogs (puromycin and blasticidin and macrolide antibiotics (erythromycin and josamycin on the chaperoning ability of the E. coli ribosome and bDV RNA. Our studies using mRNA programmed ribosomes show that a tRNA positioned at the P-site effectively inhibits the ribosome's chaperoning function. We also show that the antibiotic blasticidin (that mimics the interaction between 3'-CCA end of P/P-site tRNA with the PTC is more effective in inhibiting ribosome and bDV RNA chaperoning ability than either puromycin or the macrolide antibiotics. Mutational studies of the bDV RNA could identify the nucleotides U2585 and G2252 (both of which interact with P-site tRNA to be important for its chaperoning ability. CONCLUSION: Both protein synthesis and their proper folding are crucial for maintenance of a functional cellular proteome. The PTC of the ribosome is attributed with both these abilities. The silencing of the chaperoning ability of the ribosome in the presence of P-site bound tRNA might be a way to segregate these two important functions.

  9. Canonical Initiation Factor Requirements of the Myc Family of Internal Ribosome Entry Segments▿ †

    Spriggs, Keith A.; Cobbold, Laura C.; Jopling, Catherine L; Cooper, Rebecca E.; Wilson, Lindsay A; Stoneley, Mark; Coldwell, Mark J; Poncet, Didier; Shen, Ya-Ching; Morley, Simon; Bushell, Martin; Willis, Anne E.

    2009-01-01

    Initiation of protein synthesis in eukaryotes requires recruitment of the ribosome to the mRNA and its translocation to the start codon. There are at least two distinct mechanisms by which this process can be achieved; the ribosome can be recruited either to the cap structure at the 5' end of the message or to an internal ribosome entry segment (IRES), a complex RNA structural element located in the 5' untranslated region (5'-UTR) of the mRNA. However, it is not well understood how cellular I...

  10. Properties of the ribosome-inactivating proteins gelonin, Momordica charantia inhibitor, and dianthins.

    Falasca, A; Gasperi-Campani, A; Abbondanza, A; Barbieri, L; Stirpe, F

    1982-12-01

    The amino acid and sugar compositions of four ribosome-inactivating proteins (gelonin, Momordica charantia inhibitor, dianthin 30 and dianthin 32) were determined. The proteins are all basic glycoproteins (pI greater than 8) containing mannose (more abundant in gelonin), glucose, xylose, fucose (absent from gelonin) and glucosamine. The ribosome-inactivating properties of the proteins examined are not modified by pretreatment with N-ethylmaleimide. Precipitating and inactivating antibodies can be raised against ribosome-inactivating proteins; a weak cross-reaction was observed only between dianthin 30 and dianthin 32. PMID:6819861

  11. Echinococcus granulosus antigen B structure: subunit composition and oligomeric states.

    Karina M Monteiro

    Full Text Available BACKGROUND: Antigen B (AgB is the major protein secreted by the Echinococcus granulosus metacestode and is involved in key host-parasite interactions during infection. The full comprehension of AgB functions depends on the elucidation of several structural aspects that remain unknown, such as its subunit composition and oligomeric states. METHODOLOGY/PRINCIPAL FINDINGS: The subunit composition of E. granulosus AgB oligomers from individual bovine and human cysts was assessed by mass spectrometry associated with electrophoretic analysis. AgB8/1, AgB8/2, AgB8/3 and AgB8/4 subunits were identified in all samples analyzed, and an AgB8/2 variant (AgB8/2v8 was found in one bovine sample. The exponentially modified protein abundance index (emPAI was used to estimate the relative abundance of the AgB subunits, revealing that AgB8/1 subunit was relatively overrepresented in all samples. The abundance of AgB8/3 subunit varied between bovine and human cysts. The oligomeric states formed by E. granulosus AgB and recombinant subunits available, rAgB8/1, rAgB8/2 and rAgB8/3, were characterized by native PAGE, light scattering and microscopy. Recombinant subunits showed markedly distinct oligomerization behaviors, forming oligomers with a maximum size relation of rAgB8/3>rAgB8/2>rAgB8/1. Moreover, the oligomeric states formed by rAgB8/3 subunit were more similar to those observed for AgB purified from hydatid fluid. Pressure-induced dissociation experiments demonstrated that the molecular assemblies formed by the more aggregative subunits, rAgB8/2 and rAgB8/3, also display higher structural stability. CONCLUSIONS/SIGNIFICANCE: For the first time, AgB subunit composition was analyzed in samples from single hydatid cysts, revealing qualitative and quantitative differences between samples. We showed that AgB oligomers are formed by different subunits, which have distinct abundances and oligomerization properties. Overall, our findings have significantly

  12. Mutations in GABAA receptor subunits associated with genetic epilepsies.

    Macdonald, Robert L; Kang, Jing-Qiong; Gallagher, Martin J

    2010-06-01

    Mutations in inhibitory GABAA receptor subunit genes (GABRA1, GABRB3, GABRG2 and GABRD) have been associated with genetic epilepsy syndromes including childhood absence epilepsy (CAE), juvenile myoclonic epilepsy (JME), pure febrile seizures (FS), generalized epilepsy with febrile seizures plus (GEFS+), and Dravet syndrome (DS)/severe myoclonic epilepsy in infancy (SMEI). These mutations are found in both translated and untranslated gene regions and have been shown to affect the GABAA receptors by altering receptor function and/or by impairing receptor biogenesis by multiple mechanisms including reducing subunit mRNA transcription or stability, impairing subunit folding, stability, or oligomerization and by inhibiting receptor trafficking. PMID:20308251

  13. The IGS-ETS in Bacillus (Insecta Phasmida: molecular characterization and the relevance of sex in ribosomal DNA evolution

    Passamonti Marco

    2008-10-01

    Full Text Available Abstract Background DNA encoding for ribosomal RNA (rDNA is arranged in tandemly-repeated subunits, each containing ribosomal genes and non-coding spacers. Because tandemly-repeated, rDNA evolves under a balanced influence of selection and "concerted evolution", which homogenizes rDNA variants over the genome (through genomic turnover mechanisms and the population (through sexuality. Results In this paper we analyzed the IGS-ETS of the automictic parthenogen Bacillus atticus and the bisexual B. grandii, two closely related stick-insect species. Both species share the same IGS-ETS structure and sequence, including a peculiar head-to-tail array of putative transcription enhancers, here named Bag530. Sequence variability of both IGS-ETS and Bag530 evidenced a neat geographic and subspecific clustering in B. grandii, while B. atticus shows a little but evident geographic structure. This was an unexpected result, since the parthenogen B. atticus should lack sequence fixation through sexuality. In B. atticus a new variant might spread in a given geographic area through colonization by an all-female clone, but we cannot discard the hypothesis that B. atticus was actually a bisexual taxon in that area at the time the new variant appeared. Moreover, a gene conversion event between two Bag530 variants of B. grandii benazzii and B. grandii maretimi suggested that rRNA might evolve according to the so-called "library hypothesis" model, through differential amplification of rDNA variants in different taxa. Conclusion On the whole, Bacillus rDNA evolution appears to be under a complex array of interacting mechanisms: homogenization may be achieved through genomic turnover that stabilizes DNA-binding protein interactions but, simultaneously, new sequence variants can be adopted, either by direct appearance of newly mutated repeats, or by competition among repeats, so that both DNA-binding proteins and repeat variants drive each other's evolution. All this

  14. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    He, Kaiyu [Department of Microbiology and Molecular Genetics (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Zhou, Hui-Ren [Food Science and Human Nutrition (United States); Pestka, James J., E-mail: pestka@msu.edu [Department of Microbiology and Molecular Genetics (United States); Food Science and Human Nutrition (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States)

    2012-11-15

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  15. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  16. Crystal structures of complexes containing domains from two viral internal ribosome entry site (IRES) RNAs bound to the 70S ribosome

    Zhu, Jianyu; Korostelev, Andrei; Costantino, David A.; Donohue, John P.; Noller, Harry F.; Kieft, Jeffrey S. (UCSC); (Colorado)

    2011-08-24

    Internal ribosome entry site (IRES) RNAs are elements of viral or cellular mRNAs that bypass steps of canonical eukaryotic cap-dependent translation initiation. Understanding of the structural basis of IRES mechanisms is limited, partially due to a lack of high-resolution structures of IRES RNAs bound to their cellular targets. Prompted by the universal phylogenetic conservation of the ribosomal P site, we solved the crystal structures of proposed P site binding domains from two intergenic region IRES RNAs bound to bacterial 70S ribosomes. The structures show that these IRES domains nearly perfectly mimic a tRNA-mRNA interaction. However, there are clear differences in the global shape and position of this IRES domain in the intersubunit space compared to those of tRNA, supporting a mechanism for IRES action that invokes hybrid state mimicry to drive a noncanonical mode of translocation. These structures suggest how relatively small structured RNAs can manipulate complex biological machines.

  17. Crucial elements that maintain the interactions between the regulatory TnaC peptide and the ribosome exit tunnel responsible for Trp inhibition of ribosome function.

    Martínez, Allyson K; Shirole, Nitin H; Murakami, Shino; Benedik, Michael J; Sachs, Matthew S; Cruz-Vera, Luis R

    2012-03-01

    Translation of the TnaC nascent peptide inhibits ribosomal activity in the presence of l-tryptophan, inducing expression of the tnaCAB operon in Escherichia coli. Using chemical methylation, this work reveals how interactions between TnaC and the ribosome are affected by mutations in both molecules. The presence of the TnaC-tRNA(Pro) peptidyl-tRNA within the ribosome protects the 23S rRNA nucleotide U2609 against chemical methylation. Such protection was not observed in mutant ribosomes containing changes in 23S rRNA nucleotides of the A748-A752 region. Nucleotides A752 and U2609 establish a base-pair interaction. Most replacements of either A752 or U2609 affected Trp induction of a TnaC-regulated LacZ reporter. However, the single change A752G, or the dual replacements A752G and U2609C, maintained Trp induction. Replacements at the conserved TnaC residues W12 and D16 also abolished the protection of U2609 by TnaC-tRNA(Pro) against chemical methylation. These data indicate that the TnaC nascent peptide in the ribosome exit tunnel interacts with the U2609 nucleotide when the ribosome is Trp responsive. This interaction is affected by mutational changes in exit tunnel nucleotides of 23S rRNA, as well as in conserved TnaC residues, suggesting that they affect the structure of the exit tunnel and/or the nascent peptide configuration in the tunnel. PMID:22110039

  18. Production of ribosome-inactivating protein from hairy root cultures of Luffa cylindrica (L.) Roem.

    di Toppi, L S; Gorini, P; Properzi, G; Barbieri, L; Spanò, L

    1996-09-01

    Transformed root lines of Luffa cylindrica (L.) Roem. (Cucurbitaceae) were established by inoculation of in vitro grown plantlets with wild type Agrobacterium rhizogenes strain 1855. Cloned lines of hairy roots were tested for the presence of ribosome-inactivating proteins; crude extracts inhibited protein synthesis in a reaction mixture based on rabbit reticulocyte lysate. Inhibitory activity increased during culture period, reaching a maximum value in the stationary phase. No activity could be detected in the culture medium, nor in extracts from callus and/or suspension cultures. A ribosome-inactivating protein having specific activity of 62,100 U mg protein(-1) and a molecular mass of 26-28,000 Da was purified to homogeneity. The protein showed N-glycosidase activity on rat liver ribosomes. The results demonstrate that hairy root cultures can be successfully utilized for the in vitro production of ribosome-inactivating proteins. PMID:24178273

  19. Affinity chromatography and capillary electrophoresis for analysis of the yeast ribosomal proteins

    Miriam S. Goyder

    2012-04-01

    Full Text Available We present a top down separation platform for yeast ribosomalproteins using affinity chromatography and capillary electrophoresiswhich is designed to allow deposition of proteins ontoa substrate. FLAG tagged ribosomes were affinity purified, andrRNA acid precipitation was performed on the ribosomes followedby capillary electrophoresis to separate the ribosomalproteins. Over 26 peaks were detected with excellent reproducibility(<0.5% RSD migration time. This is the first reportedseparation of eukaryotic ribosomal proteins using capillaryelectrophoresis. The two stages in this workflow, affinity chromatographyand capillary electrophoresis, share the advantagesthat they are fast, flexible and have small sample requirementsin comparison to more commonly used techniques. This methodis a remarkably quick route from cell to separation that hasthe potential to be coupled to high throughput readout platformsfor studies of the ribosomal proteome. [BMB reports2012; 45(4: 233-238

  20. Changes in ribosomal proteins in wheat embryos in the course of grain development and maturation

    Stanisław Weidner

    2014-02-01

    Full Text Available It was found, by comparing the densitometric profiles of ribosomal proteins of wheat embryos in milk and full grain ripeness, that in the process of development and ripening of caryopses the percentual proportion of low molecular weight proteins increases at the cost of those of high molecular weight. This concerns both acidic and basic proteins. In electrophoretic separation of ribosomal proteins from embryos of fully ripe seeds by the method of two-dimensional electrophoresis the appearance of three new low molecular weight proteins - an acidic one and two basic ones - was observed. These proteins were not found in the embryos of caryopses of milk ripeness. These results indicate that with development and ripening of wheat caryopses new low molecular weight ribosomal proteins are built into the ribosomes in the embryo. These changes are both quantitative and qualitative.

  1. Generation of monoclonal antibodies for the assessment of protein purification by recombinant ribosomal coupling

    Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk;

    2005-01-01

    We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23....... We therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could...... purified by Protein G Sepharose affinity chromatography. The purified antibodies were used to evaluate the separation of ribosomes from GFP, streptavidin, murine interleukin-6, a phagedisplay antibody and yeast elongation factor 1A by centrifugation, when ribosomes with covalently coupled target protein...

  2. Study of the Ribosomal Stress Pathway in Pluripotency, Cancer and Disease

    Morgado Palacín, Lucía

    2016-01-01

    Tesis Doctoral inédita leída en la Universidad Autónoma de Madrid, Facultad de Ciencias, Departamento de Biología Molecular La vía de estrés ribosomal se describió hace más de una década como una nueva vía activadora de p53. Dicha vía monitoriza la homeostasis de la biogénesis ribosomal. Perturbaciones en cualquiera de las etapas de la biosíntesis del ribosoma, transcripción del DNA ribosomal, procesamiento del RNA ribosomal, ensamblaje o transporte nuclear, conllevan un exceso de prote...

  3. Molecular basis for the ribosome functioning as an L-tryptophan sensor.

    Bischoff, Lukas; Berninghausen, Otto; Beckmann, Roland

    2014-10-23

    Elevated levels of the free amino acid L-tryptophan (L-Trp) trigger expression of the tryptophanase tnaCAB operon in E. coli. Activation depends on tryptophan-dependent ribosomal stalling during translation of the upstream TnaC peptide. Here, we present a cryoelectron microscopy (cryo-EM) reconstruction at 3.8 Å resolution of a ribosome stalled by the TnaC peptide. Unexpectedly, we observe two L-Trp molecules in the ribosomal exit tunnel coordinated within composite hydrophobic pockets formed by the nascent TnaC peptide and the tunnel wall. As a result, the peptidyl transferase center (PTC) adopts a distinct conformation that precludes productive accommodation of release factor 2 (RF2), thereby inducing translational stalling. Collectively, our results demonstrate how the translating ribosome can act as a small molecule sensor for gene regulation. PMID:25310980

  4. Molecular Basis for the Ribosome Functioning as an L-Tryptophan Sensor

    Lukas Bischoff

    2014-10-01

    Full Text Available Elevated levels of the free amino acid L-tryptophan (L-Trp trigger expression of the tryptophanase tnaCAB operon in E. coli. Activation depends on tryptophan-dependent ribosomal stalling during translation of the upstream TnaC peptide. Here, we present a cryoelectron microscopy (cryo-EM reconstruction at 3.8 Å resolution of a ribosome stalled by the TnaC peptide. Unexpectedly, we observe two L-Trp molecules in the ribosomal exit tunnel coordinated within composite hydrophobic pockets formed by the nascent TnaC peptide and the tunnel wall. As a result, the peptidyl transferase center (PTC adopts a distinct conformation that precludes productive accommodation of release factor 2 (RF2, thereby inducing translational stalling. Collectively, our results demonstrate how the translating ribosome can act as a small molecule sensor for gene regulation.

  5. Three distinct ribosome assemblies modulated by translation are the building blocks of polysomes.

    Viero, Gabriella; Lunelli, Lorenzo; Passerini, Andrea; Bianchini, Paolo; Gilbert, Robert J; Bernabò, Paola; Tebaldi, Toma; Diaspro, Alberto; Pederzolli, Cecilia; Quattrone, Alessandro

    2015-03-01

    Translation is increasingly recognized as a central control layer of gene expression in eukaryotic cells. The overall organization of mRNA and ribosomes within polysomes, as well as the possible role of this organization in translation are poorly understood. Here we show that polysomes are primarily formed by three distinct classes of ribosome assemblies. We observe that these assemblies can be connected by naked RNA regions of the transcript. We show that the relative proportions of the three classes of ribosome assemblies reflect, and probably dictate, the level of translational activity. These results reveal the existence of recurrent supra-ribosomal building blocks forming polysomes and suggest the presence of unexplored translational controls embedded in the polysome structure. PMID:25713412

  6. The human mitochondrial ribosome recycling factor is essential for cell viability.

    Rorbach, J.; Richter, R.; Wessels, H.J.; Wydro, M.; Pekalski, M.; Farhoud, M.; Kuhl, I.; Gaisne, M.; Bonnefoy, N.; Smeitink, J.A.M.; Lightowlers, R.N.; Chrzanowska-Lightowlers, Z.M.

    2008-01-01

    The molecular mechanism of human mitochondrial translation has yet to be fully described. We are particularly interested in understanding the process of translational termination and ribosome recycling in the mitochondrion. Several candidates have been implicated, for which subcellular localization

  7. Automated genome mining of ribosomal peptide natural products

    Mohimani, Hosein; Kersten, Roland; Liu, Wei; Wang, Mingxun; Purvine, Samuel O.; Wu, Si; Brewer, Heather M.; Pasa-Tolic, Ljiljana; Bandeira, Nuno; Moore, Bradley S.; Pevzner, Pavel A.; Dorrestein, Pieter C.

    2014-07-31

    Ribosomally synthesized and posttranslationally modified peptides (RiPPs), especially from microbial sources, are a large group of bioactive natural products that are a promising source of new (bio)chemistry and bioactivity (1). In light of exponentially increasing microbial genome databases and improved mass spectrometry (MS)-based metabolomic platforms, there is a need for computational tools that connect natural product genotypes predicted from microbial genome sequences with their corresponding chemotypes from metabolomic datasets. Here, we introduce RiPPquest, a tandem mass spectrometry database search tool for identification of microbial RiPPs and apply it for lanthipeptide discovery. RiPPquest uses genomics to limit search space to the vicinity of RiPP biosynthetic genes and proteomics to analyze extensive peptide modifications and compute p-values of peptide-spectrum matches (PSMs). We highlight RiPPquest by connection of multiple RiPPs from extracts of Streptomyces to their gene clusters and by the discovery of a new class III lanthipeptide, informatipeptin, from Streptomyces viridochromogenes DSM 40736 as the first natural product to be identified in an automated fashion by genome mining. The presented tool is available at cy-clo.ucsd.edu.

  8. Visualization of ribosomal RNA operon copy number distribution

    DasGupta Indrani

    2009-09-01

    Full Text Available Abstract Background Results of microbial ecology studies using 16S rRNA sequence information can be deceiving due to differences in rRNA operon copy number and genome size of the detected organisms. It therefore will be useful for investigators to have a better understanding of how these two parameters differ in various organism types. In this study, the number of ribosomal operons and genome size were separately mapped onto a Bacterial phylogenetic tree. Results A representative Bacterial tree was constructed using 31 marker genes found in 578 bacterial genome sequences. Organism names are displayed on the trees using graduations of color such that similar colors indicate similar numbers of operons or genome size. The resulting images provide an intuitive understanding of how copy number and genome size vary in different Bacterial phyla. Conclusion Once the phylogenetic position of a novel organism is known the number of rRNA operons, and to a lesser extent the genome size, can be estimated by examination of the colored maps. Further detail can then be obtained for members of relevant taxa from the rrnDB database.

  9. Folding and escape of nascent proteins at ribosomal exit tunnel

    Bui, Phuong Thuy; Hoang, Trinh Xuan

    2016-03-01

    We investigate the interplay between post-translational folding and escape of two small single-domain proteins at the ribosomal exit tunnel by using Langevin dynamics with coarse-grained models. It is shown that at temperatures lower or near the temperature of the fastest folding, folding proceeds concomitantly with the escape process, resulting in vectorial folding and enhancement of foldability of nascent proteins. The concomitance between the two processes, however, deteriorates as temperature increases. Our folding simulations as well as free energy calculation by using umbrella sampling show that, at low temperatures, folding at the tunnel follows one or two specific pathways without kinetic traps. It is shown that the escape time can be mapped to a one-dimensional diffusion model with two different regimes for temperatures above and below the folding transition temperature. Attractive interactions between amino acids and attractive sites on the tunnel wall lead to a free energy barrier along the escape route of the protein. It is suggested that this barrier slows down the escape process and consequently promotes correct folding of the released nascent protein.

  10. Ribosome reinitiation at leader peptides increases translation of bacterial proteins.

    Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A

    2016-01-01

    Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well. PMID:27084079

  11. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides.

    Doi, Yohei; Arakawa, Yoshichika

    2007-07-01

    Methylation of 16S ribosomal RNA (rRNA) has recently emerged as a new mechanism of resistance against aminoglycosides among gram-negative pathogens belonging to the family Enterobacteriaceae and glucose-nonfermentative microbes, including Pseudomonas aeruginosa and Acinetobacter species. This event is mediated by a newly recognized group of 16S rRNA methylases, which share modest similarity to those produced by aminoglycoside-producing actinomycetes. Their presence confers a high level of resistance to all parenterally administered aminoglycosides that are currently in clinical use. The responsible genes are mostly located on transposons within transferable plasmids, which provides them with the potential to spread horizontally and may in part explain the already worldwide distribution of this novel resistance mechanism. Some of these organisms have been found to coproduce extended-spectrum beta-lactamases or metallo-beta-lactamases, contributing to their multidrug-resistant phenotypes. A 2-tiered approach, consisting of disk diffusion tests followed by confirmation with polymerase chain reaction, is recommended for detection of 16S rRNA methylase-mediated resistance. PMID:17554708

  12. Sensitivity of ribosomes of the hyperthermophilic bacterium Aquifex pyrophilus to aminoglycoside antibiotics.

    Bocchetta, M; Huber, R.; Cammarano, P

    1996-01-01

    A poly(U)-programmed cell-free system from the hyperthermophilic bacterium Aquifex pyrophilus has been developed, and the susceptibility of Aquifex ribosomes to the miscoding-inducing and inhibitory actions of all known classes of aminoglycoside antibiotics has been assayed at temperatures (75 to 80 degrees C) close to the physiological optimum for cell growth. Unlike Thermotoga maritima ribosomes, which are systematically refractory to all known classes of aminoglycoside compounds (P. Londei...

  13. KIF4 Mediates Anterograde Translocation and Positioning of Ribosomal Constituents to Axons*S⃞

    Bisbal, Mariano; Wojnacki, José; Peretti, Diego; Ropolo, Andrea; Sesma, Juliana; Jausoro, Ignacio; Cáceres, Alfredo

    2009-01-01

    In this study, we have used a combination of biochemical and molecular biology techniques to demonstrate that the C-terminal tail domain of KIF4 directly interacts with P0, a major protein component of ribosomes. Besides, in dorsal root ganglion neurons, KIF4 and P0, as well as other ribosomal constituents, colocalize in clusters distributed along axons and neuritic tips. RNA interference suppression of KIF4 or expression of KIF4 variants lacking the tail domain or mut...

  14. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis.

    Felske, A; B. Engelen; Nübel, U; Backhaus, H

    1996-01-01

    A simple method that combines an adapted ribosome isolation method and a common RNA extraction step has been developed for selective recovery of intact rRNA from natural microbial communities in soil. After mechanical cell lysis, ribosomes are separated by centrifugation steps, avoiding massive humic acid contamination and RNA degradation. The protocol accommodates the complex composition of soils by blocking adsorbing surfaces and humic acids with polyvinylpyrrolidone and bovine serum albumi...

  15. Cytoplasmic long noncoding RNAs are frequently bound to and degraded at ribosomes in human cells

    Carlevaro-Fita, Joana; Rahim, Anisa; Guigó, Roderic; Vardy, Leah A.; Johnson, Rory

    2016-01-01

    Recent footprinting studies have made the surprising observation that long noncoding RNAs (lncRNAs) physically interact with ribosomes. However, these findings remain controversial, and the overall proportion of cytoplasmic lncRNAs involved is unknown. Here we make a global, absolute estimate of the cytoplasmic and ribosome-associated population of stringently filtered lncRNAs in a human cell line using polysome profiling coupled to spike-in normalized microarray analysis. Fifty-four percent ...

  16. Structural and Functional Characterization of Ribosomal Protein Gene Introns in Sponges

    Perina, Dragutin; Korolija, Marina; Mikoč, Andreja; Roller Milošević, Maša; Pleše, Bruna; Imešek, Mirna; Morrow, Christine; Batel, Renato; Ćetković, Helena

    2012-01-01

    Ribosomal protein genes (RPGs) are a powerful tool for studying intron evolution. They exist in all three domains of life and are much conserved. Accumulating genomic data suggest that RPG introns in many organisms abound with non-protein-coding-RNAs (ncRNAs). These ancient ncRNAs are small nucleolar RNAs (snoRNAs) essential for ribosome assembly. They are also mobile genetic elements and therefore probably important in diversification and enrichment of transcriptomes through various mechanis...

  17. Internal ribosome entry sequence-mediated translation initiation triggers nonsense-mediated decay

    Holbrook, Jill A; Neu-Yilik, Gabriele; Gehring, Niels H; Kulozik, Andreas E.; Hentze, Matthias W.

    2006-01-01

    In eukaryotes, a surveillance pathway known as nonsense-mediated decay (NMD) regulates the abundance of messenger RNAs containing premature termination codons (PTCs). In mammalian cells, it has been asserted that the NMD-relevant first round of translation is special and involves initiation by a specific protein heterodimer, the nuclear cap-binding complex (CBC). Arguing against a requirement for CBC-mediated translation initiation, we show that ribosomal recruitment by the internal ribosomal...

  18. Tight binding of clarithromycin, its 14-(R)-hydroxy metabolite, and erythromycin to Helicobacter pylori ribosomes.

    Goldman, R.C. (Robert C.); Zakula, D; Flamm, R; Beyer, J; Capobianco, J.

    1994-01-01

    Clarithromycin is a recently approved macrolide with improved pharmacokinetics, antibacterial activity, and efficacy in treating bacterial infections including those caused by Helicobacter pylori, an agent implicated in various forms of gastric disease. We successfully isolated ribosomes from H. pylori and present the results of a study of their interaction with macrolides. Kinetic data were obtained by using 14C-labeled macrolides to probe the ribosomal binding site. Clarithromycin, its pare...

  19. Evidence that ribosomal protein S10 participates in control of transcription termination.

    Friedman, D I; Schauer, A T; Baumann, M R; Baron, L S; Adhya, S L

    1981-01-01

    We report the isolation of an Escherichia coli K-12 strain with a mutation, nusE71, that results in a change in ribosomal protein S10. Phage lambda fails to grow in hosts carrying the nusE71 mutation because the lambda N gene product is not active. The N product regulates phage gene expression by altering transcription complexes so that they can overcome termination barriers. This suggests that a ribosomal protein is involved in antitermination of transcription.

  20. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L. J.

    2016-01-01

    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucl...

  1. Telomerase Holoenzyme Proteins and Processivity Subunit in Tetrahymena thermophila

    Min, Bosun

    2009-01-01

    Telomeres are specialized protein-DNA structures that protect the ends of linear chromosomes, and they are maintained by the telomerase ribonucleoprotein (RNP) enzyme complex. Recombinant telomerase RNP with catalytic activity contains, at a minimum, the catalytic reverse transcriptase subunit (TERT) and the telomerase RNA (TER). However, endogenous telomerase is a much larger holoenzyme complex, with telomerase-associated subunits that contribute to RNP assembly and regulation. Telomerase-as...

  2. Echinococcus granulosus Antigen B Structure: Subunit Composition and Oligomeric States

    Monteiro, Karina M.; Cardoso, Mateus B.; Follmer, Cristian; da Silveira, Nádya P.; Vargas, Daiani M.; Kitajima, Elliot W.; Zaha, Arnaldo; Ferreira, Henrique B.

    2012-01-01

    Background Antigen B (AgB) is the major protein secreted by the Echinococcus granulosus metacestode and is involved in key host-parasite interactions during infection. The full comprehension of AgB functions depends on the elucidation of several structural aspects that remain unknown, such as its subunit composition and oligomeric states. Methodology/Principal Findings The subunit composition of E. granulosus AgB oligomers from individual bovine and human cysts was assessed by mass spectromet...

  3. Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions

    Römling, Ute; Galperin, Michael Y

    2015-01-01

    Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis ...

  4. Translation Initiation is Controlled by RNA Folding Kinetics via a Ribosome Drafting Mechanism.

    Espah Borujeni, Amin; Salis, Howard M

    2016-06-01

    RNA folding plays an important role in controlling protein synthesis as well as other cellular processes. Existing models have focused on how RNA folding energetics control translation initiation rate under equilibrium conditions but have largely ignored the effects of nonequilibrium RNA folding. We introduce a new mechanism, called "ribosome drafting", that explains how a mRNA's folding kinetics and the ribosome's binding rate collectively control its translation initiation rate. During cycles of translation, ribosome drafting emerges whenever successive ribosomes bind to a mRNA faster than the mRNA can refold, maintaining it in a nonequilibrium state with an acceleration of protein synthesis. Using computational design, time-correlated single photon counting, and expression measurements, we demonstrate that slow-folding and fast-folding RNA structures with equivalent folding energetics can vary protein synthesis rates by 1000-fold. We determine the necessary conditions for ribosome drafting by characterizing mRNAs with rationally designed ribosome binding rates, folding kinetics, and folding energetics, confirming the predictions of a nonequilibrium Markov model of translation. Our results have widespread implications, illustrating how competitive folding and assembly kinetics can shape the gene expression machinery's sequence-structure-function relationship inside cells. PMID:27199273

  5. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    Paul B. Essers

    2015-01-01

    Full Text Available The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs from normal strains of Caenorhabditis elegans to those carrying the life-extending daf-2 mutation. We found a long noncoding RNA (lncRNA, transcribed telomeric sequence 1 (tts-1, on ribosomes of the daf-2 mutant. Depleting tts-1 in daf-2 mutants increases ribosome levels and significantly shortens their extended lifespan. We find tts-1 is also required for the longer lifespan of the mitochondrial clk-1 mutants but not the feeding-defective eat-2 mutants. In line with this, the clk-1 mutants express more tts-1 and fewer ribosomes than the eat-2 mutants. Our results suggest that the expression of tts-1 functions in different longevity pathways to reduce ribosome levels in a way that promotes life extension.

  6. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  7. Ribosomal protein methylation in Escherichia coli: the gene prmA, encoding the ribosomal protein L11 methyltransferase, is dispensable.

    Vanet, A; Plumbridge, J A; Guérin, M F; Alix, J H

    1994-12-01

    The prmA gene, located at 72 min on the Escherichia coli chromosome, is the genetic determinant of ribosomal protein L11-methyltransferase activity. Mutations at this locus, prmA1 and prmA3, result in a severely undermethylated form of L11. No effect, other than the lack of methyl groups on L11, has been ascribed to these mutations. DNA sequence analysis of the mutant alleles prmA1 and prmA3 detected point mutations near the C-terminus of the protein and plasmids overproducing the wild-type and the two mutant proteins have been constructed. The wild-type PrmA protein could be crosslinked to its radiolabelled substrate, S-adenosyl-L-methionine (SAM), by u.v. irradiation indicating that it is the gene for the methyltransferase rather than a regulatory protein. One of the mutant proteins, PrmA3, was also weakly crosslinked to SAM. Both mutant enzymes when expressed from the overproducing plasmids were capable of catalysing the incorporation of 3H-labelled methyl groups from SAM to L11 in vitro. This confirmed the observation that the mutant proteins possess significant residual activity which could account for their lack of growth phenotype. However, a strain carrying an in vitro-constructed null mutation of the prmA gene, transferred to the E. coli chromosome by homologous recombination, was perfectly viable. PMID:7715456

  8. Secondary structure and phylogenetic utility of the ribosomal large subunit (28S) in monogeneans of the genus Thaparocleidus and Bifurcohaptor (Monogenea: Dactylogyridae).

    Chaudhary, Anshu; Singh, Hridaya Shanker

    2013-04-01

    Present communication deals with secondary structure of 28S rDNA of two already known species of monogeneans viz., Bifurcohaptor indicus and Thaparocleidus parvulus parasitizing gill filaments of a freshwater fish, Mystus vittatus for phylogenetic inference. Secondary structure data are best used as accessory taxonomic characters as their phylogenetic resolving power and confidence in validity. Secondary structure of the 28S rDNA transcript could provide information for identifying homologous nucleotide characters, useful for cladistic inference of relationships. Such structure data could be used as taxonomic character. The study supports that species-level sequence variability renders 28S sequence as a unique window for examining the behavior of fast evolving, non-coding DNA sequences. Apart from this it also confirms that molecular similarity present in various species could be host-induced. PMID:24431545

  9. The antibiotic Furvina® targets the P-site of 30S ribosomal subunits and inhibits translation initiation displaying start codon bias

    Fabbretti, Attilio; Brandi, Letizia; Petrelli, Dezemona; Pon, Cynthia L.; Castañedo, Nilo R.; Medina, Ricardo; Gualerzi, Claudio O.

    2012-01-01

    Furvina®, also denominated G1 (MW 297), is a synthetic nitrovinylfuran [2-bromo-5-(2-bromo-2-nitrovinyl)-furan] antibiotic with a broad antimicrobial spectrum. An ointment (Dermofural®) containing G1 as the only active principle is currently marketed in Cuba and successfully used to treat dermatological infections. Here we describe the molecular target and mechanism of action of G1 in bacteria and demonstrate that in vivo G1 preferentially inhibits protein synthesis over RNA, DNA and cell wal...

  10. Absence of association between Plasmodium falciparum small sub-unit ribosomal RNA gene mutations and in vitro decreased susceptibility to doxycycline

    Gaillard, Tiphaine; Wurtz, Nathalie; Houzé, Sandrine; Sriprawat, Kanlaya; Wangsing, Chirapat; Hubert, Véronique; Lebras, Jacques; Nosten, François; Briolant, Sébastien; Pradines, Bruno; ,

    2015-01-01

    Background Doxycycline is an antibiotic used in combination with quinine or artesunate for malaria treatment or alone for malaria chemoprophylaxis. Recently, one prophylactic failure has been reported, and several studies have highlighted in vitro doxycycline decreased susceptibility in Plasmodium falciparum isolates from different areas. The genetic markers that contribute to detecting and monitoring the susceptibility of P. falciparum to doxycycline, the pfmdt and pftetQ genes, have recentl...

  11. The phylogeny of marine and freshwater species of the genus Chloromyxum Mingazzini, 1890 (Myxosporea: Bivalvulida) based on small subunit ribosomal RNA gene sequences

    Fiala, Ivan; Dyková, Iva

    2004-01-01

    Roč. 51, 2/3 (2004), s. 211-214. ISSN 0015-5683 R&D Projects: GA ČR GD524/03/H133 Institutional research plan: CEZ:AV0Z6022909 Keywords : Myxosporea * Chloromyxum * phylogeny Subject RIV: EA - Cell Biology Impact factor: 0.837, year: 2004

  12. Secondary structure and phylogenetic utility of the ribosomal large subunit (28S) in monogeneans of the genus Thaparocleidus and Bifurcohaptor (Monogenea: Dactylogyridae)

    Chaudhary, Anshu; SINGH, HRIDAYA SHANKER

    2012-01-01

    Present communication deals with secondary structure of 28S rDNA of two already known species of monogeneans viz., Bifurcohaptor indicus and Thaparocleidus parvulus parasitizing gill filaments of a freshwater fish, Mystus vittatus for phylogenetic inference. Secondary structure data are best used as accessory taxonomic characters as their phylogenetic resolving power and confidence in validity. Secondary structure of the 28S rDNA transcript could provide information for identifying homologous...

  13. Morphology and small subunit rRNA gene sequence of Uronemita parabinucleata n. sp. (Ciliophora, Uronematidae), with an improved generic diagnosis.

    Liu, Mingjian; Gao, Feng; Al-Farraj, Saleh A; Hu, Xiaozhong

    2016-06-01

    The morphology and infraciliature of a new species, Uronemita parabinucleata n. sp., isolated from intertidal sediments in a coastal region in northern China, were investigated using live observation and silver impregnation methods. The new species is characterized by an in vivo body size of about 20-50×10-25μm, 22 or 23 somatic kineties, two macronuclear nodules, and one caudal cilium. Its small subunit ribosomal RNA gene (SSU rDNA) was sequenced and compared with those of other Uronemita species to reveal nucleotide differences. Phylogenetic analyses indicated that Uronemita is monophyletic and that the new species clusters with its congener Uronemita filificum, with full support provided by both Bayesian inference and maximum likelihood algorithms. Based on previous studies and the present study, an improved diagnosis of the genus Uronemita is supplied, which has been absent since the establishment of this genus. A key to the Uronemita species is also provided. PMID:26999559

  14. Microarray data analyses of yeast RNA Pol I subunit RPA12 deletion strain

    Kamlesh Kumar Yadav

    2016-06-01

    Full Text Available The ribosomal RNA (rRNA biosynthesis is the most energy consuming process in all living cells and the majority of total transcription activity is dedicated for synthesizing rRNA. The cells may adjust the synthesis of rRNA with the availability of resources. rRNA is mainly synthesized by RNA polymerase I that is composed of 14 subunits. Deletion of RPA12, 14, 39 and 49 are viable. RPA12 is a very small protein (13.6 kDa, and the amount of protein in the cells is very high (12,000 molecules per cell, but the role of this protein is unknown in other cellular metabolic processes (Kulak et al., 2014 [1]. RPA12 consists of two zinc-binding domains and it is required for the termination of rRNA synthesis (Mullem et al., 2002 [2]. Deletions of RPA12 in Saccharomyces cerevisiae and Schizosaccharomyces pombe cause a conditional growth defect (Nogi et al., 1993 [3]. In S. pombe, C-terminal deletion behaves like wild-type (Imazawa et al., 2001 [4]. This prompted us to investigate in detail the physiological role of RPA12 in S. cerevisiae, we performed the microarray of rpa12∆ strain and deposited into Gene Expression Omnibus under GSE68731. The analysis of microarray data revealed that the expression of major cellular metabolism genes is high. The amino acid biosynthesis, nonpolar lipid biosynthesis and glucose metabolic genes are highly expressed. The analyses also revealed that the rpa12∆ cells have an uncontrolled synthesis of cell metabolites, so RPA12 could be a master regulator for whole cellular metabolism.

  15. Mimicking Ribosomal Unfolding of RNA Pseudoknot in a Protein Channel.

    Zhang, Xinyue; Xu, Xiaojun; Yang, Zhiyu; Burcke, Andrew J; Gates, Kent S; Chen, Shi-Jie; Gu, Li-Qun

    2015-12-23

    Pseudoknots are a fundamental RNA tertiary structure with important roles in regulation of mRNA translation. Molecular force spectroscopic approaches such as optical tweezers can track the pseudoknot's unfolding intermediate states by pulling the RNA chain from both ends, but the kinetic unfolding pathway induced by this method may be different from that in vivo, which occurs during translation and proceeds from the 5' to 3' end. Here we developed a ribosome-mimicking, nanopore pulling assay for dissecting the vectorial unfolding mechanism of pseudoknots. The pseudoknot unfolding pathway in the nanopore, either from the 5' to 3' end or in the reverse direction, can be controlled by a DNA leader that is attached to the pseudoknot at the 5' or 3' ends. The different nanopore conductance between DNA and RNA translocation serves as a marker for the position and structure of the unfolding RNA in the pore. With this design, we provided evidence that the pseudoknot unfolding is a two-step, multistate, metal ion-regulated process depending on the pulling direction. Most notably, unfolding in both directions is rate-limited by the unzipping of the first helix domain (first step), which is Helix-1 in the 5' → 3' direction and Helix-2 in the 3' → 5' direction, suggesting that the initial unfolding step in either pulling direction needs to overcome an energy barrier contributed by the noncanonical triplex base-pairs and coaxial stacking interactions for the tertiary structure stabilization. These findings provide new insights into RNA vectorial unfolding mechanisms, which play an important role in biological functions including frameshifting. PMID:26595106

  16. The DNA virus white spot syndrome virus uses an internal ribosome entry site for translation of the highly expressed nonstructural protein ICP35.

    Kang, Shih-Ting; Wang, Han-Ching; Yang, Yi-Ting; Kou, Guang-Hsiung; Lo, Chu-Fang

    2013-12-01

    Although shrimp white spot syndrome virus (WSSV) is a large double-stranded DNA virus (∼300 kbp), it expresses many polycistronic mRNAs that are likely to use internal ribosome entry site (IRES) elements for translation. A polycistronic mRNA encodes the gene of the highly expressed nonstructural protein ICP35, and here we use a dual-luciferase assay to demonstrate that this protein is translated cap independently by an IRES element located in the 5' untranslated region of icp35. A deletion analysis of this region showed that IRES activity was due to stem-loops VII and VIII. A promoterless assay, a reverse transcription-PCR together with quantitative real-time PCR analysis, and a stable stem-loop insertion upstream of the Renilla luciferase open reading frame were used, respectively, to rule out the possibility that cryptic promoter activity, abnormal splicing, or read-through was contributing to the IRES activity. In addition, a Northern blot analysis was used to confirm that only a single bicistronic mRNA was expressed. The importance of ICP35 to viral replication was demonstrated in a double-stranded RNA (dsRNA) interference knockdown experiment in which the mortality of the icp35 dsRNA group was significantly reduced. Tunicamycin was used to show that the α subunit of eukaryotic initiation factor 2 is required for icp35 IRES activity. We also found that the intercalating drug quinacrine significantly inhibited icp35 IRES activity in vitro and reduced the mortality rate and viral copy number in WSSV-challenged shrimp. Lastly, in Sf9 insect cells, we found that knockdown of the gene for the Spodoptera frugiperda 40S ribosomal protein RPS10 decreased icp35 IRES-regulated firefly luciferase activity but had no effect on cap-dependent translation. PMID:24089551

  17. An RNA-binding complex involved in ribosome biogenesis contains a protein with homology to tRNA CCA-adding enzyme.

    Jinzhong Lin

    2013-10-01

    Full Text Available A multitude of proteins and small nucleolar RNAs transiently associate with eukaryotic ribosomal RNAs to direct their modification and processing and the assembly of ribosomal proteins. Utp22 and Rrp7, two interacting proteins with no recognizable domain, are components of the 90S preribosome or the small subunit processome that conducts early processing of 18S rRNA. Here, we determine the cocrystal structure of Utp22 and Rrp7 complex at 1.97 Å resolution and the NMR structure of a C-terminal fragment of Rrp7, which is not visible in the crystal structure. The structure reveals that Utp22 surprisingly resembles a dimeric class I tRNA CCA-adding enzyme yet with degenerate active sites, raising an interesting evolutionary connection between tRNA and rRNA processing machineries. Rrp7 binds extensively to Utp22 using a deviant RNA recognition motif and an extended linker. Functional sites on the two proteins were identified by structure-based mutagenesis in yeast. We show that Rrp7 contains a flexible RNA-binding C-terminal tail that is essential for association with preribosomes. RNA-protein crosslinking shows that Rrp7 binds at the central domain of 18S rRNA and shares a neighborhood with two processing H/ACA snoRNAs snR30 and snR10. Depletion of snR30 prevents the stable assembly of Rrp7 into preribosomes. Our results provide insight into the evolutionary origin and functional context of Utp22 and Rrp7.

  18. Functional diversity of complex I subunits in Candida albicans mitochondria.

    Li, Dongmei; She, Xiaodong; Calderone, Richard

    2016-02-01

    Our interest in the mitochondria of Candida albicans has progressed to the identification of several proteins that are critical to complex I (CI) activity. We speculated that there should be major functional differences at the protein level between mammalian and fungal mitochondria CI. In our pursuit of this idea, we were helped by published data of CI subunit proteins from a broad diversity of species that included two subunit proteins that are not found in mammals. These subunit proteins have been designated as Nuo1p and Nuo2p (NADH-ubiquinone oxidoreductases). Since functional assignments of both C. albicans proteins were unknown, other than having a putative NADH-oxidoreductase activity, we constructed knock-out strains that could be compared to parental cells. The relevance of our research relates to the critical roles of both proteins in cell biology and pathogenesis and their absence in mammals. These features suggest they may be exploited in antifungal drug discovery. Initially, we characterized Goa1p that apparently regulates CI activity but is not a CI subunit protein. We have used the goa1∆ for comparisons to Nuo1p and Nuo2p. We have demonstrated the critical role of these proteins in maintaining CI activities, virulence, and prolonging life span. More recently, transcriptional profiling of the three mutants and an ndh51∆ (protein is a highly conserved CI subunit) has revealed that there are overlapping yet also different functional assignments that suggest subunit specificity. The differences and similarities of each are described below along with our hypotheses to explain these data. Our conclusion and perspective is that the C. albicans CI subunit proteins are highly conserved except for two that define non-mammalian functions. PMID:26373419

  19. Cytochrome c oxidase: evolution of control via nuclear subunit addition.

    Pierron, Denis; Wildman, Derek E; Hüttemann, Maik; Markondapatnaikuni, Gopi Chand; Aras, Siddhesh; Grossman, Lawrence I

    2012-04-01

    According to theory, present eukaryotic cells originated from a beneficial association between two free-living cells. Due to this endosymbiotic event the pre-eukaryotic cell gained access to oxidative phosphorylation (OXPHOS), which produces more than 15 times as much ATP as glycolysis. Because cellular ATP needs fluctuate and OXPHOS both requires and produces entities that can be toxic for eukaryotic cells such as ROS or NADH, we propose that the success of endosymbiosis has largely depended on the regulation of endosymbiont OXPHOS. Several studies have presented cytochrome c oxidase as a key regulator of OXPHOS; for example, COX is the only complex of mammalian OXPHOS with known tissue-specific isoforms of nuclear encoded subunits. We here discuss current knowledge about the origin of nuclear encoded subunits and the appearance of different isozymes promoted by tissue and cellular environments such as hypoxia. We also review evidence for recent selective pressure acting on COX among vertebrates, particularly in primate lineages, and discuss the unique pattern of co-evolution between the nuclear and mitochondrial genomes. Finally, even though the addition of nuclear encoded subunits was a major event in eukaryotic COX evolution, this does not lead to emergence of a more efficient COX, as might be expected from an anthropocentric point of view, for the "higher" organism possessing large brains and muscles. The main function of these subunits appears to be "only" to control the activity of the mitochondrial subunits. We propose that this control function is an as yet under appreciated key point of evolution. Moreover, the importance of regulating energy supply may have caused the addition of subunits encoded by the nucleus in a process comparable to a "domestication scenario" such that the host tends to control more and more tightly the ancestral activity of COX performed by the mtDNA encoded subunits. PMID:21802404

  20. Pituitary glycoprotein hormone a-subunit secretion by cirrhotic patients

    Oliveira M.C.

    1999-01-01

    Full Text Available Secretion of the a-subunit of pituitary glycoprotein hormones usually follows the secretion of intact gonadotropins and is increased in gonadal failure and decreased in isolated gonadotropin deficiency. The aim of the present study was to determine the levels of the a-subunit in the serum of patients with cirrhosis of the liver and to compare the results obtained for eugonadal cirrhotic patients with those obtained for cirrhotic patients with hypogonadotropic hypogonadism. Forty-seven of 63 patients with cirrhosis (74.6% presented hypogonadism (which was central in 45 cases and primary in 2, 7 were eugonadal, and 9 women were in normal menopause. The serum a-subunit was measured by the fluorimetric method using monoclonal antibodies. Cross-reactivity with LH, TSH, FSH and hCG was 6.5, 1.2, 4.3 and 1.1%, respectively, with an intra-assay coefficient of variation (CV of less than 5% and an interassay CV of 5%, and sensitivity limit of 4 ng/l. The serum a-subunit concentration ranged from 36 to 6253 ng/l, with a median of 273 ng/l. The median was 251 ng/l for patients with central hypogonadism and 198 ng/l for eugonadal patients. The correlation between the a-subunit and basal LH levels was significant both in the total sample (r = 0.48, P<0.01 and in the cirrhotic patients with central hypogonadism (r = 0.33, P = 0.02. Among men with central hypogonadism there was a negative correlation between a-subunit levels and total testosterone levels (r = 0.54, P<0.01 as well as free testosterone levels (r = -0.53, P<0.01. In conclusion, although the a-subunit levels are correlated with LH levels, at present they cannot be used as markers for hypogonadism in patients with cirrhosis of the liver.

  1. The ribosome as a missing link in prebiotic evolution II: Ribosomes encode ribosomal proteins that bind to common regions of their own mRNAs and rRNAs.

    Root-Bernstein, Robert; Root-Bernstein, Meredith

    2016-05-21

    We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their

  2. A residue substitution in the plastid ribosomal protein L12/AL1 produces defective plastid ribosome and causes early seedling lethality in rice.

    Zhao, Dong-Sheng; Zhang, Chang-Quan; Li, Qian-Feng; Yang, Qing-Qing; Gu, Ming-Hong; Liu, Qiao-Quan

    2016-05-01

    The plastid ribosome is essential for chloroplast biogenesis as well as seedling formation. As the plastid ribosome closely resembles the prokaryotic 70S ribosome, many plastid ribosomal proteins (PRPs) have been identified in higher plants. However, their assembly in the chloroplast ribosome in rice remains unclear. In the present study, we identified a novel rice mutant, albino lethal 1 (al1), from a chromosome segment substitution line population. The al1 mutant displayed an albino phenotype at the seedling stage and did not survive past the three-leaf stage. No other apparent differences in plant morphology were observed in the al1 mutant. The albino phenotype of the al1 mutant was associated with decreased chlorophyll content and abnormal chloroplast morphology. Using fine mapping, AL1 was shown to encode the PRPL12, a protein localized in the chloroplasts of rice, and a spontaneous single-nucleotide mutation (C/T), resulting in a residue substitution from leucine in AL1 to phenylalanine in al1, was found to be responsible for the early seedling lethality. This point mutation is located at the L10 interface feature of the L12/AL1 protein. Yeast two-hybrid analysis showed that there was no physical interaction between al1 and PRPL10. In addition, the mutation had little effect on the transcript abundance of al1, but had a remarkable effect on the protein abundance of al1 and transcript abundance of chloroplast biogenesis-related and photosynthesis-related genes. These results provide a first glimpse into the molecular details of L12's function in rice. PMID:26873698

  3. Abiotic Stress Resistance, a Novel Moonlighting Function of Ribosomal Protein RPL44 in the Halophilic Fungus Aspergillus glaucus

    LIU, XIAO-DAN; Xie, Lixia; Wei, Yi; Zhou, Xiaoyang; Jia, Baolei; Liu, Jinliang; Zhang, Shihong

    2014-01-01

    Ribosomal proteins are highly conserved components of basal cellular organelles, primarily involved in the translation of mRNA leading to protein synthesis. However, certain ribosomal proteins moonlight in the development and differentiation of organisms. In this study, the ribosomal protein L44 (RPL44), associated with salt resistance, was screened from the halophilic fungus Aspergillus glaucus (AgRPL44), and its activity was investigated in Saccharomyces cerevisiae and Nicotiana tabacum. Se...

  4. Subunit interactions change the heme active-site geometry in p-cresol methylhydroxylase.

    McLendon, G L; Bagby, S; Charman, J A; Driscoll, P. C.; McIntire, W S; Mathews, F. S.; Hill, H A

    1991-01-01

    The enzyme p-cresol methylhydroxylase [4-cresol: (acceptor) oxidoreductase (methyl-hydroxylating), EC 1.17.99.1] contains two subunits: a cytochrome c (electron transfer) subunit (cytochrome cpc) and a flavin (catalytic) subunit. When these subunits are separated by isoelectric focusing, a stable cytochrome subunit is obtained. Significant differences are observed between the one-dimensional NMR spectra of oxidized cytochrome cpc and of oxidized p-cresol methylhydroxylase. Analysis of the two...

  5. A two-step binding model proposed for the electrostatic interactions of ricin A chain with ribosomes

    Li, Xiao-Ping; Chiou, Jia-Chi; Remacha, Miguel; Ballesta, Juan P.G.; Tumer, Nilgun E.

    2009-01-01

    Ricin is a ribosome inactivating protein that catalytically removes a universally conserved adenine from the α-sarcin/ricin loop (SRL) of the 28S rRNA. We recently showed that ricin A chain (RTA) interacts with the P1 and P2 proteins of the ribosomal stalk to depurinate the SRL in yeast. Here we examined the interaction of RTA with wild type and mutant yeast ribosomes deleted in the stalk proteins by surface plasmon resonance. The interaction between RTA and wild type ribosomes did not follow...

  6. Structure of the human protein kinase CK2 catalytic subunit CK2α' and interaction thermodynamics with the regulatory subunit CK2β

    Bischoff, Nils; Olsen, Birgitte; Raaf, Jennifer; Bretner, Maria; Issinger, Olaf-Georg; Niefind, Karsten

    2011-01-01

    Protein kinase CK2 (formerly "casein kinase 2") is composed of a central dimer of noncatalytic subunits (CK2β) binding two catalytic subunits. In humans, there are two isoforms of the catalytic subunit (and an additional splicing variant), one of which (CK2α) is well characterized. To supplement ...

  7. Nucleic acid visualization with UCSF Chimera

    Couch, Gregory S.; Hendrix, Donna K.; Ferrin, Thomas E.

    2006-01-01

    With the increase in the number of large, 3D, high-resolution nucleic acid structures, particularly of the 30S and 50S ribosomal subunits and the intact bacterial ribosome, advancements in the visualization of nucleic acid structural features are essential. Large molecular structures are complicated and detailed, and one goal of visualization software is to allow the user to simplify the display of some features and accent others. We describe an extension to the UCSF Chimera molecular visuali...

  8. Cytoplasmic long noncoding RNAs are frequently bound to and degraded at ribosomes in human cells.

    Carlevaro-Fita, Joana; Rahim, Anisa; Guigó, Roderic; Vardy, Leah A; Johnson, Rory

    2016-06-01

    Recent footprinting studies have made the surprising observation that long noncoding RNAs (lncRNAs) physically interact with ribosomes. However, these findings remain controversial, and the overall proportion of cytoplasmic lncRNAs involved is unknown. Here we make a global, absolute estimate of the cytoplasmic and ribosome-associated population of stringently filtered lncRNAs in a human cell line using polysome profiling coupled to spike-in normalized microarray analysis. Fifty-four percent of expressed lncRNAs are detected in the cytoplasm. The majority of these (70%) have >50% of their cytoplasmic copies associated with polysomal fractions. These interactions are lost upon disruption of ribosomes by puromycin. Polysomal lncRNAs are distinguished by a number of 5' mRNA-like features, including capping and 5'UTR length. On the other hand, nonpolysomal "free cytoplasmic" lncRNAs have more conserved promoters and a wider range of expression across cell types. Exons of polysomal lncRNAs are depleted of endogenous retroviral insertions, suggesting a role for repetitive elements in lncRNA localization. Finally, we show that blocking of ribosomal elongation results in stabilization of many associated lncRNAs. Together these findings suggest that the ribosome is the default destination for the majority of cytoplasmic long noncoding RNAs and may play a role in their degradation. PMID:27090285

  9. Structural analysis of a signal peptide inside the ribosome tunnel by DNP MAS NMR.

    Lange, Sascha; Franks, W Trent; Rajagopalan, Nandhakishore; Döring, Kristina; Geiger, Michel A; Linden, Arne; van Rossum, Barth-Jan; Kramer, Günter; Bukau, Bernd; Oschkinat, Hartmut

    2016-08-01

    Proteins are synthesized in cells by ribosomes and, in parallel, prepared for folding or targeting. While ribosomal protein synthesis is progressing, the nascent chain exposes amino-terminal signal sequences or transmembrane domains that mediate interactions with specific interaction partners, such as the signal recognition particle (SRP), the SecA-adenosine triphosphatase, or the trigger factor. These binding events can set the course for folding in the cytoplasm and translocation across or insertion into membranes. A distinction of the respective pathways depends largely on the hydrophobicity of the recognition sequence. Hydrophobic transmembrane domains stabilize SRP binding, whereas less hydrophobic signal sequences, typical for periplasmic and outer membrane proteins, stimulate SecA binding and disfavor SRP interactions. In this context, the formation of helical structures of signal peptides within the ribosome was considered to be an important factor. We applied dynamic nuclear polarization magic-angle spinning nuclear magnetic resonance to investigate the conformational states of the disulfide oxidoreductase A (DsbA) signal peptide stalled within the exit tunnel of the ribosome. Our results suggest that the nascent chain comprising the DsbA signal sequence adopts an extended structure in the ribosome with only minor populations of helical structure. PMID:27551685

  10. Ribosome collisions and translation efficiency: optimization by codon usage and mRNA destabilization.

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen

    2008-09-26

    Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of mRNA breakdown is offset by the concomitant increase in translation efficiency. PMID:18619977

  11. Cytoplasmic long noncoding RNAs are frequently bound to and degraded at ribosomes in human cells

    Carlevaro-Fita, Joana; Rahim, Anisa; Guigó, Roderic; Vardy, Leah A.; Johnson, Rory

    2016-01-01

    Recent footprinting studies have made the surprising observation that long noncoding RNAs (lncRNAs) physically interact with ribosomes. However, these findings remain controversial, and the overall proportion of cytoplasmic lncRNAs involved is unknown. Here we make a global, absolute estimate of the cytoplasmic and ribosome-associated population of stringently filtered lncRNAs in a human cell line using polysome profiling coupled to spike-in normalized microarray analysis. Fifty-four percent of expressed lncRNAs are detected in the cytoplasm. The majority of these (70%) have >50% of their cytoplasmic copies associated with polysomal fractions. These interactions are lost upon disruption of ribosomes by puromycin. Polysomal lncRNAs are distinguished by a number of 5′ mRNA-like features, including capping and 5′UTR length. On the other hand, nonpolysomal “free cytoplasmic” lncRNAs have more conserved promoters and a wider range of expression across cell types. Exons of polysomal lncRNAs are depleted of endogenous retroviral insertions, suggesting a role for repetitive elements in lncRNA localization. Finally, we show that blocking of ribosomal elongation results in stabilization of many associated lncRNAs. Together these findings suggest that the ribosome is the default destination for the majority of cytoplasmic long noncoding RNAs and may play a role in their degradation. PMID:27090285

  12. Detecting ricin: sensitive luminescent assay for ricin A-chain ribosome depurination kinetics.

    Sturm, Matthew B; Schramm, Vern L

    2009-04-15

    Ricin is a family member of the lethal ribosome-inactivating proteins (RIP) found in plants. Ricin toxin A-chain (RTA) from castor beans catalyzes the hydrolytic depurination of a single base from a GAGA tetraloop of eukaryotic rRNA to release a single adenine from the sarcin-ricin loop (SRL). Protein synthesis is inhibited by loss of the elongation factor binding site resulting in cell death. We report a sensitive coupled assay for the measurement of adenine released from ribosomes or small stem-loop RNAs by RTA catalysis. Adenine phosphoribosyl transferase (APRTase) and pyruvate orthophosphate dikinase (PPDK) convert adenine to ATP for quantitation by firefly luciferase. The resulting AMP is cycled to ATP to give sustained luminescence proportional to adenine concentration. Subpicomole adenine quantitation permits the action of RTA on eukaryotic ribosomes to be followed in continuous, high-throughput assays. Facile analysis of RIP catalytic activity will have applications in plant toxin detection, inhibitor screens, mechanistic analysis of depurinating agents on oligonucleotides and intact ribosomes, and in cancer immunochemotherapy. Kinetic analysis of the catalytic action of RTA on rabbit reticulocyte 80S ribosomes establishes a catalytic efficiency of 2.6 x 10(8) M(-1) s(-1), a diffusion limited reaction indicating catalytic perfection even with large reactants. PMID:19364139

  13. Ribosome profiling reveals features of normal and disease-associated mitochondrial translation

    Rooijers, Koos; Loayza-Puch, Fabricio; Nijtmans, Leo G.; Agami, Reuven

    2013-12-01

    Mitochondria are essential cellular organelles for generation of energy and their dysfunction may cause diabetes, Parkinson’s disease and multi-systemic failure marked by failure to thrive, gastrointestinal problems, lactic acidosis and early lethality. Disease-associated mitochondrial mutations often affect components of the mitochondrial translation machinery. Here we perform ribosome profiling to measure mitochondrial translation at nucleotide resolution. Using a protocol optimized for the retrieval of mitochondrial ribosome protected fragments (RPFs) we show that the size distribution of wild-type mitochondrial RPFs follows a bimodal distribution peaking at 27 and 33 nucleotides, which is distinct from the 30-nucleotide peak of nuclear RPFs. Their cross-correlation suggests generation of mitochondrial RPFs during ribosome progression. In contrast, RPFs from patient-derived mitochondria mutated in tRNA-Tryptophan are centered on tryptophan codons and reduced downstream, indicating ribosome stalling. Intriguingly, long RPFs are enriched in mutated mitochondria, suggesting they characterize stalled ribosomes. Our findings provide the first model for translation in wild-type and disease-triggering mitochondria.

  14. Expression of Muscle-Specific Ribosomal Protein L3-Like Impairs Myotube Growth.

    Chaillou, Thomas; Zhang, Xiping; McCarthy, John J

    2016-09-01

    The ribosome has historically been considered to have no cell-specific function but rather serve in a "housekeeping" capacity. This view is being challenged by evidence showing that heterogeneity in the protein composition of the ribosome can lead to the functional specialization of the ribosome. Expression profiling of different tissues revealed that ribosomal protein large 3-like (Rpl3l) is exclusively expressed in striated muscle. In response to a hypertrophic stimulus, Rpl3l expression in skeletal muscle was significantly decreased by 82% whereas expression of the ubiquitous paralog Rpl3 was significantly increased by ∼fivefold. Based on these findings, we developed the hypothesis that Rpl3l functions as a negative regulator of muscle growth. To test this hypothesis, we used the Tet-On system to express Rpl3l in myoblasts during myotube formation. In support of our hypothesis, RPL3L expression significantly impaired myotube growth as assessed by myotube diameter (-23%) and protein content (-14%). Further analysis showed that the basis of this impairment was caused by a significant decrease in myoblast fusion as the fusion index was significantly lower (-17%) with RPL3L expression. These findings are the first evidence to support the novel concept of ribosome specialization in skeletal muscle and its role in the regulation of skeletal muscle growth. J. Cell. Physiol. 231: 1894-1902, 2016. © 2015 Wiley Periodicals, Inc. PMID:26684695

  15. Regulatory elements of Caenorhabditis elegans ribosomal protein genes

    Sleumer Monica C

    2012-08-01

    Full Text Available Abstract Background Ribosomal protein genes (RPGs are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from

  16. Characterization of ribosomal DNA (rDNA in Drosophila arizonae

    Francisco Javier Tovar

    2000-06-01

    Full Text Available Ribosomal DNA (rDNA is a multigenic family composed of one or more clusters of repeating units (RU. Each unit consists of highly conserved sequences codifying 18S, 5.8S and 28S rRNA genes intercalated with poorly conserved regulatory sequences between species. In this work, we analyzed the rDNA of Drosophila arizonae, a member of the mulleri complex (Repleta group. Using genomic restriction patterns, cloning and mapping of some representative rDNA fragments, we were able to construct a representative restriction map. RU in this species are 13.5-14 kb long, restriction sites are completely conserved compared with other drosophilids and the rDNA has an R1 retrotransposable element in some RU. We were unable to detect R2 elements in this species.O DNA ribossômico (rDNA é uma família multigênica composta de um ou mais aglomerados de unidades de repetição (RU. Cada unidade consiste de seqüências altamente conservadas que codificam os rRNAs 18S, 5.8S e 28S, intercaladas com seqüências regulatórias pouco conservadas entre as espécies. Neste trabalho analisamos o rDNA de Drosophila arizonae, um membro do complexo mulleri (grupo Repleta. Usando padrões de restrição genômicos, clonagem e mapeamento de alguns fragmentos de rDNA representativos, estabelecemos um mapa de restrição do rDNA representativo desta espécie. Neste drosofilídeo, a RU tem um tamanho médio de 13.5-14 kb e os sítios de restrição estão completamente conservados com relação a outras drosófilas. Além disto, este rDNA possui um elemento transponível tipo R1 presente em algumas unidades. Neste trabalho não tivemos evidências da presença de elementos R2 no rDNA desta espécie.

  17. Dengue vaccine: an update on recombinant subunit strategies.

    Martin, J; Hermida, L

    2016-03-01

    Dengue is an increasing public health problem worldwide, with the four serotypes of the virus infecting over 390 million people annually. There is no specific treatment or antiviral drug for dengue, and prevention is largely limited to controlling the mosquito vectors or disrupting the human-vector contact. Despite the considerable progress made in recent years, an effective vaccine against the virus is not yet available. The development of a dengue vaccine has been hampered by many unique challenges, including the need to ensure the absence of vaccine-induced enhanced severity of disease. Recombinant protein subunit vaccines offer a safer alternative to other vaccine approaches. Several subunit vaccine candidates are presently under development, based on different structural and non-structural proteins of the virus. Novel adjuvants or immunopotentiating strategies are also being tested to improve their immunogenicity. This review summarizes the current status and development trends of subunit dengue vaccines. PMID:26982462

  18. Cholera Toxin B: One Subunit with Many Pharmaceutical Applications

    Keegan J. Baldauf

    2015-03-01

    Full Text Available Cholera, a waterborne acute diarrheal disease caused by Vibrio cholerae, remains prevalent in underdeveloped countries and is a serious health threat to those living in unsanitary conditions. The major virulence factor is cholera toxin (CT, which consists of two subunits: the A subunit (CTA and the B subunit (CTB. CTB is a 55 kD homopentameric, non-toxic protein binding to the GM1 ganglioside on mammalian cells with high affinity. Currently, recombinantly produced CTB is used as a component of an internationally licensed oral cholera vaccine, as the protein induces potent humoral immunity that can neutralize CT in the gut. Additionally, recent studies have revealed that CTB administration leads to the induction of anti-inflammatory mechanisms in vivo. This review will cover the potential of CTB as an immunomodulatory and anti-inflammatory agent. We will also summarize various recombinant expression systems available for recombinant CTB bioproduction.

  19. Functional biosynthesis of an allophycocyan beta subunit in Escherichia coli.

    Ge, Baosheng; Sun, Haixiang; Feng, Yang; Yang, Jinying; Qin, Song

    2009-03-01

    Allophycocyanin is a phycobiliprotein with various biological and pharmacological properties. An expression vector was constructed using CpeS as the bilin lyase for the allophycocyanin beta subunit, resulting in overexpression of a fluorescent allophycocyanin beta-subunit in Escherichia coli. A high-density cell culture was developed using a continuous feeding strategy. After 16 h of culture, the dry cell density reached 21.4 g l(-1), the expression of the allophycocyanin beta-subunit was 0.86 g l(-1) broth, and the relative chromoprotein yield was 81.4%. The recombinant protein showed spectral features similar to native allophycocyanin, which provide an efficient methodology for large-scale production of this valuable fluorescent protein. PMID:19269586

  20. AcEST: BP919363 [AcEST

    Full Text Available 7_ARATH 50S ribosomal protein L27, chloroplastic OS... 30 3.0 sp|Q3A825|NUOCD_PELCD NADH-quinone oxidoreduct...GIGKDHTIFSL 119 >sp|Q3A825|NUOCD_PELCD NADH-quinone oxidoreductase subunit C/D OS=Pelobacter carbinolicus (s

  1. Drug: D10032 [KEGG MEDICUS

    Full Text Available D10032 Drug Tylvalosin (USAN/INN) C53H87NO19 1041.5872 1042.2532 D10032.gif Veterinary...hibitor 23S rRNA of 50S ribosomal subunit inhibitor [KO:K01980] Macrolides Tylvalosin; Veterinary

  2. Drug: D02490 [KEGG MEDICUS

    Full Text Available 0] Macrolides Tylosin; Veterinary D02490 Tylosin (USP/INN) CAS: 1401-69-0 PubChem: 7849535 PDB-CCD: TYK Liga...br08307] Antibacterials Protein biosynthesis inhibitor 23S rRNA of 50S ribosomal subunit inhibitor [KO:K0198

  3. Mutations in conserved helix 69 of 23S rRNA of Thermus thermophilus that affect capreomycin resistance but not posttranscriptional modifications

    Monshupanee, Tanakarn; Gregory, Steven T; Douthwaite, Stephen; Chungjatupornchai, Wipa; Dahlberg, Albert E

    2008-01-01

    Translocation during the elongation phase of protein synthesis involves the relative movement of the 30S and 50S ribosomal subunits. This movement is the target of tuberactinomycin antibiotics. Here, we describe the isolation and characterization of mutants of Thermus thermophilus selected for...

  4. Over-represented localized sequence motifs in ribosomal protein gene promoters of basal metazoans.

    Perina, Drago; Korolija, Marina; Roller, Maša; Harcet, Matija; Jeličić, Branka; Mikoč, Andreja; Cetković, Helena

    2011-07-01

    Equimolecular presence of ribosomal proteins (RPs) in the cell is needed for ribosome assembly and is achieved by synchronized expression of ribosomal protein genes (RPGs) with promoters of similar strengths. Over-represented motifs of RPG promoter regions are identified as targets for specific transcription factors. Unlike RPs, those motifs are not conserved between mammals, drosophila, and yeast. We analyzed RPGs proximal promoter regions of three basal metazoans with sequenced genomes: sponge, cnidarian, and placozoan and found common features, such as 5'-terminal oligopyrimidine tracts and TATA-boxes. Furthermore, we identified over-represented motifs, some of which displayed the highest similarity to motifs abundant in human RPG promoters and not present in Drosophila or yeast. Our results indicate that humans over-represented motifs, as well as corresponding domains of transcription factors, were established very early in metazoan evolution. The fast evolving nature of RPGs regulatory network leads to formation of other, lineage specific, over-represented motifs. PMID:21457775

  5. Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23S ribosomal RNA

    Douthwaite, S

    1992-01-01

    Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli ribosomes has been compared by chemical footprinting. The protection afforded by both drugs is limited to the peptidyl transferase loop of 23S rRNA. Under conditions of stoichiometric binding at 1 mM drug concentration...... in vitro, both drugs strongly protect 23S rRNA bases A2058 and A2451 from dimethyl sulphate and G2505 from kethoxal modification; G2061 is also weakly protected from kethoxal. The modification patterns differ in that A2059 is additionally protected by clindamycin but not by lincomycin. The affinity...... of the two drugs for the ribosome, estimated by footprinting, is approximately the same, giving Kdiss values of 5 microM for lincomycin and 8 microM for clindamycin. The results show that in vitro the drugs are equally potent in blocking their ribosomal target site. Their inhibitory effects on...

  6. Mechanism of Tetracycline Resistance by Ribosomal Protection Protein Tet(O)

    Li, Wen; Atkinson, Gemma C.; Thakor, Nehal S.; Allas, Ülar; Lu, Chuao-chao; Chan, Kwok-Yan; Tenson, Tanel; Schulten, Klaus; Wilson, Kevin S.; Hauryliuk, Vasili; Frank, Joachim

    2013-01-01

    Tetracycline resistance protein Tet(O), which protects the bacterial ribosome from binding the antibiotic tetracycline, is a translational GTPase with significant similarity in both sequence and structure to the elongation factor EF-G. Here, we present an atomic model of the Tet(O)-bound 70S ribosome based on our cryo-electron microscopic reconstruction at 9.6 Å resolution. This atomic model allowed us to identify the Tet(O)-ribosome binding sites, which involve three characteristic loops in domain 4 of Tet(O). Replacements of the three-amino acid tips of these loops by a single glycine residue result in loss of Tet(O)-mediated tetracycline resistance. On the basis of these findings, the mechanism of Tet(O)-mediated tetracycline resistance can be explained in molecular detail. PMID:23403578

  7. Research Techniques Made Simple: Bacterial 16S Ribosomal RNA Gene Sequencing in Cutaneous Research.

    Jo, Jay-Hyun; Kennedy, Elizabeth A; Kong, Heidi H

    2016-03-01

    Skin serves as a protective barrier and also harbors numerous microorganisms collectively comprising the skin microbiome. As a result of recent advances in sequencing (next-generation sequencing), our understanding of microbial communities on skin has advanced substantially. In particular, the 16S ribosomal RNA gene sequencing technique has played an important role in efforts to identify the global communities of bacteria in healthy individuals and patients with various disorders in multiple topographical regions over the skin surface. Here, we describe basic principles, study design, and a workflow of 16S ribosomal RNA gene sequencing methodology, primarily for investigators who are not familiar with this approach. This article will also discuss some applications and challenges of 16S ribosomal RNA sequencing as well as directions for future development. PMID:26902128

  8. Amicoumacin A induces cancer cell death by targeting the eukaryotic ribosome

    Prokhorova, Irina V.; Akulich, Kseniya A.; Makeeva, Desislava S.; Osterman, Ilya A.; Skvortsov, Dmitry A.; Sergiev, Petr V.; Dontsova, Olga A.; Yusupova, Gulnara; Yusupov, Marat M.; Dmitriev, Sergey E.

    2016-01-01

    Amicoumacin A is an antibiotic that was recently shown to target bacterial ribosomes. It affects translocation and provides an additional contact interface between the ribosomal RNA and mRNA. The binding site of amicoumacin A is formed by universally conserved nucleotides of rRNA. In this work, we showed that amicoumacin A inhibits translation in yeast and mammalian systems by affecting translation elongation. We determined the structure of the amicoumacin A complex with yeast ribosomes at a resolution of 3.1  Å. Toxicity measurement demonstrated that human cancer cell lines are more susceptible to the inhibition by this compound as compared to non-cancerous ones. This might be used as a starting point to develop amicoumacin A derivatives with clinical value. PMID:27296282

  9. The Listeria monocytogenes hibernation-promoting factor is required for the formation of 100S ribosomes, optimal fitness, and pathogenesis.

    Kline, Benjamin C; McKay, Susannah L; Tang, William W; Portnoy, Daniel A

    2015-02-01

    During exposure to certain stresses, bacteria dimerize pairs of 70S ribosomes into translationally silent 100S particles in a process called ribosome hibernation. Although the biological roles of ribosome hibernation are not completely understood, this process appears to represent a conserved and adaptive response that contributes to optimal survival during stress and post-exponential-phase growth. Hibernating ribosomes are formed by the activity of one or more highly conserved proteins; gammaproteobacteria produce two relevant proteins, ribosome modulation factor (RMF) and hibernation promoting factor (HPF), while most Gram-positive bacteria produce a single, longer HPF protein. Here, we report the formation of 100S ribosomes by an HPF homolog in Listeria monocytogenes. L. monocytogenes 100S ribosomes were observed by sucrose density gradient centrifugation of bacterial extracts during mid-logarithmic phase, peaked at the transition to stationary phase, and persisted at lower levels during post-exponential-phase growth. 100S ribosomes were undetectable in bacteria carrying an hpf::Himar1 transposon insertion, indicating that HPF is required for ribosome hibernation in L. monocytogenes. Additionally, epitope-tagged HPF cosedimented with 100S ribosomes, supporting its previously described direct role in 100S formation. We examined hpf mRNA by quantitative PCR (qPCR) and identified several conditions that upregulated its expression, including carbon starvation, heat shock, and exposure to high concentrations of salt or ethanol. Survival of HPF-deficient bacteria was impaired under certain conditions both in vitro and during animal infection, providing evidence for the biological relevance of 100S ribosome formation. PMID:25422304

  10. Genetic Characterization of Nematodirella cameli Based on 18S rDNA and Cytochrome c Oxidase Subunit 1 (CO1

    Hassan SHARIFIYAZDI

    2015-01-01

    Full Text Available To determine the phylogenic position and genetic diversity of Nematodirella cameli two portions of nuclear ribosomal DNA, 18S rDNA and mitochondrial DNA gene, the subunit 1 of cytochrome C oxidase gene (CO1 were sequenced and compared with those previously reported for other nematodes in Trichostrongylina. The phylogenetic trees constructed based upon the 18S rDNA sequences, yielded strong support for close relationship between the N. cameli and Nematodirus battus, with a high bootstrap value of 100%. In the present research, the level of sequence polymorphism among N. cameli isolates was higher for CO1 with 32 polymorphic sites compared to 18S rDNA sequence. Accordingly, molecular assays based on CO1 mitochondrial marker, demonstrated the existence of at least 11 distinct haplotypes (accession nos. JX305966 to JX305976 with an intraspecific diversity of 3-7% in Iran. Whereas, all of N. cameli samples examined herein (n=11, had a unique 18S sequence (accession no. JX305977. In addition, N. cameli CO1 sequences found in this study showed maximum identities to Haemonchus (88% and Ostertagia (87% in BLAST analysis for existing Trichostrongylina sequences. Further information is necessary to infer interspecific and intraspecific phylogenetic relationships between genera and species in Trichostrongylina. This study describes for the first time the nuclear 18S rDNA and mitochondrial CO1 sequence data from Nematodirella cameli species.

  11. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  12. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling

    Jones, Joshua D.; Chung, Betty Y.-W.; Siddell, Stuart G.; Brierley, Ian

    2016-01-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global “snap-shot” of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  13. Nucleotide sequence and characterization of the transcript of a Dictyostelium ribosomal protein gene.

    Steel, L F; Smyth, A; A. Jacobson

    1987-01-01

    Dictyostelium ribosomal protein mRNAs are subject to developmental regulation of both their translation and their stability. In order to consider whether such post-transcriptional regulation can be attributed to structural features of the mRNAs, we have cloned and sequenced a 1.9 kb EcoRI genomic DNA fragment which contains the gene for the Dictyostelium ribosomal protein 1024 (rp1024). The rp1024 gene contains a single intron of 350 bp which begins just after the fourth codon of protein codi...

  14. RNase II is important for A-site mRNA cleavage during ribosome pausing

    Garza-Sánchez, Fernando; Shoji, Shinichiro; Fredrick, Kurt; Hayes, Christopher S.

    2009-01-01

    In Escherichia coli, translational arrest can elicit cleavage of codons within the ribosomal A site. This A-site mRNA cleavage is independent of RelE, and has been proposed to be an endonucleolytic activity of the ribosome. Here, we show that the 3′→5′ exonuclease RNase II plays an important role in RelE-independent A-site cleavage. Instead of A-site cleavage, translational pausing in ΔRNase II cells produces transcripts that are truncated +12 and +28 nucleotides downstream of the A-site codo...

  15. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  16. The Essential Anatomical Subunit Approximation Unilateral Cleft Lip Repair.

    Chong, David K; Swanson, Jordan W

    2016-07-01

    The anatomical subunit approximation cleft lip repair advantageously achieves a balanced lip contour, with the line of repair hidden along seams of aesthetic subunits. Dr. David Fisher's original description of the repair reflects the considerable thought that went into the evolution of his design. As his technique has gained acceptance in the intervening 10 years, the authors note several key principles embodied in it that represent a shift in the cleft lip repair paradigm. The authors believe understanding these principles is important to mastery of the anatomical subunit technique, and facilitate its teaching. First, design a plan that adheres to anatomical subunits and perform measurements precisely. Second, identify and adequately release each cleft tissue layer from the lip and nose to enable restoration of balance. Third, drive surgical approximation through inset of the lateral muscle into the superiorly backcut medial orbicularis muscle, followed by skin closure with inferior triangle interposition above the white roll. In this article, the authors present essential components of the technique, and identify several principles that enable its successful execution. PMID:27348690

  17. Editing modifies the GABA(A) receptor subunit alpha3

    Ohlson, Johan; Pedersen, Jakob Skou; Haussler, David;

    2007-01-01

    to find selectively edited sites and combined it with bioinformatic techniques that find stem-loop structures suitable for editing. We present here the first verified editing candidate detected by this screening procedure. We show that Gabra-3, which codes for the alpha3 subunit of the GABA...

  18. Bacterial cellulose biosynthesis: diversity of operons, subunits, products, and functions.

    Römling, Ute; Galperin, Michael Y

    2015-09-01

    Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits - which differ among various taxa - affect the enzymatic activity and product yield in vivo by modulating (i) the expression of the biosynthesis apparatus, (ii) the export of the nascent β-D-glucan polymer to the cell surface, and (iii) the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of resulting biofilms, which is particularly important for the interactions of bacteria with higher organisms - leading to rhizosphere colonization and modulating the virulence of cellulose-producing bacterial pathogens inside and outside of host cells. We review the organization of four principal types of cellulose synthase operon found in various bacterial genomes, identify additional bcs genes that encode components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms and in the choice between acute infection and persistence in the host. PMID:26077867

  19. Emergence of ion channel modal gating from independent subunit kinetics.

    Bicknell, Brendan A; Goodhill, Geoffrey J

    2016-09-01

    Many ion channels exhibit a slow stochastic switching between distinct modes of gating activity. This feature of channel behavior has pronounced implications for the dynamics of ionic currents and the signaling pathways that they regulate. A canonical example is the inositol 1,4,5-trisphosphate receptor (IP3R) channel, whose regulation of intracellular Ca(2+) concentration is essential for numerous cellular processes. However, the underlying biophysical mechanisms that give rise to modal gating in this and most other channels remain unknown. Although ion channels are composed of protein subunits, previous mathematical models of modal gating are coarse grained at the level of whole-channel states, limiting further dialogue between theory and experiment. Here we propose an origin for modal gating, by modeling the kinetics of ligand binding and conformational change in the IP3R at the subunit level. We find good agreement with experimental data over a wide range of ligand concentrations, accounting for equilibrium channel properties, transient responses to changing ligand conditions, and modal gating statistics. We show how this can be understood within a simple analytical framework and confirm our results with stochastic simulations. The model assumes that channel subunits are independent, demonstrating that cooperative binding or concerted conformational changes are not required for modal gating. Moreover, the model embodies a generally applicable principle: If a timescale separation exists in the kinetics of individual subunits, then modal gating can arise as an emergent property of channel behavior. PMID:27551100

  20. Thermostable Subunit Vaccines for Pulmonary Delivery: How Close Are We?

    Foged, Camilla

    2016-01-01

    influenza, tuberculosis, and Ebola, for which no good universal vaccines exist. At least two pharmaceutical improvements are expected to help filling this gap: i) The development of thermostable vaccine dosage forms, and ii) the full exploitation of the adjuvant technology for subunit vaccines to potentiate...