WorldWideScience

Sample records for 30s ribosome assembly

  1. Differential effects of ribosomal proteins and Mg2+ ions on a conformational switch during 30S ribosome 5'-domain assembly.

    Abeysirigunawardena, Sanjaya C; Woodson, Sarah A

    2015-11-01

    Ribosomal protein S4 nucleates assembly of the 30S ribosome 5' and central domains, which is crucial for the survival of cells. Protein S4 changes the structure of its 16S rRNA binding site, passing through a non-native intermediate complex before forming native S4-rRNA contacts. Ensemble FRET was used to measure the thermodynamic stability of non-native and native S4 complexes in the presence of Mg(2+) ions and other 5'-domain proteins. Equilibrium titrations of Cy3-labeled 5'-domain RNA with Cy5-labeled protein S4 showed that Mg(2+) ions preferentially stabilize the native S4-rRNA complex. In contrast, ribosomal proteins S20 and S16 act by destabilizing the non-native S4-rRNA complex. The full cooperative switch to the native complex requires S4, S16, and S20 and is achieved to a lesser degree by S4 and S16. The resulting thermodynamic model for assembly of the 30S body illustrates how ribosomal proteins selectively bias the equilibrium between alternative rRNA conformations, increasing the cooperativity of rRNA folding beyond what can be achieved by Mg(2+) ions alone. PMID:26354770

  2. Ribosome Assembly as Antimicrobial Target.

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  3. Chaperoning ribosome assembly

    Karbstein, Katrin

    2010-01-01

    Chaperones help proteins fold in all cellular compartments, and many associate directly with ribosomes, capturing nascent chains to assist their folding and prevent aggregation. In this issue, new data from Koplin et al. (2010. J. Cell Biol. doi: 10.1083/jcb.200910074) and Albanèse et al. (2010. J. Cell Biol. doi: 10.1083/jcb.201001054) suggest that in addition to promoting protein folding, the chaperones ribosome-associated complex (RAC), nascent chain–associated complex (NAC), and Jjj1 also...

  4. Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals.

    Dao, E Han; Sierra, Raymond G; Laksmono, Hartawan; Lemke, Henrik T; Alonso-Mori, Roberto; Coey, Aaron; Larsen, Kevin; Baxter, Elizabeth L; Cohen, Aina E; Soltis, S Michael; DeMirci, Hasan

    2015-07-01

    In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecond X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser. PMID:26798805

  5. Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals

    E. Han Dao

    2015-07-01

    Full Text Available In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecond X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.

  6. Mutations in the leader region of ribosomal RNA operons cause structurally defective 30 S ribosomes as revealed by in vivo structural probing.

    Balzer, M; Wagner, R

    1998-02-27

    The biogenesis of functional ribosomes is regulated in a very complex manner, involving different proteins and RNA molecules. RNAs are not only essential components of both ribosomal subunits but also transiently interacting factors during particle formation. In eukaryotes snoRNAs act as molecular chaperones to assist maturation, modification and assembly. In a very similar way highly conserved leader sequences of bacterial rRNA operons are involved in the correct formation of 30 S ribosomal subunits. Certain mutations in the rRNA leader region cause severe growth defects due to malfunction of ribosomes which are assembled from such transcription units. To understand how the leader sequences act to facilitate the formation of the correct 30 S subunits we performed in vivo chemical probing to assess structural differences between ribosomes assembled either from rRNA transcribed from wild-type operons or from operons which contain mutations in the rRNA leader region. Cells transformed with plasmids containing the respective rRNA operons were reacted with dimethylsulphate (DMS). Ribosomes were isolated by sucrose gradient centrifugation and modified nucleotides within the 16 S rRNA were identified by primer extension reaction. Structural differences between ribosomes from wild-type and mutant rRNA operons occur in several clusters within the 16 S rRNA secondary structure. The most prominent differences are located in the central domain including the universally conserved pseudoknot structure which connects the 5', the central and the 3' domain of 16 S rRNA. Two other clusters with structural differences fall in the 5' domain where the leader had been shown to interact with mature 16 S rRNA and within the ribosomal protein S4 binding site. The other differences in structure are located in sites which are also known as sites for the action of several antibiotics. The data explain the functional defects of ribosomes from rRNA operons with leader mutations and help to

  7. Neutron scattering and the 30 S ribosomal subunit of E. coli

    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today. 30 references, 5 figures

  8. Neutron Scattering and the 30 S Ribosomal Subunit of E. Coli

    Moore, P. B.; Engelman, D. M.; Langer, J. A.; Ramakrishnan, V. R.; Schindler, D. G.; Schoenborn, B. P.; Sillers, I. Y.; Yabuki, S.

    1982-06-01

    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today.

  9. Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

    The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C1400 was preserved. Changing C1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

  10. Eukaryotic Ribosome Assembly and Nuclear Export.

    Nerurkar, Purnima; Altvater, Martin; Gerhardy, Stefan; Schütz, Sabina; Fischer, Ute; Weirich, Christine; Panse, Vikram Govind

    2015-01-01

    Accurate translation of the genetic code into functional polypeptides is key to cellular growth and proliferation. This essential process is carried out by the ribosome, a ribonucleoprotein complex of remarkable size and intricacy. Although the structure of the mature ribosome has provided insight into the mechanism of translation, our knowledge regarding the assembly, quality control, and intracellular targeting of this molecular machine is still emerging. Assembly of the eukaryotic ribosome begins in the nucleolus and requires more than 350 conserved assembly factors, which transiently associate with the preribosome at specific maturation stages. After accomplishing their tasks, early-acting assembly factors are released, preparing preribosomes for nuclear export. Export competent preribosomal subunits are transported through nuclear pore complexes into the cytoplasm, where they undergo final maturation steps, which are closely connected to quality control, before engaging in translation. In this chapter, we focus on the final events that commit correctly assembled ribosomal subunits for translation. PMID:26404467

  11. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  12. Effect of ultraviolet irradiation on 30-S ribosomal subunits. Identification of the RNA region crosslinked to protein S7

    The effects of ultraviolet irradiation on Escherichia coli 30-S ribosomal subunits were studied. At the doses of radiation used in this work (0-4.5 x 105 quanta/30-S subunit), only protein S7 was found to be significantly crosslinked to the 16-S RNA. In conditions where 25% of the protein was covalently crosslinked, the ability of the irradiated 30-S subunits to reassociate with 50-S subunits and their activity in polyphenylalanine synthesis decreased strongly. Similar results were obtained by irradiation with a germicide lamp (254 nm) or with a monochromatic ultraviolet light at 248 nm. No additional proteins were crosslinked to the 16-S RNA by irradiating 30-S subunits depleted in protein S1 or 70-S ribosomes. The covalent complex of 16-S RNA and protein S7 was isolated and digested by T1 ribonuclease. The oligonucleotide remaining attached to the crosslinked protein was characterised as A-C-C-U-C-G (position 1261-1266, see the sequence published by Carbon et al. (1979) Eur. J. Biochem. 160, 399-410). Analysis of this fragment suggests that protein S7 was linked to the cytosine at position 1265 in the RNA sequence. (orig.)

  13. Serial femtosecond X-ray diffraction of 30S ribosomal subunit microcrystals in liquid suspension at ambient temperature using an X-ray free-electron laser

    Serial femtosecond X-ray (SFX) diffraction extending beyond 6 Å resolution using T. thermophilus 30S ribosomal subunit crystals is reported. High-resolution ribosome structures determined by X-ray crystallography have provided important insights into the mechanism of translation. Such studies have thus far relied on large ribosome crystals kept at cryogenic temperatures to reduce radiation damage. Here, the application of serial femtosecond X-ray crystallography (SFX) using an X-ray free-electron laser (XFEL) to obtain diffraction data from ribosome microcrystals in liquid suspension at ambient temperature is described. 30S ribosomal subunit microcrystals diffracted to beyond 6 Å resolution, demonstrating the feasibility of using SFX for ribosome structural studies. The ability to collect diffraction data at near-physiological temperatures promises to provide fundamental insights into the structural dynamics of the ribosome and its functional complexes

  14. Interrelationships between yeast ribosomal protein assembly events and transient ribosome biogenesis factors interactions in early pre-ribosomes.

    Steffen Jakob

    Full Text Available Early steps of eukaryotic ribosome biogenesis require a large set of ribosome biogenesis factors which transiently interact with nascent rRNA precursors (pre-rRNA. Most likely, concomitant with that initial contacts between ribosomal proteins (r-proteins and ribosome precursors (pre-ribosomes are established which are converted into robust interactions between pre-rRNA and r-proteins during the course of ribosome maturation. Here we analysed the interrelationship between r-protein assembly events and the transient interactions of ribosome biogenesis factors with early pre-ribosomal intermediates termed 90S pre-ribosomes or small ribosomal subunit (SSU processome in yeast cells. We observed that components of the SSU processome UTP-A and UTP-B sub-modules were recruited to early pre-ribosomes independently of all tested r-proteins. On the other hand, groups of SSU processome components were identified whose association with early pre-ribosomes was affected by specific r-protein assembly events in the head-platform interface of the SSU. One of these components, Noc4p, appeared to be itself required for robust incorporation of r-proteins into the SSU head domain. Altogether, the data reveal an emerging network of specific interrelationships between local r-protein assembly events and the functional interactions of SSU processome components with early pre-ribosomes. They point towards some of these components being transient primary pre-rRNA in vivo binders and towards a role for others in coordinating the assembly of major SSU domains.

  15. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G.

    2014-01-01

    eLife digest The production of a protein in a cell starts with a region of DNA being transcribed to produce a molecule of messenger RNA. A large molecular machine called ribosome then reads the information in the messenger RNA molecule to produce a protein. Ribosomes themselves are made of RNA and several different proteins called r-proteins. The construction of a ribosome starts with the assembly of a pre-ribosome inside the cell nucleus, and the ribosome is completed in the cytosol of the c...

  16. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Background Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role...

  17. Single protein omission reconstitution studies of tetracycline binding to the 30S subunit of Escherichia coli ribosomes

    In previous work the authors showed that on photolysis of Escherichia coli ribosomes in the presence of [3H]tetracycline (TC) the major protein labeled is S7, and they presented strong evidence that such labeling takes place from a high-affinity site related to the inhibitory action of TC. In this work they use single protein omission reconstitution (SPORE) experiments to identify those proteins that are important for high-affinity TC binding to the 30S subunit, as measured by both cosedimentation and filter binding assays. With respect to both sedimentation coefficients and relative Phe-tRNAPhe binding, the properties of the SPORE particles they obtain parallel very closely those measured earlier, with the exception of the SPORE particle lacking S13. A total of five proteins, S3, S7, S8, S14, and S19, are shown to be important for TC binding, with the largest effects seen on omission of proteins S7 and S14. Determination of the protein compositions of the corresponding SPORE particles demonstrates that the observed effects are, for the most part, directly attributable to the omission of the given protein rather than reflecting an indirect effect of omitting one protein on the uptake of another. A large body of evidence supports the notion that four of these proteins, S3, S7, S14, and S19, are included, along with 16S rRNA bases 920-1,396, in one of the major domains of the 30S subunit. The results support the conclusion that the structure of this domain is important for the binding of TC and that, within this domain, TC binds directly to S7

  18. Performance of an electron feed assembly for ORNL/MFTF-B 30-s ion sources

    An electron feed assembly similar to that used for PLT/ ISX-B injectors is used in ORNL/MFTF-B 30-s ion source. Its thermionic cathode is made of a La2O3 -doped molybdenum with an emission surface area of about 100 cm2 and is indirectly heated by a graphite heater. Working at 17000C, it needs a heating power of about 39 kW. Active water cooling is employed for the intermediate electrode liner and anode 1 which enclose the arc column: These electrodes are made of copper with cooling channels prepared by an electroforming technique. A longpulse (30 s) life time evaluation of this electron feed assembly is being conducted experimentally. Arc behavior, electrode power loading, reliability and longevity are being studied. Based on information obtained so far, the electron-feed assembly has been found to behave satisfactorily even after 2200 pulses of 30 s duration arc operation at 30% duty factor. Further progress of this study is reported

  19. Physical and biochemical nature of the bacterial cytoplasm: movement and localization of mRNA and the 30S subunits of ribosomes.

    Trevors, J T

    2012-05-01

    There is a paucity of knowledge on how mRNA transcripts in the spatially crowded, but molecularly organized bacterial cytoplasm contact the 30S ribosomal subunits. Does simple diffusion in the cytoplasm account for transcript-ribosome interactions given that a large number of ribosomes (e.g., about 72,000 in Escherichia coli during exponential growth) can be present in the cytoplasm? Or are undiscovered mechanisms present where specific transcripts are directed to specific ribosomes at specific cytoplasmic locations, while others are mobilized in a random manner? Moreover, is it possible that cytoplasmic mobilization occurs in bacteria, driven possibly by thermal infrared (IR) radiation and the generation of exclusion zone (EZ) water? These aspects will be discussed in this article and hypotheses presented. PMID:22710107

  20. Interconversion of active and inactive 30 S ribosomal subunits is accompanied by a conformational change in the decoding region of 16 S rRNA

    Moazed, D; Van Stolk, B J; Douthwaite, S;

    1986-01-01

    Zamir, Elson and their co-workers have shown that 30 S ribosomal subunits are reversibly inactivated by depletion of monovalent or divalent cations. We have re-investigated the conformation of 16 S rRNA in the active and inactive forms of the 30 S subunit, using a strategy that is designed......' regions of 16 S rRNA. The inactive form also shows significantly decreased reactivity at positions 1533 to 1538 (the Shine-Dalgarno region), in agreement with earlier findings. The principal changes in reactivity involve the universally conserved nucleotides G926, C1395, A1398 and G1401. The three purines...

  1. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly.

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers-termed here escortins-to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. PMID:25144938

  2. Incorporation of single dinitrophenyl-modified proteins in to the 30S subunit of Escherichia coli ribosomes by total reconstitution for localization by immune electron microscopy

    The ribosome is a structurally defined organelle whose function is central to the existence of all organisms. It is the unique site of protein biosynthesis in all cells. A detailed understanding of ribosome structure is essential in understanding the process of translation. This thesis represents a new approach to the systematic localization of individual proteins contained in the small subunit of Escherichia coli ribosomes using immunoelectron microscopy. All 30S proteins were purified using high performance liquid chromatography (HPLC) and eight isolated proteins (S12,S21,S14,S19,S18,S17,S16 and S13) were derivatized with 2,4-[3,5-3H]dinitrofluorobenzene (DNFB). The extent of modification of these proteins was estimated by both radioactivity and integrated peak areas, using dual wavelength monitoring at 214nm to detect protein and 360nm (to detect dinitrophenyl groups). Each dinitrophenylated protein was introduced in place of the corresponding unmodified protein into totally reconstituted 30S subunits. Antibodies raised against the DNP-hapten bound effectively to such reconstituted subunits and did not cause dissociation of the modified protein from the subunit. Electron microscopy of the immune complexes was used to localize the modified protein on the subunit surface. Incorporation of any of the DNP-modified proteins, with the exception of DNP-S18, does not interfere with the functionality of the ribosome as measure by the binding of Phe-tRNAPhe or the synthesis of poly(Phe) in a poly(U)-dependent manner. Results show that unmodified protein competes with DNP-protein and that DNP-protein can function, as its native counterpart, in stimulating uptake of specific proteins during reconstitution. This data provides evidence that each DNP-protein occupies the same position in 30S subunits as does the corresponding unmodified protein

  3. The antibiotic Furvina® targets the P-site of 30S ribosomal subunits and inhibits translation initiation displaying start codon bias.

    Fabbretti, Attilio; Brandi, Letizia; Petrelli, Dezemona; Pon, Cynthia L; Castañedo, Nilo R; Medina, Ricardo; Gualerzi, Claudio O

    2012-11-01

    Furvina®, also denominated G1 (MW 297), is a synthetic nitrovinylfuran [2-bromo-5-(2-bromo-2-nitrovinyl)-furan] antibiotic with a broad antimicrobial spectrum. An ointment (Dermofural®) containing G1 as the only active principle is currently marketed in Cuba and successfully used to treat dermatological infections. Here we describe the molecular target and mechanism of action of G1 in bacteria and demonstrate that in vivo G1 preferentially inhibits protein synthesis over RNA, DNA and cell wall synthesis. Furthermore, we demonstrate that G1 targets the small ribosomal subunit, binds at or near the P-decoding site and inhibits its function interfering with the ribosomal binding of fMet-tRNA during 30S initiation complex (IC) formation ultimately inhibiting translation. Notably, this G1 inhibition displays a bias for the nature (purine vs. pyrimidine) of the 3'-base of the codon, occurring efficiently only when the mRNA directing 30S IC formation and translation contains the canonical AUG initiation triplet or the rarely found AUA triplet, but hardly occurs when the mRNA start codon is either one of the non-canonical triplets AUU or AUC. This codon discrimination by G1 is reminiscent, though of opposite type of that displayed by IF3 in its fidelity function, and remarkably does not occur in the absence of this factor. PMID:22941660

  4. Dissecting ribosome assembly and transport in budding yeast.

    Altvater, Martin; Schütz, Sabina; Chang, Yiming; Panse, Vikram Govind

    2014-01-01

    Construction of the eukaryotic ribosome begins in the nucleolus and requires >300 evolutionarily conserved nonribosomal trans-acting factors, which transiently associate with preribosomal subunits at distinct assembly stages. A subset of trans-acting and transport factors passage assembled preribosomal subunits in a functionally inactive state through the nuclear pore complexes (NPC) into the cytoplasm, where they undergo final maturation before initiating translation. Here, we summarize the repertoire of tools developed in the model organism budding yeast that are spearheading the functional analyses of trans-acting factors involved in the assembly and intracellular transport of preribosomal subunits. We elaborate on different GFP-tagged ribosomal protein reporters and a pre-rRNA reporter that reliably monitors the movement of preribosomal particles from the nucleolus to cytoplasm. We discuss the powerful yeast heterokaryon assay, which can be employed to uncover shuttling trans-acting factors that need to accompany preribosomal subunits to the cytoplasm to be released prior to initiating translation. Moreover, we present two biochemical approaches, namely sucrose gradient analyses and tandem affinity purification, that are rapidly facilitating the uncovering of regulatory processes that control the compositional dynamics of trans-acting factors on maturing preribosomal particles. Altogether, these approaches when combined with traditional analytical biochemistry, targeted proteomics and structural methodologies, will contribute to the dissection of the assembly and intracellular transport of preribosomal subunits, as well as other macromolecular assemblies that influence diverse biological pathways. PMID:24857742

  5. Hierarchical RNA Processing Is Required for Mitochondrial Ribosome Assembly.

    Rackham, Oliver; Busch, Jakob D; Matic, Stanka; Siira, Stefan J; Kuznetsova, Irina; Atanassov, Ilian; Ermer, Judith A; Shearwood, Anne-Marie J; Richman, Tara R; Stewart, James B; Mourier, Arnaud; Milenkovic, Dusanka; Larsson, Nils-Göran; Filipovska, Aleksandra

    2016-08-16

    The regulation of mitochondrial RNA processing and its importance for ribosome biogenesis and energy metabolism are not clear. We generated conditional knockout mice of the endoribonuclease component of the RNase P complex, MRPP3, and report that it is essential for life and that heart and skeletal-muscle-specific knockout leads to severe cardiomyopathy, indicating that its activity is non-redundant. Transcriptome-wide parallel analyses of RNA ends (PARE) and RNA-seq enabled us to identify that in vivo 5' tRNA cleavage precedes 3' tRNA processing, and this is required for the correct biogenesis of the mitochondrial ribosomal subunits. We identify that mitoribosomal biogenesis proceeds co-transcriptionally because large mitoribosomal proteins can form a subcomplex on an unprocessed RNA containing the 16S rRNA. Taken together, our data show that RNA processing links transcription to translation via assembly of the mitoribosome. PMID:27498866

  6. Hydrogen bonding and packing density are factors most strongly connected to limiting sites of high flexibility in the 16S rRNA in the 30S ribosome

    Ghosh Sujit K

    2009-07-01

    Full Text Available Abstract Background Conformational flexibility in structured RNA frequently is critical to function. The 30S ribosomal subunit exists in different conformations in different functional states due to changes in the central part of the 16S rRNA. We are interested in evaluating the factors that might be responsible for restricting flexibility to specific parts of the 16S rRNA using biochemical data obtained from the 30S subunit in solution. This problem was approached taking advantage of the observation that there must be a high degree of conformational flexibility at sites where UV photocrosslinking occurs and a lack of flexibility inhibits photoreactivity at many other sites that are otherwise suitable for reaction. Results We used 30S x-ray structures to quantify the properties of the nucleotide pairs at UV- and UVA-s4U-induced photocrosslinking sites in 16S rRNA and compared these to the properties of many hundreds of additional sites that have suitable geometry but do not undergo photocrosslinking. Five factors that might affect RNA flexibility were investigated – RNA interactions with ribosomal proteins, interactions with Mg2+ ions, the presence of long-range A minor motif interactions, hydrogen bonding and the count of neighboring heavy atoms around the center of each nucleobase to estimate the neighbor packing density. The two factors that are very different in the unreactive inflexible pairs compared to the reactive ones are the average number of hydrogen bonds and the average value for the number of neighboring atoms. In both cases, these factors are greater for the unreactive nucleotide pairs at a statistically very significant level. Conclusion The greater extent of hydrogen bonding and neighbor atom density in the unreactive nucleotide pairs is consistent with reduced flexibility at a majority of the unreactive sites. The reactive photocrosslinking sites are clustered in the 30S subunit and this indicates nonuniform patterns of

  7. Identification of the oligonucleotide and oligopeptide involved in an RNA-protein crosslink induced by ultraviolet irradiation of Escherichia coli 30 S ribosomal subunits

    When 30 S ribosomal subunits are irradiated with ultraviolet light, it has been found that an RNA-protein crosslinking reaction occurs whose primary target is protein S7. This paper describes the identification of the oligopeptide and oligonucleotide at the crosslinking point, by direct analysis (a) of the peptide remaining attached to an oligonucleotide (after total digestion of the RNA in the crosslinked complex with ribonucleases A and Tperpendicular, followed by digestion with trypsin), and (b) of the nucleotides remaining attached to the crosslinked protein (after digestion of the RNA in the complex with ribonuclease Tperpendicular alone). The crosslinking site was found to lie within a single short peptide, Ser-Met-Ala-Leu-Arg (positions 113 to 117 in the S7 sequence), with methionine as the probable amino acid concerned. The principal RNA site was found to lie within an oligonucleotide three to six bases long, the bracketed portion of the partially ordered sequence C-U-A-C-[A-A-U-G.G.C]-G in section P of the 16 S RNA. The methodology involved has been designed with a view to being generally applicable in future RNA-protein crosslinking studies, where several proteins are simultaneously attached to the RNA. (author)

  8. Three distinct ribosome assemblies modulated by translation are the building blocks of polysomes.

    Viero, Gabriella; Lunelli, Lorenzo; Passerini, Andrea; Bianchini, Paolo; Gilbert, Robert J; Bernabò, Paola; Tebaldi, Toma; Diaspro, Alberto; Pederzolli, Cecilia; Quattrone, Alessandro

    2015-03-01

    Translation is increasingly recognized as a central control layer of gene expression in eukaryotic cells. The overall organization of mRNA and ribosomes within polysomes, as well as the possible role of this organization in translation are poorly understood. Here we show that polysomes are primarily formed by three distinct classes of ribosome assemblies. We observe that these assemblies can be connected by naked RNA regions of the transcript. We show that the relative proportions of the three classes of ribosome assemblies reflect, and probably dictate, the level of translational activity. These results reveal the existence of recurrent supra-ribosomal building blocks forming polysomes and suggest the presence of unexplored translational controls embedded in the polysome structure. PMID:25713412

  9. Disruption of ribosome assembly in yeast blocks cotranscriptional pre-rRNA processing and affects the global hierarchy of ribosome biogenesis.

    Talkish, Jason; Biedka, Stephanie; Jakovljevic, Jelena; Zhang, Jingyu; Tang, Lan; Strahler, John R; Andrews, Philip C; Maddock, Janine R; Woolford, John L

    2016-06-01

    In higher eukaryotes, pre-rRNA processing occurs almost exclusively post-transcriptionally. This is not the case in rapidly dividing yeast, as the majority of nascent pre-rRNAs are processed cotranscriptionally, with cleavage at the A2 site first releasing a pre-40S ribosomal subunit followed by release of a pre-60S ribosomal subunit upon transcription termination. Ribosome assembly is driven in part by hierarchical association of assembly factors and r-proteins. Groups of proteins are thought to associate with pre-ribosomes cotranscriptionally during early assembly steps, whereas others associate later, after transcription is completed. Here we describe a previously uncharacterized phenotype observed upon disruption of ribosome assembly, in which normally late-binding proteins associate earlier, with pre-ribosomes containing 35S pre-rRNA. As previously observed by many other groups, we show that disruption of 60S subunit biogenesis results in increased amounts of 35S pre-rRNA, suggesting that a greater fraction of pre-rRNAs are processed post-transcriptionally. Surprisingly, we found that early pre-ribosomes containing 35S pre-rRNA also contain proteins previously thought to only associate with pre-ribosomes after early pre-rRNA processing steps have separated maturation of the two subunits. We believe the shift to post-transcriptional processing is ultimately due to decreased cellular division upon disruption of ribosome assembly. When cells are grown under stress or to high density, a greater fraction of pre-rRNAs are processed post-transcriptionally and follow an alternative processing pathway. Together, these results affirm the principle that ribosome assembly occurs through different, parallel assembly pathways and suggest that there is a kinetic foot-race between the formation of protein binding sites and pre-rRNA processing events. PMID:27036125

  10. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors.

    Uli Ohmayer

    Full Text Available Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins and ribosomal RNAs (rRNAs. Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs.

  11. YsxC, an essential protein in Staphylococcus aureus crucial for ribosome assembly/stability

    García-Lara Jorge

    2009-12-01

    Full Text Available Abstract Background Bacterial growth and division requires a core set of essential proteins, several of which are still of unknown function. They are also attractive targets for the development of new antibiotics. YsxC is a member of a family of GTPases highly conserved across eubacteria with a possible ribosome associated function. Results Here, we demonstrate by the creation of a conditional lethal mutant that ysxC is apparently essential for growth in S. aureus. To begin to elucidate YsxC function, a translational fusion of YsxC to the CBP-ProteinA tag in the staphylococcal chromosome was made, enabling Tandem Affinity Purification (TAP of YsxC-interacting partners. These included the ribosomal proteins S2, S10 and L17, as well as the β' subunit of the RNA polymerase. YsxC was then shown to copurify with ribosomes as an accessory protein specifically localizing to the 50 S subunit. YsxC depletion led to a decrease in the presence of mature ribosomes, indicating a role in ribosome assembly and/or stability in S. aureus. Conclusions In this study we demonstrate that YsxC of S. aureus localizes to the ribosomes, is crucial for ribosomal stability and is apparently essential for the life of S. aureus.

  12. Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

    Kirsten Kehrein

    2015-02-01

    Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.

  13. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20NLS mutant gene and examined polysome profile of cells that had been transfected with the S20NLS gene. As a result, we observed the formation of recombinant 40S carried S20NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20NLS. • Cytoplasm-retained S20NLS is crucial for creating a functional small subunit

  14. ppGpp negatively impacts ribosome assembly affecting growth and antimicrobial tolerance in Gram-positive bacteria.

    Corrigan, Rebecca M; Bellows, Lauren E; Wood, Alison; Gründling, Angelika

    2016-03-22

    The stringent response is a survival mechanism used by bacteria to deal with stress. It is coordinated by the nucleotides guanosine tetraphosphate and pentaphosphate [(p)ppGpp], which interact with target proteins to promote bacterial survival. Although this response has been well characterized in proteobacteria, very little is known about the effectors of this signaling system in Gram-positive species. Here, we report on the identification of seven target proteins for the stringent response nucleotides in the Gram-positive bacteriumStaphylococcus aureus We demonstrate that the GTP synthesis enzymes HprT and Gmk bind with a high affinity, leading to an inhibition of GTP production. In addition, we identified five putative GTPases-RsgA, RbgA, Era, HflX, and ObgE-as (p)ppGpp target proteins. We show that RsgA, RbgA, Era, and HflX are functional GTPases and that their activity is promoted in the presence of ribosomes but strongly inhibited by the stringent response nucleotides. By characterizing the function of RsgA in vivo, we ascertain that this protein is involved in ribosome assembly, with anrsgAdeletion strain, or a strain inactivated for GTPase activity, displaying decreased growth, a decrease in the amount of mature 70S ribosomes, and an increased level of tolerance to antimicrobials. We additionally demonstrate that the interaction of ppGpp with cellular GTPases is not unique to the staphylococci, as homologs fromBacillus subtilisandEnterococcus faecalisretain this ability. Taken together, this study reveals ribosome inactivation as a previously unidentified mechanism through which the stringent response functions in Gram-positive bacteria. PMID:26951678

  15. De novo Synthesis and Assembly of rRNA into Ribosomal Subunits during Cold Acclimation in Escherichia coli.

    Piersimoni, Lolita; Giangrossi, Mara; Marchi, Paolo; Brandi, Anna; Gualerzi, Claudio O; Pon, Cynthia L

    2016-04-24

    During the cold adaptation that follows a cold stress, bacterial cells undergo many physiological changes and extensive reprogramming of their gene expression pattern. Bulk gene expression is drastically reduced, while a set of cold shock genes is selectively and transiently expressed. The initial stage of cold acclimation is characterized by the establishment of a stoichiometric imbalance of the translation initiation factors (IFs)/ribosomes ratio that contributes to the preferential translation of cold shock transcripts. Whereas de novo synthesis of the IFs following cold stress has been documented, nothing was known concerning the activity of the rrn operons during the cold acclimation period. In this work, we focus on the expression of the rrn operons and the fate of rRNA after temperature downshift. We demonstrate that in Escherichia coli, rRNA synthesis does not stop during the cold acclimation phase, but continues with greater contribution of the P2 compared to the P1 promoter and all seven rrn operons are active, although their expression levels change with respect to pre-stress conditions. Eight hours after the 37°→10°C temperature downshift, the newly transcribed rRNA represents up to 20% of total rRNA and is preferentially found in the polysomes. However, with respect to the de novo synthesis of the IFs, both rRNA transcription and maturation are slowed down drastically by cold stress, thereby accounting in part for the stoichiometric imbalance of the IFs/ribosomes. Overall, our data indicate that new ribosomes, which are possibly suitable to function at low temperature, are slowly assembled during cold acclimation. PMID:26953262

  16. Expression and localization of VCX/Y proteins and their possible involvement in regulation of ribosome assembly during spermatogenesis

    SHENG WEI ZOU; JIAN CHAO ZHANG; XIAO DONG ZHANG; SHI YING MIAO; SHU DONG ZONG; QI SHENG; LIN FANG WANG

    2003-01-01

    Variable Charge X/Y (VCX/Y) is a human testis-specific gene family that localized on X and Y chromo-somes. In this study, VCY protein was expressed in E. coli in the form of glutathione-S-transferase (GST)fusion protein. With the purified fusion protein as antigen, the anti-GST-VCY antibody was generated andthe localization of VCY protein in human testis was determined by immunohistochemistry. In the testisseminiferous epithelium, VCY proteins were highly expressed in nuclei of germ cells. Using propidium io-dide staining and green fluorescent protein (GFP) tag technologies, VCY and VCX-8r proteins were mainlylocalized in the nucleoli of COS7 cells. In addition, the colocalization for VCY and VCX-8r in COS7 cellswas also observed. With VCY cDNA as bait, a cDNA fragment of acidic ribosomal protein PO was obtainedusing yeast two-hybrid system. All the information above indicates that VCX/Y protein family might beinvolved in the regulation of ribosome assembly during spermatogenesis.

  17. Ribosomal Initiation Complex Assembly within the Wild-Strain of Coxsackievirus B3 and Live-Attenuated Sabin3-like IRESes during the Initiation of Translation

    Nathalie Chamond

    2013-02-01

    Full Text Available Coxsackievirus B3 (CVB3 is an enterovirus of the family of Picornaviridae. The Group B coxsackieviruses include six serotypes (B1 to B6 that cause a variety of human diseases, including myocarditis, meningitis, and diabetes. Among the group B, the B3 strain is mostly studied for its cardiovirulence and its ability to cause acute and persistent infections. Translation initiation of CVB3 RNA has been shown to be mediated by a highly ordered structure of the 5’-untranslated region (5’UTR, which harbors an internal ribosome entry site (IRES. Translation initiation is a complex process in which initiator tRNA, 40S and 60S ribosomal subunits are assembled by eukaryotic initiation factors (eIFs into an 80S ribosome at the initiation codon of the mRNA. We have previously addressed the question of whether the attenuating mutations of domain V of the poliovirus IRES were specific for a given genomic context or whether they could be transposed and extrapolated to a genomic related virus, i.e., CVB3 wild-type strain. In this context, we have described that Sabin3-like mutation (U473→C introduced in CVB3 genome led to a defective mutant with a serious reduction in translation efficiency. In this study, we analyzed the efficiency of formation of ribosomal initiation complexes 48S and 80S through 10%–30% and 10%–50% sucrose gradients using rabbit reticulocyte lysates (RRLs and stage-specific translation inhibitors: 5'-Guanylyl-imidodiphosphate (GMP-PNP and Cycloheximide (CHX, respectively. We demonstrated that the interaction of 48S and 80S ribosomal complexes within the mutant CVB3 RNA was abolished compared with the wild-type RNA by ribosome assembly analysis. Taken together, it is possible that the mutant RNA was unable to interact with some trans-acting factors critical for enhanced IRES function.

  18. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    Recht, M I; Douthwaite, S; Dahlquist, K D;

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  19. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.

    2011-01-01

    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stab...

  20. Surface topography of the Bacillus stearothermophilus ribosome

    The surface topography of the intact 70S ribosome and free 30S and 50S subunits from Bacillus stearothermophilus strain 2,184 was investigated by lactoperoxidase-catalyzed iodination. Two-dimensional polyacrylamide gel electrophoresis was employed to separate ribosomal proteins for analysis of their reactivity. Free 50S subunits incorporated about 18% more 125I than did 50S subunits derived from 70S ribosomes, whereas free 30S subunits and 30S subunits derived from 70S ribosomes incorporated similar amounts of 125I. Iodinated 70S ribosomes and subunits retained 62-78% of the protein synthesis activity of untreated particles and sedimentation profiles showed no gross conformational changes due to iodination. The proteins most reactive to enzymatic iodination were S4, S7, S10 and Sa of the small subunit and L2, L4, L5/9, L6 and L36 of the large subunit. Proteins S2, S3, S7, S13, Sa, L5/9, L10, L11 and L24/25 were labeled substantially more in the free subunits than in the 70S ribosome. Other proteins, including S5, S9, S12, S15/16, S18 and L36 were more extensively iodinated in the 70S ribosome than in the free subunits. The locations of tyrosine residues in some homologus ribosomal proteins from B. stearothermophilus and E. coli are compared. (orig.)

  1. Cooperative assembly of proteins in the ribosomal GTPase centre demonstrated by their interactions with mutant 23S rRNAs

    Rosendahl, G; Douthwaite, S

    1995-01-01

    within a hairpin loop (1068-1072), where the protein probably makes nucleotide contacts. Some of these mutations also interfere with binding of the r-protein complex L10.(L12)4 to an adjacent site on the rRNA. When added together to rRNA, proteins L10.(L12)4 and L11 bind cooperatively to overcome the......The ribosomal protein L11 binds to the region of 23S rRNA associated with the GTPase-dependent steps of protein synthesis. Nucleotides 1054-1107 within this region of the Escherichia coli 23S rRNA gene were mutagenized with bisulphite. Twenty point mutations (G-->A and C-->T transitions) and...... numerous multiple mutations were generated. Expression of mutant 23S rRNAs in vivo shows that all the mutations detectably alter the phenotype, with effects ranging from a slight growth rate reduction to lack of viability. Temperature sensitivity is conferred by 1071G-->A and 1092C-->U substitutions. These...

  2. The Cryo-EM Structure of a Complete 30S Translation Initiation Complex from Escherichia coli

    Julián, Patricia; Milon, Pohl; Agirrezabala, Xabier; Lasso, Gorka; Gil, David; Rodnina, Marina V; Valle Rodríguez, Mikel Karmel

    2011-01-01

    Author Summary Translation is the process by which a ribosome converts the sequence of a messenger RNA (mRNA)—produced from a gene—into the sequence of amino acids that comprise a protein. Bacterial ribosomes each have one large and one small subunit: the 50S and 30S subunits. Initiation of translation entails selection of an mRNA, identification of the correct starting point from which to read its code, and engagement of the initial amino acid carrier (tRNA). These events take place in the 3...

  3. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.

    2011-01-01

    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show this structural change depends only on 16S residues within the S4 binding site. SHAPE chemical-probing experiments showed that S4 strongly stabilizes the five-helix junction and helix 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in helix 16 that makes specific contacts with the S4 N-terminal extension, and a right angle motif between helices 3, 4 and 18, require a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of helix 3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  4. An overview of pre-ribosomal RNA processing in eukaryotes

    Henras, Anthony K.; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel

    2014-01-01

    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. ...

  5. Identification of nucleosome assembly protein 1 (NAP1) as an interacting partner of plant ribosomal protein S6 (RPS6) and a positive regulator of rDNA transcription

    Son, Ora [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Sunghan [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Shin, Yun-jeong [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Woo-Young [College of Pharmacy, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Koh, Hee-Jong, E-mail: heejkoh@snu.ac.kr [Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Cheon, Choong-Ill, E-mail: ccheon@sookmyung.ac.kr [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of)

    2015-09-18

    The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.

  6. Identification of nucleosome assembly protein 1 (NAP1) as an interacting partner of plant ribosomal protein S6 (RPS6) and a positive regulator of rDNA transcription

    The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription

  7. Slow formation of stable complexes during coincubation of minimal rRNA and ribosomal protein S4.

    Mayerle, Megan; Bellur, Deepti L; Woodson, Sarah A

    2011-09-23

    Ribosomal protein S4 binds and stabilizes a five-helix junction or five-way junction (5WJ) in the 5' domain of 16S ribosomal RNA (rRNA) and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and 5WJ reorganize their structures. We show that labile S4 complexes rearrange into stable complexes within a few minutes at 42 °C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show that this structural change depends only on 16S residues within the S4 binding site. SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension) chemical probing experiments showed that S4 strongly stabilizes 5WJ and the helix (H) 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in H16 that makes specific contacts with the S4 N-terminal extension, as well as a right-angle motif between H3, H4, and H18, requires a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of H3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  8. The role of human ribosomal proteins in the maturation of rRNA and ribosome production

    Robledo, Sara; Rachel A Idol; Crimmins, Dan L.; Ladenson, Jack H.; Mason, Philip J.; Bessler, Monica

    2008-01-01

    Production of ribosomes is a fundamental process that occurs in all dividing cells. It is a complex process consisting of the coordinated synthesis and assembly of four ribosomal RNAs (rRNA) with about 80 ribosomal proteins (r-proteins) involving more than 150 nonribosomal proteins and other factors. Diamond Blackfan anemia (DBA) is an inherited red cell aplasia caused by mutations in one of several r-proteins. How defects in r-proteins, essential for proliferation in all cells, lead to a hum...

  9. Architecture of the E.coli 70S ribosome

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.; Meerwinck, W.; Stuhrmann, H.B.; Pedersen, J.S.; Koch, M.H.J.; Volkov, V.V.; Kozin, M.B.; Svergun, D.I.

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast-vari...

  10. Architecture of the E.coli 70S ribosome

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.;

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  11. A Step Subsequent to Preinitiation Complex Assembly at the Ribosomal RNA Gene Promoter Is Rate Limiting for Human RNA Polymerase I-Dependent Transcription

    Panov, Kostya I.; Friedrich, J. Karsten; Zomerdijk, Joost C. B. M.

    2001-01-01

    The assembly, disassembly, and functional properties of transcription preinitiation complexes (PICs) of human RNA polymerase I (Pol I) play a crucial role in the regulation of rRNA gene expression. To study the factors and processes involved, an immobilized-promoter template assay has been developed that allows the isolation from nuclear extracts of functional PICs, which support accurate initiation of transcription. Immunoblotting of template-bound factors showed that these complexes contain...

  12. Targeted proteomics reveals compositional dynamics of 60S pre-ribosomes after nuclear export

    Altvater, Martin; Chang, Yiming; Melnik, Andre; Occhipinti, Laura; Schütz, Sabina; Rothenbusch, Ute; Picotti, Paola; Panse, Vikram Govind

    2012-01-01

    Construction and intracellular targeting of eukaryotic pre-ribosomal particles involve a multitude of diverse transiently associating trans-acting assembly factors, energy-consuming enzymes, and transport factors. The ability to rapidly and reliably measure co-enrichment of multiple factors with maturing pre-ribosomal particles presents a major biochemical bottleneck towards revealing their function and the precise contribution of >50 energy-consuming steps that drive ribosome assembly. Here,...

  13. Implications of macromolecular crowding and reducing conditions for in vitro ribosome construction

    Fritz, Brian R; Jamil, Osman K.; Jewett, Michael C

    2015-01-01

    In vitro construction of Escherichia coli ribosomes could elucidate a deeper understanding of these complex molecular machines and make possible the production of synthetic variants with new functions. Toward this goal, we recently developed an integrated synthesis, assembly and translation (iSAT) system that allows for co-activation of ribosomal RNA (rRNA) transcription and ribosome assembly, mRNA transcription and protein translation without intact cells. Here, we discovered that macromolec...

  14. Immunomodulation by microbial ribosomes

    W. Domzig

    1987-01-01

    Full Text Available Over the past twenty years, many authors have reported evidence of the immunoprotective capacity of ribosomes isolated from bacteria, fungi and parasites. Since 1971 we have explored the protective capacity of ribosomes isolated from a large variety of microorganisms responsible for human and animal diseases. More recently, using monoclonal antibodies raised against ribosomes and then selected for their ability to confer passive immunity to mice, we have studied the mechanism of the protection induced by ribosomes. These studies, in parallel with the development of a technology for the large scale production of ribosomes, have allowed us to achieve a new regard for ribosomal vaccines for use in human. The general concept of ribosomal vaccines in presented and examples of two such vaccines are described with data on the specific protection that they induce in mice against experimental infections with Klebsiella peneumoniae, Streptococcus pneumoniae, S. pyogenes and Haemophilus influenzae for the first one, and against Candida albicans type A and type B for the second one. Because of their high immunogenicity and their innocuity these vaccines represent a decisive improvement over classical microbial vaccines.

  15. Ribosome-inactivating proteins

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M.

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with oth...

  16. 30S RI Beam Production and X-ray Bursts

    Kahl, David; Binh, Dam Nguyen; Chen, Jun; Hashimoto, Takashi; Hayakawa, Seiya; Kim, Aram; Kubono, Shigeru; Kurihara, Yuzo; Lee, Nam Hee; Michimasa, Shin'ichiro; Nishimura, Shunji; Van Ouellet, Christian; nia, Kiana Setoodeh; Wakabayashi, Yasuo; Yamaguchi, Hideotoshi

    2009-01-01

    The present work reports the results of 30S radioactive beam development for a future experiment directly measuring data to extrapolate the 30S(alpha,p) stellar reaction rate in Type I X-ray bursts, a phenomena where nuclear explosions occur repeatedly on the surface of accreting neutron stars. We produce the radioactive ion 30S via the 3He(28Si,30S)n reaction, by bombarding a cryogenically cooled target of 3He at 400 Torr and 80 K with 28Si beams of 6.9 and 7.54 MeV/u. In order to perform a successful future experiment which allows us to calculate the stellar 30S(alpha, p) reaction rate, Hauser-Feshbach calculations indicate we require a 30S beam of ~10^5 particles per second at ~32 MeV. Based on our recent beam development experiments in 2006 and 2008, it is believed that such a beam may be fabricated in 2009 according to the results presented. We plan to measure the 4He(30S,p) cross-section at astrophysical energies in 2009, and some brief remarks on the planned (alpha,p) technique are also elucidated.

  17. Protein-protein interactions within late pre-40S ribosomes.

    Melody G Campbell

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  18. A protein residing at the subunit interface of the bacterial ribosome.

    Agafonov, D E; Kolb, V A; Nazimov, I V; Spirin, A S

    1999-10-26

    Surface labeling of Escherichia coli ribosomes with the use of the tritium bombardment technique has revealed a minor unidentified ribosome-bound protein (spot Y) that is hidden in the 70S ribosome and becomes highly labeled on dissociation of the 70S ribosome into subunits. In the present work, the N-terminal sequence of the protein Y was determined and its gene was identified as yfia, an ORF located upstream the phe operon of E. coli. This 12.7-kDa protein was isolated and characterized. An affinity of the purified protein Y for the 30S subunit, but not for the 50S ribosomal subunit, was shown. The protein proved to be exposed on the surface of the 30S subunit. The attachment of the 50S subunit resulted in hiding the protein Y, thus suggesting the protein location at the subunit interface in the 70S ribosome. The protein was shown to stabilize ribosomes against dissociation. The possible role of the protein Y as ribosome association factor in translation is discussed. PMID:10535924

  19. Crystal Structures of EF-G-Ribosome Complexes Trapped in Intermediate States of Translocation

    Zhou, Jie; Lancaster, Laura; Donohue, John Paul; Noller, Harry F. [UCSC

    2013-11-12

    Translocation of messenger and transfer RNA (mRNA and tRNA) through the ribosome is a crucial step in protein synthesis, whose mechanism is not yet understood. The crystal structures of three Thermus ribosome-tRNA-mRNA–EF-G complexes trapped with β,γ-imidoguanosine 5'-triphosphate (GDPNP) or fusidic acid reveal conformational changes occurring during intermediate states of translocation, including large-scale rotation of the 30S subunit head and body. In all complexes, the tRNA acceptor ends occupy the 50S subunit E site, while their anticodon stem loops move with the head of the 30S subunit to positions between the P and E sites, forming chimeric intermediate states. Two universally conserved bases of 16S ribosomal RNA that intercalate between bases of the mRNA may act as “pawls” of a translocational ratchet. These findings provide new insights into the molecular mechanism of ribosomal translocation.

  20. The Ribosome Comes Alive

    Frank, Joachim

    2010-01-01

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample (“story in a sample”), providing snapshots of an entire subprocess of translation, such as t...

  1. The Ribosome Comes Alive.

    Frank, Joachim

    2010-06-18

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample ("story in a sample"), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  2. The structure of Aquifex aeolicus ribosomal protein S8 reveals a unique subdomain that contributes to an extremely tight association with 16S rRNA.

    Menichelli, Elena; Edgcomb, Stephen P; Recht, Michael I; Williamson, James R

    2012-01-20

    The assembly of ribonucleoprotein complexes occurs under a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from Aquifex aeolicus (AS8) is unique in that there is a 41-residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually high affinity for the 16S ribosomal RNA, characterized by a picomolar dissociation constant that is approximately 26,000-fold tighter than the equivalent interaction from Escherichia coli. Deletion analysis demonstrated that binding to the minimal site on helix 21 occurred at the same nanomolar affinity found for other bacterial species. The additional affinity required the presence of a three-helix junction between helices 20, 21, and 22. The crystal structure of AS8 was solved, revealing the helix-loop-helix geometry of the unique AS8 insertion region, while the core of the molecule is conserved with known S8 structures. The AS8 structure was modeled onto the structure of the 30S ribosomal subunit from E. coli, suggesting the possibility that the unique subdomain provides additional backbone and side-chain contacts between the protein and an unpaired base within the three-way junction of helices 20, 21, and 22. Point mutations in the protein insertion subdomain resulted in a significantly reduced RNA binding affinity with respect to wild-type AS8. These results indicate that the AS8-specific subdomain provides additional interactions with the three-way junction that contribute to the extremely tight binding to ribosomal RNA. PMID:22079365

  3. Study of astrophysically important resonant states in 30 S using the 32S(p,t30 S reaction

    Wrede C.

    2010-03-01

    Full Text Available A small fraction (< 1% of presolar SiC grains is suggested to have been formed in the ejecta of classical novae. The 29P(p,γ30S reaction plays an important role in understanding the Si isotopic abundances in such grains, which in turn provide us with information on the nature of the probable white dwarf progenitor’s core, as well as the peak temperatures achieved during nova outbursts, and thus the nova nucleosynthetic path. The 29P(p,γ30S reaction rate at nova temperatures is determined by two low-lying 3+ and 2+ resonances above the proton threshold at 4399 keV in 30S. Despite several experimental studies in the past, however, only one of these two states has only been observed very recently. We have studied the 30S nuclear structure via the 32S(p,t 30S reaction at 5 laboratory angles between 9° to 62°. We have observed 14 states, eleven of which are above the proton threshold, including two levels at 4692.7 ± 4.5 keV and 4813.8 ± 3.4 keV that are candidates for the 3+ and the previously “issing” 2+ state, respectively.

  4. Ribosome recycling induces optimal translation rate at low ribosomal availability

    Marshall, E.; Stansfield, I; Romano, M. C.

    2014-01-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces ...

  5. Structural Basis for Ribosome Recruitment and Manipulation by a Viral IRES RNA

    Pfingsten, Jennifer S; Costantino, David A.; Kieft, Jeffrey S.

    2006-01-01

    Canonical cap-dependent translation initiation requires a large number of protein factors that act in a stepwise assembly process. In contrast, internal ribosomal entry sites (IRESs) are cis-acting RNAs that in some cases completely supplant these factors by recruiting and activating the ribosome using a single structured RNA. Here we present the crystal structures of the ribosome-binding domain from a Dicistroviridae intergenic region IRES at 3.1 angstrom resolution, providing a view of the ...

  6. Development of an ion source for long-pulse (30-s) neutral beam injection

    Menon, M.M.; Barber, G.C.; Blue, C.W.; Dagenhart, W.K.; Gardner, W.L.; Haselton, H.H.; Moeller, J.A.; Ponte, N.S.; Ryan, P.M.; Schecter, D.E.

    1982-01-01

    This paper describes the development of a long-pulse positive ion source that has been designed to provide high brightness deuterium beams (divergence approx. = 0.25/sup 0/ rms, current density approx. = 0.15 A cm/sup -2/) of 40 to 45 A, at a beam energy of 80 keV, for pulse lengths up to 30 s. The design and construction of the ion source components are described with particular emphasis placed on the long-pulse cathode assembly and ion accelerator.

  7. Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3

    Anuradha Seshadri; Umesh Varshney

    2006-06-01

    Ribosome recycling is a process which dissociates the post-termination complexes (post-TC) consisting of mRNA-bound ribosomes harbouring deacylated tRNA(s). Ribosome recycling factor (RRF), and elongation factor G (EFG) participate in this crucial process to free the ribosomal subunits for a new round of translation. We discuss the overall pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor 3 (IF3) in this process. Depending on the step(s) at which IF3 function is implicated, three models have been proposed. In model 1, RRF and EFG dissociate the post-TCs into the 50S and 30S subunits, mRNA and tRNA(s). In this model, IF3, which binds to the 30S subunit, merely keeps the dissociated subunits apart by its anti-association activity. In model 2, RRF and EFG separate the 50S subunit from the post-TC. IF3 then dissociates the remaining complex of mRNA, tRNA and the 30S subunit, and keeps the ribosomal subunits apart from each other. However, in model 3, both the genetic and biochemical evidence support a more active role for IF3 even at the step of dissociation of the post-TC by RRF and EFG into the 50S and 30S subunits.

  8. Structural insights into ribosome translocation.

    Ling, Clarence; Ermolenko, Dmitri N

    2016-09-01

    During protein synthesis, tRNA and mRNA are translocated from the A to P to E sites of the ribosome thus enabling the ribosome to translate one codon of mRNA after the other. Ribosome translocation along mRNA is induced by the universally conserved ribosome GTPase, elongation factor G (EF-G) in bacteria and elongation factor 2 (EF-2) in eukaryotes. Recent structural and single-molecule studies revealed that tRNA and mRNA translocation within the ribosome is accompanied by cyclic forward and reverse rotations between the large and small ribosomal subunits parallel to the plane of the intersubunit interface. In addition, during ribosome translocation, the 'head' domain of small ribosomal subunit undergoes forward- and back-swiveling motions relative to the rest of the small ribosomal subunit around the axis that is orthogonal to the axis of intersubunit rotation. tRNA/mRNA translocation is also coupled to the docking of domain IV of EF-G into the A site of the small ribosomal subunit that converts the thermally driven motions of the ribosome and tRNA into the forward translocation of tRNA/mRNA inside the ribosome. Despite recent and enormous progress made in the understanding of the molecular mechanism of ribosome translocation, the sequence of structural rearrangements of the ribosome, EF-G and tRNA during translocation is still not fully established and awaits further investigation. WIREs RNA 2016, 7:620-636. doi: 10.1002/wrna.1354 For further resources related to this article, please visit the WIREs website. PMID:27117863

  9. Ribosomal crystallography: peptide bond formation and its inhibition.

    Bashan, Anat; Zarivach, Raz; Schluenzen, Frank; Agmon, Ilana; Harms, Joerg; Auerbach, Tamar; Baram, David; Berisio, Rita; Bartels, Heike; Hansen, Harly A S; Fucini, Paola; Wilson, Daniel; Peretz, Moshe; Kessler, Maggie; Yonath, Ada

    2003-09-01

    Ribosomes, the universal cellular organelles catalyzing the translation of genetic code into proteins, are protein/RNA assemblies, of a molecular weight 2.5 mega Daltons or higher. They are built of two subunits that associate for performing protein biosynthesis. The large subunit creates the peptide bond and provides the path for emerging proteins. The small has key roles in initiating the process and controlling its fidelity. Crystallographic studies on complexes of the small and the large eubacterial ribosomal subunits with substrate analogs, antibiotics, and inhibitors confirmed that the ribosomal RNA governs most of its activities, and indicated that the main catalytic contribution of the ribosome is the precise positioning and alignment of its substrates, the tRNA molecules. A symmetry-related region of a significant size, containing about two hundred nucleotides, was revealed in all known structures of the large ribosomal subunit, despite the asymmetric nature of the ribosome. The symmetry rotation axis, identified in the middle of the peptide-bond formation site, coincides with the bond connecting the tRNA double-helical features with its single-stranded 3' end, which is the moiety carrying the amino acids. This thus implies sovereign movements of tRNA features and suggests that tRNA translocation involves a rotatory motion within the ribosomal active site. This motion is guided and anchored by ribosomal nucleotides belonging to the active site walls, and results in geometry suitable for peptide-bond formation with no significant rearrangements. The sole geometrical requirement for this proposed mechanism is that the initial P-site tRNA adopts the flipped orientation. The rotatory motion is the major component of unified machinery for peptide-bond formation, translocation, and nascent protein progression, since its spiral nature ensures the entrance of the nascent peptide into the ribosomal exit tunnel. This tunnel, assumed to be a passive path for the

  10. Ribosome recycling induces optimal translation rate at low ribosomal availability.

    Marshall, E; Stansfield, I; Romano, M C

    2014-09-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3' end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called 'closed-loop' model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  11. Nucleolus: The ribosome factory

    Cmarko, Dušan; Šmigová, J.; Minichová, L.; Popov, Alexey

    2008-01-01

    Roč. 23, č. 10 (2008), s. 1291-1298. ISSN 0213-3911 R&D Projects: GA ČR(CZ) GA304/06/1691 Grant ostatní: Wellcome Trust(XE) 075834/04/Z; GA MŠk(CZ) LC535; GA ČR(CZ) GA304/06/1662 Institutional research plan: CEZ:AV0Z50110509 Keywords : nucleolus * nucleolar architecture * ribosome biogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.194, year: 2008

  12. Structural, biophysical and functional characterization of Nop7-Erb1-Ytm1 complex and its implications in eukaryotic ribosome biogenesis

    Wegrecki, Marcin

    2015-01-01

    [EN] Ribosome biogenesis is one of the most important and energy-consuming processes in the cell. However, the vast majority of the events and factors that are involved in the synthesis of ribosomal subunits are not well understood. Ribosome maturation comprises multiple steps of rRNA processing that require sequential association and dissociation of numerous assembly factors. These proteins establish a complex network of interactions that are essential for the pathway to continue. Extensive ...

  13. Chloroplast ribosomes and protein synthesis.

    Harris, E. H.; Boynton, J E; Gillham, N W

    1994-01-01

    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles i...

  14. Ribosome dynamics and the evolutionary history of ribosomes

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.

    2015-09-01

    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  15. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  16. Structural and Functional Characterization of Ribosomal Protein Gene Introns in Sponges

    Perina, Dragutin; Korolija, Marina; Mikoč, Andreja; Roller Milošević, Maša; Pleše, Bruna; Imešek, Mirna; Morrow, Christine; Batel, Renato; Ćetković, Helena

    2012-01-01

    Ribosomal protein genes (RPGs) are a powerful tool for studying intron evolution. They exist in all three domains of life and are much conserved. Accumulating genomic data suggest that RPG introns in many organisms abound with non-protein-coding-RNAs (ncRNAs). These ancient ncRNAs are small nucleolar RNAs (snoRNAs) essential for ribosome assembly. They are also mobile genetic elements and therefore probably important in diversification and enrichment of transcriptomes through various mechanis...

  17. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L. J.

    2016-01-01

    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucl...

  18. Transcription-independent role for human mitochondrial RNA polymerase in mitochondrial ribosome biogenesis

    Surovtseva, Yulia V; Shadel, Gerald S.

    2013-01-01

    Human mitochondrial RNA polymerase, POLRMT, is required for mitochondrial DNA (mtDNA) transcription and forms initiation complexes with human mitochondrial transcription factor B2 (h-mtTFB2). However, POLRMT also interacts with the paralogue of h-mtTFB2, h-mtTFB1, which is a 12S ribosomal RNA methyltransferase required for small (28S) mitochondrial ribosome subunit assembly. Herein, we show that POLRMT associates with h-mtTFB1 in 28S mitochondrial ribosome complexes that are stable in the abs...

  19. Horizontal gene transfer of zinc and non-zinc forms of bacterial ribosomal protein S4

    Luthey-Schulten Zaida; Roberts Elijah; Chen Ke

    2009-01-01

    Abstract Background The universal ribosomal protein S4 is essential for the initiation of small subunit ribosomal assembly and translational accuracy. Being part of the information processing machinery of the cell, the gene for S4 is generally thought of as being inherited vertically and has been used in concatenated gene phylogenies. Here we report the evolution of ribosomal protein S4 in relation to a broad sharing of zinc/non-zinc forms of the gene and study the scope of horizontal gene tr...

  20. HrpA, a new ribosome-associated protein which appears in heat-stressed Mycobacterium bovis bacillus Calmette-Guérin.

    Ohara, N; Naito, M.; Miyazaki, C.; Matsumoto, S.; Tabira, Y; Yamada, T.

    1997-01-01

    A novel 18-kDa heat shock protein, HrpA, has been identified from Mycobacterium bovis BCG. HrpA was rapidly synthesized in membrane and ribosome fractions but not in the cytoplasmic fraction under heat shock stress. HrpA bound tightly to 70S ribosomes, mainly in 30S subunits. HrpA might be involved in the initiation step of translation at high temperature.

  1. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  2. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  3. Ribosome engineering to promote new crystal forms

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors

  4. Preferential translation of chloroplast ribosomal proteins in Chlamydomonas reinhardtti

    The nuclear cr-1 mutant of C. reinhardtii is deficient in the 30S subunit of the chloroplast (cp) ribosome and in cp protein synthesis. The cp spectinomycin resistant mutant, spr-u-1-27-3, has a normal level of 70S ribosomes but only a low rate of cp protein synthesis with spectinomycin present. In both mutants there is little accumulation of the large subunit of ribulose 1,5-bisphosphate carboxylase (Rubisco LSU), but near wild-type levels of cp synthesized r-proteins. In cells pulse-labelled with 35SO4 and immunoprecipitated with specific antisera, the ratio of the rate of synthesis of cp r-proteins to that of Rubisco LSU is 7 times greater in both mutants than in wild-type. No difference in the rate of turnover between r-proteins and Rubisco LSU in mutant and wild-type cells was observed during a one hour chase. The mRNA levels for r-protein L1 and Rubisco LSU actually increase slightly in the mutants. These data suggest that C. reinhardtii has a translation mechanism for preferential synthesis of cp r-proteins that operates under conditions of reduced total cp protein synthesis

  5. The Cryo-EM structure of a complete 30S translation initiation complex from Escherichia coli.

    Patricia Julián

    2011-07-01

    Full Text Available Formation of the 30S initiation complex (30S IC is an important checkpoint in regulation of gene expression. The selection of mRNA, correct start codon, and the initiator fMet-tRNA(fMet requires the presence of three initiation factors (IF1, IF2, IF3 of which IF3 and IF1 control the fidelity of the process, while IF2 recruits fMet-tRNA(fMet. Here we present a cryo-EM reconstruction of the complete 30S IC, containing mRNA, fMet-tRNA(fMet, IF1, IF2, and IF3. In the 30S IC, IF2 contacts IF1, the 30S subunit shoulder, and the CCA end of fMet-tRNA(fMet, which occupies a novel P/I position (P/I1. The N-terminal domain of IF3 contacts the tRNA, whereas the C-terminal domain is bound to the platform of the 30S subunit. Binding of initiation factors and fMet-tRNA(fMet induces a rotation of the head relative to the body of the 30S subunit, which is likely to prevail through 50S subunit joining until GTP hydrolysis and dissociation of IF2 take place. The structure provides insights into the mechanism of mRNA selection during translation initiation.

  6. The Cryo-EM structure of a complete 30S translation initiation complex from Escherichia coli.

    Julián, Patricia; Milon, Pohl; Agirrezabala, Xabier; Lasso, Gorka; Gil, David; Rodnina, Marina V; Valle, Mikel

    2011-07-01

    Formation of the 30S initiation complex (30S IC) is an important checkpoint in regulation of gene expression. The selection of mRNA, correct start codon, and the initiator fMet-tRNA(fMet) requires the presence of three initiation factors (IF1, IF2, IF3) of which IF3 and IF1 control the fidelity of the process, while IF2 recruits fMet-tRNA(fMet). Here we present a cryo-EM reconstruction of the complete 30S IC, containing mRNA, fMet-tRNA(fMet), IF1, IF2, and IF3. In the 30S IC, IF2 contacts IF1, the 30S subunit shoulder, and the CCA end of fMet-tRNA(fMet), which occupies a novel P/I position (P/I1). The N-terminal domain of IF3 contacts the tRNA, whereas the C-terminal domain is bound to the platform of the 30S subunit. Binding of initiation factors and fMet-tRNA(fMet) induces a rotation of the head relative to the body of the 30S subunit, which is likely to prevail through 50S subunit joining until GTP hydrolysis and dissociation of IF2 take place. The structure provides insights into the mechanism of mRNA selection during translation initiation. PMID:21750663

  7. Heterologous complementation reveals that mutant alleles of QSR1 render 60S ribosomal subunits unstable and translationally inactive.

    Dick, F A; Trumpower, B L

    1998-01-01

    QSR1 is a highly conserved gene which encodes a 60S ribosomal subunit protein that is required for joining of large and small ribosomal subunits. In this report we demonstrate heterologous complementation of a yeast QSR1 deletion strain with both the human and corn homologs and show that the human and corn proteins are assembled into hybrid yeast/human and yeast/corn ribosomes. While the homologous genes complement lethality of the QSR1 deletion, they also result in a diminished growth rate. ...

  8. Molecular mechanisms of ribosomal protein gene coregulation.

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B Franklin

    2015-09-15

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20-50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1-TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

  9. Experimental Conditions: SE30_S01_M01_D01 [Metabolonote[Archive

    Full Text Available SE30_S01_M01_D01 SE30 Comparison of seed metabolites among soybean varieties SE30_S...01 Glycine max Kamogawashichiri green seed SE30_S01_M01 6.7mg [MassBase ID] MDLC1_21988 SE30_MS1 LC-FT-ICR-MS ESI posit...ive method 1 SE30_DS1 PowerGet analysis for detection of all peaks (B3) 6|ITMS 2 SE30_AM1 PowerGet annotation A1 ...

  10. Experimental Conditions: SE30_S02_M02_D01 [Metabolonote[Archive

    Full Text Available SE30_S02_M02_D01 SE30 Comparison of seed metabolites among soybean varieties SE30_S02 Glycine max Koit...ozairai green seed SE30_S02_M02 6.7mg [MassBase ID] MDLC1_21992 SE30_MS1 LC-FT-ICR-MS ESI posit...ive method 1 SE30_DS1 PowerGet analysis for detection of all peaks (B3) 6|ITMS 2 SE30_AM1 PowerGet annotation A1 ...

  11. Translation Initiation is Controlled by RNA Folding Kinetics via a Ribosome Drafting Mechanism.

    Espah Borujeni, Amin; Salis, Howard M

    2016-06-01

    RNA folding plays an important role in controlling protein synthesis as well as other cellular processes. Existing models have focused on how RNA folding energetics control translation initiation rate under equilibrium conditions but have largely ignored the effects of nonequilibrium RNA folding. We introduce a new mechanism, called "ribosome drafting", that explains how a mRNA's folding kinetics and the ribosome's binding rate collectively control its translation initiation rate. During cycles of translation, ribosome drafting emerges whenever successive ribosomes bind to a mRNA faster than the mRNA can refold, maintaining it in a nonequilibrium state with an acceleration of protein synthesis. Using computational design, time-correlated single photon counting, and expression measurements, we demonstrate that slow-folding and fast-folding RNA structures with equivalent folding energetics can vary protein synthesis rates by 1000-fold. We determine the necessary conditions for ribosome drafting by characterizing mRNAs with rationally designed ribosome binding rates, folding kinetics, and folding energetics, confirming the predictions of a nonequilibrium Markov model of translation. Our results have widespread implications, illustrating how competitive folding and assembly kinetics can shape the gene expression machinery's sequence-structure-function relationship inside cells. PMID:27199273

  12. Ribosome biogenesis in replicating cells: Integration of experiment and theory.

    Earnest, Tyler M; Cole, John A; Peterson, Joseph R; Hallock, Michael J; Kuhlman, Thomas E; Luthey-Schulten, Zaida

    2016-10-01

    Ribosomes-the primary macromolecular machines responsible for translating the genetic code into proteins-are complexes of precisely folded RNA and proteins. The ways in which their production and assembly are managed by the living cell is of deep biological importance. Here we extend a recent spatially resolved whole-cell model of ribosome biogenesis in a fixed volume [Earnest et al., Biophys J 2015, 109, 1117-1135] to include the effects of growth, DNA replication, and cell division. All biological processes are described in terms of reaction-diffusion master equations and solved stochastically using the Lattice Microbes simulation software. In order to determine the replication parameters, we construct and analyze a series of Escherichia coli strains with fluorescently labeled genes distributed evenly throughout their chromosomes. By measuring these cells' lengths and number of gene copies at the single-cell level, we could fit a statistical model of the initiation and duration of chromosome replication. We found that for our slow-growing (120 min doubling time) E. coli cells, replication was initiated 42 min into the cell cycle and completed after an additional 42 min. While simulations of the biogenesis model produce the correct ribosome and mRNA counts over the cell cycle, the kinetic parameters for transcription and degradation are lower than anticipated from a recent analytical time dependent model of in vivo mRNA production. Describing expression in terms of a simple chemical master equation, we show that the discrepancies are due to the lack of nonribosomal genes in the extended biogenesis model which effects the competition of mRNA for ribosome binding, and suggest corrections to parameters to be used in the whole-cell model when modeling expression of the entire transcriptome. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 735-751, 2016. PMID:27294303

  13. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  14. Ribosome Mechanics Informs about Mechanism.

    Zimmermann, Michael T; Jia, Kejue; Jernigan, Robert L

    2016-02-27

    The essential aspects of the ribosome's mechanism can be extracted from coarse-grained simulations, including the ratchet motion, the movement together of critical bases at the decoding center, and movements of the peptide tunnel lining that assist in the expulsion of the synthesized peptide. Because of its large size, coarse graining helps to simplify and to aid in the understanding of its mechanism. Results presented here utilize coarse-grained elastic network modeling to extract the dynamics, and both RNAs and proteins are coarse grained. We review our previous results, showing the well-known ratchet motions and the motions in the peptide tunnel and in the mRNA tunnel. The motions of the lining of the peptide tunnel appear to assist in the expulsion of the growing peptide chain, and clamps at the ends of the mRNA tunnel with three proteins ensure that the mRNA is held tightly during decoding and essential for the helicase activity at the entrance. The entry clamp may also assist in base recognition to ensure proper selection of the incoming tRNA. The overall precision of the ribosome machine-like motions is remarkable. PMID:26687034

  15. Chaperone binding at the ribosomal exit tunnel

    Kristensen, Ole; Gajhede, Michael

    2003-01-01

    The exit tunnel region of the ribosome is well established as a focal point for interaction between the components that guide the fate of nascent polypeptides. One of these, the chaperone trigger factor (TF), associates with the 50S ribosomal subunit through its N-terminal domain. Targeting of TF...

  16. Biochemical characterization of three mycobacterial ribosomal fractions.

    Portelance, V; Beaudet, R

    1983-02-01

    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  17. Viral IRES RNA structures and ribosome interactions.

    Kieft, Jeffrey S

    2008-06-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  18. The antibiotic Furvina® targets the P-site of 30S ribosomal subunits and inhibits translation initiation displaying start codon bias

    Fabbretti, Attilio; Brandi, Letizia; Petrelli, Dezemona; Pon, Cynthia L.; Castañedo, Nilo R.; Medina, Ricardo; Gualerzi, Claudio O.

    2012-01-01

    Furvina®, also denominated G1 (MW 297), is a synthetic nitrovinylfuran [2-bromo-5-(2-bromo-2-nitrovinyl)-furan] antibiotic with a broad antimicrobial spectrum. An ointment (Dermofural®) containing G1 as the only active principle is currently marketed in Cuba and successfully used to treat dermatological infections. Here we describe the molecular target and mechanism of action of G1 in bacteria and demonstrate that in vivo G1 preferentially inhibits protein synthesis over RNA, DNA and cell wal...

  19. Over-represented localized sequence motifs in ribosomal protein gene promoters of basal metazoans.

    Perina, Drago; Korolija, Marina; Roller, Maša; Harcet, Matija; Jeličić, Branka; Mikoč, Andreja; Cetković, Helena

    2011-07-01

    Equimolecular presence of ribosomal proteins (RPs) in the cell is needed for ribosome assembly and is achieved by synchronized expression of ribosomal protein genes (RPGs) with promoters of similar strengths. Over-represented motifs of RPG promoter regions are identified as targets for specific transcription factors. Unlike RPs, those motifs are not conserved between mammals, drosophila, and yeast. We analyzed RPGs proximal promoter regions of three basal metazoans with sequenced genomes: sponge, cnidarian, and placozoan and found common features, such as 5'-terminal oligopyrimidine tracts and TATA-boxes. Furthermore, we identified over-represented motifs, some of which displayed the highest similarity to motifs abundant in human RPG promoters and not present in Drosophila or yeast. Our results indicate that humans over-represented motifs, as well as corresponding domains of transcription factors, were established very early in metazoan evolution. The fast evolving nature of RPGs regulatory network leads to formation of other, lineage specific, over-represented motifs. PMID:21457775

  20. First measurement of the 33Cl(p,α)30S reaction

    Deibel, C. M.; Rehm, K. E.; Figueira, J. M.; Greene, J. P.; Jiang, C. L.; Kay, B. P.; Lee, H. Y.; Lighthall, J. C.; Marley, S. T.; Pardo, R. C.; Patel, N.; Paul, M.; Ugalde, C.; Woodard, A.; Wuosmaa, A. H.; Zinkann, G.

    2011-10-01

    The 30S(α,p)33Cl reaction may have a significant impact on final elemental abundances and energy output of type I X-ray bursts, as well as influencing observables such as double-peaked luminosity profiles, because it could bypass the 30S waiting point. This reaction has been studied experimentally for the first time in inverse kinematics via the time-inverse reaction 1H(33Cl,30S)α with a 33Cl radioactive ion beam produced at the Argonne Tandem Linac Accelerator System facility by the “in-flight” technique. This reaction was studied at three different beam energies. The experimental method used and the resulting data are discussed.

  1. Viral IRES RNA structures and ribosome interactions

    Kieft, Jeffrey S.

    2008-01-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IR...

  2. The economics of ribosome biosynthesis in yeast.

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  3. Targeted proteomics reveals compositional dynamics of 60S pre-ribosomes after nuclear export.

    Altvater, Martin; Chang, Yiming; Melnik, Andre; Occhipinti, Laura; Schütz, Sabina; Rothenbusch, Ute; Picotti, Paola; Panse, Vikram Govind

    2012-01-01

    Construction and intracellular targeting of eukaryotic pre-ribosomal particles involve a multitude of diverse transiently associating trans-acting assembly factors, energy-consuming enzymes, and transport factors. The ability to rapidly and reliably measure co-enrichment of multiple factors with maturing pre-ribosomal particles presents a major biochemical bottleneck towards revealing their function and the precise contribution of >50 energy-consuming steps that drive ribosome assembly. Here, we devised a workflow that combines genetic trapping, affinity-capture, and selected reaction monitoring mass spectrometry (SRM-MS), to overcome this deficiency. We exploited this approach to interrogate the dynamic proteome of pre-60S particles after nuclear export. We uncovered assembly factors that travel with pre-60S particles to the cytoplasm, where they are released before initiating translation. Notably, we identified a novel shuttling factor that facilitates nuclear export of pre-60S particles. Capturing and quantitating protein interaction networks of trapped intermediates of macromolecular complexes by our workflow is a reliable discovery tool to unveil dynamic processes that contribute to their in vivo assembly and transport. PMID:23212245

  4. The circadian clock coordinates ribosome biogenesis.

    Céline Jouffe

    Full Text Available Biological rhythms play a fundamental role in the physiology and behavior of most living organisms. Rhythmic circadian expression of clock-controlled genes is orchestrated by a molecular clock that relies on interconnected negative feedback loops of transcription regulators. Here we show that the circadian clock exerts its function also through the regulation of mRNA translation. Namely, the circadian clock influences the temporal translation of a subset of mRNAs involved in ribosome biogenesis by controlling the transcription of translation initiation factors as well as the clock-dependent rhythmic activation of signaling pathways involved in their regulation. Moreover, the circadian oscillator directly regulates the transcription of ribosomal protein mRNAs and ribosomal RNAs. Thus the circadian clock exerts a major role in coordinating transcription and translation steps underlying ribosome biogenesis.

  5. The immunological properties of Brucella ribosomal preparations.

    Corbel, M J

    1976-01-01

    Ribosomes were isolated from Brucella abortus strains 19 and 45/20 by disruption of the cells followed by differential ultracentrifugation. The ribosome preparations contained 2-3 components reacting in immunodiffusion tests but were free of detectable lipopolysaccharide-protein agglutinogen. They crossreacted with antisera to Br. abortus, Br. melitensis, Br. suis and Br. ovis and elicited intradermal delayed hypersensitivity reactions in animals infected with Br. abortus, Br. melitensis or Br. suis. The ribosomes were antigenic in rabbits, guinea pigs and mice. Those from Br. abortus S19 induced agglutinins reaction with smooth brucella strains whereas those from Br. abortus 45/20 induced agglutinins reacting with rough brucella strains. Cattle vaccinated with S19 or 45/20 vaccines or infected with Br. abortus developed pricipitins to ribosomal components at an early stage in the immune response. PMID:816681

  6. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  7. RPG: the Ribosomal Protein Gene database

    Nakao, Akihiro; Yoshihama, Maki; Kenmochi, Naoya

    2004-01-01

    RPG (http://ribosome.miyazaki-med.ac.jp/) is a new database that provides detailed information about ribosomal protein (RP) genes. It contains data from humans and other organisms, including Drosophila melanogaster, Caenorhabditis elegans, Saccharo myces cerevisiae, Methanococcus jannaschii and Escherichia coli. Users can search the database by gene name and organism. Each record includes sequences (genomic, cDNA and amino acid sequences), intron/exon structures, genomic locations and informa...

  8. Ribosome biogenesis during skeletal muscle hypertrophy

    von Walden, Ferdinand

    2014-01-01

    Muscle adaptation to chronic resistance exercise (RE) is the result of a cumulative effect on gene expression and protein content. Following a bout of RE, muscle protein synthesis increases and, if followed by consecutive bouts (training), protein accretion and muscle hypertrophy develops. The protein synthetic capacity of the muscle is dictated by ribosome content. Therefore, the general aim of this thesis is to investigate the regulation of ribosome biogenesis during skeletal muscle hypertr...

  9. Studies on dissociation and reconstitution of nuclear 30-S ribonucleoprotein particles containing pre-mRNA.

    Kulguskin, V V; Krichevskaya, A A; Lukanidin, E M; Georgiev, G P

    1980-10-17

    Treatment of nuclear 30-S ribonucleoprotein (RNP) particles containing pre-mRNA (precursor of mRNA) with 2 M NaCl leads to dissociation of RNA and protein. The protein component is present either as an aggregate with a sedimentation coefficient close to 30 S (a free informofer) or as a slowly sedimenting material (monomers or oligomers of informatin). Most of the informofers and slowly sedimenting material are in the equilibrium state. Iodination or aging of the 30-S particles stabilizes informofers. Lowering of NaCl concentration in the mixture of RNA with informofers or informatin subunits leads to reconstitution of RNP particles. In both cases, the particles formed have a sedimentation coefficient of about 30 S and a buoyant density equal to 1.4-1.41 g/cm3 but their response to pancreatic RNAase (EC 3.1.27.5) and high salt treatment is very different. Both the particles reconstituted from RNA and informofers and the original particles are very sensitive to pancreatic RNAase and after high salt treatment free informofers are formed. In contrast, the RNA of the particles reconstituted from slowly sedimenting material is much more protected against pancreatic RNAase action. These particles are also rather stable to high salt treatment. Thus, only if a protein in the form of an informofer aggregate is used, faithful reconstitution takes place. The data obtained are discussed in terms of the structure of the nuclear ribonucleoprotein particles containing precursor of messenger RNA. PMID:7437433

  10. Visualization Software for Molecular Assemblies

    Goddard, Thomas D; Ferrin, Thomas E.

    2007-01-01

    Software for viewing three-dimensional models and maps of viruses, ribosomes, filaments and other molecular assemblies is advancing on many fronts. New developments include molecular representations that offer better control over level of detail, lighting that improves the perception of depth, and two-dimensional projections that simplify data interpretation. Programmable graphics processors offer quality, speed and visual effects not previously possible, while 3D printers, haptic interaction...

  11. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen (1H) for deuterium (2H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.)

  12. Structural and Functional Studies of Ribosome-inactivating Proteins and Ribosomal RNA

    LIU Wangyi; ZHANG Jinsong; LIU Renshui; HE Wenjun; LING Jun

    2007-01-01

    @@ A plant's ribosome-inactivating proteins (RIPs) are a group of toxic proteins. Theoretically, they can be employed as a tool enzyme in the exploration of the structure and function of the ribosomal RNA; in practical application, they can be used as an insecticide in agriculture, for preparation of immuno-toxic protein to kill cancer cells or against viral infection in medicine.

  13. Proton scattering from unstable nuclei 20O, 30S, 34Ar: experimental study and models

    Elastic and inelastic proton scattering from the unstable nuclei 20O, 30S and 34Ar were measured in inverse kinematics at the Grand Accelerateur National d'Ions Lourds. Secondary beams of 20O at 43 MeV/A, 30S at 53 MeV/A and 34Ar at 47 MeV/A impinged on a (CH2)n target. Recoiling protons were detected in the silicon strip array MUST. Energies and angular distributions of the first 2+ and 3- states were measured. A phenomenological analysis yields values of the deformation parameters β2 and β3 of 0.55 (6) and 0.35 (5) for 20O, 0.32 (3) and 0.22 (4) for 30S, 0.27 (2) and 0.39 (3) for 34Ar, respectively, and allows the extraction of the ratio of neutron to proton transition matrix elements (Mn/Mp)/(N/Z) for 2+ states: 2.35 (37) for 20O, 0.93 (20) for 30S and 1.35 (28) for 34Ar. Therefore the proton rich nuclei 30S and 34Ar show a 2+ excitation of isoscalar character whereas the excitation of 20O is of isovector character. In order to perform a microscopic analysis of the data, we have developed a QRPA model, using three Skyrme interaction: SIII, SG2, SLy4. This model reproduces measured B(EL) values for the oxygen, sulfur and argon isotopic chains, whereas RPA calculations, which do not take pairing into account, underestimate these values. In the case of the QRPA model the energies of the first 2+ state are overestimated by about 1 MeV, but the evolution along the isotopic chains is well reproduced. (Mn/Mp)/(N/Z) ratios for the first 2+ state deduced from the microscopic analysis using QRPA are 1.98 for 20O, 1.05 for 30S and 1.00 for 34Ar, in agreement with the conclusions of the phenomenological analysis. However important discrepancies are observed between the two types of analysis for other isotopes, in particular neutron rich argon and sulfur nuclei. (author)

  14. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  15. Age and fertility: Can we wait until the early 30s?

    McDonald, John W; Rosina, Alessandro; Rizzi, Ester; Colombo, Bernardo

    2005-01-01

    Delaying the start of childbearing raises the issue of fertility postponed versus fertility foregone. One of the limits of previous studies of ``How late can you wait?'' is the difficulty of controlling for sexual activity. Data on the frequency and timing of intercourse within a menstrual cycle are uncommon. We use such data from the Menstrual Cycle Fecundability Study to study ``Can we wait until the early 30s?''. We model the effect of age on conditional fecund...

  16. A residue substitution in the plastid ribosomal protein L12/AL1 produces defective plastid ribosome and causes early seedling lethality in rice.

    Zhao, Dong-Sheng; Zhang, Chang-Quan; Li, Qian-Feng; Yang, Qing-Qing; Gu, Ming-Hong; Liu, Qiao-Quan

    2016-05-01

    The plastid ribosome is essential for chloroplast biogenesis as well as seedling formation. As the plastid ribosome closely resembles the prokaryotic 70S ribosome, many plastid ribosomal proteins (PRPs) have been identified in higher plants. However, their assembly in the chloroplast ribosome in rice remains unclear. In the present study, we identified a novel rice mutant, albino lethal 1 (al1), from a chromosome segment substitution line population. The al1 mutant displayed an albino phenotype at the seedling stage and did not survive past the three-leaf stage. No other apparent differences in plant morphology were observed in the al1 mutant. The albino phenotype of the al1 mutant was associated with decreased chlorophyll content and abnormal chloroplast morphology. Using fine mapping, AL1 was shown to encode the PRPL12, a protein localized in the chloroplasts of rice, and a spontaneous single-nucleotide mutation (C/T), resulting in a residue substitution from leucine in AL1 to phenylalanine in al1, was found to be responsible for the early seedling lethality. This point mutation is located at the L10 interface feature of the L12/AL1 protein. Yeast two-hybrid analysis showed that there was no physical interaction between al1 and PRPL10. In addition, the mutation had little effect on the transcript abundance of al1, but had a remarkable effect on the protein abundance of al1 and transcript abundance of chloroplast biogenesis-related and photosynthesis-related genes. These results provide a first glimpse into the molecular details of L12's function in rice. PMID:26873698

  17. Localisation of the ribosomal proteins L2, L14 and L24 of the E. coli ribosome by means of nuclear spin contrast variation

    Ribosomes are ribonucleo-protein complexes, which are the site of the protein synthesis, one of the most important steps during the translation of the genetic code from the DNA to the proteins. The proteins L2, L14 and L24 in the 50S subunit and the protein L2 in the 70S ribosome of the E. coli bacterium were localised by means of nuclear spin contrast variation. The contrast created by isotopic substitution is increased by almost a factor of three provided that polarised neutrons are scattered by polarised hydrogen spins of the sample. To get additional information about the in situ structure of the proteins the shapes were described by a two or three sphere model. Within the project of mapping the 50S subunit of the E. coli ribosome the protein L24 is localised for the first time. L24 is one of the initiator protein for the assembly of the 50S subunit therefore the knowledge of the position is of great interest for the understanding of this process. With the localisation of the protein L14, which is one of the most conserved protein in the ribosome, new hints are given in respect of the protein function which was until now unknown. The localisation of the protein L2, which is one of the candidates of the area of the central step in protein synthesis was done both in the 50S subunit and in the whole 70S ribosome. This allows to investigate conformational changes during the association of the subunits. (orig.)

  18. Structure of a mitochondrial ribosome with minimal RNA

    Sharma, Manjuli R.; Booth, Timothy M.; Simpson, Larry; Maslov, Dmitri A.; Agrawal, Rajendra K.

    2009-01-01

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show th...

  19. Ribosome-dependent activation of stringent control.

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V

    2016-06-01

    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  20. Nucleolar dominance and ribosomal RNA gene silencing

    Tucker, Sarah; Vitins, Alexa; Pikaard, Craig S.

    2010-01-01

    Nucleolar dominance is an epigenetic phenomenon that occurs in genetic hybrids and describes the expression of 45S rRNA genes inherited from one progenitor due to the silencing of the other progenitor’s rRNA genes. Nucleolar dominance is a manifestation of rRNA gene dosage control, which also occurs in non-hybrids, regulating the number of active rRNA genes according to the cellular demand for ribosomes and protein synthesis. Ribosomal RNA gene silencing involves changes in DNA methylation an...

  1. Control of Ribosome Synthesis in Escherichia coli

    Molin, Søren; Meyenburg, K. von; Måløe, O.;

    1977-01-01

    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha}-methylgluc......The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...

  2. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  3. 30S Subunit-Dependent Activation of the Sorangium cellulosum So ce56 Aminoglycoside Resistance-Conferring 16S rRNA Methyltransferase Kmr

    Savic, Miloje; Sunita, S.; Zelinskaya, Natalia; Desai, Pooja M.; Macmaster, Rachel; Vinal, Kellie

    2015-01-01

    Methylation of bacterial 16S rRNA within the ribosomal decoding center confers exceptionally high resistance to aminoglycoside antibiotics. This resistance mechanism is exploited by aminoglycoside producers for self-protection while functionally equivalent methyltransferases have been acquired by human and animal pathogenic bacteria. Here, we report structural and functional analyses of the Sorangium cellulosum So ce56 aminoglycoside resistance-conferring methyltransferase Kmr. Our results demonstrate that Kmr is a 16S rRNA methyltransferase acting at residue A1408 to confer a canonical aminoglycoside resistance spectrum in Escherichia coli. Kmr possesses a class I methyltransferase core fold but with dramatic differences in the regions which augment this structure to confer substrate specificity in functionally related enzymes. Most strikingly, the region linking core β-strands 6 and 7, which forms part of the S-adenosyl-l-methionine (SAM) binding pocket and contributes to base flipping by the m1A1408 methyltransferase NpmA, is disordered in Kmr, correlating with an exceptionally weak affinity for SAM. Kmr is unexpectedly insensitive to substitutions of residues critical for activity of other 16S rRNA (A1408) methyltransferases and also to the effects of by-product inhibition by S-adenosylhomocysteine (SAH). Collectively, our results indicate that adoption of a catalytically competent Kmr conformation and binding of the obligatory cosubstrate SAM must be induced by interaction with the 30S subunit substrate. PMID:25733511

  4. Ribosomal Protein P2 from apicomplexan parasite Toxoplasma gondii is intrinsically a molten globule.

    Mishra, Pushpa; Choudhary, Sinjan; Hosur, Ramakrishna V

    2015-01-01

    Toxoplasma gondii is an apicomplexan parasite, which causes toxoplasmosis. Toxoplasma P2 (TgP2) is a ribosomal protein and exists as supramolecular assembly with other proteins in the ribosome. It is also shown that TgP2 is involved in some extra ribosomal functions. However, till date the protein has evaded structural characterization by any of the known techniques. In this background, we report here a systematic study using a variety of biophysical techniques and NMR, under different conditions of pH and temperature, and deduce that TgP2 consists of only helices and unstructured regions, is a monomer at low pH but forms multimers at higher pH, and has intrinsically a molten globule structure. The C-terminal half is flexible and the helices are concentrated in the N-terminal half of the chain. The dynamism inherent to the molten globule structure may have functional implications for its extra-ribosomal functions. which is contrast to that of human P2. PMID:25866913

  5. Structures of two distinct conformations of holo-non-ribosomal peptide synthetases.

    Drake, Eric J; Miller, Bradley R; Shi, Ce; Tarrasch, Jeffrey T; Sundlov, Jesse A; Allen, C Leigh; Skiniotis, Georgios; Aldrich, Courtney C; Gulick, Andrew M

    2016-01-14

    Many important natural products are produced by multidomain non-ribosomal peptide synthetases (NRPSs). During synthesis, intermediates are covalently bound to integrated carrier domains and transported to neighbouring catalytic domains in an assembly line fashion. Understanding the structural basis for catalysis with non-ribosomal peptide synthetases will facilitate bioengineering to create novel products. Here we describe the structures of two different holo-non-ribosomal peptide synthetase modules, each revealing a distinct step in the catalytic cycle. One structure depicts the carrier domain cofactor bound to the peptide bond-forming condensation domain, whereas a second structure captures the installation of the amino acid onto the cofactor within the adenylation domain. These structures demonstrate that a conformational change within the adenylation domain guides transfer of intermediates between domains. Furthermore, one structure shows that the condensation and adenylation domains simultaneously adopt their catalytic conformations, increasing the overall efficiency in a revised structural cycle. These structures and the single-particle electron microscopy analysis demonstrate a highly dynamic domain architecture and provide the foundation for understanding the structural mechanisms that could enable engineering of novel non-ribosomal peptide synthetases. PMID:26762461

  6. Molecular paleontology: a biochemical model of the ancestral ribosome

    Hsiao, Chiaolong; Lenz, Timothy K.; Peters, Jessica K; Fang, Po-Yu; Schneider, Dana M.; Anderson, Eric J.; Preeprem, Thanawadee; Bowman, Jessica C.; O'Neill, Eric B.; Lie, Lively; Athavale, Shreyas S.; Gossett, J. Jared; Trippe, Catherine; Murray, Jason; Anton S. Petrov

    2013-01-01

    Ancient components of the ribosome, inferred from a consensus of previous work, were constructed in silico, in vitro and in vivo. The resulting model of the ancestral ribosome presented here incorporates ∼20% of the extant 23S rRNA and fragments of five ribosomal proteins. We test hypotheses that ancestral rRNA can: (i) assume canonical 23S rRNA-like secondary structure, (ii) assume canonical tertiary structure and (iii) form native complexes with ribosomal protein fragments. Footprinting exp...

  7. Control of Ribosome Synthesis in Escherichia coli

    Molin, Søren; Meyenburg, K. von; Måløe, O.; Trier Hansen, M.; Pato, M. L.

    1977-01-01

    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...

  8. Ribosome evolution: Emergence of peptide synthesis machinery

    Koji Tamura

    2011-12-01

    Proteins, the main players in current biological systems, are produced on ribosomes by sequential amide bond (peptide bond) formations between amino-acid-bearing tRNAs. The ribosome is an exquisite super-complex of RNA-proteins, containing more than 50 proteins and at least 3 kinds of RNAs. The combination of a variety of side chains of amino acids (typically 20 kinds with some exceptions) confers proteins with extraordinary structure and functions. The origin of peptide bond formation and the ribosome is crucial to the understanding of life itself. In this article, a possible evolutionary pathway to peptide bond formation machinery (proto-ribosome) will be discussed, with a special focus on the RNA minihelix (primordial form of modern tRNA) as a starting molecule. Combining the present data with recent experimental data, we can infer that the peptidyl transferase center (PTC) evolved from a primitive system in the RNA world comprising tRNA-like molecules formed by duplication of minihelix-like small RNA.

  9. The Structure of Aquifex aeolicus Ribosomal Protein S8 Reveals a Unique Subdomain That Contributes to Extremely-Tight Association With 16S rRNA

    Menichelli, Elena; Edgcomb, Stephen P.; Recht, Michael I.; Williamson, James R.

    2011-01-01

    The assembly of ribonucleoprotein complexes occurs in a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from the hyperthemophilic bacterium Aquifex aeolicus (AS8) is unique in that there is a 41 residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually-high affinity for the 16S ribosomal RNA (rRNA), characterized by a picomolar dissociation constant that is a...

  10. 2.8-Å Cryo-EM Structure of the Large Ribosomal Subunit from the Eukaryotic Parasite Leishmania.

    Shalev-Benami, Moran; Zhang, Yan; Matzov, Donna; Halfon, Yehuda; Zackay, Arie; Rozenberg, Haim; Zimmerman, Ella; Bashan, Anat; Jaffe, Charles L; Yonath, Ada; Skiniotis, Georgios

    2016-07-12

    Leishmania is a single-cell eukaryotic parasite of the Trypanosomatidae family, whose members cause an array of tropical diseases. The often fatal outcome of infections, lack of effective vaccines, limited selection of therapeutic drugs, and emerging resistant strains, underline the need to develop strategies to combat these pathogens. The Trypanosomatid ribosome has recently been highlighted as a promising therapeutic target due to structural features that are distinct from other eukaryotes. Here, we present the 2.8-Å resolution structure of the Leishmania donovani large ribosomal subunit (LSU) derived from a cryo-EM map, further enabling the structural observation of eukaryotic rRNA modifications that play a significant role in ribosome assembly and function. The structure illustrates the unique fragmented nature of leishmanial LSU rRNA and highlights the irregular distribution of rRNA modifications in Leishmania, a characteristic with implications for anti-parasitic drug development. PMID:27373148

  11. Association of a multi-synthetase complex with translating ribosomes in the archaeon Thermococcus kodakarensis

    Raina, Medha; Elgamal, Sara; Santangelo, Thomas J; Ibba, Michael

    2012-01-01

    In archaea and eukaryotes aminoacyl-tRNA synthetases (aaRSs) associate in multi-synthetase complexes (MSCs), however the role of such MSCs in translation is unknown. MSC function was investigated in vivo in the archaeon Thermococcus kodakarensis, wherein six aaRSs were affinity co-purified together...... with several other factors involved in protein synthesis, suggesting that MSCs may interact directly with translating ribosomes. In support of this hypothesis, the aminoacyl-tRNA synthetase (aaRS) activities of the MSC were enriched in isolated T. kodakarensis polysome fractions. These data indicate...... that components of the archaeal protein synthesis machinery associate into macromolecular assemblies in vivo and provide the potential to increase translation efficiency by limiting substrate diffusion away from the ribosome, thus facilitating rapid recycling of tRNAs. STRUCTURED SUMMARY OF PROTEIN...

  12. GTPases and the origin of the ribosome

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  13. The Functional Role of eL19 and eB12 Intersubunit Bridge in the Eukaryotic Ribosome.

    Kisly, Ivan; Gulay, Suna P; Mäeorg, Uno; Dinman, Jonathan D; Remme, Jaanus; Tamm, Tiina

    2016-05-22

    During translation, the two eukaryotic ribosomal subunits remain associated through 17 intersubunit bridges, five of which are eukaryote specific. These are mainly localized to the peripheral regions and are believed to stabilize the structure of the ribosome. The functional importance of these bridges remains largely unknown. Here, the essentiality of the eukaryote-specific bridge eB12 has been investigated. The main component of this bridge is ribosomal protein eL19 that is composed of an N-terminal globular domain, a middle region, and a long C-terminal α-helix. The analysis of deletion mutants demonstrated that the globular domain and middle region of eL19 are essential for cell viability, most likely functioning in ribosome assembly. The eB12 bridge, formed by contacts between the C-terminal α-helix of eL19 and 18S rRNA in concert with additional stabilizing interactions involving either eS7 or uS17, is dispensable for viability. Nevertheless, eL19 mutants impaired in eB12 bridge formation displayed slow growth phenotypes, altered sensitivity/resistance to translational inhibitors, and enhanced hyperosmotic stress tolerance. Biochemical analyses determined that the eB12 bridge contributes to the stability of ribosome subunit interactions in vitro. 60S subunits containing eL19 variants defective in eB12 bridge formation failed to form 80S ribosomes regardless of Mg(2+) concentration. The reassociation of 40S and mutant 60S subunits was markedly improved in the presence of deacetylated tRNA, emphasizing the importance of tRNAs during the subunit association. We propose that the eB12 bridge plays an important role in subunit joining and in optimizing ribosome functionality. PMID:27038511

  14. Disassembly of yeast 80S ribosomes into subunits is a concerted action of ribosome-assisted folding of denatured protein.

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-22

    It has been shown by several groups that ribosome can assist folding of denatured protein in vitro and the process is conserved across the species. Domain V of large ribosomal rRNA which occupies the intersubunit side of the large subunit was identified as the key player responsible for chaperoning the folding process. Thus, it is conceivable that denatured protein needs to access the intersubunit space of the ribosome in order to get folded. In this study, we have investigated the mechanism of release of the protein from the eukaryotic ribosome following reactivation. We have observed significant splitting of yeast 80S ribosome when incubated with the denatured BCAII protein. Energy-free disassembly mechanism functions in low Mg(+2) ion concentration for prokaryotic ribosomes. Eukaryotic ribosomes do not show significant splitting even at low Mg(+2) ion concentration. In this respect, denatured protein-induced disassembly of eukaryotic ribosome without the involvement of any external energy source is intriguing. For prokaryotic ribosomes, it was reported that the denatured protein induces ribosome splitting into subunits in order to access domain V-rRNA. In contrast, our results suggest an alternative mechanism for eukaryotic ribosomal rRNA-mediated protein folding and subsequent separation of the subunits by which release of the activated-protein occurs. PMID:26723252

  15. Neurodegeneration-associated instability of ribosomal DNA

    Hallgren, Justin; Pietrzak, Maciej; Rempala, Grzegorz; Nelson, Peter T.; Hetman, Michal

    2014-01-01

    Homologous recombination (HR)-mediated instability of the repetitively organized ribosomal DNA (rDNA) has been proposed as a mediator of cell senescence in yeast triggering the DNA damage response. High individual variability in the content of human rDNA suggests that this genomic region remained relatively unstable throughout evolution. Therefore, quantitative real time PCR was used to determine the genomic content of rDNA in post mortem samples of parietal cortex from 14 young- and 9 elderl...

  16. Ribosome Inactivating Proteins from Plants Inhibiting Viruses

    Inderdeep Kaur; R C Gupta; Munish Puri

    2011-01-01

    Many plants contain ribosome inactivating proteins (RIPs) with N-glycosidase activity,which depurinate large ribosomal RNA and arrest protein synthesis.RIPs so far tested inhibit replication of mRNA as well as DNA viruses and these proteins,isolated from plants,are found to be effective against a broad range of viruses such as human immunodeficiency virus (HIV),hepatitis B virus (HBV) and herpes simplex virus (HSV).Most of the research work related to RIPs has been focused on antiviral activity against HIV; however,the exact mechanism of antiviral activity is still not clear.The mechanism of antiviral activity was thought to follow inactivation of the host cell ribosome,leading to inhibition of viral protein translation and host cell death.Enzymatic activity of RIPs is not hmited to depurination of the large rRNA,in addition they can depurinate viral DNA as well as RNA.Recently,Phase Ⅰ/Ⅱ clinical trials have demonstrated the potential use of RIPs for treating patients with HIV disease.The aim of this review is to focus on various RIPs from plants associated with anti-HIV activity.

  17. Structure of a mitochondrial ribosome with minimal RNA.

    Sharma, Manjuli R; Booth, Timothy M; Simpson, Larry; Maslov, Dmitri A; Agrawal, Rajendra K

    2009-06-16

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show that (i) the overall structure of the Lmr is considerably more porous, (ii) the topology of the intersubunit space is significantly different, with fewer intersubunit bridges, but more tunnels, and (iii) several of the functionally-important rRNA regions, including the alpha-sarcin-ricin loop, have different relative positions within the structure. Furthermore, the major portions of the mRNA channel, the tRNA passage, and the nascent polypeptide exit tunnel contain Lmr-specific proteins, suggesting that the mechanisms for mRNA recruitment, tRNA interaction, and exiting of the nascent polypeptide in Lmr must differ markedly from the mechanisms deduced for ribosomes in other organisms. Our study identifies certain structural features that are characteristic solely of mitochondrial ribosomes and other features that are characteristic of both mitochondrial and chloroplast ribosomes (i.e., organellar ribosomes). PMID:19497863

  18. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress.

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L J

    2016-01-01

    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucleolar morphology. Remarkably, we find that uL5 (formerly RPL11) and uL18 (RPL5) are the strongest contributors to nucleolar integrity. Together with the 5S rRNA, they form the late-assembling central protuberance on mature 60S subunits, and act as an Hdm2 trap and p53 stabilizer. Other major contributors to p53 homeostasis are also strictly late-assembling large subunit r-proteins essential to nucleolar structure. The identification of the r-proteins that specifically contribute to maintaining nucleolar structure and p53 steady-state level provides insights into fundamental aspects of cell and cancer biology. PMID:27265389

  19. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L. J.

    2016-01-01

    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucleolar morphology. Remarkably, we find that uL5 (formerly RPL11) and uL18 (RPL5) are the strongest contributors to nucleolar integrity. Together with the 5S rRNA, they form the late-assembling central protuberance on mature 60S subunits, and act as an Hdm2 trap and p53 stabilizer. Other major contributors to p53 homeostasis are also strictly late-assembling large subunit r-proteins essential to nucleolar structure. The identification of the r-proteins that specifically contribute to maintaining nucleolar structure and p53 steady-state level provides insights into fundamental aspects of cell and cancer biology. PMID:27265389

  20. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs

  1. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    Nichols, C. E. [Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom); Johnson, C.; Lamb, H. K. [Institute of Cell and Molecular Biosciences, Catherine Cookson Building, Medical School, Framlington Place, Newcastle University, Newcastle-upon-Tyne NE2 4HH (United Kingdom); Lockyer, M. [Arrow Therapeutics Ltd, Britannia House, Trinity Street, Borough, London SE1 1DA (United Kingdom); Charles, I. G. [The Wolfson Institute for Biomedical Research, The Cruciform Building, University College London, Gower Street, London WC1E 6BT (United Kingdom); Hawkins, A. R. [Institute of Cell and Molecular Biosciences, Catherine Cookson Building, Medical School, Framlington Place, Newcastle University, Newcastle-upon-Tyne NE2 4HH (United Kingdom); Stammers, D. K., E-mail: daves@strubi.ox.ac.uk [Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom)

    2007-11-01

    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs.

  2. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  3. Molecular Profiling of Activated Neurons by Phosphorylated Ribosome Capture

    Knight, Zachary A.; Tan, Keith; Birsoy, Kivanc; Schmidt, Sarah; Garrison, Jennifer L.; Wysocki, Robert W.; Emiliano, Ana; Ekstrand, Mats I.; Friedman, Jeffrey M.

    2012-01-01

    The mammalian brain is composed of thousands of interacting neural cell types. Systematic approaches to establish the molecular identity of functional populations of neurons would advance our understanding of neural mechanisms controlling behavior. Here, we show that ribosomal protein S6, a structural component of the ribosome, becomes phosphorylated in neurons activated by a wide range of stimuli. We show that these phosphorylated ribosomes can be captured from mouse brain homogenates, there...

  4. Structural and functional topography of the human ribosome

    Dmitri Graifer; Galina Karpova

    2012-01-01

    This review covers data on the structural organization of functional sites in the human ribosome,namely,the messenger RNA binding center,the binding site of the hepatitis C virus RNA internal ribosome entry site,and the peptidyl transferase center.The data summarized here have been obtained primarily by means of a site-directed crosslinking approach with application of the analogs of the respective ribosomal ligands bearing cross-linkers at the designed positions.These data are discussed taking into consideration available structural data on ribosomes from various kingdoms obtained with the use of cryo-electron microscopy,X-ray crystallography,and other approaches.

  5. The architecture of mammalian ribosomal protein promoters

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  6. Ribosome-Inactivating and Related Proteins

    Joachim Schrot; Alexander Weng; Matthias F. Melzig

    2015-01-01

    Ribosome-inactivating proteins (RIPs) are toxins that act as N-glycosidases (EC 3.2.2.22). They are mainly produced by plants and classified as type 1 RIPs and type 2 RIPs. There are also RIPs and RIP related proteins that cannot be grouped into the classical type 1 and type 2 RIPs because of their different sizes, structures or functions. In addition, there is still not a uniform nomenclature or classification existing for RIPs. In this review, we give the current status of all known plant ...

  7. Molecular dynamics simulation of ribosome jam

    Matsumoto, Shigenori

    2011-09-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.

  8. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  9. Single-step rapid assembly of DNA origami nanostructures for addressable nanoscale bioreactors

    Fu, Yanming; Zeng, Dongdong; Chao, Jie;

    2013-01-01

    (within only 10-20 min), exhibiting extraordinarily high cooperativity that is often observed in assembly of natural molecular machines in cells (e.g. ribosome). By exploiting the high specificity of DNA-based self-assembly, we can precisely anchor proteins on these DNA origami nanostructures with sub-10...

  10. The effect of trichloroethylene and acrylonitrile on RNA and ribosome synthesis and ribosome content in Saccharomyces cells.

    Lochmann, E R; Ehrlich, W; Mangir, M

    1984-04-01

    The effects of trichloroethylene (TCE) and acrylonitrile (ACN) on growth, RNA synthesis, ribosome synthesis, and ribosome content were tested in yeast cells. TCE causes a delay of the growth of a cell culture (prolongation of the lag phase), but does not cause inhibition. Cells exposed to increasing concentrations of ACN show increasing damage, so that, at a certain point of the growth curve, cell division stops altogether. Similar results were obtained when RNA synthesis was investigated: After treatment with TCE, the maximum RNA synthesis of the cell culture was retarded, but subsequently reached the same level as the untreated control cells. In the presence of ACN, however, the rate of RNA synthesis was lowered with increasing ACN concentrations. The same effect was observed upon investigation of ribosome synthesis: Whereas TCE produces only a slight effect, treatment with increasing concentrations of ACN leads to a substantial decrease in ribosome synthesis, and finally to total inhibition. Parallel to this, the content of free and membrane-bound ribosomes is diminished. Obviously, the decrease in ribosome content is caused not only by an inhibition of ribosome synthesis, but also by a degradation of existing ribosomes, as well as by induction of a ribosome-associated RNase. PMID:6714140

  11. Sequence assembly

    Scheibye-Alsing, Karsten; Hoffmann, S.; Frankel, Annett Maria;

    2009-01-01

    Despite the rapidly increasing number of sequenced and re-sequenced genomes, many issues regarding the computational assembly of large-scale sequencing data have remain unresolved. Computational assembly is crucial in large genome projects as well for the evolving high-throughput technologies and...... plays an important role in processing the information generated by these methods. Here, we provide a comprehensive overview of the current publicly available sequence assembly programs. We describe the basic principles of computational assembly along with the main concerns, such as repetitive sequences...... in genomic DNA, highly expressed genes and alternative transcripts in EST sequences. We summarize existing comparisons of different assemblers and provide a detailed descriptions and directions for download of assembly programs at: http://genome.ku.dk/resources/assembly/methods.html....

  12. Proteopedia Entry: The Large Ribosomal Subunit of "Haloarcula Marismortui"

    Decatur, Wayne A.

    2010-01-01

    This article presents a "Proteopedia" page that shows the refined version of the structure of the "Haloarcula" large ribosomal subunit as solved by the laboratories of Thomas Steitz and Peter Moore. The landmark structure is of great impact as it is the first atomic-resolution structure of the highly conserved ribosomal subunit which harbors…

  13. Regulating the Ribosome: A Spotlight on RNA Dark Matter

    Lintner, Nathanael G.; Cate, Jamie H. D.

    2014-01-01

    In this issue Pircher et al.(2014) show that an abundant ribosome-associated 18-nt noncoding RNA (ncRNA),derived from the open reading frame of an mRNA,acts directly on the ribosome and regulates global translation levels in response to hypertonic shock.

  14. The aminoglycoside resistance methyltransferase Sgm impedes RsmF methylation at an adjacent rRNA nucleotide in the ribosomal A site

    Cubrilo, Sonja; Babić, Fedora; Douthwaite, Stephen;

    2009-01-01

    methylated nucleotides including m(4)Cm1402 and m(5)C1407. Modification at m(5)C1407 by the methyltransferase RsmF is impeded as Sgm gains access to its adjacent G1405 target on the 30S ribosomal subunit. An Sgm mutant (G135A), which is impaired in S-adenosylmethionine binding and confers lower resistance......Ribosome-targeting antibiotics block protein synthesis by binding at functionally important regions of the bacterial rRNA. Resistance is often conferred by addition of a methyl group at the antibiotic binding site within an rRNA region that is already highly modified with several nucleotide...... methylations. In bacterial rRNA, each methylation requires its own specific methyltransferase enzyme, and this raises the question as to how an extra methyltransferase conferring antibiotic resistance can be accommodated and how it can gain access to its nucleotide target within a short and functionally...

  15. PPARA intron polymorphism associated with power performance in 30-s anaerobic Wingate Test.

    Miroslav Petr

    Full Text Available To date, polymorphisms in several genes have been associated with a strength/power performance including alpha 3 actinin, ciliary neurotrophic factor, vitamin D receptor, or angiotensin I converting enzyme, underlining the importance of genetic component of the multifactorial strength/power-related phenotypes. The single nucleotide variation in peroxisome proliferator-activated receptor alpha gene (PPARA intron 7 G/C (rs4253778; g.46630634G>C has been repeatedly found to play a significant role in response to different types of physical activity. We investigated the effect of PPARA intron 7 G/C polymorphism specifically on anaerobic power output in a group of 77 elite male Czech ice hockey players (18-36 y. We determined the relative peak power per body weight (Pmax.kg(-1 and relative peak power per fat free mass (W.kg(-1FFM during the 30-second Wingate Test (WT30 on bicycle ergometer (Monark 894E Peak bike, MONARK, Sweden. All WT30s were performed during the hockey season. Overall genotype frequencies were 50.6% GG homozygotes, 40.3% CG heterozygotes, and 9.1% CC homozygotes. We found statistically significant differences in Pmax.kg(-1 and marginally significant differences in Pmax.kg(-1FFM values in WT30 between carriers and non-carriers for C allele (14.6 ± 0.2 vs. 13.9 ± 0.3 W.kg(-1 and 15.8 ± 0.2 vs. 15.2 ± 0.3 W.kg(-1FFM, P = 0.036 and 0.12, respectively. Furthermore, Pmax.kg(-1FFM strongly positively correlated with the body weight only in individuals with GG genotypes (R = 0.55; p<0.001. Our results indicate that PPARA 7C carriers exhibited higher speed strength measures in WT30. We hypothesize that C allele carriers within the cohort of trained individuals may possess a metabolic advantage towards anaerobic metabolism.

  16. Selection of scFvs specific for the HepG2 cell line using ribosome display

    Lei Zhou; Wei-Ping Mao; Juan Fen; Hong-Yun Liu; Chuan-Jing Wei; Wen-Xiu Li; Feng-Yun Zhou

    2009-06-01

    The aim of this study was to construct a ribosome display library of single chain variable fragments (scFvs) associated with hepatocarcinoma and screen such a library for hepatocarcinoma-binding scFvs. mRNA was isolated from the spleens of mice immunized with hepatocellular carcinoma cell line HepG2. Heavy and k chain genes (VH and k) were amplified separately by RT-PCR, and an anti-HepG2 VH/k chain ribosome display library was constructed by assembling VH and k into the VH/k chain with a specially constructed linker by SOE-PCR. The VH/k chain library was transcribed and translated in vitro using a rabbit reticulocyte lysate system. In order to isolate specific scFvs, recognizing HepG2 negative selection on a normal hepatocyte line WRL-68 was carried out before three rounds of positive selection on HepG2. After three rounds of panning, cell enzyme-linked immunosorbent assay (ELISA) showed that one of the scFvs had high affinity for the HepG2 cell and lower affinity for the WRL-68 cell. In this study, we successfully constructed a native ribosome display library. Such a library would prove useful for direct intact cell panning using ribosome display technology. The selected scFv had a potential value for hepatocarcinoma treatment.

  17. Translation with frameshifting of ribosome along mRNA transcript

    Li, Jingwei

    2015-01-01

    Translation is an important process for prokaryotic and eukaryotic cells to produce necessary proteins for cell growth. Numerious experiments have been performed to explore the translational properties. Diverse models have also been developed to determine the biochemical mechanism of translation. However, to simplify the majority of the existing models, the frameshifting of ribosome along the mRNA transcript is neglected, which actually occurs in real cells and has been extensively experimentally studied. The frameshifting of ribosome evidently influences the efficiency and speed of translation, considering that the peptide chains synthesized by shifted ribosomes will not fold into functional proteins and will degrade rapidly. In this study, a theoretical model is presented to describe the translational process based on the model for totally asymmetric simple exclusion process. In this model, the frameshifting of the ribosome along the mRNA transcript and the attachment/detachment of the ribosome to/from the ...

  18. Regulation of ribosome biogenesis in maize embryonic axes during germination.

    Villa-Hernández, J M; Dinkova, T D; Aguilar-Caballero, R; Rivera-Cabrera, F; Sánchez de Jiménez, E; Pérez-Flores, L J

    2013-10-01

    Ribosome biogenesis is a pre-requisite for cell growth and proliferation; it is however, a highly regulated process that consumes a great quantity of energy. It requires the coordinated production of rRNA, ribosomal proteins and non-ribosomal factors which participate in the processing and mobilization of the new ribosomes. Ribosome biogenesis has been studied in yeast and animals; however, there is little information about this process in plants. The objective of the present work was to study ribosome biogenesis in maize seeds during germination, a stage characterized for its fast growth, and the effect of insulin in this process. Insulin has been reported to accelerate germination and to induce seedling growth. It was observed that among the first events reactivated just after 3 h of imbibition are the rDNA transcription and the pre-rRNA processing and that insulin stimulates both of them (40-230%). The transcript of nucleolin, a protein which regulates rDNA transcription and pre-rRNA processing, is among the messages stored in quiescent dry seeds and it is mobilized into the polysomal fraction during the first hours of imbibition (6 h). In contrast, de novo ribosomal protein synthesis was low during the first hours of imbibition (3 and 6 h) increasing by 60 times in later stages (24 h). Insulin increased this synthesis (75%) at 24 h of imbibition; however, not all ribosomal proteins were similarly regulated. In this regard, an increase in RPS6 and RPL7 protein levels was observed, whereas RPL3 protein levels did not change even though its transcription was induced. Results show that ribosome biogenesis in the first stages of imbibition is carried out with newly synthesized rRNA and ribosomal proteins translated from stored mRNA. PMID:23806421

  19. Ribosome-Inactivating and Related Proteins

    Joachim Schrot

    2015-05-01

    Full Text Available Ribosome-inactivating proteins (RIPs are toxins that act as N-glycosidases (EC 3.2.2.22. They are mainly produced by plants and classified as type 1 RIPs and type 2 RIPs. There are also RIPs and RIP related proteins that cannot be grouped into the classical type 1 and type 2 RIPs because of their different sizes, structures or functions. In addition, there is still not a uniform nomenclature or classification existing for RIPs. In this review, we give the current status of all known plant RIPs and we make a suggestion about how to unify those RIPs and RIP related proteins that cannot be classified as type 1 or type 2 RIPs.

  20. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function.

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  1. Proton scattering from unstable nuclei {sup 20}O, {sup 30}S, {sup 34}Ar: experimental study and models; Diffusion de protons sur les noyaux instables {sup 20}O, {sup 30}S, {sup 34}Ar: etude experimentale et developpement de modeles

    Khan, Elias [Institut de Physique Nucleaire, CNRS - IN2P3, Universite Paris - Sud, 91406 Orsay Cedex (France)

    2000-01-28

    Elastic and inelastic proton scattering from the unstable nuclei {sup 20}O, {sup 30}S and {sup 34}Ar were measured in inverse kinematics at the Grand Accelerateur National d'Ions Lourds. Secondary beams of {sup 20}O at 43 MeV/A, {sup 30}S at 53 MeV/A and {sup 34}Ar at 47 MeV/A impinged on a (CH{sub 2}){sub n} target. Recoiling protons were detected in the silicon strip array MUST. Energies and angular distributions of the first 2{sup +} and 3{sup -} states were measured. A phenomenological analysis yields values of the deformation parameters {beta}{sub 2} and {beta}{sub 3} of 0.55 (6) and 0.35 (5) for {sup 20}O, 0.32 (3) and 0.22 (4) for {sup 30}S, 0.27 (2) and 0.39 (3) for {sup 34}Ar, respectively, and allows the extraction of the ratio of neutron to proton transition matrix elements (M{sub n}/M{sub p})/(N/Z) for 2{sup +} states: 2.35 (37) for {sup 20}O, 0.93 (20) for {sup 30}S and 1.35 (28) for {sup 34}Ar. Therefore the proton rich nuclei {sup 30}S and {sup 34}Ar show a 2{sup +} excitation of isoscalar character whereas the excitation of {sup 20}O is of isovector character. In order to perform a microscopic analysis of the data, we have developed a QRPA model, using three Skyrme interaction: SIII, SG2, SLy4. This model reproduces measured B(EL) values for the oxygen, sulfur and argon isotopic chains, whereas RPA calculations, which do not take pairing into account, underestimate these values. In the case of the QRPA model the energies of the first 2{sup +} state are overestimated by about 1 MeV, but the evolution along the isotopic chains is well reproduced. (M{sub n}/M{sub p})/(N/Z) ratios for the first 2{sup +} state deduced from the microscopic analysis using QRPA are 1.98 for {sup 20}O, 1.05 for {sup 30}S and 1.00 for {sup 34}Ar, in agreement with the conclusions of the phenomenological analysis. However important discrepancies are observed between the two types of analysis for other isotopes, in particular neutron rich argon and sulfur nuclei. (author)

  2. Conservation of ribosomal protein gene ordering in 16 complete genomes

    2000-01-01

    The organization of ribosomal proteins in 16 prokaryotic genomes was studied as an example of comparative genome analyses of gene systems. Hypothetical ribosomal protein-containing operons were constructed. These operons also contained putative genes and other non-ribosomal genes. The correspondences among these genes across different organisms were clarified by sequence homology computations. In this way a cross tabulation of 70 ribosomal proteins genes was constructed. On average, these were organized into 9-14 operons in each genome. There were also 25 non-ribosomal or putative genes in these mainly ribosomal protein operons. Hence the table contains 95 genes in total. It was found that: (i) the conservation of the block of about 20 r-proteins in the L3 and L4 operons across almost the entire eubacteria and archaebacteria is remarkable; (ii) some operons only belong to eubacteria or archaebacteria; (iii) although the ribosomal protein operons are highly conserved within domain, there are fine variations in some operons across different organisms within each domain, and these variations are informative on the evolutionary relations among the organisms. This method provides a new potential for studying the origin and evolution of old species.

  3. Conservation of ribosomal protein gene ordering in 16 complete genomes

    王宁; 陈润生; 王永雄

    2000-01-01

    The organization of ribosomal proteins in 16 prokaryotic genomes was studied as an example of comparative genome analyses of gene systems. Hypothetical ribosomal protein-containing operons were constructed. These operons also contained putative genes and other non-ribosomal genes. The correspondences among these genes across different organisms were clarified by sequence homology computations. In this way a cross tabulation of 70 ribosomal proteins genes was constructed. On average, these were organized into 9-14 operons in each genome. There were also 25 non-ribosomal or putative genes in these mainly ribosomal protein operons. Hence the table contains 95 genes in total. It was found that: (i) the conservation of the block of about 20 r-proteins in the L3 and L4 operons across almost the entire eubacteria and ar-chaebacteria is remarkable; (ii) some operons only belong to eubacteria or archaebacte-ria; (iii) although the ribosomal protein operons are highly conserved within domain, there are fine variat

  4. Horizontal gene transfer of zinc and non-zinc forms of bacterial ribosomal protein S4

    Luthey-Schulten Zaida

    2009-07-01

    Full Text Available Abstract Background The universal ribosomal protein S4 is essential for the initiation of small subunit ribosomal assembly and translational accuracy. Being part of the information processing machinery of the cell, the gene for S4 is generally thought of as being inherited vertically and has been used in concatenated gene phylogenies. Here we report the evolution of ribosomal protein S4 in relation to a broad sharing of zinc/non-zinc forms of the gene and study the scope of horizontal gene transfer (HGT of S4 during bacterial evolution. Results In this study we present the complex evolutionary history of ribosomal protein S4 using 660 bacterial genomes from 16 major bacterial phyla. According to conserved characteristics in the sequences, S4 can be classified into C+ (zinc-binding and C- (zinc-free variants, with 26 genomes (mainly from the class Clostridia containing genes for both. A maximum likelihood phylogenetic tree of the S4 sequences was incongruent with the standard bacterial phylogeny, indicating a departure from strict vertical inheritance. Further analysis using the genome content near the S4 genes, which are usually located in a conserved gene cluster, showed not only that HGT of the C- gene had occurred at various stages of bacterial evolution, but also that both the C- and C+ genes were present before the individual phyla diverged. To explain the latter, we theorize that a gene pool existed early in bacterial evolution from which bacteria could sample S4 gene variants, according to environmental conditions. The distribution of the C+/- variants for seven other zinc-binding ribosomal proteins in these 660 bacterial genomes is consistent with that seen for S4 and may shed light on the evolutionary pressures involved. Conclusion The complex history presented for "core" protein S4 suggests the existence of a gene pool before the emergence of bacterial lineages and reflects the pervasive nature of HGT in subsequent bacterial evolution

  5. A local role for the small ribosomal subunit primary binder rpS5 in final 18S rRNA processing in yeast.

    Andreas Neueder

    Full Text Available In vivo depletion of the yeast small ribosomal subunit (SSU protein S5 (rpS5 leads to nuclear degradation of nascent SSUs and to a perturbed global assembly state of the SSU head domain. Here, we report that rpS5 plays an additional local role at the head/platform interface in efficient SSU maturation. We find that yeast small ribosomal subunits which incorporated an rpS5 variant lacking the seven C-terminal amino acids have a largely assembled head domain and are exported to the cytoplasm. On the other hand, 3' processing of 18S rRNA precursors is inhibited in these ribosomal particles, although they associate with the putative endonuclease Nob1p and other late acting 40S biogenesis factors. We suggest that the SSU head component rpS5 and platform components as rpS14 are crucial constituents of a highly defined spatial arrangement in the head-platform interface of nascent SSUs, which is required for efficient processing of the therein predicted SSU rRNA 3' end. Positioning of rpS5 in nascent SSUs, including its relative orientation towards platform components in the head-platform cleft, will depend on the general assembly and folding state of the head domain. Therefore, the suggested model can explain 18S precursor rRNA 3' processing phenotypes observed in many eukaryotic SSU head assembly mutants.

  6. Ribosomes containing mutants of L4 ribosomal protein from Thermus thermophilus display multiple defects in ribosomal functions and sensitivity against erythromycin

    TSAGKALIA, AIKATERINI; LEONTIADOU, FOTINI; XAPLANTERI, MARIA A.; PAPADOPOULOS, GEORGIOS; KALPAXIS, DIMITRIOS L.; CHOLI-PAPADOPOULOU, THEODORA

    2005-01-01

    Protein L4 from Thermus thermophilus (TthL4) was heterologously overproduced in Escherichia coli cells. To study the implication of the extended loop of TthL4 in the exit-tunnel and peptidyltransferase functions, the highly conserved E56 was replaced by D or Q, while the semiconserved G55 was changed to E or S. Moreover, the sequence -G55E56- was inverted to -E55G56-. When we incorporated these mutants into E. coli ribosomes and investigated their impact on poly(Phe) synthesis, high variations in the synthetic activity and response to erythromycin of the resulting ribosomes were observed. In the absence of erythromycin, ribosomes harboring mutations G55E and E56D in TthL4 protein were characterized by low activity in synthesizing poly(Phe) and decreased capability in binding tRNA at the A site. On the other hand, ribosomes possessing mutations G55E, G55S, G55E-E56G, or E56Q in TthL4 protein were unexpectedly more sensitive to erythromycin. Evidence in support of these findings was drawn by in vivo experiments, assessing the erythromycin sensitivity of E. coli cells expressing wild-type or mutant TthL4 proteins. Our results emphasize the role of the extended loop of L4 ribosomal protein in the exit-tunnel and peptidyltransferase center functions. PMID:16244130

  7. Heterogeneity in Men’s Marijuana Use in the 20s: Adolescent Antecedents and Consequences in the 30s

    Washburn, Isaac J.; Capaldi, Deborah M.

    2014-01-01

    Adolescent psychopathology is commonly connected to marijuana use. How changes in these adolescent antecedents and in adolescent marijuana use are connected to patterns of marijuana use in the 20s is little understood. Also not clearly understood is psychopathology in the 30s as predicted by marijuana use in the 20s. This study sought to examine these two issues – and associations with marijuana disorder diagnoses – using a longitudinal dataset of 205 men with essentially annual reports. Indi...

  8. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  9. Nonenzymatic microorganism identification based on ribosomal RNA

    Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.

    1999-11-01

    Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

  10. Complete Sequence Construction of the Highly Repetitive Ribosomal RNA Gene Repeats in Eukaryotes Using Whole Genome Sequence Data.

    Agrawal, Saumya; Ganley, Austen R D

    2016-01-01

    The ribosomal RNA genes (rDNA) encode the major rRNA species of the ribosome, and thus are essential across life. These genes are highly repetitive in most eukaryotes, forming blocks of tandem repeats that form the core of nucleoli. The primary role of the rDNA in encoding rRNA has been long understood, but more recently the rDNA has been implicated in a number of other important biological phenomena, including genome stability, cell cycle, and epigenetic silencing. Noncoding elements, primarily located in the intergenic spacer region, appear to mediate many of these phenomena. Although sequence information is available for the genomes of many organisms, in almost all cases rDNA repeat sequences are lacking, primarily due to problems in assembling these intriguing regions during whole genome assemblies. Here, we present a method to obtain complete rDNA repeat unit sequences from whole genome assemblies. Limitations of next generation sequencing (NGS) data make them unsuitable for assembling complete rDNA unit sequences; therefore, the method we present relies on the use of Sanger whole genome sequence data. Our method makes use of the Arachne assembler, which can assemble highly repetitive regions such as the rDNA in a memory-efficient way. We provide a detailed step-by-step protocol for generating rDNA sequences from whole genome Sanger sequence data using Arachne, for refining complete rDNA unit sequences, and for validating the sequences obtained. In principle, our method will work for any species where the rDNA is organized into tandem repeats. This will help researchers working on species without a complete rDNA sequence, those working on evolutionary aspects of the rDNA, and those interested in conducting phylogenetic footprinting studies with the rDNA. PMID:27576718

  11. Genomic location of the major ribosomal protein gene locus determines Vibrio cholerae global growth and infectivity.

    Soler-Bistué, Alfonso; Mondotte, Juan A; Bland, Michael Jason; Val, Marie-Eve; Saleh, María-Carla; Mazel, Didier

    2015-04-01

    The effects on cell physiology of gene order within the bacterial chromosome are poorly understood. In silico approaches have shown that genes involved in transcription and translation processes, in particular ribosomal protein (RP) genes, localize near the replication origin (oriC) in fast-growing bacteria suggesting that such a positional bias is an evolutionarily conserved growth-optimization strategy. Such genomic localization could either provide a higher dosage of these genes during fast growth or facilitate the assembly of ribosomes and transcription foci by keeping physically close the many components of these macromolecular machines. To explore this, we used novel recombineering tools to create a set of Vibrio cholerae strains in which S10-spec-α (S10), a locus bearing half of the ribosomal protein genes, was systematically relocated to alternative genomic positions. We show that the relative distance of S10 to the origin of replication tightly correlated with a reduction of S10 dosage, mRNA abundance and growth rate within these otherwise isogenic strains. Furthermore, this was accompanied by a significant reduction in the host-invasion capacity in Drosophila melanogaster. Both phenotypes were rescued in strains bearing two S10 copies highly distal to oriC, demonstrating that replication-dependent gene dosage reduction is the main mechanism behind these alterations. Hence, S10 positioning connects genome structure to cell physiology in Vibrio cholerae. Our results show experimentally for the first time that genomic positioning of genes involved in the flux of genetic information conditions global growth control and hence bacterial physiology and potentially its evolution. PMID:25875621

  12. Genomic location of the major ribosomal protein gene locus determines Vibrio cholerae global growth and infectivity.

    Alfonso Soler-Bistué

    2015-04-01

    Full Text Available The effects on cell physiology of gene order within the bacterial chromosome are poorly understood. In silico approaches have shown that genes involved in transcription and translation processes, in particular ribosomal protein (RP genes, localize near the replication origin (oriC in fast-growing bacteria suggesting that such a positional bias is an evolutionarily conserved growth-optimization strategy. Such genomic localization could either provide a higher dosage of these genes during fast growth or facilitate the assembly of ribosomes and transcription foci by keeping physically close the many components of these macromolecular machines. To explore this, we used novel recombineering tools to create a set of Vibrio cholerae strains in which S10-spec-α (S10, a locus bearing half of the ribosomal protein genes, was systematically relocated to alternative genomic positions. We show that the relative distance of S10 to the origin of replication tightly correlated with a reduction of S10 dosage, mRNA abundance and growth rate within these otherwise isogenic strains. Furthermore, this was accompanied by a significant reduction in the host-invasion capacity in Drosophila melanogaster. Both phenotypes were rescued in strains bearing two S10 copies highly distal to oriC, demonstrating that replication-dependent gene dosage reduction is the main mechanism behind these alterations. Hence, S10 positioning connects genome structure to cell physiology in Vibrio cholerae. Our results show experimentally for the first time that genomic positioning of genes involved in the flux of genetic information conditions global growth control and hence bacterial physiology and potentially its evolution.

  13. Improvement and efficient display of Bacillus thuringiensis toxins on M13 phages and ribosomes.

    Pacheco, Sabino; Cantón, Emiliano; Zuñiga-Navarrete, Fernando; Pecorari, Frédéric; Bravo, Alejandra; Soberón, Mario

    2015-12-01

    Bacillus thuringiensis (Bt) produces insecticidal proteins that have been used worldwide in the control of insect-pests in crops and vectors of human diseases. However, different insect species are poorly controlled by the available Bt toxins or have evolved resistance to these toxins. Evolution of Bt toxicity could provide novel toxins to control insect pests. To this aim, efficient display systems to select toxins with increased binding to insect membranes or midgut proteins involved in toxicity are likely to be helpful. Here we describe two display systems, phage display and ribosome display, that allow the efficient display of two non-structurally related Bt toxins, Cry1Ac and Cyt1Aa. Improved display of Cry1Ac and Cyt1Aa on M13 phages was achieved by changing the commonly used peptide leader sequence of the coat pIII-fusion protein, that relies on the Sec translocation pathway, for a peptide leader sequence that relies on the signal recognition particle pathway (SRP) and by using a modified M13 helper phage (Phaberge) that has an amber mutation in its pIII genomic sequence and preferentially assembles using the pIII-fusion protein. Also, both Cry1Ac and Cyt1Aa were efficiently displayed on ribosomes, which could allow the construction of large libraries of variants. Furthermore, Cry1Ac or Cyt1Aa displayed on M13 phages or ribosomes were specifically selected from a mixture of both toxins depending on which antigen was immobilized for binding selection. These improved systems may allow the selection of Cry toxin variants with improved insecticidal activities that could counter insect resistances. PMID:26606918

  14. Structural and functional characterization of ribosomal protein gene introns in sponges.

    Perina, Drago; Korolija, Marina; Mikoč, Andreja; Roller, Maša; Pleše, Bruna; Imešek, Mirna; Morrow, Christine; Batel, Renato; Ćetković, Helena

    2012-01-01

    Ribosomal protein genes (RPGs) are a powerful tool for studying intron evolution. They exist in all three domains of life and are much conserved. Accumulating genomic data suggest that RPG introns in many organisms abound with non-protein-coding-RNAs (ncRNAs). These ancient ncRNAs are small nucleolar RNAs (snoRNAs) essential for ribosome assembly. They are also mobile genetic elements and therefore probably important in diversification and enrichment of transcriptomes through various mechanisms such as intron/exon gain/loss. snoRNAs in basal metazoans are poorly characterized. We examined 449 RPG introns, in total, from four demosponges: Amphimedon queenslandica, Suberites domuncula, Suberites ficus and Suberites pagurorum and showed that RPG introns from A. queenslandica share position conservancy and some structural similarity with "higher" metazoans. Moreover, our study indicates that mobile element insertions play an important role in the evolution of their size. In four sponges 51 snoRNAs were identified. The analysis showed discrepancies between the snoRNA pools of orthologous RPG introns between S. domuncula and A. queenslandica. Furthermore, these two sponges show as much conservancy of RPG intron positions between each other as between themselves and human. Sponges from the Suberites genus show consistency in RPG intron position conservation. However, significant differences in some of the orthologous RPG introns of closely related sponges were observed. This indicates that RPG introns are dynamic even on these shorter evolutionary time scales. PMID:22880015

  15. Structural and functional characterization of ribosomal protein gene introns in sponges.

    Drago Perina

    Full Text Available Ribosomal protein genes (RPGs are a powerful tool for studying intron evolution. They exist in all three domains of life and are much conserved. Accumulating genomic data suggest that RPG introns in many organisms abound with non-protein-coding-RNAs (ncRNAs. These ancient ncRNAs are small nucleolar RNAs (snoRNAs essential for ribosome assembly. They are also mobile genetic elements and therefore probably important in diversification and enrichment of transcriptomes through various mechanisms such as intron/exon gain/loss. snoRNAs in basal metazoans are poorly characterized. We examined 449 RPG introns, in total, from four demosponges: Amphimedon queenslandica, Suberites domuncula, Suberites ficus and Suberites pagurorum and showed that RPG introns from A. queenslandica share position conservancy and some structural similarity with "higher" metazoans. Moreover, our study indicates that mobile element insertions play an important role in the evolution of their size. In four sponges 51 snoRNAs were identified. The analysis showed discrepancies between the snoRNA pools of orthologous RPG introns between S. domuncula and A. queenslandica. Furthermore, these two sponges show as much conservancy of RPG intron positions between each other as between themselves and human. Sponges from the Suberites genus show consistency in RPG intron position conservation. However, significant differences in some of the orthologous RPG introns of closely related sponges were observed. This indicates that RPG introns are dynamic even on these shorter evolutionary time scales.

  16. Identification of sirtuin and its target as the ribosomal protein S4 in Lactobacillus paracasei.

    Atarashi, Hotaka; Kawasaki, Shinji; Niimura, Yoichi; Tanaka, Naoto; Okada, Sanae; Shiwa, Yuh; Endo, Akihito; Nakagawa, Junichi

    2016-01-01

    Sirtuin is a protein with an enzymatic activity of NAD(+)-dependent protein deacetylation. It was first identified in yeast and its homologous genes have been widely found in various organisms. In bacteria, sirtuin gene was first described as cobB, encoding a cobalamin processing enzyme; and later its potential involvement in regulating acetylation levels of metabolic enzymes, transcription factors, chemotactic proteins and others have been reported. In order to study its physiological relevance in probiotic lactic acid bacteria, we analyzed the whole genome of three L. paracasei strains. All strains tested had sirtuin homolog genes designated hereby as sirA, and one of them had an additional gene designated as sirB. Following confirmation of their coding sequences by individual gene cloning, corresponding recombinant proteins have been generated and purified. The enzymatic characterization revealed that the intrinsic NAD(+)-dependent deacetylation activity of LpSirA (protein encoded by sirA) is comparable to human SIRT1. Furthermore, by blocking sirtuin activity using nicotinamide in vivo, together with an in vitro deacetylation reaction using recombinant LpSirA, we identified one of the target proteins in the lactic acid bacteria as the 30S ribosomal protein S4 (rpsD product). PMID:27118078

  17. Initiation factor 2 stabilizes the ribosome in a semirotated conformation.

    Ling, Clarence; Ermolenko, Dmitri N

    2015-12-29

    Intersubunit rotation and movement of the L1 stalk, a mobile domain of the large ribosomal subunit, have been shown to accompany the elongation cycle of translation. The initiation phase of protein synthesis is crucial for translational control of gene expression; however, in contrast to elongation, little is known about the conformational rearrangements of the ribosome during initiation. Bacterial initiation factors (IFs) 1, 2, and 3 mediate the binding of initiator tRNA and mRNA to the small ribosomal subunit to form the initiation complex, which subsequently associates with the large subunit by a poorly understood mechanism. Here, we use single-molecule FRET to monitor intersubunit rotation and the inward/outward movement of the L1 stalk of the large ribosomal subunit during the subunit-joining step of translation initiation. We show that, on subunit association, the ribosome adopts a distinct conformation in which the ribosomal subunits are in a semirotated orientation and the L1 stalk is positioned in a half-closed state. The formation of the semirotated intermediate requires the presence of an aminoacylated initiator, fMet-tRNA(fMet), and IF2 in the GTP-bound state. GTP hydrolysis by IF2 induces opening of the L1 stalk and the transition to the nonrotated conformation of the ribosome. Our results suggest that positioning subunits in a semirotated orientation facilitates subunit association and support a model in which L1 stalk movement is coupled to intersubunit rotation and/or IF2 binding. PMID:26668356

  18. Note on the shelf break upwelling off the southeast coast of Brazil (lat. 26º30'S

    Afrânio Rubens de Mesquita

    1983-01-01

    Full Text Available A western margin frontal zone is described, from measurements of temperature, salinity and currents, in a section taken with R/V "Prof. W. Besnard" in December 1980, crossing the shelf break border at latitude 26º30'S. The analyses of the sections showed consistently the occurrence of an ascension of the T and S isolines over the shelf break. Simultaneous current measurements showed a surface eddy structure with clockwise circulation and anti-clockwise circulation having a common stem over the break characterizing a shelf break upwelling.

  19. Fuel assembly

    Purpose: To improve the thermal and mechanical safety of fuel rods and structural components by making the local power coefficient of jointed fuel rods greater than that of other fuel rods in a fuel assembly. Constitution: In a fuel assembly comprising a plurality of fuel rods bundled by a spacer and held at the upper and the lower positions with tie plates for insertion into a channel, the degree of enrichment of uranium 235 for uranium dioxide fuel pellets charged in jointed fuel rods is adjusted such that the local power coefficient of the jointed fuel rods is made greater than that of the other fuel rods. In the case if the upper tie plate is moved upwardly by the extension of the jointed fuel rods, other fuel rods axially free from the upper tie plate receives no tension, whereby the safety of the fuel assembly can be improved. (Moriyama, K.)

  20. Stochastic kinetics of ribosomes: single motor properties and collective behavior

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Synthesis of protein molecules in a cell are carried out by ribosomes. A ribosome can be regarded as a molecular motor which utilizes the input chemical energy to move on a messenger RNA (mRNA) track that also serves as a template for the polymerization of the corresponding protein. The forward movement, however, is characterized by an alternating sequence of translocation and pause. Using a quantitative model, which captures the mechanochemical cycle of an individual ribosome, we derive an {\\it exact} analytical expression for the distribution of its dwell times at the successive positions on the mRNA track. Inverse of the average dwell time satisfies a ``Michaelis-Menten-like'' equation and is consistent with the general formula for the average velocity of a molecular motor with an unbranched mechano-chemical cycle. Extending this formula appropriately, we also derive the exact force-velocity relation for a ribosome. Often many ribosomes simultaneously move on the same mRNA track, while each synthesizes a c...

  1. The bacterial translocon SecYEG opens upon ribosome binding.

    Knyazev, Denis G; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-06-21

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which has the conductivity of the plug deletion mutant. The number of ion-conducting channels inserted into the planar bilayer per fusion event roughly equals the number of SecYEG channels counted by fluorescence correlation spectroscopy in a single proteoliposome. Thus, the open probability of the channel must be close to unity. To prevent the otherwise lethal proton leak, a closed post-translational conformation of the SecYEG complex bound to a ribosome must exist. PMID:23645666

  2. The Bacterial Translocon SecYEG Opens upon Ribosome Binding*

    Knyazev, Denis G.; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-01-01

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which has the conductivity of the plug deletion mutant. The number of ion-conducting channels inserted into the planar bilayer per fusion event roughly equals the number of SecYEG channels counted by fluorescence correlation spectroscopy in a single proteoliposome. Thus, the open probability of the channel must be close to unity. To prevent the otherwise lethal proton leak, a closed post-translational conformation of the SecYEG complex bound to a ribosome must exist. PMID:23645666

  3. Effects of ribosomal exit tunnel on protein's cotranslational folding

    In vivo, folding of many proteins occurs during their synthesis in the ribosome and continues after they have escaped from the ribosomal exit tunnel. In this research, we investigate the confinement effects of the ribosome on the cotranslational folding of three proteins, of PDB codes 1PGA, 1CRN and 2RJX, by using a coarse-grained model and molecular dynamics simulation. The exit tunnel is modeled as a hollow cylinder attached to a flat wall, whereas a Go-like model is adopted for the proteins. Our results show that the exit tunnel has a strong effect on the folding mechanism by setting an order by which the secondary and tertiary structures are formed. For protein 1PGA, the folding follows two different folding routes. The presence of the tunnel also improves the foldability of protein. (author)

  4. Molecular profiling of activated neurons by phosphorylated ribosome capture.

    Knight, Zachary A; Tan, Keith; Birsoy, Kivanc; Schmidt, Sarah; Garrison, Jennifer L; Wysocki, Robert W; Emiliano, Ana; Ekstrand, Mats I; Friedman, Jeffrey M

    2012-11-21

    The mammalian brain is composed of thousands of interacting neural cell types. Systematic approaches to establish the molecular identity of functional populations of neurons would advance our understanding of neural mechanisms controlling behavior. Here, we show that ribosomal protein S6, a structural component of the ribosome, becomes phosphorylated in neurons activated by a wide range of stimuli. We show that these phosphorylated ribosomes can be captured from mouse brain homogenates, thereby enriching directly for the mRNAs expressed in discrete subpopulations of activated cells. We use this approach to identify neurons in the hypothalamus regulated by changes in salt balance or food availability. We show that galanin neurons are activated by fasting and that prodynorphin neurons restrain food intake during scheduled feeding. These studies identify elements of the neural circuit that controls food intake and illustrate how the activity-dependent capture of cell-type-specific transcripts can elucidate the functional organization of a complex tissue. PMID:23178128

  5. Interaction of tRNA with Eukaryotic Ribosome

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  6. Eukaryotic ribosomes that lack a 5.8S RNA

    Vossbrinck, C. R.; Woese, C. R.

    1986-01-01

    The 5.8S ribosomal RNA is believed to be a universal eukaryotic characteristic. It has no (size) counterpart among the prokaryotes, although its sequence is homologous with the first 150 or so nucleotides of the prokaryotic large subunit (23S) ribosomal RNA. An exception to this rule is reported here. The microsporidian Vairimorpha necatrix is a eukaryote that has no 5.8S rRNA. As in the prokaryotes, it has a single large subunit rRNA, whose 5-prime region corresponds to the 5.8S rRNA.

  7. The Bacterial Translocon SecYEG Opens upon Ribosome Binding*

    Knyazev, Denis G.; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-01-01

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which ha...

  8. Ribosomal crystallography: from crystal growth to initial phasing

    Thygesen, J.; Krumbholz, S.; Levin, I.; Zaytzev-Bashan, A.; Harms, J.; Bartels, H.; Schlünzen, F.; Hansen, H. A. S.; Bennett, W. S.; Volkmann, N.; Agmon, I.; Eisenstein, M.; Dribin, A.; Maltz, E.; Sagi, I.; Morlang, S.; Fua, M.; Franceschi, F.; Weinstein, S.; Böddeker, N.; Sharon, R.; Anagnostopoulos, K.; Peretz, M.; Geva, M.; Berkovitch-Yellin, Z.; Yonath, A.

    1996-10-01

    Preliminary phases were determined by the application of the isomorphous replacement method at low and intermediate resolution for structure factor amplitudes collected from crystals of large and small ribosomal subunits from halophilic and thermophilic bacteria. Derivatization was performed with dense heavy atom clusters, either by soaking or by specific covalent binding prior to the crystallization. The resulting initial electron density maps contain features comparable in size to those expected for the corresponding particles. The packing arrangements of these maps have been compared with motifs observed by electron microscopy in positively stained thin sections of embedded three-dimensional crystals, as well as with phase sets obtained by ab-initio computations. Aimed at higher resolution phasing, procedures are being developed for multi-site binding of relatively small dense metal clusters at selected locations. Potential sites are being inserted either by mutagenesis or by chemical modifications to facilitate cluster binding to the large halophilic and the small thermophilic ribosomal subunits which yield crystals diffracting to the highest resolution obtained so far for ribosomes, 2.9 and 7.3 Å, respectively. For this purpose the surfaces of these ribosomal particles have been characterized and conditions for quantitative reversible detachment of selected ribosomal proteins have been found. The corresponding genes are being cloned, sequenced, mutated to introduce the reactive side-groups (mainly cysteines) and overexpressed. To assist the interpretation of the anticipated electron density maps, sub-ribosomal stable complexes were isolated from H50S. One of these complexes is composed of two proteins and the other is made of a stretch of the rRNA and a protein. For exploiting the exposed parts of the surface of these complexes for heavy atom binding and for attempting the determination of their three-dimensional structure, their components are being produced

  9. Single Molecule Fluorescence Measurements of Ribosomal Translocation Dynamics

    Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskarin; Cabral, Diana; Liu, Hanqing; Wang, Yuhong; Zhang, Haibo; Rosenblum, Gabriel; Smilansky, Zeev; Goldman, Yale E.; Cooperman, Barry S.

    2011-01-01

    We employ single-molecule fluorescence resonance energy transfer (smFRET) to study structural dynamics over the first two elongation cycles of protein synthesis, using ribosomes containing either Cy3-labeled ribosomal protein L11 and A- or P-site Cy5-labeled tRNA or Cy3 and Cy5 labeled tRNAs. Pre-translocation (PRE) complexes demonstrate fluctuations between classical and hybrid forms, with concerted motions of tRNAs away from L11 and from each other when classical complex converts to hybrid ...

  10. FRET Characterization of Complex Conformational Changes in a Large 16S Ribosomal RNA Fragment Site-Specifically Labeled Using Unnatural Base Pairs.

    Lavergne, Thomas; Lamichhane, Rajan; Malyshev, Denis A; Li, Zhengtao; Li, Lingjun; Sperling, Edit; Williamson, James R; Millar, David P; Romesberg, Floyd E

    2016-05-20

    Ribosome assembly has been studied intensively using Förster resonance energy transfer (FRET) with fluorophore-labeled fragments of RNA produced by chemical synthesis. However, these studies are limited by the size of the accessible RNA fragments. We have developed a replicable unnatural base pair (UBP) formed between (d)5SICS and (d)MMO2 or (d)NaM, which efficiently directs the transcription of RNA containing unnatural nucleotides. We now report the synthesis and evaluation of several of the corresponding ribotriphosphates bearing linkers that enable the chemoselective attachment of different functionalities. We found that the RNA polymerase from T7 bacteriophage does not incorporate NaM derivatives but does efficiently incorporate 5SICS(CO), whose linker enables functional group conjugation via Click chemistry, and when combined with the previously identified MMO2(A), whose amine side chains permits conjugation via NHS coupling chemistry, enables site-specific double labeling of transcribed RNA. To study ribosome assembly, we transcribed RNA corresponding to a 243-nt fragment of the central domain of Thermus thermophilus 16S rRNA containing 5SICS(CO) and MMO2(A) at defined locations and then site-specifically attached the fluorophores Cy3 and Cy5. FRET was characterized using single-molecule total internal reflection fluorescence (smTIRF) microscopy in the presence of various combinations of added ribosomal proteins. We demonstrate that each of the fragment's two three-helix junctions exist in open and closed states, with the latter favored by sequential protein binding. These results elucidate early and previously uncharacterized folding events underlying ribosome assembly and demonstrate the applicability of UBPs for biochemical, structural, and functional studies of RNAs. PMID:26942998

  11. Fuel assembly

    A fuel assembly is composed of a fuel bundle surrounded by a channel box. The fuel bundle comprises a large number of fuel rods and a water rod secured to upper and lower tie plate by way of a plurality of fuel spacers. Grooves (libretti) are formed in the direction along the flowing direction of coolants to at least one of the surface of the fuel rods, the inner surface of the channel box, the surface of the water rod and spacer constituting components. In this case, the lateral width of the libretto in the flowing direction is determined as the minimum thickness of the bottom layer of a layered flow determined by a coolant flow rate. With such a constitution, abrasion resistance relative to coolants is reduced to reduce the pressure loss of fuel assemblies. (I.N.)

  12. KONDISI SOSIAL EKONOMI BURUH PABRIK GULA SRAGI KABUPATEN PEKALONGAN PASCA G 30 S TAHUN 1965-1998

    Ilin Suryantono

    2011-10-01

    Full Text Available The presence of labor in the sugar industry was once used as a political tool during the conflict in 1965 and became the party that is often neglected in the subsequent period between the years 1965-1998. On the one hand, sugar factory was one of plantation sectors having crucial position as one of development achievement of the new order government, because it increased income. It is an irony to see that workers having a vital role for the development of the country's economy but rather their fate are often not addressed by the state. Fundamental problems that later emerged in the life of labor is poverty, but the truth of this argument needs to be proved through research in order to obtain accurate answers. Keywords: Labor, sugar factory, event G 30 S     Keberadaan buruh di pabrik gula menjadi salah satu alat politik pada tahun 1965 dan menjadi tersisih pada masa berikutnya pada tahun 1965-1998. Di satu sisi, pabrik gula menjadi salah satu sektor perkebunan yang memiliki posisi penting sebagai salah satu capaian pembangunan pada masa pemerintahan Orde Baru, karena posisinya penting dalam meningkatkan pemasukan dalam negeri. Hal ini sangat ironi ketika melihat peran pekerja yang memiliki posisi penting dalam pembangunan ekonomi, tetapi sering kali tidak diperhatikan oleh pemerintah. Permasalahan utama yang muncul dalam kehidupan buruh adalah kemiskinan, tetapi permasalahan ini membutuhkan pembuktian melalui penelitian untuk menemukan jawaban yang tepat.   Kata kunci: buruh, pabrik gula, peristiwa G 30 S  

  13. General Assembly

    Staff Association

    2016-01-01

    5th April, 2016 – Ordinary General Assembly of the Staff Association! In the first semester of each year, the Staff Association (SA) invites its members to attend and participate in the Ordinary General Assembly (OGA). This year the OGA will be held on Tuesday, April 5th 2016 from 11:00 to 12:00 in BE Auditorium, Meyrin (6-2-024). During the Ordinary General Assembly, the activity and financial reports of the SA are presented and submitted for approval to the members. This is the occasion to get a global view on the activities of the SA, its financial management, and an opportunity to express one’s opinion, including taking part in the votes. Other points are listed on the agenda, as proposed by the Staff Council. Who can vote? Only “ordinary” members (MPE) of the SA can vote. Associated members (MPA) of the SA and/or affiliated pensioners have a right to vote on those topics that are of direct interest to them. Who can give his/her opinion? The Ordinary General Asse...

  14. Shigella toxin inhibition of binding and translation of polyuridylic acid by Escherichia coli ribosomes.

    Olenick, J G; Wolfe, A D

    1980-01-01

    Shigella toxin inhibits polyuridylic acid-directed polymerization of phenylalanine in ribosome-enzyme systems obtained from Escherichia coli or from Shigella dysenteriae. The inhibition is the result of toxin acting on ribosomes to prevent polyuridylic acid attachment.

  15. Ligation-free ribosome profiling of cell type-specific translation in the brain

    Hornstein, Nicholas; Torres, Daniela; Das Sharma, Sohani; Tang, Guomei; Canoll, Peter; Sims, Peter A

    2016-01-01

    Ribosome profiling has emerged as a powerful tool for genome-wide measurements of translation, but library construction requires multiple ligation steps and remains cumbersome relative to more conventional deep-sequencing experiments. We report a new, ligation-free approach to ribosome profiling that does not require ligation. Library construction for ligation-free ribosome profiling can be completed in one day with as little as 1 ng of purified RNA footprints. We apply ligation-free ribosome...

  16. The Database of Ribosomal Cross-links: an update.

    Baranov, P. V.; Kubarenko, A V; Gurvich, O L; Shamolina, T A; Brimacombe, R

    1999-01-01

    The Database of Ribosomal Cross-links (DRC) was created in 1997. Here we describe new data incorporated into this database and several new features of the DRC. The DRC is freely available via World Wide Web at http://visitweb.com/database/ or http://www. mpimg-berlin-dahlem.mpg.de/ approximately ag_ribo/ag_brimacombe/drc/

  17. The ribosome and the mechanism of protein synthesis

    In virtually all forms of life on earth, proteins in each cell are made according to a genetic blueprint, in the form of DNA. The translation of copies of this genetic blueprint (in the form of messenger RNA) into polypeptides is performed on the ribosome, a highly complex molecular machine composed of RNAs and proteins. To this end, special adaptor molecules called transfer RNAs are lined up by the ribosome in the sequence dictated by the genetic code, such that the amino acids carried by these molecules can be linked into a polypeptide. Several cofactors are involved in these processes, some of which require energy freed up by GTP hydrolysis. Although the ribosome was discovered more than 50 years ago, its structure has only been solved recently by X-ray crystallography. Another technique, cryo-electron microscopy, is starting to contribute toward our understanding of the ribosome's function, by portraying its conformational changes and binding interactions with the cofactors and tRNA

  18. The ABC of Ribosome-Related Antibiotic Resistance

    Wilson, Daniel N.

    2016-01-01

    ABSTRACT The increase in multidrug-resistant pathogenic bacteria is limiting the utility of our current arsenal of antimicrobial agents. Mechanistically understanding how bacteria obtain antibiotic resistance is a critical first step to the development of improved inhibitors. One common mechanism for bacteria to obtain antibiotic resistance is by employing ATP-binding cassette (ABC) transporters to actively pump the drug from the cell. The ABC-F family includes proteins conferring resistance to a variety of clinically important ribosome-targeting antibiotics; however, controversy remains as to whether resistance is conferred via efflux like other ABC transporters or whether another mechanism, such as ribosome protection, is at play. A recent study by Sharkey and coworkers (L. K. Sharkey, T. A. Edwards, and A. J. O’Neill, mBio 7:e01975-15, 2016, http://dx.doi.org/10.1128/mBio.01975-15) provides strong evidence that ABC-F proteins conferring antibiotic resistance utilize ribosome protection mechanisms, namely, by interacting with the ribosome and displacing the drug from its binding site, thus revealing a novel role for ABC-F proteins in antibiotic resistance. PMID:27143393

  19. A streamlined ribosome profiling protocol for the characterization of microorganisms

    Latif, Haythem; Szubin, Richard; Tan, Justin; Brunk, Elizabeth; Lechner, Anna; Zengler, Karsten; Palsson, Bernhard O.

    2015-01-01

    the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time...... a high fraction of informative reads, all while retaining the high quality standards of the existing protocol....

  20. Purification and properties of a ribosomal casein kinase from rabbit reticulocytes

    Issinger, O G

    1977-01-01

    A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...

  1. Lactococcus lactis YfiA is necessary and sufficient for ribosome dimerization

    Puri, Pranav; Eckhardt, Thomas H; Franken, Linda E; Fusetti, Fabrizia; Stuart, Marc C A; Boekema, Egbert J; Kuipers, Oscar P; Kok, Jan; Poolman, Berend

    2014-01-01

    Dimerization and inactivation of ribosomes in Escherichia coli is a two-step process that involves the binding of ribosome modulation factor (RMF) and hibernation promotion factor (HPF). Lactococcus lactisMG1363 expresses a protein, YfiA(Ll), which associates with ribosomes in the stationary phase o

  2. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  3. Heater assembly

    An electrical resistance heater, installed in the H1 borehole, is used to thermally perturb the rock mass through a controlled heating and cooling cycle. Heater power levels are controlled by a Variac power transformer and are measured by wattmeters. Temperatures are measured by thermocouples on the borehole wall and on the heater assembly. Power and temperature values are recorded by the DAS described in Chapter 12. The heater assembly consists of a 3.55-m (11.6-ft) long by 20.3-cm (8-in.) O.D., Type 304 stainless steel pipe, containing a tubular hairpin heating element. The element has a heated length of 3 m (9.84 ft). The power rating of the element is 10 kW; however, we plan to operate the unit at a maximum power of only 3 kW. The heater is positioned with its midpoint directly below the axis of the P2 borehole, as shown in the borehole configuration diagram. This heater midpoint position corresponds to a distance of approximately 8.5 m (27.9 ft) from the H1 borehole collar. A schematic of the heater assembly in the borehole is shown. The distance from the borehole collar to the closest point on the assembly (the front end) is 6.5 m (21.3 ft). A high-temperature inflatable packer, used to seal the borehole for moisture collection, is positioned 50 cm (19.7 in.) ahead of the heater front end. The heater is supported and centralized within the borehole by two skids, fabricated from 25-mm (1-in.) O.D. stainless steel pipe. Thermocouples are installed at a number of locations in the H1 borehole. Four thermocouples that are attached to the heater skin monitor temperatures on the outer surface of the can, while three thermocouples that are held in place by rock sections monitor borehole wall temperatures beneath the heater. Temperatures are also monitored at the heater terminal and on the packer hardware

  4. Assembling consumption

    Assembling Consumption marks a definitive step in the institutionalisation of qualitative business research. By gathering leading scholars and educators who study markets, marketing and consumption through the lenses of philosophy, sociology and anthropology, this book clarifies and applies the i...... societies. This is an essential reading for both seasoned scholars and advanced students of markets, economies and social forms of consumption....... the investigative tools offered by assemblage theory, actor-network theory and non-representational theory. Clear theoretical explanation and methodological innovation, alongside empirical applications of these emerging frameworks will offer readers new and refreshing perspectives on consumer culture and market...

  5. General Assembly

    Staff Association

    2016-01-01

    Mardi 5 avril à 11 h 00 BE Auditorium Meyrin (6-2-024) Conformément aux statuts de l’Association du personnel, une Assemblée générale ordinaire est organisée une fois par année (article IV.2.1). Projet d’ordre du jour : Adoption de l’ordre du jour. Approbation du procès-verbal de l’Assemblée générale ordinaire du 5 mai 2015. Présentation et approbation du rapport d’activités 2015. Présentation et approbation du rapport financier 2015. Présentation et approbation du rapport des vérificateurs aux comptes pour 2015. Programme de travail 2016. Présentation et approbation du projet de budget 2016 Approbation du taux de cotisation pour 2017. Modifications aux Statuts de l'Association du personnel proposée. Élections des membres de la Commissio...

  6. General Assembly

    Staff Association

    2015-01-01

    Mardi 5 mai à 11 h 00 Salle 13-2-005 Conformément aux statuts de l’Association du personnel, une Assemblée générale ordinaire est organisée une fois par année (article IV.2.1). Projet d’ordre du jour : 1- Adoption de l’ordre du jour. 2- Approbation du procès-verbal de l’Assemblée générale ordinaire du 22 mai 2014. 3- Présentation et approbation du rapport d’activités 2014. 4- Présentation et approbation du rapport financier 2014. 5- Présentation et approbation du rapport des vérificateurs aux comptes pour 2014. 6- Programme 2015. 7- Présentation et approbation du projet de budget 2015 et taux de cotisation pour 2015. 8- Pas de modifications aux Statuts de l'Association du personnel proposée. 9- Élections des membres de la Commission é...

  7. General assembly

    Staff Association

    2015-01-01

    Mardi 5 mai à 11 h 00 Salle 13-2-005 Conformément aux statuts de l’Association du personnel, une Assemblée générale ordinaire est organisée une fois par année (article IV.2.1). Projet d’ordre du jour : Adoption de l’ordre du jour. Approbation du procès-verbal de l’Assemblée générale ordinaire du 22 mai 2014. Présentation et approbation du rapport d’activités 2014. Présentation et approbation du rapport financier 2014. Présentation et approbation du rapport des vérificateurs aux comptes pour 2014. Programme 2015. Présentation et approbation du projet de budget 2015 et taux de cotisation pour 2015. Pas de modifications aux Statuts de l'Association du personnel proposée. Élections des membres de la Commission électorale. &am...

  8. Fuel assembly

    The cross section of a fuel assembly is divided to a first region containing corner portions at which channel fasteners are situated and a second region not containing corner portions. The average enrichment degree of plutonium in the first region is decreased than that of the second region, and the number of fuel rods containing burnable poisons is increased at the first region than that of the second region. In the first region of the fuel assembly, the effect of moderating neutrons is enhanced since the cross section of a moderator flow channel at the outer side of the channel box is large. Therefore, local power peaking is increased in the first region while it is decreased in the second region that opposes to a narrow gap. The average enrichment degree of plutonium in the first region is decreased and that in the second region is increased by so much, to flatten the power distribution. Then, the reduction of the reactivity worth of gadolinia, as burnable poisons, can be suppressed. (N.H.)

  9. Hatch assembly

    This patent describes a nuclear reactor installation including means defining a fuel handling area and means defining a containment area separated from the fuel handling area and including a refuelling cavity; the improvement comprising: (a) a fuel transfer tube connecting the refuelling cavity with the fuel handling area; the fuel transfer tube having a first end in the fuel handling area and a second end in the refueling cavity; (b) valve means for opening and closing the first end; and (c) a hatch assembly mounted on the second end; the hatch assembly including (1) a hatch ring affixed to the fuel transfer tube at the second end the hatch ring has an integral annular seat surrounded by the hatch ring and defines a hatch opening in the second end of the fuel transfer tube; (2) a hatch cover adapts to be positioned on the annular seat for covering the hatch opening; (3) latching units are supported on the hatch ring about the hatch opening, each latching unit

  10. Fuel assembly

    The present invention concerns a fuel assembly of a BWR type reactor, and prevents aging change of flow rate of coolants leaked from a gap between a lower tie plate and a channel box. That is, in the fuel assembly, a great number of fuel rods and a plurality of water rods are bundled by a plurality of spacers, the upper and the lower ends thereof are supported by upper and lower tie plates, and they are contained in a channel box. Plate-like protrusions are disposed rotatably to the lower tie plate at a position corresponding to the lower end of the channel box. In addition, through holes are disposed on the side wall of the lower tie plate. With such a constitution, the protrusions rotate at a connection portion by hydraulic pressure of leaking coolants, and urge the channel box by the other end to control leakage of coolants. Further, since the through holes are disposed on the side wall of the lower tie plate, pressure difference is caused between the upper and the lower surfaces of the plate of the protrusion, to rotate the protrusions at the connection portion, and the other end of the protrusions presses the channel box to obtain the same effect. (I.S.)

  11. Cloning a cDNA Encoding Ribosomal Protein S25 from Amaranthus cruentus L.%籽粒苋(Amaranthus cruentus L.)核糖体蛋白S25基因(cDNA)的克隆及其表达分析

    徐芳秀; 江树业; 等

    2001-01-01

    @@ Ribosomes, the agents of protein synthesis, consist of roughly equal amounts of RNA (rRNA) and protein (r-protein). Knowledge of the ribosome and its function mainly comes from the extensive work on 70S bacterial ribosomes. There are 21 proteins in the small (30S) subunit and 30 in the large (50S) subunit in E. coil ri bosomes. The 80S eukaryotic ribosomes are more com plex than the bacterial ones and contain at least 30 pro teins in the small (40S) subunit and 40 in the large (60 S) subunit. These r-proteins are named S1 to S30 and L1 to L40 according to whether they arise from the small or large subunit, and to their mobility in gels. In plants, several ribosomal protein genes and/or cDNAs have been isolated, such as the small subunit proteins S 11, S13, S14, S16, and S19 and the large subunit proteins L2, L7, L17, and L27. Here we report the r-protein S25 cDNA, Arps25, from Amaranthus cruentus L.

  12. HCV IRES manipulates the ribosome to promote the switch from translation initiation to elongation.

    Filbin, Megan E; Vollmar, Breanna S; Shi, Dan; Gonen, Tamir; Kieft, Jeffrey S

    2013-02-01

    The internal ribosome entry site (IRES) of the hepatitis C virus (HCV) drives noncanonical initiation of protein synthesis necessary for viral replication. Functional studies of the HCV IRES have focused on 80S ribosome formation but have not explored its role after the 80S ribosome is poised at the start codon. Here, we report that mutations of an IRES domain that docks in the 40S subunit's decoding groove cause only a local perturbation in IRES structure and result in conformational changes in the IRES-rabbit 40S subunit complex. Functionally, the mutations decrease IRES activity by inhibiting the first ribosomal translocation event, and modeling results suggest that this effect occurs through an interaction with a single ribosomal protein. The ability of the HCV IRES to manipulate the ribosome provides insight into how the ribosome's structure and function can be altered by bound RNAs, including those derived from cellular invaders. PMID:23262488

  13. Fuel assembly

    A fuel assembly of a BWR type reactor comprises a rectangular parallelopiped channel box and fuel bundles contained in the channel box. The fuel bundle comprises an upper tie plate, a lower tie plate, a plurality of spacers a plurality of fuel rods and a water rod. In each fuel rod, the amount of fission products is reduced at upper and lower end regions of an effective fuel portion than that in other regions of the effective fuel region. In a portion of the fuel rods, fuel pellets containing burnable poisons are disposed at the upper and lower end regions. In addition, the upper and lower portions are constituted with natural uranium. Each of the upper and lower end regions is not greater than 15% of the effective fuel length. Since this can enhance reactivity control effect without worsening fuel economy, the control amount for excess reactivity upon long-term cycle operation can be increased. (I.N.)

  14. Evolution of Drosophila ribosomal protein gene core promoters

    Ma, Xiaotu; Zhang, Kangyu; Li, Xiaoman

    2008-01-01

    The coordinated expression of ribosomal protein genes (RPGs) has been well documented in many species. Previous analyses of RPG promoters focus only on Fungi and mammals. Recognizing this gap and using a comparative genomics approach, we utilize a motif-finding algorithm that incorporates cross-species conservation to identify several significant motifs in Drosophila RPG promoters. As a result, significant differences of the enriched motifs in RPG promoter are found among Drosophila, Fungi, a...

  15. Revised phylogeny of whales suggested by mitochondrial ribosomal DNA sequences

    Milinkovitch, M.C.; Orti, G.; Meyer, A.

    1993-01-01

    Living cetaceans are subdivided into two highly distinct suborders, Odontoceti (the echolocating toothed whales) and Mysticeti (the filter-feeding baleen whales), which are believed to have had a long independent history. Here we report the determination of DNA sequences from two mitochondrial ribosomal gene segments (930 base pairs per species) for 16 species of cetaceans, a perissodactyl and a sloth, and construct the first phylogeny for whales and dolphins based on explicit cladistic metho...

  16. Structural Insights into tRNA Dynamics on the Ribosome

    Xabier Agirrezabala

    2015-04-01

    Full Text Available High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation.

  17. Structural Insights into tRNA Dynamics on the Ribosome.

    Agirrezabala, Xabier; Valle, Mikel

    2015-01-01

    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation. PMID:25941930

  18. Structural Insights into tRNA Dynamics on the Ribosome

    Xabier Agirrezabala; Mikel Valle

    2015-01-01

    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation.

  19. Visualization of ribosomal RNA operon copy number distribution

    DasGupta Indrani; Wu Martin; Rastogi Rajat; Fox George E

    2009-01-01

    Abstract Background Results of microbial ecology studies using 16S rRNA sequence information can be deceiving due to differences in rRNA operon copy number and genome size of the detected organisms. It therefore will be useful for investigators to have a better understanding of how these two parameters differ in various organism types. In this study, the number of ribosomal operons and genome size were separately mapped onto a Bacterial phylogenetic tree. Results A representative Bacterial tr...

  20. Poliovirus tropism and attenuation are determined after internal ribosome entry

    Kauder, Steven E.; Racaniello, Vincent R

    2004-01-01

    Poliovirus replication is limited to a few organs, including the brain and spinal cord. This restricted tropism may be a consequence of organ-specific differences in translation initiation by the poliovirus internal ribosome entry site (IRES). A C-to-U mutation at base 472 in the IRES of the Sabin type 3 poliovirus vaccine strain, known to attenuate neurovirulence, may further restrict tropism by eliminating viral replication in the CNS. To determine the relationship between IRES-mediated tra...

  1. Ribosomal biosynthesis of α-amanitin in Galerina marginata

    Luo, Hong; Hallen-Adams, Heather E.; Scott-Craig, John S.; Walton, Jonathan D

    2011-01-01

    Amatoxins, including α-amanitin, are bicyclic octapeptides found in mushrooms (Agaricomycetes, Agaricales) of certain species in the genera Amanita, Galerina, Lepiota, and Conocybe. Amatoxins and the chemically similar phallotoxins are synthesized on ribosomes in Amanita bisporigera, Amanita phalloides, and Amanita ocreata. In order to determine if amatoxins are synthesized by a similar mechanism in another, distantly related mushroom, we obtained genome survey sequence data from a monokaryot...

  2. Epigeneitc silencing of ribosomal RNA genes by Mybbp1a

    Tan Bertrand

    2012-06-01

    Full Text Available Abstract Background Transcription of the ribosomal RNA gene repeats by Pol I occurs in the nucleolus and is a fundamental step in ribosome biogenesis and protein translation. Due to tight coordination between ribosome biogenesis and cell proliferation, transcription of rRNA and stable maintenance of rDNA clusters are thought to be under intricate control by intercalated mechanisms, particularly at the epigenetic level. Methods and Results Here we identify the nucleolar protein Myb-binding protein 1a (Mybbp1a as a novel negative regulator of rRNA expression. Suppression of rDNA transcription by Mybbp1a was linked to promoter regulation as illustrated by its binding to the chromatin around the hypermethylated, inactive rDNA gene promoters. Our data further showed that downregulation of Mybbp1a abrogated the local DNA methylation levels and histone marks associated with gene silencing, and altered the promoter occupancy of various factors such UBF and HDACs, consequently leading to elevated rRNA expression. Mechanistically, we propose that Mybbp1a maintains rDNA repeats in a silenced state while in association with the negative epigenetic modifiers HDAC1/2. Conclusions Results from our present work reveal a previously unrecognized co-repressor role of Mybbp1a in rRNA expression. They are further consistent with the scenario that Mybbp1a is an integral constituent of the rDNA epigenetic regulation that underlies the balanced state of rDNA clusters.

  3. Further characterization of ribosome binding to thylakoid membranes

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [3H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  4. Simulation and analysis of single-ribosome translation

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  5. Structure of Vibrio cholerae ribosome hibernation promoting factor

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  6. Single Molecule Fluorescence Measurements of Ribosomal Translocation Dynamics

    Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskarin; Cabral, Diana; Liu, Hanqing; Wang, Yuhong; Zhang, Haibo; Rosenblum, Gabriel; Smilansky, Zeev; Goldman, Yale E.; Cooperman, Barry S.

    2011-01-01

    We employ single-molecule fluorescence resonance energy transfer (smFRET) to study structural dynamics over the first two elongation cycles of protein synthesis, using ribosomes containing either Cy3-labeled ribosomal protein L11 and A- or P-site Cy5-labeled tRNA or Cy3 and Cy5 labeled tRNAs. Pre-translocation (PRE) complexes demonstrate fluctuations between classical and hybrid forms, with concerted motions of tRNAs away from L11 and from each other when classical complex converts to hybrid complex. EF-G·GTP binding to both hybrid and classical PRE complexes halts these fluctuations prior to catalyzing translocation to form the post-translocation (POST) complex. EF-G dependent translocation from the classical PRE complex proceeds via transient formation of a short-lived hybrid intermediate. A-site binding of either EF-G to the PRE complex or of aminoacyl-tRNA·EF-Tu ternary complex to the POST complex markedly suppresses ribosome conformational lability. PMID:21549313

  7. Single-molecule fluorescence measurements of ribosomal translocation dynamics.

    Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskarin; Cabral, Diana; Liu, Hanqing; Wang, Yuhong; Zhang, Haibo; Rosenblum, Gabriel; Smilansky, Zeev; Goldman, Yale E; Cooperman, Barry S

    2011-05-01

    We employ single-molecule fluorescence resonance energy transfer (smFRET) to study structural dynamics over the first two elongation cycles of protein synthesis, using ribosomes containing either Cy3-labeled ribosomal protein L11 and A- or P-site Cy5-labeled tRNA or Cy3- and Cy5-labeled tRNAs. Pretranslocation (PRE) complexes demonstrate fluctuations between classical and hybrid forms, with concerted motions of tRNAs away from L11 and from each other when classical complex converts to hybrid complex. EF-G⋅GTP binding to both hybrid and classical PRE complexes halts these fluctuations prior to catalyzing translocation to form the posttranslocation (POST) complex. EF-G dependent translocation from the classical PRE complex proceeds via transient formation of a short-lived hybrid intermediate. A-site binding of either EF-G to the PRE complex or of aminoacyl-tRNA⋅EF-Tu ternary complex to the POST complex markedly suppresses ribosome conformational lability. PMID:21549313

  8. Detecting actively translated open reading frames in ribosome profiling data.

    Calviello, Lorenzo; Mukherjee, Neelanjan; Wyler, Emanuel; Zauber, Henrik; Hirsekorn, Antje; Selbach, Matthias; Landthaler, Markus; Obermayer, Benedikt; Ohler, Uwe

    2016-02-01

    RNA-sequencing protocols can quantify gene expression regulation from transcription to protein synthesis. Ribosome profiling (Ribo-seq) maps the positions of translating ribosomes over the entire transcriptome. We have developed RiboTaper (available at https://ohlerlab.mdc-berlin.de/software/), a rigorous statistical approach that identifies translated regions on the basis of the characteristic three-nucleotide periodicity of Ribo-seq data. We used RiboTaper with deep Ribo-seq data from HEK293 cells to derive an extensive map of translation that covered open reading frame (ORF) annotations for more than 11,000 protein-coding genes. We also found distinct ribosomal signatures for several hundred upstream ORFs and ORFs in annotated noncoding genes (ncORFs). Mass spectrometry data confirmed that RiboTaper achieved excellent coverage of the cellular proteome. Although dozens of novel peptide products were validated in this manner, few of the currently annotated long noncoding RNAs appeared to encode stable polypeptides. RiboTaper is a powerful method for comprehensive de novo identification of actively used ORFs from Ribo-seq data. PMID:26657557

  9. Nucleocytoplasmic transport of ribosomes in a eukaryotic system: Is there a facilitated transport process?

    The authors have examined the kinetics of the process by which ribosomes are exported from the nucleus to the cytoplasm using Xenopus laevis oocytes microinjected into the germinal vesicle with radiolabeled ribosomes or ribosomal subunits from X. laevis, Tetrahymena thermophila, or Escherichia coli. Microinjected eukaryotic mature ribosomes are redistributed into the oocyte cytoplasm by an apparent carrier-mediated transport process that exhibits saturation kinetics as increasing amounts of ribosomes are injected. T. thermophila ribosomes are competent to traverse the Xenopus nuclear envelope, suggesting that the basic mechanism underlying ribosome transport is evolutionarily conserved. Microinjected E. coli ribosomes are not transported in this system, indicating that prokaryotic ribosomes lack the signals required for transport. Surprisingly, coinjected small (40S) and large (60S) subunits from T. thermophila are transported significantly faster than individual subunits. These observations support a facilitated transport model for the translocation of ribosomal subunits as separate units across the nuclear envelope whereby the transport rate of 60S or 40S subunits is enhanced by the presence of the partner subunit. Although the basic features of the transport mechanism have been preserved through evolution, other aspects of the process may be mediated through species-specific interactions. They hypothesize that a species-specific nuclear 40S-60S subunit association may expedite the transport of individual subunits across the nuclear envelope

  10. Preparation of ribosomes for smFRET studies: A simplified approach.

    Shebl, Bassem; Menke, Drew E; Pennella, Min; Poudyal, Raghav R; Burke, Donald H; Cornish, Peter V

    2016-08-01

    During the past decade, single-molecule studies of the ribosome have significantly advanced our understanding of protein synthesis. The broadest application of these methods has been towards the investigation of ribosome conformational dynamics using single-molecule Förster resonance energy transfer (smFRET). The recent advances in fluorescently labeled ribosomes and translation components have resulted in success of smFRET experiments. Various methods have been employed to target fluorescent dyes to specific locations within the ribosome. Primarily, these methods have involved additional steps including subunit dissociation and/or full reconstitution, which could result in ribosomes of reduced activity and translation efficiency. In addition, substantial time and effort are required to produce limited quantities of material. To enable rapid and large-scale production of highly active, fluorescently labeled ribosomes, we have developed a procedure that combines partial reconstitution with His-tag purification. This allows for a homogeneous single-step purification of mutant ribosomes and subsequent integration of labeled proteins. Ribosomes produced with this method are shown to be as active as ribosomes purified using classical methods. While we have focused on two labeling sites in this report, the method is generalizable and can in principle be extended to any non-essential ribosomal protein. PMID:27208427

  11. Fuel assembly

    Since the neutron flux distribution and the power distribution of a fuel assembly in which short fuel rods vary greatly in the vicinity of a boundary where the distribution of uranium amount is different, the reading value of local power range monitors, having the detectors positioned in the vicinity of the boundary is varied. Then in the present invention, the upper end of the effective axial length of fuel rod is so made as not approaching with the detection position of the local power range monitor in a reactor core. Further, the upper end of the effective axial length of fuel rods in a 4 x 4 fuel rod lattice positioned at the corner on the side of the local power range monitor is so made as not approaching the detection position of the local power range monitor. As a result, the change of the neutron flux distribution and power distribution in the vicinity of the position where the detector of the local power range monitor is situated can be extremely reduced. Accordingly, there is no scattering and fluctuation for the reading value by the local power range monitor, to improve the monitoring performance for thermal characteristics in the reactor core. (N.H.)

  12. Fuel assembly

    Purpose: To reconstruct a BWR type reactor into a high conversion reactor with no substantial changes for the reactor inner structure such as control rod structure. Constitution: The horizontal cross sectional shape of a channel box is reformed into a square configuration and the arrangement of fuel rods is formed as a trigonal lattice-like configuration. As a method of improving the conversion ratio, there is considered to use a dense lattice by narrowing the distance between fuel rods and trigonal lattice arrangement for fuel rod is advantageous therefor. A square shape cross sectional configuration having equal length both in the lateral and longitudinal directions is suitable for the channel box as a guide upon movement of the control rod. Fuel rods can be arranged with no loss by the trigonal lattice configuration, by which it is possible to improve the neutron moderation, increase the reactor core reactivity and conduct effective fuel combustion. In this way, it is possible to attain the object by inserting the follower portion of the control rod at the earier half and extracting the same at the latter half during the operation period in the reactor core comprising fuel assemblies suitable to a high conversion BWR type reactor having average conversion ratio of about 0.8. (Kamimura, M.)

  13. Fuel assembly

    Fuel rods are arranged in a lattice-like structure by way of a plurality of spacers and the lower ends thereof are fixed to a lower tie plate for assembling a fuel rod bundle. The outer circumference is surrounded by a basket having a plurality of openings and the basket is surrounded by a channel box. The basket is connected to a handle at the upper end and to a lower tie plate at the lower end and, further, defined with a scraper at each of openings. Coolants flown from the lower tie plate to the channel box flow the channels between the channel box and the basket and a fuel rod bundle, uprise while forming a two-phase flow and flow out from the upper end of the channel box. Since no upper tie plate is present, pressure loss of coolants flow is reduced, and liquid membranes of coolants are peeled off by the scraper disposed at the opening of the basket, which contributes to the improvement of the limit power. In addition, fuel rods are inspected and cleaned easily. (N.H.)

  14. Fuel assembly

    The object of the present invention is to improve the hydrodynamic stability in the fuel channels of BWR type reactors and effectively utilize the coolant driving power corresponding to the reduction due to pressure loss. That is, in a fuel assembly having usual fuel rods and, in addition, water rods and short fuel rods, the structures of water rods, upper tie plates and the spacers are designed from a hydrodynamic point of view, to reduce the pressure loss. On the other hand, a lattice-like flow channel resistance member is disposed to a lower tie plate. The bundle flow rate is made uniform by the flow channel resistance member, and the pressure loss of the tie plate is increased by the reduction of the pressure loss by the arrangement of the short fuel rod and the reduction of the pressure loss described above. Since this increases the ratio of the single phase stream pressure loss in the total reactor core pressure loss, the hydrodynamic stability in the fuel channel is improved. (I.J.)

  15. Nuclear reactor fuel assembly

    A fuel assembly construction for liquid metal cooled fast breeder reactors is described in which the sub-assemblies carry a smaller proportion of parasitic material than do conventional sub-assemblies. (U.K.)

  16. Mass spectrometric and bioinformatics approaches to characterizing of cyclic non-ribosomal peptides and ribosomally encoded peptide antibiotic

    Liu, Wei-Ting

    2009-01-01

    Natural products are a crucial component in drug discovery because of their considerable pharmaceutical properties. Cyclic non-ribosomally peptides are one category of natural products featured by containing non-standard amino acids and lactam or lactone structures, thus increasing the complexity of the resulting tandem mass spectrometry data. Cyclosporin, microcystins and nodularins all are well-known examples and have notable pharmacologically importance. In this current work, by collaborat...

  17. The trp RNA-binding attenuation protein of Bacillus subtilis regulates translation of the tryptophan transport gene trpP (yhaG) by blocking ribosome binding.

    Yakhnin, Helen; Zhang, Hong; Yakhnin, Alexander V; Babitzke, Paul

    2004-01-01

    Expression of the Bacillus subtilis tryptophan biosynthetic genes (trpEDCFBA and pabA [trpG]) is regulated in response to tryptophan by TRAP, the trp RNA-binding attenuation protein. TRAP-mediated regulation of the tryptophan biosynthetic genes includes a transcription attenuation and two distinct translation control mechanisms. TRAP also regulates translation of trpP (yhaG), a single-gene operon that encodes a putative tryptophan transporter. Its translation initiation region contains triplet repeats typical of TRAP-regulated mRNAs. We found that regulation of trpP and pabA is unaltered in a rho mutant strain. Results from filter binding and gel mobility shift assays demonstrated that TRAP binds specifically to a segment of the trpP transcript that includes the untranslated leader and translation initiation region. While the affinities of TRAP for the trpP and pabA transcripts are similar, TRAP-mediated translation control of trpP is much more extensive than for pabA. RNA footprinting revealed that the trpP TRAP binding site consists of nine triplet repeats (five GAG, three UAG, and one AAG) that surround and overlap the trpP Shine-Dalgarno (S-D) sequence and translation start codon. Results from toeprint and RNA-directed cell-free translation experiments indicated that tryptophan-activated TRAP inhibits TrpP synthesis by preventing binding of a 30S ribosomal subunit. Taken together, our results establish that TRAP regulates translation of trpP by blocking ribosome binding. Thus, TRAP coordinately regulates tryptophan synthesis and transport by three distinct mechanisms: attenuation transcription of the trpEDCFBA operon, promoting formation of the trpE S-D blocking hairpin, and blocking ribosome binding to the pabA and trpP transcripts. PMID:14702295

  18. Effects of anti-C23 (nucleolin) antibody on transcription of ribosomal DNA in Chironomus salivary gland cells

    Egyhazi, E.; Pigon, A. (Karolinska Institutet, Stockholm (Sweden)); Chang, Jinhong; Ghaffari, S.H.; Dreesen, T.D.; Wellman, S.E.; Case, S.T.; Olson, M.O.J. (Univ. of Mississippi Medical Center, Jackson (USA))

    1988-10-01

    Protein C23 (also called nucleolin or 100-kDa nucleolar protein) is a major nucleolar phosphoprotein involved in ribosome biogenesis. To determine the effects of protein C23 on preribosomal RNA (pre-rRNA) synthesis anti-C23 antiserum was microinjected into nuclei of Chironomus tentans salivary glands. Transcription was measured by incubation of the glands with {sup 32}P-labeled RNA precursors followed by microdissection of nucleoli, RNA extraction, and electrophoretic analyses. Injection of the anti-C23 antibody caused a 2- to 3.5-fold stimulation of {sup 32}P incorporation into 38 S pre-rRNA. No stimulation was observed in salivary glands injected with preimmune serum or antiserum preabsorbed with protein C23. The stimulatory effect was selective for pre-rRNA as indicated by the lack of stimulation of {sup 32}P incorporation into extranucleolar RNA. Injection of the antiserum produced little or no effect on pre-RNA processing as measured by the relative amounts of {sup 32}P-labeled intermediate cleavage products of pre-rRNA in stimulated versus control glands. These results suggest that protein C23 not only is involved in ribosome assembly but also plays a role in regulating the transcription of the preribosomal RNA.

  19. Effects of anti-C23 (nucleolin) antibody on transcription of ribosomal DNA in Chironomus salivary gland cells

    Protein C23 (also called nucleolin or 100-kDa nucleolar protein) is a major nucleolar phosphoprotein involved in ribosome biogenesis. To determine the effects of protein C23 on preribosomal RNA (pre-rRNA) synthesis anti-C23 antiserum was microinjected into nuclei of Chironomus tentans salivary glands. Transcription was measured by incubation of the glands with 32P-labeled RNA precursors followed by microdissection of nucleoli, RNA extraction, and electrophoretic analyses. Injection of the anti-C23 antibody caused a 2- to 3.5-fold stimulation of 32P incorporation into 38 S pre-rRNA. No stimulation was observed in salivary glands injected with preimmune serum or antiserum preabsorbed with protein C23. The stimulatory effect was selective for pre-rRNA as indicated by the lack of stimulation of 32P incorporation into extranucleolar RNA. Injection of the antiserum produced little or no effect on pre-RNA processing as measured by the relative amounts of 32P-labeled intermediate cleavage products of pre-rRNA in stimulated versus control glands. These results suggest that protein C23 not only is involved in ribosome assembly but also plays a role in regulating the transcription of the preribosomal RNA

  20. Structures of the Bacterial Ribosome in Classical and Hybrid States of tRNA Binding

    Dunkle, Jack A.; Wang, Leyi; Feldman, Michael B.; Pulk, Arto; Chen, Vincent B.; Kapral, Gary J.; Noeske, Jonas; Richardson, Jane S.; Blanchard, Scott C.; Cate, Jamie H. Doudna (Cornell); (UCB); (Duke)

    2011-09-06

    During protein synthesis, the ribosome controls the movement of tRNA and mRNA by means of large-scale structural rearrangements. We describe structures of the intact bacterial ribosome from Escherichia coli that reveal how the ribosome binds tRNA in two functionally distinct states, determined to a resolution of {approx}3.2 angstroms by means of x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit site. The structures help to explain how the ratchet-like motion of the two ribosomal subunits contributes to the mechanisms of translocation, termination, and ribosome recycling.

  1. Ribosome-dependent ATPase interacts with conserved membrane protein in Escherichia coli to modulate protein synthesis and oxidative phosphorylation.

    Mohan Babu

    Full Text Available Elongation factor RbbA is required for ATP-dependent deacyl-tRNA release presumably after each peptide bond formation; however, there is no information about the cellular role. Proteomic analysis in Escherichia coli revealed that RbbA reciprocally co-purified with a conserved inner membrane protein of unknown function, YhjD. Both proteins are also physically associated with the 30S ribosome and with members of the lipopolysaccharide transport machinery. Genome-wide genetic screens of rbbA and yhjD deletion mutants revealed aggravating genetic interactions with mutants deficient in the electron transport chain. Cells lacking both rbbA and yhjD exhibited reduced cell division, respiration and global protein synthesis as well as increased sensitivity to antibiotics targeting the ETC and the accuracy of protein synthesis. Our results suggest that RbbA appears to function together with YhjD as part of a regulatory network that impacts bacterial oxidative phosphorylation and translation efficiency.

  2. Proton and $\\gamma$- partial widths of astrophysically important states of $^{30}$S studied by the $\\beta$-delayed decay of $^{31}$Ar

    Koldste, G T; Borge, M J G; Briz, J A; Carmona-Gallardo, M; Fraile, L M; Fynbo, H O U; Giovinazzo, J; Johansen, J G; Jokinen, A; Jonson, B; Kurturkian-Nieto, T; Kusk, J H; Nilsson, T; Perea, A; Pesudo, V; Picado, E; Riisager, K; Saastamoinen, A; Tengblad, O; Thomas, J -C; Van de Walle, J

    2013-01-01

    Resonances just above the proton threshold in $^{30}$S affect the $^{29}$P(p,$\\gamma$)$^{30}$S reaction under astrophysical conditions. The (p,$\\gamma$)-reaction rate is currently determined indirectly and depends on the properties of the relevant resonances. We present here a method for finding the ratio between the proton and $\\gamma$- partial widths of resonances in $^{30}$S. The widths are determined from the $\\beta$-2p and $\\beta$-p-$\\gamma$- decay of $^{31}$Ar, which is produced at ISOLDE, CERN. Experimental limits on the ratio between the proton and $\\gamma$- partial widths for astrophysical relevant levels in $^{30}$S have been found for the first time. A level at 4689.2(24)keV is identified in the $\\gamma$-spectrum, and an upper limit on the $\\Gamma_{p}/\\Gamma_{\\gamma}$ ratio of 0.26 (95% C.L.) is found. In the two-proton spectrum two levels at 5227(3)keV and 5847(4)keV are identified. These levels were previously seen to $\\gamma$-decay and upper limits on the $\\Gamma_{\\gamma}/\\Gamma_{p}$ ratio of 0....

  3. Mammalian sperm translate nuclear-encoded proteins by mitochondrial-type ribosomes

    Gur, Yael; Breitbart, Haim

    2006-01-01

    It is widely accepted that spermatozoa are translationally silent. The present study demonstrates, for the first time, incorporation of labeled amino acids into polypeptides during sperm capacitation, which was completely inhibited by mitochondrial translation inhibitors but not by the cytoplasmic translation inhibitor. Unlike 80S cytoplasmic ribosomes, 55S mitochondrial ribosomes were present in polysomal fractions, indicating that these ribosomes are actively involved in protein translation...

  4. Amicoumacin A induces cancer cell death by targeting the eukaryotic ribosome

    Prokhorova, Irina V.; Akulich, Kseniya A.; Desislava S. Makeeva; Osterman, Ilya A.; Skvortsov, Dmitry A.; Sergiev, Petr V.; Dontsova, Olga A.; Gulnara Yusupova; Yusupov, Marat M; Dmitriev, Sergey E

    2016-01-01

    Amicoumacin A is an antibiotic that was recently shown to target bacterial ribosomes. It affects translocation and provides an additional contact interface between the ribosomal RNA and mRNA. The binding site of amicoumacin A is formed by universally conserved nucleotides of rRNA. In this work, we showed that amicoumacin A inhibits translation in yeast and mammalian systems by affecting translation elongation. We determined the structure of the amicoumacin A complex with yeast ribosomes at a ...

  5. Engineering the rRNA decoding site of eukaryotic cytosolic ribosomes in bacteria

    Hobbie, S N; Kalapala, S K; Akshay, S.; Bruell, C M; S. Schmidt; Dabow, S; Vasella, A; Sander, P; Böttger, E C

    2007-01-01

    Structural and genetic studies on prokaryotic ribosomes have provided important insights into fundamental aspects of protein synthesis and translational control and its interaction with ribosomal drugs. Comparable mechanistic studies in eukaryotes are mainly hampered by the absence of both high-resolution crystal structures and efficient genetic models. To study the interaction of aminoglycoside antibiotics with selected eukaryotic ribosomes, we replaced the bacterial drug binding site in 16S...

  6. Detecting Ricin: A Sensitive Luminescent Assay for Ricin A-chain Ribosome Depurination Kinetics+

    Sturm, Matthew B.; Schramm, Vern L.

    2009-01-01

    Ricin is a family member of the lethal ribosome-inactivating proteins (RIP) found in plants. Ricin toxin A-chain (RTA) from castor beans catalyzes the hydrolytic depurination of a single base from a GAGA tetraloop of eukaryotic ribosomal RNA to release a single adenine from the sarcin-ricin loop (SRL). Protein synthesis is inhibited by loss of elongation factor binding resulting in cell death. We report a sensitive coupled assay for the measurement of adenine released from ribosomes or small ...

  7. Visualising ribosome profiling and using it for reading frame detection and exploration of eukaryotic translation initiation

    Mannion Michel, Audrey

    2013-01-01

    Ribosome profiling (ribo-seq) is a recently developed technique that provides genomewide information on protein synthesis (GWIPS) in vivo. The high resolution of ribo-seq is one of the exciting properties of this technique. In Chapter 2, I present a computational method that utilises the sub-codon precision and triplet periodicity of ribosome profiling data to detect transitions in the translated reading frame. Application of this method to ribosome profiling data generated for human HeLa cel...

  8. Ribosome Profiling Provides Evidence that Large Noncoding RNAs Do Not Encode Proteins

    Guttman, Mitchell; Russell, Pamela; Ingolia, Nicholas T.; Weissman, Jonathan S.; Lander, Eric S.; Lander, Eric S.

    2013-01-01

    Large noncoding RNAs are emerging as an important component in cellular regulation. Considerable evidence indicates that these transcripts act directly as functional RNAs rather than through an encoded protein product. However, a recent study of ribosome occupancy reported that many large intergenic ncRNAs (lincRNAs) are bound by ribosomes, raising the possibility that they are translated into proteins. Here, we show that classical noncoding RNAs and 5′ UTRs show the same ribosome occupancy a...

  9. Spanning high-dimensional expression space using ribosome-binding site combinatorics.

    Zelcbuch, Lior; Antonovsky, Niv; Bar-Even, Arren; Levin-Karp, Ayelet; Barenholz, Uri; Dayagi, Michal; Liebermeister, Wolfram; Flamholz, Avi; Noor, Elad; Amram, Shira; Brandis, Alexander; Bareia, Tasneem; Yofe, Ido; Jubran, Halim; Milo, Ron

    2013-05-01

    Protein levels are a dominant factor shaping natural and synthetic biological systems. Although proper functioning of metabolic pathways relies on precise control of enzyme levels, the experimental ability to balance the levels of many genes in parallel is a major outstanding challenge. Here, we introduce a rapid and modular method to span the expression space of several proteins in parallel. By combinatorially pairing genes with a compact set of ribosome-binding sites, we modulate protein abundance by several orders of magnitude. We demonstrate our strategy by using a synthetic operon containing fluorescent proteins to span a 3D color space. Using the same approach, we modulate a recombinant carotenoid biosynthesis pathway in Escherichia coli to reveal a diversity of phenotypes, each characterized by a distinct carotenoid accumulation profile. In a single combinatorial assembly, we achieve a yield of the industrially valuable compound astaxanthin 4-fold higher than previously reported. The methodology presented here provides an efficient tool for exploring a high-dimensional expression space to locate desirable phenotypes. PMID:23470993

  10. Direct TFIIA-TFIID protein contacts drive budding yeast ribosomal protein gene transcription.

    Layer, Justin H; Weil, P Anthony

    2013-08-01

    We have previously shown that yeast TFIID provides coactivator function on the promoters of ribosomal protein-encoding genes (RPGs) by making direct contact with the transactivator repressor activator protein 1 (Rap1). Further, our structural studies of assemblies generated with purified Rap1, TFIID, and TFIIA on RPG enhancer-promoter DNA indicate that Rap1-TFIID interaction induces dramatic conformational rearrangements of enhancer-promoter DNA and TFIID-bound TFIIA. These data indicate a previously unknown yet critical role for yeast TFIIA in the integration of activator-TFIID contacts with promoter conformation and downstream preinitiation complex formation and/or function. Here we describe the use of systematic mutagenesis to define how specific TFIIA contacts contribute to these processes. We have verified that TFIIA is required for RPG transcription in vivo and in vitro, consistent with the existence of a critical Rap1-TFIIA-TFIID interaction network. We also identified essential points of contact for TFIIA and Rap1 within the Rap1 binding domain of the Taf4 subunit of TFIID. These data suggest a mechanism for how interactions between TFIID, TFIIA, and Rap1 contribute to the high rate of transcription initiation seen on RPGs in vivo. PMID:23814059

  11. Total synthesis of the large non-ribosomal peptide polytheonamide B

    Inoue, Masayuki; Shinohara, Naoki; Tanabe, Shintaro; Takahashi, Tomoaki; Okura, Ken; Itoh, Hiroaki; Mizoguchi, Yuki; Iida, Maiko; Lee, Nayoung; Matsuoka, Shigeru

    2010-04-01

    Polytheonamide B is by far the largest non-ribosomal peptide known at present, and displays extraordinary cytotoxicity (EC50 = 68 pg ml-1, mouse leukaemia P388 cells). Its 48 amino-acid residues include a variety of non-proteinogenic D- and L-amino acids, and the absolute stereochemistry of these amino acids alternate in sequence. These structural features induce the formation of a stable β-strand-type structure, giving rise to an overall tubular structure over 30 Å in length. In a biological setting, this fold is believed to transport cations across the lipid bilayer through a pore, thereby acting as an ion channel. Here, we report the first chemical construction of polytheonamide B. Our synthesis relies on the combination of four key stages: syntheses of non-proteinogenic amino acids, a solid-phase assembly of four fragments of polytheonamide B, silver-mediated connection of the fragments and, finally, global deprotection. The synthetic material now available will allow studies of the relationships between its conformational properties, channel functions and cytotoxicity.

  12. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [14C]CH3-methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  13. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  14. Various mechanisms in cyclopeptide production from precursors synthesized independently of non-ribosomal peptide synthetases

    Wenyan Xu; Liling Li; Liangcheng Du; Ninghua Tan

    2011-01-01

    An increasing number of cyclopeptides have been discovered as products of ribosomal synthetic pathway.The biosynthetic study of these cyclopeptides has revealed interesting new mechanisms for cyclization.This review highlighted the recent discoveries in cyclization mechanisms for cyclopeptides synthesized independently of non-ribosomal peptide synthetases,including endopeptidase-catalyzed cyclization,intein-mediated cyclization,and peptide synthetase-catalyzed cyclization.This information may help to design hybrid ribosomal and non-ribosomal biosynthetic systems to produce novel cyclopeptides with various bioactivities.

  15. γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

    γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg2+-content and γ-resistance is discussed. (orig.)

  16. Modeling of ribosome dynamics on a ds-mRNA under an external load

    Shakiba, Bahareh; Dayeri, Maryam; Mohammad-Rafiee, Farshid

    2016-07-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to the recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force and the translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  17. Modeling of Ribosome Dynamics on a ds-mRNA under an External Load

    Shakiba, Bahareh; Mohammad-Rafiee, Farshid

    2016-01-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force, and translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  18. Heritability and Variability in Ribosomal RNA Genes of Vicia faba

    Rogers, Scott O; Bendich, Arnold J.

    1987-01-01

    We have compared the restriction patterns and copy numbers of ribosomal RNA genes (rDNA) between and within individuals of Vicia faba . While the EcoRI blot-hybridization patterns changed only after one to two generations, copy number changes were found among different tissues of the same plant. Copy number differences among individuals in the population were as great as 95-fold, whereas as much as a 12-fold variation was seen among tissues of the same plant. Among individual F1 progeny from ...

  19. Newnes electronics assembly handbook

    Brindley, Keith

    2013-01-01

    Newnes Electronics Assembly Handbook: Techniques, Standards and Quality Assurance focuses on the aspects of electronic assembling. The handbook first looks at the printed circuit board (PCB). Base materials, basic mechanical properties, cleaning of assemblies, design, and PCB manufacturing processes are then explained. The text also discusses surface mounted assemblies and packaging of electromechanical assemblies, as well as the soldering process. Requirements for the soldering process; solderability and protective coatings; cleaning of PCBs; and mass solder/component reflow soldering are des

  20. Inlet nozzle assembly

    Christiansen, David W.; Karnesky, Richard A.; Precechtel, Donald R.; Smith, Bob G.; Knight, Ronald C.

    1987-01-01

    An inlet nozzle assembly for directing coolant into the duct tube of a fuel assembly attached thereto. The nozzle assembly includes a shell for housing separable components including an orifice plate assembly, a neutron shield block, a neutron shield plug, and a diffuser block. The orifice plate assembly includes a plurality of stacked plates of differently configurated and sized openings for directing coolant therethrough in a predesigned flow pattern.

  1. Tilt assembly for tracking solar collector assembly

    Almy, Charles; Peurach, John; Sandler, Reuben

    2012-01-24

    A tilt assembly is used with a solar collector assembly of the type comprising a frame, supporting a solar collector, for movement about a tilt axis by pivoting a drive element between first and second orientations. The tilt assembly comprises a drive element coupler connected to the drive element and a driver, the driver comprising a drive frame, a drive arm and a drive arm driver. The drive arm is mounted to the drive frame for pivotal movement about a drive arm axis. Movement on the drive arm mimics movement of the drive element. Drive element couplers can extend in opposite directions from the outer portion of the drive arm, whereby the assembly can be used between adjacent solar collector assemblies in a row of solar collector assemblies.

  2. Ribosomal small subunit domains radiate from a central core

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O'Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

    2016-02-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2‧OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit.

  3. Analysis of ribosomal protein gene structures: implications for intron evolution.

    2006-03-01

    Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

  4. Polyribosomes Are Molecular 3D Nanoprinters That Orchestrate the Assembly of Vault Particles

    2014-01-01

    Ribosomes are molecular machines that function in polyribosome complexes to translate genetic information, guide the synthesis of polypeptides, and modulate the folding of nascent proteins. Here, we report a surprising function for polyribosomes as a result of a systematic examination of the assembly of a large ribonucleoprotein complex, the vault particle. Structural and functional evidence points to a model of vault assembly whereby the polyribosome acts like a 3D nanoprinter to direct the ordered translation and assembly of the multi-subunit vault homopolymer, a process which we refer to as polyribosome templating. Structure-based mutagenesis and cell-free in vitro expression studies further demonstrated the critical importance of the polyribosome in vault assembly. Polyribosome templating prevents chaos by ensuring efficiency and order in the production of large homopolymeric protein structures in the crowded cellular environment and might explain the origin of many polyribosome-associated molecular assemblies inside the cell. PMID:25354757

  5. Structural assembly demonstration experiment

    Stokes, J. W.

    1982-01-01

    The experiment is of an operational variety, designed to assess crew capability in Large Space System (LSS) assembly. The six Structural Assembly Demonstration Experiment objectives include: (1) the establishment of a quantitative correlation between LSS neutral buoyancy simulation and on-orbit assembly operations in order to enhance the validity of those assembly simulations; (2) the quantitative study of the capabilities and mechanics of human assembly in an Extravehicular Activity environment; (3) the further corroboration of the LSS Assembly Analysis cost algorithm through the obtainment of hard data base information; (4) the verification of LSS assembly techniques and timeless, as well as the identification of crew imposed loads and assembly aid requirements and concepts; (5) verification of a Launch/Assembly Platform structure concept for other LSS missions; and (6) lastly, to advance thermal control concepts through a flexible heat pipe.

  6. Effects of electroacupuncture on the expression of p70 ribosomal protein S6 kinase and ribosomal protein S6 in the hippocampus of rats with vascular dementia

    Yanzhen Zhu; Xuan Wang; Xiaobao Ye; Changhua Gao; Wei Wang

    2012-01-01

    This study investigated the mechanism underlying electroacupuncture therapy for vascular dementia through electroacupuncture at the acupoints of Baihui (DU20), Dazhui (DU14), and bilateral Shenshu (BL23) in a rat model of vascular dementia produced by bilateral middle cerebral artery occlusion. Morris water maze test showed that electroacupuncture improved the learning ability of vascular dementia rats. Western blot assay revealed that the expression of p70 ribosomal protein S6 kinase and ribosomal protein S6 in vascular dementia rats was significantly increased after electroacupuncture, compared with the model group that was not treated with acupuncture. The average escape latency was also shortened after electroacupuncture, and escape strategies in the spatial probe test improved from edge and random searches, to linear and trending swim pathways. The experimental findings indicate that electroacupuncture improves learning and memory ability by up-regulating expression of p70 ribosomal protein S6 kinase and ribosomal protein S6 in the hippocampus of vascular dementia rats.

  7. Ribosome-associated Asc1/RACK1 is required for endonucleolytic cleavage induced by stalled ribosome at the 3′ end of nonstop mRNA

    Ikeuchi, Ken; Inada, Toshifumi

    2016-01-01

    Dom34-Hbs1 stimulates degradation of aberrant mRNAs lacking termination codons by dissociating ribosomes stalled at the 3′ ends, and plays crucial roles in Nonstop Decay (NSD) and No-Go Decay (NGD). In the dom34Δ mutant, nonstop mRNA is degraded by sequential endonucleolytic cleavages induced by a stalled ribosome at the 3′ end. Here, we report that ribosome-associated Asc1/RACK1 is required for the endonucleolytic cleavage of nonstop mRNA by stalled ribosome at the 3′ end of mRNA in dom34Δ mutant cells. Asc1/RACK1 facilitates degradation of truncated GFP-Rz mRNA in the absence of Dom34 and exosome-dependent decay. Asc1/RACK1 is required for the sequential endonucleolytic cleavages by the stalled ribosome in the dom34Δ mutant, depending on its ribosome-binding activity. The levels of peptidyl-tRNA derived from nonstop mRNA were elevated in dom34Δasc1Δ mutant cells, and overproduction of nonstop mRNA inhibited growth of mutant cells. E3 ubiquitin ligase Ltn1 degrades the arrest products from truncated GFP-Rz mRNA in dom34Δ and dom34Δasc1Δ mutant cells, and Asc1/RACK1 represses the levels of substrates for Ltn1-dependent degradation. These indicate that ribosome-associated Asc1/RACK1 facilitates endonucleolytic cleavage of nonstop mRNA by stalled ribosomes and represses the levels of aberrant products even in the absence of Dom34. We propose that Asc1/RACK1 acts as a fail-safe in quality control for nonstop mRNA. PMID:27312062

  8. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-01-01

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S ...

  9. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [35S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [32P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  10. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  11. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes. PMID:6121796

  12. Participation of deoxyribonucleic acid polymerase alpha in amplification of ribosomal deoxyribonucleic acid in Xenopus laevis.

    Zimmermann, W.; Weissbach, A

    1981-01-01

    Aphidicolin, a known inhibitor of eucaryotic deoxyribonucleic acid (DNA) polymerase alpha, efficiently inhibited amplification of ribosomal DNA during oogenesis in Xenopus laevis. DNA polymerase alpha, but not DNA polymerase gamma, as isolated from ovaries, was sensitive to aphidicolin. DNA polymerase beta was not detectable in Xenopus ovary extracts. Therefore, DNA polymerase alpha plays a major role in ribosomal ribonucleic acid gene amplification.

  13. Control of ribosome traffic by position-dependent choice of synonymous codons

    Mitarai, Namiko; Pedersen, Steen

    2013-10-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species.

  14. Autogenous Regulation of Splicing of the Transcript of a Yeast Ribosomal Protein Gene

    Dabeva, Mariana D.; Post-Beittenmiller, Martha A.; Warner, Jonathan R.

    1986-08-01

    The gene for a yeast ribosomal protein, RPL32, contains a single intron. The product of this gene appears to participate in feedback control of the splicing of the intron from the transcript. This autogenous regulation of splicing provides a striking analogy to the autogenous regulation of translation of ribosomal proteins in Escherichia coli.

  15. Autogenous regulation of splicing of the transcript of a yeast ribosomal protein gene.

    Dabeva, M. D.; Post-Beittenmiller, M A; Warner, J R

    1986-01-01

    The gene for a yeast ribosomal protein, RPL32, contains a single intron. The product of this gene appears to participate in feedback control of the splicing of the intron from the transcript. This autogenous regulation of splicing provides a striking analogy to the autogenous regulation of translation of ribosomal proteins in Escherichia coli.

  16. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    Essers, Paul B; Nonnekens, Julie; Goos, Yvonne J; Betist, Marco C; Viester, Marjon D; Mossink, Britt; Lansu, Nico; Korswagen, Hendrik C; Jelier, Rob; Brenkman, Arjan B; MacInnes, Alyson W

    2015-01-01

    The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs

  17. Firearm trigger assembly

    Crandall, David L.; Watson, Richard W.

    2010-02-16

    A firearm trigger assembly for use with a firearm includes a trigger mounted to a forestock of the firearm so that the trigger is movable between a rest position and a triggering position by a forwardly placed support hand of a user. An elongated trigger member operatively associated with the trigger operates a sear assembly of the firearm when the trigger is moved to the triggering position. An action release assembly operatively associated with the firearm trigger assembly and a movable assembly of the firearm prevents the trigger from being moved to the triggering position when the movable assembly is not in the locked position.

  18. Assembly plans for ITER

    The assembly of ITER represents an extrapolation of a factor of two or more in size over existing large tokamaks. An assembly plan has been developed based on the ITER Outline Design. This plan was reviewed by technical experts and critical issues were identified. Alternate designs are being developed to address the most serious concerns and to minimize cost and assembly schedule. Because ITER has many characteristics of a full-scale nuclear reactor its assembly has challenges not faced previously by the fusion community. Careful assembly planning and well-designed tooling are required to insure success in the assembly of ITER

  19. Factors and Effects of Self-Acknowledgment of Vocational Strength: An Empirical Analysis using the "Survey on the Working Style of Those in Their 30s" (Japanese)

    Honda, Yuki

    2014-01-01

    The aim of this paper is to examine how working people acknowledge their own vocational strength, using data from the "Survey on the Working Style of Those in Their 30s." Main findings are: 1) The acknowledged strengths can be classified into "skills/qualifications" and "communication/behavior"; 2) While both types of strength have been formed mostly within workplaces,"skills/qualifications" is more likely to be formed within educational institutions, especially in the case of women; 3) Men w...

  20. An evaluation of the 30-s chair stand test in older adults: frailty detection based on kinematic parameters from a single inertial unit

    Millor, Nora; Lecumberri, Pablo; Gómez, Marisol; Martínez-Ramírez, Alicia; Izquierdo, Mikel

    2013-01-01

    Background A growing interest in frailty syndrome exists because it is regarded as a major predictor of co-morbidities and mortality in older populations. Nevertheless, frailty assessment has been controversial, particularly when identifying this syndrome in a community setting. Performance tests such as the 30-second chair stand test (30-s CST) are a cornerstone for detecting early declines in functional independence. Additionally, recent advances in body-fixed sensors have enhanced the sens...

  1. Traffic of interacting ribosomes: effects of single-machine mechano-chemistry on protein synthesis

    Basu, A; Basu, Aakash; Chowdhury, Debashish

    2006-01-01

    Many ribosomes simultaneously move on the same messenger RNA (mRNA), each synthesizing a protein. Earlier models of ribosome traffic represent each ribosome by a ``self-propelled particle'' and capture the dynamics by an extension of the totally asymmetric simple exclusion process. In contrast, here we develope a ``unified'' theoretical model that not only incorporates the mutual exclusions of the interacting ribosomes, but also describes explicitly the mechano-chemistry of each of these individual cyclic machines during protein synthesis. Using a combination of analytical and numerical techniques of non-equilibrium statistical mechanics, we analyze this model and illustrate its power by making experimentally testable predictions on the rate of protein synthesis and the density profile of the ribosomes on some mRNAs in E-Coli.

  2. Ribosome collisions and Translation efficiency: Optimization by codon usage and mRNA destabilization

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen

    2008-01-01

    collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of m......Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation...... process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome...

  3. Structure of the GTP Form of Elongation Factor 4 (EF4) Bound to the Ribosome.

    Kumar, Veerendra; Ero, Rya; Ahmed, Tofayel; Goh, Kwok Jian; Zhan, Yin; Bhushan, Shashi; Gao, Yong-Gui

    2016-06-17

    Elongation factor 4 (EF4) is a member of the family of ribosome-dependent translational GTPase factors, along with elongation factor G and BPI-inducible protein A. Although EF4 is highly conserved in bacterial, mitochondrial, and chloroplast genomes, its exact biological function remains controversial. Here we present the cryo-EM reconstitution of the GTP form of EF4 bound to the ribosome with P and E site tRNAs at 3.8-Å resolution. Interestingly, our structure reveals an unrotated ribosome rather than a clockwise-rotated ribosome, as observed in the presence of EF4-GDP and P site tRNA. In addition, we also observed a counterclockwise-rotated form of the above complex at 5.7-Å resolution. Taken together, our results shed light on the interactions formed between EF4, the ribosome, and the P site tRNA and illuminate the GTPase activation mechanism at previously unresolved detail. PMID:27137929

  4. The Listeria monocytogenes Hibernation-Promoting Factor Is Required for the Formation of 100S Ribosomes, Optimal Fitness, and Pathogenesis

    Kline, Benjamin C.; McKay, Susannah L.; Tang, William W.; Portnoy, Daniel A.

    2014-01-01

    During exposure to certain stresses, bacteria dimerize pairs of 70S ribosomes into translationally silent 100S particles in a process called ribosome hibernation. Although the biological roles of ribosome hibernation are not completely understood, this process appears to represent a conserved and adaptive response that contributes to optimal survival during stress and post-exponential-phase growth. Hibernating ribosomes are formed by the activity of one or more highly conserved proteins; gamm...

  5. Mechanism of fusidic acid inhibition of RRF- and EF-G-dependent splitting of the bacterial post-termination ribosome

    Borg, Anneli; Pavlov, Michael; Ehrenberg, Måns

    2016-01-01

    The antibiotic drug fusidic acid (FA) is commonly used in the clinic against gram-positive bacterial infections. FA targets ribosome-bound elongation factor G (EF-G), a translational GTPase that accelerates both messenger RNA (mRNA) translocation and ribosome recycling. How FA inhibits translocation was recently clarified, but FA inhibition of ribosome recycling by EF-G and ribosome recycling factor (RRF) has remained obscure. Here we use fast kinetics techniques to estimate mean times of rib...

  6. “Silencing the ribosomal locus of Saccharomyces cerevisiae: role of RNA polymerase I transcription and chromatin acetylation”

    Cesarini, Elisa

    2011-01-01

    During my PhD I investigated the transcriptional silencing occurring at the ribosomal DNA of Saccharomyces cerevisiae. In yeast the ribosomal locus (rDNA) is transcribed with high efficiency by RNA polymerase I (Pol I) and III to synthetize ribosomal RNAs. It has been discovered that RNA polymerase Pol II (Pol II) can also transcribe the ribosomal locus, at low level, starting from cryptic promoters and generating non coding RNAs (ncRNAs). ncRNA transcription leads to genome...

  7. A non-canonical mechanism for Crm1-export cargo complex assembly.

    Fischer, Ute; Schäuble, Nico; Schütz, Sabina; Altvater, Martin; Chang, Yiming; Faza, Marius Boulos; Panse, Vikram Govind

    2015-01-01

    The transport receptor Crm1 mediates the export of diverse cargos containing leucine-rich nuclear export signals (NESs) through complex formation with RanGTP. To ensure efficient cargo release in the cytoplasm, NESs have evolved to display low affinity for Crm1. However, mechanisms that overcome low affinity to assemble Crm1-export complexes in the nucleus remain poorly understood. In this study, we reveal a new type of RanGTP-binding protein, Slx9, which facilitates Crm1 recruitment to the 40S pre-ribosome-associated NES-containing adaptor Rio2. In vitro, Slx9 binds Rio2 and RanGTP, forming a complex. This complex directly loads Crm1, unveiling a non-canonical stepwise mechanism to assemble a Crm1-export complex. A mutation in Slx9 that impairs Crm1-export complex assembly inhibits 40S pre-ribosome export. Thus, Slx9 functions as a scaffold to optimally present RanGTP and the NES to Crm1, therefore, triggering 40S pre-ribosome export. This mechanism could represent one solution to the paradox of weak binding events underlying rapid Crm1-mediated export. PMID:25895666

  8. Ribosome-Inactivating Proteins: From Plant Defense to Tumor Attack

    Maria Serena Fabbrini

    2010-11-01

    Full Text Available Ribosome-inactivating proteins (RIPs are EC3.2.32.22 N-glycosidases that recognize a universally conserved stem-loop structure in 23S/25S/28S rRNA, depurinating a single adenine (A4324 in rat and irreversibly blocking protein translation, leading finally to cell death of intoxicated mammalian cells. Ricin, the plant RIP prototype that comprises a catalytic A subunit linked to a galactose-binding lectin B subunit to allow cell surface binding and toxin entry in most mammalian cells, shows a potency in the picomolar range. The most promising way to exploit plant RIPs as weapons against cancer cells is either by designing molecules in which the toxic domains are linked to selective tumor targeting domains or directly delivered as suicide genes for cancer gene therapy. Here, we will provide a comprehensive picture of plant RIPs and discuss successful designs and features of chimeric molecules having therapeutic potential.

  9. A ribosome-inactivating protein in a Drosophila defensive symbiont.

    Hamilton, Phineas T; Peng, Fangni; Boulanger, Martin J; Perlman, Steve J

    2016-01-12

    Vertically transmitted symbionts that protect their hosts against parasites and pathogens are well known from insects, yet the underlying mechanisms of symbiont-mediated defense are largely unclear. A striking example of an ecologically important defensive symbiosis involves the woodland fly Drosophila neotestacea, which is protected by the bacterial endosymbiont Spiroplasma when parasitized by the nematode Howardula aoronymphium. The benefit of this defense strategy has led to the rapid spread of Spiroplasma throughout the range of D. neotestacea, although the molecular basis for this protection has been unresolved. Here, we show that Spiroplasma encodes a ribosome-inactivating protein (RIP) related to Shiga-like toxins from enterohemorrhagic Escherichia coli and that Howardula ribosomal RNA (rRNA) is depurinated during Spiroplasma-mediated protection of D. neotestacea. First, we show that recombinant Spiroplasma RIP catalyzes depurination of 28S rRNAs in a cell-free assay, as well as Howardula rRNA in vitro at the canonical RIP target site within the α-sarcin/ricin loop (SRL) of 28S rRNA. We then show that Howardula parasites in Spiroplasma-infected flies show a strong signal of rRNA depurination consistent with RIP-dependent modification and large decreases in the proportion of 28S rRNA intact at the α-sarcin/ricin loop. Notably, host 28S rRNA is largely unaffected, suggesting targeted specificity. Collectively, our study identifies a novel RIP in an insect defensive symbiont and suggests an underlying RIP-dependent mechanism in Spiroplasma-mediated defense. PMID:26712000

  10. Sensor mount assemblies and sensor assemblies

    Miller, David H.

    2012-04-10

    Sensor mount assemblies and sensor assemblies are provided. In an embodiment, by way of example only, a sensor mount assembly includes a busbar, a main body, a backing surface, and a first finger. The busbar has a first end and a second end. The main body is overmolded onto the busbar. The backing surface extends radially outwardly relative to the main body. The first finger extends axially from the backing surface, and the first finger has a first end, a second end, and a tooth. The first end of the first finger is disposed on the backing surface, and the tooth is formed on the second end of the first finger.

  11. A rapid and simple pipeline for synthesis of mRNA-ribosome-V(H)H complexes used in single-domain antibody ribosome display.

    Bencurova, Elena; Pulzova, Lucia; Flachbartova, Zuzana; Bhide, Mangesh

    2015-06-01

    The single-domain antibody (VHH) is a promising building block for a number of antibody-based applications. Ribosome display can successfully be used in the production of VHH. However, the construction of the expression cassette, confirmation of the translation and proper folding of the nascent chain, and the purification of the ribosome complexes, remain cumbersome tasks. Additionally, selection of the most suitable expression system can be challenging. We have designed primers that will amplify virtually all Camelidae VHH. With the help of a double-overlap extension (OE) polymerase chain reaction (PCR) we have fused VHH with the F1 fragment (T7 promoter and species-independent translation sequence) and the F2 fragment (mCherry, Myc-tag, tether, SecM arrest sequence and 3' stem loop) to generate a full-length DNA cassette. OE-PCR generated fragments were incubated directly with cell-free lysates (Leishmania torentolae, rabbit reticulocyte or E. coli) for the synthesis of mRNA-VHH-mCherry-ribosome complexes in vitro. Alternatively, the cassette was ligated in pQE-30 vector and transformed into E. coli to produce ribosome complexes in vivo. The results showed that the same expression cassette could be used to synthesize ribosome complexes with different expression systems. mCherry reporter served to confirm the synthesis and proper folding of the nascent chain, Myc-tag was useful in the rapid purification of ribosome complexes, and combination of the SecM sequence and 3' stem loop made the cassette universal, both for cells-free and E. coli in vivo. This rapid and universal pipeline can effectively be used in antibody ribosome display and VHH production. PMID:25902394

  12. Soldering in electronics assembly

    Judd, Mike

    2013-01-01

    Soldering in Electronics Assembly discusses several concerns in soldering of electronic assemblies. The book is comprised of nine chapters that tackle different areas in electronic assembly soldering. Chapter 1 discusses the soldering process itself, while Chapter 2 covers the electronic assemblies. Chapter 3 talks about solders and Chapter 4 deals with flux. The text also tackles the CS and SC soldering process. The cleaning of soldered assemblies, solder quality, and standards and specifications are also discussed. The book will be of great use to professionals who deal with electronic assem

  13. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  14. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Jeffrey A Hussmann

    2015-12-01

    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  15. Translation by polysome: theory of ribosome profile on a single mRNA transcript

    Sharma, Ajeet K

    2011-01-01

    The process of polymerizing a protein by a ribosome, using a messenger RNA (mRNA) as the corresponding template, is called {\\it translation}. Ribosome may be regarded as a molecular motor for which the mRNA template serves also as the track. Often several ribosomes may translate the same (mRNA) simultaneously. The ribosomes bound simultaneously to a single mRNA transcript are the members of a polyribosome (or, simply, {\\it polysome}). Experimentally measured {\\it polysome profile} gives the distribution of polysome {\\it sizes}. Recently a breakthrough in determining the instantaneous {\\it positions} of the ribosomes on a given mRNA track has been achieved and the technique is called {\\it ribosome profiling} \\cite{ingolia10,guo10}. Motivated by the success of these techniques, we have studied the spatio-temporal organization of ribosomes by extending a theoretical model that we have reported elsewhere \\cite{sharma11}. This extended version of our model incorporates not only (i) mechano-chemical cycle of indivi...

  16. Impaired Telomere Maintenance and Decreased Canonical WNT Signaling but Normal Ribosome Biogenesis in Induced Pluripotent Stem Cells from X-Linked Dyskeratosis Congenita Patients.

    Gu, Bai-Wei; Apicella, Marisa; Mills, Jason; Fan, Jian-Meng; Reeves, Dara A; French, Deborah; Podsakoff, Gregory M; Bessler, Monica; Mason, Philip J

    2015-01-01

    Dyskeratosis congenita (DC) is an inherited bone marrow failure syndrome characterized by the presence of short telomeres at presentation. Mutations in ten different genes, whose products are involved in the telomere maintenance pathway, have been shown to cause DC. The X-linked form is the most common form of the disease and is caused by mutations in the gene DKC1, encoding the protein dyskerin. Dyskerin is required for the assembly and stability of telomerase and is also involved in ribosomal RNA (rRNA) processing where it converts specific uridines to pseudouridine. DC is thought to result from failure to maintain tissues, like blood, that are renewed by stem cell activity, but research into pathogenic mechanisms has been hampered by the difficulty of obtaining stem cells from patients. We reasoned that induced pluripotent stem (iPS) cells from X-linked DC patients may provide information about the mechanisms involved. Here we describe the production of iPS cells from DC patients with DKC1 mutations Q31E, A353V and ΔL37. In addition we constructed "corrected" lines with a copy of the wild type dyskerin cDNA expressed from the AAVS1 safe harbor locus. We show that in iPS cells with DKC1 mutations telomere maintenance is compromised with short telomere lengths and decreased telomerase activity. The degree to which telomere lengths are affected by expression of telomerase during reprograming, or with ectopic expression of wild type dyskerin, is variable. The recurrent mutation A353V shows the most severe effect on telomere maintenance. A353V cells but not Q31E or ΔL37 cells, are refractory to correction by expression of wild type DKC1 cDNA. Because dyskerin is involved in both telomere maintenance and ribosome biogenesis it has been postulated that defective ribosome biogenesis and translation may contribute to the disease phenotype. Evidence from mouse and zebra fish models has supported the involvement of ribosome biogenesis but primary cells from human

  17. β-Puromycin selection of modified ribosomes for in vitro incorporation of β-amino acids.

    Dedkova, Larisa M; Fahmi, Nour Eddine; Paul, Rakesh; del Rosario, Melissa; Zhang, Liqiang; Chen, Shengxi; Feder, Glen; Hecht, Sidney M

    2012-01-10

    Ribosomally mediated protein biosynthesis is limited to α-L-amino acids. A strong bias against β-L-amino acids precludes their incorporation into proteins in vivo and also in vitro in the presence of misacylated β-aminoacyl-tRNAs. Nonetheless, earlier studies provide some evidence that analogues of aminoacyl-tRNAs bearing β-amino acids can be accommodated in the ribosomal A-site. Both functional and X-ray crystallographic data make it clear that the exclusion of β-L-amino acids as participants in protein synthesis is a consequence of the architecture of the ribosomal peptidyltransferase center (PTC). To enable the reorganization of ribosomal PTC architecture through mutagenesis of 23S rRNA, a library of modified ribosomes having modifications in two regions of the 23S rRNA (2057-2063 and 2496-2507 or 2582-2588) was prepared. A dual selection procedure was used to obtain a set of modified ribosomes able to carry out protein synthesis in the presence β-L-amino acids and to provide evidence for the utilization of such amino acids, in addition to α-L-amino acids. β-Puromycin, a putative mimetic for β-aminoacyl-tRNAs, was used to select modified ribosome variants having altered PTC architectures, thus potentially enabling incorporation of β-L-amino acids. Eight types of modified ribosomes altered within the PTC have been selected by monitoring improved sensitivity to β-puromycin in vivo. Two of the modified ribosomes, having 2057AGCGUGA2063 and 2502UGGCAG2507 or 2502AGCCAG2507, were able to suppress UAG codons in E. coli dihydrofolate reductase (DHFR) and scorpion Opisthorcanthus madagascariensis peptide IsCT mRNAs in the presence of β-alanyl-tRNA(CUA). PMID:22145951

  18. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    James M. Love

    2015-08-01

    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  19. Auxin-induced changes in the incorporation of /sup 3/H-amino acids into soybean ribosomal proteins

    Travis, R.L.; Key, J.L.

    1976-06-01

    Auxin-induced activation of 80S ribosomes and polyribosome formation in mature soybean (Glycine max var. Hawkeye) hypocotyl (R. L. Travis, J. M. Anderson, and J. L. Key. 1973. Plant Physiol. 52: 608-612) in the presence of a mixture of radioactive amino acids correlates with an increased specific radioactivity of at least three ribosomal proteins; the labeling of one of these increased severalfold above the control level. Results of experiments with 5-fluorouracil and cycloheximide indicated that the proteins in question were synthesized in response to auxin and became associated with pre-existing ribosomes. Ribosome dissociation experiments indicated that these proteins were associated with the 60S ribosome subunit.

  20. Impact of P-Site tRNA and antibiotics on ribosome mediated protein folding: studies using the Escherichia coli ribosome.

    Surojit Mondal

    Full Text Available BACKGROUND: The ribosome, which acts as a platform for mRNA encoded polypeptide synthesis, is also capable of assisting in folding of polypeptide chains. The peptidyl transferase center (PTC that catalyzes peptide bond formation resides in the domain V of the 23S rRNA of the bacterial ribosome. Proper positioning of the 3' -CCA ends of the A- and P-site tRNAs via specific interactions with the nucleotides of the PTC are crucial for peptidyl transferase activity. This RNA domain is also the center for ribosomal chaperoning activity. The unfolded polypeptide chains interact with the specific nucleotides of the PTC and are released in a folding competent form. In vitro transcribed RNA corresponding to this domain (bDV RNA also displays chaperoning activity. RESULTS: The present study explores the effects of tRNAs, antibiotics that are A- and P-site PTC substrate analogs (puromycin and blasticidin and macrolide antibiotics (erythromycin and josamycin on the chaperoning ability of the E. coli ribosome and bDV RNA. Our studies using mRNA programmed ribosomes show that a tRNA positioned at the P-site effectively inhibits the ribosome's chaperoning function. We also show that the antibiotic blasticidin (that mimics the interaction between 3'-CCA end of P/P-site tRNA with the PTC is more effective in inhibiting ribosome and bDV RNA chaperoning ability than either puromycin or the macrolide antibiotics. Mutational studies of the bDV RNA could identify the nucleotides U2585 and G2252 (both of which interact with P-site tRNA to be important for its chaperoning ability. CONCLUSION: Both protein synthesis and their proper folding are crucial for maintenance of a functional cellular proteome. The PTC of the ribosome is attributed with both these abilities. The silencing of the chaperoning ability of the ribosome in the presence of P-site bound tRNA might be a way to segregate these two important functions.

  1. Canonical Initiation Factor Requirements of the Myc Family of Internal Ribosome Entry Segments▿ †

    Spriggs, Keith A.; Cobbold, Laura C.; Jopling, Catherine L; Cooper, Rebecca E.; Wilson, Lindsay A; Stoneley, Mark; Coldwell, Mark J; Poncet, Didier; Shen, Ya-Ching; Morley, Simon; Bushell, Martin; Willis, Anne E.

    2009-01-01

    Initiation of protein synthesis in eukaryotes requires recruitment of the ribosome to the mRNA and its translocation to the start codon. There are at least two distinct mechanisms by which this process can be achieved; the ribosome can be recruited either to the cap structure at the 5' end of the message or to an internal ribosome entry segment (IRES), a complex RNA structural element located in the 5' untranslated region (5'-UTR) of the mRNA. However, it is not well understood how cellular I...

  2. Hyperaccurate and error-prone ribosomes exploit distinct mechanisms during tRNA selection

    Zaher, Hani S.; Green, Rachel

    2010-01-01

    Escherichia coli strains displaying hyper-accurate (restrictive) and ribosomal ambiguity (ram) phenotypes have long been associated with alterations in rpsL and rpsD/rpsE, respectively. Crystallographic evidence shows the ribosomal proteins S12 and S4/S5 (corresponding to these genes) to be located in separate regions of the small ribosomal subunit that are important for domain-closure thought to take place during tRNA selection. Mechanistically, the process of tRNA selection is separated int...

  3. Identical ribosomal DNA sequence data from Pfiesteria piscicida (Dinophyceae) isolates with different toxicity phenotypes

    Complete small subunit ribosomal RNA, internal transcribed spacer 1 and 2, 5.8S, and partial large subunit ribosomal RNA gene sequences were generated from multiple isolates of Pfiesteria piscicida. Sequences were derived from isolates that have been shown to be ichthyotoxic as well as isolates that have no history of toxic behavior. All of the sequences generated were identical for the different cultures, and we therefore conclude that differences in toxicity seen between isolates of P. piscicida are linked to factors other than genetic strain variation detectable by ribosomal gene sequence analyses

  4. Properties of the ribosome-inactivating proteins gelonin, Momordica charantia inhibitor, and dianthins.

    Falasca, A; Gasperi-Campani, A; Abbondanza, A; Barbieri, L; Stirpe, F

    1982-12-01

    The amino acid and sugar compositions of four ribosome-inactivating proteins (gelonin, Momordica charantia inhibitor, dianthin 30 and dianthin 32) were determined. The proteins are all basic glycoproteins (pI greater than 8) containing mannose (more abundant in gelonin), glucose, xylose, fucose (absent from gelonin) and glucosamine. The ribosome-inactivating properties of the proteins examined are not modified by pretreatment with N-ethylmaleimide. Precipitating and inactivating antibodies can be raised against ribosome-inactivating proteins; a weak cross-reaction was observed only between dianthin 30 and dianthin 32. PMID:6819861

  5. The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins

    Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech;

    2003-01-01

    The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached to the ribos......The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...... to the ribosome through the P0 protein. The "stalk" is essential for the ribosome activity, taking part in the interaction with elongation factors.In this report, we have shown that the subcellular distribution of the human P proteins does not fall into standard behavior of regular ribosomal proteins. We have...... used two approaches to assess the distribution of the P proteins, in vivo experiments with GFP fusion proteins and in vitro one with anti-P protein antibodies. In contrast to standard r-proteins, the P1 and P2 proteins are not actively transported into the nucleus compartment, remaining predominantly...

  6. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    He, Kaiyu [Department of Microbiology and Molecular Genetics (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Zhou, Hui-Ren [Food Science and Human Nutrition (United States); Pestka, James J., E-mail: pestka@msu.edu [Department of Microbiology and Molecular Genetics (United States); Food Science and Human Nutrition (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States)

    2012-11-15

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  7. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  8. Crystal structures of complexes containing domains from two viral internal ribosome entry site (IRES) RNAs bound to the 70S ribosome

    Zhu, Jianyu; Korostelev, Andrei; Costantino, David A.; Donohue, John P.; Noller, Harry F.; Kieft, Jeffrey S. (UCSC); (Colorado)

    2011-08-24

    Internal ribosome entry site (IRES) RNAs are elements of viral or cellular mRNAs that bypass steps of canonical eukaryotic cap-dependent translation initiation. Understanding of the structural basis of IRES mechanisms is limited, partially due to a lack of high-resolution structures of IRES RNAs bound to their cellular targets. Prompted by the universal phylogenetic conservation of the ribosomal P site, we solved the crystal structures of proposed P site binding domains from two intergenic region IRES RNAs bound to bacterial 70S ribosomes. The structures show that these IRES domains nearly perfectly mimic a tRNA-mRNA interaction. However, there are clear differences in the global shape and position of this IRES domain in the intersubunit space compared to those of tRNA, supporting a mechanism for IRES action that invokes hybrid state mimicry to drive a noncanonical mode of translocation. These structures suggest how relatively small structured RNAs can manipulate complex biological machines.

  9. Assembler for de novo assembly of large genomes

    Chu, Te-Chin; Lu, Chen-Hua; Liu, Tsunglin; Lee, Greg C.; Li, Wen-Hsiung; Shih, Arthur Chun-Chieh

    2013-01-01

    Assembling a large genome faces three challenges: assembly quality, computer memory requirement, and execution time. Our developed assembler, JR-Assembler, uses (a) a strategy that selects good seeds for contig construction, (b) an extension strategy that uses whole sequencing reads to increase the chance to jump over repeats and to expedite extension, and (c) detecting misassemblies by remapping reads to assembled sequences. Compared with current assemblers, JR-Assembler achieves a better ov...

  10. Characterization of the optical constants and dispersion parameters of chalcogenide Te{sub 40}Se{sub 30}S{sub 30} thin film: thickness effect

    Abd-Elrahman, M.I.; Hafiz, M.M.; Qasem, Ammar; Abdel-Rahim, M.A. [Assiut University, Physics Department, Faculty of Science, Assiut (Egypt)

    2016-02-15

    Chalcogenide Te{sub 40}Se{sub 30}S{sub 30} thin films of different thickness (100-450 nm) are prepared by thermal evaporation of the Te{sub 40}Se{sub 30}S{sub 30} bulk. X-ray examination of the film shows some prominent peaks relate to crystalline phases indicating the crystallization process. The calculated particles of crystals from the X-ray diffraction peaks are found to be from 11 to 26 nm. As the thickness increases, the transmittance decreases and the reflectance increases. This could be attributed to the increment of the absorption of photons as more states will be available for absorbance in the case of thicker films. The decrease in the direct band gap with thickness is accompanied with an increase in energy of localized states. The obtained data for the refractive index could be fit to the dispersion model based on the single oscillator equation. The single-oscillator energy decreases, while the dispersion energy increases as the thickness increases. (orig.)

  11. Assembly tool design

    The reactor core of the International Thermonuclear Experimental Reactor (ITER) is assembled with a number of large and asymmetric components within a tight tolerance in order to assure the structural integrity for various loads and to provide the tritium confinement. In addition, the assembly procedure should be compatible with remote operation since the core structures will be activated by 14-MeV neutrons once it starts operation and thus personal access will be prohibited. Accordingly, the assembly procedure and tool design are quite essential and should be designed from the beginning to facilitate remote operation. According to the ITER Design Task Agreement, the Japan Atomic Energy Research Institute (JAERI) has performed design study to develop the assembly procedures and associated tool design for the ITER tokamak assembly. This report describes outlines of the assembly tools and the remaining issues obtained in this design study. (author)

  12. Crucial elements that maintain the interactions between the regulatory TnaC peptide and the ribosome exit tunnel responsible for Trp inhibition of ribosome function.

    Martínez, Allyson K; Shirole, Nitin H; Murakami, Shino; Benedik, Michael J; Sachs, Matthew S; Cruz-Vera, Luis R

    2012-03-01

    Translation of the TnaC nascent peptide inhibits ribosomal activity in the presence of l-tryptophan, inducing expression of the tnaCAB operon in Escherichia coli. Using chemical methylation, this work reveals how interactions between TnaC and the ribosome are affected by mutations in both molecules. The presence of the TnaC-tRNA(Pro) peptidyl-tRNA within the ribosome protects the 23S rRNA nucleotide U2609 against chemical methylation. Such protection was not observed in mutant ribosomes containing changes in 23S rRNA nucleotides of the A748-A752 region. Nucleotides A752 and U2609 establish a base-pair interaction. Most replacements of either A752 or U2609 affected Trp induction of a TnaC-regulated LacZ reporter. However, the single change A752G, or the dual replacements A752G and U2609C, maintained Trp induction. Replacements at the conserved TnaC residues W12 and D16 also abolished the protection of U2609 by TnaC-tRNA(Pro) against chemical methylation. These data indicate that the TnaC nascent peptide in the ribosome exit tunnel interacts with the U2609 nucleotide when the ribosome is Trp responsive. This interaction is affected by mutational changes in exit tunnel nucleotides of 23S rRNA, as well as in conserved TnaC residues, suggesting that they affect the structure of the exit tunnel and/or the nascent peptide configuration in the tunnel. PMID:22110039

  13. Production of ribosome-inactivating protein from hairy root cultures of Luffa cylindrica (L.) Roem.

    di Toppi, L S; Gorini, P; Properzi, G; Barbieri, L; Spanò, L

    1996-09-01

    Transformed root lines of Luffa cylindrica (L.) Roem. (Cucurbitaceae) were established by inoculation of in vitro grown plantlets with wild type Agrobacterium rhizogenes strain 1855. Cloned lines of hairy roots were tested for the presence of ribosome-inactivating proteins; crude extracts inhibited protein synthesis in a reaction mixture based on rabbit reticulocyte lysate. Inhibitory activity increased during culture period, reaching a maximum value in the stationary phase. No activity could be detected in the culture medium, nor in extracts from callus and/or suspension cultures. A ribosome-inactivating protein having specific activity of 62,100 U mg protein(-1) and a molecular mass of 26-28,000 Da was purified to homogeneity. The protein showed N-glycosidase activity on rat liver ribosomes. The results demonstrate that hairy root cultures can be successfully utilized for the in vitro production of ribosome-inactivating proteins. PMID:24178273

  14. Affinity chromatography and capillary electrophoresis for analysis of the yeast ribosomal proteins

    Miriam S. Goyder

    2012-04-01

    Full Text Available We present a top down separation platform for yeast ribosomalproteins using affinity chromatography and capillary electrophoresiswhich is designed to allow deposition of proteins ontoa substrate. FLAG tagged ribosomes were affinity purified, andrRNA acid precipitation was performed on the ribosomes followedby capillary electrophoresis to separate the ribosomalproteins. Over 26 peaks were detected with excellent reproducibility(<0.5% RSD migration time. This is the first reportedseparation of eukaryotic ribosomal proteins using capillaryelectrophoresis. The two stages in this workflow, affinity chromatographyand capillary electrophoresis, share the advantagesthat they are fast, flexible and have small sample requirementsin comparison to more commonly used techniques. This methodis a remarkably quick route from cell to separation that hasthe potential to be coupled to high throughput readout platformsfor studies of the ribosomal proteome. [BMB reports2012; 45(4: 233-238

  15. Changes in ribosomal proteins in wheat embryos in the course of grain development and maturation

    Stanisław Weidner

    2014-02-01

    Full Text Available It was found, by comparing the densitometric profiles of ribosomal proteins of wheat embryos in milk and full grain ripeness, that in the process of development and ripening of caryopses the percentual proportion of low molecular weight proteins increases at the cost of those of high molecular weight. This concerns both acidic and basic proteins. In electrophoretic separation of ribosomal proteins from embryos of fully ripe seeds by the method of two-dimensional electrophoresis the appearance of three new low molecular weight proteins - an acidic one and two basic ones - was observed. These proteins were not found in the embryos of caryopses of milk ripeness. These results indicate that with development and ripening of wheat caryopses new low molecular weight ribosomal proteins are built into the ribosomes in the embryo. These changes are both quantitative and qualitative.

  16. Generation of monoclonal antibodies for the assessment of protein purification by recombinant ribosomal coupling

    Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk;

    2005-01-01

    We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23....... We therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could...... purified by Protein G Sepharose affinity chromatography. The purified antibodies were used to evaluate the separation of ribosomes from GFP, streptavidin, murine interleukin-6, a phagedisplay antibody and yeast elongation factor 1A by centrifugation, when ribosomes with covalently coupled target protein...

  17. Study of the Ribosomal Stress Pathway in Pluripotency, Cancer and Disease

    Morgado Palacín, Lucía

    2016-01-01

    Tesis Doctoral inédita leída en la Universidad Autónoma de Madrid, Facultad de Ciencias, Departamento de Biología Molecular La vía de estrés ribosomal se describió hace más de una década como una nueva vía activadora de p53. Dicha vía monitoriza la homeostasis de la biogénesis ribosomal. Perturbaciones en cualquiera de las etapas de la biosíntesis del ribosoma, transcripción del DNA ribosomal, procesamiento del RNA ribosomal, ensamblaje o transporte nuclear, conllevan un exceso de prote...

  18. Molecular basis for the ribosome functioning as an L-tryptophan sensor.

    Bischoff, Lukas; Berninghausen, Otto; Beckmann, Roland

    2014-10-23

    Elevated levels of the free amino acid L-tryptophan (L-Trp) trigger expression of the tryptophanase tnaCAB operon in E. coli. Activation depends on tryptophan-dependent ribosomal stalling during translation of the upstream TnaC peptide. Here, we present a cryoelectron microscopy (cryo-EM) reconstruction at 3.8 Å resolution of a ribosome stalled by the TnaC peptide. Unexpectedly, we observe two L-Trp molecules in the ribosomal exit tunnel coordinated within composite hydrophobic pockets formed by the nascent TnaC peptide and the tunnel wall. As a result, the peptidyl transferase center (PTC) adopts a distinct conformation that precludes productive accommodation of release factor 2 (RF2), thereby inducing translational stalling. Collectively, our results demonstrate how the translating ribosome can act as a small molecule sensor for gene regulation. PMID:25310980

  19. Molecular Basis for the Ribosome Functioning as an L-Tryptophan Sensor

    Lukas Bischoff

    2014-10-01

    Full Text Available Elevated levels of the free amino acid L-tryptophan (L-Trp trigger expression of the tryptophanase tnaCAB operon in E. coli. Activation depends on tryptophan-dependent ribosomal stalling during translation of the upstream TnaC peptide. Here, we present a cryoelectron microscopy (cryo-EM reconstruction at 3.8 Å resolution of a ribosome stalled by the TnaC peptide. Unexpectedly, we observe two L-Trp molecules in the ribosomal exit tunnel coordinated within composite hydrophobic pockets formed by the nascent TnaC peptide and the tunnel wall. As a result, the peptidyl transferase center (PTC adopts a distinct conformation that precludes productive accommodation of release factor 2 (RF2, thereby inducing translational stalling. Collectively, our results demonstrate how the translating ribosome can act as a small molecule sensor for gene regulation.

  20. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position. PMID:26926435

  1. The human mitochondrial ribosome recycling factor is essential for cell viability.

    Rorbach, J.; Richter, R.; Wessels, H.J.; Wydro, M.; Pekalski, M.; Farhoud, M.; Kuhl, I.; Gaisne, M.; Bonnefoy, N.; Smeitink, J.A.M.; Lightowlers, R.N.; Chrzanowska-Lightowlers, Z.M.

    2008-01-01

    The molecular mechanism of human mitochondrial translation has yet to be fully described. We are particularly interested in understanding the process of translational termination and ribosome recycling in the mitochondrion. Several candidates have been implicated, for which subcellular localization

  2. Phosphorylation in vivo of non-ribosomal proteins from native 40 S ribosomal particles of Krebs II mouse ascites-tumour cells

    Schuck, J; Reichert, G; Issinger, O G

    1981-01-01

    Four non-ribosomal proteins from native 40 S ribosomal subunits with mol.wts. of 110 000, 84 000, 68 000 and 26 000 were phosphorylated in vivo when ascites cells were incubated in the presence of [32P]Pi. The 110 000-, 84 000- and 26 000-dalton proteins are identical with phosphorylated products...... from native 40 S subunits after phosphorylation in vitro by a cyclic nucleotide-independent protein kinase. Phosphoserine was the major phosphorylated amino acid of the proteins phosphorylated in vivo and in vitro....

  3. Automated genome mining of ribosomal peptide natural products

    Mohimani, Hosein; Kersten, Roland; Liu, Wei; Wang, Mingxun; Purvine, Samuel O.; Wu, Si; Brewer, Heather M.; Pasa-Tolic, Ljiljana; Bandeira, Nuno; Moore, Bradley S.; Pevzner, Pavel A.; Dorrestein, Pieter C.

    2014-07-31

    Ribosomally synthesized and posttranslationally modified peptides (RiPPs), especially from microbial sources, are a large group of bioactive natural products that are a promising source of new (bio)chemistry and bioactivity (1). In light of exponentially increasing microbial genome databases and improved mass spectrometry (MS)-based metabolomic platforms, there is a need for computational tools that connect natural product genotypes predicted from microbial genome sequences with their corresponding chemotypes from metabolomic datasets. Here, we introduce RiPPquest, a tandem mass spectrometry database search tool for identification of microbial RiPPs and apply it for lanthipeptide discovery. RiPPquest uses genomics to limit search space to the vicinity of RiPP biosynthetic genes and proteomics to analyze extensive peptide modifications and compute p-values of peptide-spectrum matches (PSMs). We highlight RiPPquest by connection of multiple RiPPs from extracts of Streptomyces to their gene clusters and by the discovery of a new class III lanthipeptide, informatipeptin, from Streptomyces viridochromogenes DSM 40736 as the first natural product to be identified in an automated fashion by genome mining. The presented tool is available at cy-clo.ucsd.edu.

  4. Visualization of ribosomal RNA operon copy number distribution

    DasGupta Indrani

    2009-09-01

    Full Text Available Abstract Background Results of microbial ecology studies using 16S rRNA sequence information can be deceiving due to differences in rRNA operon copy number and genome size of the detected organisms. It therefore will be useful for investigators to have a better understanding of how these two parameters differ in various organism types. In this study, the number of ribosomal operons and genome size were separately mapped onto a Bacterial phylogenetic tree. Results A representative Bacterial tree was constructed using 31 marker genes found in 578 bacterial genome sequences. Organism names are displayed on the trees using graduations of color such that similar colors indicate similar numbers of operons or genome size. The resulting images provide an intuitive understanding of how copy number and genome size vary in different Bacterial phyla. Conclusion Once the phylogenetic position of a novel organism is known the number of rRNA operons, and to a lesser extent the genome size, can be estimated by examination of the colored maps. Further detail can then be obtained for members of relevant taxa from the rrnDB database.

  5. Folding and escape of nascent proteins at ribosomal exit tunnel

    Bui, Phuong Thuy; Hoang, Trinh Xuan

    2016-03-01

    We investigate the interplay between post-translational folding and escape of two small single-domain proteins at the ribosomal exit tunnel by using Langevin dynamics with coarse-grained models. It is shown that at temperatures lower or near the temperature of the fastest folding, folding proceeds concomitantly with the escape process, resulting in vectorial folding and enhancement of foldability of nascent proteins. The concomitance between the two processes, however, deteriorates as temperature increases. Our folding simulations as well as free energy calculation by using umbrella sampling show that, at low temperatures, folding at the tunnel follows one or two specific pathways without kinetic traps. It is shown that the escape time can be mapped to a one-dimensional diffusion model with two different regimes for temperatures above and below the folding transition temperature. Attractive interactions between amino acids and attractive sites on the tunnel wall lead to a free energy barrier along the escape route of the protein. It is suggested that this barrier slows down the escape process and consequently promotes correct folding of the released nascent protein.

  6. Ribosome reinitiation at leader peptides increases translation of bacterial proteins.

    Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A

    2016-01-01

    Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well. PMID:27084079

  7. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides.

    Doi, Yohei; Arakawa, Yoshichika

    2007-07-01

    Methylation of 16S ribosomal RNA (rRNA) has recently emerged as a new mechanism of resistance against aminoglycosides among gram-negative pathogens belonging to the family Enterobacteriaceae and glucose-nonfermentative microbes, including Pseudomonas aeruginosa and Acinetobacter species. This event is mediated by a newly recognized group of 16S rRNA methylases, which share modest similarity to those produced by aminoglycoside-producing actinomycetes. Their presence confers a high level of resistance to all parenterally administered aminoglycosides that are currently in clinical use. The responsible genes are mostly located on transposons within transferable plasmids, which provides them with the potential to spread horizontally and may in part explain the already worldwide distribution of this novel resistance mechanism. Some of these organisms have been found to coproduce extended-spectrum beta-lactamases or metallo-beta-lactamases, contributing to their multidrug-resistant phenotypes. A 2-tiered approach, consisting of disk diffusion tests followed by confirmation with polymerase chain reaction, is recommended for detection of 16S rRNA methylase-mediated resistance. PMID:17554708

  8. Target Assembly Facility

    Federal Laboratory Consortium — The Target Assembly Facility integrates new armor concepts into actual armored vehicles. Featuring the capability ofmachining and cutting radioactive materials, it...

  9. Composite turbine bucket assembly

    Liotta, Gary Charles; Garcia-Crespo, Andres

    2014-05-20

    A composite turbine blade assembly includes a ceramic blade including an airfoil portion, a shank portion and an attachment portion; and a transition assembly adapted to attach the ceramic blade to a turbine disk or rotor, the transition assembly including first and second transition components clamped together, trapping said ceramic airfoil therebetween. Interior surfaces of the first and second transition portions are formed to mate with the shank portion and the attachment portion of the ceramic blade, and exterior surfaces of said first and second transition components are formed to include an attachment feature enabling the transition assembly to be attached to the turbine rotor or disk.

  10. Assembly of ISX

    Durfee, N.W.

    1977-01-01

    The Impurity Study Experiment, a moderate size tokamak, was recently assembled at ORNL. Demountable toroidal field coils allowed for the assembly of major components at remote locations and rapid installation into ISX. A discharge cleaning plasma was generated in ISX six weeks after the arrival of the final toroidal field coil. A chronological summary of the assembly is presented, emphasizing features designed to aid in assembly and maintenance. A cross-section of the machine showing the major mechanical components to be discussed is given.

  11. Sensitivity of ribosomes of the hyperthermophilic bacterium Aquifex pyrophilus to aminoglycoside antibiotics.

    Bocchetta, M; Huber, R.; Cammarano, P

    1996-01-01

    A poly(U)-programmed cell-free system from the hyperthermophilic bacterium Aquifex pyrophilus has been developed, and the susceptibility of Aquifex ribosomes to the miscoding-inducing and inhibitory actions of all known classes of aminoglycoside antibiotics has been assayed at temperatures (75 to 80 degrees C) close to the physiological optimum for cell growth. Unlike Thermotoga maritima ribosomes, which are systematically refractory to all known classes of aminoglycoside compounds (P. Londei...

  12. KIF4 Mediates Anterograde Translocation and Positioning of Ribosomal Constituents to Axons*S⃞

    Bisbal, Mariano; Wojnacki, José; Peretti, Diego; Ropolo, Andrea; Sesma, Juliana; Jausoro, Ignacio; Cáceres, Alfredo

    2009-01-01

    In this study, we have used a combination of biochemical and molecular biology techniques to demonstrate that the C-terminal tail domain of KIF4 directly interacts with P0, a major protein component of ribosomes. Besides, in dorsal root ganglion neurons, KIF4 and P0, as well as other ribosomal constituents, colocalize in clusters distributed along axons and neuritic tips. RNA interference suppression of KIF4 or expression of KIF4 variants lacking the tail domain or mut...

  13. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis.

    Felske, A; B. Engelen; Nübel, U; Backhaus, H

    1996-01-01

    A simple method that combines an adapted ribosome isolation method and a common RNA extraction step has been developed for selective recovery of intact rRNA from natural microbial communities in soil. After mechanical cell lysis, ribosomes are separated by centrifugation steps, avoiding massive humic acid contamination and RNA degradation. The protocol accommodates the complex composition of soils by blocking adsorbing surfaces and humic acids with polyvinylpyrrolidone and bovine serum albumi...

  14. Cytoplasmic long noncoding RNAs are frequently bound to and degraded at ribosomes in human cells

    Carlevaro-Fita, Joana; Rahim, Anisa; Guigó, Roderic; Vardy, Leah A.; Johnson, Rory

    2016-01-01

    Recent footprinting studies have made the surprising observation that long noncoding RNAs (lncRNAs) physically interact with ribosomes. However, these findings remain controversial, and the overall proportion of cytoplasmic lncRNAs involved is unknown. Here we make a global, absolute estimate of the cytoplasmic and ribosome-associated population of stringently filtered lncRNAs in a human cell line using polysome profiling coupled to spike-in normalized microarray analysis. Fifty-four percent ...

  15. Internal ribosome entry sequence-mediated translation initiation triggers nonsense-mediated decay

    Holbrook, Jill A; Neu-Yilik, Gabriele; Gehring, Niels H; Kulozik, Andreas E.; Hentze, Matthias W.

    2006-01-01

    In eukaryotes, a surveillance pathway known as nonsense-mediated decay (NMD) regulates the abundance of messenger RNAs containing premature termination codons (PTCs). In mammalian cells, it has been asserted that the NMD-relevant first round of translation is special and involves initiation by a specific protein heterodimer, the nuclear cap-binding complex (CBC). Arguing against a requirement for CBC-mediated translation initiation, we show that ribosomal recruitment by the internal ribosomal...

  16. Tight binding of clarithromycin, its 14-(R)-hydroxy metabolite, and erythromycin to Helicobacter pylori ribosomes.

    Goldman, R.C. (Robert C.); Zakula, D; Flamm, R; Beyer, J; Capobianco, J.

    1994-01-01

    Clarithromycin is a recently approved macrolide with improved pharmacokinetics, antibacterial activity, and efficacy in treating bacterial infections including those caused by Helicobacter pylori, an agent implicated in various forms of gastric disease. We successfully isolated ribosomes from H. pylori and present the results of a study of their interaction with macrolides. Kinetic data were obtained by using 14C-labeled macrolides to probe the ribosomal binding site. Clarithromycin, its pare...

  17. Evidence that ribosomal protein S10 participates in control of transcription termination.

    Friedman, D I; Schauer, A T; Baumann, M R; Baron, L S; Adhya, S L

    1981-01-01

    We report the isolation of an Escherichia coli K-12 strain with a mutation, nusE71, that results in a change in ribosomal protein S10. Phage lambda fails to grow in hosts carrying the nusE71 mutation because the lambda N gene product is not active. The N product regulates phage gene expression by altering transcription complexes so that they can overcome termination barriers. This suggests that a ribosomal protein is involved in antitermination of transcription.

  18. Method of assembling nuclear fuel assembly

    Thin films are formed to the surface of a fuel rod for preventing the occurrence of injuries at the surface of the fuel rod. That is, in a method of assembling a nuclear fuel assembly by inserting fuel rods into lattice cells of a support lattice, thin films of polyvinyl alcohol are formed to a predetermined thickness at the surface of each of the fuel rods and, after insertion of the fuel rods into the lattice cells, the nuclear fuel assemblies are dipped into water or steams to dissolve and remove the thin films. Since polyvinyl alcohol is noncombustible and not containing nuclear inhibitive material as the ingredient, they cause no undesired effects on plant facilities even if not completely removed from the fuel rods. The polyvinyl alcohol thin films have high strength and can sufficiently protect the fuel rod. Further, scraping damages caused by support members of the support lattice upon insertion can also be prevented. (T.M.)

  19. Metabolism of ribosomal proteins microinjected into the oocytes of Xenopus laevis

    When the total proteins from Xenopus laevis 60 S ribosomal subunits (TP60) were 3H-labeled in vitro and injected back into X. laevis oocytes, most 3H-TP60 are integrated into the cytoplasmic 60 S subunits via the nucleus during 16 h of incubation. In the oocytes whose rRNA synthesis is inhibited, 3H-TP60 are rapidly degraded with a half-life of 2-3 h. This degradation ceased as soon as rRNA synthesis was resumed, suggesting that ribosomal proteins unassociated with nascent rRNA are unstable in the oocytes. The degradation of 3H-TP60 in the absence of RNA synthesis was inhibited by iodoacetamide, a cysteine protease inhibitor, resulting in the accumulation of 3H-TP60 in the nucleus reaching about a threefold concentration in the cytoplasm. Considering the results with enucleated oocytes, we suggest that the X. laevis nucleus has a limited capacity to accumulate ribosomal proteins in an active manner but that those ribosomal proteins accumulated in excess over rRNA synthesis are degraded by a cysteine protease in the nucleus. By contrast, ribosomal proteins from Escherichia coli only equilibrate between the nucleus and the cytoplasm and are degraded by serine protease(s) in the cytoplasm without being integrated in the form of ribosomes in the nucleus

  20. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    Paul B. Essers

    2015-01-01

    Full Text Available The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs from normal strains of Caenorhabditis elegans to those carrying the life-extending daf-2 mutation. We found a long noncoding RNA (lncRNA, transcribed telomeric sequence 1 (tts-1, on ribosomes of the daf-2 mutant. Depleting tts-1 in daf-2 mutants increases ribosome levels and significantly shortens their extended lifespan. We find tts-1 is also required for the longer lifespan of the mitochondrial clk-1 mutants but not the feeding-defective eat-2 mutants. In line with this, the clk-1 mutants express more tts-1 and fewer ribosomes than the eat-2 mutants. Our results suggest that the expression of tts-1 functions in different longevity pathways to reduce ribosome levels in a way that promotes life extension.

  1. Structure determination of archaea-specific ribosomal protein L46a reveals a novel protein fold

    Feng, Yingang, E-mail: fengyg@qibebt.ac.cn [Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, Shandong 266101 (China); Song, Xiaxia [Department of Biological Science and Engineering, School of Chemical and Biological Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Lin, Jinzhong [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Xuan, Jinsong [Department of Biological Science and Engineering, School of Chemical and Biological Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Cui, Qiu [Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, Shandong 266101 (China); Wang, Jinfeng [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China)

    2014-07-18

    Highlights: • The archaea-specific ribosomal protein L46a has no homology to known proteins. • Three dimensional structure and backbone dynamics of L46a were determined by NMR. • The structure of L46a represents a novel protein fold. • A potential rRNA-binding surface on L46a was identified. • The potential position of L46a on the ribosome was proposed. - Abstract: Three archaea-specific ribosomal proteins recently identified show no sequence homology with other known proteins. Here we determined the structure of L46a, the most conserved one among the three proteins, from Sulfolobus solfataricus P2 using NMR spectroscopy. The structure presents a twisted β-sheet formed by the N-terminal part and two helices at the C-terminus. The L46a structure has a positively charged surface which is conserved in the L46a protein family and is the potential rRNA-binding site. Searching homologous structures in Protein Data Bank revealed that the structure of L46a represents a novel protein fold. The backbone dynamics identified by NMR relaxation experiments reveal significant flexibility at the rRNA binding surface. The potential position of L46a on the ribosome was proposed by fitting the structure into a previous electron microscopy map of the ribosomal 50S subunit, which indicated that L46a contacts to domain I of 23S rRNA near a multifunctional ribosomal protein L7ae.

  2. Structure determination of archaea-specific ribosomal protein L46a reveals a novel protein fold

    Highlights: • The archaea-specific ribosomal protein L46a has no homology to known proteins. • Three dimensional structure and backbone dynamics of L46a were determined by NMR. • The structure of L46a represents a novel protein fold. • A potential rRNA-binding surface on L46a was identified. • The potential position of L46a on the ribosome was proposed. - Abstract: Three archaea-specific ribosomal proteins recently identified show no sequence homology with other known proteins. Here we determined the structure of L46a, the most conserved one among the three proteins, from Sulfolobus solfataricus P2 using NMR spectroscopy. The structure presents a twisted β-sheet formed by the N-terminal part and two helices at the C-terminus. The L46a structure has a positively charged surface which is conserved in the L46a protein family and is the potential rRNA-binding site. Searching homologous structures in Protein Data Bank revealed that the structure of L46a represents a novel protein fold. The backbone dynamics identified by NMR relaxation experiments reveal significant flexibility at the rRNA binding surface. The potential position of L46a on the ribosome was proposed by fitting the structure into a previous electron microscopy map of the ribosomal 50S subunit, which indicated that L46a contacts to domain I of 23S rRNA near a multifunctional ribosomal protein L7ae

  3. Novel Accurate Bacterial Discrimination by MALDI-Time-of-Flight MS Based on Ribosomal Proteins Coding in S10-spc-alpha Operon at Strain Level S10-GERMS

    Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki

    2013-08-01

    Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.

  4. Ribosomal protein methylation in Escherichia coli: the gene prmA, encoding the ribosomal protein L11 methyltransferase, is dispensable.

    Vanet, A; Plumbridge, J A; Guérin, M F; Alix, J H

    1994-12-01

    The prmA gene, located at 72 min on the Escherichia coli chromosome, is the genetic determinant of ribosomal protein L11-methyltransferase activity. Mutations at this locus, prmA1 and prmA3, result in a severely undermethylated form of L11. No effect, other than the lack of methyl groups on L11, has been ascribed to these mutations. DNA sequence analysis of the mutant alleles prmA1 and prmA3 detected point mutations near the C-terminus of the protein and plasmids overproducing the wild-type and the two mutant proteins have been constructed. The wild-type PrmA protein could be crosslinked to its radiolabelled substrate, S-adenosyl-L-methionine (SAM), by u.v. irradiation indicating that it is the gene for the methyltransferase rather than a regulatory protein. One of the mutant proteins, PrmA3, was also weakly crosslinked to SAM. Both mutant enzymes when expressed from the overproducing plasmids were capable of catalysing the incorporation of 3H-labelled methyl groups from SAM to L11 in vitro. This confirmed the observation that the mutant proteins possess significant residual activity which could account for their lack of growth phenotype. However, a strain carrying an in vitro-constructed null mutation of the prmA gene, transferred to the E. coli chromosome by homologous recombination, was perfectly viable. PMID:7715456

  5. Reactor fuel assemblies

    A description is given of an improved spacer grid for a nuclear fuel assembly comprising fuel rods in a matrix wherein each rod is adapted to be enclosed by a spacer ''cell'' for positioning thereof relative to adjacent rods in the fuel assembly. 7 claims, 12 drawing figures

  6. Extending reference assembly models

    Church, Deanna M.; Schneider, Valerie A.; Steinberg, Karyn Meltz;

    2015-01-01

    The human genome reference assembly is crucial for aligning and analyzing sequence data, and for genome annotation, among other roles. However, the models and analysis assumptions that underlie the current assembly need revising to fully represent human sequence diversity. Improved analysis tools...

  7. Laser bottom hole assembly

    Underwood, Lance D; Norton, Ryan J; McKay, Ryan P; Mesnard, David R; Fraze, Jason D; Zediker, Mark S; Faircloth, Brian O

    2014-01-14

    There is provided for laser bottom hole assembly for providing a high power laser beam having greater than 5 kW of power for a laser mechanical drilling process to advance a borehole. This assembly utilizes a reverse Moineau motor type power section and provides a self-regulating system that addresses fluid flows relating to motive force, cooling and removal of cuttings.

  8. Fuel Assembly Damping Summary

    This paper summary the fuel assembly damping data in air/in still water/under flow, released from foreign fuel vendors, compared our data with the published data. Some technical issues in fuel assembly damping measurement testing are also briefly discussed. Understanding of each fuel assembly damping mechanisms according to the surrounding medium and flow velocity can support the fuel design improvement in fuel assembly dynamics and structural integrity aspect. Because the upgraded requirements of the newly-developed advanced reactor system will demands to minimize fuel design margin in integrity evaluation, reduction in conservatism of fuel assembly damping can contribute to alleviate the fuel design margin for sure. Damping is an energy dissipation mechanism in a vibrating mechanical structure and prevents a resonant structure from having infinite vibration amplitudes. The sources of fuel assembly damping are various from support friction to flow contribution, and it can be increased by the viscosity or drag of surrounding fluid medium or the average velocity of water flowing. Fuel licensing requires fuel design evaluation in transient or accidental condition. Dynamic response analysis of fuel assembly is to show fuel integrity and requires information on assembly-wise damping in dry condition and under wet or water flowing condition. However, damping measurement test for the full-scale fuel assembly prototype is not easy to carry out because of the scale (fuel prototype, test facility), unsteadiness of test data (scattering, random sampling and processing), instrumentation under water flowing (water-proof response measurement), and noise. LWR fuel technology division in KAERI is preparing the infra structure for damping measurement test of full-scale fuel assembly, to support fuel industries and related research activities. Here is a preliminary summary of fuel assembly damping, published in the literature. Some technical issues in fuel assembly damping

  9. Self-assembled nanostructures

    Zhang, Jin Z; Liu, Jun; Chen, Shaowei; Liu, Gang-yu

    2003-01-01

    Nanostructures refer to materials that have relevant dimensions on the nanometer length scales and reside in the mesoscopic regime between isolated atoms and molecules in bulk matter. These materials have unique physical properties that are distinctly different from bulk materials. Self-Assembled Nanostructures provides systematic coverage of basic nanomaterials science including materials assembly and synthesis, characterization, and application. Suitable for both beginners and experts, it balances the chemistry aspects of nanomaterials with physical principles. It also highlights nanomaterial-based architectures including assembled or self-assembled systems. Filled with in-depth discussion of important applications of nano-architectures as well as potential applications ranging from physical to chemical and biological systems, Self-Assembled Nanostructures is the essential reference or text for scientists involved with nanostructures.

  10. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka;

    2012-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several...

  11. Mimicking Ribosomal Unfolding of RNA Pseudoknot in a Protein Channel.

    Zhang, Xinyue; Xu, Xiaojun; Yang, Zhiyu; Burcke, Andrew J; Gates, Kent S; Chen, Shi-Jie; Gu, Li-Qun

    2015-12-23

    Pseudoknots are a fundamental RNA tertiary structure with important roles in regulation of mRNA translation. Molecular force spectroscopic approaches such as optical tweezers can track the pseudoknot's unfolding intermediate states by pulling the RNA chain from both ends, but the kinetic unfolding pathway induced by this method may be different from that in vivo, which occurs during translation and proceeds from the 5' to 3' end. Here we developed a ribosome-mimicking, nanopore pulling assay for dissecting the vectorial unfolding mechanism of pseudoknots. The pseudoknot unfolding pathway in the nanopore, either from the 5' to 3' end or in the reverse direction, can be controlled by a DNA leader that is attached to the pseudoknot at the 5' or 3' ends. The different nanopore conductance between DNA and RNA translocation serves as a marker for the position and structure of the unfolding RNA in the pore. With this design, we provided evidence that the pseudoknot unfolding is a two-step, multistate, metal ion-regulated process depending on the pulling direction. Most notably, unfolding in both directions is rate-limited by the unzipping of the first helix domain (first step), which is Helix-1 in the 5' → 3' direction and Helix-2 in the 3' → 5' direction, suggesting that the initial unfolding step in either pulling direction needs to overcome an energy barrier contributed by the noncanonical triplex base-pairs and coaxial stacking interactions for the tertiary structure stabilization. These findings provide new insights into RNA vectorial unfolding mechanisms, which play an important role in biological functions including frameshifting. PMID:26595106

  12. The ribosome as a missing link in prebiotic evolution II: Ribosomes encode ribosomal proteins that bind to common regions of their own mRNAs and rRNAs.

    Root-Bernstein, Robert; Root-Bernstein, Meredith

    2016-05-21

    We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their

  13. Abiotic Stress Resistance, a Novel Moonlighting Function of Ribosomal Protein RPL44 in the Halophilic Fungus Aspergillus glaucus

    LIU, XIAO-DAN; Xie, Lixia; Wei, Yi; Zhou, Xiaoyang; Jia, Baolei; Liu, Jinliang; Zhang, Shihong

    2014-01-01

    Ribosomal proteins are highly conserved components of basal cellular organelles, primarily involved in the translation of mRNA leading to protein synthesis. However, certain ribosomal proteins moonlight in the development and differentiation of organisms. In this study, the ribosomal protein L44 (RPL44), associated with salt resistance, was screened from the halophilic fungus Aspergillus glaucus (AgRPL44), and its activity was investigated in Saccharomyces cerevisiae and Nicotiana tabacum. Se...

  14. Physical, meteorological, and other data from FIXED PLATFORMS from the TOGA Area - Pacific (30 N to 30 S) as part of the Tropical Ocean Global Atmosphere (TOGA) project from 01 January 1991 to 31 December 1991 (NODC Accession 9200024)

    National Oceanic and Atmospheric Administration, Department of Commerce — Physical, meteorological, and other data were collected from FIXED PLATFORMS in the TOGA Area - Pacific (30 N to 30 S) from 01 January 1991 to 31 December 1991....

  15. Current meter data from moored current meter casts and other instruments in the TOGA Area - Pacific Ocean (30 N to 30 S) from 01 January 1992 - 17 February 1993 (NODC Accession 9600019)

    National Oceanic and Atmospheric Administration, Department of Commerce — Current meter data were collected using moored current meter casts and other instruments in the TOGA Area - Pacific Ocean (30 N to 30 S) from January 1, 1992 to...

  16. Current meter data from moored current meter casts and other instruments in the TOGA Area - Pacific Ocean (30 N to 30 S) from 03 November 1992 - 05 December 1992 (NODC Accession 9600018)

    National Oceanic and Atmospheric Administration, Department of Commerce — Current meter data were collected using moored current meter casts and other instruments in the TOGA Area - Pacific Ocean (30 N to 30 S) from November 3, 1992 to...

  17. Current meter data from moored current meter casts in the TOGA area - Pacific (30 N to 30 S) as part of the Ocean Thermal Energy Conversion (OTEC) project from 27 December 1980 - 26 June 1986 (NODC Accession 9400011)

    National Oceanic and Atmospheric Administration, Department of Commerce — Current meter data were collected using moored current meter casts in the TOGA Area - Pacific (30 N to 30 S) from December 27, 1980 to June 26, 1986. Data were...

  18. Wind and temperature data from current meter in the TOGA - Pacific Ocean (30 N to 30 S) as part of the Equatorial Pacific Ocean Climate Studies (EPOCS), 28 May 1994 to 21 March 1995 (NODC Accession 9800041)

    National Oceanic and Atmospheric Administration, Department of Commerce — Wind and temperature data were collected using current meter in the TOGA Area - Pacific Ocean (30 N to 30 S) from May 28, 1994 to March 21, 1995. Data were...

  19. Current meter data from moored current meter casts in the TOGA Area - Pacific (30 N to 30 S) as part of the Equatorial Pacific Ocean Climate Studies (EPOCS) project from 16 April 1984 - 01 October 1985 (NODC Accession 8700147)

    National Oceanic and Atmospheric Administration, Department of Commerce — Current meter data were collected using moored current meter casts in the TOGA Area - Pacific (30 N to 30 S) from April 16, 1984 to October 1, 1985. Data were...

  20. Current meter data from moored current meter casts in the TOGA Area - Pacific (30 N to 30 S) as part of the Equatorial Pacific Ocean Climate Studies (EPOCS) project from 01 May 1987 to 05 May 1987 (NODC Accession 9000211)

    National Oceanic and Atmospheric Administration, Department of Commerce — Current meter data were collected using moored current meter casts in the TOGA Area - Pacific (30 N to 30 S) from 01 May 1987 to 06 August 1988. Data were submitted...

  1. Nuclear fuel assembly

    A nuclear fuel assembly includes and upper yoke, a base, an elongated, outer flow channel disposed substantially along the entire length of the fuel assembly and an elongated, internal, central water cross, formed by four, elongated metal angles, that divides the nuclear fuel assembly into four, separate, elongated fuel sections and that provides a centrally disposed path for the flow of subcooled neutron moderator along the length of the fuel assembly. A separate fuel bundle is located in each of the four fuel sections and includes an upper tie plate, a lower tie plate and a plurality of elongated fuel rods disposed therebetween. Preferably, each upper tie plate is formed from a plurality of interconnected thin metal bars and includes an elongated, axially extending pin that is received by the upper yoke of the fuel assembly for restraining lateral motion of the fuel bundle while permitting axial movement of the fuel bundle with respect to the outer flow channel. The outer flow channel is fixedly secured at its opposite longitudinal ends to the upper yoke and to the base to permit the fuel assembly to be lifted and handled in a vertical position without placing lifting loads or stresses on the fuel rods. The yoke, removably attached at the upper end of the fuel assembly to four structural ribs secured to the inner walls of the outer flow channel, includes, as integrally formed components, a lifting bail or handle, laterally extending bumpers, a mounting post for a spring assembly, four elongated apertures for receiving with a slip fit the axially extending pins mounted on the upper tie plates and slots for receiving the structural ribs secured to the outer flow channel. Locking pins securely attach the yoke to the structural ribs enabling the fuel assembly to be lifted as an entity

  2. DC source assemblies

    Campbell, Jeremy B; Newson, Steve

    2013-02-26

    Embodiments of DC source assemblies of power inverter systems of the type suitable for deployment in a vehicle having an electrically grounded chassis are provided. An embodiment of a DC source assembly comprises a housing, a DC source disposed within the housing, a first terminal, and a second terminal. The DC source also comprises a first capacitor having a first electrode electrically coupled to the housing, and a second electrode electrically coupled to the first terminal. The DC source assembly further comprises a second capacitor having a first electrode electrically coupled to the housing, and a second electrode electrically coupled to the second terminal.

  3. The insect pathogen Serratia marcescens Db10 uses a hybrid non-ribosomal peptide synthetase-polyketide synthase to produce the antibiotic althiomycin.

    Amy J Gerc

    Full Text Available There is a continuing need to discover new bioactive natural products, such as antibiotics, in genetically-amenable micro-organisms. We observed that the enteric insect pathogen, Serratia marcescens Db10, produced a diffusible compound that inhibited the growth of Bacillis subtilis and Staphyloccocus aureus. Mapping the genetic locus required for this activity revealed a putative natural product biosynthetic gene cluster, further defined to a six-gene operon named alb1-alb6. Bioinformatic analysis of the proteins encoded by alb1-6 predicted a hybrid non-ribosomal peptide synthetase-polyketide synthase (NRPS-PKS assembly line (Alb4/5/6, tailoring enzymes (Alb2/3 and an export/resistance protein (Alb1, and suggested that the machinery assembled althiomycin or a related molecule. Althiomycin is a ribosome-inhibiting antibiotic whose biosynthetic machinery had been elusive for decades. Chromatographic and spectroscopic analyses confirmed that wild type S. marcescens produced althiomycin and that production was eliminated on disruption of the alb gene cluster. Construction of mutants with in-frame deletions of specific alb genes demonstrated that Alb2-Alb5 were essential for althiomycin production, whereas Alb6 was required for maximal production of the antibiotic. A phosphopantetheinyl transferase enzyme required for althiomycin biosynthesis was also identified. Expression of Alb1, a predicted major facilitator superfamily efflux pump, conferred althiomycin resistance on another, sensitive, strain of S. marcescens. This is the first report of althiomycin production outside of the Myxobacteria or Streptomyces and paves the way for future exploitation of the biosynthetic machinery, since S. marcescens represents a convenient and tractable producing organism.

  4. An RNA-binding complex involved in ribosome biogenesis contains a protein with homology to tRNA CCA-adding enzyme.

    Jinzhong Lin

    2013-10-01

    Full Text Available A multitude of proteins and small nucleolar RNAs transiently associate with eukaryotic ribosomal RNAs to direct their modification and processing and the assembly of ribosomal proteins. Utp22 and Rrp7, two interacting proteins with no recognizable domain, are components of the 90S preribosome or the small subunit processome that conducts early processing of 18S rRNA. Here, we determine the cocrystal structure of Utp22 and Rrp7 complex at 1.97 Å resolution and the NMR structure of a C-terminal fragment of Rrp7, which is not visible in the crystal structure. The structure reveals that Utp22 surprisingly resembles a dimeric class I tRNA CCA-adding enzyme yet with degenerate active sites, raising an interesting evolutionary connection between tRNA and rRNA processing machineries. Rrp7 binds extensively to Utp22 using a deviant RNA recognition motif and an extended linker. Functional sites on the two proteins were identified by structure-based mutagenesis in yeast. We show that Rrp7 contains a flexible RNA-binding C-terminal tail that is essential for association with preribosomes. RNA-protein crosslinking shows that Rrp7 binds at the central domain of 18S rRNA and shares a neighborhood with two processing H/ACA snoRNAs snR30 and snR10. Depletion of snR30 prevents the stable assembly of Rrp7 into preribosomes. Our results provide insight into the evolutionary origin and functional context of Utp22 and Rrp7.

  5. A two-step binding model proposed for the electrostatic interactions of ricin A chain with ribosomes

    Li, Xiao-Ping; Chiou, Jia-Chi; Remacha, Miguel; Ballesta, Juan P.G.; Tumer, Nilgun E.

    2009-01-01

    Ricin is a ribosome inactivating protein that catalytically removes a universally conserved adenine from the α-sarcin/ricin loop (SRL) of the 28S rRNA. We recently showed that ricin A chain (RTA) interacts with the P1 and P2 proteins of the ribosomal stalk to depurinate the SRL in yeast. Here we examined the interaction of RTA with wild type and mutant yeast ribosomes deleted in the stalk proteins by surface plasmon resonance. The interaction between RTA and wild type ribosomes did not follow...

  6. Chromatin dynamics of plant telomeres and ribosomal genes

    Dvořáčková, Martina; Fojtová, Miloslava; Fajkus, Jiří

    2015-01-01

    Roč. 83, č. 1 (2015), s. 18-37. ISSN 0960-7412 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0068; GA ČR(CZ) GA13-06943S; GA ČR(CZ) GP13-11563P Grant ostatní: GA ČR(CZ) GAP501/11/0289 Institutional support: RVO:68081707 Keywords : HISTONE VARIANT H3.3 * ASSEMBLY FACTOR-I * REPLICATION FORK PROGRESSION Subject RIV: BO - Biophysics Impact factor: 5.972, year: 2014

  7. Cytoplasmic long noncoding RNAs are frequently bound to and degraded at ribosomes in human cells.

    Carlevaro-Fita, Joana; Rahim, Anisa; Guigó, Roderic; Vardy, Leah A; Johnson, Rory

    2016-06-01

    Recent footprinting studies have made the surprising observation that long noncoding RNAs (lncRNAs) physically interact with ribosomes. However, these findings remain controversial, and the overall proportion of cytoplasmic lncRNAs involved is unknown. Here we make a global, absolute estimate of the cytoplasmic and ribosome-associated population of stringently filtered lncRNAs in a human cell line using polysome profiling coupled to spike-in normalized microarray analysis. Fifty-four percent of expressed lncRNAs are detected in the cytoplasm. The majority of these (70%) have >50% of their cytoplasmic copies associated with polysomal fractions. These interactions are lost upon disruption of ribosomes by puromycin. Polysomal lncRNAs are distinguished by a number of 5' mRNA-like features, including capping and 5'UTR length. On the other hand, nonpolysomal "free cytoplasmic" lncRNAs have more conserved promoters and a wider range of expression across cell types. Exons of polysomal lncRNAs are depleted of endogenous retroviral insertions, suggesting a role for repetitive elements in lncRNA localization. Finally, we show that blocking of ribosomal elongation results in stabilization of many associated lncRNAs. Together these findings suggest that the ribosome is the default destination for the majority of cytoplasmic long noncoding RNAs and may play a role in their degradation. PMID:27090285

  8. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  9. Mammalian mitochondrial ribosomal small subunit (MRPS) genes: A putative role in human disease.

    Gopisetty, Gopal; Thangarajan, Rajkumar

    2016-09-01

    Mitochondria are prominently understood as power houses producing ATP the primary energy currency of the cell. However, mitochondria are also known to play an important role in apoptosis and autophagy, and mitochondrial dysregulation can lead to pathological outcomes. Mitochondria are known to contain 1500 proteins of which only 13 are coded by mitochondrial DNA and the rest are coded by nuclear genes. Protein synthesis in mitochondria involves mitochondrial ribosomes which are 55-60S particles and are composed of small 28S and large 39S subunits. A feature of mammalian mitoribosome which differentiate it from bacterial ribosomes is the increased protein content. The human mitochondrial ribosomal protein (MRP) gene family comprises of 30 genes which code for mitochondrial ribosomal small subunit and 50 genes for the large subunit. The present review focuses on the mitochondrial ribosomal small subunit genes (MRPS), presents an overview of the literature and data gleaned from publicly available gene and protein expression databases. The survey revealed aberrations in MRPS gene expression patterns in varied human diseases indicating a putative role in their etiology. PMID:27170550

  10. Structural analysis of a signal peptide inside the ribosome tunnel by DNP MAS NMR.

    Lange, Sascha; Franks, W Trent; Rajagopalan, Nandhakishore; Döring, Kristina; Geiger, Michel A; Linden, Arne; van Rossum, Barth-Jan; Kramer, Günter; Bukau, Bernd; Oschkinat, Hartmut

    2016-08-01

    Proteins are synthesized in cells by ribosomes and, in parallel, prepared for folding or targeting. While ribosomal protein synthesis is progressing, the nascent chain exposes amino-terminal signal sequences or transmembrane domains that mediate interactions with specific interaction partners, such as the signal recognition particle (SRP), the SecA-adenosine triphosphatase, or the trigger factor. These binding events can set the course for folding in the cytoplasm and translocation across or insertion into membranes. A distinction of the respective pathways depends largely on the hydrophobicity of the recognition sequence. Hydrophobic transmembrane domains stabilize SRP binding, whereas less hydrophobic signal sequences, typical for periplasmic and outer membrane proteins, stimulate SecA binding and disfavor SRP interactions. In this context, the formation of helical structures of signal peptides within the ribosome was considered to be an important factor. We applied dynamic nuclear polarization magic-angle spinning nuclear magnetic resonance to investigate the conformational states of the disulfide oxidoreductase A (DsbA) signal peptide stalled within the exit tunnel of the ribosome. Our results suggest that the nascent chain comprising the DsbA signal sequence adopts an extended structure in the ribosome with only minor populations of helical structure. PMID:27551685

  11. Structural characterization of ribosome recruitment and translocation by type IV IRES.

    Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S

    2016-01-01

    Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts tvhe otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation. PMID:27159451

  12. Ribosome collisions and translation efficiency: optimization by codon usage and mRNA destabilization.

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen

    2008-09-26

    Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of mRNA breakdown is offset by the concomitant increase in translation efficiency. PMID:18619977

  13. Cytoplasmic long noncoding RNAs are frequently bound to and degraded at ribosomes in human cells

    Carlevaro-Fita, Joana; Rahim, Anisa; Guigó, Roderic; Vardy, Leah A.; Johnson, Rory

    2016-01-01

    Recent footprinting studies have made the surprising observation that long noncoding RNAs (lncRNAs) physically interact with ribosomes. However, these findings remain controversial, and the overall proportion of cytoplasmic lncRNAs involved is unknown. Here we make a global, absolute estimate of the cytoplasmic and ribosome-associated population of stringently filtered lncRNAs in a human cell line using polysome profiling coupled to spike-in normalized microarray analysis. Fifty-four percent of expressed lncRNAs are detected in the cytoplasm. The majority of these (70%) have >50% of their cytoplasmic copies associated with polysomal fractions. These interactions are lost upon disruption of ribosomes by puromycin. Polysomal lncRNAs are distinguished by a number of 5′ mRNA-like features, including capping and 5′UTR length. On the other hand, nonpolysomal “free cytoplasmic” lncRNAs have more conserved promoters and a wider range of expression across cell types. Exons of polysomal lncRNAs are depleted of endogenous retroviral insertions, suggesting a role for repetitive elements in lncRNA localization. Finally, we show that blocking of ribosomal elongation results in stabilization of many associated lncRNAs. Together these findings suggest that the ribosome is the default destination for the majority of cytoplasmic long noncoding RNAs and may play a role in their degradation. PMID:27090285

  14. Detecting ricin: sensitive luminescent assay for ricin A-chain ribosome depurination kinetics.

    Sturm, Matthew B; Schramm, Vern L

    2009-04-15

    Ricin is a family member of the lethal ribosome-inactivating proteins (RIP) found in plants. Ricin toxin A-chain (RTA) from castor beans catalyzes the hydrolytic depurination of a single base from a GAGA tetraloop of eukaryotic rRNA to release a single adenine from the sarcin-ricin loop (SRL). Protein synthesis is inhibited by loss of the elongation factor binding site resulting in cell death. We report a sensitive coupled assay for the measurement of adenine released from ribosomes or small stem-loop RNAs by RTA catalysis. Adenine phosphoribosyl transferase (APRTase) and pyruvate orthophosphate dikinase (PPDK) convert adenine to ATP for quantitation by firefly luciferase. The resulting AMP is cycled to ATP to give sustained luminescence proportional to adenine concentration. Subpicomole adenine quantitation permits the action of RTA on eukaryotic ribosomes to be followed in continuous, high-throughput assays. Facile analysis of RIP catalytic activity will have applications in plant toxin detection, inhibitor screens, mechanistic analysis of depurinating agents on oligonucleotides and intact ribosomes, and in cancer immunochemotherapy. Kinetic analysis of the catalytic action of RTA on rabbit reticulocyte 80S ribosomes establishes a catalytic efficiency of 2.6 x 10(8) M(-1) s(-1), a diffusion limited reaction indicating catalytic perfection even with large reactants. PMID:19364139

  15. Ribosome-associated pentatricopeptide repeat proteins function as translational activators in mitochondria of trypanosomes.

    Aphasizheva, Inna; Maslov, Dmitri A; Qian, Yu; Huang, Lan; Wang, Qi; Costello, Catherine E; Aphasizhev, Ruslan

    2016-03-01

    Mitochondrial ribosomes of Trypanosoma brucei are composed of 9S and 12S rRNAs, eubacterial-type ribosomal proteins, polypeptides lacking discernible motifs and approximately 20 pentatricopeptide repeat (PPR) RNA binding proteins. Several PPRs also populate the polyadenylation complex; among these, KPAF1 and KPAF2 function as general mRNA 3' adenylation/uridylation factors. The A/U-tail enables mRNA binding to the small ribosomal subunit and is essential for translation. The presence of A/U-tail also correlates with requirement for translation of certain mRNAs in mammalian and insect parasite stages. Here, we inquired whether additional PPRs activate translation of individual mRNAs. Proteomic analysis identified KRIPP1 and KRIPP8 as components of the small ribosomal subunit in mammalian and insect forms, but also revealed their association with the polyadenylation complex in the latter. RNAi knockdowns demonstrated essential functions of KRIPP1 and KRIPP8 in the actively respiring insect stage, but not in the mammalian stage. In the KRIPP1 knockdown, A/U-tailed mRNA encoding cytochrome c oxidase subunit 1 declined concomitantly with the de novo synthesis of this subunit whereas polyadenylation and translation of cyb mRNA were unaffected. In contrast, the KRIPP8 knockdown inhibited A/U-tailing and translation of both CO1 and cyb mRNAs. Our findings indicate that ribosome-associated PPRs may selectively activate mRNAs for translation. PMID:26713541

  16. Ribosome profiling reveals features of normal and disease-associated mitochondrial translation

    Rooijers, Koos; Loayza-Puch, Fabricio; Nijtmans, Leo G.; Agami, Reuven

    2013-12-01

    Mitochondria are essential cellular organelles for generation of energy and their dysfunction may cause diabetes, Parkinson’s disease and multi-systemic failure marked by failure to thrive, gastrointestinal problems, lactic acidosis and early lethality. Disease-associated mitochondrial mutations often affect components of the mitochondrial translation machinery. Here we perform ribosome profiling to measure mitochondrial translation at nucleotide resolution. Using a protocol optimized for the retrieval of mitochondrial ribosome protected fragments (RPFs) we show that the size distribution of wild-type mitochondrial RPFs follows a bimodal distribution peaking at 27 and 33 nucleotides, which is distinct from the 30-nucleotide peak of nuclear RPFs. Their cross-correlation suggests generation of mitochondrial RPFs during ribosome progression. In contrast, RPFs from patient-derived mitochondria mutated in tRNA-Tryptophan are centered on tryptophan codons and reduced downstream, indicating ribosome stalling. Intriguingly, long RPFs are enriched in mutated mitochondria, suggesting they characterize stalled ribosomes. Our findings provide the first model for translation in wild-type and disease-triggering mitochondria.

  17. Expression of Muscle-Specific Ribosomal Protein L3-Like Impairs Myotube Growth.

    Chaillou, Thomas; Zhang, Xiping; McCarthy, John J

    2016-09-01

    The ribosome has historically been considered to have no cell-specific function but rather serve in a "housekeeping" capacity. This view is being challenged by evidence showing that heterogeneity in the protein composition of the ribosome can lead to the functional specialization of the ribosome. Expression profiling of different tissues revealed that ribosomal protein large 3-like (Rpl3l) is exclusively expressed in striated muscle. In response to a hypertrophic stimulus, Rpl3l expression in skeletal muscle was significantly decreased by 82% whereas expression of the ubiquitous paralog Rpl3 was significantly increased by ∼fivefold. Based on these findings, we developed the hypothesis that Rpl3l functions as a negative regulator of muscle growth. To test this hypothesis, we used the Tet-On system to express Rpl3l in myoblasts during myotube formation. In support of our hypothesis, RPL3L expression significantly impaired myotube growth as assessed by myotube diameter (-23%) and protein content (-14%). Further analysis showed that the basis of this impairment was caused by a significant decrease in myoblast fusion as the fusion index was significantly lower (-17%) with RPL3L expression. These findings are the first evidence to support the novel concept of ribosome specialization in skeletal muscle and its role in the regulation of skeletal muscle growth. J. Cell. Physiol. 231: 1894-1902, 2016. © 2015 Wiley Periodicals, Inc. PMID:26684695

  18. Self-Assembly of Nanocomponents into Composite Structures: Derivation and Simulation of Langevin Equations

    Pankavich, Stephen; Miao, Yinglong; Ortoleva, Peter

    2010-01-01

    The kinetics of the self-assembly of nanocomponents into a virus, nanocapsule, or other composite structure is analyzed via a multiscale approach. The objective is to achieve predictability and to preserve key atomic-scale features that underlie the formation and stability of the composite structures. We start with an all-atom description, the Liouville equation, and the order parameters characterizing nanoscale features of the system. An equation of Smoluchowski type for the stochastic dynamics of the order parameters is derived from the Liouville equation via a multiscale perturbation technique. The self-assembly of composite structures from nanocomponents with internal atomic structure is analyzed and growth rates are derived. Applications include the assembly of a viral capsid from capsomers, a ribosome from its major subunits, and composite materials from fibers and nanoparticles. Our approach overcomes errors in other coarse-graining methods which neglect the influence of the nanoscale configuration on ...

  19. Regulatory elements of Caenorhabditis elegans ribosomal protein genes

    Sleumer Monica C

    2012-08-01

    Full Text Available Abstract Background Ribosomal protein genes (RPGs are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from

  20. Characterization of ribosomal DNA (rDNA in Drosophila arizonae

    Francisco Javier Tovar

    2000-06-01

    Full Text Available Ribosomal DNA (rDNA is a multigenic family composed of one or more clusters of repeating units (RU. Each unit consists of highly conserved sequences codifying 18S, 5.8S and 28S rRNA genes intercalated with poorly conserved regulatory sequences between species. In this work, we analyzed the rDNA of Drosophila arizonae, a member of the mulleri complex (Repleta group. Using genomic restriction patterns, cloning and mapping of some representative rDNA fragments, we were able to construct a representative restriction map. RU in this species are 13.5-14 kb long, restriction sites are completely conserved compared with other drosophilids and the rDNA has an R1 retrotransposable element in some RU. We were unable to detect R2 elements in this species.O DNA ribossômico (rDNA é uma família multigênica composta de um ou mais aglomerados de unidades de repetição (RU. Cada unidade consiste de seqüências altamente conservadas que codificam os rRNAs 18S, 5.8S e 28S, intercaladas com seqüências regulatórias pouco conservadas entre as espécies. Neste trabalho analisamos o rDNA de Drosophila arizonae, um membro do complexo mulleri (grupo Repleta. Usando padrões de restrição genômicos, clonagem e mapeamento de alguns fragmentos de rDNA representativos, estabelecemos um mapa de restrição do rDNA representativo desta espécie. Neste drosofilídeo, a RU tem um tamanho médio de 13.5-14 kb e os sítios de restrição estão completamente conservados com relação a outras drosófilas. Além disto, este rDNA possui um elemento transponível tipo R1 presente em algumas unidades. Neste trabalho não tivemos evidências da presença de elementos R2 no rDNA desta espécie.

  1. Nuclear reactor spacer assembly

    A fuel assembly for a nuclear reactor is disclosed wherein the fuel element receiving and supporting grid is comprised of a first metal, the guide tubes which pass through the grid assembly are comprised of a second metal and the grid is supported on the guide tubes by means of expanded sleeves located intermediate the grid and guide tubes. The fuel assembly is fabricated by inserting the sleeves, of initial outer diameter commensurate with the guide tube outer diameters, through the holes in the grid assembly provided for the guide tubes and thereafter expanding the sleeves radially outwardly along their entire length such that the guide tubes can subsequently be passed through the sleeves. The step of radial expansion, as a result of windows provided in the sleeves having dimensions commensurate with the geometry of the grid, mechanically captures the grid and simultaneously preloads the sleeve against the grid whereby relative motion between the grid and guide tube will be precluded

  2. Spent fuel assembly hardware

    When spent nuclear fuel is disposed of in a repository, the waste package will include the spent fuel assembly hardware, the structural portion of the fuel assembly, and the fuel pins. The spent fuel assembly hardware is the subject of this paper. The basic constituent parts of the fuel assembly will be described with particular attention on the materials used in their construction. The results of laboratory analyses performed to determine radionuclide inventories and trace impurities also will be described. Much of this work has been incorporated into a US Department of Energy (DOE) database maintained by Oak Ridge National Laboratory (ORNL). This database is documented in DOE/RW-0184 and can be obtained from Karl Notz at ORNL. The database provides a single source for information regarding wastes that may be sent to the repository

  3. Steam separator latch assembly

    Challberg, Roy C.; Kobsa, Irvin R.

    1994-01-01

    A latch assembly removably joins a steam separator assembly to a support flange disposed at a top end of a tubular shroud in a nuclear reactor pressure vessel. The assembly includes an annular head having a central portion for supporting the steam separator assembly thereon, and an annular head flange extending around a perimeter thereof for supporting the head to the support flange. A plurality of latches are circumferentially spaced apart around the head flange with each latch having a top end, a latch hook at a bottom end thereof, and a pivot support disposed at an intermediate portion therebetween and pivotally joined to the head flange. The latches are pivoted about the pivot supports for selectively engaging and disengaging the latch hooks with the support flange for fixedly joining the head to the shroud or for allowing removal thereof.

  4. Assemblies of gold icosahedra

    Bilalbegovic, G.

    2004-01-01

    Low-dimensional free-standing aggregates of bare gold clusters are studied by the molecular dynamics simulation. Icosahedra of 55 and 147 atoms are equilibrated at T=300 K. Then, their one- and two-dimensional assemblies are investigated. It is found that icosahedra do not coalescence into large drops, but stable amorphous nanostructures are formed: nanowires for one-dimensional and nanofilms for two-dimensional assemblies. The high-temperature stability of these nanostructures is also invest...

  5. High speed door assembly

    Shapiro, C.

    1991-12-31

    This invention is comprised of a high speed door assembly, comprising an actuator cylinder and piston rods, a pressure supply cylinder and fittings, an electrically detonated explosive bolt, a honeycomb structured door, a honeycomb structured decelerator, and a structural steel frame encasing the assembly to close over a 3 foot diameter opening within 50 milliseconds of actuation, to contain hazardous materials and vapors within a test fixture.

  6. Fuel assembly reconstitution

    Fuel failures have been happened in Nuclear Power Plants worldwide, without lost of integrity and safety, mainly for the public, environment and power plants workers. The most common causes of these events are corrosion (CRUD), fretting and pellet cladding interaction. These failures are identified by increasing the activity of fission products, verified by chemical analyses of reactor coolant. Through these analyses, during the fourth operation cycle of Angra 2 Nuclear Power Plant, was possible to observe fuel failure indication. This indication was confirmed in the end of the cycle during the unloading of reactor core through leakage tests of fuel assembly, using the equipment called 'In Mast Sipping' and 'Box Sipping'. After confirmed, the fuel assembly reconstitution was scheduled, and happened in April, 2007, where was identified the cause and the fuel rod failure, which was substitute by dummy rods (zircaloy). The cause was fretting by 'debris'. The actions to avoid and prevent fuel assemblies failures are important. The goals of this work are to describe the methodology of fuel assembly reconstitution using the FARE (Fuel Assembly Reconstitution Equipment) system, to describe the results of this task in economic and security factors of the company and show how the fuel assembly failures are identified during operation and during the outage. (author)

  7. Polymer Directed Protein Assemblies

    Patrick van Rijn

    2013-05-01

    Full Text Available Protein aggregation and protein self-assembly is an important occurrence in natural systems, and is in some form or other dictated by biopolymers. Very obvious influences of biopolymers on protein assemblies are, e.g., virus particles. Viruses are a multi-protein assembly of which the morphology is dictated by poly-nucleotides namely RNA or DNA. This “biopolymer” directs the proteins and imposes limitations on the structure like the length or diameter of the particle. Not only do these bionanoparticles use polymer-directed self-assembly, also processes like amyloid formation are in a way a result of directed protein assembly by partial unfolded/misfolded biopolymers namely, polypeptides. The combination of proteins and synthetic polymers, inspired by the natural processes, are therefore regarded as a highly promising area of research. Directed protein assembly is versatile with respect to the possible interactions which brings together the protein and polymer, e.g., electrostatic, v.d. Waals forces or covalent conjugation, and possible combinations are numerous due to the large amounts of different polymers and proteins available. The protein-polymer interacting behavior and overall morphology is envisioned to aid in clarifying protein-protein interactions and are thought to entail some interesting new functions and properties which will ultimately lead to novel bio-hybrid materials.

  8. Nuevo esquema estratigráfico para los depósitos marinos mio-pliocenos del área de Navidad (33º00'-34º30'S, Chile central New stratigrafic scheme for the Mio-Pliocene marine deposits of the Navidad area (33º00'-34º30'S, central Chile

    Alfonso Encinas

    2006-07-01

    Full Text Available Varios autores han propuesto diferentes esquemas estratigráficos para los depósitos sedimentarios neógenos marinos que afloran en la zona costera de Chile central entre Valparaíso (~33°00'S y Punta Topocalma (~34°30'S, sin que exista un consenso al respecto. Tampoco existe acuerdo respecto a las correlaciones entre los depósitos que afloran en la parte norte de dicha zona, entre Valparaíso y San Antonio (~33°30'S con aquellos que aparecen en la parte sur, entre San Antonio y Punta Topocalma. Sobre la base de nuevos estudios estratigráficos, sedimentológicos y paleontológicos se propone, de manera formal, un nuevo esquema estratigráfico para estos depósitos. De acuerdo con este nuevo esquema se definen la Formación Navidad (Mioceno Superior-Plioceno Inferior y las formaciones Licancheu, Rapel y La Cueva (Plioceno. Se propone la elevación de las tres primeras unidades (Navidad, Licancheu y Rapel, generalmente consideradas como miembros en clasificaciones anteriores, al rango de formaciones debido a que se encuentran separadas por discontinuidades (paraconformidades de escala regional. En el presente trabajo se definen estas unidades, se revisan los esquemas anteriores y se justifica la proposición de este nuevo esquemaDifferent stratigraphic schemes have been proposed by various authors for the Neogene marine sedimentary deposits cropping out along the central Chilean coast between Valparaíso (~33°00'S and Punta Topocalma (~34°30'S, without any consensus having been reached. Neither does any agreement exist with respect to the correlation between the deposits cropping out in the northern part of this area, between San Antonio (~33°30'S and Valparaíso, and those of the southern part, between San Antonio and Punta Topocalma. Based on new stratigraphic, sedimentologic and paleontologic studies we propose a formal, new stratigraphic classification for this area. According to this scheme we define the Navidad Formation (Upper

  9. Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23S ribosomal RNA

    Douthwaite, S

    1992-01-01

    Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli ribosomes has been compared by chemical footprinting. The protection afforded by both drugs is limited to the peptidyl transferase loop of 23S rRNA. Under conditions of stoichiometric binding at 1 mM drug concentration...... in vitro, both drugs strongly protect 23S rRNA bases A2058 and A2451 from dimethyl sulphate and G2505 from kethoxal modification; G2061 is also weakly protected from kethoxal. The modification patterns differ in that A2059 is additionally protected by clindamycin but not by lincomycin. The affinity...... of the two drugs for the ribosome, estimated by footprinting, is approximately the same, giving Kdiss values of 5 microM for lincomycin and 8 microM for clindamycin. The results show that in vitro the drugs are equally potent in blocking their ribosomal target site. Their inhibitory effects on...

  10. Mechanism of Tetracycline Resistance by Ribosomal Protection Protein Tet(O)

    Li, Wen; Atkinson, Gemma C.; Thakor, Nehal S.; Allas, Ülar; Lu, Chuao-chao; Chan, Kwok-Yan; Tenson, Tanel; Schulten, Klaus; Wilson, Kevin S.; Hauryliuk, Vasili; Frank, Joachim

    2013-01-01

    Tetracycline resistance protein Tet(O), which protects the bacterial ribosome from binding the antibiotic tetracycline, is a translational GTPase with significant similarity in both sequence and structure to the elongation factor EF-G. Here, we present an atomic model of the Tet(O)-bound 70S ribosome based on our cryo-electron microscopic reconstruction at 9.6 Å resolution. This atomic model allowed us to identify the Tet(O)-ribosome binding sites, which involve three characteristic loops in domain 4 of Tet(O). Replacements of the three-amino acid tips of these loops by a single glycine residue result in loss of Tet(O)-mediated tetracycline resistance. On the basis of these findings, the mechanism of Tet(O)-mediated tetracycline resistance can be explained in molecular detail. PMID:23403578

  11. Research Techniques Made Simple: Bacterial 16S Ribosomal RNA Gene Sequencing in Cutaneous Research.

    Jo, Jay-Hyun; Kennedy, Elizabeth A; Kong, Heidi H

    2016-03-01

    Skin serves as a protective barrier and also harbors numerous microorganisms collectively comprising the skin microbiome. As a result of recent advances in sequencing (next-generation sequencing), our understanding of microbial communities on skin has advanced substantially. In particular, the 16S ribosomal RNA gene sequencing technique has played an important role in efforts to identify the global communities of bacteria in healthy individuals and patients with various disorders in multiple topographical regions over the skin surface. Here, we describe basic principles, study design, and a workflow of 16S ribosomal RNA gene sequencing methodology, primarily for investigators who are not familiar with this approach. This article will also discuss some applications and challenges of 16S ribosomal RNA sequencing as well as directions for future development. PMID:26902128

  12. Amicoumacin A induces cancer cell death by targeting the eukaryotic ribosome

    Prokhorova, Irina V.; Akulich, Kseniya A.; Makeeva, Desislava S.; Osterman, Ilya A.; Skvortsov, Dmitry A.; Sergiev, Petr V.; Dontsova, Olga A.; Yusupova, Gulnara; Yusupov, Marat M.; Dmitriev, Sergey E.

    2016-01-01

    Amicoumacin A is an antibiotic that was recently shown to target bacterial ribosomes. It affects translocation and provides an additional contact interface between the ribosomal RNA and mRNA. The binding site of amicoumacin A is formed by universally conserved nucleotides of rRNA. In this work, we showed that amicoumacin A inhibits translation in yeast and mammalian systems by affecting translation elongation. We determined the structure of the amicoumacin A complex with yeast ribosomes at a resolution of 3.1  Å. Toxicity measurement demonstrated that human cancer cell lines are more susceptible to the inhibition by this compound as compared to non-cancerous ones. This might be used as a starting point to develop amicoumacin A derivatives with clinical value. PMID:27296282

  13. Developmentally regulated phosphorylation-dephosphorylation of ribosomal proteins from maize embryonic axes

    Previous work in our lab suggests translational control during maize germination. To test this possibility the present research focuses on the phosphorylated status of the ribosomal proteins of maize axes during germination. Ribosomes from embryonic axes incubated for different periods were in vitro or in vivo labeled by 1h-pulse for 32P orthophosphate. Electrophoretic analysis of the ribosomal proteins and autoradiographs revealed: (a) in vitro, several 32P bands and very similar patterns for all stages tested (0 to 24h); in vivo, less number of labeled bands and a changing pattern from 3 to 24h of incubation. A protein of 30,900 MW did not appear phosphorylated until 8h of incubation, while a 17,000 MW protein was strongly labeled at 3h and fastly dephosphorylated toward 24h. Phosphorylated proteins belong to both the small and the large subunits. The implication of this process will be discussed

  14. The Listeria monocytogenes hibernation-promoting factor is required for the formation of 100S ribosomes, optimal fitness, and pathogenesis.

    Kline, Benjamin C; McKay, Susannah L; Tang, William W; Portnoy, Daniel A

    2015-02-01

    During exposure to certain stresses, bacteria dimerize pairs of 70S ribosomes into translationally silent 100S particles in a process called ribosome hibernation. Although the biological roles of ribosome hibernation are not completely understood, this process appears to represent a conserved and adaptive response that contributes to optimal survival during stress and post-exponential-phase growth. Hibernating ribosomes are formed by the activity of one or more highly conserved proteins; gammaproteobacteria produce two relevant proteins, ribosome modulation factor (RMF) and hibernation promoting factor (HPF), while most Gram-positive bacteria produce a single, longer HPF protein. Here, we report the formation of 100S ribosomes by an HPF homolog in Listeria monocytogenes. L. monocytogenes 100S ribosomes were observed by sucrose density gradient centrifugation of bacterial extracts during mid-logarithmic phase, peaked at the transition to stationary phase, and persisted at lower levels during post-exponential-phase growth. 100S ribosomes were undetectable in bacteria carrying an hpf::Himar1 transposon insertion, indicating that HPF is required for ribosome hibernation in L. monocytogenes. Additionally, epitope-tagged HPF cosedimented with 100S ribosomes, supporting its previously described direct role in 100S formation. We examined hpf mRNA by quantitative PCR (qPCR) and identified several conditions that upregulated its expression, including carbon starvation, heat shock, and exposure to high concentrations of salt or ethanol. Survival of HPF-deficient bacteria was impaired under certain conditions both in vitro and during animal infection, providing evidence for the biological relevance of 100S ribosome formation. PMID:25422304

  15. Human Assisted Assembly Processes

    CALTON,TERRI L.; PETERS,RALPH R.

    2000-01-01

    Automatic assembly sequencing and visualization tools are valuable in determining the best assembly sequences, but without Human Factors and Figure Models (HFFMs) it is difficult to evaluate or visualize human interaction. In industry, accelerating technological advances and shorter market windows have forced companies to turn to an agile manufacturing paradigm. This trend has promoted computerized automation of product design and manufacturing processes, such as automated assembly planning. However, all automated assembly planning software tools assume that the individual components fly into their assembled configuration and generate what appear to be a perfectly valid operations, but in reality the operations cannot physically be carried out by a human. Similarly, human figure modeling algorithms may indicate that assembly operations are not feasible and consequently force design modifications; however, if they had the capability to quickly generate alternative assembly sequences, they might have identified a feasible solution. To solve this problem HFFMs must be integrated with automated assembly planning to allow engineers to verify that assembly operations are possible and to see ways to make the designs even better. Factories will very likely put humans and robots together in cooperative environments to meet the demands for customized products, for purposes including robotic and automated assembly. For robots to work harmoniously within an integrated environment with humans the robots must have cooperative operational skills. For example, in a human only environment, humans may tolerate collisions with one another if they did not cause much pain. This level of tolerance may or may not apply to robot-human environments. Humans expect that robots will be able to operate and navigate in their environments without collisions or interference. The ability to accomplish this is linked to the sensing capabilities available. Current work in the field of cooperative

  16. An update on complex I assembly: the assembly of players

    Vartak, Rasika S.; Semwal, Manpreet Kaur; Bai, Yidong

    2014-01-01

    Defects in Complex I assembly is one of the emerging underlying causes of severe mitochondrial disorders. The assembly of Complex I has been difficult to understand due to its large size, dual genetic control and the number of proteins involved. Mutations in Complex I subunits as well as assembly factors have been reported to hinder its assembly and give rise to a range of mitochondria disorders. In this review, we summarize the recent progress made in understanding the Complex I assembly pat...

  17. RNA transcription modulates phase transition-driven nuclear body assembly.

    Berry, Joel; Weber, Stephanie C; Vaidya, Nilesh; Haataja, Mikko; Brangwynne, Clifford P

    2015-09-22

    Nuclear bodies are RNA and protein-rich, membraneless organelles that play important roles in gene regulation. The largest and most well-known nuclear body is the nucleolus, an organelle whose primary function in ribosome biogenesis makes it key for cell growth and size homeostasis. The nucleolus and other nuclear bodies behave like liquid-phase droplets and appear to condense from the nucleoplasm by concentration-dependent phase separation. However, nucleoli actively consume chemical energy, and it is unclear how such nonequilibrium activity might impact classical liquid-liquid phase separation. Here, we combine in vivo and in vitro experiments with theory and simulation to characterize the assembly and disassembly dynamics of nucleoli in early Caenorhabditis elegans embryos. In addition to classical nucleoli that assemble at the transcriptionally active nucleolar organizing regions, we observe dozens of "extranucleolar droplets" (ENDs) that condense in the nucleoplasm in a transcription-independent manner. We show that growth of nucleoli and ENDs is consistent with a first-order phase transition in which late-stage coarsening dynamics are mediated by Brownian coalescence and, to a lesser degree, Ostwald ripening. By manipulating C. elegans cell size, we change nucleolar component concentration and confirm several key model predictions. Our results show that rRNA transcription and other nonequilibrium biological activity can modulate the effective thermodynamic parameters governing nucleolar and END assembly, but do not appear to fundamentally alter the passive phase separation mechanism. PMID:26351690

  18. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  19. Lithium- and boron-bearing brines in the Central Andes: exploring hydrofacies on the eastern Puna plateau between 23° and 23°30'S

    Steinmetz, R. L. López

    2016-04-01

    Internally drained basins of the Andean Plateau are lithium- and boron-bearing systems. The exploration of ionic facies and parental links in a playa lake located in the eastern Puna (23°-23°30'S) was assessed by hydrochemical determinations of residual brines, feed waters and solutions from weathered rocks. Residual brines have been characterized by the Cl- (SO4 =)/Na+ (K+) ratio. Residual brines from the playa lake contain up to 450 mg/l of boron and up to 125 mg/l of lithium, and the Las Burras River supplies the most concentrated boron (20 mg/l) and lithium (3.75 mg/l) inflows of the basin. The hydro-geochemical assessment allowed for the identification of three simultaneous sources of boron: (1) inflow originating from granitic areas of the Aguilar and Tusaquillas ranges; (2) weathering of the Ordovician basement; and (3) boron-rich water from the Las Burras River. Most of the lithium input of the basin is likely generated by present geothermal sources rather than by weathering and leaching of ignimbrites and plutonic rocks. However, XRD analyses of playa lake sediments revealed the presence of lithian micas of clastic origin, including taeniolite and eucriptite. This study is the first to document these rare Li-micas from the Puna basin. Thus, both residual brines and lithian micas contribute to the total Li content in the studied hydrologic system.

  20. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  1. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling

    Jones, Joshua D.; Chung, Betty Y.-W.; Siddell, Stuart G.; Brierley, Ian

    2016-01-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global “snap-shot” of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  2. Mutations in the bacterial ribosomal protein l3 and their association with antibiotic resistance

    Klitgaard, Rasmus N; Ntokou, Eleni; Nørgaard, Katrine;

    2015-01-01

    Different groups of antibiotics bind to the peptidyl transferase center (PTC) in the large subunit of the bacterial ribosome. Resistance to these groups of antibiotics has often been linked with mutations or methylations of the 23S rRNA. In recent years, there has been a rise in the number of...... studies where mutations have been found in the ribosomal protein L3 in bacterial strains resistant to PTC-targeting antibiotics but there is often no evidence that these mutations actually confer antibiotic resistance. In this study, a plasmid exchange system was used to replace plasmid-carried wild...

  3. Nascent 60S ribosomal subunits enter the free pool bound by Nmd3p.

    Ho, J. H.; Kallstrom, G; Johnson, A. W.

    2000-01-01

    Nmd3p from yeast is required for the export of the large (60S) ribosomal subunit from the nucleus (Ho et al., 2000). Here, we show that Nmd3p forms a stable complex with free 60S subunits. Using an epitope-tagged Nmd3p, we show that free 60S subunits can be coimmunoprecipitated with Nmd3p. The interaction was specific for 60S subunits; 40S subunits were not coimmunoprecipitated. Using this coprecipitation technique and pulse-chase labeling of ribosomal subunit proteins we showed that Nmd3p bo...

  4. Nucleotide sequence and characterization of the transcript of a Dictyostelium ribosomal protein gene.

    Steel, L F; Smyth, A; A. Jacobson

    1987-01-01

    Dictyostelium ribosomal protein mRNAs are subject to developmental regulation of both their translation and their stability. In order to consider whether such post-transcriptional regulation can be attributed to structural features of the mRNAs, we have cloned and sequenced a 1.9 kb EcoRI genomic DNA fragment which contains the gene for the Dictyostelium ribosomal protein 1024 (rp1024). The rp1024 gene contains a single intron of 350 bp which begins just after the fourth codon of protein codi...

  5. RNase II is important for A-site mRNA cleavage during ribosome pausing

    Garza-Sánchez, Fernando; Shoji, Shinichiro; Fredrick, Kurt; Hayes, Christopher S.

    2009-01-01

    In Escherichia coli, translational arrest can elicit cleavage of codons within the ribosomal A site. This A-site mRNA cleavage is independent of RelE, and has been proposed to be an endonucleolytic activity of the ribosome. Here, we show that the 3′→5′ exonuclease RNase II plays an important role in RelE-independent A-site cleavage. Instead of A-site cleavage, translational pausing in ΔRNase II cells produces transcripts that are truncated +12 and +28 nucleotides downstream of the A-site codo...

  6. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  7. Method of loading fuel assembly

    Purpose: To shorten the fuel assembly loading time by loading fuel assembly group as one body into the reactor core. Method: A fuel assembly is fed from an auxiliary reactor building via a pit crane into the reactor container, and is stood from lateral position to vertical position. Further, the fuel assemblies are moved laterallyiin a pool of the container, and every four assembly groups are formed by an aligning jig. These assembly groups are associated into one body and loaded into the container. Thus, the round trip time of the crane in the fuel assembly loading work can be shortened. (Yoshihara, H.)

  8. Crystal structures of complexes containing domains from two viral internal ribosome entry site (IRES) RNAs bound to the 70S ribosome.

    Zhu, Jianyu; Korostelev, Andrei; Costantino, David A; Donohue, John P; Noller, Harry F; Kieft, Jeffrey S

    2011-02-01

    Internal ribosome entry site (IRES) RNAs are elements of viral or cellular mRNAs that bypass steps of canonical eukaryotic cap-dependent translation initiation. Understanding of the structural basis of IRES mechanisms is limited, partially due to a lack of high-resolution structures of IRES RNAs bound to their cellular targets. Prompted by the universal phylogenetic conservation of the ribosomal P site, we solved the crystal structures of proposed P site binding domains from two intergenic region IRES RNAs bound to bacterial 70S ribosomes. The structures show that these IRES domains nearly perfectly mimic a tRNA • mRNA interaction. However, there are clear differences in the global shape and position of this IRES domain in the intersubunit space compared to those of tRNA, supporting a mechanism for IRES action that invokes hybrid state mimicry to drive a noncanonical mode of translocation. These structures suggest how relatively small structured RNAs can manipulate complex biological machines. PMID:21245352

  9. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA

    Nielsen, Julie Mundus; Flyvbjerg, Karen Freund; Kirpekar, Finn

    2016-01-01

    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2...

  10. Mechanism of fusidic acid inhibition of RRF- and EF-G-dependent splitting of the bacterial post-termination ribosome.

    Borg, Anneli; Pavlov, Michael; Ehrenberg, Måns

    2016-04-20

    The antibiotic drug fusidic acid (FA) is commonly used in the clinic against gram-positive bacterial infections. FA targets ribosome-bound elongation factor G (EF-G), a translational GTPase that accelerates both messenger RNA (mRNA) translocation and ribosome recycling. How FA inhibits translocation was recently clarified, but FA inhibition of ribosome recycling by EF-G and ribosome recycling factor (RRF) has remained obscure. Here we use fast kinetics techniques to estimate mean times of ribosome splitting and the stoichiometry of GTP hydrolysis by EF-G at varying concentrations of FA, EF-G and RRF. These mean times together with previous data on uninhibited ribosome recycling were used to clarify the mechanism of FA inhibition of ribosome splitting. The biochemical data on FA inhibition of translocation and recycling were used to model the growth inhibitory effect of FA on bacterial populations. We conclude that FA inhibition of translocation provides the dominant cause of bacterial growth reduction, but that FA inhibition of ribosome recycling may contribute significantly to FA-induced expression of short regulatory open reading frames, like those involved in FA resistance. PMID:27001509

  11. Photovoltaic self-assembly.

    Lavin, Judith; Kemp, Richard Alan; Stewart, Constantine A.

    2010-10-01

    This late-start LDRD was focused on the application of chemical principles of self-assembly on the ordering and placement of photovoltaic cells in a module. The drive for this chemical-based self-assembly stems from the escalating prices in the 'pick-and-place' technology currently used in the MEMS industries as the size of chips decreases. The chemical self-assembly principles are well-known on a molecular scale in other material science systems but to date had not been applied to the assembly of cells in a photovoltaic array or module. We explored several types of chemical-based self-assembly techniques, including gold-thiol interactions, liquid polymer binding, and hydrophobic-hydrophilic interactions designed to array both Si and GaAs PV chips onto a substrate. Additional research was focused on the modification of PV cells in an effort to gain control over the facial directionality of the cells in a solvent-based environment. Despite being a small footprint research project worked on for only a short time, the technical results and scientific accomplishments were significant and could prove to be enabling technology in the disruptive advancement of the microelectronic photovoltaics industry.

  12. Modular Fixture Assembly Model for Virtual Assembly Design

    PENG Gao-liang; CHEN Guang-feng; LIU Xin-hua

    2009-01-01

    To support modular fixture assembly design in virtual environment, a multi-view based modular fixture virtual assembly model is proposed. Instead of squeezing all assembly related information into a single model, three complementary views of assembly model, element information, function and structure, and assembly relationship are proposed to be used. The first view contains the detailed element information, while the other two explicitly capture the hierarchical function relationships and mating relationships respectively. These views are complementary in the sense that each view only contains a specific aspect of assembly related information while together they include required assembly related information. The proposed assembly model is specialized to accommodate the features of modular fixture virtual assembly design and applied in our developed prototype system.

  13. Nuclear fuel assembly

    A fuel assembly of PWR comprises a fuel bundle portion supported by a plurality of support lattices and an upper and lower nozzles each secured to the upper and lower portions. Leaf springs are attached to the four sides of the upper nozzle for preventing rising of the fuel assembly by streams of cooling water by the contact with an upper reactor core plate. The leaf springs are attached to the upper nozzle so that four leaf springs are laminated. The uppermost leaf spring is bent slightly upwardly from the mounted portion and the other leaf springs are extended linearly from the mounted portion without being bent. The mounted portions of the leaf springs are stacked and secured to the upper nozzle by a bolt obliquely relative to the axial line of the fuel assembly. (I.N.)

  14. Blade attachment assembly

    Garcia-Crespo, Andres Jose; Delvaux, John McConnell; Miller, Diane Patricia

    2016-05-03

    An assembly and method for affixing a turbomachine rotor blade to a rotor wheel are disclosed. In an embodiment, an adaptor member is provided disposed between the blade and the rotor wheel, the adaptor member including an adaptor attachment slot that is complementary to the blade attachment member, and an adaptor attachment member that is complementary to the rotor wheel attachment slot. A coverplate is provided, having a coverplate attachment member that is complementary to the rotor wheel attachment slot, and a hook for engaging the adaptor member. When assembled, the coverplate member matingly engages with the adaptor member, and retains the blade in the adaptor member, and the assembly in the rotor wheel.

  15. Power module assembly

    Campbell, Jeremy B.; Newson, Steve

    2011-11-15

    A power module assembly of the type suitable for deployment in a vehicular power inverter, wherein the power inverter has a grounded chassis, is provided. The power module assembly comprises a conductive base layer electrically coupled to the chassis, an insulating layer disposed on the conductive base layer, a first conductive node disposed on the insulating layer, a second conductive node disposed on the insulating layer, wherein the first and second conductive nodes are electrically isolated from each other. The power module assembly also comprises a first capacitor having a first electrode electrically connected to the conductive base layer, and a second electrode electrically connected to the first conductive node, and further comprises a second capacitor having a first electrode electrically connected to the conductive base layer, and a second electrode electrically connected to the second conductive node.

  16. Lead Test Assembly program

    Implementation of the new/alternative fuel requires addressing all aspects of the fuel assembly design basis (mechanical, fuel handling, thermal-hydraulic, nuclear design, chemistry, safety analysis and licensing and including mix core effects. The scope of the work is minimized by implementing a Lead Test Assembly (LTA) program with a limited number of assemblies (6 or more), using approved designed features, and placing the LTAs in a unlimited core power location. The topics discussed in the contribution include plant licensing basis and regulatory requirements, plant interface review, compatibility with resident fuel and reactor environment, safety analysis, and post radiation examination. It is concluded that the LTA program is a prudent means of introducing new core designs into existing cores. (P.A.)

  17. Optical interconnect assembly

    Laughlin, Daric; Abel, Philip

    2015-06-09

    An optical assembly includes a substrate with a first row of apertures and a second row of apertures. A first optical die includes a first plurality of optical transducer elements and is mounted on the substrate such that an optical signal interface of each transducer element is aligned with an aperture of the first row of optical apertures. A second optical die includes a second plurality of optical transducer elements and is mounted on the substrate such that an optical signal interface of each of the second plurality of optical transducer elements is aligned with an aperture of the second row of optical apertures. A connector configured to mate with the optical assembly supports a plurality of optical fibers. A terminal end of each optical fiber protrudes from the connector and extends into one of the apertures when the connector is coupled with the optical assembly.

  18. Transfer of fuel assemblies

    Fuel assemblies of a nuclear reactor are transferred during fueling or refueling or the like by a crane. The work-engaging fixture of the crane picks up an assembly, removes it from this slot, transfers it to the deposit site and deposits it in its slot at the deposit site. The control for the crane includes a strain gauge connected to the crane line which raises and lowers the load. The strain gauge senses the load on the crane. The signal from the strain gauge is compared with setpoints; a high-level setpoint, a low-level setpoint and a slack-line setpoint. If the strain gauge signal exceeds the high-level setpoint, the line drive is disabled. This event may occur during raising of a fuel assembly which encounters resistance. The high-level setpoint may be overridden under proper precautions. The line drive is also disabled if the strain gauge signal is less than the low-level setpoint. This event occurs when a fuel assembly being deposited contacts the bottom of its slot or an obstruction in, or at the entry to the slot. To preclude lateral movement and possible damage to a fuel assembly suspended from the crane line, the traverse drive of the crane is disabled once the strain-gauge exceets the lov-level setpoint. The traverse drive can only be enabled after the strain-gauge signal is less than the slack-line set-point. This occurs when the lines has been set in slack-line setting. When the line is tensioned after slack-li ne setting, the traverse drive remains enabled only if the line has been disconnected from the fuel assembly

  19. Demyelination induces transport of ribosome-containing vesicles from glia to axons: evidence from animal models and MS patient brains.

    Shakhbazau, Antos; Schenk, Geert J; Hay, Curtis; Kawasoe, Jean; Klaver, Roel; Yong, V Wee; Geurts, Jeroen J G; van Minnen, Jan

    2016-06-01

    Glial cells were previously proven capable of trafficking polyribosomes to injured axons. However, the occurrence of such transfer in the general pathological context, such as demyelination-related diseases, needs further evidence. Since this may be a yet unidentified universal contributor to axonal survival, we study putative glia-axonal ribosome transport in response to demyelination in animal models and patients in both peripheral and central nervous system. In the PNS we investigate whether demyelination in a rodent model has the potential to induce ribosome transfer. We also probe the glia-axonal ribosome supply by implantation of transgenic Schwann cells engineered to produce fluorescent ribosomes in the same demyelination model. We furthermore examine the presence of axonal ribosomes in mouse experimental autoimmune encephalomyelitis (EAE), a well-established model for multiple sclerosis (MS), and in human MS autopsy brain material. We provide evidence for increased axonal ribosome content in a pharmacologically demyelinated sciatic nerve, and demonstrate that at least part of these ribosomes originate in the transgenic Schwann cells. In the CNS one of the hallmarks of MS is demyelination, which is associated with severe disruption of oligodendrocyte-axon interaction. Here, we provide evidence that axons from spinal cords of EAE mice, and in the MS human brain contain an elevated amount of axonal ribosomes compared to controls. Our data provide evidence that increased axonal ribosome content in pathological axons is at least partly due to glia-to-axon transfer of ribosomes, and that demyelination in the PNS and in the CNS is one of the triggers capable to initiate this process. PMID:27115494

  20. Assembling Sustainable Territories

    Vandergeest, Peter; Ponte, Stefano; Bush, Simon

    2015-01-01

    The authors show how certification assembles ‘sustainable’ territories through a complex layering of regulatory authority in which both government and nongovernment entities claim rule-making authority, sometimes working together, sometimes in parallel, sometimes competitively. It is argued that...... dynamic in assembling sustainable territories, and that certification always involves state agencies in determining how the key elements that comprise it are defined. Whereas some state agencies have been suspicious of sustainability certification, others have embraced it or even used it to extend their...

  1. Self-assembly of nanocomponents into composite structures: derivation and simulation of Langevin equations.

    Pankavich, S; Shreif, Z; Miao, Y; Ortoleva, P

    2009-05-21

    The kinetics of the self-assembly of nanocomponents into a virus, nanocapsule, or other composite structure is analyzed via a multiscale approach. The objective is to achieve predictability and to preserve key atomic-scale features that underlie the formation and stability of the composite structures. We start with an all-atom description, the Liouville equation, and the order parameters characterizing nanoscale features of the system. An equation of Smoluchowski type for the stochastic dynamics of the order parameters is derived from the Liouville equation via a multiscale perturbation technique. The self-assembly of composite structures from nanocomponents with internal atomic structure is analyzed and growth rates are derived. Applications include the assembly of a viral capsid from capsomers, a ribosome from its major subunits, and composite materials from fibers and nanoparticles. Our approach overcomes errors in other coarse-graining methods, which neglect the influence of the nanoscale configuration on the atomistic fluctuations. We account for the effect of order parameters on the statistics of the atomistic fluctuations, which contribute to the entropic and average forces driving order parameter evolution. This approach enables an efficient algorithm for computer simulation of self-assembly, whereas other methods severely limit the timestep due to the separation of diffusional and complexing characteristic times. Given that our approach does not require recalibration with each new application, it provides a way to estimate assembly rates and thereby facilitate the discovery of self-assembly pathways and kinetic dead-end structures. PMID:19466829

  2. Fire resistant PV shingle assembly

    Lenox, Carl J.

    2012-10-02

    A fire resistant PV shingle assembly includes a PV assembly, including PV body, a fire shield and a connection member connecting the fire shield below the PV body, and a support and inter-engagement assembly. The support and inter-engagement assembly is mounted to the PV assembly and comprises a vertical support element, supporting the PV assembly above a support surface, an upper interlock element, positioned towards the upper PV edge, and a lower interlock element, positioned towards the lower PV edge. The upper interlock element of one PV shingle assembly is inter-engageable with the lower interlock element of an adjacent PV shingle assembly. In some embodiments the PV shingle assembly may comprise a ventilation path below the PV body. The PV body may be slidably mounted to the connection member to facilitate removal of the PV body.

  3. An Interactive Assembly Process Planner

    廖华飞; 张林鍹; 肖田元; 曾理; 古月

    2004-01-01

    This paper describes the implementation and performance of the virtual assembly support system (VASS), a new system that can provide designers and assembly process engineers with a simulation and visualization environment where they can evaluate the assemblability/disassemblability of products, and thereby use a computer to intuitively create assembly plans and interactively generate assembly process charts. Subassembly planning and assembly priority reasoning techniques were utilized to find heuristic information to improve the efficiency of assembly process planning. Tool planning was implemented to consider tool requirements in the product design stage. New methods were developed to reduce the computation amount involved in interference checking. As an important feature of the VASS, human interaction was integrated into the whole process of assembly process planning, extending the power of computer reasoning by including human expertise, resulting in better assembly plans and better designs.

  4. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution...

  5. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    Douthwaite, S; Garrett, R A

    1981-01-01

    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecule...

  6. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A; Gwerder, Myriam; Gutsche, Katrin; Altmeyer, Matthias; Jungmichel, Stephanie; Toledo Lazaro, Luis Ignacio; Fink, Daniel; Rask, Maj-Britt; Grøfte, Merete; Lukas, Claudia; Nielsen, Michael L; Smerdon, Stephen J; Lukas, Jiri; Stucki, Manuel

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient recrui...

  7. The antibiotic thiostrepton inhibits a functional transition within protein L11 at the ribosomal GTPase centre

    Porse, B T; Leviev, I; Mankin, A S;

    1998-01-01

    reduced for the mutant L11-rRNA complexes. These results indicate that although, as shown earlier, thiostrepton binds primarily to 23 S rRNA, the drug probably inhibits peptide elongation by impeding a conformational change within protein L11 that is important for the function of the ribosomal GTPase...

  8. Ribosomal PCR and DNA sequencing for detection and identification of bacteria

    Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen;

    2014-01-01

    non-haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non...

  9. Synaptic Activation of Ribosomal Protein S6 Phosphorylation Occurs Locally in Activated Dendritic Domains

    Pirbhoy, Patricia Salgado; Farris, Shannon; Steward, Oswald

    2016-01-01

    Previous studies have shown that induction of long-term potentiation (LTP) induces phosphorylation of ribosomal protein S6 (rpS6) in postsynaptic neurons, but the functional significance of rpS6 phosphorylation is poorly understood. Here, we show that synaptic stimulation that induces perforant path LTP triggers phosphorylation of rpS6 (p-rpS6)…

  10. Development of Soft Tissue Sarcomas in Ribosomal Proteins L5 and S24 Heterozygous Mice

    Kazerounian, S.; Ciarlini, P.D.S.C.; Yuan, D.; Ghazvinian, R.; Alberich-Jorda, Meritxell; Joshi, M.; Zhang, H.; Beggs, A.H.; Gazda, H.T.

    2016-01-01

    Roč. 7, č. 1 (2016), s. 32-36. ISSN 1837-9664 R&D Projects: GA MŠk LK21307 Institutional support: RVO:68378050 Keywords : Ribosomal proteins RPL5 and RPS24 * Diamond-Blackfan anemia * Soft tissue sarcoma Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.271, year: 2014

  11. Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites

    Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E; Buurman, Ed T; Squires, Catherine L

    2015-01-01

    Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...... remaining scar sequences, facilitating homologous recombination events, presumably leads to elevated genomic instability...

  12. Virtual Ribosome - a comprehensive DNA translation tool with support for integration of sequence feature annotation

    Wernersson, Rasmus

    2006-01-01

    Virtual Ribosome is a DNA translation tool with two areas of focus. ( i) Providing a strong translation tool in its own right, with an integrated ORF finder, full support for the IUPAC degenerate DNA alphabet and all translation tables defined by the NCBI taxonomy group, including the use of...

  13. The nucleolar size is associated to the methylation status of ribosomal DNA in breast carcinomas

    There is a body of evidence that shows a link between tumorigenesis and ribosome biogenesis. The precursor of mature 18S, 28S and 5.8S ribosomal RNAs is transcribed from the ribosomal DNA gene (rDNA), which exists as 300–400 copies in the human diploid genome. Approximately one half of these copies are epigenetically silenced, but the exact role of epigenetic regulation on ribosome biogenesis is not completely understood. In this study we analyzed the methylation profiles of the rDNA promoter and of the 5’ regions of 18S and 28S in breast cancer. We analyzed rDNA methylation in 68 breast cancer tissues of which the normal counterpart was partially available (45/68 samples) using the MassARRAY EpiTYPER assay, a sensitive and quantitative method with single base resolution. We found that rDNA locus tended to be hypermethylated in tumor compared to matched normal breast tissues and that the DNA methylation level of several CpG units within the rDNA locus was associated to nuclear grade and to nucleolar size of tumor tissues. In addition we identified a subgroup of samples in which large nucleoli were associated with very limited or absent rDNA hypermethylation in tumor respect to matched normal tissue. In conclusion, we suggest that rDNA is an important target of epigenetic regulation in breast tumors and that rDNA methylation level is associated to nucleolar size

  14. Ribosome Biogenesis Factor Bmsl-like Is Essential for Liver Development in Zebrafish

    Yong Wang; Yue Luo; Yunhan Hong; Jinrong Peng; Lijan Lo

    2012-01-01

    Ribosome biogenesis in the nucleolus requires numerous nucleolar proteins and small non-coding RNAs.Among them is ribosome biogenesis factor Bmsl,which is highly conserved from yeast to human.In yeast,Bmsl initiates ribosome biogenesis through recruiting Rcll to pre-ribosomes.However,little is known about the biological function of Bmsl in vertebrates.Here we report that Bmsl plays an essential role in zebrafish liver development.We identified a zebrafish bmsllsq163 mutant which carries a T to A mutation in the gene bmsl-like (bmsll).This mutation results in L152 to Q152 substitution in a GTPase motif in Bmsll.Surprisingly,bmsllsq163 mutation confers hypoplasia specifically in the liver,exocrine pancreas and intestine after 3 days post-fertilization (dpf).Consistent with the bmsllsq163 mutant phenotypes,whole-mount in situ hybridization (WISH) on wild type embryos showed that bmsll transcripts are abundant in the entire digestive tract and its accessory organs.Immunostaining for phospho-Histone 3 (P-H3) and TUNEL assay revealed that impairment of hepatoblast proliferation rather than cell apoptosis is one of the consequences of bmsllsq163 giving rise to an underdeveloped liver.Therefore,our findings demonstrate that Bmsll is necessary for zebrafish liver development.

  15. Heterologous production of non-ribosomal peptide LLD-ACV in Saccharomyces cerevisiae

    Siewers, Verena; Chen, Xiao; Huang, Le;

    2009-01-01

    Non-ribosomal peptides (NRPs) are a diverse family of secondary metabolites with a broad range of biological activities. We started to develop an eukaryotic microbial platform based on the yeast Saccharomyces cerevisiae for heterologous production of NRPs using δ-(l-α-aminoadipyl)–l-cysteinyl–d-v...

  16. YbxF, a protein associated with exponential-phase ribosomes in Bacillus subtilis

    Sojka, Luděk; Fučík, Vladimír; Krásný, Libor; Barvík, I.; Jonák, Jiří

    2007-01-01

    Roč. 189, č. 13 (2007), s. 4809-4814. ISSN 0021-9193 R&D Projects: GA AV ČR IAA5052206 Institutional research plan: CEZ:AV0Z50520514 Keywords : ybxF * ymxC * ribosomes * Bacillus subtilis * GFP * growth phase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.013, year: 2007

  17. Protein Folding Activity of the Ribosome (PFAR –– A Target for Antiprion Compounds

    Debapriya Banerjee

    2014-10-01

    Full Text Available Prion diseases are fatal neurodegenerative diseases affecting mammals. Prions are misfolded amyloid aggregates of the prion protein (PrP, which form when the alpha helical, soluble form of PrP converts to an aggregation-prone, beta sheet form. Thus, prions originate as protein folding problems. The discovery of yeast prion(s and the development of a red-/white-colony based assay facilitated safe and high-throughput screening of antiprion compounds. With this assay three antiprion compounds; 6-aminophenanthridine (6AP, guanabenz acetate (GA, and imiquimod (IQ have been identified. Biochemical and genetic studies reveal that these compounds target ribosomal RNA (rRNA and inhibit specifically the protein folding activity of the ribosome (PFAR. The domain V of the 23S/25S/28S rRNA of the large ribosomal subunit constitutes the active site for PFAR. 6AP and GA inhibit PFAR by competition with the protein substrates for the common binding sites on the domain V rRNA. PFAR inhibition by these antiprion compounds opens up new possibilities for understanding prion formation, propagation and the role of the ribosome therein. In this review, we summarize and analyze the correlation between PFAR and prion processes using the antiprion compounds as tools.

  18. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Hori, H.; Osawa, S; Murao, K.; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

  19. An unusual mechanism for EF-Tu activation during tmRNA-mediated ribosome rescue

    Miller, Mickey R; Buskirk, Allen R.

    2014-01-01

    When ribosomes are stalled on truncated mRNAs in prokaryotes, they are rescued by the tmRNA/SmpB complex. It has been unclear how EF-Tu is activated by this complex. This manuscript analyzes this problem, and the results indicate that the normal EF-Tu GTPase cycle does not appear to apply in this specialized situation.

  20. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  1. Reconstruction of ribosomal RNA genes from metagenomic data.

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  2. Activity-dependent regulation of calcium and ribosomes in the chick cochlear nucleus.

    Call, C L; Hyson, R L

    2016-03-01

    Cochlea removal results in the death of 20-30% of neurons in the chick cochlear nucleus, nucleus magnocellularis (NM). Two potentially cytotoxic events, a dramatic rise in intracellular calcium concentration ([Ca(2+)]i) and a decline in the integrity of ribosomes are observed within 1h of deafferentation. Glutamatergic input from the auditory nerve has been shown to preserve NM neuron health by activating metabotropic glutamate receptors (mGluRs), maintaining both normal [Ca(2+)]i and ribosomal integrity. One interpretation of these results is that a common mGluR-activated signaling cascade is required for the maintenance of both [Ca(2+)]i and ribosomal integrity. This could happen if both responses are influenced directly by a common messenger, or if the loss of mGluR activation causes changes in one component that secondarily causes changes in the other. The present studies tested this common-mediator hypothesis in slice preparations by examining activity-dependent regulation of [Ca(2+)]i and ribosomes in the same tissue after selectively blocking group I mGluRs (1-Aminoindan-1,5-dicarboxylic acid (AIDA)) or group II mGluRs (LY 341495) during unilateral auditory nerve stimulation. Changes in [Ca(2+)]i of NM neurons were measured using fura-2 ratiometric calcium imaging and the tissue was subsequently processed for Y10B immunoreactivity (Y10B-ir), an antibody that recognizes a ribosomal epitope. The group I mGluR antagonist blocked the activity-dependent regulation of both [Ca(2+)]i and Y10B-ir, but the group II antagonist blocked only the activity-dependent regulation of Y10B-ir. That is, even when group II receptors were blocked, stimulation continued to maintain low [Ca(2+)]i, but it did not maintain Y10B-ir. These results suggest a dissociation in how calcium and ribosomes are regulated in NM neurons and that ribosomes can be regulated through a mechanism that is independent of calcium regulation. PMID:26739326

  3. Spool assembly support analysis

    This document provides the wind/seismic analysis and evaluation for the pump pit spool assemblies. Hand calculations were used for the analysis. UBC, AISC, and load factors were used in this evaluation. The results show that the actual loads are under the allowable loads and all requirements are met

  4. Rotary shaft sealing assembly

    Dietle, Lannie L.; Schroeder, John E.; Kalsi, Manmohan S.; Alvarez, Patricio D.

    2010-09-21

    A rotary shaft sealing assembly in which a first fluid is partitioned from a second fluid in a housing assembly having a rotary shaft located at least partially within. In one embodiment a lip seal is lubricated and flushed with a pressure-generating seal ring preferably having an angled diverting feature. The pressure-generating seal ring and a hydrodynamic seal may be used to define a lubricant-filled region with each of the seals having hydrodynamic inlets facing the lubricant-filled region. Another aspect of the sealing assembly is having a seal to contain pressurized lubricant while withstanding high rotary speeds. Another rotary shaft sealing assembly embodiment includes a lubricant supply providing a lubricant at an elevated pressure to a region between a lip seal and a hydrodynamic seal with a flow control regulating the flow of lubricant past the lip seal. The hydrodynamic seal may include an energizer element having a modulus of elasticity greater than the modulus of elasticity of a sealing lip of the hydrodynamic seal.

  5. Corium protection assembly

    Gou, Perng-Fei; Townsend, Harold E.; Barbanti, Giancarlo

    1994-01-01

    A corium protection assembly includes a perforated base grid disposed below a pressure vessel containing a nuclear reactor core and spaced vertically above a containment vessel floor to define a sump therebetween. A plurality of layers of protective blocks are disposed on the grid for protecting the containment vessel floor from the corium.

  6. Ordinary General Assembly

    Staff Association

    2011-01-01

    Tuesday 12 April at 14.00 Council Chamber, Bldg 503 In conformity with the Statutes of the Staff Association, an ordinary General Assembly is organized once a year (article IV.2.1). Agenda   Adoption of the Agenda Approval of the Draft Minutes of the Ordinary General Assembly of 20 April 2010 Presentation and approval of the Activity Report 2010 Presentation and approval of the Financial Report 2010 Presentation and approval of the Auditors Report 2010 Programme for 2011 Presentation et and approval of the draft budget and subscription rate 2012 Election of the Election Committee Election of the Board of Auditors Miscellaneous We remind members of article IV.3.4 in the Statutes of the Association which reads: “After having dealt with all the items on the agenda, the members may, with the consent of the Assembly, have other matters discussed, but decisions may be taken only on the items listed on the agenda. Nevertheless, the Assembly ma...

  7. Ordinary General Assembly

    Staff Association

    2011-01-01

    Tuesday 12 April at 14.00 Council Chamber, Bldg 503 In conformity with the Statutes of the Staff Association, an ordinary General Assembly is organized once a year (article IV.2.1). Agenda   Adoption of the Agenda Approval of the Draft Minutes of the Ordinary General Assembly of 20 April 2010 Presentation and approval of the Activity Report 2010 Presentation and approval of the Financial Report 2010 Presentation and approval of the Auditors Report 2010 Programme for 2011 Presentation and approval of the draft budget and subscription rate 2012 Election of the Election Committee Election of the Board of Auditors Miscellaneous We remind members of article IV.3.4 in the Statutes of the Association which reads: “After having dealt with all the items on the agenda, the members may, with the consent of the Assembly, have other matters discussed, but decisions may be taken only on the items listed on the agenda. Nevertheless, the Assembly may r...

  8. Assembly of primary cilia

    Pedersen, Lotte B; Veland, Iben R; Schrøder, Jacob M;

    2008-01-01

    our current knowledge about IFT is based on studies performed in Chlamydomonas and Caenorhabditis elegans. Therefore, our review of the IFT literature includes studies performed in these two model organisms. The role of several non-IFT proteins (e.g., centrosomal proteins) in the ciliary assembly...

  9. Ordinary General Assembly

    Staff Association

    2010-01-01

    Tuesday 20 April at 10.00 Council Chamber, Bldg 503 In conformity with the Statutes of the Staff Association, an ordinary General Assembly is organized once a year (article IV.2.1). Agenda   Adoption of the Agenda Approval of the Draft Minutes of the Ordinary General Assembly of 12 May 2009 Presentation and approval of the Activity Report 2009 Presentation and approval of the Financial Report 2009 Presentation and approval of the Auditors Report 2009 Programme for 2010 Presentation et and approval of the draft budget and subscription rate 2010 Election of the Election Committee Election of the Board of Auditors Miscellaneous We remind members of article IV.3.4 in the Statutes of the Association which reads: “After having dealt with all the items on the agenda, the members may, with the consent of the Assembly, have other matters discussed, but decisions may be taken only on the items listed on the agenda. Nevertheless, the Assembly may require t...

  10. Nuclear fuel assembly spacer

    In a fuel assembly for a nuclear reactor a fuel element spacer formed of an array of laterally positioned cojoined tubular ferrules each providing a passage for one of the fuel elements, the elements being laterally supported in the ferrules between slender spring members and laterally oriented rigid stops

  11. Turneri preemia 2015: Assemble

    2015-01-01

    Turneri 2015. aasta preemia pälvis radikaalne noorte arhitektide kollektiiv Assemble. Rühmitus on 18-liikmeline ja baseerub Ida-Londonis ning selle tegevust võib üldistatult nimetada hüljatud ruumide taaselustamiseks kogukondlike aktsioonide kaudu

  12. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    Schoch, Conrad L.; Seifert, Keith A.; Huhndorf, Sabine; Robert, Vincent; Spouge, John L.; Levesque, C. André; Chen, Wen; Bolchacova, Elena; Voigt, Kerstin; Crous, Pedro W.; Miller, Andrew N.; Wingfield, Michael J.; Aime, M. Catherine; An, Kwang-Deuk; Bai, Feng-Yan; Barreto, Robert W.; Begerow, Dominik; Bergeron, Marie-Josée; Blackwell, Meredith; Boekhout, Teun; Bogale, Mesfin; Boonyuen, Nattawut; Burgaz, Ana R.; Buyck, Bart; Cai, Lei; Cai, Qing; Cardinali, G.; Chaverri, Priscila; Coppins, Brian J.; Crespo, Ana; Cubas, Paloma; Cummings, Craig; Damm, Ulrike; de Beer, Z. Wilhelm; de Hoog, G. Sybren; Del-Prado, Ruth; Dentinger, Bryn; Diéguez-Uribeondo, Javier; Divakar, Pradeep K.; Douglas, Brian; Dueñas, Margarita; Duong, Tuan A.; Eberhardt, Ursula; Edwards, Joan E.; Elshahed, Mostafa S.; Fliegerova, Katerina; Furtado, Manohar; García, Miguel A.; Ge, Zai-Wei; Griffith, Gareth W.; Griffiths, K.; Groenewald, Johannes Z.; Groenewald, Marizeth; Grube, Martin; Gryzenhout, Marieka; Guo, Liang-Dong; Hagen, Ferry; Hambleton, Sarah; Hamelin, Richard C.; Hansen, Karen; Harrold, Paul; Heller, Gregory; Herrera, Cesar; Hirayama, Kazuyuki; Hirooka, Yuuri; Ho, Hsiao-Man; Hoffmann, Kerstin; Hofstetter, Valérie; Högnabba, Filip; Hollingsworth, Peter M.; Hong, Seung-Beom; Hosaka, Kentaro; Houbraken, Jos; Hughes, Karen; Huhtinen, Seppo; Hyde, Kevin D.; James, Timothy; Johnson, Eric M.; Johnson, Joan E.; Johnston, Peter R.; Jones, E.B. Gareth; Kelly, Laura J.; Kirk, Paul M.; Knapp, Dániel G.; Kõljalg, Urmas; Kovács, Gábor M.; Kurtzman, Cletus P.; Landvik, Sara; Leavitt, Steven D.; Liggenstoffer, Audra S.; Liimatainen, Kare; Lombard, Lorenzo; Luangsa-ard, J. Jennifer; Lumbsch, H. Thorsten; Maganti, Harinad; Maharachchikumbura, Sajeewa S. N.; Martin, María P.; May, Tom W.; McTaggart, Alistair R.; Methven, Andrew S.; Meyer, Wieland; Moncalvo, Jean-Marc; Mongkolsamrit, Suchada; Nagy, László G.; Nilsson, R. Henrik; Niskanen, Tuula; Nyilasi, Ildikó; Okada, Gen; Okane, Izumi; Olariaga, Ibai; Otte, Jürgen; Papp, Tamás; Park, Duckchul; Petkovits, Tamás; Pino-Bodas, Raquel; Quaedvlieg, William; Raja, Huzefa A.; Redecker, Dirk; Rintoul, Tara L.; Ruibal, Constantino; Sarmiento-Ramírez, Jullie M.; Schmitt, Imke; Schüßler, Arthur; Shearer, Carol; Sotome, Kozue; Stefani, Franck O.P.; Stenroos, Soili; Stielow, Benjamin; Stockinger, Herbert; Suetrong, Satinee; Suh, Sung-Oui; Sung, Gi-Ho; Suzuki, Motofumi; Tanaka, Kazuaki; Tedersoo, Leho; Telleria, M. Teresa; Tretter, Eric; Untereiner, Wendy A.; Urbina, Hector; Vágvölgyi, Csaba; Vialle, Agathe; Vu, Thuy Duong; Walther, Grit; Wang, Qi-Ming; Wang, Yan; Weir, Bevan S.; Weiß, Michael; White, Merlin M.; Xu, Jianping; Yahr, Rebecca; Yang, Zhu L.; Yurkov, Andrey; Zamora, Juan-Carlos; Zhang, Ning; Zhuang, Wen-Ying; Schindel, David

    2012-01-01

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494

  13. Canonical Initiation Factor Requirements of the Myc Family of Internal Ribosome Entry Segments▿ †

    Spriggs, Keith A.; Cobbold, Laura C.; Jopling, Catherine L.; Cooper, Rebecca E.; Wilson, Lindsay A.; Stoneley, Mark; Coldwell, Mark J.; Poncet, Didier; Shen, Ya-Ching; Morley, Simon J.; Bushell, Martin; Willis, Anne E.

    2009-01-01

    Initiation of protein synthesis in eukaryotes requires recruitment of the ribosome to the mRNA and its translocation to the start codon. There are at least two distinct mechanisms by which this process can be achieved; the ribosome can be recruited either to the cap structure at the 5′ end of the message or to an internal ribosome entry segment (IRES), a complex RNA structural element located in the 5′ untranslated region (5′-UTR) of the mRNA. However, it is not well understood how cellular IRESs function to recruit the ribosome or how the 40S ribosomal subunits translocate from the initial recruitment site on the mRNA to the AUG initiation codon. We have investigated the canonical factors that are required by the IRESs found in the 5′-UTRs of c-, L-, and N-myc, using specific inhibitors and a tissue culture-based assay system, and have shown that they differ considerably in their requirements. The L-myc IRES requires the eIF4F complex and the association of PABP and eIF3 with eIF4G for activity. The minimum requirements of the N- and c-myc IRESs are the C-terminal domain of eIF4G to which eIF4A is bound and eIF3, although interestingly this protein does not appear to be recruited to the IRES RNA via eIF4G. Finally, our data show that all three IRESs require a ternary complex, although in contrast to c- and L-myc IRESs, the N-myc IRES has a lesser requirement for a ternary complex. PMID:19124605

  14. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)

    2011-09-02

    Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

  15. Structural characterization of ribosome recruitment and translocation by type IV IRES

    Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S

    2016-01-01

    Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts tvhe otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation. DOI: http://dx.doi.org/10.7554/eLife.13567.001 PMID:27159451

  16. Efeito da intensidade do exercício de corrida intermitente 30s:15s no tempo de manutenção no ou próximo do VO2max Effect of intensity of intermittent running exercise 30s:15s at the time maintenance at or near VO2max

    Rafael Alves de Aguiar

    2013-03-01

    Full Text Available O presente estudo comparou o tempo mantido acima de 90% (t90VO2max e de 95% VO2max (t95VO2max em três diferentes intensidades de exercício. Após a realização de um teste incremental para determinar o VO2max, oito estudantes de educação física ativos (23 ± 3 anos executaram três sessões de exercícios intermitentes (100, 110 e 120% da velocidade do VO2max (vVO2max com razão esforço:recuperação de 30s:15s. O t95VO2max foi significantemente maior em 110%vVO2max (EI110% (218,1 ± 81,6 s quando comparado a 100%vVO2max (EI100% (91,9 ± 75,2s e a 120%vVO2max (EI120% (126,3 ± 29,4 s, porém sem diferença entre EI100% e EI120%. O t90VO2max somente apresentou diferença significante entre EI110% e EI120%. Portanto, conclui-se que durante exercício intermitente com razão 30s:15s, a intensidade de 110%vVO2max apresenta-se mais adequada para manter o VO2 próximo ou no VO2max por um tempo maior.The present study compared the time maintained above 90% (t90VO2max or 95% VO2max (t95VO2max in three different exercise intensities. After performing an incremental test to determine VO2max, eight physical education active students (23 ± 3 years performed three intermittent exercise sessions (100, 110 e 120% velocity of VO2max (vVO2max with ratio effort:recovery of 30s:15s. The t95%VO2max was significantly higher at 110%vVO2max (EI110% (218.1 ± 81.6s compared to 100% vVO2max (EI100% (91.9 ± 75.2s and 120%vVO2max (EI120% (126.3 ± 29.4s, but without differences between EI100% and EI120%. The t90%vVO2max was significantly different only between EI110% and 120%. Therefore, we conclude that during intermittent exercise with ratio 30s:15s, the intensity of 110%vVO2max appears more appropriate to maintain VO2max for a longer time.

  17. The ATP requiring step in assembly of M13 procoat protein into microsomes is related to preservation of transport competence of the precursor protein

    Wiech, Hans; Sagstetter, Maria; Müller, Günter; Zimmermann, Richard

    1987-01-01

    M13 procoat protein is processed to transmembrane coat protein by dog pancreas microsomes after completion of synthesis and in the absence of the signal recognition particle (SRP)/docking protein system. ATP is required for fast and efficient processing of procoat protein by microsomes in a reticulocyte lysate. Requirement for ATP is also observed in the absence of ribosomes or docking protein. This indicates the existence of a unique assembly pathway for procoat protein into microsomes which...

  18. Top-down assembly design using assembly features

    石万凯; DENEUX; Dominique; 等

    2002-01-01

    The primary task of top-down assembly desig is to define a product's detailed physical description satisfying its functional requirements identified during the functional design phase.The implementation of this design process requires two things,that is ,product functional representation and a general assembly model.Product functions are not only the formulation of a customer's needs,but also the input data of assembly design.A general assembly model is to support the evolving process of the elaboration of a product structure.The assembly feature of extended concept is taken as a functional carrier,which is a generic relation among assembly-modeled entities.The model of assembly features describes the link between product functions and form features of parts.On the basis of this link,the propagation of design modifications is discussed so as to preserve the functionality and the coherence of the assembly model.The formal model of assembly design process describes the top-down process of creating an assembly model.This formal model is represented by the combination of assembly feature operations,the assembly model and the evaluation process.A design case study is conducted to verify the applicability of the presented approaches.

  19. Exploring accessibility of structural elements of the mammalian 40S ribosomal mRNA entry channel at various steps of translation initiation.

    Sharifulin, Dmitri E; Bartuli, Yulia S; Meschaninova, Maria I; Ven'yaminova, Aliya G; Graifer, Dmitri M; Karpova, Galina G

    2016-10-01

    In this work, we studied how the accessibility of structural elements of the mammalian 40S ribosomal mRNA entry channel, ribosomal protein (rp) uS3 and helix (h) 16 of the 18S rRNA, changes upon the translation initiation. In particular, we examined the accessibility of rp uS3 for binding of unstructured RNAs and of riboses in h16 towards attack with benzoyl cyanide (BzCN) in complexes assembled in rabbit reticulocyte lysate utilizing synthetic oligoribonucleotides as well as full-length and truncated up to the initiation AUG codon hepatitis C virus IRES as model mRNAs. With both mRNA types, the rp uS3 peptide recognizing single-stranded RNAs was shown to become shielded only in those 48S preinitiation complexes (PICs) that contained eIF3j bound to 40S subunit in the area between the decoding site and the mRNA entry channel. Chemical probing with BzCN revealed that h16 in the 48S PICs containing eIF3j or scanning factor DHX29 is strongly shielded; the effect was observed with all the mRNAs used, and h16 remained protected as well in 80S post-initiation complexes lacking these factors. Altogether, the obtained results allowed us to suggest that eIF3j bound at the 48S PICs makes the rp uS3 inaccessible for binding of RNAs and this factor subunit is responsible for the decrease of h16 conformational flexibility; the latter is manifested as reduced accessibility of h16 to BzCN. Thus, our findings provide new insights into how eIF3j is implicated in ensuring the proper conformation of the mRNA entry channel, thereby facilitating mRNA loading. PMID:27346718

  20. [Transcript assembly and quality assessment].

    Deng, Feilong; Jia, Xianbo; Lai, Songjia; Liu, Yiping; Chen, Shiyi

    2015-09-01

    The transcript assembly is essential for transcriptome studies trom next-generation sequencing data. However, there are still many faults of algorithms in the present assemblers, which should be largely improved in the future. According to the requirement of reference genome or not, the transcript assembly could be classified into the genome-guided and de novo methods. The two methods have different algorithms and implementation processes. The quality of assembled transcripts depends on a large number of factors, such as the PCR amplification, sequencing techniques, assembly algorithm and genome character. Here, we reviewed the present tools of transcript assembly and various indexes for assessing the quality of assembled transcripts, which would help biologists to determine which assembler should be used in their studies. PMID:26955705

  1. School Assemblies: The Lost Art.

    Beach, Daniel R.

    1979-01-01

    Guidelines and suggestions are offered for successful school assemblies. The school assembly should be a positive event; an occasion for developing unity, group loyalty, and desirable audience habits. (Author/MLF)

  2. X-Ray Assembler Data

    U.S. Department of Health & Human Services — Federal regulations require that an assembler who installs one or more certified components of a diagnostic x-ray system submit a report of assembly. This database...

  3. Optical Space Telescope Assembly Project

    National Aeronautics and Space Administration — The Optical Space Telescope Assembly (OSTA) task is to demonstrate the technology readiness of assembling large space telescopes on orbit in 2015. This task is an...

  4. Ribosomal pausing at a frameshifter RNA pseudoknot is sensitive to reading phase but shows little correlation with frameshift efficiency.

    Kontos, H; Napthine, S; Brierley, I

    2001-12-01

    Here we investigated ribosomal pausing at sites of programmed -1 ribosomal frameshifting, using translational elongation and ribosome heelprint assays. The site of pausing at the frameshift signal of infectious bronchitis virus (IBV) was determined and was consistent with an RNA pseudoknot-induced pause that placed the ribosomal P- and A-sites over the slippery sequence. Similarly, pausing at the simian retrovirus 1 gag/pol signal, which contains a different kind of frameshifter pseudoknot, also placed the ribosome over the slippery sequence, supporting a role for pausing in frameshifting. However, a simple correlation between pausing and frameshifting was lacking. Firstly, a stem-loop structure closely related to the IBV pseudoknot, although unable to stimulate efficient frameshifting, paused ribosomes to a similar extent and at the same place on the mRNA as a parental pseudoknot. Secondly, an identical pausing pattern was induced by two pseudoknots differing only by a single loop 2 nucleotide yet with different functionalities in frameshifting. The final observation arose from an assessment of the impact of reading phase on pausing. Given that ribosomes advance in triplet fashion, we tested whether the reading frame in which ribosomes encounter an RNA structure (the reading phase) would influence pausing. We found that the reading phase did influence pausing but unexpectedly, the mRNA with the pseudoknot in the phase which gave the least pausing was found to promote frameshifting more efficiently than the other variants. Overall, these experiments support the view that pausing alone is insufficient to mediate frameshifting and additional events are required. The phase dependence of pausing may be indicative of an activity in the ribosome that requires an optimal contact with mRNA secondary structures for efficient unwinding. PMID:11713298

  5. Reflector-moderated critical assemblies

    Experiments with reflector-moderated critical assemblies were part of the Rover Program at the Los Alamos Scientific Laboratory (LASL). These assemblies were characterized by thick D2O or beryllium reflectors surrounding large cavities that contained highly enriched uranium at low average densities. Because interest in this type of system has been revived by LASL Plasma Cavity Assembly studies, more detailed descriptions of the early assemblies than had been available in the unclassified literature are provided. (U.S.)

  6. Expanded versions of the 16S and 23S ribosomal RNA mutation databases (16SMDBexp and 23SMDBexp)

    Triman, K L; Peister, A; R. A. Goel

    1998-01-01

    Expanded versions of the Ribosomal RNA Mutation Databases provide lists of mutated positions in 16S and 16S-like ribosomal RNA (16SMDBexp) and 23S and 23S-like ribosomal RNA (23SMDBexp) and the identity of each alteration. Alterations from organisms other than Escherichia coli are reported at positions according to the E.coli numbering system. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation, (ii) whether a mutant pheno...

  7. Measurement Technology for Engine Assembly

    GAO Li; ZHENG Zeyu; DAI Shangping

    2006-01-01

    In many industrial, it is often necessary to analyze the engine assembly. This paper introduces three kinds of new technologies on the assembly line of engine in recent years, it have played the positive role in improving the quality of assembling.

  8. Integrated magnetic transformer assembly

    2014-01-01

    The present invention relates to an integrated magnetics transformer assembly comprising a first magnetically permeable core forming a first substantially closed magnetic flux path and a second magnetically permeable core forming a second substantially closed magnetic flux path. A first input...... inductor winding is wound around a first predetermined segment of the first magnetically permeable core and a second input inductor winding is wound around a first predetermined segment of the second magnetically permeable core. The integrated magnetics transformer assembly further comprises a first output...... inductor winding comprising series coupled first and second half-windings wherein the first half-winding is wound around a second predetermined segment of the first magnetically permeable core and the second half-winding is wound around a second predetermined segment of the second magnetically permeable...

  9. Fuel assemblies chemical cleaning

    NPP Paks found a thermal-hydraulic anomaly in the reactor core during cycle 14 that was caused by corrosion product deposits on fuel assemblies (FAs) that increased the hydraulic resistance of the FAs. Consequently, the coolant flow through the FAs was insufficient resulting in a temperature asymmetry inside the reactor core. Based on this fact NPP Paks performed differential pressure measurements of all fuel assemblies in order to determine the hydraulic resistance and subsequently the limit values for the hydraulic acceptance of FAs to be used. Based on the hydraulic investigations a total number of 170 FAs was selected for cleaning. The necessity for cleaning the FAs was explained by the fact that the FAs were subjected to a short term usage in the reactor core only maximum of 1,5 years and had still a capacity for additional 2 fuel cycles. (authors)

  10. Ingestion resistant seal assembly

    Little, David A.

    2011-12-13

    A seal assembly limits gas leakage from a hot gas path to one or more disc cavities in a gas turbine engine. The seal assembly includes a seal apparatus associated with a blade structure including a row of airfoils. The seal apparatus includes an annular inner shroud associated with adjacent stationary components, a wing member, and a first wing flange. The wing member extends axially from the blade structure toward the annular inner shroud. The first wing flange extends radially outwardly from the wing member toward the annular inner shroud. A plurality of regions including one or more recirculation zones are defined between the blade structure and the annular inner shroud that recirculate working gas therein back toward the hot gas path.

  11. Turbine seal assembly

    Little, David A.

    2013-04-16

    A seal assembly that limits gas leakage from a hot gas path to one or more disc cavities in a turbine engine. The seal assembly includes a seal apparatus that limits gas leakage from the hot gas path to a respective one of the disc cavities. The seal apparatus comprises a plurality of blade members rotatable with a blade structure. The blade members are associated with the blade structure and extend toward adjacent stationary components. Each blade member includes a leading edge and a trailing edge, the leading edge of each blade member being located circumferentially in front of the blade member's corresponding trailing edge in a direction of rotation of the turbine rotor. The blade members are arranged such that a space having a component in a circumferential direction is defined between adjacent circumferentially spaced blade members.

  12. Fuel nozzle assembly

    Johnson, Thomas Edward; Ziminsky, Willy Steve; Lacey, Benjamin Paul; York, William David; Stevenson, Christian Xavier

    2011-08-30

    A fuel nozzle assembly is provided. The assembly includes an outer nozzle body having a first end and a second end and at least one inner nozzle tube having a first end and a second end. One of the nozzle body or nozzle tube includes a fuel plenum and a fuel passage extending therefrom, while the other of the nozzle body or nozzle tube includes a fuel injection hole slidably aligned with the fuel passage to form a fuel flow path therebetween at an interface between the body and the tube. The nozzle body and the nozzle tube are fixed against relative movement at the first ends of the nozzle body and nozzle tube, enabling the fuel flow path to close at the interface due to thermal growth after a flame enters the nozzle tube.

  13. Nuclear fuel assembly

    Purpose: To increase the fuel assembly rigidity while making balance in view of the dimension thereby improving the earthquake proofness. Constitution: In a nuclear fuel assembly having a control rod guide thimble tube, the gap between the thimble tube and fuel insert (inner diameter of the guiding thimble tube-outer diameter of the fuel insert) is made greater than 1.0 mm. Further, the wall thickness of the thimble tube is made to about 4 - 5 % of the outer diameter, while the flowing fluid pore cross section S in the thimble tube is set as: S = S0 x A0/A where S0: cross section of the present flowing fluid pore, A: effective cross section after improvement, = Π/4(d2 - D2) in which d is the thimble tube inner diameter and the D is the fuel insert outer diameter. A0: present effective cross section. (Seki, T.)

  14. Current meter data from moored current meter casts in the TOGA Area - Pacific (30 N to 30 S) as part of the Equatorial Pacific Ocean Climate Studies (EPOCS) project from 24 May 1988 to 26 May 1989 (NODC Accession 9100207)

    National Oceanic and Atmospheric Administration, Department of Commerce — Current meter data were collected using moored current meter casts in the TOGA Area - Pacific (30 N to 30 S) from 24 May 1988 to 26 May 1989. Data were submitted by...

  15. Protein-RNA cross-linking in the ribosomes of yeast under oxidative stress.

    Mirzaei, Hamid; Regnier, Fred

    2006-12-01

    Living systems have efficient degradative pathways for dealing with the fact that reactive oxygen species (ROS) derived from cellular metabolism and the environment oxidatively damage proteins and DNA. But aggregation and cross-linking can occur as well, leading to a series of problems including disruption of cellular regulation, mutations, and even cell death. The mechanism(s) by which protein aggregation occurs and the macromolecular species involved are poorly understood. In the study reported here, evidence is provided for a new type of aggregate between proteins and RNA in ribosomes. While studying the effect of oxidative stress induced in the yeast proteome it was noted that ribosomal proteins were widely oxidized. Eighty six percent of the proteins in yeast ribosomes were found to be carbonylated after stressing yeast cell cultures with hydrogen peroxide. Moreover, many of these proteins appeared to be cross-linked based on their coelution patterns during RPC separation. Since they were not in direct contact, it was not clear how this could occur unless it was through the RNA separating them in the ribosome. This was confirmed in a multiple-step process, the first being derivatization of all carbonylated proteins in cell lysates with biotin hydrazide through Schiff base formation. Following reduction of Schiff bases with sodium cyanoborohydride, biotinylated proteins were selected from cell lysates with avidin affinity chromatography. Oxidized proteins thus captured were then selected again using boronate affinity chromatography to capture vicinal diol-containing proteins. This would include proteins cross-linked to an RNA fragment containing a ribose residue with 2',3'-hydroxyl groups. Some glycoproteins would also be selected by this process. LC/MS/MS analyses of tryptic peptides derived from proteins captured by this process along with MASCOT searches resulted in the identification of 37 ribosomal proteins that appear to be cross-linked to RNA

  16. Composite airfoil assembly

    Garcia-Crespo, Andres Jose

    2015-03-03

    A composite blade assembly for mounting on a turbine wheel includes a ceramic airfoil and an airfoil platform. The ceramic airfoil is formed with an airfoil portion, a blade shank portion and a blade dovetail tang. The metal platform includes a platform shank and a radially inner platform dovetail. The ceramic airfoil is captured within the metal platform, such that in use, the ceramic airfoil is held within the turbine wheel independent of the metal platform.

  17. Uniform Test Assembly

    Belov, Dmitry I.

    2008-01-01

    In educational practice, a test assembly problem is formulated as a system of inequalities induced by test specifications. Each solution to the system is a test, represented by a 0-1 vector, where each element corresponds to an item included (1) or not included (0) into the test. Therefore, the size of a 0-1 vector equals the number of items "n"…

  18. Nuclear fuel assembly

    A nuclear fuel assembly comprises a cluster of elongated fuel, retained parallel and at the nodal points of a square network by a bottom supporting plate and by spacing grids. The supporting plate is connected to a top end plate via tie-rods which replace fuel pins at certain of the nodal points of the network. The diameter of the tie-rods is equal to that of the pins and both are slidably received in the grids

  19. Nuclear fuel assembly spacer

    A spacer for use in a fuel assembly of a nuclear reactor having thin, full-height divider members, slender spring members and laterally oriented rigid stops and wherein the total amount of spacer material, the amount of high neutron cross section material, the projected area of the spacer structure and changes in cross section area of the spacer structure are minimized whereby neutron absorption by the spacer and coolant flow resistance through the spacer are minimized

  20. REACTOR NOZZLE ASSEMBLY

    Capuder, F.C.; Dearwater, J.R.

    1959-02-10

    An improved nozzle assembly useful in a process for the direct reduction of uranium hexafluoride to uranium tetrafluoride by means of dissociated ammonia in a heated reaction vessel is descrlbed. The nozzle design provides for intimate mixing of the two reactants and at the same time furnishes a layer of dissociated ammonia adjacent to the interior wall of the reaction vessel, thus preventing build-up of the reaction product on the vessel wall.

  1. Assembling Toyota in Portugal

    Machado, Tiago; Moniz, António

    2003-01-01

    A lot has been written over the last decade with regard to Toyota and the productive model associated to it (toyota-ism). And more specifically concerning the "(…) best-seller that changed the... sociological world" (Castillo, 1998: 31). But the case of Salvador Caetano’s Ovar Industrial Division (OID), that assembles Toyota light commercial vehicles in Portugal, allows us to put forward a sub-hypothesis that fits into the analysis schema proposed in the First GERPISA International Program – ...

  2. SCT Barrel Assembly Complete

    L. Batchelor

    As reported in the April 2005 issue of the ATLAS eNews, the first of the four Semiconductor Tracker (SCT) barrels, complete with modules and services, arrived safely at CERN in January of 2005. In the months since January, the other three completed barrels arrived as well, and integration of the four barrels into the entire barrel assembly commenced at CERN, in the SR1 building on the ATLAS experimental site, in July. Assembly was completed on schedule in September, with the addition of the innermost layer to the 4-barrel assembly. Work is now underway to seal the barrel thermal enclosure. This is necessary in order to enclose the silicon tracker in a nitrogen atmosphere and provide it with faraday-cage protection, and is a delicate and complicated task: 352 silicon module powertapes, 352 readout-fibre bundles, and over 400 Detector Control System sensors must be carefully sealed into the thermal enclosure bulkhead. The team is currently verifying the integrity of the low mass cooling system, which must be d...

  3. Ordinary General Assembly

    Association du personnel

    2010-01-01

    Tuesday 20 April at 10.00 Council Chamber, Bldg 503 In conformity with the Statutes of the Staff Association, an ordinary General Assembly is organized once a year (article IV.2.1). Agenda Adoption of the Agenda Approval of the Draft Minutes of the Ordinary General Assembly of 12 May 2009 Presentation and approval of the Activity Report 2009 Presentation and approval of the Financial Report 2009 Presentation and approval of the Auditors Report 2009 Programme for 2010 Presentation et and approval of the draft budget and subscription rate 2010 Modifications to the statutes of the association Election of the Election Committee Election of the Board of Auditors Miscellaneous We remind members of article IV.3.4 in the Statutes of the Association which reads: “After having dealt with all the items on the agenda, the members may, with the consent of the Assembly, have other matters discussed, but decisions may be taken only on the items listed on the agenda...

  4. Gas sealed assembly

    A gas sealed assembly is disposed to a reactor core of an LMFBR type reactor. The gas sealed assembly has a cylindrical duct, and an entrance nozzle having a coolant flowing hole is connected to the lower portion of the duct. Sodium coolants and a sealed gas comprising inert gases such as argon are contained in the duct. A black material is disposed on the inner surface of the duct. Chromium carbide, for example, is used as the black material. Since the black material is disposed to the inner surface of the duct, heat from sodium at the circumference is transferred to the sealed gas by radiation by way of the duct, the gas expands sufficiently. Therefore, when the pressure of coolants is lowered and the temperature of coolants is elevated upon occurrence of an accident such as of stoppage of pumps, the liquid level of the coolants in the gas sealed assembly can be lowered reliably. Accordingly, the reactor shut down can be conducted safely. (I.N.)

  5. Fourth Doctoral Student Assembly

    Ingrid Haug

    2016-01-01

    On 10 May, over 130 PhD students and their supervisors, from both CERN and partner universities, gathered for the 4th Doctoral Student Assembly in the Council Chamber.   The assembly was followed by a poster session, at which eighteen doctoral students presented the outcome of their scientific work. The CERN Doctoral Student Programme currently hosts just over 200 students in applied physics, engineering, computing and science communication/education. The programme has been in place since 1985. It enables students to do their research at CERN for a maximum of three years and to work on a PhD thesis, which they defend at their University. The programme is steered by the TSC committee, which holds two selection committees per year, in June and December. The Doctoral Student Assembly was opened by the Director-General, Fabiola Gianotti, who stressed the importance of the programme in the scientific environment at CERN, emphasising that there is no more rewarding activity than lear...

  6. RNA gymnastics in mammalian signal recognition particle assembly.

    Wild, Klemens; Sinning, Irmgard

    2014-01-01

    More than one third of the cellular proteome is destined for incorporation into cell membranes or export from the cell. In all domains of life, the signal recognition particle (SRP) delivers these proteins to the membrane and protein traffic falls apart without SRP logistics. With the aid of a topogenic transport signal, SRP retrieves its cargo right at the ribosome, from where they are sorted to the translocation channel. Mammalian SRP is a ribonucleoprotein complex consisting of an SRP RNA of 300 nucleotides and 6 proteins bound to it. Assembly occurs in a hierarchical manner mainly in the nucleolus and only SRP54, which recognizes the signal sequence and regulates the targeting process, is added as the last component in the cytosol. Here we present an update on recent insights in the structure, function and dynamics of SRP RNA in SRP assembly with focus on the S domain, and present SRP as an example for the complex biogenesis of a rather small ribonucleoprotein particle. PMID:25692231

  7. Orientational nanoparticle assemblies and biosensors.

    Ma, Wei; Xu, Liguang; Wang, Libing; Kuang, Hua; Xu, Chuanlai

    2016-05-15

    Assemblies of nanoparticles (NPs) have regional correlated properties with new features compared to individual NPs or random aggregates. The orientational NP assembly contributes greatly to the collective interaction of individual NPs with geometrical dependence. Therefore, orientational NPs assembly techniques have emerged as promising tools for controlling inorganic NPs spatial structures with enhanced interesting properties. The research fields of orientational NP assembly have developed rapidly with characteristics related to the different methods used, including chemical, physical and biological techniques. The current and potential applications, important challenges remain to be investigated. An overview of recent developments in orientational NPs assemblies, the multiple strategies, biosensors and challenges will be discussed in this review. PMID:26708241

  8. Identification of Trichosporon spp. Strains by Sequencing D1/D2 Region and Sub-typing by Sequencing Ribosomal Intergenic Spacer Region of Ribosomal DNA

    Jingsi ZENG; Cristina Maria de Souza Motta; Kazutaka Fukushima; Kayoko Takizawa; Oliane Maria Correia Magalhes; Rejane Pereira Neves; Kazuko Nishimura

    2009-01-01

    To re-identify and further group 25 isolates of Trichosporon spp. identified morphologically previously, sequences of D1/D2 region of large subunit (LSU) of ribosomal DNA (rDNA) of 25 tested strains for identification and those of ribosomal intergenic space 1 (IGS1) region of 11 strains for sub-grouping were detected. The identifications of tested strains were changed except 6 strains. According to the alignment of the IGS1 region, 6 T. asahii isolates tested fell into 4 groups and 5 T. faecale isolates into 3 groups. Polymorphism of 2 T.japonicum isolates was found in 10 positions. With the alignments obtained in this research compared with the relative GenBank entries, it was found that T. asahii, T.faecale and T.japonicum species were divided into 7, 3 and 2 subtypes respectively. Morphological and biophysical methods are not sufficient for Trichosporon spp. identification. Sequencing becomes neces-sary for Trichosporon diagnosis. There is obvious diversity within a species.

  9. La Autoantigen Induces Ribosome Binding Protein 1 (RRBP1) Expression through Internal Ribosome Entry Site (IRES)-Mediated Translation during Cellular Stress Condition.

    Gao, Wenqing; Li, Qi; Zhu, Ruiyu; Jin, Jian

    2016-01-01

    The function of ribosome binding protein 1 (RRBP1) is regulating the transportation and secretion of some intracellular proteins in mammalian cells. Transcription of RRBP1 is induced by various cytokines. However, few studies focused on the process of RRPB1 mRNA translation. The RRBP1 mRNA has a long 5' untranslated region that potentially formed a stable secondary structure. In this study, we show that the 5' UTR of RRBP1 mRNA contains an internal ribosome entry site (IRES). Moreover, the RRBP1 expression is induced by chemotherapeutic drug paclitaxel or adriamycin in human hepatocellular carcinoma cells and accompanied with the increased expression of La autoantigen (La), which binds to RRBP1 IRES element and facilitates translation initiation. Interestingly, we found IRES-mediated RRBP1 translation is also activated during serum-starvation condition which can induce cytoplasmic localization of La. After mapping the entire RRBP1 5' UTR, we determine the core IRES activity is located between nt-237 and -58. Furthermore, two apical GARR loops within the functional RRBP1 IRES elements may be important for La binding. These results strongly suggest an important role for IRES-dependent translation of RRBP1 mRNA in hepatocellular carcinoma cells during cellular stress conditions. PMID:27447629

  10. Cloning and expression of antiviral/ribosome-inactivating protein from Bougainvillea xbuttiana

    Nandlal Choudhary; Harish C Kapoor; Madan L Lodha

    2008-03-01

    A full-length cDNA encoding ribosome-inactivating/antiviral protein (RIP/AVP) from the leaves of Bougainvillea xbuttiana was isolated. The cDNA consisted of 1364 nucleotides with an open reading frame (ORF) of 960 nucleotides encoding a 35.49 kDa protein of 319 amino acids. The deduced amino acid sequence has a putative active domain conserved in RIPs/AVPs and shows a varying phylogenetic relationship to the RIPs from other plant species. The deduced protein has been designated BBAP1 (Bougainvillea xbuttiana antiviral protein1). The ORF was cloned into an expression vector and expressed in E. coli as a fusion protein of ∼78 kDa. The cleaved and purified recombinant BBAP1 exhibited ribosome-inhibiting rRNA -glycosidase activity, and imparted a high level of resistance against the tobacco mosaic virus (TMV).

  11. The 2009 Nobel Prize in Chemistry: Thomas A. Steitz and the Structure of the Ribosome

    Zhao, Peter

    2011-01-01

    Over the past 200 years, there have been countless groundbreaking discoveries in biology and medicine at Yale University. However, one particularly noteworthy discovery with profoundly important and broad consequences happened here in just the past two decades. In 2009, Thomas Steitz, the Sterling Professor of Molecular Biophysics & Biochemistry, was awarded the Nobel Prize in Chemistry for “studies of the structure and function of the ribosome,” along with Venkatraman Ramakrishnan of the MRC Laboratory of Molecular Biology and Ada E. Yonath of the Weizmann Institute of Science. This article covers the historical context of Steitz’s important discovery, the techniques his laboratory used to study the ribosome, and the impact that this research has had, and will have, on the future of biological and medical research. PMID:21698044

  12. Transient ribosomal attenuation coordinates protein synthesis and co-translational folding.

    Zhang, Gong; Hubalewska, Magdalena; Ignatova, Zoya

    2009-03-01

    Clustered codons that pair to low-abundance tRNA isoacceptors can form slow-translating regions in the mRNA and cause transient ribosomal arrest. We report that folding efficiency of the Escherichia coli multidomain protein SufI can be severely perturbed by alterations in ribosome-mediated translational attenuation. Such alterations were achieved by global acceleration of the translation rate with tRNA excess in vitro or by synonymous substitutions to codons with highly abundant tRNAs both in vitro and in vivo. Conversely, the global slow-down of the translation rate modulated by low temperature suppresses the deleterious effect of the altered translational attenuation pattern. We propose that local discontinuous translation temporally separates the translation of segments of the peptide chain and actively coordinates their co-translational folding. PMID:19198590

  13. Infraspecific variation within and across complete organellar genomes and nuclear ribosomal repeats in a moss.

    Lewis, Lily R; Liu, Yang; Rozzi, Ricardo; Goffinet, Bernard

    2016-03-01

    Bryophytes (mosses, liverworts, and hornworts) are diverse and ecologically and evolutionarily significant yet genome scale data sets and analyses remain extremely sparse relative to other groups of plants, and are completely lacking at the infraspecific level. By sequencing the complete organellar genomes and nuclear ribosomal repeat from seven patches of a South American sub-Antarctic neo-endemic non-model moss, we present the first characterization of infraspecific polymorphism within and across the three genomic compartments for a bryophyte. Diversity within patches is accounted for by both intraindividual and interindividual variation for the nuclear ribosomal repeat and plastid genome, respectively. This represents the most extensive infraspecific genomic dataset generated for an early land plant lineage thus far and provides insight into relative rates of substitution between organellar genomes, including high rates of nonsynonymous to synonymous substitutions. PMID:26724407

  14. Engineering Biosynthesis of Non-ribosomal Peptides and Polyketides by Directed Evolution.

    Rui, Zhe; Zhang, Wenjun

    2016-01-01

    Non-ribosomal peptides (NRPs) and polyketides (PKs) play key roles in pharmaceutical industry due to their promising biological activities. The structural complexity of NRPs and PKs, however, creates significant synthetic challenges for producing these natural products and their analogues by purely chemical means. Alternatively, difficult syntheses can be achieved by using biosynthetic enzymes with improved efficiency and altered selectivity that are acquired from directed evolution. Key to the successful directed evolution is the methodology of screening/selection. This review summarizes the screening/selection strategies that have been employed to improve or modify the functions of non-ribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), in the hope of triggering the wide adoption of the directed evolution approaches in the engineered biosynthesis of NRPs and PKs for drug discovery. PMID:26456467

  15. X-ray Analyses of the Ribosomal A-Site Molecular Switches

    Kondo, Jiro

    The aminoacyl-tRNA decoding site (A-site) on the small ribosomal subunit is an RNA molecular switch guaranteeing high translation fidelity. Due to the similarity of the secondary structure of the A-site, it has long been believed that the functional characteristics and tertiary structure of the A-site molecular switch are basically conserved in three main cell types, bacteria, mitochondria and eukaryotic cytoplasm. However, these three cell types are noticeably different in their biological properties such as life cycle, genome size, structural component of ribosome and number of tRNA species. In our structural studies, we have shown how a small difference of nucleotide sequences affects the dynamics of the A-site molecular switches underlying the decoding mechanism adapted to their biological properties and environments. The observed structural insights into the decoding process allowed us to understand molecular mechanisms of non-syndromic hearing loss and toxicity mechanism of aminoglycoside antibiotics.

  16. Differential Effects of Replacing Escherichia coli Ribosomal Protein L27 with Its Homologue from Aquifex aeolicus

    Maguire, Bruce A.; Manuilov, Anton V; Zimmermann, Robert A.

    2001-01-01

    The rpmA gene, which encodes 50S ribosomal subunit protein L27, was cloned from the extreme thermophile Aquifex aeolicus, and the protein was overexpressed and purified. Comparison of the A. aeolicus protein with its homologue from Escherichia coli by circular dichroism analysis and proton nuclear magnetic resonance spectroscopy showed that it readily adopts some structure in solution that is very stable, whereas the E. coli protein is unstructured under the same conditions. A mutant of E. co...

  17. Ribosome biogenesis adaptation in resistance training-induced human skeletal muscle hypertrophy.

    Figueiredo, Vandre C; Caldow, Marissa K; Massie, Vivien; Markworth, James F; Cameron-Smith, David; Blazevich, Anthony J

    2015-07-01

    Resistance training (RT) has the capacity to increase skeletal muscle mass, which is due in part to transient increases in the rate of muscle protein synthesis during postexercise recovery. The role of ribosome biogenesis in supporting the increased muscle protein synthetic demands is not known. This study examined the effect of both a single acute bout of resistance exercise (RE) and a chronic RT program on the muscle ribosome biogenesis response. Fourteen healthy young men performed a single bout of RE both before and after 8 wk of chronic RT. Muscle cross-sectional area was increased by 6 ± 4.5% in response to 8 wk of RT. Acute RE-induced activation of the ERK and mTOR pathways were similar before and after RT, as assessed by phosphorylation of ERK, MNK1, p70S6K, and S6 ribosomal protein 1 h postexercise. Phosphorylation of TIF-IA was also similarly elevated following both RE sessions. Cyclin D1 protein levels, which appeared to be regulated at the translational rather than transcriptional level, were acutely increased after RE. UBF was the only protein found to be highly phosphorylated at rest after 8 wk of training. Also, muscle levels of the rRNAs, including the precursor 45S and the mature transcripts (28S, 18S, and 5.8S), were increased in response to RT. We propose that ribosome biogenesis is an important yet overlooked event in RE-induced muscle hypertrophy that warrants further investigation. PMID:25968575

  18. Early life stress inhibits expression of ribosomal RNA in the developing hippocampus.

    Lan Wei

    Full Text Available Children that are exposed to abuse or neglect show abnormal hippocampal function. However, the developmental mechanisms by which early life stress (ELS impairs normal hippocampal development have not been elucidated. Here we propose that exposure to ELS blunts normal hippocampal growth by inhibiting the availability of ribosomal RNA (rRNA. In support of this hypothesis, we show that the normal mouse hippocampus undergoes a growth-spurt during the second week of life, followed by a gradual decrease in DNA and RNA content that persists into adulthood. This developmental pattern is associated with accelerated ribosomal RNA (rRNA synthesis during the second week of life, followed by a gradual decline in rRNA levels that continue into adulthood. Levels of DNA methylation at the ribosomal DNA (rDNA promoter are lower during the second week of life compared to earlier development or adulthood. Exposure to brief daily separation (BDS, a mouse model of early life stress, increased DNA methylation at the ribosomal DNA promoter, decreased rRNA levels, and blunted hippocampal growth during the second week of life. Exposure to acute (3 hrs maternal separation decreased rRNA and increased DNA methylation at the rDNA proximal promoter, suggesting that exposure to stress early in life can rapidly regulate the availability of rRNA levels in the developing hippocampus. Given the critical role that rRNA plays in supporting normal growth and development, these findings suggest a novel molecular mechanism to explain how stress early in life impairs hippocampus development in the mouse.

  19. Diversity and Recombination of Dispersed Ribosomal DNA and Protein Coding Genes in Microsporidia

    Ironside, Joseph Edward

    2013-01-01

    Microsporidian strains are usually classified on the basis of their ribosomal DNA (rDNA) sequences. Although rDNA occurs as multiple copies, in most non-microsporidian species copies within a genome occur as tandem arrays and are homogenised by concerted evolution. In contrast, microsporidian rDNA units are dispersed throughout the genome in some species, and on this basis are predicted to undergo reduced concerted evolution. Furthermore many microsporidian species appear to be asexual and sh...

  20. Stem–loop structures can effectively substitute for an RNA pseudoknot in −1 ribosomal frameshifting

    Yu, Chien-Hung; Noteborn, Mathieu H.; Pleij, Cornelis W. A.; Olsthoorn, René C. L.

    2011-01-01

    −1 Programmed ribosomal frameshifting (PRF) in synthesizing the gag-pro precursor polyprotein of Simian retrovirus type-1 (SRV-1) is stimulated by a classical H-type pseudoknot which forms an extended triple helix involving base–base and base–sugar interactions between loop and stem nucleotides. Recently, we showed that mutation of bases involved in triple helix formation affected frameshifting, again emphasizing the role of the triple helix in −1 PRF. Here, we investigated the efficiency of ...