WorldWideScience

Sample records for 2slaq luminous red

  1. Friends-of-Friends Groups and Clusters in the 2SLAQ Catalogue

    Farrens, S; Cypriano, E S; Sabiu, C; Blake, C

    2011-01-01

    We present a catalogue of galaxy groups and clusters selected using a friends-of-friends algorithm with a dynamic linking length from the 2dF-SDSS and QSO (2SLAQ) luminous red galaxy survey. The linking parameters for the code are chosen through an analysis of simulated 2SLAQ haloes. The resulting catalogue includes 313 clusters containing 1,152 galaxies. The galaxy groups and clusters have an average velocity dispersion of sigma_v = 467.97 km/s and an average size of R_clt = 0.78 Mpc/h. Galaxies from regions of one square degree and centred on the galaxy clusters were downloaded from the Sloan Digital Sky Survey Data Release 6 (SDSS DR6). Investigating the photometric redshifts and cluster red-sequence of these galaxies shows that the galaxy clusters detected with the FoF algorithm are reliable out to z~0.6. We estimate masses for the clusters using their velocity dispersions. These mass estimates are shown to be consistent with 2SLAQ mock halo masses. Further analysis of the simulation haloes shows that cli...

  2. 2dF-SDSS LRG and QSO (2SLAQ) Survey: Evolution of the Most Massive Galaxies

    Nichol, R; Roseboom, I; Wake, D; Nichol, Robert; Cannon, Russell; Roseboom, Isaac; Wake, David

    2006-01-01

    The 2dF-SDSS LRG and QSO (2SLAQ) survey is a new survey of distant Luminous Red Galaxies (LRGs) and faint quasars selected from the Sloan Digital Sky Survey (SDSS) multi-color photometric data and spectroscopically observed using the 2dF instrument on the Anglo-Australian Telescope (AAT). In total, the 2SLAQ survey has measured over 11000 LRG redshifts, covering 180deg^2 of SDSS imaging data, from 87 allocated nights of AAT time. Over 90% of these galaxies are within the range 0.45=3L*. When combined with the lower redshift SDSS LRGs, the evolution in the luminosity function of these LRGs is fully consistent with that expected from a simple passive (luminosity) evolution model. This observation suggests that at least half of the LRGs seen at z~0.2 must already have more than half their stellar mass in place by z~0.6, i.e., our observations are inconsistent with a majority of LRGs experiencing a major merger in the last 6 Gyrs. However, some "frosting" (i.e., minor mergers) has taken place with ~5% of LRGs sho...

  3. Intrinsic galaxy alignments from the 2SLAQ and SDSS surveys: luminosity and redshift scalings and implications for weak lensing surveys

    Hirata, C M; Ishak, M; Seljak, U; Nichol, R; Pimbblet, K A; Ross, N P; Wake, D; Hirata, Christopher M.; Mandelbaum, Rachel; Ishak, Mustapha; Seljak, Uros; Nichol, Robert; Pimbblet, Kevin A.; Ross, Nicholas P.; Wake, David

    2007-01-01

    Correlations between intrinsic shear and the density field on large scales, a potentially important contaminant for cosmic shear surveys, have been robustly detected at low redshifts with bright galaxies in SDSS data. Here we present a more detailed characterization of this effect, which can cause anti-correlations between gravitational lensing shear and intrinsic ellipticity (GI correlations). This measurement uses 36278 Luminous Red Galaxies (LRGs) from the SDSS spectroscopic sample with 0.153sigma detections of the effect for all galaxy subsamples within the SDSS LRG sample; for the 2SLAQ sample, we find a 2sigma detection for a bright subsample, and no detection for a fainter subsample. Fitting formulae are provided for the scaling of the GI correlations with luminosity, transverse separation, and redshift. We estimate contamination in the measurement of sigma_8 for future cosmic shear surveys on the basis of the fitted dependence of GI correlations on galaxy properties. We find contamination to the power...

  4. Luminous Red Galaxy Clustering at z ~ 0.7 - First Results using AAOmega

    Ross, Nicholas P; Cannon, Russell D; Wake, D A; Sharp, R G; Croom, S M; Peacock, John A

    2007-01-01

    We report on the AAOmega-AAT LRG Pilot observing run to establish the feasibility of a large spectroscopic survey using the new AAOmega instrument. We have selected Luminous Red Galaxies (LRGs) using single epoch SDSS riz-photometry to i=0.5 LRGs. Exposure times varied from 1 - 4 hours to determine the minimum exposure for AAOmega to make an essentially complete LRG redshift survey in average conditions. We show that LRG redshifts to i<20.5 can be measured in 1.5hr exposures and present comparisons to spectroscopic and photometric redshifts obtained by the 2SLAQ LRG and COMBO-17 surveys respectively. Crucially, the riz selection coupled with the 3-4 times improved AAOmega throughput is shown to extend the LRG mean redshift from z=0.55 for 2SLAQ to z=0.681+/- 0.005 for riz-selected LRGs. This extended range is vital for maximising the S/N for the detection of the baryon acoustic oscillations (BAOs). Furthermore, we show that the amplitude of LRG clustering is s_0 = 9.9+/-0.3 h^-1 Mpc, as high as that seen i...

  5. Chandra Observations of 12 Luminous Red Quasars

    Urrutia, T; Lacy, M; Gregg, M D; Becker, R H

    2005-03-11

    The authors present results of a study of 12 dust-reddened quasars with 0.4 < z < 2.65 and reddenings in the range 0.15 < E(B-V) < 1.7. They obtained ACIS-S X-ray spectra of these quasars, estimated the column densities towards them, and hence obtained the gas:dust ratios in the material obscuring the quasar. They detect all but one of the red quasars in the X-rays. Even though there is no obvious correlation between the X-ray determined column densities of the sources and their optical color or reddening, all of the sources show absorbed X-ray spectra. When they correct the luminosity for absorption, they can be placed among luminous quasars; therefore their objects belong to the group of high luminosity analogues of the sources contributing to the X-ray background seen in deep X-ray observations. Such sources are also found in serendipitous shallow X-ray surveys. There is a hint that the mean spectral slope of the red quasar is higher than that of normal, unobscured quasars, which could be an indication for higher accretion rates and/or an evolutionary effect. They investigate the number density of these sources compared to type 2 AGN based on the X-ray background and estimate how many moderate luminosity red quasars may be found in deep X-ray fields.

  6. Detection of Stacked Filament Lensing Between SDSS Luminous Red Galaxies

    Clampitt, Joseph; Takada, Masahiro

    2014-01-01

    We search for the lensing signal of massive filaments between 220,000 pairs of Luminous Red Galaxies (LRGs) from the Sloan Digital Sky Survey. We use a nulling technique to remove the contribution of the LRG halos, resulting in a $10 \\sigma$ detection of the filament lensing signal. We compare the measurements with halo model predictions based on a calculation of 3-point halo-halo-mass correlations. Comparing the "thick" halo model filament to a "thin" string of halos, thick filaments larger than a Mpc in width are clearly preferred by the data.

  7. A prediction of a luminous red nova eruption

    Molnar, Lawrence A.; Van Noord, Daniel M.; Steenwyk, Steven D.; Spedden, Chris J.; Kinemuchi, Karen

    2015-01-01

    Luminous red novae have been distinguished as a class of stellar eruption in just the past decade. They are hypothesized to be the result of the merger of two main sequence stars. Tylenda et al. (2011) found remarkable confirmation of this hypothesis by showing that OGLE data preceding the 2008 outburst of V1309 Sco exhibited the light curve of a contact binary system with an orbital period spiraling exponentially down to zero.We will present analysis of light curves of KIC 9832227 (= NSVS 5597755) spanning 15 years that show it is a contact binary system with a negative period derivative and second derivative. The data are taken from the NSVS, WASP, and Kepler surveys, and extended by Calvin Observatory measurements in 2013 and 2014.Fitting the orbital phase timing to the exponential model of Tylenda et al. (2011) provides a satisfactory fit of the entire data set. While we cannot yet conclude the system will follow the model fit, the prediction it makes will soon be easily falsifiable. The model predicts the period derivative will very soon exceed measured values for all other contact binary stars and that the stars should merge sometime between summer 2019 and summer 2022. If the model holds up, this star presents the unprecedented opportunity to perform a set of targeted observations of a luminous red nova progenitor and to follow carefully the course of the merger.Tylenda, R., et al. (2011), AA, 528, A114.

  8. Cosmological Constraints from the SDSS Luminous Red Galaxies

    Tegmark, M; Strauss, M; Weinberg, D; Blanton, M; Frieman, J A; Fukugita, M; Gunn, J; Hamilton, A; Knapp, G; Nichol, R; Ostriker, J; Padmanabhan, N; Percival, W; Schlegel, D J; Schneider, D; Scoccimarro, R; Seljak, U; Seo, H; Swanson, M; Szalay, A S; Vogeley, M; Yoo, J; Zehavi, I; Abazajian, Kevork N; Anderson, S; Annis, J; Bahcall, Neta A; Bassett, B; Berlind, A; Brinkmann, J; Budavari, T; Castander, F; Connolly, A; Csabai, I; Doi, M; Finkbeiner, D; Gillespie, B; Glazebrook, K; Hennessy, G; Hogg, D; Ivezic, Z; Jain, B; Johnston, D; Kent, S; Lamb, D; Lee, B; Lin, H; Loveday, J; Lupton, R; Munn, J A; Pan, K; Park, C; Peoples, John; Pier, J; Pope, A; Richmond, M; Rockosi, C M; Scranton, R; Sheth, R; Stebbins, A; Stoughton, C; Szapudi, I; Tucker, D; Vanden Berk, Daniel E; Yanny, B; York, D

    2006-01-01

    We measure the large-scale real-space power spectrum P(k) using luminous red galaxies (LRGs) in the Sloan Digital Sky Survey (SDSS) and use this measurement to sharpen constraints on cosmological parameters from the Wilkinson Microwave Anisotropy Probe (WMAP). We employ a matrix-based power spectrum estimation method using Pseudo-Karhunen-Loeve eigenmodes, producing uncorrelated minimum-variance measurements in 20 k-bands of both the clustering power and its anisotropy due to redshift-space distortions, with narrow and well-behaved window functions in the range 0.01h/Mpc 0.1h/Mpc and associated nonlinear complications, yet agree well with more aggressive published analyses where nonlinear modeling is crucial.

  9. Cosmological information in the intrinsic alignments of luminous red galaxies

    The intrinsic alignments of galaxies are usually regarded as a contaminant to weak gravitational lensing observables. The alignment of Luminous Red Galaxies, detected unambiguously in observations from the Sloan Digital Sky Survey, can be reproduced by the linear tidal alignment model of Catelan, Kamionkowski and Blandford (2001) on large scales. In this work, we explore the cosmological information encoded in the intrinsic alignments of red galaxies. We make forecasts for the ability of current and future spectroscopic surveys to constrain local primordial non-Gaussianity and Baryon Acoustic Oscillations (BAO) in the cross-correlation function of intrinsic alignments and the galaxy density field. For the Baryon Oscillation Spectroscopic Survey, we find that the BAO signal in the intrinsic alignments is marginally significant with a signal-to-noise ratio of 1.8 and 2.2 with the current LOWZ and CMASS samples of galaxies, respectively, and increasing to 2.3 and 2.7 once the survey is completed. For the Dark Energy Spectroscopic Instrument and for a spectroscopic survey following the EUCLID redshift selection function, we find signal-to-noise ratios of 12 and 15, respectively. Local type primordial non-Gaussianity, parametrized by fNL = 10, is only marginally significant in the intrinsic alignments signal with signal-to-noise ratios < 2 for the three surveys considered

  10. Cosmological constraints from the SDSS luminous red galaxies

    We measure the large-scale real-space power spectrum P(k) using luminous red galaxies (LRGs) in the Sloan Digital Sky Survey (SDSS) and use this measurement to sharpen constraints on cosmological parameters from the Wilkinson Microwave Anisotropy Probe (WMAP). We employ a matrix-based power spectrum estimation method using Pseudo-Karhunen-Loeve eigenmodes, producing uncorrelated minimum-variance measurements in 20 k-bands of both the clustering power and its anisotropy due to redshift-space distortions, with narrow and well-behaved window functions in the range 0.01h/Mpcm and the baryon fraction in good agreement with WMAP. Within the context of flat ΛCDM models, our LRG measurements complement WMAP by sharpening the constraints on the matter density, the neutrino density and the tensor amplitude by about a factor of 2, giving Ωm=0.24±0.02 (1σ) (95%) and rtot=1.05±0.05 from WMAP alone to Ωtot=1.003±0.010. Assuming Ωtot=1, the equation of state parameter is constrained to w=-0.94±0.09, indicating the potential for more ambitious future LRG measurements to provide precision tests of the nature of dark energy. All these constraints are essentially independent of scales k>0.1h/Mpc and associated nonlinear complications, yet agree well with more aggressive published analyses where nonlinear modeling is crucial

  11. Detection of stacked filament lensing between SDSS luminous red galaxies

    Clampitt, Joseph; Miyatake, Hironao; Jain, Bhuvnesh; Takada, Masahiro

    2016-04-01

    We search for the lensing signal of massive filaments between 135 000 pairs of luminous red galaxies (LRGs) from the Sloan Digital Sky Survey. We develop a new estimator that cleanly removes the much larger shear signal of the neighbouring LRG haloes, relying only on the assumption of spherical symmetry. We consider two models: a `thick'-filament model constructed from ray-tracing simulations for Λ cold dark matter model, and a `thin'-filament model which models the filament by a string of haloes along the line connecting the two LRGs. We show that the filament lensing signal is in nice agreement with the thick simulation filament, while strongly disfavouring the thin model. The magnitude of the lensing shear due to the filament is below 10-4. Employing the likelihood ratio test, we find a 4.5σ significance for the detection of the filament lensing signal, corresponding to a null hypothesis fluctuation probability of 3 × 10-6. We also carried out several null tests to verify that the residual shear signal from neighbouring LRGs and other shear systematics are minimized.

  12. redMaGiC: Selecting Luminous Red Galaxies from the DES Science Verification Data

    Rozo, E; Abate, A; Bonnett, C; Crocce, M; Davis, C; Hoyle, B; Leistedt, B; Peiris, H V; Wechsler, R H; Abbott, T; Abdalla, F B; Banerji, M; Bauer, A H; Benoit-Lévy, A; Bernstein, G M; Bertin, E; Brooks, D; Buckley-Geer, E; Burke, D L; Capozzi, D; Rosell, A Carnero; Carollo, D; Kind, M Carrasco; Carretero, J; Castander, F J; Childress, M J; Cunha, C E; D'Andrea, C B; Davis, T; DePoy, D L; Desai, S; Diehl, H T; Dietrich, J P; Doel, P; Eifler, T F; Evrard, A E; Neto, A Fausti; Flaugher, B; Fosalba, P; Frieman, J; Gaztanaga, E; Gerdes, D W; Glazebrook, K; Gruen, D; Gruendl, R A; Honscheid, K; James, D J; Jarvis, M; Kim, A G; Kuehn, K; Kuropatkin, N; Lahav, O; Lidman, C; Lima, M; Maia, M A G; March, M; Martini, P; Melchior, P; Miller, C J; Miquel, R; Mohr, J J; Nichol, R C; Nord, B; O'Neill, C R; Ogando, R; Plazas, A A; Romer, A K; Roodman, A; Sako, M; Sanchez, E; Santiago, B; Schubnell, M; Sevilla-Noarbe, I; Smith, R C; Soares-Santos, M; Sobreira, F; Suchyta, E; Swanson, M E C; Thaler, J; Thomas, D; Uddin, S; Vikram, V; Walker, A R; Wester, W; Zhang, Y; da Costa, L N

    2015-01-01

    We introduce redMaGiC, an automated algorithm for selecting Luminous Red Galaxies (LRGs). The algorithm was specifically developed to minimize photometric redshift uncertainties in photometric large-scale structure studies. redMaGiC achieves this by self-training the color-cuts necessary to produce a luminosity-thresholded LRG sample of constant comoving density. We demonstrate that redMaGiC photozs are very nearly as accurate as the best machine-learning based methods, yet they require minimal spectroscopic training, do not suffer from extrapolation biases, and are very nearly Gaussian. We apply our algorithm to Dark Energy Survey (DES) Science Verification (SV) data to produce a redMaGiC catalog sampling the redshift range $z\\in[0.2,0.8]$. Our fiducial sample has a comoving space density of $10^{-3}\\ (h^{-1} Mpc)^{-3}$, and a median photoz bias ($z_{spec}-z_{photo}$) and scatter $(\\sigma_z/(1+z))$ of 0.005 and 0.017 respectively. The corresponding $5\\sigma$ outlier fraction is 1.4%. We also test our algorit...

  13. redMaGiC: selecting luminous red galaxies from the DES Science Verification data

    Rozo, E.; Rykoff, E. S.; Abate, A.; Bonnett, C.; Crocce, M.; Davis, C.; Hoyle, B.; Leistedt, B.; Peiris, H. V.; Wechsler, R. H.; Abbott, T.; Abdalla, F. B.; Banerji, M.; Bauer, A. H.; Benoit-Lévy, A.; Bernstein, G. M.; Bertin, E.; Brooks, D.; Buckley-Geer, E.; Burke, D. L.; Capozzi, D.; Rosell, A. Carnero; Carollo, D.; Kind, M. Carrasco; Carretero, J.; Castander, F. J.; Childress, M. J.; Cunha, C. E.; D'Andrea, C. B.; Davis, T.; DePoy, D. L.; Desai, S.; Diehl, H. T.; Dietrich, J. P.; Doel, P.; Eifler, T. F.; Evrard, A. E.; Neto, A. Fausti; Flaugher, B.; Fosalba, P.; Frieman, J.; Gaztanaga, E.; Gerdes, D. W.; Glazebrook, K.; Gruen, D.; Gruendl, R. A.; Honscheid, K.; James, D. J.; Jarvis, M.; Kim, A. G.; Kuehn, K.; Kuropatkin, N.; Lahav, O.; Lidman, C.; Lima, M.; Maia, M. A. G.; March, M.; Martini, P.; Melchior, P.; Miller, C. J.; Miquel, R.; Mohr, J. J.; Nichol, R. C.; Nord, B.; O'Neill, C. R.; Ogando, R.; Plazas, A. A.; Romer, A. K.; Roodman, A.; Sako, M.; Sanchez, E.; Santiago, B.; Schubnell, M.; Sevilla-Noarbe, I.; Smith, R. C.; Soares-Santos, M.; Sobreira, F.; Suchyta, E.; Swanson, M. E. C.; Thaler, J.; Thomas, D.; Uddin, S.; Vikram, V.; Walker, A. R.; Wester, W.; Zhang, Y.; da Costa, L. N.

    2016-09-01

    We introduce redMaGiC, an automated algorithm for selecting luminous red galaxies (LRGs). The algorithm was specifically developed to minimize photometric redshift uncertainties in photometric large-scale structure studies. redMaGiC achieves this by self-training the colour cuts necessary to produce a luminosity-thresholded LRG sample of constant comoving density. We demonstrate that redMaGiC photo-zs are very nearly as accurate as the best machine learning-based methods, yet they require minimal spectroscopic training, do not suffer from extrapolation biases, and are very nearly Gaussian. We apply our algorithm to Dark Energy Survey (DES) Science Verification (SV) data to produce a redMaGiC catalogue sampling the redshift range z ∈ [0.2, 0.8]. Our fiducial sample has a comoving space density of 10-3 (h-1 Mpc)-3, and a median photo-z bias (zspec - zphoto) and scatter (σz/(1 + z)) of 0.005 and 0.017, respectively. The corresponding 5σ outlier fraction is 1.4 per cent. We also test our algorithm with Sloan Digital Sky Survey Data Release 8 and Stripe 82 data, and discuss how spectroscopic training can be used to control photo-z biases at the 0.1 per cent level.

  14. redMaGiC: Selecting Luminous Red Galaxies from the DES Science Verification Data

    Rozo, E.; Rykoff, E. S.; Abate, A.; Bonnett, C.; Crocce, M.; Davis, C.; Hoyle, B.; Leistedt, B.; Peiris, H. V.; Wechsler, R. H.; Abbott, T.; Abdalla, F. B.; Banerji, M.; Bauer, A. H.; Benoit-Lévy, A.; Bernstein, G. M.; Bertin, E.; Brooks, D.; Buckley-Geer, E.; Burke, D. L.; Capozzi, D.; Rosell, A. Carnero; Carollo, D.; Kind, M. Carrasco; Carretero, J.; Castander, F. J.; Childress, M. J.; Cunha, C. E.; D'Andrea, C. B.; Davis, T.; DePoy, D. L.; Desai, S.; Diehl, H. T.; Dietrich, J. P.; Doel, P.; Eifler, T. F.; Evrard, A. E.; Neto, A. Fausti; Flaugher, B.; Fosalba, P.; Frieman, J.; Gaztanaga, E.; Gerdes, D. W.; Glazebrook, K.; Gruen, D.; Gruendl, R. A.; Honscheid, K.; James, D. J.; Jarvis, M.; Kim, A. G.; Kuehn, K.; Kuropatkin, N.; Lahav, O.; Lidman, C.; Lima, M.; Maia, M. A. G.; March, M.; Martini, P.; Melchior, P.; Miller, C. J.; Miquel, R.; Mohr, J. J.; Nichol, R. C.; Nord, B.; O'Neill, C. R.; Ogando, R.; Plazas, A. A.; Romer, A. K.; Roodman, A.; Sako, M.; Sanchez, E.; Santiago, B.; Schubnell, M.; Sevilla-Noarbe, I.; Smith, R. C.; Soares-Santos, M.; Sobreira, F.; Suchyta, E.; Swanson, M. E. C.; Thaler, J.; Thomas, D.; Uddin, S.; Vikram, V.; Walker, A. R.; Wester, W.; Zhang, Y.; da Costa, L. N.

    2016-05-01

    We introduce redMaGiC, an automated algorithm for selecting Luminous Red Galaxies (LRGs). The algorithm was specifically developed to minimize photometric redshift uncertainties in photometric large-scale structure studies. redMaGiC achieves this by self-training the color-cuts necessary to produce a luminosity-thresholded LRG sample of constant comoving density. We demonstrate that redMaGiC photo-zs are very nearly as accurate as the best machine-learning based methods, yet they require minimal spectroscopic training, do not suffer from extrapolation biases, and are very nearly Gaussian. We apply our algorithm to Dark Energy Survey (DES) Science Verification (SV) data to produce a redMaGiC catalog sampling the redshift range z ∈ [0.2, 0.8]. Our fiducial sample has a comoving space density of 10-3 (h-1Mpc)-3, and a median photo-z bias (zspec - zphoto) and scatter (σz/(1 + z)) of 0.005 and 0.017 respectively. The corresponding 5σ outlier fraction is 1.4%. We also test our algorithm with Sloan Digital Sky Survey (SDSS) Data Release 8 (DR8) and Stripe 82 data, and discuss how spectroscopic training can be used to control photo-z biases at the 0.1% level.

  15. redMaGiC: selecting luminous red galaxies from the DES Science Verification data

    Rozo, E. [Univ. of Arizona, Tucson, AZ (United States). et al.

    2016-05-30

    We introduce redMaGiC, an automated algorithm for selecting Luminous Red Galaxies (LRGs). The algorithm was developed to minimize photometric redshift uncertainties in photometric large-scale structure studies. redMaGiC achieves this by self-training the color-cuts necessary to produce a luminosity-thresholded LRG sam- ple of constant comoving density. Additionally, we demonstrate that redMaGiC photo-zs are very nearly as accurate as the best machine-learning based methods, yet they require minimal spectroscopic training, do not suffer from extrapolation biases, and are very nearly Gaussian. We apply our algorithm to Dark Energy Survey (DES) Science Verification (SV) data to produce a redMaGiC catalog sampling the redshift range z ϵ [0.2,0.8]. Our fiducial sample has a comoving space density of 10-3 (h-1Mpc)-3, and a median photo-z bias (zspec zphoto) and scatter (σz=(1 + z)) of 0.005 and 0.017 respectively.The corresponding 5σ outlier fraction is 1.4%. We also test our algorithm with Sloan Digital Sky Survey (SDSS) Data Release 8 (DR8) and Stripe 82 data, and discuss how spectroscopic training can be used to control photo-z biases at the 0.1% level.

  16. THE TWO-POINT CORRELATION OF 2QZ QUASARS AND 2SLAQ LRGS: FROM A QUASAR FUELING PERSPECTIVE

    Public data from the 2dF quasar survey and 2dF/Sloan Digital Sky Survey LRG and QSO, with their vast reservoirs of spectroscopically located and identified sources, afford us the chance to more accurately study their real-space correlations in the hopes of identifying the physical processes that trigger quasar activity. We have used these two public databases to measure the projected cross-correlation, ω p, between quasars and luminous red galaxies. We find the projected two-point correlation to have a fitted clustering radius of r 0 = 5.3 ± 0.6 and a slope γ = 1.83 ± 0.42 on scales from 0.7 to 27 h -1 Mpc. We attempt to understand this strong correlation by separating the LRG sample into two populations of blue and red galaxies. We measure at the cross-correlation with each population. We find that these quasars have a stronger correlation amplitude with the bluer, more recently star-forming population in our sample than the redder passively evolving population, which has a correlation that is much more noisy and seems to flatten on scales -1 Mpc. We compare this result to published work on hierarchical models. The stronger correlation of bright quasars with LRGs that have undergone a recent burst of star formation suggests that the physical mechanisms that produce both activities are related and that minor mergers or tidal effects may be important triggers of bright quasar activity and/or that bright quasars are less highly biased than faint quasars.

  17. Pocket Monster incident and low luminance visual stimuli: special reference to deep red flicker stimulation.

    Takahashi, T; Tsukahara, Y

    1998-12-01

    On the evening of 16 December 1997 approximately 700 people around the nation (mostly children) were rushed to hospitals and treated for seizure symptoms. The youngsters had been watching the vastly popular TV animated cartoon series Pocket Monsters (Pokemon). We designated those individuals as a main group, who presumably had simultaneous occurrence of visually induced seizures. Follow-up studies revealed that 5-10.4% of Pokemon viewers had various minor symptoms not requiring hospital treatment. We designated those as a subgroup. Due to an official report regarding the problematic TV scene as a low luminance, 12 Hz alternating red/blue stimulus, we attempted an accounting of the Pokemon incident, with regard to the main group in particular, on the basis of electroencephalographic activation by use of low luminance 15 Hz deep red flicker stimulation. In order to explain the entire Pokemon incident, including symptoms experienced by individuals of the subgroup, we considered the possibility that some healthy youngsters may have latent photosensitivity and we thought that such a sensitivity might be disclosed by use of low luminance deep red flicker stimulation which is more provocative of photoparoxysmal response than ordinary high luminance stroboscopic intermittent photic stimulation. For prevention of visually induced seizures by TV viewing, we stress that care should be taken to test not only red flicker but also flickering geometric pattern stimuli. PMID:9893306

  18. Luminous efficacy and color rendering index of high power white LEDs packaged by using red phosphor

    We packaged a series of high power white LEDs by covering the blue LED chips with yellow phosphor, red phosphor and the two phosphors mixed by appropriate mass ratio, respectively, and discussed the excitation and emission spectrum of yellow phosphor and red phosphor and the characteristics of the LEDs. We found that the luminous efficacy of the white LEDs covered with the two phosphors mixed by appropriate mass ratio was lower than that of the white LEDs covered with yellow phosphor, but the color rendering index was improved observably. (semiconductor devices)

  19. Luminous efficacy and color rendering index of high power white LEDs packaged by using red phosphor*

    Lu Pengzhi; Yang Hua; Wang Guohong

    2011-01-01

    We packaged a series of high power white LEDs by covering the blue LED chips with yellow phosphor,red phosphor and the two phosphors mixed by appropriate mass ratio, respectively, and discussed the excitation and emission spectrum of yellow phosphor and red phosphor and the characteristics of the LEDs. We found that the luminous efficacy of the white LEDs covered with the two phosphors mixed by appropriate mass ratio was lower than that of the white LEDs covered with yellow phosphor, but the color rendering index was improved observably.

  20. The Large-scale Distribution of Cool Gas around Luminous Red Galaxies

    Zhu, Guangtun; Bizyaev, Dmitry; Brewington, Howard; Ebelke, Garrett; Ho, Shirley; Kinemuchi, Karen; Malanushenko, Viktor; Malanushenko, Elena; Marchante, Moses; More, Surhud; Oravetz, Daniel; Pan, Kaike; Petitjean, Patrick; Simmons, Audrey

    2013-01-01

    We present a measurement of the correlation function between luminous red galaxies and cool gas traced by Mg II \\lambda \\lambda 2796, 2803 absorption, on scales ranging from about 30 kpc to 20 Mpc. The measurement is based on cross-correlating the positions of about one million red galaxies at z~0.5 and the flux decrements induced in the spectra of about 10^5 background quasars from the Sloan Digital Sky Survey. We find that: (i) This galaxy-gas correlation reveals a change of slope on scales of about 1 Mpc, consistent with the expected transition from a dark matter halo dominated environment to a regime where clustering is dominated by halo-halo correlations. Assuming that, on average, the distribution of Mg II gas follows that of dark matter up to a gas-to-mass ratio, we find the standard halo model to provide an accurate description of the gas distribution over three orders of magnitude in scale. Within this framework we estimate the average host halo mass of luminous red galaxies to be about 10^{13.5} M_s...

  1. Acoustic oscillations in the SDSS DR4 Luminous Red Galaxy sample power spectrum

    Huetsi, Gert

    2005-01-01

    We calculate the redshift-space power spectrum of the Sloan Digital Sky Survey (SDSS) Data Release 4 (DR4) Luminous Red Galaxy (LRG) sample, finding evidence for a full series of acoustic features down to the scales of \\sim 0.2 hMpc^{-1}. This corresponds up to the 7th peak in the CMB angular power spectrum. The acoustic scale derived, (105.4 \\pm 2.3) h^{-1}Mpc, agrees very well with the ``concordance'' model prediction and also with the one determined via the analysis of the spatial two-poin...

  2. Observations of dark and luminous matter: the radial distribution of satellite galaxies around massive red galaxies

    Tal, Tomer; van Dokkum, Pieter G

    2012-01-01

    We study the projected radial distribution of satellite galaxies around more than 28,000 Luminous Red Galaxies (LRGs) at z=0.34 and trace the gravitational potential of LRG groups in the range 725 kpc whereas baryons account for more than 50% of the mass at smaller radii. We calculate the total dark-to-baryonic mass ratio and show that it is consistent with measurements from weak lensing for environments dominated by massive early type galaxies. Finally, we divide the satellite galaxies in our sample into three luminosity bins and show that the satellite light profiles of all brightness levels are consistent with each other outside of roughly 25 kpc. At smaller radii we find evidence for a mild mass segregation with an increasing fraction of bright satellites close to the central LRG.

  3. Lensing measurements of the ellipticity of luminous red galaxies dark matter haloes

    Clampitt, Joseph; Jain, Bhuvnesh

    2016-04-01

    Lensing measurements of the shapes of dark matter haloes can provide tests of gravity theories and possible dark matter interactions. We measure the quadrupole weak lensing signal from the elliptical haloes of 70 000 Sloan Digital Sky Survey luminous red galaxies. We use a new estimator that nulls the spherical halo lensing signal, isolating the shear due to anisotropy in the dark matter distribution. One of the two Cartesian components of our estimator is insensitive to the primary systematic, a spurious alignment of lens and source ellipticities, allowing us to make robust measurements of halo ellipticity. Our best-fitting value for the ellipticity of the surface mass density is 0.24 ± 0.06, which translates to an axis ratio of 0.78. We rule out the hypothesis of no ellipticity at the 4σ confidence level, and ellipticity 0.89) at the 2σ level. We discuss how our measurements of halo ellipticity are revised to higher values using estimates of the misalignment of mass and light from simulations. Finally, we apply the same techniques to a smaller sample of redMaPPer galaxy clusters and obtain a 3σ measurement of cluster ellipticity. We discuss how the improved signal-to-noise ratio properties of our estimator can enable studies of halo shapes for different galaxy populations with upcoming surveys.

  4. The Three-Point Correlation Function of Luminous Red Galaxies in the Sloan Digital Sky Survey

    Kulkarni, G V; Sheth, R K; Seo, H J; Eisenstein, D J; Gray, A; Kulkarni, Gauri V.; Nichol, Robert C.; Sheth, Ravi K.; Seo, Hee-Jong; Eisenstein, Daniel J.; Gray, Alexander

    2007-01-01

    We present measurements of the redshift-space three-point correlation function of 50,967 Luminous Red Galaxies (LRGs) from Data Release 3 (DR3) of the Sloan Digital Sky Survey (SDSS). We have studied the shape dependence of the reduced three-point correlation function (Qz(s,q,theta)) on three different scales, s=4, 7 and 10 h-1 Mpc, and over the range of 1 < q < 3 and 0 < theta < 180. On small scales (s=4 h-1 Mpc), Qz is nearly constant, with little change as a function of q and theta. However, there is evidence for a shallow U-shaped behaviour (with theta) which is expected from theoretical modeling of Qz . On larger scales (s=7 and 10 h-1 Mpc), the U-shaped anisotropy in Qz (with theta) is more clearly detected. We compare this shape-dependence in Qz(s,q,theta) with that seen in mock galaxy catalogues which were generated by populating the dark matter halos in large N-body simulations with mock galaxies using various Halo Occupation Distributions (HOD). We find that the combination of the observ...

  5. The SDSS-IV extended Baryonic Oscillation Spectroscopic Survey: Luminous Red Galaxy Target Selection

    Prakash, Abhishek; Newman, Jeffrey A; Ross, Ashley J; Myers, Adam D; Dawson, Kyle S; Kneib, Jean-Paul; Percival, Will J; Bautista, Julian E; Comparat, Johan; Tinker, Jeremy L; Schlegel, David J; Tojeiro, Rita; Ho, Shirley; Lang, Dustin; Rao, Sandhya M; McBride, Cameron K; Zhu, Guangtun Ben; Brownstein, Joel R; Bailey, Stephen; Bolton, Adam S; Delubac, Timothee; Mariappan, Vivek; Blanton, Michael R; Reid, Beth; Schneider, Donald P; Seo, Hee-Jong; Rosell, Aurelio Carnero; Prada, Francisco

    2015-01-01

    We describe the algorithm used to select the Luminous Red Galaxy (LRG) sample for the extended Baryon Oscillation Spectroscopic Survey (eBOSS) of the Sloan Digital Sky Survey IV (SDSS-IV) using photometric data from both the SDSS and the Wide-Field Infrared Survey Explorer (WISE). LRG targets are required to meet a set of color selection criteria and have z-band and i-band MODEL magnitudes z < 19.95 and 19.9 < i < 21.8, respectively. Our algorithm selects roughly 50 LRG targets per square degree, the great majority of which lie in the redshift range 0.6 < z < 1.0 (median redshift 0.71). We demonstrate that our methods are highly effective at eliminating stellar contamination and lower-redshift galaxies. We perform a number of tests using spectroscopic data from SDSS-III/BOSS to determine the redshift reliability of our target selection and its ability to meet the science requirements of eBOSS. The SDSS spectra are of high enough signal-to-noise ratio that at least 89% of the target sample yield...

  6. Luminous Red Galaxy Halo Density Field Reconstruction and Application to Large Scale Structure Measurements

    Reid, Beth A; Bode, Paul

    2008-01-01

    The complex relationship between the galaxy density field and the underlying matter field limits our ability to extract cosmological constraints from galaxy redshift surveys. Our approach is to use halos rather than galaxies to trace the underlying mass distribution. We identify Fingers-of-God (FOGs) and replace multiple galaxies in each FOG with a single halo object. This removes the nonlinear contributions of satellite galaxies, the one-halo term. We test our method on a large set of high-fidelity mock SDSS Luminous Red Galaxy (LRG) catalogs. We find that the aggressive FOG compression algorithm adopted in the LRG P(k) analysis of Tegmark et al. (2006) leads to a ~10% correction to the underlying matter power spectrum at k = 0.1 h/Mpc and ~40% correction at k=0.2 h/Mpc, thereby compromising the cosmological constraints. In contrast, the power spectrum of our reconstructed halo density field deviates from the underlying matter power spectrum by less than 1% for k less than 0.1 h/Mpc and less than 4% for k le...

  7. Cross-Correlation of the Extragalactic Gamma-ray Background with Luminous Red Galaxies

    Shirasaki, Masato; Yoshida, Naoki

    2015-01-01

    Measurements of the cross-correlation between the extragalactic gamma-ray background (EGB) and large-scale structure provide a novel probe of dark matter on extragalactic scales. We focus on luminous red galaxies (LRGs) as optimal targets to search for the signal of dark matter annihilation. We measure the cross-correlation function of the EGB taken from the Fermi Large Area Telescope with the LRGs from the Sloan Digital Sky Survey. Statistical errors are calculated using a large set of realistic mock LRG catalogs. The amplitude of the measured cross-correlation is consistent with null detection. Based on an accurate theoretical model of the distribution of dark matter associated with LRGs, we exclude dark matter annihilation cross-sections over $\\langle \\sigma v\\rangle =3\\times10^{-25}-10^{-26}\\, {\\rm cm}^3 \\,{\\rm s}^{-1}$ for a 10 GeV dark matter. We further investigate systematic effects due to uncertainties in the Galactic gamma-ray foreground emission, which we find to be an order of magnitude smaller th...

  8. Understanding the nature of luminous red galaxies (LRGs): Connecting LRGs to central and satellite subhalos

    Masaki, Shogo; Takada, Masahiro; Spergel, David N; Sugiyama, Naoshi

    2012-01-01

    We develop a novel abundance matching method to construct a mock catalog of luminous red galaxies (LRGs) in the Sloan Digital Sky Survey (SDSS), using catalogs of halos and subhalos in N-body simulations for a Lambda-dominated, cold dark matter model. Motivated by observations suggesting that LRGs are passively-evolving, massive early-type galaxies with a typical age >5Gyr, we assume that simulated halos at z=2 (z2-halo) are progenitors for LRG-host subhalos observed today, we label the most tightly bound particles in each progenitor z2-halo as LRG "stars". We then identify the subhalos containing these stars to z=0.3 (SDSS redshift) in descending order of the masses of z2-halos until the comoving number density of the matched subhalos becomes comparable to the measured number density of SDSS LRGs, n_LRG=10^{-4} (h/Mpc)^3. Our only free parameter is the number density of halos identified at z=2 and this parameter is fixed to match the observed number density at z = 0.3. By tracing subsequent merging and assem...

  9. Mechanical feedback in the molecular ISM of luminous infra-red galaxies

    Loenen, A F; Baan, W A; Meijerink, R

    2008-01-01

    Aims: Molecular emission lines originating in the nuclei of luminous infra-red galaxies are used to determine the physical properties of the nuclear ISM in these systems. Methods: A large observational database of molecular emission lines is compared with model predictions that include heating by UV and X-ray radiation, mechanical heating, and the effects of cosmic rays. Results: The observed line ratios and model predictions imply a separation of the observedsystems into three groups: XDRs, UV-dominated high-density (n>=10^5 cm-3) PDRs, and lower-density (n=10^4.5 cm-3) PDRs that are dominated by mechanical feedback. Conclusions: The division of the two types of PDRs follows naturally from the evolution of the star formation cycle of these sources, which evolves from deeply embedded young stars, resulting in high-density (n>=10^5 cm-3) PDRs, to a stage where the gas density has decreased (n=10^4.5 cm-3) and mechanical feedback from supernova shocks dominates the heating budget.

  10. On fitting the full spectrum of luminous red galaxies by using ULySS and STARLIGHT

    We select a sample of quiescent luminous red galaxies (LRGs) from the Sloan Digital Sky Survey Data Release 7 with a high signal-to-noise ratio (S/N) to study the consistency of fitting the full spectrum by using different packages, mainly, ULySS and STARLIGHT. The spectrum of each galaxy in the sample is fitted by the full spectrum fitting packages ULySS and STARLIGHT. We find: (1) for spectra with higher S/Ns, the ages of stellar populations obtained from ULySS are slightly older than those from STARLIGHT, and metallicities derived from ULySS are slightly richer than those from STARLIGHT. In general, both packages can give roughly consistent fitting results. (2) For low S/N spectra, it is possible that the fitting by ULySS can become trapped at some local minimum in the parameter space during execution and thus may give unreliable results, but STARLIGHT can still give reliable results. Based on the fitting results of LRGs, we further analyze their star formation history and the relation between their age and velocity dispersion, and find that they agree well with conclusions from previous works

  11. EVOLUTION OF THE VELOCITY-DISPERSION FUNCTION OF LUMINOUS RED GALAXIES: A HIERARCHICAL BAYESIAN MEASUREMENT

    We present a hierarchical Bayesian determination of the velocity-dispersion function of approximately 430,000 massive luminous red galaxies observed at relatively low spectroscopic signal-to-noise ratio (S/N ∼ 3-5 per 69 km s–1) by the Baryon Oscillation Spectroscopic Survey (BOSS) of the Sloan Digital Sky Survey III. We marginalize over spectroscopic redshift errors, and use the full velocity-dispersion likelihood function for each galaxy to make a self-consistent determination of the velocity-dispersion distribution parameters as a function of absolute magnitude and redshift, correcting as well for the effects of broadband magnitude errors on our binning. Parameterizing the distribution at each point in the luminosity-redshift plane with a log-normal form, we detect significant evolution in the width of the distribution toward higher intrinsic scatter at higher redshifts. Using a subset of deep re-observations of BOSS galaxies, we demonstrate that our distribution-parameter estimates are unbiased regardless of spectroscopic S/N. We also show through simulation that our method introduces no systematic parameter bias with redshift. We highlight the advantage of the hierarchical Bayesian method over frequentist 'stacking' of spectra, and illustrate how our measured distribution parameters can be adopted as informative priors for velocity-dispersion measurements from individual noisy spectra.

  12. Characterizing the Chemically-Enriched Circumgalactic Medium of ~38000 Luminous Red Galaxies in SDSS DR12

    Huang, Yun-Hsin; Johnson, Sean D; Weiner, Benjamin J

    2015-01-01

    We report a definitive detection of chemically-enriched cool gas around massive, quiescent galaxies at z~0.4-0.7. The result is based on a survey of 37621 luminous red galaxy (LRG)-QSO pairs in SDSS DR12 with projected distance d~1Gyr) stellar population with 13% displaying [OII] emission features and LINER-like spectra. Both passive and [OII]-emitting LRGs share the same stellar mass distribution with a mean of ~11.4 and a dispersion of 0.2 dex. Both LRG populations exhibit associated strong MgII absorbers out to d_MgII > 15% and declines quickly to _MgII ~ 5% at d_MgII around passive LRGs at all radii, a modest enhancement in _MgII is detected along the major axis of [OII]-emitting LRGs at d_MgII along the major axis of [OII]-emitting LRGs at d<50 kpc, provides important insights into the origin of the observed chemically-enriched cool gas in LRG halos. We consider different scenarios and conclude that the observed MgII absorbers around LRGs are best-explained by a combination of cool clouds formed in th...

  13. Intrinsic Ellipticity Correlation of SDSS Luminous Red Galaxies and Misalignment with their Host Dark Matter Halos

    Okumura, Teppei; Li, Cheng

    2008-01-01

    We investigate the orientation correlation of giant elliptical galaxies by measuring the intrinsic ellipticity correlation function of 83,773 luminous red galaxies (LRGs) at redshifts 0.16 -- 0.47 from the Sloan Digital Sky Survey. We have accurately determined the correlation up to 30 $h^{-1}$Mpc. Luminosity dependence of the ellipticity correlation is also detected although the error bars are large, while no evidence is found for its redshift evolution between $z=0.2$ and $z=0.4$. Then we use a cosmological $N$-body simulation to examine misalignment between the central LRGs and their parent dark matter halos. Central and satellite galaxies are assigned to simulated halos by employing a halo occupation distribution model for the LRGs. The ellipticity correlation is predicted to have the same shape as but an amplitude about 4 times higher than our observation if the central LRGs are perfectly aligned with their host halos. This indicates that the central LRG galaxies are preferentially but not perfectly alig...

  14. Resurrecting the Red from the Dead: Optical Properties of BCGs in X-ray Luminous Clusters

    Bildfell, C; Babul, A; Mahdavi, A

    2008-01-01

    We present measurements of surface brightness and colour profiles for the brightest cluster galaxies (BCGs) in a sample of 48 X-ray luminous galaxy clusters. These data were obtained as part of the Canadian Cluster Comparison Project (CCCP). The Kormendy relation of our BCGs is steeper than that of the local ellipticals, suggesting differences in the assembly history of these types of systems. We also find that while most BCGs show monotonic colour gradients consistent with a decrease in metallicity with radius, 25% of the BCGs show colour profiles that turn bluer towards the centre (blue-cores). We interpret this bluing trend as evidence for recent star formation. The excess blue light leads to a typical offset from the red sequence of 0.5 to 1.0 mag in (g'-r'), thus affecting optical cluster studies that may reject the BCG based on colour. All of the blue-core BCGs are located within ~10 kpc of the peak in the cluster X-ray emission. Furthermore, virtually all of the BCGs with recent star formation are in c...

  15. Common Envelope ejection for a Luminous Red Nova in M101

    Blagorodnova, N; Polshaw, J; Kasliwal, M M; Cao, Y; Cody, A M; Doran, G B; Elias-Rosa, N; Fraser, M; Fremling, C; Gonzalez-Fernandez, C; Harmanen, J; Jencson, J; Kankare, E; Kudritzki, R -P; Kulkarni, S R; Magnier, E; Manulis, I; Masci, F J; Mattila, S; Nugent, P; Ochner, P; Pastorello, A; Reynolds, T; Smith, K; Sollerman, J; Taddia, F; Terreran, G; Tomasella, L; Turatto, M; Vreeswijk, P; Wozniak, P; Zaggia, S

    2016-01-01

    We present the results of optical, near-infrared, and mid-infrared observations of M101 OT2015-1 (PSN J14021678+5426205), a luminous red nova in M101 galaxy, spanning 16 years. The lightcurve of the object showed two peaks with absolute magnitudes $M_R\\leq-12.4$ and $M_R=-12$, on 2014 November 11 and 2016 February 17 respectively. The spectral energy distributions during the second maximum show a cool outburst temperature of $\\approx$ 3700 K and low velocity ($\\approx$ 300 km s$^{-1}$) for H I, Ca II, Ba II and K I lines. Archival data, from 15 to 8 years before the outburst, show a progenitor star that is an F-type yellow super-giant with $L$~$\\geq$~8.7~$\\times\\ 10^4$ L$_{\\odot}$ and temperature $\\approx$7000 K. This star has just finished the H burning phase in the core, started expanding, and now is crossing the Hertzsprung gap. We argue that the progenitor is a binary system, with masses $\\rm{M1}\\sim 18$ M$_{\\odot}$and $\\rm{M2}\\sim16.2$ M$_{\\odot}$, with the more evolved system overfilling the Roche lobe....

  16. Photometric Selection of a Luminous Red Galaxy Catalog with $z\\geq0.55$

    Núñez, Carolina; Ho, Shirley

    2016-01-01

    We present the development of a photometrically selected Luminous Red Galaxy (LRG) catalog at redshift $z\\geq 0.55$. LRG candidates are selected using infrared/optical color-color cuts, optimized using ROC curve analysis, with optical data from Sloan Digital Sky Survey (SDSS) and infrared data from "unWISE" forced photometry derived from the Wide-field Infrared Survey Explorer (WISE). The catalog contains 16,191,145 objects, selected over the full SDSS DR10 footprint. The redshift distribution of the resulting catalogs is estimated using spectroscopic redshifts from the DEEP2 Galaxy Redshift Survey and photometric redshifts from COSMOS. Restframe $U-B$ colors from DEEP2 are used to estimate LRG selection efficiency. In DEEP2, the resulting catalog has average redshift $z=0.65$, with standard deviation $\\sigma = 2.0$, and average restframe $U-B=1.0$, with $\\sigma=0.27$. In COSMOS, the resulting catalog has average redshift $z=0.60$, with standard deviation $\\sigma = 1.8$. We allow for 35% contamination from bl...

  17. The angular power spectra of photometric Sloan Digital Sky Survey luminous red galaxies

    Thomas, Shaun A.; Abdalla, Filipe B.; Lahav, Ofer

    2011-04-01

    We construct new galaxy angular power spectra Cℓ based on the extended, updated and final Sloan Digital Sky Survey (SDSS) II luminous red galaxy (LRG) photometric redshift survey - MegaZ (DR7). Encapsulating 7746 deg2 we utilize 723 556 photometrically determined LRGs between 0.45 preliminary parameter constraints of fb≡Ωb/Ωm= 0.173 ± 0.046 and Ωm= 0.260 ± 0.035 assuming H0= 75 km s-1 Mpc-1, ns= 1 and Ωk= 0. These limits are consistent with the cosmic microwave background and the previous data release (DR4). The Cℓ are sensitive to redshift space distortions and therefore we also recast our constraints into a measurement of β≈Ω0.55m/b in different redshift shells. The robustness of these power spectra with respect to a number of potential systematics such as extinction, photometric redshift and ANNz training set extrapolation are examined. The latter includes a cosmological comparison of available photometric redshift estimation codes where we find excellent agreement between template and empirical estimation methods. MegaZ DR7 represents a methodological prototype to next generation surveys such as the Dark Energy Survey and, furthermore, is a photometric precursor to the spectroscopic BOSS survey. Our galaxy catalogue and all power spectra data can be found at .

  18. The SDSS-IV Extended Baryon Oscillation Spectroscopic Survey: Luminous Red Galaxy Target Selection

    Prakash, Abhishek; Licquia, Timothy C.; Newman, Jeffrey A.; Ross, Ashley J.; Myers, Adam D.; Dawson, Kyle S.; Kneib, Jean-Paul; Percival, Will J.; Bautista, Julian E.; Comparat, Johan; Tinker, Jeremy L.; Schlegel, David J.; Tojeiro, Rita; Ho, Shirley; Lang, Dustin; Rao, Sandhya M.; McBride, Cameron K.; Ben Zhu, Guangtun; Brownstein, Joel R.; Bailey, Stephen; Bolton, Adam S.; Delubac, Timothée; Mariappan, Vivek; Blanton, Michael R.; Reid, Beth; Schneider, Donald P.; Seo, Hee-Jong; Carnero Rosell, Aurelio; Prada, Francisco

    2016-06-01

    We describe the algorithm used to select the luminous red galaxy (LRG) sample for the extended Baryon Oscillation Spectroscopic Survey (eBOSS) of the Sloan Digital Sky Survey IV (SDSS-IV) using photometric data from both the SDSS and the Wide-field Infrared Survey Explorer. LRG targets are required to meet a set of color selection criteria and have z-band and i-band MODEL magnitudes z < 19.95 and 19.9 < i < 21.8, respectively. Our algorithm selects roughly 50 LRG targets per square degree, the great majority of which lie in the redshift range 0.6 < z < 1.0 (median redshift 0.71). We demonstrate that our methods are highly effective at eliminating stellar contamination and lower-redshift galaxies. We perform a number of tests using spectroscopic data from SDSS-III/BOSS ancillary programs to determine the redshift reliability of our target selection and its ability to meet the science requirements of eBOSS. The SDSS spectra are of high enough signal-to-noise ratio that at least ∼89% of the target sample yields secure redshift measurements. We also present tests of the uniformity and homogeneity of the sample, demonstrating that it should be clean enough for studies of the large-scale structure of the universe at higher redshifts than SDSS-III/BOSS LRGs reached.

  19. Intrinsic Ellipticity Correlation of SDSS Luminous Red Galaxies and Misalignment with Their Host Dark Matter Halos

    Okumura, Teppei; Jing, Y. P.; Li, Cheng

    2009-03-01

    We investigate the orientation correlation of giant elliptical galaxies by measuring the intrinsic ellipticity correlation function of 83,773 luminous red galaxies (LRGs) at redshifts 0.16-0.47 from the Sloan Digital Sky Survey. We have accurately determined the correlation up to 30 h-1 Mpc. Luminosity dependence of the ellipticity correlation is also detected although the error bars are large, while no evidence is found for its redshift evolution between z = 0.2 and z = 0.4. Then we use a cosmological N-body simulation to examine misalignment between the central LRGs and their parent dark matter halos. Central and satellite galaxies are assigned to simulated halos by employing a halo occupation distribution model for the LRGs. The ellipticity correlation is predicted to have the same shape as, but an amplitude about four times higher than, our observation if the central LRGs are perfectly aligned with their host halos. This indicates that the central LRG galaxies are preferentially but not perfectly aligned with their host halos. With the assumption that there is a misalignment angle between a central LRG and its host halo which follows a Gaussian distribution with a zero mean and a width σθ, we obtain a tight constraint on the misalignment parameter, σθ = 35.4+4.0 -3.3 deg. This type of intrinsic ellipticity correlation, if not corrected, can lead to contamination at 5% level to the shear power spectrum in weak lensing surveys of limiting magnitude RAB = 24.5 if the source central galaxies follow the same misalignment distribution as the LRGs.

  20. INTRINSIC ELLIPTICITY CORRELATION OF SDSS LUMINOUS RED GALAXIES AND MISALIGNMENT WITH THEIR HOST DARK MATTER HALOS

    We investigate the orientation correlation of giant elliptical galaxies by measuring the intrinsic ellipticity correlation function of 83,773 luminous red galaxies (LRGs) at redshifts 0.16-0.47 from the Sloan Digital Sky Survey. We have accurately determined the correlation up to 30 h-1 Mpc. Luminosity dependence of the ellipticity correlation is also detected although the error bars are large, while no evidence is found for its redshift evolution between z = 0.2 and z = 0.4. Then we use a cosmological N-body simulation to examine misalignment between the central LRGs and their parent dark matter halos. Central and satellite galaxies are assigned to simulated halos by employing a halo occupation distribution model for the LRGs. The ellipticity correlation is predicted to have the same shape as, but an amplitude about four times higher than, our observation if the central LRGs are perfectly aligned with their host halos. This indicates that the central LRG galaxies are preferentially but not perfectly aligned with their host halos. With the assumption that there is a misalignment angle between a central LRG and its host halo which follows a Gaussian distribution with a zero mean and a width σθ, we obtain a tight constraint on the misalignment parameter, σθ = 35.4+4.0-3.3 deg. This type of intrinsic ellipticity correlation, if not corrected, can lead to contamination at 5% level to the shear power spectrum in weak lensing surveys of limiting magnitude RAB = 24.5 if the source central galaxies follow the same misalignment distribution as the LRGs.

  1. TOPOLOGY OF LUMINOUS RED GALAXIES FROM THE SLOAN DIGITAL SKY SURVEY

    We present measurements of the genus topology of luminous red galaxies (LRGs) from the Sloan Digital Sky Survey (SDSS) Data Release 7 catalog, with unprecedented statistical significance. To estimate the uncertainties in the measured genus, we construct 81 mock SDSS LRG surveys along the past light cone from Horizon Run 3, one of the largest N-body simulations to date, which evolved 72103 particles in a 10,815 h –1 Mpc box. After carefully modeling and removing all known systematic effects due to finite pixel size, survey boundary, radial and angular selection functions, shot noise, and galaxy biasing, we find that the observed genus amplitude reaches 272 at a 22 h –1 Mpc smoothing scale, with an uncertainty of 4.2%; the estimated error fully incorporates cosmic variance. This is the most accurate constraint on the genus amplitude to date and significantly improves on our previous results. In particular, the shape of the genus curve agrees very well with the mean topology of the SDSS LRG mock surveys in a Λ cold dark matter universe. However, comparison with simulations also shows small deviations of the observed genus curve from the theoretical expectation for Gaussian initial conditions. While these discrepancies are mainly driven by known systematic effects such as shot noise and redshift-space distortions, they do contain important cosmological information on the physical effects connected with galaxy formation, gravitational evolution, and primordial non-Gaussianity. We address the key role played by systematics on the genus curve and show how to accurately correct for their effects to recover the topology of the underlying matter. A future work will provide an interpretation of these deviations in the context of the local model of non-Gaussianity

  2. Coloration in different areas of facial skin is a cue to health: The role of cheek redness and periorbital luminance in health perception.

    Jones, Alex L; Porcheron, Aurélie; Sweda, Jennifer R; Morizot, Frederique; Russell, Richard

    2016-06-01

    Looking healthy is a desirable trait, and facial skin color is a predictor of perceived health. However, skin conditions that cause dissatisfaction with appearance are specific to particular facial areas. We investigated whether color variation in facial skin is related to perceived health. Study 1 defined three areas based on color differences between faces perceived as healthy or unhealthy: the forehead, periorbital areas, and the cheeks. Periorbital luminance and cheek redness predicted perceived health, as did global skin yellowness. In Study 2, increased luminance and redness caused faces to be perceived as healthier, but only when the increase was in the periorbital and cheek areas, respectively. Manipulating each area separately in Study 3 revealed cheek redness and periorbital luminance equally increased perceived health, with low periorbital luminance more negatively affecting perceptions. These findings show that color variation in facial skin is a cue for health perception in female faces. PMID:26967010

  3. Understanding the nature of luminous red galaxies (LRGs): connecting LRGs to central and satellite subhaloes

    Masaki, Shogo; Hikage, Chiaki; Takada, Masahiro; Spergel, David N.; Sugiyama, Naoshi

    2013-08-01

    We develop a novel abundance matching method to construct a mock catalogue of luminous red galaxies (LRGs) in the Sloan Digital Sky Survey (SDSS), using catalogues of haloes and subhaloes in N-body simulations for a Λ-dominated cold dark matter model. Motivated by observations suggesting that LRGs are passively evolving, massive early-type galaxies with a typical age ≳5 Gyr, we assume that simulated haloes at z = 2 (z2-halo) are progenitors for LRG-host subhaloes observed today, and we label the most tightly bound particles in each progenitor z2-halo as LRG `stars'. We then identify the subhaloes containing these stars to z = 0.3 (SDSS redshift) in descending order of the masses of z2-haloes until the comoving number density of the matched subhaloes becomes comparable to the measured number density of SDSS LRGs, bar{n}_LRG=10^{-4} h^3 Mpc^{-3}. Once the above prescription is determined, our only free parameter is the number density of haloes identified at z = 2 and this parameter is fixed to match the observed number density at z = 0.3. By tracing subsequent merging and assembly histories of each progenitor z2-halo, we can directly compute, from the mock catalogue, the distributions of central and satellite LRGs and their internal motions in each host halo at z = 0.3. While the SDSS LRGs are galaxies selected by the magnitude and colour cuts from the SDSS images and are not necessarily a stellar-mass-selected sample, our mock catalogue reproduces a host of SDSS measurements: the halo occupation distribution for central and satellite LRGs, the projected autocorrelation function of LRGs, the cross-correlation of LRGs with shapes of background galaxies (LRG-galaxy weak lensing) and the non-linear redshift-space distortion effect, the Finger-of-God effect, in the angle-averaged redshift-space power spectrum. The mock catalogue generated based on our method can be used for removing or calibrating systematic errors in the cosmological interpretation of LRG clustering

  4. Luminous and Variable Stars in M31 and M33. III. The Yellow and Red Supergiants and Post-Red Supergiant Evolution

    Gordon, Michael S; Jones, Terry J

    2016-01-01

    Recent supernova and transient surveys have revealed an increasing number of non-terminal stellar eruptions. Though the progenitor class of these eruptions includes the most luminous stars, little is known of the pre-supernova mechanics of massive stars in their most evolved state, thus motivating a census of possible progenitors. From surveys of evolved and unstable luminous star populations in nearby galaxies, we select a sample of yellow and red supergiant candidates in M31 and M33 for review of their spectral characteristics and spectral energy distributions. Since the position of intermediate and late-type supergiants on the color-magnitude diagram can be heavily contaminated by foreground dwarfs, we employ spectral classification and multi-band photometry from optical and near-infrared surveys to confirm membership. Based on spectroscopic evidence for mass loss and the presence of circumstellar dust in their SEDs, we find that $30-40\\%$ of the yellow supergiants are likely in a post-red supergiant state...

  5. The Atacama Cosmology Telescope: Detection or Sunyaev-Zel'Dovich Decrement in Groups and Clusters Associated with Luminous Red Galaxies

    Hand, Nick; Appel, John William; Battaglia, Nick; Bond, J. Richard; Das, Sudeep; Devlin, Mark J.; Dunkley, Joanna; Dunner, Rolando; Essinger-Hileman, Thomas; Fowler, Joseph W.; Hajian, Amir; Halpern, Mark; Hasselfield, Matthew; Hilton, Matt; Hincks, Adam D.; Hlozek, Renee; Hughes, John P.; Irwin, Kent D.; Klein, Jeff; Kosowsky, Arthur; Lin, Yen-Ting; Marriage, Tobias A.; Marsden, Danica; McLaren, Mike; Wollack, Ed

    2010-01-01

    We present a detection of the Sunyaev-Zel'dovich (SZ) decrement associated with the Luminous Red Galaxy (LRG) sample of the Sloan Digital Sky Survey. The SZ data come from 148 GHz maps of the equatorial region made by the Atacama Cosmology Telescope (ACT). The LRG sample is divided by luminosity into four bins, and estimates for the central Sunyaev-Zel'dovich temperature decrement are calculated through a stacking process. We detect and account for a bias of the SZ signal due to weak radio sources. We use numerical simulations to relate the observed decrement to Y(sub 200) and clustering properties to relate the galaxy luminosity bins to mass. We also use a relation between BCG luminosity and cluster mass based on stacked gravitational lensing measurements to estimate the characteristic halo masses. The masses are found to be in the range approx.10(exp 13) - 10(exp 14)/h Stellar Mass, a lower range than has been previously probed.

  6. THE ATACAMA COSMOLOGY TELESCOPE: DETECTION OF SUNYAEV-ZEL'DOVICH DECREMENT IN GROUPS AND CLUSTERS ASSOCIATED WITH LUMINOUS RED GALAXIES

    We present a detection of the Sunyaev-Zel'dovich (SZ) decrement associated with the luminous red galaxy (LRG) sample of the Sloan Digital Sky Survey. The SZ data come from 148 GHz maps of the equatorial region made by the Atacama Cosmology Telescope. The LRG sample is divided by luminosity into four bins, and estimates for the central SZ temperature decrement are calculated through a stacking process. We detect and account for a bias of the SZ signal due to weak radio sources. We use numerical simulations to relate the observed decrement to Y200 and clustering properties to relate the galaxy luminosity to halo mass. We also use a relation between brightest cluster galaxy luminosity and cluster mass based on stacked gravitational lensing measurements to estimate the characteristic halo masses. The masses are found to be around 1014 Msun.

  7. The clustering of luminous red galaxies at z $\\sim$ 0.7 from eBOSS data

    Zhai, Zhongxu; Hahn, ChangHoon; Seo, Hee-Jong; Blanton, Michael R; Tojeiro, Rita; Camacho, Hugo O; Lima, Marcos; Rosell, Aurelio Carnero; Sobreira, Flavia; da Costa, Luiz N; Bautista, Julian E; Brownstein, Joel R; Comparat, Johan; Dawson, Kyle; Newman, Jeffrey A; Roman-Lopes, Alexandre; Schneider, Donald P

    2016-01-01

    We present the first scientific results from the luminous red galaxy sample (LRG) of the extended Baryon Oscillation Spectroscopic Survey (eBOSS). We measure the small and intermediate scale clustering from a sample of more than 61,000 galaxies in the redshift range $0.6 < z < 0.9$. We interpret these measurements in the framework of the Halo Occupation Distribution. The bias of eBOSS LRGs is $2.30 \\pm 0.03$, with a satellite fraction of $13\\pm3$\\% and a mean halo mass of $2.5\\times10^{13}h^{-1}M_{\\odot}$. These results are consistent with expectations, demonstrating that eBOSS galaxies will be reliable tracers of large scale structure at $z\\sim 0.7$. The eBOSS galaxy bias implies a scatter of luminosity at fixed halo mass, $\\sigma_{\\log L}$, of 0.19 dex. Using the clustering of massive galaxies from BOSS-CMASS, BOSS-LOWZ, and SDSS, we find that $\\sigma_{\\log L}=0.19$ is consistent with observations over the full redshift range that these samples cover. The addition of eBOSS to previous surveys allows i...

  8. Where are the Luminous Red Galaxies (LRGs)? Using correlation measurements and lensing to relate LRGs to dark matter halos

    Hikage, Chiaki; Takada, Masahiro; Spergel, David N

    2012-01-01

    Nonlinear redshift-space distortions, the Finger-of-God (FoG) effect, can complicate the interpretation of the galaxy power spectrum. Here, we demonstrate the method proposed by Hikage et al. (2012) to use complimentary observations to directly constrain this effect on the data. We use catalogs of Luminous Red Galaxies (LRGs) and photometric galaxies from the Sloan Digital Sky Survey (SDSS) Data Release 7 (DR7) to measure the redshift-space power spectrum of LRGs, the cross-correlation of LRGs with the shapes of background photometric galaxies (galaxy-galaxy weak lensing), and the projected cross-correlation of LRGs with photometric galaxies having similar photometric redshifts to the LRG spectroscopic redshift. All of these measurements use a reconstructed halo field. While we use the position of each LRG for single LRG systems, we compare the measurements using different halo-center proxies for multiple-LRG systems (4.5 per cent of all the halos): the brightest LRG position (BLRG), the faintest LRG position...

  9. Quiescent Luminous Red Galaxies (LRGs) as Cosmic Chronometers: on the Significance of the Mass and Environmental Dependence

    Liu, Gaochao; Xie, Lizhi; Chen, Xuelei; Zhao, Yongheng

    2016-01-01

    Massive luminous red galaxies (LRGs) are believed to be evolving passively and can be used as cosmic chronometers to estimate the Hubble constant. However, different LRGs may locate in different environments. The environmental effects may limit the use of the LRGs as cosmic chronometers. We aim to investigate the environmental and mass dependence of the formation of "quiescent" LRGs selected from the Sloan Digital Sky Survey Date Release 8 and to pave the way for using the LRGs as cosmic chronometers. Using the population synthesis software STARLIGHT, we derive the stellar populations in each LRG through the full spectrum fitting and obtain the mean age distribution and the mean star formation history (SFH) of those LRGs. We find that there is no apparent dependence of the mean age and the SFH of quiescent LRGs on their environment, while the ages of those quiescent LRGs weakly depend on their mass. We compare the SFHs of the SDSS LRGs with those obtained from a semi-analytical galaxy formation model, and fin...

  10. PTF 10fqs: A LUMINOUS RED NOVA IN THE SPIRAL GALAXY MESSIER 99

    The Palomar Transient Factory (PTF) is systematically charting the optical transient and variable sky. A primary science driver of PTF is building a complete inventory of transients in the local universe (distance less than 200 Mpc). Here, we report the discovery of PTF 10fqs, a transient in the luminosity 'gap' between novae and supernovae. Located on a spiral arm of Messier 99, PTF 10fqs has a peak luminosity of Mr = -12.3, red color (g - r = 1.0), and is slowly evolving (decayed by 1 mag in 68 days). It has a spectrum dominated by intermediate-width Hα (∼930 km s-1) and narrow calcium emission lines. The explosion signature (the light curve and spectra) is overall similar to that of M85 OT2006-1, SN 2008S, and NGC 300 OT. The origin of these events is shrouded in mystery and controversy (and in some cases, in dust). PTF 10fqs shows some evidence of a broad feature (around 8600 A) that may suggest very large velocities (∼10,000 km s-1) in this explosion. Ongoing surveys can be expected to find a few such events per year. Sensitive spectroscopy, infrared monitoring, and statistics (e.g., disk versus bulge) will eventually make it possible for astronomers to unravel the nature of these mysterious explosions.

  11. THE AGE-REDSHIFT RELATION FOR LUMINOUS RED GALAXIES OBTAINED FROM FULL SPECTRUM FITTING AND ITS COSMOLOGICAL IMPLICATIONS

    The relative age of galaxies at different redshifts can be used to infer the Hubble parameter and put constraints on cosmological models. We select luminous red galaxies (LRGs) from the Sloan Digital Sky Survey Data Release 7 and then cross match it with the MPA/JHU catalog of galaxies to obtain a large sample of quiescent LRGs at redshift z ∼ 0.03-0.39. The total number of quiescent LRGs, 23,883, is divided into four sub-samples according to their velocity dispersions and each sub-sample is further divided into 12 redshift bins. The spectra of the LRGs in each redshift and velocity bin are co-added in order to obtain a combined spectrum with a relatively high signal-to-noise ratio. Adopting the GalexEV/SteLib model, we estimate the mean ages of the LRGs from these combined spectra by using the full-spectrum fitting method. We check the reliability of the estimated age by using Monte Carlo simulations and find that the estimates are robust and reliable. Assuming that the LRGs in each sub-sample and each redshift bin were on average formed at the same time, the Hubble parameter at the present time H 0 is estimated from the age-redshift relation obtained for each sub-sample, which is compatible with the H 0 value measured by other methods. We demonstrate that a systematic bias (up to ∼20%) may be introduced to the H 0 estimation because of recent star formation in the LRGs due to the later major mergers at z ∼0 = 65+7–3 km s–1 Mpc–1 or H 0 = 74+5–4 km s–1 Mpc–1 by assuming a spatially flat ΛCDM cosmology. With upcoming surveys, such as the Baryon Oscillation Spectroscopic Survey, even larger samples of quiescent massive LRGs may be obtained, and thus the Hubble parameter can be measured with high accuracy usimg the age-redshift relation.

  12. The real-space clustering of luminous red galaxies around z<0.6 quasars in the Sloan Digital Sky Survey

    Padmanabhan, N; Norberg, P; Porciani, C

    2008-01-01

    We measure the clustering of a sample of photometrically selected luminous red galaxies around a low redshift (0.2~ 10^{12} h^{-1} M_sun, Eddington ratios from 0.01 to 1 and lifetimes less than 10^{7} yr. Using simple models of halo occupation, these correspond to a number density of quasar hosts greater than 10^{-3} h^{3} Mpc^{-3} and stellar masses less than 10^{11} h^{-1} M_sun. The small-scale clustering signal can be in terpreted with the aid of our mock LRG catalogs, and depends on the manner in which quasars inhabit halos. We find that our small scale measurements are inconsistent with quasar positions being randomly subsampled from halo centers above a mass threshold, requiring a satellite fraction > 25 per cent.

  13. Photometry and spectroscopy of the luminous red nova PSNJ14021678+5426205 in the galaxy M101

    Goranskij, V. P.; Barsukova, E. A.; Spiridonova, O. I.; Valeev, A. F.; Fatkhullin, T. A.; Moskvitin, A. S.; Vozyakova, O. V.; Cheryasov, D. V.; Safonov, B. S.; Zharova, A. V.; Hancock, T.

    2016-01-01

    We present the results of the study of a red nova from the observations carried out with the Russian 6-m telescope (BTA) along with other telescopes of SAO RAS and SAI MSU. To investigate the nova progenitor,we used the data from the Digital Sky Survey and amateur photos available on the Internet. In the period between April 1993 and July 2014, the brightness of the progenitor gradually increased by 2_ \\cdot ^m 2 in the V-band. At the peak of the first outburst in mid-November 2014, the star reached an absolute visual magnitude of - 12_ \\cdot ^m 75 but was discovered later, in February 2015, in a repeated outburst at the magnitude of - 11_ \\cdot ^m 65. The amplitude of the outburst was minimum among the red novae, only 5_ \\cdot ^m 6 in V-band. The Hα emission line and the background of a cool supergiant continuum with gradually decreasing surface temperature were observed in the spectra. Such process is typical for red novae, although the object under study showed extreme parameters: maximum luminosity, maximum outburst duration, minimum outburst amplitude, unusual shape of the light curve. This event is interpreted as a massive OB star system components'merging accompanied by formation of a common envelope and then the expansion of this envelope with minimal energy losses.

  14. The Gravitational Shear-Intrinsic Ellipticity Correlation Functions of Luminous Red Galaxies in Observation and in the ΛCDM Model

    Okumura, Teppei; Jing, Y. P.

    2009-03-01

    We examine whether the gravitational shear-intrinsic ellipticity (GI) correlation function of the luminous red galaxies (LRGs) can be modeled with the distribution function of a misalignment angle advocated recently by Okumura et al. For this purpose, we have accurately measured the GI correlation for the LRGs in the Data Release 6 (DR6) of the Sloan Digital Sky Survey (SDSS), which confirms the results of Hirata et al. who used the DR4 data. By comparing the GI correlation functions in the simulation and in the observation, we find that the GI correlation can be modeled in the current ΛCDM model if the misalignment follows a Gaussian distribution with a zero mean and a typical misalignment angle σθ = 34.9+1.9 -2.1 degrees. We also find a correlation between the axis ratios and intrinsic alignments of LRGs. This effect should be taken into account in theoretical modeling of the GI and intrinsic ellipticity-ellipticity correlations for weak lensing surveys.

  15. Direct Minkowski Functional analysis of large redshift surveys: a new high-speed code tested on the luminous red galaxy Sloan Digital Sky Survey-DR7 catalogue

    Wiegand, Alexander; Buchert, Thomas; Ostermann, Matthias

    2014-09-01

    As deeper galaxy catalogues are soon to come, it becomes even more important to measure large-scale fluctuations in the catalogues with robust statistics that cover all moments of the galaxy distribution. In this paper, we reinforce a direct analysis of galaxy data by employing the Germ-Grain method to calculate the family of Minkowski Functionals. We introduce a new code, suitable for the analysis of large data sets without smoothing and without the construction of excursion sets. We provide new tools to measure correlation properties, putting emphasis on explicitly isolating non-Gaussian correlations with the help of integral-geometric relations. As a first application, we present the analysis of large-scale fluctuations in the luminous red galaxy sample of Sloan Digital Sky Survey data release 7 data. We find significant deviations from the Λ cold dark matter mock catalogues on samples as large as 500 h- 1 Mpc (more than 3σ) and slight deviations of around 2σ on 700 h- 1 Mpc, and we investigate possible sources of these deviations.

  16. Luminous Supernovae

    Gal-Yam, Avishay

    2012-01-01

    Supernovae (SNe), the luminous explosions of stars, were observed since antiquity, with typical peak luminosity not exceeding 1.2x10^{43} erg/s (absolute magnitude >-19.5 mag). It is only in the last dozen years that numerous examples of SNe that are substantially super-luminous (>7x10^{43} erg/s; <-21 mag absolute) were well-documented. Reviewing the accumulated evidence, we define three broad classes of super-luminous SN events (SLSNe). Hydrogen-rich events (SLSN-II) radiate photons diffusing out from thick hydrogen layers where they have been deposited by strong shocks, and often show signs of interaction with circumstellar material. SLSN-R, a rare class of hydrogen-poor events, are powered by very large amounts of radioactive 56Ni and arguably result from explosions of very massive stars due to the pair instability. A third, distinct group of hydrogen-poor events emits photons from rapidly-expanding hydrogen-poor material distributed over large radii, and are not powered by radioactivity (SLSN-I). Thes...

  17. Very high efficiency orange-red light-emitting devices with low roll-off at high luminance based on an ideal host-guest system consisting of two novel phosphorescent iridium complexes with bipolar transport.

    Li, Guomeng; Zhu, Dongxia; Peng, Tai; Liu, Yu; Wang, Yue; Bryce, Martin R.

    2014-01-01

    Two phosphorescent iridium complexes with bipolar transporting ability, namely FPPCA (500 nm) and BZQPG (600 nm), are synthesized and employed as an ideal host-guest system for phosphorescent organic light emitting diodes (PHOLEDs).The devices give very high-efficiency orange-red emission from BZQPG with maximum external quantum efficiency (EQE or ηext) of >27% and maximum power efficiency (PE or ηp) of >75 lm/W, and maintain high levels of 26% and 55 lm/W, 25% and 40 lm/W at high luminance o...

  18. Luminous presence

    Dawson, Paula

    2008-02-01

    The Luminous Presence project examines the use of standard film language in the framing, angle and of points of view of holographic subjects though eight digital holographic stereograms; seven 25 x 25 cm, Hail, Water, Rain, Snow, Sun, Text, Imprint and 1.5 x 1 m, Luminous Presences i. However, before embarking on a discussion of how filmic language can be used in digital holograms it is first important to explain why this line of investigation could be fruitful. Undoubtedly several of the compositional practices which sprung up and evolved throughout the development of the diverse forms of the holographic medium have contributed to a unique hologram pictorial language, however it is well known that the reading of visual imagery of any type relies a great deal on the viewer's knowledge of and experience of other images .The lens-recorded imagery of film is a far more familiar language than that of holograms and the correlation between certain filmic pictorial conventions and emotional responses are well documented and understood. ii . In short the language of film contains a highly nuanced vocabulary of shot types and lens types (which may be criticised as being formulaic) yet are effective in lending emotion to figures.

  19. The Effect of Light Therapy on Superficial Radial Nerve Conduction Using a Clustered Array of Infrared Super luminous Diodes and Red Light Emitting Diodes

    Telemeco, Todd Allen; Schrank, Edward Carl

    2013-01-01

    Introduction: Lasers, light emitting diodes (LEDs) and super luminous diodes (SLDs) are widely used to treat selected musculoskeletal, integumentary and neurological conditions.The mechanisms underlying the reported treatment effects of light therapy are unclear and the physiologic effect of light on a variety of tissues, particularly neurological, is mostly unknown. A few researchers have reported on the effects of lasers and to a lesser extent infrared LEDs on nerve conduction in superficia...

  20. Schizophrenia spectrum participants have reduced visual contrast sensitivity to chromatic (red/green and luminance (light/dark stimuli: new insights into information processing, visual channel function and antipsychotic effects

    Kristin Suzanne Cadenhead

    2013-08-01

    Full Text Available Background: Individuals with schizophrenia spectrum diagnoses have deficient visual information processing as assessed by a variety of paradigms including visual backward masking, motion perception and visual contrast sensitivity (VCS. In the present study, the VCS paradigm was used to investigate potential differences in magnocellular (M versus parvocellular (P channel function that might account for the observed information processing deficits of schizophrenia spectrum patients. Specifically, VCS for near threshold luminance (black/white stimuli is known to be governed primarily by the M channel, while VCS for near threshold chromatic (red/green stimuli is governed by the P channel. Methods: VCS for luminance and chromatic stimuli (counterphase-reversing sinusoidal gratings, 1.22 c/deg, 8.3 Hz was assessed in 53 patients with schizophrenia (including 5 off antipsychotic medication, 22 individuals diagnosed with schizotypal personality disorder and 53 healthy comparison subjects. Results: Schizophrenia spectrum groups demonstrated reduced VCS in both conditions relative to normals, and there was no significant group by condition interaction effect. Post-hoc analyses suggest that it was the patients with schizophrenia on antipsychotic medication as well as SPD participants who accounted for the deficits in the luminance condition. Conclusions: These results demonstrate visual information processing deficits in schizophrenia spectrum populations but do not support the notion of selective abnormalities in the function of subcortical channels as suggested by previous studies. Further work is needed in a longitudinal design to further assess VCS as a vulnerability marker for psychosis as well as the effect of antipsychotic agents on performance in schizophrenia spectrum populations.

  1. The Most Luminous Supernovae

    Sukhbold, Tuguldur; Woosley, S. E.

    2016-04-01

    Recent observations have revealed a stunning diversity of extremely luminous supernovae, seemingly increasing in radiant energy without bound. We consider simple approximate limits for what existing models can provide for the peak luminosity and total radiated energy for non-relativistic, isotropic stellar explosions. The brightest possible supernova is a Type I explosion powered by a sub-millisecond magnetar with field strength B ∼ few × {10}13 G. In extreme cases, such models might reach a peak luminosity of 2× {10}46 {erg} {{{s}}}-1 and radiate a total energy of up to 4× {10}52 {erg}. Other less luminous models are also explored, including prompt hyper-energetic explosions in red supergiants, pulsational-pair instability supernovae, pair-instability supernovae, and colliding shells. Approximate analytic expressions and limits are given for each case. Excluding magnetars, the peak luminosity is near 3× {10}44 {erg} {{{s}}}-1 for the brightest models and the corresponding limit on total radiated energy is 3× {10}51 {erg}. Barring new physics, supernovae with a light output over 3× {10}51 erg must be rotationally powered, either during the explosion itself or after, the most obvious candidate being a rapidly rotating magnetar. A magnetar-based model for the recent transient event, ASASSN-15lh is presented that strains, but does not exceed the limits of what the model can provide.

  2. The Most Luminous Supernovae

    Sukhbold, Tuguldur

    2016-01-01

    Recent observations have revealed an amazing diversity of extremely luminous supernovae, seemingly increasing in radiant energy without bound. We consider here the physical limits of what existing models can provide for the peak luminosity and total radiated energy for non-relativistic, isotropic stellar explosions. The brightest possible supernova is a Type I explosion powered by a sub-millisecond magnetar. Such models can reach a peak luminosity of $\\rm 2\\times10^{46}\\ erg\\ s^{-1}$ and radiate a total energy of $\\rm 4 \\times10^{52}\\ erg$. Other less luminous models are also explored, including prompt hyper-energetic explosions in red supergiants, pulsational-pair instability supernovae, and pair-instability supernovae. Approximate analytic expressions and limits are given for each case. Excluding magnetars, the peak luminosity is near $\\rm 1\\times10^{44}\\ erg\\ s^{-1}$ for the brightest models. The corresponding limits on total radiated power are $\\rm3 \\times 10^{51}\\ erg$ (Type I) and $\\rm1 \\times 10^{51}\\ ...

  3. Luminance ratio for extreme shadings

    Kaňka, Jan; Mohelníková, Jitka; Ullmannová, Kateřina; Vychytil, Jaroslav

    2015-01-01

    Luminance ratio k (-) is a photometric magnitude used for daylight calculation metrics. The paper is focused on specification of luminance ratio values and their influence on daylight factor calculations for of extremely shaded outdoor conditions.

  4. SURVEY OF THE ENTOMOFAUNA THROUGH LUMINOUS TRAP

    V. R. Andrade Neto

    2014-09-01

    Full Text Available The demand for forest-based raw materials for energy, construction, paper pulp and the pressure to comply with legal requirements concerning environmental legislation, for example, the replacement of the permanent preservation area, legal reserve and recovery of degraded area, leads to encourage the production of healthy seedlings in a health status to do not compromise their future production. The present study aimed to survey the entomofauna population using the “Luiz de Queiroz” model of luminous trap, with white and red fluorescent lamps. The experiment was conducted at the nursery “Flora Sinop” in Sinop – MT. The survey was conducted weekly between the months of April to July 2010, totaling 4 months sand, 32 samples collected. The orders Hemiptera and Coleoptera showed the highest number of individuals captured, either in attraction with white or red light. It was captured 10.089 individuals, 9.339 collected under the influence of white light, representing 92,56%, and 750 with red light, only 7,44% of the total. The white light luminous trap possessed greater efficiency in the attraction of insects when compared with the red light trap.

  5. Paul Callaghan luminous moments

    Callaghan, Paul

    2013-01-01

    Acknowledged internationally for his ground-breaking scientific research in the field of magnetic resonance, Sir Paul Callaghan was a scientist and visionary with a rare gift for promoting science to a wide audience. He was named New Zealander of the Year in 2011. His death in early 2012 robbed New Zealand of an inspirational leader. Paul Callaghan: Luminous Moments brings together some of his most significant writing. Whether he describes his childhood in Wanganui, reflects on discovering the beauty of science, sets out New Zealand's future potential or discusses the experience of fa

  6. PSP type radioactive luminous pigments

    The technical requirements are described on radioactive luminous pigments with 147Pm. The specific activity of the luminous pigments and their nominal initial brightness are tabulated. Technical inspection determines the specific and total activity, total salt content and content of radionuclide impurities. (E.S.)

  7. Mechanical feedback in the molecular ISM of luminous IR galaxies

    Loenen, A. F.; Spaans, M.; Baan, W. A.; Meijerink, R

    2008-01-01

    Aims: Molecular emission lines originating in the nuclei of luminous infra-red galaxies are used to determine the physical properties of the nuclear ISM in these systems. Methods: A large observational database of molecular emission lines is compared with model predictions that include heating by UV and X-ray radiation, mechanical heating, and the effects of cosmic rays. Results: The observed line ratios and model predictions imply a separation of the observedsystems into three groups: XDRs, ...

  8. Characterization of the Most Luminous Star in M33: A Super Symbiotic Binary

    Mikolajewska, Joanna; Shara, Michael M; Ilkiewicz, Krystian

    2014-01-01

    We present the first spectrum of the most luminous infrared star in M33, and use it to demonstrate that the object is almost certainly a binary composed of a massive O star and a dust-enshrouded Red Hypergiant. This is the most luminous symbiotic binary ever discovered. Its radial velocity is an excellent match to that of the hydrogen gas in the disk of M33, supporting our interpretation that it is a very young and massive binary star.

  9. 78 FR 66785 - Luminant Generation Company, LLC

    2013-11-06

    ... From the Federal Register Online via the Government Publishing Office NUCLEAR REGULATORY COMMISSION Luminant Generation Company, LLC AGENCY: Nuclear Regulatory Commission. ACTION: Notice of receipt... consecutive weeks of ] a combined license (COL) application from Luminant Generation Company, LLC....

  10. 78 FR 68100 - Luminant Generation Company, LLC

    2013-11-13

    ... From the Federal Register Online via the Government Publishing Office NUCLEAR REGULATORY COMMISSION Luminant Generation Company, LLC AGENCY: U.S. Nuclear Regulatory Commission (NRC). ACTION... consecutive weeks of a combined license (COL) application from Luminant Generation Company, LLC....

  11. 78 FR 70964 - Luminant Generation Company, LLC

    2013-11-27

    ... From the Federal Register Online via the Government Publishing Office NUCLEAR REGULATORY COMMISSION Luminant Generation Company, LLC AGENCY: Nuclear Regulatory Commission. ACTION: Combined license... for four consecutive weeks of a combined license (COL) application from Luminant Generation...

  12. 78 FR 69710 - Luminant Generation Company, LLC

    2013-11-20

    ... From the Federal Register Online via the Government Publishing Office NUCLEAR REGULATORY COMMISSION Luminant Generation Company, LLC AGENCY: U.S. Nuclear Regulatory Commission (NRC). ACTION... consecutive weeks of a combined license (COL) application from Luminant Generation Company, LLC....

  13. Earth village `Luminous Musashikoganei`; Earth village `Luminous Musashikoganei`

    Kimura, T.

    1997-03-31

    This paper introduces an environment symbiosis building, `Luminous Musashikoganei` of Japan Workers Housing Association. The environment symbiotic methods adopted for `Luminous Musashikoganei` multiple dwelling house include the roof vegetable garden, greening of roof and walls, rainwater utilization, small pond, rainwater permeation facility, hot water supply system using solar heat, photovoltaic power generation system, and pumping facility using wind force. Rainwater is used as the irrigation water for roof vegetable garden. The rainwater stored in the underground storage tank is pumped up using a pump with photovoltaic cell source and a hand pump. Temperature of the concrete wall surface at the west side in summer can be decreased by greening of walls. Small nature can be created in the pond as a symbiotic space where killifish, frogs, and dragonflies inhabit. The pumping facility using wind force is used for the circulation of water in the pond. The hot water supply system using solar heat and the photovoltaic power generation system for lighting of courtyard and entrance are effective for energy conservation of the multiple dwelling house. 6 figs.

  14. LED white lights with high CRI and high luminous efficacy

    He, Guoxing; Zheng, Lihong; Yan, Huafeng

    2010-11-01

    The models for spectra of a phosphor-coated white (p-W) LED and a white light LED cluster are developed based on the principle of additive color mixture. The simulation results show that p-W LEDs consisting of a blue chip (450nm), green phosphor (507 nm), yellow phosphor (580 nm) and red phosphor (655 nm) could realize color rendering indices (CRIs) above 97.7 and special CRIs of R1 to R14 above 91.1, but luminous efficacies of radiation (LERs) below 250.3 lm/W, that white/red clusters consisting of red LEDs and p-W LEDs with a blue chip (450nm), green (507 nm) and yellow (580 nm) phosphors could realize given color temperature white light with CRIs above 97.9 and special CRIs of R1 to R14 above 89.6, as well as LERs above 296.3 lm/W, and that a neutral-white /red//blue cluster consisting of blue LEDs (465 nm), red LEDs (628 nm) and neutral-white LEDs with a blue chip (452 nm), green (530 nm) and yellow (586 nm) phosphors could realize CCT tunable white lights with CRIs above 97.9 and special CRIs of R1 to R14 above 89.6, as well as LER above 296.3 lm/W.

  15. Raman Scattering Spectrum Analysis of GaP and Its Luminous Materials①②

    ZHANGFujia; QILi; 等

    1997-01-01

    The Raman scattering spectra of n-type GaP(doped S) single crystal and red and green luminous materials grown on the n-type GaP(doped S)single crystal substrate by liquid-phase epitaxy are analyed.The results show that the spectra of GaP single crystal and its luminous materials include not only the first-order longitudinal optical photons and transverse optical phonons Raman scattering peaks,but also the peaks of the bound excitons,bound electrons and bound holes.

  16. Optical coherence tomography investigations of ceramic lumineers

    Fernandes, Luana O.; Graça, Natalia D. R. L.; Melo, Luciana S. A.; Silva, Claudio H. V.; Gomes, Anderson S. L.

    2016-02-01

    Lumineers are veneer laminates used as an alternative for aesthetic dental solutions of the highest quality, but the only current means of its performance assessment is visual inspection. The objective of this study was to use the Optical Coherence Tomography (OCT) technique working in spectral domain to analyze in vivo in a single patient, 14 lumineers 180 days after cementation. It was possible to observe images in various kinds of changes in the cementing line and the laminate. It was concluded that the OCT is an effective and promising method to clinical evaluation of the cementing line in lumineers.

  17. Feedback in Luminous Obscured Quasars

    Greene, Jenny E; Ho, Luis C; Barth, Aaron J

    2011-01-01

    We use spatially resolved long-slit spectroscopy from Magellan to investigate the extent, kinematics, and ionization structure in the narrow-line regions of 15 luminous, obscured quasars with z<0.5. Increasing the dynamic range in luminosity by an order of magnitude, as well as improving the depth of existing observations by a similar factor, we revisit relations between narrow-line region size and the luminosity and linewidth of the narrow emission lines. We find a slope of 0.22 +/- 0.04 for the power-law relationship between size and luminosity, suggesting that the nebulae are limited by availability of gas to ionize at these luminosities. In fact, we find that the active galactic nucleus is effectively ionizing the interstellar medium over the full extent of the host galaxy. Broad (~300-1000 km/s) linewidths across the galaxies reveal that the gas is kinematically disturbed. Furthermore, the rotation curves and velocity dispersions of the ionized gas remain constant out to large distances, in striking c...

  18. Dust near luminous ultraviolet stars

    Henry, Richard C.

    1993-01-01

    This report describes research activities related to the Infrared Astronomical Satellite (IRAS) sky survey. About 745 luminous stars were examined for the presence of interstellar dust heated by a nearby star. The 'cirrus' discovered by IRAS is thermal radiation from interstellar dust at moderate and high galactic latitudes. The IRAS locates the dust which must (at some level) scatter ultraviolet starlight, although it was expected that thermal emission would be found around virtually every star, most stars shown no detectable emission. And the emission found is not uniform. It is not that the star is embedded in 'an interstellar medium', but rather what is found are discrete clouds that are heated by starlight. An exception is the dearth of clouds near the very hottest stars, implying that the very hottest stars play an active role with respect to destroying or substantially modifying the dust clouds over time. The other possibility is simply that the hottest stars are located in regions lacking in dust, which is counter-intuitive. A bibliography of related journal articles is attached.

  19. Luminous and variable stars in M31 and M33. II. Luminous blue variables, candidate LBVs, Fe II emission line stars, and other supergiants

    Humphreys, Roberta M.; Davidson, Kris [Minnesota Institute for Astrophysics, 116 Church Street SE, University of Minnesota, Minneapolis, MN 55455 (United States); Weis, Kerstin; Bomans, D. J.; Burggraf, Birgitta, E-mail: roberta@umn.edu, E-mail: kweis@astro.rub.de [Astronomical Institute, Ruhr-Universitaet Bochum (Germany)

    2014-07-20

    An increasing number of non-terminal eruptions are being found in the numerous surveys for optical transients. Very little is known about these giant eruptions, their progenitors and their evolutionary state. A greatly improved census of the likely progenitor class, including the most luminous evolved stars, the luminous blue variables (LBVs), and the warm and cool hypergiants is now needed for a complete picture of the final pre-supernova stages of very massive stars. We have begun a survey of the evolved and unstable luminous star populations in several nearby resolved galaxies. In this second paper on M31 and M33, we review the spectral characteristics, spectral energy distributions, circumstellar ejecta, and evidence for mass loss for 82 luminous and variable stars. We show that many of these stars have warm circumstellar dust including several of the Fe II emission line stars, but conclude that the confirmed LBVs in M31 and M33 do not. The confirmed LBVs have relatively low wind speeds even in their hot, quiescent or visual minimum state compared to the B-type supergiants and Of/WN stars which they spectroscopically resemble. The nature of the Fe II emission line stars and their relation to the LBV state remains uncertain, but some have properties in common with the warm hypergiants and the sgB[e] stars. Several individual stars are discussed in detail. We identify three possible candidate LBVs and three additional post-red supergiant candidates. We suggest that M33-013406.63 (UIT301,B416) is not an LBV/S Dor variable, but is a very luminous late O-type supergiant and one of the most luminous stars or pair of stars in M33.

  20. A spectrum-adjusted white organic light-emitting diode for the optimization of luminous efficiency and color rendering index

    Chen, Wei; Chen, Shu-ming

    2015-01-01

    High luminous efficiency and high color rendering index (CRI) are both the foremost factors for white organic light-emitting diodes (WOLEDs) to serve as next generation solid-state lighting sources. In this paper, we show that both luminous efficiency and CRI can be improved by adjusting the green/red spectra of WOLEDs. With green emission spectra matching with the human photopic curve, the WOLEDs exhibit higher luminous efficiency and higher CRI. Theoretical calculation shows that by tuning the white emission spectra to maximally match with the human photopic curve, the luminous efficiency can be improved by 41.8% without altering the color coordinates, the color correlated temperature (CCT) and the external quantum efficiency (EQE) of the WOLEDs.

  1. Colour Appearance Modelling for Self-luminous Colours

    Withouck, Martijn; Ryckaert, Wouter; Smet, Kevin; Deconinck, Geert; Hanselaer, Peter

    2012-01-01

    An experimental setup and procedure for the evaluation of self- luminous colours viewed against both dark and luminous backgrounds is presented. Physical and visual data of self-luminous colours is gathered in order to develop a Colour Appearance Model for self-luminous colours under different viewing conditions. This model is needed for the evaluation of light sources.

  2. Low luminance/eyes closed and monochromatic stimulations reduce variability of flash visual evoked potential latency

    Senthil Kumar Subramanian

    2013-01-01

    Full Text Available Context: Visual evoked potentials are useful in investigating the physiology and pathophysiology of the human visual system. Flash visual evoked potential (FVEP, though technically easier, has less clinical utility because it shows great variations in both latency and amplitude for normal subjects. Aim: To study the effect of eye closure, low luminance, and monochromatic stimulation on the variability of FVEPs. Subjects and Methods: Subjects in self-reported good health in the age group of 18-30 years were divided into three groups. All participants underwent FVEP recording with eyes open and with white light at 0.6 J luminance (standard technique. Next recording was done in group 1 with closed eyes, group 2 with 1.2 and 20 J luminance, and group 3 with red and blue lights, while keeping all the other parameters constant. Two trials were given for each eye, for each technique. The same procedure was repeated at the same clock time on the following day. Statistical Analysis: Variation in FVEP latencies between the individuals (interindividual variability and the variations within the same individual for four trials (intraindividual variability were assessed using coefficient of variance (COV. The technique with lower COV was considered the better method. Results: Recording done with closed eyes, 0.6 J luminance, and monochromatic light (blue > red showed lower interindividual and intraindividual variability in P2 and N2 as compared to standard techniques. Conclusions: Low luminance flash stimulations and monochromatic light will reduce FVEP latency variability and may be clinically useful modifications of FVEP recording technique.

  3. Super-luminous supernovae: 56Ni power versus magnetar radiation

    Dessart, Luc; Waldman, Roni; Livne, Eli; Blondin, Stephane

    2012-01-01

    Much uncertainty surrounds the origin of super-luminous supernovae (SNe). Motivated by the discovery of the Type Ic SN2007bi, we study its proposed association with a pair-instability SN (PISN). We compute stellar-evolution models for primordial ~200Msun stars, simulating the implosion/explosion due to the pair-production instability, and use them as inputs for detailed non-LTE time-dependent radiative-transfer simulations that include non-local energy deposition and non-thermal processes. We retrieve the basic morphology of PISN light curves from red-supergiant, blue-supergiant, and Wolf-Rayet (WR) star progenitors. Although we confirm that a progenitor 100Msun helium core (PISN model He100) fits well the SN2007bi light curve, the low ratios of its kinetic energy and 56Ni mass to the ejecta mass, similar to standard core-collapse SNe, conspire to produce cool photospheres, red spectra subject to strong line blanketing, and narrow line profiles, all conflicting with SN2007bi observations. He-core models of in...

  4. Color and luminance contrasts attract independent attention.

    Morrone, Maria Concetta; Denti, Valentina; Spinelli, Donatella

    2002-07-01

    Paying attention can improve vision in many ways, including some very basic functions such as contrast discrimination, a task that probably reflects very early levels of visual processing. Electrophysiological, psychophysical, and imaging studies on humans as well as single recordings in monkey show that attention can modulate the neuronal response at an early stage of visual processing, probably by acting on the response gain. Here, we measure incremental contrast thresholds for luminance and color stimuli to derive the contrast response of early neural mechanisms and their modulation by attention. We show that, for both cases, attention improves contrast discrimination, probably by multiplicatively increasing the gain of the neuronal response to contrast. However, the effects of attention are highly specific to the visual modality: concurrent attention to a competing luminance, but not chromatic pattern, greatly impedes luminance contrast discrimination; and attending to a competing chromatic, but not luminance, task impedes color contrast discrimination. Thus, the effects of attention are highly modality specific, implying separate attentional resources for different fundamental visual attributes at early stages of visual processing. PMID:12121622

  5. CO excitation in four IR luminous galaxies

    The correlation between the CO and far infrared luminosities of spiral galaxies is well established. The luminosity ration, L sub FIR/L sub CO in IR luminous active galaxies is, however, systematically five to ten times higher than in ordinary spirals and molecular clouds in our Galaxy. Furthermore, the masses of molecular hydrogen in luminous galaxies are large, M (H2) approx. equals 10(exp 10) solar magnitude, which indicates the observed luminosity ratios are due to an excess of infrared output, rather than a deficiency of molecular gas. These large amounts of molecular gas may fuel luminous galaxies through either star formation or nuclear activity. This interpretation rests on applying the M (H2)/L sub CO ratio calibrated in our Galaxy to galaxies with strikingly different luminosity ratios. But are the physical conditions of the molecular gas different in galaxies with different luminosity ratios. And, if so, does the proportionality between CO and H2 also vary among galaxies. To investigate these questions researchers observed CO (2 to 1) and (1 to 0) emission from four luminous galaxies with the Institute for Radio Astronomy in the Millimeter range (IRAM) 30 m telescope. Researchers conclude that most of the CO emission from these Arp 193, Arp 220, and Mrk 231 arises in regions with moderate ambient densities similar to the clouds in the Milky Way molecular ring. The emission is neither from dense hot cloud cores nor from the cold low density gas characteristic of the envelopes of dark clouds

  6. Eye redness

    Bloodshot eyes; Red eyes; Scleral infection; Conjunctival infection ... There are many causes of a red eye or eyes. Some are medical emergencies and some are a cause for concern, but not an emergency. Others are nothing to worry about. ...

  7. White LEDs with limit luminous efficacy

    Lisitsyn, V. M.; Stepanov, S. A., E-mail: stepanovsa@tpu.ru; Yangyang, Ju [National Research Tomsk Polytechnic University, 30 Lenin Av., Tomsk, 634050 (Russian Federation); Lukash, V. S. [JSC Research Institute of Semiconductor Devices, 99a Krasnoarmeyskaja St., Tomsk, 634050 (Russian Federation)

    2016-01-15

    In most promising widespread gallium nitride based LEDs emission is generated in the blue spectral region with a maximum at about 450 nm which is converted to visible light with the desired spectrum by means of phosphor. The thermal energy in the conversion is determined by the difference in the energies of excitation and emission quanta and the phosphor quantum yield. Heat losses manifest themselves as decrease in the luminous efficacy. LED heating significantly reduces its efficiency and life. In addition, while heating, the emission generation output and the efficiency of the emission conversion decrease. Therefore, the reduction of the energy losses caused by heating is crucial for LED development. In this paper, heat losses in phosphor-converted LEDs (hereinafter chips) during spectrum conversion are estimated. The limit values of the luminous efficacy for white LEDs are evaluated.

  8. The Formation of Primordial Luminous Objects

    Ripamonti, E; Ripamonti, Emanuele; Abel, Tom

    2005-01-01

    In these lecture notes we review the current knowledge about the formation of the first luminous objects. We start from the cosmological context of hierarchical models of structure formation, and discuss the main physical processes which are believed to lead to primordial star formation, i.e. the cooling processes and the chemistry of molecules (especially H2) in a metal-free gas. We then describe the techniques and results of numerical simulations, which indicate that the masses of the first luminous objects are likely to be much larger than that of present-day stars. Finally, we discuss the scenario presented above, exposing some of the most interesting problems which are currently being investigated, such as that of the feedback effects of these objects.

  9. Orbital masses of nearby luminous galaxies

    We use observational properties of galaxies accumulated in the Updated Nearby Galaxy Catalog to derive a dark matter mass of luminous galaxies via motions of their companions. The data on orbital-to-stellar mass ratio are presented for 15 luminous galaxies situated within 11 Mpc from us: the Milky Way, M31, M81, NGC 5128, IC342, NGC 253, NGC 4736, NGC 5236, NGC 6946, M101, NGC 4258, NGC 4594, NGC 3115, NGC 3627, and NGC 3368, as well as for a composite suite around other nearby galaxies of moderate and low luminosity. The typical ratio for these galaxies is M orb/M * = 31, corresponding to the mean local density of matter Ω m = 0.09, i.e., one-third of the global cosmic density. This quantity seems to be rather an upper limit of dark matter density, since the peripheric population of the suites may suffer from the presence of fictitious unbound members. We note that the Milky Way and M31 halos have lower dimensions and lower stellar masses than those of the other 13 nearby luminous galaxies. However, the dark-to-stellar mass ratio for both the Milky Way and M31 is typical for other neighboring luminous galaxies. The distortion in the Hubble flow, observed around the Local Group and five other neighboring groups, yields their total masses within the radius of a zero velocity surface, R 0; these masses are slightly lower than the orbital and virial values. This difference may be due to the effect of dark energy producing a kind of 'mass defect' within R 0.

  10. Lightness constancy: ratio invariance and luminance profile

    Soranzo, Alessandro; Galmonde, Alessandro; Agostini, Tiziano

    2009-01-01

    The term simultaneous lightness constancy describes the capacity of the visual system to perceive equal reflecting surfaces as having the same lightness despite lying in different illumination fields. In some cases, however, a lightness constancy failure occurs; that is, equal reflecting surfaces appear different in lightness when differently illuminated. An open question is whether the luminance profile of the illumination edges affects simultaneous lightness constancy even when the ra...

  11. Polycyclic aromatic hydrocarbon (PAH) luminous galaxies at z~1

    Takagi, T; Goto, T; Matsuhara, H; Oyabu, S; Wada, T; Pearson, C P; Lee, H M; Im, M; Lee, M G; Shim, H; Hanami, H; Ishigaki, T; Imai, K; White, G J; Serjeant, S; Malkan, M

    2010-01-01

    Using an AKARI multi-wavelength mid-infrared (IR) survey, we identify luminous starburst galaxies at z> 0.5 based on the PAH luminosity, and investigate the nature of these PAH-selected starbursts. An extragalactic survey with AKARI towards the north ecliptic pole (NEP), the NEP-Deep survey, is unique in terms of a comprehensive wavelength coverage from 2 to 24um using all 9 photometric bands of the InfraRed Camera (IRC). This survey allows us to photometrically identify galaxies whose mid-IR emission is clearly dominated by PAHs. We propose a single colour selection method to identify such galaxies, using two mid-IR flux ratios at 11-to-7um and 15-to-9um (PAH-to-continuum flux ratio in the rest-frame), which are useful to identify starburst galaxies at z~0.5 and 1, respectively. We perform a fitting of the spectral energy distributions (SEDs) from optical to mid-IR wavelengths, using an evolutionary starburst model with a proper treatment of radiative transfer (SBURT), in order to investigate their nature. T...

  12. The Evolution of Luminous Compact Blue Galaxies: Disks or Spheroids?

    Pisano, D J; Garland, C A; Guzman, R; Castander, F J; Perez-Gallego, J

    2011-01-01

    Luminous compact blue galaxies (LCBGs) are a diverse class of galaxies characterized by high luminosity, blue color, and high surface brightness that sit at the critical juncture of galaxies evolving from the blue to the red sequence. As part of our multi-wavelength survey of local LCBGs, we have been studying the HI content of these galaxies using both single-dish telescopes and interferometers. Our goals are to determine if single-dish HI observations represent a true measure of the dynamical mass of LCBGs and to look for signatures of recent interactions that may be triggering star formation in LCBGs. Our data show that while some LCBGs are undergoing interactions, many appear isolated. While all LCBGs contain HI and show signatures of rotation, the population does not lie on the Tully-Fisher relation nor can it evolve onto it. Furthermore, the HI maps of many LCBGs show signatures of dynamically hot components, suggesting that we are seeing the formation of a thick disk or spheroid in at least some LCBGs....

  13. The Evolution of Luminous Compact Blue Galaxies: Disks or Spheroids?

    Pisano, D J; Rabidoux, K; Wolfe, S; Guzman, R; Perez-Gallego, J; Castander, F J

    2009-01-01

    Luminous compact blue galaxies (LCBGs) are a diverse class of galaxies characterized by high luminosities, blue colors, and high surface brightnesses. Residing at the high luminosity, high mass end of the blue sequence, LCBGs sit at the critical juncture of galaxies that are evolving from the blue to the red sequence. Yet we do not understand what drives the evolution of LCBGs, nor how they will evolve. Based on single-dish HI observations, we know that they have a diverse range of properties. LCBGs are HI-rich with M(HI)=10^{9-10.5} M(sun), have moderate M(dyn)=10^{10-12} M(sun), and 80% have gas depletion timescales less than 3 Gyr. These properties are consistent with LCBGs evolving into low-mass spirals or high mass dwarf ellipticals or dwarf irregulars. However, LCBGs do not follow the Tully-Fisher relation, nor can most evolve onto it, implying that many LCBGs are not smoothly rotating, virialized systems. GMRT and VLA HI maps confirm this conclusion revealing signatures of recent interactions and dynam...

  14. The isolation of Luminous Blue Variables: On subdividing the sample

    Smith, Nathan

    2016-01-01

    A debate has arisen concerning the fundamental nature of LBVs) and their role in stellar evolution. While Smith and Tombleson proposed that their isolated environments indicate that LBVs must be largely the product of binary evolution, Humphreys et al. have recently expressed the view that the traditional single-star view still holds if one appropriately selects a subsample of LBVs. This paper finds the claim of Humphreys et al. to be quantitatively unjustified. A statistical test of "candidate" as opposed to "confirmed" LBVs shows no significant difference ($<$1$\\sigma$) between their environments. Even if the sample is further subdivided as proposed, the three most luminous LBVs are spatially dispersed similar to late O-type dwarfs, which have much longer lifetimes than expected for classical LBVs. Lower-luminosity LBVs have a distribution associated with red supergiants (RSGs), but these RSGs are dominated by stars of 10-15 M$_{\\odot}$ initial mass, with much longer lifetimes than expected for those low...

  15. Constraining Emission Models of Luminous Blazar Sources

    Many luminous blazars which are associated with quasar-type active galactic nuclei display broad-band spectra characterized by a large luminosity ratio of their high-energy (γ-ray) and low-energy (synchrotron) spectral components. This large ratio, reaching values up to 100, challenges the standard synchrotron self-Compton models by means of substantial departures from the minimum power condition. Luminous blazars have also typically very hard X-ray spectra, and those in turn seem to challenge hadronic scenarios for the high energy blazar emission. As shown in this paper, no such problems are faced by the models which involve Comptonization of radiation provided by a broad-line-region, or dusty molecular torus. The lack or weakness of bulk Compton and Klein-Nishina features indicated by the presently available data favors production of γ-rays via up-scattering of infrared photons from hot dust. This implies that the blazar emission zone is located at parsec-scale distances from the nucleus, and as such is possibly associated with the extended, quasi-stationary reconfinement shocks formed in relativistic outflows. This scenario predicts characteristic timescales for flux changes in luminous blazars to be days/weeks, consistent with the variability patterns observed in such systems at infrared, optical and γ-ray frequencies. We also propose that the parsec-scale blazar activity can be occasionally accompanied by dissipative events taking place at sub-parsec distances and powered by internal shocks and/or reconnection of magnetic fields. These could account for the multiwavelength intra-day flares occasionally observed in powerful blazars sources.

  16. CONSTRAINING EMISSION MODELS OF LUMINOUS BLAZAR SOURCES

    Many luminous blazars which are associated with quasar-type active galactic nuclei display broadband spectra characterized by a large luminosity ratio of their high-energy (γ-ray) and low-energy (synchrotron) spectral components. This large ratio, reaching values up to 100, challenges the standard synchrotron self-Compton models by means of substantial departures from the minimum power condition. Luminous blazars also typically have very hard X-ray spectra, and those in turn seem to challenge hadronic scenarios for the high-energy blazar emission. As shown in this paper, no such problems are faced by the models which involve Comptonization of radiation provided by a broad-line region, or dusty molecular torus. The lack or weakness of bulk-Compton and Klein-Nishina features indicated by the presently available data favors the production of γ-rays via upscattering of infrared photons from hot dust. This implies that the blazar emission zone is located at parsec-scale distances from the nucleus, and as such is possibly associated with the extended, quasi-stationary reconfinement shocks formed in relativistic outflows. This scenario predicts characteristic timescales for flux changes in luminous blazars to be days/weeks, consistent with the variability patterns observed in such systems at infrared, optical, and γ-ray frequencies. We also propose that the parsec-scale blazar activity can be occasionally accompanied by dissipative events taking place at sub-parsec distances and powered by internal shocks and/or reconnection of magnetic fields. These could account for the multiwavelength intraday flares occasionally observed in powerful blazar sources.

  17. Radiative Flow in a Luminous Disk

    Fukue, Jun

    2006-01-01

    Radiatively-driven flow in a luminous disk is examined in the subrelativistic regime of $(v/c)^1$, taking account of radiation transfer. The flow is assumed to be vertical, and the gravity and gas pressure are ignored. When internal heating is dropped, for a given optical depth and radiation pressure at the flow base (disk ``inside''), where the flow speed is zero, the flow is analytically solved under the appropriate boundary condition at the flow top (disk ``surface''), where the optical de...

  18. Luminous Efficient Compositions Based on Epoxy Resin

    R.S. Palaiah

    2006-07-01

    Full Text Available Magnesium/sodium nitrate illuminating compositions with epoxy resin - E 605 have beenstudied for luminosity and luminous efficiency by varying fuel oxidizer ratio and binder content.The compositions have been evaluated for impact and friction sensitivities, burn rate, thermalcharacteristics, and mechanical properties. Flame temperature and combustion products areevaluated theoretically by using REAL program. Experimental results show that, luminosity,burn rate, and calorimetric value are higher for polyester resin-based compositions. The highluminous efficiency composition is achieved with magnesium/sodium nitrate ratio of 70/30 with4 per cent epoxy resin.

  19. Distribution and Identification of Luminous Bacteria from the Sargasso Sea

    Orndorff, S. A.; Colwell, R R

    1980-01-01

    Vibrio fischeri and Lucibacterium harveyi constituted 75 of the 83 luminous bacteria isolated from Sargasso Sea surface waters. Photobacterium leiognathi and Photobacterium phosphoreum constituted the remainder of the isolates. Luminescent bacteria were recovered at concentrations of 1 to 63 cells per 100 ml from water samples collected at depths of 160 to 320 m. Two water samples collected at the thermocline yielded larger numbers of viable, aerobic heterotrophic and luminous bacteria. Lumin...

  20. Luminous Stars in Galaxies Beyond 3 Mpc

    Whitmore, B. C.; Wfc3 Science Oversight Committee

    2011-06-01

    I am mainly interested in the formation and destruction of young star clusters in nearby star forming galaxies such as the Antennae, M83, and M51. One of the first analysis steps is to throw out all those pesky stars that keep contaminating my young cluster samples. Recently, spurred on by our new Wide Field Camera 3 (WFC3) Early Release Science data of galaxies including M83, NGC 4214, M82, NGC 2841, and Cen A, we began taking a closer look at the stellar component. Questions we are addressing are: 1) what are the most luminous stars, 2) how can we use them to help study the destruction of star clusters and the population of the field, 3) what fraction of stars, at least the bright stars, are formed in the field, in associations, and in compact clusters. In this contribution we describe some of the beginning steps in this process. More specifically, we describe how we separate stars from clusters in our galaxies, and describe how candidate Luminous Blue Variables (LBVs) and "Single Star" HII (SSHII) regions have been identified.

  1. Luminous Stars in Galaxies Beyond 3 Mpc

    Whitmore, Bradley C

    2011-01-01

    I am mainly interested in the formation and destruction of young star clusters in nearby star forming galaxies such as the Antennae, M83, and M51. One of the first analysis steps is to throw out all those pesky stars that keep contaminating my young cluster samples. Recently, spurred on by our new WFC3 Early Release Science data of galaxies including M83, NGC 4214, M82, NGC 2841, and Cen A, we began taking a closer look at the stellar component. Questions we are addressing are: 1) what are the most luminous stars, 2) how can we use them to help study the destruction of star clusters and the population of the field, 3) what fraction of stars, at least the bright stars, are formed in the field, in associations, and in compact clusters. In this contribution we describe some of the beginning steps in this process. More specifically, we describe how we separate stars from clusters in our galaxies, and describe how candidate Luminous Blue Variables (LBVs) and "Single Star" HII (SSHII) regions have been identified.

  2. The Most Luminous Galaxies Discovered by WISE

    Tsai, Chao-Wei; Wu, Jingwen; Stern, Daniel; Assef, Roberto; Blain, Andrew; Bridge, Carrie; Benford, Dominic; Cutri, Roc; Griffith, Roger; Jarrett, Thomas; Lonsdale, Carol; Masci, Frank; Moustakas, Leonidas; Petty, Sara; Sayers, Jack; Stanford, S Adam; Wright, Edward; Yan, Lin; Leisawitz, David; Liu, Fengchuan; Mainzer, Amy; McLean, Ian; Padgett, Deborah; Skrutskie, Michael; Gelino, Christopher; Beichman, Charles; Juneau, Stéphanie

    2014-01-01

    We present 20 WISE-selected galaxies with bolometric luminosities L_bol > 10^14 L_sun, including five with infrared luminosities L_IR = L(rest 8-1000 micron) > 10^14 L_sun. These "extremely luminous infrared galaxies," or ELIRGs, were discovered using the "W1W2-dropout" selection criteria (Eisenhardt et al. 2012) which requires marginal or non-detections at 3.4 and 4.6 micron (W1 and W2, respectively) but strong detections at 12 and 22 micron in the WISE survey. Their spectral energy distributions are dominated by emission at rest-frame 4-10 micron, suggesting that hot dust with T_d ~ 450K is responsible for the high luminosities. These galaxies are likely powered by highly obscured AGNs, and there is no evidence suggesting these systems are beamed or lensed. We compare this WISE-selected sample with 116 optically selected quasars that reach the same L_bol level, corresponding to the most luminous unobscured quasars in the literature. We find that the rest-frame 5.8 and 7.8 micron luminosities of the WISE-sel...

  3. Luminance-model-based DCT quantization for color image compression

    Ahumada, Albert J., Jr.; Peterson, Heidi A.

    1992-01-01

    A model is developed to approximate visibility thresholds for discrete cosine transform (DCT) coefficient quantization error based on the peak-to-peak luminance of the error image. Experimentally measured visibility thresholds for R, G, and B DCT basis functions can be predicted by a simple luminance-based detection model. This model allows DCT coefficient quantization matrices to be designed for display conditions other than those of the experimental measurements: other display luminances, other veiling luminances, and other spatial frequencies (different pixel spacings, viewing distances, and aspect ratios).

  4. Measurements of Radium in Radium Luminizers

    A group of about 500 people, mostly women, who have worked in the radium luminizing industry over a period of about 50 yr have been measured to assess radium in the body. Measurements have been made of both the exhaled radon and that which is retained in the body. The exhaled radon has been determined on breath samples taken using specially designed breathing apparatus by means of which radon-free air can be inhaled from a cylinder and subsequently exhaled into a collecting bag. The amount of gamma-emitting radon decay products in the body was measured in a low background laboratory using a sodium iodide crystal scintillation counter. This equipment was calibrated by means of a standard radium source placed at several points in a water-filled plastic model of the human body on the assumption that any radium in the body is distributed uniformly throughout the skeleton. The error of measurement of the total radium content of the body was estimated to be about 0.005 μg Ra. Twenty people were found to have more than 0.1 μg Ra in their bodies, the largest measured amount being 0.6 μg. A further sixty people had amounts in excess of 0.05 μg but less than 0.1 μg. These results are correlated with the date of commencing luminizing and show that no person who commenced working after 1942 has an amount in excess of 0.05 μg in his body. This date can be related to the introduction by H. M. Government of a statutory order controlling the use of radium in the luminizing industry. The exhaled radon fraction has been correlated with the total radium content for about thirty people having amounts varying from 0.01 μg to 0.6 μg. Over this range the fraction of radon found in the breath was about two thirds. (author)

  5. A global mechanism creating low atmospheric luminous cold plasmas

    Gitle Hauge, Bjørn; Petter Strand, Erling

    2014-05-01

    Red, white/yellow and blue balls of light have been observed in the low atmosphere over the Hessdalen valley , Norway, standing still and moving horizontally with random speed. Characteristics of these transient luminous phenomena in Hessdalen, and data from America, suggest that the process which creates these low atmospheric plasmas is a global mechanism, not only localized to the remote and desolated Hessdalen valley in Norway (62Deg.N - 11Deg.E). Transient luminous phenomena's has been observed in the low atmosphere over the Hessdalen valley for over 200 years. The first written documentation goes back to 1811 when the priest Jakob Tode Krogh wrote about it in his diary. Since 1982, inhabitants, tourists, journalists and scientists have done recurrent observations. E.P.Strand conducted the first scientific campaign in 1984, documenting over 50 observations in one month. 15 years later, Norwegian and Italian scientists installed the first permanent automated research base here. In 2010 French researchers joined this collaboration and installed two additional research bases. This transient luminous phenomenon, TLP, has been detected simultaneously on optical and radar devices, but electromagnetic radiation from this phenomenon has until now eluded detection. Smirnov (1994) and Zou(1994) was among the first scientist who used plasma physics trying to explain this phenomenon. Work done by Pavia & Taft (2010 and 2012) suggests that the TLP in Hessdalen probably is dusty or cold plasma, arranged as a cluster of Coulomb crystals. Optical spectrum data obtained by Strand (1984), Teodorani (2004) and Hauge (2007) showing a continuous optical spectrum support this hypothesis. Pictures of spiraling light rays obtained by Strand in 1984, and Hauge in 2004 and 2010 suggests that this plasma is moving in a strong magnetic field, and might be created by it. Radar reflections from the TLP in Hessdalen obtained by Strand in 1984 and Montebugnoli and Monari in 2007 points

  6. What are the Luminous Compact Blue Galaxies?

    Pisano, D J; Guzmán, R; Gallego, J Perez; Castander, F J; Gruel, N

    2007-01-01

    Luminous Compact Blue Galaxies (LCBGs) are common at z~1, contributing significantly to the total star formation rate density. By z~0, they are a factor of ten rarer. While we know that LCBGs evolve rapidly, we do not know what drives their evolution nor into what types of galaxies they evolve. We present the results of a single-dish HI survey of local LCBGs undertaken to address these questions. Our results indicate that LCBGs have M(HI) and M(DYN) consistent with low-mass spirals, but typically exhaust their gas reservoirs in less than 2 Gyr. Overall, the properties of LCBGs are consistent with them evolving into high-mass dwarf elliptical or dwarf irregular galaxies or low-mass, late-type spiral galaxies.

  7. ISM Properties of Local Luminous Infrared Galaxies

    Diaz-Santos, Tanio; Armus, Lee; Stierwalt, Sabrina; Elbaz, David; Malhotra, Sangeeta

    2015-08-01

    Luminous and Ultra-luminous Infrared Galaxies ((U)LIRGs) represent the most important galaxy population at redshifts z > 1 as they account for more than 50% of all star formation produced in the Universe at those epochs; and encompass what it is called the main-sequence (MS) of star-forming galaxies. Investigating their local counterparts -low luminosity LIRGs- is therefore key to understand the physical properties and phases of their inter-stellar medium (ISM) - a task that is rather challenging in the distant Universe. On the other hand, high-z star-bursting (out of the MS) systems, although small in number, account for a modest yet still significant fraction of the total energy production. Here I present far-IR line emission observations ([CII]158μm, [OI]63μm, [OIII]88μm and [NII]122μm) obtained with Herschel for two large samples of nearby LIRGs: The Great Observatories All-sky LIRG Survey (GOALS), a sample of more than 240 relatively cold LIRGs, and a survey of 30 LIRGs selected to have very warm mid- to far-IR colors, suggestive of an ongoing intense nuclear starburst and/or an AGN. Using photo-dissociation region (PDR) models we derive the basic characteristics of the ISM (ionization intensity and density) for both samples and study differences among systems as a function of AGN activity, merger stage, dust temperature, and compactness of the starburst - parameters that are thought to control the life cycle of galaxies moving in and out of the MS, locally and at high-z.

  8. Luminous flux and colour maintenance investigation of integrated LED lamps

    Corell, Dennis Dan; Thorseth, Anders; Dam-Hansen, Carsten

    2014-01-01

    This article will present an investigation of the luminous flux and colour maintenance of white LED based retrofit lamps. The study includes 23 different types of integrated LED lamps, covering 18 directional and 5 non-directional. Luminous flux and colour data for operation up to 20000 h has been...

  9. Covariation of Color and Luminance Facilitate Object Individuation in Infancy

    Woods, Rebecca J.; Wilcox, Teresa

    2010-01-01

    The ability to individuate objects is one of our most fundamental cognitive capacities. Recent research has revealed that when objects vary in color or luminance alone, infants fail to individuate those objects until 11.5 months. However, color and luminance frequently covary in the natural environment, thus providing a more salient and reliable…

  10. Black Sun: Ocular Invisibility of Relativistic Luminous Astrophysical Bodies

    Lee, Jeffrey S

    2015-01-01

    The relativistic Doppler shifting of visible electromagnetic radiation to beyond the human ocular range reduces the incident radiance of the source. Consequently, luminous astrophysical bodies (LABs) can be rendered invisible with sufficient relativistic motion. This paper determines the proper distance as a function of relativistic velocity at which a luminous object attains ocular invisibility.

  11. (-)-Reboxetine inhibits muscle nicotinic acetylcholine receptors by interacting with luminal and non-luminal sites.

    Arias, Hugo R; Ortells, Marcelo O; Feuerbach, Dominik

    2013-11-01

    The interaction of (-)-reboxetine, a non-tricyclic norepinephrine selective reuptake inhibitor, with muscle-type nicotinic acetylcholine receptors (AChRs) in different conformational states was studied by functional and structural approaches. The results established that (-)-reboxetine: (a) inhibits (±)-epibatidine-induced Ca(2+) influx in human (h) muscle embryonic (hα1β1γδ) and adult (hα1β1εδ) AChRs in a non-competitive manner and with potencies IC50=3.86±0.49 and 1.92±0.48 μM, respectively, (b) binds to the [(3)H]TCP site with ~13-fold higher affinity when the Torpedo AChR is in the desensitized state compared to the resting state, (c) enhances [(3)H]cytisine binding to the resting but activatableTorpedo AChR but not to the desensitized AChR, suggesting desensitizing properties, (d) overlaps the PCP luminal site located between rings 6' and 13' in the Torpedo but not human muscle AChRs. In silico mutation results indicate that ring 9' is the minimum structural component for (-)-reboxetine binding, and (e) interacts to non-luminal sites located within the transmembrane segments from the Torpedo AChR γ subunit, and at the α1/ε transmembrane interface from the adult muscle AChR. In conclusion, (-)-reboxetine non-competitively inhibits muscle AChRs by binding to the TCP luminal site and by inducing receptor desensitization (maybe by interacting with non-luminal sites), a mechanism that is shared by tricyclic antidepressants. PMID:23917086

  12. Enhancement of Luminous Efficacy by Random Patterning of Phosphor Matrix

    Fellows, Natalie; Masul, Hisashi; Diana, Frederic; Denbaars, Steven P.; Nakamura, Shuji

    We have demonstrated the ability to increase the luminous flux and luminous efficacy of white light-emitting diodes (LEDs) by randomly patterning the surface of the yellow phosphor matrix. The phosphor was moved away from the LED die by placing it on top of a silicone optic and then roughening the surface of the phosphor/resin mixture. It was found that the roughening increases the luminous flux and efficacy by 10% over the smooth, non-patterned phosphor mixture. The roughened sample’s operating voltage, luminous flux, luminous efficacy, CCT, color coordinates, and CRI were 3.2 V, 7.4 lm, 115.6 lm/W, 4244 K, (0.388, 0.448), and 61 at 20 mA, CW, and room temperature operation. A brief presentation on phosphor scattering is introduced to help explain the effect of the roughening.

  13. Densities, cellulases, alginate and pectin lyases of luminous and other heterotrophic bacteria associated with marine algae

    Ramaiah, N.; Chandramohan, D.

    Epiphytic luminous and non-luminous bacteria were determined quantitatively for eight intertidal algal species from rocky beaches of Goa and Lakshadweep coral reef lagoon. Luminous bacteria were present on all eight algal species and contributed 2...

  14. Red Sirius

    A hypothesis is proposed explaining the assumption that Sirius changes its colour from red in the second century to pale blue in the tenth century A.D. The hypothesis is based on the possibility of transformation of a Sirius satellite (Sirius B) from a red giant in the past to a white dwarf in the present. Such a transformation would have been accompanied by an explosion of Sirius B, which is clearly visible from the Earth. The fact that the increase in Sirius brightness by 4-5 units is not reflected in historical chronicles is attributed to the degradation of sciences in Europe in 4-10 centuries

  15. Compact radio sources in luminous infrared galaxies

    Parra, Rodrigo

    2007-08-01

    Radio interferometry is an observational technique of high sensitivity and incomparably high spatial resolution. Moreover, because radio waves can freely propagate through interstellar dust and gas, it allows the study of regions of the universe completely obscured at other wavelengths. This thesis reports the observational and theoretical results of my research during the past four years which are mostly based on interferometric radio data. The COLA sample is an infrared selected sample of active star forming galaxies. We conducted 6 cm VLA and VLBI snapshot observations of the northern half of this sample. The radio emission seen at VLA scales is consistent with being powered by star formation activity because it follows the far infrared to radio correlation. We detect 22% of the sample sources in our VLBI snapshots. Based on luminosity arguments, we argue that these sub-parsec VLBI sources are powered by AGN activity. Furthermore, we find that VLBI detections are preferentially found in sources whose VLA scale structures have the highest peak brightnesses suggesting a strong correlation between compact starburst and AGN activity. This observational result is consistent with the theoretical picture of an Eddington-limited nuclear starburst acting as the last valve in the pipeline transporting the gas from kiloparsec scales onto the accretion disc of a buried AGN. Arp 220 is the archetypical ultra luminous infrared galaxy. For many years this source has been known to harbour a compact (~100 pc) cluster of unresolved 18 cm bright sources believed to be bright core collapse supernovae. Using multiwavelength VLBI observations, we obtained for the first time radio spectra for 18 of these sources. We find that over a half of them have spectra consistent with young supernovae. The rest can be better explained as older supernova remnants interacting with the high density starburst ISM. This finding allowed us to constrain the number of possible scenarios for the Arp 220

  16. Studies of luminous stars in nearby galaxies. I. Supergiants and O stars in the Milky Way

    In this paper the fundamental properties of the brightest known stars in our Galaxy are determined for future comparison with results for the most luminous stars in other galaxies. The H-R diagrams (M/sub v/ versus spectral type and M/sub bol/ versus log T/sub e/), the luminosities of the brightest stars, and the ratios of blue to red supergiants are all discussed, and a catalog of over 1000 supergiants and O stars in associations and clusters is included at the end of the paper.The ''theoretical'' H-R diagram (M/sub bol/ versus log T/sub e/) reveals a group of superluminous O stars with M/sub bol/ between -12 mag, a lack of evolved supergiants at these very high luminosities, and an apparent upper limit to the luminosities of the later-type supergiants (>B5) near M/sub bol/=-9.5 mag.The most luminous red supergiants have a maximum visual luminosity near M/sub v/approx. =-8 mag, supporting the suggestion by Sandage and Tammann that they are good distance indicators. Excluding the superluminous star Cyg OB 2 No. 12 (M/sub v/approx. =-9.9 mag), the brightest blue stars are found at M/sub v/approx. =-8.5 mag.The variation of the ratio of blue to red supergiants with luminosity is discussed. There is also evidence for a gradient in this ratio with distance from the galactic center, although the results are limited by the incompleteness of the data

  17. Ultra Luminous X-ray Sources

    Webb, N. A.; Godet, O.

    2015-12-01

    Ultra Luminous X-ray sources (ULXs) are X-ray bright objects that are not coincident with the central nucleus of the host galaxy and which have luminosities that exceed the Eddington limit for a stellar mass black hole, typically L > 3 × 10^{39} erg s^{-1} for a black hole of 20 M_⊙. The nature of these objects is still unclear. However, it is possible that these sources do not form a single class of objects. Many ULXs may house stellar mass black holes accreting at super-Eddington rates, even if the physical mechanism for such high accretion rates is still not understood. Some ULXs may contain intermediate mass black holes (˜1 × 10^{2} - ˜1 × 10^{5} M_⊙). These elusive black holes are thought to be the building blocks of the more massive supermassive black holes, observed at the centre of many galaxies. Other ULXs may not be accreting black holes at all. Recent evidence for the different types of ULXs is presented in this paper.

  18. Radiative Flow in a Luminous Disk

    Fukue, J

    2005-01-01

    Radiatively-driven flow in a luminous disk is examined in the subrelativistic regime of $(v/c)^1$, taking account of radiation transfer. The flow is assumed to be vertical, and the gravity and gas pressure are ignored. When internal heating is dropped, for a given optical depth and radiation pressure at the flow base (disk ``inside''), where the flow speed is zero, the flow is analytically solved under the appropriate boundary condition at the flow top (disk ``surface''), where the optical depth is zero. The loaded mass and terminal speed of the flow are both determined by the initial conditions; the mass-loss rate increases as the initial radiation pressure increases, while the flow terminal speed increases as the initial radiation pressure and the loaded mass decrease. In particular, when heating is ignored, the radiative flux $F$ is constant, and the radiation pressure $P_0$ at the flow base with optical depth $\\tau_0$ is bound in the range of $2/3 < cP_0/F < 2/3 + \\tau_0$. In this case, in the limit...

  19. Galaxy Clustering Around Nearby Luminous Quasars

    Fisher, Karl B.; Bahcall, John N.; Kirhakos, Sofia; Schneider, Donald P.

    1996-01-01

    We examine the clustering of galaxies around a sample of 20 luminous low redshift (z approx. less than 0.30) quasars observed with the Wide Field Camera-2 on the Hubble Space Telescope (HST). The HST resolution makes possible galaxy identification brighter than V = 24.5 and as close as 1 min or 2 min to the quasar. We find a significant enhancement of galaxies within a projected separation of approx. less than 100 1/h kpc of the quasars. If we model the QSO/galaxy correlation function as a power law with a slope given by the galaxy/galaxy correlation function, we find that the ratio of the QSO/galaxy to galaxy/galaxy correlation functions is 3.8 +/- 0.8. The galaxy counts within r less than 15 1/h kpc of the quasars are too high for the density profile to have an appreciable core radius (approx. greater than 100 1/h kpc). Our results reinforce the idea that low redshift quasars are located preferentially in groups of 10-20 galaxies rather than in rich clusters. We see no significant difference in the clustering amplitudes derived from radio-loud and radio-quiet subsamples.

  20. Super-luminous supernovae from PESSTO

    Nicholl, M; Jerkstrand, A; Inserra, C; Chen, T -W; Kotak, R; Valenti, S; Howell, D A; McCrum, M; Margheim, S; Rest, A; Benetti, S; Fraser, M; Gal-Yam, A; Smith, K W; Sullivan, M; Young, D R; Baltay, C; Hadjiyska, E; McKinnon, R; Rabinowitz, D; Walker, E S; Feindt, U; Nugent, P; Lawrence, A; Mead, A; Anderson, J P; Sollerman, J; Taddia, F; Leloudas, G; Mattila, S; Elias-Rosa, N

    2014-01-01

    We present optical spectra and light curves for three hydrogen-poor super-luminous supernovae followed by the Public ESO Spectroscopic Survey of Transient Objects (PESSTO). Time series spectroscopy from a few days after maximum light to 100 days later shows them to be fairly typical of this class, with spectra dominated by Ca II, Mg II, Fe II and Si II, which evolve slowly over most of the post-peak photospheric phase. We determine bolometric light curves and apply simple fitting tools, based on the diffusion of energy input by magnetar spin-down, \\Ni decay, and collision of the ejecta with an opaque circumstellar shell. We investigate how the heterogeneous light curves of our sample (combined with others from the literature) can help to constrain the possible mechanisms behind these events. We have followed these events to beyond 100-200 days after peak, to disentangle host galaxy light from fading supernova flux and to differentiate between the models, which predict diverse behaviour at this phase. Models p...

  1. Star Formation in Two Luminous Spiral Galaxies

    Hunter, Deidre A; Rubin, Vera C; Ashburn, Allison; Wright, Teresa; Jozsa, Gyula I G; Struve, Christian

    2013-01-01

    We have examined star formation in two very luminous (M_V=-22 to -23) Sc-type spiral galaxies, NGC 801 and UGC 2885, using ultra-deep Halpha images. We combine these with UBV and 2MASS JHK images and HI maps to explore the star formation characteristics of disk galaxies at high luminosity. Halpha traces star formation in these galaxies to 4-6 disk scale lengths, but the lack of detection of Halpha further out is likely due to loss of Lyman continuum photons. Considering gravitational instabilities alone, we find that the gas and stars in the outer regions are marginally stable in an average sense, but considering dissipative gas and radial and azimuthal forcing, the outer regions are marginally unstable to form spiral arms. Star formation is taking place in spiral arms, which are regions of locally higher gas densities. Furthermore, we have traced smooth exponential stellar disks over 3-orders of magnitude and 4-6 disk scale lengths, in spite of a highly variable gravitational instability parameter. Thus, gra...

  2. Warm Molecular Gas in Luminous Infrared Galaxies

    Lu, N; Xu, C K; Gao, Y; Armus, L; Mazzarella, J M; Isaak, K G; Petric, A O; Charmandaris, V; Diaz-Santos, T; Evans, A S; Howell, J; Appleton, P; Inami, H; Iwasawa, K; Leech, J; Lord, S; Sanders, D B; Schulz, B; Surace, J; van der Werf, P P

    2014-01-01

    We present our initial results on the CO rotational spectral line energy distribution (SLED) of the $J$ to $J$$-$1 transitions from $J=4$ up to $13$ from Herschel SPIRE spectroscopic observations of 65 luminous infrared galaxies (LIRGs) in the Great Observatories All-Sky LIRG Survey (GOALS). The observed SLEDs change on average from one peaking at $J \\le 4$ to a broad distribution peaking around $J \\sim\\,$6$-$7 as the IRAS 60-to-100 um color, $C(60/100)$, increases. However, the ratios of a CO line luminosity to the total infrared luminosity, $L_{\\rm IR}$, show the smallest variation for $J$ around 6 or 7. This suggests that, for most LIRGs, ongoing star formation (SF) is also responsible for a warm gas component that emits CO lines primarily in the mid-$J$ regime ($5 \\lesssim J \\lesssim 10$). As a result, the logarithmic ratios of the CO line luminosity summed over CO (5$-$4), (6$-$5), (7$-$6), (8$-$7) and (10$-$9) transitions to $L_{\\rm IR}$, $\\log R_{\\rm midCO}$, remain largely independent of $C(60/100)$, ...

  3. Morphological Classification of Local Luminous Infrared Galaxies

    Psychogyios, A; Santos, T Diaz-; Armus, L; Haan, S; Howell, J; Floc'h, E Le; Petty, S M; Evans, A S

    2016-01-01

    We present an analysis of the morphological classification of 89 luminous infrared galaxies (LIRGs) from the Great Observatories All-sky LIRG Survey (GOALS) sample using non-parametric coefficients and compare their morphology as a function of wavelength. We rely on images obtained in the optical (B- and I-band) as well as in the infrared (H-band and 5.8$\\mu$m). Our classification is based on the calculation of $Gini$ and the second order of light ($M_{20}$) non-parametric coefficients which we explore as a function of stellar mass ($M_\\star$), infrared luminosity ($L_{IR}$) and star formation rate (SFR). We investigate the relation between $M_{20}$, the specific SFR (sSFR) and the dust temperature ($T_{dust}$) in our galaxy sample. We find that $M_{20}$ is a better morphological tracer than $Gini$, as it allows to distinguish systems formed by double systems from isolated and post-merger LIRGs. The multi-wavelength analysis allows us to identify a region in the $Gini$-$M_{20}$ parameter space where ongoing m...

  4. Synthesis of ordered mesoporous γ-Al2O3:Eu3+ with high luminous performance and thermal stability

    YU Caixia; YANG Qu; SHA Lei; LIU Yingliang

    2011-01-01

    An efficient and convenient one-step process was developed for synthesizing nev effective red luminous materials through ordered mesoporous γ-alumina assembling with Eu3+.Employing P123 as a structure-directing agent and hydrochloric acid,citric acid as pH adjustor,ordered mesoporous γ-alumina was fabricated by simple sol-gel method.The pore structure was characterized by X-ray diffraction (XRD),N2 adsorption-desorption isotherms and transmission electron microscopy (TEM).The as-synthesized γ-aluminas had narrow pore-size distribution (5-7 nm),large surface area (246 m2/g) and high thermal stability (750-1000 ℃).The luminous property of materials was characterized by Photoluminescence (PL) spectra.The γ-Al2O3;Eu3+ materials had efficient luminescence,and the emission strength was related to the content of Eu3+.

  5. Luminance uniformity compensation for OLED panels based on FPGA

    OU Peng; YANG Gang; JIANG Quan; YU Jun-sheng; WU Qi-peng; SHANG Fu-hai; YIN Wei; WANG Jun; ZHONG Jian; LUO Kai-jun

    2009-01-01

    en in program. The irradiance brightness is controlled by changing its irradiance time, and finally, luminance compensation of the panel is realized. The simulation result indicates that the design ismasonable

  6. Ecology and biology of luminous bacteria in the Arabian Sea

    Ramaiah, N.; Chandramohan, D.

    the water column with temperatures lower than 25 degrees C. Bacterial luminescence in all the seawater samples was very low indicating energy conservation mechanism in free living luminous procaryotes. In contrast, a 10000 fold higher bacterial luminescence...

  7. ASASSN-15lh: The Most Luminous Supernova Ever Discovered

    Dong, Subo; Prieto, J L; Jha, S W; Stanek, K Z; Holoien, T W -S; Kochanek, C S; Thompson, T A; Morrell, N; Thompson, I B; Basu, U; Beacom, J F; Bersier, D; Brimacombe, J; Brown, J S; Chen, Ping; Conseil, E; Danilet, A B; Falco, E; Grupe, D; Kiyota, S; Masi, G; Nicholls, B; Olivares, F; Pignata, G; Pojmanski, G; Simonian, G V; Szczygiel, D M; Wozniak, P R

    2015-01-01

    We report the discovery and early evolution of ASASSN-15lh, the most luminous supernova ever found. At redshift z=0.2326, ASASSN-15lh reached an absolute magnitude of M_{u,AB} ~ -23.5 and bolometric luminosity L_bol ~ 2.2x10^45 ergs/s, which is >~ 2 times more luminous than any previously known supernova. Its spectra match the hydrogen-poor sub-class of super-luminous supernovae (SLSNe-I), whose energy sources and progenitors are poorly understood. In contrast to known SLSNe-I, most of which reside in star-forming, dwarf galaxies, its host appears to be a luminous galaxy (M_V ~ -22; M_K ~ -25.1) with little star formation. In the two months since its first detection, ASASSN-15lh has radiated ~7.5x10^51 ergs, challenging the popular magnetar model for the engine of SLSNe-I.

  8. Luminal breast cancer metastasis is dependent on estrogen signaling

    Ganapathy, Vidya; Banach-Petrosky, Whitney; Xie, Wen; Kareddula, Aparna; Nienhuis, Hilde; Miles, Gregory; Reiss, Michael

    2012-01-01

    Luminal breast cancer is the most frequently encountered type of human breast cancer and accounts for half of all breast cancer deaths due to metastatic disease. We have developed new in vivo models of disseminated human luminal breast cancer that closely mimic the human disease. From initial lesions in the tibia, locoregional metastases develop predictably along the iliac and retroperitoneal lymph node chains. Tumors cells retain their epithelioid phenotype throughout the process of dissemin...

  9. The Three-Dimensional Spectrum Analysis of HDTV Luminance Signal

    2000-01-01

    The international standard for High Definition Television (HDTV) in MPEG- 2 has been established for a few years. Some industrialized modern countries are positively developing HDTV products. However, there are few profound analyses of the HDTV luminance signal' s three-dimensional (3- D) spectrum. The authors make a detailed study of them and sum up the features of the (3-D) HDTV luminance signal' s spectrums and their mathe matical expressions. Based on them, the authors draw their spectral figures.

  10. The dependence of luminous efficiency on chromatic adaptation

    Stockman, A.; Jaegle, H.; Pirzer, M.; Sharpe, L. T.

    2008-01-01

    We investigated the dependence of luminous efficiency on background chromaticity by measuring 25-Hz heterochromatic flicker photometry (HFP) matches in six genotyped male observers on 21 different 1000-photopic-troland adapting fields: 14 spectral ones ranging from 430 to 670 nm and 7 bichromatic mixtures of 478 and 577 nm that varied in luminance ratio. Each function was analyzed in terms of the best-fitting linear combination of the long- (L) and middle- (M) wavelength sensitive cone fundam...

  11. Luminance controlled pupil size affects Landolt C task performance

    Berman, S.M. (Lawrence Berkeley Lab., CA (United States)); Fein, G. (Neurobehavioral Lab. Software, San Rafael, CA (United States)); Jewett, D.L.; Ashford, F. (ABRATech Corp., Mill Valley, CA (United States))

    1993-02-01

    Subjects judged the orientation of a 2 min. gap Landolt C located at a distance of 2.4 m. The stimuli were presented in central vision on a CRT, at low to medium contrast. The effects of varying the spectrum and luminance of surround lighting were assessed on both pupil size (measured using infrared pupillometry during task performance) and task accuracy. The task display was protected from the surround lighting, so that its luminance and contrast could be varied independently of the changes in the surround lighting. Indirect surround illumination was provided by either two illuminants of very different scotopic spectral content but with the same photopic luminance (Experiments 1 and 3), or by using the same illuminant at two different luminance levels (Experiment 2). In Experiment 3, the effect of changing surround spectrum was compared to the effect of varying task background luminance between 12 cd/m[sup 2] and 73 cd/m[sup 2]. In all experiments, scotopically enhanced surround lighting produced pupil areas which were reduced by almost 50% in comparison with surround lighting with relatively less scotopic luminance. Concomitantly there was improvement in Landolt C task performance with the scotopically enhanced surround lighting at all contrast and luminance levels. In these experiments, smaller pupil sizes were associated with significantly better visual-task performance in spite of lower task retinal illuminance when compared to the condition with larger pupils. These results suggest that changes in surround spectrum can compensate for the effect on task performance of a reduction in task luminance and supports the hypothesis that lighting energy savings could accrue in the workplace by shifting lamp spectra to obtain greater scotopic efficacy.

  12. Luminance controlled pupil size affects Landolt C task performance. Revision

    Berman, S.M. [Lawrence Berkeley Lab., CA (United States); Fein, G. [Neurobehavioral Lab. Software, San Rafael, CA (United States); Jewett, D.L.; Ashford, F. [ABRATech Corp., Mill Valley, CA (United States)

    1993-02-01

    Subjects judged the orientation of a 2 min. gap Landolt C located at a distance of 2.4 m. The stimuli were presented in central vision on a CRT, at low to medium contrast. The effects of varying the spectrum and luminance of surround lighting were assessed on both pupil size (measured using infrared pupillometry during task performance) and task accuracy. The task display was protected from the surround lighting, so that its luminance and contrast could be varied independently of the changes in the surround lighting. Indirect surround illumination was provided by either two illuminants of very different scotopic spectral content but with the same photopic luminance (Experiments 1 and 3), or by using the same illuminant at two different luminance levels (Experiment 2). In Experiment 3, the effect of changing surround spectrum was compared to the effect of varying task background luminance between 12 cd/m{sup 2} and 73 cd/m{sup 2}. In all experiments, scotopically enhanced surround lighting produced pupil areas which were reduced by almost 50% in comparison with surround lighting with relatively less scotopic luminance. Concomitantly there was improvement in Landolt C task performance with the scotopically enhanced surround lighting at all contrast and luminance levels. In these experiments, smaller pupil sizes were associated with significantly better visual-task performance in spite of lower task retinal illuminance when compared to the condition with larger pupils. These results suggest that changes in surround spectrum can compensate for the effect on task performance of a reduction in task luminance and supports the hypothesis that lighting energy savings could accrue in the workplace by shifting lamp spectra to obtain greater scotopic efficacy.

  13. STAR FORMATION IN TWO LUMINOUS SPIRAL GALAXIES

    Hunter, Deidre A.; Ashburn, Allison; Wright, Teresa [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Elmegreen, Bruce G. [IBM T. J. Watson Research Center, P.O. Box 218, Yorktown Heights, NY 10598 (United States); Rubin, Vera C. [Carnegie Institution of Washington, 5241 Broad Branch Road NW, Washington, DC 20015 (United States); Józsa, Gyula I. G.; Struve, Christian [ASTRON (Netherlands Organisation for Scientific Research NWO), Oude Hoogeveensedijk 4, 7991-PD Dwingeloo (Netherlands)

    2013-10-01

    We examined star formation in two very luminous (M{sub V} = –22 to –23) Sc-type spiral galaxies, NGC 801 and UGC 2885, using ultra-deep Hα images. We combine these Hα images with UBV and Two-Micron All-Sky Survey JHK images and H I maps to explore the star formation characteristics of disk galaxies at high luminosity. Hα traces star formation in these galaxies to 4-6 disk scale lengths, but the lack of detection of Hα further out is likely due to the loss of Lyman continuum photons. Considering gravitational instabilities alone, we find that the gas and stars in the outer regions are marginally stable in an average sense, but considering dissipative gas and radial and azimuthal forcing, the outer regions are marginally unstable to forming spiral arms. Star formation is taking place in spiral arms, which are regions of locally higher gas densities. Furthermore, we have traced smooth exponential stellar disks over four magnitudes in V-band surface brightness and 4-6 disk scale lengths, in spite of a highly variable gravitational instability parameter. Thus, gravitational instability thresholds do not seem relevant to the stellar disk. One possibility for creating an exponential disk is that the molecular cloud densities and star formation rates have exponential profiles and this fact forces the stellar disk to build up such a profile. Another possibility is that the stellar disk is continuously adjusted to an exponential shape regardless of the star formation profile, for example, through global dynamical processes that scatter stars. However, such scattering processes are only known to operate in spiral systems, in which case they cannot explain the same dilemma of smooth exponential disks observed in dwarf irregular galaxies.

  14. WARM MOLECULAR GAS IN LUMINOUS INFRARED GALAXIES

    We present our initial results on the CO rotational spectral line energy distribution (SLED) of the J to J–1 transitions from J = 4 up to 13 from Herschel SPIRE spectroscopic observations of 65 luminous infrared galaxies (LIRGs) in the Great Observatories All-Sky LIRG Survey. The observed SLEDs change on average from one peaking at J ≤ 4 to a broad distribution peaking around J ∼ 6 to 7 as the IRAS 60-to-100 μm color, C(60/100), increases. However, the ratios of a CO line luminosity to the total infrared luminosity, L IR, show the smallest variation for J around 6 or 7. This suggests that, for most LIRGs, ongoing star formation (SF) is also responsible for a warm gas component that emits CO lines primarily in the mid-J regime (5 ≲ J ≲ 10). As a result, the logarithmic ratios of the CO line luminosity summed over CO (5–4), (6–5), (7–6), (8–7) and (10–9) transitions to L IR, log R midCO, remain largely independent of C(60/100), and show a mean value of –4.13 (≡log RmidCOSF) and a sample standard deviation of only 0.10 for the SF-dominated galaxies. Including additional galaxies from the literature, we show, albeit with a small number of cases, the possibility that galaxies, which bear powerful interstellar shocks unrelated to the current SF, and galaxies, in which an energetic active galactic nucleus contributes significantly to the bolometric luminosity, have their R midCO higher and lower than RmidCOSF, respectively

  15. STAR FORMATION IN TWO LUMINOUS SPIRAL GALAXIES

    We examined star formation in two very luminous (MV = –22 to –23) Sc-type spiral galaxies, NGC 801 and UGC 2885, using ultra-deep Hα images. We combine these Hα images with UBV and Two-Micron All-Sky Survey JHK images and H I maps to explore the star formation characteristics of disk galaxies at high luminosity. Hα traces star formation in these galaxies to 4-6 disk scale lengths, but the lack of detection of Hα further out is likely due to the loss of Lyman continuum photons. Considering gravitational instabilities alone, we find that the gas and stars in the outer regions are marginally stable in an average sense, but considering dissipative gas and radial and azimuthal forcing, the outer regions are marginally unstable to forming spiral arms. Star formation is taking place in spiral arms, which are regions of locally higher gas densities. Furthermore, we have traced smooth exponential stellar disks over four magnitudes in V-band surface brightness and 4-6 disk scale lengths, in spite of a highly variable gravitational instability parameter. Thus, gravitational instability thresholds do not seem relevant to the stellar disk. One possibility for creating an exponential disk is that the molecular cloud densities and star formation rates have exponential profiles and this fact forces the stellar disk to build up such a profile. Another possibility is that the stellar disk is continuously adjusted to an exponential shape regardless of the star formation profile, for example, through global dynamical processes that scatter stars. However, such scattering processes are only known to operate in spiral systems, in which case they cannot explain the same dilemma of smooth exponential disks observed in dwarf irregular galaxies

  16. WARM MOLECULAR GAS IN LUMINOUS INFRARED GALAXIES

    Lu, N.; Zhao, Y.; Xu, C. K.; Mazzarella, J. M.; Howell, J.; Appleton, P.; Lord, S.; Schulz, B. [Infrared Processing and Analysis Center, California Institute of Technology, MS 100-22, Pasadena, CA 91125 (United States); Gao, Y. [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China); Armus, L.; Díaz-Santos, T.; Surace, J. [Spitzer Science Center, California Institute of Technology, MS 220-6, Pasadena, CA 91125 (United States); Isaak, K. G. [ESA Astrophysics Missions Division, ESTEC, P.O. Box 299, 2200-AG Noordwijk (Netherlands); Petric, A. O. [Gemini Observatory, 670 N. A' ohoku Place, Hilo, HI 96720 (United States); Charmandaris, V. [Department of Physics, University of Crete, GR-71003 Heraklion (Greece); Evans, A. S. [Department of Astronomy, University of Virginia, 530 McCormick Road, Charlottesville, VA 22904 (United States); Inami, H. [National Optical Astronomy Observatory, Tucson, AZ 85719 (United States); Iwasawa, K. [ICREA and Institut de Ciències del Cosmos (ICC), Universitat de Barcelona (IEEC-UB), Martí i Franquès 1, E-08028 Barcelona (Spain); Leech, J. [Department of Physics, University of Oxford, Denys Wilkinson Building, Keble Road, Oxford OX1 3RH (United Kingdom); Sanders, D. B., E-mail: lu@ipac.caltech.edu [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); and others

    2014-06-01

    We present our initial results on the CO rotational spectral line energy distribution (SLED) of the J to J–1 transitions from J = 4 up to 13 from Herschel SPIRE spectroscopic observations of 65 luminous infrared galaxies (LIRGs) in the Great Observatories All-Sky LIRG Survey. The observed SLEDs change on average from one peaking at J ≤ 4 to a broad distribution peaking around J ∼ 6 to 7 as the IRAS 60-to-100 μm color, C(60/100), increases. However, the ratios of a CO line luminosity to the total infrared luminosity, L {sub IR}, show the smallest variation for J around 6 or 7. This suggests that, for most LIRGs, ongoing star formation (SF) is also responsible for a warm gas component that emits CO lines primarily in the mid-J regime (5 ≲ J ≲ 10). As a result, the logarithmic ratios of the CO line luminosity summed over CO (5–4), (6–5), (7–6), (8–7) and (10–9) transitions to L {sub IR}, log R {sub midCO}, remain largely independent of C(60/100), and show a mean value of –4.13 (≡log R{sub midCO}{sup SF}) and a sample standard deviation of only 0.10 for the SF-dominated galaxies. Including additional galaxies from the literature, we show, albeit with a small number of cases, the possibility that galaxies, which bear powerful interstellar shocks unrelated to the current SF, and galaxies, in which an energetic active galactic nucleus contributes significantly to the bolometric luminosity, have their R {sub midCO} higher and lower than R{sub midCO}{sup SF}, respectively.

  17. Carotid stenosis degree in CT angiography: assessment based on luminal area versus luminal diameter measurements

    The aim of this study was to investigate CT angiography (CTA) luminal area measurements in the assessment of carotid artery stenosis compared with the current clinically used criteria based on lumen diameter measurements. Seventy-two vessels in 36 patients were evaluated by CTA and digital subtraction angiography (DSA). Two observers measured area and diameter stenosis degrees using automated 3D CTA analysis software. The ratio of the largest/smallest luminal diameter at the level of maximal stenosis (L/S ratio) was used to describe lumen morphology. Diagnostic agreement between CTA and DSA was calculated. For the assessment of area stenosis, interobserver and intraobserver correlation coefficients were 0.898 and 0.906 (p<0.001). The correlation coefficient between the diameter stenosis and area stenosis was lower in stenoses with extremely noncircular lumen (L/S ratio ≥1.5) (r=0.797, p<0.001) compared with stenoses with circular lumen (LS ratio <1.2) (r=0.978, p<0.001). Only satisfactory agreement (κ 0.54-0.77, p<0.001) was obtained between area stenosis on CTA and diameter stenosis on DSA. Assessment of stenosis degree with area measurements on 3D CTA proved to be reproducible. Area stenosis provides a less-severe estimate of the degree of carotid stenosis but might theoretically express the real hemodynamic significance of the lesion better than diameter stenosis, especially in stenoses with noncircular lumen. (orig.)

  18. A COMPARATIVE STUDY OF TRACHEOBRONCHIAL PATTERN USING LUMINAL PLASTINATION

    Venketesh G Kamath

    2013-12-01

    Full Text Available Background: The tracheobronchial pattern of human lungs is well known. An attempt was made to compare the pattern with that of sheep lung using luminal plastination of sheep lung. Several similarities were observed between the two patterns, due to which, the sheep lung serves as an ideal experimental model to study the effect of treatment in several human airway diseases. Objective: The first objective was to compare the two tracheobronchial patterns. Moreover the study also provided an opportunity to the authors to attempt a luminal plastination. The final objective is to highlight the various advantages of advances in luminal plastination in current medical education and research. Materials and methods: Silicon sealant was injected into the tracheobroncheal tree of sheep after thoroughly cleaning the lungs with saline. After the sealant solidified the surrounding lung tissue was destroyed by boiling. Thus a luminal cast was prepared. Result: The result was a splendid luminal cast of the sheep lung showing its tracheobronchial pattern. Conclusion: It was observed that the tracheobronchial division pattern showed significant similarities and a single variation. Therefore the sheep lung is an ideal experimental model and luminal plastination can be applied to comparative anatomical study to identify more such models.

  19. IDENTIFYING LUMINOUS ACTIVE GALACTIC NUCLEI IN DEEP SURVEYS: REVISED IRAC SELECTION CRITERIA

    Spitzer/IRAC selection is a powerful tool for identifying luminous active galactic nuclei (AGNs). For deep IRAC data, however, the AGN selection wedges currently in use are heavily contaminated by star-forming galaxies, especially at high redshift. Using the large samples of luminous AGNs and high-redshift star-forming galaxies in COSMOS, we redefine the AGN selection criteria for use in deep IRAC surveys. The new IRAC criteria are designed to be both highly complete and reliable, and incorporate the best aspects of the current AGN selection wedges and of infrared power-law selection while excluding high-redshift star-forming galaxies selected via the BzK, distant red galaxy, Lyman-break galaxy, and submillimeter galaxy criteria. At QSO luminosities of log L2-10keV(erg s–1) ≥44, the new IRAC criteria recover 75% of the hard X-ray and IRAC-detected XMM-COSMOS sample, yet only 38% of the IRAC AGN candidates have X-ray counterparts, a fraction that rises to 52% in regions with Chandra exposures of 50-160 ks. X-ray stacking of the individually X-ray non-detected AGN candidates leads to a hard X-ray signal indicative of heavily obscured to mildly Compton-thick obscuration (log NH (cm–2) = 23.5 ± 0.4). While IRAC selection recovers a substantial fraction of luminous unobscured and obscured AGNs, it is incomplete to low-luminosity and host-dominated AGNs.

  20. Red maca (Lepidium meyenii reduced prostate size in rats

    Rubio Julio

    2005-01-01

    Full Text Available Abstract Background Epidemiological studies have found that consumption of cruciferous vegetables is associated with a reduced risk of prostate cancer. This effect seems to be due to aromatic glucosinolate content. Glucosinolates are known for have both antiproliferative and proapoptotic actions. Maca is a cruciferous cultivated in the highlands of Peru. The absolute content of glucosinolates in Maca hypocotyls is relatively higher than that reported in other cruciferous crops. Therefore, Maca may have proapoptotic and anti-proliferative effects in the prostate. Methods Male rats treated with or without aqueous extracts of three ecotypes of Maca (Yellow, Black and Red were analyzed to determine the effect on ventral prostate weight, epithelial height and duct luminal area. Effects on serum testosterone (T and estradiol (E2 levels were also assessed. Besides, the effect of Red Maca on prostate was analyzed in rats treated with testosterone enanthate (TE. Results Red Maca but neither Yellow nor Black Maca reduced significantly ventral prostate size in rats. Serum T or E2 levels were not affected by any of the ecotypes of Maca assessed. Red Maca also prevented the prostate weight increase induced by TE treatment. Red Maca administered for 42 days reduced ventral prostatic epithelial height. TE increased ventral prostatic epithelial height and duct luminal area. These increases by TE were reduced after treatment with Red Maca for 42 days. Histology pictures in rats treated with Red Maca plus TE were similar to controls. Phytochemical screening showed that aqueous extract of Red Maca has alkaloids, steroids, tannins, saponins, and cardiotonic glycosides. The IR spectra of the three ecotypes of Maca in 3800-650 cm (-1 region had 7 peaks representing 7 functional chemical groups. Highest peak values were observed for Red Maca, intermediate values for Yellow Maca and low values for Black Maca. These functional groups correspond among others to benzyl

  1. A Spitzer IRS Spectral Atlas of Luminous 8 micron Sources in the Large Magellanic Cloud

    Buchanan, C L; Forrest, W J; Hrivnak, B J; Sahai, R; Egan, M; Frank, A; Barnbaum, C; Buchanan, Catherine L.; Kastner, Joel H.; Forrest, William J.; Hrivnak, Bruce J.; Sahai, Raghvendra; Egan, Michael; Frank, Adam

    2006-01-01

    We present an atlas of Spitzer Space Telescope Infrared Spectrograph (IRS) spectra of highly luminous, compact mid-infrared sources in the Large Magellanic Cloud. Sources were selected on the basis of infrared colors and 8 micron (MSX) fluxes indicative of highly evolved, intermediate- to high-mass stars with current or recent mass loss at large rates. We determine the chemistry of the circumstellar envelope from the mid-IR continuum and spectral features and classify the spectral types of the stars. In the sample of 60 sources, we find 21 Red Supergiants (RSGs), 16 C-rich Asymptotic Giant Branch (AGB) stars, 11 HII regions, 4 likely O-rich AGB stars, 4 Galactic O-rich AGB stars, 2 OH/IR stars, and 2 B[e] supergiants with peculiar IR spectra. We find that the overwhelming majority of the sample AGB stars (with typical IR luminosities ~1.0E4 L_sun) have C-rich envelopes, while the O-rich objects are predominantly luminous RSGs with L_IR ~ 1.0E5 L_sun. We determine mean bolometric corrections to the stellar K-b...

  2. The Nebula around the Luminous Blue Variable WRAY 15-751 as seen by Herschel

    Vamvatira-Nakou, C.; Hutsemekers, D.; Royer, P.; Naze, Y.; Magain, P.; Exter, K.; Waelkens, C.; Groenewegen, M.

    2013-06-01

    To understand the evolution of massive stars it is crucial to study the nebulae associated to Luminous Blue Variables which can reveal the star mass-loss history. We obtained far-infrared Herschel PACS imaging and spectroscopic observations of the nebula associated with the Luminous Blue Variable star WRAY 15-751. These images revealed a second nebula, bigger and cooler, lying in an empty cavity that probably delineates the remnant of the O-star bubble formed when the star was on the Main Sequence. The dust mass and temperature were derived from the modeling of the far-infrared SED. The analysis of the emission line spectrum revealed that the main nebula consists of a region of photoionised gas surrounded by a thin photodissociation region. Both regions are mixed with dust. The calculated C, N, O abundances, together with the estimated mass-loss rate, show that the nebula was ejected from the star during a Red Supergiant phase. This is compatible with the latest evolutionary tracks for a ~40 Mo star with little rotation.

  3. Color matrix display simulation based upon luminance and chromatic contrast sensitivity of early vision

    Martin, Russel A.; Ahumada, Albert J., Jr.; Larimer, James O.

    1992-01-01

    This paper describes the design and operation of a new simulation model for color matrix display development. It models the physical structure, the signal processing, and the visual perception of static displays, to allow optimization of display design parameters through image quality measures. The model is simple, implemented in the Mathematica computer language, and highly modular. Signal processing modules operate on the original image. The hardware modules describe backlights and filters, the pixel shape, and the tiling of the pixels over the display. Small regions of the displayed image can be visualized on a CRT. Visual perception modules assume static foveal images. The image is converted into cone catches and then into luminance, red-green, and blue-yellow images. A Haar transform pyramid separates the three images into spatial frequency and direction-specific channels. The channels are scaled by weights taken from human contrast sensitivity measurements of chromatic and luminance mechanisms at similar frequencies and orientations. Each channel provides a detectability measure. These measures allow the comparison of images displayed on prospective devices and, by that, the optimization of display designs.

  4. Red Alive

    Reynaldo Thompson Lopez

    2010-01-01

    Full Text Available Red Alive is an installation consisting of video, sound and an aquarium containing a beta fish in it. The idea came out by observing the peculiar behavior of the small creature that fights to death with other fishes of his kind that are in his proximity. Its character and physical appearance are good reasons to capture it in a video recording since its color and sensual movements contrast with its aggressive instinct. The conduct of such fish is similar in many aspects to those of humans.

  5. Red Alive

    Reynaldo Thompson Lopez

    2010-01-01

    Red Alive is an installation consisting of video, sound and an aquarium containing a beta fish in it. The idea came out by observing the peculiar behavior of the small creature that fights to death with other fishes of his kind that are in his proximity. Its character and physical appearance are good reasons to capture it in a video recording since its color and sensual movements contrast with its aggressive instinct. The conduct of such fish is similar in many aspects to those of humans.

  6. Red-Enhanced White-Light-Emitting Diode Using a New Red Phosphor

    Yamada, Motokazu; Naitou, Takahiro; Izuno, Kunihiro; Tamaki, Hiroto; Murazaki, Yoshinori; Kameshima, Masatoshi; Mukai, Takashi

    2003-01-01

    We fabricated a high-color-rendering, red-enhanced white-light-emitting diode (LED) using a new red phosphor and a short-wavelength YAG phosphor. When the new white-LED was operated at a forward-bias current of 20 mA at room temperature (RT), color temperature (Tcp), the general color rendering index (Ra) and luminous efficiency were 4670 K, 87.7 and 25.5 lm/W, respectively. Most of the color-rendering indexes (CRIs) of the new white-LED were larger than those of current white-LEDs, in which only YAG is used. In particular, the CRI-No.9 value, which shows the color reproduction in the red region, is improved from -2.5 to 62.6.

  7. Morphological classification of local luminous infrared galaxies

    Psychogyios, A.; Charmandaris, V.; Diaz-Santos, T.; Armus, L.; Haan, S.; Howell, J.; Le Floc'h, E.; Petty, S. M.; Evans, A. S.

    2016-06-01

    We present analysis of the morphological classification of 89 luminous infrared galaxies (LIRGs) from the Great Observatories All-sky LIRG Survey (GOALS) sample, using non-parametric coefficients and compare their morphology as a function of wavelength. We rely on images that were obtained in the optical (B- and I-band) as well as in the infrared (H-band and 5.8 μm). Our classification is based on the calculation of Gini and the second order of light (M20) non-parametric coefficients, which we explore as a function of stellar mass (M⋆), infrared luminosity (LIR), and star formation rate (SFR). We investigate the relation between M20, the specific SFR (sSFR) and the dust temperature (Tdust) in our galaxy sample. We find that M20 is a better morphological tracer than Gini, as it allows us to distinguish systems that were formed by double systems from isolated and post-merger LIRGs. The effectiveness of M20 as a morphological tracer increases with increasing wavelength, from the B to H band. In fact, the multi-wavelength analysis allows us to identify a region in the Gini-M20 parameter space where ongoing mergers reside, regardless of the band used to calculate the coefficients. In particular, when measured in the H band, a region that can be used to identify ongoing mergers, with minimal contamination from LIRGs in other stages. We also find that, while the sSFR is positively correlated with M20 when measured in the mid-infrared, i.e. star-bursting galaxies show more compact emission, it is anti-correlated with the B-band-based M20. We interpret this as the spatial decoupling between obscured and unobscured star formation, whereby the ultraviolet/optical size of an LIRG experience an intense dust-enshrouded central starburst that is larger that in the mid-infrared since the contrast between the nuclear to the extended disk emission is smaller in the mid-infrared. This has important implications for high redshift surveys of dusty sources, where sizes of galaxies

  8. Longitudinal measurements of luminance and chromatic contrast sensitivity: comparison between wavefront-guided LASIK and contralateral PRK for myopia

    Mirella Telles Salgueiro Barboni; Claudia Feitosa-Santana; Jackson Barreto Junior; Marcos Lago; Samir Jacob Bechara; Milton Ruiz Alves; Dora Fix Ventura

    2013-01-01

    PURPOSE: The present study aimed to compare the postoperative contrast sensitivity functions between wavefront-guided LASIK eyes and their contralateral wavefront-guided PRK eyes. METHODS: The participants were 11 healthy subjects (mean age=32.4 ± 6.2 years) who had myopic astigmatism. The spatial contrast sensitivity functions were measured before and three times after the surgery. Psycho and a Cambridge graphic board (VSG 2/4) were used to measure luminance, red-green, and blue-yellow spati...

  9. LED light engine concept with ultra-high scalable luminance

    Hoelen, Christoph; de Boer, Dick; Bruls, Dominique; van der Eyden, Joost; Koole, Rolf; Li, Yun; Mirsadeghi, Mo; Vanbroekhoven, Vincent; Van den Bergh, John-John; Van de Voorde, Patrick

    2016-03-01

    Although LEDs have been introduced successfully in many general lighting applications during the past decade, high brightness light source applications are still suffering from the limited luminance of LEDs. High power LEDs are generally limited in luminance to ca 100 Mnit (108 lm/m2sr) or less, while dedicated devices for projection may achieve luminance values up to ca 300 Mnit with phosphor converted green. In particular for high luminous flux applications with limited étendue, like in front projection systems, only very modest luminous flux values in the beam can be achieved with LEDs compared to systems based on discharge lamps. In this paper we introduce a light engine concept based on a light converter rod pumped with blue LEDs that breaks through the étendue and brightness limits of LEDs, enabling LED light source luminance values that are more than 4 times higher than what can be achieved with LEDs so far. In LED front projection systems, green LEDs are the main limiting factor. With our green light emitting modules, peak luminance values well above 1.2 Gnit have been achieved, enabling doubling of the screen brightness of LED based DLP projection systems, and even more when this technology is applied to other colors as well. This light source concept, introduced as the ColorSpark High Lumen Density (HLD) LED technology, enables a breakthrough in the performance of LED-based light engines not only for projection, where >2700 ANSI lm was demonstrated, but for a wide variety of high brightness applications.

  10. Study of lumineers' interfaces by means of optical coherence tomography

    de Andrade Borges, Erica; Fernandes Cassimiro-Silva, Patrícia; Osório Fernandes, Luana; Leônidas Gomes, Anderson Stevens

    2015-06-01

    OCT has been used to evaluate dental materials, and is employed here to evaluate lumineers for the first time. Lumineers are used as esthetical indirect restoration, and after wearing and aging, several undesirable features such as gaps, bubbles and mismatch can appear in which would only be seen by invasive analysis. The OCT (spectral domain SD-OCT, 930nm central wavelength) was used to evaluate noninvasively the lumineer- cement-tooth interface. We analyzed 20 specimens of lumineers-teeth that were prepared in bovine teeth and randomly allocated in 4 experimental groups (n=5) with two different cementation techniques and two different types of cementing agent (RelyX U200 and RelyX Veneer, 3M ESPE, with the adhesive recommended by the manufacture). The lumineers were made of lithium disilicate and obtained using a vacuum injection technique. The analysis was performed by using 2D and 3D OCT images, obtained before and after cementing and the thermal cycling process to simulate thermal stress in a oral cavity. Initial measurements showed that the SD-OCT was able to see through the 500μm thick lumineer, as delivered by the fabricant, and internal stress was observed. Failures were found in the cementing process and also after ageing simulation by thermal cycling. The adhesive failures as bubbles, gaps and degradation of the cementation line are the natural precursors of other defects reported by several studies of clinical follow-up (detachments, fractures and cracks). Bubble dimensions ranging from 146 μm to 1427 μm were measured and the OCT was validated as an investigative and precise tool for evaluation of the lumineer-cement-tooth.

  11. Seeing Red

    2008-01-01

    This New Horizons image of Jupiter's volcanic moon Io was taken at 13:05 Universal Time during the spacecraft's Jupiter flyby on February 28, 2007. It shows the reddish color of the deposits from the giant volcanic eruption at the volcano Tvashtar, near the top of the sunlit crescent, as well as the bluish plume itself and the orange glow of the hot lava at its source. The relatively unprocessed image on the left provides the best view of the volcanic glow and the plume deposits, while the version on the right has been brightened to show the much fainter plume, and the Jupiter-lit night side of Io. New Horizons' color imaging of Io's sunlit side was generally overexposed because the spacecraft's color camera, the super-sensitive Multispectral Visible Imaging Camera (MVIC), was designed for the much dimmer illumination at Pluto. However, two of MVIC's four color filters, the blue and 'methane' filter (a special filter designed to map methane frost on the surface of Pluto at an infrared wavelength of 0.89 microns), are less sensitive than the others, and thus obtained some well-exposed views of the surface when illumination conditions were favorable. Because only two color filters are used, rather than the usual three, and because one filter uses infrared light, the color is only a rough approximation to what the human eye would see. The red color of the Tvashtar plume fallout is typical of Io's largest volcanic plumes, including the previous eruption of Tvashtar seen by the Galileo and Cassini spacecraft in 2000, and the long-lived Pele plume on the opposite side of Io. The color likely results from the creation of reddish three-atom and four-atom sulfur molecules (S3 and S4) from plume gases rich in two-atom sulfur molecules (S2 After a few months or years, the S3 and S4 molecules recombine into the more stable and familiar yellowish form of sulfur consisting of eight-atom molecules (S8), so these red deposits are only seen around recently-active Io volcanos

  12. Luminal Ca2+ dynamics during IP3R mediated signals

    Lopez, Lucia F.; Ponce Dawson, Silvina

    2016-06-01

    The role of cytosolic Ca2+ on the kinetics of Inositol 1,4,5-triphosphate receptors (IP3Rs) and on the dynamics of IP3R-mediated Ca2+ signals has been studied at large both experimentally and by modeling. The role of luminal Ca2+ has not been investigated with that much detail although it has been found that it is relevant for signal termination in the case of Ca2+ release through ryanodine receptors. In this work we present the results of observing the dynamics of luminal and cytosolic Ca2+ simultaneously in Xenopus laevis oocytes. Combining observations and modeling we conclude that there is a rapid mechanism that guarantees the availability of free Ca2+ in the lumen even when a relatively large Ca2+ release is evoked. Comparing the dynamics of cytosolic and luminal Ca2+ during a release, we estimate that they are consistent with a 80% of luminal Ca2+ being buffered. The rapid availability of free luminal Ca2+ correlates with the observation that the lumen occupies a considerable volume in several regions across the images.

  13. The Formation of Primordial Luminous Objects

    Ripamonti, Emanuele; /Kapteyn Astron. Inst., Groningen; Abel, Tom; /KIPAC, Menlo Park

    2005-08-04

    formed and how they influence subsequent structure formation. In these notes we will leave the discussion of feedback to lecture notes by Ferrara & Salvaterra and by Madau & Haardt in this same book and focus only on the aspects of the formation of the first objects. The advent of cosmological numerical hydrodynamics in particular allow a fresh new look at these questions. Hence, these notes will touch on aspects of theoretical cosmology to chemistry, computer science, hydrodynamics and atomic physics. For further reading and more references on the subject we refer the reader to other relevant reviews such as Barkana & Loeb 2001, and more recently Ciardi & Ferrara 2004, Glover 2004 and Bromm & Larson 2004. In these notes, we try to give a brief introduction to only the most relevant aspects. We will start with a brief overview of the relevant cosmological concepts in section 2, followed by a discussion of the properties of primordial material (with particular emphasis to its cooling and its chemistry) in section 3. We will then review the technique and the results of numerical simulations in sections 4 and 5: the former will deal with detailed 3D simulations of the formation of gaseous clouds which are likely to transform into luminous objects, while the latter will examine results (mostly from 1D codes) about the modalities of such transformation. Finally, in section 6 we will critically discuss the results of the previous sections, examining their consequences and comparing them to our present knowledge of the universe.

  14. The Formation of Primordial Luminous Objects

    discussion of feedback to lecture notes by Ferrara and Salvaterra and by Madau and Haardt in this same book and focus only on the aspects of the formation of the first objects. The advent of cosmological numerical hydrodynamics in particular allow a fresh new look at these questions. Hence, these notes will touch on aspects of theoretical cosmology to chemistry, computer science, hydrodynamics and atomic physics. For further reading and more references on the subject we refer the reader to other relevant reviews such as Barkana and Loeb 2001, and more recently Ciardi and Ferrara 2004, Glover 2004 and Bromm and Larson 2004. In these notes, we try to give a brief introduction to only the most relevant aspects. We will start with a brief overview of the relevant cosmological concepts in section 2, followed by a discussion of the properties of primordial material (with particular emphasis to its cooling and its chemistry) in section 3. We will then review the technique and the results of numerical simulations in sections 4 and 5: the former will deal with detailed 3D simulations of the formation of gaseous clouds which are likely to transform into luminous objects, while the latter will examine results (mostly from 1D codes) about the modalities of such transformation. Finally, in section 6 we will critically discuss the results of the previous sections, examining their consequences and comparing them to our present knowledge of the universe

  15. Luminous efficacy enhancement of ultraviolet-excited white light-emitting diodes through multilayered phosphor-in-glass.

    Peng, Yang; Wang, Sinmin; Li, Ruixin; Li, Hong; Cheng, Hao; Chen, Mingxiang; Liu, Sheng

    2016-06-20

    To enhance the luminous efficacy of ultraviolet-excited white light-emitting diodes (WLEDs), a novel packaging structure that is based on a multilayered red, green, and blue (RGB) phosphor-in-glass (PiG) was proposed. The RGB PiG was prepared by screenprinting and low temperature sintering, and the effects of different configuration orders of RGB phosphor layers on the optical performance of WLEDs were studied. Compared with the conventional mixed-RGB PiG, the luminous efficacy of WLEDs packaged by the multilayered PiG with the order of R-G-B is increased by 8.2% at the driving current of 500 mA, and the corresponding correlated color temperature (CCT) and color rendering index (CRI) are 2984 K and 86.8, respectively. Moreover, the WLEDs packaged by multilayered G-R-B PiG yield the highest luminous efficacy of 27.19 lm/W at the expense of color quality, which is still an acceptable warm light, with a CCT of 3326 K and a CRI of 84.2. PMID:27409121

  16. Luminous efficacy of white LED in the mesopic vision state

    JIN Peng; WANG Yi-feng; ZHOU Qi-feng; John Rooymans; YU Chun-yu

    2009-01-01

    The traditional eye sensitivity function based on photopic vision is not applicable in the mesopic vision state. The mesopic vision is studied by using the photopic and scotopic vision state sensitivity functions. And the model which links the mesopic sensitivity with the photopic and scotopic states is built. Based on the model, the luminous efficacy of mesopic vision is calculated and applied to the spectrum distribution of LED light sources. The results show that the luminous efficacy of a commercial YAG phosphor converted white LED is up to 172.7 lm/W at mesopic vision, which is 67.2 % higher than that of photopic vision state. We also conclude that the optimal spectral power distribution of the LED will greatly increase the mesopic luminous efficacy.

  17. The Luminous Convolution Model for spiral galaxy rotation curves

    Cisneros, S; Oblath, N S; Formaggio, J A

    2015-01-01

    The Luminous Convolution Model (LCM) is an empirical formula, based on a heuristic convolution of Relativistic transformations, which makes it possible to predict the observed rotation curves of a broad class of spiral galaxies from luminous matter alone. Since the LCM is independent of distance estimates or dark matter halo densities, it is the first model of its kind which constrains luminous matter modeling directly from the observed spectral shifts of characteristic photon emission/absorption lines. In this paper we present the LCM solution to a diverse sample of twenty-five (25) galaxies of varying morphologies and sizes. For the chosen sample, it is shown that the LCM is more accurate than either Modified Newtonian Dynamics or dark matter models and returns physically reasonable mass to light ratios and exponential scale lengths. Unlike either Modified Newtonian Dynamics or dark matter models, the LCM predicts something which is directly falsifiable through improvements in our observational capacity, th...

  18. Luminance Effects on Neural Mechanism at Photopic Level

    Ge, Jing-Jing; Wang, Zhao-Qi

    2011-05-01

    In order to obtain the influence of the luminance at photopic level on the neural mechanism, a neural contrast sensitivity function (NCSF) measurement system is established. The contrast sensitivity function (CSF) of the visual system and the modulation transfer function (MTF) of the eye's optical system are first measured with correspondent instruments respectively. Then the NCSF is calculated as the ratio of CSF to MTF. Four individual eyes are involved in the cases of green light and white light. With increasing luminance, the tendency of the variation of the CSFs is similar to that of the NCSFs, while the gain is larger than that of the NCSFs, especially in the region of higher spatial frequency. It is the NCSF, rather than CSF, that reflects tie luminance sensitivity in the retina-brain neural system, because the influence of the eye's optical system is excluded.

  19. Human Mammary Luminal Epithelial Cells Contain Progenitors to Myoepithelial Cells

    Pechoux, Christine; Gudjonsson, Thorarinn; Ronnov-Jessen, Lone; Bissell, Mina J; Petersen, Ole

    1999-02-01

    The origin of the epithelial and myoepithelial cells in the human breast has not been delineated. In this study we have addressed whether luminal epithelial cells and myoepithelial cells are vertically connected, i.e., whether one is the precursor for the other. We used a primary culture assay allowing preservation of basic phenotypic traits of luminal epithelial and myoepithelial cells in culture. The two cell types were then separated immunomagnetically using antibodies directed against lineage-specific cell surface antigens into at best 100% purity. The cellular identity was ascertained by cytochemistry, immunoblotting, and 2-D gel electrophoresis. Luminal epithelial cells were identified by strong expression of cytokeratins 18 and 19 while myoepithelial cells were recognized by expression of vimentin and {alpha}-smooth muscle actin. We used a previously devised culture medium (CDM4) that allows vigorous expansion of proliferative myoepithelial cells and also devised a medium (CDM6) that allowed sufficient expansion of differentiated luminal epithelial cells based on addition of hepatocyte growth factor/scatter factor. The two different culture media supported each lineage for at least five passages without signs of interconversion. We used parallel cultures where we switched culture media, thus testing the ability of each lineage to convert to the other. Whereas the myoepithelial lineage showed no signs of interconversion, a subset of luminal epithelial cells, gradually, but distinctly, converted to myoepithelial cells. We propose that in the mature human breast, it is the luminal epithelial cell compartment that gives rise to myoepithelial cells rather than the other way around.

  20. Effect of Ionizing Radiation on Luminous Bacteria Cells

    Marine luminous bacteria were used to monitor toxicity of alpha- (Am-241, U-235+238) and beta- (tritium) radionuclide solutions. Increase or inhibition of bacterial luminescence was observed under exposure to radionuclides. Radiation toxicity of Am and chemical toxicity of U were demonstrated. Effects of U were similar to those of stable heavy metals: sensitivity was about 10-5 M. Sensitivity of the bacteria to Am-241 was 300 Bq/L (10-11M). Inhibition of bacterial growth was observed under exposure to Am-241 and tritium. Role of peroxides and electron transfer processes in the effects of radionuclides on luminous bacteria is discussed.

  1. A Blind Pilot: Who is a Super-Luminal Observer?

    Rabounski D.

    2008-04-01

    Full Text Available This paper discusses the nature of a hypothetical super-luminal observer who, as well as a real (sub-light speed observer, perceives the world by light waves. This consideration is due to that fact that the theory of relativity permits different frames of reference, including light-like and super-luminal reference frames. In analogy with a blind pilot on board a supersonic jet aeroplane (or missile, perceived by blind people, it is concluded that the light barrier is observed in the framework of only the light signal exchange experiment.

  2. Luminal nucleotides are tonic inhibitors of renal tubular transport

    Leipziger, Jens Georg

    2011-01-01

    in all renal tubular segments and their stimulation generally leads to transport inhibition. Recent evidence has identified the tubular lumen as a restricted space for purinergic signaling. The concentrations of ATP in the luminal fluids are sufficiently high to inflict a tonic inhibition of renal...... necessary for flow-stimulated luminal ATP release. Tubular ATP secretion may occur via nonjunctional connexin-hemichannels (connexin 30), which are strategically placed in the apical membrane of distal tubular intercalated cells and can be activated by tubular flow. SUMMARY: The tubular lumen has been...

  3. A luminal flavoprotein in endoplasmic reticulum-associated degradation

    Riemer, Jan; Appenzeller-Herzog, Christian; Johansson, Linda; Bodenmiller, Bernd; Hartmann-Petersen, Rasmus; Ellgaard, Lars

    2009-01-01

    The quality control system of the endoplasmic reticulum (ER) discriminates between native and nonnative proteins. The latter are degraded by the ER-associated degradation (ERAD) pathway. Whereas many cytosolic and membrane components of this system are known, only few luminal players have been...... identified. In this study, we characterize ERFAD (ER flavoprotein associated with degradation), an ER luminal flavoprotein that functions in ERAD. Upon knockdown of ERFAD, the degradation of the ERAD model substrate ribophorin 332 is delayed, and the overall level of polyubiquitinated cellular proteins is...

  4. Spectral optimization of color temperature tunable white LEDs with excellent color rendering and luminous efficacy.

    He, Guoxing; Tang, Ju

    2014-10-01

    The optimization model of limited luminous efficacy (LLE) for correlated color temperature (CCT) tunable phosphor-coated white light-emitting diodes (pc-W LEDs) consisting of blue chips, green and yellow phosphors, and red chips, including downconversion energy loss, has been developed under the constraint of a designated color-rendering index (CRI) and a special CRI of R9 for strong red. The optimal spectra of pc-W LEDs are obtained with a nonlinear program for maximizing LLE under conditions of both CRI and R9 above 90, 95, and 98 at CCTs of 2700-6500 K. The pc-W LEDs with LLE>301  lm/W for both CRI and R9 above 90, LLE>290  lm/W for both CRI and R9 above 95, and LLE>276  lm/W for both CRI and R9 above 98 could be achieved at CCTs of 2700-6500 K. The recommended peak wavelengths and full widths at half-maximum (FWHMs) for the current LEDs and phosphors and their photometric and colorimetric performances are presented. PMID:25360930

  5. NGC 5824: a luminous outer halo globular cluster with an intrinsic abundance spread

    Da Costa, G S; Saviane, I

    2013-01-01

    We present a detailed study of the strengths of the calcium triplet absorption lines in the spectra of a large sample of red giant members of the luminous outer Galactic halo globular cluster NGC 5824. The spectra were obtained with the FORS2 and GMOS-S multi-object spectrographs at the VLT and the Gemini-S telescope, respectively. By comparing the line strengths of the NGC 5824 stars with those for red giants in clusters with well established abundances, we conclude that there is an intrinsic abundance dispersion in NGC 5824 characterized by an inter-quartile range in [Fe/H] of 0.10 dex and a total range of ~0.3 dex. As for omega-Cen and M22, the abundance distribution shows a steep rise on the metal-poor side and a shallower decline on the metal-rich side. There is also some indication that the distribution is not unimodal with perhaps 3 distinct abundance groupings present. NGC 5824 has a further unusual characteristic: the outer surface density profile shows no signs of a tidal cutoff. Instead the profile...

  6. Obscuration by Gas and Dust in Luminous Quasars

    Usman, Shawn M.; Murray, Stephen S.; Hickox, Ryan C.; Brodwin, Mark

    2014-01-01

    We explore the connection between absorption by neutral gas and extinction by dust in mid-infrared (IR) selected luminous quasars. We use a sample of 33 quasars at redshifts 0.7 150 counts) in Chandra observations. We divide the quasars into dust-obscured and unobscured samples based on their optical to...

  7. Astronomy. ASASSN-15lh: A highly super-luminous supernova.

    Dong, Subo; Shappee, B J; Prieto, J L; Jha, S W; Stanek, K Z; Holoien, T W-S; Kochanek, C S; Thompson, T A; Morrell, N; Thompson, I B; Basu, U; Beacom, J F; Bersier, D; Brimacombe, J; Brown, J S; Bufano, F; Chen, Ping; Conseil, E; Danilet, A B; Falco, E; Grupe, D; Kiyota, S; Masi, G; Nicholls, B; Olivares E, F; Pignata, G; Pojmanski, G; Simonian, G V; Szczygiel, D M; Woźniak, P R

    2016-01-15

    We report the discovery of ASASSN-15lh (SN 2015L), which we interpret as the most luminous supernova yet found. At redshift z = 0.2326, ASASSN-15lh reached an absolute magnitude of Mu ,AB = -23.5 ± 0.1 and bolometric luminosity Lbol = (2.2 ± 0.2) × 10(45) ergs s(-1), which is more than twice as luminous as any previously known supernova. It has several major features characteristic of the hydrogen-poor super-luminous supernovae (SLSNe-I), whose energy sources and progenitors are currently poorly understood. In contrast to most previously known SLSNe-I that reside in star-forming dwarf galaxies, ASASSN-15lh appears to be hosted by a luminous galaxy (MK ≈ -25.5) with little star formation. In the 4 months since first detection, ASASSN-15lh radiated (1.1 ± 0.2) × 10(52) ergs, challenging the magnetar model for its engine. PMID:26816375

  8. Evolution of the ISM in luminous infrared galaxies

    Baan, W. A.; Loenen, A. F.; Spaans, M.

    2010-01-01

    Aims. Molecules that trace the high-density regions of the interstellar medium may be used to evaluate the changing physical and chemical environment during the ongoing nuclear activity in (ultra-) luminous infrared galaxies (ULIRGs). Methods. The changing ratios of the HCN (1-0), HNC (1-0), HCO(+)

  9. Profile of a Growing Urban School: The Lumin Experience

    Ford, Terry

    2015-01-01

    This fairytale-come-true began with an idealistic public school teacher just out of college who lived in the neighborhood of her students. In stages, working with a community organizing group consisting mainly of concerned parents, Terry Ford founded what is now called Lumin Education, a network of campuses serving more than six hundred children…

  10. Vocal Fold Epithelial Response to Luminal Osmotic Perturbation

    Sivasankar, Mahalakshmi; Fisher, Kimberly V.

    2007-01-01

    Purpose: Dry-air challenges increase the osmolarity of fluid lining the luminal surface of the proximal airway. The homeostasis of surface fluid is thought to be essential for voice production and laryngeal defense. Therefore, the authors hypothesized that viable vocal fold epithelium would generate a water flux to reduce an osmotic challenge (150…

  11. Development and validation of a luminance camera : final report

    Meyer, Jason E.; Gibbons, Ronald B. (Ronald Bruce); Edwards, Christopher J.

    2009-01-01

    Under the sponsorship of the National Surface Transportation Safety Center for Excellence (NSTSCE), an effort was undertaken to develop a system of image capture to analyze luminance data gathered in naturalistic driving research. Jason E. Meyer, Ronald B. Gibbons and Christopher J. Edwards

  12. SPECTRAL AND SPATIAL SELECTIVITY OF LUMINANCE VISION IN REEF FISH

    Ulrike E Siebeck

    2014-09-01

    Full Text Available Luminance vision has high spatial resolution and is used for form vision and texture discrimination. In humans, birds and bees luminance channel is spectrally selective – it depends on the signals of the long-wavelength sensitive photoreceptors (bees or on the sum of long- and middle- wavelength sensitive cones (humans, but not on the signal of the short-wavelength sensitive (blue photoreceptors. The reasons of such selectivity are not fully understood. The aim of this study is to reveal the inputs of cone signals to high resolution luminance vision in reef fish. 16 freshly caught damselfish, Pomacentrus amboinensis, were trained to discriminate stimuli differing either in their colour or in their fine patterns (stripes vs. cheques. Three colours (‘bright green’, ‘dark green’ and ‘blue’ were used to create two sets of colour and two sets of pattern stimuli. The ‘bright green’ and ‘dark green’ were similar in their chromatic properties for fish, but differed in their lightness; the ‘dark green’ differed from ‘blue’ in the signal for the blue cone, but yielded similar signals in the long-wavelength and middle-wavelength cones. Fish easily learned to discriminate ‘bright green’ from ‘dark green’ and ‘dark green’ from ‘blue’ stimuli. Fish also could discriminate the fine patterns created from ‘dark green’ and ‘bright green’. However, fish failed to discriminate fine patterns created from ‘blue’ and ‘dark green’ colours, i.e. the colours that provided contrast for the blue-sensitive photoreceptor, but not for the long-wavelength sensitive one. High resolution luminance vision in damselfish, Pomacentrus amboinensis, does not have input from the blue-sensitive cone, which may indicate that the spectral selectivity of luminance channel is a general feature of visual processing in both aquatic and terrestrial animals.

  13. Effects of Irradiation on bacterial atp luminous intensity of cooled pork and chicken

    The effect of irradiation on cooled pork and chicken was detected with ATP luminous intensity method. The influences of other factors to ATP luminous intensity were also discussed. There was positive correlation between ATP standard concentration and ATP luminous intensity, and negative correlation between irradiation dosage and ATP luminous intensity. The trend of ATP luminous intensity of cooled pork and chicken after irradiation was inverse S, and the maximum ATP luminous intensity appeared at 6.0 kGy, and minimum at 4.0 and 8.0 kGy. Sterilized water and sterilized pork had no interference to ATP luminous intensity of the samples. There was significant positive correlation between E. coli 10003 concentration and ATP luminous intensity, the coefficient correlation was 0.9437. (authors)

  14. V1 neurons respond to luminance changes faster than contrast changes

    Wen-Liang Wang; Ran Li; Jian Ding; Louis Tao; Da-Peng Li; Yi Wang(Kavli Institute for the Physics and Mathematics of the Universe, Todai Institutes for Advanced Study, University of Tokyo (WPI), 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8583, Japan)

    2015-01-01

    Luminance and contrast are two major attributes of objects in the visual scene. Luminance and contrast information received by visual neurons are often updated simultaneously. We examined the temporal response properties of neurons in the primary visual cortex (V1) to stimuli whose luminance and contrast were simultaneously changed by 50 Hz. We found that response tuning to luminance changes precedes tuning to contrast changes in V1. For most V1 neurons, the onset time of response tuning to l...

  15. METALLICITY EVOLUTION OF THE SIX MOST LUMINOUS M31 DWARF SATELLITES

    We present global metallicity properties, metallicity distribution functions (MDFs), and radial metallicity profiles for the six most luminous M31 dwarf galaxy satellites: M32, NGC 205, NGC 185, NGC 147, Andromeda VII, and Andromeda II. The results presented are the first spectroscopic MDFs for dwarf systems surrounding a host galaxy other than the Milky Way (MW). Our sample consists of individual metallicity measurements for 1243 red giant branch member stars spread across these six systems. We determine metallicities based on the strength of the Ca II triplet lines using the empirical calibration of Carrera et al., which is calibrated over the metallicity range –4 < [Fe/H] <+0.5. We find that these M31 satellites lie on the same luminosity-metallicity relationship as the MW dwarf satellites. We do not find a trend between the internal metallicity spread and galaxy luminosity, contrary to previous studies. The MDF widths of And II and And VII are similar to the MW dwarf spheroidal (dSph) satellites of comparable luminosity; however, our four brightest M31 dwarf satellites are more luminous than any of the MW dSphs and have broader MDFs. The MDFs of our six M31 dwarf satellites are consistent with the leaky box model of chemical evolution, although our metallicity errors allow a wide range of evolution models. We find a significant radial gradient in metallicity in only two of our six systems, NGC 185 and Andromeda II, and flat radial metallicity gradients in the rest of our sample with no observed correlation between rotational support and radial metallicity gradients. Although the average properties and radial trends of the M31 dwarf galaxies agree with their MW counterparts at similar luminosity, the detailed MDFs are different, particularly at the metal-rich end

  16. File list: His.Brs.10.AllAg.Luminal_cells [Chip-atlas[Archive

    Full Text Available His.Brs.10.AllAg.Luminal_cells mm9 Histone Breast Luminal cells SRX213395,SRX213418...,SRX213416 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Brs.10.AllAg.Luminal_cells.bed ...

  17. File list: ALL.Brs.05.AllAg.Luminal_cells [Chip-atlas[Archive

    Full Text Available ALL.Brs.05.AllAg.Luminal_cells mm9 All antigens Breast Luminal cells SRX213395,SRX2...13398,SRX213418,SRX213416 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/ALL.Brs.05.AllAg.Luminal_cells.bed ...

  18. File list: His.Brs.20.AllAg.Luminal_cells [Chip-atlas[Archive

    Full Text Available His.Brs.20.AllAg.Luminal_cells mm9 Histone Breast Luminal cells SRX213395,SRX213418...,SRX213416 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Brs.20.AllAg.Luminal_cells.bed ...

  19. File list: His.Brs.05.AllAg.Luminal_cells [Chip-atlas[Archive

    Full Text Available His.Brs.05.AllAg.Luminal_cells mm9 Histone Breast Luminal cells SRX213395,SRX213418...,SRX213416 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Brs.05.AllAg.Luminal_cells.bed ...

  20. 10 CFR 30.19 - Self-luminous products containing tritium, krypton-85, or promethium-147.

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Self-luminous products containing tritium, krypton-85, or... DOMESTIC LICENSING OF BYPRODUCT MATERIAL Exemptions § 30.19 Self-luminous products containing tritium... transfer for sale or distribution self-luminous products containing tritium, krypton-85, or...

  1. File list: ALL.Brs.50.AllAg.Luminal_cells [Chip-atlas[Archive

    Full Text Available ALL.Brs.50.AllAg.Luminal_cells mm9 All antigens Breast Luminal cells SRX213395,SRX2...13418,SRX213398,SRX213416 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/ALL.Brs.50.AllAg.Luminal_cells.bed ...

  2. Luminal A and luminal B (HER2 negative subtypes of breast cancer consist of a mixture of tumors with different genotype

    Yanagawa Masumi

    2012-07-01

    Full Text Available Abstract Background The St Gallen International Expert Consensus 2011 has proposed a new classification system for breast cancer. The purpose of this study was to elucidate the relationship between the breast cancer subtypes determined by the new classification system and genomic characteristics. Methods Invasive breast cancers (n = 363 were immunohistochemically classified as follows: 111 (30.6% as luminal A, 95 (26.2% as luminal B (HER2 negative, 69 (19.0% as luminal B (HER2 positive, 41 (11.3% as HER2, and 47 (12.9% as basal-like subtypes. Results The high expression of Ki-67 antigen was detected in 236 tumors; no cases of luminal A subtype showed high expression of the Ki-67 antigen, but more than 85% of tumors of the other subtypes showed high expression. In addition, DNA ploidy and chromosomal instability (CIN were assessed using imaging cytometry and FISH, respectively. In this series, 336 (92.6% tumors consisted of 129 diploid/CIN- and 207 aneuploid/CIN + tumors. Diploid/CIN- and aneuploid/CIN+ features were detected in 64.9% and 27.9% of luminal A, 41.1% and 49.5% of luminal B (HER2-, 11.6% and 81.2% of luminal B (HER2+, 4.9% and 90.2% of HER2, and 17.0% and 76.6% of basal-like subtypes, respectively. Unlike the luminal B (HER2+, HER2 and basal-like subtypes, the luminal A and luminal B (HER2- subtypes were heterogeneous in terms of DNA ploidy and CIN. Conclusions It is reasonable to propose that the luminal A and luminal B (HER2- subtypes should be further divided into two subgroups, diploid/CIN- and aneuploid/CIN+, based on their underlying genomic status.

  3. Two Host-Dopant Emitting Systems Realizing Four-Color Emission: A Simple and Effective Strategy for Highly Efficient Warm-White Organic Light-Emitting Diodes with High Color-Rendering Index at High Luminance.

    Zhuang, Xuming; Zhang, Hao; Ye, Kaiqi; Liu, Yu; Wang, Yue

    2016-05-11

    A four-color warm-white organic light-emitting diode employing a simple adjacent two-emitting-layer structure as a blue host-orange dopant/green host-red dopant has been fabricated, which exhibited a stable high electroluminescent performance: an external quantum efficiency of 23.3% and a power efficiency of 63.2 lm W(-1) at an illumination-relevant luminance of 1000 cd m(-2) with a high color-rendering index (CRI) of 92 and maintained high levels of 21.6% and 48.8 lm W(-1) with a CRI value of 93 at the extremely high luminance of 5000 cd m(-2). To our knowledge, this should be the best result so far for a white-light organic light-emitting diode with CRI > 90, simultaneously exhibiting very high efficiencies based on a high luminance level for the solid-state lighting. PMID:27105391

  4. Infrared spectroscopy of radio-luminous OH/IR stars

    Jones, Terry Jay; Hyland, A. R.; Fix, John D.; Cobb, Michael L.

    1988-01-01

    Low-resolution 1.5-2.5-micron spectra for 21 radio-luminous OH/IR stars are presented. These spectra divide into two broad classes. Those with very strong water-vapor absorption closely resemble the spectra of classical Mira variables and are classified Type VM. Those with weaker water-vapor absorption, but still showing strong CO absorption, resemble the spectra of true core-burning supergiants and are classified Type SG. Comparison of the classification of 30 radio-luminous OH/IR stars with their Delta(V)s and luminosities suggests this classification is a good indicator of the intrinsic nature of the underlying star. There is some evidence, however, that some true supergiants (massive main-sequence progenitors) develop the pulsation properties and photospheric characteristics of the Mira-like OH/IR stars when they become optically obscured OH/IR stars.

  5. Detecting Exomoons Around Self-luminous Giant Exoplanets Through Polarization

    Sengupta, Sujan

    2016-01-01

    Many of the directly imaged self-luminous gas giant exoplanets have been found to have cloudy atmospheres. Scattering of the emergent thermal radiation from these planets by the dust grains in their atmospheres should locally give rise to significant linear polarization of the emitted radiation. However, the observable disk averaged polarization should be zero if the planet is spherically symmetric. Rotation-induced oblateness may yield a net non-zero disk averaged polarization if the planets have sufficiently high spin rotation velocity. On the other hand, when a large natural satellite or exomoon transits a planet with cloudy atmosphere along the line of sight, the asymmetry induced during the transit should give rise to a net non-zero, time resolved linear polarization signal. The peak amplitude of such time dependent polarization may be detectable even for slowly rotating exoplanets. Therefore, we suggest that large exomoons around directly imaged self-luminous exoplanets may be detectable through time re...

  6. Searching for molecular outflows in Hyper-Luminous Infrared Galaxies

    Calderón, D; Veilleux, S; Graciá-Carpio, J; Sturm, E; Lira, P; Schulze, S; Kim, S

    2016-01-01

    We present constraints on the molecular outflows in a sample of five Hyper-Luminous Infrared Galaxies using Herschel observations of the OH doublet at 119 {\\mu}m. We have detected the OH doublet in three cases: one purely in emission and two purely in absorption. The observed emission profile has a significant blueshifted wing suggesting the possibility of tracing an outflow. Out of the two absorption profiles, one seems to be consistent with the systemic velocity while the other clearly indicates the presence of a molecular outflow whose maximum velocity is about ~1500 km/s. Our analysis shows that this system is in general agreement with previous results on Ultra-luminous Infrared Galaxies and QSOs, whose outflow velocities do not seem to correlate with stellar masses or starburst luminosities (star formation rates). Instead the galaxy outflow likely arises from an embedded AGN.

  7. Do gravitational lens galaxies have an excess of luminous substructure?

    Nierenberg, A M; Treu, T

    2013-01-01

    Strong gravitational lensing can be used to directly measure the mass function of their satellites, thus testing one of the fundamental predictions of cold dark matter cosmological models. Given the importance of this test it is essential to ensure that galaxies acting as strong lenses have dark and luminous satellites which are representative of the overall galaxy population. We address this issue by measuring the number and spatial distribution of luminous satellites in ACS imaging around lens galaxies from the Sloan Lens Advanced Camera for Surveys (SLACS) lenses, and comparing them with the satellite population in ACS imaging of non lens galaxies selected from COSMOS, which has similar depth and resolution to the ACS images of SLACS lenses. In order to compare the samples of lens and non lens galaxies, which have intrinsically different stellar mass distributions, we measure, for the first time, the number of satellites per host as a continuous function of host stellar mass for both populations. We find t...

  8. Development and construction of a programmable generator of luminous impulses

    The design and construction of an impulse generator, for light waves, designed to control the characteristics of a scintillator. In these detectors, a particle gives rise to the emission of a luminous signal, which must be transformed in an electrical signal. In the present work, photomultipliers are used as luminous-electrical signal converters. The principles of operation of a scintillator, of a scintillator connected with a photodiode, and of a scintillator connected with a photomultiplier are reviewed. The analysis of the performance and of the possibilies offered by the usual generators of light, show that more suitable solutions are required. The characteristics of the electroluminescent diodes, their performances, concerning light emission and power, are investigated. The principles, the operating conditions and the performances of a generator of light, applying electroluminescent diodes, are examined. The construction and the results obtained with a prototype are presented

  9. Searching for molecular outflows in Hyper-Luminous Infrared Galaxies

    D. Calderón; Bauer, F. E.; Veilleux, S; Graciá-Carpio, J; Sturm, E; P. Lira; Schulze, S.; Kim, S.

    2016-01-01

    We present constraints on the molecular outflows in a sample of five Hyper-Luminous Infrared Galaxies using Herschel observations of the OH doublet at 119 {\\mu}m. We have detected the OH doublet in three cases: one purely in emission and two purely in absorption. The observed emission profile has a significant blueshifted wing suggesting the possibility of tracing an outflow. Out of the two absorption profiles, one seems to be consistent with the systemic velocity while the other clearly indi...

  10. Selected luminal mucosal complications of adult celiac disease

    Freeman, Hugh J

    2009-01-01

    Hugh J FreemanDepartment of Medicine (Gastroenterology), University of British Columbia, Vancouver, BC, CanadaAbstract: Celiac disease is a gluten-dependent intestinal disorder that appears to be associated with several clinical conditions. Some involve the luminal mucosa of the stomach and intestinal tract and may, occasionally, complicate the course of celiac disease. Collagenous colitis has been associated with celiac disease and may lead to chronic diarrhea. Conversely, some of t...

  11. Luminance ratio at the visual tasks in classroom

    Helštýnová, Barbara; Novák, Tomáš; Sokanský, Karel; Bos, Petr

    2015-01-01

    Possibilities of action learning methods such as interactive whiteboards, blackboards and whiteboards along with copying to a workbook depends not only on visual comfort, but also on the subjective feeling of the observer. This measurement could be performed objective was chosen as the place of visual task workbook, as the surrounding visual task desk (table) and a background visual task was elected boards according to the type of measurement rooms. Measurements was done by luxmeter and lumin...

  12. Race-associated biological differences among Luminal A breast tumors.

    D'Arcy, Monica; Fleming, Jodie; Robinson, Whitney R; Kirk, Erin L; Perou, Charles M; Troester, Melissa A

    2015-07-01

    African-American (AA) women have higher breast cancer-specific mortality rates. A higher prevalence of the worse outcome Basal-like breast cancer subtype contributes to this, but AA women also have higher mortality even within the more favorable outcome Luminal A breast cancers. These differences may reflect treatment or health care access issues, inherent biological differences, or both. To identify potential biological differences by race among Luminal A breast cancers, gene expression data from 108 CAU and 57 AA breast tumors were analyzed. Race-associated genes were evaluated for associations with survival. Finally, expression of race- and survival-associated genes was evaluated in normal tissue of AA and CAU women. Six genes (ACOX2, MUC1, CRYBB2, PSPH, SQLE, TYMS) were differentially expressed by race among Luminal A breast cancers and were associated with survival (HR 1.25). For all six genes, tumors in AA had higher expression of poor prognosis genes (CRYBB2, PSPH, SQLE, TYMS) and lower expression of good prognosis genes (ACOX2, MUC1). A score based on all six genes predicted survival in a large independent dataset (HR = 1.9 top vs. bottom quartile, 95% CI: 1.4-2.5). For four genes, normal tissue of AA and CAU women showed similar expression (ACOX2, MUC1, SQLE, TYMS); however, the poor outcome-associated genes CRYBB2 and PSPH were more highly expressed in AA versus CAU women's normal tissue. This analysis identified gene expression differences that may contribute to mortality disparities and suggests that among Luminal A breast tumors there are biological differences between AA and CAU patients. Some of these differences (CRYBB2 and PSPH) may exist from the earliest stages of tumor development, or may even precede malignancy. PMID:26109344

  13. Luminous hot accretion flows: thermal equilibrium curve and thermal stability

    Yuan, Feng(Nuclear Science Division, Lawrence Berkeley National Laboratory, Berkeley, CA, 94720, USA)

    2003-01-01

    In a previous paper, we presented the global solution of a new accretion flow model, namely luminous hot accretion flows (LHAFs). In this {\\em Letter}, we first show the corresponding thermal equilibrium curve of LHAFs in the mass accretion rate vs. surface density diagram. Then we examine its thermal stability again local perturbations. We find that LHAFs are thermally unstable when thermal conduction is neglected. However, when the accretion rate is not very large, the timescale of the grow...

  14. A COMPARATIVE STUDY OF TRACHEOBRONCHIAL PATTERN USING LUMINAL PLASTINATION

    Venketesh G Kamath; Radha Krishan K shetty; Muhammed Asif; Ramakrishna A

    2013-01-01

    Background: The tracheobronchial pattern of human lungs is well known. An attempt was made to compare the pattern with that of sheep lung using luminal plastination of sheep lung. Several similarities were observed between the two patterns, due to which, the sheep lung serves as an ideal experimental model to study the effect of treatment in several human airway diseases. Objective: The first objective was to compare the two tracheobronchial patterns. Moreover the study also provided an o...

  15. Luminous Satellites versus Dark Subhaloes: Clustering in the Milky Way

    Bozek, Brandon; Gilmore, Gerard

    2013-01-01

    The observed population of the Milky Way satellite galaxies offer a unique testing ground for galaxy formation theory on small-scales. Our novel approach was to investigate the clustering of the known Milky Way satellite galaxies and to quantify the amount of substructure within their distribution using a two-point correlation function statistic in each of three spaces: configuration space, line-of-sight velocity space, and four-dimensional phase-space. These results were compared to those for three sets of subhaloes in the Via Lactea II Cold Dark Matter simulation defined to represent the luminous dwarfs. We found no evidence at a significance level above 2-sigma of substructure within the distribution of the Milky Way satellite galaxies in any of the three spaces. The "luminous" subhalo sets are more strongly clustered than are the Milky Way satellites in all three spaces and over a broader range of scales in four-dimensional phase-space. Each of the "luminous" subhalo sets are clustered as a result of subs...

  16. Night sky luminance under clear sky conditions: Theory vs. experiment

    Kocifaj, Miroslav

    2014-05-01

    Sky glow is caused by both natural phenomena and factors of anthropogenic origin, and of the latter ground-based light sources are the most important contributors for they emit the spatially linked spectral radiant intensity distribution of artificial light sources, which are further modulated by local atmospheric optics and perceived as the diffuse light of a night sky. In other words, sky glow is closely related to a city's shape and pattern of luminaire distribution, in practical effect an almost arbitrary deployment of random orientation of heterogeneous electrical light sources. Thus the luminance gradation function measured in a suburban zone or near the edges of a city is linked to the City Pattern or vice versa. It is shown that clear sky luminance/radiance data recorded in an urban area can be used to retrieve the bulk luminous/radiant intensity distribution if some a-priori information on atmospheric aerosols is available. For instance, the single scattering albedo of aerosol particles is required under low turbidity conditions, as demonstrated on a targeted experiment in the city of Frýdek-Mistek. One of the main advantages of the retrieval method presented in this paper is that the single scattering approximation is satisfactorily accurate in characterizing the light field near the ground because the dominant contribution to the sky glow has originated from beams propagated along short optical paths.

  17. Luminal oxidants selectively modulate electrogenic ion transport in rat colon

    Julio M Mayol; Yolanda Adame-Navarrete; Pilar Alarma-Estrany; Elena Molina-Roldan; Fernando Huete-Toral; Jesus A Fernandez-Represa

    2006-01-01

    AIM: To investigate the effects of luminal exposure to H2O2 and two related thiol oxidizing agents on basal and stimulated chloride secretion in native colon using electrophysiological and pharmacological approaches.METHODS: Unstripped rat distal colon segments were mounted in Ussing chambers. Potential difference, cal culated resistance and short-circuit current across unstripped colon segments were monitored with a dual voltage/current clamp. Paracellular permeability was assessed by measuring the mucosa-to-serosa flux of a fluorescent probe (FITC).RESULTS: Luminal exposure to hydrogen peroxide transitorily stimulated chloride secretion without altering barrier function. This stimulatory effect could be blocked by basolateral atropine but not indomethacin. The cysteine and methionine oxidizing compounds, phenylarsine oxide and chloramine T respectively, mimicked the effect of H2O2, except for a drop in transcolonic resistance after 30 min. In contrast to the observed stimulatory effect on basal secretion, cAMP-stimulated electrogenic ion trans port was blunted by luminal H2O2. However, the Ca2+-activated response remained unchanged.CONCLUSION: H2O2 may be an important selective modulator of intestinal ion and water secretion in certain pathologic conditions such as inflammation or ischemiareperfusion by multiple mechanisms.

  18. Life prediction of OLED for constant-stress accelerated degradation tests using luminance decaying model

    In order to acquire the life information of organic light emitting diode (OLED), three groups of constant stress accelerated degradation tests are performed to obtain the luminance decaying data of samples under the condition that the luminance and the current are respectively selected as the indicator of performance degradation and the test stress. Weibull function is applied to describe the relationship between luminance decaying and time, least square method (LSM) is employed to calculate the shape parameter and scale parameter, and the life prediction of OLED is achieved. The numerical results indicate that the accelerated degradation test and the luminance decaying model reveal the luminance decaying law of OLED. The luminance decaying formula fits the test data very well, and the average error of fitting value compared with the test data is small. Furthermore, the accuracy of the OLED life predicted by luminance decaying model is high, which enable rapid estimation of OLED life and provide significant guidelines to help engineers make decisions in design and manufacturing strategy from the aspect of reliability life. - Highlights: • We gain luminance decaying data by accelerated degradation tests on OLED. • The luminance decaying model objectively reveals the decaying law of OLED luminance. • The least square method (LSM) is employed to calculate Weibull parameters. • The plan designed for accelerated degradation tests proves to be feasible. • The accuracy of the OLED life and the luminance decaying fitting formula is high

  19. Red Bull Crisis

    2009-01-01

    Additives make Red Bull the first company to test China’s new Food Safety Law "Drink Red Bull when you feel sleepy or tired" is a famous advertising slogan well-known to Chinese. But a recent German

  20. American Red Cross

    ... to Help Sand Fire Evacuees » 90% of the Red Cross Workforce are Volunteers Learn More. Search for ... Volunteer» Digital Advocates» SEARCH FOR OPENINGS Shop the Red Cross Store Be Prepared and Ready to Respond ...

  1. Red Wine Over China

    2007-01-01

    The color red dominates Chinese life and now growing interest in red wine maintains that trend and ushers in a new fashionable addition to local culture There was a time when trying to find a good red wine in China was a difficult affair. But as with all

  2. Longitudinal measurements of luminance and chromatic contrast sensitivity: comparison between wavefront-guided LASIK and contralateral PRK for myopia

    Mirella Telles Salgueiro Barboni

    2013-10-01

    Full Text Available PURPOSE: The present study aimed to compare the postoperative contrast sensitivity functions between wavefront-guided LASIK eyes and their contralateral wavefront-guided PRK eyes. METHODS: The participants were 11 healthy subjects (mean age=32.4 ± 6.2 years who had myopic astigmatism. The spatial contrast sensitivity functions were measured before and three times after the surgery. Psycho and a Cambridge graphic board (VSG 2/4 were used to measure luminance, red-green, and blue-yellow spatial contrast sensitivity functions (from 0.85 to 13.1 cycles/degree. Longitudinal analysis and comparison between surgeries were performed. RESULTS: There was no significant contrast sensitivity change during the one-year follow-up measurements neither for LASIK nor for PRK eyes. The comparison between procedures showed no differences at 12 months postoperative. CONCLUSIONS: The present data showed similar contrast sensitivities during one-year follow-up of wave-front guided refractive surgeries. Moreover, one year postoperative data showed no differences in the effects of either wavefront-guided LASIK or wavefront-guided PRK on the luminance and chromatic spatial contrast sensitivity functions.

  3. Extensive Transcriptomic and Genomic Analysis Provides New Insights about Luminal Breast Cancers

    Tishchenko, Inna; Milioli, Heloisa Helena; Riveros, Carlos; Moscato, Pablo

    2016-01-01

    Despite constituting approximately two thirds of all breast cancers, the luminal A and B tumours are poorly classified at both clinical and molecular levels. There are contradictory reports on the nature of these subtypes: some define them as intrinsic entities, others as a continuum. With the aim of addressing these uncertainties and identifying molecular signatures of patients at risk, we conducted a comprehensive transcriptomic and genomic analysis of 2,425 luminal breast cancer samples. Our results indicate that the separation between the molecular luminal A and B subtypes—per definition—is not associated with intrinsic characteristics evident in the differentiation between other subtypes. Moreover, t-SNE and MST-kNN clustering approaches based on 10,000 probes, associated with luminal tumour initiation and/or development, revealed the close connections between luminal A and B tumours, with no evidence of a clear boundary between them. Thus, we considered all luminal tumours as a single heterogeneous group for analysis purposes. We first stratified luminal tumours into two distinct groups by their HER2 gene cluster co-expression: HER2-amplified luminal and ordinary-luminal. The former group is associated with distinct transcriptomic and genomic profiles, and poor prognosis; it comprises approximately 8% of all luminal cases. For the remaining ordinary-luminal tumours we further identified the molecular signature correlated with disease outcomes, exhibiting an approximately continuous gene expression range from low to high risk. Thus, we employed four virtual quantiles to segregate the groups of patients. The clinico-pathological characteristics and ratios of genomic aberrations are concordant with the variations in gene expression profiles, hinting at a progressive staging. The comparison with the current separation into luminal A and B subtypes revealed a substantially improved survival stratification. Concluding, we suggest a review of the definition of

  4. Spitzer IRS-based Classification of Luminous 8 Micron Sources in the Large Magellanic Cloud

    Thorndike, S L; Hrivnak, B J; Sahai, R; Egan, M; Thorndike, Stephen L.; Buchanan, Joel H. Kastner & Catherine; Hrivnak, Bruce J.; Sahai, Raghvendra; Egan, Michael

    2007-01-01

    To ascertain the nature of the brightest mid-infrared sources in the Large Magellanic Cloud (LMC), we have applied the Buchanan et al. (2006) 2MASS-MSX color classification system, which is based on the results of Spitzer Space Telescope spectroscopy, to a mid-infrared flux-limited sample of 254 LMC objects for which 2MASS and MSX photometry is available. We find 72 sources are most likely H II regions; 49 sources are identified as oxygen rich objects, where 42 of these are red supergiants and 7 are likely oxygen rich asymptotic giant branch (AGB) stars; 77 sources are identified as carbon-rich AGB stars; and 7 objects are found to be foreground Mira variables in the halo of the Milky Way. An additional 49 objects cannot be reliably classified based on their positions in 2MASS/MSX color-color and color-magnitude diagrams. The very large ratio of carbon-rich to oxygen-rich objects among the luminous and heavily dust-enshrouded AGB stars in our sample (~10:1) is consistent with the hypothesis that carbon stars ...

  5. Strange mode instability for micro-variations in Luminous Blue Variables

    Saio, Hideyuki; Meynet, Georges

    2013-01-01

    If a massive star has lost significant mass during its red-supergiant stage, it would return to blue region in the HR diagram and spend a part of the core-He burning stage as a blue supergiant having a luminosity to mass ratio (L/M) considerably larger than about 10^4 (in solar units); the duration depends on the degree of internal mixing and on the metallicity. Then, various stellar pulsations are excited by enhanced \\kappa-mechanism and strange mode instability. Assuming these pulsations to be responsible for (at least some of) the quasi-periodic light and radial-velocity variations in \\alpha Cygni variables including luminous blue variables (LBVs; or S Dor variables), we can predict masses and surface compositions for these variables, and compare them with observed ones to constrain the evolutionary models. We discuss radial pulsations excited in evolutionary models of an initial mass of 40 M_\\odot with solar metallicity of Z=0.014, and compare them to micro-variations in the two Galactic LBVs, HR Car and ...

  6. VARIABILITY OF LUMINOUS STARS IN THE LARGE MAGELLANIC CLOUD USING 10 YEARS OF ASAS DATA

    Motivated by the detection of a recent outburst of the massive luminous blue variable LMC-R71, which reached an absolute magnitude MV = -9.3 mag, we undertook a systematic study of the optical variability of 1268 massive stars in the Large Magellanic Cloud, using a recent catalog by Bonanos et al. as the input. The ASAS All Star Catalog provided well-sampled light curves of these bright stars spanning 10 years. Combining the two catalogs resulted in 599 matches, on which we performed a variability search. We identified 117 variable stars, 38 of which were not known before, despite their brightness and large amplitude of variation. We found 13 periodic stars that we classify as eclipsing binary (EB) stars, 8 of which are newly discovered bright massive EBs composed of OB-type stars. The remaining 104 variables are either semi- or non-periodic, the majority (85) being red supergiants (RSGs). Most (26) of the newly discovered variables in this category are also RSGs with only three B and four O stars.

  7. A search for gravitational lensing among highly luminous quasars - New results

    Magain, P.; Remy, M.; Surdej, J.; Swings, J.-P.; Smette, A.

    Images of highly luminous QSOs are analyzed to determine whether the gravitational magnification of the background QSO by matter associated with the foreground galaxies accounts for the excess of galaxies in the fields of distant QSOs. Galaxy detection is increased by utilizing red-filter images, 40 taken with the EFOSC at the ESO 3.6-m telescope and 43 taken with a direct CCD camera at the ESO/MPI 2.2-m telescope. The R-magnitude ranges from 22.5 to 23.0 for the sample, for which the number of galaxies is counted by eye, showing 45 galaxies of radio and optical type. The overdensity found is not as pronounced as that of Fugmann (1988) or that of Webster et al. (1988). A systematic subtraction of the point spread function is also described to investigate the idea that some galaxies responsible for the QSO light magnification are within the inner 3-arcsec circle. The galaxies very close to the line-of-sight are theorized to contribute significantly to the magnification of these QSOs.

  8. High-resolution radio observations of nuclear and circumnuclear starbursts in Luminous Infrared Galaxies

    Perez-Torres, Miguel A

    2008-01-01

    High-resolution radio observations of nearby starburst galaxies have shown that the distribution of their radio emission consists of a compact (<150 pc), high surface brightness, central radio source immersed in a low surface brightness circumnuclear halo. This radio structure is similar to that detected in bright Seyferts galaxies like NGC 7469 or Mrk 331, which display clear circumnuclear rings. While the compact, centrally located radio emission in these starbursts might be generated by a point-like source (AGN), or by the combined effect of multiple radio supernovae and supernova remnants (e.g., the evolved nuclear starburst in Arp~220), it seems well established that the circumnuclear regions of those objects host an ongoing burst of star-formation (e.g., NGC 7469; Colina et al. 2001, Alberdi et al. 2006). Therefore, high-resolution radio observations of Luminous Infra-Red Galaxies (LIRGs) in our local universe are a powerful tool to probe the dominant dust heating mechanism in their nuclear and circu...

  9. OBSERVATIONAL CONSTRAINTS ON RED AND BLUE HELIUM BURNING SEQUENCES

    We derive the optical luminosity, colors, and ratios of the blue and red helium burning (HeB) stellar populations from archival Hubble Space Telescope observations of nineteen starburst dwarf galaxies and compare them with theoretical isochrones from Padova stellar evolution models across metallicities from Z = 0.001 to 0.009. We find that the observational data and the theoretical isochrones for both blue and red HeB populations overlap in optical luminosities and colors and the observed and predicted blue to red HeB ratios agree for stars older than 50 Myr over the time bins studied. These findings confirm the usefulness of applying isochrones to interpret observations of HeB populations. However, there are significant differences, especially for the red HeB population. Specifically, we find (1) offsets in color between the observations and theoretical isochrones of order 0.15 mag (0.5 mag) for the blue (red) HeB populations brighter than MV ∼ -4 mag, which cannot be solely due to differential extinction; (2) blue HeB stars fainter than MV ∼ -3 mag are bluer than predicted; (3) the slope of the red HeB sequence is shallower than predicted by a factor of ∼3; and (4) the models overpredict the ratio of the most luminous blue to red HeB stars corresponding to ages ∼ 0.5 Zsun), the red HeB stars overlap with the red giant branch stars in the color-magnitude diagrams, thus reducing their usefulness as indicators of star formation for ages ∼> 100 Myr.

  10. LUMINOUS SATELLITES VERSUS DARK SUBHALOS: CLUSTERING IN THE MILKY WAY

    Bozek, Brandon; Wyse, Rosemary F. G. [Physics and Astronomy Department, Johns Hopkins University, 3400 North Charles Street, Baltimore, MD 21218 (United States); Gilmore, Gerard, E-mail: bbozek@pha.jhu.edu [Institute of Astronomy, University of Cambridge, Madingley Road, Cambridge CB3 0HA (United Kingdom)

    2013-08-01

    The observed population of the Milky Way satellite galaxies offers a unique testing ground for galaxy formation theory on small scales. Our novel approach was to investigate the clustering of the known Milky Way satellite galaxies and to quantify the amount of substructure within their distribution using a two-point correlation function statistic in each of three spaces: configuration space, line-of-sight velocity space, and four-dimensional (4D) phase space. These results were compared to those for three sets of subhalos in the Via Lactea II cold dark matter (CDM) simulation defined to represent the luminous dwarfs. We found no evidence at a significance level above 2{sigma} of substructure within the distribution of the Milky Way satellite galaxies in any of the three spaces. The 'luminous' subhalo sets are more strongly clustered than are the Milky Way satellites in all three spaces and over a broader range of scales in 4D phase space. Each of the 'luminous' subhalo sets are clustered as a result of substructure within their line-of-sight velocity space distributions at greater than 3{sigma} significance, whereas the Milky Way satellite galaxies are randomly distributed in line-of-sight velocity space. While our comparison is with only one CDM simulation, the inconsistencies between the Milky Way satellite galaxies and the Via Lactea II subhalo sets for all clustering methods suggest a potential new 'small-scale' tension between CDM theory and the observed Milky Way satellites. Future work will obtain a more robust comparison between the observed Milky Way satellites and CDM theory by studying additional simulations.

  11. HER2 status and disparities in luminal breast cancers.

    Holowatyj, Andreana N; Ruterbusch, Julie J; Ratnam, Manohar; Gorski, David H; Cote, Michele L

    2016-08-01

    National Comprehensive Care Network guidelines for adjuvant treatment of invasive breast cancer are based on HER2 and hormone receptor (HR) status, where HR+ disease encompasses all estrogen receptor (ER)+ and/or progesterone receptor (PR)+ tumors. We sought to explore clinical and demographic differences among patients with HR+ breast cancer subtypes, and the role of HER2 status, age, race/ethnicity, and socioeconomic status (SES) in disease risk. We evaluated breast cancer subtype distribution, defined by HR and HER2 status, using patient clinical, demographic, and socioeconomic characteristics. Differences in HR categories by demographic and tumor characteristics were examined using chi-squared tests. Multinomial logistic regression was used to estimate odds ratios (OR) and 95% confidence intervals (CI) to quantify associations between breast cancer HR status and demographic factors. We found that differences in HR+ (ER-/PR+ vs. ER+/PR- or ER+/PR+) tumor biology are likely clinically significant and may play a role in breast cancer, regardless of HER2 status. While clinical and patient characteristics differed within each luminal subtype, we found disparities in SES only among Luminal A (HR+/HER2-) tumors. Among HR+/HER2- cases, we observed that ER-/PR+ patients tend to live in areas of higher poverty (OR = 1.20, 95% CI = 1.03-1.40) and are 70% more likely to be aged 50 years or older. However, this pattern was not found in women with Luminal B (HR+/HER2+) disease (Poverty OR = 0.98, 95% CI = 0.76-1.27; Age OR = 1.01, 95% CI = 0.81-1.26). Racial/ethnic disparities among non-Hispanic black and Hispanic women persisted across HR+/HER2- cases compared to non-Hispanic white women. Our findings suggest that while race/ethnicity and SES are correlated, each plays an independent role in contributing to disease among Luminal A tumors. Further study is needed to investigate how tumor biology, race/ethnicity, and socioeconomic disparities among HR+/HER2

  12. Automated selection of LEDs by luminance and chromaticity coordinate

    Fischer, Ulrich H P; Reinboth, Christian

    2010-01-01

    The increased use of LEDs for lighting purposes has led to the development of numerous applications requiring a pre-selection of LEDs by their luminance and / or their chromaticity coordinate. This paper demonstrates how a manual pre-selection process can be realized using a relatively simple configuration. Since a manual selection service can only be commercially viable as long as only small quantities of LEDs need to be sorted, an automated solution suggests itself. This paper introduces such a solution, which has been developed by Harzoptics in close cooperation with Rundfunk Gernrode. The paper also discusses current challenges in measurement technology as well as market trends.

  13. Positron excess, luminous-dark matter unification and family structure

    It is commonly assumed that dark matter may be composed of one or at most a few elementary particles. PAMELA data present a window of opportunity into a possible relationship between luminous and dark matter. Along with ATIC data the two positron excesses are interpreted as a reflection of dark matter family structure. In a unified model it is predicted that at least a third enhancement might show up at a different energy. The strength of the enhancements however depends on interfamily mixing angles.

  14. The Exceptionally Luminous Type Ia Supernova 2007if

    Yuan, F.; Quimby, R. M.; Wheeler, J C; Vinko, J.; Chatzopoulos, E.; Akerlof, C. W.; Kulkarni, S.; Miller, J M; McKay, T. A.; Aharonian, F.

    2010-01-01

    SN 2007if was the third over-luminous SN Ia detected after 2003fg and 2006gz. We present the photometric and spectroscopic observations of the supernova and its host by ROTSE-III, HET and Keck. From the H_alpha line identified in the host spectra, we determine a redshift of 0.0736. At this distance, the supernova reached an absolute magnitude of -20.4, brighter than any other SNe Ia ever observed. If the source of luminosity is radioactive decay, a large amount of radioactive nickel (~1.5 sol...

  15. Coronaridine congeners inhibit human α3β4 nicotinic acetylcholine receptors by interacting with luminal and non-luminal sites.

    Arias, Hugo R; Targowska-Duda, Katarzyna M; Feuerbach, Dominik; Jozwiak, Krzysztof

    2015-08-01

    To characterize the interaction of coronaridine congeners with human (h) α3β4 nicotinic acetylcholine receptors (AChRs), structural and functional approaches were used. The Ca(2+) influx results established that coronaridine congeners noncompetitively inhibit hα3β4 AChRs with the following potency (IC50's in μM) sequence: (-)-ibogamine (0.62±0.23)∼(+)-catharanthine (0.68±0.10)>(-)-ibogaine (0.95±0.10)>(±)-18-methoxycoronaridine [(±)-18-MC] (1.47±0.21)>(-)-voacangine (2.28±0.33)>(±)-18-methylaminocoronaridine (2.62±0.57 μM)∼(±)-18-hydroxycoronaridine (2.81±0.54)>(-)-noribogaine (6.82±0.78). A good linear correlation (r(2)=0.771) between the calculated IC50 values and their polar surface area was found, suggesting that this is an important structural feature for its activity. The radioligand competition results indicate that (±)-18-MC and (-)-ibogaine partially inhibit [(3)H]imipramine binding by an allosteric mechanism. Molecular docking, molecular dynamics, and in silico mutation results suggest that protonated (-)-18-MC binds to luminal [i.e., β4-Phe255 (phenylalanine/valine ring; position 13'), and α3-Leu250 and β4-Leu251 (leucine ring; position 9')], non-luminal, and intersubunit sites. The pharmacophore model suggests that nitrogens from the ibogamine core as well as methylamino, hydroxyl, and methoxyl moieties at position 18 form hydrogen bonds. Collectively our data indicate that coronaridine congeners inhibit hα3β4 AChRs by blocking the ion channel's lumen and probably by additional negative allosteric mechanisms by interacting with a series of non-luminal sites. PMID:26022277

  16. Luminal DMSO: Effects on Detrusor and Urothelial/Lamina Propria Function

    Smith, Katrina J.; Russ Chess-Williams; Catherine McDermott

    2014-01-01

    DMSO is used as a treatment for interstitial cystitis and this study examined the effects of luminal DMSO treatment on bladder function and histology. Porcine bladder was incubated without (controls) or with DMSO (50%) applied to the luminal surface and the release of ATP, acetylcholine, and LDH assessed during incubation and in tissues strips after DMSO incubation. Luminally applied DMSO caused ATP, Ach, and LDH release from the urothelial surface during treatment, with loss of urothelial la...

  17. THE METHOD OF CAR HEADLIGHTS LUMINOUS INTENSITY MEASURING FOR NON-POINT SOURCES OF LIGHT

    A. Kupko

    2015-12-01

    Full Text Available It is shown that the measurements of luminous intensity of car headlights luminous intensity for non-point sources have pecularities. A simplified method for correction the luminous intensity at various distances is developed. The applicability of the given method with possible measurement errors is studied. The results were obtained, using a stand of the National Scientific Center “Institute of Metroligy”.

  18. Identifying Luminous AGN in Deep Surveys: Revised IRAC Selection Criteria

    Donley, J L; Brusa, M; Capak, P; Cardamone, C N; Civano, F; Ilbert, O; Impey, C D; Kartaltepe, J S; Miyaji, T; Salvato, M; Sanders, D B; Trump, J R; Zamorani, G

    2012-01-01

    Spitzer IRAC selection is a powerful tool for identifying luminous AGN. For deep IRAC data, however, the AGN selection wedges currently in use are heavily contaminated by star-forming galaxies, especially at high redshift. Using the large samples of luminous AGN and high-redshift star-forming galaxies in COSMOS, we redefine the AGN selection criteria for use in deep IRAC surveys. The new IRAC criteria are designed to be both highly complete and reliable, and incorporate the best aspects of the current AGN selection wedges and of infrared power-law selection while excluding high redshift star-forming galaxies selected via the BzK, DRG, LBG, and SMG criteria. At QSO-luminosities of log L(2-10 keV) (ergs/s) > 44, the new IRAC criteria recover 75% of the hard X-ray and IRAC-detected XMM-COSMOS sample, yet only 38% of the IRAC AGN candidates have X-ray counterparts, a fraction that rises to 52% in regions with Chandra exposures of 50-160 ks. X-ray stacking of the individually X-ray non-detected AGN candidates lead...

  19. Reduced-Reference Video Quality Estimation Using Representative Luminance

    Yamada, Toru; Miyamoto, Yoshihiro; Serizawa, Masahiro; Nishitani, Takao

    This paper proposes a video-quality estimation method based on a reduced-reference model for realtime quality monitoring in video streaming services. The proposed method chooses representative-luminance values for individual original-video frames at a server side and transmits those values, along with the pixel-position information of the representative-luminance values in each frame. On the basis of this information, peak signal-to-noise ratio (PSNR) values at client sides can be estimated. This enables realtime monitoring of video-quality degradation by transmission errors. Experimental results show that accurate PSNR estimation can be achieved with additional information at a low bit rate. For SDTV video sequences which are encoded at 1 to 5Mbps, accurate PSNR estimation (correlation coefficient of 0.92 to 0.95) is achieved with small amount of additional information of 10 to 50kbps. This enables accurate realtime quality monitoring in video streaming services without average video-quality degradation.

  20. Companions around the nearest luminous galaxies: segregation and selection effects

    Karachentsev, I D

    2015-01-01

    Using the "Updated Nearby Galaxy Catalog", we consider different properties of companion galaxies around luminous hosts in the Local Volume. The data on stellar masses, linear diameters,surface brightnesses, HI-richness, specific star formation rate (sSFR), and morphological types are discussed for members of the nearest groups, including the Milky Way and M 31 groups, as a function of their separation from the hosts. Companion galaxies in groups tend to have lower stellar masses, smaller linear diameters and fainter mean surface brightnesses as the distance to their host decreases. The hydrogen-to-stellar mass ratio of the companions increases with their linear projected separation from the dominant luminous galaxy. This tendency is more expressed around the bulge-dominated hosts. While linear separation of the companions decreases, their mean sSFR becomes lower, accompanied with the increasing sSFR scatter. Typical linear projected separation of dSphs around the bulge-dominated hosts, 350 kpc, is substantia...

  1. Radiation detection using long lasting phosphor (luminous paint)

    The detection characteristic of long lasting phosphor (LLP, SrAl2O4; Eu2+, Dy3+) has been studied in α, β, and γ radiation field. It was found that the total luminous intensity of LLP had linear response over a wide range of absorbed energy for all radiations. The luminous intensity showed significant temperature dependence and the peak intensity was observed near room temperature. The thermoluminescence glow curve suggested that the luminosity of LLP consisted of 4-components and the time profile of LLP luminescence was found to be described by a simple sum of these components. The Arrhenius plot of escape rates calculated from the afterglow region provided the activation energies of escape process form trap levels and these values were ranged from 24 meV to 0.34 eV, which corresponded to the escape rates of 0.8-8.3x103 s-1 at room temperature. The trapping ratios to the 4 traps were also determined from afterglow ratio curves and had no temperature dependence. These trapping ratios were ranging from 0.16 to 0.35 for β and γ irradiation and slightly different values were obtained for α rays. The experimental time profile can be fitted within experimental error using the trapping ratios and escape rates. Various applications of LLP will be expected as radiation detectors, especially as 2-dimensional imaging devices. (author)

  2. The luminous and dark matter content of disk galaxies

    Zavala, I; Hernández-Toledo, H M; Firmani, C

    2003-01-01

    For a compiled sample of disk galaxies with available photometry (B and K bands), velocity line-widths and HI integral fluxes, several parameters which trace the luminous, baryonic and dark matter contents were inferred. We investigated how these parameters do vary with different galaxy properties, and confronted the results with predictions of galaxy evolutionary models in the context of the LCDM cosmogony. The ratio of disk-to-total maximum circular velocity, vd/vt, depends mainly on the central disk surface density Sig_d (or surface brightness, SB), increasing roughly as Sig_d^0.15. While a fraction of high SB galaxies have a vd/vt ratio corresponding to the maximum disk solution, the low SB are completely dark matter dominated. The trend is similar for the models, although they have slightly smaller vd/vt ratios than observations. An analysis of residuals of the vd/vt-Sig_d relation shows that vd/vt tends to decrease as the galaxy is redder, more luminous (massive), and of earlier type. The models allow u...

  3. Effect of americium-241 on luminous bacteria. Role of peroxides

    Alexandrova, M., E-mail: maka-alexandrova@rambler.r [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Rozhko, T. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Vydryakova, G. [Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation); Kudryasheva, N. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation)

    2011-04-15

    The effect of americium-241 ({sup 241}Am), an alpha-emitting radionuclide of high specific activity, on luminous bacteria Photobacterium phosphoreum was studied. Traces of {sup 241}Am in nutrient media (0.16-6.67 kBq/L) suppressed the growth of bacteria, but enhanced luminescence intensity and quantum yield at room temperature. Lower temperature (4 {sup o}C) increased the time of bacterial luminescence and revealed a stage of bioluminescence inhibition after 150 h of bioluminescence registration start. The role of conditions of exposure the bacterial cells to the {sup 241}Am is discussed. The effect of {sup 241}Am on luminous bacteria was attributed to peroxide compounds generated in water solutions as secondary products of radioactive decay. Increase of peroxide concentration in {sup 241}Am solutions was demonstrated; and the similarity of {sup 241}Am and hydrogen peroxide effects on bacterial luminescence was revealed. The study provides a scientific basis for elaboration of bioluminescence-based assay to monitor radiotoxicity of alpha-emitting radionuclides in aquatic solutions. - Highlights: {yields} Am-241 in water solutions (A = 0.16-6.7 kBq/L) suppresses bacterial growth.{yields} Am-241 (A = 0.16-6.7 kBq/L) stimulate bacterial luminescence. {yields} Peroxides, secondary radiolysis products, cause increase of bacterial luminescence.

  4. Spectro-Polarimetry of Self-Luminous Extrasolar Planets

    Sujan Sengupta

    2013-06-01

    Planets which are old and close to their parent stars are considered as reflecting planets because their intrinsic temperature is extremely low but they are heated strongly by the impinging stellar radiation and hence radiation of such planets are the reflected star light that is governed by the stellar radiation, orbital distance and albedo of the planet. These planets cannot be resolved from the host stars. The second kind of exoplanets are those which are very young and hence they have high intrinsic temperature. They are far away from their star and so they can be resolved by blocking the star-light. It is now realized that radiation of such planets are linearly polarized due to atmospheric scattering and polarization can determine various physical properties including the mass of such directly detected self-luminous exoplanets. It is suggested that a spectropolarimeter of even low spectral resolution and with a capacity to record linear polarization of 0.5–1% at the thirty-meter telescope would immensely help in understanding the atmosphere, especially the cloud chemistry of the self-luminous and resolvable exoplanets.

  5. Color Discrimination Is Affected by Modulation of Luminance Noise in Pseudoisochromatic Stimuli

    Cormenzana Méndez, Iñaki; Martín, Andrés; Charmichael, Teaire L.; Jacob, Mellina M.; Lacerda, Eliza M. C. B.; Gomes, Bruno D.; Fitzgerald, Malinda E. C.; Ventura, Dora F.; Silveira, Luiz C. L.; O'Donell, Beatriz M.; Souza, Givago S.

    2016-01-01

    Pseudoisochromatic stimuli have been widely used to evaluate color discrimination and to identify color vision deficits. Luminance noise is one of the stimulus parameters used to ensure that subject's response is due to their ability to discriminate target stimulus from the background based solely on the hue between the colors that compose such stimuli. We studied the influence of contrast modulation of the stimulus luminance noise on threshold and reaction time color discrimination. We evaluated color discrimination thresholds using the Cambridge Color Test (CCT) at six different stimulus mean luminances. Each mean luminance condition was tested using two protocols: constant absolute difference between maximum and minimum luminance of the luminance noise (constant delta protocol, CDP), and constant contrast modulation of the luminance noise (constant contrast protocol, CCP). MacAdam ellipses were fitted to the color discrimination thresholds in the CIE 1976 color space to quantify the color discrimination ellipses at threshold level. The same CDP and CCP protocols were applied in the experiment measuring RTs at three levels of stimulus mean luminance. The color threshold measurements show that for the CDP, ellipse areas decreased as a function of the mean luminance and they were significantly larger at the two lowest mean luminances, 10 cd/m2 and 13 cd/m2, compared to the highest one, 25 cd/m2. For the CCP, the ellipses areas also decreased as a function of the mean luminance, but there was no significant difference between ellipses areas estimated at six stimulus mean luminances. The exponent of the decrease of ellipse areas as a function of stimulus mean luminance was steeper in the CDP than CCP. Further, reaction time increased linearly with the reciprocal of the length of the chromatic vectors varying along the four chromatic half-axes. It decreased as a function of stimulus mean luminance in the CDP but not in the CCP. The findings indicated that visual

  6. Identification of Different Classes of Luminal Progenitor Cells within Prostate Tumors

    Supreet Agarwal

    2015-12-01

    Full Text Available Primary prostate cancer almost always has a luminal phenotype. However, little is known about the stem/progenitor properties of transformed cells within tumors. Using the aggressive Pten/Tp53-null mouse model of prostate cancer, we show that two classes of luminal progenitors exist within a tumor. Not only did tumors contain previously described multipotent progenitors, but also a major population of committed luminal progenitors. Luminal cells, sorted directly from tumors or grown as organoids, initiated tumors of adenocarcinoma or multilineage histological phenotypes, which is consistent with luminal and multipotent differentiation potentials, respectively. Moreover, using organoids we show that the ability of luminal-committed progenitors to self-renew is a tumor-specific property, absent in benign luminal cells. Finally, a significant fraction of luminal progenitors survived in vivo castration. In all, these data reveal two luminal tumor populations with different stem/progenitor cell capacities, providing insight into prostate cancer cells that initiate tumors and can influence treatment response.

  7. Luminance meter for photopic and scotopic measurements in the mesopic range

    Shpak, M.; Kärhä, P.; Porrovecchio, G.; Smid, M.; Ikonen, E.

    2014-09-01

    This paper presents a design and realization of a dual-channel luminance meter for simultaneous measurement of luminance with photopic and scotopic weightings. Such measurements are useful in mesopic conditions, i.e. when the luminance is in the range of 0.005-5 cd m-2. The instrument is a spot luminance meter with two spectrally weighted channels. The collected light is detected with silicon detectors and a computer-controlled dual-channel switched-integration amplifier. The instrument is characterized for relative spectral responsivity against a calibrated spectroradiometer using a radiance source based on an integrating sphere with input from a monochromator. An absolute luminance responsivity calibration is made against a sphere-based luminance standard at a level close to the high end of the mesopic range. The standard uncertainty in luminance responsivity calibration is 0.3% for the photopic channel and 0.6% for the scotopic channel. In addition, characterization measurements were carried out for the instrument’s linearity, stray light sensitivity and polarization dependence. The results show very good noise performance, allowing fast measurements over the whole mesopic range. The noise equivalent power was measured to be approximately 20 fW Hz-1/2, equal to a noise equivalent luminance of 30 µcd m-2 Hz-1/2. Estimated uncertainty of measurements for typical light sources is 2.2% (k = 2) at the lowest luminance levels of the mesopic range.

  8. THE AGN, STAR-FORMING, AND MORPHOLOGICAL PROPERTIES OF LUMINOUS IR-BRIGHT/OPTICALLY-FAINT GALAXIES

    We present the active galactic nucleus (AGN), star-forming, and morphological properties of a sample of 13 MIR-luminous (f 24 ∼> 700 μJy) IR-bright/optically-faint galaxies (IRBGs, f24/f R ∼> 1000). While these z ∼ 2 sources were drawn from deep Chandra fields with >200 ks X-ray coverage, only seven are formally detected in the X-ray and four lack X-ray emission at even the 2σ level. Spitzer InfraRed Spectrograph (IRS) spectra, however, confirm that all of the sources are AGN-dominated in the mid-IR, although half have detectable polycyclic aromatic hydrocarbon (PAH) emission responsible for ∼25% of their mid-infrared flux density. When combined with other samples, this indicates that at least 30%-40% of luminous IRBGs have star formation rates in the ultraluminous infrared galaxy (ULIRG) range (∼100-2000 Msun yr-1). X-ray hardness ratios and MIR to X-ray luminosity ratios indicate that all members of the sample contain heavily X-ray obscured AGNs, 80% of which are candidates to be Compton thick. Furthermore, the mean X-ray luminosity of the sample, log L2-10keV(erg s-1) ∼44.6, indicates that these IRBGs are Type 2 QSOs, at least from the X-ray perspective. While those sources most heavily obscured in the X-ray are also those most likely to display strong silicate absorption in the mid-IR, silicate absorption does not always accompany X-ray obscuration. Finally, ∼70% of the IRBGs are merger candidates, a rate consistent with that of sub-mm galaxies (SMGs), although SMGs appear to be physically larger than IRBGs. These characteristics are consistent with the proposal that these objects represent a later, AGN-dominated, and more relaxed evolutionary stage following soon after the star-formation-dominated one represented by the SMGs.

  9. Inquiring into Red/Red Inquiring

    Ken Gale

    2013-05-01

    Full Text Available This layered account of an inquiry into ‘red’ emerged out of a collective biography workshop. In the middle of the Wiltshire countryside, an international and interdisciplinary group of scholars gathered together to write and make other things and marks on paper that asked questions of, and into, the spaces between words, people, things and their environments. We did not set out to workshop or write into or paint ‘red’ but, rather, it was red that slipped in, uninvited, and painted and wrote us. Red arose as a blush or a stain seeping amongst us that became referenced obliquely by material objects, metaphors and fairytales. The stain spread, became noticeable through our weekend together and beyond it, creating another (bright red artery vein of connection to write with.

  10. Luminal lactate in acute pancreatitis - validation and relation to disease severity

    Pynnönen Lauri

    2012-04-01

    Full Text Available Abstract Background Increased rectal luminal lactate concentration may be associated with the severity of the septic shock and high dose of vasopressors. It suggests hypoperfusion of the gut mucosa. This is potentially associated with bacterial translocation from the gut leading to local and systemic inflammation. In acute pancreatitis (AP bacterial translocation is considered as the key event leading to infection of necrotic pancreatic tissue and high severity of illness. Methods We used rectal luminal equilibration dialysis for the measurement of gut luminal lactate in 30 consecutive patients admitted to hospital due to acute pancreatitis to test the hypothesis that a single measurement of rectal luminal lactate predicts the severity of acute pancreatitis, the length of hospital stay, the need of intensive care and ultimately, mortality. We also tested the physiological validity of luminal lactate concentration by comparing it to luminal partial tension of oxygen. Additionally, a comparison between two different L-lactate analyzers was performed. Results High rectal luminal lactate was associated with low mucosal partial tension of oxygen (R = 0.57, p = 0.005 thereby indicating the physiological validity of the method. Rectal luminal lactate at the hospital admission was not associated with the first day or the highest SOFA score, CRP level, hospital length of stay, length of stay in intensive care or mortality. In this cohort of unselected consecutive patients with acute pancreatitis we observed a tendency of increased rectal lactate in the severe cases. Low precision and high bias was observed between two lactate analyzers. Conclusions The association between rectal luminal lactate and oxygen tension indicates that luminal lactate is a marker mucosal anaerobiosis. Comparison between two different analyzers showed poor, non-constant precision over the range of lactate concentrations. Rectal luminal lactate concentration at the time of

  11. Effect of light conversion agent on luminous properties of a new down-converting material SrAl2O4:Eu2+,Dy3+/light conversion agent

    朱亚楠; 逄增媛; 王建; 葛明桥; 孙思瑾; 胡泽华; 翟佳鹤; 高佳欣; 姜伏生

    2016-01-01

    A new luminous materialSrAl2O4:Eu2+,Dy3+/light conversion agent that can emit red light in the darkness after being ex-cited was fabricated by combining light conversion agent on to SrAl2O4:Eu2+,Dy3+particles through YsiX3. The morphology of the luminous materials was analyzed by scan electron microscopy (SEM). The emission behavior was evaluated by fluorescence spec-trophotometric analysis and the results demonstrated that the emission spectra of samples had a redshift compared to SrAl2O4:Eu2+, Dy3+ and the emission intensity rose dramatically atfirst and then decreased when the ratio of light conversion agentdoping was over 1.4 wt.%. And the emission color of SrAl2O4:Eu2+,Dy3+/light conversion agent was tuned from green (SrAl2O4:Eu2+,Dy3+) to or-ange-red. Furthermore, the afterglow property was also investigated, and the results indicated that the afterglow brightness reached 6.5 cd/m2, and as the light conversion agent concentration increased the brightness intensity decreased.

  12. A New Luminous Blue Variable in M31

    Humphreys, Roberta M; Gordon, Michael S

    2015-01-01

    We report the fifth confirmed Luminous Blue Variable/S Doradus variable in M31. In 2006, J004526.62+415006.3 had the spectrum of hot Fe II emission line star with strong P Cygni profiles in the Balmer lines. In 2010, its absorption line spectrum resembled an early A-type supergiant with H and Fe II emission lines with strong P Cygni profiles, and in 2013 the spectrum had fully transitioned to an F-type supergiant due to the formation of the optically thick, cool wind which characterizes LBVs at maximum light. The photometric record supports the LBV/S Dor nature of the variability. Its bolometric luminosity ~ -9.65 mag places it on the HR Diagram near the known LBVs, AE And, Var C in M33 and S Dor.

  13. Shock waves in luminous early-type stars

    Shock waves that occur in stellar atmospheres have their origin in some hydrodynamic instability of the atmosphere itself or of the stellar interior. In luminous early-type stars these two possibilities are represented by shocks due to an unstable radiatively-accelerated wind, and to shocks generated by the non-radial pulsations known to be present in many or most OB stars. This review is concerned with the structure and development of the shocks in these two cases, and especially with the mass loss that may be due specifically to the shocks. Pulsation-produced shocks are found to be very unfavorable for causing mass loss, owing to the great radiation efficiency that allows them to remain isothermal. The situation regarding radiatively-driven shocks remains unclear, awaiting detailed hydrodynamics calculations. 20 refs., 2 figs

  14. Clustering of very luminous infrared galaxies and their environment

    Gao, YU

    1993-01-01

    The IRAS survey reveals a class of ultraluminous infrared (IR) galaxies (ULIRG's) with IR luminosities comparable to the bolometric luminosities of quasars. The nature, origin, and evolution of ULIRG's are attracting more and more attention recently. Since galaxy morphology is certainly a function of environment, morphological observations show that ULIRG's are interacting/merging galaxies, and some ULIRG's might be the dust-enshrouded quasars (S88) or giant ellipticals, the study of ULIRG's environment and large scale clustering effects should be worthwhile. ULIRG's and very luminous IR galaxies have been selected from the 2Jy IRAS redshift survey. Meanwhile, a catalog of IRAS groups of galaxies has been constructed using a percolation-like algorithm. Therefore, whether ULIRG's and/or VLIRG's have a group environment can be checked immediately. Other aspects of the survey are discussed.

  15. Partitioning contrast or luminance disparity into perceived intensity and rotation.

    Hetley, Richard S; Stine, Wm Wren

    2011-01-01

    While most of the work on stereopsis focuses on geometric disparities, humans also respond to intensity (contrast or luminance) disparities in the absence of geometric disparities. A rectangular-wave grating viewed with an intensity disparity engenders two perceptions: a perceived intensity, and a perceived rotation of the individual bars of the grating (the Venetian blind effect). Measuring perceived intensity and perceived rotation in gratings with intensity disparities, we found that the two degrees of freedom from the intensities presented to each eye are conserved in the form of two perceptions: perceived intensity is related to the sum of the grating intensities and perceived rotation is related to the difference. Perceived rotation as a function of intensity disparity was then modeled as a simple difference in the neural response of each eye. Perceived contrast and brightness as a function of intensity disparity were modeled using the two-stage gain-control model. PMID:21864458

  16. Black hole feedback in the luminous quasar PDS 456

    Nardini, E; Gofford, J; Harrison, F A; Risaliti, G; Braito, V; Costa, M T; Matzeu, G A; Walton, D J; Behar, E; Boggs, S E; Christensen, F E; Craig, W W; Hailey, C J; Matt, G; Miller, J M; O'Brien, P T; Stern, D; Turner, T J; Ward, M J

    2015-01-01

    The evolution of galaxies is connected to the growth of supermassive black holes in their centers. During the quasar phase, a huge luminosity is released as matter falls onto the black hole, and radiation-driven winds can transfer most of this energy back to the host galaxy. Over five different epochs, we detected the signatures of a nearly spherical stream of highly ionized gas in the broadband X-ray spectra of the luminous quasar PDS 456. This persistent wind is expelled at relativistic speeds from the inner accretion disk, and its wide aperture suggests an effective coupling with the ambient gas. The outflow's kinetic power larger than 10^46 ergs per second is enough to provide the feedback required by models of black hole and host galaxy co-evolution.

  17. Experimental information: 1096 [RED

    Full Text Available 1000_24_4_3 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  18. Experimental information: 1083 [RED

    Full Text Available 1000_22_6_5 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  19. Experimental information: 1079 [RED

    Full Text Available 1000_21_12_11 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  20. Experimental information: 1101 [RED

    Full Text Available 1000_24_14_13 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  1. Experimental information: 1091 [RED

    Full Text Available 1000_23_8_7 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  2. Experimental information: 1092 [RED

    Full Text Available 1000_23_10_9 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  3. Experimental information: 1077 [RED

    Full Text Available 1000_21_8_7 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  4. Experimental information: 1082 [RED

    Full Text Available 1000_22_4_3 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  5. Experimental information: 1097 [RED

    Full Text Available 1000_24_6_5 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  6. Experimental information: 1100 [RED

    Full Text Available 1000_24_12_11 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  7. Experimental information: 1085 [RED

    Full Text Available 1000_22_10_9 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  8. Experimental information: 1088 [RED

    Full Text Available 1000_23_2_1 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  9. Experimental information: 1090 [RED

    Full Text Available 1000_23_6_5 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  10. Experimental information: 1076 [RED

    Full Text Available 1000_21_6_5 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  11. Experimental information: 1099 [RED

    Full Text Available 1000_24_10_9 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  12. Experimental information: 1084 [RED

    Full Text Available 1000_22_8_7 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  13. Experimental information: 1087 [RED

    Full Text Available 1000_22_14_13 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... d Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  14. Experimental information: 1094 [RED

    Full Text Available 1000_23_14_13 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  15. Experimental information: 1089 [RED

    Full Text Available 1000_23_4_3 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  16. Experimental information: 1075 [RED

    Full Text Available 1000_21_4_3 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  17. Experimental information: 1080 [RED

    Full Text Available 1000_21_14_13 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  18. Experimental information: 1098 [RED

    Full Text Available 1000_24_8_7 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  19. Experimental information: 1095 [RED

    Full Text Available 1000_24_2_1 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  20. Experimental information: 1086 [RED

    Full Text Available 1000_22_12_11 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... d Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  1. Experimental information: 1078 [RED

    Full Text Available 1000_21_10_9 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  2. Experimental information: 1081 [RED

    Full Text Available 1000_22_2_1 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  3. Experimental information: 1074 [RED

    Full Text Available 1000_21_2_1 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  4. Experimental information: 1093 [RED

    Full Text Available 1000_23_12_11 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  5. Probe data: 5652 [RED

    Full Text Available R02-002330-1AR RED D41273 AU174297 ST3645 >AGU83687_1(U83687|pid:g1835701) Apium graveolens NADP ... H-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  6. OBSCURATION BY GAS AND DUST IN LUMINOUS QUASARS

    We explore the connection between absorption by neutral gas and extinction by dust in mid-infrared (IR) selected luminous quasars. We use a sample of 33 quasars at redshifts 0.7 < z ≲ 3 in the 9 deg2 Boötes multiwavelength survey field that are selected using Spitzer Space Telescope Infrared Array Camera colors and are well-detected as luminous X-ray sources (with >150 counts) in Chandra observations. We divide the quasars into dust-obscured and unobscured samples based on their optical to mid-IR color, and measure the neutral hydrogen column density N H through fitting of the X-ray spectra. We find that all subsets of quasars have consistent power law photon indices Γ ≈ 1.9 that are uncorrelated with N H. We classify the quasars as gas-absorbed or gas-unabsorbed if N H > 1022 cm–2 or N H < 1022 cm–2, respectively. Of 24 dust-unobscured quasars in the sample, only one shows clear evidence for significant intrinsic N H, while 22 have column densities consistent with N H < 1022 cm–2. In contrast, of the nine dust-obscured quasars, six show evidence for intrinsic gas absorption, and three are consistent with N H < 1022 cm–2. We conclude that dust extinction in IR-selected quasars is strongly correlated with significant gas absorption as determined through X-ray spectral fitting. These results suggest that obscuring gas and dust in quasars are generally co-spatial, and confirm the reliability of simple mid-IR and optical photometric techniques for separating quasars based on obscuration

  7. Physical properties of luminous dust-poor quasars

    We identify and characterize a population of luminous, dust-poor quasars at 0 < z < 5 that is photometrically similar to objects previously found at z > 6. This class of active galactic nuclei is known to show little IR emission from dusty structure, but it is poorly understood in terms of number evolution and dependence on physical quantities. To better understand the properties of these quasars, we compile a rest-frame UV to IR library of 41,000 optically selected type 1 quasars with L bol > 1045.7 erg s–1. After fitting the broadband spectral energy distributions (SEDs) with accretion disk and dust components, we find 0.6% of our sample to be hot dust-poor, with rest-frame 2.3 μm to 0.51 μm flux density ratios of –0.5 dex or less. The dust-poor SEDs are blue in the UV-optical and weak in the mid-IR, such that their accretion disks are less obscured and the hot dust emission traces that of warm dust down to the dust-poor regime. At a given bolometric luminosity, dust-poor quasars are lower in black hole mass and higher in Eddington ratio than general luminous quasars, suggesting that they are in a rapidly growing evolutionary state in which the dust-poor phase appears as a short or rare phenomenon. The dust-poor fraction increases with redshift, and possible implications for their evolution are discussed.

  8. Determination of the luminal diameter of the radial artery in man by high frequency ultrasound

    Nielsen, T H; Iversen, Helle Klingenberg; Tfelt-Hansen, P

    1990-01-01

    administration of 0.5 mg ergotamine tartrate to 5 subjects caused a decrease in the mean luminal diameter of the radial artery from 2.94 mm to 2.42 mm 1 h after ergotamine (p less than 0.05). This ultrasound method for measurements of the luminal diameter should thus be suitable for investigating the effects of...

  9. The Development of Luminance- and Texture-Defined Form Perception during the School-Aged Years

    Bertone, Armando; Hanck, Julie; Guy, Jacalyn; Cornish, Kim

    2010-01-01

    The objective of the present study was to assess the development of luminance- and texture-defined static form perception in school-aged children. This was done using an adapted Landolt-C technique where C-optotypes were defined by either luminance or texture information, the latter necessitating extra-striate neural processing to be perceived.…

  10. Consecutive daily measurements of luminal concentrations of lactate in the rectum in septic shock patients

    Ibsen, Michael; Wiis, Jørgen; Waldau, Tina; Perner, Anders

    2012-01-01

    In a recent study we found no difference in the concentrations of luminal lactate in the rectum between nonsurvivors and survivors in early septic shock (......In a recent study we found no difference in the concentrations of luminal lactate in the rectum between nonsurvivors and survivors in early septic shock (...

  11. On the clustering of faint red galaxies

    Xu, Haojie; Zheng, Zheng; Guo, Hong; Zhu, Ju; Zehavi, Idit

    2016-08-01

    Faint red galaxies in the Sloan Digital Sky Survey show a puzzling clustering pattern in previous measurements. In the two-point correlation function (2PCF), they appear to be strongly clustered on small-scales, indicating a tendency to reside in massive haloes as satellite galaxies. However, their weak clustering on large scales suggests that they are more likely to be found in low mass haloes. The interpretation of the clustering pattern suffers from the large sample variance in the 2PCF measurements, given the small volume of the volume-limited sample of such faint galaxies. We introduce a method to improve the clustering measurements of faint galaxies by making a full use of a flux-limited sample to obtain volume-limited measurements with an increased effective volume. In the improved 2PCF measurements, the fractional uncertainties on large-scales drop by more than 40 per cent, and the strong contrast between small-scale and large-scale clustering amplitudes seen in previous work is no longer prominent. From halo occupation distribution modelling of the measurements, we find that a considerable fraction of faint red galaxies to be satellites in massive haloes, a senario supported by the strong covariance of small-scale 2PCF measurements and the relative spatial distribution of faint red galaxies and luminous galaxies. However, the satellite fraction is found to be degenerate with the slope of the distribution profile of satellites in inner haloes. We compare the modelling results with semi-analytic model predictions and discuss the implications.

  12. Color stable white phosphorescent organic light emitting diodes with red emissive electron transport layer

    We analyzed the performance of multi-emissive white phosphorescent organic light-emitting diodes (PHOLEDs) in relation to various red emitting sites of hole and electron transport layers (HTL and ETL). The shift of the recombination zone producing stable white emission in PHOLEDs was utilized as luminance was increased with red emission in its electron transport layer. Multi-emissive white PHOLEDs including the red light emitting electron transport layer yielded maximum external quantum efficiency of 17.4% with CIE color coordinates (−0.030, +0.001) shifting only from 1000 to 10 000 cd/m2. Additionally, we observed a reduction of energy loss in the white PHOLED via Ir(piq)3 as phosphorescent red dopant in electron transport layer

  13. A LUMINOUS, FAST RISING UV-TRANSIENT DISCOVERED BY ROTSE: A TIDAL DISRUPTION EVENT?

    Vinkó, J.; Wheeler, J. C.; Chatzopoulos, E.; Marion, G. H. [Department of Astronomy, McDonald Observatory, University of Texas at Austin, Austin, TX 78712 (United States); Yuan, F.; Akerlof, C. [Physics Department, University of Michigan, Ann Arbor, MI 48109 (United States); Quimby, R. M. [Kavli IPMU, University of Tokyo, 5-1-5 Kahiwanoha, Kashiwa-shi, Chiba 277-8583 (Japan); Ramirez-Ruiz, E.; Guillochon, J., E-mail: vinko@astro.as.utexas.edu [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States)

    2015-01-01

    We present follow-up observations of an optical transient (OT) discovered by ROTSE on 2009 January 21. Photometric monitoring was carried out with ROTSE-IIIb in the optical and Swift in the UV up to +70 days after discovery. The light curve showed a fast rise time of ∼10 days followed by a steep decline over the next 60 days, which was much faster than that implied by {sup 56}Ni—{sup 56}Co radioactive decay. The Sloan Digital Sky Survey Data Release 10 database contains a faint, red object at the position of the OT, which appears slightly extended. This and other lines of evidence suggest that the OT is of extragalactic origin, and this faint object is likely the host galaxy. A sequence of optical spectra obtained with the 9.2 m Hobby-Eberly Telescope between +8 and +45 days after discovery revealed a hot, blue continuum with no visible spectral features. A few weak features that appeared after +30 days probably originated from the underlying host. Fitting synthetic templates to the observed spectrum of the host galaxy revealed a redshift of z = 0.19. At this redshift, the peak magnitude of the OT is close to –22.5, similar to the brightest super-luminous supernovae; however, the lack of identifiable spectral features makes the massive stellar death hypothesis less likely. A more plausible explanation appears to be the tidal disruption of a Sun-like star by the central supermassive black hole. We argue that this transient likely belongs to a class of super-Eddington tidal disruption events.

  14. Next generation red teaming

    Dalziel, Henry

    2015-01-01

    Red Teaming is can be described as a type of wargaming.In private business, penetration testers audit and test organization security, often in a secretive setting. The entire point of the Red Team is to see how weak or otherwise the organization's security posture is. This course is particularly suited to CISO's and CTO's that need to learn how to build a successful Red Team, as well as budding cyber security professionals who would like to learn more about the world of information security. Teaches readers how to dentify systemic security issues based on the analysis of vulnerability and con

  15. Inteligencia de red

    Barba Martí, Antonio; Hesselbach Serra, Xavier

    2002-01-01

    Bibliografia Actualmente existe una necesidad cada vez mayor de ofrecer servicios de red avanzados, que proporcionen un alto valor añadido al cliente. Eso es ya posible gracias a las nuevas capacidades de computación añadidas a los nodos de red, que proporcionan inteligencia y facilitan la gestión de red a los operadores y proveedores de servicios. En este texto, se presentan las nuevas redes inteligentes basadas en señalización número 7, los nuevos servicios sobre Internet (voz sobre IP, ...

  16. Spectroscopic Determination of Masses (and Implied Ages) for Red Giants

    Ness, M.; Hogg, David W.; Rix, H.-W.; Martig, M.; Pinsonneault, Marc H.; Ho, A. Y. Q.

    2016-06-01

    The mass of a star is arguably its most fundamental parameter. For red giant stars, tracers luminous enough to be observed across the Galaxy, mass implies a stellar evolution age. It has proven to be extremely difficult to infer ages and masses directly from red giant spectra using existing methods. From the Kepler and apogee surveys, samples of several thousand stars exist with high-quality spectra and asteroseismic masses. Here we show that from these data we can build a data-driven spectral model using The Cannon, which can determine stellar masses to ∼0.07 dex from apogee dr12 spectra of red giants; these imply age estimates accurate to ∼0.2 dex (40%). We show that The Cannon constrains these ages foremost from spectral regions with CN absorption lines, elements whose surface abundances reflect mass-dependent dredge-up. We deliver an unprecedented catalog of 70,000 giants (including 20,000 red clump stars) with mass and age estimates, spanning the entire disk (from the Galactic center to R∼ 20 kpc). We show that the age information in the spectra is not simply a corollary of the birth-material abundances {{[Fe/H]}} and [α /{Fe}], and that, even within a monoabundance population of stars, there are age variations that vary sensibly with Galactic position. Such stellar age constraints across the Milky Way open up new avenues in Galactic archeology.

  17. Spectroscopic Determination of Masses (and Implied Ages) for Red Giants

    Ness, M.; Hogg, David W.; Rix, H.-W.; Martig, M.; Pinsonneault, Marc H.; Ho, A. Y. Q.

    2016-06-01

    The mass of a star is arguably its most fundamental parameter. For red giant stars, tracers luminous enough to be observed across the Galaxy, mass implies a stellar evolution age. It has proven to be extremely difficult to infer ages and masses directly from red giant spectra using existing methods. From the Kepler and apogee surveys, samples of several thousand stars exist with high-quality spectra and asteroseismic masses. Here we show that from these data we can build a data-driven spectral model using The Cannon, which can determine stellar masses to ˜0.07 dex from apogee dr12 spectra of red giants; these imply age estimates accurate to ˜0.2 dex (40%). We show that The Cannon constrains these ages foremost from spectral regions with CN absorption lines, elements whose surface abundances reflect mass-dependent dredge-up. We deliver an unprecedented catalog of 70,000 giants (including 20,000 red clump stars) with mass and age estimates, spanning the entire disk (from the Galactic center to R˜ 20 kpc). We show that the age information in the spectra is not simply a corollary of the birth-material abundances {{[Fe/H]}} and [α /{Fe}], and that, even within a monoabundance population of stars, there are age variations that vary sensibly with Galactic position. Such stellar age constraints across the Milky Way open up new avenues in Galactic archeology.

  18. Spectroscopic determination of masses (and implied ages) for red giants

    Ness, M; Rix, H-W; Martig, M; Pinsonneault, Marc H; Ho, A Y Q

    2015-01-01

    The mass of a star is arguably its most fundamental parameter. For red giant stars, tracers luminous enough to be observed across the Galaxy, mass implies a stellar evolution age. It has proven to be extremely difficult to infer ages and masses directly from red giant spectra using existing methods. From the KEPLER and APOGEE surveys, samples of several thousand stars exist with high-quality spectra and asteroseismic masses. Here we show that from these data we can build a data-driven spectral model using The Cannon, which can determine stellar masses to $\\sim$ 0.07 dex from APOGEE DR12 spectra of red giants; these imply age estimates accurate to $\\sim$ 0.2 dex (40 percent). We show that The Cannon constrains these ages foremost from spectral regions with CN absorption lines, elements whose surface abundances reflect mass-dependent dredge-up. We deliver an unprecedented catalog of 80,000 giants (including 20,000 red-clump stars) with mass and age estimates, spanning the entire disk (from the Galactic center t...

  19. Experimental information: 225 [RED

    Full Text Available 2202_21_1_2 RED Cy3 Cy3 Masaaki Umeda The University of Tokyo Cell ... cycle Transgenic Cell ... cycle T ... ransgenic cell ... division,cell ... cycle,cyclin,CDK,transgenic plant on ...

  20. Experimental information: 226 [RED

    Full Text Available 2202_21_1_3 RED Cy3 Cy3 Masaaki Umeda The University of Tokyo Cell ... cycle Transgenic Cell ... cycle T ... ransgenic cell ... division,cell ... cycle,cyclin,CDK,transgenic plant on ...

  1. Probe data: 2827 [RED

    Full Text Available R06-035040-2AR RED C72992 AU101214 E02619 EB2619 >(P35339) EXOPOLYGALACTURONASE PRECURSOR (EC 3. ... 2.1.67) (EXOPG) (PECTINASE ) (GALACTURAN 1,4-ALPHA-GALACTURONIDASE). &S30067(S ...

  2. Probe data: 6229 [RED

    Full Text Available R03-061580-1AR RED AU108708 C96917 C50119 CG0119 >(P52424) PHOSPHORIBOSYLFORMYLGLYCINAMIDINE CYC ... LO-LIGASE PRECURSOR (EC 6.3.3.1) (AIR S) (PHOSPHORIBOSYL-AMINOIMIDAZOLE SYNTHETASE) (AIR ...

  3. Experimental information: 1043 [RED

    Full Text Available 2112_21_11_12 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo ... Nutrient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  4. Experimental information: 1038 [RED

    Full Text Available 2112_21_1_2 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  5. Experimental information: 1040 [RED

    Full Text Available 2112_21_5_6 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  6. Experimental information: 1042 [RED

    Full Text Available 2112_21_9_10 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo N ... utrient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  7. Experimental information: 1039 [RED

    Full Text Available 2112_21_3_4 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  8. Experimental information: 1041 [RED

    Full Text Available 2112_21_7_8 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  9. Luminance-Corrected 3D Point Clouds for Road and Street Environments

    Matti T. Vaaja

    2015-09-01

    Full Text Available A novel approach to evaluating night-time road and street environment lighting conditions through 3D point clouds is presented. The combination of luminance imaging and 3D point cloud acquired with a terrestrial laser scanner was used for analyzing 3D luminance on the road surface. A calculation of the luminance (cd/m2 was based on the RGB output values of a Nikon D800E digital still camera. The camera was calibrated with a reference luminance source. The relative orientation between the luminance images and intensity image of the 3D point cloud was solved in order to integrate the data sets into the same coordinate system. As a result, the 3D model of road environment luminance is illustrated and the ability to exploit the method for evaluating the luminance distribution on the road surface is presented. Furthermore, the limitations and future prospects of the methodology are addressed. The method provides promising results for studying road lighting conditions in future lighting optimizations. The paper presents the methodology and its experimental application on a road section which consists of five luminaires installed on one side of a two-lane road in Otaniemi, Espoo, Finland.

  10. Effect of display polarity and luminance contrast on visual lobe shape characteristics.

    Tsang, Steve N H; Chan, Alan H S; Yu, R F

    2012-01-01

    The effect of display polarity and luminance contrast on visual lobe (effective visual field) shape characteristics was studied using three levels of luminance contrast with combinations of positive and negative polarities. The binocular effective visual field for a detection task, with a peripherally presented target (V) embedded in a homogeneous competing background (Xs), was mapped on 24 imaginary axes passing through the fixation point. The results showed that visual lobes mapped using positive polarity were statistically larger in area, rounder and more regular in shape than those for negative polarity. The medium contrast condition lobes were more symmetric and regular than low contrast condition lobes, and lobe area and perimeter increased with increasing luminance contrast ratio. Under the interaction of positive polarity and high luminance contrast, visual lobes were found to be larger, smoother and rounder. The high level of luminance and contrast however resulted in a higher degree of visual discomfort. The results indicated that positive polarity and contrast of medium (26:1) to high (41:1) levels are possible display settings for better visual lobe characteristics and better anticipated search performance. Practitioner Summary: The effect of display polarity and luminance contrast on visual lobe shape characteristics was examined with uniform stimulus materials in this study. The results help to identify the optimum display settings for luminance contrast and display polarity to enhance lobe shape characteristics and hence search performance in industrial inspection tasks. PMID:22676836

  11. Frequency analysis of a task-evoked pupillary response: Luminance-independent measure of mental effort.

    Peysakhovich, Vsevolod; Causse, Mickaël; Scannella, Sébastien; Dehais, Frédéric

    2015-07-01

    Pupil diameter is a widely-studied cognitive load measure, which, despite its convenience for non-intrusive operator state monitoring in complex environments, is still not available for in situ measurements because of numerous methodological limitations. The most important of these limitations is the influence of pupillary light reflex. Hence, there is the need of providing a pupil-based cognitive load measure that is independent of light conditions. In this paper, we present a promising technique of pupillary signal analysis resulting in luminance-independent measure of mental effort that could be used in real-time without a priori on luminous conditions. Twenty-two participants performed a short-term memory task under different screen luminance conditions. Our results showed that the amplitude of pupillary dilation due to load on memory was luminance-dependent with higher amplitude corresponding to lower-luminance condition. Furthermore, our experimentation showed that load on memory and luminance factors express themselves differently according to frequency. Therefore, as our statistical analysis revealed, the ratio between low (0-1.6 Hz) and high frequency (1.6-4 Hz) bands (LF/HF ratio) of power spectral densities of pupillary signal is sensitive to the cognitive load but not to luminance. Our results are promising for the measurement of load on memory in ecological settings. PMID:25941013

  12. Probe data: 3426 [RED

    Full Text Available R02-002330-1AR RED C26646 AU108627 C12762 CB2762 >AGU83687_1(U83687|pid:g1835701) Apium graveole ... ns NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  13. Probe data: 779 [RED

    Full Text Available R02-002330-1AR RED D48175 AU032804 S14252 SS4252 >AGU83687_1(U83687|pid:g1835701) Apium graveole ... ns NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  14. Probe data: 3773 [RED

    Full Text Available R02-002330-1AR RED AU163183 AU163184 S00625 ST0625 >AGU83687_1(U83687|pid:g1835701) Apium graveo ... lens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  15. Luminance meter for photopic and scotopic measurements in the mesopic range

    This paper presents a design and realization of a dual-channel luminance meter for simultaneous measurement of luminance with photopic and scotopic weightings. Such measurements are useful in mesopic conditions, i.e. when the luminance is in the range of 0.005–5 cd m−2. The instrument is a spot luminance meter with two spectrally weighted channels. The collected light is detected with silicon detectors and a computer-controlled dual-channel switched-integration amplifier. The instrument is characterized for relative spectral responsivity against a calibrated spectroradiometer using a radiance source based on an integrating sphere with input from a monochromator. An absolute luminance responsivity calibration is made against a sphere-based luminance standard at a level close to the high end of the mesopic range. The standard uncertainty in luminance responsivity calibration is 0.3% for the photopic channel and 0.6% for the scotopic channel. In addition, characterization measurements were carried out for the instrument’s linearity, stray light sensitivity and polarization dependence. The results show very good noise performance, allowing fast measurements over the whole mesopic range. The noise equivalent power was measured to be approximately 20 fW Hz−1/2, equal to a noise equivalent luminance of 30 µcd m−2 Hz−1/2. Estimated uncertainty of measurements for typical light sources is 2.2% (k = 2) at the lowest luminance levels of the mesopic range. (paper)

  16. Observation of Photovoltaic Effects in Bright Red Organic Electroluminescent Diodes Doped with Red Dopant

    WEI Han-Zhi; Li Wen-Lian; WANG Dong-Yue; CHU Bei; Li Ming-Tao; ZHANG Zhi-Qiang; HU Zhi-Zhi

    2004-01-01

    @@ Photovoltaic (PV) effects for red bright organic light-emitting diodes (OLEDs) in which the red light emitted from the dopant 4-(dicyanomethylene)-2-t-butyl-6- (1,1,7, 7-tetramethyljulolidyl-9-enyl)-4H-pyran (DCJTB) have been observed. The OLEDs show organic photovoltaic properties. At the optimum doping concentration, the main eletroluminescence parameters including the maximum brightness and the maximum luminous efficiency under current density of 20mA/cm2 are 3280cd/m2 and 1.54cd/A, respectively. When irradiated by a 365-nm UVlight (4 mW/cm2), the device exhibits the PV parameters of the open-circuit voltage 1.4 V, short-circuit current 2.9 μA/cm2, fill factor 0.22, and power conversion efficiency 0.022%. Effects of every organic layer, especially the doped DCJTB on the PV performance, are also discussed. It is expected that the research for the PV property of the small molecular doping OLEDs will be of benefit for flat panel display technology in the future.

  17. Evaluation of High Dynamic Range Photography as a Luminance Mapping Technique

    Inanici, Mehlika; Galvin, Jim

    2004-12-30

    The potential, limitations, and applicability of the High Dynamic Range (HDR) photography technique is evaluated as a luminance mapping tool. Multiple exposure photographs of static scenes are taken with a Nikon 5400 digital camera to capture the wide luminance variation within the scenes. The camera response function is computationally derived using the Photosphere software, and is used to fuse the multiple photographs into HDR images. The vignetting effect and point spread function of the camera and lens system is determined. Laboratory and field studies have shown that the pixel values in the HDR photographs can correspond to the physical quantity of luminance with reasonable precision and repeatability.

  18. AKARI Detections of Hot Dust in Luminous Infrared Galaxies

    Oyabu, S; Malkan, M; Matsuhara, H; Wada, T; Nakagawa, T; Ohyama, Y; Toba, Y; Onaka, T; Takita, S; Kataza, H; Yamamura, I; Shirahata, M

    2011-01-01

    We have made a new sample of Active Galactic Nuclei (AGNs), using the catalog of the AKARI Mid-infrared(MIR) All-Sky Survey. Our MIR search has an advantage in detecting AGNs that are obscured at optical wavelengths due to extinction. First, we selected AKARI 9micron excess sources with F(9micron)/F(K_S)>2 where K_S magnitudes were taken from the Two Micron All Sky Survey. Then, we obtained follow-up near-infrared spectroscopy with the AKARI/IRC, to confirm that the excess is caused by hot dust. We also obtained optical spectroscopy with the Kast Double Spectrograph on the Shane 3-m telescope at Lick Observatory. Based on these observations, we detected hot dust with a characteristic temperature of ~500K in two luminous infrared galaxies. The hot dust is suspected to be associated with AGNs, which show their nonstellar activity not in the optical, but in the near- and mid-infrared bands--i.e., they harbor buried AGNs. The host galaxy stellar masses of 4-6 x 10^9 M_sun are small compared with the hosts in opti...

  19. Tritium application: self-luminous glass tube(SLGT)

    Kim, K.; Lee, S.K.; Chung, E.S.; Kim, K.S.; Kim, W.S. [Nuclear Power Lab., Korea Electric Power Research Inst. (KEPRI), Daejeon (Korea); Nam, G.J. [Engineering Information Technology Center, Inst. for Advanced Engineering (IAE), Kyonggi-do (Korea)

    2005-07-01

    To manufacture SLGTs (self-luminous glass tubes), 4 core technologies are needed: coating technology, tritium injection technology, laser sealing/cutting technology and tritium handling technology. The inside of the glass tubes is coated with greenish ZnS phosphor particles with sizes varying from 4{proportional_to}5 [{mu}m], and Cu, and Al as an activator and a co-dopant, respectively. We also found that it would be possible to produce a phosphor coated glass tube for the SLGT using the well established cold cathode fluorescent lamp (CCFL) bulb manufacturing technology. The conceptual design of the main process loop (PL) is almost done. A delicate technique will be needed for the sealing/cutting of the glass tubes. Instead of the existing torch technology, a new technology using a pulse-type laser is under investigation. The design basis of the tritium handling facilities is to minimize the operator's exposure to tritium uptake and the emission of tritium to the environment. To fulfill the requirements, major tritium handling components are located in the secondary containment such as the glove boxes (GBs) and/or the fume hoods. The tritium recovery system (TRS) is connected to a GB and PL to minimize the release of tritium as well as to remove the moisture and oxygen in the GB. (orig.)

  20. XMM-Newton observations of three interacting luminous infrared galaxies

    Mudd, Dale; Mathur, Smita [Department of Astronomy, The Ohio State University, Columbus, OH 43210 (United States); Guainazzi, Matteo [European Space Astronomy Centre of ESA, P.O. Box 78, Villanueva de la Cañada, E-28691 Madrid (Spain); Piconcelli, Enrico; Nicastro, Fabrizio [Osservatorio Astronomico di Roma-INAF, Via di Frascati 33, I-00040 Monte Porzio Catone, RM (Italy); Bianchi, Stefano [Dipartimento di Fisica, Università degli Studi Roma Tre, via della Vasca Navale 84, I-00416 Roma (Italy); Komossa, S. [Max-Planck Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Vignali, Cristian [INAF-Osservatorio Astronomico di Bologna, Via Ranzani 1, I-40127 Bologna (Italy); Lanzuisi, Giorgio [INAF-Istituto di Astrofisica Spaziale e Fisica Cosmica di Bologna, via Gobetti 101, I-40129 Bologna (Italy); Fiore, Fabrizio [INAF-Osservatorio Astronomico di Roma, Via di Frascati 33, I-00040 Monteporzio Catone (Italy); Maiolino, Roberto, E-mail: mudd@astronomy.ohio-state.edu [Department of Physics, University of Cambridge, 19 JJ Thomson Avenue, Cambridge CB3 0HE (United Kingdom)

    2014-05-20

    We investigate the X-ray properties of three interacting luminous infrared galaxy systems. In one of these systems, IRAS 18329+5950, we resolve two separate sources. A second and third source, IRAS 19354+4559 and IRAS 20550+1656, have only a single X-ray source detected. We compare the observed emission to point-spread function (PSF) profiles and determine that they are all consistent with the PSF, albeit with large uncertainties for some of our sources. We then model the spectra to determine soft (0.5-2 keV) and hard (2-10 keV) luminosities for the resolved sources and compare these to relationships found in the literature between infrared and X-ray luminosities for starburst galaxies. We obtain luminosities (0.5-10 keV) ranging from 1.7 to 7.3 × 10{sup 41} erg s{sup –1} for our systems. These X-ray luminosities are consistent with predictions for star-formation-dominated sources and thus are most likely due to starbursts, but we cannot conclusively rule out active galactic nuclei.

  1. The [NII] 205 micron Emission in Local Luminous Infrared Galaxies

    Zhao, Yinghe; Xu, C Kevin; Gao, Yu; Lord, Steven D; Charmandaris, Vassilis; Diaz-Santos, Tanio; Evans, Aaron; Howell, Justin; Petric, Andreea O; van der Werf, Paul P; Sanders, David B

    2016-01-01

    In this paper, we present the measurements of the [NII] 205micron line ([NII]205) for a flux-limited sample of 122 (ultra-)luminous infrared galaxies [(U)LIRGs] and 20 additional normal galaxies, obtained with the Herschel Space Observatory. We explore the far-infrared (FIR) color dependence of the [NII]205 (L[NII]205) to the total infrared (LIR) luminosity ratio, and find that L[NII]205/LIR only depends modestly on the 70-to-160 micron flux density ratio (f70/f160) when f70/f160 0.6. We also investigate the relation between L[NII]205 and star formation rate (SFR), and show that L[NII]205 has a nearly linear correlation with SFR, albeit the intercept of such relation varies somewhat with f60/f100, consistent with our previous conclusion that \\NIIab\\ emission can serve as a SFR indicator with an accuracy of ~0.4 dex, or ~0.2 dex if f60/f100 is known independently. Furthermore, together with the ISO measurements of [NII] 122 micron emission we use a total of ~200 galaxies to derive the local [NII]205 luminosit...

  2. Production of Nitrogen Oxides by Laboratory Simulated Transient Luminous Events

    Peterson, H.; Bailey, M.; Hallett, J.; Beasley, W.

    2007-12-01

    Restoration of the polar stratospheric ozone layer has occurred at rates below those originally expected following reductions in chlorofluorocarbon (CFC) usage. Additional reactions affecting ozone depletion now must also be considered. This research examines nitrogen oxides (NOx) produced in the middle atmosphere by transient luminous events (TLEs), with NOx production in this layer contributing to the loss of stratospheric ozone. In particular, NOx produced by sprites in the mesosphere would be transported to the polar stratosphere via the global meridional circulation and downward diffusion. A pressure-controlled vacuum chamber was used to simulate middle atmosphere pressures, while a power supply and in-chamber electrodes were used to simulate TLEs in the pressure controlled environment. Chemiluminescence NOx analyzers were used to sample NOx produced by the chamber discharges- originally a Monitor Labs Model 8440E, later a Thermo Environment Model 42. Total NOx production for each discharge as well as NOx per ampere of current and NOx per Joule of discharge energy were plotted. Absolute NOx production was greatest for discharge environments with upper tropospheric pressures (100-380 torr), while NOx/J was greatest for discharge environments with stratospheric pressures (around 10 torr). The different production efficiencies in NOx/J as a function of pressure pointed to three different production regimes, each with its own reaction mechanisms: one for tropospheric pressures, one for stratospheric pressures, and one for upper stratospheric to mesospheric pressures (no greater than 1 torr).

  3. Asphericity and clumpiness in the winds of Luminous Blue Variables

    Davies, B; Vink, J S; Davies, Ben; Oudmaijer, Rene D.; Vink, Jorick S.

    2005-01-01

    We present the first systematic spectropolarimetric study of Luminous Blue Variables (LBVs) in the Galaxy and the Magellanic Clouds, in order to investigate the geometries of their winds. We find that at least half of our sample show changes in polarization across the strong H$\\alpha$ emission line, indicating that the light from the stars is intrinsically polarized and therefore that asphericity already exists at the base of the wind. Multi-epoch spectropolarimetry on four targets reveals variability in their intrinsic polarization. Three of these, AG Car, HR Car and P Cyg, show a position angle (PA) of polarization which appears random with time. Such behaviour can be explained by the presence of strong wind-inhomogeneities, or `clumps' within the wind. Only one star, R 127, shows variability at a constant PA, and hence evidence for axi-symmetry as well as clumpiness. However, if viewed at low inclination, and at limited temporal sampling, such a wind would produce a seemingly random polarization of the typ...

  4. XMM-Newton Observations of Three Interacting Luminous Infrared Galaxies

    Mudd, Dale; Guainazzi, Matteo; Piconcelli, Enrico; Bianchi, Stefano; Komossa, Stefanie; Vignali, Cristian; Lanzuisi, Giorgio; Nicastro, Fabrizio; Fiore, Fabrizio; Maiolino, Roberto

    2012-01-01

    We investigate the X-ray properties of three interacting luminous infrared galaxy systems. In one of these systems, IRAS 18329+5950, we resolve two separate sources. A second, IRAS 20550+1656, and third, IRAS 19354+4559, have only a single X-ray source detected. We compare the observed emission to PSF profiles and determine that three are extended in emission. One is compact, which is suggestive of an AGN, although all of our profiles have large uncertainties. We then model the spectra to determine soft (0.5--2 keV) and hard (2--10 keV) luminosities for the resolved sources and then compare these to relationships found in the literature between infrared and X-ray luminosities for starburst galaxies. We obtain luminosities of $\\log(L_{\\textrm{soft}}/\\lsol) = 7.32,\\:7.06,\\:7.68$ and $\\log(L_{\\textrm{hard}}/\\lsol) = 7.33,\\: 7.07,\\: 7.88$ for IRAS 18329+5950, IRAS 19354+4559, and IRAS 20550+1656, respectively. These are intermediate to two separate predictions in the literature for star-formation-dominated source...

  5. Discovery of a Luminous Quasar in the Nearby Universe

    Torres, C A O; Coziol, R; Jablonski, F J; De la Reza, R; Lépine, J R D; Gregorio-Hetem, J; Torres, Carlos A. O.; Quast, Germano R.; Coziol, Roger; Jablonski, Francisco; Reza, Ramiro de la; Lepine, Jacques R. D.; Gregorio-Hetem, Jane

    1997-01-01

    In the course of the Pico dos Dias survey (PDS), we identified the stellar like object PDS456 at coordinates alpha = 17h 28m 19.796s, delta = -14deg 15' 55.87'' (epoch 2000), with a relatively nearby (z = 0.184) and bright (B = 14.69) quasar. Its position at Galactic coordinates l_II = 10.4deg, b_II = +11.2deg, near the bulge of the Galaxy, may explain why it was not detected before. The optical spectrum of PDS456 is typical of a luminous quasar, showing a broad (FWHM ~ 4000 km/s) H_\\beta line, very intense FeII lines and a weak [OIII]\\lambda5007 line. PDS456 is associated to the infrared source IRAS 17254-1413 with a 60 \\mum infrared luminosity L_{60} = 3.8 x 10^{45} erg/s. The relatively flat slopes in the infrared (\\alpha(25,60) = -0.33 and \\alpha(12,25) = -0.78) and a flat power index in the optical (F_{\

  6. Sub-luminal pulses from cosmic ray air showers

    Linsley, J.

    1985-01-01

    Some of the signals produced by air showers in scintillators possess a distinctive feature, a sub-luminal pulse (SLP) following the normal one with a time delay of approximately 1.5 r/c. The average amplitude of the SLP corresponds to an energy deposit of about 50 MeV, three times as much as is deposited in a typical scintillator by vertical minimum ionizing muons. The SLP account for approximately 5% of the energy deposited in the atmosphere by IR showers with energy 10 to the 10th power GeV at impact parameters 1 km. Assuming that these pulses are due to neutrons travelling with a speed slightly less than c, they provide a unique means of estimating E sub h, the energy deposited by slow hadrons, in showers of this very high energy. On the other hand, if not allowed for properly, these pulses are liable to cause errors in estimating the impact parameters of large showers from pulse width observations.

  7. Confirmation of the Luminous Blue Variable status of MWC 930

    Miroshnichenko, A S; Zharikov, S V; Zsargo, J; Jimenez, J A Juarez; Groh, J H; Levato, H; Grosso, M; Rudy, R J; Laag, E A; Crawford, K B; Puetter, R C; Reichart, D E; Ivarsen, K M; Haislip, J B; Nysewander, M C; LaCluyze, A P

    2014-01-01

    We present spectroscopic and photometric observations of the emission-line star MWC 930 (V446 Sct) during its long-term optical brightening in 2006--2013. Based on our earlier data we suggested that the object has features found in Luminous Blue Variables (LBV), such as a high luminosity (~3 10^5 Lsun, a low wind terminal velocity (~ 140 km/s), and a tendency to show strong brightness variations (~1 mag over 20 years). For the last ~7 years it has been exhibiting a continuous optical and near-IR brightening along with a change of the emission-line spectrum appearance and cooling of the star's photosphere. We present the object's $V$--band light curve, analyze the spectral variations, and compare the observed properties with those of other recognized Galactic LBVs, such as AG Car and HR Car. Overall we conclude the MWC 930 is a bona fide Galactic LBV that is currently in the middle of an S Dor cycle.

  8. Evolution of the ISM in Luminous IR Galaxies

    Baan, W A; Spaans, M

    2010-01-01

    Molecules that trace the high-density regions of the interstellar medium may be used to evaluate the changing physical and chemical environment during the ongoing nuclear activity in (Ultra-)Luminous Infrared Galaxies. The changing ratios of the HCN(1-0), HNC(1-0), HCO+(1-0), CN(1-0) and CN(2-1), and CS(3-2) transitions were compared with the HCN(1-0)/CO(1-0) ratio, which is proposed to represent the progression time scale of the starburst. These diagnostic diagrams were interpreted using the results of theoretical modeling using a large physical and chemical network to describe the state of the nuclear ISM in the evolving galaxies. Systematic changes are seen in the line ratios as the sources evolve from early stage for the nuclear starburst (ULIRGs) to later stages. These changes result from changing environmental conditions and particularly from the lowering of the average density of the medium. A temperature rise due to mechanical heating of the medium by feedback explains the lowering of the ratios at la...

  9. Gemini Near-infrared Spectroscopy of Luminous z~6 Quasars

    Jiang, Linhua; Fan, Xiaohui; Vestergaard, Marianne;

    2007-01-01

    We present Gemini near-infrared spectroscopic observations of six luminous quasars at z=5.8$\\sim$6.3. Five of them were observed using Gemini-South/GNIRS, which provides a simultaneous wavelength coverage of 0.9--2.5 $\\mu$m in cross dispersion mode. The other source was observed in K band with...... Gemini-North/NIRI. We calculate line strengths for all detected emission lines and use their ratios to estimate gas metallicity in the broad-line regions of the quasars. The metallicity is found to be supersolar with a typical value of $\\sim$4 Z_{\\sun}, and a comparison with low-redshift observations...... shows no strong evolution in metallicity up to z$\\sim$6. The FeII/MgII ratio of the quasars is 4.9+/-1.4, consistent with low-redshift measurements. We estimate central BH masses of 10^9 to 10^{10} M_{\\sun} and Eddington luminosity ratios of order unity. We identify two MgII $\\lambda\\lambda$2796...

  10. The Neutral ISM in Nearby Luminous Compact Blue Galaxies

    Garland, C A; Williams, J P; Guzmán, R; Castander, F J

    2003-01-01

    We observed 20 nearby Luminous Compact Blue Galaxies (LCBGs) in HI and CO(J=2-1) with the GBT and JCMT. These ~L^star galaxies are blue, high surface brightness, starbursting, high metallicity galaxies with an underlying older stellar population. They are common at z~1, but rare in the local Universe. It has been proposed that intermediate redshift LCBGs may be the progenitors of local dwarf ellipticals or low luminosity spirals, or that they may be more massive disks forming from the center outward to become L^star galaxies. To discriminate among various possible evolutionary scenarios, we have measured the dynamical masses and gas depletion time scales of this sample of nearby LCBGs. We find that local LCBGs span a wide range of dynamical masses, from 4 x 10^9 to 1 x 10^11 M_solar (measured within R_25). Molecular gas in local LCBGs is depleted quite quickly, in 30 to 200 million years. The molecular plus atomic gas is depleted in 30 million to 10 billion years; however, ~80% of the local LCBGs deplete thei...

  11. SN2008am: A Super-Luminous Type IIn Supernova

    Chatzopoulos, E; Vinko, J; Quimby, R; Robinson, E L; Miller, A A; Foley, R J; Perley, D A; Yuan, F; Akerlof, C; Bloom, J S

    2011-01-01

    We present observations and interpretation of the Type IIn supernova SN 2008am discovered by the ROTSE Supernova Verification Project (RSVP). SN 2008am peaked at approximately -22.3 mag at a redshift of z=0.2338, giving it a peak luminosity of 3 x 10^{44}erg/s and making it one of the most luminous supernovae ever observed. The total radiated energy is ~ 2 x 10^{51} erg. Photometric observations in the ultraviolet, optical and infrared bands (J,H,Ks) constrain the SED evolution. We obtained six optical spectra of the supernova, five on the early decline from maximum light and a sixth nearly a year later plus a very late-time spectrum (~2 yr) of the host galaxy. The spectra of SN 2008am show strong Balmer-line and He I lambda 5876A emission with intermediate widths (~25A) in the first ~40 days after optical maximum. We examine a variety of models for the line wings and conclude that multiple scattering is most likely, implying that our spectra contain no specific information on the bulk flow velocity. We exami...

  12. Human efficiency for recognizing 3-D objects in luminance noise.

    Tjan, B S; Braje, W L; Legge, G E; Kersten, D

    1995-11-01

    The purpose of this study was to establish how efficiently humans use visual information to recognize simple 3-D objects. The stimuli were computer-rendered images of four simple 3-D objects--wedge, cone, cylinder, and pyramid--each rendered from 8 randomly chosen viewing positions as shaded objects, line drawings, or silhouettes. The objects were presented in static, 2-D Gaussian luminance noise. The observer's task was to indicate which of the four objects had been presented. We obtained human contrast thresholds for recognition, and compared these to an ideal observer's thresholds to obtain efficiencies. In two auxiliary experiments, we measured efficiencies for object detection and letter recognition. Our results showed that human object-recognition efficiency is low (3-8%) when compared to efficiencies reported for some other visual-information processing tasks. The low efficiency means that human recognition performance is limited primarily by factors intrinsic to the observer rather than the information content of the stimuli. We found three factors that play a large role in accounting for low object-recognition efficiency: stimulus size, spatial uncertainty, and detection efficiency. Four other factors play a smaller role in limiting object-recognition efficiency: observers' internal noise, stimulus rendering condition, stimulus familiarity, and categorization across views. PMID:8533342

  13. Effect of tritium on luminous marine bacteria and enzyme reactions

    The paper studies chronic effect of tritiated water, HTO, (0.0002–200 MBq/L) on bioluminescent assay systems: marine bacteria Photobacterium phosphoreum (intact and lyophilized) and coupled enzyme reactions. Bioluminescence intensity serves as a marker of physiological activity. Linear dependencies of bioluminescent intensity on exposure time or radioactivity were not revealed. Three successive stages in bacterial bioluminescence response to HTO were found: (1) absence of the effect, (2) activation, and (3) inhibition. They were interpreted in terms of reaction of organisms to stress-factor i.e. stress recognition, adaptive response/syndrome, and suppression of physiological function. In enzyme system, in contrast, the kinetic stages mentioned above were not revealed, but the dependence of bioluminescence intensity on HTO specific radioactivity was found. Damage of bacteria cells in HTO (100 MBq/L) was visualized by electron microscopy. Time of bioluminescence inhibition is suggested as a parameter to evaluate the bacterial sensitivity to ionizing radiation. -- Highlights: ► Nonlinear dose–effect relations were found for luminous bacteria in HTO. ► HTO induced three-stage response in bacteria: threshold, activation, inhibition. ► Stability of cells to HTO is higher than that of enzymes. ► Inhibition time is a parameter to evaluate sensitivity of organisms to radiation

  14. MN112: a new Galactic candidate Luminous Blue Variable

    Gvaramadze, V V; Fabrika, S; Sholukhova, O; Berdnikov, L N; Cherepashchuk, A M; Zharova, A V

    2009-01-01

    We report the discovery of a new Galactic candidate Luminous Blue Variable (cLBV) via detection of an infrared circular nebula and follow-up spectroscopy of its central star. The nebula, MN112, is one of many dozens of circular nebulae detected at 24 $\\mu$m the Spitzer Space Telescope archival data, whose morphology is similar to that of nebulae associated with known (c)LBVs and related evolved massive stars. Specifically, the core-halo morphology of MN112 bears a striking resemblance to the circumstellar nebula associated with the Galactic cLBV GAL 079.29+00.46, which suggests that both nebulae might have a similar origin and that the central star of MN112 is a LBV. The spectroscopy of the central star showed that its spectrum is almost identical to that of the bona fide LBV P Cygni, which also supports the LBV classification of the object. To further constrain the nature of MN112, we searched for signatures of possible high-amplitude ($\\ga 1$ mag) photometric variability of the central star using archival a...

  15. The Evolution of Galaxies in X-ray Luminous Groups

    Jeltema, T E; Lubin, L M; Fassnacht, C D; Jeltema, Tesla E.; Mulchaey, John S.; Lubin, Lori M.; Fassnacht, Christopher D.

    2006-01-01

    We investigate the galaxy populations in seven X-ray selected, intermediate-redshift groups (0.2 < z < 0.6). Overall, the galaxy populations in these systems are similar to those in clusters at the same redshift; they have large fractions of early-type galaxies (f_e ~ 70%) and small fractions of galaxies with significant star formation (f_[OII] ~ 30%). We do not observe a strong evolution in the galaxy populations from those seen in X-ray luminous groups at low-redshift. Both f_e and f_[OII] are correlated with radius but do not reach the field value out to ~r_500. However, we find significant variation in the galaxy populations between groups with some groups having field-like populations. Comparisons between the morphological and spectral properties of group galaxies reveals both gas-poor mergers and a population of passive spirals. Unlike low-redshift, X-ray emitting groups, in some of these groups the brightest galaxy does not lie at the center of the X-ray emission, and in several of the groups whi...

  16. High-ionization Fe K emission from luminous infrared galaxies

    Iwasawa, K; Evans, A S; Massarella, J M; Armus, L; Surace, J A

    2009-01-01

    The Chandra component of the Great Observatories All-Sky LIRG Survey (GOALS) presently contains 44 luminous and ultraluminous infrared galaxies with log (Lir/Lsun) = 11.73-12.57. Omitting 15 obvious AGNs, the other galaxies are, on average, underluminous in the 2-10 keV band by 0.7 dex at a given far-infrared luminosity, compared to nearby star-forming galaxies with lower star formation rates. The integrated spectrum of these hard X-ray quiet galaxies shows strong high-ionization Fe K emission (Fe XXV at 6.7 keV), which is incompatible with X-ray binaries as its origin. The X-ray quietness and the Fe K feature could be explained by hot gas produced in a starburst, provided that the accompanying copious emission from high-mass X-ray binaries is somehow suppressed. Alternatively, these galaxies may contain deeply embedded supermassive black holes that power the bulk of their infrared luminosity and only faint photoionized gas is visible, as seen in some ULIRGs with Compton-thick AGN.

  17. Organic solution-processible electroluminescent molecular glasses for non-doped standard red OLEDs with electrically stable chromaticity

    Bi, Xiaoman; Zuo, Weiwei; Liu, Yingliang, E-mail: liuylxn@sohu.com; Zhang, Zhenru; Zeng, Cen; Xu, Shengang; Cao, Shaokui, E-mail: caoshaokui@zzu.edu.cn

    2015-10-15

    Highlights: • The D–A–D electroluminescent molecular glasses are synthesized. • Non-doped red electroluminescent film is fabricated by spin-coating. • Red OLED shows stable wavelength, luminous efficiency and chromaticity. • CIE1931 coordinate is in accord with standard red light in PAL system. - Abstract: Organic light-emitting molecular glasses (OEMGs) are synthesized through the introduction of nonplanar donor and branched aliphatic chain into electroluminescent emitters. The target OEMGs are characterized by {sup 1}H NMR, {sup 13}C NMR, IR, UV–vis and fluorescent spectra as well as elemental analysis, TG and DSC. The results indicated that the optical, electrochemical and electroluminescent properties of OEMGs are adjusted successfully by the replacement of electron-donating group. The non-doped OLED device with a standard red electroluminescent emission is achieved by spin-coating the THF solution of OEMG with a triphenylamine moiety. This non-doped red OLED device takes on an electrically stable electroluminescent performance, including the stable maximum electroluminescent wavelength of 640 nm, the stable luminous efficiency of 2.4 cd/A and the stable CIE1931 coordinate of (x, y) = (0.64, 0.35), which is basically in accord with the CIE1931 coordinate (x, y) = (0.64, 0.33) of standard red light in PAL system.

  18. Organic solution-processible electroluminescent molecular glasses for non-doped standard red OLEDs with electrically stable chromaticity

    Highlights: • The D–A–D electroluminescent molecular glasses are synthesized. • Non-doped red electroluminescent film is fabricated by spin-coating. • Red OLED shows stable wavelength, luminous efficiency and chromaticity. • CIE1931 coordinate is in accord with standard red light in PAL system. - Abstract: Organic light-emitting molecular glasses (OEMGs) are synthesized through the introduction of nonplanar donor and branched aliphatic chain into electroluminescent emitters. The target OEMGs are characterized by 1H NMR, 13C NMR, IR, UV–vis and fluorescent spectra as well as elemental analysis, TG and DSC. The results indicated that the optical, electrochemical and electroluminescent properties of OEMGs are adjusted successfully by the replacement of electron-donating group. The non-doped OLED device with a standard red electroluminescent emission is achieved by spin-coating the THF solution of OEMG with a triphenylamine moiety. This non-doped red OLED device takes on an electrically stable electroluminescent performance, including the stable maximum electroluminescent wavelength of 640 nm, the stable luminous efficiency of 2.4 cd/A and the stable CIE1931 coordinate of (x, y) = (0.64, 0.35), which is basically in accord with the CIE1931 coordinate (x, y) = (0.64, 0.33) of standard red light in PAL system

  19. BLUE LUMINOUS STARS IN NEARBY GALAXIES-UIT 005: A POSSIBLE LINK TO THE LUMINOUS BLUE VARIABLE STAGE

    A detailed study of the blue supergiant UIT 005 (B2-2.5Ia+) in M 33 is presented. The results of our quantitative spectral analysis indicate that the star is a very luminous (log L/Lsun ∼ 5.9 dex) and massive (M ∼ 50 Msun) object, showing a very high nitrogen-to-oxygen ratio in its surface (N/O∼8, by mass). Based on the derived Mg and Si abundances, we argue that this high N/O ratio cannot be the result of an initial low O content due to its location on the disk of M 33, a galaxy known to present a steep metallicity gradient. In combination with the He abundance, the most plausible interpretation is that UIT 005 is in an advanced stage of evolution, showing in its surface N enrichment and O depletion resulting from mixing with CNO processed material from the stellar interior. A comparison with the predictions of current stellar evolutionary models indicates that there are significant discrepancies, in particular with regard to the degree of chemical processing, with the models predicting a much lower degree of O depletion than observed. At the same time, the mass-loss rate derived in our analysis is an order of magnitude lower than the values considered in the evolutionary calculations. Based on a study of the surrounding stellar population and the nearby cluster, NGC 588, using Hubble Space Telescope/WFPC2 photometry, we suggest that UIT 005 could be in fact a runaway star from this cluster. Regardless of its origin, the derived parameters place the star in a region of the Hertzsprung-Russell diagram where luminous blue variables (LBVs) are usually found, but we find no evidence supporting photometric or spectroscopic variability, except for small Hα changes, otherwise observed in Galactic B-type supergiants. Whether UIT 005 is an LBV in a dormant state or a regular blue supergiant could not be discerned in this study. Subsequent monitoring would help us to improve our knowledge of the more massive stars, bridging the gap between regular and more exotic

  20. Galaxy Zoo: Passive Red Spirals

    Masters, Karen L; Romer, A Kathy; Nichol, Robert C; Bamford, Steven P; Schawinski, Kevin; Lintott, Chris J; Andreescu, Dan; Campbell, Heather C; Crowcroft, Ben; Doyle, Isabelle; Edmondson, Edward M; Murray, Phil; Raddick, M Jordan; Slosar, Anze; Szalay, Alexander S; Vandenberg, Jan

    2009-01-01

    We study the spectroscopic properties and environments of red spiral galaxies found by the Galaxy Zoo project. By carefully selecting face-on, disk dominated spirals we construct a sample of truly passive disks (not dust reddened, nor dominated by old stellar populations in a bulge). As such, our red spirals represent an interesting set of possible transition objects between normal blue spirals and red early types. We use SDSS data to investigate the physical processes which could have turned these objects red without disturbing their morphology. Red spirals prefer intermediate density regimes, however there are no obvious correlations between red spiral properties and environment - environment alone is not sufficient to determine if a galaxy will become a red spiral. Red spirals are a small fraction of spirals at low masses, but dominate at large stellar masses - massive galaxies are red independent of morphology. We confirm that red spirals have older stellar populations and less recent star formation than ...

  1. DNA methylation patterns in luminal breast cancers differ from non-luminal subtypes and can identify relapse risk independent of other clinical variables.

    Kamalakaran, Sitharthan; Varadan, Vinay; Giercksky Russnes, Hege E; Levy, Dan; Kendall, Jude; Janevski, Angel; Riggs, Michael; Banerjee, Nilanjana; Synnestvedt, Marit; Schlichting, Ellen; Kåresen, Rolf; Shama Prasada, K; Rotti, Harish; Rao, Ramachandra; Rao, Laxmi; Eric Tang, Man-Hung; Satyamoorthy, K; Lucito, Robert; Wigler, Michael; Dimitrova, Nevenka; Naume, Bjorn; Borresen-Dale, Anne-Lise; Hicks, James B

    2011-02-01

    The diversity of breast cancers reflects variations in underlying biology and affects the clinical implications for patients. Gene expression studies have identified five major subtypes- Luminal A, Luminal B, basal-like, ErbB2+ and Normal-Like. We set out to determine the role of DNA methylation in subtypes by performing genome-wide scans of CpG methylation in breast cancer samples with known expression-based subtypes. Unsupervised hierarchical clustering using a set of most varying loci clustered the tumors into a Luminal A majority (82%) cluster, Basal-like/ErbB2+ majority (86%) cluster and a non-specific cluster with samples that were also inconclusive in their expression-based subtype correlations. Contributing methylation loci were both gene associated loci (30%) and non-gene associated (70%), suggesting subtype dependant genome-wide alterations in the methylation landscape. The methylation patterns of significant differentially methylated genes in luminal A tumors are similar to those identified in CD24 + luminal epithelial cells and the patterns in basal-like tumors similar to CD44 + breast progenitor cells. CpG islands in the HOXA cluster and other homeobox (IRX2, DLX2, NKX2-2) genes were significantly more methylated in Luminal A tumors. A significant number of genes (2853, p < 0.05) exhibited expression-methylation correlation, implying possible functional effects of methylation on gene expression. Furthermore, analysis of these tumors by using follow-up survival data identified differential methylation of islands proximal to genes involved in Cell Cycle and Proliferation (Ki-67, UBE2C, KIF2C, HDAC4), angiogenesis (VEGF, BTG1, KLF5), cell fate commitment (SPRY1, OLIG2, LHX2 and LHX5) as having prognostic value independent of subtypes and other clinical factors. PMID:21169070

  2. The Onset of a Common Envelope Episode: Lessons from the Remarkable M31 2015 Luminous Red Nova Outburst

    MacLeod, Morgan; Ramirez-Ruiz, Enrico; Grindlay, Jonathan; Batta, Aldo; Montes, Gabriela

    2016-01-01

    This paper investigates the recent transient M31LRN 2015 in the Andromeda galaxy. We analyze published optical photometry and spectroscopy along with a Hubble Space Telescope detection of the color and magnitude of the pre-outburst source. Using these data, we determine that the transient outburst is caused by dynamically driven ejecta at the onset of a common envelope episode, which eventually leads to the complete merger of a binary system. Just prior to merger, we find that the primary star is a $3-5.5 M_\\odot$ sub-giant branch star with radius of $30-40R_\\odot$. Its position in the color-magnitude diagram shows that it is growing in radius to eventually engulf its companion. By matching the properties of the binary system to the transient outburst, we show that the light curve contains two components: first $10^{-2} M_\\odot$ of fast ejecta driven by shocks at contact in between the primary and secondary, and later, $0.2 M_\\odot$ of slower ejecta as the secondary becomes more deeply engulfed within the pri...

  3. Luminal lactate in acute pancreatitis - validation and relation to disease severity

    Pynnönen, Lauri; Minkkinen, Minna; Räty, Sari;

    2012-01-01

    systemic inflammation. In acute pancreatitis (AP) bacterial translocation is considered as the key event leading to infection of necrotic pancreatic tissue and high severity of illness. METHODS: We used rectal luminal equilibration dialysis for the measurement of gut luminal lactate in 30 consecutive...... patients admitted to hospital due to acute pancreatitis to test the hypothesis that a single measurement of rectal luminal lactate predicts the severity of acute pancreatitis, the length of hospital stay, the need of intensive care and ultimately, mortality. We also tested the physiological validity of...... the physiological validity of the method. Rectal luminal lactate at the hospital admission was not associated with the first day or the highest SOFA score, CRP level, hospital length of stay, length of stay in intensive care or mortality. In this cohort of unselected consecutive patients with acute...

  4. SI 1985 No. 1048 - The Radioactive Substances (Luminous Articles) Exemption Order 1985

    This Order, which came into force on 17 September 1985, is concerned with exemptions and exclusions under the Radioactive Substances Act 1960 in respect of radioactive luminous instruments and indicators. (NEA)

  5. Glutamate prevents intestinal atrophy via luminal nutrient sensing in a mouse model of total parenteral nutrition

    Xiao, Weidong; Feng, Yongjia; Holst, Jens Juul;

    2014-01-01

    Small intestine luminal nutrient sensing may be crucial for modulating physiological functions. However, its mechanism of action is incompletely understood. We used a model of enteral nutrient deprivation, or total parenteral nutrition (TPN), resulting in intestinal mucosal atrophy and decreased...

  6. Red giant seismology: Observations

    Mosser B.

    2013-03-01

    Full Text Available The CoRoT and Kepler missions provide us with thousands of red-giant light curves that allow a very precise asteroseismic study of these objects. Before CoRoT and Kepler, the red-giant oscillation patterns remained obscure. Now, these spectra are much more clear and unveil many crucial interior structure properties. For thousands of red giants, we can derive from seismic data precise estimates of the stellar mass and radius, the evolutionary status of the giants (with a clear difference between clump and RGB stars, the internal differential rotation, the mass loss, the distance of the stars... Analyzing this amount of information is made easy by the identification of the largely homologous red-giant oscillation patterns. For the first time, both pressure and mixed mode oscillation patterns can be precisely depicted. The mixed-mode analysis allows us, for instance, to probe directly the stellar core. Fine details completing the red-giant oscillation pattern then provide further information on the interior structure, including differential rotation.

  7. Constancy of built-in luminance meter measurements in diagnostic displays

    Purpose: Liquid crystal displays used to interpret medical images are often equipped with built-in luminance meters to evaluate luminance response and Grayscale Standard Display Function conformance. This work evaluates agreement between luminance reported by the built-in meters and external measurements. Methods: The white level luminance was measured using a built-in meter and an external meter for 93 primary review workstations (Models MFGD 3420 and MDCG 3120-CB) with between 117 and 49 336 backlight hours (BLH). Measured luminance values were compared viat-test for displays with less than 25 000 BLH and those with more than 25 000 BLH. Bias between meters was also evaluated. Changes in luminance uniformity with increasing backlight hours were explored by determining the maximum luminance deviation (MLD) for subsets of these displays with less than 800 BLH and greater than 35 000 BLH. Results: The mean difference between built-in and external luminance measurements was 5.84% and 38.92% for displays with less than 25 000 and greater than 25 000 BLH, respectively, with a statistically significant difference in the means (p < 0.001). For displays with low BLH, a statistically significant bias was observed (p < 0.001) between built-in and external measurements. A high degree of correlation was observed between measurements made with two separate external meters (r = 0.999). The mean MLD was 9.5% and 11.2% for MDCG 3120-CB displays with less than 800 and greater than 35 000 BLH, respectively. The difference in the mean values was not statistically significant (p < 0.001). Conclusions: Disagreement between the white level luminance measured using the built-in and external meter increased with BLH. Consequently, reliance on values reported by the built-in luminance meter may result in a reduction in image contrast with time. Recommendations have been proposed regarding luminance response testing and corrective action for failing displays

  8. Contrast Thresholds in Additive Luminance Noise: Effect of Noise Temporal Characteristics

    McAnany, J. Jason; Alexander, Kenneth R.

    2009-01-01

    This study investigated how the temporal properties of additive luminance noise influence threshold contrast and affect estimates of equivalent noise and sampling efficiency. Threshold contrast was obtained from four visually normal observers for a 2-cycle-per-degree Gabor patch across a range of target durations in the absence and presence of additive luminance noise that was either static or dynamic. In addition, the temporal relationship between target and noise was either synchronous (sim...

  9. Color rendering ability and luminous efficacy enhancements in white light-emitting diodes

    Mirhosseini, Roya; Schubert, Martin; Chhajed, Sameer; Cho, Jaehee; Kim, Jong Kyu; Schubert, E. Fred

    2009-08-01

    There exists a fundamental trade-off relation between color rendering index (CRI) and luminous efficacy; in other words, improvements in one are generally detrimental to the other. We analyze and demonstrate through simulation that phosphor-converted white LEDs with dual-blue emitting active regions, as opposed to single-blue emitting active regions, significantly enhance color rendering ability while maximizing the output luminous flux. The improvements are achieved over a broad range of correlated color temperatures.

  10. An analytical model for backscattered luminance in fog: comparisons with Monte Carlo computations and experimental results

    Taillade, Frédéric; Belin, Etienne; Dumont, Eric

    2008-01-01

    We propose an analytical model for backscattered luminance in fog and derive an expression for the visibility signal-to-noise ratio as a function of meteorological visibility distance. The model uses single scattering processes. It is based on the Mie theory and the geometry of the optical device (emitter and receiver). In particular, we present an overlap function and take the phase function of fog into account. The results of the backscattered luminance obtained with our analytical model...

  11. Measures of response bias at minimum-detectable luminance levels in the pigeon.

    McCarthy, D

    1983-01-01

    Using an operant analogue of the yes-no detection task, six pigeons were trained to detect luminance changes under two different reinforcement-scheduling procedures. In the first, an uncontrolled reinforcement-ratio procedure, the relative frequency of food reinforcers obtained for correct detections was free to vary with the birds' behavior as luminance levels were changed. In the second, a controlled reinforcement-ratio procedure, changes in preference could not alter the relative distribut...

  12. Influence of high ambient illuminance and display luminance on readability and subjective preference

    De Moor, Katrien; Andrén, Börje; Guo, Yi; Brunnström, Kjell; Wang, Kun; Drott, Anton; Hermann, David S.

    2015-03-01

    Many devices, such as tablets, smartphones, notebooks, fixed and portable navigation systems are used on a (nearly) daily basis, both in in- and outdoor environments. It is often argued that contextual factors, such as the ambient illuminance in relation to characteristics of the display (e.g., surface treatment, screen reflectance, display luminance …) may have a strong influence on the use of such devices and corresponding user experiences. However, the current understanding of these influence factors is still rather limited. In this work, we therefore focus in particular on the impact of lighting and display luminance on readability, visual performance, subjective experience and preference. A controlled lab study (N=18) with a within-subjects design was performed to evaluate two car displays (one glossy and one matte display) in conditions that simulate bright outdoor lighting conditions. Four ambient luminance levels and three display luminance settings were combined into 7 experimental conditions. More concretely, we investigated for each display: (1) whether and how readability and visual performance varied with the different combinations of ambient luminance and display luminance and (2) whether and how they influenced the subjective experience (through self-reported valence, annoyance, visual fatigue) and preference. The results indicate a limited, yet negative influence of increased ambient luminance and reduced contrast on visual performance and readability for both displays. Similarly, we found that the self-reported valence decreases and annoyance and visual fatigue increase as the contrast ratio decreases and ambient luminance increases. Overall, the impact is clearer for the matte display than for the glossy display.

  13. Advanced luminance control and black offset correction for multi-projector display systems

    Zietlow, Timon; Heinz, Marcel; Brunnett, Guido

    2015-01-01

    In order to display a homogeneous image using multiple projectors, differences in the projected intensities must be compensated. In this paper, we present novel approaches to combine and extend existing techniques for edge blending and luminance harmonization to achieve a detailed luminance control. Furthermore, we apply techniques for improving the contrast ratio of multi-segmented displays also to the black offset correction. We also present a simple scheme to involve the displayed context ...

  14. Comparative study of methods for measuring window film UV and luminous transmittance

    This work presents a comparison of window film ultraviolet transmission calculated according ISO 13837 methods A and B and window film luminous transmission calculated for illuminates A and D65. The results show a difference from 350% to 800% in ultraviolet transmission between ISO 13837 methods A and B for the evaluated window films. On the other hand, the difference in luminous transmission results for the evaluated window films is less than 1%

  15. Contrast normalization in colour vision: the effect of luminance contrast on colour contrast detection

    Mullen, Kathy T.; Kim, Yeon Jin; Gheiratmand, Mina

    2014-01-01

    While contrast normalization is well known to occur in luminance vision between overlaid achromatic contrasts, and in colour vision between overlaid colour contrasts, it is unknown whether it transfers between colour and luminance contrast. Here we investigate whether contrast detection in colour vision can be normalized by achromatic contrast, or whether this is a selective process driven only by colour contrast. We use a method of cross-orientation masking, in which colour detection is mask...

  16. Study of preferred background luminance in watching computer screen in children

    Shen Yang; Kuai Shuguang; Zhou Weixi; Peng Sheng; Tian Mi; Liu Kangjun; Zhou Xingtao

    2014-01-01

    Background In recent years,computers have been intensively used at home.In contrast to paper-based books and documents,computer screen is self-illuminated with larger screen-background luminance difference,which greatly induces visual discomfort.To compensate for that,one effective solution is to offer an additional background luminance.In this study,we investigated whether and to what extent additional background lighting is needed in looking at a computer display comfortably.Methods In this study,60 healthy children aged from 9 to 12 years and 58 adults aged from 21 to 39 years participated in the experiments.They were asked to choose their most preferred background luminance intensities at three screen luminance levels.The data were analyzed by Matlab (R2012b) and SPSS 20.0.Results Both children and adult participants selected a non-dark background as their comfortable lighting condition when watching a computer display (children:t (59)=22.0,P <0.01,adults:t (57)=15.5,P <0.01).Comparatively,children preferred brighter background in general (F (1,116)=7.0,P <0.01).More importantly,participants' preferred background luminance levels were linearly correlated with screen luminance intensities (children:slope=0.97,R2=0.98; adults:slope=0.38,R2=1.00).Conclusion These results indicate that varying background luminance to maintain screen-background luminance ratio is beneficial to human visual comfort.

  17. The First Hyper-Luminous Infrared Galaxy Discovered by WISE

    Eisenhardt, Peter R.; Wu, Jingwen; Tsai, Chao-Wei; Assef, Roberto; Benford, Dominic; Blain, Andrew; Bridge, Carrie; Condon, J. J.; Cushing, Michael C.; Cutri, Roc; Evans, Neal J., III; Gelino, Chris; Griffith, Roger L.; Grillmair, Carl J.; Jarrett, Tom; Lonsdale, Carol J.; Masci, Frank J.; Mason, Brian S.; Petty, Sara; Sayers, Jack; Stanford, S. Adam; Stern, Daniel; Wright, Edward L.; Yan, Lin

    2012-01-01

    We report the discovery by the Wide-field Infrared Survey Explorer of the z = 2.452 source WISEJ181417.29+341224.9, the first hyperluminous source found in the WISE survey. WISE 1814+3412 is also the prototype for an all-sky sample of approximately 1000 extremely luminous "W1W2-dropouts" (sources faint or undetected by WISE at 3.4 and 4.6 micrometers and well detected at 12 or 22 micrometers). The WISE data and a 350 micrometers detection give a minimum bolometric luminosity of 3.7 x 10(exp 13) solar luminosity, with approximately 10(exp 14) solar luminosity plausible. Followup images reveal four nearby sources: a QSO and two Lyman Break Galaxies (LBGs) at z = 2.45, and an M dwarf star. The brighter LBG dominates the bolometric emission. Gravitational lensing is unlikely given the source locations and their different spectra and colors. The dominant LBG spectrum indicates a star formation rate approximately 300 solar mass yr(exp -1), accounting for less than or equal to 10 percent of the bolometric luminosity. Strong 22 micrometer emission relative to 350 micrometer implies that warm dust contributes significantly to the luminosity, while cooler dust normally associated with starbursts is constrained by an upper limit at 1.1 mm. Radio emission is approximately 10? above the far-infrared/radio correlation, indicating an active galactic nucleus is present. An obscured AGN combined with starburst and evolved stellar components can account for the observations. If the black hole mass follows the local MBH-bulge mass relation, the implied Eddington ratio is approximately greater than 4. WISE 1814+3412 may be a heavily obscured object where the peak AGN activity occurred prior to the peak era of star formation.

  18. MEAN SPECTRAL ENERGY DISTRIBUTIONS AND BOLOMETRIC CORRECTIONS FOR LUMINOUS QUASARS

    We explore the mid-infrared (mid-IR) through ultraviolet (UV) spectral energy distributions (SEDs) of 119,652 luminous broad-lined quasars with 0.064 2500Å =2.75 ± 0.40 using the integrated light from 1 μm-2 keV, and we further explore the range of bolometric corrections exhibited by individual objects. In addition, we investigate the dependence of the mean SED on various parameters, particularly the UV luminosity for quasars with 0.5 ∼ 1.6; the latter is a possible indicator of the strength of the accretion disk wind, which is expected to be SED-dependent. Luminosity-dependent mean SEDs show that, relative to the high-luminosity SED, low-luminosity SEDs exhibit a harder (bluer) far-UV spectral slope (αUV), a redder optical continuum, and less hot dust. Mean SEDs constructed instead as a function of UV emission line properties reveal changes that are consistent with known Principal Component Analysis trends. A potentially important contribution to the bolometric correction is the unseen extreme UV (EUV) continuum. Our work suggests that lower-luminosity quasars and/or quasars with disk-dominated broad emission lines may require an extra continuum component in the EUV that is not present (or much weaker) in high-luminosity quasars with strong accretion disk winds. As such, we consider four possible models and explore the resulting bolometric corrections. Understanding these various SED-dependent effects will be important for accurate determination of quasar accretion rates.

  19. WISE: From the Dimmest Stars to the most Luminous Galaxies!

    Craig, N.; Mendez, B. J.; Wright, E. L.

    2004-12-01

    The Wide-field Infrared Survey Explorer (WISE) Mission, led by UCLA PI Dr. Edward L. Wright is a newly selected MIDEX Mission, scheduled to launch in Summer 2008. WISE will conduct a survey of the entire sky in the infrared (3.5 - 23 microns) with far greater sensitivity than any previous program or mission. WISE will catalogue more than 100,000 asteroids, discover the coolest, dimmest, and nearest stars to the Sun, and determine which are the most luminous galaxies in the Universe. The WISE survey will consist of over a million images, from which hundreds of millions of astronomical objects will be catalogued, providing a vast storehouse of knowledge about the Solar System, the Milky Way, and the Universe. We will discuss our plans for an Education and Public Outreach (E/PO) program for WISE, including how our program will leverage resources from other IR mission E/PO programs such as Spitzer and SOFIA. We will also discuss our plans to partner with the amateur astronomer community to reach out to the K-12 education community, including underserved communities. The University of California, Berkeley's SEGway group from the Space Sciences Laboratory will lead the E/PO efforts of the WISE Mission with formal and informal education partners such as NOAO, Hands-On-Universe, the American Museum of Natural History, Space Science Institute, Space Dynamics Laboratory, the Astronomical Society of the Pacific, and Cornerstone Evaluations. The outreach program of WISE will captivate a wide range of audiences in the formal and informal science education communities with beautiful imagery and engaging science.

  20. Underlying mechanisms of transient luminous events: a review

    V. V. Surkov

    2012-08-01

    Full Text Available Transient luminous events (TLEs occasionally observed above a strong thunderstorm system have been the subject of a great deal of research during recent years. The main goal of this review is to introduce readers to recent theories of electrodynamics processes associated with TLEs. We examine the simplest versions of these theories in order to make their physics as transparent as possible. The study is begun with the conventional mechanism for air breakdown at stratospheric and mesospheric altitudes. An electron impact ionization and dissociative attachment to neutrals are discussed. A streamer size and mobility of electrons as a function of altitude in the atmosphere are estimated on the basis of similarity law. An alternative mechanism of air breakdown, runaway electron mechanism, is discussed. In this section we focus on a runaway breakdown field, characteristic length to increase avalanche of runaway electrons and on the role played by fast seed electrons in generation of the runaway breakdown. An effect of thunderclouds charge distribution on initiation of blue jets and gigantic jets is examined. A model in which the blue jet is treated as upward-propagating positive leader with a streamer zone/corona on the top is discussed. Sprite models based on streamer-like mechanism of air breakdown in the presence of atmospheric conductivity are reviewed. To analyze conditions for sprite generation, thunderstorm electric field arising just after positive cloud-to-ground stroke is compared with the thresholds for propagation of positively/negatively charged streamers and with runway breakdown. Our own estimate of tendril's length at the bottom of sprite is obtained to demonstrate that the runaway breakdown can trigger the streamer formation. In conclusion we discuss physical mechanisms of VLF (very low frequency and ELF (extremely low frequency phenomena associated with sprites.

  1. The Red Supergiant Content of M31

    Massey, Philip

    2016-01-01

    We investigate the red supergiant (RSG) population of M31, obtaining radial velocities of 255 stars. These data substantiate membership of our photometrically-selected sample, demonstrating that Galactic foreground stars and extragalactic RSGs can be distinguished on the basis of B-V, V-R two-color diagrams. In addition, we use these spectra to measure effective temperatures and assign spectral types, deriving physical properties for 192 RSGs. Comparison with the solar-metallicity Geneva evolutionary tracks indicates astonishingly good agreement. The most luminous RSGs in M31 are likely evolved from 25-30 Mo stars, while the vast majority evolved from stars with initial masses of 20 Mo or less. There is an interesting bifurcation in the distribution of RSGs with effective temperatures that increases with higher luminosities, with one sequence consisting of early K-type supergiants, and with the other consisting of M-type supergiants that become later (cooler) with increasing luminosities. This separation is o...

  2. Little Red Riding Hood

    胡蓉

    2011-01-01

    你一定看过并知道小红帽(Little Red Riding Hood)的故事吧!下面是英语版的小红帽,你看过吗? Once upon a time,people liked a little girl very much.Her red hood(头巾 ) fit her, so people called her Little Red Riding Hood. One day,her mother said, "Take a piece of cake and a bottle ofwine to your grandmother.She is ill and weak.These will do her good.Donot run off the road,or you may fall and break the bottle,and then yourgrandmother will get nothing.OK! Go at once."

  3. Mercury-free electrodeless discharge lamp: effect of xenon pressure and plasma parameters on luminance

    Since there is much concern about environmental preservation, the authors have paid attention to the uses of mercury in lighting application. They have focused on the application of the xenon low-pressure inductively coupled plasma (ICP) discharge in developing cylindrical type mercury-free light sources. ICP can be operated at low filling gas pressures and demonstrates significant potential in producing high density plasma. Xenon pressure was varied from 0.1 to 100 Torr and the lamp luminance was measured. The gas pressure dependence shows an increase in luminance at pressures below 1 Torr. In order to clarify this behaviour, measurement of plasma parameters was carried out using the double probe method and its relation to lamp luminance is discussed. As the gas pressure is decreased (from 1 to 0.01 Torr), the electron temperature increases while the electron density decreases while at the same time the lamp luminance increases. There are several factors that are believed to contribute to the increase in luminance in the very low pressure region. Increases in luminance are considered to be due to the electron-ion recombination process which brings a strong recombination radiation in continuum in the visible region and also due to the effect of stochastic heating.

  4. White-dwarf red-giant mergers, early-type R stars, J stars and lithium

    Zhang, Xianfei

    2013-01-01

    Early-type R stars and J stars are a special type of carbon star, having enhanced nitrogen ($\\rm [N/Fe]\\approx 0.5$), lithium, a low \\iso{12}{C}/\\iso{13}{C} ratio ($<15$) and no s-element enhancements. The merger of a helium white dwarf with a red giant is regarded to be a possible model for the origin of early-type R stars, but the details of nucleosynthesis are not clear. In this paper we investigate three possible channels for helium white-dwarf + red-giant mergers, and find that, amongst the three, only a high-mass helium white dwarf subducted into a low core-mass red giant can make an early-type R star. Nucleosynthesis of elements carbon, nitrogen, oxygen and lithium correspond well with the observations. Furthermore, we find that the J stars may represent a short and luminous stage in the evolution of an early-R star.

  5. The Gaia-ESO survey: Hydrogen lines in red giants directly trace stellar mass

    Bergemann, Maria; Schoenrich, Ralph; Ruchti, Greg; Korn, Andreas; Hekker, Saskia; Kovalev, Mikhail; Mashonkina, Lyudmila; Gilmore, Gerry; Randich, Sofia; Asplund, Martin; Rix, Hans-Walter; Casey, Andrew R; Jofre, Paula; Pancino, Elena; Recio-Blanco, Alejandra; de Laverny, Patrick; Smiljanic, Rodolfo; Tautvaisiene, Grazina; Bayo, Amelia; Lewis, Jim; Koposov, Sergey; Hourihane, Anna; Worley, Clare; Morbidelli, Lorenzo; Franciosini, Elena; Sacco, Germano; Magrini, Laura; Damiani, Francesco; Bestenlehner, Joachim M

    2016-01-01

    Red giant stars are perhaps the most important type of stars for Galactic and extra-galactic archaeology: they are luminous, occur in all stellar populations, and their surface temperatures allow precise abundance determinations for many different chemical elements. Yet, the full star formation and enrichment history of a galaxy can be traced directly only if two key observables can be determined for large stellar samples - age and chemical composition. While spectroscopy is a powerful method to analyse the detailed abundances of stars, stellar ages are the "missing link in the chain", since they are not a direct observable. However, spectroscopy should be able to estimate stellar masses, which for red giants directly infer ages provided their chemical composition is known. Here we establish a new empirical relation between the shape of the hydrogen line in the observed spectra of red giants and stellar mass determined from asteroseismology. The relation allows to determine stellar masses and ages with the ac...

  6. Luminous and Variable Stars in M31 and M33. II. Luminous Blue Variables, Candidate LBVs, Fe II Emission Line Stars, and Other Supergiants

    Humphreys, Roberta M; Davidson, Kris; Bomans, D J; Burggraf, Birgitta

    2014-01-01

    An increasing number of non-terminal eruptions are being found in the numerous surveys for optical transients. Very little is known about these giant eruptions, their progenitors and their evolutionary state. A greatly improved census of the likely progenitor class, including the most luminous evolved stars, the Luminous Blue Varaibles (LBVs), and the warm and cool hypergiants is now needed for a complete picture of the final pre-SN stages of very massive stars. We have begun a survey of the evolved and un stable luminous star populations in several nearby resolved galaxies. In this second paper on M31 and M33, we review the spectral characteristics, spectral energy distributions, circumstellar ejecta, and evidence for mass loss for 82 luminous and variable stars.We show that many of these stars have warm circumstellar dust including several of the Fe II emission line stars, but conclude that the confirmed LBVs in M31 and M33 do not. The confirmed LBVs have relatively low wind speeds even in their hot, quiesc...

  7. Red sprites and blue jets: Thunderstorm-excited optical emissions in the stratosphere, mesosphere, and ionosphere

    Recent low light level monochrome television observations obtained from the ground and from the space shuttle, and low light level color and monochrome television images obtained from aboard jet aircraft, have shown that intense lightning in mesoscale thunderstorm systems may excite at least two distinct types of optical emissions that together span the space between the tops of some thunderstorms and the ionosphere. The first of these emissions, dubbed ''sprites,'' are luminous red structures that typically span the altitude range 60--90 km, often with faint bluish tendrils dangling below. A second, rarer, type of luminous emission are ''blue jets'' that appear to spurt upward out of the anvil top in narrow cones to altitudes of 40--50 km at speeds of ∼100 km/s. In this paper the principal observational characteristics of sprites and jets are presented, and several proposed production mechanisms are reviewed. copyright 1995 American Institute of Physics

  8. Deep-red to near-infrared electrophosphorescence based on bis(8-hydroxyquinolato) platinum(II) complexes

    Xiang, Hai-Feng; Xu, Zong-Xiang; Roy, V. A. L.; Yan, Bei-Ping; Chan, Siu-Chung; Che, Chi-Ming; Lai, P. T.

    2008-04-01

    A series of neutral platinum(II) complexes with substituted 8-hydroxyquinoline ligands for use in organic electroluminescent devices have been prepared. These platinum(II) complexes give deep-red to near-infrared phosphorescence with λmax ,peak from 650to695nm and λmax ,shoulder from 705to755nm. High-performance organic light-emitting devices are obtained using these bis(8-hydroxyquinolato) platinum(II) complexes as a deep-red to near-infrared emitter with maximum external quantum efficiency, luminous efficiency, and turn-on voltage of 1.7%, 0.32cd/A, and 3.2V, respectively.

  9. Probe data: 5037 [RED

    Full Text Available R12-044780-1AR RED AU173063 AU173064 RA0155 >XLU37373_1(U37373|pid:g1234787) Xenopus laevis tail ... -specific thyroid ... hormone up-regulated (gene 5) mRNA, complete cds; ... up-regulated by thyroid ... hormone in tadpoles; expressed specifically in the ...

  10. Probe data: 5576 [RED

    Full Text Available R03-047910-1AR RED AU174190 AU174191 ST1070 >XLU37373_1(U37373|pid:g1234787) Xenopus laevis tail ... -specific thyroid ... hormone up-regulated (gene 5) mRNA, complete cds; ... up-regulated by thyroid ... hormone in tadpoles; expressed specifically in the ...

  11. Probe data: 6197 [RED

    Full Text Available R07-048110-1AR RED D22267 C96749 C10642 CB0642 >TAU87163_1(U87163|pid:g2306768) Triticum aestivu ... eta subunit mRNA, complete cds; assignment of open reading ... frame based on alignment with other plant eIF2 sub ...

  12. Probe data: 2895 [RED

    Full Text Available R03-021800-1AR RED C19773 AU101326 E10917 EC0917 >TAU87163_1(U87163|pid:g2306768) Triticum aesti ... eta subunit mRNA, complete cds; assignment of open reading ... frame based on alignment with other plant eIF2 sub ...

  13. Probe data: 5564 [RED

    Full Text Available R02-057040-1AR RED D39512 AU174175 ST0896 >SPAC19A8_12(Z98974|pid:g2388911) S.pombe chromosome I ... ar eg. to YNL118C, PSU1_YEAST, P53550, involved in respiration , (970aa), fasta scores, opt:776, E():0, (29.1% ide ...

  14. Probe data: 5495 [RED

    Full Text Available R09-031940-1R RED D48735 AU174075 SS5125 >SPBC215_13(AL033534|pid:g3873550) S.pombe chromosome I ... 932 aa), fasta scores: opt: 694, E():8e-27, (41.8% identity ... in 457 aa). ...

  15. Probe data: 2587 [RED

    Full Text Available R11-011010-4R RED AU062718 AU100766 C30311 CE0311 >AE000959_10(AE000959|pid:g2648442) Archaeoglo ... similar to GB:X79560 SP:P46464 PID:517390 percent identity : 61.98; identified by sequence similarity; putativ ...

  16. Probe data: 3857 [RED

    Full Text Available R06-042830-1AR RED AU064223 AU164111 ED0143 >AE001019_19(AE001019|pid:g2649345) Archaeoglobus fu ... similar to GB:L77117 SP:Q60179 PID:1591690 percent identity : 39.38; identified by sequence similarity; putativ ...

  17. Probe data: 3925 [RED

    Full Text Available R03-019390-1AR RED AU164858 AU164859 EH1645 >AP000005_67(AP000005|pid:g3257577) Pyrococcus horik ... position (5/7); similar to owl:HPAE0006332 percent identity :27.451 in 212aa; Swiss_Prot:P44659 percent identit ...

  18. Probe data: 3184 [RED

    Full Text Available R05-006300-1AR RED D48993 AU101824 S15595 SS5595 >AE001130_3(AE001130|pid:g2688094) Borrelia bur ... SP:P17580 GB:M24503 PID:290500 PID:551840 percent identity : 38.99; identified by sequence similarity; putativ ...

  19. Probe data: 5521 [RED

    Full Text Available R03-030160-1AR RED AU174105 AU174106 SS6038 >ATNAP16KD_1(Z96936|pid:g2765837) Arabidopsis thalia ... ociated protein NAP16kDa; pos. 112 to 116 sequence identity ... to nitrilase isoform 1 and 2. ...

  20. Probe data: 5482 [RED

    Full Text Available R02-017290-1AR RED AU174055 AU174056 SS4954 >AE000956_15(AE000956|pid:g2648379) Archaeoglobus fu ... e genome; similar to PID:1045016 SP:Q51790 percent identity : 31.21; identified by sequence similarity; putativ ...

  1. Probe data: 364 [RED

    Full Text Available R02-031580-1AR RED AU075434 AU031062 E60705 EH0705 >AF036618_1(AF036618|pid:g2708624) Arabidopsi ... thaliana acetyl-CoA synthetase mRNA, complete cds; identity ... based on similarity to known acetyl-CoA synthetase ...

  2. Probe data: 252 [RED

    Full Text Available R09-033840-1AR RED AU162299 AU030444 E51070 EG1070 >AE000968_9(AE000968|pid:g2648586) Archaeoglo ... similar to GB:L77117 SP:Q57665 PID:1498988 percent identity : 60.92; identified by sequence similarity; putativ ...

  3. Probe data: 4505 [RED

    Full Text Available R01-017940-1AR RED AU166950 AU166951 CH0192 >AE001265_11(AE001265|pid:g3323304) Treponema pallid ... the complete genome; similar to GP:606359 percent identity : 29.47; identified by sequence similarity; putativ ...

  4. Probe data: 1244 [RED

    Full Text Available R02-038610-1AR RED AU057404 AU057405 S21415 SA1415 >SPAC57A7_5(Z95396|pid:g2104440) S.pombe chro ... 5 aa), fasta scores: opt: 199, E():0.00029, (20.5% identity ... in 366 aa). ...

  5. Probe data: 5087 [RED

    Full Text Available R07-015750-1AR RED D24254 AU173174 RA1586 >AE001048_5(AE001048|pid:g2649798) Archaeoglobus fulgi ... e genome; similar to GB:L77117 PID:1591676 percent identity : 48.77; identified by sequence similarity; putativ ...

  6. Probe data: 1808 [RED

    Full Text Available R01-015680-1AR RED C72327 AU078752 EB1437 >AE000949_5(AE000949|pid:g2648274) Archaeoglobus fulgi ... of 172 of the complete genome; similar to percent identity : 28.02; identified by sequence similarity; putativ ...

  7. Probe data: 5456 [RED

    Full Text Available R08-023200-1AR RED D47972 AU174021 SS3803 >AE001011_18(AE001011|pid:g2649239) Archaeoglobus fulg ... the complete genome; similar to SP:P24297 percent identity : 67.92; identified by sequence similarity; putativ ...

  8. Probe data: 4990 [RED

    Full Text Available R12-008240-1AR RED AU064916 AU172911 EF0791 >AF052429_1(AF052429|pid:g2981214) Zea mays photosys ... tem I complex PsaN subunit precursor (psaN) mRNA, nuclear ... gene encoding chloroplast protein, partial cds; nu ...

  9. Probe data: 581 [RED

    Full Text Available R02-011070-2AR RED AU031849 AU031850 R02164 RA2164 >XLU69669_1(U69669|pid:g1850344) Xenopus laev ... is nuclear ... pore complex-associated protein TPR (tpr) mRNA, pa ... rtial cds; nuclear ... pore complex-associated protein; translocated prom ...

  10. Probe data: 6247 [RED

    Full Text Available R02-008440-1AR RED C26839 C96955 C50194 CG0194 >ATF19H22_3(AL035679|pid:g4539312) Arabidopsis th ... 778, T76313, H76773, T76734 are in 3' untranslated region ; EST T42894 covers intron in 5' untranslated regio ...

  11. Probe data: 5314 [RED

    Full Text Available R03-013800-1AR RED AU065355 AU173508 RA3452 >DOG01_1(D43756|pid:g1304047) Dog gene for fibrinoge ... n A-alpha-chain, partial cds (C-terminal region ); carboxy-terminal region . ...

  12. Probe data: 5984 [RED

    Full Text Available RED AU174977 AU174976 FL0119 >OLRKLP2_1(U72725|pid:g2586083) Oryza longistaminata receptor kinas ... e-like protein gene, family ... member A1, complete cds; Xa21 gene family ... member A ... of microsatellite region; disease resistance gene family ... member. ...

  13. Probe data: 5952 [RED

    Full Text Available RED AU174907 AU174908 FL0036 >OLRKLP2_1(U72725|pid:g2586083) Oryza longistaminata receptor kinas ... e-like protein gene, family ... member A1, complete cds; Xa21 gene family ... member A ... of microsatellite region; disease resistance gene family ... member. ...

  14. Probe data: 991 [RED

    Full Text Available R06-046410-1AR RED AU162658 AU056152 S20333 SA0333 >CAN012165_1(AJ012165|pid:g3808101) Capsicum ... for chloroplast protease (CACP)from the AAA atpase family ; AAA atpase family . ...

  15. Probe data: 2696 [RED

    Full Text Available R07-042870-1AR RED AU101001 AU101000 C62681 CH2681 >AF078103_1(AF078103|pid:g4218945) Homo sapie ... ns developmentally regulated GTP-binding protein (DRG ) mRNA, complete cds. &HSA005940_1(AJ005940|pid:g41 ...

  16. Probe data: 2995 [RED

    Full Text Available R11-007900-2AR RED AU030559 AU101484 E51237 EG1237 >AF020193_1(AF020193|pid:g2895198) Glycine ma ... x DNA ... polymerase delta (Pol delta) mRNA, complete cds; D ... NA-dependent DNA ... polymerase. ...

  17. Probe data: 3754 [RED

    Full Text Available R02-042000-1AR RED D48054 AU162984 SS3984 >CELZC13_4(U67953|pid:g1519683) Caenorhabditis elegans ... ity to EGF-like domain cysteine pattern signature (PS :PS 00022); coded for by C. elegans cDNA yk70d5.3; c ...

  18. Probe data: 4083 [RED

    Full Text Available R08-045490-1AR RED AU077699 AU166249 E50587 EG0587 >MEU72662_12(U72662|pid:g2160684) Methylobact ... tative ABC transporter ATP-binding subunit (abcC), methanol ... dyhydrogenase large subunit homolog (mxaF'), cytoc ...

  19. Probe data: 4655 [RED

    Full Text Available R03-018670-1AR RED C72142 AU172460 EB1070 >TDU89271_1(U89271|pid:g1877482) Tripsacum dactyloides ... short-chain alcohol dehydrogenase (gynomonoecious sex ... form 1) gene, allele gsf1, complete cds; similar t ...

  20. Probe data: 5077 [RED

    Full Text Available R02-043650-1AR RED AU173162 AU173163 RA1507 >AF057183_1(AF057183|pid:g3264596) Zea mays putative ... nscript 1 (HIT1); induced by submergence, hypoxia, mechanical ... impedence, and 40% O2 conditions. ...

  1. Probe data: 487 [RED

    Full Text Available R05-018490-1AR RED D23861 AU031673 R00448 RA0448 >OSU30479_1(U30479|pid:g1041712) Oryza sativa e ... 3 (Os-EXP3) mRNA, complete cds; induces extension (creep ) in plant cell walls; former gene name RiExD. ...

  2. Probe data: 3148 [RED

    Full Text Available R12-043420-1AR RED D47342 AU101752 S12658 SS2658 >(P38076) CYSTEINE SYNTHASE (EC 4.2.99.8) (O -AC ... ETYLSERINE SULFHYDRYLASE) (O -ACETYLSERINE (THIO L)-LYASE) (CSASE). &JS0762(JS076 ...

  3. Probe data: 3928 [RED

    Full Text Available R03-053360-1AR RED AU164935 AU164936 E61827 EH1827 >(Q43317) CYSTEINE SYNTHASE (EC 4.2.99.8) (O - ... ACETYLSERINE SULFHYDRYLASE) (O -ACETYLSERINE (THIO L)-LYASE) (CSASE). &CNAPCCS7_1(D ...

  4. Probe data: 4200 [RED

    Full Text Available R03-028920-1AR RED AU062597 AU166443 CB2410 >EBV_10(V01555|pid:g1334843) Epstein-Barr virus (EBV ... stoid cell line immortalized with human EBV from a mononucleosis ... patient; BWRF1 reading frame 8; Protein sequence i ...

  5. Probe data: 4637 [RED

    Full Text Available R02-008940-1AR RED C71953 AU172434 EB0676 >ATF10M23_3(AL035440|pid:g4455192) Arabidopsis thalian ... weak similarity to hypothetical protein PFB0835c - malaria , PID:g3845289; contains EST gb:T42321, R65259, Aa7 ...

  6. Probe data: 6350 [RED

    Full Text Available R11-026990-1AR RED C97557 C97558 C60385 CH0385 >HTU32872_1(U32872|pid:g1463038) Human T-cell lym ... photropic virus type 2 rex and tax ... genes, partial cds, clone SP2; putative. &HTU32875 ...

  7. Probe data: 2820 [RED

    Full Text Available R03-000280-1AR RED C72958 AU101205 E02550 EB2550 >S39445(S39445;A42119) DNA-directed RNA polymer ... ase (EC 2.7.7.6) II chain 9, 15K - fruit fly ... (Drosophila melanogaster) &S66940_1(S66940|pid:g45 ...

  8. Probe data: 3103 [RED

    Full Text Available R09-032390-1AR RED D39322 AU101671 R03330 RA3330 >ATT5C23_17(AL049500|pid:g4539465) Arabidopsis ... e 4, BAC clone T5C23 (ESSA project); similarity to Fly ... Fas-associated factor (FFAF), Drosophila melanogas ...

  9. Probe data: 3422 [RED

    Full Text Available R02-049940-1AR RED C96862 AU108608 C12691 CB2691 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cyt ... oplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  10. Probe data: 1384 [RED

    Full Text Available R02-049940-1AR RED AU068083 AU068084 C11828 CB1828 >ZMU43082_1(U43082|pid:g1421730) Zea mays T c ... ytoplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  11. Probe data: 5862 [RED

    Full Text Available R06-016110-1AR RED AU174691 AU174690 FE0214 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cytoplas ... m male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  12. Probe data: 635 [RED

    Full Text Available R01-039520-1AR RED D39230 AU031992 R03072 RA3072 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cyt ... oplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  13. Probe data: 2296 [RED

    Full Text Available R02-049940-1AR RED C19367 AU094406 E10314 EC0314 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cyt ... oplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  14. Probe data: 3192 [RED

    Full Text Available R06-016110-1AR RED AU101840 AU101841 S15881 SS5881 >ZMU43082_1(U43082|pid:g1421730) Zea mays T c ... ytoplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  15. Probe data: 1631 [RED

    Full Text Available R01-039510-1AR RED AU075853 AU075854 S20436 SA0436 >ZMU43082_1(U43082|pid:g1421730) Zea mays T c ... ytoplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  16. Probe data: 2872 [RED

    Full Text Available R04-052870-1AR RED C73509 AU101290 E04274 EB4274 >AF023159_1(AF023159|pid:g3057120) Zea mays starch ... ULL1 (dull1) mRNA, complete cds; similar to potato starch ... synthase SSIII; likely to be the maize starch ... synt ...

  17. Probe data: 173 [RED

    Full Text Available R04-032560-4R RED AU030096 AU030097 E50621 EG0621 >ZMU65948_1(U65948|pid:g2340108) Zea mays starch ... ch branching enzyme IIa (Sbe2a) mRNA, partial cds; starch ... branching enzyme isozyme SBEIIa. ...

  18. Probe data: 3220 [RED

    Full Text Available R09-025420-1AR RED AU032971 AU101898 S00086 ST0086 >D88434_1(D88434|pid:g4519507) Malus domestic ... a mRNA for protein abundantly expressed during apple ... fruit development, complete cds; similar to Garden ...

  19. Probe data: 4872 [RED

    Full Text Available R03-007550-2AR RED AU172766 AU172767 EE0037 >F9D12_1(AF077407|pid:g3319342) Arabidopsis thaliana ... BAC F9D12; similar to mit ochondrial carrier proteins (Pfam: mit _carr.hmm, sc ...

  20. Probe data: 1918 [RED

    Full Text Available R06-001500-1AR RED AU031498 AU082419 E61744 EH1744 >ATU20347_1(U20347|pid:g790583) Arabidopsis t ... responding to this gene accumulates in response to ozone ... stress and pathogen (bacterial) infection; putativ ...

  1. Probe data: 1601 [RED

    Full Text Available R06-043000-1AR RED C26746 AU075577 C12957 CB2957 >HSU49082_1(U49082|pid:g1840045) Human transpor ... ter protein (g17) mRNA, complete cds; member of a new ... family of transporter protein genes; resides in th ...

  2. Probe data: 3050 [RED

    Full Text Available R05-046640-1AR RED AU031556 AU101584 E61844 EH1844 >HS1119A7_2(AL022313|pid:g4200328) Human DNA ... iation factor EIF3-P66 subunit, EST, GSS, STS, CpG island , complete sequence; &HSU54558_1(U54558|pid:g235137 ...

  3. Probe data: 3094 [RED

    Full Text Available R12-040640-1AR RED D24605 AU101660 R02241 RA2241 >AF099082_1(AF099082|pid:g4176766) Homo sapiens ... xenotropic and polytropic murine retrovirus ... receptor (XPR1) mRNA, complete cds; related to yea ...

  4. EST data: 8680 [RED

    Full Text Available ST3645 D41273 AU174297 DPlate 090 H05 AAAAGCCCCCATTATTGTTC AGGAGGAGAGATTGCAGGAG >AGU83687_1(U836 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  5. EST data: 8002 [RED

    Full Text Available SS4252 D48175 AU032804 S14252 4 G DPlate 083 B05 CGCAAATACACGAAATATAG TGCTTGATGAATTATGAGTC >AGU8 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  6. EST data: 8329 [RED

    Full Text Available ST0625 AU163183 AU163184 S00625 4 G DPlate 086 A10 ACTTGGCAGGCTGGTTGGTG GAGTGGTTTGGGTCCGTTTC >AG ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  7. Probe data: 66 [RED

    Full Text Available R07-032820-1AR RED AU166075 AU029521 EE1034 >AF020814_1(AF020814|pid:g2997591) Pisum sativum glu ... cose-6-phosphate /phosphate -translocator precursor (GPT) mRNA, nucle ... n, complete cds; metabolite transporter; glucose-6-phosphate ... is the precursor for starch synthesis in many plas ...

  8. Probe data: 6267 [RED

    Full Text Available R08-034590-1AR RED AU108817 C97061 C51323 CG1323 >(Q43272) NADP-DEPENDENT GLYCERALDEHYDE-3-PHOSPHATE ... (EC 1.2.1.9) (NON-PHOSPHORYLATING GLYCERALDEHYDE 3-PHOSPHATE ... DEHYDROGENASE) (GLYCERALDEHYDE-3-PHOSPHATE ... DEHYDRO ... GENASE (NADP+)) (TRIOSEPHOSPHATE ... DEHYDROGENASE). &S43833(S43833) &ZMRNAGAPN_1(X7532 ...

  9. Probe data: 783 [RED

    Full Text Available R08-034590-1AR RED D48732 AU032835 S15122 SS5122 >(Q43272) NADP-DEPENDENT GLYCERALDEHYDE-3-PHOSPHATE ... (EC 1.2.1.9) (NON-PHOSPHORYLATING GLYCERALDEHYDE 3-PHOSPHATE ... DEHYDROGENASE) (GLYCERALDEHYDE-3-PHOSPHATE ... DEHYDRO ... GENASE (NADP+)) (TRIOSEPHOSPHATE ... DEHYDROGENASE). &S43833(S43833) &ZMRNAGAPN_1(X7532 ...

  10. Probe data: 3500 [RED

    Full Text Available R04-059760-1AR RED C27462 AU160841 CG1937 >AF020814_1(AF020814|pid:g2997591) Pisum sativum gluco ... se-6-phosphate /phosphate -translocator precursor (GPT) mRNA, nucle ... n, complete cds; metabolite transporter; glucose-6-phosphate ... is the precursor for starch synthesis in many plas ...

  11. Canadian Red Cross.

    Lavender, Colleen

    2008-01-01

    The Canadian Red Cross is guided by its Fundamental Principles--humanity, impartiality, neutrality, independence, voluntary service, unity, and universality--and organized in a traditional geographic hierarchical structure. Among the characteristics that have contributed to its success are a budgeting process that starts at the local level, measurement of program outcomes, and coordinated fundraising activities at the regional level. PMID:18551842

  12. Probe data: 1164 [RED

    Full Text Available R06-003380-1AR RED AU078263 AU056903 S20966 SA0966 >HVSCOAT_1(L37299|pid:g609504) Helicoverpa ar ... tics, makes tube-like structures when expressed in bacteria , unstable when expressed in baculovirus, start cod ...

  13. Probe data: 5088 [RED

    Full Text Available R10-035910-1AR RED D24257 AU173175 RA1590 >ATF23E12_14(AL022604|pid:g3080420) Arabidopsis thalia ... lone F23E12 (ESSAII project); strong similarity to sugar ... transporter, Arabidopsis thaliana, db_xref=PID:g14 ... 95273; Contains Sugar ... transport proteins signatures [SGGVADWLGRRPMLILS] ...

  14. Probe data: 5473 [RED

    Full Text Available R10-035910-1AR RED D48171 AU174043 SS4246 >ATF23E12_14(AL022604|pid:g3080420) Arabidopsis thalia ... lone F23E12 (ESSAII project); strong similarity to sugar ... transporter, Arabidopsis thaliana, db_xref=PID:g14 ... 95273; Contains Sugar ... transport proteins signatures [SGGVADWLGRRPMLILS] ...

  15. Probe data: 4686 [RED

    Full Text Available R04-036560-1AR RED AU063886 AU172500 EB1608 >F9D12_15(AF077407|pid:g3319354) Arabidopsis thalian ... a BAC F9D12; contains similarity to sugar ... transporters (Pfam: sugar _tr.hmm, score: 395.39); ...

  16. Sample information: 2201 [RED

    Full Text Available 2201 2 T Cell cycle Oryza sativa (rice) C5924 (Ghaiya) Rice cell (Oc cells from rice root) culture ... red in AA medium 0 Root t 30 min culture ... (cell cycle)|Rice Oc cells were transferred to a n ... ew culture ... medium and collected after 30min ...

  17. Probe data: 2199 [RED

    Full Text Available R01-053030-1AR RED C27281 AU092509 C51502 CG1502 >(P29677) MITOCHONDRIAL PROCESSING PEPTIDASE AL ... PHA SUBUNIT PREC URSOR (EC ... 3.4.24.64) (ALPHA-MPP) (UBIQUINOL-CYTOCHR ... OME C ... REDUCTASE SUBUNIT II) (EC ... 1.10.2.2). &S23558(S235 ...

  18. Probe data: 438 [RED

    Full Text Available R02-055920-1AR RED AU095379 AU031455 E61595 EH1595 >(Q42876) CHLOROPLAST AMINOPEPTIDASE 1 PREC UR ... SOR (EC ... 3.4.11.1) (LEUCINE AMINOPEPTIDASE) (LAP) (LEUCYL A ... MINOPEPTIDASE) (PROLINE AMINOPEPTIDASE) (EC ... 3.4.11.5) (PROLYL AMINOPEPTIDASE). &S57812(S57812) ...

  19. Probe data: 621 [RED

    Full Text Available R11-008840-1AR RED D39164 AU031950 R02794 RA2794 >(P52588) PROTEIN DISULFIDE ISOMERASE PREC URSOR ... (PDI) (EC ... 5.3.4.1) / DOLICHYL- DIPHOSPHOOLIGOSACCHARIDE-PROT ... EIN GLYCOTRANSFERASE (EC ... 2.4.1.119) (GLYCOSYLATION SITE-BINDING CHAIN) (GSB ...

  20. Probe data: 4096 [RED

    Full Text Available R12-025080-1AR RED AU166273 AU166274 CB0250 >(P07814) MULTIFUNCTIONAL AMINOACYL-TRNA SYNTHETASE ... (CONTAINS: GLUTAMYL-TRNA SYNTHETASE (EC ... 6.1.1.17) (GLUTAMATE--TRNA LIGASE), AND PROLYL-TRN ... A SYNTHETASE (EC ... 6.1.1.15) (PROLINE--TRNA LIGASE)). &HSGTS_1(X54326 ...

  1. Probe data: 6356 [RED

    Full Text Available R01-072960-1AR RED C28243 C97586 C60441 CH0441 >(Q42942) URIDINE 5'-MONOPHOSPHATE SYNTHASE (UMP ... SYNTHASE) (OROTATE PHOSPHORIBOSYLTRANSFERASE (EC ... 2.4.2.10) AND OROTIDINE 5'-PHOSPHATE DEC ARBOXYLASE ... (EC ... 4.1.1.23)) (FRAGMENT). &NTU22260_1(U22260|pid:g747 ...

  2. Probe data: 1484 [RED

    Full Text Available R02-005160-1AR RED AU068643 AU068642 C30624 CE0624 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsi ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  3. Probe data: 450 [RED

    Full Text Available R02-005160-1AR RED AU031552 AU031553 E61840 EH1840 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsi ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  4. Probe data: 539 [RED

    Full Text Available R06-015880-1AR RED D24296 AU031777 R01679 RA1679 >ATF17M5_25(AL035678|pid:g4490316) Arabidopsis ... R:G2290202; Contains Eukaryotic and viral aspartyl proteases ... active site [LDLDTGSDLTWL]. ...

  5. Probe data: 67 [RED

    Full Text Available R08-035600-3AR RED AU029523 AU029522 EE1035 >F6N15_22(AF069299|pid:g3193320) Arabidopsis thalian ... tains similarity to the subtilase family of serine proteases ... (Pfam: subtilase.hmm, score: 47.57); strong simila ...

  6. Probe data: 2573 [RED

    Full Text Available R02-050030-1AR RED C26608 AU100748 C12680 CB2680 >ATF17M5_25(AL035678|pid:g4490316) Arabidopsis ... R:G2290202; Contains Eukaryotic and viral aspartyl proteases ... active site [LDLDTGSDLTWL]. ...

  7. Probe data: 4726 [RED

    Full Text Available R03-005800-1AR RED C72916 AU172547 EB2461 >ATT25K17_14(AL049171|pid:g4539429) Arabidopsis thalia ... e, Arabidopsis thaliana, AF055848; Contains Serine proteases , subtilase family, active sites [GTSMSCPHVAG]. ...

  8. Probe data: 629 [RED

    Full Text Available R05-000860-1AR RED D39203 AU031981 RA3021 >ATF23E12_9(AL022604|pid:g3080415) Arabidopsis thalian ... PIR2:S71773; Contains Eukaryotic thiol (cysteine) proteases ... active sites [QGQCGSCWAFST][LDHGVAAVGYG]; contains ...

  9. Probe data: 3935 [RED

    Full Text Available R04-031750-1AR RED AU165241 AU165240 C62825 CH2825 >(P49727) UBIQUINOL-CYTOCHROME C REDUCTASE IRON ... ON-SULFUR SUBUNIT PRECURSOR (EC 1.10.2.2) (RIESKE IRON -SULFUR PROTEIN) (RISP). &A41607(A41607) &MZERFESPA ...

  10. Probe data: 1697 [RED

    Full Text Available R10-029050-2AR RED AU077497 AU077496 C51971 CG1971 >(P48600) EUKARYOTIC TRANSLATION INITIATION F ... (EIF-4E) (EIF4E) (MRNA CAP-BINDING PROTEIN) (EIF-(ISO )4F 25 KD SUBUNIT) (EIF-(ISO )4F P28 SUBUNIT). &JC53 ...

  11. Probe data: 6548 [RED

    Full Text Available R02-004920-4AR RED C73633 C99436 E20022 ED0022 >S72415_5(S72415|pid:g632873) putative protein ki ... sequence comes from Fig. 2. Protein sequence is in conflict ... with the conceptual translation; mismatches(518-52 ...

  12. Probe data: 5046 [RED

    Full Text Available R06-046030-1AR RED AU173086 AU173087 RA0369 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thali ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  13. Probe data: 4866 [RED

    Full Text Available R07-030880-3AR RED C91611 AU172758 ED0945 >S62928_1(S62928|pid:g386431) PRB1M=PRB1 medium length ... equence comes from Fig. 3A. Protein sequence is in conflict ... with the conceptual translation; mismatch(177[R- & ...

  14. Probe data: 3457 [RED

    Full Text Available R03-022440-3AR RED C27097 AU108766 CG0974 >S58544_1(S58544|pid:g299703) 75 kda infertility-relat ... sequence comes from Fig. 4. Protein sequence is in conflict ... with the conceptual translation; mismatches(46[R- ...

  15. Probe data: 1379 [RED

    Full Text Available R11-043720-4R RED AU166370 AU068062 C11732 CB1732 >AMTAM1TR_1(X57297|pid:g1345502) A. majus TAM1 ... gene for TNP1 and TNP2; Protein sequence is in conflict ... with the conceptual translation; no ATG start codo ...

  16. Probe data: 988 [RED

    Full Text Available R01-019390-1AR RED AU056143 AU056144 S20327 SA0327 >HSPM5_1(X57398|pid:g1335273) Human mRNA for ... pM5 protein; Protein sequence is in conflict ... with the conceptual translation.. &S21977(S21977) ...

  17. Probe data: 1072 [RED

    Full Text Available R01-066870-1AR RED AU162697 AU056522 S20655 SA0655 >ATATAF1_1(X74755|pid:g1345506) A.thaliana AT ... AF1 mRNA; Protein sequence is in conflict ... with the conceptual translation.. &S37101(S37101) ...

  18. Probe data: 4820 [RED

    Full Text Available R05-004160-1AR RED C19333 AU172698 EC0269 >S72926_1(S72926|pid:g633890) Hordeum vulgare glucose ... sequence comes from Fig. 1. Protein sequence is in conflict ... with the conceptual translation.. ...

  19. Probe data: 5707 [RED

    Full Text Available R09-000620-2R RED AU161807 AU174368 ST5674 >S81497_1(S81497|pid:g1336726) lysosomal acid lipase= ... sequence comes from Fig. 2. Protein sequence is in conflict ... with the conceptual translation; mismatches(82[G- ...

  20. Probe data: 2355 [RED

    Full Text Available R06-046030-1AR RED AU065261 AU095249 EH0928 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thali ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  1. Probe data: 862 [RED

    Full Text Available R03-008820-1AR RED AU055750 AU055751 S20035 SA0035 >S75487_1(S75487|pid:g913445) adh3a=alcohol d ... rom Fig. 2. Map location 4. Protein sequence is in conflict ... with the conceptual translation; mismatch(46[R- &V ...

  2. Probe data: 3193 [RED

    Full Text Available R04-033600-2AR RED C24862 AU101846 S16003 SS6003 >IT U51741_1(U51741|pid:g1272351) Ipomoea trifid ... eceptor protein kinase 2 (IRK2) mRNA, partial cds; it ... is unknown whether kinase domain is translated; ge ...

  3. Probe data: 3966 [RED

    Full Text Available R09-031370-1AR RED C72012 AU165393 EB0781 >AC002329_15(AC002329|pid:g2262170) DNA sequence of Ar ... 9); glycosyl hydrolase family I signature found at residues ... 329 to 337 [SLLLENGAA]. ...

  4. Probe data: 3897 [RED

    Full Text Available R06-022230-4R RED D23831 AU164531 RA0286 >AC002329_18(AC002329|pid:g2262173) DNA sequence of Ara ... nucleotide-disulphide oxidoreductases located from residues ... 197 to 219 [CAVCD...IGGGD]. ...

  5. WISE Discovery of Hyper Luminous Galaxies at z=2-4 and Their Implications for Galaxy and AGN Evolution

    Tsai, Chao Wei; Eisenhardt, Peter; Wu, Jingwen; Bridge, Carrie; Assef, Roberto; Benford, Dominic; Blain, Andrew; Cutri, Roc; Griffith, Robert L.; Jarrett, Thomas; Lonsdale, Carol; Petty, Sara; Sayers, Jack; Stanford, Adam; Stern, Daniel; Wright, Edward L.; Yan, Lin

    2014-01-01

    On behalf of the WISE Science team, we present the discovery of a class of distant dust-enshrouded galaxies with extremely high luminosity. These galaxies are selected to have extreme red colors in the mid-IR using NASA's Wide-field Infrared Survey Explorer (WISE). They are faint in the optical and near-IR, predominantly at zeta = 2-4, and with IR luminosity > 10(exp 13) Solar Luminosity, making them Hyper-Luminous Infrared Galaxies (HyLIRGs). SEDs incorporating the WISE, Spitzer, and Herschel PACS and SPIRE photometry indicate hot dust dominates the bolometric luminosity, presumably powered by AGN. Preliminary multi-wavelength follow-up suggests that they are different from normal populations in the local M-sigma relation. Their low source density implies that these objects are either intrinsically rare, or a short-lived phase in a more numerous population. If the latter is the case, these hot, dust-enshrouded galaxies may be an early stage in the interplay between AGN and galaxies.

  6. Optical Counterparts of Ultra-Luminous X-ray Sources identified from Archival Hubble Space Telescope/WFPC2

    Ptak, A; Van der Marel, R; Roye, E; Heckman, T; Towne, B

    2006-01-01

    We present a systematic analysis of archival HST WFPC2 ``Association'' data sets that correlate with the Chandra positions of a set of 44 ultra-luminous X-ray sources (ULXs) of nearby galaxies. We have improved the Chandra-HST relative astrometry whenever possible. Disparate numbers of potential ULX counterparts are found, and in some cases none are found. The lack of or low number of counterparts in some cases may be due to insufficient depth in the WFPC2 images. Particularly in late-type galaxies, the HST image in the ULX region was often complex or crowded. We therefore address various scenarios for the nature of the ULX since it is not known which, if any, of the sources found are true counterparts. The optical luminosities of the sources are typically in the range 10^4-6 L_sun. In several cases color information is available, with the colors roughly tending to be more red in early-type galaxies. This suggests that, in general, the (potential) counterparts found in early-type galaxies are likely to be old...

  7. WISE Discovery of Hyper Luminous Galaxies at z=2-4 and Their Implications for Galaxy and AGN Evolution

    Tsai, Chao-Wei; Wu, Jingwen; Bridge, Carrie; Assef, Roberto; Benford, Dominic; Blain, Andrew; Cutri, Roc; Griffith, Roger L; Jarrett, Thomas; Lonsdale, Carol; Petty, Sara; Sayers, Jack; Stanford, Adam; Stern, Daniel; Wright, Edward L; Yan, Lin

    2013-01-01

    On behalf of the WISE Science team, we present the discovery of a class of distant dust-enshrouded galaxies with extremely high luminosity. These galaxies are selected to have extreme red colors in the mid-IR using NASA's Wide-field Infrared Survey Explorer (WISE). They are faint in the optical and near-IR, predominantly at z=2-4, and with IR luminosity > $10^{13}\\, L_{Sun}$, making them Hyper-Luminous Infrared Galaxies (HyLIRGs). SEDs incorporating the WISE, Spitzer, and Herschel PACS and SPIRE photometry indicate hot dust dominates the bolometric luminosity, presumably powered by AGN. Preliminary multi-wavelength follow-up suggests that they are different from normal populations in the local M-sigma relation. Their low source density implies that these objects are either intrinsically rare, or a short-lived phase in a more numerous population. If the latter is the case, these hot, dust-enshrouded galaxies may be an early stage in the interplay between AGN and galaxies.

  8. SPECTRAL ENERGY DISTRIBUTIONS OF LOCAL LUMINOUS AND ULTRALUMINOUS INFRARED GALAXIES

    Luminous (LIRGs; log (LIR/L☉) = 11.00-11.99) and ultraluminous infrared galaxies (ULIRGs; log (LIR/L☉) = 12.00-12.99) are the most extreme star-forming galaxies in the universe. The local (U)LIRGs provide a unique opportunity to study their multi-wavelength properties in detail for comparison with their more numerous counterparts at high redshifts. We present common large aperture photometry at radio through X-ray wavelengths and spectral energy distributions (SEDs) for a sample of 53 nearby (z IR/L☉) = 11.14-12.57 from the flux-limited (f60μm > 5.24 Jy) Great Observatories All-sky LIRG Survey. The SEDs for all objects are similar in that they show a broad, thermal stellar peak (∼0.3-2 μm), and a dominant FIR (∼40-200 μm) thermal dust peak, where νLν(60 μm)/νLν(V) increases from ∼2 to 30 with increasing LIR. When normalized at IRAS 60 μm, the largest range in the luminosity ratio, R(λ) ≡ log[νLν(λ)/νLν(60 μm)], observed over the full sample is seen in the hard X-rays (HX = 2-10 keV), where ΔRHX = 3.73 (R-barHX= -3.10). A small range is found in the radio (1.4 GHz), ΔR1.4GHz = 1.75, where the mean ratio is largest, (R-bar1.4GHz= -5.81). Total infrared luminosities, LIR(8-1000 μm), dust temperatures, and dust masses were computed from fitting thermal dust emission modified blackbodies to the mid-infrared (MIR) through submillimeter SEDs. The new results reflect an overall ∼0.02 dex lower luminosity than the original IRAS values. Total stellar masses were computed by fitting stellar population synthesis models to the observed near-infrared (NIR) through ultraviolet (UV) SEDs. Mean stellar masses are found to be log (M*/M☉) = 10.79 ± 0.40. Star formation rates have been determined from the infrared (SFRIR ∼ 45 M☉ yr–1) and from the monochromatic UV luminosities (SFRUV ∼ 1.3 M☉ yr–1), respectively. Multi-wavelength active galactic nucleus (AGN) indicators have be used to select putative AGNs: About 60% of the ULIRGs

  9. Modeling of response to endocrine therapy in a panel of human luminal breast cancer xenografts.

    Cottu, P; Marangoni, E; Assayag, F; de Cremoux, P; Vincent-Salomon, A; Guyader, Ch; de Plater, L; Elbaz, C; Karboul, N; Fontaine, J J; Chateau-Joubert, S; Boudou-Rouquette, P; Alran, S; Dangles-Marie, V; Gentien, D; Poupon, M-F; Decaudin, D

    2012-06-01

    Resistance to endocrine therapy is a major complication of luminal breast cancer and studies of the biological features of hormonal resistance are limited by the lack of adequate preclinical models. The aim of this study is to establish and characterize a panel of primary human luminal breast carcinoma xenografts, and to evaluate their response to endocrine therapies. Four hundred and twenty-three tumor fragments obtained directly from patients have been grafted in the interscapular fatpad of Swiss nude mice. After stable engraftment with estradiol supplementation, xenografted tumors have been validated by conventional pathology and immunohistochemistry examination, and additional molecular studies. In vivo tumor growth and response to different endocrine treatments were evaluated. We have engrafted 423 tumors including 314 ER+ tumors, and 8 new luminal breast cancer xenografts have been obtained (2.5%). Tumor take was much lower for luminal tumors than for non-luminal tumors (2.5 vs. 24.7%, P < 0.0001), and was associated with two independent criteria, i.e., ER status (P < 0.0001) and a high grade tumor (P = 0.05). Histological and immunohistochemical analyses performed on patient's tumors and xenografts showed striking similarities in the tumor morphology as well as in the expression level of ER, PR, and HER2. Response to hormone therapy, evaluated in 6 luminal models, showed different sensitivities, thus exhibiting heterogeneity similar to what is observed in the clinic. We have established a panel of primary human luminal breast cancer xenografts, recapitulating the biological and clinical behaviors of patient tumors, and therefore suitable for further preclinical experiments. PMID:22002565

  10. Final report on regional comparison EURAMET.PR-K4: luminous flux

    Lindemann, Matthias; Maass, Robert; Sauter, Georg

    2015-01-01

    This report describes the EURAMET comparison for luminous flux carried out at 12 participating national metrology laboratories (NMIs). More than a decade ago, the CCPR initialised a key comparison for luminous flux denoted as CCPR K4. The reference value CCPR-KCRV for luminous flux is maintained since that time by the participants of that early CCPR comparison. Beside the pilot laboratory, the Physikalisch-Technische Bundesanstalt (PTB), two additional former participants acted as link laboratories for this EURAMET-Key-Comparison. The luminous flux CCPR-KCRV, maintained at the link laboratories and transferred by batches of incandescent lamps, was used to evaluate a reference value (EURAMET-RV) at the pilot laboratory as a weighted luminous flux average for this comparison. Finally, the realized or preserved luminous flux values of all other participants were compared with the EURAMET-RV in a star-type comparison at the pilot with batches of three to six lamps of various types. The DOEs of the values of the participants with respect to the reference value and mutually with all other luminous flux values are evaluated and published in the report together with the associated uncertainties. The deviations from the EURAMET-RV and hence from the CCPR-KCRV are within the declared expanded uncertainties for all participants. Main text. To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCPR, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

  11. Final report on regional comparison EURAMET.PR-K3.a: Luminous intensity

    Sperling, A.; Sauter, G.; Lindner, D.; Eltmann, M.

    2014-01-01

    This report describes the EURAMET comparison for luminous intensity carried out at 16 participating national metrology laboratories (NMIs). More than a decade ago, the CCPR initialised a key comparison for luminous intensity denoted as CCPR-K3.a. The reference value CCPR-KCRV for luminous intensity has been maintained since that time by the participants of that early CCPR comparison. Beside the pilot laboratory, the Physikalisch-Technische Bundesanstalt (PTB), two additional former participants acted as link laboratories for this EURAMET Key Comparison. The luminous intensity CCPR-KCRV, maintained at the link laboratories and transferred by batches of incandescent lamps, was used to evaluate a reference value (EURAMET-RV) at the pilot laboratory as a weighted luminous intensity average for this comparison. Finally, the realized or preserved luminous intensity values of all other participants were compared with the EURAMET-RV in a star-type comparison at the pilot with batches of three to eight lamps of various types. The DOEs of the values of the participants with respect to the reference value and mutually with all other luminous intensity values are evaluated and published in the report together with the associated uncertainties. The deviations from the EURAMET-RV and hence from the CCPR-KCRV are within the declared expanded uncertainties for all participants. Main text. To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCPR, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

  12. Infra-red material structures

    A process for modifying properties of infra-red materials in or for use in infra-red windows and other structures, in which the infra-red material is subjected to ion implantation whereby ions of an elemental dopant are implanted into the infra-red material under vacuum conditions. Heat diffusion may improve the depth of ion penetration. Specified materials are germanium, zinc sulphide, cadmium mercury telluride, calcium lanthanum sulphide and zinc selenide; specified dopants are boron, carbon and silicon. (author)

  13. Registration of 'Red Ruby' Wheat

    Red Ruby’ soft red winter wheat (Triticum aestivum L.) was developed by the Michigan Agricultural Experiment Station and released in 2007 via an exclusive licensing agreement through Michigan State University (MSU) Technologies. Red Ruby was selected from the cross Pioneer ‘2552’/Pioneer ‘2737W’ ma...

  14. Glossiness and perishable food quality: visual freshness judgment of fish eyes based on luminance distribution.

    Takuma Murakoshi

    Full Text Available BACKGROUND: Previous studies have reported the effects of statistics of luminance distribution on visual freshness perception using pictures which included the degradation process of food samples. However, these studies did not examine the effect of individual differences between the same kinds of food. Here we elucidate whether luminance distribution would continue to have a significant effect on visual freshness perception even if visual stimuli included individual differences in addition to the degradation process of foods. METHODOLOGY/PRINCIPAL FINDINGS: We took pictures of the degradation of three fishes over 3.29 hours in a controlled environment, then cropped square patches of their eyes from the original images as visual stimuli. Eleven participants performed paired comparison tests judging the visual freshness of the fish eyes at three points of degradation. Perceived freshness scores (PFS were calculated using the Bradley-Terry Model for each image. The ANOVA revealed that the PFS for each fish decreased as the degradation time increased; however, the differences in the PFS between individual fish was larger for the shorter degradation time, and smaller for the longer degradation time. A multiple linear regression analysis was conducted in order to determine the relative importance of the statistics of luminance distribution of the stimulus images in predicting PFS. The results show that standard deviation and skewness in luminance distribution have a significant influence on PFS. CONCLUSIONS/SIGNIFICANCE: These results show that even if foodstuffs contain individual differences, visual freshness perception and changes in luminance distribution correlate with degradation time.

  15. Characteristics of estrogen-induced peroxidase in mouse uterine luminal fluid

    Peroxidase activity in the uterine luminal fluid of mice treated with diethylstilbestrol was measured by the guaiacol assay and also by the formation of 3H2O from [2-3H]estradiol. In the radiometric assay, the generation of 3H2O and 3H-labeled water-soluble products was dependent on H2O2 (25 to 100 microM), with higher concentrations being inhibitory. Tyrosine or 2,4-dichlorophenol strongly enhanced the reaction catalyzed either by the luminal fluid peroxidase or the enzyme in the CaCl2 extract of the uterus, but decreased the formation of 3H2O from [2-3H]estradiol by lactoperoxidase in the presence of H2O2 (80 microM). NADPH, ascorbate, and cytochrome c inhibited both luminal fluid and uterine tissue peroxidase activity to the same extent, while superoxide dismutase showed a marginal activating effect. Lactoferrin, a major protein component of uterine luminal fluid, was shown not to contribute to its peroxidative activity, and such an effect by prostaglandin synthase was also ruled out. However, it was not possible to exclude eosinophil peroxidase, brought to the uterus after estrogen stimulation, as being the source of peroxidase activity in uterine luminal fluid

  16. Human red cell acetyltransferase

    Acetyltransferase was isolated by histone-Sepharose affinity chromatography from human cord blood red cells. The enzyme was detected only in very young red cells. The semipurified enzyme and [14C]acetyl-CoA were used to acetylate isolated Hb F tetramer and α and γ subunits. The in vitro acetylated products were characterized by globin chain separation by CM-cellulose chromatography and tryptic peptide analysis by reverse-phase HPLC. Acetylation of both the γ-chains and the α-chains could occur within the Hb F tetramer. Acetylation also could take place on intact subunits. It appears that some Hb F/sub Ic/ could be formed in the cells by utilizing Hb F or free γ-chains as acetylation substrate

  17. Transient luminous events above two mesoscale convective systems

    Lang, Timothy; Rutledge, Steve; Lyons, Walt; Cummer, Steve; Li, Jingbo; Macgorman, Don

    2010-05-01

    Two warm-season mesoscale convective systems (MCSs) were analyzed with respect to production of transient luminous events (TLEs), mainly sprites. Sprites were documented over the lightning mapping array (LMA) network in Oklahoma, USA, using highly sensitive optical cameras operated at Yucca Ridge in Ft. Collins, Colorado, as part of our Sprites 2007 field campaign. Information about charge moment changes in lightning flashes was obtained by the National Charge Moment Change Network (CMCN). Cloud-to-ground lightning data were obtained from the National Lightning Detection Network (NLDN). The 20 June 2007 symmetric MCS produced 282 observed TLEs over a 4-h period, during which time the storm's intense convection weakened and its stratiform region strengthened. In contrast to previous sprite studies, the stratiform charge layer involved in producing the TLE-parent positive cloud-to-ground (+CG) lightning flash was situated at upper levels as opposed to near the melting level. This layer was physically connected to an even higher upper-level convective positive charge region via a downward-sloping pathway. The average altitude discharged by TLE-parent flashes during TLE activity was 8.2 km above mean sea level (MSL; -25 °C). The 9 May 2007 asymmetric MCS produced 25 observed TLEs over a 2-h period, during which the storm's convection rapidly weakened before recovering later. The 9 May storm best fit the conventional model of low-altitude positive charge playing the dominant role in sprite production; however, the average altitude discharged during the TLE phase of flashes still was higher than the melting level: 6.1 km MSL (-15 °C). The average TLE-parent +CG flash in the symmetric 20 June case initiated at higher altitude, discharged a substantially larger area, had a larger peak current, and tapped positive charge at higher altitude compared to the asymmetric 9 May case. Analysis of full charge moment change (CMC) data from TLE-parent +CGs in these two cases

  18. Probe data: 2561 [RED

    Full Text Available R08-000680-1AR RED C26504 AU100736 CB2477 >SPAC4F8_3(Z98530|pid:g2330820) S.pombe chromosome I c ... orf, (250aa), fasta scores, opt:691, E():0, (47.2% identity ... in 246 aa overlap), also similar to C.elegans Q232 ... 6E11, (258aa), fasta scores, opt:632,E():0, (40.2% identity ... in 249 aa overlap). ...

  19. Probe data: 2942 [RED

    Full Text Available R01-031330-1AR RED C74139 AU101397 E30485 EE0485 >SPBC3B9_12(AL022070|pid:g2950478) S.pombe chro ... (219aa), fasta scores, opt:182, E():1e-29, (29.8% identity ... in 215 aa overlap), also similar eg. to C. elegans ... 224aa), fasta scores, opt:303, E():1.2e-26, (41.4% identity ... in 111 aa overlap). ...

  20. Probe data: 5856 [RED

    Full Text Available R10-024200-4R RED AU174678 AU174679 FE0202 >AP000002_62(AP000002|pid:g3256770) Pyrococcus horiko ... nt. position (2/7); similar to PIR:S44960 percent identity :40.645 in 320aa; PIR:S69807 percent identity :41.10 ... 0 in 319aa; owl:MTY13D1217 percent identity :39.171 in 224aa. &H71145(H71145) ...

  1. Probe data: 5450 [RED

    Full Text Available R04-032550-1AR RED D47635 AU174014 SS3251 >AC002534_10(AC002534|pid:g2392772) Arabidopsis thalia ... products; the lack of similarity in the N-terminal region ... between T32N15.11 and bacterial PheA gene products ... re located from residue 279 to 301 [YNLQI..RFLML] (region ... includes a conserved threonine found to be essenti ...

  2. Probe data: 1459 [RED

    Full Text Available R09-012590-1AR RED AU166582 AU068404 CE0184 >DMSEG0007_4(AL033125|pid:g4185888) Drosophila melan ... e.; 2-match_species=Drosophila melanogaster (fruit fly ); 2-method=blastn;1.4.9; 2-method_score=2580.00; 2 ... e.; 3-match_species=Drosophila melanogaster (fruit fly ); 3-method=blastn;1.4.9; 3-method_score=3101.00; 4 ...

  3. EST data: 731 [RED

    Full Text Available CB2762 C26646 AU108627 C12762 4 G DPlate 008 C08 5' AAC AAT AAT GGG GGC TTT TC 3' 5' TTA TTG ATT ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  4. Demonstration of sub-luminal propagation of single-cycle terahertz pulses for particle acceleration

    Walsh, D A; Snedden, E W; Cliffe, M J; Graham, D M; Jamison, S P

    2016-01-01

    The sub-luminal phase velocity of electromagnetic waves in free space is generally unobtainable, being closely linked to forbidden faster than light group velocities. The requirement of effective sub-luminal phase-velocity in laser-driven particle acceleration schemes imposes a fundamental limit on the total acceleration achievable in free-space, and necessitates the use of dielectric structures and waveguides for extending the field-particle interaction. Here we demonstrate a new travelling-source and free space propagation approach to overcoming the sub-luminal propagation limits. The approach exploits the relative ease of generating ultrafast optical sources with slow group velocity propagation, and a group-to-phase front conversion through non-linear optical interaction near a material-vacuum boundary. The concept is demonstrated with two terahertz generation processes, non-linear optical rectification and current-surge rectification. The phase velocity is tunable, both above and below vacuum speed of lig...

  5. Feasibility analysis on integration of luminous environment measuring and design based on exposure curve calibration

    Zou, Yuan; Shen, Tianxing

    2013-03-01

    Besides illumination calculating during architecture and luminous environment design, to provide more varieties of photometric data, the paper presents combining relation between luminous environment design and SM light environment measuring system, which contains a set of experiment devices including light information collecting and processing modules, and can offer us various types of photometric data. During the research process, we introduced a simulation method for calibration, which mainly includes rebuilding experiment scenes in 3ds Max Design, calibrating this computer aid design software in simulated environment under conditions of various typical light sources, and fitting the exposure curves of rendered images. As analytical research went on, the operation sequence and points for attention during the simulated calibration were concluded, connections between Mental Ray renderer and SM light environment measuring system were established as well. From the paper, valuable reference conception for coordination between luminous environment design and SM light environment measuring system was pointed out.

  6. The time course of color- and luminance-based salience effects.

    Isabel C Dombrowe

    2010-11-01

    Full Text Available Salient objects in the visual field attract our attention. Recent work in the orientation domain has shown that the effects of the relative salience of two singleton elements on covert visual attention disappear over time. The present study aims to investigate how salience derived from color and luminance differences affects covert selection. In two experiments, observers indicated the location of a probe which was presented at different stimulus-onset-asynchronies after the presentation of a singleton display containing a homogeneous array of oriented lines and two distinct color singletons (Experiment 1 or luminance singletons (Experiment 2. The results show that relative singleton salience from luminance and color differences, just as from orientation differences, affects covert visual attention in a brief time span after stimulus onset. The mere presence of an object, however, can affect covert attention for a longer time span regardless of salience.

  7. A Catalog of Luminous Infrared Galaxies in the IRAS Survey and Second Data Release of SDSS

    2006-01-01

    We selected a sample of luminous infrared galaxies by cross-identification of the Faint Source Catalogue (FSC) and Point Source Catalogue (PSC) of the IRAS Survey with the Second Data Release of the SDSS. The size of our sample is 1267 for FSC and 427 for PSC by using the 2σ significance level cross-section. The "likelihood ratio" method is used to estimate the individual's reliability and for defining two more reliable subsamples (908 for FSC and 356 for PSC). A catalog of infrared,optical and radio data is compiled and will be used in further work. Some statistical results show that luminous infrared galaxies are quite different from ultra-luminous infrared galaxies. The AGN fractions of galaxies at different infrared luminosities and the radio-infrared correlations are consistent with the previous studies.

  8. Luminous Processes Co.: the cleanup of a low-level radioactive waste site

    Luminous Processes Co., located in Athens, Georgia, painted luminous watch dials and clock faces with paint containing radium-226 and tritium. Following bankruptcy, Luminous left the site in a contaminated condition. The State of Georgia ultimately declared the site their number one priority for cleanup under Superfund. In the bidding process, O.H. Materials Co., of Findlay, Ohio, was judged as having the most technically superior cleanup approach in addition to being the low bidder. Decontamination of the site included excavation of soil adjacent to the main building, removal of interior walls and fixtures from inside the building, and decontamination of various items on the premises. The decontamination of the site was successfully completed, well under budget. All cleanup objectives were met and the site was rehabilitated without a single incident of exposure to any of the participants in the cleanup operation

  9. Opposing effects of atropine and timolol on the color and luminance emmetropization mechanisms in chicks.

    Goldberg, Laura A; Rucker, Frances J

    2016-05-01

    This study analyzed the luminance and color emmetropization response in chicks treated with the nonselective parasympathetic antagonist atropine and the sympathetic β-receptor blocker timolol. Chicks were binocularly exposed (8h/day) for 4days to one of three illumination conditions: 2Hz sinusoidal luminance flicker, 2Hz sinusoidal blue/yellow color flicker, or steady light (mean 680lux). Atropine experiments involved monocular daily injections of either 20μl of atropine (18nmol) or 20μl of phosphate-buffered saline. Timolol experiments involved monocular daily applications of 2 drops of 0.5% timolol or 2 drops of distilled H2O. Changes in the experimental eye were compared with those in the fellow eye after correction for the effects of saline/water treatments. Atropine caused a reduction in axial length with both luminance flicker (-0.078±0.021mm) and color flicker (-0.054±0.017mm), and a reduction in vitreous chamber depth with luminance flicker (-0.095±0.023mm), evoking a hyperopic shift in refraction (3.40±1.77D). Timolol produced an increase in axial length with luminance flicker (0.045±0.030mm) and a myopic shift in refraction (-4.07±0.92D), while color flicker caused a significant decrease in axial length (-0.046±0.017mm) that was associated with choroidal thinning (-0.046±0.015mm). The opposing effects on growth and refraction seen with atropine and timolol suggest a balancing mechanism between the parasympathetic and β-receptor mediated sympathetic system through stimulation of the retina with luminance and color contrast. PMID:26971621

  10. Mapping Luminous Blue Compact Galaxies with VIRUS-P: morphology, line ratios and kinematics

    Cairos, L. M.; Caon, N.; Garcia-Lorenzo, B.; Kelz, A.; Roth, M.; Papaderos, P.; Streicher, O.

    2012-01-01

    [abridged] We carry out an integral field spectroscopy (IFS) study of a sample of luminous BCGs, with the aim to probe the morphology, kinematics, dust extinction and excitation mechanisms of their warm interstellar medium (ISM). IFS data for five luminous BCGs were obtained using VIRUS-P, the prototype instrument for the Visible Integral Field Replicable Unit Spectrograph, attached to the 2.7m Harlan J. Smith Telescope at the McDonald Observatory. VIRUS-P consists of a square array of 247 op...

  11. Classification of radioactive self-luminous light sources. American national standard

    This standard establishes the classification of certain radioactive self-luminous light sources according to radionuclide, type of source, activity, and performance requirements. The objectives are to establish minimum prototype testing requirements for radioactive self-luminous light sources, to promote uniformity of marking such sources, and to establish minimum physical performance for such sources. This standard is primarily directed toward assuring adequate containment of the radioactive material. Testing procedures and classification designations are specified for discoloration, temperature, thermal shock, reduced pressure, impact, vibration, and immersion. A range of test requirements is presented according to intended usage and source activity

  12. High luminance organic light-emitting diodes with efficient multi-walled carbon nanotube hole injectors

    Shi, S; Silva, SRP

    2012-01-01

    We report high luminance organic light-emitting diodes by use of acid functionalized multi-walled carbon nanotube (o-MWCNTs) as efficient hole injector electrodes with a simple and solution processable device structure. At only 10 V, the luminance can reach nearly 50,000 cd/m2 with an external quantum efficiency over 2% and a current efficiency greater than 21 cd/A. The investigation of hole-only devices shows that the mechanism for hole injection is changed from injection limited to bulk lim...

  13. The Artificial Sky Luminance And The Emission Angles Of The Upward Light Flux

    Cinzano, P.; Castro, F. J. Diaz

    1998-01-01

    The direction of the upward light emission has different polluting effects on the sky depending on the distance of the observation site. We studied with detailed models for light pollution propagation the ratio $(b_{H})/(b_{L})$, at given distances from a city, between the artificial sky luminance $b_{H}$ produced by its upward light emission between a given threshold angle $\\theta_{0}$ and the vertical and the artificial sky luminance $b_{L}$ produced by its upward light emission between the...

  14. Pan-STARRS1 Discovery of Two Ultra-Luminous Supernovae at z ~ 0.9

    Chomiuk, Laura B; Chornock, Ryan T.; Soderberg, Alicia M.; Berger, Edo; Chevalier, R. A.; Foley, R. J.; Huber, M. E.; Narayan, Gautham Siddharth; Rest, A.; Gezari, S.; Kirshner, Robert P.; Riess, A.; Rodney, S. A.; Smartt, S. J.; Stubbs, Christopher William

    2011-01-01

    We present the discovery of two ultra-luminous supernovae (SNe) at z ~ 0.9 with the Pan-STARRS1 Medium-Deep Survey. These SNe, PS1-10ky and PS1-10awh, are amongst the most luminous SNe ever discovered, comparable to the unusual transients SN 2005ap and SCP 06F6. Like SN 2005ap and SCP 06F6, they show characteristic high luminosities (M_bol ~ -22.5 mag), blue spectra with a few broad absorption lines, and no evidence for H or He. We have constructed a full multi-color light curve sensitive to ...

  15. Early phase observations of extremely luminous Type Ia Supernova 2009dc

    Yamanaka, Masayuki; Kawabata, Koji S.; Kinugasa, Kenzo; Tanaka, Masaomi; Imada, Akira; Maeda, Keiichi; Nomoto, Ken'ichi; Arai, Akira; Chiyonobu, Shingo; Fukazawa, Yasushi; Hashimoto, Osamu; Honda, Satoshi; Ikejiri, Yuki; Itoh, Ryosuke; Kamata, Yukiko

    2009-01-01

    We present early phase observations in optical and near-infrared wavelengths for the extremely luminous Type Ia supernova (SN Ia) 2009dc. The decline rate of the light curve is Delta m(15)(B) = 0.65 +/- 0.03, which is one of the slowest among SNe Ia. The peak V-band absolute magnitude is estimated to be M-V = -19.90 +/- 0.15 mag if no host extinction is assumed. It reaches M-V = -20.19 +/- 0.19 mag if we assume the host extinction of A(V) = 0.29 mag. SN 2009dc belongs to the most luminous cla...

  16. Chicks use changes in luminance and chromatic contrast as indicators of the sign of defocus

    Rucker, Frances J.; Wallman, Josh

    2012-01-01

    As the eye changes focus, the resulting changes in cone contrast are associated with changes in color and luminance. Color fluctuations should simulate the eye being hyperopic and make the eye grow in the myopic direction, while luminance fluctuations should simulate myopia and make the eye grow in the hyperopic direction. Chicks without lenses were exposed daily (9 a.m. to 5 p.m.) for three days on two consecutive weeks to 2 Hz sinusoidally modulated illumination (mean illuminance of 680 lux...

  17. Angular dependence of the luminance and contrast in medical monochrome liquid crystal displays

    Active-matrix liquid crystal displays (AMLCDs) are light-modulating devices that generate images by differentially transmitting a nearly uniform luminous field provided by a backlight. While emissive displays exhibit a quasi-Lambertian emission with almost constant contrast at off-normal viewing, the anisotropy of the electro-optic effect that controls light transmission in AMLCDs causes a pixel luminance that varies, sometimes strongly, with viewing angle. These variations are not identical for all gray levels and can eventually cause grayscale inversions. In this paper, we measured the luminance emission of a monochrome medical AMLCD, a medical cathode-ray tube monitor, and a color desktop AMLCD, using a collimated photopic probe positioned on a manual rotation arm, and a research radiometer with automatic readout. The probe measures luminance with a small acceptance angle and provides optical shielding from emissions at other viewing directions that contaminate the readings. We obtained luminance response curves versus angle in the vertical, horizontal and at 45 deg. diagonal directions. The display systems were calibrated to reflect the DICOM Part 3.14 standard grayscale display function (GDF) when measured using the manufacturer's probe and software tools. We analyzed the measurements at different viewing directions with respect to their departure from the GDF by computing the normalized contrast (ΔL/L) as a function of the DICOM just-noticeable difference index. Although cathode-ray tubes are known to be quasi-Lambertian emitters, the luminance at normal viewing is higher than the luminance observed at large angles. This decrease in luminance is however proportionally similar for all gray levels, resulting in a relatively flat contrast response for all angles. In addition to being more pronounced, the angular variation in AMLCDs does not follow the same profile at different intensities with the subsequent variation in the achieved display contrast. The

  18. Deep Red (Profondo Rosso)

    Cine Club

    2015-01-01

    Wednesday 29 April 2015 at 20:00 CERN Council Chamber    Deep Red (Profondo Rosso) Directed by Dario Argento (Italy, 1975) 126 minutes A psychic who can read minds picks up the thoughts of a murderer in the audience and soon becomes a victim. An English pianist gets involved in solving the murders, but finds many of his avenues of inquiry cut off by new murders, and he begins to wonder how the murderer can track his movements so closely. Original version Italian; English subtitles

  19. Red DirCom

    Joan Costa

    2007-01-01

    Catorce países congregados de manera activa, a través de una plataforma de encuentro donde se comparten conocimiento y experiencias en la gestión estratégica de la comunicación en las organizaciones. La red reconoce en el DirCom una figura clave del desarrollo corporativo en el nuevo contexto de los negocios, impulsa la exigencia ética a través de la formación y consolida la proyección profesional para posicionar la gestión integral del DirCom en Iberoamérica.

  20. Red de sensores SIPIA

    Mercado, Gustavo; Ortiz Uriburu, Gisela; Diedrichs, Ana; Borgo, Roberto; Gonzalez Antivilo, Francisco; Tromer, Sebastián; Ledezma, Nicolás; Aguirre, Matías; Panella, Cristian; Tabacchi, Germán; Martí, Juan; Grünwaldt, Guillermo; Rigoni, Ignacio; Antón, Gabriel; Chamorro, Fernando

    2012-01-01

    El proyecto consiste en el análisis, implementación y evaluación de una red de sensores inalámbricos basada en la norma IEEE 802.15.4, aplicada al entorno agropecuario en el ámbito de agricultura de precisión, con participación de tanto ingenieros electrónicos e informáticos como de ingenieros e investigadores agrónomos, Se propone entonces el estudio de estas tecnologías en el contexto de un grupo de investigaciones que permita: • La colaboración interinstitucional e interdisciplinaria en...

  1. Probe data: 305 [RED

    Full Text Available R08-039710-1AR RED AU030739 AU030740 EH0171 >PTU27116_1(U27116|pid:g857578) Po pulus tremulo ides ... caffeo yl-Co A 3-O -methyltransferase mRNA, co mplete cds; S- ... adenyo syl-methio nine caffeo yl-Co A 3-O -methyltransferase; ... similar to ... Swiss-Pro t Accessio n Number P28034; similar to ... pro ... teins enco ded by GenBank accessio n Numbers U20736, U13151, an ...

  2. Big Red Telephone, Gone

    Toni Piech

    2006-01-01

    @@ The Chinese big red telephones looked exactly as Iimagined the ones servicing the direct emergen line between the Kreml and the White House duing the cold-war era would have look like. But here in China, every kio seemed to have such a device in t1990s, and anyone could use it for ju 0.2 yuan. The government did not juinstall public phones on street corner but they let small-business owners pa ticipate in telecommunication. Supply and demand were juggled by a kind of Hutong capitalism.

  3. Red DirCom

    Joan Costa

    2007-01-01

    Full Text Available Catorce países congregados de manera activa, a través de una plataforma de encuentro donde se comparten conocimiento y experiencias en la gestión estratégica de la comunicación en las organizaciones. La red reconoce en el DirCom una figura clave del desarrollo corporativo en el nuevo contexto de los negocios, impulsa la exigencia ética a través de la formación y consolida la proyección profesional para posicionar la gestión integral del DirCom en Iberoamérica.

  4. Alaistaitokartoitus, Red Events Oy

    Latva, Mariikka

    2013-01-01

    Tämän tutkimuksellisen opinnäytetyön tarkoituksena oli kartoittaa tapahtuma-alan yrityksen Red Events Oy:n vuokratyöntekijöiden mielipiteitä heidän omista alaistaidoistaan. Työn tavoitteena oli saada kartoituksen tulosten pohjalta mahdollisia kehittämisehdotuksia. Opinnäytetyön tietoperusta muodostui alaistaidoista ja psykologisesta sopimuksesta. Psykologisen sopimuksen osa-alueista esiteltiin työn kannalta merkittävimmät, joita olivat vuorovaikutus, palautteen antaminen ja vastaanottam...

  5. Probe data: 5759 [RED

    Full Text Available R10-026870-1AR RED AU174436 AU174437 EA0016 >C ELC 46G7_4(U97593|pid:g1946975) C aenorhabditis eleg ... ans c osmid C 46G7; weak similarity to human ataxin-1 X792 ... 04 (NID:g529662); c oded for by C . elegans c DNA yk153d2.5; c oded for by ... C . elegans c DNA yk95h11.5; c oded for by C . elegans c ... DNA yk5a4.5; c oded for by C . elegans c DNA yk11g5.5; c oded for by ...

  6. Probe data: 331 [RED

    Full Text Available R04-032990-1AR RED AU030864 AU030865 E60359 EH0359 >C ELB0546_1(AF038604|pid:g2702370) C aenorhabd ... itis elegans c osmid B0546; c ontains similarity to Drosophila ovar ... ian tumor loc us protein (GB:X13693); c oded for by C . elegans c DN ... A yk389b1.5; c oded for by C . elegans c DNA yk332a1.5; c oded for by ... C . elegans c DNA yk314b10.5; c oded for by C . elegans ...

  7. Probe data: 739 [RED

    Full Text Available R05-012910-1AR RED C 23575 AU032457 SS0091 >C ELH17B01_3(AF040646|pid:g2746826) C aenorhabditis ele ... gans c osmid H17B01; c oded for by C . elegans c DNA yk169c 10 ... .3; c oded for by C . elegans c DNA yk125b6.3; c oded for by ... C . elegans c DNA yk71e8.3; c oded for by C . elegans c D ... NA C EESD11FB; c oded for by C . elegans c DNA C EESD11F; c o ...

  8. THE CLUSTERING OF EXTREMELY RED OBJECTS

    Palamara, David P.; Brown, Michael J. I.; Pimbblet, Kevin A. [School of Physics, Monash University, Clayton, Victoria 3800 (Australia); Jannuzi, Buell T.; Dey, Arjun [National Optical Astronomy Observatory, 950 North Cherry Avenue, Tucson, AZ 85719 (United States); Stern, Daniel [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States); Weiner, Benjamin J.; Rieke, Marcia [Steward Observatory, University of Arizona, 933 North Cherry Avenue, Tucson, AZ, 85721 (United States); Ashby, Matthew L. N. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Kochanek, C. S. [Department of Astronomy, The Ohio State University, 140, West 18th Avenue, Columbus, OH 43210 (United States); Gonzalez, Anthony [Department of Astronomy, University of Florida, Gainesville, FL 32611-2055 (United States); Brodwin, Mark [Department of Physics and Astronomy, University of Missouri, 5110 Rockhill Road, Kansas City, MO 64110 (United States); Le Floc' h, Emeric [Laboratoire AIM, CEA-Saclay-CNRS-Universite Paris Diderot, Service d' Astrophysique, Orme des Merisiers, F-91191 Gif-sur-Yvette (France)

    2013-02-10

    We measure the clustering of extremely red objects (EROs) in Almost-Equal-To 8 deg{sup 2} of the NOAO Deep Wide Field Survey Booetes field in order to establish robust links between ERO (z Almost-Equal-To 1.2) and local galaxy (z < 0.1) populations. Three different color selection criteria from the literature are analyzed to assess the consequences of using different criteria for selecting EROs. Specifically, our samples are (R - K{sub s} ) > 5.0 (28, 724 galaxies), (I - K{sub s} ) > 4.0 (22, 451 galaxies), and (I - [3.6]) > 5.0 (64, 370 galaxies). Magnitude-limited samples show the correlation length (r {sub 0}) to increase for more luminous EROs, implying a correlation with stellar mass. We can separate star-forming and passive ERO populations using the (K{sub s} - [24]) and ([3.6] - [24]) colors to K{sub s} = 18.4 and [3.6] = 17.5, respectively. Star-forming and passive EROs in magnitude-limited samples have different clustering properties and host dark halo masses and cannot be simply understood as a single population. Based on the clustering, we find that bright passive EROs are the likely progenitors of {approx}> 4L* elliptical galaxies. Bright EROs with ongoing star formation were found to occupy denser environments than star-forming galaxies in the local universe, making these the likely progenitors of {approx}> L* local ellipticals. This suggests that the progenitors of massive {approx}> 4L* local ellipticals had stopped forming stars by z {approx}> 1.2, but that the progenitors of less massive ellipticals (down to L*) can still show significant star formation at this epoch.

  9. The Red Supergiant Content of M31*

    Massey, Philip; Evans, Kate Anne

    2016-08-01

    We investigate the red supergiant (RSG) population of M31, obtaining the radial velocities of 255 stars. These data substantiate membership of our photometrically selected sample, demonstrating that Galactic foreground stars and extragalactic RSGs can be distinguished on the basis of B ‑ V, V ‑ R two-color diagrams. In addition, we use these spectra to measure effective temperatures and assign spectral types, deriving physical properties for 192 RSGs. Comparison with the solar metallicity Geneva evolutionary tracks indicates astonishingly good agreement. The most luminous RSGs in M31 are likely evolved from 25–30 M ⊙ stars, while the vast majority evolved from stars with initial masses of 20 M ⊙ or less. There is an interesting bifurcation in the distribution of RSGs with effective temperatures that increases with higher luminosities, with one sequence consisting of early K-type supergiants, and with the other consisting of M-type supergiants that become later (cooler) with increasing luminosities. This separation is only partially reflected in the evolutionary tracks, although that might be due to the mis-match in metallicities between the solar Geneva models and the higher-than-solar metallicity of M31. As the luminosities increase the median spectral type also increases; i.e., the higher mass RSGs spend more time at cooler temperatures than do those of lower luminosities, a result which is new to this study. Finally we discuss what would be needed observationally to successfully build a luminosity function that could be used to constrain the mass-loss rates of RSGs as our Geneva colleagues have suggested. Observations reported here were obtained at the MMT Observatory, a joint facility of the University of Arizona and the Smithsonian Institution. This paper uses data products produced by the OIR Telescope Data Center, supported by the Smithsonian Astrophysical Observatory.

  10. Analysis of RED ONE Digital Cinema Camera and RED Workflow

    Foroughi Mobarakeh, Taraneh

    2009-01-01

    RED Digital Cinema is a rather new company that has developed a camera that has shaken the world of the film industry, the RED One camera. RED One is a digital cinema camera with the characteristics of a 35mm film camera. With a custom made 12 megapixel CMOS sensor it offers images with a filmic look that cannot be achieved with many other digital cinema cameras. With a new camera comes a new set of media files to work with, which brings new software applications supporting them. RED Digital ...

  11. 10 CFR 32.22 - Self-luminous products containing tritium, krypton-85 or promethium-147: Requirements for license...

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Self-luminous products containing tritium, krypton-85 or... containing tritium, krypton-85 or promethium-147: Requirements for license to manufacture, process, produce... self-luminous products containing tritium, krypton-85, or promethium-147, or to initially transfer...

  12. The Bright End of the Luminosity Function of Red Sequence Galaxies

    Loh, Y S; Loh, Yeong-Shang; Strauss, Michael A.

    2006-01-01

    We study the bright end of the luminosity distribution of galaxies in fields with Luminous Red Galaxies (LRG) from the Sloan Digital Sky Survey (SDSS). Using 2099 square degree of SDSS imaging data, we search for luminous (> L*) early-type galaxies within 1.0 Mpc/h of a volume-limited sample of 12,608 spectroscopic LRG in the redshift range 0.12 < z < 0.38. Most of these objects lie in rich environments, with the LRG being the brightest object within 1.0 Mpc/h. The luminosity gap, M12, between the first and second-rank galaxies within 1.0 Mpc/h is large (~0.8 mag), substantially larger than can be explained with an exponentially decaying luminosity function of galaxies. The brightest member is less luminous (by 0.1 to 0.2 mag), and shows a larger gap in LRG selected groups than in cluster-like environments. The large luminosity gap shows little evolution with redshift to z = 0.4, ruling out the scenario that these LRG selected brightest cluster or group galaxies grow by recent cannibalism of cluster mem...

  13. Red Tape, Corruption and Finance

    Keith Blackburn; Rashmi Sarmah

    2006-01-01

    We study the effects of red tape and corruption in a model of occupational choice, entry regulation and imperfect capital markets. Red tape is the set of rules and regulations that private agents are obliged to comply with in order to engage in entrepreneurial activity. Corruption is the payment of bribes to public officials for the purpose of circumventing red tape. Capital market imperfections are the asymmetries of information between borrowers and lenders about the returns to entrepreneur...

  14. LUMINATE: Linking agricultural land use, local water quality and Gulf of Mexico hypoxia

    In this paper, we discuss the importance of developing integrated assessment models to support the design and implementation of policies to address water quality problems associated with agricultural pollution. We describe a new modelling system, LUMINATE, which links land use decisions made at the...

  15. Luminous electrical phenomena in Huntsville, Alabama, tornadoes on April 3, 1974

    Vaughan, O. H., Jr.; Vonnegut, B.

    1976-01-01

    Unusual lightning and varicolored luminous phenomena were observed on the evening of April 3, 1974, when severe tornadoes passed through Madison County, Alabama. Photographs and eyewitness accounts of this electrical activity are related to the trajectories of the tornadoes and the damage areas they produced.

  16. Luminous Intensity Control System Based on ZigBee Wireless Sensor Networks

    PEI Yan-ming

    2012-10-01

    Full Text Available This paper introduces an energy conservation luminous intensity control system based on ZigBee sensor networks for smart home. The study is conducted to reduce unnecessary energy consumption by changing the luminous intensity of white LED according to the light coming into the room. A detecting circuit connected to the pin of CC2430 is set on the working face to collect the real-time luminous intensity signal. Then the ZigBee module adjusts the PWM signal to drive the white LEDs aiming at keeping a fixed and appropriate luminous intensity (e.g. 500Lux. Meanwhile, it transmits the data to the ZigBee coordinator through ZigBee wireless network. The monitoring PC get the data through the serial communication interface and display the states of the lights. Administrators can turn on or off the lights by clicking on the screen. This system can realize monitoring and controlling all the lights wirelessly so that users can save a lot energy and staff members. The system has been proved to be effective and convenient.

  17. Luminance- and texture-defined information processing in school-aged children with autism.

    Jessica B Rivest

    Full Text Available According to the complexity-specific hypothesis, the efficacy with which individuals with autism spectrum disorder (ASD process visual information varies according to the extensiveness of the neural network required to process stimuli. Specifically, adults with ASD are less sensitive to texture-defined (or second-order information, which necessitates the implication of several cortical visual areas. Conversely, the sensitivity to simple, luminance-defined (or first-order information, which mainly relies on primary visual cortex (V1 activity, has been found to be either superior (static material or intact (dynamic material in ASD. It is currently unknown if these autistic perceptual alterations are present in childhood. In the present study, behavioural (threshold and electrophysiological measures were obtained for static luminance- and texture-defined gratings presented to school-aged children with ASD and compared to those of typically developing children. Our behavioural and electrophysiological (P140 results indicate that luminance processing is likely unremarkable in autistic children. With respect to texture processing, there was no significant threshold difference between groups. However, unlike typical children, autistic children did not show reliable enhancements of brain activity (N230 and P340 in response to texture-defined gratings relative to luminance-defined gratings. This suggests reduced efficiency of neuro-integrative mechanisms operating at a perceptual level in autism. These results are in line with the idea that visual atypicalities mediated by intermediate-scale neural networks emerge before or during the school-age period in autism.

  18. MLF1IP is correlated with progression and prognosis in luminal breast cancer.

    Huang, Du-Ping; Luo, Rong-Cheng

    2016-09-01

    Myeloid leukemia factor 1-interacting protein (MLF1IP) has been found to be involved in the progression of several malignancies. The potential correlation between MLF1IP and clinical outcome in patients with luminal breast cancer, however, remains unknown. In the present study, we demonstrated that MLF1IP was significantly upregulated in luminal breast cancer tissue compared with adjacent normal tissue both in validated cohort and TCGA cohort. Upregulated expression of MLF1IP was correlated with more often lymph node metastasis and negative progesterone receptor expression in TCGA cohorts. Kaplan-Meier analysis indicated that patients with high MLF1IP expression had significantly lower overall survival. Moreover, multivariate analysis revealed that high MLF1IP expression was independent high risk factor as well as old age (>60) and distant metastasis. This study provides new insights and evidences that MLF1IP over-expression plays important roles in progression of luminal breast cancer. However, the precise cellular mechanisms for MLF1IP in luminal breast cancer need to be further explored. PMID:27378428

  19. Electrical-thermal-luminous-chromatic model of phosphor-converted white light-emitting diodes

    Ye, H.; Koh, S.W.; Yuan, C.; Zeijl, H. van; Gielen, A.W.J.; Lee, S.W.R.; Zhang, G.

    2014-01-01

    The drive of increased electrical currents to achieve high luminous output for phosphor-converted white light-emitting diodes (PW-LED) has led to a series of thermal problems. The light performance of PW-LED is affected by the heat generated by the two major sources in a package/module: chip(s) and

  20. First observations of transient luminous events in Indian sub-continent

    Singh, Rajesh; Maurya, Ajeet K.; Veenadhari, B.;

    2014-01-01

    The article offers information on the initial observations of flashes of lightning discharge observed above thunderstorms. It mentions that the transient luminous events (TLE) are classified on the basis of their geometrical shape and luminosity into Sprites, Halos and Blue Starters. It also...